WorldWideScience

Sample records for cl cn nc

  1. Theoretical insights into the properties of the borazine×××X– complexes (X– = H, F, Cl, CN, NC or NCO

    Directory of Open Access Journals (Sweden)

    REZA GHIASI

    2009-09-01

    Full Text Available The character of the NH×××X- (X- = H, F, Cl, CN, NC or NCO in-teractions of borazine with anions was studied using ab initio method. The interaction energies were calculated at the B3LYP/6-311++G(d,p level. The energetic and geometric characteristics of the complexes were compared. The “atoms in molecules” methodology was used to analyze the electron density and to obtain atomic contributions to the total energy and charge of the systems. Natural bond orbital (NBO analysis demonstrated the charge transfer in the study of the nature of the intermolecular interactions. The aromaticity of these compounds was predicted in light of the nucleus-independent chemical shift (NICS.

  2. Structure and bonding of ScCN and ScNC: Ground and low-lying states

    International Nuclear Information System (INIS)

    Graphical abstract: The experimentally unknown systems ScCN and ScNC have been studied through single reference CISD and CCSD(T) methods. A total of 20 = 10 (ScCN) + 10 (ScNC) states were examined. All states are quite ionic whereas ScNC(X∼3Δ) is stabler than ScCN(X∼3Δ) by ∼5 kcal/mol. Display Omitted Highlights: ► We have studied through ab initio methods the polytopic system Sc[CN]. ► A series of low lying states for both isomeric forms have been examined. ► Around equilibrium the system displays a pronounced Sc+[CN]− ionic character. - Abstract: We have studied the experimentally unknown Sc[CN] molecular system in both its isomeric forms, scandium cyanide (ScCN) and isocyanide (ScNC), through ab initio computations. We report energetics, geometries, harmonic frequencies, and dipole moments for the first 20 Sc[CN] states correlating diabatically to Sc+(3D, 1D, 3F) + CN−(X1Σ+). Both isomers have a pronounced ionic character around equilibrium due to the high electron affinity of the CN group and the low ionization energy of the Sc atom. According to our calculations the ScNC isomer (X∼3Δ) is stabler than the ScCN(X∼3Δ) by ∼5 kcal/mol.

  3. Effect of carbon content on nanostructural, mechanical and electrochemical characteristics of self-organized nc-ZrCN/a-CNx nanocomposite films

    International Nuclear Information System (INIS)

    Highlights: • The superhard nanocomposite nc-ZrCN/a-CNx films were prepared by filtered cathodic vacuum arc technique (FCVA). • This work provides an understanding of relationship between composition, nanostructure and properties of nc-ZrCN/a-CNx nanocomposite films. • The effects of the thickness of amorphous a-CNx matrix on the structure and properties of the films were detailedly performed. - Abstract: The nanocomposite nc-ZrCN/a-CNx films with a carbon content varying from 34 to 61 at.% were deposited by filtered cathodic vacuum arc technique (FCVA) under different C2H2/N2 reactive gas flows. The effect of different carbon contents on compositional, nanostructural characteristics of nanocomposite nc-ZrCN/a-CNx films was investigated by scanning electron microscopy (SEM), X-ray diffraction (XRD), transmission electron microscope (TEM), Raman scattering spectroscopy (Raman) and X-ray photoelectron spectroscopy (XPS). Results showed that nanocomposite nc-ZrCN/a-CNx films were composed of about 8 nm sized ZrCN nanocrystalline embedded in different amount of a-CNx amorphous matrix. Mechanical properties of nanocomposite nc-ZrCN/a-CNx films showed a significant dependency on thickness of a-CNx matrix. Nanocomposite nc-ZrCN/a-CNx film reached the highest hardness (41 GPa) and reduced modulus (320 GPa) when the thickness of a-CNx matrix was around 0.4 nm. Nanocomposite nc-ZrCN/a-CNx film at higher carbon content has lower friction coefficient (0.2) and better wear resistance. The nanocomposite films possess lower Icorr and higher Rp values than the single phase film

  4. The electron density distribution in CN−, LiCN and LiNC. The use of minimal and extended basis set SCF calculations

    NARCIS (Netherlands)

    Bats, J.W.; Feil, D.

    1977-01-01

    Electron density maps are reported for the CN−ion and the LiCN and LiNC molecules, calculated from molecular wave-functions near the Hartree-Fock limit. The electron density distribution derived from CNDO/ 2 wavefunctions does not resemble the ab initio results. The ultimate ability of a minimal bas

  5. Reaction of CN(-) with F, Cl, O, and S Atoms: Attachment or Associative Detachment?

    Science.gov (United States)

    Khiri, D; Chambaud, G

    2015-11-19

    Highly correlated ab initio wave functions within the UCCSD(T)-F12 approach have been used to map the potential energy surfaces (PESs) describing the reactivity of the CN(-) (X(1)Σ(+)) anion with neutral atoms present in interstellar media (F, Cl, O, and S). With the H atom, for comparison, the reaction [CN(-)((1)Σ(+)) + H((2)S)] evolves along the PES of the X(2)Σ(+) electronic ground state of HCN(-) (or HNC(-)) until the crossing with the X(1)Σ(+) electronic ground state of HCN (or HNC), where electron detachment occurs. The process is rather similar to the two halogen atoms F and Cl, with some differences due to the larger electron affinity of the halogens, making possible the existence of ClCN(-) in a (2)Σ(+) state. The reaction of CN(-) with O and S atoms proceeds via a multistep mechanism. The lowest electronic state at long distance, the (3)Π state arising from the [CN(-)((1)Σ(+)) + O/S((3)P)] reaction channel, does not correlate with the X(1)Σ(+) ground state of the XCN(-) anion (X = O or S). This (3)Π state and its bent components cross at medium RXC (RXN) distances the X(1)Σ(+) ground state of XCN(-) or XNC(-), and at shorter distances the X(2)Π state of the neutral XCN or XNC where the extra electron can detach. With both O and S atoms, it is shown that the spin-orbit couplings can efficiently lead the [CN(-)((1)Σ(+)) + O/S((3)P)] reaction toward the stable X(1)Σ(+) ground state of XCN(-) and XNC(-). PMID:26517187

  6. DSC/TG-MS联用技术研究CL-20与NC-NG体系的相互作用%Research on the Interaction between CL-20 and NC-NG System via DSC/TG-MS

    Institute of Scientific and Technical Information of China (English)

    常海

    2007-01-01

    应用DSC/TG-MS联用新技术研究了CL-20与NC/NG双基混合体系的相互作用,在溶解制样条件下,NC/NG体系与CL-20不仅有物理相互作用,还有明显的化学相互作用,表现为:CL-20的存在,使得NG的升华过程和CL-20的分解过程显著提前,NC/NG体系的分解过程滞后;并研究了不同粒度的CL-20的热失重过程,表现为大颗粒CL-20热分解过程中有两次明显的热失重,小颗粒CL-20为一次热失重.

  7. Theoretical study on the reaction of CN radicals with ClO radicals by density functional theory

    Institute of Scientific and Technical Information of China (English)

    2009-01-01

    The reaction mechanism of CN radicals with ClO radicals has been studied theoretically using ab initio and density functional theory(DFT).The result shows that the main reaction path is the O atom in radical ClO attacks the C atom in radical CN to compose the intermediate 1 ClOCN.Three thermodynamically accessible prodncts,P1(CO+ClN),P3(NO+CCl),and P4(ClNCO),were obtained from intermediate 1 through isomerization and decomposition reactions.P4 is the primary product,and P1 and P3 are the secondary product.Compared with the singlet potential energy surface,the contribution of the triplet potential energy surface can be ignored.

  8. Perchlorate cerium(3) complexes with 1,10-phenanthroline. Crystal structure of [Ce(C12H8N2)4(CH3CN)2](ClO4)3 · 3CH3CN

    International Nuclear Information System (INIS)

    The Ce(ClO4)3 · 2Phen · 2H2O (1) and Ce(ClO4)3 · 3Phen (2) complexes are obtained through interaction of anhydrous Ce(ClO4)3 · H2O with 1,10-phenanthroline. The Ce(ClO4)3 · 4Phen · 5CH3CN (3) complex is separated from the solution 2. The IR-spectra of compounds 1-3, their thermal behavior are studied, X-ray diffraction data on compounds 1 and 2 are presented. The RSA is carried out for compound 3: rhombic crystals, a = 12.059(3), b 20.657(5), c = 24.170(6) A, sp. gr. Pccn, Z = 4. The structure 3 consists of complex cations [Ce(Phen)4 · (CH3CN)2]3+, outerspheric anions ClO4- and solvate molecules of acetonitrile

  9. New nitrosyl complexes of rhenium: ReCl3(NO)2, ReCl3(NO)2(CH3CN), AsPh4[ReCl4(NO)2

    International Nuclear Information System (INIS)

    ReCl3(NO)2, which is associated via chlorine bridges, was obtained in quantitative yield from rhenium pentachloride and trichloronitromethane. Using acetonitrile, the monomer complex ReCl3(NO)2(CH3CN) can be obtained from it, from which AsPh4[ReCl4(NO)2] arises with tetraphenylarsoniumchloride. The i.r. spectra are reported and assigned. The crystal structures were determined for the latter two compounds with the help of X-ray diffraction data. ReCl3(NO)2(CH3CN) crystallizes in the monoclinic space group P21/n with four molecules per unit cell, AsPh4[ReCl4(NO)2] crystallizes in the tetragonal space group P4/n with two formula units. In all three compounds, the two NO groups linked to a Re atom are arranged cis to one another. As the anion in AsPh4[ReCl4(NO)2] is situated on a fourfold axis, the cis-configuration causes a statistical disorder in the crystal. (author)

  10. Studies of the microwave resistivity of κ-(BEDT-TTF)2Cu[N(CN)2]Cl

    International Nuclear Information System (INIS)

    The authors have performed temperature dependent measurements of the surface impedance of κ-(BEDT-TTF)2Cu[N(CN)2]Cl in both directions, parallel and perpendicular to the highly conducting planes. In both orientations the microwave resistivity basically follows the dc behavior for T > 15 K: the crystal undergoes a broad metal-insulator transition at around 50 K. While there are no indications of superconductivity at ambient pressure found in the dc resistivity and by ac susceptibility, the microwave resistivity clearly drops at 13 K and again at 5 K, indicating two superconducting phases. When pressure is applied by embedding it in grease, only the well known superconducting phase transition at Tc = 13 K remains

  11. Study by electronic paramagnetic resonance of the Ni(CN)4K2 irradiated with electrons in KCl e NaCl

    International Nuclear Information System (INIS)

    The Ni(CN)4K2 irradiated with electrons in KCl and NaCl is studied by electronic paramagnetic resonance. The validity of two approximations, is tested, one, said of intermediate symmetry and the other one of super-hyperfine structure, to evaluate the coefficients of the ligants in the molecular orbital

  12. Alkylammonium ion radicals in layered ionic crystals of (CnH2n+1NH3)2CdCl4; n=1, 2, 3

    International Nuclear Information System (INIS)

    Single crystals of (CnH2n+1NH3)2CdCl4; n=1, 2, 3 were irradiated with 60Co γ-rays at 77 K. Electron paramagnetic resonance measurements revealed that chlorine molecular ions, Cl-2 were formed with γ-irradiation at 77 K. The crystals irradiated at 77 K were warmed to 300 K for n=1, 2 and to 200 K for n=3. The Cl-2 ions became unstable at temperatures higher than 100 K. Then there appeared quite different features of the electron paramagnetic resonance signals, which had been buried under the signals of Cl-2 at 77 K. It was confirmed by the analysis of the electron paramagnetic resonance signals that the alkylammonium ion radicals were formed. The alkylammonium ions are composed of double sheets, which are similar to the lipid bilayers of plasma membranes. A model of radiation effects on membranes is proposed from the present results. ((orig.))

  13. Inelastic Incoherent Neutron Scattering Investigation of Lattice Dynamics of [N(C_{2}H_{5})_{4}]_{2}MeCl_{4} (Me=Zn,Cu) Compound

    CERN Document Server

    Kazimirov, V Yu; Tylczynski, Z

    2001-01-01

    Generalized phonon densities of states of polycrystalline samples of [N(C_{2}H_{5})_{4}]_{2}MeCl_{4} (Me=Zn,Cu) in a wide temperatures range higher and below phase transitions points were investigated by inelastic incoherent neutron scattering. The character of change of phonon densities with temperature allows us to make some conclusions about a nature of observed phase transitions. In particular, since inelastic incoherent scattering is most sensitive to vibrations of protons, it is possible to conclude, that decrease of temperature leads to ordering protons of a C_{2}H_{5} radical, and, apparently, [N(C_{2}H_{5})_{4}]^{+} cation as whole. In result, rotary diffusion of molecular complexes of crystal transforms into librations with decrease of temperature and appropriate lowering of symmetry.

  14. Nuclear magnetic resonance study of the ferroelastic phase transition of order-disorder type in [N(C2H5)4]2CdCl4

    Science.gov (United States)

    Lim, Ae Ran; Kim, Min Soo; Lim, Kye-Young

    2016-08-01

    This study uses nuclear magnetic resonance (NMR) techniques to examine the detailed changes in [N(C2H5)4]2CdCl4 around its phase transition at the temperature TC = 284 K. The chemical shifts and spin-lattice relaxation times in the rotating frame (T1ρ) were determined from 1H magic angle spinning (MAS) NMR and 13C cross-polarization (CP)/MAS NMR spectra. The two sets of inequivalent 1H and 13C nuclei in CH3 and CH2 were distinguished. A ferroelastic phase transition was observed at TC, without structural symmetry change. The phase transition is mainly attributed to the orientational ordering of the [N(C2H5)4]+ cations, and the spectral splitting at low temperature is associated with different ferroelastic domains.

  15. Ab initio and AIM theoretical analysis of hydrogen-bond radius of HD (D = F, Cl, Br, CN, HO, HS and CCH) donors and some acceptors

    OpenAIRE

    Raghavendra, B; Pankaj K Mandal; Arunan, E

    2006-01-01

    Recently, we defined ‘hydrogen-bond radii’ for various hydrogen-bond donors, DH where D=F, Cl, Br, CN, HO or CCH from an empirical analysis. It was shown that the $A^{...} H$ distances in $B^{...}HD$ complexes could be written as a sum of hydrogen bond radius for DH and a constant acceptor radius for A, which is the bonding atom/centre in B. This manuscript reports the determination of the hydrogen-bond radii for these molecules and $H_2S$ from ab initio and atoms in molecules (AIM) theoreti...

  16. Crystal structure and AC conductivity mechanism of [N(C3H7)4]2CoCl4 compound

    Science.gov (United States)

    Moutia, N.; Oueslati, A.; Ben Gzaiel, M.; Khirouni, K.

    2016-09-01

    We found that the new organic-inorganic compound [N(C3H7)4]2 CoCl4, crystallizes at room temperature in the centrosymmetric monoclinic system with P21/c space group. The atomic arrangement can be described by an alternation of organic and organic-inorganic layers parallel to the (001) plan. Indeed, the differential scanning calorimetry (DSC) studies indicate a presence of three order-disorder phase transitions located at 332, 376 and 441 K. Furthermore, the conductivity was measured in the frequency range from 200 MHz to 5 MHz and temperatures between 318 K and 428 K using impedance spectroscopy. Analysis of the AC conductivity experimental data obtained, and the frequency exponent s with theoretical models reveals that the correlated barrier hopping (CBH) model is the appropriate mechanism for conduction in the title compound. The analysis of the dielectric constants ε ‧ and ε ″ versus temperature, at several frequencies, shows a distribution of relaxation times. This relaxation is probably due to the reorientational dynamics of [N(C3H7)4]+ cations.

  17. Structural characterization and AC conductivity of bis tetrapropylammonium hexachlorado-dicadmate, [N(C3H7)4]2Cd2Cl6

    International Nuclear Information System (INIS)

    Synthesis, crystal structure, vibrational study, 13C, 111Cd CP-MAS-NMR analysis and electrical properties of the compound [N(C3H7)4]2Cd2Cl6, are reported. The latter crystallizes in the triclinic system (space group P1-bar, Z = 2) with the following unit cell dimensions: a = 9.530(1) A, b = 11.744(1) A, c = 17.433(1) A, α = 79.31(1)o, β = 84.00(1)o and γ = 80.32(1)o. Besides, its structure was solved using 6445 independent reflections down to R = 0.037. The atomic arrangement can be described by alternating organic and inorganic layers parallel to the (11-bar 0) plan, made up of tetrapropylammonium groups and Cd2Cl6 dimers, respectively. In crystal structure, the inorganic layer, built up by Cd2Cl6 dimers, is connected to the organic ones through van der Waals interaction in order to build cation-anion-cation cohesion. Impedance spectroscopy study, reported in the sample, reveals that the conduction in the material is due to a hopping process. The temperature and frequency dependence of dielectric constants of the single crystal sample has been investigated to determine some related parameters to the dielectric relaxation.

  18. Crystal structure and phase transitions in dipropylammonium hexachloroantimonate(V): [N(C 3H 7) 2H 2][SbCl 6

    Science.gov (United States)

    Kulicka, B.; Jakubas, R.; Bednarska-Bolek, B.; Bator, G.; Ciunik, Z.

    2006-07-01

    The crystal structure of dipropylammonium hexachloroantimonate(V), [N(C 3H 7) 2H 2][SbCl 6] (DPACA) has been determined by means of X-ray diffraction at 290 K. The compound crystallizes in the monoclinic space group: P21/ n. The crystal undergoes three structural phase transitions: two first-order type at 388/376 K (heating-cooling) from phase (I) to (II) and at 157/144 K from phase (III) to (IV), and one second-order type at 210 K from phase (II) to (III). The dielectric relaxation process has been found to appear in a kilohertz frequency region over the phases (II) and (III) with the activation energy ca. 28 kJ mol -1. A polydispersive character of the dielectric dispersion indicates a presence of complex molecular motions of dipolar groups in the crystal. The mechanism of the phase transitions in DPACA is proposed.

  19. Electrical properties and conduction mechanism of [N(C2H5)4][N(CH3)4]CuCl4 compound

    Science.gov (United States)

    Drissi, N.; Karoui, K.; Jomni, F.; Rhaiem, A. Ben

    2016-09-01

    The [N(CH3)4][N(C2H5)4]CuCl4 single crystal has been synthetized in order to determinate the temperatures transition and to study the electrical properties and the conduction mechanism. At room temperature, this compound crystallizes in the tetragonal system with P-421m space group. The calorimetric study shows three anomalies at 248, 284 and 326 K. Electrical conduction and dielectrical relaxation mechanisms at various frequencies and temperatures were analyzed by impedance spectroscopy and the equivalent circuit based on the Z-View-software was proposed. The variation of fp relaxation determinate by the modulus study and σdc specific to the AC conductivity as a function of temperature and confirm the all transitions for our sample. The values of the activation energy are determined and compared by those, which are found in the similar compound. Frequencies dependence of alternative current (AC) conductivity is interpreted in terms of Jonscher's law and the conduction mechanisms for each phase are determined with the Elliot's theory.

  20. Cyano Bridged Bimetallic Compounds of the Type M2+-NC-Fe3+ (M = Co, Ni, Cu, Zn, Cd Using the [Fe(CN6]3- Building Block and their Antibacterial Evaluation

    Directory of Open Access Journals (Sweden)

    Mohammad Nasir Uddin

    2014-01-01

    Full Text Available Reactions between [M(L]2+ [M= Cu(II, Co(II, Cd(II, Zn(II and Ni(II] and [Fe(CN6]3- give rise to cyano-bridged assembled bimetallic complexes. Their structures have been proposed by elemental analyses, IR, UV-VIS and 13C NMR spectra, conductance and magnetic measurements studies. The structure is supposed to consist of zigzag chains formed by an alternate array of the cations and [Fe(CN6]3- anion having neutral Ni3Fe2 units. Each hexacyanoferrate(III ion connects three nickel(II ions using three cis CN- groups and the remaining CN- groups are terminal. The bridging cyanide ligands co-ordinate to the metal ion in a trans fashion forming trans-ML(CN2 moieties. Antibacterial activity of some of the prepared complexes has also been investigated against three human pathogen bacteria.

  1. Lattice potential energies and thermochemical properties of phase change materials (1-CnH2n+1NH3)2MnCl4(s) (n = 10 and 11)

    International Nuclear Information System (INIS)

    Graphical abstract: Two novel crystalline compounds (1-CnH2n+1NH3)2MnCl4(s) (n = 10 and 11) were synthesized. Crystal structures of the two complexes were determined by X-ray crystallography. The lattice potential energies were calculated. Molar enthalpies of dissolution of the compounds were measured by a solution calorimeter. According to Pitzer’s electrolyte solution theory, molar enthalpies of dissolution at infinite dilution and Pitzer’s parameters of the compounds were obtained. Finally, using the molar enthalpies of dissolution and other auxiliary thermodynamic data, the enthalpy change of the dissociation of [MnCl4]2− as for [MnCl4]2-(g)→Mn2+(g)+4Cl-(g) was obtained. - Highlights: • Compounds (1-CnH2n+1NH3)2MnCl4(s) (n = 10 and 11) were synthesized. • Lattice potential energies of the compounds were calculated. • Molar enthalpies of dissolution at infinite dilution of the compounds were obtained. • The molar enthalpy of dissociation of [MnCl4]2−(g) were obtained. - Abstract: Two novel crystalline compounds (1-C10H21NH3)2MnCl4(s) and (1-C11H23NH3)2MnCl4(s), which may be used as solid–solid phase change materials, were synthesized. The compositions and mass fraction purities of the samples prepared were determined by chemical and elemental analyses. The crystal structures of the two compounds were characterised by X-ray crystallography. The lattice potential energies of the two compounds were obtained from crystallographic data. Molar enthalpies of dissolution of the compounds at various values of molality were measured in the double-distilled water at T = 298.15 K by means of an isoperibol solution–reaction calorimeter. According to Pitzer’s unsymmetrical mixing electrolyte solution theory, the values of molar enthalpies of dissolution at infinite dilution and Pitzer’s parameters of the compounds were obtained. Finally, using the values of molar enthalpies of dissolution at infinite dilution (ΔsHm∞) and other auxiliary

  2. New k-phase materials, k-(ET) sub 2 Cu(N(CN) sub 2 )X: X = Cl, Br and I: The synthesis, structure and superconductivity above 11 K in the Cl ( Tc = 12. 8 K, 0. 3 kbar) and Br( Tc = 11. 6 K) salts

    Energy Technology Data Exchange (ETDEWEB)

    Wang, H.H.; Carlson, K.D.; Geiser, U.; Kini, A.M.; Schultz, A.J.; Williams, J.M.; Montgomery, L.K.; Kwok, W.K.; Welp, U.; Vandervoort, K.G.; Boryschuk, S.J.; Strieby Crouch, A.V.; Kommers, J.M.; Watkins, D.M. (Argonne National Lab., IL (USA)); Schirber, J.E.; Overmyer, D.L. (Sandia National Labs., Albuquerque, NM (USA)); Jung, D.; Novoa, J.J.; Whangbo, M.H. (North Carolina State Univ., Raleigh, NC (USA))

    1990-01-01

    The syntheses, structures, selected physical properties, and band electronic structures of three copper (I) dicyanamide halide salts of bis(ethylenedithio)tetrathiafulvalene ({kappa}-(ET){sub 2}Cu(N(CN){sub 2})X, where X = Cl, Br, and I) are discussed. X-ray crystallographic studies demonstrate that the three derivatives are isostructural. The bromide salt is an ambient pressure superconductor with an inductive onset at 11.6 K and a resistive onset at 12.5 K. {kappa}-(ET){sub 2}Cu(N(CN){sub 2})Cl exhibits the highest reported superconducting transition temperature ({Tc} = 12.8 K, 0.3 kbar) for an organic superconductor, once a semiconductor-semiconductor transition (42 K) is suppressed. The application of GE varnish or Apiezon N grease to crystals of {kappa}-(ET){sub 2}Cu(N(CN){sub 2})Cl provides sufficient stress to induce superconductivity at ambient pressure.'' Crystals of the iodide remain metallic to {approximately}150 K, where they become weakly semiconductive. No sign of superconductivity was detected at pressures (hydrostatic and shearing) up to 5.2 kbar and at temperatures as low as 1.1 K. The band electronic structures of the three salts are essentially identical. The differences in superconducting properties are explained in terms of differences in lattice softness, which are strongly influenced by short C-H{hor ellipsis}donor and C-H{hor ellipsis}anion contacts. 17 refs., 2 figs.

  3. A nuclear magnetic resonance study of molecular motion in solid tris (n-propylammonium) enneachlorodiantimonate (III) (n-C3H7NH3)3Sb2Cl9.

    Science.gov (United States)

    Tritt-Goc, J; Piślewski, N; Goc, R; Piślewska, H; Jakubas, R

    1997-12-01

    Proton magnetic resonance second moment and spin-lattice relaxation time were carried out on polycrystalline tris (n-propylammonium) enneachlorodiantimonate (III), (n-C3H7NH3)3Sb2Cl9, in the temperature range of 10-370 K. The second moment measurements show that the structure is not rigid on the NMR scale at 10 K, the lowest temperature studied, and that CH3 and NH3 groups execute rotations about C3 axis. The proton spin-lattice relaxation measurements reveal two minima due to the motions of the amino and methyl groups. Analysis of the relaxation data yields the activation energy barriers of 11.0 kJ mol(-1) and 5.8 kJ mol(-1), respectively, for the NH3 and CH3 groups' motion. NMR data confirm the phase transition at Tc = 232 K, known from different studies. PMID:9472794

  4. Electrochemical properties of metallocene hydroxo and oxo complexes of Ta(V): [Cp*(CpR)TaOHCl]+Cl-, R = H, SiMe3 or (CH2)3NC4H4, Cp*(Cp(CH2)3NC4H4)TaOCl

    International Nuclear Information System (INIS)

    Redox properties of three cationic tantalocene hydroxo complexes, [Cp*(CpR)TaVOHCl]+, with one pentamethylated cyclopentadienyl ligand, Cp* = η5-C5Me5, Me = CH3, and one monosubstituted cyclopentadienyl ligand, CpR, Cp = C5H4, R = H, SiMe3 or (CH2)3NC4H4, as well as of an oxo complex with the pyrrole-containing ligand, Cp*(Cp(CH2)3NC4H4)TaOCl, have been studied in acetonitrile solutions with cyclic voltammetry in the ranges of the Ta(V) reduction to Ta(IV) and to Ta(III). Both transitions are irreversible due to the dissociation of reduced complexes with the loss of their chloride ligand. The mechanism of hydroxo complex reduction is discussed in terms of its reversible deprotonation/protonation equilibrium with the corresponding oxo complex, Cp*(CpR)TaOCl. The variation of the reduction potential for the Ta(V)/Ta(IV) transition in the negative direction in the series of tantalocene complexes: dichloride > hydroxo > oxo, as well as the difference in the behavior of the reduced (Ta(IV)) complexes (stable for dichloride but losing their chloride ligand for hydroxo and oxo complexes) was explained by the increase of the electronic density at the central metal in this series, correlated with the weakening of the Ta-Cl bond and its easier dissociation. The tantalocene centers were immobilized inside a polypyrrole matrix on the electrode surface by electropolymerization of the cationic complex [Cp*(Cp(CH2)3NC4H4)TaOHCl]+. This was possible after removal of the 'free' chloride ions from the polymerization bath by their precipitation upon addition of TlPF6. The corresponding polymer, poly[Cp*(Cp(CH2)3NC4H4)TaOHCl], was found to be electroactive in contact with a background electrolyte, giving a redox response both in the polymer matrix and tantalocene potential ranges. The mechanism of the immobilized tantalocene complex transformation was the same as that for the same species dissolved in solution

  5. Thermodynamics of solvent extraction on (C8H17)3N-C6H5CH3-UO2Cl2-HCl system

    International Nuclear Information System (INIS)

    Solvent extraction thermodynamics in the system n-trioctylamine-toluene-UO2CL2-HCl-water was considered. Pitzer equation and improved Frank-Thompson equation were used to calculate coefficients of electrolyte activity in aqueous phase. Activity coefficients of all components in organic phase were measured or calculated. Thermodynamic equilibrium constants of studied system were obtained

  6. Theoretical Characterization of Hydrogen Bonding Interactions between RCHO (R = H, CN, CF3, OCH3, NH2) and HOR′(R′ = H, Cl, CH3, NH2, C(O)H, C6H5)

    Indian Academy of Sciences (India)

    Damanjit Kaur; Rajinder Kaur

    2015-07-01

    In this work, density functional theory and ab initio molecular orbital calculations were used to investigate the hydrogen bonded complexes of type RCHO···HOR′(R = H, CN, CF3, OCH3, NH2; R′ = H, Cl, CH3, NH2, C(O)H, C6H5) employing 6-31++g** and cc-pVTZ basis sets. Thus, the present work considers how the substituents at both the hydrogen bond donor and acceptor affect the hydrogen bond strength. From the analysis, it is reflected that presence of –OCH3 and –NH2 substituents at RCHO greatly strengthen the stabilization energies, while –CN and –CF3 decrease the same with respect to HCHO as hydrogen bond acceptor. The highest stabilization results in case of (H2N)CHO as hydrogen bond acceptor. The variation of the substituents at –OH functional group also influences the strength of hydrogen bond; nearly all the substituents increase the stabilization energy relative to HOH. The analysis of geometrical parameters; proton affinities, charge transfer, electron delocalization studies have been carried out.

  7. Synthesis, Characterization, Spectroscopy and Study of Antimicrobial Properties of Two New Substituted Trichloroaluminate(Ⅲ)Complexes [AlCl3X]-(X =SCN-, CN-)

    Institute of Scientific and Technical Information of China (English)

    Zahra Shokri Aghbolagh; Shahriar Ghammamy; Sajjad Sedaghat; Shahram Jahandide

    2013-01-01

    The synthesis and characterization of two new aluminate(Ⅲ) complexes with general formula K[AlCl3X] are reported.These compounds derived from aluminate trichloride and related salts.Potassium trichlorothiocyanoaluminate,PCTA,and potassium trichlorocyanatoaluminate,PCCA,are two new ionic aluminate complexes.They can be easily synthesized in a nearly quantitative yield by using the direct reaction of AlCl3 and KX.The complexes were characterized by physico-chemical and spectroscopic methods.Theoretical calculations have been used for the extraction of structural and spectroscopic data of these new synthesized complexes.The antibacterial activities of such compounds were studied against the Staphylococcus aureus,Escherichia coli,Staphylococcus Epidermidis,Estreptococo B and Shigella.

  8. Cyanido-bridged one-dimensional systems assembled from[ReⅣCl4(CN)2]2-and [MⅡ(cyclam)]2+(M=Ni,Cu)precursors

    Institute of Scientific and Technical Information of China (English)

    BHOWMICK Indrani; HARRIS T.David; DECHAMBENOIT Pierre; HILLARD Elizabeth A.; PICHON Céline; JEON Ie-Rang; CL(E)RAC Rodolphe

    2012-01-01

    Three new cyanido-bridged heterometallic ReIVNiⅡ and ReIVCuⅡ one-dimensional systems were synthesized and extensively characterized both structurally and magnetically.Single-crystal X-ray diffraction analysis revealed that these compounds display a common topology,with chains composed of alternating[ReⅣCI4(CN)2]2- and [MⅡ(cyclam)]2+(M =Ni in 1,Cu in 2)or[CuⅡ(N,N'-dimethylcyclam)]2+(in 3)building units.Two different chain orientations with a tilt angle of ca.51° to 55° are present in the crystal packing of these compounds.The magnetic susceptibility measurements suggest the presence of intrachain ferromagnetic interactions between the S =3/2 RenⅣcenters and the 3d metal ions:S =1 NiⅡ or S =1/2 CuⅡ.At low temperature,a three-dimensional ordered magnetic phase induced by interchain antiferromagnetic interactions(antiferromagnetic for 1 and 2; canted antiferromagnetic for 3)is detected for the three compounds.

  9. Solid solution cermet: (Ti,Nb)(CN)-Ni cermet.

    Science.gov (United States)

    Kwon, Hanjung; Jung, Sun-A

    2014-11-01

    Solid solution powders without W, (Ti,Nb)(CN) powders with a B1 structure (NaCl like), were synthesized by high energy milling and carbothermal reduction in nitrogen. The range of molar ratios of Ti/Nb for forming complete (Ti,Nb)(CN) phase was broader than that of Ti/W for the (Ti,W)(CN) phase because carbide or carbonitride of Nb had a B1 crystal structure identical to Ti(CN) while WC had a hexagonal crystal structure. The results revealed that the hardness of (Ti,Nb)(CN)-Ni cermets was higher than that of (Ti,W)(CN)-Ni cermets. The lower density of the (Ti,Nb)(CN) powder contributed to the higher hardness compared to (Ti,W)(CN) because the volumetric ratio of (Ti,Nb)(CN) in the (Ti,Nb)(CN)-Ni cermets was higher than that of (Ti,Nb)(CN) in the (Ti,W)(CN)-Ni cermets at the same weight ratio of Ni. Additionally, it was assumed that intrinsic the properties of (Ti,Nb)(CN) could also be the cause for the high hardness of the (Ti,Nb)(CN)-Ni cermets. PMID:25958611

  10. Electronic and electrochemical properties of platinum(II) and platinum-mercury-carboxylato complexes containing 2-Me2NCH2C6H4, 2,6-(Me2NCH2)2C6H3- and 2-Me2NC6H4CH2 - ligands

    NARCIS (Netherlands)

    Koten, G. van; Ploeg, A.F.M.J. van der; Schmitz, J.E.J.; Linden, J.G.M. van der

    1982-01-01

    The organoplatinum(II) compounds [{2, 6-(Me{2}NCH{2}){2}C{6}H{3}}PtBr] and cis-[(C-N){2}Pt] (C-N = 2-Me{2}NCH{2}C{6}H{4}, 2-Me{2}NC{6}H{4}CH{2}) can be chemically irreversibly oxidized in the potential range 1.00 to 1.35 V vs. an Ag/AgCl electrode, whereas the organoplatinum@?mercury complexes [{2,6

  11. Fusion-Fission process and gamma spectroscopy of binary products in light heavy ion collisions (40 {<=} A{sub CN} {<=} 60); Processus de fusion-fission et spectroscopie gamma des produits binaires dans les collisions entre ions lourds legers (40 {<=} A{sub NC} {<=} 60)

    Energy Technology Data Exchange (ETDEWEB)

    Nouicer, Rachid [Institut de Recherche Subatomique, CNRS-IN2P3 - Universite Louis Pasteur, 67 - Strasbourg (France)

    1997-11-21

    During the work on which this Thesis is based, the significant role of the Fusion-Fission Asymmetric mechanism in light heavy ion collisions (A{sub NC} {<=} 60) has been emphasized. The Spin Dis-alignment in the oblate-oblate system has supplied evidence for the first time for the Butterfly mode in a resonant-like reaction. These two aspects, one macroscopic and the other more closely related to microscopic effects are certainly different from a conceptual point of view but are quite complementary for a global understanding of dinuclear systems. In the first part, inclusive and exclusive measurements of the {sup 35}Cl + {sup 12}C and {sup 35}Cl + {sup 24}Mg reaction have been performed at 8 MeV/nucleon in the Saclay experiment. These measurements have permitted us to verify the origin of products which have given rise of the asymmetric fusion-fission mechanism and which have demonstrated that the three-body process in this energy range is very weak. In the second part the {sup 28}Si + {sup 28}Si reaction has been performed at the resonance energy E{sub lab}> = 111.6 MeV at Strasbourg with the Eurogam phase II multi-detector array and VIVITRON accelerator. An angular momentum J{sup {pi}} 38{sup +} for inelastic and mutual channels of the {sup 28}Si + {sup 28}Si exit channel has been measured and has supplied evidence for a spin dis-alignment which has been interpreted in the framework of a molecular model by Butterfly motion. The spectroscopic study of {sup 32}S nucleus, has revealed the occurrence of a new {gamma}-ray transition 0{sup +}(8507.8 keV) {yields} 2{sub 1}{sup +}(2230.2 keV). (author) 105 refs., 116 figs., 26 tabs.

  12. Large N_c

    OpenAIRE

    Jenkins, Elizabeth E.

    2009-01-01

    The 1/N_c expansion of QCD with N_c=3 has been successful in explaining a wide variety of QCD phenomenology. Here I focus on the contracted spin-flavor symmetry of baryons in the large-N_c limit and deviations from spin-flavor symmetry due to corrections suppressed by powers of 1/N_c. Baryon masses provide an important example of the 1/N_c expansion, and successful predictions of masses of heavy-quark baryons continue to be tested by experiment. The ground state charmed baryon masses have all...

  13. Phenomenology of large Nc QCD

    International Nuclear Information System (INIS)

    These lectures are designed to introduce the methods and results of large Nc QCD in a presentation intended for nuclear and particle physicists alike. Beginning with definitions and motivations of the approach, we demonstrate that all quark and gluon Feynman diagrams are organized into classes based on powers of 1/Nc. We then show that this result can be translated into definite statements about mesons and baryons containing arbitrary numbers of constituents. In the mesons, numerous well-known phenomenological properties follow as immediate consequences of simply counting powers of Nc, while for the baryons, quantitative large Nc analyses of masses and other properties are seen to agree with experiment, even when 'large' Nc is set equal to its observed value of 3. Large Nc reasoning is also used to explain some simple features of nuclear interactions. (author)

  14. Pro Engineerin NC-ohjelmointi

    OpenAIRE

    Tervo, Toni

    2003-01-01

    Insinöörityön ensisijaisena tavoitteena oli selvittää NC-ohjelman luonti Pro Engineerillä ja dokumentoida prosessi. Työssä tutustuttiin Pro Engineerin Manufacture-toimintoon, jonka avulla työstöratojen määrittely sekä niiden simulointi on mahdollista. Toissijaisena tavoitteena oli luoda NC-ohjelma valitulle kappaleelle ja yrittää koneistaa se koulun NC-koneella. Työssä selvitettiin NC-ohjelman luonnin kaikista vaiheista tärkeimmät asiat toimivan ohjelman luomiseksi. Ensimmäisessä vaiheessa...

  15. Atmospheric chemistry of 4 : 2 fluorotelomer alcohol (n-C4F9CH2CH2OH): Products and mechanism of Cl atom initiated oxidation in the presence of NOx

    DEFF Research Database (Denmark)

    Andersen, Mads Peter Sulbæk; Nielsen, OJ; Hurley, MD; Ball, JC; Wallington, TJ; Ellis, DA; Martin, JW; Mabury, SA

    2005-01-01

    Smog chamber/FTIR techniques were used to study the Cl atom initiated oxidation of 4:2 fluorotelomer alcohol (C4F9CH2CH2OH, 4:2 FTOH) in the presence of NOx in 700 Torr of N-2/O-2 diluent at 296 K. Chemical activation effects play an important role in the atmospheric chemistry of the peroxy, and...... possibly the alkoxy, radicals derived from 4:2 FTOH. Cl atoms react with C4F9CH2CH2OH to give C4F9CH2C.HOH radicals which add O-2 to give chemically activated alpha-hydroxyperoxy radicals, [C4F9CH2C(OO.)HOH]*. In 700 Torr of N-2/ O-2 at 296 K, approximately 50% of the [C4F9CH2C(OO.)HOH]* radicals decompose...... ``promptly'' to give HO2 radicals and C4F9CH2CHO, the remaining [C4F9CH2C(OO.)HOH]* radicals undergo collisional deactivation to give thermalized peroxy radicals, C4F9CH2C(OO.)HOH. Decomposition to HO2 and C4F9CH2CHO is the dominant atmospheric fate of the thermalized peroxy radicals. In the presence of...

  16. SIGNIFICANT NATURAL HERITAGE AREAS (NC)

    Science.gov (United States)

    The North Carolina Department of Environment and Natural Resources, Division of Parks and Recreation, Natural Heritage Program in cooperation with the NC Center for Geographic Information & Analysis, developed the Significant Natural Heritage Areas digital data to determine the a...

  17. Environmental effects on electron spin relaxation in N@C60

    CERN Document Server

    Morton, J J L; Ardavan, A; Porfyrakis, K; Lyon, S A; Briggs, G A D; Morton, John J. L.; Tyryshkin, Alexei M.; Ardavan, Arzhang; Porfyrakis, Kyriakos

    2006-01-01

    We examine environmental effects of surrounding nuclear spins on the electron spin relaxation of the N@C60 molecule (which consists of a nitrogen atom at the centre of a fullerene cage). Using dilute solutions of N@C60 in regular and deuterated toluene, we observe and model the effect of translational diffusion of nuclear spins of the solvent molecules on the N@C60 electron spin relaxation times. We also study spin relaxation in frozen solutions of N@C60 in CS2, to which small quantities of a glassing agent, S2Cl2 are added. At low temperatures, spin relaxation is caused by spectral diffusion of surrounding nuclear (35,37)Cl spins in the S2Cl2, but nevertheless, at 20 K, T2 times as long as 0.23 ms are observed

  18. Teach NC Basics Step by Step.

    Science.gov (United States)

    Schroeder, Roger

    1978-01-01

    Rapid expansion of numerical control (NC) machining in industry has created the need for inclusion of NC basic concepts in the industrial education curriculum. The author describes an NC unit in an industrial technology class and the program sheet and NC worksheet that he developed for machining a product. (MF)

  19. Alternative large Nc baryons and holography

    International Nuclear Information System (INIS)

    In gauge theories in the limit of a large number Nc of colors baryons are usually described as heavy solitonic objects with mass of order Nc. We discuss an alternative large Nc description both directly in the field theory as well as using holography. In this alternative large Nc limit at least some of the baryons behave like mesons, that is they stay light even at large Nc and their interactions vanish in that limit. For Nc=3 these alternative large Nc baryons are equivalent to the standard baryons. In the holographic description it is manifest that the Regge slopes of mesons and alternative baryons are degenerate.

  20. Alternative large Nc baryons and holography

    CERN Document Server

    Hoyos-Badajoz, Carlos

    2009-01-01

    In gauge theories in the limit of a large number Nc of colors, baryons are usually described as heavy solitonic objects with mass of order Nc. We discuss an alternative large Nc description both directly in the field theory as well as using holography. In this alternative large Nc limit at least some of the baryons behave like mesons, that is they stay light even at large Nc and their interactions vanish in that limit. For Nc=3 these alternative large Nc baryons are equivalent to the standard baryons. In the holographic description it is manifest that the Regge slopes of mesons and alternative baryons are degenerate.

  1. Detection of MgCn in IRC + 10216: A new metal-bearing free radical

    Science.gov (United States)

    Ziurys, L. M.; Apponi, A. J.; Guelin, M.; Cernicharo, J.

    1995-01-01

    A new metal-containing molecule, MgCN, has been detected toward the late-type star IRC + 10216, using the NRAO 12 m and IRAM 30 m telescopes. The N = 11 approaches 10, 10 approaches 9, and 9 approaches 8 transtions of this species which has a (sup 2)Sigma(sup +) ground state, have been observed in the outer envelope of this object at 3 mm. For the N = 11 approaches 10 transitions, the two spin-rotation components are clearly resolved and conclusively identify this new radical. These measurements imply a column of density for MgCN of N(sub tot) approximately 10(exp 12)/sq cm in the outer shell, which corresponds to a fractional abundance of f approximately 7x10(exp -10). This molecule, the metastable isomer of MgNC, is the third metal-bearing species thus far identified in the outer shell of IRC + 10216, and its detection implies a ratio of MgNC/MgCN approximately 22/1. MgCN may be formed through a reaction scheme involving magnesium and HNC or CN, both prominent outer shell molecules, or through synthesis on grains.

  2. Anion-Dependent Aggregate Formation and Charge Behavior of Colloidal Fullerenes (n-C60)

    Science.gov (United States)

    Mukherjee, B.; Weaver, J. W.

    2009-12-01

    The fate and transport of colloidal fullerenes (n-C60) in the environment are likely to be guided by their electrokinetic and aggregation behavior. In natural water bodies inorganic ions exert significant effects in determining the size and charge of dispersed n-C60. Although the effects of cations on the behavior of n-C60 have been studied extensively; studies on the effect of anions are relatively few and thus were the focus of our investigation. The effects of anions (e.g., Cl- , SO42-) on average aggregate size (DH) and zeta potential (ZP) of n-C60 were found to be absent in presence of monovalent cations (e.g., Na+) over the tested range of pH (3-to-12) and ionic strength (0-to-20 mM). Similar observations were noted in the presence of multivalent cations (e.g., Mg2+) near acidic and neutral pH conditions. However, under alkaline conditions (pH~10) a strong anion-dependent reversal of surface charge was noted. The ZP of n-C60 changed from -65 mV, when dispersed in DI water, to +4 mV and +40 mV in the presence of SO42- and Cl-, respectively in a 10mM salt concentration (i.e., MgCl2 and MgSO4). The corresponding DH of the dispersed n-C60 changed simultaneously from 115 nm, in DI water, to 1450 nm and 225 nm for the MgSO4 and MgCl2 electrolytes. These findings provide a better understanding of interfacial interaction characteristics of n-C60 NPs, and may lead to remediation strategies for n-C60 NPs in the environment.

  3. The effect of Ti(CN/TiNb(CN coating on erosion–corrosion resistance

    Directory of Open Access Journals (Sweden)

    William Aperador Chaparro

    2013-02-01

    Full Text Available The goal of this work was to study electrochemical behaviour in corrosion-erosion conditions for Ti(CN/TiNb(CN multilayer coatings having 1, 50, 100, 150 and 200 bilayer periods on AISI 4140 steel substrates by using a multi-target magnetron reactive sputtering device, with an r.f. source (13.56 MHz, two cylindrical magnetron cathodes and two stoichiometric TiC and Nb targets. The multi-layers were evaluated by comparing them to corrosion, erosion and erosion corrosion for a 30º impact angle in a solution of 0.5 M NaCl and silica, analysing the effect of impact angle and the number of bilayers on these coatings’ corrosion resistance. The electrochemical characterisation was performed using electrochemical impedance spectroscopy for analysing corrosion surface; surface morphology was characterised by using a high-resolution scanning electron microscope (SEM. The results showed a de-creased corrosion rate for multilayer systems tested at 30°.

  4. Adsorption and Reaction of CN + O → OCN on Cu(100) Surface: A Density Functional Theory Study

    Institute of Scientific and Technical Information of China (English)

    LI Yi; HU Jian-Ming; ZHANG Yong-Fan; LI Jun-Qian

    2005-01-01

    The adsorption and reaction of O + CN → OCN on Cu(100) are studied by using density functional theory and cluster model.Cu14 cluster model is used to simulate the surface.The calculated results show that the OCN species with the molecule perpendicular to the surface via N atom (N-down) is more favorable than other adsorption models, and the N-down at the bridge site is the most favorable.For N-down, calculated OCN symmetric and asymmetric stretching frequencies are all blue-shifted compared with the calculated values of free and in good agreement with the experiments.The charge transfer from the surface to the OCN species leads to that the bonding of OCN to the metal surface is largely ionic.The present studies also show that CN with the molecule perpendicular to the surface via C atom (NC-down) at the top site is the most stable.Except NC-down at the top site, the calculated CN stretching frequencies are all red-shifted.With O coadsorbed at the hollow site, the adsorption of NC-down at the next nearest bridge or top site is energetically more favorable than that at the adjacent hollow site.The reaction of O + CN → OCN on Cu(100) has no energy barrier via both Eley-Rideal and Langmuir-Hinshelwood processes.

  5. Heavy baryons in the large Nc limit

    CERN Document Server

    Albertus, C; Fernando, I P; Goity, J L

    2015-01-01

    It is shown that in the large Nc limit heavy baryon masses can be estimated quantitatively in a 1/Nc expansion using the Hartree approximation. The results are compared with available lattice calculations for different values of the ratio between the square root of the string tension and the heavy quark mass tension independent of Nc. Using a potential adjusted to agree with the one obtained in lattice QCD, a variational analysis of the ground state spin averaged baryon mass is performed using Gaussian Hartree wave functions. Relativistic corrections through the quark kinetic energy are included. The results provide good estimates for the first sub-leading in 1/Nc corrections.

  6. Colloidal Behavior of Fullerenes (nC60): Role of Coions

    Science.gov (United States)

    Effects of coions on the average initial aggregate size (DH) and zeta potential (ZP) of nC60 in mono and divalent counterion (10 mM) systems were investigated at pH 3, 5.8, and 10. Differences in the effects of SO42-and Cl- could not be established, in presence of Na+, for all pH...

  7. Mammalian Mitochondrial ncRNA Database

    OpenAIRE

    Anandakumar, Shanmugam; Vijayakumar, Saravanan; Arumugam, Nagarajan; Gromiha, M. Michael

    2015-01-01

    Mammalian Mitochondrial ncRNA is a web-based database, which provides specific information on non-coding RNA in mammals. This database includes easy searching, comparing with BLAST and retrieving information on predicted structure and its function about mammalian ncRNAs. Availability The database is available for free at http://www.iitm.ac.in/bioinfo/mmndb/

  8. Hemisphere jet mass distribution at finite Nc

    Directory of Open Access Journals (Sweden)

    Yoshikazu Hagiwara

    2016-05-01

    Full Text Available We perform the leading logarithmic resummation of nonglobal logarithms for the single-hemisphere jet mass distribution in e+e− annihilation including the finite-Nc corrections. The result is compared with the previous all-order result in the large-Nc limit as well as fixed-order perturbative calculations.

  9. Heavy baryons in the large Nc limit

    Science.gov (United States)

    Albertus, C.; Ruiz Arriola, E.; Fernando, I. P.; Goity, J. L.

    2015-11-01

    It is shown that in the large Nc limit heavy baryon masses can be estimated quantitatively in a 1 /Nc expansion using the Hartree approximation. The results are compared with available lattice calculations for different values of the ratio between the square root of the string tension and the heavy quark mass √{ σ} /mQ. These estimates implement important 1 /Nc corrections and assume a string tension independent of Nc. Using a potential adjusted to agree with the one obtained in lattice QCD, a variational analysis of the ground state spin averaged baryon mass is performed using Gaussian Hartree wave functions. Relativistic corrections through the quark kinetic energy are included. The results provide good estimates for the first sub-leading in 1 /Nc corrections.

  10. Strong super-superphyperfine and quadrupole interations by RPE in divalent Co,RH,IR complexes in NaCl, KCl and RbCl lattices

    International Nuclear Information System (INIS)

    The M(CN)4Cl24-:NaCl, M = Co, Rh and Ir paramagnetic complexes obtained by irradiation are analysed by ESR spectroscopy. These complexes present a superhyperfine structure due to the interaction of the unpaired electron with the host lattice Na nearest-neighbors atoms. This structure is explained by overlap and covalent effects in a molecular orbital approach. ESR quadrupolar interaction measurements of the Ir(CN)53-, Ir(CN)5Cl4- and Ir(CN)4Cl24- complexes in NaCl, KCl and RbCl host lattices indicate that the origin of the electron field gradient at the iridium nucleus is correlated to the Π and δ bonds ailities of the ligands. (author)

  11. Interstellar CN and CH+ in Diffuse Molecular Clouds: 12C/13C Ratios and CN Excitation

    CERN Document Server

    Ritchey, A M; Lambert, D L

    2010-01-01

    We present very high signal-to-noise ratio absorption-line observations of CN and CH+ along 13 lines of sight through diffuse molecular clouds. The data are examined to extract precise isotopologic ratios of 12CN/13CN and 12CH+/13CH+ in order to assess predictions of diffuse cloud chemistry. Our results on 12CH+/13CH+ confirm that this ratio does not deviate from the ambient 12C/13C ratio in local interstellar clouds, as expected if the formation of CH+ involves nonthermal processes. We find that 12CN/13CN, however, can be significantly fractionated away from the ambient value. The dispersion in our sample of 12CN/13CN ratios is similar to that found in recent surveys of 12CO/13CO. For sight lines where both ratios have been determined, the 12CN/13CN ratios are generally fractionated in the opposite sense compared to 12CO/13CO. Chemical fractionation in CO results from competition between selective photodissociation and isotopic charge exchange. An inverse relationship between 12CN/13CN and 12CO/13CO follows ...

  12. The millimeter and submillimeter rotational spectrum of the MgCN radical (X (sup 2) Sigma(+))

    Science.gov (United States)

    Anderson, M. A.; Steimle, T. C.; Ziurys, L. M.

    1994-01-01

    The pure rotational spectrum of the MgCN radical has been recorded in the laboratory using millimeter/submillimeter direct absorption spectroscopy. Twenty-seven rotational transitions of the species were observed in the range 101-376 GHz and indicate that the molecule is linear with a (sup 2)Sigma(+) ground electronic state, as predicted by theory. Spin rotation interactions were resolved in the spectra, but no hyperfine splittings were observed, which would originate with the nitrogen nuclear spin. The rotational and fine-structure constants were determined for this radical from a nonlinear least-squares fit to the data using a (sup 2)Sigma Hamiltonian. MgCN is of astrophysical interest because it is the metastable isomer of MgNC, which recently has been detected toward IRC +10216

  13. Crystal structures of bis[2-(pyridin-2-ylphenyl-κ2N,C1]rhodium(III complexes containing an acetonitrile or monodentate thyminate(1− ligand

    Directory of Open Access Journals (Sweden)

    Mika Sakate

    2016-04-01

    Full Text Available The crystal structures of bis[2-(pyridin-2-ylphenyl]rhodium(III complexes with the metal in an octahedral coordination containing chloride and acetonitrile ligands, namely (OC-6-42-acetonitrilechloridobis[2-(pyridin-2-ylphenyl-κ2N,C1]rhodium(III, [RhCl(C11H8N2(CH3CN] (1, thyminate(1− and methanol, namely (OC-6-42-methanol(5-methyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidin-1-ido-κN1bis[2-(pyridin-2-ylphenyl-κ2N,C1]rhodium(III, [Rh(C11H8N2(C5H5N2O2(CH3OH]·CH3OH·0.5H2O (2, and thyminate(1− and ethanol, namely (OC-6-42-ethanol(5-methyl-2,4-dioxo-1,2,3,4-tetrahydropyrimidin-1-ido-κN1bis[2-(pyridin-2-ylphenyl-κ2N,C1]rhodium(III, [Rh(C11H8N2(C5H5N2O2(C2H5OH]·C2H5OH (3, are reported. The acetonitrile complex, 1, is isostructural with the IrIII analog. In complexes 2 and 3, the monodeprotonated thyminate (Hthym− ligand coordinates to the RhIII atom through the N atom, and the resulting Rh—N(Hthym bond lengths are relatively long [2.261 (2 and 2.252 (2 Å for 2 and 3, respectively] as compared to the Rh—N bonds in the related thyminate complexes. In each of the crystals of 2 and 3, the complexes are linked via a pair of intermolecular N—H...O hydrogen bonds between neighbouring Hthym− ligands, forming an inversion dimer. A strong intramolecular O—H...O hydrogen bond between the thyminate(1− and alcohol ligands in mutually cis positions to each other is also observed.

  14. CM()CN D-computable state

    Institute of Scientific and Technical Information of China (English)

    LIU DongDong; DI YaoMin

    2008-01-01

    The notions of D-computable state and D-concurrence are generalized to the CM()CN system. A class of D-computable state on CM()CN is given and the calculating method of the lower bound of D-concurrence is provided. The obvious expression of the lower bound of D-concurrence for the state mixed by two D-pure states is derived.

  15. Transport of fullerene nanoparticles (nC60) in saturated sand and sandy soil: controlling factors and modeling.

    Science.gov (United States)

    Zhang, Lunliang; Hou, Lei; Wang, Lilin; Kan, Amy T; Chen, Wei; Tomson, Mason B

    2012-07-01

    Understanding subsurface transport of fullerene nanoparticles (nC(60)) is of critical importance for the benign use and risk management of C(60). We examined the effects of several important environmental factors on nC(60) transport in saturated porous media. Decreasing flow velocity from approximately 10 to 1 m/d had little effect on nC(60) transport in Ottawa sand (mainly pure quartz), but significantly inhibited the transport in Lula soil (a sandy, low-organic-matter soil). The difference was attributable to the smaller grain size, more irregular and rougher shape, and greater heterogeneity of Lula soil. Increasing ionic strength and switching background solution from NaCl to CaCl(2) enhanced the deposition of nC(60) in both sand and soil columns, but the effects were more significant for soil. This was likely because the clay minerals (and possibly soil organic matter) in soil responded to changes of ionic strength and species differently than quartz. Anions in the mobile phase had little effect on nC(60) transport, and fulvic acid in the mobile phase (5.0 mg/L) had a small effect in the presence of 0.5 mM Ca(2+). A two-site transport model that takes into account both the blocking-affected attachment process and straining effects can effectively model the breakthrough of nC(60). PMID:22681192

  16. Zirconia (NC) zircon as a potential standard

    Science.gov (United States)

    Covey, A. K.; Braun, S. A.; Gualda, G. A.; Bream, B. R.; Fisher, C.; Wooden, J. L.; Schmitz, M. D.

    2012-12-01

    As microanalysis continues to advance and become more widespread there is a greater need for abundant and suitable age standards. Megacrystic zircons from the inactive Freeman Mine near Zirconia, NC were collected from weathered mine dump piles. Zirconia zircon crystals are large (> 1 mm) relative to typical zircons (up to 100s μm) and easily obtained; attributes that make them attractive as a potential standard. We present here preliminary data and assess the suitability of Zirconia zircons as a U-Pb geochronology, Hf-isotope and trace-element standard. Grains are variably fluorescent (Callahan et al, Southeastern Geol., 2007), and we used shortwave fluorescence to separate grains with high, medium, low/no fluorescence from one another. Images were taken of the grains before mounting and post-polishing to understand the fluorescence characterization of the surface to the core. After preparing the grains, we found that the fluorescence was not homogenous and did not provide a good means of separating out grains. In order to investigate the differences in fluorescence, we collected cathodoluminescence (CL) and backscatter electron (BSE) images and energy dispersive spectroscopy (EDS) maps using a Tescan Vega 3 LMU equipped with an Oxford X-max 50 mm2 solid-state EDS detector at Vanderbilt University. This allowed division of the grains into two types: (a) grains with finely oscillatory zoned rims, which are variably crosscut by dull-CL irregular zones, sometimes showing hourglass zoning; and (b) grains with cores showing more irregular, patchy zoning with and without thin oscillatory rims. EDS maps show no major element zoning in the zircon grains, but reveal a variety of inclusions, particularly of quartz and thorite. Preliminary U-Pb ages were obtained using a Perkin Elmer Elan DRCII ICP-MS coupled with a New Wave/Mechantek 213 nm Nd:YAG laser ablation system at Vanderbilt University. A total of ~150 individual ages on oscillatory-zoned (Type a) crystals yield a

  17. A combined crossed molecular beams and theoretical study of the reaction CN + C2H4

    International Nuclear Information System (INIS)

    Highlights: • The CN + C2H4 reaction was investigated in crossed beam experiments. • Electronic structure calculations of the potential energy surface were performed. • RRKM estimates qualitatively reproduce the experimental C2H3NC yield. - Abstract: The CN + C2H4 reaction has been investigated experimentally, in crossed molecular beam (CMB) experiments at the collision energy of 33.4 kJ/mol, and theoretically, by electronic structure calculations of the relevant potential energy surface and Rice–Ramsperger–Kassel–Marcus (RRKM) estimates of the product branching ratio. Differently from previous CMB experiments at lower collision energies, but similarly to a high energy study, we have some indication that a second reaction channel is open at this collision energy, the characteristics of which are consistent with the channel leading to CH2CHNC + H. The RRKM estimates using M06L electronic structure calculations qualitatively support the experimental observation of C2H3NC formation at this and at the higher collision energy of 42.7 kJ/mol of previous experiments

  18. Diagnóstico diferencial de colestase neonatal: parâmetros clínicos e laboratoriais Differential diagnosis of neonatal cholestasis: clinical and laboratory parameters

    Directory of Open Access Journals (Sweden)

    Maria Angela Bellomo-Brandao

    2010-02-01

    Full Text Available OBJETIVO: Avaliar se os parâmetros clínicos e laboratoriais poderiam auxiliar no diagnóstico diferencial da colestase neonatal (CN intra- e extra-hepática. MÉTODOS: Estudo retrospectivo de pacientes com CN hospitalizados na Clínica de Hepatologia Pediátrica do Hospital de Clínicas da Universidade Estadual de Campinas (UNICAMP, Campinas (SP, entre dezembro de 1980 e março de 2005. A abordagem para o diagnóstico da CN foi padronizada. De acordo com o diagnóstico, os pacientes foram classificados em dois grupos: I (colestase neo natal intra-hepática e II (colestase neonatal extrahepática. Para verificar se havia associação com a variável categórica, os testes de qui-quadrado e Mann-Whitney foram utilizados com correções para idade para a análise de covariância (ANCOVA. A determinação da precisão das variáveis clínicas e laboratoriais para a diferenciação dos grupos foi realizada através da análise da curva ROC. RESULTADOS: Cento e sessenta e oito pacientes foram avaliados (grupo I = 54,8% e grupo II = 45,2%. Nos pacientes com menos de 60 dias de vida, houve predominância de causas intra-hepáticas, enquanto que naqueles com mais de 60 dias, houve predominância de etiologia extrahepática (p OBJECTIVE: To evaluate if clinical and laboratory parameters could assist in the differential diagnosis of intra and extra-hepatic neonatal cholestasis (NC. METHODS: Retrospective study of NC patients admitted at the Pediatric Hepatology Outpatient Clinic of the teaching hospital of Universidade Estadual de Campinas (UNICAMP, Campinas, Brazil, between December 1980 and March 2005. The approach to the diagnosis of NC was standardized. According to diagnosis, patients were classified into two groups: I (intra-hepatic neonatal cholestasis and II (extra-hepatic neonatal cholestasis. In order to verify if there was association with the categorical variable, the chi-square and Mann-Whitney tests were used, with corrections for age for

  19. WebCN: A web-based computation tool for in situ-produced cosmogenic nuclides

    International Nuclear Information System (INIS)

    Cosmogenic nuclide techniques are increasingly being utilized in geoscience research. For this it is critical to establish an effective, easily accessible and well defined tool for cosmogenic nuclide computations. We have been developing a web-based tool (WebCN) to calculate surface exposure ages and erosion rates based on the nuclide concentrations measured by the accelerator mass spectrometry. WebCN for 10Be and 26Al has been finished and published at http://www.physics.purdue.edu/primelab/for_users/rockage.html. WebCN for 36Cl is under construction. WebCN is designed as a three-tier client/server model and uses the open source PostgreSQL for the database management and PHP for the interface design and calculations. On the client side, an internet browser and Microsoft Access are used as application interfaces to access the system. Open Database Connectivity is used to link PostgreSQL and Microsoft Access. WebCN accounts for both spatial and temporal distributions of the cosmic ray flux to calculate the production rates of in situ-produced cosmogenic nuclides at the Earth's surface

  20. Detection of FeCN (X^4Δ_i) in the Circumstellar Envelope of IRC+10216

    Science.gov (United States)

    Zack, L. N.; Halfen, D. T.; Ziurys, L. M.

    2011-06-01

    A new interstellar molecule, FeCN (X^4Δ_i), has been detected in the envelope of the carbon-rich AGB star, IRC+10216. This work is the first definitive detection of an iron-bearing molecule in the interstellar medium, and is based on newly-measured rest frequencies. Eight successive rotational transitions of this linear free radical in the lowest spin ladder, Ω = 7/2, were observed at 2 and 3 mm using the Arizona Radio Observatory (ARO) 12 m telescope. Three transitions appear as single, unblended features at the 1-2 mK level and exhibit characteristic IRC+10216 line profiles; one had previously been observed with the IRAM 30 m telescope. Two other transitions are partially blended, but exhibit distinct emission at the FeCN frequencies. The remaining transitions are either completely contaminated, or are too high in energy. Comparison of the ARO and IRAM data suggests a source size for FeCN in IRC+10216 of 30'', indicating an outer shell distribution, as expected for a free radical. The column density derived for FeCN in this object is NTot = 4.0x1011 Cm-2 with a rotational temperature of TRot = 21 K The fractional abundance of this molecule is [FeCN]/[H_2] = 3x10-10, comparable to that of AlNC and KCN in the outer envelope. FeCN is likely formed by gas-phase reactions of Fe^+ or neutral iron, which has a significant gas-phase abundance in the outer shell. The detection of FeCN is further evidence that, aside from silicon, metal cyanides/isocyanides dominate the chemistry of refractory elements in IRC+10216.

  1. Carbon Nanotubes Investigated by N@C60 and N@C70 Spin Probes

    Science.gov (United States)

    Corzilius, B.; Gembus, A.; Dinse, K.-P.; Simon, F.; Kuzmany, H.

    2005-09-01

    Nitrogen atoms encapsulated in C60 can be used to detect small deviations from spherical symmetry via deformation-induced non-vanishing Zero-Field-Splitting (ZFS). In this context, experiments were performed by using these electronic quartet spin probes to investigate single wall carbon nanotubes. Time-fluctuating ZFS interaction would be indicative for rotational and/or translational degrees of freedom. Using pulsed EPR techniques, spin relaxation rates of N@C60 and also of N@C70 molecules with inherent static ZFS were measured. The analysis of their temperature dependence gave information about the dynamics of N@C60 and N@C70 molecules confined to the inside of the tubes.

  2. Phonon dispersion curves of CsCN

    Indian Academy of Sciences (India)

    N K Gaur; Preeti Singh; E G Rini; Jyotsna Galgale; R K Singh

    2004-08-01

    The motivation for the present work was gained from the recent publication on phonon dispersion curves (PDCs) of CsCN from the neutron scattering technique. We have applied the extended three-body force shell model (ETSM) by incorporating the effect of coupling between the translation modes and the orientation of cyanide molecules for the description of phonon dispersion curves of CsCN between the temperatures 195 and 295 K. Our results on PDCs in symmetric direction are in good agreement with the experimental data measured with inelastic neutron scattering technique.

  3. Physical Properties of (NH4)2Pt(CN)4[Clo.42].3H2O: A new Quasi-One-Dimensional Conductor

    DEFF Research Database (Denmark)

    Carneiro, Kim; Petersen, A. S.; Underhill, A. E.; Wood, D. J.; Watkins, D. M.; Mackenzie, Gordon A.

    1979-01-01

    The quasi-one-dimensional conductor (NH4)2[Pt(CN)4]Cl0.42·3H2O, ACP(Cl), has been studied experimentally by means of electrical conduction measurements, x-ray diffuse scattering, and neutron inelastic scattering. This allows the determination of all the physical parameters of interest for the...

  4. Adjacent Nucleotide Dependence in ncRNA and Order-1 SCFG for ncRNA Identification

    OpenAIRE

    Wong, Thomas K. F.; Lam, Tak-Wah; Sung, Wing-Kin; Yiu, Siu-Ming

    2010-01-01

    Background: Non-coding RNAs (ncRNAs) are known to be involved in many critical biological processes, and identification of ncRNAs is an important task in biological research. A popular software, Infernal, is the most successful prediction tool and exhibits high sensitivity. The application of Infernal has been mainly focused on small suspected regions. We tried to apply Infernal on a chromosome level; the results have high sensitivity, yet contain many false positives. Further enhancing Infer...

  5. (Special Issue STEP-NC) Enabling feedback of process data by use of STEP-NC

    OpenAIRE

    Wosnik, Michael; Kramer, Christian; Selig, Andreas; Klemm, Peter

    2006-01-01

    Abstract Today?s Computer Aided Process Planning (CAPP) systems are performing NC programming with insufficient consideration of real machine capabilities and resulting workpiece characteristics. Computer Numerical Controls (CNCs) receive no information about actual workpiece characteristics and applied manufacturing processes. Machine and process observation are not closely coupled to the actual executed machining workingstep. STEP-NC addresses these problems by aiming at the avai...

  6. Oral administration of royal jelly inhibits the development of atopic dermatitis-like skin lesions in NC/Nga mice.

    Science.gov (United States)

    Taniguchi, Yoshifumi; Kohno, Keizo; Inoue, Shin-ichiro; Koya-Miyata, Satomi; Okamoto, Iwao; Arai, Norie; Iwaki, Kanso; Ikeda, Masao; Kurimoto, Masashi

    2003-09-01

    We have shown previously that in addition to IL-4, IL-5 and IL-10, antigen-specific interferon-gamma (IFN-gamma) production by spleen cells from ovalbumin (OVA)/Alum-immunized mice is inhibited by the administration of royal jelly (RJ). Since it has been shown that both Th1 and Th2 cytokines play pathogenic roles in the generation of atopic dermatitis (AD), we have examined whether RJ suppresses the development of AD-like skin lesions in NC/Nga mice induced by repeated application of picryl chloride (PiCl) under specific pathogen-free (SPF) conditions. Oral administration of RJ to the PiCl-treated NC/Nga mice inhibited the development of AD-like skin lesions in these mice as exemplified by the significant decrease in the total skin severity scores and the decrease in hypertrophy, hyperkeratosis, and infiltration of the epidermis and corium by inflammatory cells. IFN-gamma production by spleen cells from PiCl-treated NC/Nga mice in response to TNP-KLH was partially but significantly inhibited by the oral administration of RJ, while IFN-gamma production by Con A-stimulated spleen cells was not affected. Since inducible nitric oxide (NO) synthase (iNOS)-derived NO has been suggested as an important immunoregulatory mediator in inflammatory autoimmune diseases, we have also examined the expression of iNOS in the dorsal skin lesions of PiCl-treated NC/Nga mice. Interestingly, the expression of iNOS was significantly increased in the skin lesions of RJ-administered mice compared with those of control PBS-administered mice. Thus, our results suggest that RJ suppresses the development of AD-like skin lesions in PiCl-treated NC/Nga mice, possibly by a combination of down-regulating TNP-specific IFN-gamma production and up-regulating iNOS expression. PMID:12890429

  7. NC/NG与ADN的相互作用%Interaction of NG/NC with ADN

    Institute of Scientific and Technical Information of China (English)

    张腊莹; 衡淑云; 刘子如; 张皋; 赵凤起; 谭惠民

    2009-01-01

    用高压差示扫描量热法(PDSC),热重-微商热重法(TG-DTG),研究了双基粘合剂(NC/NG体系)与二硝酰胺铵(ADN)之间的相互作用.结果表明,(NC/NG)/ADN体系中NG的分解峰由NC/NG中的207.0 ℃提前至159.8 ℃,在高压下该分解峰温提前至153.6 ℃.NC/ADN的分解峰温比NG/ADN提前了4.8 ℃,而且大部分的ADN没有被NG加速而提前分解,表明NC对ADN的作用比NG更强烈.此外,还用真空安定性试验(VST)评价了NC/NG与ADN的相容性,混合体系的净增放气量大于11 mL,属于严重不相容,证明在90 ℃下NC/NG与ADN之间也存在强烈的相互作用.

  8. A structural study of CN treated amorphous silicon

    Science.gov (United States)

    Yamazaki, Yuji; Shirai, Koun; Katayama-Yoshida, Hiroshi

    2003-06-01

    Recently, a remarkable technique to overcome the problem of light-induced degradation in amorphous silicon (a-Si) solar cells using a cyanide (CN) treatment has been developed. Structural and bonding characteristics of CN in a-Si has been studied using ab initio molecular dynamics simulations. It was found that CN incorporation results in more than just the termination of dangling bonds. The connectivity of the covalent random network increases because the CN changes from triply bonded, which is a common form in molecular CN, to the singly bonded form. This may be the mechanism by which CN incorporation produces significant reductions in light-induced degradation.

  9. Anomalous absorption in H2CN and CH2CN molecules

    Indian Academy of Sciences (India)

    S Chandra; S V Shinde

    2008-07-01

    Structures of H2CN and CH2CN molecules are similar to that of H2CO molecule. The H2CO has shown anomalous absorption for its transition 111 - 110 at 4.8 GHz in a number of cool molecular clouds. Though the molecules H2CN and CH2CN have been identified in TMC-1 and Sgr B2 through some transitions in ortho as well as in para species, here we have investigated the condition under which transitions 111 - 110 and 212 - 211 of these molecules may show anomalous absorption. For the present investigation, we have calculated energy levels and radiative transition probabilities. However, we have used scaled values for collisional rate coefficients. We found that relative values of collisional rate coefficients can produce the required anomalous absorption in 111 - 110 and 212 - 211 transitions in the molecules.

  10. Excited Baryon Spectroscopy in the Large $N_c$ Limit

    CERN Document Server

    Goity, J L

    1996-01-01

    The leading in 1/N_c spin-flavor symmetry breaking mass splittings, of order N_c^0, in excited non-strange Baryons are shown to be given, up to two-body operators, by three different effective Hamiltonians: Thomas precession spin-orbit, spin-isospin tensor, and spin-orbit with isospin exchange. Explicit expressions for their matrix elements between low excited Baryons are obtained, and the structure of the mass splittings in large N_c is established to first order of perturbation theory. The problem of extending the large N_c results to the real world with N_c=3 is briefly addressed.

  11. Three-nucleon forces in the 1/Nc expansion

    CERN Document Server

    Phillips, Daniel R

    2013-01-01

    The operator structures that can contribute to three-nucleon forces are classified in the 1/Nc expansion. At leading order in 1/Nc a spin-flavor independent term is present, as are the spin-flavor structures associated with the Fujita-Miyazawa three-nucleon force. Modern phenomenological three-nucleon forces are thus consistent with this O(Nc) leading force, corrections to which are suppressed by a power series in 1/Nc^2. A complete basis of operators for the three-nucleon force, including all independent momentum structures, is given explicitly up to next-to-leading order in the 1/Nc expansion.

  12. Thermochemistry on crystalline compounds bis-(n-dodecylammonium) tetrachlorometallates (n-C12H25NH3)2MCl4(s) (M = Cu and Cd)

    International Nuclear Information System (INIS)

    Graphical abstract: Crystalline (n-C12H25NH3)2CuCl4(s) and (n-C12H25NH3)2CdCl4(s) were synthesized. Chemical analysis, elemental analysis, and X-ray crystallography were applied to characterise the compositions and crystal structures of the two complexes. In accordance with Hess law, two thermochemical cycles were designed, and the enthalpy changes of the reactions of n-dodecylammonium hydrochloride with CuCl2·2H2O(s) and CdCl2·2.5H2O(s) were determined by an isoperibol solution-reaction calorimeter. Eventually, the standard molar enthalpies of formation of the title compounds were derived. Highlights: • Compounds (n-C12H25NH3)2MCl4(s) (M = Cu and Cd) were synthesized. • The enthalpy changes of the synthesis reactions were obtained. • Standard molar enthalpies of formation were obtained. -- Abstract: Crystalline bis-(n-dodecylammonium) tetrachlorocuprate (n-C12H25NH3)2CuCl4(s) and bis-(n-dodecylammonium) tetrachlorocadmate (n-C12H25NH3)2CdCl4(s) were synthesized. Chemical analysis, elemental analysis and X-ray crystallography were applied to characterise the compositions and crystal structures of the two complexes. In accordance with Hess’ law, two thermochemical cycles were designed, and the enthalpy changes of the reactions of n-dodecylammonium hydrochloride with CuCl2·2H2O(s) and CdCl2·2.5H2O(s) were determined as ΔrHm,1o = (32.86 ± 0.40) kJ · mol−1 and ΔrHm,2o = −(5.28 ± 0.38) kJ · mol−1 by an isoperibol solution-reaction calorimeter, respectively. Eventually, the standard molar enthalpies of formation of the title compounds were derived to be ΔfHmo [(n-C12H25NH3)2CuCl4, s] = −(1630.4 ± 8.0) kJ · mol−1 and ΔfHmo [(n-C12H25NH3)2CdCl4, s] = −(1836.2 ± 8.0) kJ · mol−1, respectively

  13. The circumstellar shell of the post-AGB star HD 56126 the $^{12}CN\\/^{13}CN$ isotope ratio and fractionation

    CERN Document Server

    Bakker, E J; Bakker, Eric J.; Lambert, David L.

    1997-01-01

    We have detected circumstellar absorption lines of the $^{12}$CN and $^{13}$CN Violet and Red System in the spectrum of the post-AGB star HD~56126. From a synthetic spectrum analysis, we derive a Doppler broadening parameter of $b=0.51\\pm0.04$ km~s$^{-1}$, $^{12}$CN/$^{13}$CN$=38\\pm2$, and a lower limit of $2000$ on $^{12}$CN/$^{14}$CN and $^{12}$C$^{14}$N/$^{12}$C$^{15}$N. A simple chemical model has been computed of the circumstellar shell surrounding HD~56126 that takes into account the gas-phase ion-molecule reaction between CN and C$^{+}$. From this we infer that this reaction leads to isotopic fractionation of CN. Taking into account the isotopic exchange reaction and the observed $^{12}$CN/$^{13}$CN we find $^{12}$C/$^{13}$C$\\sim 67$ (for $T_{\\rm kin}=25$ K). Our analysis suggests that $^{12}$CN has a somewhat higher rotational temperature than $^{13}$CN: $T_{\\rm rot}=11.5\\pm0.6$ and $8.0\\pm0.6$ K respectively. We identify possible causes for this difference in excitation temperature, among which the $...

  14. The effect of Ti(CN)/TiNb(CN) coating on erosion–corrosion resistance

    OpenAIRE

    William Aperador Chaparro; Carlos Ramírez Martín; Julio Cesar Caicedo

    2013-01-01

    The goal of this work was to study electrochemical behaviour in corrosion-erosion conditions for Ti(CN)/TiNb(CN) multilayer coatings having 1, 50, 100, 150 and 200 bilayer periods on AISI 4140 steel substrates by using a multi-target magnetron reactive sputtering device, with an r.f. source (13.56 MHz), two cylindrical magnetron cathodes and two stoichiometric TiC and Nb targets. The multi-layers were evaluated by comparing them to corrosion, erosion and erosion corrosion for a 30º impact ang...

  15. The CN isotopic ratios in comets

    Science.gov (United States)

    Manfroid, J.; Jehin, E.; Hutsemékers, D.; Cochran, A.; Zucconi, J.-M.; Arpigny, C.; Schulz, R.; Stüwe, J. A.; Ilyin, I.

    2009-08-01

    Our aim is to determine the isotopic ratios 12C/13C and 14N/15N in a variety of comets and link these measurements to the formation and evolution of the solar system. The 12C/13C and 14N/15N isotopic ratios are measured for the CN radical by means of high-resolution optical spectra of the R branch of the B-X (0, 0) violet band. 23 comets from different dynamical classes have been observed, sometimes at various heliocentric and nucleocentric distances, in order to estimate possible variations of the isotopic ratios in parent molecules. The 12C/13C and 14N/15N isotopic ratios in CN are remarkably constant (average values of, respectively, 91.0 ± 3.6 and 147.8 ± 5.7) within our measurement errors, for all comets whatever their origin or heliocentric distance. While the carbon isotopic ratio does agree with the terrestrial value (89), the nitrogen ratio is a factor of two lower than the terrestrial value (272), indicating a fractionation in the early solar system, or in the protosolar nebula, common to all the comets of our sample. This points towards a common origin of the comets independently of their birthplaces, and a relationship between HCN and CN. Appendices and Table [see full textsee full textsee full text] are only available in electronic form at http://www.aanda.org Based on observations made with ESO Telescopes at the La Silla Paranal Observatory under programmes ID 268.C-5570, 270.C-5043, 073.C-0525, 274.C-5015 and 075.C-0355(A).

  16. Measured appearance energies of Cn+ (3 60

    International Nuclear Information System (INIS)

    We have used mass spectrometric techniques to determine the appearance energies for the formation of small, singly charged Cn+ fragment ions (3 60 under single collision conditions. The measured appearance energies range from 79 eV (C3+) to 91 eV (C10+) and show, within the experimental error bar of ± 5 eV, little variation with the cluster size. This result is distinctly different from the behaviour of the previously measured appearance energies for the large fragment ions C58+ to C44+ and indicates that the small fragment ions are the result of a different fragmentation pathway. (author)

  17. Efficient known ncRNA search including pseudoknots

    OpenAIRE

    Yuan Cheng; Sun Yanni

    2013-01-01

    Abstract Background Searching for members of characterized ncRNA families containing pseudoknots is an important component of genome-scale ncRNA annotation. However, the state-of-the-art known ncRNA search is based on context-free grammar (CFG), which cannot effectively model pseudoknots. Thus, existing CFG-based ncRNA identification tools usually ignore pseudoknots during search. As a result, dozens of sequences that do not contain the native pseudoknots are reported by these tools. When pse...

  18. 复合离子镀膜技术制备Cr+Ti+TiNC/TiNC+C/DLC膜性能研究%Properties of Cr+Ti+TiNC/TiNC+C/DLC films prepared by composite ion plating

    Institute of Scientific and Technical Information of China (English)

    马胜歌; 于大洋; 杨宏伟; 张以忱

    2008-01-01

    结合中频孪生靶非平衡磁控溅射、电弧离子镀和霍尔离子源辅助沉积三种工艺,制备了Cr+Ti+TiNC/TiNC+C/DLC硬质膜.硬质膜呈深黑色,表面比较光滑,顶层为掺N的类金刚石(Diamond-like Carbon,DLC)膜,中间层为含C的TiNC,底层为含Ti和Cr的TiNC,力学性能良好.

  19. Multicomponent Interstitial Diffusion in and Thermodynamic Characteristics of the Interstitial Solid Solution ɛ-Fe3(N,C)1+ x : Nitriding and Nitrocarburizing of Pure α-Iron

    Science.gov (United States)

    Woehrle, T.; Leineweber, A.; Mittemeijer, E. J.

    2013-06-01

    A series of gas nitriding and gas nitrocarburizing experiments was performed at 823 K (550 °C) to investigate the growth kinetics of ɛ-Fe3(N,C)1+ x /γ'-Fe4N1- z -double layers on pure α-iron substrates. The growth rate and composition of the (sub)layers were determined by (sub)layer-thickness measurements using light optical microscopy and electron-probe microanalyses (EPMA), respectively. Models for the growth of bilayers into a substrate, controlled by the interstitial diffusion of two elements (N and C), were applied to the experimental data to determine the intrinsic diffusion coefficients of N and C in ɛ-Fe3(N,C)1+ x as well as the self-diffusion coefficient of N in γ'-Fe4N1- z . For ɛ-Fe3(N,C)1+ x , it was found that the four components of the diffusion matrix, D_{{NN}}^{\\varepsilon } , D_{{CC}}^{\\varepsilon } , D_{{NC}}^{\\varepsilon } and D_{{CN}}^{\\varepsilon } , are all positive. The significant values of the off-diagonal diffusivities D_{{NC}}^{\\varepsilon } and D_{{CN}}^{\\varepsilon } indicate profound interaction of both interstitial species. Thereby, additional information is obtained about the thermodynamic properties of the ɛ phase in the ternary Fe-N-C system.

  20. SCS-CN parameter determination using rainfall-runoff data in heterogeneous watersheds – the two-CN system approach

    Directory of Open Access Journals (Sweden)

    J. D. Valiantzas

    2012-03-01

    Full Text Available The Soil Conservation Service Curve Number (SCS-CN approach is widely used as a simple method for predicting direct runoff volume for a given rainfall event. The CN parameter values corresponding to various soil, land cover, and land management conditions can be selected from tables, but it is preferable to estimate the CN value from measured rainfall-runoff data if available. However, previous researchers indicated that the CN values calculated from measured rainfall-runoff data vary systematically with the rainfall depth. Hence, they suggested the determination of a single asymptotic CN value observed for very high rainfall depths to characterize the watersheds' runoff response. In this paper, the hypothesis that the observed correlation between the calculated CN value and the rainfall depth in a watershed reflects the effect of soils and land cover spatial variability on its hydrologic response is being tested. Based on this hypothesis, the simplified concept of a two-CN heterogeneous system is introduced to model the observed CN-rainfall variation by reducing the CN spatial variability into two classes. The behaviour of the CN-rainfall function produced by the simplified two-CN system is approached theoretically, it is analysed systematically, and it is found to be similar to the variation observed in natural watersheds. Synthetic data tests, natural watersheds examples, and detailed study of two natural experimental watersheds with known spatial heterogeneity characteristics were used to evaluate the method. The results indicate that the determination of CN values from rainfall runoff data using the proposed two-CN system approach provides reasonable accuracy and it over performs the previous methods based on the determination of a single asymptotic CN value. Although the suggested method increases the number of unknown parameters to three (instead of one, a clear physical reasoning for them is presented.

  1. A combined crossed molecular beams and theoretical study of the reaction CN + C{sub 2}H{sub 4}

    Energy Technology Data Exchange (ETDEWEB)

    Balucani, Nadia, E-mail: nadia.balucani@unipg.it [Dipartimento di Chimica, Biologia e Biotecnologie, Università degli Studi di Perugia, Perugia (Italy); Leonori, Francesca; Petrucci, Raffaele [Dipartimento di Chimica, Biologia e Biotecnologie, Università degli Studi di Perugia, Perugia (Italy); Wang, Xingan [Dipartimento di Chimica, Biologia e Biotecnologie, Università degli Studi di Perugia, Perugia (Italy); Department of Chemical Physics, University of Science and Technology of China, Hefei 230026 (China); Casavecchia, Piergiorgio [Dipartimento di Chimica, Biologia e Biotecnologie, Università degli Studi di Perugia, Perugia (Italy); Skouteris, Dimitrios [Scuola Normale Superiore, Pisa (Italy); Albernaz, Alessandra F. [Instituto de Física, Universidade de Brasília, Brasília (Brazil); Gargano, Ricardo [Instituto de Física, Universidade de Brasília, Brasília (Brazil); Departments of Chemistry and Physics, University of Florida, Quantum Theory Project, Gainesville, FL 32611 (United States)

    2015-03-01

    Highlights: • The CN + C{sub 2}H{sub 4} reaction was investigated in crossed beam experiments. • Electronic structure calculations of the potential energy surface were performed. • RRKM estimates qualitatively reproduce the experimental C{sub 2}H{sub 3}NC yield. - Abstract: The CN + C{sub 2}H{sub 4} reaction has been investigated experimentally, in crossed molecular beam (CMB) experiments at the collision energy of 33.4 kJ/mol, and theoretically, by electronic structure calculations of the relevant potential energy surface and Rice–Ramsperger–Kassel–Marcus (RRKM) estimates of the product branching ratio. Differently from previous CMB experiments at lower collision energies, but similarly to a high energy study, we have some indication that a second reaction channel is open at this collision energy, the characteristics of which are consistent with the channel leading to CH{sub 2}CHNC + H. The RRKM estimates using M06L electronic structure calculations qualitatively support the experimental observation of C{sub 2}H{sub 3}NC formation at this and at the higher collision energy of 42.7 kJ/mol of previous experiments.

  2. Large N_c confinement and turbulence

    CERN Document Server

    Blaizot, Jean-Paul

    2008-01-01

    We suggest that the transition that occurs at large $N_c$ in the eigenvalue distribution of a Wilson loop has a turbulent origin. We arrived at this conclusion by studying the complex-valued inviscid Burgers-Hopf equation that corresponds to the Makeenko-Migdal loop equation, and we demonstrate the appearance of a shock wave in the spectral flow of the Wilson loop eigenvalues. This picture supplements that of the Durhuus-Olesen transition with a particular realization of disorder. The critical behavior at the formation of the shock allows us to infer exponents that have been measured recently in lattice simulations by Narayanan and Neuberger in $d=2$ and $d=3$. Our analysis leads us to speculate that the universal behavior observed in these lattice simulations might be a generic feature of confinement, also in $d=4$ Yang-Mills theory.

  3. Preparation and EPR characterization of N@C60 and N@C70 based peapods

    Science.gov (United States)

    Corzilius, B.; Gembus, A.; Weiden, N.; Dinse, K.-P.

    2005-09-01

    Using the quartet spin of encased nitrogen atoms as an electron paramagnetic resonance (EPR) probe, it is possible to examine the fullerene/nanotube interactions in a peapod. A purification method is developed which allows low temperature filling of nanotubes with endohedral fullerenes. The paramagnetic impurities of undoped single wall carbon nanotubes (SWNT) are characterized via EPR resulting in a broad superparamagnetic signal of the remaining catalyst particles and a rather narrow signal of carbonaceous material. Comparison of EPR spectra of several nitrogen endohedral doped peapods with their analogues obtained in a solid fullerene matrix shows a significant broadening of N@C60 and N@C70 EPR signals. This broadening is related to a non-vanishing zero-field splitting caused by deformation of the fullerene cage upon encapsulation.

  4. NC10 bacteria in marine oxygen minimum zones

    DEFF Research Database (Denmark)

    Padilla, Cory C; Bristow, Laura A; Sarode, Neha;

    2016-01-01

    . rRNA and mRNA transcripts assignable to NC10 peaked within the OMZ and included genes of the putative nitrite-dependent intra-aerobic pathway, with high representation of transcripts containing the unique motif structure of the nitric oxide (NO) reductase of NC10 bacteria, hypothesized to...

  5. Synthesis and single-crystal structure of the pseudo-ternary compounds LiA[N(CN){sub 2}]{sub 2} (A = K or Rb)

    Energy Technology Data Exchange (ETDEWEB)

    Reckeweg, Olaf; DiSalvo, Francis J. [Cornell Univ., Ithaca, NY (United States). Baker Lab.

    2016-04-01

    Crystals of LiA[N(CN){sub 2}]{sub 2} were obtained from the reaction of LiCl and ACl (A = K or Rb) with Ag[N(CN){sub 2}] in water and subsequent evaporation of the filtered solution at 80 C under normal atmospheric conditions. Crystals of the title compound form thin rectangular plates that are transparent, colorless, and very fragile. Single-crystal structure analyses have shown that both compounds are isotypic and adopt the tetragonal space group I4/mcm (no. 140, Z = 4) with the cell parameters a = 701.53(12) and c = 1413.7(5) pm for LiK[N(CN){sub 2}]{sub 2} and a = 730.34(10) and c = 1414.4(4) pm for LiRb[N(CN){sub 2}]{sub 2}. The crystal structure is described and compared to that of the pseudo-binary alkali metal dicyanamides.

  6. Identification of a potential superhard compound ReCN

    Energy Technology Data Exchange (ETDEWEB)

    Fan, Xiaofeng, E-mail: xffan@jlu.edu.cn [College of Materials Science and Engineering and Key Laboratory of Automobile Materials of MOE, Jilin University, Changchun 130012 (China); Li, M.M. [College of Materials Science and Engineering and Key Laboratory of Automobile Materials of MOE, Jilin University, Changchun 130012 (China); Singh, David J. [College of Materials Science and Engineering, Jilin University, Changchun 130012 (China); Materials Science and Technology Division, Oak Ridge National Laboratory, Oak Ridge, Tennessee 37831-6056 (United States); Jiang, Qing [College of Materials Science and Engineering and Key Laboratory of Automobile Materials of MOE, Jilin University, Changchun 130012 (China); Zheng, W.T., E-mail: wtzheng@jlu.edu.cn [College of Materials Science and Engineering and Key Laboratory of Automobile Materials of MOE, Jilin University, Changchun 130012 (China); State Key Laboratory of Superhard Materials, Jilin University, Changchun 130012 (China)

    2015-05-15

    Highlights: • We identify a new ternary compound ReCN with theoretical calculation. • The ternary compound ReCN is with two stable structures with P63mc and P3m1. • ReCN is a semiconductor from the calculation of electronic structures. • ReCN is found to possess the outstanding mechanical properties. • ReCN may be synthesized relatively easily. - Abstract: We identify a new ternary compound, ReCN and characterize its properties including structural stability and indicators of hardness using first principles calculations. We find that there are two stable structures with space groups P63mc (HI) and P3m1 (HII), in which there are no C–C and N–N bonds. Both structures, H1 and III are elastically and dynamically stable. The electronic structures show that ReCN is a semiconductor, although the parent compounds, ReC{sub 2} and ReN{sub 2} are both metallic. ReCN is found to possess the outstanding mechanical properties with the large bulk modulus, shear modulus and excellent ideal strengths. In addition, ReCN may perhaps be synthesized relatively easily because it becomes thermodynamic stable with respect to decomposition at very low pressures.

  7. Identification of a potential superhard compound ReCN

    International Nuclear Information System (INIS)

    Highlights: • We identify a new ternary compound ReCN with theoretical calculation. • The ternary compound ReCN is with two stable structures with P63mc and P3m1. • ReCN is a semiconductor from the calculation of electronic structures. • ReCN is found to possess the outstanding mechanical properties. • ReCN may be synthesized relatively easily. - Abstract: We identify a new ternary compound, ReCN and characterize its properties including structural stability and indicators of hardness using first principles calculations. We find that there are two stable structures with space groups P63mc (HI) and P3m1 (HII), in which there are no C–C and N–N bonds. Both structures, H1 and III are elastically and dynamically stable. The electronic structures show that ReCN is a semiconductor, although the parent compounds, ReC2 and ReN2 are both metallic. ReCN is found to possess the outstanding mechanical properties with the large bulk modulus, shear modulus and excellent ideal strengths. In addition, ReCN may perhaps be synthesized relatively easily because it becomes thermodynamic stable with respect to decomposition at very low pressures

  8. Effect of C/N ratio and salinity on power generation in compost microbial fuel cells.

    Science.gov (United States)

    Md Khudzari, Jauharah; Tartakovsky, Boris; Raghavan, G S Vijaya

    2016-02-01

    In this work, compost Microbial Fuel Cells (cMFCs) were used to generate electricity from a mix of fruit and vegetable wastes, and soil with different C/N ratios and salinities. Experiments were carried out in 500mL cMFCs equipped with carbon felt anodes and manganese dioxide cathodes. The cMFCs were loaded with fresh compost and operated at 20-23°C for up to 97days. The low C/N ratio (C/N 24) had a greater power production with a maximum power density of 5.29mW/m(2) (71.43mW/m(3)), indicating a more favorable condition for microbial growth. High-saline cMFCs produced lower power, suggesting that their level of salinity (10g/L of NaCl) inhibited electricigenic microorganisms. The closed-circuit cMFC showed an improved degradation of organic matter by 6% to 8% compared to the control MFC operated in an open circuit mode (no external resistor attached). PMID:26611399

  9. In situ measurements of HCN and CH3CN over the Pacific Ocean: Sources, sinks, and budgets

    Science.gov (United States)

    Singh, H. B.; Salas, L.; Herlth, D.; Kolyer, R.; Czech, E.; Viezee, W.; Li, Q.; Jacob, D. J.; Blake, D.; Sachse, G.; Harward, C. N.; Fuelberg, H.; Kiley, C. M.; Zhao, Y.; Kondo, Y.

    2003-10-01

    We report the first in situ measurements of hydrogen cyanide (HCN) and methyl cyanide (CH3CN, acetonitrile) from the Pacific troposphere (0-12 km) obtained during the NASA Transport and Chemical Evolution over the Pacific (TRACE-P) airborne mission (February-April 2001). Mean HCN and CH3CN mixing ratios of 243 ± 118 (median 218) ppt and 149 ± 56 (median 138) ppt, respectively, were measured. These in situ observations correspond to a mean tropospheric HCN column of 4.2 × 1015 molecules cm-2 and a CH3CN column of 2.5 × 1015 molecules cm-2. This is in good agreement with the 0-12 km HCN column of 4.4 (±0.6) × 1015 molecules cm-2 derived from infrared solar spectroscopic observations over Japan. Mixing ratios of HCN and CH3CN were greatly enhanced in pollution outflow from Asia and were well correlated with each other as well as with known tracers of biomass combustion (e.g., CH3Cl, CO). Volumetric enhancement (or emission) ratios (ERs) relative to CO in free tropospheric plumes, likely originating from fires, were 0.34% for HCN and 0.17% for CH3CN. ERs with respect to CH3Cl and CO in selected biomass burning (BB) plumes in the free troposphere and in boundary layer pollution episodes are used to estimate a global BB source of 0.8 ± 0.4 Tg (N) yr-1 for HCN and 0.4 ± 0.1 Tg (N) yr-1 for CH3CN. In comparison, emissions from industry and fossil fuel combustion are quite small (cyanides and that they deposit some 1.4 Tg (N) of nitrogen annually to the oceans. Assuming loss to the oceans and reaction with OH radicals as the major removal processes, a mean atmospheric residence time of 5.0 months for HCN and 6.6 months for CH3CN is calculated. A global budget analysis shows that the sources and sinks of HCN and CH3CN are roughly in balance but large uncertainties remain in part due to a lack of observational data from the atmosphere and the oceans. Pathways leading to the oceanic (and soil) degradation of these cyanides are poorly known but are expected to be

  10. Positive parity pentaquark towers in large Nc QCD

    CERN Document Server

    Pirjol, D; Pirjol, Dan; Schat, Carlos

    2006-01-01

    We construct the complete set of positive parity pentaquarks, which correspond in the quark model to {\\bar s} q^{Nc+1} states with one unit of orbital angular momentum L=1. In the large Nc limit they fall into the K=1/2 and K=3/2 irreps (towers) of the contracted SU(4)c symmetry. We derive predictions for the mass spectrum and the axial couplings of these states at leading order in 1/Nc. The strong decay width of the lowest-lying positive parity exotic state is of order O(1/Nc), such that this state is narrow in the large Nc limit. Replacing the antiquark with a heavy antiquark {\\bar Q} q^{Nc+1}, the two towers become degenerate, split only by O(1/mQ) hyperfine interactions. We obtain predictions for the strong decay widths of heavy pentaquarks to ordinary baryons and heavy H(*)_{\\bar Q} mesons at leading order in 1/Nc and 1/mQ.

  11. Evolutionary conservation and functional roles of ncRNA

    OpenAIRE

    Qu, Zhipeng; Adelson, David L.

    2012-01-01

    Non-coding RNAs (ncRNAs) are a class of transcribed RNA molecules without protein-coding potential. They were regarded as transcriptional noise, or the byproduct of genetic information flow from DNA to protein for a long time. However, in recent years, a number of studies have shown that ncRNAs are pervasively transcribed, and most of them show evidence of evolutionary conservation, although less conserved than protein-coding genes. More importantly, many ncRNAs have been confirmed as playing...

  12. Critical association of ncRNA with introns

    OpenAIRE

    Rearick, David; Prakash, Ashwin; McSweeny, Andrew; Shepard, Samuel S.; Fedorova, Larisa; Fedorov, Alexei

    2010-01-01

    It has been widely acknowledged that non-coding RNAs are master-regulators of genomic functions. However, the significance of the presence of ncRNA within introns has not received proper attention. ncRNA within introns are commonly produced through the post-splicing process and are specific signals of gene transcription events, impacting many other genes and modulating their expression. This study, along with the following discussion, details the association of thousands of ncRNAs—snoRNA, miR...

  13. Non-leptonic kaon decays at large $N_c$

    CERN Document Server

    Donini, A; Pena, C; Romero-López, F

    2016-01-01

    We study the scaling with the number of colours, $N_c$, of the weak amplitudes mediating kaon mixing and decay. We evaluate the amplitudes of the two relevant current-current operators on the lattice for $N_c=3-7$. We conclude that the subleading $1/N_c$ corrections in $\\hat{B}_K$ are small, but those in the $K \\rightarrow \\pi\\pi$ amplitudes are large and fully anti-correlated in the $I=0, 2$ isospin channels. We briefly comment on the implications for the $\\Delta I=1/2$ rule.

  14. On pseudorandom generators in NC0

    DEFF Research Database (Denmark)

    Cryan, Mary; Miltersen, Peter Bro

    In this paper we consider the question of whether NC 0 circuits can generate pseudorandom distributions. While we leave the general question unanswered, we show – • Generators computed by NC 0 circuits where each output bit depends on at most 3 input bits (i.e, DNC 3 0 circuits) and with stretch...... is an NC 4 0 generator with a super-linear stretch that passes the linear dependency test as well as k-wise independence tests, for any constant k....

  15. Lattice study of large $N_c$ QCD

    CERN Document Server

    DeGrand, Thomas

    2016-01-01

    We present a lattice simulation study of large $N_c$ regularities of meson and baryon spectroscopy in $SU(N_c)$ gauge theory with two flavors of dynamical fundamental representation fermions. Systems investigated include $N_c=2$, 3, 4, and 5, over a range of fermion masses parametrized by a squared pseudoscalar to vector meson mass ratio between about 0.2 to 0.7. Good agreement with large $N_c$ scaling is observed in the static potential, in meson masses and decay constants, and in baryon spectroscopy.

  16. Nanomechanical properties of TiCN and TiCN/Ti coatings on Ti prepared by Filtered Arc Deposition

    Energy Technology Data Exchange (ETDEWEB)

    Sun, Yong [School of Mechanical, Materials & Mechatronic Engineering, University of Wollongong, Wollongong, NSW 2522 (Australia); Lu, Cheng, E-mail: chenglu@uow.edu.au [School of Mechanical, Materials & Mechatronic Engineering, University of Wollongong, Wollongong, NSW 2522 (Australia); Yu, Hailiang [School of Mechanical, Materials & Mechatronic Engineering, University of Wollongong, Wollongong, NSW 2522 (Australia); School of Mechanical Engineering, Shenyang University, Shenyang 110044 (China); Kiet Tieu, A.; Su, Lihong; Zhao, Yue; Zhu, Hongtao [School of Mechanical, Materials & Mechatronic Engineering, University of Wollongong, Wollongong, NSW 2522 (Australia); Kong, Charlie [Electron Microscope Unit, University of New South Wales, Sydney, NSW 2052 (Australia)

    2015-02-11

    Monolayer TiCN and multilayer TiCN/Ti coatings were deposited on the surface of Ti using the Filtered Arc Deposition System (FADS). Nanoindentation tests were performed on both coatings. The multilayer TiCN/Ti coating exhibited better ductility than the monolayer TiCN coating. The lattice constants of the coatings were characterized by X-ray diffraction. Transmission Electron Microscopy (TEM) was used to investigate the fracture behavior of the coatings. Inter-columnar, inclined and lateral cracks were found to be the dominant crack modes in the monolayer TiCN coatings while small bending crack and radial crack were the dominant crack modes in the multilayer TiCN/Ti coatings. The Finite Element Method (FEM) was used to simulate the indentation process. It was found that the Ti interlayer in the multilayer TiCN/Ti coating could efficiently suppress the fracture, which is responsible for the improved ductility of the multilayer TiCN/Ti coating.

  17. Nanomechanical properties of TiCN and TiCN/Ti coatings on Ti prepared by Filtered Arc Deposition

    International Nuclear Information System (INIS)

    Monolayer TiCN and multilayer TiCN/Ti coatings were deposited on the surface of Ti using the Filtered Arc Deposition System (FADS). Nanoindentation tests were performed on both coatings. The multilayer TiCN/Ti coating exhibited better ductility than the monolayer TiCN coating. The lattice constants of the coatings were characterized by X-ray diffraction. Transmission Electron Microscopy (TEM) was used to investigate the fracture behavior of the coatings. Inter-columnar, inclined and lateral cracks were found to be the dominant crack modes in the monolayer TiCN coatings while small bending crack and radial crack were the dominant crack modes in the multilayer TiCN/Ti coatings. The Finite Element Method (FEM) was used to simulate the indentation process. It was found that the Ti interlayer in the multilayer TiCN/Ti coating could efficiently suppress the fracture, which is responsible for the improved ductility of the multilayer TiCN/Ti coating

  18. Large Nc from Seiberg-Witten curve and localization

    Science.gov (United States)

    Russo, Jorge G.

    2015-09-01

    When N = 2 gauge theories are compactified on S4, the large Nc limit then selects a unique vacuum of the theory determined by saddle-point equations, which remains determined even in the flat-theory limit. We show that exactly the same equations can be reproduced purely from Seiberg-Witten theory, describing a vacuum where magnetically charged particles become massless, and corresponding to a specific degenerating limit of the Seiberg-Witten spectral curve where 2Nc - 2 branch points join pairwise giving aDn = 0, n = 1 , … ,Nc - 1. We consider the specific case of N = 2 SU (Nc) SQCD coupled with 2Nf massive fundamental flavors. We show that the theory exhibits a quantum phase transition where the critical point describes a particular Argyres-Douglas point of the Riemann surface.

  19. 78 FR 49317 - North Carolina Disaster # NC-00054

    Science.gov (United States)

    2013-08-13

    ... From the Federal Register Online via the Government Publishing Office SMALL BUSINESS ADMINISTRATION North Carolina Disaster NC-00054 AGENCY: U.S. Small Business Administration. ACTION: Notice.... Small Business Administration, Processing And Disbursement Center, 14925 Kingsport Road, Fort Worth,...

  20. Observations of NC stop nets for bottlenose dolphin takes

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — To observe the NC stop net fishery to document the entanglement of bottlenose dolphins and movement of dolphins around the nets.

  1. How large is "large $N_c$" for Nuclear matter?

    CERN Document Server

    Torrieri, Giorgio

    2011-01-01

    We argue that a so far neglected dimensionless scale, the number of neighbors in a closely packed system, is relevant for the convergence of the large $N_c$ expansion at high chemical potential. It is only when the number of colors is large w.r.t. this new scale ($\\sim \\order{10}$) that a convergent large $N_c$ limit is reached. This provides an explanation as to why the large $N_c$ expansion, qualitatively successful in in vacuum QCD, fails to describe high baryo-chemical potential systems, such as nuclear matter. It also means that phenomenological claims about high density matter based on large $N_c$ extrapolations should be treated with caution.

  2. Research on Visual Virtual Design Platform for NC Machine Tools

    Institute of Scientific and Technical Information of China (English)

    HU Rufu; CHEN Xiaoping; SUN Qinghong

    2006-01-01

    The fundamental ideas on building the collaborative design platform of virtual visualization for NC machine tools are introduced. The platform is based on the globally shared product model conforming to the STEP Standard, and used PDM system to integrate and encapsulate CAD/CAE and other application software for the product development. The platform also integrated the expert system of NC machine tools design, analysis and estimation. This expert system utilized fuzzy estimation principle to evaluate the design and simulation analysis results and make decisions. The platform provides the collaborative intelligent environment for the design of virtual NC machine tools prototype aiming at integrated product design team. It also supports the customized development of NC machine tools.

  3. Reliability Evaluation of NC Machine Tools considering Working Conditions

    OpenAIRE

    Li, Hongzhou; Yang, Zhaojun; Xu, Binbin; Chen, Chuanhai; Kan, Yingnan; Liu, Guofei

    2016-01-01

    Reliability evaluation is the basis for reliability design of NC machine tools. Since traditional reliability evaluation methods do not consider the working conditions’ effects on reliability, there is a great error of a result of a traditional method compared with an actual value. A new reliability evaluation model of NC machine tools is proposed based on the Cox proportional hazards model, which describes the mathematical relation between the working condition covariates and the reliability...

  4. precision deburring using NC and robot equipment. Final report

    Energy Technology Data Exchange (ETDEWEB)

    Gillespie, L.K.

    1980-05-01

    Deburring precision miniature components is often time consuming and inconsistent. Although robots are available for deburring parts, they are not precise enough for precision miniature parts. Numerical control (NC) machining can provide edge break consistencies to meet requirements such as 76.2-..mu..m maximum edge break (chamfer). Although NC machining has a number of technical limitations which prohibits its use on many geometries, it can be an effective approach to features that are particularly difficult to deburr.

  5. Vanishing chiral couplings in the large-Nc resonance theory

    OpenAIRE

    Portolés, Jorge; Rosell, Ignasi; Ruiz Femenía, Pedro

    2007-01-01

    The construction of a resonance theory involving hadrons requires implementing the information from higher scales into the couplings of the effective Lagrangian. We consider the large-Nc chiral resonance theory incorporating scalars and pseudoscalars, and we find that, by imposing LO short-distance constraints on form factors of QCD currents constructed within this theory, the chiral low-energy constants satisfy resonance saturation at NLO in the 1/Nc expansion.

  6. Seismotectonic models and CN algorithm: The case of Italy

    International Nuclear Information System (INIS)

    The CN algorithm is here utilized both for the intermediate term earthquake prediction and to validate the seismotectonic model of the Italian territory. Using the results of the analysis, made through the CN algorithm and taking into account the seismotectonic model, three areas, one for Northern Italy, one for Central Italy and one for Southern Italy, are defined. Two transition areas, between the three main areas are delineated. The earthquakes which occurred in these two areas contribute to the precursor phenomena identified by the CN algorithm in each main area. (author). 26 refs, 6 figs, 2 tabs

  7. CN Variations in High Metallicity Globular and Open Clusters

    OpenAIRE

    Martell, Sarah L.; Smith, Graeme H.

    2009-01-01

    We present a comparison of CN bandstrength variations in the high-metallicity globular clusters NGC 6356 and NGC 6528 with those measured in the old open clusters NGC 188, NCG 2158 and NGC 7789. Star-to-star abundance variations, of which CN differences are a readily observable sign, are commonplace in moderate-metallicity halo globular clusters but are unseen in the field or in open clusters. We find that the open clusters have narrow, unimodal distributions of CN bandstrength, as expected f...

  8. Nc-Si Thin Film Deposited at Low Temperature and Nc-Si Heterojunction Solar Cell

    Institute of Scientific and Technical Information of China (English)

    赵占霞; 崔容强; 孟凡英; 于化丛; 周之斌

    2004-01-01

    This paper reported some results about intrinsic nanocrystalline silicon thin films deposited by high frequency (HF) sputtering on p-type c-Si substrates at low temperature. Samples were examined by atomic force microscopy (AFM), X-ray diffraction (XRD), infrared absorption, and ellipsometry. XRD measurements show that this film has a new microstructure, which is different from the films deposited by other methods. The ellipsometry result gives that the optical band gap of the film is about 2.63 eV. In addition, the n-type nc-Si ∶ H/p-type c-Si heterojunction solar cell, which has open circuit voltage (Uoc) of 558 mV and short circuit current intensity (Isc) of 29 mA/cm2, was obtained based on the nanocrystalline silicon thin film. Irradiated under AM1.5, 100 mW/cm2 light intensity, the Uoc, Isc, and FF can keep stable for 10 h.

  9. Operator-Schmidt decomposition of the quantum Fourier transform on CN1 x CN2

    International Nuclear Information System (INIS)

    Operator-Schmidt decompositions of the quantum Fourier transform on CN1 x CN2 are computed for all N1, N2 ≥ 2. The decomposition is shown to be completely degenerate when N1 is a factor of N2 and when N1 > N2. The first known special case, N1 = N2 = 2n, was computed by Nielsen in his study of the communication cost of computing the quantum Fourier transform of a collection of qubits equally distributed between two parties (M A Nielsen 1998 PhD Thesis University of New Mexico ch 6 Preprint quant-ph/0011036). More generally, the special case N1 = 2n1 ≤ 2n2 = N2 was computed by Nielsen et al in their study of strength measures of quantum operations (M A Nielsen et al 2002 Preprint quant-ph/0208077 (2003 Phys. Rev. A at press)). Given the Schmidt decompositions presented here, it follows that in all cases the bipartite communication cost of exact computation of the quantum Fourier transform is maximal

  10. The production of CnO, HCnO, and H2CnO molecules in dense interstellar clouds

    International Nuclear Information System (INIS)

    Measurements of the rate coefficients for ternary association reactions between unsaturated hydrocarbon ions CnHm+ (4≤ n≤ 6, 0≤ m≤6) and CO in a SIFT apparatus have been used to deduce rate coefficients for the corresponding radiative association processes. These latter rate coefficients have been used to estimate the relative abundances of a variety of unusual chemical species and their isomers with the chemical formulae CnO, HCnO, and H2CnO in dense interstellar clouds such as TMC-1. Two of these species -C3O and HC2 CHO (propynal)- have already been detected in this source

  11. Higher-order Cn dispersion coefficients for hydrogen

    International Nuclear Information System (INIS)

    The complete set of second-, third-, and fourth-order van der Waals coefficients Cn up to n=32 for the H(1s)-H(1s) dimer have been determined. They are computed by diagonalizing the nonrelativistic Hamiltonian for hydrogen to obtain a set of pseudostates that are used to evaluate the appropriate sum rules. A study of the convergence pattern for n≤16 indicates that all the Cn/16 coefficients are accurate to 13 significant digits. The relative size of the fourth-order Cn(4) to the second-order Cn(2) coefficients is seen to increase as n increases and at n=32 the fourth-order term is actually larger

  12. CN Bimodality at Low Metallicity: The Globular Cluster M53

    CERN Document Server

    Martell, Sarah L; Briley, Michael M

    2007-01-01

    We present low resolution UV-blue spectroscopic observations of red giant stars in the globular cluster M53 ([Fe/H]=-1.84), obtained to study primordial abundance variations and deep mixing via the CN and CH absorption bands. The metallicity of M53 makes it an attractive target: a bimodal distribution of 3883 angstrom CN bandstrength is common in moderate- and high-metallicity globular clusters ([Fe/H] > -1.6) but unusual in those of lower metallicity ([Fe/H] < -2.0). We find that M53 is an intermediate case, and has a broad but not strongly bimodal distribution of CN bandstrength, with CN and CH bandstrengths anticorrelated in the less-evolved stars. Like many other globular clusters, M53 also exhibits a general decline in CH bandstrength and [C/Fe] abundance with rising luminosity on the red giant branch.

  13. CN Variations in High Metallicity Globular and Open Clusters

    CERN Document Server

    Martell, Sarah L

    2009-01-01

    We present a comparison of CN bandstrength variations in the high-metallicity globular clusters NGC 6356 and NGC 6528 with those measured in the old open clusters NGC 188, NCG 2158 and NGC 7789. Star-to-star abundance variations, of which CN differences are a readily observable sign, are commonplace in moderate-metallicity halo globular clusters but are unseen in the field or in open clusters. We find that the open clusters have narrow, unimodal distributions of CN bandstrength, as expected from the literature, while the globular clusters have broad, bimodal distributions of CN bandstrength, similar to moderate-metallicity halo globular clusters. This result has interesting implications for the various mechanisms proposed to explain the origin of globular cluster abundance inhomogeneities, and suggests that the local environment at the epoch of cluster formation plays a vital role in regulating intracluster enrichment processes.

  14. NC Geometry and Discrete Torsion Fractional Branes I

    CERN Document Server

    Saidi, E H

    2002-01-01

    Considering the complex n-dimension Calabi-Yau homogeneous hyper-surfaces ${\\cal H}_{n}$ and using algebraic geometry methods, we develop the crossed product algebra method, introduced by Berenstein et Leigh in hep-th/0105229, and build the non commutative (NC) geometries for orbifolds ${\\cal O}={\\cal H}_{n}/{\\bf Z}_{n+2}^{n}$ with a discrete torsion matrix $t_{ab}=exp[{\\frac{i2\\pi}{n+2}}{(\\eta_{ab}-\\eta_{ba})}]$, $\\eta_{ab} \\in SL(n,{\\bf Z})$. We show that the NC manifolds ${\\cal O}^{(nc)}$ are given by the algebra of functions on the real $(2n+4)$ Fuzzy torus ${\\cal T}^{2(n+2)}_{\\beta_{ij}}$ with deformation parameters $\\beta_{ij}=exp{\\frac{i2\\pi}{n+2}}{[(\\eta^{-1}_{ab}-\\eta^{-1}_{ba})} q_{i}^{a} q_{j}^{b}]$, $q_{i}^{a}$'s being Calabi-Yau charges of ${\\bf Z}_{n+2}^{n}$. We develop graph rules to represent ${\\cal O}^{(nc)}$ by quiver diagrams which become completely reducible at singularities. Generic points in these NC geometries are be represented by polygons with $(n+2)$ vertices linked by $(n+2)$ edges ...

  15. Is interstellar detection of higher members of the linear radicals CnCH and CnN feasible?

    International Nuclear Information System (INIS)

    Rotational constants and dipole moments for linear-chain radicals CnCH and CnN are estimated using a combinatiaon of ab initio molecular orbital calculations and observed data on the starting members of the series. CnCH with n = 0-5 have been observed by radioastronomy in carbon-rich interstellar clouds; higher members of the series have 2Pi ground states with large dipole moments and are strong candidates for observation. CN and C3N have also been observed by radioastronomy; higher members of the series, with the possible exception of C5N, have 2Pi ground states with near-zero dipole moments making their interstellar detection hopeless under present observational conditions. C5N can be a strong candidate only if it has a 2Sigma ground state, and best computations so far indicate that this is not the case. 20 refs

  16. Is interstellar detection of higher members of the linear radicals CnCH and CnN feasible?

    Science.gov (United States)

    Pauzat, F.; Ellinger, Y.; Mclean, A. D.

    1991-01-01

    Rotational constants and dipole moments for linear-chain radicals CnCH and CnN are estimated using a combinatiaon of ab initio molecular orbital calculations and observed data on the starting members of the series. CnCH with n = 0-5 have been observed by radioastronomy in carbon-rich interstellar clouds; higher members of the series have 2Pi ground states with large dipole moments and are strong candidates for observation. CN and C3N have also been observed by radioastronomy; higher members of the series, with the possible exception of C5N, have 2Pi ground states with near-zero dipole moments making their interstellar detection hopeless under present observational conditions. C5N can be a strong candidate only if it has a 2Sigma ground state, and best computations so far indicate that this is not the case.

  17. Non-global logarithms at finite Nc beyond leading order

    CERN Document Server

    Khelifa-Kerfa, Kamel

    2015-01-01

    We analytically compute non-global logarithms at finite Nc fully up to 4 loops and partially at 5 loops, for the hemisphere mass distribution in e+e- to di-jets to leading logarithmic accuracy. Our method of calculation relies solely on integrating the eikonal squared-amplitudes for the emission of soft energy-ordered real-virtual gluons over the appropriate phase space. We show that the series of non-global logarithms in the said distribution exhibits a pattern of exponentiation thus confirming - by means of brute force - previous findings. In the large-Nc limit, our results coincide with those recently reported in literature. A comparison of our proposed exponential form with all-orders numerical solutions is performed and the phenomenological impact of the finite-Nc corrections is discussed.

  18. Eikonal gluon radiation at finite-Nc beyond 2 loops

    CERN Document Server

    Khelifa-Kerfa, Kamel

    2015-01-01

    We present first calculations of QCD matrix-elements in perturbation theory at finite Nc beyond 2 loops in the eikonal approximation for e+ e- annihilation processes. For the emission of n soft energy-ordered gluons we solve both the colour and kinematic structures at a given order in perturbation theory by means of a Mathematica program that relies solely on a recently developed Mathematica code, ColorMath, that evaluates the trace of products of colour matrices. At large Nc, our squared amplitudes reduce to those already known in the literature.

  19. Shear viscosity from a large-Nc NJL model

    International Nuclear Information System (INIS)

    We investigate the shear viscosity to entropy ratio within the vicinity of the chiral phase transition/crossover using the NJL model in a large-Nc expansion. As heavy-ion collisions at RHIC and LHC in combination with hydrodynamic simulations suggest, this ratio is close to the AdS/CFT benchmark. This indicates a strongly correlated state of matter produced in such collisions. We study in detail the non-perturbative structure of the NJL model and the question if resummation techniques are required. In the large-Nc expansion next-to-leading-order contributions to the shear viscosity are derived.

  20. Resummation of non-global logarithms at finite Nc

    International Nuclear Information System (INIS)

    In the context of inter-jet energy flow, we present the first quantitative result of the resummation of non-global logarithms at finite Nc. This is achieved by refining Weigert's approach in which the problem is reduced to the simulation of associated Langevin dynamics in the space of Wilson lines. We find that, in e+e− annihilation, the exact result is rather close to the result previously obtained in the large-Nc mean field approximation. However, we observe enormous event-by-event fluctuations in the Langevin process which may have significant consequences in hadron collisions

  1. O(Nc) and USp(Nc) QCD from String Theory

    Science.gov (United States)

    Imoto, T.; Sakai, T.; Sugimoto, S.

    2009-12-01

    We propose a holographic dual of large N_c quantum chromodynamics (QCD) with the gauge groups O(N_c) and USp(N_c) and N_f flavors of massless quarks. This is constructed by adding O6-planes to an intersecting D4-D8 system in type IIA superstring theory. The holographic dual description is formulated in Witten's D4-brane background with D8-branes and O6-planes embedded in it as probes. The D4-brane background gives rise to a smooth interpolation of D8-overline{D8} pairs and an O6-overline{O6} pair. We show that the resultant brane configuration explains geometrically the flavor symmetry breaking patterns in O(N_c) and USp(N_c) QCD, which are caused by quark bilinear condensates. We next discuss that baryons can be realized as D4-overline{D4} pairs wrapped on S^4, which intersect with the O6-plane. By analyzing the tachyons on it, we reproduce the stability conditions of the baryons that are expected from the gauge theory viewpoint . The stable baryon configurations are classified systematically using K-theory. We also give a similar analysis of the flux tubes and again reproduce the results that are consistent with QCD.

  2. Preparation of compounds AWCl6 from WCl6 in Cl--containing solvents

    International Nuclear Information System (INIS)

    In Glyme, ACN or CH2Cl2 WCl6 is reduced by Cl- to WCl6-. From those solutions compounds AWCl6 can be isolated with A = Cs (Glyme, ACN), A = Rb, K, NH4(ACN) and A = N(C2H5)4 (CH2Cl2). By concentrating of glyme-solutions a precipitate of A2WCl6 is formed by disproportionation. In methanol/HCl also solvolysis to oxo-compounds of W6+ takes place as function of the H+-concentration. With N(C2H5)4Cl not only chlorotungstates but also methoxy- and oxo-spezies of W5+ can be isolated. (author)

  3. Magnetic properties of high-efficiency core materials NC-M3 and NC-M4

    Science.gov (United States)

    Kubota, T.; Nagai, T.

    1992-03-01

    High-efficiency core materials—New Core NC-M3 and NC-M4— with very low core loss and high permeability have been developed to improve the magnetic properties of conventional magnetic lamination steels. The magnetically favorable crystalline textures are enhanced through the addition of Mn and Sn to low-silicon steel. By adding Mn, particularly more than ~ 1.0 wt.%, to low- silicon steel, a decrease in (111) plane crystals and an increase in (110) and (100) plane crystals are achieved. Moreover, by adding Sn to low- silicon steel containing Mn, the decrease in (111) plane crystals and the increase in (110) plane crystals are more significant. The most suitable amount for the addition of Sn is ~ 0.1 wt.%, because excessive Sn content prevents normal grain growth in steels and makes magnetic properties, particularly core loss, inferior. Typical magnetic properties of NC- M3 (0.47- mm thickness) are 1.70 W/lb in W15/60 and 3000 Gauss/Oe in µ15/60, and those of NC- M4 (0.47- mm thickness) are 1.57 W/lb in W15/60 and 3000 Gauss/Oe in µ15/60. The lower core losses are attained mainly by reducing hysteresis loss. The superior magnetic properties of NC- M4 compared to NC- M3 are due to the fact that the steel is cleaner and has undergone sufficient hot band annealing during manufacturing.

  4. Highly conducting and preferred oriented boron doped nc-Si films for window layers in nc-Si solar cells

    Science.gov (United States)

    Mondal, Praloy; Das, Debajyoti

    2016-05-01

    Growth and optimization of the boron dopednanocrystalline silicon (nc-Si) films have been studied by varyingthe gaspressure applied to the hydrogendiluted silane plasma in RF (13.56 MHz) plasma-enhanced chemical vapor deposition (PECVD) system, using diborane (B2H6) as the dopant gas. High magnitudeof electrical conductivity (~102 S cm-1) andorientedcrystallographic lattice planes have been obtained with high crystalline volume fraction (~86 %) at an optimum pressure of 2.5 Torr. XRD and Raman studies reveal good crystallinity with preferred orientation, suitable for applications in stacked layer devices, particularly in nc-Si solar cells.

  5. 75 FR 34365 - Safety Zone, Alligator River, NC

    Science.gov (United States)

    2010-06-17

    ... SECURITY Coast Guard 33 CFR Part 165 RIN 1625-AA00 Safety Zone, Alligator River, NC AGENCY: Coast Guard... the waters of the Alligator River at East Lake, North Carolina. The safety zone is intended to... on the Alligator River makes safety zone regulations necessary to provide for the safety...

  6. 75 FR 65389 - North Carolina Disaster #NC-00030

    Science.gov (United States)

    2010-10-22

    ... From the Federal Register Online via the Government Publishing Office SMALL BUSINESS ADMINISTRATION North Carolina Disaster NC-00030 AGENCY: U.S. Small Business Administration. ACTION: Notice... Carolina (FEMA-1942-DR), dated 10/14/ 2010. Incident: Severe storms, flooding, and straight-line...

  7. 78 FR 12806 - North Carolina Disaster #NC-00048

    Science.gov (United States)

    2013-02-25

    ... From the Federal Register Online via the Government Publishing Office SMALL BUSINESS ADMINISTRATION North Carolina Disaster NC-00048 AGENCY: U.S. Small Business Administration. ACTION: Notice... INFORMATION CONTACT: A. Escobar, Office of Disaster Assistance, U.S. Small Business Administration, 409...

  8. 77 FR 56250 - North Carolina Disaster #NC-00044

    Science.gov (United States)

    2012-09-12

    ... From the Federal Register Online via the Government Publishing Office SMALL BUSINESS ADMINISTRATION North Carolina Disaster NC-00044 AGENCY: U.S. Small Business Administration. ACTION: Notice... INFORMATION CONTACT: A. Escobar, Office of Disaster Assistance, U.S. Small Business Administration, 409...

  9. 77 FR 33997 - Television Broadcasting Services; Greenville, NC

    Science.gov (United States)

    2012-06-08

    ... COMMISSION 47 CFR Part 73 Television Broadcasting Services; Greenville, NC AGENCY: Federal Communications... Commission instituted a freeze on the acceptance of rulemaking petitions by full power television stations... petitions for rulemaking filed by full power television stations seeking to relocate from channel...

  10. Solution-Processed, Ultrathin Solar Cells from CdCl3(-)-Capped CdTe Nanocrystals: The Multiple Roles of CdCl3(-) Ligands.

    Science.gov (United States)

    Zhang, Hao; Kurley, J Matthew; Russell, Jake C; Jang, Jaeyoung; Talapin, Dmitri V

    2016-06-22

    Solution-processed CdTe solar cells using CdTe nanocrystal (NC) ink may offer an economically viable route for large-scale manufacturing. Here we design a new CdCl3(-)-capped CdTe NC ink by taking advantage of novel surface chemistry. In this ink, CdCl3(-) ligands act as surface ligands, sintering promoters, and dopants. Our solution chemistry allows obtaining very thin continuous layers of high-quality CdTe which is challenging for traditional vapor transport methods. Using benign solvents, in air, and without additional CdCl2 treatment, we obtain a well-sintered CdTe absorber layer from the new ink and demonstrate thin-film solar cells with power conversion efficiency over 10%, a record efficiency for sub-400 nm thick CdTe absorber layer. PMID:27269672

  11. Electron densities and the excitation of CN in molecular clouds

    Science.gov (United States)

    Black, John H.; Van Dishoeck, Ewine F.

    1991-01-01

    In molecular clouds of modest density and relatively high fractional ionization, the rotational excitation of CN is controlled by a competition among electron impact, neutral impact and the interaction with the cosmic background radiation. The degree of excitation can be measured through optical absorption lines and millimeter-wave emission lines. The available, accurate data on CN in diffuse and translucent molecular clouds are assembled and used to determine electron densities. The derived values, n(e) = roughly 0.02 - 0.5/cu cm, imply modest neutral densities, which generally agree well with determinations by other techniques. The absorption- and emission-line measurements of CN both exclude densities higher than n(H2) = roughly 10 exp 3.5/cu cm on scales varying from 0.001 to 60 arcsec in these clouds.

  12. Low temperature synthesis of SiCN nanostructures

    Institute of Scientific and Technical Information of China (English)

    CHENG Wen Juan; MA XueMing

    2009-01-01

    Silicon carbon nitride (SiCN) nanowires, nanorods and nanotubes have gained much attention due to their excellent field emission and photoluminescence properties. These nanostructures were usually grown using catalysts at high temperature (800-1000℃). In this paper, synthesis of SiCN nanostruc-tures at a temperature less than 500℃ is reported. Various kinds of SiCN nanostructures were synthe-sized using microwave plasma chemical vapor deposition method. Gas mixtures of CH4, H2 and N2 were used as precursors and Si chips were inserted in the sample holder at symmetrical positions around the specimen as additional Si sources. Metallic gallium was used as the liquid medium in a mechanism similar to vapor-liquid-solid. Morphologies of the resultant were characterized by field emission scan-ning electron microscopy. Energy dispersive spectrometry and X-ray photoelectron spectroscopy were used to characterize their compositions and bonding states.

  13. Low temperature synthesis of SiCN nanostructures

    Institute of Scientific and Technical Information of China (English)

    2009-01-01

    Silicon carbon nitride (SiCN) nanowires, nanorods and nanotubes have gained much attention due to their excellent field emission and photoluminescence properties. These nanostructures were usually grown using catalysts at high temperature (800―1000℃). In this paper, synthesis of SiCN nanostruc-tures at a temperature less than 500℃ is reported. Various kinds of SiCN nanostructures were synthe-sized using microwave plasma chemical vapor deposition method. Gas mixtures of CH4, H2 and N2 were used as precursors and Si chips were inserted in the sample holder at symmetrical positions around the specimen as additional Si sources. Metallic gallium was used as the liquid medium in a mechanism similar to vapor-liquid-solid. Morphologies of the resultant were characterized by field emission scan-ning electron microscopy. Energy dispersive spectrometry and X-ray photoelectron spectroscopy were used to characterize their compositions and bonding states.

  14. ncRNA orthologies in the vertebrate lineage.

    Science.gov (United States)

    Pignatelli, Miguel; Vilella, Albert J; Muffato, Matthieu; Gordon, Leo; White, Simon; Flicek, Paul; Herrero, Javier

    2016-01-01

    Annotation of orthologous and paralogous genes is necessary for many aspects of evolutionary analysis. Methods to infer these homology relationships have traditionally focused on protein-coding genes and evolutionary models used by these methods normally assume the positions in the protein evolve independently. However, as our appreciation for the roles of non-coding RNA genes has increased, consistently annotated sets of orthologous and paralogous ncRNA genes are increasingly needed. At the same time, methods such as PHASE or RAxML have implemented substitution models that consider pairs of sites to enable proper modelling of the loops and other features of RNA secondary structure. Here, we present a comprehensive analysis pipeline for the automatic detection of orthologues and paralogues for ncRNA genes. We focus on gene families represented in Rfam and for which a specific covariance model is provided. For each family ncRNA genes found in all Ensembl species are aligned using Infernal, and several trees are built using different substitution models. In parallel, a genomic alignment that includes the ncRNA genes and their flanking sequence regions is built with PRANK. This alignment is used to create two additional phylogenetic trees using the neighbour-joining (NJ) and maximum-likelihood (ML) methods. The trees arising from both the ncRNA and genomic alignments are merged using TreeBeST, which reconciles them with the species tree in order to identify speciation and duplication events. The final tree is used to infer the orthologues and paralogues following Fitch's definition. We also determine gene gain and loss events for each family using CAFE. All data are accessible through the Ensembl Comparative Genomics ('Compara') API, on our FTP site and are fully integrated in the Ensembl genome browser, where they can be accessed in a user-friendly manner.Database URL: http://www.ensembl.org. PMID:26980512

  15. CN Morphology Studies of Comet 103P/Hartley 2

    OpenAIRE

    Knight, Matthew M.; Schleicher, David G.

    2011-01-01

    We report on narrowband CN imaging of Comet 103P/Hartley 2 obtained at Lowell Observatory on 39 nights from 2010 July until 2011 January. We observed two features, one generally to the north and the other generally to the south. The CN morphology varied during the apparition: no morphology was seen in July; in August and September the northern feature dominated and appeared as a mostly face-on spiral; in October, November, and December the northern and southern features were roughly equal in ...

  16. On Levi-flat hypersurfaces with given boundary in Cn

    Institute of Scientific and Technical Information of China (English)

    Pierre DOLBEAULT

    2008-01-01

    Let S Cn be a compact connected 2-codimensional submanifold.If n ≥ 3,essentially local conditions and the assumption: every complex point of S is elliptic imply the existence of a projection in Cn of a Levi-flat (2n - 1)-subvariety whose boundary is S (Dolbeault,Tomassini,Zaitsev,2005).We extend the result when S is homeomorphic to a sphere and has one hyperbolic point.For n = 2 many results are known since the 1980's and a new result with a very technical hypothesis is announced.

  17. CN Bimodality at Low Metallicity: The Globular Cluster M53

    OpenAIRE

    Martell, Sarah L.; Smith, Graeme H.; Briley, Michael M.

    2007-01-01

    We present low resolution UV-blue spectroscopic observations of red giant stars in the globular cluster M53 ([Fe/H]=-1.84), obtained to study primordial abundance variations and deep mixing via the CN and CH absorption bands. The metallicity of M53 makes it an attractive target: a bimodal distribution of 3883 angstrom CN bandstrength is common in moderate- and high-metallicity globular clusters ([Fe/H] > -1.6) but unusual in those of lower metallicity ([Fe/H] < -2.0). We find that M53 is an i...

  18. SbCl5—wet acetonitrile: a new system for chemoselective O-desilylation

    OpenAIRE

    Glória, Paulo M. C.; Prabhakar, Sundaresan; Lobo, Ana M; Gomes, Mário

    2003-01-01

    Abstract—A new efficient method for deprotection of TBDMS derivatives of phenols, primary alcohols, carboxylic acids and secondary amines, consisting of SbCl5 and MeCN with 0.1% water (w/v), is reported. It effects inter alia desilylation of a CH2OTBDMS group in the presence of a ketal function.

  19. New molecules in IRC+10216: confirmation of C$_5$S and tentative identification of MgCCH, NCCP, and SiH$_3$CN

    CERN Document Server

    Agúndez, Marcelino; Guélin, Michel

    2014-01-01

    The C-star envelope IRC+10216 harbors a rich variety of molecules, with more than 80 detected to date. During the course of a $\\lambda$ 3 mm survey of IRC+10216 carried out with the IRAM 30-m telescope we have detected various weak lines, with antenna temperatures of a few mK, that we assign to rotational transitions of four new molecules. The observation of three lines of C$_5$S confirms a previous tentative identification of this molecule by Bell et al. (1993) based on a line at 24.0 GHz. We also report the tentative identification of three molecules not yet observed in space: MgCCH, the first metal acetylide detected in space, and NCCP and SiH$_3$CN, the phosphorus and silicon analogs of cyanogen (NCCN) and methyl cyanide (CH$_3$CN). We derive the following column densities: $N$(C$_5$S) = (2-14) $\\times$ 10$^{12}$ cm$^{-2}$ (depending on the rotational temperature adopted), $N$(MgCCH) = 2 $\\times$ 10$^{12}$ cm$^{-2}$, $N$(NCCP) = 7 $\\times$ 10$^{11}$ cm$^{-2}$, and $N$(SiH$_3$CN) = 10$^{12}$ cm$^{-2}$. The...

  20. Mechanism of Nucleic Acid Chaperone Function of Retroviral Nuceleocapsid (NC) Proteins

    Science.gov (United States)

    Rouzina, Ioulia; Vo, My-Nuong; Stewart, Kristen; Musier-Forsyth, Karin; Cruceanu, Margareta; Williams, Mark

    2006-03-01

    Recent studies have highlighted two main activities of HIV-1 NC protein contributing to its function as a universal nucleic acid chaperone. Firstly, it is the ability of NC to weakly destabilize all nucleic acid,(NA), secondary structures, thus resolving the kinetic traps for NA refolding, while leaving the annealed state stable. Secondly, it is the ability of NC to aggregate NA, facilitating the nucleation step of bi-molecular annealing by increasing the local NA concentration. In this work we use single molecule DNA stretching and gel-based annealing assays to characterize these two chaperone activities of NC by using various HIV-1 NC mutants and several other retroviral NC proteins. Our results suggest that two NC functions are associated with its zinc fingers and cationic residues, respectively. NC proteins from other retroviruses have similar activities, although expressed to a different degree. Thus, NA aggregating ability improves, and NA duplex destabilizing activity decreases in the sequence: MLV NC, HIV NC, RSV NC. In contrast, HTLV NC protein works very differently from other NC proteins, and similarly to typical single stranded NA binding proteins. These features of retroviral NCs co-evolved with the structure of their genomes.

  1. Reanalysis of UHS Cofrentes; Reanalisis del UHS de CN Cofrentes

    Energy Technology Data Exchange (ETDEWEB)

    Rodriguez Garcia, G. M.; Arteaga Sualdea, M. A.; Rebollo Garcia, C.; Mota coloma, M.

    2012-07-01

    The purpose of the reanalysis of the UHS is to revalue the cooling flow required for each changer ESW NC Cofrentes, to evacuate thermal loads their H / X, giving credit to lower water temperature UHS reservoir (heat sink ), maintaining the same heat exchange capacity in all H / X.

  2. Phonons and Colossal Thermal Expansion Behavior of Ag3Co(CN)6 and Ag3Fe(CN)6

    OpenAIRE

    Mittal, R.; Zbiri, M.; Schober, H.; Achary, S. N.; Tyagi, A. K.; Chaplot, S. L.

    2012-01-01

    Recently colossal positive volume thermal expansion has been found in the framework compounds Ag3Co(CN)6 and Ag3Fe(CN)6. Phonon spectra have been measured using the inelastic neutron scattering technique as a function of temperature and pressure. The data has been analyzed using ab-initio calculations. We find that the bonding is very similar in both compounds. At ambient pressure modes in the intermediate frequency part of the vibrational spectra in the Co compound are shifted to slightly hi...

  3. Rotational constants of linear and/or bent Cn+1H+ and CnN+(n = 1-6): A DFT study

    Science.gov (United States)

    Aoki, Kozo

    2014-10-01

    The geometries, dipole moments, and rotational constants for the linear and/or bent cations, Cn+1H+ and CnN+(n = 1-6), were studied by the B3LYP method with the modest basis sets. For CnH+(n = odd; 3, 5, 7) and CnN+(n = even; 2, 4, 6), the theoretical rotational constants (Bes) of closed-shell singlet C3H+, C5H+, C7H+, CCN+, C4N+, and C6N+ were calculated to be about 11,244, 2420, 885.2, 11,970, 2439, and 880.8 MHz, respectively. By contrast, the triplets are stable than the corresponding singlets for CnH+(n = odd; 2, 4, 6) and CnN+(n = even; 3, 5) except CN+.

  4. Phase equilibria and structural species in NdCl3-NaCl, NdCl3-CaCl2, PrCl3-NaCl, and PrCl3-CaCl2 systems

    International Nuclear Information System (INIS)

    This paper reports that equilibrium phase diagrams for the systems NdCl3---CaCl2 and NdCl3---NaCl were determined by differential thermal analysis. A simple eutectic was observed at 59 ± 1 mol% CaCl2 and 600 degrees ± 2 degrees C in the NdCl3---CaCl2 system. A compound NaCl · 3NdCl3 which melts incongruently at 545 degrees ± 5 degrees C to NdCl3 and a liquid containing approximately 47 mol% NaCl, and a eutectic at 68 mol% NaCl and 439 degrees ± 2 degrees C were found in the NdCl3---NaCl system. On the basis of agreements between the activities calculated by the Clausius-Clapeyron equation and Temkin's model using the present data for the NdCl3---CaCl2 system and the literature data for the PrCl3---CaCl2 system, the melts in the former system consist of Nd3+, Ca2+, and Cl- ions and in the latter system of Pr3+, Ca2+, and Cl- ions. The above approach indicates the presence of Na+, Cl-, and NdCl4- in the NdCl3-rich melts in the NdCl3--NaCl system

  5. EST Table: CN374031 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available CN374031 rzhswab0_004056 10/09/28 39 %/209 aa gb|EEZ99927.1| hypothetical protein TcasGA2_TC0027 ... gi|91079384|ref|XP_971392.1| PREDICTED: similar to jitterbug ... CG30092-PD [Tribolium castaneum] BY917108 L12 ...

  6. Multiplier theorems for special Hermite expansions on Cn

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    The weak type (1,1) estimate for special Hermite expansions on Cn is proved by using the Calderón-Zygmund decomposition. Then the multiplier theorem in Lp(1

  7. EST Table: CN374452 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available CN374452 rzhswab0_005251 10/09/28 50 %/177 aa ref|NP_001026619.1| alpha-methylacyl-CoA racemase ... 0/08/28 37 %/167 aa ZK892.4#CE32784#WBGene00014128#L-carnitine ... dehydratase#status:Partially_confirmed#UniProt:Q09 ...

  8. EST Table: CN211786 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available CN211786 rzhswab0_006460 10/09/28 46 %/130 aa ref|XP_002430772.1| tyrosine-protein phosphatase corkscrew..., putative [Pediculus humanus corporis] gb|EEB18034.1| tyrosine-protein phosphatase corkscrew

  9. EST Table: CN374995 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available CN374995 rzhswab0_002423 10/09/28 71 %/171 aa ref|XP_970542.1| PREDICTED: similar to brix...26-PA 10/09/10 71 %/171 aa gi|91090402|ref|XP_970542.1| PREDICTED: similar to brix domain-containing protein 2 [Tribolium castaneum] FS911686 L12 ...

  10. EST Table: CN374994 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available CN374994 rzhswab0_003238 10/09/28 72 %/191 aa ref|XP_970542.1| PREDICTED: similar to brix...26-PA 10/09/10 72 %/191 aa gi|91090402|ref|XP_970542.1| PREDICTED: similar to brix domain-containing protein 2 [Tribolium castaneum] FS911686 L12 ...

  11. EST Table: CN211963 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available CN211963 rzhswbb0_006380 10/09/28 100 %/136 aa ref|NP_001040402.1| preimplantation ...protein [Bombyx mori] gb|ABF51322.1| preimplantation protein [Bombyx mori] 10/09/01 87 %/137 aa FBpp0116991|

  12. EST Table: CN375203 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available CN375203 rzhswab0_003107 10/09/28 100 %/199 aa ref|NP_001166288.1| sericin 2 isofor...m 2 precursor [Bombyx mori] gb|ADB04958.1| sericin 2 precursor [Bombyx mori] 10/09/01 low homology 10/08/28

  13. EST Table: CN375202 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available CN375202 rzhswab0_006736 10/09/28 98 %/193 aa ref|NP_001166288.1| sericin 2 isoform... 2 precursor [Bombyx mori] gb|ADB04958.1| sericin 2 precursor [Bombyx mori] 10/09/01 low homology 10/08/28 l

  14. EST Table: CN211900 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available CN211900 rzhswab0_002080 10/09/28 88 %/197 aa ref|NP_001093316.1| adiponectin recep...tor [Bombyx mori] gb|ABK57116.2| adiponectin receptor [Bombyx mori] 10/09/01 73 %/197 aa FBpp0151302|DgriGH1

  15. Cosmogenic 10Be, 21Ne and 36Cl in sanidine and quartz from Chilean ignimbrites

    International Nuclear Information System (INIS)

    Our initial results indicate that three cosmogenic nuclides: 10Be, 21Ne and 36Cl can be analyzed in sanidine. To uncover complex exposure histories or marked changes in denudation rates over time several nuclides with different half-lives (or stable) must be measured. Because of its shorter half-life, the combination of 36Cl and a long-lived nuclide 10Be or stable nuclide 21Ne will provide more information than the pairs 10Be and 26Al or 10Be and 21Ne (in quartz). Sanidine (alkali feldspar) is a common high temperature mineral and often dominates the phenocryst assemblage in silicic to intermediate volcanic rocks. Bedrock surfaces studied come from the Oxaya (erupted 19-23 Ma) and Lauca (erupted 2.7 Ma) ignimbrites of northern Chile. Quartz and sanidine phenocrysts coexist; therefore, we can check the viability of sanidine through direct comparison with nuclide concentrations in quartz. In addition, as quartz has no target for 36Cl in significant abundance we show that the unique power of sanidine is that 36Cl can be measured. We have obtained very good agreement between 10Be and 21Ne concentrations measured in sanidine and coexisting quartz. No meteoric 10Be was apparent in these sanidines. Concentrations of all three nuclides in mineral separates from rock sample CN309 from the Lauca ignimbrite in the Western Cordillera agree well and correspond to minimum exposure ages of 30-50 ka. 10Be and 21Ne measured in both sanidine and quartz from three rock samples from the Oxaya ignimbrite (CN19, CN23, CN104a) in the Western Escarpment record low average landscape modification rates (36Cl data from sanidine in CN23 seem to indicate shorter minimum exposures and more rapid maximum erosion rates

  16. Baryon Isovector Electric Properties and the Large N_c and Chiral Limits

    OpenAIRE

    Cohen, Thomas D.

    1995-01-01

    A model independent calculation is given for the nucleon isovector electric charge radius which is valid in the limit $N_c \\rightarrow \\infty$, $m_\\pi \\rightarrow 0$, $N_c m_\\pi$ fixed. This expression reduces to that of the Skyrme model in the limit $N_c m_{\\pi} \\rightarrow \\infty$.

  17. Parametric Modeling for Globoidal Cam Based and NC Machining

    Directory of Open Access Journals (Sweden)

    Haitao Liu

    2013-02-01

    Full Text Available The design and machining of globoidal cam is difficult, because the shape of working surface is complex,and the curved surface of its space is undevelopable. Based on the above reasons,we proposed the parametric Modeling method for globoidal cam based. Through the secondary development, we realized the parameterized modeling of globoidal cam. Base on using of globular indexing cam NC milling machine existing in the lab,research the programming technology,analyses the defects of conventional programming method,raise improvement measures,control the programming error,modify the feeding speed,develop the special purpose programming software, creat globular indexing cam NC machining program automaticly ,improve the machining precision and efficiency of globular indexing cam.  

  18. Permutation group SN and large Nc excited baryons

    International Nuclear Information System (INIS)

    We study the excited baryon states for an arbitrary number of colors Nc from the perspective of the permutation group SN of N objects. Classifying the transformation properties of states and quark-quark interaction operators under SN allows a general analysis of the spin-flavor structure of the mass operator of these states, in terms of a few unknown constants parametrizing the unknown spatial structure. We explain how to perform the matching calculation of a general two-body quark-quark interaction onto the operators of the 1/Nc expansion. The inclusion of core and excited quark operators is shown to be necessary. Considering the case of the negative parity L=1 states transforming in the MS of SN, we discuss the matching of the one-gluon and the Goldstone-boson exchange interactions.

  19. Series Design of Large-Scale NC Machine Tool

    Institute of Scientific and Technical Information of China (English)

    TANG Zhi

    2007-01-01

    Product system design is a mature concept in western developed countries. It has been applied in war industry during the last century. However, up until now, functional combination is still the main method for product system design in China. Therefore, in terms of a concept of product generation and product interaction we are in a weak position compared with the requirements of global markets. Today, the idea of serial product design has attracted much attention in the design field and the definition of product generation as well as its parameters has already become the standard in serial product designs. Although the design of a large-scale NC machine tool is complicated, it can be further optimized by the precise exercise of object design by placing the concept of platform establishment firmly into serial product design. The essence of a serial product design has been demonstrated by the design process of a large-scale NC machine tool.

  20. Large Nc from Seiberg–Witten curve and localization

    Directory of Open Access Journals (Sweden)

    Jorge G. Russo

    2015-09-01

    Full Text Available When N=2 gauge theories are compactified on S4, the large Nc limit then selects a unique vacuum of the theory determined by saddle-point equations, which remains determined even in the flat-theory limit. We show that exactly the same equations can be reproduced purely from Seiberg–Witten theory, describing a vacuum where magnetically charged particles become massless, and corresponding to a specific degenerating limit of the Seiberg–Witten spectral curve where 2Nc−2 branch points join pairwise giving aDn=0, n=1,…,Nc−1. We consider the specific case of N=2 SU(Nc SQCD coupled with 2Nf massive fundamental flavors. We show that the theory exhibits a quantum phase transition where the critical point describes a particular Argyres–Douglas point of the Riemann surface.

  1. Non-global jet evolution at finite N_c

    CERN Document Server

    Weigert, H

    2003-01-01

    Resummations of soft gluon emissions play an important role in many applications of QCD, among them jet observables and small x saturation effects. Banfi, Marchesini, and Smye have derived an evolution equation for non-global jet observables that exhibits a remarkable analogy with the BK equation used in the small x context. Here, this analogy is used to generalize the former beyond the leading N_c approximation. The result shows striking analogy with the JIMWLK equation describing the small x evolution of the color glass condensate. A Langevin description allows numerical implementation and provides clues for the formulation of closed forms for amplitudes at finite N_c. The proof of the new equation is based on these amplitudes with ordered soft emission. It is fully independent of the derivation of the JIMWLK equation and thus sheds new light also on this topic.

  2. Non-global jet evolution at finite Nc

    International Nuclear Information System (INIS)

    Resummations of soft gluon emissions play an important role in many applications of QCD, among them jet observables and small x saturation effects. For the case of non-global observables, Banfi, Marchesini, and Smye have cast the problem in terms of an evolution equation that exhibits a remarkable analogy with the BK equation used in the small x context. Here, this analogy is used to generalize the former beyond the leading Nc approximation. The result shows striking analogy with the JIMWLK equation describing the small x evolution of the color glass condensate. A Langevin description allows numerical implementation and provides clues for the formulation of closed forms for amplitudes at finite Nc. The proof of the new equation is based on amplitudes with ordered soft emission. It is fully independent of the derivation of the JIMWLK equation and thus sheds new light also on this topic

  3. Parametric Modeling for Globoidal Cam Based and NC Machining

    OpenAIRE

    Haitao Liu; Zhibin Chang; Lei Zhang; Wei Jiang; Guangguo Zhang

    2013-01-01

    The design and machining of globoidal cam is difficult, because the shape of working surface is complex,and the curved surface of its space is undevelopable. Based on the above reasons,we proposed the parametric Modeling method for globoidal cam based. Through the secondary development, we realized the parameterized modeling of globoidal cam. Base on using of globular indexing cam NC milling machine existing in the lab,research the programming technology,analyses the defects of conventional p...

  4. Steam turbine generators -from NC manufacturing to CAD/CAM

    Energy Technology Data Exchange (ETDEWEB)

    Searle, D.R.; King, F.E.; Kiniskern, J.M.

    1985-04-01

    A program has been designed to integrate engineering, manufacturing, and business systems using a common data base. There has been a significant increase in benefits obtained by extending the automation of the design/drafting function to include manufacturing operations. This extension would have been difficult without the existence of highly developed family-of-parts NC programs. The integration concept has also been applied to turbine buckets and is being extended to other turning-generator components.

  5. The Built Environment and Childhood Obesity in Durham, NC

    OpenAIRE

    Miranda, Marie Lynn; Edwards, Sharon E.; Anthopolos, Rebecca; DOLINSKY, DIANA H; Kemper, Alex R.

    2012-01-01

    The relationship between childhood obesity and aspects of the built environment characterizing neighborhood social context is understudied. We evaluate the association between seven built environment domains and childhood obesity in Durham, NC. Measures of housing damage, property disorder, vacancy, nuisances, and territoriality were constructed using data from a 2008 community assessment. Renter-occupied housing and crime measures were developed from public databases. We linked these measure...

  6. NC Lathe Training System Based on the Web

    Institute of Scientific and Technical Information of China (English)

    卢碧红; 黄文丽; 葛研军

    2004-01-01

    Based on an analysis of the requirement of network-oriented NC lathe training system, a general framework of web-based training system is established. The key techniques for establishing this system include a three-layer web structure in building the general framework, the technique of VRML to model a virtual operating environment, and the access to the database using the ASP technique.

  7. ncRNA orthologies in the vertebrate lineage

    OpenAIRE

    Pignatelli, M.; Vilella, A. J.; Muffato, M.; Gordon, L; White, S.; Flicek, P.; Herrero, J.

    2016-01-01

    Annotation of orthologous and paralogous genes is necessary for many aspects of evolutionary analysis. Methods to infer these homology relationships have traditionally focused on protein-coding genes and evolutionary models used by these methods normally assume the positions in the protein evolve independently. However, as our appreciation for the roles of non-coding RNA genes has increased, consistently annotated sets of orthologous and paralogous ncRNA genes are increasingly needed. At the ...

  8. Non-global jet evolution at finite N_c

    OpenAIRE

    Weigert, Heribert

    2003-01-01

    Resummations of soft gluon emissions play an important role in many applications of QCD, among them jet observables and small x saturation effects. Banfi, Marchesini, and Smye have derived an evolution equation for non-global jet observables that exhibits a remarkable analogy with the BK equation used in the small x context. Here, this analogy is used to generalize the former beyond the leading N_c approximation. The result shows striking analogy with the JIMWLK equation describing the small ...

  9. A hybrid approach to automatic generation of NC programs

    OpenAIRE

    G. Payeganeh; M. Tolouei-Rad

    2005-01-01

    Purpose: This paper describes AGNCP, an intelligent system for integrating commercial CAD and CAM systems for 2.5D milling operations at a low cost.Design/methodology/approach: It deals with different machining problems with the aid of two expert systems. It recognizes machining features, determines required machining process plans, cutting tools and parameters necessary for generation of NC programs.Findings: The system deals with different machining problems with the aid of two expert syste...

  10. Iodide, azide, and cyanide complexes of (N,C), (N,N), and (N,O) metallacycles of tetra- and pentavalent uranium

    International Nuclear Information System (INIS)

    In contrast to the neutral macrocycle [UN*2(N,C)] (1) [N* = N(SiMe3)3; N,C = CH2SiMe2N-(SiMe3)] which was quite inert toward I2, the anionic bismetallacycle [NaUN*(N,C)2] (2) was readily transformed into the enlarged monometallacycle [UN*(N,N)I] (4) [N,N = (Me3Si)NSiMe2CH2CH2SiMe2N(SiMe3)] resulting from C-C coupling of the two CH2 groups, and [NaUN*(N,O)2] (3) [N,O = OC(=CH2)SiMe2N(SiMe3)], which is devoid of any U-C bond, was oxidized into the UV bismetallacycle [Na{UN*(N,O)2}2(μ-I)] (5). Sodium amalgam reduction of 4 gave the U(III) compound [UN*(N,N)] (6). Addition of MN3 or MCN to the (N,C), (N,N), and (N,O) metallacycles 1, 4, and 5 led to the formation of the anionic azide or cyanide derivatives M[UN*2(N,C)(N3)] [M = Na, 7a or Na(15-crown-5), 7b], M[UN*2(N,C)(CN)] [M = NEt4, 8a or Na(15-crown-5), 8b or K(18-crown-6), 8c], M[UN*(N,N)(N3)2] [M = Na, 9a or Na(THF)4, 9b], [NEt4][UN*(N,N)(CN)2] (10), M[UN*(N,O)2(N3)] [M = Na, 11a or Na(15-crown-5), 11b], M[UN*(N,O)2(CN)] [M = NEt4, 12a or Na(15-crown-5), 12b]. In the presence of excess iodine in THF, the cyanide 12a was converted back into the iodide 5, while the azide 11a was transformed into the neutral UV complex [U(N{SiMe3}-SiMe2C{CHI}O)2I(THF)] (13). The X-ray crystal structures of 4, 7b, 8a-c, 9b, 10, 12b, and 13 were determined. (authors)

  11. Iodide, azide, and cyanide complexes of (N,C), (N,N), and (N,O) metallacycles of tetra- and pentavalent uranium.

    Science.gov (United States)

    Bénaud, Olivier; Berthet, Jean-Claude; Thuéry, Pierre; Ephritikhine, Michel

    2011-12-01

    In contrast to the neutral macrocycle [UN*(2)(N,C)] (1) [N* = N(SiMe(3))(3); N,C = CH(2)SiMe(2)N(SiMe(3))] which was quite inert toward I(2), the anionic bismetallacycle [NaUN*(N,C)(2)] (2) was readily transformed into the enlarged monometallacycle [UN*(N,N)I] (4) [N,N = (Me(3)Si)NSiMe(2)CH(2)CH(2)SiMe(2)N(SiMe(3))] resulting from C-C coupling of the two CH(2) groups, and [NaUN*(N,O)(2)] (3) [N,O = OC(═CH(2))SiMe(2)N(SiMe(3))], which is devoid of any U-C bond, was oxidized into the U(V) bismetallacycle [Na{UN*(N,O)(2)}(2)(μ-I)] (5). Sodium amalgam reduction of 4 gave the U(III) compound [UN*(N,N)] (6). Addition of MN(3) or MCN to the (N,C), (N,N), and (N,O) metallacycles 1, 4, and 5 led to the formation of the anionic azide or cyanide derivatives M[UN*(2)(N,C)(N(3))] [M = Na, 7a or Na(15-crown-5), 7b], M[UN*(2)(N,C)(CN)] [M = NEt(4), 8a or Na(15-crown-5), 8b or K(18-crown-6), 8c], M[UN*(N,N)(N(3))(2)] [M = Na, 9a or Na(THF)(4), 9b], [NEt(4)][UN*(N,N)(CN)(2)] (10), M[UN*(N,O)(2)(N(3))] [M = Na, 11a or Na(15-crown-5), 11b], M[UN*(N,O)(2)(CN)] [M = NEt(4), 12a or Na(15-crown-5), 12b]. In the presence of excess iodine in THF, the cyanide 12a was converted back into the iodide 5, while the azide 11a was transformed into the neutral U(V) complex [U(N{SiMe(3)}SiMe(2)C{CHI}O)(2)I(THF)] (13). The X-ray crystal structures of 4, 7b, 8a-c, 9b, 10, 12b, and 13 were determined. PMID:22050237

  12. Preparation and Structure of [RuII/III 2(O2CMe)4]2[Fe(CN)5NO] and Magnetically ordered Hx[RuII/III 2(O2CMe)4]3x[Cr(CN)5NO] Possessing Interpenetrating Lattices

    Energy Technology Data Exchange (ETDEWEB)

    Kennon, B.; Stone, K; Stephens, P; Miller, J

    2010-01-01

    Reaction of [Ru{sub 2}(O{sub 2}CMe){sub 4}]Cl with K{sub 3}[Cr(CN){sub 5}NO] in water forms Hx[Ru{sub 2}{sup II/III}(O{sub 2}CMe){sub 4}]{sub 3-x}-[Cr(CN){sub 5}NO] {center_dot} zH{sub 2}O (x = 0.2) that magnetically orders at 4.0 K and possesses an interpenetrating body centered cubic [a = 13.2509(2) {angstrom}] structure with random locations of the bridging nitrosyl ligands, and x/3 vacant cation sites. Similarly, the aqueous reaction of [Ru{sub 2}(O{sub 2}CMe){sub 4}]Cl with Na{sub 2}[Fe(CN){sub 5}NO] forms paramagnetic [Ru{sub 2}(O{sub 2}CMe){sub 4}]{sub 2}[Fe(CN){sub 5}NO] {center_dot} H{sub 2}O, which has a similar tetragonal interpenetrating structure [a = 13.0186(1) {angstrom}, c = 13.0699(2) {angstrom}] where the NO ligands are presumably nonbridging and 1/3 of the expected cation sites are unoccupied. The presence of uncoordinated NO sites in addition to missing neighboring [Ru{sub 2}(O{sub 2}CMe){sub 4}]{sup +} units, results in significant vacancies (or holes) in the lattice.

  13. A theory of baryon resonances at large N_c

    CERN Document Server

    Diakonov, Dmitri; Vladimirov, Alexey A

    2013-01-01

    At large number of colors, N_c quarks in baryons are in a mean field of definite space and flavor symmetry. We write down the general Lorentz and flavor structure of the mean field, and derive the Dirac equation for quarks in that field. The resulting baryon resonances exhibit an hierarchy of scales: The crude mass is O(N_c), the intrinsic quark excitations are O(1), and each intrinsic quark state entails a finite band of collective excitations that are split as O(1/N_c). We build a (new) theory of those collective excitations, where full dynamics is represented by only a few constants. In a limiting (but unrealistic) case when the mean field is spherically-and flavor-symmetric, our classification of resonances reduces to the SU(6) classification of the old non-relativistic quark model. Although in the real world N_c is only three, we obtain a good accordance with the observed resonance spectrum up to 2 GeV.

  14. NC-Audit: Auditing for Network Coding Storage

    CERN Document Server

    Le, Anh

    2012-01-01

    Network coding-based storage has recently received a lot of attention thanks to its ability to efficiently repair failed nodes. Independently, another body of work has proposed integrity checking schemes for cloud storage, none of which, however, is customized for network coding storage or can efficiently support repair. In this work, we bridge the gap between these currently disconnected bodies of work, and we focus on the (novel) advantage of network coding for integrity checking. We propose NC-Audit - a remote data integrity checking scheme, designed specifically for network coding-based storage cloud. NC-Audit provides a unique combination of desired properties: (i) efficient checking of data integrity (ii) efficient support for repairing failed nodes (iii) full support for modification of outsourced data and (iv) protection against information leakage when checking is performed by a third party. The key ingredient of the design of NC-Audit is a novel combination of SpaceMac, a homomorphic MAC scheme for ...

  15. The Pattern of CN, O, and Na Inhomogeneities on the Red Giant Branch of Messier 5

    CERN Document Server

    Smith, Graeme H; Hamren, Katherine M

    2013-01-01

    Data from the literature are used to explore the relation between $\\lambda$3883 CN band strength and the sodium and oxygen abundances of red giants in the globular cluster Messier 5. Although there is a broad tendency for CN-strong giants in this cluster to have higher sodium abundances and lower oxygen abundances than CN-weak giants of comparable absolute magnitude there are some secondary features in these relations. The oxygen abundance [O/Fe] shows a greater range (0.6-0.7 dex) among the CN-strong giants than the CN-weak giants (approximately 0.3 dex). By contrast [Na/Fe] shows a 0.6-0.7 dex range among the CN-weak giants, but a more limited range of 0.3-0.4 dex among the CN-strong giants. The $\\lambda$3883 CN band anticorrelates in strength with [O/Fe] among the CN-strong giants, but there is little, if any, such trend among the CN-weak giants. In contrast, the CN band strength may show a modest correlation with [Na/Fe] among the CN-weak giants, but there is little evidence for such among the CN-strong g...

  16. TRAC-PF1 post-test predictions for the Semiscale Natural-Circulation Tests S-NC-2 and S-NC-6

    International Nuclear Information System (INIS)

    The TRAC prediction are compared to the data for the Semiscale natural-circular Tests S-NC-2B and S-NC-6. S-NC-2B is a baseline test covering single- and two-phase natural circulation as well as reflux; here TRAC compares quite well with the experiment results for mass flow. For Test S-NC-6, which is a reflux test with various amounts of nitrogen injected into the system, the TRAC prediction of the reflux rate is close to the experiment value with no nitrogen in the system. Ultimately, the maximum reflux rate predicted by TRAC is about 20% higher than the data

  17. Monoclonal Antibody RYSK173 Recognizes the Dinuclear Zn Center of Serum Carnosinase 1 (CN-1: Possible Consequences of Zn Binding for CN-1 Recognition by RYSK173.

    Directory of Open Access Journals (Sweden)

    Shiqi Zhang

    Full Text Available The proportion of serum carnosinase (CN-1 recognized by RYSK173 monoclonal antibody negatively correlates with CN-1 activity. We thus hypothesized that the epitope recognized by RYSK173 is accessible only in a catalytically incompetent conformation of the zinc dependent enzyme and we mapped its position in the CN-1 structure. Since patients with kidney failure are often deficient in zinc and other trace elements we also assessed the RYSK173 CN-1 proportion in serum of these patients and studied the influence of hemodialysis hereon in relation to Zn2+ and Cu2+ concentration during hemodialysis.Epitope mapping using myc-tagged CN-1 fragments and overlapping peptides revealed that the RYSK173 epitope directly contributes to the formation of the dinuclear Zn center in the catalytic domain of homodimeric CN-1. Binding of RYSK173 to CN-1 was however not influenced by addition of Zn2+ or Cu2+ to serum. In serum of healthy controls the proportion of CN-1 recognized by RYSK173 was significantly lower compared to end-stage renal disease (ESRD patients (1.12 ± 0.17 vs. 1.56 ± 0.40% of total CN-1; p<0.001. During hemodialysis the relative proportion of RYSK173 CN-1 decreased in parallel with increased serum Zn2+ and Cu2+ concentrations after dialysis.Our study clearly indicates that RYSK173 recognizes a sequence within the transition metal binding site of CN-1, thus supporting our hypothesis that metal binding to CN-1 masks the epitope. The CN-1 RYSK173 proportion appears overall increased in ESRD patients, yet it decreases during hemodialysis possibly as a consequence of a relative increase in transition metal bound enzyme.

  18. Model of automated computer aided NC machine tools programming

    Directory of Open Access Journals (Sweden)

    J. Balic

    2006-04-01

    Full Text Available Purpose: Modern companies tend towards the greatest possible automation in all areas. The new control concepts of manufacturing processes required development of adequate tools for the introduction of automated control in a certain area. The paper presents such system for automated programming of CNC machine tools.Design/methodology/approach: The system is based on the previously incorporated know-how and the rules of it implementation in tool – shop. The existing manufacturing knowledge of industry tool production was collected and analysing. On this bases flow chart of all activities were made. Theoretical contribution is made in systemization of technological knowledge, which is now accessible for all workers in NC preparation units.Findings: Utilization of technology knowledge. On the basis of the recognized properties it has worked out the algorithms with which the process of manufacture, the tool and the optimum parameters selected are indirectly determined, whereas the target function was working out of the NC programme. We can first out that with information approaching of the CAM and CAPP the barriers between them, strict so far, disappear.Research limitations/implications: Till now, the system is limited to milling, drilling and similar operation. It could be extended to other machining operations (turning, grinding, wire cutting, etc. with the same procedure. In advanced, some methods of artificial intelligence could be use.Practical implications: It is suitable for industry tools, dies and moulds production, while the system was proved in the real tool shop (production of tools for casting. The system reduces the preparation time of NC programs and could be used with any commercial available CAD/CAM/NC programming systems. Human errors are avoid or at lover level. It is important for engineers in CAD/CAM field and in tool – shops.Originality/value: The developed system is original and was not found in the literature or in the

  19. The NC (numerically controlled) assistant: Interfacing knowledge based manufacturing tools to CAD/CAM systems

    Energy Technology Data Exchange (ETDEWEB)

    Burd, W.C.

    1988-01-01

    A knowledge based computer program that assists programmers of numerically controlled (NC) machine tools is described. The program uses part features identified by the NC programmer and a set of expert system manufacturing rules to select cutting parameters and produce NC part programs. An expert system shell determines the NC sequence and the machining parameters. Several point-to-point NC functions are currently in production. A CAD/CAM system interface for milling and turning functions is also described. 2 refs., 24 figs.

  20. Software module for geometric product modeling and NC tool path generation

    International Nuclear Information System (INIS)

    The intelligent CAD/CAM system named VIRTUAL MANUFACTURE is created. It is consisted of four intelligent software modules: the module for virtual NC machine creation, the module for geometric product modeling and automatic NC path generation, the module for virtual NC machining and the module for virtual product evaluation. In this paper the second intelligent software module is presented. This module enables feature-based product modeling carried out via automatic saving of the designed product geometric features as knowledge data. The knowledge data are afterwards applied for automatic NC program generation for the designed product NC machining. (Author)

  1. smyRNA: A Novel Ab Initio ncRNA Gene Finder

    OpenAIRE

    Sahinalp, S. Cenk; Salari, Raheleh; Aksay, Cagri; HAJIRASOULIHA, Iman; Karakoc, Emre; Unrau, Peter J.

    2009-01-01

    Background Non-coding RNAs (ncRNAs) have important functional roles in the cell: for example, they regulate gene expression by means of establishing stable joint structures with target mRNAs via complementary sequence motifs. Sequence motifs are also important determinants of the structure of ncRNAs. Although ncRNAs are abundant, discovering novel ncRNAs on genome sequences has proven to be a hard task; in particular past attempts for ab initio ncRNA search mostly failed with the exception of...

  2. New insights into the compressibility and high-pressure stability of Ni(CN)2: a combined study of neutron diffraction, Raman spectroscopy, and inelastic neutron scattering.

    Science.gov (United States)

    Mishra, Sanjay K; Mittal, Ranjan; Zbiri, Mohamed; Rao, Rekha; Goel, Prabhatasree; Hibble, Simon J; Chippindale, Ann M; Hansen, Thomas; Schober, Helmut; Chaplot, Samrath L

    2016-02-01

    Nickel cyanide is a layered material showing markedly anisotropic behaviour. High-pressure neutron diffraction measurements show that at pressures up to 20.1 kbar, compressibility is much higher in the direction perpendicular to the layers, c, than in the plane of the strongly chemically bonded metal-cyanide sheets. Detailed examination of the behaviour of the tetragonal lattice parameters, a and c, as a function of pressure reveal regions in which large changes in slope occur, for example, in c(P) at 1 kbar. The experimental pressure dependence of the volume data is fitted to a bulk modulus, B0, of 1050 (20) kbar over the pressure range 0-1 kbar, and to 124 (2) kbar over the range 1-20.1 kbar. Raman spectroscopy measurements yield additional information on how the structure and bonding in the Ni(CN)2 layers change with pressure and show that a phase change occurs at about 1 kbar. The new high-pressure phase, (Phase PII), has ordered cyanide groups with sheets of D4h symmetry containing Ni(CN)4 and Ni(NC)4 groups. The Raman spectrum of phase PII closely resembles that of the related layered compound, Cu1/2Ni1/2(CN)2, which has previously been shown to contain ordered C≡N groups. The phase change, PI to PII, is also observed in inelastic neutron scattering studies which show significant changes occurring in the phonon spectra as the pressure is raised from 0.3 to 1.5 kbar. These changes reflect the large reduction in the interlayer spacing which occurs as Phase PI transforms to Phase PII and the consequent increase in difficulty for out-of-plane atomic motions. Unlike other cyanide materials e.g. Zn(CN)2 and Ag3Co(CN)6, which show an amorphization and/or a decomposition at much lower pressures (~100 kbar), Ni(CN)2 can be recovered after pressurising to 200 kbar, albeit in a more ordered form. PMID:26751175

  3. 75 FR 6862 - Airworthiness Directives; Bombardier, Inc. Model CL-600-1A11 (CL-600), CL-600-2A12 (CL-601), CL...

    Science.gov (United States)

    2010-02-12

    ... Policies and Procedures (44 FR 11034, February 26, 1979); and 3. Will not have a significant economic.... Model CL-600-1A11 (CL- 600), CL-600-2A12 (CL-601), CL-600-2B16 (CL-601-3A, CL-601-3R, and CL- 604 Variants (Including CL-605 Marketing Variant)) Airplanes AGENCY: Federal Aviation Administration (FAA),...

  4. 7 CFR Appendix C to Part 225 - Child Nutrition (CN) Labeling Program

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 4 2010-01-01 2010-01-01 false Child Nutrition (CN) Labeling Program C Appendix C to... Appendix C to Part 225—Child Nutrition (CN) Labeling Program 1. The Child Nutrition (CN) Labeling Program... 7 CFR 210.10, 225.16, and 226.20 and are served in the main dish. (b) Juice drinks and juice...

  5. 7 CFR Appendix C to Part 226 - Child Nutrition (CN) Labeling Program

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 4 2010-01-01 2010-01-01 false Child Nutrition (CN) Labeling Program C Appendix C to.... C Appendix C to Part 226—Child Nutrition (CN) Labeling Program 1. The Child Nutrition (CN) Labeling... 7 CFR 210.10, 225.21, and 226.20 and are served in the main dish. (b) Juice drinks and juice...

  6. Jensen measures and unbounded B-regular domains in Cn

    International Nuclear Information System (INIS)

    We extend the concept of B-regularity initiated in the class of bounded domains in Cn by Sibony to the class of unbounded domains. The main tool is a duality theorem expressing upper envelopes of functions in terms of lower envelopes of integrals relative to different classes of Jensen measures. We also obtain a global approximation theorem for bounded plurisubharmonic functions on unbounded domains. (author)

  7. EST Table: CN376274 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available CN376274 rzhswab0_006395 10/09/28 44 %/199 aa ref|YP_015696.1| polyprotein [Kakugo ...virus] dbj|BAD06930.1| polyprotein [Kakugo virus] 10/09/01 n.h 10/08/28 n.h 10/09/10 n.h 10/09/10 n.h 10/09/10 n.h CK528690 L12 ...

  8. EST Table: CN376272 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available CN376272 rzhswba0_003793 10/09/28 45 %/209 aa ref|YP_015696.1| polyprotein [Kakugo ...virus] dbj|BAD06930.1| polyprotein [Kakugo virus] 10/09/01 n.h 10/08/28 n.h 10/09/10 n.h 10/09/10 n.h 10/09/10 n.h CK528690 L12 ...

  9. EST Table: CN212174 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available CN212174 rzhswab0_007010 10/09/28 77 %/192 aa ref|NP_001166288.1| sericin 2 isoform... 2 precursor [Bombyx mori] gb|ADB04958.1| sericin 2 precursor [Bombyx mori] 10/09/01 n.h 10/08/28 n.h 10/09/10 n.h 10/09/10 n.h 10/09/10 n.h BB985569 L12 ...

  10. Outline of CHN Elementary and CN Environmental Analysis

    OpenAIRE

    Kudzin, Zbigniew H.; Waśkowski, Bogdan

    2004-01-01

    Wydrukowano z dostarczonych Wydawnictwu UŁ gotowych materiałów A review on the CHN analysis of organic compounds and the CN environmental analysis is described. The review contains outline of the evolutionary development of elementary analysis, since Gay-Lussac, Dumas and Liebig era until a present slate analysis, with computer controlled, fully automated analyzers. Physical principles of high temperature and low temperature combustions are discussed. Technical foundations o...

  11. Classification of ncRNAs using position and size information in deep sequencing data

    Science.gov (United States)

    Erhard, Florian; Zimmer, Ralf

    2010-01-01

    Motivation: Small non-coding RNAs (ncRNAs) play important roles in various cellular functions in all clades of life. With next-generation sequencing techniques, it has become possible to study ncRNAs in a high-throughput manner and by using specialized algorithms ncRNA classes such as miRNAs can be detected in deep sequencing data. Typically, such methods are targeted to a certain class of ncRNA. Many methods rely on RNA secondary structure prediction, which is not always accurate and not all ncRNA classes are characterized by a common secondary structure. Unbiased classification methods for ncRNAs could be important to improve accuracy and to detect new ncRNA classes in sequencing data. Results: Here, we present a scoring system called ALPS (alignment of pattern matrices score) that only uses primary information from a deep sequencing experiment, i.e. the relative positions and lengths of reads, to classify ncRNAs. ALPS makes no further assumptions, e.g. about common structural properties in the ncRNA class and is nevertheless able to identify ncRNA classes with high accuracy. Since ALPS is not designed to recognize a certain class of ncRNA, it can be used to detect novel ncRNA classes, as long as these unknown ncRNAs have a characteristic pattern of deep sequencing read lengths and positions. We evaluate our scoring system on publicly available deep sequencing data and show that it is able to classify known ncRNAs with high sensitivity and specificity. Availability: Calculated pattern matrices of the datasets hESC and EB are available at the project web site http://www.bio.ifi.lmu.de/ALPS. An implementation of the described method is available upon request from the authors. Contact: florian.erhard@bio.ifi.lmu.de PMID:20823303

  12. Pressure-induced polymerization of P(CN)3

    International Nuclear Information System (INIS)

    Motivated to explore the formation of novel extended carbon-nitrogen solids via well-defined molecular precursor pathways, we studied the chemical reactivity of highly pure phosphorous tricyanide, P(CN)3, under conditions of high pressure at room temperature. Raman and infrared (IR) spectroscopic measurements reveal a series of phase transformations below 10 GPa, and several low-frequency vibrational modes are reported for the first time. Synchrotron powder X-ray diffraction measurements taken during compression show that molecular P(CN)3 is highly compressible, with a bulk modulus of 10.0 ± 0.3 GPa, and polymerizes into an amorphous solid above ∼10.0 GPa. Raman and IR spectra, together with first-principles molecular-dynamics simulations, show that the amorphization transition is associated with polymerization of the cyanide groups into CN bonds with predominantly sp2 character, similar to known carbon nitrides, resulting in a novel phosphorous carbon nitride (PCN) polymeric phase, which is recoverable to ambient pressure

  13. Compositional depth profiling of TaCN thin films

    Energy Technology Data Exchange (ETDEWEB)

    Adelmann, Christoph; Conard, Thierry; Franquet, Alexis; Brijs, Bert; Munnik, Frans; Burgess, Simon; Witters, Thomas; Meersschaut, Johan; Kittl, Jorge A.; Vandervorst, Wilfried; Van Elshocht, Sven [Imec, B-3001 Leuven (Belgium); Forschungszentrum Dresden-Rossendorf, D-01314 Dresden (Germany); Oxford Instruments NanoAnalysis, High Wycombe, HP12 3SE (United Kingdom); Imec, B-3001 Leuven (Belgium); Imec, B-3001 Leuven, Belgium and Instituut voor Kern- en Stralingsfysica, Katholieke Universiteit Leuven, B-3001 Leuven (Belgium); Imec, B-3001 Leuven (Belgium)

    2012-07-15

    The composition profiling of thin TaCN films was studied. For the composition profile determination using x-ray photoemission spectrometry (XPS) in combination with Ar sputtering, preferential sputtering effects of N with respect to Ta and C were found to lead to inaccurate elemental concentrations. Sputter yield calculations for the given experimental conditions allowed for the correction of a part of the error, leading to fair accuracy by reference-free measurements. Further improvement of the accuracy was demonstrated by the calibration of the XPS compositions against elastic recoil detection analysis (ERDA) results. For Auger electron spectrometry (AES) in combination with Ar sputtering, accurate results required the calibration against ERDA. Both XPS and AES allowed for a reliable and accurate determination of the compositional profiles of TaCN-based thin films after calibration. Time-of-flight secondary-ion mass spectrometry was also used to assess the composition of the TaCN films. However, the analysis was hampered by large matrix effects due to small unintentional oxygen contents in the films. Energy-dispersive x-ray spectrometry is also discussed, and it is shown that an accurate reference-free measurement of the average film concentration can be achieved.

  14. CN and CH Bandstrengths in Bright Globular Cluster Red Giants

    Science.gov (United States)

    Martell, Sarah L.; Smith, G. H.

    2006-12-01

    We present preliminary results from a survey of CN and CH bandstrengths in bright red giant stars (MV -1.5) in Galactic globular clusters. Our cluster sample spans a wide metallicity range, from M92 ([Fe/H]=-2.28) to M71 ([Fe/H]=-0.73). The data were all taken using the Shane 120-inch telescope and the Kast spectrograph at Lick Observatory; the homogeneity of the sample makes it ideal for a comparative study of carbon depletion (and therefore deep mixing rate) as a function of stellar metallicity. Thus far we have measured molecular bandstrength indices for CH and CN, as well as indices for Ca and Mg lines; the task of converting the index measurements to carbon and nitrogen abundances will require comparisons with synthetic spectra. The molecular CN index behaves as expected from a study of the literature: within individual clusters, it varies significantly from star to star. The data also allow us to examine the dependence of the Ca and Mg indices on cluster metallicity at a given MV. The index MHK shows clear sensitivity to [Fe/H] across the full metallicity range of our sample. A similar study is also in progress involving analogous stars in the open clusters NGC 188, NGC 2158, NGC 6791, and NGC 7789 (-0.3 < [Fe/H] < +0.3).

  15. TiAlN and TiAlCN deposition in an industrial PaCVD-plant

    Energy Technology Data Exchange (ETDEWEB)

    Heim, D.; Hochreiter, R. [Ruebig GmbH, Co., Wels (Austria)

    1998-01-01

    An industrial PaCVD-plant was equipped with an AlCl{sub 3}-generator. By using Ar, H{sub 2}, N{sub 2}, CH{sub 4}, TiCl{sub 4} and AlCl{sub 3}, TiAlN- and TiAlCN-films could be deposited on hard metal and steel substrates. The plasma was generated by a DC-pulse power supply with frequencies up to 50 kHz. The reactor size was 350 mm in diameter and 900 mm in height. During one batch 1200 indexable inserts could be coated. The growth rates were about 1-3 {mu}m h{sup -1}. The deposited films show a fine structure and Cl-concentrations below 3%. The measured critical loads were between 30 and 40 N. Wear test results show an increase in tool life up to several 100% compared with uncoated or TiN-coated tools. (orig.) 7 refs.

  16. VizieR Online Data Catalog: C2 Phillips and CN Red bands in HD 56126 (Bakker+,

    Science.gov (United States)

    Bakker, E. J.; Waters, L. B. F. M.; Lamers, H. J. G. L. M.; Trams, N. R.; van der Wolf, F. L. A.

    1996-03-01

    We present the detection of molecular absorption lines in the optical spectrum of the post-AGB star HD 56126. The C2 Phillips A1{PI}u- X1{SIGMA}+g(1,0), (2,0), and (3,0); Swan d3{PI}g-a3{PI}u(0,0) and (1,0); and CN Red system A2{PI}-X2{SIGMA}+ (1,0), (2,0), (3,0), and (4,0) bands have been identified. From the identification of the molecular bands we find an expansion velocity of 8.5+/-0.6km/s independent of excitation condition or molecular specie. On the basis of the expansion velocity, rotational temperatures, and molecular column densities we argue that the line-forming region is the AGB remnant. This is in agreement with the expansion velocity derived from the CO lines. We find column densities of logNC2=15.3+/-0.3cm-2 and logNCN=15.5+/-0.3cm-2, and rotational temperatures of Trot=242+/-20K and Trot=24+/-5K respectively for C2 and CN. By studying molecular line absorption in optical spectra of post-AGB stars we have found a new tracer of the AGB remnant. From comparison with the results of CO and IR observations it is possible to obtain information on non-spherical behavior of the AGB remnant. Using different molecules with different excitation conditions it should be possible to study the AGB remnant as a function of the distance to the star, and thus as a function of the evolutionary status of the star on the AGB. (6 data files).

  17. Recovery of iodine from waste CuI containing CuCN%从含CuCN的CuI废渣中回收碘

    Institute of Scientific and Technical Information of China (English)

    蔡作乾; 胡震宁

    1999-01-01

    在生产液晶的一种废渣中含有大量的CuI和微量的CuCN.随着碘的市场价格上涨,从废渣中回收碘变得越来越有意义.为了从废渣中回收碘,选择合适的方法--氧化法提取单质碘,不使其中CN-形成气态形式而逸出.氧化剂采用FeCl3.对CN-的含量进行测定.对于提出的粗碘采用水蒸气蒸馏法进行提纯分析,确定一套安全有效的工艺流程:在室温下,用FeCl3饱和溶液与废渣一起搅拌反应0.5h以上.回收率达85%左右.

  18. Universell kopplingsbox mellan NC-maskin och industrirobot

    OpenAIRE

    Martín, Jose Antonio; Trujillo, Eduardo

    2010-01-01

    The aim of this thesis is the design and implementation of a standardized interface to communicate a NC machine with an industrial robot. This interface consists of an ‘electronic box’ which includes a powerful board that is perfect for automation projects composed of a microcontroller, serial ports, optocouplers, relays, etc… The main component of this PCB is the microcontroller. The Atmel AT90CAN128 microcontroller is a good choice for this purpose since it is perfectly suited for industria...

  19. CNC LATHE MACHINE PRODUCING NC CODE BY USING DIALOG METHOD

    Directory of Open Access Journals (Sweden)

    Yakup TURGUT

    2004-03-01

    Full Text Available In this study, an NC code generation program utilising Dialog Method was developed for turning centres. Initially, CNC lathes turning methods and tool path development techniques were reviewed briefly. By using geometric definition methods, tool path was generated and CNC part program was developed for FANUC control unit. The developed program made CNC part program generation process easy. The program was developed using BASIC 6.0 programming language while the material and cutting tool database were and supported with the help of ACCESS 7.0.

  20. Application of COBRA-NC to hydrogen transport

    International Nuclear Information System (INIS)

    COBRA-NC, a thermal-hydraulic computer code for the analysis of light water reactor (LWR) containment system transients is presented. A brief description of the code is provided. While the code is being developed for all phases of a containment transient, data comparisons with hydrogen distribution test data obtained in the Hanford Engineering Development Laboratory test facility and in the Battelle Memorial Institute's test facility are presented in this paper. The advantages this code features over other containment codes is also discussed

  1. A theoretical study of spectroscopy and metastability of the CN2+ dication

    International Nuclear Information System (INIS)

    Graphical abstract: Spectroscopic constants and adiabatic excitation energies of CN2+ were calculated, and double ionization energy of CN was estimated using high-level abinitio methods. Tunneling and spin–orbit induced predissociation lifetimes were predicted. Highlights: ► Spectroscopic constants of 13 electronic states of CN2+. ► Double ionization energy of CN by MRCI and RCCSD(T) methods. ► Spin–orbit integrals of CN2+ as a function of internuclear distance. ► Tunneling and spin–orbit induced predissociation lifetimes of CN2+. - Abstract: Potential energy curves of low-lying electronic states of the CN2+ dication and of the electronic ground states of CN+ and the neutral CN molecule were calculated using internally contracted multireference CI and the coupled cluster RCCSD(T) methods. Spectroscopic constants and adiabatic excitation energies of 13 quasibound electronic states of the dication were obtained and the energy of charge stripping of CN+ and double ionization energy of CN were predicted. Tunneling and spin–orbit induced predissociation lifetimes for the vibrational levels in the low-lying electronic states are presented and the metastability of the dication is discussed.

  2. Before and After How has the SNO NC measurement changed things?

    CERN Document Server

    Bahcall, J N; Peña-Garay, C; Bahcall, John N.; Peña-Garay, Carlos

    2002-01-01

    We present "Before and After" global oscillation solutions, as well as predicted "Before and After" values and ranges for eight future solar neutrino observables. The ``Before'' case includes all solar neutrino data (and some theoretical improvements) available prior to April 20, 2002 and the ``After'' case includes, in addition, the new SNO data on the CC, NC, and day-night asymmetry. The LMA solution is the only currently allowed MSW oscillation solution at a CL of 98.8 %. The LOW solution is allowed only at 2.5 sigma, SMA at 3.7 sigma, and pure sterile oscillations at 5.4 sigma. Small mixing angles are ``out''(pure sterile is ``way out''); MSW with large mixing angles is definitely ``in''. Vacuum oscillations are allowed, but not robustly, at 2.1 sigma. Precise maximal mixing is excluded at 3.2 sigma for MSW solutions and at 2.8 sigma for vacuum solutions. Most of the predicted values for future observables for the BOREXINO, KamLAND, and future SNO measurements are changed only by minor amounts by the incl...

  3. 75 FR 37994 - Airworthiness Directives; Bombardier, Inc. Model CL-600-1A11 (CL-600), CL-600-2A12 (CL-601), CL...

    Science.gov (United States)

    2010-07-01

    ... FR 6862). That NPRM proposed to correct an unsafe condition for the specified products. The MCAI... ``significant rule'' under the DOT Regulatory Policies and Procedures (44 FR 11034, February 26, 1979); and 3..., Inc. Model CL-600-1A11 (CL- 600), CL-600-2A12 (CL-601), CL-600-2B16 (CL-601-3A, CL-601-3R, and CL-...

  4. Can the nucleon axial charge be O(Nc^0)?

    CERN Document Server

    Kojo, Toru

    2012-01-01

    The nucleon self-energy and its relation to the nucleon axial charge gA are discussed at large Nc. The energy is compared for the hedgehog, conventional, and recently proposed dichotomous nucleon wavefunctions which give different values for gA. We consider their energies at both perturbative and non-perturbative levels. In perturbative estimates, we take into account the pion exchanges among quarks up to the third orders of axial charge vertices, including the many-body forces such as the Wess-Zumino terms. It turns out that the perturbative pion exchanges among valence quarks give the same leading Nc contributions for three wavefunctions, while their mass differences are O(Lamba_qcd). The signs of splittings flip for different orders of the axial charge vertices, so it is hard to conclude which one is the most energetically favored. For non-perturbative estimates involving the modification of quark bases, we use the chiral quark soliton model as an illustration. With the hedgehog quark wavefunctions with gA...

  5. The aeronautics face-gear NC hobbing machining technology

    Science.gov (United States)

    Wu, Canhui; Wang, Yanzhong

    2013-03-01

    Face-gear drives become the main direction of research for aeronautical drives because of their special advantages. Face-gear machining problems have became to baffle the embedded research for face-gear. The basal coordinate systems of face-gear hobbing were setted up according to the face-gear hobbing theory. The hobbing surface equation of facegear was established by using the equation of pinion tooth surface and matrix for coordinate transform based on the gear geometry and applied theory, then the hobbing tooth surface constrain conditions for dedendum undercutting were analyzed, at the same time, the hobbing nodal points were used to construct the three-dimensional basal worm model of face-gear hob by recurring to the three-dimensional software. Furthermore, the special hob for face-gear machining was designed and manufactured. The exact assembly and machining simulation were finished by using the program development software VC++6.0 and the UG customization function in the light of the face-gear hobbing theory. It validates the hob correctness and gets the gear hobbing program. According to the result of machining simulation, facegear numerical control(NC) hob machining was realized in the four-axis NC machine tool. It improves the cutting efficiency and establishs the base for face-gear grinding.

  6. ISO 14649 (STEP-NC: New Standards for CNC Machining

    Directory of Open Access Journals (Sweden)

    Yusri Yusof

    2010-06-01

    Full Text Available The changing economic climate has made global manufacturing a growing reality over the last decade, forcing companies from east and west and all over the world to collaborate beyond geographic boundaries in the design, manufacture and assemble of products. The ISO10303 and ISO14649 Standards (STEP and STEP-NC have been developed to introduce interoperability into manufacturing enterprises so as to meet the challenge of responding to production on demand. The paper focuses on the use of this new standard to address the process planning and machining of turn/mill discrete components. Due to the complexity of programming these machines there is a need to model their process capability to improve the interoperable manufacturing capability in places such as turning centres. Finally a proposed computational environment for a STEP-NC compliant system for turning operations (SCSTO is described. And supported by the specification of information models and constructed using a structured methodology and object-oriented methods. SCSTO was developed to generate a Part 21 file based on machining features to support the interactive generation of process plans utilizing feature extraction. A case study component has been developed to prove the concept for using the milling and turning parts of ISO14649 to provide a turn-mill CAD/CAPP/CAM environment.

  7. Homocoupling of aryl halides in flow: Space integration of lithiation and FeCl3 promoted homocoupling

    OpenAIRE

    Aiichiro Nagaki; Yuki Uesugi; Yutaka Tomida; Jun-ichi Yoshida

    2011-01-01

    The use of FeCl3 resulted in a fast homocoupling of aryllithiums, and this enabled its integration with the halogen–lithium exchange reaction of aryl halides in a flow microreactor. This system allows the homocoupling of two aryl halides bearing electrophilic functional groups, such as CN and NO2, in under a minute.

  8. Homocoupling of aryl halides in flow: Space integration of lithiation and FeCl3 promoted homocoupling

    OpenAIRE

    Nagaki, Aiichiro; Uesugi, Yuki; Tomida, Yutaka; Yoshida, Jun-ichi

    2011-01-01

    The use of FeCl3 resulted in a fast homocoupling of aryllithiums, and this enabled its integration with the halogen–lithium exchange reaction of aryl halides in a flow microreactor. This system allows the homocoupling of two aryl halides bearing electrophilic functional groups, such as CN and NO2, in under a minute.

  9. Specific heat measurements of the antiferroelectric phase transition in the mixed system KCN sub(x)Cl sub(1-x)

    International Nuclear Information System (INIS)

    The specific heat of KCN sub(x)Cl sub(1-x) mixed crystals was measured for four chlorine concentrations between x=0,90 and x=1,00. The entropy change ΔS and critical temperature T sub(c) were obtained and the results are discussed in terms of the orientational motion of the CN- molecular ions. (Author)

  10. Anhydrous ZnCl2: A Highly Efficient Reagent for Facile and Regioselective Conversion of Epoxides to β-Chlorohydrins

    Directory of Open Access Journals (Sweden)

    Ronak Eisavi

    2016-01-01

    Full Text Available Facile conversion of structurally different epoxides to the corresponding β-chlorohydrins was carried out successfully with anhydrous ZnCl2 in CH3CN. The reactions were carried out within 10-50 min to give β-chlorohydrins with perfect regioselectivity and high yields (80-97%.

  11. Homocoupling of aryl halides in flow: Space integration of lithiation and FeCl3 promoted homocoupling

    Directory of Open Access Journals (Sweden)

    Aiichiro Nagaki

    2011-08-01

    Full Text Available The use of FeCl3 resulted in a fast homocoupling of aryllithiums, and this enabled its integration with the halogen–lithium exchange reaction of aryl halides in a flow microreactor. This system allows the homocoupling of two aryl halides bearing electrophilic functional groups, such as CN and NO2, in under a minute.

  12. LiCl(NaCl)-CeCl3-H2O systems at 25 deg C

    International Nuclear Information System (INIS)

    It has been found by the method of isothermal solubility that aqueous ternary systems LiCl(NaCl)-CeCl3-H2O at 25 deg C refer to the eutonic type with crystallization of the initial components LiClxH2O, NaCl, and CeCl3x7H2O

  13. Microarray analysis of ncRNA expression patterns in Caenorhabditis elegans after RNAi against snoRNA associated proteins

    OpenAIRE

    Skogerbø Geir; He Housheng; Aftab Muhammad; Chen Runsheng

    2008-01-01

    Abstract Background Short non-coding RNAs (ncRNAs) perform their cellular functions in ribonucleoprotein (RNP) complexes, which are also essential for maintaining the stability of the ncRNAs. Depletion of individual protein components of non-coding ribonucleoprotein (ncRNP) particles by RNA interference (RNAi) may therefore affect expression levels of the corresponding ncRNA, and depletion of candidate associated proteins may constitute an alternative strategy when investigating ncRNA-protein...

  14. Construction of the Active Site of Metalloenzyme on Au NC Micelles

    Institute of Scientific and Technical Information of China (English)

    ZHANG, Zhiming; FU, Qiuan; HUANG, Xin; XU, Jiayun; LIU, Junqiu; SHEN, Jiacong

    2009-01-01

    For developing an efficient nanoenzyme system with self-assembly strategy, gold nanocrystal micelles (Au NC micelles) with inserted catalytic Zn(Ⅱ) centers were constructed by self-assembly of a catalytic ligand [N,N-bis(2-aminoethyl)-N'dodecylethylenediamine] Zn(Ⅱ) complexes (Zn(Ⅱ)L) on the surface of Au NC via hy- drophobic interaction. The functionalized Au NC micelles acted as an excellent nanoenzyme model for imitating ribonuclease. The catalytic capability of the Au NC micelles was evaluated by accelerating the cleavage of 2-hydroxypropyl p-nitrophenyl phosphate (HPNP). These functionalized Au NC micelles exhibited considerable ri- bonuclease-like activities by a factor of 4.9×104 (kcat/kuncat) for the cleavage of HPNP in comparison to the sponta- neous cleavage of HPNP at 37℃. The catalytic capability of the functionalized Au NC micelles can be considera- bly compared to other models reported previously as nanoenzymes under the comparable conditions.

  15. The Nc dependencies of baryon masses: Analysis with Lattice QCD and Effective Theory

    Energy Technology Data Exchange (ETDEWEB)

    Calle Cordon, Alvaro C. [JLAB; DeGrand, Thomas A. [University of Colorado; Goity, Jose L. [JLAB

    2014-07-01

    Baryon masses at varying values of Nc and light quark masses are studied with Lattice QCD and the results are analyzed in a low energy effective theory based on a combined framework of the 1/Nc and Heavy Baryon Chiral Perturbation Theory expansions. Lattice QCD results for Nc=3, 5 and 7 obtained in quenched calculations, as well as results for unquenched calculations for Nc=3, are used for the analysis. The results are consistent with a previous analysis of Nc=3 LQCD results, and in addition permit the determination of sub-leading in 1/Nc effects in the spin-flavor singlet component of the baryon masses as well as in the hyperfine splittings.

  16. Flexible charge balanced stimulator with 5.6 fC accuracy for 140 nC injections.

    Science.gov (United States)

    Nag, Sudip; Jia, Xiaofeng; Thakor, Nitish V; Sharma, Dinesh

    2013-06-01

    Electrical stimulations of neuronal structures must ensure net injected charges to be zero for biological safety and voltage compliance reasons. We present a novel architecture of general purpose biphasic constant current stimulator that exhibits less than 5.6 fC error while injecting 140 nC charges using 1.4 mA currents. The floating current sources and conveyor switch based system can operate in monopolar or bipolar modes. Anodic-first or cathodic-first pulses with optional inter-phase delays have been demonstrated with zero quiescent current requirements at the analog front-end. The architecture eliminates blocking capacitors, electrode shorting and complex feedbacks. Bench-top and in-vivo measurement results have been presented with emulated electrode impedances (resistor-capacitor network), Ag-AgCl electrodes in saline and in-vivo (acute) peripheral nerve stimulations in anesthetized rats. PMID:23853326

  17. EST Table: CN373995 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available x mori] dbj|BAE53372.1| antibacterial peptide [Bombyx mori] dbj|BAF51564.1| gloverin2 [Bombyx mori] 10/09/01 n.h 10/08/28 n.h 10/09/10 n.h 10/09/10 n.h 10/09/10 n.h FS917189 L12 ... ...CN373995 rzhswba0_009205 10/09/28 95 %/144 aa ref|NP_001037683.1| gloverin 2 [Bomby

  18. Fission decay of $^{282}$Cn studied using cranking inertia

    CERN Document Server

    Poenaru, D N

    2014-01-01

    Superheavy nuclei produced until now are decaying mainly by $\\alpha$~emission and spontaneous fission. Calculated $\\alpha$~decay half-lives are in agreement with experimental data within one order of magnitude. The discrepancy between theory and experiment can be as high as ten orders of magnitude for spontaneous fission. We analyze a way to improve the accuracy by using the action integral based on cranking inertia and a potential barrier computed by the macroscopic-microscopic method with a two-center shell model. Illustrations are given for $^{282}$Cn which has a measured fission half-life.

  19. Fission decay of 282Cn studied using cranking inertia

    International Nuclear Information System (INIS)

    Superheavy nuclei produced until now are decaying mainly by α emission and spontaneous fission. Calculated α decay half-lives are in agreement with experimental data to within one order of magnitude. The discrepancy between theory and experiment can be as high as ten orders of magnitude for spontaneous fission. We analyze a way to improve the accuracy by using the action integral based on cranking inertia and a potential barrier computed by the macroscopic-microscopic method with a two-center shell model. Illustrations are given for 282Cn which has a measured fission half-life. (paper)

  20. EST Table: CN373799 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available ] gb|ABF51339.1| ferritin isoform 1 [Bombyx mori] gb|ABG76018.1| iron storage protein [Bombyx mori] gb|ABG76019.1| iron stor...CN373799 rzhswba0_000912 10/09/28 100 %/109 aa ref|NP_001037584.1| ferritin [Bombyx mori...66312.1| PREDICTED: similar to putative ferritin 2 isoform 1 [Tribolium castaneum] FS916237 L12 ... ...age protein [Bombyx mandarina] 10/09/01 40 %/104 aa FBpp0225182|DvirGJ10765-PA 10/08/28

  1. CIM Diffusion: The Case of NC-Machines in the U.S. Metalworking Industry

    OpenAIRE

    Tchijov, I.

    1987-01-01

    Analysis and forecasting of NC-machine diffusion constitute one of the main activities of the IIASA Project "Computer Integrated Manufacturing" (CIM). Numerically controlled (NC) machines represent the first stage of flexible automation in the metalworking industry. NC-machines were developed in the early 1950s and became available commercially in 1955. Currently, they account for 5% of the total number of machine tools installed. Their share of production output is mare than 50% by value. ...

  2. Bioinformatics of Cancer ncRNA in High Throughput Sequencing: Present State and Challenges

    OpenAIRE

    Jorge, Natasha Andressa Nogueira; Ferreira, Carlos Gil; Passetti, Fabio

    2012-01-01

    The numerous genome sequencing projects produced unprecedented amount of data providing significant information to the discovery of novel non-coding RNA (ncRNA). Several ncRNAs have been described to control gene expression and display important role during cell differentiation and homeostasis. In the last decade, high throughput methods in conjunction with approaches in bioinformatics have been used to identify, classify, and evaluate the expression of hundreds of ncRNA in normal and patholo...

  3. De Novo Discovery of Structured ncRNA Motifs in Genomic Sequences

    OpenAIRE

    RUZZO, WALTER L.; Gorodkin, Jan

    2014-01-01

    De novo discovery of "motifs" capturing the commonalities among related noncoding ncRNA structured RNAs is among the most difficult problems in computational biology. This chapter outlines the challenges presented by this problem, together with some approaches towards solving them, with an emphasis on an approach based on the CMfinder CMfinder program as a case study. Applications to genomic screens for novel de novo structured ncRNA ncRNA s, including structured RNA elements in untranslated ...

  4. Role of the NC-Loop in Catalytic Activity and Stability in Lipase from Fervidobacterium changbaicum

    OpenAIRE

    Li, Binchun; Yang, Guangyu; Wu, Lie; Feng, Yan

    2012-01-01

    Flexible NC-loops between the catalytic domain and the cap domain of the α/β hydrolase fold enzymes show remarkable diversity in length, sequence, and configuration. Recent investigations have suggested that the NC-loop might be involved in catalysis and substrate recognition in many enzymes from the α/β hydrolase fold superfamily. To foster a deep understanding of its role in catalysis, stability, and divergent evolution, we here systemically investigated the function of the NC-loop (residue...

  5. Multi-agent System for Process Planning in Step-nc Based Manufacturing

    OpenAIRE

    Juan Du; Xianguo Yan

    2012-01-01

    In order to realize STEP-NC-oriented computer numerical control machining and achieve optimal performance in manufacturing, a multi-agent system for process planning in STEP-NC based manufacturing was designed. By analyzing the characteristic of STEP-NC data model, a manufacturing feature-oriented process planning method was proposed in this study and the distributed artificial intelligence methods, namely collaborative multi-agent was employed to accomplish process planning of part. The prop...

  6. Quaternary hard nanocomposite TiCxNy/SiCN coatings prepared by plasma enhanced chemical vapor deposition

    International Nuclear Information System (INIS)

    Individual hard thin film materials such as TiN, SiN1.3, SiC and CNx exhibit attractive mechanical, tribological, optical and electronic properties related to their microstructure and chemical bonding. In the present work, we combine the characteristics of such materials, while systematically studying quaternary thin films prepared by plasma enhanced chemical vapor deposition (PECVD) from TiCl4/SiH4/N2/CH4 mixtures with different concentrations of CH4. Detailed structural and chemical characterizations using transmission electron microscopy, X-ray diffraction (XRD), X-ray photoelectron spectroscopy (XPS) and elastic recoil detection suggest formation of a TiCxNy/SiCN nanocomposite structure. Depth-sensing indentation, static indentation and curvature measurements, on samples prepared under optimal conditions, reveal a hardness of 55 GPa, reduced Young's modulus of 302 GPa, a compressive stress of 2.0 GPa, an elastic rebound of more than 80 %, H3/Er2 coefficient of 1.8 GPa and a high toughness. The friction coefficient and the wear rate, measured against diamond, are 0.13*10-6 and 12*10-6 mm3/Nm, respectively. We compare the properties of the present nanocomposite TiCxNy/SiCN coatings with the performance of PECVD films from our earlier studies: these include TiN/SiN1.3 nanocomposites and SiCN, for which we obtained a hardness of 45 and 33 GPa, and a reduced Young's modulus of 350 and 200 GPa, respectively

  7. Characterizing ncRNAs in human pathogenic protists using high-throughput sequencing technology

    Directory of Open Access Journals (Sweden)

    Lesley Joan Collins

    2011-12-01

    Full Text Available ncRNAs are key genes in many human diseases including cancer and viral infection, as well as providing critical functions in pathogenic organisms such as fungi, bacteria, viruses and protists. Until now the identification and characterization of ncRNAs associated with disease has been slow or inaccurate requiring many years of testing to understand complicated RNA and protein gene relationships. High-throughput sequencing now offers the opportunity to characterize miRNAs, siRNAs, snoRNAs and long ncRNAs on a genomic scale making it faster and easier to clarify how these ncRNAs contribute to the disease state. However, this technology is still relatively new, and ncRNA discovery is not an application of high priority for streamlined bioinformatics. Here we summarize background concepts and practical approaches for ncRNA analysis using high-throughput sequencing, and how it relates to understanding human disease. As a case study, we focus on the parasitic protists Giardia lamblia and Trichomonas vaginalis, where large evolutionary distance has meant difficulties in comparing ncRNAs with those from model eukaryotes. A combination of biological, computational and sequencing approaches has enabled easier classification of ncRNA classes such as snoRNAs, but has also aided the identification of novel classes. It is hoped that a higher level of understanding of ncRNA expression and interaction may aid in the development of less harsh treatment for protist-based diseases.

  8. Classification of ncRNAs using position and size information in deep sequencing data

    OpenAIRE

    Erhard, Florian; Zimmer, Ralf

    2010-01-01

    Motivation: Small non-coding RNAs (ncRNAs) play important roles in various cellular functions in all clades of life. With next-generation sequencing techniques, it has become possible to study ncRNAs in a high-throughput manner and by using specialized algorithms ncRNA classes such as miRNAs can be detected in deep sequencing data. Typically, such methods are targeted to a certain class of ncRNA. Many methods rely on RNA secondary structure prediction, which is not always accurate and not all...

  9. NC flame pipe cutting machine tool based on open architecture CNC system

    Institute of Scientific and Technical Information of China (English)

    Xiaogen NIE; Yanbing LIU

    2009-01-01

    Based on the analysis of the principle and flame movement of a pipe cutting machine tool, a retrofit NC flame pipe cutting machine tool (NFPCM) that can meet the demands of cutting various pipes is proposed. The paper deals with the design and implementation of an open architecture CNC system for the NFPCM, many of whose aspects are similar to milling machines; however, different from their machining processes and control strategies. The paper emphasizes on the NC system structure and the method for directly creating the NC file according to the cutting type and parameters. Further, the paper develops the program and sets up the open and module NC system.

  10. Study on tetraethylammonium group dynamics in [N(C2H5)4]SbCl4 and [N(C2H5)4]3Sb2Cl9 polycrystals

    International Nuclear Information System (INIS)

    Dynamics of quaternary ammonium groups in antimonychlorides polycrystalline samples have been investigated by means of NMR method. Relaxation time T1 has been measured in pulsed NMR Brucker spectrometer for frequency of 55.2 MHz in temperature range 73-303 K

  11. CN Morphology Studies of Comet 103P/Hartley 2

    CERN Document Server

    Knight, Matthew M

    2011-01-01

    We report on narrowband CN imaging of Comet 103P/Hartley 2 obtained at Lowell Observatory on 39 nights from 2010 July until 2011 January. We observed two features, one generally to the north and the other generally to the south. The CN morphology varied during the apparition: no morphology was seen in July; in August and September the northern feature dominated and appeared as a mostly face-on spiral; in October, November, and December the northern and southern features were roughly equal in brightness and looked like more side-on corkscrews; in January the southern feature was dominant but the morphology was indistinct due to very low signal. The morphology changed smoothly during each night and similar morphology was seen from night to night. However, the morphology did not exactly repeat each rotation cycle, suggesting that there is a small non-principal axis rotation. Based on the repetition of the morphology, we find evidence that the fundamental rotation period was increasing: 16.7 hr from August 13-17,...

  12. A new technique of integral representations in Cn

    Institute of Scientific and Technical Information of China (English)

    YAO; Zongyuan

    2001-01-01

    [1]Bochner, S., Analytic and meromorphic continuation by means of Green's formula, Ann. of Math., 1943, 44: 652—671.[2]Yao Zongyuan, An integral formula on bounded domains in Cn, Science in China, Ser. A (in Chinese), 1992, 22(1): 1—10.[3]Zhong Tongde, Huang Sha, Complex Analysis in Several Variables (in Chinese), Shijiazhuang: Hebei Educational Press, 1990.[4]Henkin, G. M., Leiterer, J., Theory of Functions on Complex Manifolds, Berlin: Academie-Verlag Berlin and Birkh user-Verlag Boston, 1984.[5]Yao Zongyuan, Bochner-Ono formula for the local solution of the -equation on bounded domains in Cn, Advances in Mathematics (in Chinese), 1993, 22(6): 550—560.[6]Henkin, G. M., Integral representations of holomorphic functions in strictly pseudoconvex domains and some applications, Mat. Sb. (in Russian), 1969, 78(120): 611—632.[7]Henkin, G. M., Integral representations of holomorphic functions in strictly pseudoconvex domains and applications to the  problem, Mat. Sb. (in Russian), 1970, 82(124): 300—308.[8]Grauert, H., Lieb, I., Das Ramirezsche integral und diellisung der Gleichung f=α im bereich der beschr nkten fornen, Proc. Conf. Complex Analysis, Rice Univ. Studies, 1970, 56: 29—50.

  13. Low energy electron attachment to cyanamide (NH2CN)

    International Nuclear Information System (INIS)

    Cyanamide (NH2CN) is a molecule relevant for interstellar chemistry and the chemical evolution of life. In the present investigation, dissociative electron attachment to NH2CN has been studied in a crossed electron–molecular beams experiment in the electron energy range from about 0 eV to 14 eV. The following anionic species were detected: NHCN−, NCN−, CN−, NH2−, NH−, and CH2−. The anion formation proceeds within two broad electron energy regions, one between about 0.5 and 4.5 eV and a second between 4.5 and 12 eV. A discussion of possible reaction channels for all measured negative ions is provided. The experimental results are compared with calculations of the thermochemical thresholds of the anions observed. For the dehydrogenated parent anion, we explain the deviation between the experimental appearance energy of the anion with the calculated corresponding reaction threshold by electron attachment to the isomeric form of NH2CN—carbodiimide

  14. Dynamical Effects and Product Distributions in Simulated CN + Methane Reactions.

    Science.gov (United States)

    Preston, Thomas J; Hornung, Balázs; Pandit, Shubhrangshu; Harvey, Jeremy N; Orr-Ewing, Andrew J

    2016-07-14

    Dynamics of collisions between structured molecular species quickly become complex as molecules become large. Reactions of methane with halogen and oxygen atoms serve as model systems for polyatomic molecule chemical dynamics, and replacing the atomic reagent with a diatomic radical affords further insights. A new, full-dimensional potential energy surface for collisions between CN + CH4 to form HCN + CH3 is developed and then used to perform quasi-classical simulations of the reaction. Coupled-cluster energies serve as input to an empirical valence bonding (EVB) model, which provides an analytical function for the surface. Efficient sampling permits simulation of velocity-map ion images and exploration of dynamics over a range of collision energies. Reaction populates HCN vibration, and energy partitioning changes with collision energy. The reaction cross-section depends on the orientation of the diatomic CN radical. A two-dimensional extension of the cone of acceptance for an atom in the line-of-centers model appropriately describes its reactivity. The simulation results foster future experiments and diatomic extensions to existing atomic models of chemical collisions and reaction dynamics. PMID:26812395

  15. OPTIMIZATION AND APPROXIMATION OF NC POLYNOMIALS WITH SUMS OF SQUARES

    Directory of Open Access Journals (Sweden)

    Kristijan Cafuta

    2010-12-01

    Full Text Available In this paper we study eigenvalue optimization of non-commutative polynomials. That is, we compute the smallest or biggest eigenvalue a non-commutative polynomial can attain. Our algorithm is based on sums of hermittian squares. To test for exactness, the solutions of the dual SDP are investigated. When we consider the eigenvalue lower bounds we can show that attainability of the optimal value on the dual side implies that the eigenvalue bound is attained. We also show how to extract global eigenvalue optimizers with a procedure based on two ingredients: - the first is the solution to the truncated (tracial moment problem; - the second is the Gelfand-Naimark-Segal (GNS construction. The implementation of these procedures in our computer algebra system NC-SOStools is presented and several examples pertaining to matrix inequalities are given to illustrate the results.

  16. METHODS OF OBTAINING HIGH QUALITY OF METALWORKING NC MACHINES

    OpenAIRE

    Ota, Yoshimi

    2009-01-01

    Приведены сведения об опыте работы японской компании Mori Seiki в области создания перспективного металлообрабатывающего оборудования с ЧПУInformation about operational experience of Japanese company Mori Seiki in the field of making perspective metal-working NC machines is presented

  17. A study of Internet-based virtual NC turning system

    Science.gov (United States)

    Li, Yue; Li, Shujuan

    2004-03-01

    The virtual machining technique is a key issue of Virtual Manufacturing (VM) system, and the simulation of virtual machining process is a focus research field at the present time. This paper addresses the importance of integrating a virtual manufacturing system with the Internet and proposes a web-based, scalable and distributed architecture for developing a platform-independent virtual NC turning system. A Web-based virtual turning system has been developed using Virtual Reality Modeling Language and Java, and describes the structure of the system and the realization of its main functions. The user can easily setups machining conditions, operates the virtual turning machine in a web browser, and evaluates and optimizes the machining process on the Internet.

  18. Study of Machining Error Forecast in NC Lathe

    Institute of Scientific and Technical Information of China (English)

    LIU Jiwei; ZHANG Ying; YANG Zheqing

    2006-01-01

    This paper brings forward a kind of machining error forecast principle in NC lathe simulation system. It combines the method of math, dynamic, material and mechanism, etc, sums up the factors which can affect the machining error, coalescent knowledge of mechanism manufacture technique and interconvert characteristic, mapped the change of physics factor in cutting process into virtual manufacture system by mathematical model. On the platform of Windows 2000 and Visual C++, applying program is developed by use of C++. The lean warehouse of MATLAB is transferred in order to command MATLAB on the language platform of MATLAB, and then the curve of the results is drawn by the outcome of calculation, which is based on the mathematical model in order to manifest the simulation results in the pattern of data and curve.

  19. Thermal expansion and negative linear compressibility in ZnAu2(CN)4: An inelastic neutron scattering measurements and lattice dynamical studies

    International Nuclear Information System (INIS)

    ZnAu2(CN)4 shows negative thermal expansion behavior as well as negative linear compressibility. The linear thermal expansion behavior is highly anisotropic (αa~ 36.9×10-6 K-1, αc~ -57.6×10-6 K-1). On application of hydrostatic pressure the c-axis expands along which the NTE behavior has also been reported. We have performed the inelastic neutron scattering measurment using IN4C spectrometer at ILL, Grenoble France. The measurments are performed at various temperatures ranging from 150 K to 400 K as shown in Fig 1(a). From the temperature dependence measurements we observed that modes below 20 meV show significant change in energy with temperature indicating the anharmonic nature of these modes. To understand the anamolus properties from microscpic view we have been calculated in the phonon in entire Brillouin zone using DFT. Our calculation suggest that these modes mostly involve motion of Zn(CN)4 tetrahedral units connected via Au atoms. The calculated pressure dependence of the phonon energies have been used for thermal expansion calculation (Fig. 1(b)) of the compound. We observe that low energy modes below 5 meV contribute negative to the total thermal expansion (αV) behavior. However modes around 10 meV have large positive contribution to αV and results in positive volume thermal expansion behavior. The eigen vector of a zone centre phonon mode of energy around 4 meV energy with largest negative Grüneisen parameter of -9.2 suggest the twisting motion of the -Zn-NC-Au-CN-Zn- chain along with rotational motion of ZnN4 tetrahedra. Such motion would lead to contraction along c direction.

  20. ncDNA and drift drive binding site accumulation

    Directory of Open Access Journals (Sweden)

    Ruths Troy

    2012-08-01

    Full Text Available Abstract Background The amount of transcription factor binding sites (TFBS in an organism’s genome positively correlates with the complexity of the regulatory network of the organism. However, the manner by which TFBS arise and accumulate in genomes and the effects of regulatory network complexity on the organism’s fitness are far from being known. The availability of TFBS data from many organisms provides an opportunity to explore these issues, particularly from an evolutionary perspective. Results We analyzed TFBS data from five model organisms – E. coli K12, S. cerevisiae, C. elegans, D. melanogaster, A. thaliana – and found a positive correlation between the amount of non-coding DNA (ncDNA in the organism’s genome and regulatory complexity. Based on this finding, we hypothesize that the amount of ncDNA, combined with the population size, can explain the patterns of regulatory complexity across organisms. To test this hypothesis, we devised a genome-based regulatory pathway model and subjected it to the forces of evolution through population genetic simulations. The results support our hypothesis, showing neutral evolutionary forces alone can explain TFBS patterns, and that selection on the regulatory network function does not alter this finding. Conclusions The cis-regulome is not a clean functional network crafted by adaptive forces alone, but instead a data source filled with the noise of non-adaptive forces. From a regulatory perspective, this evolutionary noise manifests as complexity on both the binding site and pathway level, which has significant implications on many directions in microbiology, genetics, and synthetic biology.

  1. Study on Interaction of ADN and (NC+NG) by Gasometric Method%量气法研究ADN与(NC+NG)的相互作用

    Institute of Scientific and Technical Information of China (English)

    何少蓉; 张林军; 衡淑云; 刘子如

    2008-01-01

    用 NBK型"拉瓦"量气测试系统研究了较高温度下二硝酰胺铵(ADN)与双基吸收药(NC+NG)体系的相互作用,从动力学角度阐述了二者的相互作用.结果表明: ADN与(NC+NG)混合物加热分解的最终放气量在标准状态下为626.8 mL·g-1,与ADN和(NC+NG)最大放气量之和相比并没有增加,但分解速度显著提高,活化能显著降低至82.58 kJ·mol-1,ADN与(NC+NG)之间存在强烈的相互作用.

  2. Land Use and Land Cover, NC Ecosystem Enhancement Program Targeted Local Watersheds, Published in 2007, 1:24000 (1in=2000ft) scale, NC DENR / Ecosystem Enhancement Program.

    Data.gov (United States)

    NSGIC GIS Inventory (aka Ramona) — This Land Use and Land Cover dataset, published at 1:24000 (1in=2000ft) scale, was produced all or in part from Other information as of 2007. It is described as 'NC...

  3. Land Use and Land Cover, NC Ecosystem Enhancement Program Local Watershed Plans, Published in 2007, 1:24000 (1in=2000ft) scale, NC DENR / Ecosystem Enhancement Program.

    Data.gov (United States)

    NSGIC GIS Inventory (aka Ramona) — This Land Use and Land Cover dataset, published at 1:24000 (1in=2000ft) scale, was produced all or in part from Other information as of 2007. It is described as 'NC...

  4. Study on Intelligent NC Programming for Complex Components of Marine Diesel Based on KBE and UG NX

    Institute of Scientific and Technical Information of China (English)

    ZHANG Liang; ZHANG Shengwen; FANG Xifeng

    2006-01-01

    The NC programming for complex components has lots drawbacks such as excessive repetitious labors, heavy workload and lack of optimization, which are especially serious in NC programming for complex components of marine diesel. Based on the key technologies of applying KBE(Knowledge Based Engineering)to NC programming--knowledge representation, generalized knowledge base, knowledge acquisition and knowledge reasoning, the system of intelligent NC programming for complex components of marine diesel has been built by means of the knowledge template and the UG/Open. The experiment results indicate that the NC program generated with high efficiency of NC programming by the system is accurate enough to meet the need of NC machining. Consequently, the automatization and intelligentization of NC programming has been presented, and the study is proved to be a successful attempt in the area of applying KBE to NC programming.

  5. potential role of H2CN radicals in pre-biotic synthesis

    International Nuclear Information System (INIS)

    Using ab initio method, the minimum energy conformations and net charge distribution have been studied for H2CN radical isomers formed by addition of a H atom (or an electron) to HCN (or HNC) molecule. Calculations show that there are three possible isomers, namely H2CN(I), H2CN(II) and H2CN(III). The order of relative stability is (I) > (III) > (II). From quantum chemical study and the estimations in thermochemistry for the reactions (1) and (2), the possible role of H2CN radicals in pre-biotic organic synthesis has been discussed and it has been proposed that H2CN(III) radical is an important intermediate to synthesize amino acids. The results, show that HNC is also an important product in the evolution chain of biomolecules under some special conditions, such as the electric discharge for atmosphere

  6. A Survey of CN and CH Variations in Galactic Globular Clusters from SDSS Spectroscopy

    CERN Document Server

    Smolinski, Jason P; Beers, Timothy C; Lee, Young Sun

    2011-01-01

    We present a homogeneous survey of the CN and CH bandstrengths in eight Galactic globular clusters observed during the course of the Sloan Extension for Galactic Understanding and Exploration (SEGUE) sub-survey of the SDSS. We confirm the existence of a bimodal CN distribution among RGB stars in all of the clusters with metallicity greater than [Fe/H] = -1.7; the lowest metallicity cluster with an observed CN bimodality is M53, with [Fe/H] ~ -2.1. There is also some evidence for individual CN groups on the subgiant branches of M92, M2, and M13, and on the red giant branches of M92 and NGC 5053. Finally, we quantify the correlation between overall cluster metallicity and the slope of the CN bandstrength-luminosity plot as a means of further demonstrating the level of CN-enrichment in cluster giants. Our results agree well with previous studies reported in the literature.

  7. Conversion of Cn-Unsaturated into Cn-2-Saturated LCFA Can Occur Uncoupled from Methanogenesis in Anaerobic Bioreactors.

    Science.gov (United States)

    Cavaleiro, Ana J; Pereira, Maria Alcina; Guedes, Ana P; Stams, Alfons J M; Alves, M Madalena; Sousa, Diana Z

    2016-03-15

    Fat, oils, and grease present in complex wastewater can be readily converted to methane, but the energy potential of these compounds is not always recyclable, due to incomplete degradation of long chain fatty acids (LCFA) released during lipids hydrolysis. Oleate (C18:1) is generally the dominant LCFA in lipid-containing wastewater, and its conversion in anaerobic bioreactors results in palmitate (C16:0) accumulation. The reason why oleate is continuously converted to palmitate without further degradation via β-oxidation is still unknown. In this work, the influence of methanogenic activity in the initial conversion steps of unsaturated LCFA was studied in 10 bioreactors continuously operated with saturated or unsaturated C16- and C18-LCFA, in the presence or absence of the methanogenic inhibitor bromoethanesulfonate (BrES). Saturated Cn-2-LCFA accumulated both in the presence and absence of BrES during the degradation of unsaturated Cn-LCFA, and represented more than 50% of total LCFA. In the presence of BrES further conversion of saturated intermediates did not proceed, not even when prolonged batch incubation was applied. As the initial steps of unsaturated LCFA degradation proceed uncoupled from methanogenesis, accumulation of saturated LCFA can be expected. Analysis of the active microbial communities suggests a role for facultative anaerobic bacteria in the initial steps of unsaturated LCFA biodegradation. Understanding this role is now imperative to optimize methane production from LCFA. PMID:26810160

  8. Experiment data report for Semiscale MOD-2A Natural-Circulation Test Series (tests S-NC-8B and S-NC-9)

    International Nuclear Information System (INIS)

    This report presents test data recorded for Tests S-NC-8B and S-NC-9 of the Semiscale Mod-2A Natural Circulation Test Series. These tests are part of a series of Semiscale tests that investigate the thermal-hydraulic phenomena resulting from operational transients involving loss of mechanical primary coolant circulation in a pressurized water reactor. Both tests also simulated a loss-of-coolant accident resulting from a 0.4% communicative cold-leg break. These tests provide experimental data to develop and assess the analytical capability of computer models used to predict the results of small-break loss-of-coolant accidents or operational transients involving the loss of primary pumping ability. The primary objective of Tests S-NC-8B and S-NC-9 was to experimentally characterize the thermal-hydraulic behavior of a system during single-phase, two-phase, and reflux natural circulation conditions experienced in the course of an integral small break with and without the presence of emergency core cooling water. Of special interest were the effects on single-phase natural circulation flow caused by changes in core power, primary pressure, and external heater power. This report presents the uninterpreted data from Tests S-NC-8B and S-NC-9 for future analysis. The data, presented as graphs in engineering units, have been analyzed only to the extent necessary to ensure that they are reasonable and consistent

  9. 7 CFR Appendix C to Part 220 - Child Nutrition (CN) Labeling Program

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 4 2010-01-01 2010-01-01 false Child Nutrition (CN) Labeling Program C Appendix C to... Appendix C to Part 220—Child Nutrition (CN) Labeling Program 1. The Child Nutrition (CN) Labeling Program... 7 CFR 210.10 or 210.10a, whichever is applicable, 225.21, and 226.20 and are served in the main...

  10. Laser annealing of sputter-deposited -SiC and -SiCN films

    Indian Academy of Sciences (India)

    M A Fraga; M Massi; I C Oliveira; F D Origo; W Miyakawa

    2011-12-01

    This work describes the laser annealing of -SiC and -SiCN films deposited on (100) Si and quartz substrates by RF magnetron sputtering. Two samples of -SiCN thin films were produced under different N2/Ar flow ratios. Rutherford backscattering spectroscopy (RBS), Raman analysis and Fourier transform infrared spectrometry (FTIR) techniques were used to investigate the composition and bonding structure of as-deposited and laser annealed SiC and SiCN films.

  11. Pengaruh Penambahan Degradable Symbiosis Bacteria Terhadap Penurunan Kadar Sianida (CN-) Dalam Limbah Cair Pabrik Tapioka

    OpenAIRE

    Silitonga, Noaksen

    2014-01-01

    Research about the effect of adding Degra Simba (Degradable Bacteria Symbiosis) to decreased levels of cyanide (CN-) contained in wastewater of tapioca factory has been done. Determination of cyanide (CN-) concentration performed by spectrophotometric method. The principle of measurement is based on the reaction of cyanide (CN-) with kloramin-T and pyridine-barbituric acid that forms a bluish-red solution was measured at a wavelength (λ) = 576 nm. In this research, Degra Simba were added v...

  12. 33 CFR 165.T05-0091 - Safety Zone; Alligator River, NC.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Safety Zone; Alligator River, NC... Safety Zone; Alligator River, NC. (a) Definitions. For the purposes of this section, Captain of the Port... on the waters of the Alligator River centered at (35°54′3″ N/076°00′25″ W) a position directly...

  13. Anion-Dependent Aggregate Formation and Charge Behavior of Colloidal Fullerenes (n-C60)

    Science.gov (United States)

    The fate and transport of colloidal fullerenes (n-C60) in the environment is likely to be guided by electrokinetic and aggregation behavior. In natural water bodies inorganic ions exert significant effects in determining the size and charge of n-C60 nanoparticles. Although the ef...

  14. Nucleic Acid Chaperone Activity of HIV-1 NC Proteins Investigated by Single Molecule DNA Stretching

    Science.gov (United States)

    Williams, Mark C.; Gorelick, Robert J.; Musier-Forsyth, Karin; Bloomfield, Victor A.

    2002-03-01

    HIV-1 Nucleocapsid Protein (NC) is a nucleic acid chaperone protein that is responsible for facilitating numerous nucleic acid rearrangements throughout the reverse transcription cycle of HIV-1. To understand the mechanism of NC’s chaperone function, we carried out single molecule DNA stretching studies in the presence of NC and mutant forms of NC. Using an optical tweezers instrument, we stretch single DNA molecules from the double-stranded helical state to the single-stranded (coil) state. Based on the observed cooperativity of DNA force-induced melting, we find that the fraction of melted base pairs at room temperature is increased dramatically in the presence of NC. Thus, upon NC binding, increased thermal fluctuations cause continuous melting and reannealing of base pairs so that DNA strands are able to rapidly sample configurations in order to find the lowest energy state. While NC destabilizes the double-stranded form of DNA, a mutant form of NC that lacks the zinc finger structures does not. DNA stretching experiments carried out in the presence of NC variants containing more subtle changes in the zinc finger structures were conducted to elucidate the contribution of each individual finger to NC’s chaperone activity, and these results will be reported.

  15. 46 CFR 7.60 - Cape Fear, NC to Sullivans Island, SC.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 1 2010-10-01 2010-10-01 false Cape Fear, NC to Sullivans Island, SC. 7.60 Section 7.60... Atlantic Coast § 7.60 Cape Fear, NC to Sullivans Island, SC. (a) A line drawn from the southernmost... Buoy “2CF”); thence to Oak Island Light. (b) A line drawn from the southernmost extremity of...

  16. 78 FR 42011 - Drawbridge Operation Regulation; The Straights, Harkers Island, NC

    Science.gov (United States)

    2013-07-15

    ... SECURITY Coast Guard 33 CFR Part 117 Drawbridge Operation Regulation; The Straights, Harkers Island, NC... 70/Harkers Island Bridge, across The Straights, mile 0.6, Harkers Island, NC. This deviation is necessary to facilitate coupling repair on the Route 70/ Harkers Island Bridge. This temporary...

  17. 77 FR 32394 - Drawbridge Operation Regulation; The Straights, Harkers Island, NC

    Science.gov (United States)

    2012-06-01

    ... SECURITY Coast Guard 33 CFR Part 117 Drawbridge Operation Regulation; The Straights, Harkers Island, NC... operation of the Route 70/Harkers Island Bridge across The Straights, at Harkers Island, NC. The deviation...) owns and operates the swing span of the Route 70/Harkers Island Bridge across The Straights, in...

  18. Renormalization of the baryon axial vector current in large-Nc chiral perturbation theory

    International Nuclear Information System (INIS)

    The baryon axial vector current is considered within the combined framework of large-Nc baryon chiral perturbation theory (where Nc is the number of colors) and the baryon axial vector couplings are extracted. Loop graphs with octet and decuplet intermediate states are systematically incorporated into the analysis

  19. Subleading-Nc corrections in non-linear small-x evolution

    International Nuclear Information System (INIS)

    We explore the subleading-Nc corrections to the large-Nc Balitsky-Kovchegov (BK) evolution equation by comparing its solution to that of the all-Nc Jalilian-Marian-Iancu-McLerran-Weigert-Leonidov-Kovner (JIMWLK) equation. In earlier simulations it was observed that the difference between the solutions of JIMWLK and BK is unusually small for a quark dipole scattering amplitude, of the order of 0.1%, which is two orders of magnitude smaller than the naively expected 1/Nc2∼11%. In this paper we argue that this smallness is not accidental. We provide analytical arguments showing that saturation effects and correlator coincidence limits fixed by group theory constraints conspire with the particular structure of the dipole kernel to suppress subleading-Nc corrections reducing the difference between the solutions of JIMWLK and BK to 0.1%. We solve the JIMWLK equation with improved numerical accuracy and verify that the remaining 1/Nc corrections, while small, still manage to slow down the rapidity-dependence of JIMWLK evolution compared to that of BK. We demonstrate that a truncation of JIMWLK evolution in the form of a minimal Gaussian generalization of the BK equation captures some of the remaining 1/Nc contributions leading to an even better agreement with JIMWLK evolution. As the 1/Nc corrections to BK include multi-reggeon exchanges one may conclude that the net effect of multi-reggeon exchanges on the dipole amplitude is rather small.

  20. NP is not AL and P is not NC is not NL is not L

    CERN Document Server

    Kobayashi, Koji

    2011-01-01

    This paper talk about that NP is not AL = P, P is not NC, NC is not NL, and NL is not L. The point about this paper is the dependent relation of the problem that need other problem's result to compute it. I show the structure of depend relation that could divide each coputation classes.

  1. Concept of automatic programming of NC machine for metal plate cutting by genetic algorithm method

    Directory of Open Access Journals (Sweden)

    B. Vaupotic

    2005-12-01

    Full Text Available Purpose: In this paper the concept of automatic programs of the NC machine for metal plate cutting by genetic algorithm method has been presented.Design/methodology/approach: The paper was limited to automatic creation of NC programs for two-dimensional cutting of material by means of adaptive heuristic search algorithms.Findings: Automatic creation of NC programs in laser cutting of materials combines the CAD concepts, the recognition of features and creation and optimization of NC programs. The proposed intelligent system is capable to recognize automatically the nesting of products in the layout, to determine the incisions and sequences of cuts forming the laid out products. Position of incisions is determined at the relevant places on the cut. The system is capable to find the shortest path between individual cuts and to record the NC program.Research limitations/implications: It would be appropriate to orient future researches towards conceiving an improved system for three-dimensional cutting with optional determination of positions of incisions, with the capability to sense collisions and with optimization of the speed and acceleration during cutting.Practical implications: The proposed system assures automatic preparation of NC program without NC programer.Originality/value: The proposed concept shows a high degree of universality, efficiency and reliability and it can be simply adapted to other NC-machines.

  2. Estimation of CN Parameter for Small Agricultural Watersheds Using Asymptotic Functions

    Directory of Open Access Journals (Sweden)

    Tomasz Kowalik

    2015-03-01

    Full Text Available This paper investigates a possibility of using asymptotic functions to determine the value of curve number (CN parameter as a function of rainfall in small agricultural watersheds. It also compares the actually calculated CN with its values provided in the Soil Conservation Service (SCS National Engineering Handbook Section 4: Hydrology (NEH-4 and Technical Release 20 (TR-20. The analysis showed that empirical CN values presented in the National Engineering Handbook tables differed from the actually observed values. Calculations revealed a strong correlation between the observed CN and precipitation (P. In three of the analyzed watersheds, a typical pattern of the observed CN stabilization during abundant precipitation was perceived. It was found that Model 2, based on a kinetics equation, most effectively described the P-CN relationship. In most cases, the observed CN in the investigated watersheds was similar to the empirical CN, corresponding to average moisture conditions set out by NEH-4. Model 2 also provided the greatest stability of CN at 90% sampled event rainfall.

  3. THE SPATIAL DISTRIBUTION OF OH AND CN RADICALS IN THE COMA OF COMET ENCKE

    International Nuclear Information System (INIS)

    Multiple potential parent species have been proposed to explain CN abundances in comet comae, but the parent has not been definitively identified for all comets. This study examines the spatial distribution of CN radicals in the coma of comet Encke and determines the likelihood that CN is a photodissociative daughter of HCN in the coma. Comet Encke is the shortest orbital period (3.3 years) comet known and also has a low dust-to-gas ratio based on optical observations. Observations of CN were obtained from 2003 October 22 to 24, using the 2.7 m telescope at McDonald Observatory. To determine the parent of CN, the classical vectorial model was modified by using a cone shape in order to reproduce Encke's highly aspherical and asymmetric coma. To test the robustness of the modified model, the spatial distribution of OH was also modeled. This also allowed us to obtain CN/OH ratios in the coma. Overall, we find the CN/OH ratio to be 0.009 ± 0.004. The results are consistent with HCN being the photodissociative parent of CN, but we cannot completely rule out other possible parents such as CH3CN and HC3N. We also found that the fan-like feature spans ∼90°, consistent with the results of Woodney et al..

  4. A Survey of CN and CH Variations in Galactic Globular Clusters from SDSS Spectroscopy

    OpenAIRE

    Smolinski, Jason P.; Martell, Sarah L.; Beers, Timothy C.; Lee, Young Sun

    2011-01-01

    We present a homogeneous survey of the CN and CH bandstrengths in eight Galactic globular clusters observed during the course of the Sloan Extension for Galactic Understanding and Exploration (SEGUE) sub-survey of the SDSS. We confirm the existence of a bimodal CN distribution among RGB stars in all of the clusters with metallicity greater than [Fe/H] = -1.7; the lowest metallicity cluster with an observed CN bimodality is M53, with [Fe/H] ~ -2.1. There is also some evidence for individual CN...

  5. Baryon wave function in large-Nc QCD: universality, nonlinear evolution equation and asymptotic limit

    CERN Document Server

    Pobylitsa, P V

    2004-01-01

    The 1/Nc expansion is formulated for the baryon wave function in terms of a specially constructed generating functional. The leading order of this 1/Nc expansion is universal for all low lying baryons [including the O(1/Nc)and O(1)excited resonances] and for baryon-meson scattering states. A nonlinear evolution equation of Hamilton-Jacobi type is derived for the generating functional describing the baryon distribution amplitude in the large-Nc limit. In the asymptotic regime this nonlinear equation is solved analytically. The anomalous dimensions of the leading twist baryon operators diagonalizing the evolution are computed analytically up to the next-to-leading order of the 1/Nc expansion.

  6. On the Attosecond charge migration in Cl.....N, Cl.....O, Br.....N and Br.....O Halogen-bonded clusters: Effect of donor, acceptor, vibration, rotation, and electron correlation

    Indian Academy of Sciences (India)

    SANKHABRATA CHANDRA; MOHAMMED MUSTHAFA IQBAL; ATANU BHATTACHARYA

    2016-08-01

    The electron-electron relaxation and correlation-driven charge migration process, which features pure electronic aspect of ultrafast charge migration phenomenon, occurs on a very short timescale in ionized molecules and molecular clusters, prior to the onset of nuclear motion. In this article, we have presented natureof ultrafast pure electronic charge migration dynamics through Cl.....N, Cl.....O, Br.....N, and Br.....O halogen bonds, explored using density functional theory. We have explored the role of donor, acceptor, electron correlation, vibration and rotation in charge migration dynamics through these halogen bonds. For this work, we have selected ClF, Cl₂, ClOH, ClCN, BrF, BrCl, BrOH, and BrCN molecules paired with either NH₃ or H₂O. We have found that the timescale for pure electron-electron relaxation and correlation-driven charge migration through the Cl.....N, Br.....N, Cl.....O, and Br.....O halogen bonds falls in the range of 300–600 attosecond. The primary driving force behind the attosecond charge migration through the Cl.....N, Br.....N, Cl.....O, and Br.....O halogen bonds is the energy difference (∆E) between two stationary cationic orbitals (LUMO-β and HOMO-β), which together represents the initial hole density immediately following vertical ionization. We have also predicted that the strength of electron correlation has significant effect on the charge migration timescale in Cl.....N, Br.....N, Cl.....O, and Br.....O halogen bonded clusters. Vibration and rotation are also found to exhibit profound effect on attosecond charge migration dynamics through halogen bonds.

  7. Neutronic Calculation Analysis for CN HCCB TBM-Set

    Science.gov (United States)

    Cao, Qixiang; Zhao, Fengchao; Zhao, Zhou; Wu, Xinghua; Li, Zaixin; Wang, Xiaoyu; Feng, Kaiming

    2015-07-01

    Using the Monte Carlo transport code MCNP, neutronic calculation analysis for China helium cooled ceramic breeder test blanket module (CN HCCB TBM) and the associated shield block (together called TBM-set) has been carried out based on the latest design of HCCB TBM-set and C-lite model. Key nuclear responses of HCCB TBM-set, such as the neutron flux, tritium production rate, nuclear heating and radiation damage, have been obtained and discussed. These nuclear performance data can be used as the basic input data for other analyses of HCCB TBM-set, such as thermal-hydraulics, thermal-mechanics and safety analysis. supported by the Major State Basic Research Development Program of China (973 Program) (No. 2013GB108000)

  8. Solution of the CN equations using singular eigenfunctions and applications

    International Nuclear Information System (INIS)

    The third form of Boltzmann equation involves only the angular flux at the boundary while the usual transport equation deals with the angular flux at any point. The kernel of this equation is the infinite medium Green's function and satisfies the linear transport equation. The method of solution of this equation is known as the CN method and is based on the Placzek lemma and depends on the calculation of the infinite medium Green's function. Here, the well-known form of the Green's function in terms of elementary solutions is used to solve the third form of the transport equation and applications for the half-space albedo problems for both isotropic and extremely anisotropic scatterings are given. Uncollided neutrons are also taken into account. (Author)

  9. CN MORPHOLOGY STUDIES OF COMET 103P/HARTLEY 2

    International Nuclear Information System (INIS)

    We report on narrowband CN imaging of Comet 103P/Hartley 2 obtained at Lowell Observatory on 39 nights from 2010 July until 2011 January. We observed two features, one generally to the north and the other generally to the south. The CN morphology varied during the apparition: no morphology was seen in July; in August and September, the northern feature dominated and appeared as a mostly face-on spiral; in October, November, and December, the northern and southern features were roughly equal in brightness and looked like more side-on corkscrews; in January, the southern feature was dominant but the morphology was indistinct due to very low signal. The morphology changed smoothly during each night and similar morphology was seen from night to night. However, the morphology did not exactly repeat each rotation cycle, suggesting that there is a small non-principal axis rotation. Based on the repetition of the morphology, we find evidence that the fundamental rotation period was increasing: 16.7 hr from August 13 to 17, 17.2 hr from September 10 to 13, 18.2 hr from October 12 to 19, and 18.7 hr from October 31 to November 7. We conducted Monte Carlo jet modeling to constrain the pole orientation and locations of the active regions based on the observed morphology. Our preliminary, self-consistent pole solution has an obliquity of 100 relative to the comet's orbital plane (i.e., it is centered near R.A. = 2570 and decl. = +670 with an uncertainty around this position of about 150) and has two mid-latitude sources, one in each hemisphere.

  10. Evolution of e-Business Standards and Research on cnXML%电子商务标准的演进与cnXML的研究

    Institute of Scientific and Technical Information of China (English)

    徐博艺; 杨冬梅; 姜丽红; 马范援

    2004-01-01

    综述了电子商务标准的发展状况,对传统EDI与当前几种新型电子商务标准进行了比较,研究了中国电子商务规范cnXML的架构,剖析了利用cnXML进行电子商务交易的过程.

  11. Optimalizace NC programu pomocí CAD/CAM software

    OpenAIRE

    Paseka, Jan

    2014-01-01

    Cílem této diplomové práce je návrh úsporných opatření v procesu technologické přípravy výroby průmyslového podniku. V první části je zpracován obecný teoretický rozbor součástkové základny a stávajících NC programů. Na základě těchto poznatků a provedené analýzy byly stanoveny návrhy optimalizace popsané ve druhé části. Díky těmto návrhům dochází při jejich plné implementaci k úspoře časových nároků a finančních prostředků potřebných pro zavedení prototypového výrobku do sériové produkce....

  12. A hybrid approach to automatic generation of NC programs

    Directory of Open Access Journals (Sweden)

    G. Payeganeh

    2005-12-01

    Full Text Available Purpose: This paper describes AGNCP, an intelligent system for integrating commercial CAD and CAM systems for 2.5D milling operations at a low cost.Design/methodology/approach: It deals with different machining problems with the aid of two expert systems. It recognizes machining features, determines required machining process plans, cutting tools and parameters necessary for generation of NC programs.Findings: The system deals with different machining problems with the aid of two expert systems. The first communicates with CAD system for recognizing machining features. It is developed in LISP as machining features can be properly represented by LISP codes is ideal for manipulating lists and input data. The second expert system requires extensive communications with several databases for retrieving tooling and machining information and VP-Expert shell was found to be the most suitable package to perform this task.Research limitations/implications: 2.5D milling covers a wide range of operations. However, work is in progress cover 3D milling operations. The system can also be modified to be used for other activities such as turning, flame cutting, electro discharge machining (EDM, punching, etc.Practical implications: Use of AGNCP resulted in improved efficiency, noticeable time savings, and elimination of the need for expert process planners.Originality/value: The paper describes a method for eliminating the need for extensive user intervention for CAD/CAM integration.

  13. 76 FR 46597 - Airworthiness Directives; Bombardier, Inc. Model CL-600-2A12 (CL-601) and CL-600-2B16 (CL-601-3A...

    Science.gov (United States)

    2011-08-03

    .... Model CL-600-2A12 (CL- 601) and CL-600-2B16 (CL-601-3A, CL-601-3R, and CL-604 Variants) Airplanes... Bombardier, Inc. model-- Task(s)-- Initial compliance time (whichever occurs later)-- CL-600-2A12 (CL-601... icing. accumulation of 4,800 after the effective inclusive; and CL-600-2B16 (CL- total flight hours;...

  14. A hydrochemical investigation using 36Cl/Cl in groundwaters

    OpenAIRE

    Metcalfe, R.

    2003-01-01

    This report describes 36Cl studies which were undertaken during the H14 financial year. 6 groundwater samples were collected for 36Cl analysis. The results of this study suggest that 36Cl data could potentially be useful for interpreting groundwater origins and flow paths.

  15. Sequence Variation in the Gp120 region of SHIV-CN97001 during in vivo Passage

    Institute of Scientific and Technical Information of China (English)

    Qiang LIU; Gui-bo YANG; Yue MA; Chen-li QIU; Jie-jie DAI; Hui XING; Yi-ming SHAO

    2008-01-01

    SHIV-CN97001 played an important role in assessing the immune effect and strategy of the AIDS vaccine which included genes of the predominant prevalent HIV-1 strain in China. In this study, SHIV-CN97001 was in vivo passaged serially to construct pathogenic SHIV-CN97001/rhesus macaques model. To identify variation in the gp120 region of SHIV-CN97001 during passage, the fragments of gp120 gene were amplified by RT-PCR from the plasma of SHIV-CN97001 infected animals at the peak viral load time point and the gene distances (divergence, diversity) were calculated using DISTANCE. The analysis revealed that the genetic distances of SHIV-CN97001 in the third passage animals were the highest during in vivo passage. It had a relationship between viral divergence from the founder strain and viral replication ability. The nucleic acid sequence of the V3 region was highly conservative. All of the SHIV-CN97001 strains had V3 loop central motif (GPGQ) and were predicted to be using CCR5 co-receptor on the basis of the critical amino acids within V3 loop. These results show that there was no significant increase in the genetic distance during serial passage, and SHIV-CN97001 gp120 gene evolved toward ancestral states upon transmission to a new host. This could partly explain why there was no pathogenic viral strain obtained during in vivo passage.

  16. Theoretical study on the reaction mechanism of CN radical with ketene

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    The bimolecular single collision reaction potential energy surface of CN radical with ketene (CH2CO) was investigated by means of B3LYP and QCISD(T) methods. The calculated results indicate that there are three possible channels in the reaction. The first is an attack reaction by the carbon atom of CN at the carbon atom of the methylene of CH2CO to form the intermediate NCCH2CO followed by a rupture reaction of the C-C bond combined with -CO group to the products CH2CN+CO. The second is a direct addition reaction between CN and CH2CO to form the intermediate CH2C(O)CN followed by its isomerization into NCCH2CO via a CN-shift reaction, and subsequently, NCCH2CO dissociates into CH2CN+CO through a CO-loss reaction. The last is a direct hydrogen abstraction reaction of CH2CO by CN radical. Because of the existence of a 15.44 kJ/mol reaction barrier and higher energy of reaction products, the path can be ruled out as an important channel in the reaction kinetics. The present theoretical computation results, which give an available suggestion on the reaction mechanism, are in good agreement with previous experimental studies.

  17. Spatial and temporal variations in the column density distribution of comet Halley's CN coma

    Science.gov (United States)

    Schulz, Rita; Schlosser, W.; Meisser, W.; Koczet, P.; Celnik, W. E.

    1992-01-01

    Mean radial column density profiles of comet P/Halley's CN coma were derived by combining photographic and photoelectric observations. The shape of the profiles as well as their temporal variations were analyzed in detail and compared with the results of other CN observations of the comet.

  18. Preparation and properties of SiCN diffusion barrier layer for Cu interconnect in ULSI

    Institute of Scientific and Technical Information of China (English)

    ZHOU Ji-cheng; SHI Zhi-jie; ZHENG Xu-qiang

    2009-01-01

    SiCN thin films and Cu/SiCN/Si structures were fabricated by magnetron sputtering. And some samples underwent the rapid thermal annealing(RTA) processing. The thin-film surface morphology, crystal structure and electronic properties were characterized by atomic force microscopy(AFM), X-ray diffractometry(XRD), Fourier transform infrared transmission(FTIR) and four-point probe(FPP) analyses. The results reveal the formation of complex networks among the three elements, Si, C and N, and the existence of different chemical bonds in the SiCN films, such as Si-C, Si-N, C-N and C=N. The as-deposited SiCN thin films are amorphous in the Cu/SiCN/Si structures and have good thermal stability, and the SiCN thin films are still able to prevent the diffusion reaction between Cu and Si interface after RTA processing at 600 ℃ for 5 min.

  19. Laguerre expansion on the Heisenberg group and Fourier-Bessel transform on Cn

    Institute of Scientific and Technical Information of China (English)

    CHANG Der-Chen; GRIENER Peter; TIE Jingzhi

    2006-01-01

    Given a principal value convolution on the Heisenberg group Hn = Cn × R, we study the relation between its Laguerre expansion and the Fourier-Bessel expansion of its limit on Cn. We also calculate the Dirichlet kernel for the Laguerre expansion on the group Hn.

  20. Subtractive hybridization identifies novel differentially expressed ncRNA species in EBV-infected human B cells

    OpenAIRE

    Mrázek, Jan; Kreutmayer, Simone B.; Grässer, Friedrich A; Polacek, Norbert; Hüttenhofer, Alexander

    2007-01-01

    Non-protein-coding RNAs (ncRNAs) fulfill a wide range of cellular functions from protein synthesis to regulation of gene expression. Identification of novel regulatory ncRNAs by experimental approaches commonly includes the generation of specialized cDNA libraries encoding small ncRNA species. However, such identification is severely hampered by the presence of constitutively expressed and highly abundant ‘house-keeping’ ncRNAs, such as ribosomal RNAs, small nuclear RNAs or transfer RNAs. We ...

  1. Small ncRNA transcriptome analysis from Aspergillus fumigatus suggests a novel mechanism for regulation of protein synthesis

    OpenAIRE

    Jöchl, Christoph; Rederstorff, Mathieu; Hertel, Jana; Stadler, Peter F.; Hofacker, Ivo L.; Schrettl, Markus; Haas, Hubertus; Hüttenhofer, Alexander

    2008-01-01

    Small non-protein-coding RNAs (ncRNAs) have systematically been studied in various model organisms from Escherichia coli to Homo sapiens. Here, we analyse the small ncRNA transcriptome from the pathogenic filamentous fungus Aspergillus fumigatus. To that aim, we experimentally screened for ncRNAs, expressed under various growth conditions or during specific developmental stages, by generating a specialized cDNA library from size-selected small RNA species. Our screen revealed 30 novel ncRNA c...

  2. Low friction and wear resistant nanocomposite nc-MeC/a-C and nc-MeC/a-C:H coatings

    Directory of Open Access Journals (Sweden)

    K. Włodarczyk

    2009-12-01

    Full Text Available Purpose: Elaboration of nanocomposite, low friction and wear resistant coatings in order to increase the life-time and reliability of friction couples especially in aviation industry, car industry and of cutting tools. These coatings consist of nanocrystallites of chromium or titanium carbides built into amorphous carbon matrix.Design/methodology/approach: Coatings type nc-MeC/a-C and nc-MeC/a-C:H (where Me means Cr or Ti transition metal are deposited by a PVD method based on magnetron sputtering of pure Ti or Cr and pure graphite targets in the atmosphere of Ar or Ar+H2, respectively. The coatings are deposited onto the surface of quenched and tempered HSS steel Vanadis23 and diffusion hardened titanium alloy Ti6Al4V.Findings: Depending on deposition parameters, like the power ratio of transition metal to carbon targets or the substrate bias, it is possible to obtain different morphological and tribological properties of coatings. These latter are very important for designing friction couples in mechanical applications.Originality/value: The coatings are characterized of very low friction coefficient (0.06 for nc-TiC/a-C and 0.08 for nc-TiC/a-C:H and nc-CrC/a-C:H coatings.

  3. A tale of two skyrmions: The nucleon's strange quark content in different large Nc limits

    International Nuclear Information System (INIS)

    The nucleon's strange quark content comes from closed quark loops, and hence should vanish at leading order in the traditional large Nc (TLNC) limit. Quark loops are not suppressed in the recently proposed orientifold large Nc (OLNC) limit, and thus the strange quark content should be non-vanishing at leading order. The Skyrme model is supposed to encode the large Nc behavior of baryons, and can be formulated for both of these large Nc limits. There is an apparent paradox associated with the large Nc behavior of strange quark matrix elements in the Skyrme model. The model only distinguishes between the two large Nc limits via the Nc scaling of the couplings and the Witten-Wess-Zumino term, so that a vanishing leading order strange matrix element in the TLNC limit implies that it also vanishes at leading order in the OLNC limit, contrary to the expectations based on the suppression/non-suppression of quark loops. The resolution of this paradox is that the Skyrme model does not include the most general type of meson-meson interaction and, in fact, contains no meson-meson interactions which vanish for the TLNC limit but not the OLNC. The inclusion of such terms in the model yields the expected scaling for strange quark matrix elements

  4. Study of the effect of the silver content on the structural and mechanical behavior of Ag–ZrCN coatings for orthopedic prostheses

    Energy Technology Data Exchange (ETDEWEB)

    Ferreri, I., E-mail: isabelferreri@gmail.com [GRF-CFUM, University of Minho, Campus of Azurém, 4800-058 Guimarães (Portugal); CEB, Centre for Biological Engineering, University of Minho, Campus of Gualtar, 4700-057 (Portugal); Lopes, V. [GRF-CFUM, University of Minho, Campus of Azurém, 4800-058 Guimarães (Portugal); Calderon V, S. [GRF-CFUM, University of Minho, Campus of Azurém, 4800-058 Guimarães (Portugal); SEG-CEMUC, Mechanical Engineering Department, University of Coimbra, 3030-788 Coimbra (Portugal); Tavares, C.J. [GRF-CFUM, University of Minho, Campus of Azurém, 4800-058 Guimarães (Portugal); Cavaleiro, A. [SEG-CEMUC, Mechanical Engineering Department, University of Coimbra, 3030-788 Coimbra (Portugal); Carvalho, S. [GRF-CFUM, University of Minho, Campus of Azurém, 4800-058 Guimarães (Portugal); SEG-CEMUC, Mechanical Engineering Department, University of Coimbra, 3030-788 Coimbra (Portugal)

    2014-09-01

    With the increase of elderly population and health problems that are arising nowadays, hip joint prostheses are being widely used. However, it is estimated that 20% of hip replacement surgeries simply fails after few years, mainly due to wear fatigue. Bearing this in mind, this work reports on the development of new coatings that are able to sustain long and innocuous life inside the patient, which will confer to the usual biomaterials improved physical, mechanical and tribological properties. In particular, the development of multifunctional coatings based on Ag-ZrCN, prepared by DC reactive magnetron sputtering using two targets, Zr and a modified Zr target, in an Ar + C{sub 2}H{sub 2} + N{sub 2} atmosphere. Silver pellets were placed in the erosion area of the alloyed Zr target in order to obtain a silver content up to 8 at.%. The structural results obtained by x-ray diffraction show that the coatings crystallize in a NaCl crystal structure typical of ZrC{sub 1-x}N{sub x}. The increase of Ag content promoted the formation of an additional a-CN{sub x} amorphous phase, besides a silver crystalline phase. Hardness is decreasing, as increasing silver content. Despite the low thicknesses, adhesion values (L{sub C3}) can be considered as good. Dynamic fatigue results suggest that these coatings system can be a real asset in terms of mechanical properties, by improving the performance of usual Stainless Steel 316 L biomaterials. - Highlights: • ZrCN, silver and carbon based amorphous phases, form the structure of the coatings. • Ag–ZrCN coatings have a high capacity to withstand an impact load without fracturing. • Silver incorporation reduces the fatigue failures of the coatings. • The films possess mechanical resistance and biocompatibility, required in prostheses.

  5. theCN.com: An Academic-cum-Social Networking Online Platform

    Directory of Open Access Journals (Sweden)

    Mandar Lakshmikant Bhanushe

    2013-09-01

    Full Text Available This article is a review of theCN, an online virtual learning environment. CN is more than a learning management system, as it not only focuses on course content delivery and management, but takes it a step further by introducing the networking of courses and their content. In comparison with existing LMS’s, which are housed in closed walls with limited access to learners and instructors within institutions, used to merely manage courses online, CN is an open, free, academic and social networking framework scalable to massive numbers of learners from any place in the world within a single environment. CN is free for all to use across the globe. With some minor improvements, CN, as an LMS is surely one of very useful and helpful virtual learning technology tool available to distance learners and institutions to make learning entertaining and fruitful in achieving its learning objectives.

  6. Radiative electron attachment to molecules of astrophysical interest. Benchmark study of CN^-.

    Science.gov (United States)

    Kokoouline, Viatcheslav; Douguet, Nicolas; Dulieu, Olivier; Raoult, Maurice; Orel, Ann E.

    2012-06-01

    We develop a first-principles approach to study the process of radiative electron attachment (REA) to linear molecules of astrophysical interest Mol +e^- ->Mol^- + φ. (Mol^- = CnH^-, CnN^-). The approach is based on accurate ab initio calculations of electronic bound and continuum states of the negative ion. The electronic continuum states are obtained with the complex-Kohn variational method. A preliminary calculation for the formation of the simplest observed ion, CN^-, by REA gave a low rate coefficient. We will present also a preliminary result for the C4H^- formation by REA. For this molecule, the REA rate coefficient is expected to be somewhat larger due to the Renner-Teller non-adiabatic coupling that should enhance electron capture. The goal of this study is to answer the question if negative molecular ions CnH^- and CnN^- recently observed in the interstellar space could indeed be formed by REA as previously suggested.

  7. State-Resolved Dynamics of the CN(B2Σ+) and CH(A2Δ) Excited Products Resulting from the VUV Photodissociation of CH3CN

    International Nuclear Information System (INIS)

    Fourier transform visible spectroscopy, in conjunction with VUV photons produced by a synchrotron, is employed to investigate the photodissociation of CH3CN. Emission is observed from both the CN(B2Sigma+-X2Sigma+) and CH(A2Delta-X2PI) transitions; only the former is observed in spectra recorded at 10.2 and 11.5 eV, whereas both are detected in the 16 eV spectrum. The rotational and vibrational temperatures of both the CN(B2Sigma+) and CH(A2Delta) radical products are derived using a combination of spectral simulations and Boltzmann plots. The CN(B2Sigma+) fragment displays a bimodal rotational distribution in all cases. Trot(CN(B2Sigma+)) ranges from 375 to 600 K at lower K(prime) and from 1840 to 7700 K at higher K(prime) depending on the photon energy used. Surprisal analyses indicate clear bimodal rotational distributions, suggesting CN(B2Sigma+) is formed via either linear or bent transition states, respectively, depending on the extent of rotational excitation in this fragment. CH(A2Delta) has a single rotational distribution when produced at 16 eV which results in Trot(CH(A2Delta)) = 4895 +- 140 K in nu(prime) = 0 and 2590 +- 110 K in nu(prime) =1. From thermodynamic calculations, it is evident that CH(A2Delta) is produced along with CN(X2Sigma+) + H2. These products can be formed by a two step mechanism (via excited CH3* and ground state CN(X2Sigma+)) or a process similar to the 'roaming' atom mechanism; the data obtained here are insufficient to definitively conclude whether either pathway occurs.A comparison of the CH(A2Delta) and CN(B2Sigma+) rotational distributions produced by 16 eV photons allows the ratio between the two excited fragments at this energy to be determined. An expression that considers the rovibrational populations of both band systems results in a CH(A2Delta):CN(B2Sigma+) ratio of (1.2 +- 0.1):1 at 16 eV, thereby indicating that production of CH(A2Delta) is significant at 16eV

  8. Synthesis and characterization of polyureasilazane derived SiCN ceramics

    Science.gov (United States)

    Andronenko, Sergey I.; Stiharu, Ion; Misra, Sushil K.

    2006-06-01

    Samples of SiCN ceramics were synthesized by thermal treatment of commercially available CERASET™ polyureasilazane, used as liquid-polymer precursor, at pyrolysis temperatures of 1000, 1050, 1100, 1150, and 1200 °C. Electron paramagnetic resonance (EPR) signals due to sp2-hybridized carbon-related dangling bonds were recorded over the 4-300 K temperature range at X band (9.6 GHz), and the spectra showed the presence of an intense EPR line with g=2.0027 at room temperature for all samples; at liquid helium temperature an additional line was seen present as a shoulder to main line. These two signals are due to carbon-related dangling bonds present as (i) defects on the free-carbon phase and (ii) within the bulk of SiCN ceramic network. The value of the antiferromagnetic exchange constant between dangling bonds in the various samples, not hitherto available in the literature, was estimated from the temperature variation of the EPR linewidth to be anywhere from J=-12 to J=-15 K in the samples synthesized at 1000, 1100, and 1150 °C. The EPR linewidth of the samples decreased with increasing pyrolysis temperature of a sample, being 0.07 mT at X band at room temperature for the samples synthesized at 1150 and 1200 °C, which can be used potentially as stable g markers, due to their very narrow linewidth. The W-band (95 GHz) room-temperature spectrum of the sample pyrolyzed at 1100 °C exhibited only one line consistent with the X-band spectrum. At higher frequency of G band (170 GHz) the EPR spectra are better resolved, clearly showing the presence of a strong (g=2.0027) and a weak (g=2.0032) EPR line at room temperature, and the latter corresponds to the line present at X band as shoulder at liquid-helium temperature. In addition, nuclear magnetic resonance measurements were carried out to confirm the existence of free-carbon phase and oxygen atoms in the samples.

  9. Synthesis and characterization of polyureasilazane derived SiCN ceramics

    International Nuclear Information System (INIS)

    Samples of SiCN ceramics were synthesized by thermal treatment of commercially available CERASETTM polyureasilazane, used as liquid-polymer precursor, at pyrolysis temperatures of 1000, 1050, 1100, 1150, and 1200 deg. C. Electron paramagnetic resonance (EPR) signals due to sp2-hybridized carbon-related dangling bonds were recorded over the 4-300 K temperature range at X band (9.6 GHz), and the spectra showed the presence of an intense EPR line with g=2.0027 at room temperature for all samples; at liquid helium temperature an additional line was seen present as a shoulder to main line. These two signals are due to carbon-related dangling bonds present as (i) defects on the free-carbon phase and (ii) within the bulk of SiCN ceramic network. The value of the antiferromagnetic exchange constant between dangling bonds in the various samples, not hitherto available in the literature, was estimated from the temperature variation of the EPR linewidth to be anywhere from J=-12 to J=-15 K in the samples synthesized at 1000, 1100, and 1150 deg. C. The EPR linewidth of the samples decreased with increasing pyrolysis temperature of a sample, being 0.07 mT at X band at room temperature for the samples synthesized at 1150 and 1200 deg. C, which can be used potentially as stable g markers, due to their very narrow linewidth. The W-band (95 GHz) room-temperature spectrum of the sample pyrolyzed at 1100 deg. C exhibited only one line consistent with the X-band spectrum. At higher frequency of G band (170 GHz) the EPR spectra are better resolved, clearly showing the presence of a strong (g=2.0027) and a weak (g=2.0032) EPR line at room temperature, and the latter corresponds to the line present at X band as shoulder at liquid-helium temperature. In addition, nuclear magnetic resonance measurements were carried out to confirm the existence of free-carbon phase and oxygen atoms in the samples

  10. Directly Generating the NC Machining Program from AutoCAD Graph

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    One kind of auto-programming method directly gener at ing the NC machining program by AutoCAD graph is discussed in this article. Firs tly, the article discusses the open type graphic interface of AutoCAD. Then the graphic export among the AutoCAD, the adding of process information and the data storage, as well as technology of generating NC program has been introduced . Finally, a NC auto-programming system GAPS based on AutoCAD graph is develope d. The tendency of auto-programming is graphic auto-pro...

  11. Naming 'junk': Human non-protein coding RNA (ncRNA) gene nomenclature

    OpenAIRE

    Wright Mathew W; Bruford Elspeth A

    2011-01-01

    Abstract Previously, the majority of the human genome was thought to be 'junk' DNA with no functional purpose. Over the past decade, the field of RNA research has rapidly expanded, with a concomitant increase in the number of non-protein coding RNA (ncRNA) genes identified in this 'junk'. Many of the encoded ncRNAs have already been shown to be essential for a variety of vital functions, and this wealth of annotated human ncRNAs requires standardised naming in order to aid effective communica...

  12. ViRBase: a resource for virus–host ncRNA-associated interactions

    OpenAIRE

    Li, Yanhui; Wang, Changliang; Miao, Zhengqiang; Bi, Xiaoman; Wu, Deng; Jin, Nana; WANG, LIQIANG; Wu, Hao; Qian, Kun; Li, Chunhua; Zhang, Ting; Zhang, Chunrui; Yi, Ying; Lai, Hongyan; Hu, Yongfei

    2014-01-01

    Increasing evidence reveals that diverse non-coding RNAs (ncRNAs) play critically important roles in viral infection. Viruses can use diverse ncRNAs to manipulate both cellular and viral gene expression to establish a host environment conducive to the completion of the viral life cycle. Many host cellular ncRNAs can also directly or indirectly influence viral replication and even target virus genomes. ViRBase (http://www.rna-society.org/virbase) aims to provide the scientific community with a...

  13. A comparative genome-wide study of ncRNAs in trypanosomatids

    Directory of Open Access Journals (Sweden)

    Wachtel Chaim

    2010-11-01

    Full Text Available Abstract Background Recent studies have provided extensive evidence for multitudes of non-coding RNA (ncRNA transcripts in a wide range of eukaryotic genomes. ncRNAs are emerging as key players in multiple layers of cellular regulation. With the availability of many whole genome sequences, comparative analysis has become a powerful tool to identify ncRNA molecules. In this study, we performed a systematic genome-wide in silico screen to search for novel small ncRNAs in the genome of Trypanosoma brucei using techniques of comparative genomics. Results In this study, we identified by comparative genomics, and validated by experimental analysis several novel ncRNAs that are conserved across multiple trypanosomatid genomes. When tested on known ncRNAs, our procedure was capable of finding almost half of the known repertoire through homology over six genomes, and about two-thirds of the known sequences were found in at least four genomes. After filtering, 72 conserved unannotated sequences in at least four genomes were found, 29 of which, ranging in size from 30 to 392 nts, were conserved in all six genomes. Fifty of the 72 candidates in the final set were chosen for experimental validation. Eighteen of the 50 (36% were shown to be expressed, and for 11 of them a distinct expression product was detected, suggesting that they are short ncRNAs. Using functional experimental assays, five of the candidates were shown to be novel H/ACA and C/D snoRNAs; these included three sequences that appear as singletons in the genome, unlike previously identified snoRNA molecules that are found in clusters. The other candidates appear to be novel ncRNA molecules, and their function is, as yet, unknown. Conclusions Using comparative genomic techniques, we predicted 72 sequences as ncRNA candidates in T. brucei. The expression of 50 candidates was tested in laboratory experiments. This resulted in the discovery of 11 novel short ncRNAs in procyclic stage T. brucei

  14. Sources of suspended sediment in the Lower Roanoke River, NC

    Science.gov (United States)

    Jalowska, A. M.; McKee, B. A.; Rodriguez, A. B.; Laceby, J. P.

    2015-12-01

    The Lower Roanoke River, NC, extends 220 km from the fall line to the bayhead delta front in the Albemarle Sound. The Lower Roanoke is almost completely disconnected from the upper reaches by a series of dams, with the furthest downstream dam located at the fall line. The dams effectively restrict the suspended sediment delivery from headwaters, making soils and sediments from the Lower Roanoke River basin, the sole source of suspended sediment. In flow-regulated rivers, bank erosion, especially mass wasting, is the major contributor to the suspended matter. Additional sources of the suspended sediment considered in this study are river channel, surface soils, floodplain surface sediments, and erosion of the delta front and prodelta. Here, we examine spatial and temporal variations in those sources. This study combined the use of flow and grain size data with a sediment fingerprinting method, to examine the contribution of surface and subsurface sediments to the observed suspended sediment load along the Lower Roanoke River. The fingerprinting method utilized radionuclide tracers 210Pb (natural atmospheric fallout), and 137Cs (produced by thermonuclear bomb testing). The contributions of surface and subsurface sources to the suspended sediment were calculated with 95% confidence intervals using a Monte-Carlo numerical mixing model. Our results show that with decreasing river slope and changing hydrography along the river, the contribution of surface sediments increases and becomes a main source of sediments in the Roanoke bayhead delta. At the river mouth, the surface sediment contribution decreases and is replaced by sediments eroded from the delta front and prodelta. The area of high surface sediment contribution is within the middle and upper parts of the delta, which are considered net depositional. Our study demonstrates that floodplains, often regarded to be a sediment sink, are also a sediment source, and they should be factored into sediment, carbon and

  15. Constitutional Isomerism of BiW6Cl15: (BiCl)[W6Cl14] and (BiCl2)[W6Cl13

    OpenAIRE

    Meyer, Hans-Juergen

    2009-01-01

    Abstract The compound (BiCl)[W6Cl14] was previously characterized as a product of the reduction of tungsten hexachloride with elemental bismuth. Another modification of BiW6Cl15 is now presented as (BiCl2)[W6Cl13], based on the results of an X-ray single crystal structure determination (space group P21/c, a = 1354.3(2) pm, b = 1234.4(2) pm, c = 1538.9(2) pm, and ? = 118.76(1) ?). The structure of (BiCl2)[W6Cl13] contains chains of [(W6Cl8i)Cl4aCl2/2a-a]- clusters bridged by chlorin...

  16. Anything But Ordinary ——hebrew.cri.cn

    Institute of Scientific and Technical Information of China (English)

    徐嘉

    2014-01-01

    In the present era of accelerated technological development with its proliferation of new digital media,PC and Internet,the main questions concerning communication practices examine the patterns of interaction between these practices and the use of‘old’media,such as print,the electronic and audiovisual media,television,radio and VCR,which have all dominated the communication scene until fairly recently.Definitely we can say that the internet has become a family member that no one can live without it,especially the new types electronic products’sale in the markets and the development of the wireless(wifi),what’s more,the high click rates of facebook,youtube,twitter and so on.This great change also have happened in China that you can see the first thing for everyone in the morning is connecting the internet so as to read weibo(micro blog,its function is similar to twitter,now it is the most popular and famous micro blog in China),youku(similar to ytube),xiaonei(like facebook)and so on.Therefore a great many‘old’media in China is now experiencing the large reform.CRI(China Radio International)cannot lag behind.In this paper,I am trying to introduce one website from CRI which is called"hebrew.cri.cn"as a landscape to state her"birth","grow up(development)"and her"future".

  17. Star formation around the mid-infrared bubble CN 148

    CERN Document Server

    Dewangan, L K; Grave, J M C; Mallick, K K

    2014-01-01

    We present a multi-wavelength study to analyse the star formation process associated with the mid-infrared bubble CN 148 (H II region G10.3-0.1), which harbors an O5V-O6V star. The arc-shaped distribution of molecular CO(2-1) emission, the cold dust emission, and the polycyclic aromatic hydrocarbon features trace a photodissociation region (PDR) around the H II region. We have identified 371 young stellar objects (YSOs) in the selected region and, interestingly, their spatial distribution correlates well with the PDR. 41% of these YSOs are present in 13 clusters, each having visual extinction larger than 16 mag. The clusters at the edges of the bubble (both northeast and southwest) are found to be relatively younger than the clusters located further away from the bubble. We also find that four 6.7 GHz methanol masers, two Extended Green Objects, an ultra-compact H II region, and a massive protostar candidate (as previously reported) are spatially positioned at the edges of the bubble. The existence of an appa...

  18. Photometric Modelling of Close Binary Star CN And

    Indian Academy of Sciences (India)

    D. M. Z. Jassur; A. Khodadadi

    2006-03-01

    The results of two color photometry of active close binary CN And are presented and analyzed. The light curves of the system are obviously asymmetric, with the primary maximum brighter than the secondary maximum, which is known as the O’Conell effect. The most plausible explanation of the asymmetry is expected to be due to spot activity of the primary component. For the determination of physical and geometrical parameters, the most new version of W–D code was used, but the presence of asymmetry prevented the convergence of the method when the whole light curves were used. The solutions were obtained by applying mode 3 of W–D code to the first half of the light curves, assuming synchronous rotation and zero eccentricity. Absolute parameters of the system were obtained from combining the photometric solution with spectroscopic data obtained from radial velocity curve analysis. The results indicate the poor thermal contact of the components and transit primary minimum. Finally the O–C diagram was analyzed. It was found that the orbital period of the system is changing with a rate of / = -2.2(6) × 10-10 which corresponds to mass transfer from more massive component to less massive with the rate of / ∼ 4.82 × 10-88sun/year.

  19. The NC16A Domain of Collagen XVII Plays a Role in Triple Helix Assembly and Stability*

    OpenAIRE

    Van den Bergh, Françoise; Fu, Chang-Ling; Olague-Marchan, Monica; Giudice, George J.

    2006-01-01

    Collagen XVII/BP180 is a transmembrane constituent of the epidermal anchoring complex. To study the role of its non-collagenous linker domain, NC16A, in protein assembly and stability, we analyzed the following recombinant proteins: the collagen XVII extracellular domain with or without NC16A, and a pair of truncated proteins comprising the COL15-NC15 stretch expressed with or without NC16A. All four proteins were found to exist as stable collagen triple helices; however, the two missing NC16...

  20. NcRNA-microchip analysis: A novel approach to identify differential expression of non-coding RNAs

    OpenAIRE

    Hutzinger, Roland; Mrázek, Jan; Vorwerk, Sonja; Hüttenhofer, Alexander

    2010-01-01

    Epstein-Barr virus (EBV) infection of human B cells requires the presence of non-coding RNAs (ncRNAs), which regulate expression of viral and host genes. To identify differentially expressed regulatory ncRNAs involved in EBV infection, a specialized cDNA library, enriched for ncRNAs derived from EBV-infected cells, was subjected to deep-sequencing. From the deep-sequencing analysis, we generated a custom-designed ncRNA-microchip to investigate differential expression of ncRNA candidates. By t...

  1. Holographic realization of large-Nc orbifold equivalence with non-zero chemical potential

    CERN Document Server

    Hanada, Masanori; Karch, Andreas; Yaffe, Laurence G

    2012-01-01

    Recently, it has been suggested that large-Nc orbifold equivalences may be applicable to certain theories with chemical potentials, including QCD, in certain portions of their phase diagram. When valid, such an equivalence offers the possibility of relating large-Nc QCD at non-zero baryon chemical potential, a theory with a complex fermion determinant, to a related theory whose fermion determinant is real and positive. In this paper, we provide a test of this large Nc equivalence using a holographic realization of a supersymmetric theory with baryon chemical potential and a related theory with isospin chemical potential. We show that the two strongly-coupled, large-Nc theories are equivalent in a large region of the phase diagram.

  2. EnviroAtlas -Durham, NC- One Meter Resolution Urban Area Land Cover Map (2010)

    Data.gov (United States)

    U.S. Environmental Protection Agency — The EnviroAtlas Durham, NC land cover map was generated from USDA NAIP (National Agricultural Imagery Program) four band (red, green, blue and near infrared) aerial...

  3. Investigation on the foaming behaviors of NC-based gun propellants

    Directory of Open Access Journals (Sweden)

    Yu-xiang Li

    2014-09-01

    Full Text Available To prepare the porous NC-based (nitrocellulose-based gun propellants, the batch foaming process of using supercritical CO2 as the physical blowing agent is used. The solubilities of CO2 in the single-base propellants and TEGDN (trimethyleneglycol dinitrate propellants are measured by the gravimetric method, and SEM (scanning electron microscope is used to observe the morphology of foamed propellants. The result shows that a large amount of CO2 could be dissolved in NC-based propellants. The experimental results also reveal that the energetic plasticizer TEGDN exerts an important influence on the pore structure. The triaxial tensile failure mechanism for solid-state nucleation is used to explain the nucleation of NC-based propellants in the solid state. Since some specific foaming behaviors of NC-based propellants can not be explained by the failure mechanism, a solid-state nucleation mechanism which revises the triaxial tensile failure mechanism is proposed and discussed.

  4. Bidirectional expression of long ncRNA/protein-coding gene pairs in cancer.

    Science.gov (United States)

    Albrecht, Anne-Susann; Ørom, Ulf Andersson

    2016-05-01

    Bidirectional initiation of transcription by RNA polymerase II occurs prevalently at active promoters during protein-coding gene (PCG) expression. Upstream, antisense noncoding RNAs (ncRNAs) of differing lengths, stabilities and processings are being expressed from these promoters in concert with downstream, processive messenger RNA transcription. Although abundantly detected, the functional role and regulatory capacity of such transcripts have only been determined for individual cases. Long ncRNAs in general are reportedly able to regulate all steps of the gene expression process. Therefore, to get insight into the functionality of long ncRNAs transcribed bidirectionally from cancer-associated PCGs is of interest, as expression changes of tumor suppressor genes and oncogenes are prevalent in cancer.Here, we review the sources and characteristics of antisense transcription occurring at PCG loci in the human genome, and focus on the functional impact of bidirectional long ncRNA expression at cancer-associated PCGs. PMID:26578749

  5. EnviroAtlas -Durham, NC- One Meter Resolution Urban Area Land Cover Map (2010) Web Service

    Data.gov (United States)

    U.S. Environmental Protection Agency — This EnviroAtlas web service supports research and online mapping activities related to EnviroAtlas (https://www.epa.gov/enviroatlas ). The EnviroAtlas Durham, NC...

  6. De Novo Discovery of Structured ncRNA Motifs in Genomic Sequences

    DEFF Research Database (Denmark)

    Ruzzo, Walter L; Gorodkin, Jan

    2014-01-01

    De novo discovery of "motifs" capturing the commonalities among related noncoding ncRNA structured RNAs is among the most difficult problems in computational biology. This chapter outlines the challenges presented by this problem, together with some approaches towards solving them, with an emphas...... on an approach based on the CMfinder CMfinder program as a case study. Applications to genomic screens for novel de novo structured ncRNA ncRNA s, including structured RNA elements in untranslated portions of protein-coding genes, are presented.......De novo discovery of "motifs" capturing the commonalities among related noncoding ncRNA structured RNAs is among the most difficult problems in computational biology. This chapter outlines the challenges presented by this problem, together with some approaches towards solving them, with an emphasis...

  7. EnviroAtlas - Durham, NC - Tree Cover Configuration and Connectivity, Water Background Web Service

    Data.gov (United States)

    U.S. Environmental Protection Agency — This EnviroAtlas web service supports research and online mapping activities related to EnviroAtlas (https://www.epa.gov/enviroatlas ). The EnviroAtlas Durham, NC...

  8. Tree species is the major factor explaining C:N ratios in European forest soils

    DEFF Research Database (Denmark)

    Cools, Nathalie; Vesterdal, Lars; De Vos, Bruno;

    2014-01-01

    The C:N ratio is considered as an indicator of nitrate leaching in response to high atmospheric nitrogen (N) deposition. However, the C:N ratio is influenced by a multitude of other site-related factors. This study aimed to unravel the factors determining C:N ratios of forest floor, mineral soil...... and peat top soils in more than 4000 plots of the ICP Forests large-scale monitoring network. The first objective was to quantify forest floor, mineral and peat soil C:N ratios across European forests. Secondly we determined the main factors explaining this C:N ratio using a boosted regression tree...... analysis (BRT), including fifteen site and environmental variables. Ninety-five percent of the C:N ratios were between 16 and 44 in the forest floor, between 13 and 44 in the peat topsoil and between 10 and 32 in the mineral topsoil. Within the aerated forest floor and the mineral soil, the C:N ratios...

  9. Fe(CN){sub 6}{sup 3-}/Fe(CN){sub 6}{sup 4-} redox in the interlayer determined by the charge density of Zn{sub n}Cr-layered double hydroxides

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Jia; Xu, Yunfeng; Liu, Jiangyong; Zhou, Jizhi [School of Environmental and Chemical Engineering, Shanghai University, No. 333 Nanchen Rd, Shanghai 200444 (China); Xu, Zhi Ping, E-mail: gordonxu@uq.edu.au [ARC Centre of Excellence for Functional Nanomaterials, Australian Institute for Bioengineering and Nanotechnology, The University of Queensland, Brisbane, QLD 4072 (Australia); Qian, Guangren, E-mail: grqian@shu.edu.cn [School of Environmental and Chemical Engineering, Shanghai University, No. 333 Nanchen Rd, Shanghai 200444 (China)

    2013-02-15

    Redox of Fe(CN){sub 6}{sup 3-} and Fe(CN){sub 6}{sup 4-} in the ZnCr layered double hydroxide interlayer has been investigated. The conversion from Fe(CN){sub 6}{sup 3-} to Fe(CN){sub 6}{sup 4-} or from Fe(CN){sub 6}{sup 4-} to Fe(CN){sub 6}{sup 3-} in the ZnCr-LDH interlayer has been confirmed, depending on the Zn:Cr molar ratio. Both Fe(CN){sub 6}{sup 3-} and Fe(CN){sub 6}{sup 4-} are observed in all samples no matter whether the initial anion is Fe(CN){sub 6}{sup 3-} or Fe(CN){sub 6}{sup 4-} before precipitation. Deconvolution of the FTIR band around 2100 cm{sup -1} reveals that the relative amount of Fe(CN){sub 6}{sup 4-} and Fe(CN){sub 6}{sup 3-} in the LDH interlayer is considerably dependent on the Zn:Cr molar ratio. In brief, Fe(CN){sub 6}{sup 4-} is preferred at the ratio of 2:1 while there is more Fe(CN){sub 6}{sup 3-} in the ratio of 4:1. Therefore, it is our hypothesis that the charge density of the hydroxide layer is a key factor that directs the redox of Fe(CN){sub 6}{sup 3-}/Fe(CN){sub 6}{sup 4-}. The possible redox processes have also been proposed. - Graphical abstract: Redox reactions of Fe(CN){sub 6}{sup 3-} and Fe(CN){sub 6}{sup 4-} take place in the ZnCr layered double hydroxide (LDH) interlayer, which are reflected by Fe(CN){sub 6}{sup 3-}/Fe(CN){sub 6}{sup 4-} FTIR area ratio. Highlights: Black-Right-Pointing-Pointer An interlayer redox phenomena was observed in Fe(CN){sub 6}{sup 3/4-} intercalated ZnCr-LDHs. Black-Right-Pointing-Pointer The ratio of interlayer redox was examined by FTIR fitting analysis. Black-Right-Pointing-Pointer The tendency of redox was influenced by Zn:Cr molar ratio. Black-Right-Pointing-Pointer The mechanism relies on the charge density of metal hydroxyl layer.

  10. SIMULATION SYSTEM FOR FIVE-AXIS NC MACHINING USING GENERAL CUTTING TOOL

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    A simulation system for five-axis NC machining using general cutting tools is presented. This system differs from other simulation system in that it not only focuses on the geometric simulation but also focuses on the collision detection which is usually not included in NC machining simulation. Besides all of these, estimating cutting forces is also discussed. In order to obtain high efficiency, all algorithms use swept volume modeling technique, so the simulation system is compact and can be performed efficiently.

  11. Climate Analysis in IOWA Using XML and Spatiotemporal Dataset-NC94

    OpenAIRE

    Sugam Sharma; Shashi Gadia; Niranjan Kumar; Valliappan Narayanan; Xinyuan Zhao

    2010-01-01

    NC94 is a spatiotemporal (agricultural) dataset of North Central Region in USA and vastly used in variousresearch domains. In this research work we exploit XML on NC94 dataset to assess the impact of extremetemperatures in Iowa. The variation in climate is one of the factors that affect human life. The results of thisresearch help to identify the counties with suitable modest climate with least variations.

  12. Colorless quark-gluon gas in the limit of large Nc

    International Nuclear Information System (INIS)

    A quark-gluon gas in a finite volume with global internal symmetry group SU(Nc) on the states of which the condition of being colorless is imposed is studied in the limit Nc → ∞. It is shown that without allowance for the conservation law of the baryon charge this system undergoes a phase transition of the third kind. However, in the more realistic situation in which this conservation law is taken into account there is no phase transition

  13. NPInter v2.0: an updated database of ncRNA interactions

    OpenAIRE

    Yuan, Jiao; Wei WU; Xie, Chaoyong; Zhao, Guoguang; Zhao, Yi; Chen, Runsheng

    2013-01-01

    NPInter (http://www.bioinfo.org/NPInter) is a database that integrates experimentally verified functional interactions between noncoding RNAs (excluding tRNAs and rRNAs) and other biomolecules (proteins, RNAs and genomic DNAs). Extensive studies on ncRNA interactions have shown that ncRNAs could act as part of enzymatic or structural complexes, gene regulators or other functional elements. With the development of high-throughput biotechnology, such as cross-linking immunoprecipitation and hig...

  14. The baryon vector current in the combined chiral and 1/Nc expansions

    Energy Technology Data Exchange (ETDEWEB)

    Flores-Mendieta, Ruben; Goity, Jose L [JLAB

    2014-12-01

    The baryon vector current is computed at one-loop order in large-Nc baryon chiral perturbation theory, where Nc is the number of colors. Loop graphs with octet and decuplet intermediate states are systematically incorporated into the analysis and the effects of the decuplet-octet mass difference and SU(3) flavor symmetry breaking are accounted for. There are large-Nc cancellations between different one-loop graphs as a consequence of the large-Nc spin-flavor symmetry of QCD baryons. The results are compared against the available experimental data through several fits in order to extract information about the unknown parameters. The large-Nc baryon chiral perturbation theory predictions are in very good agreement both with the expectations from the 1/Nc expansion and with the experimental data. The effect of SU(3) flavor symmetry breaking for the |Delta S|=1 vector current form factors f1(0) results in a reduction by a few percent with respect to the corresponding SU(3) symmetric values.

  15. A novel denitrifying methanotroph of the NC10 phylum and its microcolony.

    Science.gov (United States)

    He, Zhanfei; Cai, Chaoyang; Wang, Jiaqi; Xu, Xinhua; Zheng, Ping; Jetten, Mike S M; Hu, Baolan

    2016-01-01

    The NC10 phylum is a candidate phylum of prokaryotes and is considered important in biogeochemical cycles and evolutionary history. NC10 members are as-yet-uncultured and are difficult to enrich, and our knowledge regarding this phylum is largely limited to the first species 'Candidatus Methylomirabilis oxyfera' (M. oxyfera). Here, we enriched NC10 members from paddy soil and obtained a novel species of the NC10 phylum that mediates the anaerobic oxidation of methane (AOM) coupled to nitrite reduction. By comparing the new 16S rRNA gene sequences with those already in the database, this new species was found to be widely distributed in various habitats in China. Therefore, we tentatively named it 'Candidatus Methylomirabilis sinica' (M. sinica). Cells of M. sinica are roughly coccus-shaped (0.7-1.2 μm), distinct from M. oxyfera (rod-shaped; 0.25-0.5 × 0.8-1.1 μm). Notably, microscopic inspections revealed that M. sinica grew in honeycomb-shaped microcolonies, which was the first discovery of microcolony of the NC10 phylum. This finding opens the possibility to isolate NC10 members using microcolony-dependent isolation strategies. PMID:27582299

  16. ncRNAclassifier: a tool for detection and classification of transposable element sequences in RNA hairpins

    Directory of Open Access Journals (Sweden)

    Tempel Sébastien

    2012-09-01

    Full Text Available Abstract Background Inverted repeat genes encode precursor RNAs characterized by hairpin structures. These RNA hairpins are then metabolized by biosynthetic pathways to produce functional small RNAs. In eukaryotic genomes, short non-autonomous transposable elements can have similar size and hairpin structures as non-coding precursor RNAs. This resemblance leads to problems annotating small RNAs. Results We mapped all microRNA precursors from miRBASE to several genomes and studied the repetition and dispersion of the corresponding loci. We then searched for repetitive elements overlapping these loci. We developed an automatic method called ncRNAclassifier to classify pre-ncRNAs according to their relationship with transposable elements (TEs. We showed that there is a correlation between the number of scattered occurrences of ncRNA precursor candidates and the presence of TEs. We applied ncRNAclassifier on six chordate genomes and report our findings. Among the 1,426 human and 721 mouse pre-miRNAs of miRBase, we identified 235 and 68 mis-annotated pre-miRNAs respectively corresponding completely to TEs. Conclusions We provide a tool enabling the identification of repetitive elements in precursor ncRNA sequences. ncRNAclassifier is available at http://EvryRNA.ibisc.univ-evry.fr.

  17. Silver Blaze Puzzle in 1/Nc Expansions of Cold and Dense QCD Matter

    CERN Document Server

    Armoni, Adi

    2014-01-01

    We consider quantum chromodynamics (QCD) with Nc colors and Nf quark flavors at finite quark chemical potential mu_q or isospin chemical potential mu_I. We specifically address the nature of the ``Silver Blaze'' behavior in the framework of 1/Nc expansion. Starting with the QCD partition function, we implement Veneziano's Nf/Nc expansion to identify the density onset. We find the baryon mass M_B and the pion mass m_pi appearing from different order of Veneziano's expansion. We argue that the confining properties are responsible for the Silver Blaze in the region of m_pi/2 < mu_q < M_B/Nc. We point out, however, that Veneziano's expansion brings about a puzzling subtlety along the same line as the baryon problem in finite-density quenched simulations. We emphasize that the large-Nc limit can allow for the physical ordering of M_B and m_pi thanks to the similarity to the quenched approximation, while the unphysical ghost quarks contaminate the baryon sector if Nc is finite. We also discuss the ``orientifo...

  18. The Dichotomous Nucleon: Some Radical Conjectures for the Large $\\Nc$ Limit

    CERN Document Server

    Hidaka, Yoshimasa; McLerran, Larry; Pisarski, Robert D

    2010-01-01

    We discuss some problems in the naive large Nc approximation for nucleons. As noted previously, a Skyrmion solution is susceptible to collapse. A natural scale for it to collapse to is r \\sim 1/fpi: since at large Nc, fpi \\sim Nc^1/2 Lambda_QCD, this is parametrically small in comparison to 1/Lambda_QCD. Quantum corrections to the pion sigma model become important at a scale \\sim 1/fpi. In a string vertex model of the baryon, this is also the typical scale over which the string vertex moves. The collapse of a Skyrmion to such a small size might solve some problems with the large Nc limit, especially the Goldberger-Treiman relation. We argue that most quarks bind into colored scalar diquarks, so that for odd Nc, the spin and isospin of the nucleon is carried by the lone, unpaired quark. The problems with the large Nc limit are resolved if the unpaired quark is in a spatial wavefunction orthogonal to the wavefunctions of the scalar diquarks. This could happen if the unpaired quark orbits at a size which is para...

  19. Naming 'junk': Human non-protein coding RNA (ncRNA gene nomenclature

    Directory of Open Access Journals (Sweden)

    Wright Mathew W

    2011-01-01

    Full Text Available Abstract Previously, the majority of the human genome was thought to be 'junk' DNA with no functional purpose. Over the past decade, the field of RNA research has rapidly expanded, with a concomitant increase in the number of non-protein coding RNA (ncRNA genes identified in this 'junk'. Many of the encoded ncRNAs have already been shown to be essential for a variety of vital functions, and this wealth of annotated human ncRNAs requires standardised naming in order to aid effective communication. The HUGO Gene Nomenclature Committee (HGNC is the only organisation authorised to assign standardised nomenclature to human genes. Of the 30,000 approved gene symbols currently listed in the HGNC database (http://www.genenames.org/search, the majority represent protein-coding genes; however, they also include pseudogenes, phenotypic loci and some genomic features. In recent years the list has also increased to include almost 3,000 named human ncRNA genes. HGNC is actively engaging with the RNA research community in order to provide unique symbols and names for each sequence that encodes an ncRNA. Most of the classical small ncRNA genes have now been provided with a unique nomenclature, and work on naming the long (> 200 nucleotides non-coding RNAs (lncRNAs is ongoing.

  20. A new Leray formula for smooth functions on bounded domains in Cn

    Institute of Scientific and Technical Information of China (English)

    YAO; Zongyuan(姚宗元); QIU; Chunhui(邱春晖); ZHONG; Chunping

    2002-01-01

    By means of a new technique of integral representations in Cn given by the authors, we establish a new abstract formula with a vector function W for smooth functions on bounded domains in Cn, which is different from the well-known Leray formula, This new formula eliminates the term that contains the parameter λ from the classical Leray formula, and especially on some domains the uniform estimates for the -equation are very simple. From the new Leray formula, we can obtain correspondingly many new formulas for smooth functions on many domains in Cn, which are different from the classical ones, when we properly select the vector function W.

  1. Polymer-derived SiAlCN ceramics resist oxidation at 1400 deg. C

    International Nuclear Information System (INIS)

    The oxidation kinetics of polymer-derived SiAlCN ceramics are determined at 1400 deg. C by measuring oxide-scale thickness as a function of oxidation time. The results reveal that the SiAlCN ceramics possess much better oxidation resistance than polymer-derived SiCN without Al, pure SiC and Si3N4. X-ray diffraction studies reveal that the oxide scales consist of cristobalite, plus a small amount of mullite for the sample with high aluminum-content. The reason that the SiAlCNs exhibited better oxidation resistance is discussed

  2. CL2QCD - Lattice QCD based on OpenCL

    CERN Document Server

    Philipsen, Owe; Sciarra, Alessandro; Bach, Matthias

    2014-01-01

    We present the Lattice QCD application CL2QCD, which is based on OpenCL and can be utilized to run on Graphic Processing Units as well as on common CPUs. We focus on implementation details as well as performance results of selected features. CL2QCD has been successfully applied in LQCD studies at finite temperature and density and is available at http://code.compeng.uni-frankfurt.de/projects/clhmc.

  3. High 36Cl/Cl ratios in Chernobyl groundwater

    International Nuclear Information System (INIS)

    After the explosion of the Chernobyl Nuclear Power Plant in April 1986, contaminated material was buried in shallow trenches within the exclusion zone. A 90Sr plume was evidenced downgradient of one of these trenches, trench T22. Due to its conservative properties, 36Cl is investigated here as a potential tracer to determine the maximal extent of the contamination plume from the trench in groundwater. 36Cl/Cl ratios measured in groundwater, trench soil water and leaf leachates are 1–5 orders of magnitude higher than the theoretical natural 36Cl/Cl ratio. This contamination occurred after the Chernobyl explosion and currently persists. Trench T22 acts as an obvious modern point source of 36Cl, however other sources have to be involved to explain such contamination. 36Cl contamination of groundwater can be explained by dilution of trench soil water by uncontaminated water (rainwater or deep groundwater). With a plume extending further than that of 90Sr, radionuclide which is impacted by retention and decay processes, 36Cl can be considered as a suitable tracer of contamination from the trench in groundwater provided that modern release processes of 36Cl from trench soil are better characterized. - Highlights: • High 36Cl/Cl ratios measured in the Chernobyl Pilot Site groundwater. • Trench T22 acts as a modern source of groundwater contamination by 36Cl but other sources are involved. • Contamination results from dilution of a contaminated “T22” soil water with rainwater. • Processes involved in the modern release need to be investigated

  4. Synthesis and Crystal Structure of a Cyano-bridged Bimetallic Complex[La(DMSO)3(H2O)3Cr(CN)6]·H2O (DMSO = Dimethylsulfoxide) with One-dimensional Chain Molecular Structure

    Institute of Scientific and Technical Information of China (English)

    梁淑惠; 车云霞; 郑吉民

    2004-01-01

    The title complex [La(DMSO)3(H2O)3Cr(CN)6](H2O was obtained by the reaction of LaCl3(7H2O, DMSO and K3[Cr(CN)6] in aqueous solution on a hot water bath. The crystal crystallizes in orthorhombic, space group P212121 with a = 9.827(3), b = 15.037(4), c = 17.633(5)A, C12H26CrLaN6O7S3, Mr = 653.48, Z = 4, V = 2605.7(13) A3, Dc = 1.666 g/m3, μ (MoKα) = 2.314 mm-1, F(000) = 1300, R = 0.0205 and wR = 0.0481 for 5038 observed reflections (I > 2σ(I)). La3+ ion is eight-coordinated by three DMSO molecules, three H2O molecules and two [Cr(CN)6]3- units. The structure of the title complex possesses a cyano-bridged onedimensional zigzag chain structure with alternating La(DMSO)3(H2O)3 and Cr(CN)6 moieties, which are linked by some hydrogen bonds to form a 3D network structure.

  5. Design and Investigation of SST/nc-Si:H/M (M = Ag, Au, Ni and M/nc-Si:H/M Multifunctional Devices

    Directory of Open Access Journals (Sweden)

    A. F. Qasrawi

    2013-01-01

    Full Text Available Hydrogenated nanocrystalline Silicon thin films prepared by the very high frequency chemical vapor deposition technique (VHF-CVD on stainless steel (SST substrates are used to design Schottky point contact barriers for the purpose of solar energy conversion and passive electronic component applications. In this process, the contact performance between SST and M (M = Ag, Au, and Ni and between Ag, Au, and Ni electrodes was characterized by means of current-voltage, capacitance-voltage, and light intensity dependence of short circuit ( current and open circuit voltage ( of the contacts. Particularly, the devices ideality factors, barrier heights were evaluated by the Schottky method and compared to the Cheung's. Best Schottky device performance with lowest ideality factor suitable for electronic applications was observed in the SST/nc-Si:H/Ag structure. This device reflects a of 229 mV with an of 1.6 mA/cm2 under an illumination intensity of ~40 klux. On the other hand, the highest being 9.0 mA/cm2 and the of 53.1 mV were observed for Ni/nc-Si:H/Au structure. As these voltages represent the maximum biasing voltage for some of the designed devices, the SST/nc-Si:H/M and M/nc-Si:H/M can be regarded as multifunctional self-energy that provided electronic devices suitable for active or passive applications.

  6. High (36)Cl/Cl ratios in Chernobyl groundwater.

    Science.gov (United States)

    Roux, Céline; Le Gal La Salle, Corinne; Simonucci, Caroline; Van Meir, Nathalie; Fifield, L Keith; Diez, Olivier; Bassot, Sylvain; Simler, Roland; Bugai, Dmitri; Kashparov, Valery; Lancelot, Joël

    2014-12-01

    After the explosion of the Chernobyl Nuclear Power Plant in April 1986, contaminated material was buried in shallow trenches within the exclusion zone. A (90)Sr plume was evidenced downgradient of one of these trenches, trench T22. Due to its conservative properties, (36)Cl is investigated here as a potential tracer to determine the maximal extent of the contamination plume from the trench in groundwater. (36)Cl/Cl ratios measured in groundwater, trench soil water and leaf leachates are 1-5 orders of magnitude higher than the theoretical natural (36)Cl/Cl ratio. This contamination occurred after the Chernobyl explosion and currently persists. Trench T22 acts as an obvious modern point source of (36)Cl, however other sources have to be involved to explain such contamination. (36)Cl contamination of groundwater can be explained by dilution of trench soil water by uncontaminated water (rainwater or deep groundwater). With a plume extending further than that of (90)Sr, radionuclide which is impacted by retention and decay processes, (36)Cl can be considered as a suitable tracer of contamination from the trench in groundwater provided that modern release processes of (36)Cl from trench soil are better characterized. PMID:25128774

  7. 75 FR 30740 - Airworthiness Directives; Bombardier, Inc. Model CL-600-2B16 (CL-604 Variants (Including CL-605...

    Science.gov (United States)

    2010-06-02

    ... Procedures (44 FR 11034, February 26, 1979); and 3. Will not have a significant economic impact, positive or... Directives; Bombardier, Inc. Model CL-600-2B16 (CL- 604 Variants (Including CL-605 Marketing Variant... addition to Bombardier Inc. Models CL-600-2B19, CL-600-2C10 and CL-600-2D24. The latter three models...

  8. A Manganese Coordination Polymer and a Palladium Molecular Compound of 3-Pyridinepropionic acid (HL): [MnL2(H2O)2]∞ and trans-[Pd(HL)2Cl2

    International Nuclear Information System (INIS)

    Three coordination polymers, [ML2(H2O)2] (M = Co (1), Ni (2), Mn (3)), were prepared from metal acetates (M(CH3COO)2·4H2O) and 3-pyridinepropionic acid (HL = (3-py).CH2CH2COOH) by solvent-layer methods. By contrast, a discrete molecular compound, trans-[Pd(HL)2Cl2] (4), was synthesized by replacing benzonitrile (PhCN) ligands in trans-[Pd(PhCN)2Cl2] with HL under microwave-heating conditions. Compounds 1-3 have a 2D framework, and compound 4 contains a square-planar Pd metal

  9. H-D exchange in metal carbene complexes: Structure of cluster (μ-H)(μ-OCD3)Os3(CO)9{:C(CD3)NC2H8O}

    Science.gov (United States)

    Savkov, Boris; Maksakov, Vladimir; Kuratieva, Natalia

    2015-10-01

    X-ray and spectroscopic data for the new complex (μ-H)(μ-OCH3)Os3(CO)9{:C(CD3)NC2H8O} (2) obtained in the reaction of the (μ-H)(μ-Cl)Os3(CO)9{:C(CH3)NC2H8O} (1) with NaOCD3 in CD3OD solution are reported. It is shown that cluster 1 has the property of CH-acidity inherent of Fisher type carbenes. This had demonstrated using hydrogen deuterium exchange reaction in the presence of a strong base. Bridging chlorine to metoxide ligand substitution takes place during the reaction. The molecular structure of 2 is compared with known analogues.

  10. 76 FR 477 - Airworthiness Directives; Bombardier, Inc. Model CL-600-2A12 (CL-601) and CL-600-2B16 (CL-601-3A...

    Science.gov (United States)

    2011-01-05

    ... Policies and Procedures (44 FR 11034, February 26, 1979); and 3. Will not have a significant economic.... Model CL-600-2A12 (CL- 601) and CL-600-2B16 (CL-601-3A, CL-601-3R, and CL-604 Variants) Airplanes AGENCY... applicability of the directive for CL-600-2A12 aircraft, serial numbers 3001 through 3066, and for CL-...

  11. 76 FR 66203 - Airworthiness Directives; Bombardier, Inc. Model CL-600-2B16 (CL-601-3A, CL-601-3R, and CL-604...

    Science.gov (United States)

    2011-10-26

    ... Policies and Procedures (44 FR 11034, February 26, 1979); and 3. Will not have a significant economic.... Model CL-600-2B16 (CL- 601-3A, CL-601-3R, and CL-604 Variants) Airplanes AGENCY: Federal Aviation... Bombardier, Inc. Model CL-600-2B16 (CL- 601-3A, CL-601-3R, and CL-604 Variants) airplanes, certificated...

  12. Ru/WCoCN as a seedless Cu barrier system for advanced Cu metallization

    International Nuclear Information System (INIS)

    The properties of Ru(5 nm)/WCoCN(5 nm) stacked layers as a seedless Cu barrier system has been investigated. Its barrier properties compared to single 10 nm Ru film were investigated by sheet resistances, X-ray diffraction patterns, transmission electron microscopy, energy dispersive spectrometry spot analysis, line scans, and leakage currents. Thermal stability of the Ru(5 nm)/WCoCN(5 nm) improved by over 100 deg. C than that of Ru(10 nm) barrier. The results show that Ru(5 nm)/WCoCN(5 nm) can effectively block Cu diffusion up to 600 deg. C for 30 min. The Ru(5 nm)/WCoCN(5 nm) bilayer is a great Cu barrier candidate for seedless Cu interconnects.

  13. On the Coefficients Problem of Quasi-convex Mappings and Starlike Mapppings in Cn

    Institute of Scientific and Technical Information of China (English)

    LIUWei-xian; WANGYu-min

    2003-01-01

    Let Bn be the unit ball in Cn, we study quasi-convex mappings and starlike mappings on Bn.The upper bounds of second order item coefficients ofr quasi-convex mappings and starlike mappings are obtained.

  14. Characterization of NCAM expression and function in BT4C and BT4Cn glioma cells

    DEFF Research Database (Denmark)

    Andersson, A M; Moran, N; Gaardsvoll, H; Linnemann, D; Bjerkvig, R; Laerum, O D; Bock, Elisabeth Marianne

    1991-01-01

    The neural cell adhesion molecule, NCAM, plays an important role in cell-cell adhesion. Therefore, we have studied NCAM expression in the glioma cell lines BT4C and BT4Cn. We demonstrate that the 2 cell lines differ in their metastatic ability; while BT4C cells have a very low capacity for......-substratum binding assay in which the binding of BT4C and BT4Cn cells to NCAM immobilized to glass was assessed. We found thatBT4C cells adhere specifically to NCAM, and that adhesion is inhibited by anti-NCAM Fab'-fragments, while no specific binding of BT4Cn cells to NCAM was observed. The BT4C and BT4Cn cell...... lines thus constitute an important new model system for the study of tumor invasion and metastasis and of the role of cell adhesion molecules in these processes....

  15. 76 FR 6536 - Airworthiness Directives; Bombardier, Inc. Model CL-215-1A10 (CL-215), CL-215-6B11 (CL-215T...

    Science.gov (United States)

    2011-02-07

    ... products. That NPRM was published in the Federal Register on November 9, 2010 (75 FR 68728). That NPRM... Regulatory Policies and Procedures (44 FR 11034, February 26, 1979); and 3. Will not have a significant.... Model CL-215-1A10 (CL- 215), CL-215-6B11 (CL-215T Variant), and CL-215-6B11 (CL-415 Variant)...

  16. CN molecule collisions with H+ at a wide range of astrophysical energies

    OpenAIRE

    Sultanova, Madina R.; Guster, Dennis

    2012-01-01

    We analyze the quantum-mechanical rotational excitation/de-excitation spectrum and cross sections of CN molecules during low and high-energy collisions with protons, H+. The problem is of significant importance in astrophysics of the early Universe, specifically connected with the problems of cosmic microwave background (CMB) radiation. A quantum-mechanical close-coupling method is applied in this work. The cyanide molecule (CN) is treated as a rigid rotor, i.e. the distance between the carbo...

  17. Vibrational emission analysis of the CN molecules in laser-induced breakdown spectroscopy of organic compounds

    International Nuclear Information System (INIS)

    Laser-induced breakdown spectroscopy (LIBS) of organic materials is based on the analysis of atomic and ionic emission lines and on a few molecular bands, the most important being the CN violet system and the C2 Swan system. This paper is focused in molecular emission of LIBS plasmas based on the CN (B2Σ–X2Σ) band, one of the strongest emissions appearing in all carbon materials when analyzed in air atmosphere. An analysis of this band with sufficient spectral resolution provides a great deal of information on the molecule, which has revealed that valuable information can be obtained from the plume chemistry and dynamics affecting the excitation mechanisms of the molecules. The vibrational emission of this molecular band has been investigated to establish the dependence of this emission on the molecular structure of the materials. The paper shows that excitation/emission phenomena of molecular species observed in the plume depend strongly on the time interval selected and on the irradiance deposited on the sample surface. Precise time resolved LIBS measurements are needed for the observation of distinctive CN emission. For the organic compounds studied, larger differences in the behavior of the vibrational emission occur at early stages after plasma ignition. Since molecular emission is generally more complex than that involving atomic emission, local plasma conditions as well as plume chemistry may induce changes in vibrational emission of molecules. As a consequence, alterations in the distribution of the emissions occur in terms of relative intensities, being sensitive to the molecular structure of every single material. - Highlights: • Vibrational emission of CN species in laser-induced plasmas has been investigated. • Distribution of vibrational emission of CN has been found to be time dependent. • Laser irradiance affects the vibrational distribution of the CN molecules. • Plume chemistry controls the excitation mechanisms of CN molecules in the

  18. InterProScan Result: CN375685 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available CN375685 CN375685_1_ORF2 6541062F4B100B1C PANTHER PTHR23115:SF31 ELONGATION FACTOR ...TU (EF-TU) 3.5e-31 T IPR004541 Translation elongation factor EFTu/EF1A, bacterial/organelle Molecular Function: translation elong...r Component: intracellular (GO:0005622)|Biological Process: translational elongation (GO:0006414) ...

  19. Study on re-sputtering during CN{sub x} film deposition through spectroscopic diagnostics of plasma

    Energy Technology Data Exchange (ETDEWEB)

    Liang, Peipei; Yang, Xu; Li, Hui; Cai, Hua [Department of Optical Science and Engineering, Fudan University, Shanghai 200433 (China); Sun, Jian; Xu, Ning [Department of Optical Science and Engineering, Fudan University, Shanghai 200433 (China); Shanghai Engineering Research Center of Ultra-Precision Optical Manufacturing, Fudan University, Shanghai 200433 (China); Wu, Jiada, E-mail: jdwu@fudan.edu.cn [Department of Optical Science and Engineering, Fudan University, Shanghai 200433 (China); Shanghai Engineering Research Center of Ultra-Precision Optical Manufacturing, Fudan University, Shanghai 200433 (China); Engineering Research Center of Advanced Lighting Technology, Ministry of Education, Fudan University, Shanghai 200433 (China)

    2015-10-15

    A nitrogen-carbon plasma was generated during the deposition of carbon nitride (CN{sub x}) thin films by pulsed laser ablation of a graphite target in a discharge nitrogen plasma, and the optical emission of the generated nitrogen-carbon plasma was measured for the diagnostics of the plasma and the characterization of the process of CN{sub x} film deposition. The nitrogen-carbon plasma was recognized to contain various species including nitrogen molecules and molecular ions excited in the ambient N{sub 2} gas, carbon atoms and atomic ions ablated from the graphite target and CN radicals. The temporal evolution and spatial distribution of the CN emission and their dependence on the substrate bias voltage show two groups of CN radicals flying in opposite directions. One represents the CN radicals formed as the products of the reactions occurring in the nitrogen-carbon plasma, revealing the reactive deposition of CN{sub x} film due to the reactive expansion of the ablation carbon plasma in the discharge nitrogen plasma and the effective formation of gaseous CN radicals as precursors for CN{sub x} film growth. The other one represents the CN radicals re-sputtered from the growing CN{sub x} film by energetic plasma species, evidencing the re-sputtering of the growing film accompanying film growth. And, the re-sputtering presents ion-induced sputtering features.

  20. New approach to neurorehabilitation: cranial nerve noninvasive neuromodulation (CN-NINM) technology

    Science.gov (United States)

    Danilov, Yuri P.; Tyler, Mitchel E.; Kaczmarek, Kurt A.; Skinner, Kimberley L.

    2014-06-01

    Cranial Nerve NonInvasive NeuroModulation (CN-NINM) is a primary and complementary multi-targeted rehabilitation therapy that appears to initiate the recovery of multiple damaged or suppressed brain functions affected by neurological disorders. It is deployable as a simple, home-based device (portable neuromodulation stimulator, or PoNSTM) and training regimen following initial patient training in an outpatient clinic. It may be easily combined with many existing rehabilitation therapies, and may reduce or eliminate the need for more aggressive invasive procedures or possibly decrease total medication intake. CN-NINM uses sequenced patterns of electrical stimulation on the tongue. Our hypothesis is that CN-NINM induces neuroplasticity by noninvasive stimulation of two major cranial nerves: trigeminal (CN-V), and facial (CN-VII). This stimulation excites a natural flow of neural impulses to the brainstem (pons varolli and medulla), and cerebellum, to effect changes in the function of these targeted brain structures, extending to corresponding nuclei of the brainstem. CN-NINM represents a synthesis of a new noninvasive brain stimulation technique with applications in physical medicine, cognitive, and affective neurosciences. Our new stimulation method appears promising for treatment of a full spectrum of movement disorders, and for both attention and memory dysfunction associated with traumatic brain injury.

  1. Influence of N atomic percentages on cell attachment for CN$_x$ coatings

    Indian Academy of Sciences (India)

    D J Li; L F Niu

    2003-06-01

    Carbon film is an excellent candidate for use as a biocompatible coating due to its excellent properties. However, considerable attention has just been focused on the biocompatibility of diamond-like carbon (DLC) in recent years. It is difficult to find reports on the investigations of the biocompatibility of CN$_x$ so far. It is well known that CN$_x$ has similar structural characteristics as that of DLC. Its excellent mechanical and tribological properties are comparable to that of DLC. In addition, it is probable that the presence of nitrogen leads to a positive effect on biocompatibility. So, this work focusses on cell attachment of CN$_x$ coating and the relation between nitrogen atomic percentage and cell attachment. CN$_x$ coatings were prepared using magnetron sputtering under two N2 partial pressures for the evaluation of relation between nitrogen atomic percentage and cell attachment. Cell culture tests using human endothelial cells and mouse fibroblasts were performed. Both coatings resulted in no adverse effects on the cells in culture. Compared with CN$_x$ ( = 0.088), CN$_x$ ( = 0.149) film provided a better surface for normal cellular attachment, spreading and proliferation without apparent impairment of cell physiology. At the same time, the coatings exhibited excellent tribological and corrosion performance. XPS and AES analyses showed that higher nitrogen atomic percentage might lead to a positive effect on the cell attachment.

  2. Hyperfine excitation of CN by para- and ortho-H2

    Science.gov (United States)

    Kalugina, Yulia; Lique, François

    2015-01-01

    Among the interstellar molecules, the CN radical is of particular interest since it is a good probe of cold dark molecular clouds, and especially prestellar cores. Modelling of CN emission spectra from these dense molecular clouds requires the calculation of rate coefficients for excitation by collisions with the most abundant species. We calculate fine- and hyperfine-structure-resolved excitation rate coefficients of CN(X2Σ+) by para- and ortho-H2. The calculations are based on a new potential energy surface obtained recently from highly correlated ab initio calculations. State-to-state rate coefficients between fine and hyperfine levels of CN were calculated for low temperatures ranging from 5 to 100 K. The new results are compared to available CN rate coefficients. Significant differences are found between the different sets of rate coefficients. This comparison shows that the new CN-H2 rate coefficients have to be used for observations interpretations. We expect that their use will help significantly to have a new insight into the physical conditions of prestellar cores.

  3. A CN Band Survey of Red Giants in the Globular Cluster M53

    Science.gov (United States)

    Martell, S. L.; Smith, G. H.

    2004-12-01

    We investigate the star-to-star variations in λ 3883 CN bandstrength among red giant stars in the low-metallicity globular cluster M53 ([Fe/H] = --2.0). Our data were taken with the Kast spectrograph on the 3-meter Shane telescope at Lick Observatory in April 2001. Star-to-star variations in CN bandstrength are common in intermediate- and high-metallicity globular clusters ([Fe/H] ≥ --1.6). Our data were obtained to test whether that variation will also be present in a low-metallicity globular cluster, or whether it will be suppressed by the overall lack of metals in the stars. Our preliminary result is that the λ 3883 CN band is weak in our program stars, which span the brightest magnitude of the red giant branch. On visual inspection, the M53 giants appear to be similar in their CN bandstrength to the four CN-weak giants in NGC 6752 whose average spectrum is plotted in Fig. 4 of Norris et al. (1981, ApJ, 244, 205). This work is planned to form part of a larger study of the metallicity dependence of CN bandstrength and carbon abundance behavior on the upper giant branch of globular clusters. This work is supported by NSF grant AST 00-98453 and by an award from the ARCS foundation, Northern California Chapter.

  4. Design of Fault Analysis and Diagnosis System in NC Machine Tool%数控机床故障分析与诊断系统的设计

    Institute of Scientific and Technical Information of China (English)

    欧敏

    2013-01-01

    In this typical faults of CNC machine tools, through careful analysis and research, find out the fault and the relationship between certain signal characteristics, and on the basis of the design of fault diagnosis system, presents a diagnostic system of soft, hardware design, failure to effectively forecast and diagnosis. In practice the effective for NC machine tool maintenance, ensure the normal operation of CN machine tools.%针对数控机床的典型故障,进行认真分析和研究,找出典型故障与某些信号特征间的关系,并在此基础上设计出故障诊断系统,提出了诊断系统的软、硬件设计方案,对故障进行有效的预测与诊断。在实际操作中对数控机床进行有效维护,保证了数控机床的正常运行。

  5. ClEST cluster :Cl_singleton2103 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton2103 brain ... protein 44 Cimex lectularius nuclear gene 353 CACCAAGAAAATTACAAGTTTCTGCAG ... ATTCCGAAGAACGTGTTTATGTGCTTTGTGAACCTATCAA mb13004 1 brain ... protein 44 [Culex quinquefasciatus] XP_001847023 8 ...

  6. ClEST cluster :Cl_singleton0405 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0405 isoform a Cimex lectularius nuclear gene 310 CACCGACGCCACTCAGAGAGGGAGAGCTAAGCAG ... GAAGATTCAAGACTCTGTACCGCTGCTAAAAGGCCGCCAG fb20013 1 brain ... peptide IDL-like protein [Tribolium castaneum] EFA ...

  7. ClEST cluster :Cl_singleton0355 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0355 acyl- synthetase long- isoform b Cimex lectularius nuclear gene 19...GGAAGGTGCATTGGGAGCAATAAAAGCGATCGCATTTGTCTGTGATATCATCACTTATCCAGTGTACCTTATTCTACAACGGCCATGGG fb18010 1 acyl-CoA synthetase [Gl

  8. ClEST cluster :Cl_singleton0763 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0763 aldo-keto reductase Cimex lectularius nuclear gene 591 CACCGGGTAGG...GTGAATAAAGGCTTAGTTAGGTCAATCGGACTATCCAATTTCAACAAAAGACAGATCGAAGATGTTT fs09012 1 aldo-keto reductase [Gl

  9. Polarized photoluminescence of nc-Si–SiO{sub x} nanostructures

    Energy Technology Data Exchange (ETDEWEB)

    Michailovska, E. V.; Indutnyi, I. Z.; Shepeliavyi, P. E.; Sopinskii, N. V., E-mail: sopinsky@isp.kiev.ua, E-mail: sopinskyy@ua.fm [National Academy of Sciences of Ukraine, Lashkarev Institute of Semiconductor Physics (Ukraine)

    2016-01-15

    The effect of photoluminescence polarization memory in nc-Si–SiO{sub x} light-emitting structures containing Si nanoparticles (nc-Si) in an oxide matrix is for the first time studied. The polarization properties of continuous and porous nanostructures passivated in HF vapors (or solutions) are studied. It is established that the polarization memory effect is manifested only after treatment of the structures in HF. The effect is also accompanied by a shift of the photoluminescence peak to shorter wavelengths and by a substantial increase in the photoluminescence intensity. It is found that, in anisotropic nc-Si–SiO{sub x} samples produced by oblique deposition in vacuum, the degree of linear photoluminescence polarization in the sample plane exhibits a noticeable orientation dependence and correlates with the orientation of SiO{sub x} nanocolumns forming the structure of the porous layer. These effects are attributed to the transformation of symmetrically shaped Si nanoparticles into asymmetric elongated nc-Si particles upon etching in HF. In continuous layers, nc-Si particles are oriented randomly, whereas in porous structures, their preferential orientation coincides with the orientation of oxide nanocolumns.

  10. Link between the Potentially Hazardous Asteroid (86039) 1999 NC43 and the Chelyabinsk meteoroid tenuous

    CERN Document Server

    Reddy, Vishnu; Bottke, William F; Pravec, Petr; Sanchez, Juan A; Gary, Bruce L; Klima, Rachel; Cloutis, Edward A; Galád, Adrián; Guan, Tan Thiam; Hornoch, Kamil; Izawa, Matthew R M; Kušnirák, Peter; Corre, Lucille Le; Mann, Paul; Moskovitz, Nicholas; Skiff, Brian; Vraštil, Jan

    2015-01-01

    We explored the statistical and compositional link between Chelyabinsk meteoroid and potentially hazardous asteroid (86039) 1999 NC43 to investigate their proposed relation proposed by Borovi\\v{c}ka et al. (2013). Using detailed computation we confirm that the orbit of the Chelyabinsk impactor is anomalously close to 1999 NC43. We find about (1-3) x 10-4 likelihood of that to happen by chance. Taking the standpoint that the Chelyabinsk impactor indeed separated from 1999 NC43 by a cratering or rotational fission event, we run a forward probability calculation, which is an independent statistical test. However, we find this scenario is unlikely at the about (10-3 -10-2) level. We also verified compositional link between Chelyabinska and 1999NC43. Mineralogical analysis of Chelyabinsk (LL chondrite) and (8) Flora (the largest member of the presumed LL chondrite parent family) shows that their olivine and pyroxene chemistries are similar to LL chondrites. Similar analysis of 1999 NC43 shows that its olivine and ...

  11. nC60 deposition kinetics: the complex contribution of humic acid, ion concentration, and valence.

    Science.gov (United States)

    McNew, Coy P; LeBoeuf, Eugene J

    2016-07-01

    The demonstrated toxicity coupled with inevitable environmental release of nC60 raise serious concerns about its environmental fate and transport, therefore it is crucial to understand how nC60 will interact with subsurface materials including attached phase soil and sediment organic matter (AP-SOM). This study investigated the attachment of nC60 onto a Harpeth humic acid (HHA) coated silica surface under various solution conditions using a quartz crystal microbalance with dissipation monitoring. The HHA coating greatly enhanced nC60 attachment at low ion concentrations while hindering attachment at high ion concentrations in the presence of both mono and divalent cations. At low ion concentrations, the HHA greatly reduced the surface potential of the silica, enhancing nC60 deposition through reduction in the electrostatic repulsion. At high ion concentrations however, the reduced surface potential became less important due to the near zero energy barrier to deposition and therefore non-DLVO forces dominated, induced by compaction of the HHA layer, and leading to hindered attachment. In this manner, observed contributions from the HHA layer were more complex than previously reported and by monitoring surface charge and calculated DLVO interaction energy alongside attachment experiments, this study advances the mechanistic understanding of the variable attachment contributions from the humic acid layer. PMID:27061365

  12. Kinetic models of the interference of gene transcription to ncRNA and mRNA

    Science.gov (United States)

    Zhdanov, Vladimir P.

    2011-06-01

    The experiments indicate that the transcription of genes into ncRNA can positively or negatively interfere with transcription into mRNA. We propose two kinetic models describing this effect. The first model is focused on the ncRNA-induced chromatin modification facilitating the transcription of the downstream gene into mRNA. The second model includes the competition between the transcription into ncRNA and the binding of activator to a regulatory site of the downstream gene transcribed into mRNA. Our analysis based on the mean-field kinetic equations and Monte Carlo simulations shows the likely dependences of the transcription rate on RNA polymerase concentration in situations with different rate-limiting steps. Our models can also be used to scrutinize the dependence of the transcription rate on other kinetic parameters. Our kinetic Monte Carlo simulations show that the first model predicts stochastic bursts in the mRNA formation provided that the transcription into ncRNA is slow, while the second model predicts in addition anti-phase stochastic bursts in the mRNA and ncRNA formation provided that that the protein attachment to and detachment from a regulatory site is slow.

  13. Delta I=1/2 and ε'ε in Large-Nc QCD

    International Nuclear Information System (INIS)

    We present new results for the matrix elements of the Q6 and Q4 penguin operators, evaluated in a large-Nc approach which incorporates important O(Nc2/{nf}{Nc}) unfactorized contributions. Our approach shows analytic matching between short- and long-distance scale dependences within dimensional renormalization schemes, such as MS-bar. Numerically, we find that there is a large positive contribution to the Delta I =1/2 matrix element of Q6 and hence to the direct CP-violation parameter epsilon'/epsilon. We also present results for the Delta I = 1/2 rule in K→ππ amplitudes, which incorporate the related and important 'eye-diagram' contributions of O(Nc2/{1}/{Nc}) from the Q2 operator (i.e. the penguin-like contraction). The results lead to an enhancement of the Delta I = 1/2 effective coupling. The origin of the large unfactorized contributions which we find is discussed in terms of the relevant scales of the problem. (author)

  14. Polarization memory effect in the photoluminescence of nc-Si-SiOx light-emitting structures.

    Science.gov (United States)

    Michailovska, Katerina; Indutnyi, Ivan; Shepeliavyi, Petro; Sopinskyy, Mykola

    2016-12-01

    The polarization memory (PM) effect in the photoluminescence (PL) of the porous nc-Si-SiOx light-emitting structures, containing nanoparticles of silicon (nc-Si) in the oxide matrix and passivated in a solution of hydrofluoric acid (HF), has been investigated. The studied nc-Si-SiOx structures were produced by evaporation of Si monoxide (SiO) powder in vacuum and oblique deposition on Si wafer, and then the deposited silicon oxide (SiOx) films were annealed in the vacuum at 975 °C to grow nc-Si. It was found that the PM effect in the PL is observed only after passivation of nanostructures: during etching in HF solution, the initial symmetric nc-Si becomes asymmetric elongated. It was also found that in investigated nanostructures, there is a defined orientational dependence of the PL polarization degree (ρ) in the sample plane which correlates with the orientation of SiOx nanocolumns, forming the structure of the porous layer. The increase of the ρ values in the long-wavelength spectral range with time of HF treatment can be associated with increasing of the anisotropy of large Si nanoparticles. The PM effect for this spectral interval can be described by the dielectric model. In the short-wavelength spectral range, the dependence of the ρ values agrees qualitatively with the quantum confinement effect. PMID:27255897

  15. Potential energy surface and quasiclassical trajectory studies of the CN+H2 reaction

    International Nuclear Information System (INIS)

    We present dynamical studies of the CN+H2 reaction based on an empirical potential energy surface that is derived from high quality ab initio calculations. The ab initio calculations, which use a multireference configuration interaction method with large correlation consistent basis sets, indicate that the linear HHCN barrier is about 4.3 kcal/mol above CN+H2, and that there is no reaction path which connects CN+H2 to the stable intermediate H2CN, although there is a path for dissociation of H2CN to H+HCN. The empirical surface is written as a sum of two-, three-, and four-body terms, with the two- and three-body terms for HCN based on an accurate global surface that describes both the HCN and HNC force fields. The four-body terms are developed so as to describe the HHCN linear saddle point and the H2CN minimum accurately, as well as dissociation of H2CN into HCN+H, and the ridge which separates the abstraction and H2CN dissociation pathways. Other features of the potential surface, such as the HCNH cis and trans minima, and the pathways leading to the formation of HNC+H are also described, though less accurately. Three different choices for the HHCN saddle point properties are considered. We find that the surface which matches the ab initio barrier energy most accurately gives rate constants that are too low. Much better agreement is obtained using a 3.2 kcal/mol barrier. The trajectory results show typical dependence of the CN+H2 reactive cross sections on initial translational energy and initial vibration/rotation state, with CN behaving as a spectator and H2 playing an active role in the reaction dynamics. Analysis of the H+HCN products indicates that both the C-H stretch and bend modes are significantly excited, with bend excitation showing strong sensitivity to the saddle point properties and to reagent translational energy

  16. Nuclear Quadrupole Hyperfine Structure in HC14N/H14NC and DC15N/D15NC Isomerization: A Diagnostic Tool for Characterizing Vibrational Localization

    CERN Document Server

    Wong, Bryan M

    2010-01-01

    Large-amplitude molecular motions which occur during isomerization can cause significant changes in electronic structure. These variations in electronic properties can be used to identify vibrationally-excited eigenstates which are localized along the potential energy surface. This work demonstrates that nuclear quadrupole hyperfine interactions can be used as a diagnostic marker of progress along the isomerization path in both the HC14N/H14NC and DC15N/D15NC chemical systems. Ab initio calculations at the CCSD(T)/cc-pCVQZ level indicate that the hyperfine interaction is extremely sensitive to the chemical bonding of the quadrupolar 14N nucleus and can therefore be used to determine in which potential well the vibrational wavefunction is localized. A natural bonding orbital analysis along the isomerization path further demonstrates that hyperfine interactions arise from the asphericity of the electron density at the quadrupolar nucleus. Using the CCSD(T) potential surface, the quadrupole coupling constants of...

  17. Study of the effect of the silver content on the structural and mechanical behavior of Ag–ZrCN coatings for orthopedic prostheses

    International Nuclear Information System (INIS)

    With the increase of elderly population and health problems that are arising nowadays, hip joint prostheses are being widely used. However, it is estimated that 20% of hip replacement surgeries simply fails after few years, mainly due to wear fatigue. Bearing this in mind, this work reports on the development of new coatings that are able to sustain long and innocuous life inside the patient, which will confer to the usual biomaterials improved physical, mechanical and tribological properties. In particular, the development of multifunctional coatings based on Ag-ZrCN, prepared by DC reactive magnetron sputtering using two targets, Zr and a modified Zr target, in an Ar + C2H2 + N2 atmosphere. Silver pellets were placed in the erosion area of the alloyed Zr target in order to obtain a silver content up to 8 at.%. The structural results obtained by x-ray diffraction show that the coatings crystallize in a NaCl crystal structure typical of ZrC1-xNx. The increase of Ag content promoted the formation of an additional a-CNx amorphous phase, besides a silver crystalline phase. Hardness is decreasing, as increasing silver content. Despite the low thicknesses, adhesion values (LC3) can be considered as good. Dynamic fatigue results suggest that these coatings system can be a real asset in terms of mechanical properties, by improving the performance of usual Stainless Steel 316 L biomaterials. - Highlights: • ZrCN, silver and carbon based amorphous phases, form the structure of the coatings. • Ag–ZrCN coatings have a high capacity to withstand an impact load without fracturing. • Silver incorporation reduces the fatigue failures of the coatings. • The films possess mechanical resistance and biocompatibility, required in prostheses

  18. Compositional, structural and mechanical characteristics of nc-TiC/a-C:H nanocomposite films

    International Nuclear Information System (INIS)

    Nanocomposite nc-TiC/a-C:H films, with an unusual combination of superhardness, high elastic modulus and high elastic recovery, are prepared by filtered cathodic vacuum arc technique using the C2H2 gas as the precursor. The effects of filter coil current on compositional, structural and mechanical properties of the nc-TiC/a-C:H films have been investigated by X-ray diffraction (XRD), X-ray photoelectron spectroscopy (XPS), energy disperse spectroscopy (EDS), microindentation and tribotester measurements. XPS and Raman analyses show that composition and nanostructure of the nc-TiC/a-C:H films can be changed by varying the filter coil current. By selecting the proper value of filter coil current, 2.5 A, one can remarkably enhance the mechanical properties of films such as superhardness (43.6 GPa). The superhardness can be ascribed to the phase variation and the nanostructure.

  19. NC INCREMENTAL SHEET METAL FORMING PROCESS AND VERTICAL WALL SQUARE BOX FORMING

    Institute of Scientific and Technical Information of China (English)

    Zhou Liuru; Mo Jianhua; Xiao Xiangzhi

    2004-01-01

    The forming principle and deformation analysis of NC incremental sheet metal forming process as well as the process planning, experiment and key process parameters of vertical wall square box forming are presented. Because the deformation of sheet metal only occurs around the tool head and the deformed region is subjected to stretch deformation, the deformed region of sheet metal thins, and surface area increases. Sheet metal forming stepwise is to lead to the whole sheet metal deformation. The forming half-apex angle θ and corner radius R are the main process parameters in NC incremental forming of vertical wall square box. According to sine law, a vertical wall square box can't be formed by NC incremental sheet metal forming process in a single process, rather, it must be formed in multi processes. Thus, the parallel line type tool path process method is presented to form the vertical wall square box, and the experiment and analysis are made to verify it.

  20. Comments on a Minimal Quasiparticle Approach for the QGP and Its Large-Nc Limits

    International Nuclear Information System (INIS)

    A minimal quasiparticle approach for describing QGP at temperatures much higher than the critical one is discussed. It involves an ideal-gas framework in which quark and gluon masses depend on temperature. This model is able to reproduce the recent equations of state computed in lattice QCD for temperatures typically higher than 2 Tc, in a range in which it is reasonable to neglect interactions between quasiparticles. In addition, the equations of state for a generic gauge theory with gauge groups SU(Nc) and quarks in an arbitrary representation are studied. The gauge independence in the pure glue sector and the large-N c equivalence between the gauge groups SU(Nc) and SO(2Nc) in a full plasma is finally shown for normalized thermodynamic quantities. (author)

  1. Multi-agent System for Process Planning in Step-nc Based Manufacturing

    Directory of Open Access Journals (Sweden)

    Juan Du

    2012-09-01

    Full Text Available In order to realize STEP-NC-oriented computer numerical control machining and achieve optimal performance in manufacturing, a multi-agent system for process planning in STEP-NC based manufacturing was designed. By analyzing the characteristic of STEP-NC data model, a manufacturing feature-oriented process planning method was proposed in this study and the distributed artificial intelligence methods, namely collaborative multi-agent was employed to accomplish process planning of part. The proposed multi-agent system consists of three types of autonomous agents, which are global manager agents, planning agents and manufacturing resource agents, respectively. Process planning can be automatically completed by multiple agents’ cooperation. Each agent is capable of communicating to each other through improved Knowledge Query and Manipulation Language (KQML. At last, one test part was designed and simulated to demonstrate the capabilities of this research in the study.

  2. Reactions of the CN Radical with Benzene and Toluene: Product Detection and Low-Temperature Kinetics

    Energy Technology Data Exchange (ETDEWEB)

    Trevitt, Adam J.; Goulay, Fabien; Taatjes, Craig A.; Osborn, David L.; Leone, Stephen R.

    2009-12-23

    Low temperature rate coefficients are measured for the CN + benzene and CN + toluene reactions using the pulsed Laval nozzle expansion technique coupled with laser-induced fluorescence detection. The CN + benzene reaction rate coefficient at 105, 165 and 295 K is found to be relatively constant over this temperature range, 3.9 - 4.9 x 10-10 cm3 molecule-1 s-1. These rapid kinetics, along with the observed negligible temperature dependence, are consistent with a barrierless reaction entrance channel and reaction efficiencies approaching unity. The CN + toluene reaction is measured to have a slower rate coefficient of 1.3 x 10-10 cm3 molecule-1 s-1 at 105 K. At room temperature, non-exponential decay profiles are observed for this reaction that may suggest significant back-dissociation of intermediate complexes. In separate experiments, the products of these reactions are probed at room temperature using synchrotron VUV photoionization mass spectrometry. For CN + benzene, cyanobenzene (C6H5CN) is the only product recorded with no detectable evidence for a C6H5 + HCN product channel. In the case of CN + toluene, cyanotoluene (NCC6H4CH3) constitutes the only detected product. It is not possible to differentiate among the ortho, meta and para isomers of cyanotoluene because of their similar ionization energies and the ~;; 40 meV photon energy resolution of the experiment. There is no significant detection of benzyl radicals (C6H5CH2) that would suggest a H-abstraction or a HCN elimination channel is prominent at these conditions. As both reactions are measured to be rapid at 105 K, appearing to have barrierless entrance channels, it follows that they will proceed efficiently at the temperatures of Saturn?s moon Titan (~;;100 K) and are also likely to proceed at the temperature of interstellar clouds (10-20 K).

  3. Discovery of Novel ncRNA Sequences in Multiple Genome Alignments on the Basis of Conserved and Stable Secondary Structures

    OpenAIRE

    Fu, Yinghan; Xu, Zhenjiang Zech; Lu, Zhi J.; ZHAO, SHAN; Mathews, David H.

    2015-01-01

    Recently, non-coding RNAs (ncRNAs) have been discovered with novel functions, and it has been appreciated that there is pervasive transcription of genomes. Moreover, many novel ncRNAs are not conserved on the primary sequence level. Therefore, de novo computational ncRNA detection that is accurate and efficient is desirable. The purpose of this study is to develop a ncRNA detection method based on conservation of structure in more than two genomes. A new method called Multifind, using Multili...

  4. An overview of the role of context-sensitive HMMs in the prediction of ncRNA genes

    OpenAIRE

    Yoon, Byung-Jun; Vaidyanathan, P.P.

    2005-01-01

    Non-coding RNAs (ncRNA) are RNA molecules that function in the cells without being translated into proteins. In recent years, much evidence has been found that ncRNAs play a crucial role in various biological processes. As a result, there has been an increasing interest in the prediction of ncRNA genes. Due to the conserved secondary structure in ncRNAs, there exist pairwise dependencies between distant bases. These dependencies cannot be effectively modeled using traditional HMMs, and we nee...

  5. Role of the NC-loop in catalytic activity and stability in lipase from Fervidobacterium changbaicum.

    Directory of Open Access Journals (Sweden)

    Binchun Li

    Full Text Available Flexible NC-loops between the catalytic domain and the cap domain of the α/β hydrolase fold enzymes show remarkable diversity in length, sequence, and configuration. Recent investigations have suggested that the NC-loop might be involved in catalysis and substrate recognition in many enzymes from the α/β hydrolase fold superfamily. To foster a deep understanding of its role in catalysis, stability, and divergent evolution, we here systemically investigated the function of the NC-loop (residues 131-151 in a lipase (FClip1 from thermophilic bacterium Fervidobacterium changbaicum by loop deletion, alanine-scanning mutagenesis and site-directed mutagenesis. We found that the upper part of the NC-loop (residues 131-138 was of great importance to enzyme catalysis. Single substitutions in this region could fine-tune the activity of FClip1 as much as 41-fold, and any deletions from this region rendered the enzyme completely inactive. The lower part of the NC-loop (residues 139-151 was capable of enduring extensive deletions without loss of activity. The shortened mutants in this region were found to show both improved activity and increased stability simultaneously. We therefore speculated that the NC-loop, especially the lower part, would be a perfect target for enzyme engineering to optimize the enzymatic properties, and might present a hot zone for the divergent evolution of α/β hydrolases. Our findings may provide an opportunity for better understanding of the mechanism of divergent evolution in the α/β hydrolase fold superfamily, and may also guide the design of novel biocatalysts for industrial applications.

  6. 大腸菌L-form NC7の濁土変化と増殖に及ぼす浸透的安定剤の効果

    OpenAIRE

    小野田, 哲夫; 大島, 朗伸

    1988-01-01

    The effects of osmotic stabilizers on swelling and growth of L-form NC7 derived from Escherichia coli K 12 were examined. The presence of impermeable solute , such as NaCl or KCl, in the suspended medium were effective as osmotic stabilizer, while permeable solute, such as glycerol were ineffective . On the other hand, when sucrose was used as osmotic stabilizer, in cells upshocked with 0.2 M sucrose, rapid decrease in optical density and then slow restoration were observed. In the upshocked ...

  7. OpenCL programming guide

    CERN Document Server

    Munshi, Aaftab; Mattson, Timothy G; Fung, James; Ginsburg, Dan

    2011-01-01

    Using the new OpenCL (Open Computing Language) standard, you can write applications that access all available programming resources: CPUs, GPUs, and other processors such as DSPs and the Cell/B.E. processor. Already implemented by Apple, AMD, Intel, IBM, NVIDIA, and other leaders, OpenCL has outstanding potential for PCs, servers, handheld/embedded devices, high performance computing, and even cloud systems. This is the first comprehensive, authoritative, and practical guide to OpenCL 1.1 specifically for working developers and software architects. Written by five leading OpenCL authorities, OpenCL Programming Guide covers the entire specification. It reviews key use cases, shows how OpenCL can express a wide range of parallel algorithms, and offers complete reference material on both the API and OpenCL C programming language. Through complete case studies and downloadable code examples, the authors show how to write complex parallel programs that decompose workloads across many different devices. They...

  8. Sublimation of the Endohedral Fullerene Er3N@C80

    OpenAIRE

    Stibor, Alexander; Schefzyk, Hannah; Fortágh, József

    2009-01-01

    The heat of sublimation of the endohedral metallofullerene Er3N@C80 was measured via Knudsen effusion mass spectrometry. The large molecule consists of a C80 fullerene cage which is stabilized by comprising a complex of three erbium atoms bounded to a nitrogen atom and has a mass of 1475 amu. The mass spectrum at a temperature of 1045 K and the relative intensities of the thermal fractions of Er3N@C80 are provided. We also discuss possible thermal decomposition processes for these particles. ...

  9. Covariant meson-baryon scattering with chiral and large Nc constraints

    International Nuclear Information System (INIS)

    We give a review of recent progress on the application of the relativistic chiral SU(3) Lagrangian to meson-baryon scattering. It is shown that a combined chiral and 1/Nc expansion of the Bethe-Salpeter interaction kernel leads to a good description of the kaon-nucleon, antikaon-nucleon and pion-nucleon scattering data typically up to laboratory momenta of plab ≅ 500 MeV. We solve the covariant coupled channel Bethe-Salpeter equation with the interaction kernel truncated to chiral order Q3 where we include only those terms which are leading in the large Nc limit of QCD. (orig.)

  10. A Search for Neutrino Induced Coherent NC($\\pi^{0}$) Production in the MINOS Near Detector

    Energy Technology Data Exchange (ETDEWEB)

    Cherdack, Daniel David [Tufts Univ., Medford, MA (United States)

    2011-02-01

    The production of single, highly forward π0 mesons by NC coherent neutrino-nucleus interactions (νμ + N → νμ + N + π0) is a process which probes fundamental aspects of the weak interaction. This reaction may also pose as a limiting background for long baseline searches for νμ → νe oscillations if the neutrino mixing angle θ13 is very small. The high-statistics sample of neutrino interactions recorded by the MINOS Near Detector provides an opportunity to measure the cross section of this coherent reaction on a relatively large-A nucleus at an average Ev = 4.9 GeV. A major challenge for this measurement is the isolation of forward-going electromagnetic (EM) showers produced by the relatively rare coherent NC0) process amidst an abundant rate of incoherently produced EM showers. The backgrounds arise from single π0 dominated NC events and also from quasi-elastic-like CC scattering of electron neutrinos. In this Thesis the theory of coherent interactions is summarized, and previous measurements of the coherent NC0) cross section are reviewed. Then, methods for selecting a sample of coherent NC0) like events, extracting the coherent NC0) event rate from that sample, estimating the analysis uncertainties, and calculating a cross section, are presented. A signal for neutrino-induced NC0) production is observed in the relevant kinematic regime as an excess of events of three standard deviations above background. The reaction cross sections, averaged over an energy window of 2.5 ≤ Ev ≤ 9.0 GeV is determined to be (31.6±10.5) x 10-40 cm2/nucleus. The result is the first evidence obtained for neutrino-nucleus coherent NC0) scattering on iron, and is the first measurement on an average nuclear target above A = 30. The cross section measurement

  11. RNAspace.org: An integrated environment for the prediction, annotation, and analysis of ncRNA

    OpenAIRE

    Cros, Marie-Josee; de Monte, Antoine; Mariette, Jérôme; Bardou, Philippe; Grenier-Boley, Benjamin; Gautheret, Daniel

    2011-01-01

    The annotation of noncoding RNA genes remains a major bottleneck in genome sequencing projects. Most genome sequences released today still come with sets of tRNAs and rRNAs as the only annotated RNA elements, ignoring hundreds of other RNA families. We have developed a web environment that is dedicated to noncoding RNA (ncRNA) prediction, annotation, and analysis and allows users to run a variety of tools in an integrated and flexible manner. This environment offers complementary ncRNA gene f...

  12. DARIO: a ncRNA detection and analysis tool for next-generation sequencing experiments

    OpenAIRE

    Fasold, Mario; Langenberger, David; Binder, Hans; Stadler, Peter F.; Hoffmann, Steve

    2011-01-01

    Small non-coding RNAs (ncRNAs) such as microRNAs, snoRNAs and tRNAs are a diverse collection of molecules with several important biological functions. Current methods for high-throughput sequencing for the first time offer the opportunity to investigate the entire ncRNAome in an essentially unbiased way. However, there is a substantial need for methods that allow a convenient analysis of these overwhelmingly large data sets. Here, we present DARIO, a free web service that allows to study shor...

  13. A Search for Neutrino Induced Coherent NC($\\pi^{0}$) Production in the MINOS Near Detector

    Energy Technology Data Exchange (ETDEWEB)

    Cherdack, Daniel David; /Tufts U.

    2010-11-01

    The production of single, highly forward {pi}{sup 0} mesons by NC coherent neutrino-nucleus interactions ({nu}{sub {mu}} + N {yields} {nu}{sub {mu}} + N + {pi}{sup 0}) is a process which probes fundamental aspects of the weak interaction. This reaction may also pose as a limiting background for long baseline searches for {nu}{sub {mu}} {yields} {nu}{sub e} oscillations if the neutrino mixing angle {theta}{sub 13} is very small. The high-statistics sample of neutrino interactions recorded by the MINOS Near Detector provides an opportunity to measure the cross section of this coherent reaction on a relatively large-A nucleus at an average E{sub {nu}} = 4.9 GeV. A major challenge for this measurement is the isolation of forward-going electromagnetic (EM) showers produced by the relatively rare coherent NC({pi}{sup 0}) process amidst an abundant rate of incoherently produced EM showers. The backgrounds arise from single {pi}{sup 0} dominated NC events and also from quasi-elastic-like CC scattering of electron neutrinos. In this Thesis the theory of coherent interactions is summarized, and previous measurements of the coherent NC({pi}{sup 0}) cross section are reviewed. Then, methods for selecting a sample of coherent NC({pi}{sup 0}) like events, extracting the coherent NC({pi}{sup 0}) event rate from that sample, estimating the analysis uncertainties, and calculating a cross section, are presented. A signal for neutrino-induced NC({pi}{sup 0}) production is observed in the relevant kinematic regime as an excess of events of three standard deviations above background. The reaction cross sections, averaged over an energy window of 2.5 {<=} E{sub {nu}} {<=} 9.0 GeV is determined to be (31.6{+-}10.5) x 10{sup -40} cm{sup 2}/nucleus. The result is the first evidence obtained for neutrino-nucleus coherent NC({pi}{sup 0}) scattering on iron, and is the first measurement on an average nuclear target above A = 30. The cross section measurement is in agreement with NEUGEN3

  14. The NC Power Supply Design of Large Current and Wide Frequency Pulse in SEAM

    OpenAIRE

    Jianping Zhou; Yan Xu; Qiang He; Bisheng Zhou

    2013-01-01

    There are a lot of ways to achieve large current pulse power supply, and the more common way is to adopt the inverter switching circuit to achieve pulse power supply. The core of the NC power supply design of large current and wide frequency pulse in SEAM is using two-stage modulation. Combined with inverter technology, DC chopper technology and NC technology, it not only can achieve the adjustability of the output pulse amplitude, but also can realize continuous adjustment of the output puls...

  15. CyNC - a method for Real Time Analysis of Systems with Cyclic Data Flows

    DEFF Research Database (Denmark)

    Schiøler, Henrik; Nielsen, Jens F. Dalsgaard; Larsen, Kim Guldstrand;

    2005-01-01

    The paper addresses a novel method for realtime analysis of systems with cyclic data flows. The presented method is based on Network Calculus principles, where upper and lower flow and service constraint are used to bound data flows and processing resources. In acyclic systems flow constraints may...... equation in a space of constraint functions. In this paper a method denoted CyNC for obtaining a well defined solution to that problem is presented along with a theoretical justification of the method as well as comparative results for CyNC and alternative methods on a relevant example. The method is...

  16. Historia clínica

    OpenAIRE

    Juan Martínez Hernández

    2006-01-01

    La historia clínica ha estado regulada hasta la actualidad por diferentes disposiciones legislativas con base en la Ley General de Sanidad 14/1986, de 25 de abril. Con la Ley 41/2002, de 14 de noviembre, básica y reguladora de la autonomía del paciente y de derechos y obligaciones en materia de información y documentación clínica, se actualizan los derechos y obligaciones de los pacientes o usuarios y profesionales, entre ellos los relativos a la historia clínica. En el pres...

  17. 76 FR 59067 - Airworthiness Directives; Bombardier, Inc. Model CL-600-2B16 (CL-601-3A, CL-601-3R, and CL-604...

    Science.gov (United States)

    2011-09-23

    ... ``significant rule'' under the DOT Regulatory Policies and Procedures (44 FR 11034, February 26, 1979); and 3.... Model CL-600-2B16 (CL- 601-3A, CL-601-3R, and CL-604 Variants) Airplanes AGENCY: Federal Aviation...) events have occurred where the Air-Driven Generator (ADG) failed to provide power on CL-600-2B19...

  18. CN and C2 vibrational spectra analysis in molecular LIBS of organic materials

    Science.gov (United States)

    Mousavi, S. J.; Hemati Farsani, M.; Darbani, S. M. R.; Mousaviazar, A.; Soltanolkotabi, M.; Eslami Majd, A.

    2016-05-01

    With the objective of investigation of the influence of molecular structure on CN violet and C2 Swan bands system spectra, plasma emissions from different organic materials, including polycyclic aromatic hydrocarbons, aromatic carboxylic acid, aliphatic carboxylic acid, amides and polymers, have been analyzed by laser-induced breakdown spectroscopy (LIBS) technique in air. To evaluate the influence of N2 and O2 molecules concentration on the CN and C2 molecular emissions, LIB spectra of four different samples have been recorded in air (approximately 80 % N2 and 20 % O2), nitrogen, oxygen and argon atmospheres. Experimental results indicate that the main reason for the absence of C2 emission in LIB spectra of samples which do not contain C-C bonds, when measurements were taken in air, is the presence of oxygen which could potentially deplete C2 emission rather than the absence of C-C bonds in their structure. Also, comparisons between experiment and theory spectra are made using a Nelder-Mead temperature program for CN and C2 bands with the ∆ν = 0 sequences from LIB spectra of different samples in various atmospheres. Furthermore, CN and C2 vibrational temperatures in Kelvin (K) are calculated from these spectral fittings. Both CN and C2 vibrational temperatures have highest values in argon atmosphere, and increasing the oxygen concentration in ambient atmosphere decreased those in most cases.

  19. Thermodynamic stability of in situ W–ZrC and W–Zr(CN) composites

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Jae-Hee [Korea Aerospace Research Institute, Daejeon 305-806 (Korea, Republic of); Zhe, Gao [Saint-Gobain Research Shanghai Co., Ltd, Wenjing-road, Minhang-district, Shanghai 200245 (China); Lim, Jaehyuk [Samsung Electronics, Yongin 446-811 (Korea, Republic of); Park, Choongkwon [Department of Materials Science and Engineering, Seoul National University, Seoul 151-744 (Korea, Republic of); Kang, Shinhoo, E-mail: shinkang@snu.ac.kr [Department of Materials Science and Engineering, Seoul National University, Seoul 151-744 (Korea, Republic of)

    2015-10-25

    Powders of W–ZrC and W–Zr(CN) were carbothermally synthesized in situ from milled mixtures of graphite, WO{sub 3} and ZrO{sub 2}. The thermal stability of Zr(CN) in a W matrix was simulated and compared with that of ZrC in W in terms of free energy change and carbide coarsening. Carbon and nitrogen had high mutual affinity in Zr(CN) of B1 crystal structure, which led their activity curves to exhibit strong negative deviation from ideal mixing behavior. Zr(CN) was more stable than ZrC up to 2075 K; however, a microstructural study showed that it became less stable than ZrC at around 1975 K. This result is attributed to the decreasing thermodynamic stability of ZrN with increasing temperature. Other transition metal carbonitrides containing group 4–6 elements are expected to show similar coarsening behaviors at high temperatures. - Highlights: • The Zr(CN) phase formed due to the high affinity between C and N in ZrC. • A complete reversal of the slope is found in the formation energy curves. • The growth of the carbonitride is due to the nitrogen, reducing the stability. • Solid solutions containing group 4 elements would show similar growth behavior.

  20. Probing the gaseous disk of T Tau N with CN 5-4 lines

    CERN Document Server

    Podio, L; Codella, C; Nisini, B; Aresu, G; Brittain, S; Cabrit, S; Dougados, C; Grady, C; Meijerink, R; Sandell, G; Spaans, M; Thi, W -F; White, G J; Woitke, P

    2014-01-01

    We present spectrally resolved Herschel/HIFI observations of the young multiple system T Tau in atomic and molecular lines. While CO, H2O, [C II], and SO lines trace the envelope and the outflowing gas up to velocities of 33 km/s with respect to systemic, the CN 5-4 hyperfine structure lines at 566.7, 566.9 GHz show a narrow double-peaked profile centered at systemic velocity, consistent with an origin in the outer region of the compact disk of T Tau N. Disk modeling of the T Tau N disk with the thermo-chemical code ProDiMo produces CN line fluxes and profiles consistent with the observed ones and constrain the size of the gaseous disk (R_out = 110 (+10, -20) AU) and its inclination (i = 25 \\pm 5 degree). The model indicates that the CN lines originate in a disk upper layer at 40-110 AU from the star, which is irradiated by the stellar UV field and heated up to temperatures of 50-700 K. With respect to previously observed CN 2-1 millimeter lines, the CN 5-4 lines appear to be less affected by envelope emissio...

  1. A CH3CN and HCO+ survey towards southern methanol masers associated with star formation

    CERN Document Server

    Purcell, C R; Burton, M G; Walsh, A J; Minier, V; Hunt-Cunningham, M R; Kedziora-Chudczer, L L; Longmore, S N; Hill, T; Bains, I; Barnes, P J; Busfield, A L; Calisse, P; Crighton, N H M; Curran, S J; Davis, T M; Dempsey, J T; Derragopian, G; Fulton, B R; Hidas, M G; Hoare, M G; Lee, J K; Ladd, E F; Lumsden, S L; Moore, T J T; Murphy, M T; Oudmaijer, R D; Pracy, M B; Rathborne, J; Robertson, S; Schultz, A S B; Shobbrook, J; Sparks, P A; Storey, J; Travouillion, T

    2005-01-01

    We present the initial results of a 3-mm spectral line survey towards 83 methanol maser selected massive star-forming regions. Here we report observations of the J=5-4 and 6-5 rotational transitions of methyl cyanide (CH3CN) and the J=1-0 transition of HCO+and H13CO+. CH3CN emission is detected in 58 sources (70 %) of our sample). We estimate the temperature and column density for 37 of these using the rotational diagram method. The temperatures we derive range from 28-166 K, and are lower than previously reported temperatures, derived from higher J transitions. We find that CH3CN is brighter and more commonly detected towards ultra-compact HII (UCHII) regions than towards isolated maser sources. Detection of CH3CN towards isolated maser sources strongly suggests that these objects are internally heated and that CH3CN is excited prior to the UCHII phase of massive star-formation. HCO+ is detected towards 82 sources (99 % of our sample), many of which exhibit asymmetric line profiles compared to H13CO+. Skewed...

  2. Circumstellar C2, CN, and CH+ in the optical spectra of post-AGB stars

    CERN Document Server

    Bakker, E J; Waters, L B F M; Schoenmaker, T; Bakker, Eric J.; Dishoeck, Ewine F. van; Schoenmaker, Ton

    1996-01-01

    We present optical high-resolution spectra of a sample of sixteen post-AGB stars and IRC +10216. Of the post-AGB stars, ten show C2 Phillips and Swan and CN Red System absorption, one CH+ emission, one CH+ absorption, and four without any molecules. We find typically Trot=43-399, 155-202, and 18-50 K, log N = 14.90-15.57, 14.35, and 15.03-16.47 cm-2 for C2, CH+, and CN respectively, and 0.620. The presence of C2 and CN absorption is correlated with cold dust (Tdust300K). All objects with the unidentified 21mum emission feature exhibit C2 and CN absorption, but not all objects with C2 and CN detections exhibit a 21mum feature. The derived expansion velocity, ranging from 5 to 44 km/s, is the same as that derived from CO millimeter line emission. This unambiguously proves that these lines are of circumstellar origin and are formed in the AGB ejecta (circumstellar shell expelled during the preceding AGB phase). Furthermore there seems to be a relation between the C2 molecular column density and the expansion vel...

  3. SO(n)-Invariant Special Lagrangian Submanifolds of Cn+1 with Fixed Loci

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    Let SO(n) act in the standard way on Cn and extend this action in the usual way toCn+1=C((+))Cn.It is shown that a nonsingular special Lagrangian submanifold L (∩) Cn+1 that is invariant under this SO(n)-action intersects the fixed C (∩) Cn+1 in a nonsingular real-analytic arc A (which may be empty). If n > 2, then A has no compact component.Conversely, an embedded, noncompact nonsingular real-analytic arc A (∩) C lies in an embedded nonsingular special Lagrangian submanifold that is SO(n)-invariant. The same existence result holds for compact A if n = 2. If A is connected, there exist n distinct nonsingular SO(n)-invariant special Lagrangian extensions of A such that any embedded nonsingular SO(n)-invariant special Lagrangian extension of A agrees with one of these n extensions in some open neighborhood of A.The method employed is an analysis of a singular nonlinear PDE and ultimately calls on the work of Gérard and Tahara to prove the existence of the extension.

  4. 微腔中nc-Si/SiN超晶格的光致发光%Photoluminescence of nc-Si/SiN Superlattices Embedded in Optical Microcavities

    Institute of Scientific and Technical Information of China (English)

    陈三; 黄信凡; 钱波; 陈坤基; 岑展鸿; 刘艳松; 韩培高; 马忠元; 徐骏; 李伟

    2006-01-01

    We fabricate a-Si/a-SiNz superlattices and a one-dimensional amorphous silicon nitride photonic crystal microcavity by plasma enhancement chemical vapor deposition (PECVD). To improve the light-emitting efficiency of the nc-Si/a-SiNz superlattices, which are made from a-Si/a-SiNz superlattices by laser annealing, an nc-Si quantum dot array is inserted into the photonic crystal microcavity. Raman spectroscopy and transmission electron microscopy analysis show that nc-Si with a size of 4nm,which is close to the designed thickness of the a-Si sublayers,is formed in the a-Si sublayers. Owing to microcavity effects,the PL peak of the nc-Si/a-SiNz superlattices embedded in the microcavity is strongly narrowed, and the intensity of the PL is enhanced by two orders of magnitude with respect to the emission of λ/2-thick nc-Si/a-SiNz superlattices. Light emission at a cavity-resonant frequency from the nc-Si/a-SiNz superlattices is enhanced while other frequencies are forbidden. This leads to the narrowing of the PL spectrum and enhancement of the intensity.%研究了一维光子晶体微腔结构对nc-Si/a-SiNz超晶格发射的调制.一维光子晶体微腔采用两种具有不同折射率的非化学组分非晶氮化硅的周期调制结构,腔中嵌入采用激光晶化方法制备的硅量子点阵列,从Raman谱和透射电子显微镜分析得到其尺寸约为3~4 nm.从光致发光谱上观察到明显的选模作用、明显变窄的发光峰以及约两个量级的发光强度的增强.微腔对硅量子点阵列发光的调制主要表现在两个方面:共振模式的增强和非共振模式的抑制.硅量子点中位于腔共振模式的辐射跃迁被增强,非共振模式的辐射跃迁被抑制,因此位于腔共振频率处的跃迁通道成为硅量子点中唯一的辐射跃迁通道,导致光致发光谱的窄化和强度的增强.因此,在提高硅材料发光效率方面,光子晶体微腔具有非常大的应用前景.

  5. Microarray analysis of ncRNA expression patterns in Caenorhabditis elegans after RNAi against snoRNA associated proteins

    Directory of Open Access Journals (Sweden)

    Skogerbø Geir

    2008-06-01

    Full Text Available Abstract Background Short non-coding RNAs (ncRNAs perform their cellular functions in ribonucleoprotein (RNP complexes, which are also essential for maintaining the stability of the ncRNAs. Depletion of individual protein components of non-coding ribonucleoprotein (ncRNP particles by RNA interference (RNAi may therefore affect expression levels of the corresponding ncRNA, and depletion of candidate associated proteins may constitute an alternative strategy when investigating ncRNA-protein interactions and ncRNA functions. Therefore, we carried out a pilot study in which the effects of RNAi against protein components of small nucleolar RNPs (snoRNPs in Caenorhabditis elegans were observed on an ncRNA microarray. Results RNAi against individual C. elegans protein components of snoRNPs produced strongly reduced mRNA levels and distinct phenotypes for all targeted proteins. For each type of snoRNP, individual depletion of at least three of the four protein components produced significant (P ≦ 1.2 × 10-5 reductions in the expression levels of the corresponding small nucleolar RNAs (snoRNAs, whereas the expression levels of other ncRNAs were largely unaffected. The effects of depletion of individual proteins were in accordance with snoRNP structure analyses obtained in other species for all but two of the eight targeted proteins. Variations in snoRNA size, sequence and secondary structure characteristics were not systematically reflected in the affinity for individual protein component of snoRNPs. The data supported the classification of nearly all annotated snoRNAs and suggested the presence of several novel snoRNAs among unclassified short ncRNA transcripts. A number of transcripts containing canonical Sm binding element sequences (Sm Y RNAs also showed reduced expression after depletion of protein components of C/D box snoRNPs, whereas the expression of some stem-bulge RNAs (sbRNAs was increased after depletion of the same proteins. Conclusion

  6. Li dynamics in carbon-rich polymer-derived SiCN ceramics probed by nuclear magnetic resonance

    OpenAIRE

    Baek, Seung-Ho; Reinold, Lukas Mirko; Graczyk-Zajac, Magdelena; Riedel, Ralf; Hammerath, Franziska; Büchner, Bernd; Grafe, Hans-Joachim

    2014-01-01

    We report $^{7}$Li, $^{29}$Si, and $^{13}$C NMR studies of two different carbon-rich SiCN ceramics SiCN-1 and SiCN-3 derived from the preceramic polymers polyphenylvinylsilylcarbodiimide and polyphenylvinylsilazane, respectively. From the spectral analysis of the three nuclei at room temperature, we find that only the $^{13}$C spectrum is strongly influenced by Li insertion/extraction, suggesting that carbon phases are the major electrochemically active sites for Li storage. Temperature and L...

  7. Pathways for the OH + Cl2 → HOCl + Cl and HOCl + Cl → HCl + ClO Reactions.

    Science.gov (United States)

    Wang, Hongyan; Qiu, Yudong; Czakó, Gábor; Schaefer, Henry F

    2015-07-16

    High level coupled-cluster theory, with spin-orbit coupling evaluated via the Breit-Pauli operator in the interacting-states approach, is used to investigate the OH radical reaction with Cl2 and the subsequent reaction HOCl + Cl. The entrance complex, transition state, and exit complex for both reactions have been determined using the CCSD(T) method with correlation consistent basis sets up to cc-pV6Z. Also reported are CCSDT computations. The OH + Cl2 reaction is predicted to be endothermic by 2.2 kcal/mol, compared to the best experiments, 2.0 kcal/mol. The above theoretical results include zero-point vibrational energy corrections and spin-orbit contributions. The activation energy (Ea) of the OH + Cl2 reaction predicted here, 2.3 kcal/mol, could be as much as 1 kcal/mol too high, but it falls among the four experimental Ea values, which span the range 1.1-2.5 kcal/mol. The exothermicity of the second reaction HOCl + Cl → HCl + ClO is 8.4 kcal/mol, compared to experiment 8.7 kcal/mol. The activation energy for latter reaction is unknown experimentally, but predicted here to be large, 11.5 kcal/mol. There are currently no experiments relevant to the theoretical entrance and exit complexes predicted here. PMID:25965106

  8. Historia clínica

    Directory of Open Access Journals (Sweden)

    Juan Martínez Hernández

    2006-01-01

    Full Text Available La historia clínica ha estado regulada hasta la actualidad por diferentes disposiciones legislativas con base en la Ley General de Sanidad 14/1986, de 25 de abril. Con la Ley 41/2002, de 14 de noviembre, básica y reguladora de la autonomía del paciente y de derechos y obligaciones en materia de información y documentación clínica, se actualizan los derechos y obligaciones de los pacientes o usuarios y profesionales, entre ellos los relativos a la historia clínica. En el presente artículo, se expone el contenido de la Ley 41/2002 y referencias a otras normas legislativas y fuentes bibliográficas. La Ley define la historia clínica, sus contenidos, funciones y usos, su soporte y conservación, aclara la propiedad de la historia clínica y recoge las características de acceso y custodia, así como la privacidad y confidencialidad de la historia clínica.

  9. Phase diagrams for the binary systems NdCl3-LiCl and PrCl3-LiCl

    International Nuclear Information System (INIS)

    Equilibrium diagrams for the binary systems NdCl3-LiCl and PrCl3-LiCl were studied over the temperature range 200-800degC by differential thermal analysis techniques. A peritectic was observed in the NdCl3-LiCl system. The eutectic occurred at 456±2degC and 30.7mol% NdCl3 and the peritectic occurred at 467±1degC. A single eutectic was observed in the PrCl3-LiCl system with no evidence of solid solution or compound formation. The eutectic occurred at 464±1degC and 30.6mol% PrCl3 in the PrCl3-LiCl system. Binary phase diagrams for the two systems were proposed from the DTA results. (author)

  10. Electrochemical and Kinetic Behaviors of Fe(Ⅱ) Ion in DMSO, DMF and CH3CN

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    The cyclic voltammetry, current-time curve at potential step were used to investigate the electrochemical behavior of Fe(Ⅱ) in DMSO, DMF and CH3CN solutions on Pt cathode. Experimental results indicate that the electroreduction of Fe(Ⅱ) to Fe(0) is irreversible in one step on Pt electrode. The diffusion coefficients of Fe(Ⅱ) in DMSO, DMF and CH3CN solutions at 298 K were determined to be 2.3×10-6, 1.32×10-6 and 2.5×10-6 cm2*s-1, respectively. The transfer coefficients of Fe(Ⅱ)+2e→Fe(0) in DMSO, DMF and CH3CN solutions were determined to be 0.11, 0.10 and 0.06, respectively.

  11. CN molecule collisions with H+ at a wide range of astrophysical energies

    CERN Document Server

    Sultanova, Madina R

    2012-01-01

    We analyze the quantum-mechanical rotational excitation/de-excitation spectrum and cross sections of CN molecules during low and high-energy collisions with protons, H+. The problem is of significant importance in astrophysics of the early Universe, specifically connected with the problems of cosmic microwave background (CMB) radiation. A quantum-mechanical close-coupling method is applied in this work. The cyanide molecule (CN) is treated as a rigid rotor, i.e. the distance between the carbon and nitrogen atoms is fixed at an average equilibrium value. The new results of the excitation/de-excitation cross-sections and corresponding thermal rate coefficients are compared with the results of few previous calculations performed on the basis of few approximate semiclassical frameworks. The interaction potential between CN and H+ is taken in the following form: proton induced polarization potential + proton-dipole potential + proton-quadrupole potential.

  12. Kinetic analysis of simultaneous denitrification and biomineralization of novel Acinetobacter sp. CN86.

    Science.gov (United States)

    Su, Jun-Feng; Shi, Jing-Xin; Huang, Ting-Lin; Ma, Fang

    2016-08-15

    A novel aerobic denitrification and biomineralization strain CN86 was isolated from the Qu Jiang artificial lake. Based on phylogenetic characteristics, the isolated strain was identified as Acinetobacter species. Strain CN86 was confirmed to have the ability to perform simultaneous denitrification and biomineralization. Exponential decay equation was used for the matching of kinetic processes on denitrification and biomineralization. A highest nitrate removal rate was achieved at the pH7.0, organic concentration of 1.5g/L and temperature of 30°C. An optimal hardness removal rate was obtained at the pH9.0, organic concentration of 2.0g/L and temperature of 30°C. Strain CN86 is a suitable candidate for the simultaneous removal of nitrate and hardness in groundwater treatment. PMID:27287863

  13. Depressurization accident analysis for the HTTR by the TAC-NC

    International Nuclear Information System (INIS)

    The two-dimensional thermal analysis code TAC-NC is modified from the analytical code TAC-2D in order to calculate temperature transients in the case of loss of forced cooling accidents of the HTTR (High Temperature engineering Test Reactor) such as a depressurization accident. In these conditions, temperature transients in the core are affected by natural convection between hotter and colder regions in the pressure vessel. The TAC-NC code includes a special function to calculate heat transfer by natural convection in addition to conduction, radiation and forced convection. Verification of the TAC-NC code was carried out by the comparison of the analytical results with the experimental ones of an air ingress test. Analytical results of simulated core temperature were in good agreement with experimental results. Temperature transients during a depressurization accident were evaluated by the TAC-NC code for the HTTR. The maximum fuel temperature decreases rapidly after the reactor scram and increases slightly after that due to decay heat. The maximum fuel temperature, however, remains below the initial maximum fuel temperature since most of the core decay heat is absorbed in the large thermal capacity of graphite in the core and reflector. The peak vessel temperature occurs at about 30 hours after the beginning of the accident and also remains lower than the allowable temperature, even if one of the reactor pressure vessel cooling systems is failed. (author)

  14. 75 FR 17792 - North Carolina Disaster # NC-00025 Declaration of Economic Injury

    Science.gov (United States)

    2010-04-07

    ... ADMINISTRATION North Carolina Disaster NC-00025 Declaration of Economic Injury AGENCY: U.S. Small Business Administration. ACTION: Notice. SUMMARY: This is a notice of an Economic Injury Disaster Loan (EIDL) declaration... the Administrator's EIDL declaration, applications for economic injury disaster loans may be filed...

  15. Anaerobic Oxidation of Methane Coupled to Nitrite Reduction by Halophilic Marine NC10 Bacteria.

    Science.gov (United States)

    He, Zhanfei; Geng, Sha; Cai, Chaoyang; Liu, Shuai; Liu, Yan; Pan, Yawei; Lou, Liping; Zheng, Ping; Xu, Xinhua; Hu, Baolan

    2015-08-15

    Anaerobic oxidation of methane (AOM) coupled to nitrite reduction is a novel AOM process that is mediated by denitrifying methanotrophs. To date, enrichments of these denitrifying methanotrophs have been confined to freshwater systems; however, the recent findings of 16S rRNA and pmoA gene sequences in marine sediments suggest a possible occurrence of AOM coupled to nitrite reduction in marine systems. In this research, a marine denitrifying methanotrophic culture was obtained after 20 months of enrichment. Activity testing and quantitative PCR (qPCR) analysis were then conducted and showed that the methane oxidation activity and the number of NC10 bacteria increased correlatively during the enrichment period. 16S rRNA gene sequencing indicated that only bacteria in group A of the NC10 phylum were enriched and responsible for the resulting methane oxidation activity, although a diverse community of NC10 bacteria was harbored in the inoculum. Fluorescence in situ hybridization showed that NC10 bacteria were dominant in the enrichment culture after 20 months. The effect of salinity on the marine denitrifying methanotrophic culture was investigated, and the apparent optimal salinity was 20.5‰, which suggested that halophilic bacterial AOM coupled to nitrite reduction was obtained. Moreover, the apparent substrate affinity coefficients of the halophilic denitrifying methanotrophs were determined to be 9.8 ± 2.2 μM for methane and 8.7 ± 1.5 μM for nitrite. PMID:26048927

  16. 76 FR 29647 - Safety Zone; Big Rock Blue Marlin Air Show; Bogue Sound, Morehead City, NC

    Science.gov (United States)

    2011-05-23

    ... 400 yards south of the shoreline of Morehead City. (b) Definition: For the purposes of this section..., Morehead City, NC AGENCY: Coast Guard, DHS. ACTION: Temporary final rule. SUMMARY: The Coast Guard is... held over the waters of Bogue Sound, adjacent to Morehead City, North Carolina. This Safety Zone...

  17. 78 FR 79726 - Norfolk Southern Railway Company-Abandonment Exemption-in Gaston County, NC

    Science.gov (United States)

    2013-12-31

    ... Surface Transportation Board Norfolk Southern Railway Company--Abandonment Exemption--in Gaston County, NC Norfolk Southern Railway Company (NSR) has filed a verified notice of exemption under 49 CFR part 1152... report that addresses the effects, if any, of the abandonment on the environment and historic...

  18. 78 FR 15797 - Eastern Band of Cherokee Indians Disaster #NC-00049

    Science.gov (United States)

    2013-03-12

    ... ADMINISTRATION Eastern Band of Cherokee Indians Disaster NC-00049 AGENCY: U.S. Small Business Administration... Assistance Only for the Eastern Band of Cherokee Indians (FEMA-4103-DR), dated 03/01/2013. Incident: Severe... adversely affected by the disaster: Primary Areas: Eastern Band of Cherokee Indians and Associated...

  19. Optical spectroscopy study of nc-Si-based p-i-n solar cells

    Energy Technology Data Exchange (ETDEWEB)

    Sancho-Parramon, Jordi; Gracin, Davor; Gajovic, Andreja [Rudjer Boskovic Institute, Bijenicka cesta 54, 10000 Zagreb (Croatia); Modreanu, Mircea [Tyndall Institute, Lee Maltings, Prospect Row, Cork (Ireland)

    2009-10-15

    In the present study we analyzed nanocrystalline silicon (nc-Si)-based p-i-n thin film structures (SiC/nc-Si/n-doped amorphous Si) on glass produced by radio-frequency plasma-enhanced chemical vapor deposition. The crystallinity of the nc-Si layer was modified by varying the deposition conditions ([SiH{sub 4}]/[H{sub 2}] ratio in the plasma and radio-frequency power). Structural properties of the samples (crystalline fraction and crystal size distribution) were inferred by Raman spectroscopy. Different optical spectroscopy methods were combined for the determination of the optical constants in different spectral ranges: spectrophotometry, ellipsometry and photothermal deflection spectroscopy. Characterization results evidence that the optical properties of the nc-Si layers are strongly connected with the layer structural properties. Thus, the correlation between density of defects, Urbach energy, band-gap and line-shape of dielectric function critical points with the crystalline properties of the films is established. (author)

  20. MALAT1 long ncRNA promotes gastric cancer metastasis by suppressing PCDH10

    DEFF Research Database (Denmark)

    Qi, Ying; Ooi, Hong Sain; Wu, Jun; Chen, Jian; Zhang, Xiaoli; Tan, Sheng; Yu, Qing; Li, Yuan-Yuan; Kang, Yani; Li, Hua; Xiong, Zirui; Zhu, Tao; Liu, Bingya; Shao, Zhifeng; Zhao, Xiaodong

    2016-01-01

    EZH2, the catalytic component of polycomb repressive complex 2 (PRC2), is frequently overexpressed in human cancers and contributes to tumor initiation and progression, in part through transcriptional silencing of tumor suppressor genes. A number of noncoding RNAs (ncRNAs) recruit EZH2 to specifi...

  1. Electromagnetic Form Factors of Hadrons in Dual-Large Nc QCD

    International Nuclear Information System (INIS)

    In this talk, results are presented of determinations of electromagnetic form factors of hadrons (pion, proton, and Δ(1236)) in the framework of Dual-Large Nc QCD (Dual-QCD∞). This framework improves considerably tree-level VMD results by incorporating an infinite number of zero-width resonances, with masses and couplings fixed by the dual-resonance (Veneziano-type) model.

  2. 76 FR 53341 - Drawbridge Operation Regulation; Trent River, New Bern, NC

    Science.gov (United States)

    2011-08-26

    ... approximately 14 feet, above mean high water. On behalf of the City of New Bern NC, the National Multiple Sclerosis (MS) Society has requested a temporary deviation from the current operating regulations of the....regulations.gov , inserting USCG-2011-0781 in the ``Keyword'' box and then clicking ``Search''. They are...

  3. 76 FR 14970 - National Starch and Chemical Company, Salisbury, Rowan County, NC; Notice of Settlement

    Science.gov (United States)

    2011-03-18

    ... AGENCY National Starch and Chemical Company, Salisbury, Rowan County, NC; Notice of Settlement AGENCY... National Starch and Chemical Company Site located in Mobile, Mobile County, Alabama for publication. DATES..., identified by Docket ID No. EPA-RO4- SFUND-2011-0278 or Site name National Starch and Chemical...

  4. SYNTHESIS AND THERMAL STABILITY OF NANOCOMPOSITE nc-TiN/a-TiB2 THIN FILMS

    Institute of Scientific and Technical Information of China (English)

    Y.H. Lu; Z.F. Zhou; P. Sit; Y.G. Shen; K.Y. Li; H. Chen

    2005-01-01

    Several nc-TiN/a-TiB2 thin films comprised of nanocrystalline (nc-) TiN and amorphous (a-) TiB2phases were deposited on Si(100)at room temperature by reactive unbalanced dc magnetron sputtering, followed by vacuum annealed at 400, 600, 800 and 1000℃ for 1h, respectively. Effects of B content on microstructure, mechanical behaviors and thermal microstructure stability have been investigated by X-ray diffraction (XRD), scanning electron microscopy (SEM), X-ray photoelectron spectroscopy (XPS) and nanoindentation measurements. The results indicated that B addition greatly affected both microstructure and mechanieal behavior of nc-TiN/a-TiB2 thin films. With increasing B content the grain size decreased. A maximum hardness value of about 33GPa was obtained at B content of about 19at. %. The improved mechanical properties of nc-TiN/a-TiB2films with the addition of B into TiN were attributed to their densified microstructure with development of fine grain size. Only addition of sufficient B could restrain grain growth during annealing. High B content resulted in high microstructure stability. The crystallization of amorphous matrix occurred at about 800℃, forming TiB or TiB2 crystallite, depending on B content. Before that no change in bonding configuration was found.

  5. Investigation on the foaming behaviors of NC-based gun propellants

    Institute of Scientific and Technical Information of China (English)

    Yu-xiang LI; Wei-tao YANG; San-jiu YING

    2014-01-01

    To prepare the porous NC-based (nitrocellulose-based) gun propellants, the batch foaming process of using supercritical CO2 as the physical blowing agent is used. The solubilities of CO2 in the single-base propellants and TEGDN (trimethyleneglycol dinitrate) propellants are measured by the gravimetric method, and SEM (scanning electron microscope) is used to observe the morphology of foamed propellants. The result shows that a large amount of CO2 could be dissolved in NC-based propellants. The experimental results also reveal that the energetic plasticizer TEGDN exerts an important influence on the pore structure. The triaxial tensile failure mechanism for solid-state nucleation is used to explain the nucleation of NC-based propellants in the solid state. Since some specific foaming behaviors of NC-based propellants can not be explained by the failure mechanism, a solid-state nucleation mechanism which revises the triaxial tensile failure mechanism is proposed and discussed. Copyright © 2014, China Ordnance Society. Production and hosting by Elsevier B.V. All rights reserved.

  6. Size effect of fullerene cages and encaged clusters in M3N@C2n

    Institute of Scientific and Technical Information of China (English)

    2009-01-01

    Based on the calculated findings that the sizes of encaged clusters determine the structures and the stability of C80-based trimetallic nitride fullerenes (TNFs), more extensive density functional theory calculations were performed on M3N@C68, M3N@C78 and M3N@C80 (M=Sc, Y and La). The calculated results demonstrated that the structures and stability undergo a transition with the increasing of the sizes of the cages and clusters. Sc3N is planar inside the three considered cages, Y3N is slightly pyramidal inside C68-6140 and C78-5 and planar inside I h C80-7, however, La3N is pyramidal inside all the three cages. Those cages with pyramidal clusters inside deformed considerably, compared with their parent cages. In these cases, the bonding of metallic atoms toward the cages does not play an impor-tant role, and the encaged cluster tends to be located inside the cages with the largest M-M and M-C distances so that the strain energy can be released mostly. These calculations revealed the size effect of fullerene cages and encaged clusters, and can explain the position priority of M3N inside fullerene cages and the differences in yield of M3N@C2n.

  7. 75 FR 81269 - Ward Transformer Superfund Site Raleigh, Wake County, NC; Notice of Settlements

    Science.gov (United States)

    2010-12-27

    ... AGENCY Ward Transformer Superfund Site Raleigh, Wake County, NC; Notice of Settlements AGENCY... Ward Transformer Superfund Site located in Raleigh, Wake County, North Carolina for publication. DATES... your comments, identified by Docket ID No. EPA-RO4- SFUND-2010-1053 or Site name Ward...

  8. 78 FR 14543 - Ward Transformer Superfund Site; Raleigh, Wake County, NC; Notice of Settlement

    Science.gov (United States)

    2013-03-06

    ... AGENCY Ward Transformer Superfund Site; Raleigh, Wake County, NC; Notice of Settlement AGENCY... Agency has entered into a settlement at the Ward Transformer Superfund Site located in Raleigh, Wake... EPA Region 4 contact Ms. Paula V. Painter. Submit your comments by Site name Ward...

  9. 77 FR 3326 - Cancellation of Environmental Impact Statement in Orange County, NC

    Science.gov (United States)

    2012-01-23

    ... [Federal Register Volume 77, Number 14 (Monday, January 23, 2012)] [Notices] [Page 3326] [FR Doc.... Clarence W. Coleman, Jr., Preconstruction and Environmental Team Leader, Raleigh, North Carolina. [FR Doc... Environmental Impact Statement in Orange County, NC AGENCY: Federal Highway Administration (FHWA),...

  10. 76 FR 38389 - Caraleigh Phosphate and Fertlizer Works Superfund Site; Raleigh, Wake County, NC; Notice of...

    Science.gov (United States)

    2011-06-30

    ... AGENCY Caraleigh Phosphate and Fertlizer Works Superfund Site; Raleigh, Wake County, NC; Notice of... response costs concerning the Caraleigh Phosphate and Fertilizer Works Superfund Site located in Raleigh...-0534 or Site name Caraleigh Phosphate and Fertilizer Works Superfund Site by one of the...

  11. Cranberry magnetite deposits Avery County, N.C., and Carter County, Tenn.

    Science.gov (United States)

    Kline, M.H.; Ballard, T.J.

    1948-01-01

    The Cranberry magnetite deposits occur in pre-Cambrian granite-gneiss in a belt extending from 3 miles southeast of Cranberry, N.C., to about 6 miles southwest of Magnetic City, Tenn. The belt forms a curve, elongated to the north, approximately 26 miles in length.

  12. PROBING THE GASEOUS DISK OF T Tau N WITH CN 5-4 LINES

    Energy Technology Data Exchange (ETDEWEB)

    Podio, L.; Codella, C. [INAF-Osservatorio Astrofisico di Arcetri, Largo E. Fermi 5, I-50125, Florence (Italy); Kamp, I.; Meijerink, R.; Spaans, M. [Kapteyn Astronomical Institute, University of Groningen, Landleven 12, 9747 AD Groningen (Netherlands); Nisini, B. [INAF-Osservatorio Astronomico di Roma, via di Frascati 33, I-00040, Monte Porzio Catone (Italy); Aresu, G. [INAF-Osservatorio Astronomico di Cagliari, Via della Scienza 5, I-09047, Selargius (Italy); Brittain, S. [Department of Physics and Astronomy, 118 Kinard Laboratory, Clemson University, Clemson, SC 29634 (United States); Cabrit, S.; Dougados, C.; Thi, W.-F. [UJF-Grenoble 1/CNRS-INSU, Institut de Planétologie et d' Astrophysique de Grenoble (IPAG) UMR 5274, Grenoble, F-38041 (France); Grady, C. [Eureka Scientific, 2452 Delmer, Suite 100, Oakland, CA 96002 (United States); Sandell, G. [SOFIA-USRA, NASA Ames Research Center, MS 232-12, Building N232, Rm. 146, P.O. Box 1, Moffett Field, CA 94035-0001 (United States); White, G. J. [Department of Physical Sciences, The Open University, Milton Keynes, MK7 6AA (United Kingdom); Woitke, P. [SUPA, School of Physics and Astronomy, University of St. Andrews, KY16 9SS (United Kingdom)

    2014-03-10

    We present spectrally resolved observations of the young multiple system T Tau in atomic and molecular lines obtained with the Heterodyne Instrument for the Far Infrared on board Herschel. While CO, H{sub 2}O, [C II], and SO lines trace the envelope and the outflowing gas up to velocities of 33 km s{sup –1} with respect to systemic, the CN 5-4 hyperfine structure lines at 566.7, 566.9 GHz show a narrow double-peaked profile centered at systemic velocity, consistent with an origin in the outer region of the compact disk of T Tau N. Disk modeling of the T Tau N disk with the thermo-chemical code ProDiMo produces CN line fluxes and profiles consistent with the observed ones and constrain the size of the gaseous disk (R{sub out}=110{sub −20}{sup +10} AU) and its inclination (i = 25°± 5°). The model indicates that the CN lines originate in a disk upper layer at 40-110 AU from the star, which is irradiated by the stellar UV field and heated up to temperatures of 50-700 K. With respect to previously observed CN 2-1 millimeter lines, the CN 5-4 lines appear to be less affected by envelope emission, due to their larger critical density and excitation temperature. Hence, high-J CN lines are a unique confusion-free tracer of embedded disks, such as the disk of T Tau N.

  13. 75 FR 68728 - Airworthiness Directives; Bombardier, Inc. Model CL-215-1A10 (CL-215), CL-215-6B11 (CL-215T...

    Science.gov (United States)

    2010-11-09

    ... Procedures (44 FR 11034, February 26, 1979); and 3. Will not have a significant economic impact, positive or.... Model CL-215-1A10 (CL- 215), CL-215-6B11 (CL-215T Variant), and CL-215-6B11 (CL-415 Variant) Airplanes...: * * * * * Seven cases of on-ground hydraulic accumulator screw cap or end cap failure have been experienced on...

  14. 76 FR 41653 - Airworthiness Directives; Bombardier, Inc. Model CL-600-2A12 (CL-601) and CL-600-2B16 (CL-601-3A...

    Science.gov (United States)

    2011-07-15

    ... products. That NPRM was published in the Federal Register on January 5, 2011 (76 FR 477). That NPRM...; 2. Is not a ``significant rule'' under the DOT Regulatory Policies and Procedures (44 FR 11034.... Model CL-600-2A12 (CL- 601) and CL-600-2B16 (CL-601-3A, CL-601-3R, and CL-604 Variants) Airplanes...

  15. Sulphur and oxygen sequestration of n-C37 and n-C38 unsaturated ketones in an immature kerogen and the release of their carbon skeletons during early stages of thermal maturation

    Science.gov (United States)

    Koopmans, M.P.; Schaeffer-Reiss, C.; De Leeuw, J. W.; Lewan, M.D.; Maxwell, J.R.; Schaeffer, P.; Sinninghe, Damste J.S.

    1997-01-01

    Sedimentary rock from the Gessoso-solfifera Formation (Messinian) in the Vena del Gesso Basin (northern Italy) containing immature (Ro = 0.25%) S-rich organic matter was artificially matured by hydrous pyrolysis at temperatures from 160 to 330??C for 72 h to study the diagenetic fate of n-C37 and n-C38 di-and tri-unsaturated methyl and ethyl ketones (alkenones) biosynthesised by several prymnesiophyte algae. During early diagenesis, the alkenones are incorporated into the kerogen by both sulphur and oxygen cross-linking as indicated by chemical degradation experiments with the kerogen of the unheated sample. Heating at temperatures between 160 and 260??C, which still represents early stages of thermal maturation, produces large amounts (up to 1 mg/g TOC) of S-bound, O-bound, and both S-and O-bound n-C37 and n-C38 skeletons, saturated n-C37 and n-C38 methyl, ethyl, and mid-chain ketones, C37 and C38 mid-chain 2,5-di-n-alkylthiophenes, C37 and C38 1,2-di-n-alkylbenzenes, and C37 and C38 n-alkanes. With increasing thermal maturation, three forms of the n-C37 and n-C38 skeletons are relatively stable (saturated hydrocarbons, 1,2-di-n-alkylbenzenes and saturated ketones), whereas the S-and O-bound skeletons are relatively labile. These results suggest that in natural situations saturated ketones with an n-C37 and n-C38 skeleton can be expected as well as the corresponding hydrocarbons. Copyright ?? 1997 Elsevier Science Ltd.

  16. ClEST cluster :Cl_singleton1875 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1875 beta-carotene -monooxygenase Cimex lectularius nuclear gene 443 CAGACGAAGACATGT ... CGCTTTATGGAAGTACAGATACAAGTGTGAAG mb05043 1 Retinal pigment ... epithelium-specific protein b [Danio rerio] AAH921 ...

  17. ClEST cluster :Cl_contig0243 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig0243 barrier-to-autointegration factor Cimex lectularius nuclear gene 428 ...TAATAAATACAGTATGATGTGCG fb29038 fs25084 mb23031 3 barrier to autointegration factor [Rhodnius prolixus] AEL79235 5.9E-56 GO:0003677 ...

  18. ClEST cluster :Cl_singleton0811 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0811 nuclear ... transcription factor gamma Cimex lectularius nuclear ... gene 506 GATGGTTGG ... GGGTACATACTGAGGATAACAAACGTCGAACTTTACAGCG fs11035 1 nuclear ... transcription factor Y gamma isoform 1 [Nasonia vi ...

  19. ClEST cluster :Cl_singleton1046 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1046 u2 small nuclear ... ribonucleoprotein a Cimex lectularius nuclear ... gene 633 TTGTTTG ... CGCTCACGAGC fs21006 1 PREDICTED: probable U2 small nuclear ... ribonucleoprotein A'-like [Bombus terrestris] XP_0 ...

  20. ClEST cluster :Cl_singleton1703 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1703 p8 nuclear ... protein Cimex lectularius nuclear ... gene 541 AGTCGTTCGACAACGTTCAAACAAT ... AACGGTTAAGCATTTGTACTTACGTTAT fw21041 1 DNA-binding nuclear ... protein p8 [Triatoma infestans] ABR27869 2.01616E- ...

  1. ClEST cluster :Cl_singleton2134 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton2134 rna-binding region ... rnp-1 domain-containing protein Cimex lectularius nuclear ge ... GTGTACCTTGCAAAAGTGATTTATCATC mb16086 1 RNA-binding region ... RNP-1 domain-containing protein [Dictyostelium dis ...

  2. ClEST cluster :Cl_singleton1569 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1569 b-cell ... receptor-associated protein 31-like Cimex lectularius nuclear gene 410 C ... CTCTGTTCCTCTCCATTGTGATTCGACGATTCGTGTCT fw16029 1 B-cell ... receptor-associated protein 31-like [Acyrthosiphon ...

  3. ClEST cluster :Cl_singleton2269 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton2269 germ cell -less protein Cimex lectularius nuclear gene 466 CACACACGCGCTTCATAAAAA ... TCAATATTCTTGA mb21032 1 PREDICTED: similar to germ cell -less protein [Tribolium castaneum] XP_967783 3.440 ...

  4. ClEST cluster :Cl_singleton0908 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0908 bone marrow stromal cell -derived ubiquitin-like protein Cimex lectularius nucle ... s15049 1 PREDICTED: similar to bone marrow stromal cell -derived ubiquitin-like protein [Tribolium castaneu ...

  5. ClEST cluster :Cl_singleton0360 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0360 cell ... cycle control protein 50a-like isoform 1 Cimex lectularius nuclear gene 41 ... ACAAAATGCATGAATGCCTTGTCACCAAC fb18030 1 PREDICTED: cell ... cycle control protein 50A-like isoform 2 [Nasonia ...

  6. ClEST cluster :Cl_contig0436 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig0436 lethal essential for life ... l2efl Cimex lectularius nuclear gene 432 TAAGAATCTCTCCCG ... GACGTTATT fs18066 fw18019 2 lethal(2)essential for life ... protein-like protein [Maconellicoccus hirsutus] AB ...

  7. ClEST cluster :Cl_singleton1657 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1657 pumilio ... 2 Cimex lectularius nuclear gene 590 TGATGATGAAAGATCAGTACGCCAATTATGTCGT ... ATATGATACATCAAATAAATTATTTGAGA fw20025 1 PREDICTED: pumilio ... homolog 2-like isoform 1 [Acyrthosiphon pisum] XP_ ...

  8. ClEST cluster :Cl_singleton2448 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton2448 probable gdp-fucose ... transporter-like Cimex lectularius nuclear gene 314 ACGAATT ... AAAGTTTTCCCTGTCA mb31096 1 PREDICTED: probable GDP-fucose ... transporter-like [Acyrthosiphon pisum] XP_00194993 ...

  9. ClEST cluster :Cl_singleton1765 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1765 rab11 family -interacting protein 4a-like Cimex lectularius nuclear gene 578 GGT ... GGCGAGGGTTTTGATGCTTGAAG fw23061 1 PREDICTED: rab11 family -interacting protein 4A-like isoform 1 [Acyrthosiph ...

  10. ClEST cluster :Cl_singleton0942 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0942 tbc1 domain family ... member 4-like Cimex lectularius nuclear gene 488 GCATTCGTATT ... CCACCATAAAGGAGCAA fs16074 1 PREDICTED: TBC1 domain family ... member 4-like [Acyrthosiphon pisum] XP_001947975 6 ...

  11. ClEST cluster :Cl_contig0251 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig0251 member ras oncogene family ... Cimex lectularius nuclear gene 413 GAGTGTGTAAACTTAAAATA ... 3 PREDICTED: similar to RAB18 member RAS oncogene family ... [Tribolium castaneum] XP_970378 2.6E-29 ...

  12. ClEST cluster :Cl_singleton0243 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0243 solute carrier family ... 35 member f5-like Cimex lectularius nuclear gene 403 GAAA ... AATAAAACTCCCAA fb12090 1 PREDICTED: solute carrier family ... 35 member F5-like [Nasonia vitripennis] XP_0016016 ...

  13. ClEST cluster :Cl_singleton1038 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1038 pleckstrin homology domain- family ... a (phosphoinositide binding specific) member ... : similar to pleckstrin homology domain-containing family ... A (phosphoinositide binding specific) member 3 [Tr ...

  14. ClEST cluster :Cl_singleton0344 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0344 l antigen family ... member 3 Cimex lectularius nuclear gene 461 CCAAGTAAAAATTTAAAT ... AGGGCAAATTATGGCTTCGCCCTCTATCTG fb17054 1 L antigen family ... member 3 isoform 1 [Nasonia vitripennis] NP_001155 ...

  15. ClEST cluster :Cl_singleton1438 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1438 sodium pump ... alpha subunit Cimex lectularius nuclear gene 282 GAGTCTGGTTCCAGTGCT ... ACTGGACTCACACACGCCAAAGCT fw09093 1 putative sodium pump ... alpha subunit [Danaus plexippus] EHJ73788 1.10687E ...

  16. ClEST cluster :Cl_singleton0353 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0353 sodium pump ... alpha subunit Cimex lectularius nuclear gene 155 GGCTGTCGGACCTCCACC ... CATAAAATATCTGTAGAAGAACTA fb18007 1 putative sodium pump ... alpha subunit [Danaus plexippus] EHJ73788 2.28502E ...

  17. ClEST cluster :Cl_singleton1521 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1521 Histone-lysine ... N-methyltransferase SETMAR Cimex lectularius nuclear gene 357 CT ... TTCATAAAGATATTTGAAAGTTTCGTTCAACT fw14041 1 Histone-lysine ... N-methyltransferase SETMAR [Harpegnathos saltator] ...

  18. ClEST cluster :Cl_contig0318 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig0318 histone-lysine ... n-methyltransferase setmar Cimex lectularius nuclear gene 571 TTTGA ... AATTTTCGAGTTTTTTCACTTTTC fw04055 mb08029 2 histone-lysine ... N-methyltransferase SETMAR [Bos taurus] NP_0010771 ...

  19. ClEST cluster :Cl_singleton1580 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1580 histone-lysine ... n-methyltransferase setmar-like Cimex lectularius nuclear gene 3 ... AGTACATTAACTCATCTTTTC fw17018 1 PREDICTED: histone-lysine ... N-methyltransferase SETMAR-like [Bombus terrestris ...

  20. ClEST cluster :Cl_singleton0551 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0551 rna-directed dna ... polymerase from mobile element jockey- partial Cimex lectulari ... CTATCTATCCCGTCTG fb26037 1 PREDICTED: RNA-directed DNA ... polymerase from mobile element jockey-like [Acyrth ...

  1. ClEST cluster :Cl_singleton1396 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1396 dna ... repair and recombination protein rad54b-like Cimex lectularius nuclear gene ... ACGATTACTATTTTTTTCCTTCGAGCCTT fw08090 1 PREDICTED: DNA ... repair and recombination protein RAD54B-like [Acyr ...

  2. ClEST cluster :Cl_singleton0669 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0669 n -adenine-specific dna ... methyltransferase 2-like Cimex lectularius nuclear gene ... GATGATAAAACTGTAAAAA fs03050 1 N-6 adenine-specific DNA ... methyltransferase 2 [Nasonia vitripennis] NP_00112 ...

  3. ClEST cluster :Cl_singleton1305 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1305 dna -directed rna polymerase ii kda polypeptide Cimex lectularius nuclear gene 4 ... TGAAGAAAGATTCAAAGAGGCGATCAAGGACAGGAAGGAA fw05060 1 DNA -directed RNA polymerase II 13.3 kda polypeptide [T ...

  4. ClEST cluster :Cl_singleton0185 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0185 dna -directed rna polymerases and iii subunit rpabc1-like Cimex lectularius nucl ... CTTCTGCTAAGCAATCACTCGTGGACATG fb10023 1 PREDICTED: DNA -directed RNA polymerases I II and III subunit RPAB ...

  5. ClEST cluster :Cl_singleton0563 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0563 dna -directed rna polymerases i and iii subunit rpac1 Cimex lectularius nuclear ... GTGAAATGCACTAAAAACCCACACTGCCG fb27031 1 PREDICTED: DNA -directed RNA polymerases I and III subunit RPAC1 [ ...

  6. ClEST cluster :Cl_singleton0580 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0580 rna-directed dna ... polymerase from mobile element jockey- partial Cimex lectulari ... ACCTTTATTAATCACATTCCGAGCCTA fb28040 1 RNA-directed DNA ... polymerase from mobile element jockey [Harpegnatho ...

  7. ClEST cluster :Cl_singleton0423 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0423 dna ... replication licensing factor mcm9-like Cimex lectularius nuclear gene 423 C ... CAAAGAAAGAGTGAGGCGTTAAATGCATC fb20074 1 PREDICTED: DNA ... replication licensing factor MCM9-like [Bos taurus ...

  8. ClEST cluster :Cl_singleton2256 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton2256 aminopeptidase -like Cimex lectularius nuclear gene 480 GTACACACTACACAGCACTGAGT ... TCACGTTTTCCCAAGACAAAGCTTG mb20082 1 PREDICTED: LOW QUALITY ... PROTEIN: putative aminopeptidase W07G4.4-like [Bom ...

  9. ClEST cluster :Cl_singleton0131 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0131 hemicentin 1 Cimex lectularius nuclear gene 552 TATCAGCACCAATTCCTTCAATTCCTGAAGA ... TACATGTGTCAGGGGAGCAACAAAG fb07055 1 PREDICTED: LOW QUALITY ... PROTEIN: hemicentin-1-like [Meleagris gallopavo] X ...

  10. ClEST cluster :Cl_singleton0993 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0993 low quality ... protein: wd repeat and fyve domain-containing protein 3-like Cimex ... GTGTTTCGCACGCCGCAGTGGTGGC fs18057 1 PREDICTED: LOW QUALITY ... PROTEIN: WD repeat and FYVE domain-containing prot ...

  11. ClEST cluster :Cl_singleton0484 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0484 protein polybromo-1 Cimex lectularius nuclear gene 500 GGGAGTCGTGAAGATGGTCGTGAA ... TAAGACTGACGAGTATGATGATATA fb23037 1 PREDICTED: LOW QUALITY ... PROTEIN: protein polybromo-1-like [Bombus terrestr ...

  12. ClEST cluster :Cl_singleton0415 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0415 ctp synthase Cimex lectularius nuclear gene 485 CGGTGAAACGTACGTTCTTGATGATGGAGGG ... CTTTCACCAGACCTCATTGTTTGCC fb20048 1 PREDICTED: LOW QUALITY ... PROTEIN: CTP synthase-like [Bombus impatiens] XP_0 ...

  13. ClEST cluster :Cl_contig0368 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig0368 astakine variant 1 Cimex lectularius nuclear gene 522 GAACAGTTTCAGTCGGCGACTGGTTGAC ... CAGTAAATAACTGTGAT fb05079 mb05073 2 PREDICTED: LOW QUALITY ... PROTEIN: astakine-like [Bombus terrestris] XP_0034 ...

  14. ClEST cluster :Cl_singleton0904 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0904 male -specific lethal 3 homolog Cimex lectularius nuclear gene 394 CTCGCAGGTTGAG ... GAATTCGACTTGGGATAGATTCGTTACCG fs15038 1 PREDICTED: male -specific lethal 3 homolog [Acyrthosiphon pisum] XP ...

  15. ClEST cluster :Cl_singleton1087 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1087 calreticulin Cimex lectularius nuclear gene 333 CGAAACCCAGCTCGAGACGATGAGGGCTCTT ... calreticulin [Rhodnius prolixus] ACI23246 4.17952E-42 ... GO:0006457 GO:0005783 GO:0051082 GO:0005509 ...

  16. ClEST cluster :Cl_contig0178 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig0178 transposase-like Cimex lectularius nuclear gene 625 AACTTCGTCAGAAAATAAAACTCTCTTCCA ... asGA2_TC010512 [Tribolium castaneum] EFA01186 1.5E-42 ... GO:0004803 GO:0015074 GO:0006313 GO:0003677 ...

  17. ClEST cluster :Cl_contig0085 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig0085 leucine aminopeptidase Cimex lectularius nuclear gene 650 ACTACTCAAAATTTTTGTTTCTGG ... 1 5 GJ21638 [Drosophila virilis] XP_002049525 2.0E-42 ... GO:0008238 GO:0007498 ...

  18. ClEST cluster :Cl_singleton2379 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton2379 tubulin polymerization ... promoting protein Cimex lectularius nuclear gene 406 AAA ... TTGCGGATTACAACAAATTCCTCGAGGATCTG mb25089 1 tubulin polymerization ... promoting protein [Triatoma matogrossensis] ADN299 ...

  19. ClEST cluster :Cl_singleton0582 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0582 stress -induced-phosphoprotein 1 Cimex lectularius nuclear gene 592 GGAAAAGGTTAT ... AAGGCACGAGAAATTATTCCCACCGATATTACATTTTACA fb28049 1 Stress -induced-phosphoprotein 1 [Acromyrmex echinatior] E ...

  20. ClEST cluster :Cl_singleton0472 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0472 oxidative stress -induced growth inhibitor 1 Cimex lectularius nuclear gene 476 ... CCGATTACCACAAGATATGGCAGATGATGA fb22084 1 Oxidative stress -induced growth inhibitor 1 [Camponotus floridanus] ...

  1. ClEST cluster :Cl_singleton1313 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1313 27 kda hemolymph ... Cimex lectularius nuclear gene 441 CCATTACGGCCGGGGAGAGTGGAATGA ... GAGGTGTTGATGAAAGAAATAA fw05075 1 PREDICTED: 27 kDa hemolymph ... protein-like [Acyrthosiphon pisum] XP_001947666 2. ...

  2. ClEST cluster :Cl_contig0283 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig0283 bladder cancer -associated Cimex lectularius nuclear gene 641 AGAGTCAGGATTGACTGTTTC ... TTAAAATATAAGC fb02042 fs13007 2 PREDICTED: bladder cancer -associated protein-like [Nasonia vitripennis] XP_0 ...

  3. ClEST cluster :Cl_contig0334 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig0334 1-acyl-sn-glycerol-3-phosphate ... acyltransferase Cimex lectularius nuclear gene 551 ... fw03026 fw07037 2 PREDICTED: 1-acyl-sn-glycerol-3-phosphate ... acyltransferase alpha-like isoform 2 [Acyrthosipho ...

  4. ClEST cluster :Cl_singleton0136 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0136 sodium-dependent phosphate ... transporter Cimex lectularius nuclear gene 573 GTACG ... TTTTTCAGCTCTGGCTGACAT fb07076 1 Putative inorganic phosphate ... cotransporter [Harpegnathos saltator] EFN85104 8.7 ...

  5. ClEST cluster :Cl_singleton1944 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1944 deoxyribose-phosphate ... aldolase Cimex lectularius nuclear gene 535 GATATCTGAAATG ... TG mb07072 1 PREDICTED: similar to 2-deoxyribose-5-phosphate ... aldolase homolog [Tribolium castaneum] XP_972358 7 ...

  6. ClEST cluster :Cl_singleton0117 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0117 phosphatidylinositol-4-phosphate ... 3-kinase c2 domain-containing beta polypeptide ... CAAAAG fb07013 1 PREDICTED: phosphatidylinositol-4-phosphate ... 3-kinase C2 domain-containing subunit alpha-like [ ...

  7. ClEST cluster :Cl_singleton2005 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton2005 glycerol-3-phosphate ... dehydrogenase Cimex lectularius nuclear gene 411 ATCGAGCTC ... GTATTGCTGATCTTGTCACCACTTGTTAC mb09081 1 glycerol-3-phosphate ... dehydrogenase [Drosophila ficusphila] BAB39756 2.6 ...

  8. ClEST cluster :Cl_singleton0341 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0341 ribose-phosphate ... pyrophosphokinase Cimex lectularius nuclear gene 379 TTCTATGTG ... TGCTGTTATTCCATATTTGCCCTATAGCAAGCA fb17043 1 ribose-phosphate ... pyrophosphokinase 1 2 [Culex quinquefasciatus] XP_ ...

  9. ClEST cluster :Cl_contig0206 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig0206 sodium-dependent phosphate ... transporter Cimex lectularius nuclear gene 554 TCTAGTCG ... 8 mb18034 3 PREDICTED: similar to sodium-dependent phosphate ... transporter [Tribolium castaneum] XP_001809051 9.4 ...

  10. ClEST cluster :Cl_singleton0167 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0167 sugar phosphate ... exchanger 2-like isoform 2 Cimex lectularius nuclear gene 506 C ... TATTCGCATACGCTGCATCAATG fb09027 1 PREDICTED: sugar phosphate ... exchanger 2-like isoform 2 [Apis mellifera] XP_397 ...

  11. ClEST cluster :Cl_singleton1124 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1124 glyceraldehyde-3-phosphate ... dehydrogenase Cimex lectularius nuclear gene 609 CTC ... TTTGAATTGTTA fs25045 1 PREDICTED: glyceraldehyde-3-phosphate ... dehydrogenase-like [Acyrthosiphon pisum] XP_001943 ...

  12. ClEST cluster :Cl_singleton0888 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0888 mannose-6-phosphate ... isomerase Cimex lectularius nuclear gene 314 GTTGGCTTGTGTGG ... AAGGAGTTGGCTGCTGTAC fs14088 1 PREDICTED: mannose-6-phosphate ... isomerase-like [Bombus impatiens] XP_003491147 1.3 ...

  13. ClEST cluster :Cl_singleton1290 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1290 glucose-6-phosphate ... 1-epimerase-like Cimex lectularius nuclear gene 605 AGAGGAA ... CGAATGTGGTCTCAGGAAG fw05014 1 PREDICTED: glucose-6-phosphate ... 1-epimerase-like [Apis mellifera] XP_003251860 4.4 ...

  14. ClEST cluster :Cl_singleton1771 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1771 inorganic phosphate ... cotransporter Cimex lectularius nuclear gene 540 GGTTTTAAAA ... AGGTCCGATT fw23080 1 PREDICTED: putative inorganic phosphate ... cotransporter-like isoform 2 [Acyrthosiphon pisum] ...

  15. ClEST cluster :Cl_singleton1772 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1772 myosin heavy chain Cimex lectularius nuclear gene 539 GAGTCAGACTCGCTCCAGCTCCCTC ... AACAAAGAAA fw23081 1 PREDICTED: myosin heavy chain muscle ... isoform 1 [Acyrthosiphon pisum] XP_001952092 5.076 ...

  16. ClEST cluster :Cl_contig0096 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig0096 muscle ... lim protein Cimex lectularius nuclear gene 588 AACTTGTTAGTGTGATAAAACCGTCGGC ... TCTGAATA fw01077 fw02081 fw16071 fw23005 fw24093 5 muscle ... LIM protein isoform 2 [Bombyx mori] NP_001037398 6 ...

  17. ClEST cluster :Cl_contig0487 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig0487 synaptic glycoprotein sc2 Cimex lectularius nuclear gene 366 GTTGTTTTATCTGATTCGGAG ... PREDICTED: steroid Alpha ReducTase family member (art -1)-like [Saccoglossus kowalevskii] XP_002732370 2. ...

  18. ClEST cluster :Cl_singleton0302 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0302 150 kda oxygen-regulated protein Cimex lectularius nuclear gene 290 CGATCGAGACT ... AAAGAGAAGGGGACAGTGGAGCTCCCAAG fb15026 1 PREDICTED: hypoxia ... up-regulated protein 1-like isoform 4 [Nasonia vit ...

  19. ClEST cluster :Cl_singleton0264 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0264 dnaj homolog subfamily a member 2 Cimex lectularius nuclear gene 633 GGACTTTTGA ... TGGCAGTAGAATGGCCAAAGAGATCAGGACAATGTGTAGT fb13059 1 molecular ... chaperone [Rhodnius prolixus] AEL79216 3.81379E-61 ...

  20. ClEST cluster :Cl_singleton0071 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0071 nucleosome-remodeling factor subunit nurf301 Cimex lectularius nuclear gene 605 ... GGCACCGTCATC fb05014 1 PREDICTED: similar to fetal alzheimer ... antigen falz [Tribolium castaneum] XP_001811424 2. ...

  1. ClEST cluster :Cl_singleton1298 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1298 nadh dehydrogenase Cimex lectularius nuclear gene 236 GAGTTCTAAGTCGTCTGGTCCTGAA ... TTTGAAAA fw05041 1 NADH dehydrogenase [ubiquinone] iron -sulfur protein 5 [Acyrthosiphon pisum] NP_00115530 ...

  2. ClEST cluster :Cl_contig0235 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig0235 tyrosine tryptophan ... Cimex lectularius nuclear gene 453 CGACCCTGATGGACGGTGGAAATTACA ... GACATTGCCT fb16033 fw14092 mb16034 3 phenylalanine-tryptophan ... hydroxylase [Gryllus bimaculatus] BAJ83477 2.8E-78 ...

  3. ClEST cluster :Cl_singleton0416 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0416 ornithine aminotransferase Cimex lectularius nuclear gene 438 TATC...CAGTTTGCCGAGTATATCACCCGTTATTT fb20049 1 PREDICTED: probable ornithine aminotransferase-like [Glycine max] XP_003531161 4.30167E-26 GO:0008483 ...

  4. ClEST cluster :Cl_singleton2093 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton2093 selenoprotein t Cimex lectularius nuclear gene 435 GAGAAGGAGATTCCG...GAGACGGGAAGAATA mb12059 1 selenoprotein T [Glossina morsitans morsitans] ADD19835 7.29481E-59 GO:0045454 GO:0008430 GO:0005575 ...

  5. ClEST cluster :Cl_contig0079 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig0079 death -associated protein Cimex lectularius nuclear gene 811 GAGTGATCATAGTGAGAACGGT ... ATTCTGTA fb07073 fb13017 fs15001 fw07030 mb18092 5 death -associated protein-like protein [Maconellicoccus h ...

  6. ClEST cluster :Cl_singleton1627 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1627 death -associated protein kinase 1 Cimex lectularius nuclear gene 571 TCCCAATGGG ... CCTACAGCGGAGT fw19023 1 PREDICTED: similar to DAP (Death -Associated Protein) Kinase homolog family member ( ...

  7. ClEST cluster :Cl_singleton0883 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0883 dehydrogenase domain protein Cimex lectularius nuclear gene 257 TCGATTACAACTGAA ... AAAAGGCTACTGACG fs14067 1 unnamed protein product [Azospirillum ... lipoferum 4B] YP_005037771 4.11457E-19 GO:0016616 ...

  8. ClEST cluster :Cl_singleton0781 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0781 membrane magnesium ... transporter 1-like Cimex lectularius nuclear gene 546 TCTAAA ... TACATGAATTGTTTAGTTTAATTATCTCTGT fs09088 1 Membrane magnesium ... transporter 1-B [Acromyrmex echinatior] EGI59871 6 ...

  9. The higher-order C_n dispersion coefficients for hydrogen

    CERN Document Server

    Mitroy, J

    2004-01-01

    The complete set of 2nd, 3rd and 4th order van der Waals coefficients, C_n up to n=32 for the H(1s)-H(1s) dimer are computed using pseudo-states to evaluate the appropriate sum rules. A study of the convergence pattern for n<=16 indicates that all the C_n (n<=16) coefficients are accurate to 13 significant digits. The relative size of the 4th-order C^4_n to the 2nd-order C^2_n coefficients is seen to increase as n increases and at n=32 the 4th-order term is actually larger.

  10. Characterisation of dihydroazulene and vinylheptafulvene derivatives using Raman spectroscopy: The CN-stretching region

    Science.gov (United States)

    Hansen, Anne S.; Mackeprang, Kasper; Broman, Søren L.; Hansen, Mia Harring; Gertsen, Anders S.; Kildgaard, Jens V.; Nielsen, Ole Faurskov; Mikkelsen, Kurt V.; Nielsen, Mogens Brøndsted; Kjaergaard, Henrik G.

    2016-05-01

    The effect of adding electron donating and withdrawing groups on the dihydroazulene (DHA)/vinylheptafulvene (VHF) photochromic system has been investigated using Raman spectroscopy in CS2 solutions. The photoswitching between DHA and VHF is often characterised with UV-Vis spectroscopy. However, Raman spectroscopy can also be used for this purpose and give structural insight, as the light induced ring-opening from DHA to VHF causes changes in the CN-stretching frequencies. The CN-stretching frequencies in DHA and VHF are isolated and optimal for the identification of DHA and VHF. The DHA system is also investigated in the solid state.

  11. Chemical transitions for interstellar C2 and CN in cloud envelopes

    Science.gov (United States)

    Federman, S. R.; Strom, C. J.; Lambert, D. L.; Cardelli, Jason A.; Smith, V. V.; Joseph, C. L.

    1994-01-01

    Observations were made of absorption from CH, C2, and CN toward moderately reddened stars in Sco, OB2, Ceo OB3, and Taurus/Auriga. For these directions, most of the reddening is associated with a single cloud complex, for example, the rho Ophiuchus molecular cloud, and as a result, the observations probe moderately dense material. When combined with avaliable data for nearby directions, the survey provides the basis for a comprehensive analysis of the chemistry for these species. The chemical transitions affecting C2 and CN in cloud envelopes were analyzed. The depth into a cloud at which a transition takes place was characterized by tau(sub uv), the grain optical depth at 1000 A. One transition at tau(sub uv) approx. = 2, which arises from, the conversion of C(+) into CO, affects the chemistries for both molecules because of the key role this ion plays. A second one involving production terms in the CN chemistry occurs at tau(sub uv) of approx. = 3; neutral reactions which C2 and CH is more important at larger values for tau(sub uv). The transition from photodissociation to chemical destruction takes place at tau(sub uv) approx. = 4.5 for C2 and CN. The observational data for stars in Sco OB2, Cep OB3, and Taurus/Auriga were studied with chemical rate equations containing the most important production and destruction mechanisms. Because the sample of stars in Sco OB2 includes sight lines with A(sub v) ranging from 1-4 mag, sight lines dominated by photochemistry could be analyzed separately from those controlled by gas-phase destruction. The analysis yielded values for two poorly known rate constants for reactions involved in the production of CN; the reactions are C2 + N yields CN + C and C(+) + NH yields all products. The other directions were analyzed with the inferred values. The predicted column densities for C2 and CN agree with the observed values to better than 50%, and in most instances 20%. When combining the estimates for density and temperature derived

  12. ON THE SHARP GROWTH, COVERING THEOREMS FOR NORMALIZED BIHOLOMORPHIC MAPPINGS IN Cn

    Institute of Scientific and Technical Information of China (English)

    Liu Xiaosong; Liu Taishun

    2007-01-01

    In this article, a normalized biholomorphic mapping f defined on bounded starlike circular domain in Cn is considered, where z = 0 is a zero of order k + 1 of f(z) - z.The sharp growth, covering theorems for almost starlike mappings of order α and starlike mappings of order α are established. Meanwhile, the construction of the above mappings on bounded starlike circular domain in Cn is also discussed, it provides the extremal mappings for the growth, covering theorems of the above mappings.

  13. Tribological development of TiCN coatings by adjusting the flowing rate of reactive gases

    Science.gov (United States)

    Tillmann, Wolfgang; Momeni, Soroush

    2016-03-01

    TiCN coatings were deposited by means of direct current magnetron sputtering of Ti targets in presence of N2 and C2H2 reactive gases. The microstructure, composition, mechanical and tribological properties of the deposited thin films were analyzed by using X-ray diffraction (XRD), field emission scanning electron microscopy (FESEM), nanoindentation, ball-on-disc, scratch test, and three dimensional (3D) optical microscopy. The obtained results presents a reproducible processing route for tailoring microstructure, mechanical and tribological behavior of TiCN coatings by controlling flowing rate of the reactive gases.

  14. Wireless passive polymer-derived SiCN ceramic sensor with integrated resonator/antenna

    Science.gov (United States)

    Li, Yan; Yu, Yuxi; San, Haisheng; Wang, Yansong; An, Linan

    2013-10-01

    This paper presents a passive wireless polymer-derived silicon carbonitride (SiCN) ceramic sensor based on cavity radio frequency resonator together with integrated slot antenna. The effect of the cavity sensor dimensions on the Q-factor and resonant frequency is investigated by numerical simulation. A sensor with optimal dimensions is designed and fabricated. It is demonstrated that the sensor signal can be wirelessly detected at distances up to 20 mm. Given the high-temperature stability of the SiCN, the sensor is very promising for high-temperature wireless sensing applications.

  15. Corrosion resistance appraisal of TiN, TiCN and TiAlN coatings deposited by CAE-PVD method on WC-Co cutting tools exposed to artificial sea water

    Science.gov (United States)

    Matei, A. A.; Pencea, I.; Branzei, M.; Trancă, D. E.; Ţepeş, G.; Sfăt, C. E.; Ciovica (Coman), E.; Gherghilescu, A. I.; Stanciu, G. A.

    2015-12-01

    A new advanced sintered composite cutting tool has been developed based on tungsten carbide matrix ligated with cobalt (WC-Co) additivated with tantalum carbide (TaC), titanium carbide (TiC) and niobium carbide (NbC) as grain growth inhibitors. Titanium nitride (TiN), titanium carbonitride (TiCN) and titanium aluminium nitride (TiAlN) coatings were deposited on these tools by CAE-PVD technique to find out the best solution to improve the corrosion resistance of this tool in marine environment. The electrochemical behaviours of the specimens in 3.5% NaCl water solution were estimated by potentiodynamic polarization measurements i.e. the open circuit potential (Eoc), corrosion potential (Ecorr) and corrosion current density (icorr). Wide angle X-ray diffraction (WAXD), optical microscopy (OM) and atomic force microscopy (AFM) investigations have been carried on tested and untested specimens to substantiate the corrosion resistance of the tested specimens. Based on the open circuit potential (Eoc) and corrosion potential (Ecorr) results, the tested specimens were ranked as TiN, TiAlN, TiCN and WC-Co while on corrosion current density (icorr) and protective efficiency (P) values they have been ranked as TiN, TiAlN, WC-Co and TiCN. The WAXD, MO and AFM results unambiguously show that the corrosion resistance depends on the nature and morphology of the coating.

  16. Sodium uptake in cell construction and subsequent in operando electrode behaviour of Prussian blue analogues, Fe[Fe(CN)6](1-x)·yH2O and FeCo(CN)6.

    Science.gov (United States)

    Pramudita, James C; Schmid, Siegbert; Godfrey, Thomas; Whittle, Thomas; Alam, Moshiul; Hanley, Tracey; Brand, Helen E A; Sharma, Neeraj

    2014-11-28

    The development of electrodes for ambient temperature sodium-ion batteries requires the study of new materials and the understanding of how crystal structure influences properties. In this study, we investigate where sodium locates in two Prussian blue analogues, Fe[Fe(CN)6]1-x·yH2O and FeCo(CN)6. The evolution of the sodium site occupancies, lattice and volume is shown during charge-discharge using in situ synchrotron X-ray powder diffraction data. Sodium insertion is found to occur in these electrodes during cell construction and therefore Fe[Fe(CN)6]1-x·yH2O and FeCo(CN)6 can be used as positive electrodes. NazFeFe(CN)6 electrodes feature higher reversible capacities relative to NazFeCo(CN)6 electrodes which can be associated with a combination of structural factors, for example, a major sodium-containing phase, ∼Na0.5FeFe(CN)6 with sodium locating either at the x = y = z = 0.25 or x = y = 0.25 and z = 0.227(11) sites and an electrochemically inactive sodium-free Fe[Fe(CN)6]1-x·yH2O phase. This study demonstrates that key questions about electrode performance and attributes in sodium-ion batteries can be addressed using time-resolved in situ synchrotron X-ray diffraction studies. PMID:25072188

  17. Esterification and Chemoselective Synthesis of R-Tetrahydrothiazo-2- thione-4-carboxylic Esters Catalyzed by TiCl4

    Institute of Scientific and Technical Information of China (English)

    SHANG Yan-mei; LI Jing; SONG Zhi-guang; LI Ye-zhi; HUANG Hua-min

    2007-01-01

    A series of esters of R-tetrahydrothiazo-2-thione-4-carboxylic acid[ R-TTCA] was synthesized by direct esterification of R-TTCA with alcohols(CH3OH, C2H5OH, n-C3H7OH, i-C3H7OH, n-C4H9OH, sec-C4H9OH) in the presence of TiCl4 as the catalyst at room temperature without using any other solvent or dehydrant in high yields,91.6%-99.1% for primary alcohols and 55%- 80% for secondary alcohols. The catalyst has a strong chemoselecfive activity for the esterification of primary alcohols with R-TTCA in the presence of secondary alcohols. Owing to high yield, high chemoselectivity, and mild conditions used, this is an efficient method for the esterification of primary alcohols with R-TTCA.

  18. Quantitative and sensitive analysis of CN molecules using laser induced low pressure He plasma

    Energy Technology Data Exchange (ETDEWEB)

    Pardede, Marincan [Department of Electrical Engineering, University of Pelita Harapan, 1100 M.H. Thamrin Boulevard, Lippo Village, Tangerang 15811 (Indonesia); Hedwig, Rinda [Department of Computer Engineering, Bina Nusantara University, 9 K.H. Syahdan, Jakarta 14810 (Indonesia); Abdulmadjid, Syahrun Nur; Lahna, Kurnia; Idris, Nasrullah; Ramli, Muliadi [Department of Physics, Faculty of Mathematics and Natural Sciences, Syiah Kuala University, Darussalam, Banda Aceh 23111, NAD (Indonesia); Jobiliong, Eric [Department of Industrial Engineering, University of Pelita Harapan, 1100 M.H. Thamrin Boulevard, Lippo Village, Tangerang 15811 (Indonesia); Suyanto, Hery [Department of Physics, Faculty of Mathematics and Natural Sciences, Udayana University, Kampus Bukit Jimbaran, Denpasar 80361, Bali (Indonesia); Marpaung, Alion Mangasi [Department of Physics, Faculty of Mathematics and Natural Sciences, Jakarta State University, 10 Rawamangun, Jakarta 13220 (Indonesia); Suliyanti, Maria Margaretha [Research Center for Physics, Indonesia Institute of Sciences, Kawasan Puspiptek, Serpong, Tangerang Selatan, 15314 Banten (Indonesia); Tjia, May On [Physics of Magnetism and Photonics Group, Faculty of Mathematics and Natural Sciences, Bandung Institute of Technology, 10 Ganesha, Bandung 40132 (Indonesia); Research Center of Maju Makmur Mandiri Foundation, 40/80 Srengseng Raya, Jakarta 11630 (Indonesia); Lie, Tjung Jie; Lie, Zener Sukra; Kurniawan, Davy Putra; Kurniawan, Koo Hendrik, E-mail: kurnia18@cbn.net.id [Research Center of Maju Makmur Mandiri Foundation, 40/80 Srengseng Raya, Jakarta 11630 (Indonesia); Kagawa, Kiichiro [Research Center of Maju Makmur Mandiri Foundation, 40/80 Srengseng Raya, Jakarta 11630 (Indonesia); Fukui Science Education Academy, Takagi Chuou 2 choume, Fukui 910-0804 (Japan)

    2015-03-21

    We report the results of experimental study on CN 388.3 nm and C I 247.8 nm emission characteristics using 40 mJ laser irradiation with He and N{sub 2} ambient gases. The results obtained with N{sub 2} ambient gas show undesirable interference effect between the native CN emission and the emission of CN molecules arising from the recombination of native C ablated from the sample with the N dissociated from the ambient gas. This problem is overcome by the use of He ambient gas at low pressure of 2 kPa, which also offers the additional advantages of cleaner and stronger emission lines. The result of applying this favorable experimental condition to emission spectrochemical measurement of milk sample having various protein concentrations is shown to yield a close to linear calibration curve with near zero extrapolated intercept. Additionally, a low detection limit of 5 μg/g is found in this experiment, making it potentially applicable for quantitative and sensitive CN analysis. The visibility of laser induced breakdown spectroscopy with low pressure He gas is also demonstrated by the result of its application to spectrochemical analysis of fossil samples. Furthermore, with the use of CO{sub 2} ambient gas at 600 Pa mimicking the Mars atmosphere, this technique also shows promising applications to exploration in Mars.

  19. Quantitative and sensitive analysis of CN molecules using laser induced low pressure He plasma

    International Nuclear Information System (INIS)

    We report the results of experimental study on CN 388.3 nm and C I 247.8 nm emission characteristics using 40 mJ laser irradiation with He and N2 ambient gases. The results obtained with N2 ambient gas show undesirable interference effect between the native CN emission and the emission of CN molecules arising from the recombination of native C ablated from the sample with the N dissociated from the ambient gas. This problem is overcome by the use of He ambient gas at low pressure of 2 kPa, which also offers the additional advantages of cleaner and stronger emission lines. The result of applying this favorable experimental condition to emission spectrochemical measurement of milk sample having various protein concentrations is shown to yield a close to linear calibration curve with near zero extrapolated intercept. Additionally, a low detection limit of 5 μg/g is found in this experiment, making it potentially applicable for quantitative and sensitive CN analysis. The visibility of laser induced breakdown spectroscopy with low pressure He gas is also demonstrated by the result of its application to spectrochemical analysis of fossil samples. Furthermore, with the use of CO2 ambient gas at 600 Pa mimicking the Mars atmosphere, this technique also shows promising applications to exploration in Mars

  20. Electron paramagnetic resonance of K3Rh(CN)6 irradiated with electrons in KCl

    International Nuclear Information System (INIS)

    Using a simple theory, it was estimated the electronic density of the diamagnetic complex Rh (CN)3-6 in a KCl lattice. The g// and g1 values were determined by EPR, and the experimental results fit the theoretical calculations. (M.W.O.)