
Sample records for cl br h2dhp

  1. Molecular dynamics simulations of Si etching in Cl- and Br-based plasmas: Cl+ and Br+ ion incidence in the presence of Cl and Br neutrals

    International Nuclear Information System (INIS)

    Classical molecular dynamics (MD) simulations have been performed for Cl+ and Br+ ions incident on Si(100) surfaces with Cl and Br neutrals, respectively, to gain a better understanding of the ion-enhanced surface reaction kinetics during Si etching in Cl- and Br-based plasmas. The ions were incident normally on surfaces with translational energies in the range Ei = 20–500 eV, and low-energy neutrals of En = 0.01 eV were also incident normally thereon with the neutral-to-ion flux ratio in the range Γn0/Γi0 = 0–100, where an improved Stillinger--Weber potential form was employed for the interatomic potential concerned. The etch yields and thresholds presently simulated were in agreement with the experimental results previously reported for Si etching in Cl2 and Br2 plasmas as well as in Cl+, Cl2+, and Br+ beams, and the product stoichiometry simulated was consistent with that observed during Ar+ beam incidence on Si in Cl2. Moreover, the surface coverage of halogen atoms, halogenated layer thickness, surface stoichiometry, and depth profile of surface products simulated for Γn0/Γi0 = 100 were in excellent agreement with the observations depending on Ei reported for Si etching in Cl2 plasmas. The MD also indicated that the yield, coverage, and surface layer thickness are smaller in Si/Br than in Si/Cl system, while the percentage of higher halogenated species in product and surface stoichiometries is larger in Si/Br. The MD further indicated that in both systems, the translational energy distributions of products and halogen adsorbates desorbed from surfaces are approximated by two Maxwellians of temperature T1 ≈ 2500 K and T2 ≈ 7000–40 000 K. These energy distributions are discussed in terms of the desorption or evaporation from hot spots formed through chemically enhanced physical sputtering and physically enhanced chemical sputtering, which have so far been speculated to both occur in the ion-enhanced surface reaction

  2. Molecular dynamics simulations of Si etching in Cl- and Br-based plasmas: Cl+ and Br+ ion incidence in the presence of Cl and Br neutrals (United States)

    Nakazaki, Nobuya; Takao, Yoshinori; Eriguchi, Koji; Ono, Kouichi


    Classical molecular dynamics (MD) simulations have been performed for Cl+ and Br+ ions incident on Si(100) surfaces with Cl and Br neutrals, respectively, to gain a better understanding of the ion-enhanced surface reaction kinetics during Si etching in Cl- and Br-based plasmas. The ions were incident normally on surfaces with translational energies in the range Ei = 20-500 eV, and low-energy neutrals of En = 0.01 eV were also incident normally thereon with the neutral-to-ion flux ratio in the range Γn0/Γi0 = 0-100, where an improved Stillinger--Weber potential form was employed for the interatomic potential concerned. The etch yields and thresholds presently simulated were in agreement with the experimental results previously reported for Si etching in Cl2 and Br2 plasmas as well as in Cl+, Cl2+, and Br+ beams, and the product stoichiometry simulated was consistent with that observed during Ar+ beam incidence on Si in Cl2. Moreover, the surface coverage of halogen atoms, halogenated layer thickness, surface stoichiometry, and depth profile of surface products simulated for Γn0/Γi0 = 100 were in excellent agreement with the observations depending on Ei reported for Si etching in Cl2 plasmas. The MD also indicated that the yield, coverage, and surface layer thickness are smaller in Si/Br than in Si/Cl system, while the percentage of higher halogenated species in product and surface stoichiometries is larger in Si/Br. The MD further indicated that in both systems, the translational energy distributions of products and halogen adsorbates desorbed from surfaces are approximated by two Maxwellians of temperature T1 ≈ 2500 K and T2 ≈ 7000-40 000 K. These energy distributions are discussed in terms of the desorption or evaporation from hot spots formed through chemically enhanced physical sputtering and physically enhanced chemical sputtering, which have so far been speculated to both occur in the ion-enhanced surface reaction kinetics of plasma etching.

  3. Dynamics of endoergic substitution reactions. II. Br+/C2H2Cl2/→Cl+/C2H2ClBr/

    International Nuclear Information System (INIS)

    We have extended the crossed beams studies described in the preceding paper to the reactions of Br atoms with 1,1- and trans-dichloroethylene. The shapes of the product translational energy distributions and excitation functions for both reactions support our previous conclusion that Cl elimination from Br--R--Cl collision complexes can compete with Br elimination only in the limit that few vibrational modes of the complex are active in energy redistribution. The substitution cross section for the Br+CH2CCl2 reaction is considerably lower than that for the Br+trans-CHClCHCl reaction in the collision energy range 15--25 kcal/mol, suggesting that steric effects play a dominant role in determining the relative magnitudes of the cross sections

  4. Systematic hardness measurements on CsClBr(1–x) and NH4ClBr(1–x) mixed crystals

    Indian Academy of Sciences (India)

    K G Subhadra; E Balaiah; D B Sirdeshmukh


    Vickers hardness measurements have been made on polycrystalline blanks of CsClBr(1–x) and single crystals of NH4ClBr(1–x). The composition dependence of hardness is highly nonlinear in both systems and follows an empirical model that includes a lattice contribution and a disorder contribution. The Gilman–Chin parameter (/44) has been calculated and its significance discussed.

  5. Molecular dynamics simulations of Si etching in Cl- and Br-based plasmas: Cl{sup +} and Br{sup +} ion incidence in the presence of Cl and Br neutrals

    Energy Technology Data Exchange (ETDEWEB)

    Nakazaki, Nobuya, E-mail:; Takao, Yoshinori; Eriguchi, Koji; Ono, Kouichi, E-mail: [Department of Aeronautics and Astronautics, Graduate School of Engineering, Kyoto University, Kyoto-daigaku Katsura, Nishikyo-ku, Kyoto 615-8540 (Japan)


    Classical molecular dynamics (MD) simulations have been performed for Cl{sup +} and Br{sup +} ions incident on Si(100) surfaces with Cl and Br neutrals, respectively, to gain a better understanding of the ion-enhanced surface reaction kinetics during Si etching in Cl- and Br-based plasmas. The ions were incident normally on surfaces with translational energies in the range E{sub i} = 20–500 eV, and low-energy neutrals of E{sub n} = 0.01 eV were also incident normally thereon with the neutral-to-ion flux ratio in the range Γ{sub n}{sup 0}/Γ{sub i}{sup 0} = 0–100, where an improved Stillinger--Weber potential form was employed for the interatomic potential concerned. The etch yields and thresholds presently simulated were in agreement with the experimental results previously reported for Si etching in Cl{sub 2} and Br{sub 2} plasmas as well as in Cl{sup +}, Cl{sub 2}{sup +}, and Br{sup +} beams, and the product stoichiometry simulated was consistent with that observed during Ar{sup +} beam incidence on Si in Cl{sub 2}. Moreover, the surface coverage of halogen atoms, halogenated layer thickness, surface stoichiometry, and depth profile of surface products simulated for Γ{sub n}{sup 0}/Γ{sub i}{sup 0} = 100 were in excellent agreement with the observations depending on E{sub i} reported for Si etching in Cl{sub 2} plasmas. The MD also indicated that the yield, coverage, and surface layer thickness are smaller in Si/Br than in Si/Cl system, while the percentage of higher halogenated species in product and surface stoichiometries is larger in Si/Br. The MD further indicated that in both systems, the translational energy distributions of products and halogen adsorbates desorbed from surfaces are approximated by two Maxwellians of temperature T{sub 1} ≈ 2500 K and T{sub 2} ≈ 7000–40 000 K. These energy distributions are discussed in terms of the desorption or evaporation from hot spots formed through chemically enhanced physical

  6. Photostimulated process in CsBrCl:Eu2+: a promising image screen phosphor

    International Nuclear Information System (INIS)

    CsBrCl and CsBrCl:Eu2+ have been grown by 'Double Run Bridgman technique'. Optical investigations have been carried out on the samples. The formation of F(Br-) and F(Cl-) centers have been confirmed by optical absorption bands at 640 and 615 nm, respectively. The photoluminescence (PL) spectra for europium (100 ppm) doped CsBrCl samples give emission of europium at 442 nm. This 442 nm emission is due to the transition from T2g component of 4f65d configuration to the ground state 8S of europium. The emission due to the presence of impurities in the host lattice is detected by PL technique. The OH- impurity in the host lattice due to decomposition of the salt in open air gives out emission at 395 and 365 nm. The O2- emission is observed at 465 and 468 nm. Photostimulated luminescence (PSL) process is studied in the samples by exciting them at F-absorption wavelength after irradiation. No PSL is observed for the undoped CsBrCl samples grown in vacuum. The PSL of vacuum grown CsBrCl:Eu2+ samples for excitations at 640 nm [F(Br-)] and 615 nm [F(Cl-)] is observed at 420 nm. It is deciphered that both F(Cl-) and F(Br-) centers contribute to PSL. The two F-centers noticed in absorption are stimulated separately; the resulting PSL signal confirms the participation of F-centers in photostimulated process. The lifetime of the PSL emission for CsBrCl:Eu2+ is determined to be 0.69 μs. Application of the material as a prospective image screen phosphor is elaborated based on PSL results

  7. A New Promising X-Ray Storage Phosphor BaBrCl:Eu2+

    Institute of Scientific and Technical Information of China (English)


    Photostimulated luminescence was observed in X-ray irradiated BaBrCl doped with Eu2+. It shows an emission band that peak at 413 nm, and two difference absorption spectra (DAS) bands that peak at ~550 nm and 675 nm respectively. The stimulation energy is lower than that of BaFX:Eu2+ (X=Cl, Br), and matches the cheaper, more portable, and more convenient semiconductor laser better. The results indicate that BaBrCl:Eu2+ shows positive potential as a promising X-ray storage phosphor for practical utilization.

  8. Fractionation of Cl/Br during fluid phase separation in magmatic-hydrothermal fluids (United States)

    Seo, Jung Hun; Zajacz, Zoltán


    Brine and vapor inclusions were synthesized to study Cl/Br fractionation during magmatic-hydrothermal fluid phase separation at 900 °C and pressures of 90, 120, and 150 MPa in Li/Na/K halide salt-H2O systems. Laser ablation ICP-MS microanalysis of high-density brine inclusions show an elevated Cl/Br ratio compared to the coexisting low-density vapor inclusions. The degree of Cl/Br fractionation between vapor and brine is significantly dependent on the identity of the alkali metal in the system: stronger vapor partitioning of Br occurs in the Li halide-H2O system compared to the systems of K and Na halide-H2O. The effect of the identity of alkali-metals in the system is stronger compared to the effect of vapor-brine density contrast. We infer that competition between alkali-halide and alkali-OH complexes in high-temperature fluids might cause the Cl/Br fractionation, consistent with the observed molar imbalances of alkali metals compared to halides in the analyzed brine inclusions. Our experiments show that the identity of alkali metals controls the degrees of Cl/Br fractionation between the separating aqueous fluid phases at 900 °C, and suggest that a significant variability in the Cl/Br ratios of magmatic fluids can arise in Li-rich systems.

  9. Quasiclassical trajectory study of the four-center reactions: HBr+Cl2 and HBr+BrCl

    International Nuclear Information System (INIS)

    A quasiclassical trajectory study has been made of the dynamics of two four-center reactions: HBr+Cl2→HCl+BrCl, HBr+BrCl→HCl+Br2. Semiempirical, valence-bond potential-energy surfaces were employed, with potential parameters obtained from related atom--diatomic molecule systems. Reaction probabilities and cross sections were computed as functions of reactant vibration, rotation, and translation. Extrapolated cross section curves were used to make estimates of thermal rate coefficients. The dependence of the reaction probability on other dynamics variables such as impact parameter and orientation angles was also investigated. These results indicate that under attainable laboratory conditions (including IR excitation) the reaction proceeds at a rate too slow to be observed by usual methods

  10. On the Attosecond charge migration in Cl.....N, Cl.....O, Br.....N and Br.....O Halogen-bonded clusters: Effect of donor, acceptor, vibration, rotation, and electron correlation

    Indian Academy of Sciences (India)



    The electron-electron relaxation and correlation-driven charge migration process, which features pure electronic aspect of ultrafast charge migration phenomenon, occurs on a very short timescale in ionized molecules and molecular clusters, prior to the onset of nuclear motion. In this article, we have presented natureof ultrafast pure electronic charge migration dynamics through Cl.....N, Cl.....O, Br.....N, and Br.....O halogen bonds, explored using density functional theory. We have explored the role of donor, acceptor, electron correlation, vibration and rotation in charge migration dynamics through these halogen bonds. For this work, we have selected ClF, Cl₂, ClOH, ClCN, BrF, BrCl, BrOH, and BrCN molecules paired with either NH₃ or H₂O. We have found that the timescale for pure electron-electron relaxation and correlation-driven charge migration through the Cl.....N, Br.....N, Cl.....O, and Br.....O halogen bonds falls in the range of 300–600 attosecond. The primary driving force behind the attosecond charge migration through the Cl.....N, Br.....N, Cl.....O, and Br.....O halogen bonds is the energy difference (∆E) between two stationary cationic orbitals (LUMO-β and HOMO-β), which together represents the initial hole density immediately following vertical ionization. We have also predicted that the strength of electron correlation has significant effect on the charge migration timescale in Cl.....N, Br.....N, Cl.....O, and Br.....O halogen bonded clusters. Vibration and rotation are also found to exhibit profound effect on attosecond charge migration dynamics through halogen bonds.

  11. Corrosion of type 316 stainless steel in molten LiF-LiCl-LiBr

    International Nuclear Information System (INIS)

    The properties of LiF-LiCl-LiBr salt make it attractive as a solvent for extracting tritium from a fusion reactor lithium blanket. Consequently, the corrosion of type 316 stainless steel by flowing (about 15 mm/s) LiF-LiCl-LiBr at a maximum temperature of 5350C was studied to determine whether compatibility with the structural material would be limiting in such a system. The corrosion rate was found to be low (0C (approximately that of type 316 stainless steel exposed to lithium flowing at a similar velocity). At the proposed operating temperature (less than or equal to approx. 5350C), however, it appears that type 316 stainless steel has acceptable compatibility with the tritium-processing salt LiF-LiCl-LiBr for use with a lithium blanket

  12. Proton and helium stopping cross sections in Cl2 and Br2

    International Nuclear Information System (INIS)

    Proton and 4He stopping powers for gaseous Cl2 and Br2 were measured in the energy ranges 50-750 keV and 100-1000 keV, respectively, and fitted with the semi-empirical Andersen-Ziegler formula. The peak energies are located near the minima of the oscillating structure as a function of the target atomic number Z2 recently observed by Gowda et al. The stopping-power ratios Ssub(He)/Ssub(p) for Cl2 and Br2 as a function of ion velocity show a similar behavior as for the adjacent inert gases Ar and Kr. The low-energy helium stopping cross sections were described by the power functions S=kEsup(p), whereby p values of 0.5 for Cl2 and 0.67 for Br2 were found. (orig.)

  13. Magnetic ordering in the erbium honey comb lattices of ErX3 (X = Cl, Br,

    International Nuclear Information System (INIS)

    Complete text of publication follows. Unusual 2-D and 3-D magnetic ordering phenomena have been observed in the insulating, transparent erbium trihalides ErX3 (X = Cl, Br, I) in the mini Kelvin temperature range. The layer-type crystal structures of ErCl3 (AlCl3 type structure) and ErBr3/ErI3 (BiI3 type structure) are closely related. All three compounds show a new type of 2 sublattice 120 deg antiferromagnetic order in the erbium honey comb layers with an infinite rotational degeneracy. The magnetic structures were determined by powder and single crystal neutron diffraction. ErCl3 shows a transition to 3-D magnetic order at 350 mK with a k-vector of (2/3, 0, -1/12). ErBr3 and ErI3 display short-range 2-D magnetic order from 400 mK to several Kelvin, longrange 2-D order between 280 mK and 400 mK, and short-range 3-D order below 280 mK with a correlation length of 15 A and k = (1/3, 1/3, 0). The differences between ErCl3 and ErBr3/ErI3 are due to different geometrical layer stackings. For ErBr3/ErI3 a threefold ambiguity in the magnetic layer stacking causes the disorder along the c-axis. The ordered magnetic moments at saturation increase from 3.3 to 4.7 and 5.5 μB/Er3+ for ErCl3, ErBr3 and ErI3, respectively. This is the first report on magnetic structures of layer-type rare-earth trihalides. (author)

  14. Fast oxidative reactions following irradiation in aqueous solutions of Cl-, Br-, and CNS-

    International Nuclear Information System (INIS)

    The reactions of sup(.)OH, the oxidizing species produced by radiation are well characterized for nanosecond times. Hamill suggested, however, that a normal competition scheme does not explain the observed results in concentrated solutions. Using the stroboscopic pulse radiolysis technique a study has been made of the initial reactions of scavengers such as Cl-, Br-and CNS- in concentrations from 1 to 5M. A fast component of the absorption signals has been observed with the time resolution as short as 18ps. In all of the concentrated solutions studied, the normal absorption spectra and yields of Cl2-, Br2- and (CNS)2- were found. A concentration of 1M NaOH greatly reduced the yield of Cl2-, but not the yields of Br2- and (CNS)2-. The best model that has been found is to assume two steps in the reaction; that is the reaction of the short-lived species, H2O+, with the scavenger X-, followed by a fast reaction between neighbouring molecules to produce the observed species, X2-. Recently, mixtures of Cl2- and scavengers such as dextrose and propanol were studied. The yield of Cl2- was reduced markedly. Since this observation cannot be accounted for by a normal competition scheme involving sup(.)OH, it is in support of the view that the initial positive ion, H2O+, is important in concentrated solutions. (author)

  15. H 2O and halogen (F, Cl, Br) behaviour during shallow magma degassing processes (United States)

    Villemant, Benoı̂t; Boudon, Georges


    Degassing paths of silicic H 2O-rich magmas during explosive Plinian and dome-forming eruptions may be represented in simple evolution diagrams relating the residual volatile content of the melt to the volume ratio of gas over melt ( Vg/ Vl). These parameters are measurable in erupted magma fragments. They are used for interpreting the H 2O and halogen contents determined in a series of variously degassed volcanic clasts from the 650 y. B.P. eruption at Mt. Pelée (Martinique, FWI) which is characterized by the succession of a dome extrusion and a Plinian activity. H 2O degassing of Plinian pumice clasts are modeled by an equilibrium closed system evolution which allows to calculate the partition coefficients of halogen between the aqueous fluid and the rhyolitic melt d v-li: ≪1 for F, 10±1.5 for Cl and 3.7±1 for Br, at around 900°C. The strong increase of the dv-li values of Cl and Br during dome extrusion is explained by an open system degassing model with a simultaneous crystallization of the melt. Some significant Br enrichments relative to Cl in dome fragments are attributed to interactions with an hydrothermal fluid close to seawater in composition. The models allow calculation of Cl and Br contents of aqueous fluids generated by the different degassing paths: Cl contents are ≈0.5 mol/l for closed system evolution and vary between 0.2 and 1 mol/l during open system evolutions. These fluids are able to extract significant amounts of chloride complexed metals and silica from the magma during dome forming eruptions. They also may generate mineralization of the wall rocks or the rising dome itself (e.g. silica precipitation) which may seal the volcanic system and be responsible for the dome explosivity and the transition from dome-forming to Plinian eruptive style. The Cl/Br ratio of initial melts of P1 eruption (≈250) is much lower than the basaltic and exospheric ratios (≈400), suggesting that strong Cl-Br fractionation may occur during the

  16. Proton-stopping cross sections and mean excitation energies for gaseous Cl2 and Br2

    International Nuclear Information System (INIS)

    First measurements of proton stopping powers in gaseous Cl2 and Br2 are reported for the energy range between 50 and 750 keV with statistical and systematical errors of about 1% each. In the stopping-power maximum the experimental values are higher than those predicted by the Andersen-Ziegler tables; moreover, lower peak energies are found. Experimental shell corrections were deduced from the proton stopping cross sections and adjusted to the theoretical predictions of Bonderup, whereby higher-order Z1 correction terms were included. Within this procedure semiempirical values for the mean ionization potentials of 174 eV for Cl2 and 363 eV for Br2 were obtained

  17. Proton induced activation of LaBr3:Ce and LaCl3:Ce

    International Nuclear Information System (INIS)

    In the framework of an assessment of lanthanum halide scintillators, such as LaBr3:Ce and LaCl3:Ce on their suitability for space based gamma-ray spectroscopy, proton induced activation of the materials has been studied. One inch scintillators were subjected to proton irradiations in the range of 60-184 MeV, where after the activation was measured. The activation was analyzed by identifying the decaying isotopes by means of gamma-ray spectroscopy and lifetime measurements using both a germanium detector and the activated scintillator itself. It was found that the dominant source of activation in the scintillators originates from the lighter elements in the materials: bromide and chloride, respectively. The activation of LaBr3:Ce manifest itself through gamma-decay, which partly leaves the volume. Activation of LaCl3:Ce originates mainly from beta decay, which is confined to the volume itself

  18. Laser cooling of MgCl and MgBr in theoretical approach

    International Nuclear Information System (INIS)

    Ab initio calculations for three low-lying electronic states (X2Σ+, A2Π, and 22Π) of MgCl and MgBr molecules, including spin-orbit coupling, are performed using multi-reference configuration interaction plus Davidson correction method. The calculations involve all-electronic basis sets and Douglas–Kroll scalar relativistic correction. Spectroscopic parameters well agree with available theoretical and experimental data. Highly diagonally distributed Franck-Condon factors f00 for A2Π3/2,1/2 (υ′ = 0) → X2Σ+1/2 (υ″ = 0) are determined for both MgCl and MgBr molecules. Suitable radiative lifetimes τ of A2Π3/2,1/2 (υ′ = 0) states for rapid laser cooling are also obtained. The proposed laser drives A2Π3/2 (υ′ = 0) → X2Σ+1/2 (υ″ = 0) transition by using three wavelengths (main pump laser λ00; two repumping lasers λ10 and λ21). These results indicate the probability of laser cooling MgCl and MgBr molecules

  19. Laser cooling of MgCl and MgBr in theoretical approach

    Energy Technology Data Exchange (ETDEWEB)

    Wan, Mingjie; Shao, Juxiang; Huang, Duohui; Yang, Junsheng; Cao, Qilong; Jin, Chengguo; Wang, Fanhou, E-mail: [Computational Physics Key Laboratory of Sichuan Province, Yibin University, Yibin 644007 (China); Gao, Yufeng [Institute of Atomic and Molecular Physics, Sichuan University, Chengdu 610065 (China)


    Ab initio calculations for three low-lying electronic states (X{sup 2}Σ{sup +}, A{sup 2}Π, and 2{sup 2}Π) of MgCl and MgBr molecules, including spin-orbit coupling, are performed using multi-reference configuration interaction plus Davidson correction method. The calculations involve all-electronic basis sets and Douglas–Kroll scalar relativistic correction. Spectroscopic parameters well agree with available theoretical and experimental data. Highly diagonally distributed Franck-Condon factors f{sub 00} for A{sup 2}Π{sub 3/2,1/2} (υ′ = 0) → X{sup 2}Σ{sup +}{sub 1/2} (υ″ = 0) are determined for both MgCl and MgBr molecules. Suitable radiative lifetimes τ of A{sup 2}Π{sub 3/2,1/2} (υ′ = 0) states for rapid laser cooling are also obtained. The proposed laser drives A{sup 2}Π{sub 3/2} (υ′ = 0) → X{sup 2}Σ{sup +}{sub 1/2} (υ″ = 0) transition by using three wavelengths (main pump laser λ{sub 00}; two repumping lasers λ{sub 10} and λ{sub 21}). These results indicate the probability of laser cooling MgCl and MgBr molecules.

  20. A MS-CASPT2 study of the low-lying electronic excited states of CH 2BrCl (United States)

    Rozgonyi, Tamás; Feurer, Thomas; González, Leticia


    The low-lying singlet excited states of CH 2BrCl have been calculated using multiconfigurational CASSCF, second-order perturbation theory CASPT2 and its multistate extension MS-CASPT2. The CASSCF method shows spurious valence-Rydberg mixing and a wrong order of states. Inclusion of dynamical correlation by single root CASPT2 lowers dramatically the energy of the valences states but does not lead to a complete separation between valence and Rydberg states. This situation is improved by the MS-CASPT2 calculations, which gives two valence states for both A ' and A″ symmetries below the lowest Rydberg state, corresponding to n(Br)→σ *(C-Br) and n(Cl)→σ *(C-Cl) transitions at 6.1 eV (203 nm) and 7.2 eV (173 nm), and being repulsive along C-Br and C-Cl coordinates.

  1. X-ray excited optical luminescence studies on the system Ba (, =F, Cl, Br, I)

    Indian Academy of Sciences (India)

    K Govinda Rajan; A Jestin Lenus


    The present paper reports the experimental observations on the x-ray excited optical luminescence (XEOL) along with the afterglow and colour center features found for the barium salts, represented by the formula, Ba, where and are the halides. The system thus consists of four dihalides (BaF2, . . . ,BaI2) and six mixed halides (BaFCl,. . . ,BaBrI). To start with, it was found that on two of the binary halides of barium, BaClI and BaBrI, no literature exists, and so these were prepared for the first time and their crystal structures were determined. An x-ray generator of 3-kW rating was next coupled to a spectrometer via a high throughput fiberoptic sensor for recording the luminescence spectra under x-irradiation. Also presented in this paper are the observations on the Ba compounds in which about 0.1 mole% of Eu2+ was doped, in order to study the efficiency between the prompt luminescence and the photostimulated luminescence in these compounds. The crystal structure varies from fluorite (BaF2), to matlockite (BaF) and finally to orthorhombic (BaCl2, . . .,BaBrI) for these compounds. Hence searching for systematics and empirical relations in the observed XEOL behaviour of these compounds is still a challenging problem.

  2. Specific oxidation pattern of soluble starch with TEMPO-NaBr-NaClO system. (United States)

    Hao, Jie; Lu, Jiaojiao; Xu, Naiyu; Linhardt, Robert J; Zhang, Zhenqing


    Oxidized starch, one of the most important starch derivatives, has many different properties and applications. Currently, there are two ways to produce oxidized starch, through specific and nonspecific oxidation. Specific oxidation using the stable nitroxyl radical, 2,2,6,6-tetramethyl preparidinloxy (TEMPO), with NaBr and NaClO can produce oxidized starches with different properties under good quality control. In the current study, we examine the products of specifically oxidized starch. As the amount of oxidant and the temperature, two critical factors impacting the oxidation of starch were thoroughly investigated. Analysis of the molecular weight (MW), degree of oxidization (DO) and the detailed structures of corresponding products was accomplished using gel permeation chromatography with multi-angle laser light scattering (GPC-MALLS), infrared (IR) spectroscopy, nuclear magnetic resonance (NMR) spectroscopy, and quadrapole time-of-flight mass spectrometry (Q/TOF-MS). According to the analytical results, the oxidation patterns of starch treated with specific oxidant TEMPO-NaBr-NaClO were established. When high amounts of oxidant was applied, more glucose residues within starch were oxidized to glucuronic acids (higher DO) and substantial degradation to starch oligosaccharides was observed. By selecting a reaction temperature of 25°C a high DO could be obtained for a given amount of oxidant. The reducing end sugar residue within oxidized starch was itself oxidized and ring opened in all TEMPO-NaBr-NaClO reactions. Furthermore, extra oxidant generated additional novel structures in the reducing end residues of some products, particularly in low temperature reactions. PMID:27112871

  3. Theoretical analysis of static properties of mixed ionic crystal: NH4Cl1−Br

    Indian Academy of Sciences (India)

    D Rawat; N K Gaur; Sadhna Singh; A Gour


    In the present paper, we have investigated the static properties of the mixed ionic crystal NH4Cl1−Br using three-body potential model (TBPM) by the application of Vegard’s law. The results for the mixed crystal counterparts are also in fair agreement with the pseudo-experimental data generated from the application of Vegard’s law. The results for the end point members ( = 0 and 1) are in good agreement with the experimental data. The results on compressibility, molecular force constant, infrared absorption frequencies and Debye temperature are presented probably for the first time for these mixed crystal counterparts.

  4. Structure and bonding of [(SIPr)AgX] (X = Cl, Br, I and OTf). (United States)

    Wong, Valerie H L; White, Andrew J P; Hor, T S Andy; Hii, King Kuok Mimi


    A series of iso-structural complexes [(SIPr)AgX] (X = Cl, Br, I, OTf; SIPr = 1,3-bis(2,6-diisopropylphenyl)imidazolidene) were synthesised, including the first example of a N-heterocyclic carbene silver(I) complex containing an O-bound triflate. Bond Energy Dissociation and Natural Orbitals for Chemical Valence bond analyses (BEDA & ETS-NOCV) revealing a significant NHC → M σ-back-donation, which influences the stability and sigma-donicity of these complexes. PMID:26489888

  5. Mutual neutralization of He+ with the anions Cl-, Br-, I-, and SF6- (United States)

    Wiens, Justin P.; Shuman, Nicholas S.; Miller, Thomas M.; Viggiano, Albert A.


    Mutual neutralization (MN) rate coefficients kMN for He+ with the anions Cl-, Br-, I-, and SF6- are reported from 300 to 500 K. The measured rate coefficients may contain a contribution from transfer ionization, i.e., double ionization of the anion. The large rate coefficient for He+ + SF6- (2.4 × 10-7 cm3 s-1 at 300 K) is consistent with earlier polyatomic MN results found to have a reduced mass dependence of μ-1/2. Neutralization of He+ by the atomic halides follows the trend observed earlier for Ne+, Ar+, Kr+, and Xe+ neutralized by atomic halides, kMN (Cl-) SF6- is small or negligible.

  6. Mutual neutralization of He(+) with the anions Cl(-), Br(-), I(-), and SF6 (.). (United States)

    Wiens, Justin P; Shuman, Nicholas S; Miller, Thomas M; Viggiano, Albert A


    Mutual neutralization (MN) rate coefficients kMN for He(+) with the anions Cl(-), Br(-), I(-), and SF6 (-) are reported from 300 to 500 K. The measured rate coefficients may contain a contribution from transfer ionization, i.e., double ionization of the anion. The large rate coefficient for He(+) + SF6 (-) (2.4 × 10(-7) cm(3) s(-1) at 300 K) is consistent with earlier polyatomic MN results found to have a reduced mass dependence of μ(-1/2). Neutralization of He(+) by the atomic halides follows the trend observed earlier for Ne(+), Ar(+), Kr(+), and Xe(+) neutralized by atomic halides, kMN (Cl(-)) SF6 (-) is small or negligible. PMID:27250308

  7. Thermodynamics of reactions of ClHg and BrHg radicals with atmospherically abundant free radicals

    Directory of Open Access Journals (Sweden)

    T. S. Dibble


    Full Text Available Quantum calculations are used to determine the stability of reactive gaseous mercury (Hg(II compounds likely to be formed in the Br-initiated oxidation of gaseous elemental mercury (Hg(0. Due to the absence of any evidence, current models neglect the possible reaction of BrHg• with abundant radicals such as NO, NO2, HO2, ClO, or BrO. The present work demonstrates that BrHg• forms stable compounds, BrHgY, with all of these radicals except NO. Additional calculations on the analogous ClHgY compounds reveal that the strength of the XHg-Y bond (for X=Cl, Br varies little with the identity of the halogen. Calculations further suggest that ClO, BrO, and NO3 do not form strong bonds with Hg(0, and cannot initiate Hg(0 oxidation in the gas phase. The theoretical approach is validated by comparison to published data on HgX2 compounds, both from experiments and highly refined quantum chemical calculations. Quantum calculations on the stability of the anions of XHgY are carried out in order to aid future laboratory studies aimed at molecular-level characterization of gaseous Hg(II compounds. Spectroscopic data on BrHg• are analyzed to determine the equilibrium constant for its formation, and BrHg• is determined to be much less stable than previously estimated. An expression is presented for the rate constant for BrHg• dissociation.

  8. Electronic structures and geometries of the XF3 (X = Cl, Br, I, At) fluorides

    International Nuclear Information System (INIS)

    The potential energy surfaces of the group 17 XF3 (X = Cl, Br, I, At) fluorides have been investigated for the first time with multiconfigurational wave function theory approaches. In agreement with experiment, bent T-shaped C2v structures are computed for ClF3, BrF3, and IF3, while we predict that an average D3h structure would be experimentally observed for AtF3. Electron correlation and scalar relativistic effects strongly reduce the energy difference between the D3h geometry and the C2v one, along the XF3 series, and in the X = At case, spin-orbit coupling also slightly reduces this energy difference. AtF3 is a borderline system where the D3h structure becomes a minimum, i.e., the pseudo-Jahn-Teller effect is inhibited since electron correlation and scalar-relativistic effects create small energy barriers leading to the global C2v minima, although both types of effects interfere

  9. Electronic structures and geometries of the XF{sub 3} (X = Cl, Br, I, At) fluorides

    Energy Technology Data Exchange (ETDEWEB)

    Sergentu, Dumitru-Claudiu [SUBATECH, UMR CNRS 6457, IN2P3/EMN Nantes/Université de Nantes, 4 Rue A. Kastler, BP 20722, 44307 Nantes Cedex 3 (France); CEISAM, UMR CNRS 6230, Université de Nantes, 2 Rue de la Houssinière, BP 92208, 44322 Nantes Cedex 3 (France); Amaouch, Mohamed; Pilmé, Julien [Sorbonne Universités, UPMC Univ Paris 06, UMR 7616, Laboratoire de Chimie Théorique, Case Courier 137, 4 Place Jussieu, 75252 Paris Cedex 05 (France); CNRS, UMR 7616, Laboratoire de Chimie Théorique, Case Courier 137, 4 Place Jussieu, 75252 Paris Cedex 05 (France); Galland, Nicolas, E-mail: [CEISAM, UMR CNRS 6230, Université de Nantes, 2 Rue de la Houssinière, BP 92208, 44322 Nantes Cedex 3 (France); Maurice, Rémi, E-mail: [SUBATECH, UMR CNRS 6457, IN2P3/EMN Nantes/Université de Nantes, 4 Rue A. Kastler, BP 20722, 44307 Nantes Cedex 3 (France)


    The potential energy surfaces of the group 17 XF{sub 3} (X = Cl, Br, I, At) fluorides have been investigated for the first time with multiconfigurational wave function theory approaches. In agreement with experiment, bent T-shaped C{sub 2v} structures are computed for ClF{sub 3}, BrF{sub 3}, and IF{sub 3}, while we predict that an average D{sub 3h} structure would be experimentally observed for AtF{sub 3}. Electron correlation and scalar relativistic effects strongly reduce the energy difference between the D{sub 3h} geometry and the C{sub 2v} one, along the XF{sub 3} series, and in the X = At case, spin-orbit coupling also slightly reduces this energy difference. AtF{sub 3} is a borderline system where the D{sub 3h} structure becomes a minimum, i.e., the pseudo-Jahn-Teller effect is inhibited since electron correlation and scalar-relativistic effects create small energy barriers leading to the global C{sub 2v} minima, although both types of effects interfere.

  10. Geochemistry of the Halogens (I, Br, Cl) and Evolution of the Seawater During the Archean (United States)

    Avice, G.; Marty, B.; Burgess, R.; Goldsmith, S. L.


    Halogens (I, Cl, Br) on Earth are depleted relative to the results of the condensation sequence of elements from the solar nebula [1]. The cause of this depletion remains unknown but might be related to loss from impacts or to the presence of an hidden reservoir (e.g. core). The presence of fluid inclusions in hydrothermal quartz of various ages is an opportunity to follow the evolution of the composition of the atmosphere (N, noble gases) through time [2] but also of halogens in seawater (their main reservoir). Such studies may help to constrain what is the origin of these volatile elements on Earth. For this purpose, we analysed quartz from hydrothermal veins and pods of various localities and ages (e.g. Barberton Greenstone Belt (South Africa; 3.2 Ga), Fortescue Group (Australia; 2.7 Ga)) by crushing and step-heating following the extended Ar-Ar method [3]. In Barberton and Fortescue Gp. quartz, a hydrothermal component characterized by excess 40Ar (40ArE) and closely associated with chlorine is clearly identified from crushing and step-heating results and permits to define a 40ArE/Cl used to correct Ar-Ar data for this contribution. In the case of Barberton, the correction for the hydrothermal component leads to an approximate formation age of the quartz of 3.2 (+/- 0.1) Ga. In Barberton quartz, halogens elemental ratios obtained during crushing and step-heating experiments are highly enriched in iodine and bromine (I/Cl=2-7x10-4; Br/Cl=4-10x10-3) relative to modern seawater. These results are similar to those found in a previous study of Barberton fluid inclusions [3] and can be interpreted as indicators that organic carbon was not sufficiently abundant at this time and/or this location to efficiently pump Br and I during sediment burial. Iodine and bromine, in Fortescue Gp. quartz, are less enriched suggesting that, in that case, organic activity already acted as pump for these elements. [1] Sharp & Draper (2013) EPSL, 369-370, p. 71-77 [2] Pujol et al. (2011

  11. Temperature-induced structural changes in CaCl2,CaBr2, and CrCl2: A synchrotron x-ray powder diffraction study

    International Nuclear Information System (INIS)

    The halides CaCl2,CaBr2, and CrCl2 all adopt, at room temperature, the same distorted rutile structure, in orthorhombic space group Pnnm, known as the calcium chloride structure. Upon heating, CaCl2 and CaBr2 each undergoes a continuous transformation to the true tetragonal rutile structure, in space group P42/mnm, the transition temperatures being 235 and 553 deg. C, respectively. By contrast, the structural change in CrCl2 upon heating is just further elongation of octahedra already lengthened by Jahn-Teller effects, and no phase transition occurs. The orthorhombic structure is maintained by a strong and temperature-dependent geometrical coupling of the orthorhombic strain to the order parameter, represented by the tilt angle of the CrCl6 octahedron

  12. Microhardness studies on as-grown faces of NaClO3 and NaBrO3 crystals

    Indian Academy of Sciences (India)

    K Kishan Rao; V Surender; B Saritha Rani


    Single crystals of NaClO3 and NaBrO3 are grown from their aqueous solutions at a constant temperature of 35°C by slow evaporation by using good quality seed crystals. Systematic microhardness studies are made on as-grown faces of these crystals at various loads. Typical cracks are observed at the corners of the impressions in NaClO3 whereas in addition to the cracks at the corners microcracks also appeared in NaBrO3 crystals around the impressions. The impressions formed in NaBrO3 are not very clear as in NaClO3, a possible mechanism for it is discussed. The work hardening index number () for both these crystals is around 1.6 suggesting that these are moderately harder samples. The hardness studies point out that NaBrO3 is harder than NaClO3 ( ≈ 100 kg/mm2), this could be due to strong inter ionic forces acting between Na–Br in NaBrO3 crystals. Using Gilman’s empirical relation, hardness values are calculated from the values of elastic constants (44) and are found to be close to the experimental results.

  13. Theoretical investigation of potential energy surface and bound states for the van der Waals complex Ar–BrCl dimer

    Energy Technology Data Exchange (ETDEWEB)

    Zheng, Rui [School of Mathematics and Information Science, North China University of Water Resources and Electric Power, Zhengzhou (China); Key Laboratory of Magnetic Resonance in Biological Systems, State Key Laboratory of Magnetic Resonance and Atomic and Molecular Physics, Wuhan Centre for Magnetic Resonance, Wuhan Institute of Physics and Mathematics, Chinese Academy of Sciences, Wuhan (China); Li, Song, E-mail: [School of Physics and Optoelectronic Engineering, Yangtze University, Jingzhou (China); Chen, Shan-Jun; Chen, Yan [School of Physics and Optoelectronic Engineering, Yangtze University, Jingzhou (China); Zheng, Li-Min [Key Laboratory of Magnetic Resonance in Biological Systems, State Key Laboratory of Magnetic Resonance and Atomic and Molecular Physics, Wuhan Centre for Magnetic Resonance, Wuhan Institute of Physics and Mathematics, Chinese Academy of Sciences, Wuhan (China)


    Highlights: • A two-dimensional potential for Ar–BrCl is constructed at the CCSD(T) level. • The PES is characterized by three minima and two saddle points between them. • Bound state calculations were carried out for the complex. - Abstract: The intermolecular potential energy surface (PES) of the ground electronic state for the Ar–BrCl dimer is constructed at the CCSD(T) level with the aug-cc-pVQZ basis set and mid-bond functions. The PES is characterized by three minima and two saddle points. The global minimum corresponding to a collinear Ar–BrCl configuration, which has been observed experimentally, is located at R = 4.10 Å and θ = 2.5° with a well depth of −285.207 cm{sup −1}. A nearly T-shaped structure and an anti-linear Ar–ClBr geometry is also predicted. The bound state calculations are preformed to study intermolecular vibrational modes, rotational levels and average structures for the complex. Our transition frequencies, spectroscopic constants and average structures for all isotopomers of the collinear isomer agree well with experimental data. We have also provided pure rotational transitional frequencies for both nearly T-shaped and anti-linear isomers. These results are significant for further experimental investigations of the Ar–BrCl dimer.

  14. Growth mechanism of NaClO3 and NaBrO3 crystals from aqueous solutions

    Indian Academy of Sciences (India)

    V Surender; N Arundhathi; K Kishan Rao


    A study of growth rates of NaClO3 and NaBrO3 has been carried out using a small growth cell by in situ observation. Normal growth rates of {100} faces of NaClO3 and {111} faces of NaBrO3 along $\\langle 110 \\rangle$ direction are measured under relatively high supersaturation ranging from 3–8%. In the initial stages of growth, {100}, {110} and {111} faces develop in NaClO3 and gradually all the faces are replaced by the {100} faces only. In the case of NaBrO3, mostly {111} faces develop with occasional occurrence of small {100} faces at the intersection of {111} faces. The growth mechanisms are investigated from growth rate vs supersaturation plots and from the observations of surface features. In the present supersaturation range, the growth mechanism appears to be due to two-dimensional growth mechanism.

  15. Features of arsenic coordination in AsXn complexes (X=F, Cl, Br, I)

    International Nuclear Information System (INIS)

    Investigation into stoichiometry of F-, Cl-, Br-, and I-containing arsenic complexes was conducted using Voronoi-Dirichlet polyhedrons (VDP). Decrease of third-dimensional effect of unshared electron pairs of As(3) atoms is established as decrease of electronegativity of surrounding atom in the AsFn-AsCln-AsBrn-AsIn system. Method of interlaced spheres may be used for determination of coordination number of arsenic atoms in the crystal structure. Whatever oxidation degree of arsenic atoms and their coordination numbers common linear dependences between solid angles of VDP Ω grains and internuclear distances r(As-X) corresponding those grains are observed. For I-containing arsenic compounds the equilibrium Ω(As-I) = 40(1) - 8.1(3) r(As-I) { = -0.940.91 contact As-I} is employed

  16. Manifestation of long-range ordered state in layered VX2 (X = Cl, Br, I) systems

    International Nuclear Information System (INIS)

    We report the first-principles based density functional investigation of correlated magnetic behavior for the layered VX2 (X = Cl, Br, I) system both in bulk and monolayer forms. The bulk system stabilizes in the Néel 120° spin structure with the onset of long-range order at a very low temperature. However, a monolayer of the same system results in a two-dimensional long-range ordered spin-gel configuration in the a–b plane. The occurrence of this two-dimensional non-collinear long-range order for such hexagonal systems with honeycomb topology may provide an additional feature for controlling the use of such materials in magnetic memory devices. (paper)

  17. Solid-liquid equilibria in the systems ClF5-BF3 and BrF5-BF3

    International Nuclear Information System (INIS)

    The method of differential thermal analysis has been used to investigate solid-liquid equilibria in the systems ClF5-BF3 and BrF5-BF3 in the whole range of concent-- rations of components. No formation of chemical compounds is found. BrF5-BF3 system refers to the series of simple systems of the eutectic type and is characterized by eutectics depleted in bromine pentafluoride content (less than 5 mol. %) with the melting temperature close to melting temperature of pure boron trifluoride. In the ClF5-BF3 system components are mutually insoluble in both liquid and solid states

  18. Formability of ABX3 (X = F, Cl, Br, I) halide perovskites. (United States)

    Li, Chonghea; Lu, Xionggang; Ding, Weizhong; Feng, Liming; Gao, Yonghui; Guo, Ziming


    In this study a total of 186 complex halide systems were collected; the formabilities of ABX3 (X = F, Cl, Br and I) halide perovskites were investigated using the empirical structure map, which was constructed by Goldschmidt's tolerance factor and the octahedral factor. A model for halide perovskite formability was built up. In this model obtained, for all 186 complex halides systems, only one system (CsF-MnF2) without perovskite structure and six systems (RbF-PbF2, CsF-BeF2, KCl-FeCl2, TlI-MnI2, RbI-SnI2, TlI-PbI2) with perovskite structure were wrongly classified, so its predicting accuracy reaches 96%. It is also indicated that both the tolerance factor and the octahedral factor are a necessary but not sufficient condition for ABX3 halide perovskite formability, and a lowest limit of the octahedral factor exists for halide perovskite formation. This result is consistent with our previous report for ABO3 oxide perovskite, and may be helpful to design novel halide materials with the perovskite structure. PMID:19029699

  19. Temperature behaviour of Raman spectra in the Cs2HgBr4, Cs2HgCl4 crystals

    International Nuclear Information System (INIS)

    Polarized Raman spectra of the Cs2HgBr4 and Cs2HgCl4 crystals are obtained and analyzed at different temperatures in the range of 300-2 K. The similarity of the structural transformations in the both crystals is established

  20. Evaluation of production samples of the scintillators LaBr3:Ce and LaCl3:Ce

    International Nuclear Information System (INIS)

    We report on the evaluation of the performance of two recently developed scintillator materials, LaCl3:Ce and LaBr3:Ce, at the task of gamma ray spectroscopy. Their performance is compared to a standard scintillator used for gamma ray spectroscopy--a 25 mm diameter 25 mm tall cylinder of NaI:Tl. We measure the pulse height, energy resolution, and full-energy efficiency of production LaBr3:Ce and LaCl3:Ce scintillation crystals of different sizes and geometries for a variety of gamma-ray energies. Using production rather than specially selected crystals will establish whether immediate large-scale use is feasible. The crystal is excited by gamma rays from one of six isotopic sources (125I, 241Am, 57Co, 22Na, 137Cs, and 60Co) placed 15 cm away from the scintillator. Our measurements show that both LaCl3 and LaBr3 outperform NaI:Tl in almost all cases. They outperform NaI:Tl at all energies for the photopeak fraction and counting rate measurements, and for energy resolution at higher energies (above 200 keV for LaCl3 and 75 keV for LaBr3). The performance of production crystals is excellent and these scintillators should be considered for immediate use in systems where stopping power and energy resolution are crucial

  1. Solid-liquid equilibrium in ClF3-BF3 and BrF3-BF3 systems

    International Nuclear Information System (INIS)

    Solid-liquid equilibrium in ClF3-BF3 (1) and BrF3-BF3 (2) systems was measured within the whole range of component concentrations. One congruently melting copmpound (ClF3xBF3) (melting poiunt - 30 deg C) is formed in the system (1). Two incongruently melting compounds: BrF3xBF3 (melting point - 30 deg C) and BrF3x2BF3 (melting point - 121 deg C) were identified in the system (2). Conclusion on relative strength of halogen fluorides in acid-basic interactions according to Lewis was made on the basis of equilibria comparison in HalF5-BF3 and HalF3-BF3 systems

  2. Characterization of intermolecular interaction between Cl2 and HX (X=F, Cl and Br: An ab initio, DFT, NBO and AIM study

    Directory of Open Access Journals (Sweden)

    Morteza Vatanparast


    Full Text Available The character of the intermolecular interactions in Cl2-HX (X =F, Cl and Br complexes has been investigated by means of the second-order Möller–Plesset perturbation theory (MP2 and the density functional theory (DFT calculations. The results show that there are two types of lowest interaction potential equilibrium structures in the interactions between Cl2 and HX: X∙∙∙Cl type geometry and hydrogen-bonded geometry. The calculated interaction energies show that the X∙∙∙Cl type structures are more stable than the corresponding hydrogen-bonded structures. The nature of the intermolecular interactions has been also investigated by natural bond orbital (NBO and atoms in molecules (AIM. The AIM analysis reveals that both types of intermolecular interactions are “closed-shell” noncovalent interactions.

  3. An experimental study of formation of the mercury mixed halides HgClBr and HgBrI and of their purity

    Directory of Open Access Journals (Sweden)

    Rabia Ahmad


    Full Text Available Claims to have produced the mixed halides of mercury are very old. However, their stability or even their very existence was seriously questioned by Ammlung and Brill several decades back, on the basis of their study, in several solvents, of what was thought to be HgBrI. The mixed halide HgClI was already known to be unstable. On the basis of these facts, which were also lent some theoretical support, it was strongly conjectured that the mixed halides of mercury and similar elements, were expected to be unstable. However, the matter does not seem to have received the attention it deserved. It was in this light that this study was taken up. What has been thought to be HgClBr has been produced by several methods and HgBrI by one or rather two methods. The product has been subjected to X-ray diffraction, FTIR and Raman studies. Studies confined to the solid product are being reported here and only those results are being presented for which all the three techniques could be employed. These studies show that a new product is indeed formed in most of these cases, but the product is not pure in any of these cases, although the impurity seems to be quite small in most of these cases. This calls for having a thorough look at not only the mixed halides of the elements, but of all compounds claimed to be like:

  4. Halogen (F, Cl, Br, I) behaviour in subducting slabs: A study of lawsonite blueschists in western Turkey (United States)

    Pagé, Lilianne; Hattori, Keiko; de Hoog, Jan C. M.; Okay, Aral I.


    We examined the F, Cl, Br and I abundance of minimally retrogressed lawsonite blueschists from the Tavsanli Zone in northwest Turkey to evaluate the behaviour of halogens in subduction zones, and to determine the role coexisting high pressure minerals may play in transporting the halogens to the Earth's mantle. The blueschists contain sodic amphibole and lawsonite, with variable amounts of phengite and chlorite, and minor apatite. A positive correlation between Cl, Br and I contents in bulk rocks suggests their overall coherent behaviour in subduction zones, although high ratios of I/Cl and Br/Cl compared to altered oceanic crust indicate that Cl is preferentially lost relative to Br and I before or during blueschist metamorphism. Iodine and F are enriched relative to altered oceanic crust, suggesting incorporation from marine sediments. In situ analyses of minerals in thin sections reveal F preferentially concentrates in apatite (avg. 3.13 wt%), over phengite (482 ppm), lawsonite (avg. 413 ppm) and Na-amphibole (257 ppm). Chlorine also preferentially resides in apatite (138 ppm), followed by equal partitioning between phengite (59 ppm) and Na-amphibole (56 ppm), and lower concentrations in lawsonite (27 ppm). Upon apatite decomposition at a depth of ∼200 km, F may redistribute into lawsonite and phengite in slabs, whilst Cl is likely expelled to the overlying mantle wedge. Given the stability of lawsonite and phengite to a depth of 280-300 km in cold subduction zones, they may transport F beyond subarc depths, contributing to the high F in magmas derived from the deep mantle.

  5. Structural and electronic properties of silicene on MgX2 (X = Cl, Br, and I)

    KAUST Repository

    Zhu, Jiajie


    Silicene is a monolayer of Si atoms in a two-dimensional honeycomb lattice, being expected to be compatible with current Si-based nanoelectronics. The behavior of silicene is strongly influenced by the substrate. In this context, its structural and electronic properties on MgX2 (X = Cl, Br, and I) have been investigated using first-principles calculations. Different locations of the Si atoms are found to be energetically degenerate because of the weak van der Waals interaction with the substrates. The Si buckling height is below 0.55 Å, which is close to the value of free-standing silicene (0.49 Å). Importantly, the Dirac cone of silicene is well preserved on MgX2 (located slightly above the Fermi level), and the band gaps induced by the substrate are less than 0.1 eV. Application of an external electric field and stacking can be used to increase the band gap. © 2014 American Chemical Society.

  6. Solid state physics and actinide spectroscopy with ThBr4 and ThCl4

    International Nuclear Information System (INIS)

    From the solid state physics to the optical spectroscopy of 5 f elements, we have described in details how ThBr4 and ThCl4 are acting an important role in the applied and basic research field. The possible applications are based on the scintillation properties of these crystals while the fundamental aspect is related to their special incommensurate structure which modulates the host properties of these matrices at low temperature. This very small perturbation of bromine atom positions have optical consequences on the absorption and emission of the actinide studied ions which are interpreted in function of the modulated structure parameters determined by inelastic and elastic neutron scattering and by Raman spectroscopy. The structural model proposed shows, for the first time, how the optical properties of the investigated ion are influenced by the sinusoidal displacements of the bromine atoms, leading to an energy continuum in the absorption and reducing the site symmetry from Dsub(2d) to a multisite of D2 symmetry

  7. Coordination polyhedra OsXn (X = F, Cl, Br, I) in crystal structures

    International Nuclear Information System (INIS)

    Crystallochemical analysis of the compounds containing [OsaXb]z- (X F, Cl, Br, I) composition complexes in the structure was conducted using Voronoi-Dirichlet polyhedrons and crossing spheres. It was found that only the atoms Os(3) with coordination number 4 and forming tetragonal pyramids OsI4, where angles IOsI = 86(1) Deg, were presented in the iodides. In the all iodides the pyramids OsI4- are arranged in pairs by the Os-Os bond in the dimers [Os2I8] 2-, in which r(Os-Os) = 2.22(1) A. In the iodides with the ratio I : Os = 4 the dimers [Os2I8]2- are independent structural units, and in the crystals with the ratio I : Os = 3.5 the dimers collectivize in pairs 2 from 8 iodine atoms lying on one from the ribs of tetragonal grain. As a result of such jointing, which may be described by the system 2[Os2I8/1]2- → 2[Os2I2/2I6/1]2- + 2I- → [Os4I4/2I12/1]2- + 2I-, the dimers turn to the centro symmetrical four-nuclear complexes anions [Os4I14]2-

  8. Modeling study of vibrational photochemical isotope enrichment. [HBr + Cl/sub 2/; HCl + Br/sub 2/

    Energy Technology Data Exchange (ETDEWEB)

    Badcock, C.C.; Hwang, W.C.; Kalsch, J.F.


    Chemical kinetic modeling studies of vibrational-photochemical isotope enrichment have been performed on two systems: Model (I), H/sup 79/Br(H/sup 81/Br) + Cl/sub 2/ and, Model (II), H/sup 37/Cl(H/sup 35/Cl) + Br. Pulsed laser excitation was modeled to the first excited vibrational level of H/sup 79/Br in Model I and the first and second excited vibrational levels of both HCl isotopes in Model II. These are prototype systems of exoergic (Model I) and endoergic (Model II) reactions. The effects on enrichment of varying the external parameters (pressure, laser intensity) and the internal parameters (rate constants for V-V exchange and excited-state reactions) were examined. Studies of these prototype systems indicate that a favorable reaction for enrichment, with isotopically-specific excitation and a significantly accelerated vibrationally-excited-state reaction should have the following properties: the reaction from v = 0 should be only moderately exoergic, and the most favorable coreactant should be a polyatomic species, such as alkyl radical. Direct excitation of the reacting vibrational level is at least an order of magnitude more favorable for enrichment than is population by energy transfer. Enrichment of the minor isotope by these processes is more effective than is major isotope enrichment. Within limits, increased laser intensity is beneficial. However, for sequential excitation of a second vibrational level, major isotope enrichment can be diminished by high populations of the first vibrational level.

  9. An experimental study of formation of the mercury mixed halides HgClBr and HgBrI and of their purity


    Rabia Ahmad; Jamshed Ali; Qamer Faisal


    Claims to have produced the mixed halides of mercury are very old. However, their stability or even their very existence was seriously questioned by Ammlung and Brill several decades back, on the basis of their study, in several solvents, of what was thought to be HgBrI. The mixed halide HgClI was already known to be unstable. On the basis of these facts, which were also lent some theoretical support, it was strongly conjectured that the mixed halides of mercury and similar elements, were...

  10. A theoretical study of the carbenoids LiCH2X (X = Cl, Br, I) cyclopropanation reaction with ketene

    Indian Academy of Sciences (India)

    Xing Hui Zhang; Fu Long Zhang; Zhi Yuan Geng


    A computational study for the [2 + 1] addition of the lithium carbenoids LiCH2X (X = Cl, Br, I) with ketene have been investigated by means of the B3LYP hybrid density functional method. All the reactions examined displayed similar concerted mechanisms for the cyclopropanation of these reagents. The lithium carbenoids react with ketene via an asynchronous attack on one CH2 or C group of ketene with relatively low barrier to reaction in the range of 25.34-33.74 kJ/mol in THF solvent. The trend of the lithium carbenoids reaction barrier with ketene is LiCH2Cl < LiCH2Br < LiCH2I. The results show that the reactions could be highly chemical reactivity with low barriers and could be favoured in experiment. The reactions could proceed easily at lower temperature. The computational results are briefly compared to other carbenoid reactions and related species.

  11. Zintl Salts Ba2P7X (X = Cl, Br, and I: Synthesis, Crystal, and Electronic Structures

    Directory of Open Access Journals (Sweden)

    Juli-Anna Dolyniuk


    Full Text Available Two barium phosphide halides, Ba2P7Br and Ba2P7I, were synthesized and structurally characterized by single crystal X-ray diffraction. Both compounds crystallize in the monoclinic space group P21/m (No. 11 and are isostructural to Ba2P7Cl. The crystal structures of Ba2P7X (X = Cl, Br, I feature the presence of heptaphosphanortricyclane P73− clusters along with halogen anions and barium cations. According to the Zintl concept, Ba2P7X compounds are electron-balanced semiconductors. Quantum-chemical calculations together with UV-Visible spectroscopy confirm the title compounds are wide bandgap semiconductors. The bonding in the P73− clusters was analyzed by means of electron localization function. The elemental compositions were confirmed using energy dispersive X-ray spectroscopy.

  12. The investigation of influence of iodine ions on a luminescence of Cd Br2 - Mn Cl2

    International Nuclear Information System (INIS)

    Optical and luminescence properties of the crystal Cd Br2 - Mn Cl2, Cd I2 are investigated in the 85 - 295 K temperature interval. It is found that additional doping Cd Br2 - Mn Cl2 with iodine results in increasing photo- and thermoluminescence efficiencies due to 4 Tlg (4 G) → 6 Alg(6S) electron-phonon transitions in Mn2+ -centers under LGI-21 nitric laser excitation. The additional band at 495 nm attributed to radiative recombination of excitons localized on I- ions is observed in X-ray luminescence spectra of the crystal at 85 K. The nature of activation bands in excitation spectra and the mechanism of the thermally stimulated luminescence are discussed

  13. Theoretical investigation of structural properties of CuCl, CuBr and CuI compounds under hydrostatic pressure

    Energy Technology Data Exchange (ETDEWEB)

    Louhibi-Fasla, S.; Djabri, H. Rekab; Achour, H. [Laboratoire de Micro et de Nanophysique LaMiN - ENP d' ORAN, BP 1523, El M' Naouer, 31000 (Algeria); Kefif, K. [Laboratoire de Physique des Couches Minces et Matériaux pour l' Electronique, Université d' ORAN, Es-senia (Algeria)


    We have applied a recent version of the full potential linear muffin-tin orbitals method (FPLMTO) to study the structural properties of copper halides CuX (X=Cl, Br, I) under high pressure using the generalized gradient approximation (GGA) for the exchange and correlation potential by Perdew et al. Results are given for lattice parameters, bulk modulus and its first derivatives in the wurtzite(B4), zinc-blende (B3), CsCl (B2), rock-salt (B1), and PbO (B10) structures. The results of these calculations are compared with the available theoretical and experimental data.

  14. Theoretical study on O$\\cdots$Br and O$\\cdots$Cl halogen bonds in some small model molecular systems

    Indian Academy of Sciences (India)

    Damanjit Kaur; Rajinder Kaur


    Halogen bonding interactions of type X$\\cdots$O=C are important in various fields including biological systems. In this work, theoretical calculations were carried out using B3LYP/6-31++G∗∗, MP2/6-31++G∗∗ and MP2/aug-cc-pVDZ methods on a series of O$\\cdots$X halogen bonds between CH2O andCH3CHO as halogen bond acceptor with X-Y (X = Cl, Br; Y = CF3, CF2 H, CFH2, CN, CCH, CCCN) as halogen bond donors. The strength of interaction energy for O$\\cdots$Br halogen-bonded complexes varies from −2.16 to −5.26 kcal/mol while for O$\\cdots$Cl complexes, it is between −1.65 to −3.67 kcal/mol, which indicate the O$\\cdots$Br bond to be stronger in comparison to O$\\cdots$Cl bond. SAPT analysis suggests that the strength of halogen bonding arises from the electrostatic and induction forces while dispersion is playing a comparatively smaller role. The halogen-bonded interaction energies were found to correlate well with positive electrostatic potential VS,max, halogen bonded distances, and the change in s-character of C-X bond. The halogen-bonded interaction energies were also evaluated for O$\\cdots$I bonded complexes and thus these complexes were found to be stronger than O$\\cdots$Br and O$\\cdots$Cl bonded complexes.

  15. Vacuum-UV negative photoion spectroscopy of CH3F, CH3Cl and CH3Br


    Rogers, N J; Simpson, M.J.; Tuckett, R. P.; Dunn, K; Latimer, C. J.


    Using tunable vacuum-UV radiation from a synchrotron, negative ions are detected by quadrupolar mass spectrometry following photoexcitation of three gaseous halogenated methanes CH\\(_3\\)X (X = F,Cl,Br). The anions X\\(^-\\), H\\(^-\\), CX\\(^-\\), CHX\\(^-\\) and CH\\(_2\\)X\\(^-\\) are observed, and their ion yields recorded in the range 8-35 eV. The anions show a linear dependence of signal with pressure, showing that they arise from unimolecular ion-pair dissociation, generically described as AB + h\\(...

  16. Syntheses, crystal structures, and optical properties of Pb6B3O10X (X=F, Cl, Br)

    International Nuclear Information System (INIS)

    A series of lead-containing halogen oxyborates, Pb6B3O10X (X=F, Cl, Br), have been grown by high-temperature solution method and their crystal structures were determined by single-crystal X-ray diffraction. They are isostructural and crystallize in the space group Pbcm of the orthorhombic crystal system. The crystal structures are dominated by one-dimensional ∞[(Pb4O)(BO3)3] “Zig-Zag”-chains, while the remaining Pb atoms and X (X=F, Cl, Br) atoms are filled to balance the charge. Compared with the previously reported compound Pb4O(BO3)2 (the molecular formula Pb4O(BO3)2 can be regarded as Pb6B3O10.5) with the space group Aba2, the structures of Pb6B3O10X (X=F, Cl, Br) are completely different from that of Pb4O(BO3)2. IR spectroscopy, UV–vis-NIR diffuse reflectance spectroscopy, thermal analysis, and theoretical calculations were also performed on the reported materials. Highlights: • A new family of lead-containing halogen oxyborates, Pb6B3O10X (X=F, Cl, Br), have been grown by high-temperature solution method. • Owing to the introduction of X atoms into Pb4O(BO3)2, the structures of Pb6B3O10X are completely different. The crystal structures are dominated by one-dimensional ∞[(Pb4O)(BO3)3] “Zig-Zag”-chains

  17. Bulk and surface band structure of the new family of semiconductors BiTeX (X=I, Br, Cl)

    Energy Technology Data Exchange (ETDEWEB)

    Moreschini, L., E-mail: [Advanced Light Source (ALS), Lawrence Berkeley National Laboratory, Berkeley, CA 94720 (United States); Autès, G. [Institute of Theoretical Physics, Ecole Polytechnique Fédérale de Lausanne (EPFL), CH-1015 Lausanne (Switzerland); Crepaldi, A. [Institute of Condensed Matter Physics, Ecole Polytechnique Fédérale de Lausanne (EPFL), CH-1015 Lausanne (Switzerland); Moser, S. [Advanced Light Source (ALS), Lawrence Berkeley National Laboratory, Berkeley, CA 94720 (United States); Institute of Condensed Matter Physics, Ecole Polytechnique Fédérale de Lausanne (EPFL), CH-1015 Lausanne (Switzerland); Johannsen, J.C. [Institute of Condensed Matter Physics, Ecole Polytechnique Fédérale de Lausanne (EPFL), CH-1015 Lausanne (Switzerland); Kim, K.S. [Advanced Light Source (ALS), Lawrence Berkeley National Laboratory, Berkeley, CA 94720 (United States); Department of Physics, Pohang University of Science and Technology, Pohang 790-784 (Korea, Republic of); Center for Artificial Low Dimensional Electronic Systems, Institute for Basic Science, Pohang 790-784 (Korea, Republic of); Berger, H.; Bugnon, Ph.; Magrez, A. [Institute of Condensed Matter Physics, Ecole Polytechnique Fédérale de Lausanne (EPFL), CH-1015 Lausanne (Switzerland); Denlinger, J.; Rotenberg, E.; Bostwick, A. [Advanced Light Source (ALS), Lawrence Berkeley National Laboratory, Berkeley, CA 94720 (United States); Yazyev, O.V. [Institute of Theoretical Physics, Ecole Polytechnique Fédérale de Lausanne (EPFL), CH-1015 Lausanne (Switzerland); and others


    Highlights: • We provide an ARPES comparison between the three tellurohalides BiTeX (X = I, Br, Cl). • They present a similar band structure with namely spin-split bulk and surface states. • They offer, except for BiTeCl, the possibility of ambipolar conduction. • They can be easily doped. • From the data appeared so far, BiTeBr may be the most appealing for applications. - Abstract: We present an overview of the new family of semiconductors BiTeX (X = I, Br, Cl) from the perspective of angle resolved photoemission spectroscopy. The strong band bending occurring at the surface potentially endows them with a large flexibility, as they are capable of hosting both hole and electron conduction, and can be modified by inclusion or adsorption of foreign atoms. In addition, their trigonal crystal structure lacks a center of symmetry and allows for both bulk and surface spin-split bands at the Fermi level. We elucidate analogies and differences among the three materials, also in the light of recent theoretical and experimental work.

  18. The effects of CaCl2 and CaBr2 on the reproduction of Daphnia magna Straus. (United States)

    Mažuran, Neda; Hršak, Vladimir; Kovačević, Goran


    Concentrated CaCl2 and CaBr2 salt solutions of densities up to 2.3 kg L-1 are regularly used to control hydrostatic pressure in oil wells during special operations in the exploration and production of natural gas and crude oil. Various concentrations of high density salts are frequently left in mud pits near the drilling site as waste, polluting fresh and ground waters by spillage and drainage. The toxic effects of these salts have already been observed. This study investigated the effects of CaCl2 and CaBr2 on water flea Daphnia magna Straus in a 21-day reproduction test. The three tested concentrations of CaCl2 (240, 481, and 1925 mg L-1) caused a significant dose-response decrease of reproduction (p<0.001). With CaBr2 (533 and 1066 mg L-1), only aborted eggs were produced, demonstrating the embryotoxicity of the substance. The results suggest that high concentrations of the tested chemicals are harmful to Daphnia's reproduction and could reduce its abundance. PMID:26110475

  19. Bulk and surface band structure of the new family of semiconductors BiTeX (X=I, Br, Cl)

    International Nuclear Information System (INIS)

    Highlights: • We provide an ARPES comparison between the three tellurohalides BiTeX (X = I, Br, Cl). • They present a similar band structure with namely spin-split bulk and surface states. • They offer, except for BiTeCl, the possibility of ambipolar conduction. • They can be easily doped. • From the data appeared so far, BiTeBr may be the most appealing for applications. - Abstract: We present an overview of the new family of semiconductors BiTeX (X = I, Br, Cl) from the perspective of angle resolved photoemission spectroscopy. The strong band bending occurring at the surface potentially endows them with a large flexibility, as they are capable of hosting both hole and electron conduction, and can be modified by inclusion or adsorption of foreign atoms. In addition, their trigonal crystal structure lacks a center of symmetry and allows for both bulk and surface spin-split bands at the Fermi level. We elucidate analogies and differences among the three materials, also in the light of recent theoretical and experimental work

  20. Caveats for poly(methimazolyl)borate chemistry: the novel inorganic heterocycles [H2C(mt)2BR2]Cl (mt = methimazolyl; BR2 = BH2, BH(mt), 9-BBN). (United States)

    Crossley, Ian R; Hill, Anthony F; Humphrey, Elizabeth R; Smith, Matthew K; Tshabang, Never; Willis, Anthony C


    Whilst frequently used for reactions of poly(methimazolyl)borates, dichloromethane is not an innocent solvent, but rather slowly forms heterocyclic salts [H(2)C(mt)(2)BR(2)]Cl, three examples of which (BR(2) = BH(2), BH(mt), 9-borabicyclononyl) have been structurally characterised to confirm the unprecedented B(NCS)(2)C connectivity. PMID:15306929

  1. Theoretical Study of Decomposition Pathways for Rare-gas-containing Compounds HRgX (Rg = He, Ne, Ar, Kr; X = Cl, Br)

    Institute of Scientific and Technical Information of China (English)

    AI Chun-Zhi; SUN Ren-An; YAN Jie


    Eight species, HRgX (Rg = He, Ne, Ar, Kr; X = Cl, Br), are predicted to have bending transition states at B3PW91/AUG-cc-PVTZ level, leading to 2-body decomposition pathway like . The reaction path has been obtained with Intricate Reaction Coordinates (IRC) method on identical theoretical level. Additionally, the linear transition states of HArCl, HArBr, HKrCl and HKrBr were obtained at MP2/6-311++G (2d, 2p) level, resulting in 3-body dissociation channel as.

  2. Study of vibrational spectra of NH sub 4 Cl and NH sub 4 Br at high pressure

    CERN Document Server

    Glazkov, V P; Syrykh, G F; Kozlenko, D P; Savenko, B N; Telepnev, A S


    The NH sub 4 Cl vibrational spectra at the pressures up to 2.6 GPa and the NH sub 4 Br spectra at the pressures up to 7 GPa are studied through the method of the neutrons inelastic incoherent scattering. It is established that the linear baric dependence of the libration mode changes its inclination in the area above the pressure of transition from the disordered cubic phase to the ordered cubic phase with the CsCl-type structure. The baric dependence inclination of the cross-sectional optical translation mode remains unchanged. The evaluations of the Grueneisen parameters are presented in the one-dimensional approximation and the form of the potential function for the libration oscillations in the disordered and ordered cubic phases with the CsCl-type structure is calculated. It is shown that the observed effects are related to the high anharmonism of the potential in the disordered phase

  3. Reduction of Diaryldiselenides by System of Cp2TiCl2/ BuiMgBr/ THF and Its Application in Synthesis of Unsymmetrical Diaryl Selenides

    Institute of Scientific and Technical Information of China (English)


    Reduction of diaryldiselenides by the system of Cp2TiCl2/BuiMgBr/THF gave the nucleophilic arylselenium complex. They reacted with diaryl iodonium salts to afford unsymmetrical diaryl selenides in high yields.

  4. Waste-water impacts on groundwater: Cl/Br ratios and implications for arsenic pollution of groundwater in the Bengal Basin and Red River Basin, Vietnam


    McArthur, J. M.; Sikdar, P. K.; Hoque, M. A.; Ghosal, U.


    Across West Bengal and Bangladesh, concentrations of Cl in much groundwater exceed the natural, upper limit of 10 mg/L. The Cl/Br mass ratios in groundwaters range up to 2500 and scatter along mixing lines between waste-water and dilute groundwater, with many falling near the mean end-member value for waste-water of 1561 at 126 mg/L Cl. Values of Cl/Br exceed the seawater ratio of 288 in uncommon NO3-bearing groundwaters, and in those containing measurable amounts of salt-corrected SO4 (SO4 c...

  5. Preparation and characterization of poly(lithium acrylate-arcylonitrile)/LiClO4-LiNO3-LiBr solid polymer electrolytes

    Institute of Scientific and Technical Information of China (English)

    PAN Chun-yue; YUAN Yun-lan; CHEN Zhen-hua; XU Xian-hua; ZHANG Jian


    Through orthogonal experiment, a new type of LiClO4-LiNO3-LiBr eutectic salt with optimum mole ratio of n(LiClO4):n(LiNO3):n(LiBr)=1.6:3.8:1.0 was prepared. The poly(lithium acrylate-acrylonitrile)/LiClO4-LiNO3-LiBr solid polymer electrolytes were prepared with poly(lithium acrylate-acrylonitrile) and LiClO4-LiNO3-LiBr eutectic salts. The effect of LiClO4-LiNO3-LiBr eutectic salts content on the conductivity of solid polymer electrolytes was studied by alternating current impedance method, and the structures of eutectic salts and solid polymer electrolytes were characterized by differential thermal analysis, infrared spectroscopy and X-ray diffractometry. The results show that the room temperature conductivity of LiClO4-LiNO3-LiBr eutectic salts reaches 3.11×10-4 S·cm-1. The poly(lithium acrylate-acrylonitrile)/LiClO4-LiNO3-LiBr solid polymer electrolytes possess the highest room temperature conductivity at 70% LiClO4-LiNO3-LiBr eutectic salts content, and exhibit lower glass transition temperature of 75 ℃ compared with that of poly(lithium acrylate-acrylonitrile) of 105 ℃. A complex may be formed in the solid polymer electrolytes from the differential thermal analysis and infrared spectroscopy analysis. X-ray diffraction results show that the poly(lithium acrylate-acrylonitrile) can suppress the crystallization of eutectic salts in this system.

  6. Electronic structure, elastic anisotropy, thermal conductivity and optical properties of calcium apatite Ca5(PO4)3X (X = F, Cl or Br)

    International Nuclear Information System (INIS)

    Highlights: • The degree of elastic anisotropy is ordered as follows BrA > ClA > FA. • The thermal conductivity in (112¯0) plane is smaller than in (0 0 0 1) plane. • The refractive indexes for FA, ClA and BrA are 1.17, 1.19 and 1.21, respectively. - Abstract: The density-functional theory with the generalized gradient approximation was performed to investigate the structural properties, phase stability, electronic structure, elastic properties, and optical properties of selected Ca5(PO3)4F (FA), Ca5(PO3)4Cl (ClA) and Ca5(PO3)4Br (BrA). Results of formation enthalpies show that FA is regarded as the most stable one in these apatites. The electronic structures including band structure, density of states and Mulliken analysis have been discussed. The predicted elastic moduli results indicate that the degree of elastic anisotropy is ordered as follows BrA > ClA > FA. By using the Clarke’s model and Cahill’s model, the thermal conductivities and the anisotropy in thermal conductivity have also been analyzed. Optic properties results indicate that the refractive indexes n for FA, ClA and BrA are 1.17, 1.19 and 1.21, respectively

  7. Electronic structure, elastic anisotropy, thermal conductivity and optical properties of calcium apatite Ca{sub 5}(PO{sub 4}){sub 3}X (X = F, Cl or Br)

    Energy Technology Data Exchange (ETDEWEB)

    Li, Cheng-Xiu [Kunming University of Science and Technology, Kunming 650093 (China); Institute of Multipurpose Utilization of Mineral Resources, Chinese Academy of Geological Sciences, Chengdu 610041 (China); Research Center of Multipurpose Utilization of Metal Mineral Resources of China Geological Survey, Chengdu 610041 (China); Duan, Yong-Hua, E-mail: [Kunming University of Science and Technology, Kunming 650093 (China); Hu, Wen-Cheng [School of Mechanical and Electrical Engineering, Nanchang University, Nanchang 330031 (China)


    Highlights: • The degree of elastic anisotropy is ordered as follows BrA > ClA > FA. • The thermal conductivity in (112{sup ¯}0) plane is smaller than in (0 0 0 1) plane. • The refractive indexes for FA, ClA and BrA are 1.17, 1.19 and 1.21, respectively. - Abstract: The density-functional theory with the generalized gradient approximation was performed to investigate the structural properties, phase stability, electronic structure, elastic properties, and optical properties of selected Ca{sub 5}(PO{sub 3}){sub 4}F (FA), Ca{sub 5}(PO{sub 3}){sub 4}Cl (ClA) and Ca{sub 5}(PO{sub 3}){sub 4}Br (BrA). Results of formation enthalpies show that FA is regarded as the most stable one in these apatites. The electronic structures including band structure, density of states and Mulliken analysis have been discussed. The predicted elastic moduli results indicate that the degree of elastic anisotropy is ordered as follows BrA > ClA > FA. By using the Clarke’s model and Cahill’s model, the thermal conductivities and the anisotropy in thermal conductivity have also been analyzed. Optic properties results indicate that the refractive indexes n for FA, ClA and BrA are 1.17, 1.19 and 1.21, respectively.

  8. Theoretical study of the reactivity trends in the Cl-abstraction reactions of CHCl3 + CHX·−/CX$_{2}^{·−}$ (X = Cl, Br and I)

    Indian Academy of Sciences (India)

    Jun Xi Liang; Zhi Yuan Geng; Yong Cheng Wang


    To better understand how and to what extent the halosubstituted carbene radical anions effect the chlorine abstraction of CHCl3, a detailed theoretical investigation has been performed at the UMP2/6-311++G (d, p)/RECP level of theory. The model system CHCl3+CHX·−/CX$^{·−}_{2}$ (X = Cl, Br, and I) has been chosen for the present study. According to the detailed discussions of geometries and energetics of the optimized stationary points, our theoretical findings suggest that the Cl-abstraction reactions by CHX·− are energetically favourable, indicating the less massive substitution X in CHX·− the easier abstraction reaction, as compared to those by CX$^{·−}_{2}$, which are energetically unfavourable and would be endothermic.

  9. On the chain lenth in Ox, HOx, NOx, ClOx and BrOx cycles in the middle atmosphere (United States)

    Larin, Igor; Kuskov, Michael


    Analysis of chain mechanisms of ozone depletion in Ox, HOx, NOx, ClOx and BrOx cycles has been performed. The carried out analysis has allowed to get analytical expression for calculation of the rate of limiting stage of chain prolongation, as well as chain breaking and chain length in cycles specified. It has been shown, that the correct estimation of ozone depletion in the chain processes is possible only through definition of the rate of limiting stage with taking into account of all reactions of chain prolongation, instead of the unique reaction possessing the least rate as it usually became earlier. It has been shown also, that choice of one reaction means ignoring a chain character of the process and leads to overestimate of real rate of ozone destruction. The role of null chain processes in the cycles specified above has been considered. It has been shown, that these processes play defining role in formation of families of odd oxygen, nitrogen, chlorine and bromine. By means of methods developed, data of IPCC scenario RCP 4.5, and two-dimensional model Socrates the rate of ozone destruction and chain length in Ox, HOx, NOx, ClOx and BrOx cycles for modeling conditions of April 2013 at 50 N and height diapason 15-120 km has been calculated. It has been shown, that in the middle stratosphere ozone destruction is due mainly to NOx cycle, whereas in the mesosphere and low thermosphere it is due mainly HOx one. It has been also shown that ClOx and BrOx have the greatest chain length in the upper stratosphere which exceeds 106 and HOx cycle in the low thermosphere has a chain length exceeding 1011.

  10. In situ quantification of Br and Cl in minerals and fluid inclusions by LA-ICP-MS: a powerful tool to identify fluid sources (United States)

    Hammerli, Johannes; Rusk, Brian; Spandler, Carl; Emsbo, Poul; Oliver, Nicholas H.S.


    Bromine and chlorine are important halogens for fluid source identification in the Earth's crust, but until recently we lacked routine analytical techniques to determine the concentration of these elements in situ on a micrometer scale in minerals and fluid inclusions. In this study, we evaluate the potential of in situ Cl and Br measurements by LA-ICP-MS through analysis of a range of scapolite grains with known Cl and Br concentrations. We assess the effects of varying spot sizes, variable plasma energy and resolve the contribution of polyatomic interferences on Br measurements. Using well-characterised natural scapolite standards, we show that LA-ICP-MS analysis allows measurement of Br and Cl concentrations in scapolite, and fluid inclusions as small as 16 μm in diameter and potentially in sodalite and a variety of other minerals, such as apatite, biotite, and amphibole. As a demonstration of the accuracy and potential of Cl and Br analyses by LA-ICP-MS, we analysed natural fluid inclusions hosted in sphalerite and compared them to crush and leach ion chromatography Cl/Br analyses. Limit of detection for Br is ~8 μg g−1, whereas relatively high Cl concentrations (> 500 μg g−1) are required for quantification by LA-ICP-MS. In general, our LA-ICP-MS fluid inclusion results agree well with ion chromatography (IC) data. Additionally, combined cathodoluminescence and LA-ICP-MS analyses on natural scapolites within a well-studied regional metamorphic suite in South Australia demonstrate that Cl and Br can be quantified with a ~25 μm resolution in natural minerals. This technique can be applied to resolve a range of hydrothermal geology problems, including determining the origins of ore forming brines and ore deposition processes, mapping metamorphic and hydrothermal fluid provinces and pathways, and constraining the effects of fluid–rock reactions and fluid mixing.

  11. Unconventional superconductivity in electron-doped layered metal nitride halides MNX (M = Ti, Zr, Hf; X = Cl, Br, I)

    Energy Technology Data Exchange (ETDEWEB)

    Kasahara, Yuichi, E-mail: [Department of Physics, Kyoto University, Kyoto 606-8502 (Japan); Kuroki, Kazuhiko, E-mail: [Department of Physics, Osaka University, Toyonaka, Osaka 560-0043 (Japan); Yamanaka, Shoji, E-mail: [Department of Applied Chemistry, Graduate School of Engineering, Hiroshima University, Higashi-Hiroshima, Hiroshima 739-8527 (Japan); Taguchi, Yasujiro, E-mail: [RIKEN Center for Emergent Matter Science (CEMS), Wako 351-0198 (Japan)


    In this review, we present a comprehensive overview of superconductivity in electron-doped metal nitride halides MNX (M = Ti, Zr, Hf; X = Cl, Br, I) with layered crystal structure and two-dimensional electronic states. The parent compounds are band insulators with no discernible long-range ordered state. Upon doping tiny amount of electrons, superconductivity emerges with several anomalous features beyond the conventional electron–phonon mechanism, which stimulate theoretical investigations. We will discuss experimental and theoretical results reported thus far and compare the electron-doped layered nitride superconductors with other superconductors.

  12. Viscosimetric investigations of NaCl and NaBr in hexamethylphosphoramidc-water mixtures at 298.15 K


    Jóżwiak, Małgorzata


    This work was supported by the CPBP 01.15 programme of Ministry of Higher Education, Poland The maesurements of density and viscosity of hexamethylphosphoramida (HMPA)-water mixtures containing NaCl and NaBr were performed at 298.15 K. The B-coefficients of the Jones-Dole equation were calculated. The relative viscosity and the B-coefficient are discussed in this work together with the standard enthalpy of solution of the electrolytes in HMPA-H₂O mixtures at 298.15 K. Prz...

  13. Magnetic Torque Studies of π-d System κ-(BDH-TTP)2FeX4 (X = Br, Cl) (United States)

    Sugii, Kaori; Takai, Kazuyuki; Tsuchiya, Satoshi; Uji, Shinya; Terashima, Taichi; Akutsu, Hiroki; Wada, Atsushi; Ichikawa, Shun; Yamada, Jun-ichi; Enoki, Toshiaki


    Systematic measurements of the magnetic torque of organic π-d conductors κ-(BDH-TTP)2FeX4 (X = Br, Cl) have been performed to investigate the magnetic properties. The Fe 3d spins of both salts show antiferromagnetic (AF) orders at low temperatures. A simple two-sublattice model is found to well reproduce the essential features of the torque data in the AF states. The exchange interaction and anisotropic parameter of the ligand field obtained by the simulations are consistent with previous experimental results.

  14. Luminescence of MFX:Eu/sup 2+/ M=Ca,Sr,Ba; X=Cl,Br, I

    International Nuclear Information System (INIS)

    BaFCl:Eu/sup 2+/ as an excellent x-ray phosphor, has been used successfully in medical x-ray intensifying screens and other x-ray displaying devices. Others have reported the emission spectra of MFCl:Eu (M=Ca, Sr, Ba). In this paper the authors focus the discussion on the characteristics of the emission and the energy level splitting of 4f 5d excited state of Eu/sup 2+/ ion in matrices MFX (M=Ca, Sr or Ba; X=Cl, Br or I)

  15. Unconventional superconductivity in electron-doped layered metal nitride halides MNX (M = Ti, Zr, Hf; X = Cl, Br, I)

    International Nuclear Information System (INIS)

    In this review, we present a comprehensive overview of superconductivity in electron-doped metal nitride halides MNX (M = Ti, Zr, Hf; X = Cl, Br, I) with layered crystal structure and two-dimensional electronic states. The parent compounds are band insulators with no discernible long-range ordered state. Upon doping tiny amount of electrons, superconductivity emerges with several anomalous features beyond the conventional electron–phonon mechanism, which stimulate theoretical investigations. We will discuss experimental and theoretical results reported thus far and compare the electron-doped layered nitride superconductors with other superconductors

  16. Dihydroxyacetone (DHA) monomer complexes with CaBr2 and CdCl2. (United States)

    Rlepokura, Katarzyna; Lis, Tadeusz


    Two hydrated complexes of monomeric dihydroxyacetone (DHA; the simplest ketose), viz. the calcium bromide complex bis(mu-dihydroxyacetone)bis[tetraaquacalcium(II)] tetrabromide (isomorphous with the chloride compound reported previously), [Ca(2)(C(3)H(6)O(3))(2)(H(2)O)(8)]Br(4), (2e), and the cadmium chloride complex poly[[bis(mu-dihydroxyacetone)bis[bis(dihydroxyacetone)cadmium(II)

  17. Trace-element compositions and Br/Cl ratios of fluid inclusions in the Tsushima granite, Japan: Significance for formation of granite-derived fluids (United States)

    Kurosawa, Masanori; Sasa, Kimikazu; Shin, Ki-Choel; Ishii, Satoshi


    Fluid inclusions in quartz samples from a miarolitic cavity, two quartz veins, and a hydrothermal ore vein in the Tsushima granite, Japan, were analyzed by particle-induced X-ray emission to examine the chemistry and process of formation of hydrothermal fluids in an island-arc granite. Most of the inclusions were polyphase or vapor, and there were smaller numbers of two-phase aqueous inclusions. The inclusions contained Cl, K, Ca, Ti, Mn, Fe, Cu, Zn, Ge, Br, Rb, Sr, Ba, and Pb. For each inclusion, there was a strong positive correlation between Cl content and contents of other elements identified. Concentration ranges for most elements (other than Rb and Ge) in polyphase inclusions from the miarolitic cavity were comparable to those from cavities in alkaline granites; those from the ore vein were comparable to large-scale continental hydrothermal ore deposits. The lower Rb and higher Ge contents in the polyphase inclusions of the Tsushima granite may be characteristic of hydrothermal fluids from calc-alkaline granites in an island-arc setting. Br/Cl ratios (by weight) for the vapor and two-phase inclusions were 0.0013-0.0030 and differed among the three geological settings. Br/Cl ratios of polyphase inclusions increased with increasing Cl content in single-crystal and polycrystalline quartz, and high values of more than 0.0100 were found. The high Br/Cl ratios and the differences among the geological settings sampled may be due to pressure dependences of partitioning of Cl and Br between fluid and magma during fluid segregation and between liquid and vapor during boiling. Using a simple model based on these dependences, we calculated Br/Cl ratios greater than 0.01 in brine generated at pressures polyphase and vapor inclusions from each geological setting were attributed to mixing between two end-member fluids: a high Br/Cl fluid generated at low pressure and a low Br/Cl fluid generated at high pressure. Br/Cl ratios of polyphase inclusions in quartz may be a key

  18. Vapor pressures and isopiestic molalities of concentrated CaCl2(aq), CaBr2(aq), and NaCl(aq) to T = 523 K

    International Nuclear Information System (INIS)

    The Oak Ridge National Laboratory high-temperature isopiestic apparatus was outfitted with precise pressure gauges to allow for direct vapor pressure measurements. Vapor pressures over concentrated solutions of CaCl2(aq), and CaBr2(aq) were measured at temperatures between (380.15 and 523.15) K in the range of water activities between 0.2 and 0.85. Isopiestic molalities were used to determine osmotic coefficients at the conditions where NaCl reference standard solutions remained undersaturated. The main goal of this work was to improve the accuracy of isopiestic comparisons based on the calcium chloride reference standard. Osmotic coefficients for CaCl2(aq) and CaBr2(aq) calculated from both isopiestic and direct vapor pressure results were combined with the literature data and used to build general thermodynamic models based on a variant of extended Pitzer ion-interaction equations and valid at the saturation pressure of water. While these empirical models approach the accuracy of the experimental data in a wider range of concentrations and temperatures than any previously published equations, considerable amounts of accurate data and a substantial effort are required in order to obtain a satisfactory representation using power series-based virial equations. The effect of experimental uncertainties on the accuracy of the direct vapor pressure results is discussed, including in particular the error caused by the presence in the apparatus of a small amount of CO2. The substantial decrease of the solubility product of CaCO3 in concentrated chloride solutions at temperatures above 423 K is a serious defect of calcium chloride as a water activity reference standard

  19. Decolorization of Blue CL-BR dye by AOPs using bleach wastewater as source of H2O2

    Institute of Scientific and Technical Information of China (English)


    This research was focused on the investigation of the efficacy of advanced oxidation processes (Fenton, ozonation and UV/H2O2)for decolorization of reactive azo dye (Blue CL-BR) using bleach wastewater as possible source of H2O2. All the experiments were performed on the laboratory scale set-up. Thc results showed that colour removal efficiencies by UV or bleach (H2O2) alone were not so efficient. Fenton process with bleach wastewater was found to be the most effective at process conditions such as pH of 3 and H2O2/Fe2+ratio of 24:1, resulting in 64% colour removal. Almost complete colour removal, i.e., 99% and 95% were achieved by UV/H2O2 and UV/bleach wastewater in 30 and 60 min, respectively. Ozonation proved an efficient method for decolorization of Blue CL-BR dye at alkaline pH. It was possible to achieve 98% colour removal with 30 min of ozonation at pH 9. The colour removal of dye was found to follow first order kinetics.

  20. Multiple bonds to gold: a theoretical investigation of XAuC (X = F, Cl, Br, I) molecules

    International Nuclear Information System (INIS)

    Structures and spectroscopic properties are reported for the linear XAuC (X = F, Cl, Br, I) series of molecules and their related diatomic species at a high level of accuracy. The singles and doubles coupled cluster method including a perturbational correction for connected triple excitations, CCSD(T), with systematic sequences of new correlation consistent basis sets have been employed. Scalar relativistic effects have been accurately included by making use of relativistic effective core potentials. Extrapolation to the complete basis set limit has been used with accurate treatments of core-valence correlation and spin-orbit effects in order to accurately predict spectroscopic properties, as well as dissociation and atomization energies at 0 K of AuC, AuC+, AuF, AuCl, AuBr, AuI, and the XAuC molecules. The Au-C bond length in the FAuC molecule is predicted to be nearly identical to that calculated for AuC+, which makes it the shortest known for a neutral gold molecule. The Au-C and Au-F (0 K) bond dissociation energies in FAuC are predicted to be 92.5 and 93.1 kcal/mol, respectively, also making them some of the strongest known bonds to gold

  1. Periodicity, Electronic Structures, and Bonding of Gold Tetrahalides [AuX4]- (X = F, Cl, Br, I, At, Uus). (United States)

    Li, Wan-Lu; Li, Yong; Xu, Cong-Qiao; Wang, Xue-Bin; Vorpagel, Erich; Li, Jun


    Systematic theoretical and experimental investigations have been performed to understand the periodicity, electronic structures, and bonding of gold halides using tetrahalide [AuX4](-) anions (X = F, Cl, Br, I, At, Uus). The [AuX4](-) (X = Cl, Br, I) anions were experimentally produced in the gas phase, and their negative-ion photoelectron spectra were obtained, exhibiting rich and well-resolved spectral peaks. As expected, Au-X bonds in such series contain generally increasing covalency when halogen ligands become heavier. We calculated the adiabatic electron detachment energies as well as vertical electron detachment energies using density functional theory methods with scalar relativistic and spin-orbit coupling effects. The computationally simulated photoelectron spectra are in good agreement with the experimental ones. Our results show that the trivalent Au(III) oxidation state becomes progressively less stable while Au(I) tends to be preferred when the halides become heavier along the Periodic Table. This series of molecules provides an example for manipulating the oxidation state of metals in complexes through ligand design. PMID:26550845

  2. The tunable quantum spin ladder Cu(Qnx)(Cl{sub (1−x)}Br{sub x}){sub 2}

    Energy Technology Data Exchange (ETDEWEB)

    Povarov, K.Yu., E-mail: [Neutron Scattering and Magnetism, Laboratory for Solid State Physics, ETH Zürich (Switzerland); Lorenz, W.E.A. [Neutron Scattering and Magnetism, Laboratory for Solid State Physics, ETH Zürich (Switzerland); Xiao, F.; Landee, C.P. [Department of Physics, Clark University, Worcester, MA 01610 (United States); Krasnikova, Y. [P.L. Kapitza Institute for Physical Problems RAS, 119334, Moscow (Russian Federation); Moscow Institute for Physics and Technology, 141700 Dolgoprudny (Russian Federation); Zheludev, A. [Neutron Scattering and Magnetism, Laboratory for Solid State Physics, ETH Zürich (Switzerland)


    We report magnetic, specific heat and ESR measurements on a series of S=1/2 spin ladder compounds Cu(Qnx)(Cl{sub (1−x)}Br{sub x}){sub 2}. Down to T=2 K all the observables can be described by the spin ladder model with about 1% of S=1/2 impurities in the background, which are present even in a nominally pure Cu(Qnx)Cl{sub 2} and Cu(Qnx)Br{sub 2}, for the whole range of 0≤x≤1. We extract ladder exchange constants J{sub l}(x) and J{sub r}(x) as well as the gap value Δ(x) by comparing the experimental data to quantum Monte-Carlo simulations. As the ESR measurements show the g-factor of impurities to be precisely equal to g-factor of the ladder spins, we suppose the impurities to be the consequence of structural defects resulting in broken ladder ends. - Highlights: • A family of isostructural spin-ladder compounds was investigated. • A variation in exchange parameters with the degree of chemical substitution was found. • A small amount of paramagnetic spins was attributed to structural defects in a ladder.

  3. Structural, optical and some physical properties of PVDF films filled with LiBr/MnCl2 mixed fillers

    International Nuclear Information System (INIS)

    Films of polyvinylidene fluoride (PVDF) filled with (X)LiBr(20-X)MnCl2 mixture, where X=0, 1, 2, 8, 16 and 20 wt%, were prepared by casting method and studied by ultraviolet/visible optical absorption (UV), differential scanning calorimetry (DSC), X-ray diffraction (XRD), infrared transmission (IR) and electron spin resonance (ESR). The optical absorption spectra suggested the presence of an optical gap (Eg) which depends on filler concentration (W) and arises due to the variation in crystallinity within the polymer matrix. Melting and degradation temperatures were identified using DSC. XRD implied a semicrystalline structure (containing α- and β-PVDF phases for all films). Conjugated double bonds and the role of dimethylformamide with a PVDF chain were detected by IR spectra. The ESR analysis revealed the existence of both isolated and aggregated Mn2+ ions within the PVDF matrix. -- Research highlights: → Films of polyvinylidene fluoride (PVDF) filled with (X)LiBr(20-X)MnCl2 mixture were prepared by casting method. → UV/Vis spectra suggested the presence of an optical gap (Eg), which depends on filler concentration. → Eg arises due to the variation in crystallinity within the polymer matrix. → Melting and degradation temperatures were identified using DSC. → XRD implied a semicrystalline structure (containing α- and β-PVDF phases for all films).

  4. Electronic properties of PbX₃CH₃NH₃ (X = Cl, Br, I) compounds for photovoltaic and photocatalytic applications. (United States)

    Melissen, Sigismund Teunis Alexander George; Labat, Frédéric; Sautet, Philippe; Le Bahers, Tangui


    Since the discovery of their excellent performance as the light-absorbing semiconducting component in photovoltaic cells, the PbX3CH3NH3 (X = I, Br, Cl) perovskites have received renewed attention. The five polymorphs stable above 200 K - the tetragonal phases for X = I, Br, Cl and the cubic phases for X = I, Br - were studied using periodic DFT calculations involving hybrid functionals (PBE0 and HSE), employing Gaussian-type orbitals as well as plane waves and including relativistic effects (spin-orbit coupling). The influence of the halogen substitution and of the crystal phase on these properties is analysed by comparing the properties obtained in this study to the experimental ones and to the theoretical ones computed using other methods. We show that an accurate treatment of these systems requires the description of dispersion forces and spin-orbit coupling. The different time scales for the electronic and vibrational components of the polarizability inspire the hypothesis that several interfacial charge transfer mechanisms are encountered in the working principle of the photovoltaic devices involving these perovskite materials. The heavy elements in the structure (Pb, I) play a major role in the high polarizability and the low effective charge carrier masses and hence in the low exciton binding energies and the high charge mobility. This systematic work on the PbX3CH3NH3 family offers to theoreticians an overview of the landscape of quantum chemical methods to enable a reasonable choice of methodology for studying these systems. PMID:25483273

  5. Comparison of the directionality of the halogen, hydrogen, and lithium bonds between HOOOH and XF (X = Cl, Br, H, Li). (United States)

    Liu, Lixun; Meng, Lingpeng; Zhang, Xueying; Zeng, Yanli


    Detailed electrostatic potential (ESP) analyses were performed to compare the directionality of halogen bonds with those of hydrogen bonds and lithium bonds. To do this, the interactions of HOOOH with the molecules XF (X = Cl, Br, H, Li) were investigated. For each molecule, the percentage of the van der Waals (vdW) molecular surface that intersected with the ESP surface was used to roughly quantify the directionality of the halogen/hydrogen/lithium bond associated with the molecule. The size of the region of intersection was found to increase in the following order: ClF BrF BrF BrF, the positive electrostatic potential was concentrated in a very small region of the vdW molecular surface. On the other hand, for HF and LiF, the positive electrostatic potential was more diffusely scattered across the vdW surface than for ClF and BrF. Also, the optimized geometries of the dipolymers HOOOH··· XF (X = Cl, Br, H, Li) indicated that halogen bonds are more directional than hydrogen bonds and lithium bonds, consistent with the results of ESP analyses. PMID:26847451

  6. Estudio comparativo de las moléculas isovalentes de interés atmosférico CF3Cl y CF3Br y sus correspondientes halógenos aislados Cl y Br. (United States)

    Mayor, E.; Velasco, A. M.; Martín, I.; Lavín, C.

    Los estados Rydberg moleculares han suscitado en los últimos años un creciente interés entre los espectroscopistas experimentales, motivado en parte por el desarrollo de nuevas técnicas espectroscópicas capaces de investigar estos estados altamente excitados electrónicamente. Los procesos de fotoabsorción que implican estados Rydberg en los derivados halogenados del metano son de gran importancia, debido a su abundancia en la atmósfera y a sus implicaciones medioambientales. Por ello, la obtención de datos relativos a sus fuerzas de oscilador es de gran interés. En este trabajo se aborda el estudio de dichas propiedades para las moléculas isovalentes CF3Cl y CF3Br. Ambas moléculas presentan idéntica estructura electrónica para el estado fundamental por lo que se espera que sus espectros Rydberg presenten grandes similitudes, en ausencia de perturbaciones. Por ello y dada la escasez de datos relativos a fuerzas de oscilador, hemos establecido la corrección de nuestros resultados en base a las analogías esperadas en las intensidades espectrales correspondientes a transiciones análogas. Por otro lado, Novak y col. [1] han encontrado experimentalmente un marcado carácter atómico en el espectro correspondiente a estas moléculas, siendo muy similar a los de los átomos de Cl y Br. Por ello en el presente trabajo, además de establecer la comparación entre ambas moléculas hemos buscado las similitudes con sus respectivos halógenos. Los cálculos relativos a las especies moleculares se han realizado utilizando la Metodología Molécular de Orbítales de Defecto Cuántico (MQDO) [2], mientras que para el estudio de los átomos de Cl y Br se empleó la versión relativista del método (RQDO) [3].

  7. Chemistry of ruthenium in N2P2X2 (X=Cl,Br) coordination sphere: synthesis, characterization and reactivities

    International Nuclear Information System (INIS)

    Reaction of 2-(phenylazo)pyridine (pap) with (Ru(PPh3)3X2) (X=Cl,Br) in dichloromethane solution affords (Ru(PPh3)2(pap)X2). These diamagnetic complexes exhibit a weak d-d transition and two intense MLCT transitions in the visible region. In dichloromethane solution they display a one-electron reduction of pap near -0.90 V vs SCE and a reversible ruthenium(II)-ruthenium(III) oxidation near 0.70 V vs SCE. The (RuIII(PPh3)2 (pap)Cl2)+ complex cation, generated by coulometric oxidation of (Ru(PPh3)2(pap)Cl2), shows two intense LMCT transitions in the visible region. It oxidizes N,N-dimethylaniline and (RuII(bpy)2Cl2) (bpy=2,2'bipyridine) to produce N, N, N',N'-tetramethylbenzidine and (RuIII(bpy)2Cl2)+ respectively. Reaction of (Ru(PPh3)2(pap)X2) with Ag+ in ethanol produces (Ru(PPh3)2(pap)(EtOH)2)2+ which upon further reaction with L (L=pap, bpy, acetylacetonate ion(acac-) and oxalate ion (ox2-)) gives complexes of type (Ru(PPh3)2(pap)(L))n+ (n=0,1,2). All these diamagnetic complexes show a weak d-d transition and several intense MLCT transitions in the visible region. The ruthenium(II)-ruthenium(III) oxidation potential decreases in the order (of L): pap>bpy>acac->ox2-. Reductions of the coordinated pap and bpy are also observed. (author). 29 refs., 3 figs., 1 tab

  8. Room-temperature and gram-scale synthesis of CsPbX3 (X = Cl, Br, I) perovskite nanocrystals with 50-85% photoluminescence quantum yields. (United States)

    Wei, Song; Yang, Yanchun; Kang, Xiaojiao; Wang, Lan; Huang, Lijian; Pan, Daocheng


    All inorganic CsPbX3 (X = Cl, Br, I) perovskite nanocrystals (PNCs) with 50-85% photoluminescence quantum yields and tunable emission in the range of 440-682 nm have been successfully synthesized at room temperature in open air. This facile strategy enables us to prepare gram-scale CsPbBr3 NCs with a PLQY approaching 80%. PMID:27180872

  9. High-pressure synthesis and crystal structures of beta- M NX (M = Zr, Hf; X = Cl, Br, I)

    CERN Document Server

    Chen, X; Yamanaka, S


    The single crystals of six kinds of metal nitride halide, beta- M NX (M = Zr, Hf; X = Cl, Br, I), were grown in sealed Au (or Pt) tubes by the reaction of M N or M NX powders with NH sub 4 X as fluxes under high-temperature and high-pressure conditions such as 3-5 GPa at 900-1200 sup o C. The x-ray structure analysis revealed that all six kinds of compound crystallize in a rhombohedral space group R3-bar m, Z = 6. beta-ZrNCl, beta-ZrNBr, and beta-HfNCl are isotypic with SmSI, and the others isostructural with YOF.

  10. Quantitative assessment of the multiplicity of carbon-halogen bonds: carbenium and halonium ions with F, Cl, Br, and I. (United States)

    Kalescky, Robert; Zou, Wenli; Kraka, Elfi; Cremer, Dieter


    CX (X = F, Cl, Br, I) and CE bonding (E = O, S, Se, Te) was investigated for a test set of 168 molecules using the local CX and CE stretching force constants k(a) calculated at the M06-2X/cc-pVTZ level of theory. The stretching force constants were used to derive a relative bond strength order (RBSO) parameter n. As alternative bond strength descriptors, bond dissociation energies (BDE) were calculated at the G3 level or at the two-component NESC (normalized elimination of the small component)/CCSD(T) level of theory for molecules with X = Br, I or E = Se, Te. RBSO values reveal that both bond lengths and BDE values are less useful when a quantification of the bond strength is needed. CX double bonds can be realized for Br- or I-substituted carbenium ions where as suitable reference the double bond of the corresponding formaldehyde homologue is used. A triple bond cannot be realized in this way as the diatomic CX(+) ions with a limited π-donor capacity for X are just double-bonded. The stability of halonium ions increases with the atomic number of X, which is reflected by a strengthening of the fractional (electron-deficient) CX bonds. An additional stability increase of up to 25 kcal/mol (X = I) is obtained when the X(+) ion can form a bridged halonium ion with ethene such that a more efficient 2-electron-3-center bonding situation is created. PMID:24555526

  11. Quantum chemical investigation of linear hydrogen bonding in ONCCN···HX (X = F, Cl, Br) dimers (United States)

    Varadwaj, Pradeep R.

    Linear hydrogen bonding formed between the nitrogen end of cyanogen-N-oxide (ONCCN) and hydrogen halides HX (X = F, Cl, Br) has been observed in their ground ? states. The order of agreement of energetic stabilities between the correlated functionals used in this calculation is: B3LYP bonds in these dimers follows the conventional trend: ONCCN···HF > ONCCN···HCl > ONCCN···HBr in the series, except H-bond lengths and static dipole polarizabilities which are in reverse order. The atomic charges obtained from the Mulliken and natural population analysis is used to assess the charge transfer effects that accompany the dimer formation. It is found from the investigation that the dimers having highest binding energy are accompanied by the highest transfer of charge. The 14N nuclear quadrupole coupling constants of the monomer ON1CCN2 are found to be decreased upon complection and in the series it increases from F through Br. We observed enhancements in the values of the dimer dipole moment and intrinsic dipole polarizabilities compared with the sum of the monomer values by intermolecular electrical interaction. Investigation reveals vibrational spectral shifts of HX and CN stretching modes similar to the conventional red-shifted H-bonded dimers; for the former case, the infrared band intensity increases significantly. Finally, the new vibrational modes originated from the intermolecular interaction are outlined.

  12. Relativistic effects on the nuclear magnetic resonance shielding of FX (X = F, Cl, Br, I, and At) molecular systems. (United States)

    Gómez, Sergio S; Aucar, Gustavo A


    We present ab inito full four-component and spin-free calculations of the NMR shielding parameter, σ, in the FX (X = F, Cl, Br, I and At) molecular systems. A different expression that overcomes the traditional non-relativistic (NR) approximation used to calculate the relationship between spin-rotation constants and the paramagnetic terms of σ(p) are given. Large deviations from NR results are obtained for σ(X; X = I and At) and for σ(F; FAt). σ(∥)(p)(I; FI) is zero within the NR approach but -447.4 parts per million from our calculations. The electronic origin of relativistic corrections are analyzed. All passive SO contributions are obtained as a difference between full four-component calculations and spin-free ones. Considering relativistic effects on the anisotropy, we obtain a deviation of 10% for I and 25% for At. σ(∥)(SO)(X) is always negative and σ(∥)(SF)(X) is always positive; the passive SO becomes larger than the SF one for X = Br, I, and At. Both σ(∥)(SO)(X) and σ(⊥)(SO)(X) have a functional dependence such as a Z(X)(b) being the exponent 3.5 and 3.65, respectively. The passive SO contribution to the anisotropy has a similar functional dependence with an exponent of 3.60, meaning that its perpendicular component is larger than its corresponding parallel component. PMID:21639447

  13. Structural and energetic properties of closed shell XF(n) (X = Cl, Br, and I; n = 1-7) and XO(n)F(m) (X = Cl, Br, and I; n = 1-3; m = 0-6) molecules and ions leading to stability predictions for yet unknown compounds. (United States)

    Thanthiriwatte, K Sahan; Vasiliu, Monica; Dixon, David A; Christe, Karl O


    Atomization energies at 0 K and heats of formation at 0 and 298 K were predicted for the closed shell compounds XF, XF(2)(-), XF(2)(+), XF(3), XF(4)(-), XF(4)(+), XF(5), XF(6)(-), XF(6)(+) (X = Cl and Br) and XO(+), XOF, XOF(2)(-), XOF(2)(+), XOF(3), XOF(4)(-), XOF(4)(+), XOF(5), XOF(6)(-), XO(2)(+), XO(2)F, XO(2)F(2)(-), XO(2)F(2)(+), XO(2)F(3), XO(2)F(4)(-), XO(3)(+), XO(3)F, XO(3)F(2)(-) (X = Cl, Br, and I) using a composite electronic structure approach based on coupled cluster CCSD(T) calculations extrapolated to the complete basis set limit with additional corrections. The calculated heats of formation are in good agreement with the available experimental data. The calculated heats of formation were used to predict fluoride affinities, fluorine cation affinities, and F(2) binding energies. On the basis of our results, BrOF(5) and BrO(2)F(3) are predicted to be stable against spontaneous loss of F(2) and should be able to be synthesized, whereas BrF(7), ClF(7), BrOF(6)(-), and ClOF(6)(-) are unstable by a very wide margin. The stability of ClOF(5) is a borderline case. Although its F(2) loss is predicted to be exothermic by 4.4 kcal/mol, it may have a sufficiently large barrier toward decomposition and be preparable. This situation would resemble ClO(2)F(3) which was successfully synthesized in spite of being unstable toward F(2) loss by 3.3 kcal/mol. On the other hand, the ClOF(4)(+) and BrOF(4)(+) cations are less likely to be preparable with F(2) loss exothermicities of -17.5 and -9.3 kcal/mol, respectively. On the basis of the F(-) affinities of ClOF (45.4 kcal/mol), BrOF (58.7 kcal/mol), and BrO(2)F(3) (65.7 kcal/mol) and their predicted stabilities against loss of F(2), the ClOF(2)(-), BrOF(2)(-), and BrO(2)F(4)(-) anions are excellent targets for synthesis. Our previous failure to prepare the ClO(2)F(4)(-) anion can be rationalized by the predicted high exothermicity of -17.4 kcal/mol for the loss of F(2). PMID:23009656

  14. A simple model for calculating the bulk modulus of the mixed ionic crystal: NH4Cl1−xBr

    Indian Academy of Sciences (India)

    Vassiliki Katsika-Tsigourakou


    The ammonium halides are an interesting systems because of their polymorphism and the possible internal rotation of the ammonium ion. The static properties of the mixed ionic crystal NH4Cl1−Br have been recently investigated, using the three-body potential model (TDPM) by applying Vegard’s law. Here, by using a simple theoretical model, we estimate the bulk modulus of the alloys NH4Cl1−Br, in terms of the bulk modulus of the end members alone. The calculated values are comparable to those deduced from the three-body potential model (TDPM) by applying Vegard’s law.

  15. Cl/Br ratios and chlorine isotope evidences for groundwater salinization and its impact on groundwater arsenic, fluoride and iodine enrichment in the Datong basin, China. (United States)

    Li, Junxia; Wang, Yanxin; Xie, Xianjun


    In order to identify the salinization processes and its impact on arsenic, fluoride and iodine enrichment in groundwater, hydrogeochemical and environmental isotope studies have been conducted on groundwater from the Datong basin, China. The total dissolved solid (TDS) concentrations in groundwater ranged from 451 to 8250mg/L, and 41% of all samples were identified as moderately saline groundwater with TDS of 3000-10,000mg/L. The results of groundwater Cl concentrations, Cl/Br molar ratio and Cl isotope composition suggest that three processes including water-rock interaction, surface saline soil flushing, and evapotranspiration result in the groundwater salinization in the study area. The relatively higher Cl/Br molar ratio in groundwater from multiple screening wells indicates the contribution of halite dissolution from saline soil flushed by vertical infiltration to the groundwater salinization. However, the results of groundwater Cl/Br molar ratio model indicate that the effect of saline soil flushing practice is limited to account for the observed salinity variation in groundwater. The plots of groundwater Cl vs. Cl/Br molar ratio, and Cl vs δ(37)Cl perform the dominant effects of evapotranspiration on groundwater salinization. Inverse geochemical modeling results show that evapotranspiration may cause approximately 66% loss of shallow groundwater to account for the observed hydrochemical pattern. Due to the redox condition fluctuation induced by irrigation activities and evapotranspiration, groundwater salinization processes have negative effects on groundwater arsenic enrichment. For groundwater iodine and fluoride enrichment, evapotranspiration partly accounts for their elevation in slightly saline water. However, too strong evapotranspiration would restrict groundwater fluoride concentration due to the limitation of fluorite solubility. PMID:26657361

  16. Antiperovskite Chalco-Halides Ba3(FeS4)Cl, Ba3(FeS4)Br, and Ba3(FeSe4)Br with Spin Super-Super Exchange


    Xian Zhang; Kai Liu; Jian-Qiao He; Hui Wu; Qing-Zhen Huang; Jian-Hua Lin; Zhong-Yi Lu; Fu-Qiang Huang


    Perovskite-related materials have received increasing attention for their broad applications in photovoltaic solar cells and information technology due to their unique electrical and magnetic properties. Here we report three new antiperovskite chalco-halides: Ba3(FeS4)Cl, Ba3(FeS4)Br, and Ba3(FeSe4)Br. All of them were found to be good solar light absorbers. Remarkably, although the shortest Fe-Fe distance exceeds 6 Å, an unexpected anti-ferromagnetic phase transition near 100 K was observed ...

  17. Further Analysis of Boiling Points of Small Molecules, CH[subscript w]F[subscript x]Cl[subscript y]Br[subscript z (United States)

    Beauchamp, Guy


    A study to present specific hypothesis that satisfactorily explain the boiling point of a number of molecules, CH[subscript w]F[subscript x]Cl[subscript y]Br[subscript z] having similar structure, and then analyze the model with the help of multiple linear regression (MLR), a data analysis tool. The MLR analysis was useful in selecting the…

  18. Charge transfer and relativistic effects in the low-lying electronic states of CuCl, CuBr and CuI

    NARCIS (Netherlands)

    Sousa, C; DeJong, WA; Broer, R; Nieuwpoort, WC; Jong, W.A. de


    The spectral transitions and the character of the low-lying excited states of the copper halides, CuX (X = Cl, Br, I) are studied by means of two different relativistic computational approaches. One is based on the CASSCF/CASPT2 approach with operators accounting for scalar relativistic effects eval

  19. Bond properties of anionic halogenocadmate (II) complexes of the type CdX3Y2-(Xnot=Y=Cl,Br,I)

    International Nuclear Information System (INIS)

    A normal coordinate analysis has been performed for the anionic halogenocadmate (II) complexes CdX3Y2-(Xnot=Y=Cl,Br,I). The results have been discussed in relation to the bond properties and the vibrational assignments are examined. (author)

  20. Study of optical properties of protactinium IV (5f1) in ThBr4 and ThCl4 matrices

    International Nuclear Information System (INIS)

    This thesis introduces spectroscopy studies of a (IV) which are realized in ThBr4 and ThCl4 host matrices. The optical polarized spectra are reported in the infrared region between 4.2K and 300K. The most important point is the first observation of the Pa4+ fluorescence spectrum. We determined experimentally the energy of all the Stark levels of tetrapositive protactinium ion doped into ThBr4. Consequently the values of the crystal field parameters and the spin-orbit coupling constant are deduced. The same behaviour for Pa4+:ThBr4 and Pa4+:ThCl4 characterized different interactions when the electron (5f1) comes in a different crystal field

  1. Electronic structure and magnetic ordering of the semiconducting chromium trihalides CrCl3, CrBr3, and CrI3

    KAUST Repository

    Wang, Hao


    We present results from an electronic structure investigation of the chromium halides CrCl3, CrBr3, and CrI3, as obtained by the linearized augmented plane wave method of density functional theory. Our interest focuses on the chloride. While all three halides display strong ferromagnetic coupling within the halide-Cr-halide triple layers, our emphasis is on differences in the interlayer magnetic coupling. In agreement with experimental results, our calculations indicate ferromagnetic ordering for CrBr3 as well as CrI3. The antiferromagnetic state of CrCl3 can be reproduced by introducing an on-site electron-electron repulsion. However, we observe that the ground state depends critically on the specific approach used. Our results show that a low temperature structural phase transition from monoclinic to trigonal is energetically favourable for CrCl3. © 2011 IOP Publishing Ltd.

  2. Methane hydrate phase equilibrium in the presence of NaBr, KBr, CaBr2, K2CO3, and MgCl2 aqueous solutions: Experimental measurements and predictions of dissociation conditions

    International Nuclear Information System (INIS)

    In this communication, experimental data for dissociation conditions of methane hydrates in the presence of 0.05 and 0.1 mass fractions NaBr, KBr, K2CO3, and MgCl2 aqueous solutions and in the presence of 0.05 and 0.15 mass fractions CaBr2 aqueous solutions are reported. The experimental data were generated using an isochoric pressure-search method. The new experimental dissociation data for methane hydrates in the presence of 0.1 mass fraction MgCl2 aqueous solution are compared with some selected experimental data from the literature and the agreements are generally found acceptable. Some of new data are finally compared with the predictions of a correlation, which is generally used in the absence of experimental data, and acceptable agreements between the experimental and predicted data are observed.

  3. Methane hydrate phase equilibrium in the presence of NaBr, KBr, CaBr{sub 2}, K{sub 2}CO{sub 3}, and MgCl{sub 2} aqueous solutions: Experimental measurements and predictions of dissociation conditions

    Energy Technology Data Exchange (ETDEWEB)

    Mohammadi, Amir H. [Mines ParisTech, CEP/TEP - Centre energetique et procedes, CNRS FRE 2861, 35 Rue Saint Honore, 77305 Fontainebleau (France); Kraouti, Ilyas [Departement Mesures Physiques, Institut Universitaire de Technologie, Universite de Paris-Sud (International Institute for Applied Systems Analysis (IIASA)), Plateau de Moulon, 91400 Orsay (France); Richon, Dominique [Mines ParisTech, CEP/TEP - Centre energetique et procedes, CNRS FRE 2861, 35 Rue Saint Honore, 77305 Fontainebleau (France)], E-mail:


    In this communication, experimental data for dissociation conditions of methane hydrates in the presence of 0.05 and 0.1 mass fractions NaBr, KBr, K{sub 2}CO{sub 3}, and MgCl{sub 2} aqueous solutions and in the presence of 0.05 and 0.15 mass fractions CaBr{sub 2} aqueous solutions are reported. The experimental data were generated using an isochoric pressure-search method. The new experimental dissociation data for methane hydrates in the presence of 0.1 mass fraction MgCl{sub 2} aqueous solution are compared with some selected experimental data from the literature and the agreements are generally found acceptable. Some of new data are finally compared with the predictions of a correlation, which is generally used in the absence of experimental data, and acceptable agreements between the experimental and predicted data are observed.

  4. Theoretical insight into the interaction between SnX2 (X = H, F, Cl, Br, I) and benzene. (United States)

    Matczak, Piotr


    For a series of five model complexes composed of a singlet SnX2 molecule (X = H, F, Cl, Br, I) and a benzene molecule, the first-principles calculations of their energetics and the analysis of their electron density topology have been performed. The CCSD(T)/CBS interaction energy between SnX2 and C6H6 fall into the range between -10.0 and -11.2 kcal/mol, which indicates that the complexes are rather weakly bound. The relevant role of electrostatic and dispersion contributions to the interaction energy between SnX2 and C6H6 is highlighted in the results obtained from the symmetry-adapted perturbation theory (SAPT). The electron density topological analysis has been carried out using the quantum theory of atoms in molecules (QTAIM) and the noncovalent interactions (NCI) visualization index. Both QTAIM and NCI prove the closed-shell, noncovalent and attractive character of the interaction. A very small charge transfer from C6H6 to SnX2 has been detected. The formation of the five complexes is accompanied by the electron density deformations that are spatially restricted mostly to the region around the Sn atom and its adjacent C atom. The results presented in this work shed some light on the nature of the interactions associated with crystalline structural motifs involving low-valent tin complexed with neutral aryl rings. PMID:27525639

  5. The nature of inter- and intramolecular interactions in F2OXe(…)HX (X= F, Cl, Br, I) complexes. (United States)

    Makarewicz, Emilia; Lundell, Jan; Gordon, Agnieszka J; Berski, Slawomir


    Electronic structure of the XeOF2 molecule and its two complexes with HX (X= F, Cl, Br, I) molecules have been studied in the gas phase using quantum chemical topology methods: topological analysis of electron localization function (ELF), electron density, ρ(r), reduced gradient of electron density |RDG(r)| in real space, and symmetry adapted perturbation theory (SAPT) in the Hilbert space. The wave function has been approximated by the MP2 and DFT methods, using APF-D, B3LYP, M062X, and B2PLYP functionals, with the dispersion correction as proposed by Grimme (GD3). For the Xe-F and Xe=O bonds in the isolated XeOF2 molecule, the bonding ELF-localization basins have not been observed. According to the ELF results, these interactions are not of covalent nature with shared electron density. There are two stable F2OXe(…)HF complexes. The first one is stabilized by the F-H(…)F and Xe(…)F interactions (type I) and the second by the F-H(…)O hydrogen bond (type II). The SAPT analysis confirms the electrostatic term, Eelst ((1)) and the induction energy, Eind ((2)) to be the major contributors to stabilizing both types of complexes. PMID:27146283

  6. Excitation of Rydberg states of HgCl2 and HgBr2 by electron impact

    International Nuclear Information System (INIS)

    We have examined the electronic structure of HgCl2 and HgBr2 from 5 eV to 14 eV by high-resolution electron energy-loss spectroscopy. Our measurements include the near-UV region, which has not been examined by any previous technique and which is found to be rich in Rydbery states. In particular, in each molecule we identify members of two optically allowed Rydberg series and one forbidden series with electronic structures sigma/sub g/2 sigma/sub u/2 π/sub u/4 π/sub g/3 [npπ/sub u/, npsigma/sub u/ and ndπ/sub g/, or (n+1)ssigma/sub g/] that converge to the 2PI/sub g/ ground ionic state. In addition, other structures that form the dominant energy-loss mechanisms in our spectra are identified as arising from optically allowed Rydberg states associated with the excited ionic states 2PI/sub u/, 2Σ/sub u/, and 2Σ/sub g/. Measurements at energy losses below 9 eV confirm previous valence states observed in photoabsorption and suggest the existence of two new valence states in each molecule. Angular measurements facilitate identification of many of the newly observed structures in our electron energy-loss spectra

  7. New low-dimensional molecular conductors: α''-(BEDO-TTF)2Cl.3H2O and θ-(BDH-TTP)2(Br0.67Cl0.33).3H2O (United States)

    Zorina, L. V.; Simonov, S. V.; Khasanov, S. S.; Shibaeva, R. P.


    X-ray single-crystal diffraction studies of two new molecular conductors α''-(BEDO-TTF)2Cl.3H2O and θ-(BDH-TTP)2(Br0.67Cl0.33).3H2O are reported. Both crystals have a layered structure in which conducting layers of organic BEDO-TTF or BDH-TTP π-electron donors are separated by complex anion layers. The anion layers consist of honeycomb networks of Cl- (Br-) halogen anions and water molecules, which are stable owing to the formation of hydrogen bonds. Calculations of the electron band structure of these crystals show that metallic conductivity is to be expected in the organic α''-(BEDO-TTF) and θ-(BDH-TTP) layers.

  8. Kinetic smog-chamber studies on halogen activation from a simulated salt pan, using dry and wet NaCl/NaBr surfaces (United States)

    Bleicher, Sergej; Balzer, Natalja; Zetzsch, Cornelius; Buxmann, Joelle; Platt, Ulrich


    Field experiments and laboratory studies have shown that atomic Br and Cl are released from sea-salt aerosol and saline soils. This halogen release is based on the uptake of gaseous HOX by aqueous, acidified salt surfaces. Br and Cl play an important role in atmospheric ozone depletion and the destruction of hydrocarbons. Furthermore, Secondary Organic Aerosol (SOA) and HUmic LIke Substances (HULIS) may take part in these reaction cycles by halogenation and production of volatile organic halogen compounds. Aerosol smog-chamber facilities (coolable to -25°C) enable us to simulate the halogen release mechanism under arctic tropospheric conditions. Mechanistic and kinetic studies are carried out to investigate the influence of SOA and HULIS on halogen cycles and to determine halogenated gaseous and solid organic products. The present laboratory measurements study halogen activation from salt surfaces, which are similar to typical salt pan environments. In these experiments we placed different artificial salt mixtures with NaCl/NaBr ratios up to 300:1 on a Teflon pan located in a Teflon chamber with a volume of 3.5 m3. Under clean air conditions we inject ozone and a mixture of non-methane hydrocarbons with well-known reactivities against OH and Cl and irradiated the chamber with a solar simulator. Beside the usual observing instruments like an ozone monitor and a gas chromatograph we used Differential Optical Absorption Spectroscopy (DOAS) in a White cell with a light path up to 320 m to observe various gas-phase species including BrO radicals. A dry air / dry salt pan environment showed no ozone depletion and no halogen activation. At relative humidity above 50%, a rapid ozone depletion (4.7 h half-life) was observed, which is much faster than for pure NaCl under the same conditions (77 h). Furthermore, the mixed salt was acidified with H2SO4 to a pH value of 4.3, no difference in ozone depletion and halogen activation was observed at this point. The DOAS

  9. The role of reduction extent of graphene oxide in the photocatalytic performance of Ag/AgX (X = Cl, Br)/rGO composites and the pseudo-second-order kinetics reaction nature of the Ag/AgBr system. (United States)

    Gao, Weiyin; Ran, Chenxin; Wang, Minqiang; Li, Le; Sun, Zhongwang; Yao, Xi


    Although reduced graphene oxide (rGO)-based photocatalyst composites have been intensively developed during the past few years, the influence of reduction extent of rGO on the photocatalytic performance of the rGO-based composite has virtually not been investigated due to some technical limitations, such as the poor water dispersibility of rGO and low reduction selectivity of the hydrothermal method, which make it difficult to control the reduction extent of rGO in these composites. Herein, we used a facile room-temperature method to synthesize Ag/AgX (X = Cl, Br)/rGO photocatalyst composites as a model to study the effect of reduction extent of rGO on the photocatalytic performance of the photocatalyst. It was found that the photocatalytic activities of both Ag/AgCl/PrGO and Ag/AgBr/PrGO systems had an optimized threshold of the reduction extent of photoreduced GO (PrGO). More importantly, due to the different conductive band values of AgCl and AgBr, the optimized thresholds in the two systems were at different PrGO reduction extents, based on which we proposed that the favorable energy band matching between AgX and PrGO in the two systems played a crucial role in obtaining high photocatalysis performance. Besides, the photocatalytic reaction of the Ag/AgBr based system was confirmed to be a pseudo-second-order kinetics reaction rather than pseudo-first-order kinetics reaction. The new insights presented in this work provided useful information on the design and development of a more sophisticated photocatalyst, and can also be applied to many other applications. PMID:27332751

  10. Dimer splitting of Er3+ in Cs3Er2X9 (X=Cl, Br). Mystery solved

    International Nuclear Information System (INIS)

    Complete text of publication follows. Cs3R2X9 (R: rare earth; X: Cl, Br, I) is a compound of potential use in upconversion lasers. Structurally it forms rare earth dimers. Dimer splittings of typically up to some hundred μeV due to the exchange interaction have been observed for different rare earths in this structure [1]. For a long time the absence of any observable dimer splitting in the Er compound was a mystery. There were some measurements of a rather huge splitting (> 1 meV) [2] but these signals could be attributed to the crystal electric field (CEF) splitting of the secondary phase Cs2ErX5 present in the parent compound to percentages ranging up to 25%. Recently, it has been demonstrated that the extreme single ion anisotropy (in excess of 102 for χc/χab) for Er due to the CEF is responsible for the lack of any dimer signal. This almost pure Ising system (compared to almost perfect Heisenberg systems for the other rare earths) splits in the presence of the dimer interaction into a magnetic ground-state doublet, and a non-magnetic excited doublet without any allowed transitions between these two. (author) [1] A. Doemi et al., J. de Phys. 49, (1988) C8-1513; A. Furrer et al., PRL 62, (1989) 210; A. Furrer et al., PRL 64, (1990) 68; A. Furrer et al., Inorg. Chem. 29, (1990) 4081.; [2] P. Allenspach et al., Physica B 234-236, (1997) 744

  11. Entrance Channel X-HF (X=Cl, Br, and I) Complexes studied by High-Resolution Infrared Laser Spectroscopy in Helium Nanodroplets

    CERN Document Server

    Merritt, J M; Miller, R E; Merritt, Jeremy M.; K\\"upper, Jochen; Miller, Roger E.


    Rotationally resolved infrared spectra are reported for halogen atom - HF free radical complexes formed in helium nanodroplets. An effusive pyrolysis source is used to dope helium droplets with Cl, Br and I atoms, formed by thermal dissociation of Cl$_2$, Br$_2$ and I$_2$. A single hydrogen fluoride molecule is then added to the droplets, resulting in the formation of the X-HF complexes of interest. Analysis of the resulting spectra confirms that the observed species have $^2\\Pi_{3/2}$ ground electronic states, consistent with the linear hydrogen bound structures predicted from theory. Stark spectra are also reported for these species, from which the permanent electric dipole moments are determined.

  12. Synthesis of [6-36Cl]chlorouracil, [6-82Br]bromouracil and [6-123I]iodouracil

    International Nuclear Information System (INIS)

    Three C-6 radiohalogenated uracil derivatives were prepared by non-isotopic halogen exchange reactions for evaluation as diagnostic radiopharmaceuticals. [6-36Cl]chlorouracil (radiochemical yield 77%, specific activity 5.66 MBq mmol-1) was prepared via calcium [36Cl]chloride exchange on 6-iodouracil, [6-82Br]bromouracil (27%, 68.4 MBq mmol-1) was prepared via ammonium [82Br]bromide exchange on 6-iodouracil and [6-123I]iodouracil (55.4%, 5.41 GBq mmol-1) was prepared via sodium [123I]iodide exchange on 6-chlorouracil. The specific activities and radiochemical yields were dependent upon the halide-ion concentration. (author)

  13. Recognition of a novel type X═N-Hal···Hal (X = C, S, P; Hal = F, Cl, Br, I) halogen bonding. (United States)

    Gushchin, Pavel V; Kuznetsov, Maxim L; Haukka, Matti; Kukushkin, Vadim Yu


    The chlorination of the eight-membered platinum(II) chelates [PtCl2{NH═C(NR2)N(Ph)C(═NH)N(Ph)C(NR2)═NH}] (R = Me (1); R2 = (CH2)5 (2)) with uncomplexed imino group with Cl2 gives complexes bearing the ═N-Cl moiety [PtCl4{NH═C(NR2)N(Ph)C(═NCl)N(Ph)C(NR2)═NH}] (R = Me (3); R2 = (CH2)5 (4)). X-ray study for 3 revealed a novel type intermolecular halogen bonding ═N-Cl···Cl(-), formed between the Cl atom of the chlorinated imine and the chloride bound to the platinum(IV) center. The processing relevant structural data retrieved from the Cambridge Structural Database (CSDB) shows that this type of halogen bonding is realized in 18 more molecular species having X═N-Hal moieties (X = C, P, S, V, W; Hal = Cl, Br, I), but this weak ═N-Hal···Hal(-) bonding was totally neglected in the previous works. The presence of the halogen bonding in 3 was confirmed by theoretical calculations at the density functional theory (DFT, M06-2X) level, and its nature was analyzed. PMID:23469756

  14. Molecular beam studies of unimolecular reactions: Cl, F + C/sub 2/H/sub 3/Br. [Angular and velocity distributions, mechanism

    Energy Technology Data Exchange (ETDEWEB)

    Buss, R.J.; Coggiola, M.J.; Lee, Y.T.


    Several methods currently used to study unimolecular decomposition in molecular beams are discussed. Experimental product angular and velocity distributions obtained for the reaction of F, Cl with C/sub 2/H/sub 3/Br are presented. The mechanism by which conservation of angular momemtum can cause coupling of the product angular and velocity distributions in dissociation of long-lived complexes is introduced. 14 references.

  15. Coupled evolution of BrOx-ClOx-HOx-NOx chemistry during bromine-catalyzed ozone depletion events in the arctic boundary layer


    M. J. Evans; Jacob, Daniel James; Atlas, E.; Cantrell, C; Eisele, F.; Flocke, F.; Fried, A.; Mauldin, R; Ridley, B.; Wert, B; Talbot, R.; Blake, D.; B. Heikes; Snow, J.; Walega, J


    Extensive chemical characterization of ozone (O3) depletion events in the Arctic boundary layer during the TOPSE aircraft mission in March–May 2000 enables analysis of the coupled chemical evolution of bromine (BrOx), chlorine (ClOx), hydrogen oxide (HOx) and nitrogen oxide (NOx) radicals during these events. We project the TOPSE observations onto an O3 chemical coordinate to construct a chronology of radical chemistry during O3 depletion events, and we compare this chronology to results from...

  16. Synergistic photocatalytic inactivation mechanisms of bacteria by graphene sheets grafted plasmonic AgAgX (X = Cl, Br, I) composite photocatalyst under visible light irradiation. (United States)

    Xia, Dehua; An, Taicheng; Li, Guiying; Wang, Wanjun; Zhao, Huijun; Wong, Po Keung


    By coupling graphene sheet and plasmonic photocatalysis technologies, a series of AgAgX/RGOs (X = Cl, Br, I; RGO = reduced graphene oxide) composites were prepared and found to be efficient antimicrobial agents for water disinfection upon visible light. Attributed to the efficient charge transfer by RGO sheets, the optimum AgAgBr/0.5% RGO could completely inactivate 2 × 10(7) cfu mL(-1) of Escherichia coli within 8 min, much faster than bare AgAgBr within 35 min. The synergistic antimicrobial mechanism of AgAgBr/0.5% RGO was studied by Ag(+) ions release evaluation, radical scavengers study, and radical determination. The enhanced photocatalytic activity of irradiated AgAgBr/0.5% RGO originated from the synergistic activities of its three components including Ag, AgBr and RGO, and the proposed mechanisms contained enhanced attraction by RGO followed by two pathways: primary oxidative stress caused by plasma induced reactive species like H2O2 and bactericidal effect of released Ag(+) ions. Furthermore, characterization of E. coli cells using SEM, fluorescent microscopy, and cytoplasmic substance leakage illustrated that VL irradiated AgAgBr/0.5% RGO could not only cause metabolic dysfunction but also destroy the cell envelope and biomolecular, while irradiated Ag(+) ions play a differential bactericidal action with a limited metabolic injury and no cell-membrane damage. The present work provides an efficient water disinfection technology and also opens a new idea in studying the antimicrobial mechanism of plasmonic photocatalyst. PMID:27155987

  17. Effect of the calcium halides, CaCl{sub 2} and CaBr{sub 2}, on hydrogen desorption in the Li–Mg–N–H system

    Energy Technology Data Exchange (ETDEWEB)

    Bill, Rachel F. [School of Chemistry, University of Birmingham, Edgbaston, Birmingham B15 2TT (United Kingdom); Reed, Daniel; Book, David [School of Metallurgy and Materials, University of Birmingham, Edgbaston, Birmingham B15 2TT (United Kingdom); Anderson, Paul A., E-mail: [School of Chemistry, University of Birmingham, Edgbaston, Birmingham B15 2TT (United Kingdom)


    Highlights: • H{sub 2} desorption from 2LiNH{sub 2}–MgH{sub 2}–xCaX{sub 2} (x = 0, 0.1, 0.15; X = Cl, Br) samples studied. • Addition of calcium halides reduced the desorption temperature in all samples. • Peak H{sub 2} release was around 150 °C lower in ball-milled than in hand-ground samples. • The 2LiNH{sub 2}–MgH{sub 2}–0.15CaBr{sub 2} sample showed the lowest peak desorption temperature. • CaBr{sub 2} reduced the activation energy to 78.8 kJ mol{sup −1}, 24% less than the undoped sample. - Abstract: Calcium-halide-doped lithium amide–magnesium hydride samples were prepared both by hand-grinding and ball-milling 2LiNH{sub 2}–MgH{sub 2}–xCaX{sub 2} (x = 0, 0.1, and 0.15; X = Cl or Br). The addition of calcium halides reduced the hydrogen desorption temperature in all samples. The ball-milled undoped sample (2LiNH{sub 2}–MgH{sub 2}) began to desorb hydrogen at around 125 °C and peaked at 170 °C. Hydrogen desorption from the 0.15 mol CaCl{sub 2}-containing sample began ca 30 °C lower than that of the undoped sample and peaked at 150 °C. Both the onset and peak temperatures of the CaBr{sub 2} sample (x = 0.15) were reduced by 15 °C compared to the chloride. Kissinger’s method was used to calculate the effective activation energy (E{sub a}) for the systems: E{sub a} for the 0.15 mol CaCl{sub 2}-containing sample was found to be 91.8 kJ mol{sup −1} and the value for the 0.15 mol CaBr{sub 2}-containing sample was 78.8 kJ mol{sup −1}.

  18. Effect of the calcium halides, CaCl2 and CaBr2, on hydrogen desorption in the Li–Mg–N–H system

    International Nuclear Information System (INIS)

    Highlights: • H2 desorption from 2LiNH2–MgH2–xCaX2 (x = 0, 0.1, 0.15; X = Cl, Br) samples studied. • Addition of calcium halides reduced the desorption temperature in all samples. • Peak H2 release was around 150 °C lower in ball-milled than in hand-ground samples. • The 2LiNH2–MgH2–0.15CaBr2 sample showed the lowest peak desorption temperature. • CaBr2 reduced the activation energy to 78.8 kJ mol−1, 24% less than the undoped sample. - Abstract: Calcium-halide-doped lithium amide–magnesium hydride samples were prepared both by hand-grinding and ball-milling 2LiNH2–MgH2–xCaX2 (x = 0, 0.1, and 0.15; X = Cl or Br). The addition of calcium halides reduced the hydrogen desorption temperature in all samples. The ball-milled undoped sample (2LiNH2–MgH2) began to desorb hydrogen at around 125 °C and peaked at 170 °C. Hydrogen desorption from the 0.15 mol CaCl2-containing sample began ca 30 °C lower than that of the undoped sample and peaked at 150 °C. Both the onset and peak temperatures of the CaBr2 sample (x = 0.15) were reduced by 15 °C compared to the chloride. Kissinger’s method was used to calculate the effective activation energy (Ea) for the systems: Ea for the 0.15 mol CaCl2-containing sample was found to be 91.8 kJ mol−1 and the value for the 0.15 mol CaBr2-containing sample was 78.8 kJ mol−1.

  19. Composition Analysis of Glasses in the PbBr2-PbCl2-PbF2-PbO-P2O5 System%PbBr2-PbCl2-PbF2-PbO-P2O5系统玻璃成分分析*

    Institute of Scientific and Technical Information of China (English)

    朱冬梅; 周万城; 赵宏生



  20. Four new chalcohalides, NaBa{sub 2}SnS{sub 4}Cl, KBa{sub 2}SnS{sub 4}Cl, KBa{sub 2}SnS{sub 4}Br and CsBa{sub 2}SnS{sub 4}Cl: Syntheses, crystal structures and optical properties

    Energy Technology Data Exchange (ETDEWEB)

    Li, Chao; Feng, Kai; Tu, Heng [Center for Crystal Research and Development, Technical Institute of Physics and Chemistry, Chinese Academy of Sciences, Beijing 100190 (China); Key Laboratory of Functional Crystals and Laser Technology, Technical Institute of Physics and Chemistry, Chinese Academy of Sciences, Beijing 100190 (China); University of the Chinese Academy of Sciences, Beijing 100049 (China); Yao, Jiyong, E-mail: [Center for Crystal Research and Development, Technical Institute of Physics and Chemistry, Chinese Academy of Sciences, Beijing 100190 (China); Key Laboratory of Functional Crystals and Laser Technology, Technical Institute of Physics and Chemistry, Chinese Academy of Sciences, Beijing 100190 (China); Wu, Yicheng [Center for Crystal Research and Development, Technical Institute of Physics and Chemistry, Chinese Academy of Sciences, Beijing 100190 (China); Key Laboratory of Functional Crystals and Laser Technology, Technical Institute of Physics and Chemistry, Chinese Academy of Sciences, Beijing 100190 (China)


    Four new chalcohalides, namely NaBa{sub 2}SnS{sub 4}Cl, KBa{sub 2}SnS{sub 4}Cl, KBa{sub 2}SnS{sub 4}Br, and CsBa{sub 2}SnS{sub 4}Cl, have been synthesized by the conventional high temperature solid-state reactions. They crystallize in three different space groups: space group I4/mcm for NaBa{sub 2}SnS{sub 4}Cl and KBa{sub 2}SnS{sub 4}Cl, Pnma for KBa{sub 2}SnS{sub 4}Br, and P2{sub 1}/c for CsBa{sub 2}SnS{sub 4}Cl. In all four compounds, the X{sup −} halide anions are only connected to six alkali metal or Ba cations, and the Sn atoms are only tetrahedrally enjoined to four S atoms. However, the M–X–Ba pseudo layers and the SnS{sub 4} tetrahedra are arranged in different ways in the three structural types, which demonstrates the interesting effect of ionic radii on the crystal structures. UV–vis–NIR spectroscopy measurements indicate that NaBa{sub 2}SnS{sub 4}Cl, KBa{sub 2}SnS{sub 4}Cl, KBa{sub 2}SnS{sub 4}Br, and CsBa{sub 2}SnS{sub 4}Cl have band gaps of 2.28, 2.30, 1.95, and 2.06 eV, respectively. - Graphical abstract: A new series of chalcohalides, NaBa{sub 2}SnS{sub 4}Cl, KBa{sub 2}SnS{sub 4}Cl, KBa{sub 2}SnS{sub 4}Br and CsBa{sub 2}SnS{sub 4}Cl have been obtained. They present three different space groups: NaBa{sub 2}SnS{sub 4}Cl and KBa{sub 2}SnS{sub 4}Cl in space group I4/mcm, KBa{sub 2}SnS{sub 4}Br in Pnma and CsBa{sub 2}SnS{sub 4}Cl in space group P2{sub 1}/c. UV–vis–NIR spectroscopy measurements indicate that NaBa{sub 2}SnS{sub 4}Cl, KBa{sub 2}SnS{sub 4}Cl, KBa{sub 2}SnS{sub 4}Br and CsBa{sub 2}SnS{sub 4}Cl have band gaps of 2.28, 2.30 1.95, and 2.06 eV, respectively. - Highlights: • Four new chalcohalides, NaBa{sub 2}SnS{sub 4}Cl, KBa{sub 2}SnS{sub 4}Cl, KBa{sub 2}SnS{sub 4}Br and CsBa{sub 2}SnS{sub 4}Cl were obtained. • They adopt three different structures owing to different ionic radii and elemental electronegativity. • NaBa{sub 2}SnS{sub 4}Cl, KBa{sub 2}SnS{sub 4}Cl, KBa{sub 2}SnS{sub 4}Br and CsBa{sub 2}SnS{sub 4}Cl have band gaps

  1. Theoretical Study of Electronic Properties of X-Doped (X = F, Cl, Br, I) VO2 Nanoparticles for Thermochromic Energy-Saving Foils. (United States)

    Ren, Qinghua; Wan, Jinyu; Gao, Yanfeng


    First-principles density functional theory (DFT) electronic structure calculations were carried out for the model halogen-doped VO2 (M1 phase) to evaluate the effect of halogen (X = F, Cl, Br, I) doping on the band edges. The model structures of X-doped VO2 with X at V site or O site were constructed on the basis of 96-atom 2 × 2 × 2 supercell of monoclinic M1 phase of VO2. Our results showed that the band gap Eg2 for Cl-doped VO2 at O1 site (0.51 eV) is smaller than that of F-doped VO2 at O1 site (0.61 eV) and that of pure VO2 (0.78 eV). We also investigated the substitution of chlorine, bromine, and iodine for vanadium in VO2, where the band gaps Eg2 are 0.40, 0.45, and 0.37 eV for Cl-, Br-, and I-doped VO2 at V site, respectively. The Cl-doped VO2 at V site is the best one for achieving good VO2 thermochromic energy-saving foils. PMID:25353175

  2. Broad Wavelength Tunable Robust Lasing from Single-Crystal Nanowires of Cesium Lead Halide Perovskites (CsPbX3, X = Cl, Br, I). (United States)

    Fu, Yongping; Zhu, Haiming; Stoumpos, Constantinos C; Ding, Qi; Wang, Jue; Kanatzidis, Mercouri G; Zhu, Xiaoyang; Jin, Song


    Lead halide perovskite nanowires (NWs) are emerging as a class of inexpensive semiconductors with broad bandgap tunability for optoelectronics, such as tunable NW lasers. Despite exciting progress, the current organic-inorganic hybrid perovskite NW lasers suffer from limited tunable wavelength range and poor material stability. Herein, we report facile solution growth of single-crystal NWs of inorganic perovskite CsPbX3 (X = Br, Cl) and their alloys [CsPb(Br,Cl)3] and a low-temperature vapor-phase halide exchange method to convert CsPbBr3 NWs into perovskite phase CsPb(Br,I)3 alloys and metastable CsPbI3 with well-preserved perovskite crystal lattice and NW morphology. These single crystalline NWs with smooth end facets and subwavelength dimensions are ideal Fabry-Perot cavities for NW lasers. Optically pumped tunable lasing across the entire visible spectrum (420-710 nm) is demonstrated at room temperature from these NWs with low lasing thresholds and high-quality factors. Such highly efficient lasing similar to what can be achieved with organic-inorganic hybrid perovskites indicates that organic cation is not essential for light emission application from these lead halide perovskite materials. Furthermore, the CsPbBr3 NW lasers show stable lasing emission with no measurable degradation after at least 8 h or 7.2 × 10(9) laser shots under continuous illumination, which are substantially more robust than their organic-inorganic counterparts. The Cs-based perovskites offer a stable material platform for tunable NW lasers and other nanoscale optoelectronic devices. PMID:27437566

  3. Potential groundwater age tracer found: Halon-1301 (CF3Br), as previously identified as CFC-13 (CF3Cl) (United States)

    Beyer, Monique; van der Raaij, Rob; Morgenstern, Uwe; Jackson, Bethanna


    Groundwater dating using anthropogenic and natural tracer substances is a powerful tool for understanding groundwater dynamics for improved management of groundwater resources. Due to limitations in individual dating methods, often multiple tracers are used to reduce ambiguities. It is commonly accepted that there is a need for further complementary age tracers, in addition to current ones (e.g., tritium, SF6, and CFCs). We propose a potential new groundwater age tracer, Halon-1301 (CF3Br), which can easily be determined using gas chromatography with an attached electron capture detector (GC/ECD) developed by Busenberg and Plummer (2008). Its peak was noted by Busenberg and Plummer (2008), but they believed it to be CFC-13 (CF3Cl) at that time. We performed rigorous tests on gases containing or excluding Halon-1301 and CFC-13 and modern water samples and concluded that the two compounds have extremely similar retention times. Additionally, we found that the ECD response of CFC-13 is far too low to be detected in groundwater or air using standard volumes and sampling techniques. However, the peak areas and concentrations Busenberg and Plummer (2008) reported are in line with what would be expected for Halon-1301. Thus, we are confident that the peak formerly identified as CFC-13 is actually Halon-1301. Busenberg agrees with our findings. We further suggest that Halon-1301 has potential as a (complementary) age tracer, due to its established atmospheric history, and could hypothetically be used to date groundwater recharged in the 1970s or onward. We discuss known relevant properties, such as solubility and stability of Halon-1301 in the context of how these effect its potential application as a groundwater age tracer. Some open questions remain concerning how conservative Halon-1301 is—is it subject to degradation, retardation, and/or local contamination in groundwater. We are confident that Halon-1301 possesses important tracer relevant properties, but further

  4. "XA6" octahedra influencing the arrangement of anionic groups and optical properties in inverse-perovskite [B6O10]XA3 (X = Cl, Br; A = alkali metal). (United States)

    Yang, Zhihua; Lei, Bing-Hua; Yang, Bin; Pan, Shilie


    Exploring the effect of microscopic units, which set up the perovsikte framework, is of importance for material design. In this study, a series of borate halides with inverse-perovskite structures [B6O10]XA3 (X = Cl, Br; A = alkali metal) have been studied. It was revealed that the distortion and volume of XA6 octahedra influence the arrangement of anionic groups, which leads to the flexibility of the perovskite-related framework and differences in optical properties. Under the structural control scheme, the structure of Rb3B6O10Cl was predicted. The stability of the predicted structure was confirmed by an ab initio density functional theory-based method. The calculation shows Rb3B6O10Cl has a short UV cutoff edge of less than 200 nm, a moderate birefringence and a large second harmonic generation response. PMID:27211304

  5. PROPERTY OF GLASSES IN THE PbBr2-PbCl2-PbF2-PbO-P2O5 SYSTEM%PbBr2-PbCl2-PbF2-PbO-P2O5系统玻璃性能研究

    Institute of Scientific and Technical Information of China (English)

    朱冬梅; 周万城; 赵宏生


    研究了PbBr2-PbCl2-PbF2-PbO-P2O5系统的玻璃转变温度、密度、耐水性和透光率.PbBr2-PbCl2-P2O5系统的玻璃转变温度低达146 ℃,密度高达4.75 g/cm3.加入PbF2和/或PbO可显著提高玻璃的转变温度和密度,其中PbO的影响更为显著,可使玻璃的密度增加到5.48 g/cm3.多数PbBr2-PbCl2-PbF2-PbO-P2O5系统玻璃的耐水性都很好,在水中的溶解速率为10-5 mm/day.玻璃的透光性较好,加入PbBr2使玻璃的紫外截断波长明显向长波方向移动.

  6. 四元体系NaCl-NaBr-Na2SO4-H2O348K相平衡研究%Study on Phase Equilibria for Quaternary System of NaCl-NaBr-Na2SO4-H2O at 348 K

    Institute of Scientific and Technical Information of China (English)

    张勇刚; 桑世华; 张凯杰; 胡富铭; 崔瑞芝


    The phase equilibria of the quaternary system of NaCl - NaBr - Na2SO4 - H2O at 348 K are investigated, and the solubility and density of the solution are determined by isothermal e-quilibrium method. The experimental results indicate that the quaternary system is the system with solid in the solution. Based on the experimental data, the phase diagram of the quaternary system is plotted, which consists of a univariant dissolution curve and two crystallization fields: Na ( ClBr) and Na2SO4. The experimental results show that the sodium bromide has the salting - out effect on sodium chloride. Meanwhile, the rule of density is discussed briefly.%采用等温溶解平衡法研究了348 K下四元体系NaCl-NaBr-Na2 SO4-H2O的相平衡规律,测定了平衡液相的溶解度和密度.研究发现,四元体系NaCl-NaBr-Na2SO4-H2O是含有固体溶液的体系.根据实验研究数据绘制了等温溶解度图,相图中只有一条单变量溶解曲线,两个结晶相区,平衡固相分别为Na(Cl、Br)和Na2SO4.实验结果表明,NaBr对NaCl具有盐析效应,并简要讨论了密度变化规律.

  7. Behaviour of I/Br/Cl-THMs and their projected toxicities under simulated cooking conditions: Effects of heating, table salt and residual chlorine. (United States)

    Yan, Mingquan; Li, Mingyang; Han, Xuze


    This study examined the effects of heating, residual chlorine and concentration of table salt on the generation of iodine-, bromine- and chlorine-containing trihalomethanes (THMs) under simulated cooking conditions. In the case of addition of either KI- or KIO3-fortified salt, total I-THM concentrations increased with increasing iodine concentration, while total Cl/Br-THM concentrations decreased. CHCl2I, CHBrClI, CHBrI2, CHBr2I and CHI3 were formed in the presence of KI salt, while only CHCl2I was formed in the presence of KIO3 salt. CHCl2I was unstable under cooking conditions, and >90% of this DBP was removed during heating, which in some cases increased the concentrations of the other I-THMs. The calculated cytotoxicity increased with addition of KI- or KIO3-fortified salt due to the generation of I-THMs, whose impact on the cytotoxicity at room temperature was equal to or five times higher, respectively, than the cytotoxicity of the simultaneously formed Cl/Br-THMs for the cases of salts. Heating decreased the cytotoxicity, except for the case of addition of KI salt, in which the calculated cytotoxicity of I-THMs increased above 150% as the temperature was increased up to 100°C. The reported results may have important implications for epidemiologic exposure assessments and, ultimately, for public health protection. PMID:27107240

  8. PbBr2-PbCl2-PbF2-PbO-P2O5系统玻璃的热性质和化学稳定性%Thermal Properties and Water Durability of Glasses in the PbBr2-PbCl2-PbF2-PbO-P2O5 System

    Institute of Scientific and Technical Information of China (English)

    朱冬梅; 周万城; 赵宏生; 吴静波


    重点研究了PbBr2-PbCl2-PbF2-PbO-P2O5系统玻璃的热性质、耐水性和抗潮解性. 结果表明:该系统玻璃的热膨胀系数较大,一般在25×10-6°C-1左右. PbBr2-PbCl2-P2O5系统的玻璃具有较低的玻璃转变温度,可低达146°C. 加入PbF2和/或PbO可显著提高玻璃的转变温度和密度,其中PbO对试样的影响更为显著. PbBr2-PbCl2-PbF2-PbO-P2O5系统玻璃的抗潮解性一般较好. 多数玻璃在水中的溶解速率可达10-5mm/day, 具有较好的耐水性.%A series of new glasses in the PbBr2-PbCl2-PbF2-PbO-P2O5 system were prepared and some properties of the glasses in the PbBr2-PbCl2-PbF2-PbO-P2O5 system were studied. Their composition dependence of glass transition temperature(T g), thermal expansion coefficient and water durability was reported. Glasses in the PbBr2-PbCl2-P2O5 ternary system have relative low glass transition temperature(>146C). When PbO and/or PbF2 are introduced into the ternary system, the glass transition temperature increases considerably. Glasses containing PbO have higher transition temperature than those containing PbF2. The glasses in this system have relative high thermal expansion coefficient(25×10-6/C). Most of the glasses exhibit good water durability, and the dissolution rate in deionised water at 25C is in the order of 10-4~10-5mm/day. The introduction of PbO and/or PbF2 into the glasses does not change their water durability much. With the increase of P2O5, the water durability of the glass becomes bad obviously.

  9. Synthetic cannabinoid JWH-018 and its halogenated derivatives JWH-018-Cl and JWH-018-Br impair Novel Object Recognition in mice: Behavioral, electrophysiological and neurochemical evidence. (United States)

    Barbieri, M; Ossato, A; Canazza, I; Trapella, C; Borelli, A C; Beggiato, S; Rimondo, C; Serpelloni, G; Ferraro, L; Marti, M


    It is well known that an impairment of learning and memory function is one of the major physiological effects caused by natural or synthetic cannabinoid consumption in rodents, nonhuman primates and in humans. JWH-018 and its halogenated derivatives (JWH-018-Cl and JWH-018-Br) are synthetic CB1/CB2 cannabinoid agonists, illegally marketed as "Spice" and "herbal blend" for their Cannabis-like psychoactive effects. In the present study the effects of acute exposure to JWH-018, JWH-018-Cl, JWH-018-Br (JWH-018-R compounds) and Δ(9)-THC (for comparison) on Novel Object Recognition test (NOR) has been investigated in mice. Moreover, to better characterize the effects of JWH-018-R compounds on memory function, in vitro electrophysiological and neurochemical studies in hippocampal preparations have been performed. JWH-018, JWH-018-Cl and JWH-018-Br dose-dependently impaired both short- and long-memory retention in mice (respectively 2 and 24 h after training session). Their effects resulted more potent respect to that evoked by Δ(9)-THC. Moreover, in vitro studies showed as JWH-018-R compounds negatively affected electrically evoked synaptic transmission, LTP and aminoacid (glutamate and GABA) release in hippocampal slices. Behavioral, electrophysiological and neurochemical effects were fully prevented by CB1 receptor antagonist AM251 pretreatment, suggesting a CB1 receptor involvement. These data support the hypothesis that synthetic JWH-018-R compounds, as Δ(9)-THC, impair cognitive function in mice by interfering with hippocampal synaptic transmission and memory mechanisms. This data outline the danger that the use and/or abuse of these synthetic cannabinoids may represent for the cognitive process in human consumer. PMID:27346209

  10. Zero-field splitting and local structure for V2+ ions in CsMgX$_{3} (X=Cl, Br, I)$ crystals

    Indian Academy of Sciences (India)

    Q Wei; Q M Xu; Z Y Yang; D Y Zhang; J G Zhang


    The zero-field splitting and local structure for V2+ ions in CsMgX3 $(X = Cl, Br, I)$ crystals are theoretically investigated using complete diagonalization method (CDM) for a $3d^{3}$ ion in trigonal symmetry. Spin–spin (SS) and spin–other-orbit (SOO) interactions are taken into account in addition to the general spin–orbit (SO) interaction. On this basis, using ligand ion displacement model, we find that the ligand ions move away from $C_{3}$-axis, and therefore the local angles in the $V^{2+}$ centres are larger than the angles in the hosts. The results show good agreement with the observed values.

  11. A tentative model for estimating the compressibility of rock-salt AgCl$_{x}$ Br$_{1−x}$ alloys

    Indian Academy of Sciences (India)

    Vassiliki Katsika-Tsigourakou; Efthimios S Skordas


    Ab initio detailed calculations of the elastic properties of AgCl Br1− alloys were recently made using density-functional perturbation theory and by employing the virtual crystal approximation or by means of the full potential linearized augmented plane wave method. Here, we suggest a simple theoretical model that enables estimation of isothermal compressibility of these alloys in terms of the elastic data of end-members alone. The calculated values are in satisfactory agreement with the experimental ones. The present model makes use of an early suggestion that interconnects Gibbs energy for the formation and/or migration of defects in solids with bulk properties.

  12. Ab initio design of CsSn(XxY 1−x)3 (X and Y = Cl, Br, and I) perovskites for photovoltaics


    Arpan Krishna Deb; Vijay Kumar


    Ab initio calculations on CsSnX3 perovskites and mixed halides CsSn(XxY 1−x)3, X and Y = I, Cl, and Br, show that all of them have a direct band gap of ∼1 eV which can be tuned by varying the compositions of X and Y. The optimized supercells are tetragonal, orthorhombic or monoclinic. The top of the valence band arises from hybridization of Sn 4s and halogen p valence orbitals while the bottom of the conduction band has predominantly Sn p character. Similar to organo-metallic lead halides thi...

  13. Self-assembly of [UO2X4]2- (X=Cl, Br) dianions with γ substituted pyridinium cations: Structural systematics and fluorescence properties (United States)

    Surbella, Robert G.; Andrews, Michael B.; Cahill, Christopher L.


    Room temperature self-assembly of [UO2X4]2- (X=Cl, Br) with γ substituted pyridinium cations has resulted in the formation of twelve compounds that were studied via single crystal X-ray diffraction and fluorescence spectroscopy. Systematic variation of electron donating groups on the pyridinium species is shown to influence the presence and/or strength of various supramolecular synthons, including hydrogen bonding and pi interactions. Combinations of such non-covalent interactions (NCIs) have given rise to a range of supramolecular assemblies, and are shown to influence uranyl emission by way of second sphere coordination to equatorial ligands.

  14. Ab initio and AIM theoretical analysis of hydrogen-bond radius of HD (D = F, Cl, Br, CN, HO, HS and CCH) donors and some acceptors


    Raghavendra, B; Pankaj K Mandal; Arunan, E


    Recently, we defined ‘hydrogen-bond radii’ for various hydrogen-bond donors, DH where D=F, Cl, Br, CN, HO or CCH from an empirical analysis. It was shown that the $A^{...} H$ distances in $B^{...}HD$ complexes could be written as a sum of hydrogen bond radius for DH and a constant acceptor radius for A, which is the bonding atom/centre in B. This manuscript reports the determination of the hydrogen-bond radii for these molecules and $H_2S$ from ab initio and atoms in molecules (AIM) theoreti...

  15. Parity violation in nuclear magnetic resonance frequencies of chiral tetrahedral tungsten complexes NWXYZ (X, Y, Z = H, F, Cl, Br or I)

    CERN Document Server

    Nahrwold, Sophie; Schwerdtfeger, Peter


    Density functional theory within the two-component quasi-relativistic zeroth-order regular approximation (ZORA) is used to predict parity violation shifts in 183W nuclear magnetic resonance shielding tensors of chiral, tetrahedrally bonded tungsten complexes of the form NWXYZ (X, Y, Z = H, F, Cl, Br or I). The calculations reveal that sub-mHz accuracy is required to detect such tiny effects in this class of compounds, and that parity violation effects are very sensitive to the choice of ligands.

  16. Phonon analysis of the S = 1 quantum spin systems Ni5Te4O12X2 (X Cl and Br)

    International Nuclear Information System (INIS)

    We report our investigations of the electrodynamic response of the S = 1 quantum spin systems Ni5Te4O12X2 (X = Cl and Br), which develop a magnetic ordered state below 30 K. We measure the optical reflectivity over a broad spectral range extending from the far infrared up to the ultraviolet. Besides identifying the electronic interband transitions, we primarily focus our attention on the lattice dynamics, emphasizing the phonon modes spectrum and its temperature dependence. Our findings do not reveal any direct link between possible structural anomalies and the transition into the magnetically ordered state at low temperatures

  17. NMR shielding and spin–rotation constants of 175LuX (X = 19F, 35Cl, 79Br, 127I) molecules

    International Nuclear Information System (INIS)

    This presentation demonstrates the relativistic effects on the spin-rotation constants, absolute nuclear magnetic resonance (NMR) shielding constants and shielding spans of 175LuX (X = 19F, 35Cl, 79Br, 127I) molecules. The results are obtained from calculations performed using density functional theory (non-relativistic and four-component relativistic) and coupled-cluster calculations. The spin-rotation constants are compared with available experimental values. In most of the molecules studied, relativistic effects make an order of magnitude difference on the NMR absolute shielding constants

  18. Determination of F-, Cl-, NO2-, Br-, PO43- and SO42- ions in high-level liquid waste and sludge

    International Nuclear Information System (INIS)

    The determination of anions F-, Cl-, NO2-, Br-, PO3-4 and SO42- in high-level liquid waste (HLLW) and high-level radioactive sludge (HLRS) by ion chromatography (IC) is studied in detail. Potentially interfering cations are removed by pretreatment with a cation exchange resin column. A 104 times decrease in radioactivity is achieved by this step. Borate-gluconic acid solution is used as an eluent for IC to alter the peak sequence, and thus suppress the influence of NO3- ion. The method has been successfully used for determination of various anions HLLW and HLRS

  19. NMR shielding and spin–rotation constants of {sup 175}LuX (X = {sup 19}F, {sup 35}Cl, {sup 79}Br, {sup 127}I) molecules

    Energy Technology Data Exchange (ETDEWEB)

    Demissie, Taye B. [Centre for Theoretical and Computational Chemistry Department of Chemistry, UiT – The Arctic University of Norway, N-9037 Tromsø (Norway)


    This presentation demonstrates the relativistic effects on the spin-rotation constants, absolute nuclear magnetic resonance (NMR) shielding constants and shielding spans of {sup 175}LuX (X = {sup 19}F, {sup 35}Cl, {sup 79}Br, {sup 127}I) molecules. The results are obtained from calculations performed using density functional theory (non-relativistic and four-component relativistic) and coupled-cluster calculations. The spin-rotation constants are compared with available experimental values. In most of the molecules studied, relativistic effects make an order of magnitude difference on the NMR absolute shielding constants.

  20. Crystal electric field and dimer splitting in Cs{sub 3}Er{sub 2}X{sub 9} (X=Cl, Br)

    Energy Technology Data Exchange (ETDEWEB)

    Allenspach, P.; Furrer, A. [Paul Scherrer Inst. (PSI), Villigen (Switzerland); Guedel, H.U.; Furer, N. [Bern Univ. (Switzerland); Buettner, H. [Institut Max von Laue - Paul Langevin, 75 - Paris (France)


    Inelastic neutron scattering technique was used to measure the crystal electric field (CEF) splitting of Cs{sub 3}Er{sub 2}Cl{sub 9}. Besides a low lying magnetic excitation at around 2 meV all the other transitions are in agreement with CEF transitions found in optical measurements. Similar additional low-lying magnetic transitions were found in Cs{sub 3}Er{sub 2}Br{sub 9}. While excitations of the rare-earth dimers most likely play a role, the size of the splitting and its absence in optical spectra still remain a mystery. (author) 2 figs., 5 refs.

  1. UV-VIS absorption spectra of molten AgCl and AgBr and of their mixtures with group I and II halide salts

    Energy Technology Data Exchange (ETDEWEB)

    Greening, Giorgio G.W. [Technische Universitaet Darmstadt (Germany). Eduard-Zintl-Institut fuer Anorganische und Physikalische Chemie


    The UV-VIS absorption spectra of (Ag{sub 1-X}[Li-Cs, Ba]{sub X})Cl and of (Ag{sub 1-X}[Na, K, Cs]{sub X})Br at 823 K at the concentrations X=0.0, 0.1, 0.2 have been measured. The findings show that on adding the respective halides to molten silver chloride and silver bromide, shifts of the fundamental absorption edge to shorter wavelengths result. A correlation between the observed shifts and the expansion of the silver sub-lattice is found, which is valid for both silver halide systems studied in this work.

  2. Magnetization and Specific Heat Investigations of the Bose Glass: Br-doped NiCl2-4SC(NH2)2 (United States)

    Weickert, Franziska; Miclea, Corneliu; Movshovich, Roman; Zapf, Vivien; Yu, Rong; Roscilde, Tommaso


    NiCl2-4SC(NH2)2 (DTN) is an insulating material, which shows field induced XY-AFM order between Hc1 = 2.1 T and Hc2 = 12.6 T. In boson language, the ground state of DTN can be described as a Mott insulator, and the ordered state as a Bose-Einstein condensation of magnons. Bond disorder is introduced by substituting Br atoms on Cl positions, which simultaneously changes the super exchange interaction along the c-direction on a local scale and leads to a Mott-glass ground state in zero field. Furthermore, the system develops a gapless Bose glass for magnetic fields 0 Hc2, followed by a Mott insulating state above the saturation field Hsat. Note, that the critical fields Hc1,2 and Hsat are shifted compared to those of pure DTN. In this talk, we report on measurements of the magnetization and specific heat at very low temperatures between 50 mK and 3 K in high magnetic fields up to 14 T on an 8% Br-doped single crystal DTN. We compare our data with the local gap model, which reduces the low-temperature and low-field behavior to those of an ensemble of individual three level systems with local magnetization MS = 0, ±1 and a finite energy gap for H = 0.

  3. Relevance of weak intermolecular forces on the supramolecular structure of free or DMSO solvated 5-(4-X-benzylidene)rhodanines (X = F, Cl, Br, I) (United States)

    Casas, José S.; Castaño, M. Victoria; Couce, María D.; Sánchez, Agustín; Sordo, José; Torres, M. Dolores; Vázquez, Saulo A.; Vázquez-López, Ezequiel M.


    The rhodanines of the title (Xp-Rhod, X = F, Cl, Br, I) were synthesized and characterized in solid state and in solution. The crystal structures of the four compounds show different supramolecular organizations. In the F-, Cl- and Br-derivatives, a R22(8) (CSNH)2 ring forms via Nsbnd H⋯S hydrogen bonds between two neighbouring molecules to give dimers. The I-derivative is also dimeric, but exhibits R22(8) (CONH)2 rings. The two type of dimers are associated in a variety of structures through hydrogen bonding, π-stacking, Csbnd H⋯π interactions and halogen bonding. These interactions were analysed from a crystallographic point of view and their relative relevance was explored using DFT calculations. The effect produced on all these interactions by the incorporation of DMSO molecules to the lattice was analysed by comparing the crystal structures of Xp-Rhod compounds and those of corresponding Xp-RhodṡDMSO solvates.

  4. 81Br, 37Cl, and 87Sr studies to assess groundwater flow and solute sources in the southwestern Great Artesian Basin, Australia

    International Nuclear Information System (INIS)

    The Great Artesian Basin (GAB) is a water source for more than 200,000 residents in central Australia. This study investigates the relationship of bromine and chlorine stable isotopes to groundwater chemistry in a confined aquifer in the southwestern GAB to better understand its flow regime and solute sources. δ81Br values range from +0.660/00 near the recharge area to +1.04 0/00, 150 km down gradient, while δ37Cl ranges from 00/00 to -2.50/00. While δ37Cl decreases with distance from the recharge area, δ81Br increases slightly. Bromide in the recharge area is possibly enriched from selective atmospheric processes causing fractionation in marine aerosols during transport. When confined and isolated from the atmosphere, increases in bromide and to a lesser extent strontium concentrations may contribute through water-rock interaction to changes in isotopic signatures along the flow system. 87Sr/86Sr values range from ∼0.717 near the recharge zone to a depleted 0.708 160 km down gradient. (authors)

  5. Structures, properties and nature of DMSO-XY (XY=ClF and BrF) complexes: redshift and blueshift of S=O stretch. (United States)

    Li, Qing-Zhong; Xu, Wen-Rui; Li, Ran; Liu, Xiao-Feng; Li, Wen-Zuo; Cheng, Jian-Bo


    The DMSO-XY (XY=ClF and BrF) complexes have been investigated with quantum chemical calculations. In general, two minima complexes were found, one with an O···X halogen bond and the other one with a S···X halogen bond. The former is more stable than the latter. Additionally, one first order saddle point complex was also observed. The interaction energies in the S complexes suffer a prominent influence from the calculation methods. At the CCSD(T)/aug-cc-pVDZ level, the interaction energies are calculated to be -9.19 and -12.73 kcal/mol for the Cl and Br global minima, respectively. Both complexes have also been evidenced to be stable at room temperature. The SO stretch vibration exhibits a red shift at the global minimum but a blue shift at the local minimum, whereas the CSC and CH stretch vibrations move to high frequency in both cases. The energy decomposition analyses indicate that the electrostatic interaction plays a dominant role in stabilizing these halogen-bonded complexes. PMID:22858607

  6. Comparison of π-hole tetrel bonding with σ-hole halogen bonds in complexes of XCN (X = F, Cl, Br, I) and NH3. (United States)

    Nziko, Vincent de Paul N; Scheiner, Steve


    In addition to the standard halogen bond formed when NH3 approaches XCN (X = F, Cl, Br, I) along its molecular axis, a perpendicular approach is also possible, toward a π-hole that is present above the X-C bond. MP2/aug-cc-pVDZ calculations indicate the latter geometry is favored for X = F, and the σ-hole structure is preferred for the heavier halogens. The π-hole structure is stabilized by charge transfer from the NH3 lone pair into the π*(CN) antibonding orbital, and is characterized by a bond path from the N of NH3 to the C atom of XCN, a form of tetrel bond. The most stable 2 : 1 NH3/XCN heterotrimer for X = F and Cl is cyclic and contains a tetrel bond augmented by a pair of NHN H-bonds. For X = Br and I, the favored trimer is noncyclic, stabilized by a tetrel and a halogen bond. PMID:26750543

  7. Descriptions and systematics of raman spectra for TlCdBr3 (TlCdCl3) crystal

    International Nuclear Information System (INIS)

    Polarized spectra of the TlCdCl3, TlCdCl3 isomorphic crystals have been studied at 300,77 and 2 K. A brief quality analysis of the Raman spectra of the studied crystals as representatives of the ABX3 group has been carried out proceeding from the assumption on existence of group vibrational motions of distinguished quasimolecular BX5 complexes

  8. Structure and properties of [2-NH2C5H4NH][SbCl4] and [2-NH2C5H4NH][SbBr4

    International Nuclear Information System (INIS)

    The crystal structures of [2-NH2C5H4NH][SbCl4] (2-APyHSbCl4) and [2-NH2C5H4NH][SbBr4] (2-APyHSbBr4) are determined at 100 K. Both compounds crystallize in the monoclinic space group: P 21/c. The structure is composed of SbX4- (X = Cl,Br) ions which form infinite chains through the crystal via halogen linkages. The structural phase transformations are detected by the differential scanning calorimetry and dilatometric techniques: at 402 K, close to continuous, and at 412 K, clearly discontinuous, in 2-APyHSbCl4 and 2-APyHSbBr4, respectively. Dielectric relaxation studies in the frequency range between 1 kHz and 25 MHz indicate reorientations of the 2-aminopyridinium (2-APyH) cations in both compounds in the low temperature phases. The proton NMR second moment, M2, and spin-lattice relaxation time, T1, for 2-APyHSbCl4 and 2-APyHSbBr4 measured between 78 and 430 K reveal the in-plane reorientation of the 2-APyH cations. The possible mechanism of the phase transitions in the title crystals is discussed on the basis of the results presented

  9. Structure and properties of [2-NH2C5H4NH][SbCl4] and [2-NH2C5H4NH][SbBr4 (United States)

    Kulicka, B.; Jakubas, R.; Bator, G.; Ciunik, Z.; Medycki, W.


    The crystal structures of [2-NH2C5H4NH][SbCl4] (2-APyHSbCl4) and [2-NH2C5H4NH][SbBr4] (2-APyHSbBr4) are determined at 100 K. Both compounds crystallize in the monoclinic space group: P 21/c. The structure is composed of SbX4- (X = Cl,Br) ions which form infinite chains through the crystal via halogen linkages. The structural phase transformations are detected by the differential scanning calorimetry and dilatometric techniques: at 402 K, close to continuous, and at 412 K, clearly discontinuous, in 2-APyHSbCl4 and 2-APyHSbBr4, respectively. Dielectric relaxation studies in the frequency range between 1 kHz and 25 MHz indicate reorientations of the 2-aminopyridinium (2-APyH) cations in both compounds in the low temperature phases. The proton NMR second moment, M2, and spin-lattice relaxation time, T1, for 2-APyHSbCl4 and 2-APyHSbBr4 measured between 78 and 430 K reveal the in-plane reorientation of the 2-APyH cations. The possible mechanism of the phase transitions in the title crystals is discussed on the basis of the results presented.

  10. Proton response of CEPA4: A novel LaBr3(Ce)–LaCl3(Ce) phoswich array for high-energy gamma and proton spectroscopy

    International Nuclear Information System (INIS)

    A new phoswich array, for the detection of high-energy protons and gamma rays from nuclear reactions, has been built. This new detector consists of four individual closely packed scintillator detectors, each of them made of 4 cm of LaBr3(Ce) and 6 cm of LaCl3(Ce) in phoswich configuration (optically coupled and with a common readout). In this paper we report on the results of a beam test performed at the Bronowice Cyclotron Centre (CCB) in Krakow, showing the response of this versatile instrument to high energy protons (70–230 MeV). Furthermore, for the first time we prove that we can reconstruct the original energy of fast protons (E>200MeV) which pass through the total length of the crystal while still retaining a good energy resolution

  11. Ab initio design of CsSn(XxY 1−x3 (X and Y = Cl, Br, and I perovskites for photovoltaics

    Directory of Open Access Journals (Sweden)

    Arpan Krishna Deb


    Full Text Available Ab initio calculations on CsSnX3 perovskites and mixed halides CsSn(XxY 1−x3, X and Y = I, Cl, and Br, show that all of them have a direct band gap of ∼1 eV which can be tuned by varying the compositions of X and Y. The optimized supercells are tetragonal, orthorhombic or monoclinic. The top of the valence band arises from hybridization of Sn 4s and halogen p valence orbitals while the bottom of the conduction band has predominantly Sn p character. Similar to organo-metallic lead halides this is expected to facilitate p-p optical transitions that are highly favourable for photoabsorption. Our results suggest that these inorganic perovskites have the desired features to achieve high efficiency of photo-response with appropriate combination of halogens.

  12. Optical properties of the alkaline-earth fluorohalides matlockite-type structure SrFX (X=Cl, Br, I) compounds

    International Nuclear Information System (INIS)

    The optical properties of the SrFX (X=Cl, Br, I) compound have been reported using the full potential linearized augmented plane wave (FP-LAPW) method as implemented in the WIEN2K code. We employed the generalized gradient approximation (GGA), which is based on exchange-correlation energy optimization to calculate the total energy. Also we have used the Engel-Vosko GGA formalism, which optimizes the corresponding potential for band structure calculations. Our calculations show that the valence band maximum (VBM) and conduction band minimum (CBM) are located at Γ resulting in a direct energy gap. We present calculations of the frequency-dependent complex dielectric function ε(ω) and its zero-frequency limit ε1(0). We find that the value of ε1(0) increases on decreasing the energy gap. The reflectivity spectra and absorption coefficient have been calculated and compared with the available experimental data

  13. Halogen Bonding or Hydrogen Bonding between 2,2,6,6-Tetramethyl-piperidine-noxyl Radical and Trihalomethanes CHX3 (X=Cl, Br, I)

    Institute of Scientific and Technical Information of China (English)

    Xiao-ran Zhao; Xue Pang; Xiao-qing Yan; Wei-jun Jin


    The halogen and hydrogen bonding complexes between 2,2,6,6-tetramethylpiperidine-noxyl and trihalomethanes (CHX3,X=Cl,Br,I) are simulated by computational quantum chemistry.The molecular electrostatic potentials,geometrical parameters and interaction energy of halogen and hydrogen bonding complexes combined with natural bond orbital analysis are obtained.The results indicate that both halogen and hydrogen bonding interactions obey the order Cl<Br<I,and hydrogen bonding is stronger than the corresponding halogen bond ing.So,hydrogen bonding complexes should be dominant in trihalomethanes.However,it is possible that halogen bonding complex is competitive,even preponderant,in triiodomethane due to the similar interaction energy.This work might provide useful information on specific solvent effects as well as for understanding the mechanism of nitroxide radicals as a bioprobe to interact with the halogenated compounds in biological and biochemical fields.

  14. Low-dimensional charge transport of the ferroic NH 2(C 2H 5) 4CoCl 2Br 2 nanocrystals (United States)

    Tkaczyk, S. W.; Kityk, I. V.; Rudyk, V.; Kapustianyk, V.


    DC-conductivity of the nanocomposites consisting of ferroic nanocrystals NH 2(C 2H 5) 4CoCl 2Br 2 (TEA-CCB) incorporated into the polymer PMMA matrices is investigated. The investigations are performed for different number of nanocrystallite chromophores and thickness of the samples. The thickness of the nanocomposite films was varied within 0.44-0.48 μm. The measurements were done at different temperatures and different applied voltages. As a dominant mechanism thermoemission was considered, which is determined by temperature of the samples.. The gold electrodes were used as principle electrodes. The observed phenomena were explained within a framework of hopping between the trapping levels and possible contribution of self-trapped excitons.

  15. Na, Al, K, Mn, Mg, Br, Ca, And Cl Concentration Values in the whole Blood Samples of Human Cancer using Short Time Neutron Irradiation Facility of ETRR-2

    International Nuclear Information System (INIS)

    The National Cancer Institute of Egypt submit us with 18 blood samples (11 Breast),(2 Prostate),(2 Colon),(1 Pancreatic),(1 Ovarian) and one samples from random person to estimate the concentration values of Na, Al ,K , Mn , Mg ,Br and Cl. The pneumatic irradiation rabbit system (PIRS) built in the vertical thermal column of the ETRR-2 reactor is used for short time irradiation at constant power. Elemental concentrations were estimated from measurements of the gamma ray spectra of the product short lived isotopes in the samples. The thermal to epithermal neutron flux ratio was calculated f (169) at irradiation position. The obtained concentration was calculated using kθ standardization method. Fortran and Axel programs were constructed for the determination of neutron fluxes and for elemental concentration values .For sake of comparisons the obtained results, the elemental concentrations of the random sample using (kθ - NAA) compared with the concentrations obtained by (ICP-MS) technique.

  16. Photoelectron spectroscopy of aqueous solutions: Streaming potentials of NaX (X = Cl, Br, and I) solutions and electron binding energies of liquid water and X−

    International Nuclear Information System (INIS)

    The streaming potentials of liquid beams of aqueous NaCl, NaBr, and NaI solutions are measured using soft X-ray, He(I), and laser multiphoton ionization photoelectron spectroscopy. Gaseous molecules are ionized in the vicinity of liquid beams and the photoelectron energy shifts are measured as a function of the distance between the ionization point and the liquid beam. The streaming potentials change their polarity with concentration of electrolytes, from which the singular points of concentration eliminating the streaming potentials are determined. The streaming currents measured in air also vanish at these concentrations. The electron binding energies of liquid water and I−, Br−, and Cl− anions are revisited and determined more accurately than in previous studies

  17. Using Halogens (Cl, Br, F, I) and Stable Isotopes of Water (δ18O, δ2H) to Trace Hydrological and Biogeochemical Processes in Prairie Wetlands (United States)

    Levy, Z. F.; Lu, Z.; Mills, C. T.; Goldhaber, M. B.; Rosenberry, D. O.; Mushet, D.; Siegel, D. I.; Fiorentino, A. J., II; Gade, M.; Spradlin, J.


    Prairie pothole wetlands are ubiquitous features of the Great Plains of North America, and important habitat for amphibians and migratory birds. The salinity of proximal wetlands varies highly due to groundwater-glacial till interactions, which influence wetland biota and associated ecosystem functions. Here we use halogens and stable isotopes of water to fingerprint hydrological and biogeochemical controls on salt cycling in a prairie wetland complex. We surveyed surface, well, and pore waters from a groundwater recharge wetland (T8) and more saline closed (P1) and open (P8) basin discharge wetlands in the Cottonwood Lake Study Area (ND) in August/October 2013 and May 2014. Halogen concentrations varied over a broad range throughout the study area (Cl = 2.2 to 170 mg/L, Br = 13 to 2000 μg/L, F = pond water (δ18O = -9.5 to -2.71 ‰) mixes with shallow groundwater in the top 0.6 m of fringing wetland soils and 1.2 m of the substrate in the center of P1. Our results suggest endogenous sources for Br and I within the prairie landscape that may be controlled by biological mechanisms or weathering of shale from glacial till.

  18. Formation of the Si-B bond: insertion reactions of silylenes into B-X(X = F, Cl, Br, O, and N) bonds. (United States)

    Geng, Bing; Xu, Chongjuan; Chen, Zhonghe


    The insertion reactions of the silylene H2Si with H2BXHn-1 (X = F, Cl, Br, O, N; n = 1, 1, 1, 2, 3) have been studied by DFT and MP2 methods. The calculations show that the insertions occur in a concerted manner, forming H2Si(BH2)(XHn-1). The essences of H2Si insertions with H2BXHn-1 are the transfers of the σ electrons on the Si atom to the positive BH2 group and the electrons of X into the empty p orbital on the Si atom in H2Si. The order of reactivity in vacuum shows the barrier heights increase for the same-family element X from up to down and the same-row element X from right to left in the periodic table. The energies relating to the B-X bond in H2BXHn-1, and the bond energies of Si-X and Si-B in H2Si(BH2)(XHn-1) may determine the preference of insertions of H2Si into B-X bonds for the same-column element X or for the same-row element X. The insertion reactions in vacuum are similar to those in solvents, acetone, ether, and THF. The barriers in vacuum are lower than those in solvents and the larger polarities of solvents make the insertions more difficult to take place. Both in vacuum and in solvents, the silylene insertions are thermodynamically exothermic. Graphical Abstract The insertion process of H2Si and H2BXHn-1(X = F, Cl, Br, O, and N; n = 1, 1 , 1, 2, 3). PMID:27184004

  19. Evaluation of the levels of Br, Cl, K, Mg, Mn and V in Perna perna Mussels (Linnaeus, 1758: Mollusca, Bivalvia) collected in coast of Sao Paulo, Brazil

    International Nuclear Information System (INIS)

    In this study the content of Br, Cl, K, Mg, Mn and V was evaluated in samples of Perna perna mussels collected in coastal regions of Sao Paulo (Ponta de Itaipu and Palmas Island, in Santos) subjected to anthropogenic contamination, to compare these values with those of mussels from reference site of Cocanha Beach (in Caraguatatuba). The mussels were collected seasonally from September 2008 to July 2009. They were cleaned, ground, homogenized, lyophilized and then analyzed by Instrumental Neutron Activation Analysis (INAA). The INAA procedure consisted in the irradiation of the samples and synthetic elemental standards for 8 and 10 s, under a thermal neutron flux of 6.6 x 1012 n cm-2 s-1 in the IEA-R1 nuclear research reactor. For quality control of analytical results, certified reference materials NIST 1566b Oyster Tissue and NIST 2876 Mussel Tissue were analyzed and their results indicated good accuracy. The ranges of concentrations (dry basis) of the elements obtained in mussels collected for the four seasons of the year were: 173.80 to 358.99 mg kg-1 for Br; 45658 ± 1811 to 109166 ± 824 mg kg-1 for Cl; 7043 ± 856 to 12506 ± 675 mg kg-1 for K; 2774 ± 211 to 5691 ± 717 mg kg-1 for Mg; 7.01 ± 0.30 to 29.74 ± 3.32 mg kg-1 for Mn and 0.77 ± 0.02 to 3.43 ± 0.28 mg kg-1 for V. The seasonal and spatial variations of these element concentrations were in this study. (author)

  20. Evaluation of the levels of Br, Cl, K, Mg, Mn and V in Perna perna Mussels (Linnaeus, 1758: Mollusca, Bivalvia) collected in coast of Sao Paulo, Brazil

    Energy Technology Data Exchange (ETDEWEB)

    Seo, Daniele; Vasconcellos, Marina B.A.; Saiki, Mitiki; Catharino, Marilia G.M.; Moreira, Edson G., E-mail:, E-mail:, E-mail:, E-mail:, E-mail: [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil); Sousa, Eduinetty C.P.M. de, E-mail: [Universidade de Sao Paulo (IO/USP), Sao Paulo, SP (Brazil). Instituto Oceanografico. Laboratorio de Ecotoxicologia Marinha e Microfitobentos


    In this study the content of Br, Cl, K, Mg, Mn and V was evaluated in samples of Perna perna mussels collected in coastal regions of Sao Paulo (Ponta de Itaipu and Palmas Island, in Santos) subjected to anthropogenic contamination, to compare these values with those of mussels from reference site of Cocanha Beach (in Caraguatatuba). The mussels were collected seasonally from September 2008 to July 2009. They were cleaned, ground, homogenized, lyophilized and then analyzed by Instrumental Neutron Activation Analysis (INAA). The INAA procedure consisted in the irradiation of the samples and synthetic elemental standards for 8 and 10 s, under a thermal neutron flux of 6.6 x 10{sup 12} n cm{sup -2} s{sup -1} in the IEA-R1 nuclear research reactor. For quality control of analytical results, certified reference materials NIST 1566b Oyster Tissue and NIST 2876 Mussel Tissue were analyzed and their results indicated good accuracy. The ranges of concentrations (dry basis) of the elements obtained in mussels collected for the four seasons of the year were: 173.80 to 358.99 mg kg{sup -1} for Br; 45658 ± 1811 to 109166 ± 824 mg kg{sup -1} for Cl; 7043 ± 856 to 12506 ± 675 mg kg{sup -1} for K; 2774 ± 211 to 5691 ± 717 mg kg{sup -1} for Mg; 7.01 ± 0.30 to 29.74 ± 3.32 mg kg{sup -1} for Mn and 0.77 ± 0.02 to 3.43 ± 0.28 mg kg{sup -1} for V. The seasonal and spatial variations of these element concentrations were in this study. (author)

  1. Theoretical and Synthetic Study on the Existence, Structures, and Bonding of the Halide-Bridged [B2X7](-) (X = F, Cl, Br, I) Anions. (United States)

    Bertocco, Philipp; Bolli, Christoph; Correia Bicho, Bruno A; Jenne, Carsten; Erken, Berrin; Laitinen, Risto S; Seeger, Helene A; Takaluoma, Teemu T


    While hydrogen bridging is very common in boron chemistry, halogen bridging is rather rare. The simplest halogen-bridged boron compounds are the [B2X7](-) anions (X = F, Cl, Br, I), of which only [B2F7](-) has been reported to exist experimentally. In this paper a detailed theoretical and synthetic study on the [B2X7](-) anions is presented. The structures of [B2X7](-) anions have been calculated at the MP2/def2-TZVPP level of theory, and their local minima have been shown to be of C2 symmetry in all cases. The bonding situation varies significantly between the different anions. While in [B2F7](-) the bonding is mainly governed by electrostatics, the charge is almost equally distributed over all atoms in [B2I7](-) and additional weak iodine···iodine interactions are observed. This was shown by an atoms in molecules (AIM) analysis. The thermodynamic stability of the [B2X7](-) anions was estimated in all phases (gas, solution, and solid state) based on quantum-chemical calculations and estimations of the lattice enthalpies using a volume-based approach. In the gas phase the formation of [B2X7](-) anions from [BX4](-) and BX3 is favored in accord with the high Lewis acidity of the BX3 molecules. In solution and in the solid state only [B2F7](-) is stable against dissociation. The other three anions are borderline cases, which might be detectable under favorable conditions. However, experimental attempts to identify [B2X7](-) (X = Cl, Br, I) anions in solution by (11)B NMR spectroscopy and to prepare stable [PNP][B2X7] salts failed. PMID:26977788

  2. Bromide does not bind to the Mn4Ca complex in its S1 state in Cl(-)-depleted and Br(-)-reconstituted oxygen-evolving photosystem II: evidence from X-ray absorption spectroscopy at the Br K-edge. (United States)

    Haumann, Michael; Barra, Marcos; Loja, Paola; Löscher, Simone; Krivanek, Roland; Grundmeier, Alexander; Andreasson, Lars-Erik; Dau, Holger


    Chloride is an important cofactor in photosynthetic water oxidation. It can be replaced by bromide with retention of the oxygen-evolving activity of photosystem II (PSII). Binding of bromide to the Mn(4)Ca complex of PSII in its dark-stable S(1) state was studied by X-ray absorption spectroscopy (XAS) at the Br K-edge in Cl(-)-depleted and Br(-)-substituted PSII membrane particles from spinach. The XAS spectra exclude the presence of metal ions in the first and second coordination spheres of Br(-). EXAFS analysis provided tentative evidence of at least one metal ion, which may be manganese or calcium, at a distance of approximately 5 A to Br(-). The native Cl(-) ion may bind at a similar distance. Accordingly, water oxidation may not require binding of a halide directly to the metal ions of the Mn complex in its S(1) state. PMID:17059227

  3. The phase situation and ferroelectric properties in the mixed crystals [4-NH 2PyH][SbCl 4(1- x) Br 4 x (United States)

    Wojtaś, M.; Jakubas, R.; Zaleski, J.; Bator, G.; Baran, J.


    The group of mixed crystals of general formula: [4-APyH][SbCl 4(1- x) Br 4 x] with x ranging from 0 to 1 was studied by means of differential scanning calorimetry, dilatometry and dielectric spectroscopy. The ferroelectric properties are preserved for mixed crystals with replacement fraction, x, less than 0.30. Moreover, such a substitution of the chlorine atoms by the bromine ones significantly lowers the temperature of the structural phase transition shifting it from 240 K for pure [4-APyH][SbCl 4] to about 185 K for the mixed crystals richer in bromine. The dielectric relaxation process exhibited by the mixed crystal with x = 0.90 in the radio-frequency region was analyzed and the activation energy was estimated ( Ea = 18 kJ/mol). Additional measurements of single crystals X-ray diffraction and powder IR and Raman spectroscopy were performed. On the basis of the experimental results the phase diagram for mixed crystals has been proposed.

  4. Investigation on a two-stage solar liquid-desiccant (LiBr) dehumidification system assisted by CaCl{sub 2} solution

    Energy Technology Data Exchange (ETDEWEB)

    Xiong, Z.Q. [Institute of Refrigeration and Cryogenics, Shanghai Jiao Tong University, Shanghai 200240 (China); Dai, Y.J. [Institute of Refrigeration and Cryogenics, Shanghai Jiao Tong University, Shanghai 200240 (China)], E-mail:; Wang, R.Z. [Institute of Refrigeration and Cryogenics, Shanghai Jiao Tong University, Shanghai 200240 (China)


    A two-stage solar powered liquid-desiccant dehumidification system, for which two kinds of desiccant solution (lithium chloride and calcium bromide) are fed to the two dehumidification stages separately, has been studied. In the studied system air moisture (latent) load is separately removed by a pre-dehumidifier using cheap calcium chloride (CaCl{sub 2}) and a main dehumidifier using stable lithium bromide (LiBr). Side-effect of mixing heat rejected during dehumidification process is considerably alleviated by an indirect evaporative cooling unit added between the two dehumidification stages. The feasibility of high-desiccant concentration difference achieved by reusing desiccant solution to dehumidify air and regenerating desiccant repeatedly is analyzed. By increasing desiccant concentration difference, desiccant storage capacity is effectively explored. It is found that the pre-dehumidification effect of CaCl{sub 2} solution is significant in high ambient humidity condition. Also seen is that the desiccant investment can be decreased by 53%, though the cost of equipments is somewhat increased, and the Tcop and COP of the proposed system can reach 0.97 and 2.13, respectively.

  5. Investigation on a two-stage solar liquid-desiccant (LiBr) dehumidification system assisted by CaCl2 solution

    International Nuclear Information System (INIS)

    A two-stage solar powered liquid-desiccant dehumidification system, for which two kinds of desiccant solution (lithium chloride and calcium bromide) are fed to the two dehumidification stages separately, has been studied. In the studied system air moisture (latent) load is separately removed by a pre-dehumidifier using cheap calcium chloride (CaCl2) and a main dehumidifier using stable lithium bromide (LiBr). Side-effect of mixing heat rejected during dehumidification process is considerably alleviated by an indirect evaporative cooling unit added between the two dehumidification stages. The feasibility of high-desiccant concentration difference achieved by reusing desiccant solution to dehumidify air and regenerating desiccant repeatedly is analyzed. By increasing desiccant concentration difference, desiccant storage capacity is effectively explored. It is found that the pre-dehumidification effect of CaCl2 solution is significant in high ambient humidity condition. Also seen is that the desiccant investment can be decreased by 53%, though the cost of equipments is somewhat increased, and the Tcop and COP of the proposed system can reach 0.97 and 2.13, respectively

  6. Convergence of Breit-Pauli spin-orbit matrix elements with basis set size and configuration interaction space: The halogen atoms F, Cl, and Br

    International Nuclear Information System (INIS)

    Systematic sequences of basis sets are used to calculate the spin-orbit splittings of the halogen atoms F, Cl, and Br in the framework of first-order perturbation theory with the Breit-Pauli operator and internally contracted configuration interaction wave functions. The effects of both higher angular momentum functions and the presence of tight functions are studied. By systematically converging the one-particle basis set, an unambiguous evaluation of the effects of correlating different numbers of electrons in the Cl treatment is carried out. Correlation of the 2p-electrons in chlorine increases the spin-orbit splitting by ∼80 cm-1, while in bromine we observe incremental increases of 130, 145, and 93 cm-1, when adding the 3d, 3p, and 2p electrons to the set of explicitly correlated electrons, respectively. For fluorine and chlorine the final basis set limit, all-electrons correlated results match the experimentally observed spin-orbit splittings to within ∼5 cm-1, while for bromine the Breit-Pauli operator underestimates the splitting by about 100 cm-1. More extensive treatment of electron correlation results in only a slight lowering of the spin-orbit matrix elements. Thus, the discrepancy for bromine is proposed to arise from the nonrelativistic character of the underlying wave function. (c) 2000 American Institute of Physics

  7. X-ray, i.r., and Raman studies of the anhydrous chlorates and bromates of strontium, barium, and lead - crystal structure of Sr(ClO3)2 and Sr(BrO3)2

    International Nuclear Information System (INIS)

    Single crystals of the hitherto badly characterized anhydrous halates Sr(ClO3)2, Sr(BrO3)2, Ba(BrO3)2, Pb(ClO3)2, and Pb(BrO3)2 have been obtained by crystallization from an aqueous solution or by heating aqueous suspensions of the corresponding monohydrates to 95, 185, 130, and 105 0C, respectively, in a vacuum. The halates crystallize in the orthorhombic space group Fdd2-C/sub 2v//sup 19/ (Z = 8) with the exception of Sr(BrO3)2, which is distorted to the monoclinic space group Cc-C/sub s//sup 4/ (Z = 4). The crystal structure of Sr(ClO3)2 and Sr(BrO3)2 have been determined using single crystal X-ray diffraction data. In both compounds, distorted SrO8 dodecahedra (bisphenoids) are connected to a four-connected three-dimensional net. The ClO3- ions and one of the two crystallographically non-equivalent BrO3- ions are strongly distorted. The structures of these compounds and those of Ba(IO3)2 and of Ba(ClO3)2 x 1 H2O type compounds are related to a hypothetical AB2 structure with diamond like arrangement of the metal ions of the common super group Fddd-D/sub 2h//sup 4/. The results of i.r. and Raman spectroscopic measurements are reported and discussed in terms of the crystal structures. (author)

  8. Electric Multipole Moments and (HyperPolarizability of X–C≡C–X, X = F, Cl, Br and I

    Directory of Open Access Journals (Sweden)

    Demetrios Xenides


    Full Text Available Abstract: We have calculated self-consistent field (SCF and second-order Møller-Plesset perturbation theory (MP2 for the dihaloethynes X–C≡C–X, X = F, Cl, Br and I. All calculations have been performed with carefully optimized, flexible basis sets of gaussiantype functions. Our best values for the quadrupole moment (Θ/ea02 are -0.6524 (FCCF, 3.6612 (ClCCCl, 5.8143 (BrCCBr and 8.3774 (ICCI. The dipole polarizability is strongly anisotropic. For the mean (α /e2a02Eh-1 and the anisotropy (Δα/e2a02Eh-1 we obtain 23.58 and 15.09 (FCCF, 51.75 and 48.30 (ClCCCl, 66.53 and 60.04 (BrCCBr, 93.79 and 78.91 (ICCI. The mean dipole hyperpolarizability (γ /e4a04Eh-3 increases rapidly as 2932 (FCCF, 9924 (ClCCCl, 17409 (BrCCBr and 35193 (ICCI. The transversal component of the hyperpolarizability is larger than the longitudinal one for FCCF, γxxxx > γzzzz but this is reversed for the other molecules in the series. Difluoroethyne is less (hyperpolarizable than ethyne.

  9. A comparison of experimental and DFT calculations of ¹⁹⁵Pt NMR shielding trends for [PtX(n)Y(6-n)](2-) (X, Y = Cl, Br, F and I) anions. (United States)

    Burger, Marga R; Kramer, J; Chermette, H; Koch, Klaus R


    A comparison between experimental and calculated gas-phase as well as the conductor-like screening model DFT (195)Pt chemical shifts of a series of octahedral [PtX(6-n)Y(n)](2-) complexes for X = Cl, Br, F, I was carried out to assess the accuracy of computed NMR shielding and to gain insight into the dominant σ(dia), σ(para) and σ(SO) shielding contributions. The discrepancies between the experimental and the DFT-calculated (195)Pt chemical shifts vary for these complexes as a function of the coordinated halide ions, the largest being obtained for the fluorido-chlorido and fluorido-bromido complexes, while negligible discrepancies are found for the [PtCl(6-n)Br(n)](2-) series; the discrepancies are somewhat larger where a significant deviation from the ideal octahedral symmetry such as for the geometric cis/trans or fac/mer isomers of [PtF(6-n)Cl(n)](2-) and [PtF(6-n)Br(n)](2-) may be expected. The discrepancies generally increase in the order [PtCl(6-n)Br(n)](2-) sensitivity to Pt-X bond displacement, ∂(δ(195)Pt)/∂(ΔPt-X), of these complexes is very large and depends on the halide ion, decreasing from 24 800, 18 300, 15 700 to 12 000 ppm/Å for [PtF(6)](2-), [PtCl(6)](2-), [PtBr(6)](2-) and [PtI(6)](2-), respectively. PMID:21104761

  10. Absorption of water vapour in the falling film of water-(LiBr + LiI + LiNO{sub 3} + LiCl) in a vertical tube at air-cooling thermal conditions

    Energy Technology Data Exchange (ETDEWEB)

    Bourouis, Mahmoud; Valles, Manel; Medrano, Marc; Coronas, Alberto [Centro de Innovacion Tecnologica en Revalorizacion Energetica y Refrigeracion, CREVER, Universitat Rovira i Virgili, Autovia de Salou, s/n, 43006, Tarragona (Spain)


    In air-cooled water-LiBr absorption chillers the working conditions in the absorber and condenser are shifted to higher temperatures and concentrations, thereby increasing the risk of crystallisation. To develop this technology, two main problems are to be addressed: the availability of new salt mixtures with wider range of solubility than water-LiBr, and advanced absorber configurations that enable to carry out simultaneously an appropriate absorption process and an effective air-cooling. One way of improving the solubility of LiBr aqueous solutions is to add other salts to create multicomponent salt solutions. The aqueous solution of the quaternary salt system (LiBr + LiI + LiNO{sub 3} + LiCl) presents favourable properties required for air-cooled absorption systems: less corrosive and crystallisation temperature about 35 K lower than that of water-LiBr.This paper presents an experimental study on the absorption of water vapour over a wavy laminar falling film of an aqueous solution of (LiBr + LiI + LiNO{sub 3} + LiCl) on the inner wall of a water-cooled smooth vertical tube. Cooling water temperatures in the range 30-45 C were selected to simulate air-cooling thermal conditions. The results are compared with those obtained in the same experimental set-up with water-LiBr solutions.The control variables for the experimental study were: absorber pressure, solution Reynolds number, solution concentration and cooling water temperature. The parameters considered to assess the absorber performance were: absorber thermal load, mass absorption flux, degree of subcooling of the solution leaving the absorber, and the falling film heat transfer coefficient.The higher solubility of the multicomponent salt solution makes possible the operation of the absorber at higher salt concentration than with the conventional working fluid water-LiBr. The absorption fluxes achieved with water-(LiBr + LiI + LiNO{sub 3} + LiCl) at a concentration of 64.2 wt% are around 60 % higher than

  11. LaBr3(Ce):LaCl3(Ce) Phoswich with pulse shape analysis for high energy gamma-ray and proton identification

    International Nuclear Information System (INIS)

    A novel Phoswich design based on new generation scintillator crystals is presented. The detector composed from a combination of a LaBr3(Ce) with a LaCl3(Ce) crystal in one cylinder coupled to a photo multiplier tube has been tested both for incident gamma rays in the range of 0.3–6 MeV, as well as for high energy protons in the range 120–180 MeV. The Phoswich assembly has not significantly deteriorated the energy resolution, which for 662 KeV gamma rays gives a resolution of 4.5%, while for high energy protons (Ep=180 MeV) an energy resolution of 1% was obtained. It is shown that the signals from the two crystals can be separated in an event by event based mode. Using direct digitizing of the detector pulse an off-line pulse-shape analysis was performed built either on a total to tail or total to pulse height method in order to fully identify the incoming radiation. Our aim with this R and D is to in the future build a detector which is able to detect with good efficiency and resolution over a wide energy range; 0.1–30 MeV gamma rays and 20–400 MeV protons. Monte Carlo simulations made in order to design the next prototype are presented

  12. Theoretical calculations of spin-Hamiltonian parameters for the (MoOX5)2− (X=Cl, Br) metallic complexes in solution or frozen-glass

    International Nuclear Information System (INIS)

    The spin-Hamiltonian parameters (g factors g//, g⊥ and hyperfine structure constants A//, A⊥) of the (MoOX5)2− (X=Cl, Br) metallic complexes in solution or frozen-glass are calculated from the high-order perturbation formulas based on the two-mechanism model. In these formulas, the contributions to spin-Hamiltonian parameters due to both the widely-applied crystal-field (CF) mechanism and the charge-transfer (CT) mechanism (which is neglected in CF theory) are taken into account, and the needed CF and CT energy levels are obtained from the optical spectra. The calculated results with two adjustable parameters are in reasonable agreement with the experimental values. The calculations show that (i) the relative importance of CT mechanism in (MoOBr5)2− metallic complexes is larger than that in (MoOCl5)2− ones because of the stronger covalence of Mo5+–Br− combination, and (ii) in both (MoOCl5)2− and (MoOBr5)2− metallic complexes, the contributions to spin-Hamiltonian parameters due to CT mechanism should also be taken into account because of the high valence state of Mo5+ ion

  13. Direct evaluation of the hyperconjugative interactions in 1,1,1-trihaloethane (CH3CX3, X = F, Cl, and Br). (United States)

    Chen, Zhenhua; Corminboeuf, Clémence; Mo, Yirong


    Following the computational strategy proposed by Mulliken in 1939 ( J. Chem. Phys. 1939, 7 (5), 339-352), when the concept of hyperconjugation was coined, we evaluated the hyperconjugative stabilization energy in 1,1,1-trihaloethane using the block-localized wave function (BLW) method. The BLW method is the simplest and most efficient variant of ab initio valence bond (VB) theory and can derive the strictly electron-localized state wave function self-consistently. The latter serves as a reference for the quantification of the electron delocalization effect in terms of the resonance theory. Computations show that the overall hyperconjugative interactions in 1,1,1-trihaloethane, dominated by σ(CH) → σ'(CX) with minor contribution from σ(CX) → σ'(CH), ranges from 9.59 to 7.25 kcal/mol in the staggered structures and decreases in the order Br > Cl > F. This is in accord with the (1)H NMR spectra of CH3CX3. Notably, the hyperconjugation effect accounts for 35-40% of the rotation barriers in these molecules, which are dominated by the conventional steric repulsion. This is consistent with the recent findings with 1,2-difluoroethane (Freitas, Bühl, and O'Hagan. Chem. Comm. 2012, 48, 2433-2435) that the variation of (1)J(CF) with the FCCF torsional angle cannot be well explained by the hyperconjugation model PMID:24041308

  14. Enhanced surface modification engineering (H, F, Cl, Br, and NO{sub 2}) of CdS nanowires with and without surface dangling bonds

    Energy Technology Data Exchange (ETDEWEB)

    Zeng, Yijie; Xing, Huaizhong, E-mail:; Lu, Aijiang; Wang, Chunrui; Xu, Xiaofeng [Department of Applied Physics and State Key Laboratory for Modification of Chemical Fibers and Polymer Materials, Donghua University, Ren Min Road 2999, Songjiang District, Shanghai 201620 (China); Huang, Yan; Chen, Xiaoshuang, E-mail:, E-mail: [National Lab. of Infrared Physics, Shanghai Institute for Technical Physics, Chinese Academy of Science, 500 Yu Tian Road, Shanghai 200083 (China); Wang, Jiqing, E-mail:, E-mail: [Key Laboratory of Polarized Materials and Devices, East China Normal University, Shanghai 200062 (China)


    Semiconductor nanowires (NWs) can be applied in gas sensing and cell detection, but the sensing mechanism is not clearly understood. In this study, surface modification effect on the electronic properties of CdS NWs for different diameters with several species (H, F, Cl, Br, and NO{sub 2}) is investigated by first principles calculations. The surface dangling bonds and halogen elements are chosen to represent the environment of the surface. Halogen passivation drastically changes the band gaps due to the strong electronegativity and the energy level of halogen atoms. Density of states analysis indicates that valence band maximum (VBM) of halogen-passivated NWs is formed by the p states of halogen atoms, while VBM of H-passivated NWs is originated from Cd 4d and S 3p orbitals. To illustrate that surface modification can be applied in gas sensing, NO{sub 2}-absorbed NWs with different coverage are calculated. Low coverage of NO{sub 2} introduces a deep p-type dopant-like level, while high coverage introduces a shallow n-type dopant-like level into the band structure. The transformation is due to that at low coverage the adsorption is chemical while at high coverage is physical. These findings might promote the understanding of surface modification effect and the sensing mechanism of NWs as gas sensors.

  15. Theoretical study on potential energy curves and spectroscopy properties of ground and low-lying excited electronic states of BrCl+

    Institute of Scientific and Technical Information of China (English)

    WANG MingWei; WANG BingWu; CHEN ZhiDa


    The calculations on the potential energy curves and spectroscopic constants of the ground and low-lying excited states of BrCl+, one of the important molecular ions in environment science, have been performed by using the multireference configuration interaction method at high level of theory in quantum chemistry. Through analyses of the effects of the spin-orbit coupling interaction on the electronic structures and spectroscopic properties, the multiconfiguration characteristic of the X2∏ ground state and low-lying excited states was established. The spin-orbit coupling splitting energy of the X2∏ ground state was calculated to be 1814 cm-1, close to the experimental value 2070 cm-1. The spin-orbit coupling splitting energy of the 2∏(Ⅱ) exited state was predicted to be 766 cm-1. The transition dipole moments and Frank-Condon factors of the 3/2(Ⅲ)-X3/2 and 1/2(Ⅲ)-1/2(Ⅰ) transitions were estimated, and the radiative lifetimes of the two transitions were briefly discussed.

  16. Synthesis, crystal structures, magnetic properties, and lattice dynamics of Ba2XCu(OH)[V2O7] with X=Cl, Br (United States)

    Sun, Kewen; Litvinchuk, Alexander P.; Tapp, Joshua; Möller, Angela


    We have synthesized Ba2XCu(OH)[V2O7] with X=Cl, Br by hydrothermal methods. The isotypic structures (Pnma, Z=4, a≈15.1 Å, b≈6.1 Å, c≈9.6 Å) contain distorted hexagonal layers of Ba and X in a BN-type arrangement. Each halide is further coordinated by one out-of plane Ba atom in an alternate up-down fashion resulting in an overall 3+∞ 2[Ba2 X ] structural feature. The planar Ba-X hexagonal rings are centered by divanadate groups in an eclipsed orientation. Edge-sharing chains of 5-∞ 1[CuO2/2(OH)2/2O2/1 ] complement the structure. The magnetic properties are associated with the magnetic Cu2+ ions and can be described as an antiferromagnetic quasi 1D S=1/2 Heisenberg system. Confirmation is obtained from both magnetic and specific heat measurements. Furthermore, lattice dynamics are studied by DFT methods, IR, and Raman spectroscopy.

  17. Theoretical study on potential energy curves and spectroscopy properties of ground and low-lying excited electronic states of BrCl~+

    Institute of Scientific and Technical Information of China (English)


    The calculations on the potential energy curves and spectroscopic constants of the ground and low-lying excited states of BrCl+,one of the important molecular ions in environment science,have been performed by using the multireference configuration interaction method at high level of theory in quantum chemistry.Through analyses of the effects of the spin-orbit coupling interaction on the elec-tronic structures and spectroscopic properties,the multiconfiguration characteristic of the X2Π ground state and low-lying excited states was established.The spin-orbit coupling splitting energy of the X2 Π ground state was calculated to be 1814 cm-1,close to the experimental value 2070 cm-1.The spin-orbit coupling splitting energy of the 2Π(Ⅱ) exited state was predicted to be 766 cm-1.The transition dipole moments and Frank-Condon factors of the 3/2(Ⅲ)-X3/2 and 1/2(Ⅲ)-1/2(I) transitions were estimated,and the radiative lifetimes of the two transitions were briefly discussed.

  18. Enhanced surface modification engineering (H, F, Cl, Br, and NO2) of CdS nanowires with and without surface dangling bonds

    International Nuclear Information System (INIS)

    Semiconductor nanowires (NWs) can be applied in gas sensing and cell detection, but the sensing mechanism is not clearly understood. In this study, surface modification effect on the electronic properties of CdS NWs for different diameters with several species (H, F, Cl, Br, and NO2) is investigated by first principles calculations. The surface dangling bonds and halogen elements are chosen to represent the environment of the surface. Halogen passivation drastically changes the band gaps due to the strong electronegativity and the energy level of halogen atoms. Density of states analysis indicates that valence band maximum (VBM) of halogen-passivated NWs is formed by the p states of halogen atoms, while VBM of H-passivated NWs is originated from Cd 4d and S 3p orbitals. To illustrate that surface modification can be applied in gas sensing, NO2-absorbed NWs with different coverage are calculated. Low coverage of NO2 introduces a deep p-type dopant-like level, while high coverage introduces a shallow n-type dopant-like level into the band structure. The transformation is due to that at low coverage the adsorption is chemical while at high coverage is physical. These findings might promote the understanding of surface modification effect and the sensing mechanism of NWs as gas sensors

  19. Preparation of highly dispersed Ru-Sn bimetallic supported catalysts from the single source precursors Cp(PPh32Ru-SnX3 (X = Cl or Br

    Directory of Open Access Journals (Sweden)

    Ana Cláudia Bernardes Silva


    Full Text Available In this work highly dispersed Ru-Sn bimetallic catalysts have been prepared from organobimetallic Cp(PPh32Ru-SnX3 (X = Cl or Br complexes. These single source precursors can be easily impregnated in high surface area supports, such as activated carbon and sol-gel SiO2, and upon controlled thermal treatment the ligands are released as volatile products resulting in the formation of the bimetallic system Ru-Sn. Catalytic reactions, such as hydrodechlorination of CCl4 and chlorobenzene and TPR (Temperature Programmed Reduction experiments carried out with these RuSn catalysts suggested a strong interaction between Ruthenium and Tin. Mössbauer measurements showed that these materials when exposed to air are immediately oxidized to form Sn (IV. It was shown that upon controlled reduction conditions with H2 it is possible to reduce selectively Sn to different oxidation states and different phases. The Sn oxidation state showed significant effect on the catalytic hydrogenation of 1,5-cyclooctadiene. The use of these single source precursors with a controlled decomposition/reduction procedure allows the preparation of unique catalysts with an intimate interaction between the components ruthenium and tin and the possibility of varying the Sn oxidation state around the Ru metal.

  20. New k-phase materials, k-(ET) sub 2 Cu(N(CN) sub 2 )X: X = Cl, Br and I: The synthesis, structure and superconductivity above 11 K in the Cl ( Tc = 12. 8 K, 0. 3 kbar) and Br( Tc = 11. 6 K) salts

    Energy Technology Data Exchange (ETDEWEB)

    Wang, H.H.; Carlson, K.D.; Geiser, U.; Kini, A.M.; Schultz, A.J.; Williams, J.M.; Montgomery, L.K.; Kwok, W.K.; Welp, U.; Vandervoort, K.G.; Boryschuk, S.J.; Strieby Crouch, A.V.; Kommers, J.M.; Watkins, D.M. (Argonne National Lab., IL (USA)); Schirber, J.E.; Overmyer, D.L. (Sandia National Labs., Albuquerque, NM (USA)); Jung, D.; Novoa, J.J.; Whangbo, M.H. (North Carolina State Univ., Raleigh, NC (USA))


    The syntheses, structures, selected physical properties, and band electronic structures of three copper (I) dicyanamide halide salts of bis(ethylenedithio)tetrathiafulvalene ({kappa}-(ET){sub 2}Cu(N(CN){sub 2})X, where X = Cl, Br, and I) are discussed. X-ray crystallographic studies demonstrate that the three derivatives are isostructural. The bromide salt is an ambient pressure superconductor with an inductive onset at 11.6 K and a resistive onset at 12.5 K. {kappa}-(ET){sub 2}Cu(N(CN){sub 2})Cl exhibits the highest reported superconducting transition temperature ({Tc} = 12.8 K, 0.3 kbar) for an organic superconductor, once a semiconductor-semiconductor transition (42 K) is suppressed. The application of GE varnish or Apiezon N grease to crystals of {kappa}-(ET){sub 2}Cu(N(CN){sub 2})Cl provides sufficient stress to induce superconductivity at ambient pressure.'' Crystals of the iodide remain metallic to {approximately}150 K, where they become weakly semiconductive. No sign of superconductivity was detected at pressures (hydrostatic and shearing) up to 5.2 kbar and at temperatures as low as 1.1 K. The band electronic structures of the three salts are essentially identical. The differences in superconducting properties are explained in terms of differences in lattice softness, which are strongly influenced by short C-H{hor ellipsis}donor and C-H{hor ellipsis}anion contacts. 17 refs., 2 figs.

  1. NMR espectroscopic parameters of HX and Si (Sn)X{sub 4} (X = H, F, Cl, Br and I) and SnBr{sub 4-n}I{sub n} model compounds

    Energy Technology Data Exchange (ETDEWEB)

    Maldonado, Alejandro F.; Gimenez, Carlos A. [Physics Department, Natural and Exact Science Faculty, Northeastern University of Argentina and Institute of Modelling and Innovation on Technology, IMIT Avda Libertad 5460, W3404AAS Corrientes (Argentina); Aucar, Gustavo A., E-mail: [Physics Department, Natural and Exact Science Faculty, Northeastern University of Argentina and Institute of Modelling and Innovation on Technology, IMIT Avda Libertad 5460, W3404AAS Corrientes (Argentina)


    Graphical abstract: Optimized fully relativistic calculations of NMR J-couplings (HBr, HI), chemical shifts (Si, Sn) and absolute shielding for reference compounds of heavy atoms (Si, Sn) are given. Highlights: Black-Right-Pointing-Pointer In this article we show a procedure to get accurate NMR {sigma}{sup Ref} of Si and Sn. Black-Right-Pointing-Pointer Calculations of {sigma} on more than three heavy-atom-containing molecules are given. Black-Right-Pointing-Pointer Our results are closer to {delta}{sup exp} than previous calculations for SnX{sub 4} (X = H, Cl, Br, I). Black-Right-Pointing-Pointer Optimized basis sets were considered for full R and NR calculations of NMR J and {sigma}. Black-Right-Pointing-Pointer Relativistic effects enlarge electron correlation effects on J-couplings. - Abstract: The NMR spectroscopic parameters are largely influenced by relativistic effects. They are highly dependent on the electronic behavior inside the spatial regions occupied by nuclei. Full relativistic calculations of indirect nuclear spin-spin couplings at random phase level of approach (RPA) in the title compounds with reoptimized Dyall cVTZ basis sets are given. A comparison with the results of calculations with other basis sets that are mostly used within the non-relativistic (NR) domain is presented. We analyzed the dependence of that couplings with the speed of light over the whole range of values, from the full relativistic to the NR regimes. Within this last regime, calculations at the second-order level of approach (SOPPA) indicated that electron correlation effects may not be as important for nuclear magnetic shieldings, but they must be included with care for J-coupling calculations. From these calculations, we determined that relativity enlarges the electron correlation effects of the J-couplings of HBr and HI. Because the results of nuclear magnetic shielding calculations within polarization propagators at the RPA level were reliable, we were able to show a new

  2. Method of obtaining concentrated preparations of Cl36 and Br82 by recoil nuclei under exposure to high-density neutron fields

    International Nuclear Information System (INIS)

    The classical Szilard-Chalmers method for obtaining concentrated radioactive preparations is usually considered rather ineffective when large integral neutron fluxes are used, because of the considerable disintegration of the compound under irradiation. The authors found compounds of bromine and chlorine with carbon which made it possible to enrich considerably the chlorine and bromine in radioisotopes by means of recoil nuclei during exposure to neutron fluxes of the order of 1013 n/cm2s. These compounds correspond to the formula CnX, where X = Cl or Br, and n = 10-20 for chlorine compounds and 25-70 for bromine compounds. They are fairly stable thermally and chemically. The compound C30 Br withstands heat up to 300oC in an argon atmosphere without detachment of bromine; it disintegrates completely at a temperature of 600oC. It is practically unaffected by reducing agents in aqueous sofution. The chlorine and carbon compounds are about as stable as the bromine and carbon compounds. Only strong reducing agents (e.g. solution of the sulphate CrSO4) slowly detach the chlorine from the compounds of chlorine and activated carbon at room temperature. Enrichment of bromine in Br82 with these bromine and carbon compounds goes up 50-500 times in integral fluxes of the order of 5 X 1017 n/cm2. The specific activity of the concentration fluctuates between 6 and 35 mc/mg of bromine, and will probably be raised by improvement of the method. The structure of the compound ensures a good extraction of radioactive bromine (up to 75%) by a very simple technique. The carbon + chlorine iron + chlorine system proved the most effective for obtaining concentrated chlorine-36. By this system an enrichment factor of 6-20 was obtained, with a specific activity of the concentrate of 230-55 μc/g chlorine. The concentration effect when these chlorine and bromine compounds are exposed to neutrons is the cumulative result of a number of processes: formation of radioactive chlorine atoms

  3. NQR and X-ray crystal structure studies of cadmium halide complexes: [C(NH2)3]CdI3 and [4-ClC6H5NH3]3CdBr5

    International Nuclear Information System (INIS)

    The crystal structures of [C(NH2)3]CdI3 (1) and [4-ClC6H5NH3]3CdBr5 (2) have been determined at 100 K: monoclinic, Cc, a = 828.75(3) pm, b = 1615.31(5) pm, c = 810.64(3) pm, and β = 106.5820(10) for 1; monoclinic, P21/c, a = 1486.93(5) pm, b = 794.31(3) pm, c = 2290.59(7) pm, and β = 99.6830(10) for 2. The structure of 1 has an infinite chain of anions consisting of [CdI4] tetrahedra sharing two corners. The structure of 2 has an infinite chain of anions consisting of [CdBr6] octahedra sharing two corners in cis positions. In both structures, isolated cations are connected to the anion chains through weak hydrogen bonds Cd-X..H to result in three-dimensional network structures. In accordance with the crystal structures, three 127I (m = ±1/2 <-> m = ±3/2), five 81Br, and three 35Cl nuclear quadrupole resonance (NQR) lines were observed for 1 and 2. The NQR spectra reflect the anion chain structures and their weak hydrogen bonds. The MO calculations of the models [Cd5I16]6- for 1 and [Cd3Br16]10- for 2 estimate only about half the values for the NQR frequencies but give accurate electric field gradient directions.

  4. Theoretical exploration of pnicogen bond noncovalent interactions in HCHO· · · PH2X (X=CH3, H, C6H5, F, Cl, Br, and NO2) complexes

    Indian Academy of Sciences (India)

    Yan-Zhi Liu; Kun Yuan; Zhao Yuan; Yuan-Cheng Zhu; Xiang Zhao


    Pnicogen bond (ZB) is a new kind of intermolecular weak interaction, which would be an important strategy for the construction of supramolecular materials. In this paper, ab initio MP2/aug-cc-pvDZ calculations have been carried out to characterize the X-P ⋯ O ZB interactions between HCHO and PH2X (X=CH3, H, C6H5, F, Cl, Br, and NO2). The calculated interaction energies with basis set super-position error (BSSE) corrections in seven ZB complexes are between −7.51 and −20.36 kJ·mol−1. The relative stabilities of the seven complexes increase in the order: HCHO⋯ PH2CH3 < HCHO⋯ PH3 < HCHO⋯ PH2 C6H5 < HCHO⋯ PH2 Br < HCHO⋯ PH2 Cl < HCHO⋯ PH2F < HCHO⋯ PH2NO2. The natural bond orbital (NBO) and natural resonance theory (NRT) analysis were employed to investigate the electron behavior and nature of the ZBs. The natural bond orbital interactions in the ZBs are mainly LP1,2 (O) → * (P-X). The P-X (X= Br, Cl, F and NO2) are more suitable for acting as ZB donors than the P-X (X=H, CH3 and C6H5) groups. The electron density topology properties based on atoms-inmolecules (AIM) theory showed that the ZB interactions in the HCHO⋯ PH2X (X=Br, Cl, F and NO2) are stronger than those of HCHO⋯ PH2 X(X=CH3 , H and C6H5) complexes, indicating that the electron withdrawing of X benefits for the stability of ZB structure.


    Directory of Open Access Journals (Sweden)

    K. Ikeda


    Full Text Available Cs2[AuIX2][AuIIIX4](X = Cl, Br, and I is well known for the perovskite-type gold mixed-valence system. This system undergoes pressure-induced and photo-induced Au valence transition from the mixed valence state of AuI,III to the single valence state of AuII. Recently, we have succeeded in synthesizing new gold mixed-valence complexes having perovskite-type structure, Cs2[AuIX2][AuIIIY4](X, Y = halogen, X ¹ Y, in organic solvent by using a new method. This hetero-halogen bridged gold mixed-valence system was confirmed by means of Raman spectroscopy. From the analysis of 197Au Mössbauer spectra, it was elucidated that the charge transfer interaction between AuI(5dx2-y2 and AuIII(5dx2-y2in the a-b plane becomes dominant for the AuI-AuIII interaction in Cs2[AuIX2][AuIIIY4] (X, Y = Cl, Br, and I in the order of X = Cl < Br < I, where Y is fixed. In order to elucidate the Au valence transition for Cs2[AuIX2][AuIIIY4], we have investigated the X-ray diffraction and Raman spectra under high pressure. Moreover, we have synthesized TlAuX3(X = Cl and Br having cubic perovskite structure and highly conducting behavior. The Au valence state in TlAuX3 is considered to be AuII at ambient pressure.

  6. Ammonia Uptake and Release in the MnX2–NH3 (X = Cl, Br Systems and Structure of the Mn(NH3nX2 (n = 6, 2 Ammines

    Directory of Open Access Journals (Sweden)

    Duncan H. Gregory


    Full Text Available Hexa-ammine complexes, Mn(NH36X2 (X = Cl, Br, have been synthesized by ammoniation of the corresponding transition metal halide and characterized by Powder X-ray diffraction (PXRD and Raman spectroscopy. The hexa-ammine complexes are isostructural (Cubic, Fm-3m, Z = 4; a = 10.2742(6 Å and 10.527(1 Å for X = Cl, Br respectively. Temperature programmed desorption (TPD demonstrated that ammonia release from Mn(NH36X2 complexes occurred in three stages corresponding to the release of 4, 1 and 1 NH3 equivalents respectively. The chloride and bromide both exhibit a deammoniation onset temperature below 323 K. The di-ammoniates from the first desorption step were isolated during TPD measurements and their crystal structures determined by Rietveld refinement against PXRD data (X = Cl: orthorhombic Cmmm, a = 8.1991(9 Å, b = 8.2498(7 Å, c = 3.8212(4 Å, Z = 2; X = Br: orthorhombic Pbam, a = 6.0109(5 Å, b = 12.022(1 Å, c = 4.0230(2 Å, Z = 2.

  7. Framework solids based on copper(II) halides (Cl/Br) and methylene-bridged bis(1-hydroxybenzotriazole): synthesis, crystal structures, magneto-structural correlation, and density functional theory (DFT) studies. (United States)

    Sasmal, Ashok; Shit, Shyamapada; Rizzoli, Corrado; Wang, Hongfeng; Desplanches, Cédric; Mitra, Samiran


    A methylene-bridged 1-hydroxybenzotriazole derived ligand L [L = 1, 3-bis(benzotriazol-1-yl)-1,3-dioxapropane] has been synthesized and characterized by spectroscopic and structural methods. Reaction of L with two different copper(II) halides [CuX(2); X = Br, Cl] in an identical condition yields two different compounds of similar compositions, {[Cu(μ-Br)(Br)(μ-L)](2)}(n)·2nH(2)O (1) and {[Cu(μ-Cl)(Cl)(μ-L)](2)}(n)·2nH(2)O (2), both being characterized by various physicochemical techniques. Single crystal X-ray studies reveal that they appear as 2D coordination polymers with similar bridging fashion of L. Low temperature magnetic susceptibility measurements reveal antiferromagnetic and ferromagnetic behaviors for 1 and 2 with magnetic coupling constants J = -15.2 and +1.7 cm(-1), which are in a reasonable agreement with their calculated values (J = -9.79 and +0.68 cm(-1) respectively, for 1 and 2). The role of bridging halides in the structure and magnetic properties of the complexes are investigated, and a possible magneto-structural correlation has been established. Influence of spin density of bridging halides on the magnitude of coupling constants has been discussed with the help of density functional theory (DFT) calculations. PMID:22974283

  8. The binding of platinum hexahalides (Cl, Br and I) to hen egg-white lysozyme and the chemical transformation of the PtI6 octahedral complex to a PtI3 moiety bound to His15

    International Nuclear Information System (INIS)

    The platinum hexahalides have an octahedral arrangement of six halogen atoms bound to a Pt centre, thus having an octahedral shape that could prove to be useful in interpreting poor electron-density maps. In a detailed characterization, PtI6 chemically transformed to a square-planar PtI3 complex bound to the Nδ atom of His15 of HEWL was also observed, which was not observed for PtBr6 or PtCl6. This study examines the binding and chemical stability of the platinum hexahalides K2PtCl6, K2PtBr6 and K2PtI6 when soaked into pre-grown hen egg-white lysozyme (HEWL) crystals as the protein host. Direct comparison of the iodo complex with the chloro and bromo complexes shows that the iodo complex is partly chemically transformed to a square-planar PtI3 complex bound to the Nδ atom of His15, a chemical behaviour that is not exhibited by the chloro or bromo complexes. Each complex does, however, bind to HEWL in its octahedral form either at one site (PtI6) or at two sites (PtBr6 and PtCl6). As heavy-atom derivatives of a protein, the octahedral shape of the hexahalides could be helpful in cases of difficult-to-interpret electron-density maps as they would be recognisable ‘objects’

  9. Evaluation of the levels of Br, Cl, K, Mg, Mn and V in Perna perna mussels (Linnaeus, 1758: Mollusca Bivalvia) collected in the coast of Sao Paulo state, Brazil; Avaliacao dos teores de Br, Cl, K, Mg, Mn e V em mexilhoes Perna perna (Linnaeus, 1758: Mollusca Bivalvia) coletados no litoral do estado de Sao Paulo, Brasil

    Energy Technology Data Exchange (ETDEWEB)

    Seo, Daniele


    The coastal environment has been heavily altered by multiple environmental impacts of human activities, such as disposal of sewage from urban areas, the release of numerous chemical industries, agriculture and the flow of vessels, which can lead to accidental spills of oil and oil products, fuels and other products transported by sea. In this context, a means of determining concentrations of these potentially toxic substances in the sea water is the biomonitoring by means of different types of bivalves, which have been used by various researchers, in Brazil and other countries. With regard to bivalve mollusks, particularly mussels, their use in monitoring the marine contamination is mainly due to their wide geographic distribution, sessile habit and ability to concentrate toxic metals to 102-105 times in relation to the concentrations detected in water. In the present study, we employed the passive biomonitoring using the Perna perna bivalve mollusk with respect to the elements Br, Cl, K, Mg, Mn and V. These elements were chosen since they can be determined by INAA method (Instrumental Neutron Activation Analysis), by means of short irradiation which provides faster analyzes and also due to their importance from the standpoint of environmental or nutritional studies. The aim of this study was to evaluate the content of Br, Cl, K, Mg, Mn and V in samples of Perna perna mussels (Linnaeus, 1758: Mollusca, Bivalvia) collected in coastal regions of Sao Paulo subject to anthropogenic contamination (Ponta de Itaipu and Palmas Island, in Santos), comparing the values obtained in sites potentially impacted with the values of the control site in Praia da Cocanha, in Caraguatatuba. The collection points located in Sao Paulo coast are located in the geographical areas 23 Masculine-Ordinal-Indicator 37'S - 45 Degree-Sign 24' W (Caraguatatuba) and 23 Masculine-Ordinal-Indicator 57'S - 46 Masculine-Ordinal-Indicator 20' W (Santos). The collection of organisms

  10. Theoretical Study of the Red-Shifting and Blue-Shifting Hydrogen Bonding Between Pyridine and CHX3 (X=F,Cl ,Br or I)%吡啶与CHX3(X=F,Cl,Br,I)形成分子间红移和蓝移氢键的理论研究

    Institute of Scientific and Technical Information of China (English)

    王素纹; 黎安勇



  11. Using Cl/Br ratios and other indicators to assess potential impacts on groundwater quality from septic systems: A review and examples from principal aquifers in the United States (United States)

    Katz, B.G.; Eberts, S.M.; Kauffman, L.J.


    A detailed review was made of chemical indicators used to identify impacts from septic tanks on groundwater quality. Potential impacts from septic tank leachate on groundwater quality were assessed using the mass ratio of chloride-bromide (Cl/Br), concentrations of selected chemical constituents, and ancillary information (land use, census data, well depth, soil characteristics) for wells in principal aquifers of the United States. Chemical data were evaluated from 1848 domestic wells in 19 aquifers, 121 public-supply wells in 6 aquifers, and associated monitoring wells in four aquifers and their overlying hydrogeologic units. Based on previously reported Cl/Br ratios, statistical comparisons between targeted wells (where Cl/Br ratios range from 400 to 1100 and Cl concentrations range from 20 to 100 mg/L) and non-targeted wells indicated that shallow targeted monitoring and domestic wells (0.5. mg/L) shallow groundwater from target domestic wells, relative to non-target wells (1.5. mg/L), corresponded to significantly higher potassium, boron, chloride, dissolved organic carbon, and sulfate concentrations, which may also indicate the influence of septic-tank effluent. Impacts on groundwater quality from septic systems were most evident for the Eastern Glacial Deposits aquifer and the Northern High Plains aquifer that were associated with the number of housing units using septic tanks, high permeability of overlying sediments, mostly oxic conditions, and shallow wells. Overall, little or no influence from septic systems were found for water samples from the deeper public-supply wells.The Cl/Br ratio is a useful first-level screening tool for assessing possible septic tank influence in water from shallow wells (<20 m) with the range of 400-1100. The use of this ratio would be enhanced with information on other chloride sources, temporal variability of chloride and bromide concentrations in shallow groundwater, knowledge of septic-system age and maintenance, and the

  12. Chemical control of electrical properties and phase diagram of a series of {lambda}-type BETS superconductors, {lambda}-(BETS){sub 2}GaBr{sub x}Cl{sub 4{minus}x}

    Energy Technology Data Exchange (ETDEWEB)

    Tanaka, Hisashi; Kobayashi, Akiko; Sato, Akane; Akutsu, Hiroki; Kobayashi, Hayao


    {lambda}-(BETS){sub 2}GaBr{sub x}Cl{sub 4{minus}x} [BETS = bis(ethylenedithio)tetraselenafulvalene; 0 {le} x {le} 2] is a molecular superconductor with strongly correlated conduction electrons. The electrical transport properties of {lambda}-(BETS){sub 2}GaBr{sub x}-Cl{sub 4{minus}x} are drastically changed by varying the bromine content x or by applying pressure. At ambient pressure, the superconducting transition could be observed for x < 0.75. The pressure and x dependencies of {Tc} were examined. The M-H curve (M = magnetization; H = magnetic field) at 2 K indicated the almost perfect Meissner state of the superconducting phase of {lambda}-(BETS){sub 2}GaCl{sub 4}. The H{sub c1} is {approximately} 8 Oe for H{perpendicular} and 12 Oe for H{parallel}, where H{perpendicular} and H{parallel} are the magnetic fields perpendicular and parallel to the c axis, respectively. The magnetic susceptibility of {lambda}-(BETS){sub 2}GaBr{sub x}Cl{sub 4{minus}x} increases with decreasing temperature to {approximately} 60 K, below which the susceptibility becomes x-dependent and tends to be suppressed with increasing x. The isotropic decrease of the static susceptibility at lower temperature observed in the insulating system with x > 1.0 indicates the insulating ground state seems not to be suppressed with increasing x. The isotropic decrease of the static susceptibility at lower temperature observed in the insulating system with x > 1.0 indicates the insulating ground state seems not to be antiferromagnetic but probably nonmagnetic. The crystal structure determinations of a series of {lambda}-(BETS){sub 2}GaBr{sub x}Cl{sub 4{minus}x} and the calculations of the intermolecular overlap integrals of the highest occupied molecular orbital of BETS were made to elucidate a key factor of the superconducting transition mechanism. The x-dependence of intermolecular overlap integrals seems to suggest that the magnitude of the spin gap of the nonmagnetic insulating state tends to be

  13. Using Cl/Br ratios and other indicators to assess potential impacts on groundwater quality from septic systems: A review and examples from principal aquifers in the United States (United States)

    Katz, Brian G.; Eberts, Sandra M.; Kauffman, Leon J.


    SummaryA detailed review was made of chemical indicators used to identify impacts from septic tanks on groundwater quality. Potential impacts from septic tank leachate on groundwater quality were assessed using the mass ratio of chloride-bromide (Cl/Br), concentrations of selected chemical constituents, and ancillary information (land use, census data, well depth, soil characteristics) for wells in principal aquifers of the United States. Chemical data were evaluated from 1848 domestic wells in 19 aquifers, 121 public-supply wells in 6 aquifers, and associated monitoring wells in four aquifers and their overlying hydrogeologic units. Based on previously reported Cl/Br ratios, statistical comparisons between targeted wells (where Cl/Br ratios range from 400 to 1100 and Cl concentrations range from 20 to 100 mg/L) and non-targeted wells indicated that shallow targeted monitoring and domestic wells (non-targeted wells. Higher ( p = 0.08) median nitrate-N concentration (3.1 mg/L) in oxic (dissolved oxygen concentrations >0.5 mg/L) shallow groundwater from target domestic wells, relative to non-target wells (1.5 mg/L), corresponded to significantly higher potassium, boron, chloride, dissolved organic carbon, and sulfate concentrations, which may also indicate the influence of septic-tank effluent. Impacts on groundwater quality from septic systems were most evident for the Eastern Glacial Deposits aquifer and the Northern High Plains aquifer that were associated with the number of housing units using septic tanks, high permeability of overlying sediments, mostly oxic conditions, and shallow wells. Overall, little or no influence from septic systems were found for water samples from the deeper public-supply wells. The Cl/Br ratio is a useful first-level screening tool for assessing possible septic tank influence in water from shallow wells (<20 m) with the range of 400-1100. The use of this ratio would be enhanced with information on other chloride sources, temporal

  14. Using Cl/Br ratios and other indicators to assess potential impacts on groundwater quality from septic systems: A review and examples from principal aquifers in the United States (United States)

    Katz, Brian G.; Eberts, Sandra M.; Kauffman, Leon J.


    SummaryA detailed review was made of chemical indicators used to identify impacts from septic tanks on groundwater quality. Potential impacts from septic tank leachate on groundwater quality were assessed using the mass ratio of chloride-bromide (Cl/Br), concentrations of selected chemical constituents, and ancillary information (land use, census data, well depth, soil characteristics) for wells in principal aquifers of the United States. Chemical data were evaluated from 1848 domestic wells in 19 aquifers, 121 public-supply wells in 6 aquifers, and associated monitoring wells in four aquifers and their overlying hydrogeologic units. Based on previously reported Cl/Br ratios, statistical comparisons between targeted wells (where Cl/Br ratios range from 400 to 1100 and Cl concentrations range from 20 to 100 mg/L) and non-targeted wells indicated that shallow targeted monitoring and domestic wells (0.5 mg/L) shallow groundwater from target domestic wells, relative to non-target wells (1.5 mg/L), corresponded to significantly higher potassium, boron, chloride, dissolved organic carbon, and sulfate concentrations, which may also indicate the influence of septic-tank effluent. Impacts on groundwater quality from septic systems were most evident for the Eastern Glacial Deposits aquifer and the Northern High Plains aquifer that were associated with the number of housing units using septic tanks, high permeability of overlying sediments, mostly oxic conditions, and shallow wells. Overall, little or no influence from septic systems were found for water samples from the deeper public-supply wells. The Cl/Br ratio is a useful first-level screening tool for assessing possible septic tank influence in water from shallow wells (<20 m) with the range of 400-1100. The use of this ratio would be enhanced with information on other chloride sources, temporal variability of chloride and bromide concentrations in shallow groundwater, knowledge of septic-system age and maintenance, and

  15. Behavior of Halogen Bonds of the Y-X⋅⋅⋅π Type (X, Y=F, Cl, Br, I) in the Benzene π System, Elucidated by Using a Quantum Theory of Atoms in Molecules Dual-Functional Analysis. (United States)

    Sugibayashi, Yuji; Hayashi, Satoko; Nakanishi, Waro


    The nature of halogen bonds of the Y-X-✶-π(C6 H6 ) type (X, Y=F, Cl, Br, and I) have been elucidated by using the quantum theory of atoms in molecules (QTAIM) dual-functional analysis (QTAIM-DFA), which we proposed recently. Asterisks (✶) emphasize the presence of bond-critical points (BCPs) in the interactions in question. Total electron energy densities, Hb (rc ), are plotted versus Hb (rc )-Vb (rc )/2 [=(ħ(2) /8m)∇(2) ρb (rc )] for the interactions in QTAIM-DFA, in which Vb (rc ) are potential energy densities at the BCPs. Data for perturbed structures around fully optimized structures were used for the plots, in addition to those of the fully optimized ones. The plots were analyzed by using the polar (R, θ) coordinate for the data of fully optimized structures with (θp , κp ) for those that contained the perturbed structures; θp corresponds to the tangent line of the plot and κp is the curvature. Whereas (R, θ) corresponds to the static nature, (θp , κp ) represents the dynamic nature of the interactions. All interactions in Y-X-✶-π(C6 H6 ) are classified by pure closed-shell interactions and characterized to have vdW nature, except for Y-I-✶-π(C6 H6 ) (Y=F, Cl, Br) and F-Br-✶-π(C6 H6 ), which have typical hydrogen-bond nature without covalency. I-I-✶-π(C6 H6 ) has a borderline nature between the two. Y-F-✶-π(C6 H6 ) (Y=Br, I) were optimized as bent forms, in which Y-✶-π interactions were detected. The Y-✶-π interactions in the bent forms are predicted to be substantially weaker than those in the linear F-Y-✶-π(C6 H6 ) forms. PMID:27124373

  16. Synthesis, characterization and sorption properties of functionalized Cr-MIL-101-X (X=-F, -Cl, -Br, -CH3, -C6H4, -F2, -(CH3)2) materials (United States)

    Buragohain, Amlan; Couck, Sarah; Van Der Voort, Pascal; Denayer, Joeri F. M.; Biswas, Shyam


    Four existing and three new functionalized chromium terephthalates having MIL-101 topology and denoted as Cr-MIL-101-X (existing ones with X=-F, 1-F; -Cl, 2-Cl; -Br, 3-Br; -CH3, 4-CH3; new ones with X=-C6H4, 5-C6H4; -F2, 6-F2, -(CH3)2, 7-(CH3)2) were synthesized under hydrothermal conditions. All the materials except 5-C6H4 could be prepared by a general synthetic route, in which the mixtures of CrO3, H2BDC-X (BDC=1,4-benzenedicarboxylate) linkers, conc. HCl and water with a molar ratio of 1:1:3.9:222.2 were reacted at 180 °C for 144 h. Compared to the 144 h of synthesis time, three of the compounds, namely 1-Cl, 2-Br and 5-C6H4, could be prepared in much shorter reaction times (12-18 h at 180-210 °C). The materials possess high thermal stability up to 270-300 °C in an air atmosphere. The activated compounds exhibit significant porosity (SBET range: 1273-2135 m2 g-1). At 0 °C and 1 bar, the CO2 adsorption capacities of the compounds fall in the 1.7-2.9 mmol g-1 range. Compounds 1-F and 6-F2 showed enhanced CO2 uptake values compared to parent Cr-MIL-101. The benzene adsorption capacities of the compounds lie in the range of 66.2-139.5 molecules per unit cell at 50 °C and p/p0=0.35. The increased benzene uptake value of 1-F compared to un-functionalized Cr-MIL-101 and 4-CH3 suggests that the fluorination has induced more hydrophobicity in Cr-MIL-101 as compared to the methylation.

  17. The binding of platinum hexahalides (Cl, Br and I) to hen egg-white lysozyme and the chemical transformation of the PtI{sub 6} octahedral complex to a PtI{sub 3} moiety bound to His15

    Energy Technology Data Exchange (ETDEWEB)

    Tanley, Simon W. M.; Starkey, Laurina-Victoria; Lamplough, Lucinda; Kaenket, Surasek; Helliwell, John R., E-mail: [University of Manchester, Brunswick Street, Manchester M13 9PL (United Kingdom)


    The platinum hexahalides have an octahedral arrangement of six halogen atoms bound to a Pt centre, thus having an octahedral shape that could prove to be useful in interpreting poor electron-density maps. In a detailed characterization, PtI{sub 6} chemically transformed to a square-planar PtI{sub 3} complex bound to the N{sup δ} atom of His15 of HEWL was also observed, which was not observed for PtBr{sub 6} or PtCl{sub 6}. This study examines the binding and chemical stability of the platinum hexahalides K{sub 2}PtCl{sub 6}, K{sub 2}PtBr{sub 6} and K{sub 2}PtI{sub 6} when soaked into pre-grown hen egg-white lysozyme (HEWL) crystals as the protein host. Direct comparison of the iodo complex with the chloro and bromo complexes shows that the iodo complex is partly chemically transformed to a square-planar PtI{sub 3} complex bound to the N{sup δ} atom of His15, a chemical behaviour that is not exhibited by the chloro or bromo complexes. Each complex does, however, bind to HEWL in its octahedral form either at one site (PtI{sub 6}) or at two sites (PtBr{sub 6} and PtCl{sub 6}). As heavy-atom derivatives of a protein, the octahedral shape of the hexahalides could be helpful in cases of difficult-to-interpret electron-density maps as they would be recognisable ‘objects’.

  18. Magnetic properties and evidence for lattice instabilities of the frustrated 2D s=1/2 systems (CuCl)LaNb2O7 and (CuBr)LaNb2O7

    International Nuclear Information System (INIS)

    We report on the magnetic properties and raman scattering data of the double-layered perovskites (CuBr)LaNb2O7 and (CuCl)LaNb2O7 with a square lattice of s=21 prepared by topotactic ion-exchange reactions. Evidence for competing ferro- and antiferromagnetic exchange pathes connecting nearest and second-nearest-neighbors, respectively, exist. Despite nearly identical structural parameters of the two compounds there is a different magnetic ground state. Work supported by DFG and ESF-HFM. (orig.)

  19. Preparation of highly dispersed Ru-Sn bimetallic supported catalysts from the single source precursors Cp(PPh3)2Ru-SnX3 (X = Cl or Br)


    Ana Cláudia Bernardes Silva; Ana Paula Guimarães de Sousa; José Domingos Ardisson; Helmuth Guido Luna Siebald; Edmilson Moura; Eduardo Nicolau dos Santos; Nelcy Della Santina Mohallem; Rochel Montero Lago


    In this work highly dispersed Ru-Sn bimetallic catalysts have been prepared from organobimetallic Cp(PPh3)2Ru-SnX3 (X = Cl or Br) complexes. These single source precursors can be easily impregnated in high surface area supports, such as activated carbon and sol-gel SiO2, and upon controlled thermal treatment the ligands are released as volatile products resulting in the formation of the bimetallic system Ru-Sn. Catalytic reactions, such as hydrodechlorination of CCl4 and chlorobenzene and TPR...

  20. Synthesis of iridacarborane halide complexes [(η-9-SMe2-7,8-C2B9H10)IrX2]2 (X=Cl, Br, I)

    International Nuclear Information System (INIS)

    By interaction between Na[9-SMe2-7,8-C2B9H10] and [(Cod)IrCl]2 (Cod - cycloocta-1,5-diene) iridium complex (η-9-SMe2-7,8-C2B9H10)Ir(Cod), which under the action of anhydrous hydrohalogenic acids HX (X=Cl, Br, I) yields iridacarborane halide complexes [(η-9-SMe2-7,8-C2B9H10)IrX2]2, being analogs of cyclopentadienyl complexes [(C5Me5)IrX2]2. The complexes prepared were characterized on the basis of data of elementary analysis and 1H, 11B NMR spectra

  1. 无铅或少铅钙钛矿CH3NH3M1-xPbxX3(M=Sn,Sr;X=Cl,Br,I)太阳能电池的研究进展%Research Development of Lead-free or Less-lead Perovskite CH3NH3M1-xPbxX3 (M =Sn, Sr and X =Cl, Br, I) Solar Cells

    Institute of Scientific and Technical Information of China (English)

    邸学倩; 杨秋华; 安宏乐


    本文综述了Sn2+或Sr2+取代的无铅或少铅钙钛矿CH3NH3PbX3 (X=Cl,Br,I)的结构及其主要的制备方法,评述了各种方法的优缺点.简要介绍了无铅或少铅钙钛矿材料的能隙以及材料的稳定性对太阳能电池的影响,并对其发展前景进行了展望.

  2. Synthesis and Chemical Characterization of the Hexanuclear Anions [IR6(CO)14X]- (X=CL, BR, I, OR SCN): Crystal and Molecular-Structures of [PPH4][IR6(MU-CO)2(CO)12(MU-BR)] and [N(PPH3)2][IR6(MU-CO)2(CO)12(MU-X)] (X=I OR SCN)


    DELLA PERGOLA, R; Garlaschelli, L; MARTINENGO, S; Demartin, F; M. Manassero; N. Masciocchi


    The salts of the monosubstituted hexanuclear anions [Ir6(CO)14X]- [X = Cl (1,)Br (2), I (3), or SCN (4)] have been prepared by treating [Ir6(CO)16] with halides or pseudohalides at room temperature in tetrahydrofuran solution. The three anions consist of slightly distorted octahedra of iridium atoms bearing twelve terminal and two edge bridging carbon monoxide groups. In all cases the halogen atoms or the pseudohalogen group adopt a bridging co-ordination on an Ir-lr edge.

  3. Magnetic Torque Experiments on TPP[Fe(Pc)L2]2 (L = Br and Cl): Antiferromagnetic Short-Range Ordering of d Electrons, Antiferromagnetic Ordering of π Electrons, and Anisotropy Energy (United States)

    Torizuka, Kiyoshi; Tajima, Hiroyuki; Inoue, Munenori; Hanasaki, Noriaki; Matsuda, Masaki; Yu, Derrick E. C.; Naito, Toshio; Inabe, Tamotsu


    We have measured the magnetic torque of TPP[Fe(Pc)Br2]2 and TPP[Fe(Pc)Cl2]2 to clarify their magnetic state, comparing our results with those of formerly performed experiments on TPP[Fe(Pc)CN2]2. The conductors in this family exhibit giant negative magnetoresistance. We employed the cantilever magnetometry technique with our newly developed calibration method to obtain absolute values of the torque (J/rad Fe mol), enabling the comparison between experimental and calculated results. With decreasing temperature, the antiferromagnetic ordering of the π electron is found to occur at ˜13 K, and then the antiferromagnetic short-range ordering of the d electron follows at ˜8 K in these two salts. Our anisotropic one-dimensional Heisenberg model can explain 1) the susceptibility data quantitatively, 2) the torque curves quantitatively, which were obtained when the magnetic field was rotated in the ac-plane, and 3) the behavior of the d electron in the torque curves qualitatively, which were obtained by rotating the field in the ab-plane. By combining our model with the antiferromagnetic model for the π electron, the experimental torque data on TPP[Fe(Pc)Br2]2 and TPP[Fe(Pc)Cl2]2 are satisfactorily described. In addition, we could also successfully obtain the anisotropy energy in the antiferromagnetic state.

  4. Tuning of electronic structures of quasi-one-dimensional halogen-bridged Ni-Pd mixed-metal complexes, [Ni1-xPdx(chxn)2X]X2 (X=Cl, Br) with strong electron correlation

    International Nuclear Information System (INIS)

    This article describes the tuning of the electronic structures in a series of quasi-one-dimensional halogen-bridged Ni-Pd mixed-metal complexes, [Ni1-xPdx(chxn)2X]X2 (chxn=1R,2R-diaminocyclohexane; X, Y=Cl or Br). In these compounds, planar (M(chxn)2] units are bridged by halogen ions (X), forming linear chain M-X-M structures. Therefore, their electronic structures are 1D and are composed of hybridization between the dz2 orbitals of the metal ions and pz orbitals of the bridging halogens. In this system, electron-correlation on the Ni sites and electron-phonon interaction on the Pd sites should compete with each other. Their electronic structures have been investigated by means of the single-crystal reflectance, ESR and IR spectroscopies, electrical conductivities, and X-ray diffuse scattering. Moreover, their local electronic structures have been directly observed by scanning tunneling microscopy (STM) using single-crystals at room temperature and under ambient pressure. As a result, while the oxidation state of the Ni sites is +3 in all mixing ratios in these compounds due to strong electron-correlation, the conversion from the PdIII Mott-Hubbard states to the PdII-PdIV mixed-valence states is observed around x approx. = 0.90 for Br and x approx. = 0.85 for Cl. Interestingly, the spin-soliton in Ni0.05Pd0.95(chxn)2Br3 was directly observed by STM for the first time. (author)

  5. Structure and properties of [2-NH{sub 2}C{sub 5}H{sub 4}NH][SbCl{sub 4}] and [2-NH{sub 2}C{sub 5}H{sub 4}NH][SbBr{sub 4}

    Energy Technology Data Exchange (ETDEWEB)

    Kulicka, B [Faculty of Chemistry, University of Wroclaw, Joliot-Curie 14, 50-383 Wroclaw (Poland); Jakubas, R [Faculty of Chemistry, University of Wroclaw, Joliot-Curie 14, 50-383 Wroclaw (Poland); Bator, G [Faculty of Chemistry, University of Wroclaw, Joliot-Curie 14, 50-383 Wroclaw (Poland); Ciunik, Z [Faculty of Chemistry, University of Wroclaw, Joliot-Curie 14, 50-383 Wroclaw (Poland); Medycki, W [Institute of Molecular Physics, PAS, M Smoluchowskiego 17, 60-179 Poznan (Poland)


    The crystal structures of [2-NH{sub 2}C{sub 5}H{sub 4}NH][SbCl{sub 4}] (2-APyHSbCl{sub 4}) and [2-NH{sub 2}C{sub 5}H{sub 4}NH][SbBr{sub 4}] (2-APyHSbBr{sub 4}) are determined at 100 K. Both compounds crystallize in the monoclinic space group: P 2{sub 1}/c. The structure is composed of SbX{sub 4}{sup -} (X = Cl,Br) ions which form infinite chains through the crystal via halogen linkages. The structural phase transformations are detected by the differential scanning calorimetry and dilatometric techniques: at 402 K, close to continuous, and at 412 K, clearly discontinuous, in 2-APyHSbCl{sub 4} and 2-APyHSbBr{sub 4}, respectively. Dielectric relaxation studies in the frequency range between 1 kHz and 25 MHz indicate reorientations of the 2-aminopyridinium (2-APyH) cations in both compounds in the low temperature phases. The proton NMR second moment, M{sub 2}, and spin-lattice relaxation time, T{sub 1}, for 2-APyHSbCl{sub 4} and 2-APyHSbBr{sub 4} measured between 78 and 430 K reveal the in-plane reorientation of the 2-APyH cations. The possible mechanism of the phase transitions in the title crystals is discussed on the basis of the results presented.

  6. Synthesis, structural and optical characterization of APbX3 (A=methylammonium, dimethylammonium, trimethylammonium; X=I, Br, Cl) hybrid organic-inorganic materials (United States)

    Mancini, Alessandro; Quadrelli, Paolo; Amoroso, Giuseppe; Milanese, Chiara; Boiocchi, Massimo; Sironi, Angelo; Patrini, Maddalena; Guizzetti, Giorgio; Malavasi, Lorenzo


    In this paper we report the synthesis, the crystal structure and the optical response of APbX3 (A=MA, DMA, and TMA; X=I, Br) hybrid organic-inorganic materials including some new phases. We observe that as the cation group increases in size, the optical absorption edge shifts to higher energies with energy steps which are systematic and independent on the anion. A linear correlation between the optical bad gap and the tolerance factor has been shown for the series of samples investigated.

  7. The chemistry of uranium: Pt. 42; Cationic uranium(IV) complexes CX sub 2 L sub 4 Y sub 2 (X = Cl, Br or I; Y = ClO sub 4 or BPh sub 4; L = bulky strong neutral O-donor ligand) and (U(ClO sub 4 ) sub 4 (OAsPh sub 3 ) sub 4 ): crystal structures of (UX sub 2 L sub 4 )(BPh sub 4 ) sub 2 (L = tris(pyrrolidine-1-yl)phosphine oxide, X = Br or I)

    Energy Technology Data Exchange (ETDEWEB)

    Preez, J.G.H. du; Gouws, Leon; Rohwer, Hans; Brecht, B.J.A.M. van; Zeelie, Ben (Port Elizabeth Univ. (South Africa). Uranium Chemistry Research Unit); Casellato, Umberto (Consiglio Nazionale delle Ricerche, Padua (Italy). Lab. di Chimica e Tecnologia dei Radioelementi); Graziani, Rodolfo (Padua Univ. (Italy). Dip. di Chimica Inorganica, Metallorganica e Analitica)


    Solid complexes of the type (UX{sub 2}L{sub 4}(ClO{sub 4}){sub 2}) (X=Cl or Br; L triphenylphosphine oxide (tppo), tris(dimethylamino)phosphine oxide (tdpo), tris(pyrrolidin-1-yl)phosphine oxide (tpyrpo) or triphenylarsine oxide (tpao)) were isolated and characterized. All formed six-co-ordinated doubly charged cationic complexes in polar non-aqueous solvents. The major bands around 1900 nm in the electronic spectra were shifted towards higher energy as the donor strength of L increased and could be used to identify the different species. Spectrophotometric titrations of solutions of (UX{sub 2}(ClO{sub 4}){sub 2}) with L in acetone indicated disproportionation, resulting in the formation of (UX{sub 4}L{sub 2}) and (U(ClO{sub 4}){sub 4}L{sub n}) moieties with n varying from 0 to 5. Differences between the chloro and bromo systems were identified. Spectral studies on solutions of (U(ClO{sub 4}){sub 4}(tpao){sub n}) when n<2 suggested the presence of both mono- and bi-dentate perchlorato groups. The complex (U(ClO{sub 4}){sub 4}(tpao){sub 4}), which has unusual perchlorate co-ordination, was isolated as a surprisingly stable solid. The structures of the isomorphous pair (UX{sub 2}(tpyrpo){sub 4})(BPh{sub 4}){sub 2} (X =Br or I) were determined by X-ray crystallography. The structural details of the compounds were comparable. (author).

  8. Synthesis and studies of dihalophosphate of (Ge,Ti,Sb,Sn)and the compounds Br-3B.OPBrCl-2 and (Me-2 Pcs)2O

    International Nuclear Information System (INIS)

    The compounds Et3 GeOp(O)X2 were prepared by the reaction of P2O3X4 with (Et3Ge)2O in 1:1 molar ratio.Further in terest was also to study the interaction of the compounds Et-3Ge OP(0)X-2 with lewis acids (Ticl-4,Sbcl-5),and to prepare the dihalophosphate of Ti and Sb.The compounds Et-3 GeOP(O)X-2.Sbcl-5(X=F,cl)have been formed,when Et-3 GeOP(O)X-2 was reacted with Sbcl-5 in the ratio 1:1.From the Ir spectra of the above memtioned compounds it was concluded that Sbcl-5 has no ability to cleave the Ge-O bond in the compounds Et-3 GeOP(O)X-2 and therefore the adduct formation occurs as a result of interaction between the terminal oxygen atom in Et-3 GeOP(O)X-2 and Sb atom containing an empty 'd' orbital.Compound Me-3Sno- Pcl-2 has been prepared by a new method,by reaction Me-3SnNEt-2 with P-2O-3 Cl-4 in ctt-2cl-2.(23 tabs., 22 figs., 70 refs.)

  9. Proton response of CEPA4: A novel LaBr{sub 3}(Ce)–LaCl{sub 3}(Ce) phoswich array for high-energy gamma and proton spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Nácher, E., E-mail: [Instituto de Estructura de la Materia, CSIC, E-28006 Madrid (Spain); Mårtensson, M. [Chalmers University of Technology, S-41296 Göteborg (Sweden); Tengblad, O. [Instituto de Estructura de la Materia, CSIC, E-28006 Madrid (Spain); Álvarez-Pol, H. [Universidad de Santiago de Compostela, E-15782 (Spain); Bendel, M. [Technische Universität München, 80333 (Germany); Cortina-Gil, D. [Universidad de Santiago de Compostela, E-15782 (Spain); Gernhäuser, R.; Le Bleis, T. [Technische Universität München, 80333 (Germany); Maj, A. [Polish Acad. Sci., H Niewodniczanski Inst Nucl Phys, PL-31342 Krakow (Poland); Nilsson, T. [Chalmers University of Technology, S-41296 Göteborg (Sweden); Perea, A. [Instituto de Estructura de la Materia, CSIC, E-28006 Madrid (Spain); Pietras, B. [Universidad de Santiago de Compostela, E-15782 (Spain); Ribeiro, G.; Sánchez del Río, J.; Sánchez Rosado, J. [Instituto de Estructura de la Materia, CSIC, E-28006 Madrid (Spain); Heinz, A. [Chalmers University of Technology, S-41296 Göteborg (Sweden); Szpak, B. [Polish Acad. Sci., H Niewodniczanski Inst Nucl Phys, PL-31342 Krakow (Poland); Winkel, M. [Technische Universität München, 80333 (Germany); Zieblinski, M. [Polish Acad. Sci., H Niewodniczanski Inst Nucl Phys, PL-31342 Krakow (Poland)


    A new phoswich array, for the detection of high-energy protons and gamma rays from nuclear reactions, has been built. This new detector consists of four individual closely packed scintillator detectors, each of them made of 4 cm of LaBr{sub 3}(Ce) and 6 cm of LaCl{sub 3}(Ce) in phoswich configuration (optically coupled and with a common readout). In this paper we report on the results of a beam test performed at the Bronowice Cyclotron Centre (CCB) in Krakow, showing the response of this versatile instrument to high energy protons (70–230 MeV). Furthermore, for the first time we prove that we can reconstruct the original energy of fast protons (E>200MeV) which pass through the total length of the crystal while still retaining a good energy resolution.

  10. Electron and electron-phonon effects in quasi-two-dimensional molecular conductor θ-(BETS)4HgBr4(C6H5Cl): optical investigations at 300-15 K

    International Nuclear Information System (INIS)

    One studied the polarized spectra of reflection and spectra of optical transmission of θ-(BETS)4HgBr4(C6H5Cl) quasi-two-dimensional molecular conductor within 700-6500 cm-1 range under 300-15 K temperatures and within 9000-40000 cm-1 under 300 K for two principal directions within crystal plane parallel to conducting layers of BETS molecules. Under 300 K within IR region the spectra are characterized by the intensive essential peculiarities (1200-1400 cm-1) caused by electron-oscillation coupling (EOC). At temperature drop within 180-80 K range one observes in the spectra a Lorentz term with ωt = 2900 cm-1 and three extra bands within 800-1180 cm-1 region caused by EOC. The derived results are indicative of unstable structural distortions along two principal directions in a crystal followed by formation of a charge density comparable wave

  11. Thermopower studies of a series of salts of tetramethyltetrathiafulvalene [(TMTTF)2X, X=Br, ClO4, NO3, SCN, BF4, AsF6, and PF6

    DEFF Research Database (Denmark)

    Mortensen, Kell; Conwell, E. M.; Fabre, J. M.


    Thermoelectric power measurements on a group of tetramethyltetrathiafulvalene (TMTTF)2X salts show a wide variety of behavior. In the range of temperatures 300≥T≳100 K several of the salts (X=BF4, ClO4, NO3, SCN) have a constant thermopower S≃35 μV/K, while the PF6 and AsF6 salts have S∝1 / T, and...... the Br salt has S increasing with T. Below ∼100 K, S shows a steep increase or decrease with decreasing temperature for each salt which, with the exception of the SCN salt, is not associated with a phase transition. These materials had been identified as semiconductors below the maximum in...

  12. A rapid method for the measurement of sulfur hexafluoride (SF6), trifluoromethyl sulfur pentafluoride (SF5CF3), and Halon 1211 (CF2ClBr) in hydrologic tracer studies (United States)

    Busenberg, Eurybiades; Plummer, L. Niel


    A rapid headspace method for the simultaneous laboratory determination of intentionally introduced hydrologic tracers, sulfur hexafluoride (SF6), trifluoromethyl sulfur pentafluoride (SF5CF3), Halon 1211 (CF2ClBr), and other halocarbons in water and gases is described. The high sensitivity of the procedure allows for introduction of minimal tracer mass (a few grams) into hydrologic systems with a large dynamic range of analytical detection (dilutions to 1:108). Analysis times by gas chromatography with electron capture detector are less than 1 min for SF6; about 2 min for SF6 and SF5CF3; and 4 min for SF6, SF5CF3, and Halon 1211. Many samples can be rapidly collected, preserved in stoppered septum bottles, and analyzed at a later time in the laboratory. Examples are provided showing the effectiveness of the gas tracer test studies in varied hydrogeological settings.

  13. A rapid method for the measurement of sulfur hexafluoride (SF6), trifluoromethyl sulfur pentafluoride (SF5CF3), and Halon 1211 (CF2ClBr) in hydrologic tracer studies (United States)

    Busenberg, Eurybiades; Plummer, L. Niel


    A rapid headspace method for the simultaneous laboratory determination of intentionally introduced hydrologic tracers, sulfur hexafluoride (SF6), trifluoromethyl sulfur pentafluoride (SF5CF3), Halon 1211 (CF2ClBr), and other halocarbons in water and gases is described. The high sensitivity of the procedure allows for introduction of minimal tracer mass (a few grams) into hydrologic systems with a large dynamic range of analytical detection (dilutions to 1:108). Analysis times by gas chromatography with electron capture detector are less than 1 min for SF6; about 2 min for SF6 and SF5CF3; and 4 min for SF6, SF5CF3, and Halon 1211. Many samples can be rapidly collected, preserved in stoppered septum bottles, and analyzed at a later time in the laboratory. Examples are provided showing the effectiveness of the gas tracer test studies in varied hydrogeological settings.

  14. Analytical formulae for total cross sections for electron scattering by atoms (N, O, F, Ne, P, S, Cl, Ar, As, Se, Br, Kr) between 0.5-10 keV

    Energy Technology Data Exchange (ETDEWEB)

    Williart, A. [Univ. Nacional de Educacion a Distancia, Madrid (Spain). Dept. de Fisica de los Materiales; Garcia, G. [Centro de Investigaciones Energeticas, Medioambientales y Tecnologicas, Madrid (Spain)


    Analytical formulae for total cross sections for electron scattering by atoms which are close to the noble gases (Ne, Ar and Kr), for electron energies ranging from 0.5 to 10 keV, have been obtained in this study. We have shown, previously, that molecular total cross sections, at these energies, depend on target polarizability and the number of target electrons. A similar behaviour has been supposed for total cross sections of some atoms (N, O, F, P, S, Cl, As, Se and Br). The obtained expression depends on atomic parameters and it is based in some correlation derived from noble gases. The applicability of the formula has been checked by comparison with available data for atomic oxygen. (orig.)

  15. Comprehensive interferometric characterization of red and near-infrared emissions of C, H, N, O, F, Cl, Br, I, P, S, and Si in a 370-W microwave-induced helium plasma

    International Nuclear Information System (INIS)

    The red/near-infrared emission spectrum from a 370-W atmospheric pressure helium microwave-induced plasma (MIP) has been characterized for eleven nonmetals with a Fourier transform spectrometer and silicon photodiode detector. A comprehensive list of all observed lines and relative intensities has been tabulated for MIP-excited emissions of C, H, N, O, F, Cl, Br, I, P, S, Si, and the helium background in the diode detector region 15,750 to 8500 cm-1 (6349--11,764 A). Many of these red/near-infrared lines (especially of phosphorous and silicon) are reported for the first time in an analytically useful plasma. Data for silicon and phosphorus are shown to fit known Grotrian diagrams. The data of this paper were used with corresponding known upper-state energies and transitions to construct a partial Grotrian diagram for helium plasma emissions of iodine

  16. Crystal structure, phase transition and ferroelectric properties of the [(CH3)3NH]3[Sb2Cl9(1-x)Br9x] (TMACBA) mixed crystals (United States)

    Wojtas, M.; Bator, G.; Jakubas, R.; Zaleski, J.


    The paraelectric-ferroelectric phase transition in the [(CH3)3NH]3[Sb2Cl9(1-x) Br9x] (TMACBA) mixed crystals is investigated by the differential scanning calorimetry, dilatometric and dielectric methods. The phase transition is found at 363.5, 362.7, 360.5 and 350.9 K (on cooling) for TMACBA crystals with x = 0, 0.02, 0.17 and 0.42, respectively. The crystal structures of the pure bromine analogue (x = 1), TMABA, and the mixed crystal TMACBA (x = 0.55) are determined at 297 K. TMABA crystallizes in the trigonal space group Rbar 3c: a = 15.098(2) Å, c = 21.906(4) Å, Z = 3, R1 = 0.0393, wR2 = 0.0746. Its structure is built up of discrete Sb2Br93- bioctahedra and disordered trimethylammonium cations. Ferroelectric TMACBA (x = 0.55) crystallizes in the monoclinic space group Pc: a = 10.245(2) Å, b = 9.122(2) Å, c = 15.549(3) Å, beta = 90.52(3)°, Z = 2, R1 = 0.0340, wR2 = 0.0712. The crystal is built of two-dimensional layer anions ('honeycomb-like structure') and three trimethylammonium cations. Dielectric studies on TMACBA (x = 0.42) in the frequency range 75 kHz-900 MHz indicate relatively fast reorientation of the trimethylammonium cations over the paraelectric phase. The ferroelectricity of mixed crystals is preserved for Br concentration smaller than 0.60 +/- 0.05. The polar properties are strictly connected with the presence of the polyanionic layer structure. A possible mechanism for the paraelectric-ferroelectric phase transition in the TMACBA mixed crystals is discussed on the basis of the results presented.

  17. Crystal structure, phase transition and ferroelectric properties of the [(CH3)3NH]3[Sb2Cl9(1-x)Br9x] (TMACBA) mixed crystals

    International Nuclear Information System (INIS)

    The paraelectric-ferroelectric phase transition in the [(CH3)3NH]3[Sb2Cl9(1-x) Br9x] (TMACBA) mixed crystals is investigated by the differential scanning calorimetry, dilatometric and dielectric methods. The phase transition is found at 363.5, 362.7, 360.5 and 350.9 K (on cooling) for TMACBA crystals with x = 0, 0.02, 0.17 and 0.42, respectively. The crystal structures of the pure bromine analogue (x = 1), TMABA, and the mixed crystal TMACBA (x = 0.55) are determined at 297 K. TMABA crystallizes in the trigonal space group R3-bar c: a = 15.098(2) A, c 21.906(4) A, Z = 3, R1 = 0.0393, wR2 = 0.0746. Its structure is built up of discrete Sb2Br93- bioctahedra and disordered trimethylammonium cations. Ferroelectric TMACBA (x = 0.55) crystallizes in the monoclinic space group Pc: a = 10.245(2) A, b = 9.122(2) A, c = 15.549(3) A, β = 90.52(3)deg , Z = 2, R1 = 0.0340, wR2 = 0.0712. The crystal is built of two-dimensional layer anions ('honeycomb-like structure') and three trimethylammonium cations. Dielectric studies on TMACBA (x = 0.42) in the frequency range 75 kHz-900 MHz indicate relatively fast reorientation of the trimethylammonium cations over the paraelectric phase. The ferroelectricity of mixed crystals is preserved for Br concentration smaller than 0.60 ± 0.05. The polar properties are strictly connected with the presence of the polyanionic layer structure. A possible mechanism for the paraelectric-ferroelectric phase transition in the TMACBA mixed crystals is discussed on the basis of the results presented

  18. Band Gaps of the Lead-Free Halide Double Perovskites Cs2BiAgCl6 and Cs2BiAgBr6 from Theory and Experiment. (United States)

    Filip, Marina R; Hillman, Samuel; Haghighirad, Amir Abbas; Snaith, Henry J; Giustino, Feliciano


    The recent discovery of lead-free halide double perovskites with band gaps in the visible represents an important step forward in the design of environmentally friendly perovskite solar cells. Within this new family of semiconductors, Cs2BiAgCl6 and Cs2BiAgBr6 are stable compounds crystallizing in the elpasolite structure. Following the recent computational discovery and experimental synthesis of these compounds, a detailed investigation of their electronic properties is warranted in order to establish their potential as optoelectronic materials. In this work, we perform many-body perturbation theory calculations and obtain high accuracy band gaps for both compounds. In addition, we report on the synthesis of Cs2BiAgBr6 single crystals, which are stable in ambient conditions. From our complementary theoretical and experimental analysis, we are able to assign the indirect character of the band gaps and obtain both experimental and theoretical band gaps of these novel semiconductors that are in close agreement. PMID:27322413

  19. Theoretical calculations of spin-Hamiltonian parameters for the (MoOX{sub 5}){sup 2−} (X=Cl, Br) metallic complexes in solution or frozen-glass

    Energy Technology Data Exchange (ETDEWEB)

    Mei, Yang [School of Physics and Electronic Engineering, Mianyang Normal University, Mianyang 621000 (China); Research Center of Laser Fusion, CAEP, Mianyang 621900 (China); Research Center of Computational Physics, Mianyang Normal University, Mianyang 621000 (China); Zheng, Wen-Chen, E-mail: [Department of Material Science, Sichuan University, Chengdu 610064 (China); Zhang, Lin [Research Center of Laser Fusion, CAEP, Mianyang 621900 (China); Chen, Bo-Wei [School of Physics and Electronic Engineering, Mianyang Normal University, Mianyang 621000 (China); Research Center of Laser Fusion, CAEP, Mianyang 621900 (China); Research Center of Computational Physics, Mianyang Normal University, Mianyang 621000 (China)


    The spin-Hamiltonian parameters (g factors g{sub //}, g{sub ⊥} and hyperfine structure constants A{sub //}, A{sub ⊥}) of the (MoOX{sub 5}){sup 2−} (X=Cl, Br) metallic complexes in solution or frozen-glass are calculated from the high-order perturbation formulas based on the two-mechanism model. In these formulas, the contributions to spin-Hamiltonian parameters due to both the widely-applied crystal-field (CF) mechanism and the charge-transfer (CT) mechanism (which is neglected in CF theory) are taken into account, and the needed CF and CT energy levels are obtained from the optical spectra. The calculated results with two adjustable parameters are in reasonable agreement with the experimental values. The calculations show that (i) the relative importance of CT mechanism in (MoOBr{sub 5}){sup 2−} metallic complexes is larger than that in (MoOCl{sub 5}){sup 2−} ones because of the stronger covalence of Mo{sup 5+}–Br{sup −} combination, and (ii) in both (MoOCl{sub 5}){sup 2−} and (MoOBr{sub 5}){sup 2−} metallic complexes, the contributions to spin-Hamiltonian parameters due to CT mechanism should also be taken into account because of the high valence state of Mo{sup 5+} ion.

  20. Spectroscopic investigation and mid-infrared luminescence properties of the Pr{sup 3+}-doped low phonon single crystals CsCdBr{sub 3}, KpB{sub 2}Cl{sub 5} and Tl{sub 3}PbBr{sub 5}

    Energy Technology Data Exchange (ETDEWEB)

    Ferrier, Alban, E-mail: alban.ferrier@ensicaen.f [Centre de Recherche sur les Ions, les Materiaux et la Photonique (CIMAP), UMR 6252 CEA-CNRS-ENSICAEN, Universite de Caen, 14050 Caen (France); French-German Research Institute of Saint Louis (ISL), P.O.Box 70034 F-68301 SAINT-LOUIS CEDEX (France); Velazquez, Matias; Doualan, Jean-Louis; Moncorge, Richard [Centre de Recherche sur les Ions, les Materiaux et la Photonique (CIMAP), UMR 6252 CEA-CNRS-ENSICAEN, Universite de Caen, 14050 Caen (France)


    The low phonon materials KPb{sub 2}Cl{sub 5,} CsCdBr{sub 3} and Tl{sub 3}PbBr{sub 5} were successfully grown by using the Bridgman-Stockbarger method. These crystals were stable, homogeneous, no moisture sensitive and could be doped with Pr{sup 3+} ions. Spectroscopic properties of the {sup 3}H{sub 5}->{sup 3}H{sub 4} Pr{sup 3+} transition have been investigated for the three low phonon materials. Absorption and emission cross sections of this transition around 3.8-5.5 {mu}m are broad and present high peak values. Furthermore, gain cross sections derived from these measurements could be positive for small population inversion ratio. Finally, the performance of a continuous wave Pr-doped low phonon single-crystal laser operating on this transition is studied using numerical modelling. By this way it was possible to demonstrate that compact solid-state laser systems could be achieved via quantum-cascade laser (QCL) pumping.

  1. Ammonium dynamics in the disordered α-phase of K1-x(NH4)xY (Y = Cl, Br, I). A neutron scattering study

    International Nuclear Information System (INIS)

    The effect of temperature and concentration on the lattice parameters and amplitude-weighted phonon density of states in mixed salts of ammonium-potassium halides is investigated by neutron powder diffraction and incoherent inelastic neutron scattering. In the disordered α-phase (NaCl type) ammonium ions exhibit a fast stochastic reorientation at phonon frequency rates down to ca. 80 K. At 10 K, the incoherent inelastic neutron scattering spectra display four distinct ammonium excitations: two (resonant) modes below and two (localized) above the Debye cut-off energy of potassium halides. High-frequency localized modes correspond to translational and librational vibrations of NH4 ions. These modes are typical for the ordered phases of ammonium halides. The effect of ammonium concentration on localized and resonant modes is studied for the K1-x(NH4)xI mixed salts. The harmonic excitations of ammonium in a hypothetical low-temperature α-phase of NH4I are approximated to ca. 30, 95, 155 and 250 cm-1. In a real low-temperature ordered γ-phase of NH4I, translational ammonium vibrations are observed at ca. 140-160 cm-1 and librational vibrations at ca.300 cm-1

  2. Thermoluminescence response of new KClxBr1-x :EuCl3 sintered phosphors exposed to beta and gamma radiation

    International Nuclear Information System (INIS)

    Alkali halides crystals have been the subject of intense research for an understanding of their radiation-induced defects and luminescence properties. They exhibit noteworthy thermoluminescence (TL) properties when exposed to ionising radiation. Currently, these materials are grown employing expensive and rather complicated techniques. In this work, the results on the TL properties of new alkali halides phosphors fabricated by a simple and inexpensive procedure are presented. The samples were made by mixing KCl, KBr and EuCl3 salts, and compressing them at a pressure of 3.2 x 107 Pa during 3 min, followed by sintering at 700 deg. C during 24 h under air atmosphere. The dosimetric response of the samples showed an increase with radiation dose in the 1.5-20.0 Gy dose range for beta and gamma radiation. The TL glow curves in sintered samples presented significant differences in their peak structures compared with monocrystalline samples, indicating that the nature of the trapping states and the recombination mechanisms may be different. (authors)

  3. Evaluation of the levels of Br, Cl, K, Mg, Mn and V in Perna perna mussels (Linnaeus, 1758: Mollusca Bivalvia) collected in the coast of Sao Paulo state, Brazil

    International Nuclear Information System (INIS)

    The coastal environment has been heavily altered by multiple environmental impacts of human activities, such as disposal of sewage from urban areas, the release of numerous chemical industries, agriculture and the flow of vessels, which can lead to accidental spills of oil and oil products, fuels and other products transported by sea. In this context, a means of determining concentrations of these potentially toxic substances in the sea water is the biomonitoring by means of different types of bivalves, which have been used by various researchers, in Brazil and other countries. With regard to bivalve mollusks, particularly mussels, their use in monitoring the marine contamination is mainly due to their wide geographic distribution, sessile habit and ability to concentrate toxic metals to 102-105 times in relation to the concentrations detected in water. In the present study, we employed the passive biomonitoring using the Perna perna bivalve mollusk with respect to the elements Br, Cl, K, Mg, Mn and V. These elements were chosen since they can be determined by INAA method (Instrumental Neutron Activation Analysis), by means of short irradiation which provides faster analyzes and also due to their importance from the standpoint of environmental or nutritional studies. The aim of this study was to evaluate the content of Br, Cl, K, Mg, Mn and V in samples of Perna perna mussels (Linnaeus, 1758: Mollusca, Bivalvia) collected in coastal regions of São Paulo subject to anthropogenic contamination (Ponta de Itaipu and Palmas Island, in Santos), comparing the values obtained in sites potentially impacted with the values of the control site in Praia da Cocanha, in Caraguatatuba. The collection points located in São Paulo coast are located in the geographical areas 23º 37'S - 45° 24' W (Caraguatatuba) and 23º 57'S - 46º 20' W (Santos). The collection of organisms was performed in all seasons of the year, beginning in spring 2008 and ending in winter 2009. The samples

  4. Crystal structure, phase transition and ferroelectric properties of the [(CH{sub 3}){sub 3}NH]{sub 3}[Sb{sub 2}Cl{sub 9(1-x)}Br{sub 9x}] (TMACBA) mixed crystals

    Energy Technology Data Exchange (ETDEWEB)

    Wojtas, M [Faculty of Chemistry, University of Wroclaw, Joliot-Curie 14, 50-383 Wroclaw (Poland); Bator, G [Faculty of Chemistry, University of Wroclaw, Joliot-Curie 14, 50-383 Wroclaw (Poland); Jakubas, R [Faculty of Chemistry, University of Wroclaw, Joliot-Curie 14, 50-383 Wroclaw (Poland); Zaleski, J [Institute of Chemistry, University of Opole, Oleska 48, 45-951 Opole (Poland)


    The paraelectric-ferroelectric phase transition in the [(CH{sub 3}){sub 3}NH]{sub 3}[Sb{sub 2}Cl{sub 9(1-x)} Br{sub 9x}] (TMACBA) mixed crystals is investigated by the differential scanning calorimetry, dilatometric and dielectric methods. The phase transition is found at 363.5, 362.7, 360.5 and 350.9 K (on cooling) for TMACBA crystals with x = 0, 0.02, 0.17 and 0.42, respectively. The crystal structures of the pure bromine analogue (x = 1), TMABA, and the mixed crystal TMACBA (x = 0.55) are determined at 297 K. TMABA crystallizes in the trigonal space group R3-bar c: a = 15.098(2) A, c 21.906(4) A, Z = 3, R{sub 1} = 0.0393, wR{sub 2} = 0.0746. Its structure is built up of discrete Sb{sub 2}Br{sub 9}{sup 3-} bioctahedra and disordered trimethylammonium cations. Ferroelectric TMACBA (x = 0.55) crystallizes in the monoclinic space group Pc: a = 10.245(2) A, b = 9.122(2) A, c = 15.549(3) A, {beta} = 90.52(3)deg , Z = 2, R{sub 1} = 0.0340, wR{sub 2} = 0.0712. The crystal is built of two-dimensional layer anions ('honeycomb-like structure') and three trimethylammonium cations. Dielectric studies on TMACBA (x = 0.42) in the frequency range 75 kHz-900 MHz indicate relatively fast reorientation of the trimethylammonium cations over the paraelectric phase. The ferroelectricity of mixed crystals is preserved for Br concentration smaller than 0.60 {+-} 0.05. The polar properties are strictly connected with the presence of the polyanionic layer structure. A possible mechanism for the paraelectric-ferroelectric phase transition in the TMACBA mixed crystals is discussed on the basis of the results presented.

  5. Absolute NMR shielding scales and nuclear spin–rotation constants in 175LuX and 197AuX (X = 19F, 35Cl, 79Br and 127I)

    International Nuclear Information System (INIS)

    We present nuclear spin–rotation constants, absolute nuclear magnetic resonance (NMR) shielding constants, and shielding spans of all the nuclei in 175LuX and 197AuX (X = 19F, 35Cl, 79Br, 127I), calculated using coupled-cluster singles-and-doubles with a perturbative triples (CCSD(T)) correction theory, four-component relativistic density functional theory (relativistic DFT), and non-relativistic DFT. The total nuclear spin–rotation constants determined by adding the relativistic corrections obtained from DFT calculations to the CCSD(T) values are in general in agreement with available experimental data, indicating that the computational approach followed in this study allows us to predict reliable results for the unknown spin–rotation constants in these molecules. The total NMR absolute shielding constants are determined for all the nuclei following the same approach as that applied for the nuclear spin–rotation constants. In most of the molecules, relativistic effects significantly change the computed shielding constants, demonstrating that straightforward application of the non-relativistic formula relating the electronic contribution to the nuclear spin–rotation constants and the paramagnetic contribution to the shielding constants does not yield correct results. We also analyze the origin of the unusually large absolute shielding constant and its relativistic correction of gold in AuF compared to the other gold monohalides

  6. Thermodynamics of the amalgam cells {Cs-amalgam|CsX (m)|AgX|Ag} (X=Cl, Br, I) and primary medium effects in (methanol+water) (acetonitrile+water), and (1,4-dioxane+water) solvent mixtures

    International Nuclear Information System (INIS)

    The potential difference E of the amalgam cell {CsxHg1-x|CsX (m)|AgX|Ag} (X=Cl, Br, I) has been measured as a function of the mole fraction xCs of Cs metal in amalgams and of the molality m of CsX in (methanol+water) (acetonitrile+water), and (1,4-dioxane+water) solvent mixtures containing up to 0.75 mass fraction of the organic component, at the temperature 298.15K. The respective standard molal potential differences Emo have been determined together with the relevant activity coefficients γ+/- as functions of the CsX molality. The found Emo values show a parabolic decrease with increasing proportion of the organic component in the solvent mixture. Analysis of the relevant primary medium effects upon CsX shows that the CsX transfer from the standard state in water to the standard state in the (aqueous+organic) mixture is always unfavoured, and the acetonitrile is the least unfavoured co-solvent studied. Analysis of the primary medium effect upon CsI in terms of Feakins and French's theory leads to a primary hydration number close to zero, which is consistent with the results of supplementary EXAFS experiments on Cs+ and I- in (acetonitrile+water) solvent mixtures

  7. Theoretical study of the nuclear spin-molecular rotation coupling for relativistic electrons and non-relativistic nuclei. II. Quantitative results in HX (X = H,F,Cl,Br,I) compounds. (United States)

    Aucar, I Agustín; Gómez, Sergio S; Melo, Juan I; Giribet, Claudia C; Ruiz de Azúa, Martín C


    In the present work, numerical results of the nuclear spin-rotation (SR) tensor in the series of compounds HX (X = H,F,Cl,Br,I) within relativistic 4-component expressions obtained by Aucar et al. [J. Chem. Phys. 136, 204119 (2012)] are presented. The SR tensors of both the H and X nuclei are discussed. Calculations were carried out within the relativistic Linear Response formalism at the Random Phase Approximation with the DIRAC program. For the halogen nucleus X, correlation effects on the non-relativistic values are shown to be of similar magnitude and opposite sign to relativistic effects. For the light H nucleus, by means of the linear response within the elimination of the small component approach it is shown that the whole relativistic effect is given by the spin-orbit operator combined with the Fermi contact operator. Comparison of "best estimate" calculated values with experimental results yield differences smaller than 2%-3% in all cases. The validity of "Flygare's relation" linking the SR tensor and the NMR nuclear magnetic shielding tensor in the present series of compounds is analyzed. PMID:23574208

  8. Mechanisms of the acid catalysed bridge cleavage reactions of two trinuclear ruthenium(III) complex ions (Ru3(NH3)13(SCN)X2)6+, (X=Cl-, Br-)

    International Nuclear Information System (INIS)

    Acid catalysed bridge cleavage reaction of two doubly bridged trinuclear ions [Ru3(NH3)13(SCN)X2]6+, (X=Cl-, Br-) have been investigated at 59o in perchloric and nitric acid media respectively. Both the complexes show two stages of reaction. Plots of kobs versus [acid] are linear for both the complexes in the two stages of reactions. Only the plots for first stage have intercept on rate axis. The rate constants for the chloro and the bromo complexes for acid - dependent path are as follows : first stage 5.15 x 10-4 and 2.43 x 10-4 dm3 mol-1 s-1 and second stage 7.35 x 10-3 and 4.02 x 10-4 dm3 mol-1s-1 respectively. An associative mechanism has been invoked for the reactions in which bond formation by the incoming solvent (water) molecule with the middle ruthenium atom leads to rupture of bridging bonds. (author)

  9. Electron and electron-phonon effects in quasi-two-dimensional molecular conductor theta-(BETS) sub 4 HgBr sub 4 (C sub 6 H sub 5 Cl): optical investigations at 300-15 K

    CERN Document Server

    Vlasova, R M; Petrov, B V; Semkin, N D; Zhilyaeva, E I; Bogdanova, O A; Lyubovskaya, R N; Graja, A


    One studied the polarized spectra of reflection and spectra of optical transmission of theta-(BETS) sub 4 HgBr sub 4 (C sub 6 H sub 5 Cl) quasi-two-dimensional molecular conductor within 700-6500 cm sup - sup 1 range under 300-15 K temperatures and within 9000-40000 cm sup - sup 1 under 300 K for two principal directions within crystal plane parallel to conducting layers of BETS molecules. Under 300 K within IR region the spectra are characterized by the intensive essential peculiarities (1200-1400 cm sup - sup 1) caused by electron-oscillation coupling (EOC). At temperature drop within 180-80 K range one observes in the spectra a Lorentz term with omega sub t = 2900 cm sup - sup 1 and three extra bands within 800-1180 cm sup - sup 1 region caused by EOC. The derived results are indicative of unstable structural distortions along two principal directions in a crystal followed by formation of a charge density comparable wave

  10. The Hydrogen Bonded Structures of Two 5-Bromobarbituric Acids and Analysis of Unequal C5–X and C5–X′ Bond Lengths (X = X′ = F, Cl, Br or Me in 5,5-Disubstituted Barbituric Acids

    Directory of Open Access Journals (Sweden)

    Thomas Gelbrich


    Full Text Available The crystal structure of the methanol hemisolvate of 5,5-dibromobarbituric acid (1MH displays an H-bonded layer structure which is based on N–H∙∙∙O=C, N–H∙∙∙O(MeOH and (MeOHO–H∙∙∙O interactions. The barbiturate molecules form an H-bonded substructure which has the fes topology. 5,5′-Methanediylbis(5-bromobarbituric acid 2, obtained from a solution of 5,5-dibromobarbituric acid in nitromethane, displays a N–H···O=C bonded framework of the sxd type. The conformation of the pyridmidine ring and the lengths of the ring substituent bonds C5–X and C5–X′ in crystal forms of 5,5-dibromobarbituric acid and three closely related analogues (X = X′ = Br, Cl, F, Me have been investigated. In each case, a conformation close to a C5-endo envelope is correlated with a significant lengthening of the axial C5–X′ in comparison to the equatorial C5–X bond. Isolated molecule geometry optimizations at different levels of theory confirm that the C5-endo envelope is the global conformational energy minimum of 5,5-dihalogenbarbituric acids. The relative lengthening of the axial bond is therefore interpreted as an inherent feature of the preferred envelope conformation of the pyrimidine ring, which minimizes repulsive interactions between the axial substituent and pyrimidine ring atoms.

  11. Spectroscopic Studies with N-Chloroarylsulphonamides: IR and 1H, 13C and 23Na Nmr Spectra of Sodium Salts of N-Chloro-Mono- and Di-Substituted-Benzenesulphonamides, 4-X-C6H4SO2NANCl (X = H; CH3; C2H5; F; Cl; Br; I or NO2) and i-X, j-YC6H3SO2NANCl (i-X, j-Y = 2,3-(CH3)2; 2,4-(CH3)2; 2,5-(CH3)2; 2-CH3, 4-Cl; 2-CH3, 5-Cl; 3-CH3, 4-Cl; 2,4-Cl2 or 3,4-Cl2) (United States)

    Gowda; D'Souza, J. D.; Kumar, B. H. Arun


    In an effort to introduce N-chloroarylsulphonamides of different oxydising strengths, sixteen sodium salts of N-chloro-mono- and di-substituted benzenesulphonamides of the configuration, 4- X-C6H4SO2NaNCl (where X = H; CH3; C2H5; F; Cl; Br; I or NO2) and i-X, j-YC6H3SO2NaNCl (where i-X, j-Y = 2,3-(CH3)2; 2,4-(CH3)2; 2,5-(CH3)2; 2-CH3,4-Cl; 2-CH3,5-Cl; 3-CH3,4-Cl; 2,4- Cl2 or 3,4-Cl2) are prepared, characterized through their infrared spectra in the solid state and NMR spectra in solution. The υN-Cl frequencies vary in the range 950 - 927 cm-1. Effects of substitution in the benzene ring in terms of electron donating and electron withdrawing groups have been considered, and conclusions drawn. The chemical shifts of aromatic protons and carbon-13 in all the N-chloroarylsulphonamides have been calculated by adding substituent contributions to the shift of benzene. Considering the approximation employed the agreement between the calculated and experimental chemical shift values for different protons or carbon-13 is quite good. Effects of phenyl ring substitution on chemical shift values of both 1H and 13C are also graphically represented in terms of line diagrams.

  12. Interaction in ternary HgBr2-BaBr2-CsBr system

    International Nuclear Information System (INIS)

    Series of polythermal sections in ternary HgBr2-BaBr2-CsBr system are investigated by the methods of physicochemical analysis. In double systems restricting ternary HgBr2-BaBr2-CsBr system formation of CsHg2Br5, CsHgBr3, Cs2HgBr4, CsBa2Br4 and CsBa2Br5 compounds is detected. Projection of liquidus surface of ternary HgBr2-BaBr2-CsBr system on triangle of compositions is plotted. This projection consists of eight fields of the primary crystallization of phases: HgBr2, BaBr2, CsBr, CsHgBr5, CsHgBr3, Cs2HgBr4, Cs2BaBr4 and CsBa2Br5. Coordinates of nonvariant points are determined

  13. Cd4As2Br3

    Directory of Open Access Journals (Sweden)

    Mohammed Kars


    Full Text Available Single crystals of Cd4As2Br3 (tetracadmium biarsenide tribromide were grown by a chemical transport reaction. The structure is isotypic with the members of the cadmium and mercury pnictidohalides family with general formula M4A2X3 (M = Cd, Hg; A = P, As, Sb; X = Cl, Br, I and contains two independent As atoms on special positions with site symmetry -3 and two independent Cd atoms, of which one is on a special position with site symmetry -3. The Cd4As2Br3 structure consists of AsCd4 tetrahedra sharing vertices with isolated As2Cd6 octahedra that contain As–As dumbbells in the centre of the octahedron. The Br atoms are located in the voids of this three-dimensional arrangement and bridge the different polyhedra through Cd...Br contacts.

  14. NQR and X-ray crystal structure studies of cadmium halide complexes: [C(NH{sub 2}){sub 3}]CdI{sub 3} and [4-ClC{sub 6}H{sub 5}NH{sub 3}]{sub 3}CdBr{sub 5}

    Energy Technology Data Exchange (ETDEWEB)

    Gesing, Thorsten M.; Lork, Enno [Bremen Univ. (Germany). MAPEX Center for Material and Processes; Terao, Hiromitsu [Tokushima Univ. (Japan). Faculty of Integrated Arts and Sciences; Ishihara, Hideta [Saga Univ. (Japan). Faculty of Culture and Education


    The crystal structures of [C(NH{sub 2}){sub 3}]CdI{sub 3} (1) and [4-ClC{sub 6}H{sub 5}NH{sub 3}]{sub 3}CdBr{sub 5} (2) have been determined at 100 K: monoclinic, Cc, a = 828.75(3) pm, b = 1615.31(5) pm, c = 810.64(3) pm, and β = 106.5820(10) for 1; monoclinic, P2{sub 1}/c, a = 1486.93(5) pm, b = 794.31(3) pm, c = 2290.59(7) pm, and β = 99.6830(10) for 2. The structure of 1 has an infinite chain of anions consisting of [CdI{sub 4}] tetrahedra sharing two corners. The structure of 2 has an infinite chain of anions consisting of [CdBr{sub 6}] octahedra sharing two corners in cis positions. In both structures, isolated cations are connected to the anion chains through weak hydrogen bonds Cd-X..H to result in three-dimensional network structures. In accordance with the crystal structures, three {sup 127}I (m = ±1/2 <-> m = ±3/2), five {sup 81}Br, and three {sup 35}Cl nuclear quadrupole resonance (NQR) lines were observed for 1 and 2. The NQR spectra reflect the anion chain structures and their weak hydrogen bonds. The MO calculations of the models [Cd{sub 5}I{sub 16}]{sup 6-} for 1 and [Cd{sub 3}Br{sub 16}]{sup 10-} for 2 estimate only about half the values for the NQR frequencies but give accurate electric field gradient directions.

  15. Dispositif de distribution quantique de clé avec des<br />états cohérents à longueur d'onde télécom


    Lodewyck, Jérôme


    La distribution quantique de clé permet la transmission d'une clé de cryptage secrète entre deux interlocuteurs distants. Les lois de la physique quantique garantissent la sécurité inconditionnelle du transfert.L'utilisation de variables continues dans le domaine de l'information quantique, récemment apparue, permet de concevoir des systèmes de distribution quantique de clé qui ne nécessitent que des composants standards de l'industrie des télécommunications. Ces composants ouvrent la voie ve...

  16. Spectra and energy levels of Br XXV, Br XXIX, Br XXX, and Br XXXI

    International Nuclear Information System (INIS)

    Emission lines of highly ionized bromine in the wavelength region 17-93 A have been identified in spectra recorded at the University of Rochester's OMEGA laser facility. The wavelengths of 2s-2p transitions in nitrogen-like Br XXIX, carbon-like Br XXX, and boron-like Br XXXI are presented. The wavelengths of the magnetic dipole transitions within the 2s22p3 ground configurations of Br XXIX are predicted from the experimental energy levels. Transitions from the n = 4 and 5 levels of sodium-like Br XXV were also identified, and the ionization energy of Br XXV was determined to be 9,023,800 +- 2 000cm-1 (1118.8 +- 0.2 eV)

  17. Reactor BR2

    International Nuclear Information System (INIS)

    The BR2 reactor is still SCK-CEN's most important nuclear facility. After an extensive refurbishment to compensate for the ageing of the installation, the reactor was restarted in April 1997. Various aspects concerning the operation of the BR2 Reactor, the utilisation of the CALLISTO loop and the irradiation programme, the BR2 R and D programme and the production of isotopes and of NTD-silicon are discussed. Progress and achievements in 1999 are reported

  18. Hydrogen for X-group exchange in CH3X, X = Cl, Br, I, OMe and NMe2 byMonomeric [1,2,4-(Me3C)3C5H2]2CeH: Experimental and Computational Support for a Carbenoid Mechanism

    Energy Technology Data Exchange (ETDEWEB)

    Werkema, Evan; Andersen, Richard; Yahia, Ahmed; Maron, Laurent; Eisenstein, Odile


    The reaction between [1,2,4-(Me3C)3C5H2]2CeH, referred to as Cp'2CeH, andCH3X where X is Cl, Br, I, OMe and NMe2, are described. The reactions fall intothree distinct classes. Class a, where X = Cl, Br and I rapidly form Cp'2CeX and CH4without formation of identifiable intermediates in the 1H NMR spectra. Class b, whereX = OMe proceeds rapidly to Cp'2Ce(eta2-CH2OMe) and H2 and then to Cp'2CeOMeand CH4. The methoxymethyl derivative is sufficiently stable to be isolated andcharacterized and it is rapidly converted to Cp'2CeOMe in presence of BPh3. Class c,where X = NMe2 does not result in formation of Cp'2CeNMe2, but deuterium labelingexperiments show that H for D exchange occurs in NMe3. Density functionalcalculations DFT(B3PW91) on the reaction of (C5H5)2CeH, referred to as Cp2CeH,and CH3X show that the barrier for alpha-CH activation, resulting in formation ofCp2Ce(eta2-CH2X), proceeds with a relatively low activation barrier (DeltaG++) but thesubsequent ejection of CH2 and trapping by H2 has a higher barrier; the height of thesecond barrier lies in the order F, Cl, Br, I< OMe<< NMe2, consistent with theexperimental studies. The DFT calculations also show that the two-step reaction,which proceeds through a carbenoid intermediate, has a lower barrier than a directone-step sigma bond metathesis mechanism. The reaction of Cp2CeCH2OMe and BPh3 is calculated to be a low barrier process and the ylide, CH2(+)BPh3(-), is a transition state and not an intermediate.

  19. Thermal Variance Investigation and Scintillation Mechanisms of Cs2LiLaBr6-xClx:Ce (CLLBC) and Cs2LiYBr6:Ce (CLYB)

    Energy Technology Data Exchange (ETDEWEB)

    Coupland, Daniel David Schechtman [Los Alamos National Laboratory; Budden, Brent Scott [Los Alamos National Laboratory; Stonehill, Laura Catherine [Los Alamos National Laboratory


    We perform an investigation into the scintillation processes and performance of elpasolites Cs2LiLaBr6-xClx:Ce (CLLBC) and Cs2LiYBr6:Ce (CLYB) using a thermal cycle over a range of -20 to +50º C. At 10º increments, we acquire data with both a waveform digitizer and charge-integrating electronics. We identify decay components and evaluate decay times, thermal neutron gamma-equivalent energy (GEE), and pulse shape discrimination (PSD) performance. Results are compared to common Cs2LiYCl6:Ce (CLYC).

  20. Structure and Heats of Formation of Iodine Fluorides and the Respective Closed-Shell Ions from CCSD(T) Electronic Structure Calculations and Reliable Prediction of the Steric Activity of the Free-Valence Electron Pair in ClF₆⁻, BrF₆⁻, and IF₆⁻

    Energy Technology Data Exchange (ETDEWEB)

    Dixon, David A.; Grant, Daniel J.; Christe, Karl O.; Peterson, Kirk A.


    The research described in this product was performed in part in the Environmental Molecular Sciences Laboratory, a national scientific user facility sponsored by the Department of Energy's Office of Biological and Environmental Research and located at Pacific Northwest National Laboratory. Atomization energies at 0 K and heats of formation at 0 and 298 K are predicted for IF, IF₂-, IF₂+, IF₃, IF₄-, IF₄+,IF₅, IF₆-, IF₆+, IF₇, IF₈-, BrF₆-, and ClF₆- from coupled cluster theory [CCSD(T)] calculations with effective-core potential correlation-consistent basis sets for I. In order to achieve near chemical accuracy (±1 kcal/mol), three corrections were added to the complete basis set binding energies based on frozen-core coupled-cluster theory energies: a correction for core-valence effects, a correction for scalar relativistic effects, and a correction for firstorder atomic spin-orbit effects. Vibrational zero-point energies were computed at the coupled-cluster level of theory except for IF₆-, IF₇, and IF₈-. The calculated heats of formation for the neutral and ionic IFn fluorides were used to predict fluoride affinities. It is shown that high-level calculations are required to predict correctly the steric activity of the free-valence electron pair on the central atoms in IF₆- (C₃v), BrF₆- (Oh), and ClF₆- (Oh). The vibrational spectrum of IF₈- was reanalyzed, and complete mode descriptions for square-antiprismatic XF₈ species of D₄d symmetry are given.

  1. The association between content of the elements S, Cl, K, Fe, Cu, Zn and Br in normal and cirrhotic liver tissue from Danes and Greenlandic Inuit examined by dual hierarchical clustering analysis

    DEFF Research Database (Denmark)

    Laursen, Jens; Milman, Nils; Pind, N.;


    contents according to calculated similarities, one clustering elements according to correlation coefficients between the element contents, both using Euclidian distance and Ward Procedure. RESULTS: One dendrogram separated subjects in 7 clusters showing no differences in ethnicity, gender or age. The...... analysis discriminated between elements in normal and cirrhotic livers. The other dendrogram clustered elements in four clusters: sulphur and chlorine; copper and bromine; potassium and zinc; iron. There were significant correlations between the elements in normal liver samples: S was associated with Cl, K...

  2. The BR eigenvalue algorithm

    Energy Technology Data Exchange (ETDEWEB)

    Geist, G.A. [Oak Ridge National Lab., TN (United States). Computer Science and Mathematics Div.; Howell, G.W. [Florida Inst. of Tech., Melbourne, FL (United States). Dept. of Applied Mathematics; Watkins, D.S. [Washington State Univ., Pullman, WA (United States). Dept. of Pure and Applied Mathematics


    The BR algorithm, a new method for calculating the eigenvalues of an upper Hessenberg matrix, is introduced. It is a bulge-chasing algorithm like the QR algorithm, but, unlike the QR algorithm, it is well adapted to computing the eigenvalues of the narrowband, nearly tridiagonal matrices generated by the look-ahead Lanczos process. This paper describes the BR algorithm and gives numerical evidence that it works well in conjunction with the Lanczos process. On the biggest problems run so far, the BR algorithm beats the QR algorithm by a factor of 30--60 in computing time and a factor of over 100 in matrix storage space.

  3. Energy levels of HoBr 63- (United States)

    Tanner, Peter A.


    The excitation, electronic absorption and luminescence spectra of cubic Cs 2NaHoBr 6 have been recorded at temperatures down to that of liquid helium. The detailed spectral analyses enable comparisons to be made of the crystal-field splittings of Russell—Saunders terms with those in Cs 2NaHoCl 6. Under intense 647.1 nm laser excitation, luminescence is observed in the neat material in the spectral region between 17800 and 21750 cm -1.

  4. Improving the Photoluminescence Properties of Perovskite CH3NH3PbBr3-xClx Films by Modulating Organic Cation and Chlorine Concentrations. (United States)

    Yan, Jun; Zhang, Bing; Chen, Yunlin; Zhang, Ao; Ke, Xiaohan


    The photoluminescence (PL) properties of inorganic-organic perovskites can be drastically changed by tuning the halogen composition, especially the Cl content. However, our research demonstrated that in addition to the influence of Cl concentration, the PL emission intensity of CH3NH3PbBr3 strongly depends on the content of CH3NH3Br in the coating solution. The effects of CH3NH3Br and Cl concentrations on the PL properties of CH3NH3PbBr3-xClx were investigated. We found that a strong PL emission intensity of CH3NH3PbBr3 can be obtained from solutions with a high CH3NH3Br concentration. The PL emission intensities of CH3NH3PbBr3-xClx films were enhanced by adjusting the molar ratio of PbBr to PbCl2 only in a highly concentrated CH3NH3Br environment. Moreover, it was found that an optimum CH3NH3Br/PbBr2/PbCl2 ratio in the precursor solutions can be used to obtain the strongest PL emission intensity of CH3NH3PbBr3-xClx films. Further studies revealed that both CH3NH3Br and Cl concentrations significantly influence the CH3NH3PbBr3-xClx films evolution, which affects their PL properties. PMID:27163386

  5. Ammonium dynamics in the disordered alpha-phase of K sub 1 sub - sub x (NH sub 4) sub x Y (Y = Cl, Br, I). A neutron scattering study

    CERN Document Server

    Natkaniec, I; Smirnov, L S


    The effect of temperature and concentration on the lattice parameters and amplitude-weighted phonon density of states in mixed salts of ammonium-potassium halides is investigated by neutron powder diffraction and incoherent inelastic neutron scattering. In the disordered alpha-phase (NaCl type) ammonium ions exhibit a fast stochastic reorientation at phonon frequency rates down to ca. 80 K. At 10 K, the incoherent inelastic neutron scattering spectra display four distinct ammonium excitations: two (resonant) modes below and two (localized) above the Debye cut-off energy of potassium halides. High-frequency localized modes correspond to translational and librational vibrations of NH sub 4 ions. These modes are typical for the ordered phases of ammonium halides. The effect of ammonium concentration on localized and resonant modes is studied for the K sub 1 sub - sub x (NH sub 4) sub x I mixed salts. The harmonic excitations of ammonium in a hypothetical low-temperature alpha-phase of NH sub 4 I are approximated...

  6. Reactor BR2. Introduction

    Energy Technology Data Exchange (ETDEWEB)

    Gubel, P


    The BR2 is a materials testing reactor and is still one of SCK-CEN's important nuclear facilities. After an extensive refurbishment to compensate for the ageing of the installation, the reactor was restarted in April 1997. During the last three years, the availability of the installation was maintained at an average level of 97.6 percent. In the year 2000, the reactor was operated for a total of 104 days at a mean power of 56 MW. In 2000, most irradiation experiments were performed in the CALLISTO PWR loop. The report describes irradiations achieved or under preparation in 2000, including the development of advanced facilities and concept studies for new programmes. An overview of the scientific irradiation programmes as well as of the R and D programme of the BR2 reactor in 2000 is given.

  7. Reactor BR2. Introduction

    Energy Technology Data Exchange (ETDEWEB)

    Gubel, P


    The BR2 materials testing reactor is one of SCK-CEN's most important nuclear facilities. After an extensive refurbishment to compensate for the ageing of the installation, the reactor was restarted in April 1997. In 2001, the reactor was operated for a total of 123 days at a mean power of 59 MW in order to satisfy the irradiation conditions of the internal and external programmes using mainly the CALLISTO PWR loop. The mean consumption of fresh fuel elements was 5.26 per 1000 MWd. Main achievements in 2001 included the development of a three-dimensional full-scale model of the BR2 reactor for simulation and prediction of irradiation conditions for various experiments; the construction of the FUTURE-MT device designed for the irradiation of fuel plates under representative conditions of geometry, neutron spectrum, heat flux and thermal-hydraulic conditions and the development of in-pile instrumentation and a data acquisition system.

  8. Reactor BR2. Introduction

    International Nuclear Information System (INIS)

    The BR2 is a materials testing reactor and is still one of SCK-CEN's important nuclear facilities. After an extensive refurbishment to compensate for the ageing of the installation, the reactor was restarted in April 1997. During the last three years, the availability of the installation was maintained at an average level of 97.6 percent. In the year 2000, the reactor was operated for a total of 104 days at a mean power of 56 MW. In 2000, most irradiation experiments were performed in the CALLISTO PWR loop. The report describes irradiations achieved or under preparation in 2000, including the development of advanced facilities and concept studies for new programmes. An overview of the scientific irradiation programmes as well as of the R and D programme of the BR2 reactor in 2000 is given

  9. C6H6/C2H2…(HX)2(X=F,Cl,Br,I)分子间相互作用研究%Research on the interaction between molecules of C6H6/C2H2···(HX)2

    Institute of Scientific and Technical Information of China (English)

    阳杰; 叶青; 肖扬; 赵培培; 张霞; 李少波; 叶朗; 席小倩


    采用从头算MP2方法,对乙炔分子中的π键与(HX)2(X=F,Cl,Br,I)形成的典型X-H···π键复合物进行了系统的研究,并对构建的复合物结构、相互作用能和BSSE进行了优化计算,对计算结果在结构、分子间相互作用能等参数进行分析,最后对C6H6中的π键与(HCl)2形成的典型X-H…π键复合物进行计算研究,并比较炔烃和芳香烃中的两种π键与卤化氢形成的复合物在氢键性质差异。研究结果表明,C2H2···(HX)2复合物体系随着卤素原子序数的递增,结构参数都出现了周期性增加,复合物的相互作用能在整体上呈现减小的总趋势;C6H6···(HCl)2复合物相互作用明显强于C2H2···(HCl)2复合物。%Applyingab initio theoretical MP2 method studies on the complex of C2H2 and(HX)2(X=F,Cl,Br,I),which formed by X-H···π bond.They optimized the complexes,then,calculated the BSSE and the binding energy of different systems, analysis the calculation results in the geometry, intermolecular interaction energy parameters, and finally the typicalπ bond ofC6H6molecule and (HCl)2 form ofX-H···π bond complexes have been studied, composites and compare alkyne to aromatic hydrocarbon twoπ bond with a hydrogen halide formed by the difference in the nature of hydrogen bonding.The results demonstrated that C2H2···(HX)2,with increasing halogen atomic number,from HF to HI,the bond length have all increasing,however,the binding energy of complex and X-H···π interaction present in the overall decreasing trend, correspondingX-H···πinteraction weakened;C6H6···(HCl)2 complex interaction was stronger than C2H2···(HCl)2 complex.

  10. Photoelectron spectroscopic study of the E ⊗ e Jahn-Teller effect in the presence of a tunable spin-orbit interaction. III. Two-state excitonic model accounting for observed trends in the X~ 2E ground state of CH3X+ (X=F, Cl, Br, I) and CH3Y (Y=O, S) (United States)

    Grütter, M.; Qian, X.; Merkt, F.


    Open-shell molecules in doubly degenerate 2E electronic states are subject to the E ⊗ e Jahn-Teller effect and spin-orbit interactions. The rotational structure of the ground vibrational level of the tildeX^+ 2E ground state of CH3F+ has been observed by high-resolution photoelectron spectroscopy. In contrast to what is observed in other members of the isoelectronic families {CH}_3{X}^+ ({X}={Cl, Br, I}) and {CH}_3{Y} ({Y}={O, S}), the spin-orbit interaction does not lead to a splitting of the ground state of CH3F+. Observed trends in the spectra of the tildeX 2E ground states of these molecules are summarized. Whereas certain trends, such as the reduction of the observable effects of the Jahn-Teller interactions and the increase of the spin-orbit splitting with increasing nuclear charge of X and Y are easily understood, other trends are more difficult to explain, such as the much reduced spin-orbit splitting in {CH}_3{F}^+ compared to {CH}_3{O}. A simple two-state excitonic model is used to account for the trends observed within the series of the methyl-halide radical cations and also the similarities and differences between {CH}_3{F}^+ and the isoelectronic {CH}_3{O} radical. Within this model, the electron hole in the 2E ground states of {CH}_3{X}^+ and {CH}_3{Y} is described in terms of contributions from the halogenic (or chalcogenic) px, y orbitals and the pyramidal-methylic (e) orbitals. This model enables a global, semi-quantitative description of the combined effects of the Jahn-Teller and spin-orbit interactions in these molecules and also a simple interpretation of the spin-orbit-coupling reduction factor ζe.

  11. BR2 Reactor: Introduction

    International Nuclear Information System (INIS)

    The irradiations in the BR2 reactor are in collaboration with or at the request of third parties such as the European Commission, the IAEA, research centres and utilities, reactor vendors or fuel manufacturers. The reactor also contributes significantly to the production of radioisotopes for medical and industrial applications, to neutron silicon doping for the semiconductor industry and to scientific irradiations for universities. Along the ongoing programmes on fuel and materials development, several new irradiation devices are in use or in design. Amongst others a loop providing enhanced cooling for novel materials testing reactor fuel, a device for high temperature gas cooled fuel as well as a rig for the irradiation of metallurgical samples in a Pb-Bi environment. A full scale 3-D heterogeneous model of BR2 is available. The model describes the real hyperbolic arrangement of the reactor and includes the detailed 3-D space dependent distribution of the isotopic fuel depletion in the fuel elements. The model is validated on the reactivity measurements of several tens of BR2 operation cycles. The accurate calculations of the axial and radial distributions of the poisoning of the beryllium matrix by 3He, 6Li and 3T are verified on the measured reactivity losses used to predict the reactivity behavior for the coming decades. The model calculates the main functionals in reactor physics like: conventional thermal and equivalent fission neutron fluxes, number of displacements per atom, fission rate, thermal power characteristics as heat flux and linear power density, neutron/gamma heating, determination of the fission energy deposited in fuel plates/rods, neutron multiplication factor and fuel burn-up. For each reactor irradiation project, a detailed geometry model of the experimental device and of its neighborhood is developed. Neutron fluxes are predicted within approximately 10 percent in comparison with the dosimetry measurements. Fission rate, heat flux and

  12. Comparative study of α and β-ThBr4: structure and luminescence. Spectroscopy of U4+ in α-ThBr4

    International Nuclear Information System (INIS)

    UV absorption of β-ThBr4: presents a plain absorption front and for the same temperature the threshold energy has the same value than the threshold energy of excitation function and photocurrent peak. Emission intensity and lifetime decrease when temperature increases from 300 K to 400K (extinction temperature). Results are interpreted either by molecular orbital levels of the ThBr84- cluster or either by conduction and valence bands of the matrix above. Absorption and emission spectra of U4+ in α-ThBr4 (where U4+ has a S4 symmetry) between 300 K and 4.2 K allow indexation of 30 levels. Spectroscopic parameters are calculated in D2d and S4 symmetry. Comparison of these parameters with those of U4+ in β-ThBr4 and β-ThCl4 shows that crystal field force is practically the same in the three matrices but the structure transformation from β to α has more influence on Bqk than ligand change from Br- to Cl-. Owing to very low phonon energy, fluorescence spectra of U4+ is easy to observe in α-ThBr4 as it is in β-ThBr4 and ThCl4

  13. Pathways for the OH + Br2 → HOBr + Br and HOBr + Br → HBr + BrO Reactions. (United States)

    Wang, Hongyan; Qiu, Yudong; Schaefer, Henry F


    The OH radical reaction with Br2 and the subsequent reaction HOBr + Br are of exceptional importance to atmospheric chemistry and environmental chemistry. The entrance complex, transition state, and exit complex for both reactions have been determined using the coupled-cluster method with single, double, and perturbative triple excitations CCSD(T) with correlation consistent basis sets up to size cc-pV5Z and cc-pV5Z-PP. Coupled cluster effects with full triples (CCSDT) and full quadruples (CCSDTQ) are explicitly investigated. Scalar relativistic effects, spin-orbit coupling, and zero-point vibrational energy corrections are evaluated. The results from the all-electron basis sets are compared with those from the effective core potential (ECP) pseudopotential (PP) basis sets. The results are consistent. The OH + Br2 reaction is predicted to be exothermic 4.1 ± 0.5 kcal/mol, compared to experiment, 3.9 ± 0.2 kcal/mol. The entrance complex HO···BrBr is bound by 2.2 ± 0.2 kcal/mol. The transition state lies similarly well below the reactants OH + Br2. The exit complex HOBr···Br is bound by 2.7 ± 0.6 kcal/mol relative to separated HOBr + Br. The endothermicity of the reaction HOBr + Br → HBr + BrO is 9.6 ± 0.7 kcal/mol, compared with experiment 8.7 ± 0.3 kcal/mol. For the more important reverse (exothermic) HBr + BrO reaction, the entrance complex BrO···HBr is bound by 1.8 ± 0.6 kcal/mol. The barrier for the HBr + BrO reaction is 6.8 ± 0.9 kcal/mol. The exit complex (Br···HOBr) for the HBr + BrO reaction is bound by 1.9 ± 0.2 kcal/mol with respect to the products HOBr + Br. PMID:26766412

  14. Thallium bromide chloride (TlBrxCl1-x) nuclear radiation detector

    International Nuclear Information System (INIS)

    Thallium bromide (TlBr) has been studied as an X- and gamma-ray detector material and relatively good spectrometric performances have been obtained from the detectors. However, the energy resolution of the TlBr detectors is limited by the relatively low resistivity of the crystals. Thallium bromide chloride (TlBrxCl1-x) is a mixed crystal of TlBr and thallium chloride (TlCl). TlBr0.8Cl0.2 crystals have been grown by the traveling molten zone method (TMZ) from purified materials. Nuclear radiation detectors have been fabricated from the grown TlBr0.8Cl0.2 crystals and the detector performance has been characterized. Optical transmittance was evaluated in order to characterize bandgap of the grown crystal. The results confirm that the bandgap of TlBr0.8Cl0.2 is wider than the bandgap of TlBr. Leakage currents of the detectors were measured as a function of the bias voltage at room temperature. The resistivity of the TlBr0.8Cl0.2 detector is approximately equal to the resistivity of typical TlBr detector. A TlBr0.8Cl0.2 detector operated at room temperature was irradiated with gamma-rays from 137Cs source. The detector exhibited a clear peak corresponding 662 keV gamma-rays. The resolution obtained by the TlBr0.8Cl0.2 detector, however, was presently not better than the resolution obtained by the typical TlBr detector. (M. Suetake)

  15. 3c/4e [small sigma, Greek, circumflex]-type long-bonding competes with ω-bonding in noble-gas hydrides HNgY (Ng = He, Ne, Ar, Kr, Xe, Rn; Y = F, Cl, Br, I): a NBO/NRT perspective. (United States)

    Zhang, Guiqiu; Li, Hong; Weinhold, Frank; Chen, Dezhan


    Noble-gas hydrides HNgY are frequently described as a single ionic form (H-Ng)(+)Y(-). We apply natural bond orbital (NBO) and natural resonance theory (NRT) analyses to a series of noble-gas hydrides HNgY (Ng = He, Ne, Ar, Kr, Xe, Rn; Y = F, Cl, Br, I) to gain quantitative insight into the resonance bonding of these hypervalent molecules. We find that each of the studied species should be better represented as a resonance hybrid of three leading resonance structures, namely, H-Ng(+ -):Y (I), H:(- +)Ng-Y (II), and H^Y (III), in which the "ω-bonded" structures I and II arise from the complementary donor-acceptor interactions nY → σ*HNg and nH → σ*NgY, while the "long-bond" ([small sigma, Greek, circumflex]-type) structure III arises from the nNg → [small sigma, Greek, circumflex]*HY/[small sigma, Greek, circumflex]HY interaction. The bonding for all of the studied molecules can be well described in terms of the continuously variable resonance weightings of 3c/4e ω-bonding and [small sigma, Greek, circumflex]-type long-bonding motifs. Furthermore, we find that the calculated bond orders satisfy a generalized form of "conservation of bond order" that incorporates both ω-bonding and long-bonding contributions [viz., (bHNg + bNgY) + bHY = bω-bonding + blong-bonding = 1]. Such "conservation" throughout the title series implies a competitive relationship between ω-bonding and [small sigma, Greek, circumflex]-type long-bonding, whose variations are found to depend in a chemically reasonable manner on the electronegativity of Y and the outer valence-shell character of the central Ng atom. The calculated bond orders are also found to exhibit chemically reasonable correlations with bond lengths, vibrational frequencies, and bond dissociation energies, in accord with Badger's rule and related empirical relationships. Overall, the results provide electronic principles and chemical insight that may prove useful in the rational design of noble-gas hydrides of

  16. Temperature dependence of rate constants of the reactions Br(Br*)+IBr → Br2+I

    International Nuclear Information System (INIS)

    Rate constant and their temperature dependence in the range from -25 to +50 deg C for reactions Br(2P3/2)+IBr → Br2+I(2P2/3) and Br*(2P1/2)+IBr → Br2+I(2P3/2) have been measured by the method of laser atomic-resonance spectroscopy using radiation of iodine and bromine lasers. It has been detected that at 300 K the values of k1 and k2 agree with the known ones, meanwhile with the temperature growth both constants increase, moreover, for k2 the temperature dependence is much stronger. It is shown that the value of deceleration of the rate of reaction between Br atom and IBr in case of its spin-orbital excitation is the function of the temperature, decreasing with the temperature increase. 14 refs.; 3 figs.; 2 tabs

  17. Transition probabilities of Br II (United States)

    Bengtson, R. D.; Miller, M. H.


    Absolute transition probabilities of the three most prominent visible Br II lines are measured in emission. Results compare well with Coulomb approximations and with line strengths extrapolated from trends in homologous atoms.

  18. Radiochemical solar neutrino experiment using 81Br(nu, e-)81Kr

    International Nuclear Information System (INIS)

    Both geochemical and radiochemical experiments based on the interaction 81Br(nu,e-)81Kr to detect 7Be solar neutrinos have been suggested as a logical extension of the 37Cl experiment of Davis et al. The 81Br experiment, however, requires the development of a direct counter for the slowly decaying 81Kr. Progress toward such a detector based on Resonance Ionization Spectroscopy (RIS) is discussed

  19. Nitrosyl bromo complexes of rhenium: Re(NO)2Br3 and [Re(NO)2Br4]-; crystal structure of PPh4[Re(NO)2Br4] . 2 CCl4

    International Nuclear Information System (INIS)

    PPh4[Re(NO)2Br4] is prepared in the form of dark red-brown powder by the reaction of PPh4[Re(NO)2Cl4] with excess boron tribromide. From a solution of CH2Br2 and CCl4 it crystallizes with two moles CCl4, one of which splits off easily in vacuo. The reaction of aluminium tribromide in CH2Br2 solution leads to a slightly soluble red-brown Re(NO)2Br3 powder. The i.r. spectra indicate cis positions of the covalently bound NO ligands in both complexes. Re(NO)2Br3 is dimeric via bromo bridges. The crystal structure determination of PPh4[Re(NO)2Br4] . 2 CCl4 was solved by X-ray diffraction methods at -115 0C. The complex crystallizes in the monoclinic space group P21/c with four formula units per unit cell (4434 independent reflexions, R = 0.085). The unit cell dimensions are a = 1092.3 pm, b = 2088.0 pm, c = 1657.6 pm, β = 96.100. The structure consists of P(C6H5)4+ cations, [Re(NO)2Br4]- anions and intercalated CCl4 molecules. In the anion the NO groups are covalently bound to the Re atom like Re-=N+=O and they are arranged in cis position to one another. (author)

  20. Inhibitory role of TRIP-Br1 oncoprotein in hypoxia-induced apoptosis in breast cancer cell lines. (United States)

    Li, Chengping; Jung, Samil; Yang, Young; Kim, Keun-Il; Lim, Jong-Seok; Cheon, Chung-Il; Lee, Myeong-Sok


    TRIP-Br1 oncoprotein is known to be involved in many vital cellular functions. In this study, we examined the role of TRIP-Br1 in hypoxia-induced cell death. Exposure to the overcrowded and CoCl2-induced hypoxic conditions increased TRIP-Br1 expression at the protein level in six breast cancer cell lines (MCF7, MDA-MB-231, T47D, Hs578D, BT549, and MDA-MB-435) but resulted in no significant change in three normal cell lines (MCF10A, MEF and NIH3T3). Our result revealed that CoCl2-induced hypoxia stimulated apoptosis and autophagy, in which TRIP-Br1 expression was found to be upregulated. Interestingly, TRIP-Br1 silencing in the MCF7 and MDA-MB-231 cancer cells accelerated apoptosis and destabilization of XIAP under the CoCl2-induced hypoxic condition, implying that TRIP-Br1 may render cancer cells resistant to apoptosis through the stabilization of XIAP. We also propose that TRIP-Br1 seems to be upregulated at least partly as a result of the inhibition of PI3K/AKT signaling pathway and the overexpression of HIF-1α. In conclusion, our findings suggest that TRIP-Br1 functions as an oncogenic protein by providing cancer cells resistance to the hypoxia-induced cell death. PMID:27035851

  1. Sepp, Brüder



    Vater der Brüder war Johann S. (* 24.6.1626 Kaltern/Südtirol [Caldaro/I], † zw. 1679/84 Schlanders/Südtirol [Silandro/I]). Paul (Paolo): * 1649 Kaltern/Südtirol (Caldaro/I), † April 1670 Bozen/Südtirol (Bolzano/I) oder 1692 Kaltern. Sänger, Komponist, Organist.

  2. Underground-brändien rakentuminen


    Hänninen, Johanna


    Markkinajohtajuudesta eri toimialoilla taistelevat usein suuret ja kauan toiminnassa olleet brändit, joiden haastaminen saattaa olla vaikeaa. Brändinrakennus kannattaakin suunnata näiden suurien brändien väliin jääviin tyhjiin markkinarakoihin. Yksi esimerkki tällaisesta hyvin hyödynnetystä markkinaraosta ovat underground-brändit, joiden brändinrakennuksen lähtökohtana ei ole kilpailla toimialan suurien brändien kanssa, vaan hallita omaa markkinarakoaan kohdennetulla tarjonnallaan. Niiden tav...

  3. Inhibition of Ps Formation in Benzene and Cyclohexane by CH3CI and CH3Br

    DEFF Research Database (Denmark)

    Wikander, G.; Mogensen, O. E.; Pedersen, Niels Jørgen


    Positron-annihilation lifetime spectra have been measured for mixtures of CH3Cl and CH3Br in cyclohexane and of CH3Cl in benzene. The ortho-positronium (Ps) yield decreased monotonically from 38% and 43% in cyclohexane and benzene respectively to 11% in pure CH3Cl and 6% in pure CH3Br. The strength...... electron from the CH3X− anions to form Ps. while it forms a bound state with the halides. X−. CH3Cl was a roughly three times weaker Ps inhibitor in benzene than in cyclohexane, which shows that CH3Cl− does not dechlorinate in times comparable to or shorter than 400–500 ps in benzene. An improved model for...

  4. Gas-Phase Reactions of (n, γ) and Isomeric Transition-Activated Br80 with Alkanes and Haloalkanes

    International Nuclear Information System (INIS)

    Experimental data are presented on the gas-phase reactions of alkanes and haloalkanes with bromine atoms and ions activated by nuclear transformations. The target molecules include CH4 CD4, C2H6, C2D6, CH3Cl, CH2Cl2, CHCI3, CCl4, CH2F2, CHF3, CF4, C2F6, CF3Br, and CH3Br. The nuclear reactions and transformations used in producing the energetic recoil atoms and ions were Br80m (isomeric transition), Br80, and Br79 (n, γ) Br80. The percentage of the radioactivity found in organic combination (the organic yield, O. Y.) was determined as a function of the concentration of the target molecule in the mole-fraction range of about 0.95 to 1.00. Elemental Br2 served both as a source of hot atoms and as a scavenger. Usually 20-50 separate samples of each reaction system were examined and the data of O.Y. as a function of the concentration of scavenger were plotted and extrapolated to unit mole fraction of target molecule. In all cases, die O.Y. decreased with increasing halogen concentration. Data on the (n, γ) activated reactions of Br80 with isotopic alkanes suggest a comparable extrapolated O.Y. for C2H6 and C2D6, but an O.Y. for CD4 about half of the O.Y. with CH4. Gas chromatographic analysis of the organic products indicates that about 90% of the O.Y. in CH4 is caused by CH3Br and 10% by CH2Br2 For CD4 as the target the distribution of organic activity is approx. 75% CD3Br and 25% CD2Br2. These various data are discussed in terms of possible mechanisms involving hot halogen atoms and ions

  5. Metathesis Polymerization Reactions Induced by the Bimetallic Complex (Ph4P2[W2(μ-Br3Br6

    Directory of Open Access Journals (Sweden)

    Despoina Chriti


    Full Text Available The reactivity of the bimetallic complex (Ph4P2[W2(μ-Br3Br6] ({W 2.5 W}7+, a′2e3 towards ring opening metathesis polymerization (ROMP of norbornene (NBE and some of its derivatives, as well as the mechanistically related metathesis polymerization of phenylacetylene (PA, is presented. Our results show that addition of a silver salt (AgBF4 is necessary for the activation of the ditungsten complex. Polymerization of PA proceeds smoothly in tetrahydrofuran (THF producing polyphenylacetylene (PPA in high yields. On the other hand, the ROMP of NBE and its derivatives is more efficient in CH2Cl2, providing high yields of polymers. 13C Cross Polarization Magic Angle Spinning (CPMAS spectra of insoluble polynorbornadiene (PNBD and polydicyclopentadiene (PDCPD revealed the operation of two mechanisms (metathetic and radical for cross-linking, with the metathesis pathway prevailing.

  6. Chamber wall interactions with HBr/Cl{sub 2}/O{sub 2} plasmas

    Energy Technology Data Exchange (ETDEWEB)

    Srivastava, Ashutosh K.; Ohashi, Tomohiro; Donnelly, Vincent M., E-mail: [Department of Chemical and Biomolecular Engineering, University of Houston, Houston, Texas 77204-4004 (United States)


    The authors have studied the interaction of HBr/Cl{sub 2}/O{sub 2} inductively coupled plasmas with reactor chamber wall deposits, with and without Si etching, using the “spinning wall” technique. The spinning wall is part of the reactor chamber walls, allowing near-real-time analysis of the composition of surface layers via Auger electron spectrometry and determination of species desorbing off the walls by mass spectrometry. In HBr plasmas with no bias voltage on the Si substrate, and hence no Si etching, HBr is ∼30% dissociated, and H{sub 2} and Br{sub 2} form in the plasma. Layers deposited on the reactor chamber contained little if any Br under these conditions. Adding O{sub 2} to an HBr plasma leads to formation of H{sub 2}O and increased Br{sub 2} (compared to a pure HBr plasma) products that desorb from the spinning wall. H{sub 2}O has a very long residence time on the surface. With bias voltage applied to the Si substrate in an HBr plasma, mass spectrometer signals are prominent for SiBr and SiBr{sub 3}, and weaker for SiBr{sub 2}, SiBr{sub 4}, Si{sub 2}Br{sub 4}, Si{sub 2}Br{sub 5}, and Si{sub 2}OBr{sub 5}. Under these conditions, a SiO{sub x}Br{sub y} layer deposits on the spinning wall. Adding 20% O{sub 2} to HBr stops etching and eliminates Br from the surface layer, indicating that Br on the reactor walls is a result of SiBr{sub x} impingement and not from bromination by impinging Br. With HBr/Cl{sub 2} plasmas and no bias on the stage, a SiO{sub x}Cl{sub y} layer deposits, and no Br is detected. HCl, BrCl, and Br{sub 2} were detected in the line-of-sight leak, around the spinning wall, of a HBr/Cl{sub 2} (1:1) gas mixture in the absence of a plasma. Residence time analysis of species in the chamber and a change in the product distribution with a change in the composition of the layer deposited on the chamber wall suggest that reactions forming these products in the absence of a plasma occur on the reactor walls. With a plasma and bias on the Si

  7. Yrityksen brändin uudistaminen


    Saarimaa, Petri


    Brändin rakentaminen on tänä päivänä tärkeä osa yrityksen näkyvyyden ja kilpailukyvyn edistämisessä. Huolellisesti rakennetulla brändillä ja hyvällä markkinoinnilla yritys voi erottua kilpailijoistaan positiivisesti. Tie menestyvään brändiin on kuitenkin pitkä prosessi. Toimeksiantajana opinnäytetyössä toimi rakennusyritys Rakennus Vuoriot Oy. Opinnäytetyön tavoitteena oli toteuttaa yritykselle brändin uudistaminen luomalla kokonaan uusi perusta ja rakennusosat olemassa olevalle brändille...

  8. Effect of NaCl on thermophilic (55°C) methanol degradation in sulfate reducing granular sludge reactors

    NARCIS (Netherlands)

    Vallero, M.V.G.; Hulshoff Pol, L.W.; Lettinga, G.; Lens, P.N.L.


    The effect of NaCl on thermophilic (55degreesC) methanol conversion in the presence of excess of sulfate (COD/SO42-=0.5) was investigated in two 6.5L lab-scale upflow anaerobic sludge bed reactors inoculated with granular sludge previously not adapted to NaCl/>The effect of NaCl on thermophilic (

  9. Ravintola Teerenpelin brändi


    Malaste, Paavo-Sakari


    Tässä opinnäytetyössä käsitellään brändiä ja sen luomista palveluyrityksissä. Tässä työssä tutkitaan myös millaisena asiakkaat kokevat Teerenpeli-ravintolan brändin. Teoriaosassa selvitetään brändin luomista ja asemointia palveluyrityksissä. Brändin luomiseen palveluyrityksissä liittyy samoja piirteitä kuin tavaroidenkin kohdalla, mutta palvelut eroavat tavaroista siinä, että ne ovat aineettomia. Brändillä tarkoitetaan sekä brändin luojan näkemystä eli brändi-identiteettiä että asiakkaiden nä...

  10. BR2 reactor neutron beams

    International Nuclear Information System (INIS)

    The use of reactor neutron beams is becoming increasingly more widespread for the study of some properties of condensed matter. It is mainly due to the unique properties of the ''thermal'' neutrons as regards wavelength, energy, magnetic moment and overall favorable ratio of scattering to absorption cross-sections. Besides these fundamental reasons, the impetus for using neutrons is also due to the existence of powerful research reactors (such as BR2) built mainly for nuclear engineering programs, but where a number of intense neutron beams are available at marginal cost. A brief introduction to the production of suitable neutron beams from a reactor is given. (author)

  11. Heavy Halogen (Br, I) Injections into the Stratosphere from Large Explosive Volcanic Eruptions: Information from Melt Inclusions (United States)

    Hansteen, T. H.; Kutterolf, S.; Freundt, A.; Frische, M.; Wehrmann, H.; Schmincke, H.; Kluegel, A.


    Large explosive volcanic eruptions inject gases, aerosols and ash into the stratosphere, thus influencing stratospheric chemistry and the Earth´s radiation budget. Such periodic injections cause turbulent mixing which enhance chemical reactions. Reactive species responsible for catalytic ozone depletion following large eruptions include not only chlorine (Cl), but also the heavy halogens bromine (Br) and iodine (I) occurring in trace amounts in volcanic plumes. Due to the higher catalytic potential for ozone destruction of Br and I than of Cl, even trace amounts of these elements in volcanic emissions are relevant for stratospheric chemistry. We have analysed halogens in volcanic glasses and in glass inclusions in phenocrysts using electron microprobe and Synchrotron-XRF microprobe methods. Halogens from bulk glass samples were extracted using pyrohydrolysis, and analysed by ICP-MS. Eruptions investigated include Baitoushan, China /North Korea (ca. 969 AD), Mt. Hudson, Chile (1991), and several dacitic Quaternary eruptions from Nicaragua. Chlorine concentrations in glass inclusions are typically 2000 to 4000 ppm, which is on average about 50 percent higher than the concentrations in the matrix glasses. Br concentrations in glass inclusions are typically in the range of 2 to 20 ppm. This gives an average Cl/ Br ratios of about 300:1. Using the petrologic method, involving the concentration differences of halogens between the glass inclusion and those retained in the matrix glass, the average Cl/ Br ratio of the volcanic emissions were about 200:1 Typical I concentrations of Nicaraguan glass inclusions range between 1 and 3 ppm. The resulting Cl/ I ratio of eruptive emissions is about 1100:1. Depending on eruption size, each large event injected between several kt and several hundred kt Br and I into the atmosphere. As a first approach to estimate global Br and I fluxes from subduction zones, although affected by several sources of uncertainty, we combine these

  12. Ozone Depletion Potential of CH3Br (United States)

    Sander, Stanley P.; Ko, Malcolm K. W.; Sze, Nien Dak; Scott, Courtney; Rodriquez, Jose M.; Weisenstein, Debra K.


    The ozone depletion potential (ODP) of methyl bromide (CH3Br) can be determined by combining the model-calculated bromine efficiency factor (BEF) for CH3Br and its atmospheric lifetime. This paper examines how changes in several key kinetic data affect BEF. The key reactions highlighted in this study include the reaction of BrO + H02, the absorption cross section of HOBr, the absorption cross section and the photolysis products of BrON02, and the heterogeneous conversion of BrON02 to HOBR and HN03 on aerosol particles. By combining the calculated BEF with the latest estimate of 0.7 year for the atmospheric lifetime of CH3Br, the likely value of ODP for CH3Br is 0.39. The model-calculated concentration of HBr (approximately 0.3 pptv) in the lower stratosphere is substantially smaller than the reported measured value of about I pptv. Recent publications suggested models can reproduce the measured value if one assumes a yield for HBr from the reaction of BrO + OH or from the reaction of BrO + H02. Although the DeAlore et al. evaluation concluded any substantial yield of HBr from BrO + HO2 is unlikely, for completeness, we calculate the effects of these assumed yields on BEF for CH3Br. Our calculations show that the effects are minimal: practically no impact for an assumed 1.3% yield of HBr from BrO + OH and 10% smaller for an assumed 0.6% yield from BrO + H02.

  13. Vibrational, rotational, and isotopic dependence of CaBr X2 Σ spin-rotational and HFS parameters

    International Nuclear Information System (INIS)

    The previously published molecular-beam, laser-rf, double-resonance study of the rotational and isotopic dependences of the spin-rotational and hyperfine interactions in the v'' = 0, X2Σ state of CaBr is supplemented here with data for v''=1. The vibrational dependence of the parameters is now obtained. The results for CaBr are displayed along with analogous, previously published results for CaF and CaCl

  14. Phase diagram of the CsBr-CaBr2 system

    Institute of Scientific and Technical Information of China (English)

    BAO Xinhua; CHEN Nianyi; LU Wencong; CHENG Zhixuan; LUO Yunyun; LU Weiying; XIA Yiben


    The phase diagram of the CsBr-CaBr2 system was re-determined by using differential thermal analysis and high temperature and room temperature X-ray diffraction analysis. It is concluded that there are three intermediate compounds in this system: a congruently melting compound, CsCaBr3, with a melting point of 823℃ and two incongruently melting compounds, Cs2CaBr4 and Cs3Ca2Br7, whose peritectic points being 597℃ and 635℃, respectively. X-ray diffraction analysis indicated that compound CsCaBr3 is of slightly distorted perovskite structure.

  15. Miten brändi säilyttää brändiarvonsa?


    Sara, Maria


    Tässä opinnäytetyössä tarkasteltiin brändiä ja sen ylläpitämistä. Tavoitteena oli selvittää, miten brändi voi säilyttää jo saavuttamansa brändiarvon. Brändillä tarkoitetaan tavaramerkin ympärille muodostunutta positiivista mielikuvaa. Yrityksen kannalta brändi on kilpailukeino. Vahvan brändin etuja yritykselle ovat esimerkiksi uskolliset asiakkaat, haluttavuus yhteistyökumppanina ja kiinnostavuus työnantajana. Aihe valittiin työn tekijän oman kiinnostuksen perusteella. Aihetta tarkastelti...

  16. Conductivities of AlCl3/Ionic Liquid Systems and Their Application in Electrodeposition of Aluminium

    Institute of Scientific and Technical Information of China (English)

    岳贵宽; 吕兴梅; 朱艳丽; 王慧; 张香平; 张锁江


    Solubilities and conduetivities of anliydrons AlCl3 in six kinds of ionic liquids (ILs) were measured. Among the sixkinds of ILs [bmim]Cl, [bmim]Br, [bmim]BF4, [bmim]PF6, [emim][EtSO4] and [bmim][HSO4], anhydrous AlCl3 could bedissolved in the first five kinds but was hardly dissolved in [bmim][HSO4]. The results showed that the nominal solubilities ofAlCl3 in ILs increased in the order of [bmim][HSO4] < [bmim]PF6 < [emim][EtSO4] <[bmim]BF4<[bmim]Cl<[bmim]Br.Conduetivities of the AlCl3/ILs systems depended apparently on the nominal molar ratio of AlCl3 to ILs. The conduetivities ofAlCl3/[bmim]Cl, AlCl3/[bmim]Br and AlCl3/[bmim]PF6 systems had a similar tendency as a fimetion of the nominal molarratio, that is, as the molar ratio was increased, conductivities increased first and then decreased, with the maximumconductivity obtained at approximately 0.9:1, 1.0:1 and 0.5:1, respectively. Conduetivities of the AlCl3/[bmim]BF4 exhibited adentate change and decreased with the molar ratio of AlCl3 to [bmim]BF4 increasing in general. With the increasing of theanhydrous AlCl3 amount in [emim][EtSO4], conductivity of AlCl3/[emim][EtSO4] monotonically decreased. AlCl3/[bmim]Clsystem was chosen as the electrolyte for the electrodeposition of Al. Preliminary experimental results showed that dense,adherent and homogeneous Al coatings could be electrodeposited on stainless steel by means of constant potential techniqueand the surface coverage was quite satisfactory.

  17. The structure, phase transition and molecular dynamics of [C(NH2)3]3[Sb2Br9

    International Nuclear Information System (INIS)

    The crystal structures of [C(NH2)3]3[Sb2Br9] (Gu3Sb2Br9) at 300 K and of [C(NH2)3]3[Sb2Cl9] (Gu3Sb2Cl9) at 90 and 300 K are determined. The compounds crystallize in the monoclinic space group: C 2/c. The structure is composed of Sb2X93- (X = Cl, Br) ions, which form two-dimensional layers through the crystal, and guanidinium cations. In Gu3Sb2Br9 the structural phase transformation of the first-order type is detected at 435/450 K (on cooling/heating) by the DSC and dilatometric techniques. The dielectric relaxation process in the frequency range between 75 kHz and 5 MHz over the low temperature phase indicates reorientations of weakly distorted guanidinium cations. The proton 1H NMR second-moment and spin-lattice relaxation time, T1, temperature runs for the polycrystalline Gu3Sb2Br9 sample indicate a complex cation motion. A significant dynamical non-equivalence of two guanidinium cations was found. The possible mechanism of the phase transition in Gu3Sb2Br9 is discussed on the basis of the results presented

  18. The structure, phase transition and molecular dynamics of [C(NH2)3]3[Sb2Br9 (United States)

    Szklarz, P.; Zaleski, J.; Jakubas, R.; Bator, G.; Medycki, W.; Falinska, K.


    The crystal structures of [C(NH2)3]3[Sb2Br9] (Gu3Sb2Br9) at 300 K and of [C(NH2)3]3[Sb2Cl9] (Gu3Sb2Cl9) at 90 and 300 K are determined. The compounds crystallize in the monoclinic space group: C 2/c. The structure is composed of Sb2X93- (X = Cl, Br) ions, which form two-dimensional layers through the crystal, and guanidinium cations. In Gu3Sb2Br9 the structural phase transformation of the first-order type is detected at 435/450 K (on cooling/heating) by the DSC and dilatometric techniques. The dielectric relaxation process in the frequency range between 75 kHz and 5 MHz over the low temperature phase indicates reorientations of weakly distorted guanidinium cations. The proton 1H NMR second-moment and spin-lattice relaxation time, T1, temperature runs for the polycrystalline Gu3Sb2Br9 sample indicate a complex cation motion. A significant dynamical non-equivalence of two guanidinium cations was found. The possible mechanism of the phase transition in Gu3Sb2Br9 is discussed on the basis of the results presented.

  19. Phase diagram study of CaBr2-SrBr2 binary system

    International Nuclear Information System (INIS)

    Hydride ion conducting electrolytes are used in the electrochemical sensors for detecting hydrogen in liquid sodium coolant of fast reactors. In this connection several combinations of alkali/alkaline earth metal halides mixed with alkali/alkaline earth metal hydrides were investigated for using them as hydride ion conducting electrolytes. Currently, a mixture of CaBr2-CaH2 is used as the solid electrolyte in electrochemical sensors. With a view to develop and understand electrolyte characteristics of CaBr2-SrBr2-CaH2, system, the binary phase diagram of CaBr2-SrBr2 is being investigated in this work. Samples were prepared in dry argon atmosphere glove box using purified CaBr2 and SrBr2 salts covering the composition range of 0 to 100 mol% of CaBr2 in SrBr2 in steps of ∼10 mol%. Approximately 30 mg of samples were loaded inside hermetically closed iron capsules and were analysed by DTA under argon+4% hydrogen gas at controlled heating and cooling rates. Results have shown that the system shows appreciable terminal solid solution at both CaBr2 and SrBr2 rich sides. The system exhibits a eutectic reaction involving the terminal solid solutions at 553℃ and at ∼40 mol% CaBr2 in SrBr2. Further investigations are in progress. (author)

  20. Photoinduced Br Desorption from CsBr Thin Films Grown on Cu(100)

    Energy Technology Data Exchange (ETDEWEB)

    Halliday, Matthew T.; Joly, Alan G.; Hess, Wayne P.; Shluger, AL


    Thin films of CsBr deposited onto metals such as copper are potential photocathode materials for light sources and other applications. We investigate desorption dynamics of Br atoms from CsBr films grown on insulator (KBr, LiF) and metal (Cu) substrates induced by sub-bandgap 6.4 eV laser pulses. The experimental results demonstrate that the peak kinetic energy of Br atoms desorbed from CsBr/Cu films is much lower than that for the hyperthermal desorption from CsBr/LiF films. Kelvin probe measurements indicate negative charge at the surface following Br desorption from CsBr/Cu films. Our ab initio calculations of excitons at CsBr surfaces demonstrate that this behavior can be explained by an exciton model of desorption including electron trapping at the CsBr surface. Trapped negative charges reduce the energy of surface excitons available for Br desorption. We examine the electron-trapping characteristics of low-coordinated sites at the surface, in particular, divacancies and kink sites. We also provide a model of cation desorption caused by Franck-Hertz excitation of F centers at the surface in the course of irradiation of CsBr/Cu films. These results provide new insights into the mechanisms of photoinduced structural evolution of alkali halide films on metal substrates and activation of metal photocathodes coated with CsBr.

  1. Laser Pyrolysis of CH3Br


    Chang, Hua,; Hsieh, Jang Ching


    Laser pyrolysis of CH3Br by a strong laser irradiation was studied in this work. Besides a fine needle of solid carbon was deposited at the surface on the substrate, HBr and CH4, were found as gaseous products with a ratio of 2:1. Small amount of C2H2 was also detected. The variation in the pressures of CH3Br, HBr and CH4 were measured by Raman spectroscopy. It indicated that the decomposition of CH3Br was first order with respect to CH3Br. The reaction mechanism of the laser pyrolysis was su...

  2. Punkaliven brändiohjeisto


    Vikiö, Timo


    Tässä opinnäytetyössä käsitellään brändiohjeiston rakentamista pk-yritys Punkalivelle, joka valmistaa designkalusteita ja paviljonkeja Finnforestin kehittämästä Kerto®-puumateriaalista. Yrityksen strategisena lähtökohtana on ollut rakentaa uutta yritys-trendiä, joka ottaa huomioon nykypäivän vaativan kuluttajan ja on kiinnostunut kestä-vän kehityksen arvoista. Opinnäytetyön tavoitteena on ollut kartoittaa kestävän kehityksen käsitettä, siihen liit-tyviä tekijöitä niin viestinnässä kuin mu...

  3. Creation of a quaternary centre by copper mediated SN2’ substitution with PhMgBr

    DEFF Research Database (Denmark)

    Tønder, Janne Ejrnæs; Ahrenst, Alex B.; Tanner, David Ackland

    In our studies of the formation of quaternary stereogenic centres, we have worked on the addition of arylcoppermagnesium reagents to geranyl chloride. Based on the work published by Bäckvall(1), the primary focus was optimisation of SN2’-substitution versus SN2-substitution. By examination of...... different copper salts, it was found that SN2’-selectivity increased in the following order; CuCl Br Cl > Br...

  4. Sokos Herkun brändimielikuva nuorten silmissä brändiarvojen perusteella mitattuna


    Lappalainen, Sanna


    Tämä opinnäytetyö tehtiin Tampereen keskustassa sijaitsevalle Sokos Herkku ruokakaupalle. Opinnäytetyöni käsittelee brändin rakentamista ja brändimielikuvan muodostumista. Teoriaosiossa käydään läpi brändin rakentaminen brändi-identiteetin luomisesta brändin johtamiseen brändipääomalla. Teoriaosiossani katsotaan brändiä myös palvelubrändin näkökulmasta, sillä elintarvikekaupat ovat yhä kasvavassa määrin palveluyrityksiä. Tutkimuksen tavoitteena oli kehittää Sokos Herkun brändimielikuvaa n...

  5. Nickel-catalyzed vinylation of aryl chlorides and bromides with vinyl ZnBr.MgBrCl. (United States)

    Yamamoto, Tetsuya; Yamakawa, Tetsu


    The Ni-catalyzed cross-coupling of aryl halides and vinylzinc bromide for the synthesis of styrene derivatives was investigated. Of the catalysts surveyed, the combination of Ni(acac)(2) and Xantphos was found to be the most effective for this cross-coupling. This catalyst could be used in reactions with various aryl bromides and chlorides, including electron-rich aryl chlorides such as chloroanisoles. PMID:19354270

  6. Som brødre vi dele

    DEFF Research Database (Denmark)

    Holm, Claus


    Debatten om forskningsfrihed gjorde broderskabet til forudsætningen for forskningfrihed, men skal forskere dele som brødre i 2010?......Debatten om forskningsfrihed gjorde broderskabet til forudsætningen for forskningfrihed, men skal forskere dele som brødre i 2010?...

  7. Phase equilibria and structural species in NdCl3-NaCl, NdCl3-CaCl2, PrCl3-NaCl, and PrCl3-CaCl2 systems

    International Nuclear Information System (INIS)

    This paper reports that equilibrium phase diagrams for the systems NdCl3---CaCl2 and NdCl3---NaCl were determined by differential thermal analysis. A simple eutectic was observed at 59 ± 1 mol% CaCl2 and 600 degrees ± 2 degrees C in the NdCl3---CaCl2 system. A compound NaCl · 3NdCl3 which melts incongruently at 545 degrees ± 5 degrees C to NdCl3 and a liquid containing approximately 47 mol% NaCl, and a eutectic at 68 mol% NaCl and 439 degrees ± 2 degrees C were found in the NdCl3---NaCl system. On the basis of agreements between the activities calculated by the Clausius-Clapeyron equation and Temkin's model using the present data for the NdCl3---CaCl2 system and the literature data for the PrCl3---CaCl2 system, the melts in the former system consist of Nd3+, Ca2+, and Cl- ions and in the latter system of Pr3+, Ca2+, and Cl- ions. The above approach indicates the presence of Na+, Cl-, and NdCl4- in the NdCl3-rich melts in the NdCl3--NaCl system

  8. Band structure of 79Br

    International Nuclear Information System (INIS)

    High-spin states of 79Br have been studied in the reaction 76Ge(7Li, 4nγ) at 32 MeV. A gamma-detector array with twelve Compton-suppressed HPGe detectors was used. The positive-parity yrast states, interpreted as a rotationally aligned g(9(2)) proton band, and the negative-parity ground state band have been extended to spins of (33(2+)) and (25(2-)), respectively. Lifetime measurements indicate that both bands have a similar quadrupole deformation of β2 ∼ 0.2. The positive-parity α = -(1(2)) band has been identified. Several new inter-band transitions are observed. A cranked-shell model analysis shows that the νg(9(2)) and πg(9(2)) alignments occur in the positive-parity and the negative-parity bands at rotational frequencies of ℎω ∼ 0.6 and 0.4 MeV, respectively. The level energies and the electromagnetic properties of the g(9(2)) band can be well reproduced by a particle-rotor model calculation with an axially symmetric core

  9. The reaction ensemble method for the computer simulation of chemical and phase equilibria. II. The Br2+Cl2+BrCl system

    Czech Academy of Sciences Publication Activity Database

    Lísal, Martin; Nezbeda, Ivo; Smith, W. R.


    Roč. 110, č. 17 (1999), s. 8597-8604. ISSN 0021-9606 R&D Projects: GA ČR GA203/98/1446; GA AV ČR KSK2004601 Grant ostatní: NSERC(US) OGP1041 Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 3.289, year: 1999

  10. Lastnosti lesa bršljana


    Merhar, Klemen


    Raziskali smo tiste izbrane lastnosti lesa navadnega bršljana (Hedera helix L.), ki bi utegnile predvideti njegovo uporabo. Raziskali smo anatomsko zgradbo in makroskopske posebnosti, vlažnost v svežem stanju, gostoto, anizotropijo krčenja in nabrekanja, kazalnike dimenzijske stabilnosti ter tlačno in upogibno trdnost bršljanovega lesa. Raziskava je pokazala, da bršljanov les spada med polvenčasto porozne drevesne vrste. Gostota absolutno suhega lesa je 522 kg/m3. Vlažnost svežega lesa, ki jo...

  11. Performance tests of a large volume cerium tribromide (CeBr3) scintillation detector. (United States)

    Naqvi, A A; Khiari, F Z; Liadi, F A; Khateeb-Ur-Rehman; Isab, A A


    The response of a large cylindrical 76mm×76mm (height×diameter) cerium tribromide (CeBr3) detector was measured for prompt gamma rays. The total intrinsic activity of the CeBr3 detector, which was measured over 0.33-3.33MeV range, was found to be 0.022±0.001 counts/s/cm(3). The partial intrinsic activity ( due to (227)Ac contamination), was measured over a energy range of 1.22-2.20MeV energy, was found to be 0.007±0.001 counts/s/cm(3). Compared to intrinsic activities of LaBr3:Ce and LaCl3:Ce detectors of equivalent volume, the CeBr3 detector has 7-8 times less total intrinsic activity. The detector response for low energy prompt gamma rays was measured over 0.3-0.6MeVgamma energy range using a portable neutron generator-based Prompt Gamma Neutron Activation Analysis (PGNAA) setup. The experimental yield of boron, cadmium and mercury prompt gamma-rays was measured from water samples contaminated with 0.75-2.5wt% mercury, 0.31-2.50wt% boron, and 0.0625-0.500wt% cadmium, respectively. An excellent agreement has been observed between the calculated and experimental yields of the gamma rays. Also minimum detection limit (MDC) of the CeBr3 detector was measured for boron, cadmium and mercury samples. The CeBr3 detector has 23% smaller value of MDCB and 18% larger value of MDCCd than those of a LaBr3:Ce detector of equivalent size. This study has shown that CeBr3 detector has an excellent response for the low energy prompt gamma-rays with almost an order of magnitude low intrinsic activity as compared to LaCl3:Ce and LaBr3:Ce detectors of equivalent volume. PMID:27180221

  12. Eu-doped CsBr phosphor as a new optically-stimulable phosphor material for medical x-ray imaging sensor

    International Nuclear Information System (INIS)

    CsBr phosphor ceramics doped with different luminescence centres such as In2O3, Eu2O3, EuCl3, SmCl3, TbCl3, GdCl3 or NdCl3 as the candidate for a new optically-stimulable phosphor for medical X-ray imaging sensor were prepared using a conventional ceramic fabrication process. It was found that X-ray-irradiated Eu-doped CsBr (CsBr:Eu) exhibited intense optically stimulated luminescence (OSL). The peak wavelength of the OSL emission and stimulation spectra of CsBr:Eu phosphor ceramic sample were 450 and 690 nm, respectively. The dependence of OSL properties on the conditions of preparation of phosphor ceramic samples, such as Eu concentration, sintering temperature and sintering time, were studied. The optimum preparation conditions were also studied. It was found that the OSL intensity of CsBr:Eu phosphor ceramics fabricated under optimum preparation conditions is higher than that of commercially available imaging plates using BaFBr:Eu. (authors)

  13. Chloride (Cl-) ion-mediated shape control of palladium nanoparticles (United States)

    Nalajala, Naresh; Chakraborty, Arup; Bera, Bapi; Neergat, Manoj


    The shape control of Pd nanoparticles is investigated using chloride (Cl-) ions as capping agents in an aqueous medium in the temperature range of 60-100 °C. With weakly adsorbing and strongly etching Cl- ions, oxygen plays a crucial role in shape control. The experimental factors considered are the concentration of the capping agents, reaction time and reaction atmosphere. Thus, Pd nanoparticles of various shapes with high selectivity can be synthesized. Moreover, the removal of Cl- ions from the nanoparticle surface is easier than that of Br- ions (moderately adsorbing and etching) and I- ions (strongly adsorbing and weakly etching). The cleaned Cl- ion-mediated shape-controlled Pd nanoparticles are electrochemically characterized and the order of the half-wave potential of the oxygen reduction reaction in oxygen-saturated 0.1 M HClO4 solution is of the same order as that observed with single-crystal Pd surfaces.

  14. 75 FR 6862 - Airworthiness Directives; Bombardier, Inc. Model CL-600-1A11 (CL-600), CL-600-2A12 (CL-601), CL... (United States)


    ... Policies and Procedures (44 FR 11034, February 26, 1979); and 3. Will not have a significant economic.... Model CL-600-1A11 (CL- 600), CL-600-2A12 (CL-601), CL-600-2B16 (CL-601-3A, CL-601-3R, and CL- 604 Variants (Including CL-605 Marketing Variant)) Airplanes AGENCY: Federal Aviation Administration (FAA),...

  15. CsPbBr3 nanocrystal saturable absorber for mode-locking ytterbium fiber laser (United States)

    Zhou, Yan; Hu, Zhiping; Li, Yue; Xu, Jianqiu; Tang, Xiaosheng; Tang, Yulong


    Cesium lead halide perovskite nanocrystals (CsPbX3, X = Cl, Br, I) have been reported as efficient light-harvesting and light-emitting semiconductor materials, but their nonlinear optical properties have been seldom touched upon. In this paper, we prepare layered CsPbBr3 nanocrystal films and characterize their physical properties. Broadband linear absorption from ˜0.8 to over 2.2 μm and nonlinear optical absorption at the 1-μm wavelength region are measured. The CsPbBr3 saturable absorber (SA), manufactured by drop-casting of colloidal CsPbBr3 liquid solution on a gold mirror, shows modulation depth and saturation intensity of 13.1% and 10.7 MW/cm2, respectively. With this SA, mode-locking operation of a polarization-maintained ytterbium fiber laser produces single pulses with duration of ˜216 ps, maximum average output power of 10.5 mW, and the laser spectrum is centered at ˜1076 nm. This work shows that CsPbBr3 films can be efficient SA candidates for fiber lasers and also have great potential to become broadband linear and nonlinear optical materials for photonics and optoelectronics.

  16. Brändimielikuvia kosmetiikan markkinoilla : Cliniquen brändimielikuva


    Pitkä, Nea


    Tämän opinnäytetyön tarkoituksena oli selvittää, millainen Cliniquen brändimielikuva on kuluttajien kokemana. Clinique on suurimpia kosmetiikkabrändejä selektiivisen kosmetiikan markkinoilla. Yhdysvaltalaisella Cliniquella on omalaatuinen kliininen imago kilpailijoihinsa nähden, joten brändistä muotoutunutta mielikuvaa tutkittiin sen pohjalta. Toinen selvityksen kohde oli Cliniquen brändimielikuvan vaikutus ostopäätökseen. Työssä käsiteltiin laajasti brändin määritelmää ja olennaisimpia t...

  17. Brändivalokuva Suomessa : Kuinka saavutetaan laadukas brändivalokuva


    Luostarinen, Antti


    Opinnäytetyössä tutkitaan mitä brändivalokuva on ja miten laadukas brändivalokuva saavutetaan Suomessa. Kentällä tapahtuvaa toimintaa lähestytään kolmesta suunnasta: valokuvaajan (toteuttaja), suunnittelijan (luova toimisto) sekä yrityksen (tilaaja) näkökulmasta. Brändivalokuvan tekemisen prosessia kuvataan yrityksen ja sen palkkaamien ulkoistettujen yhteistyötahojen toiminnan kautta. Opinnäyte ei siis ota kantaa inhouse-toiminnassa tuotettuun brändivalokuvaan. Tutkimuksen tavoitteena on...

  18. Precision measurement of the ratio BR($K_{S} \\to \\pi^{+}\\pi^{-}e^{+}e^{-}$)/BR($K_{L} \\to \\pi^{+}\\pi^{-}\\pi^{0}_{D}$)

    CERN Document Server

    Batley, J R; Lazzeroni, C; Munday, D J; Patel, M; Slater, M W; Wotton, S A; Arcidiacono, R; Bocquet, G; Ceccucci, A; Cundy, D; Doble, N; Falaleev, V; Gatignon, L; Gonidec, A; Grafström, P; Kubischta, W; Marchetto, F; Mikulec, I; Norton, A; Panzer-Steindel, B; Rubin, P; Wahl, H; Goudzovski, E; Hristov, P; Kekelidze, V; Kozhuharov, V; Litov, L; Madigozhin, D; Molokanova, N; Potrebenikov, Yu.; Stoynev, S; Zinchenko, A; Monnier, E; Swallow, E C; Winston, R; Sacco, R; Walker, A; Baldini, W; Dalpiaz, P; Frabetti, P L; Gianoli, A; Martini, M; Petrucci, F; Scarpa, M; Savrié, M; Bizzeti, A; Calvetti, M; Collazuol, E; Iacopini, E; Lenti, M; Ruggiero, G; Veltri, M; Behler, M; Eppard, K; Eppard, M; Hirstius, A; Kleinknecht, K; Koch, U; Marouelli, P; Masetti, L; Moosbrugger, U; Morales Morales, C; Peters, A; Wanke, R; Winhart, A; Dabrowski, A; Fonseca Martin, T; Szleper, M; Velasco, M; Anzivino, G; Cenci, P; Imbergamo, E; Lamanna, G; Lubrano, P; Michetti, A; Nappi, A; Pepe, M; Petrucci, M C; Piccini, M; Valdata, M; Cerri, C; Costantini, F; Fantechi, R; Fiorini, L; Giudici, S; Mannelli, I; Pierazzini, G; Sozzi, M; Cheshkov, C; Chèze, J B; De Beer, M; Debu, P; Gouge, G; Marel, G; Mazzucato, E; Peyaud, B; Vallage, B; Holder, M; Maier, A; Ziolkowski, M; Biino, C; Cartiglia, N; Clemencic, M; Goy Lopez, S; Menichetti, E; Pastrone, N; Wislicki, W; Dibon, H; Jeitler, M; Markytan, M; Neuhofer, G; Widhalm, L


    The $K_{S} \\rightarrow \\pi^{+}\\pi^{-}e^{+}e^{-}$ decay mode was investigated using the data collected in 2002 by the NA48/1 collaboration. With about 23,k $K_{S} \\rightarrow \\pi^{+}\\pi^{-}e^{+}e^{-}$ events and 59,k $K_{L} \\rightarrow \\pi^{+}\\pi^{-}\\pi^{0}_{D}$ normalization decays, the $K_{S} \\rightarrow \\pi^{+}\\pi^{-}e^{+}e^{-}$ branching ratio relative to the $K_{L}\\rightarrow \\pi^{+}\\pi^{-}\\pi^{0}_{D}$ one was determined to be BR($K_{S} \\rightarrow \\pi^{+}\\pi^{-}e^{+}e^{-}$)/BR($K_{L} \\rightarrow \\pi^{+}\\pi^{-}\\pi^{0}_{D}$) = $ (3.28 \\pm 0.06_{stat}\\pm 0.04_{syst})\\times 10^{-2}$. This result was used to set the upper limit $|g_{E1}/g_{BR}| \\lt 3.0$ at $90%$ CL on the presence, in the decay amplitude, of an E1 direct emission ($g_{E1}$) term relative to the dominant inner bremsstrahlung ($g_{BR}$) term. The CP-violating asymmetry ${cal A}_{\\phi}$ in the sin$\\phi$,cos$\\phi$ distribution of $K_{S} \\rightarrow \\pi^{+}\\pi^{-}e^{+}e^{-}$ events, where $\\phi$ is the angle between the $\\pi^{+} \\pi^{-}$ and the $...

  19. 3+ and [Sb13Se16Br2] 5+ - Double and quadruple spiro cubanes from ionic liquids

    KAUST Repository

    Ahmed, Ejaz


    The reaction of antimony and selenium in the bromine-rich Lewis acidic ionic liquid [BMIm]Br·4.7AlBr3 (BMIm: 1-butyl-3- methylimidazolium) in the presence of a small amount of NbCl5 at 160 °C yielded dark-red crystals of [Sb7Se8Br 2][AlX4]3. For X = Cl0.15(1)Br 0.85(1), the compound is isostructural to [Sb7S 8Br2][AlCl4]3 [P212 121, a = 12.5132(5) Å, b = 17.7394(6) Å, c = 18.3013(6) Å]. For a higher chlorine content, X = Cl 0.58(1)Br0.42(1), a slightly disordered variant with a bisected unit cell is found [P21212, a = 12.3757(3) Å, b = 17.4116(5) Å, c = 9.0420(2) Å]. The [Sb 7Se8Br2]3+ heteropolycation (C 2 symmetry) is a spiro double-cubane with an antimony atom on the shared corner. From this distorted octahedrally coordinated central atom, tricoordinate selenium and antimony atoms alternate in the bonding sequence. The terminal antimony atoms each bind to a bromine atom. Quantum chemical calculations confirm polar covalent Sb-Se bonding within the cubes and indicate three-center, four-electron bonds for the six-coordinate spiro atoms. The calculated charge distribution reflects the electron-donor role of the antimony atoms. The use of a chlorine-rich ionic liquid resulted in the formation of triclinic [Sb13Se16Br2][AlX4] 5 with X = Cl0.80(1)Br0.20(1) [P$\\\\bar {1}$, a = 9.0842(5) Å, b = 19.607(1) Å, c = 21.511(1) Å, α = 64.116(6), β = 79.768(7), γ = 88.499(7)]. The cationic cluster [Sb13Se16Br2]5+ is a bromine-terminated spiro quadruple-cubane. This 31 atom concatenation of four cubes is assumed to be the largest known discrete main group polycation. A similar reaction in a chloride-free system yielded [Sb7Se 8Br2][Sb13Se16Br2] [AlBr4]8. In its monoclinic structure [P2/c, a = 27.214(5) Å, b = 9.383(2) Å, c = 22.917(4) Å, β = 101.68(1)], the two types of polycations alternate in layers along the a axis. In the series [Sb4+3nSe4+4nBr2](2+n)+, these cations are the members with n = 1 and 3. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGa

  20. Variation of Br-in groundwater and its relationship with other main ions along eastern coast of Leizhou peninsular%雷州半岛东岸地下水 Br-变化及其与宏量离子的关系研究

    Institute of Scientific and Technical Information of China (English)

    黄向青; 甘华阳; 路剑飞; 张顺枝; 潘毅


    According to the lab data on groundwater samples during two tidal cycles from monitoring wells J1 and J2 along eastern coast of Leizhou Peninsular , the paper analyzed the anion Br -'s concentration , variation and relationship with other main ions .The results demonstrate that Br -comes mainly from sea-water intrusion, and the basic types of measured well are Na +K· Ca· Mg-Cl· SO4 , and the types of J2 is Na+K· Ca· Mg-Cl· SO4· HCO3;the average content of Br -in J1 is 11.69~14.35mg/L and the concentration of Br -in J2 is almost half in J1's.Br -statistical characteristics every well change with the number of measurement .Combined with the ratio of Br -/Cl -and the invironment of measured well , it is thought that J1 primarily has sea-phase and J2 has river-sea phase in term of Br -/Cl -;Br -owns al-most the same relative amplitudes with Cl -and SO4 2-,which show Br -also actively takes part in the process of seawater intrusion;the correlation of Br -with other ions also varies with wells and the ratio of Br-to Na +is the lowest among the ratio of Br -to cations.the highest is K +;the ratio of Br -to Mg2+is in the meantime .The frequency in the region of milligram equivalent ratio chiefly appears the distribu-tion forms of left lean, sharp peak and flat peak , especially in well J2, the ratio ofγBr -/γK+is close to normal .The relativity of milligram equivalent ratio and mass equivalent ratio is consistent .The linear rela-tionship between Br -/Na +and Br -/Cl -is good.The paper finally made linear LST fitness .%依据雷州半岛东岸J1、J2测井地下水潮周期取样测试数据,对Br-含量、变化及其与其它宏量离子的关系进行了分析。结果显示:Br-主要来源于海水侵染,测井基本类型为 Na +K · Ca · Mg -Cl · SO4, J2为Na+K· Ca· Mg-Cl· SO4· HCO3。 J1测井Br-平均含量为11.69~14.35 mg/L,J2测井Br-平均值约为J1的一半,各测井Br-统计特征随测次而有所变化。进一步结

  1. 75 FR 37994 - Airworthiness Directives; Bombardier, Inc. Model CL-600-1A11 (CL-600), CL-600-2A12 (CL-601), CL... (United States)


    ... FR 6862). That NPRM proposed to correct an unsafe condition for the specified products. The MCAI... ``significant rule'' under the DOT Regulatory Policies and Procedures (44 FR 11034, February 26, 1979); and 3..., Inc. Model CL-600-1A11 (CL- 600), CL-600-2A12 (CL-601), CL-600-2B16 (CL-601-3A, CL-601-3R, and CL-...

  2. Etude structurale et vibrationnelle d'un nouveau composé complexe de cobalt: [Co(imidazole4Cl]Cl

    Directory of Open Access Journals (Sweden)

    Amira Derbel


    Full Text Available In the title complex, chloridotetrakis(1H-imidazole-κN3cobalt(II chloride, [CoCl(C3H4N24]Cl, the CoII cation has a distorted square-pyramidal coordination environment. It is coordinated by four N atoms of four imidazole (Im groups in the basal plane, and by a Cl atom in the apical position. It is isostructural with [Cu(Im4Cl]Cl [Morzyk-Ociepa et al. (2012. J. Mol. Struct. 1028, 49–56] and [Cu(Im4Br]Br [Hossaini Sadr et al. (2004. Acta Cryst. E60, m1324–m1326]. In the crystal, the [CoCl(C3H4N24]+ cations and Cl− anions are linked via N—H...Cl hydrogen bonds, forming layers parallel to (010. These layers are linked via C—H...Cl hydrogen bonds and C—H...π and π–π [inter-centroid distance = 3.794 (2 Å] interactions, forming a three-dimensional framework. The IR spectrum shows vibrational bands typical for imidazol groups. The monoclinic unit cell of the title compound emulates an orthorhombic cell as its β angle is close to 90°. The crystal is twinned, with the refined ratio of twin components being 0.569 (1:0.431 (1.

  3. Radiative forcing calculations for CH3Br

    International Nuclear Information System (INIS)

    Methyl Bromide, CH3Br, is the major organobromine species in the lower atmosphere and is a primary source of bromine in the stratosphere. It has a lifetime of 1.3 years. The IR methyl bromide spectra in the atmospheric window region, 7--13μ, was determined using a well tested Coriolis resonance and ell-doubling (and ell-resonance) computational system. A radiative forcing value of 0.00493 W/m2/ppbv was obtained for CH3Br and is approximately linear in the background abundance. This value is about 2 percent of the forcing of CFC-11 and about 278 times the forcing of C02, on a per molecule basis. The radiative forcing calculation is used to estimate the global warming potential (GWP) of CH3Br. The results give GWPs for CH3Br of the order of 13 for an integration period of 20 years and 4 for an integration period of 100 years (assuming C02 = 1, following IPCC [1994]). While CH3Br has a GWP which is approximately 25 percent of the GWP of CH4, the current emission rates are too low to cause serious atmospheric greenhouse heating effects at this time

  4. Brändikäsikirja brändinhallinnan tukena Case: Innojok Oy


    Tamminen, Tytti; Uusitalo, Nea


    Opinnäytetyön tavoitteena oli laatia brändikäsikirja opinnäytetyön case yritys Innojok Oy:lle. Tutkimustyön tarkoituksena on selvittää, mitä tehokkaan ja hyödyllisen brändikäsikirjan tulisi sisältää, jotta sen optimaalinen käyttötarkoitus toteutuu. Toimeksianto saatiin case yritykseltä, koska yrityksellä ei ollut vielä brändikäsikirjaa olemassa. Opinnäytetyön teoreettinen viitekehys käsittelee brändiä ja brändinhallinnan merkitystä liiketoiminnan kannalta. Opinnäytetyön teoreettisen ...

  5. Optical properties of CdBr2:Eu and CdBr2:Eu, Mn crystals

    International Nuclear Information System (INIS)

    Optical and luminescent properties of the CdBr:Eu and CdBr2:Eu, Mn crystals, grown through the Stockbarger-Bridgman method in evacuated quartz ampoules, are studied within the temperature range of 85-295 K. The results obtained are compared with spectral characteristics of the CdBr2 and CdBr2:Mn crystals. The band with the maximum about 254 nm, observed in the absorption spectra of mono- and polyactivated crystals of cadmium bromide, is attributed to the 4f7 -> 4f65d electron transitions in the Eu2+ ions. The manganese sensitized luminescence is identified by excitation of the CdBr2:Eu, Mn crystals by the light from the area of this band. The nature of the capture centers, responsible for thermostimulated fluorescence, and excitation mechanisms of recombination luminescence in the studied crystals are considered

  6. Brändiopas : brändäys kauneudenhoitoalalla


    Rastas, Kaisa


    Brändit vetoavat asiakkaan tunteisiin ja tuottavat elämyksiä sekä unohtumattomia kokemuksia. Brändi on aineeton ulottuvuus, mielikuva, joka rakentuu asiakkaan mielessä. Brändi onkin hieman erilainen eri ihmiseltä kysyttäessä. Tässä oppaassa käsiteltiin kauneudenhoitoalan yritys- ja henkilöbrändin rakentamisen vaiheita. Oppaassa käsiteltiin myös asiakaskokemuksen merkitystä menestyvän yritysbrändin rakentumisessa. Vaikka brändi termiä käytetään hyvin laajasti puhekielessä, se usein liitet...

  7. LiCl(NaCl)-CeCl3-H2O systems at 25 deg C

    International Nuclear Information System (INIS)

    It has been found by the method of isothermal solubility that aqueous ternary systems LiCl(NaCl)-CeCl3-H2O at 25 deg C refer to the eutonic type with crystallization of the initial components LiClxH2O, NaCl, and CeCl3x7H2O

  8. Preparation, characterization, and photocatalytic activity of porous AgBr@Ag and AgBrI@Ag plasmonic photocatalysts (United States)

    Yang, Fan; Tian, Baozhu; Zhang, Jinlong; Xiong, Tianqing; Wang, Tingting


    Porous AgBr@Ag and AgBrI@Ag plasmonic photocatalysts were synthesized by a multistep route, including a dealloying method to prepare porous Ag, a transformation from Ag to AgBr and AgBrI, and a photo-reduction process to form Ag nanoparticles on the surface of AgBr and AgBrI. It was found that the porous structure kept unchanged during Ag was transferred into AgBr, AgBrI, AgBr@Ag, and AgBrI@Ag. Both porous AgBr@Ag and porous AgBrI@Ag showed much higher visible-light photocatalytic activity than cubic AgBr@Ag for the degradation of methyl orange, which is because the interconnected pore channels not only provide more reactive sites but also favor the transportation of photo-generated electrons and holes. For AgBrI@Ag, AgBrI solid solution formed at the interface of AgBr and AgI, and the phase junction can effectively separate the photo-generated electrons and holes, favorable to the improvement of photocatalytic activity. The optimal I content for obtaining the highest activity is ∼10 at.%.

  9. Airborne I-DOAS measurements at Mt. Etna: BrO and OClO evolution in the plume (United States)

    General, S.; Bobrowski, N.; Pöhler, D.; Weber, K.; Fischer, C.; Platt, U.


    Spatial distributions of bromine monoxide (BrO), chlorine dioxide (OClO) and sulfur dioxide (SO2) were determined in the volcanic emissions of Mt. Etna on 8th and 9th of July 2011 by Airborne Imaging Differential Optical Absorption Spectroscopy (AI-DOAS). Slant column densities (SCDs in units of molec/cm2) of up to 4.2 × 1014 for BrO, 1.5 × 1014 for OClO and 4.6 × 1018 for SO2 were detected. Assuming SO2 to be a stable tracer to overcome dilution effects, measurements of BrO/SO2 and OClO/SO2 ratios from distances of 1-19 km to the summit crater region were used to investigate the evolution of BrO and OClO within corresponding plume ages of 2-34 min. Along the centerline of the plume relatively constant BrO/SO2 ratios of 1.4 × 10- 4 and 2.0 × 10- 4 were detected on 8th and 9th of July 2011, respectively. Furthermore the BrO/SO2 ratio was investigated along several cross-sections of the volcanic plume. On both days significant increases by a factor of 2-3 in the BrO/SO2 ratio from the center to the edge of the plume were seen. From simultaneous measurements of BrO and OClO the mixing ratios of ClO could be inferred to range from about 80 to 300 ppt. In addition, decreases in the BrO/SO2 ratio with time could be observed by measurements three to four hours before the culmination of a paroxysm at Mt. Etna on 9th July 2011.

  10. Brändäys pelialalla


    Saarelainen, Joona


    Tämän opinnäytetyön tavoitteena oli tarjota lukijalle tietopaketti siitä, mikä merkitys brändeillä ja brändäyksellä on kuluttajille videopelimarkkinoilla. Työn tarkoituksena oli tarjota kansainvälisille pelimarkkinoille pyrkivälle yritykselle tietoa brändin rakentamisen aloittamisesta ja siinä tarvittavista analyyseistä. Tämä oli myös opinnäytetyöhön valittu tutkimusongelma. Opinnäytetyö kirjoitettiin kahdessa eri osassa. Teoriaosuus käsittelee suomalaista ja kansainvälistä pelialaa sekä...

  11. Production of 77 Br for medical application

    International Nuclear Information System (INIS)

    Bromine-77 is produced with the variable energy cyclotron (CV-28) at the Instituto de Engenharia Nuclear, via the 75 As. (α, 2 n) 77 Br reaction, by bombarding arsenic trioxide with 28 MeV alpha-particles. The thick target yield is 0.3 mCi/μAh. The target is dissolved in concentrated N H4 OH and 77 Br, separated from arsenic, by an anionic exchange resin, is obtained carrier-free with a separation yield greater than 90%. All the process is remotely controlled using electric and pneumatic systems, manipulators and tongs. The quality control is made by atomic absorption and gamma-ray spectroscopy. The present production rate of Br-77 is 2.3 mCi per irradiation. (author)

  12. Prévention de la maladie thromboembolique veineuse chez le brûlé (United States)

    Siah, S.; El Farouki, A.


    Summary Les complications thromboemboliques sont considérées comme rares chez le patient brûlé. Leur incidence varie selon les études réalisées. Les patients brûlés présentent de nombreux facteurs de risque favorisant la survenue de ces complications. Le diagnostic clinique de la thrombose veineuse profonde et de l’embolie pulmonaire reste difficile vu leur évolution infraclinique et la non spécificité des signes cliniques. L’échodoppler veineux et l’angioscanner thoracique constituent les éléments clés dans la stratégie diagnostique de la thrombose veineuse profonde et de l’embolie pulmonaire chez les patients brûlés. Le traitement ne diffère pas de celui administré aux autres patients non brûlés et victimes de la thrombose veineuse profonde et de l’embolie pulmonaire. La prophylaxie controversée entre les auteurs, est un sujet d’actualité. Plusieurs praticiens et organismes recommandent son utilisation de routine chez les patients brûlés à risque. Elle reste le seul moyen capable d’empêcher la survenue de la maladie thromboembolique veineuse capable d’engager le pronostic vital chez ces patients. Nous rapportons 6 observations de patients brûlés ayant développé une maladie thromboembolique veineuse. PMID:26170780

  13. Carbon monoxide protonation in condensed phases and bonding to surface superacidic Brønsted centers. (United States)

    Stoyanov, Evgenii S; Malykhin, Sergei E


    Using infrared (IR) spectroscopy and density functional theory (DFT) calculations, interaction of CO with the strongest known pure Brønsted carborane superacids, H(CHB11Hal11) (Hal = F, Cl), was studied. CO readily interacted at room temperature with H(CHB11F11) acid, forming a mixture of bulk salts of formyl and isoformyl cations, which were in equilibrium An(-)H(+)CO COH(+)An(-). The bonding of CO to the surface Brønsted centers of the weaker acid, H(CHB11Cl11), resulted in breaking of the bridged H-bonds of the acid polymers without proton transfer (PT) to CO. The binding occurred via the C atom (blue shift ΔνCO up to +155-167 cm(-1), without PT) or via O atom (red shift ΔνCO up to -110 cm(-1), without PT) always simultaneously, regardless of whether H(+) is transferred to CO. IR spectra of all species were interpreted by B3LYP/cc-pVQZ calculations of the simple models, which adequately mimic the ability of carborane acids to form LH(+)CO, LH(+)CO, COH(+)L, and COH(+)L compounds (L = bases). The CO bond in all compounds was triple. Acidic strength of the Brønsted centers of commonly used acid catalysts, even so-called superacidic catalysts, is not sufficient for the formation of the compounds studied. PMID:26805010

  14. Angular correlation for gamma-gamma transitions in 81Br and 83Br nuclei

    International Nuclear Information System (INIS)

    The directional angular correlation of coincident gamma transitions in 81Br and 83Br have been measured following the β- decay of 81Se(T sub(1/2) = 18.6 min) and 83Se(T sub(1/2) = 22.6 min) respectively, using Ge(Li) - high purity Ge and Ge(Li)-NaI(Tl) spectrometers. The radioactive sources were prepared by irradiating with neutrons in the IEA-R1 reactor, metallic selenium (natural) to produce 81Se and samples of metallic selenium enriched (to approx. 90% in 82Se) to produce 83Se. Measurements have been carried out for the gamma cascades 260-276 KeV, 290-276 KeV and 552-276 KeV in 81Br and the gamma cascades 225(510)-356 KeV, 510-356 KeV, 572-(510)-356 KeV, 718-(225)-(510)-356 KeV, 1064-356 KeV, 718-225 KeV, 718-(225)-510 KeV, 836-718 KeV, 718-(225)-866 KeV, 883-718 KeV and 1895-799 KeV in 83Br. The multipole mixing ratios, σ(E2/M1), were determined for 3 gamma transitions in 81Br and 11 gamma transitions in 83Br. In the case of 81Br present results confirmed some of the earlier results. The spin and parity assignment were made to the majority of levels in 81Br and 83Br involved in the present study, some of them confirming the earlier results. A comparison of some of the nuclear properties of the 79Br, 81Br and 83Br is made based on the available experimental data. The experimental results are also discussed qualitatively in terms of some nuclear models applicable for the description of the properties of odd-A bromine isotopes. (Author)

  15. Investigation of LaBr3:Ce probe for gamma-ray spectroscopy and dosimetry (United States)

    Maghraby, Ahmed M.; Alzimami, K. S.; Alkhorayef, M. A.; Alsafi, K. G.; Ma, A.; Alfuraih, A. A.; Alghamdi, A. A.; Spyrou, N. M.


    The main thrust of this work is the investigation of performance of relatively new commercial LaBr3:Ce probe (Inspector 1000™ with LaBr3:Ce crystal) for gamma-ray spectroscopy and dosimetry measurements in comparison to LaCl3:Ce and NaI:Tl scintillators. The crystals were irradiated by a wide range of energies (57Co, 22Na, 18F, 137Cs and 60Co). The study involved recording of detected spectra and measurement of energy resolution, photopeak efficiency, internal radioactivity measurements as well as dose rate. The Monte Carlo package, Geant4 Application for Tomographic Emission (GATE) was used to validate the experiments. Overall results showed very good agreement between the measurements and the simulations. The LaBr3:Ce crystal has excellent energy resolution, energy resolutions of (3.37±0.05)% and (2.98±0.07)% for a 137Cs 662 keV and a 60Co 1332 keV gamma-ray point sources respectively, were recorded. The disadvantage of the lanthanum halide scintillators is their internal radioactivity. Inspector 1000™ with LaBr3:Ce scintillator has shown an accurate and quick dose measurements at Positron Emission Tomography (PET) Units which allows accurate assessment of the radiation dose received by staff members compared to the use of electronic personal dosimeters (EPD).

  16. Synthesis of C-fused Penems By Br- or Cl-Promoted S-Heterocyclization

    Institute of Scientific and Technical Information of China (English)


    @@ Introduction In the past several years, much research work has been done for the synthesis of C-fused bicyclo-β-lactam compounds and a concise “Double Annulation” procedure has been developed. The β-lactam ring is formed by the classical Staudinger reaction[1—3] between α-(alkylthio) acyl chloride and an equivalent α,β-unsaturated imine. The sulfur ring is subsequently fused onto the β-lactam unit by means of a halogen-promoted heterocyclization process[4—6]. This procedure was applied to the synthesis of penem as illustrated in Fig.1. The obtained X-penems are a kind of important intermediates for synthesizing a series of β-lactam compounds, for example, they are carboxylated by coupling reactions on the C atom which is linked to halagen, forming penem[7]. An important purpose in the research field is to probe into new β-lactam medicines.

  17. Method of increments for the halogen molecular crystals: Cl, Br, and I

    Energy Technology Data Exchange (ETDEWEB)

    Steenbergen, Krista G. [Physikalische und Theoretische Chemie, Freie Universität Berlin, Takustr. 3, 14195 Berlin (Germany); MacDiarmid Institute for Advanced Materials and Nanotechnology, Victoria University of Wellington, P.O. Box 600, Wellington 6012 (New Zealand); Gaston, Nicola [MacDiarmid Institute for Advanced Materials and Nanotechnology, Victoria University of Wellington, P.O. Box 600, Wellington 6012 (New Zealand); Müller, Carsten; Paulus, Beate [Physikalische und Theoretische Chemie, Freie Universität Berlin, Takustr. 3, 14195 Berlin (Germany)


    Method of increments (MI) calculations reveal the n-body correlation contributions to binding in solid chlorine, bromine, and iodine. Secondary binding contributions as well as d-correlation energies are estimated and compared between each solid halogen. We illustrate that binding is entirely determined by two-body correlation effects, which account for >80% of the total correlation energy. One-body, three-body, and exchange contributions are repulsive. Using density-fitting (DF) local coupled-cluster singles, doubles, and perturbative triples for incremental calculations, we obtain excellent agreement with the experimental cohesive energies. MI results from DF local second-order Møller-Plesset perturbation (LMP2) yield considerably over-bound cohesive energies. Comparative calculations with density functional theory and periodic LMP2 method are also shown to be less accurate for the solid halogens.

  18. Ravintola Tallin brändi-identiteetti ja -imago


    Hirvikoski, Mira


    Opinnäytetyöni aiheena on brändi. Brändit ovat nykyaikana oleellinen osa liiketoimintaa ja parhaimmil-laan jopa yritystensä kallisarvoisinta omaisuutta. Brändi-identiteetti on tulevaisuuden tavoite, johon yritys pyrkii. Se kertoo, millaisena yritys toivoisi ulkopuolisten tahojen, kuten asiakkaiden, näkevän sen brändin. Brändi-imago taas kuvaa sitä, millaisena yrityksen ulkopuoliset tahot näkevät sen brändin juuri tällä het-kellä. Opinnäytetyöni tavoitteena oli selvittää, miten Ravintola T...

  19. The TbBr3–LiBr binary system: Experimental thermodynamic investigation and assessment of phase diagram

    International Nuclear Information System (INIS)

    Highlights: ► DSC measurements for the (LiBr + TbBr3) system. ► congruently Li3TbBr6 and incongruently melting Li5TbBr8 compounds. ► Thermodynamic description of the liquid phase in the (LiBr + TbBr3) system. ► Assessment with a two-sublattice ionic solution model. - Abstract: DSC was used to study the phase equilibrium in the TbBr3–LiBr binary system. The results obtained provided a basis for constructing the phase diagram of this system. It exhibits two compounds: Li5TbBr8, which decomposes in the solid state at 611 K, and Li3TbBr6, which melts congruently at 785 K with the related enthalpy 59.1 kJ·mol−1. The binary LiBr–TbBr3 system was then optimized using the available experimental information on phase diagram and thermodynamic properties. A two-sub-lattice ionic solution model (Li+)P:(Br−, TbBr6−3, TbBr3)Q was adopted to describe the liquid phase. The present assessment of the binary LiBr–TbBr3 system was in good agreement with the corresponding experimental data and confirmed their consistency.

  20. Elamusturundus: riigi brändimine ja Eesti bränd / Siiri Same

    Index Scriptorium Estoniae

    Same, Siiri


    Artikli autor oma 2015. a. Tallinna Tehnikaülikoolis kaitstud doktoritööst "Conceptualization of experience marketing and country branding from a marketing management perspective" ("Elamusturunduse ja riigi brändimise kontseptualiseerimine turunduse juhtimise vaatenurgast")

  1. Vahva ja erottuva brändi yrityksen kilpailuetuna : VihreäKeiju-brändin kuluttaja-asiakastutkimus


    Merta, Helinä


    Brändi on kaikkien niiden mielikuvien ja tietojen summa, joita ihmisellä on jostain asiasta. Brändi syntyi 1700-luvun Amerikassa, jossa karja merkittiin polttomerkein (engl. brand), jotta jokainen erottaisi oman karjansa. Brändi tarkoittikin aluksi erilaistavaa tunnistetta tai symbolia. Nykyisin brändillä viitataan konkreettisiin ja mielikuvallisiin ominaisuuksiin, joiden avulla tuotteet erottuvat toisistaan. Brändiä rakentamalla pyritään kirkastamaan brändiin liitettyjä mielikuvia sekä er...

  2. Experimental studies on BrO/Br ratios at Stromboli, Etna, Masaya, Gorely and Nyiragongo (United States)

    Bobrowski, Nicole; Wittmer, Julian; Liotta, Marcello; Calabrese, Sergio; Giuffrida, Giovanni; Brusca, Lorenzo; Platt, Ulrich


    Since the discovery of BrO in a volcanic plume (Bobrowski et al. 2003) many measurements have been performed as well as modelling to understand the radical chemistry in volcanic plumes, in particular, the interaction between volcanic gas species, released under strongly reduced conditions, and the oxidizing atmosphere. Besides the goal in atmospheric chemistry to better determine the impact of volcanic emission (e.g. reactive bromine) on the local (and maybe global) scale, volcanologists also have an interest to understand if the BrO/SO2 ratios can be used as a monitoring parameter giving further insides in dynamic processes of volcanoes. One of the major advantages when utilizing BrO/SO2 ratios is the relatively easiness of the measurements, which can be taken in a safe distance from volcanic activity accompanied by a good temporal resolution partly even during explosive eruptions. Recently, it has been shown (Lübcke et al., 2013) that already existing automatically running measurement networks can now be used to gain long-term data sets of BrO/SO2 ratios. However, one of the arguments which potentially makes volcanological interpretations difficult is the reactivity of BrO. Therefore it is, of great importance to link the measurements of BrO and gaseous hydrogen bromide to the total emission flux of bromine in order to estimate the pristine gas composition released from magmas. In particular, meteorological influences, trace gas composition of the surrounding atmosphere and the volcanic gas composition can all potentially effect the formation of BrO and might have to be considered. Some of these factors potentially also influence near source in-situ measurement. We need to answer the question: Can we correlate BrO measurements to the total bromine outgassing? Only with this knowledge we can relate changes of the measured gas ratios (BrO/SO2) to the volcanic fluids emitted by the underlying magma and can interpret data as signals from depth, which provide insight

  3. Aging and mechanical properties of NR/BR blends (United States)

    Chiu, Hsien-Tang; Tsai, Peir-An


    The mechanical properties and post-thermal aging properties of natural rubber (NR) and polybutadiene rubber (BR) blends at different blending ratios are investigated herein. The experimental results show that both tensile and tear strengths of NR/BR blends increase with increasing NR content. BR has a higher compression stiffness than NR. The deformation of BR is less than that of NR under the same load conditions. With regard to aging properties, both tensile stress and strain of NR/BR blends decrease after prolonged aging. In addition, the stress loss of BR is lower than that of NR, meaning that the aging resistance property of BR is superior to that of NR. Furthermore, accumulated thermal history has shifted the glass transition temperature (T g) of NR/BR blends toward lower temperatures while the loss tangent (tan δ) value increases with prolonged thermal aging.

  4. Molecular elimination of Br2 in photodissociation of CH2BrC(O)Br at 248 nm using cavity ring-down absorption spectroscopy

    International Nuclear Information System (INIS)

    The primary elimination channel of bromine molecule in one-photon dissociation of CH2BrC(O)Br at 248 nm is investigated using cavity ring-down absorption spectroscopy. By means of spectral simulation, the ratio of nascent vibrational population in v = 0, 1, and 2 levels is evaluated to be 1:(0.5 ± 0.1):(0.2 ± 0.1), corresponding to a Boltzmann vibrational temperature of 581 ± 45 K. The quantum yield of the ground state Br2 elimination reaction is determined to be 0.24 ± 0.08. With the aid of ab initio potential energy calculations, the obtained Br2 fragments are anticipated to dissociate on the electronic ground state, yielding vibrationally hot Br2 products. The temperature-dependence measurements support the proposed pathway via internal conversion. For comparison, the Br2 yields are obtained analogously from CH3CHBrC(O)Br and (CH3)2CBrC(O)Br to be 0.03 and 0.06, respectively. The trend of Br2 yields among the three compounds is consistent with the branching ratio evaluation by Rice-Ramsperger-Kassel-Marcus method. However, the latter result for each molecule is smaller by an order of magnitude than the yield findings. A non-statistical pathway so-called roaming process might be an alternative to the Br2 production, and its contribution might account for the underestimate of the branching ratio calculations.

  5. BR2 Reactor: Irradiation of Fusion Materials

    International Nuclear Information System (INIS)

    In collaboration with the EFDA (European Fusion Development Agreement), SCK-CEN irradiates several materials in the BR2 reactor at different temperatures and up to different doses to study their mechanical and physical properties during and after irradiation. Those materials are candidates for the construction of different parts of the ITER fusion reactor and of the long-term DEMO (DEMOnstration) reactor. The objectives of research performed at SCK-CEN are to irradiate up to 2 dpa RAFM (Reduced Activity Ferritic Martensitic) steels joints and RAFM ODS (Oxide Dispersion Strengthening) at 300 degrees Celsius; to build and test an experimental rig to perform in-situ creep-fatigue tests under neutron irradiation and its out-pile equipment and to design a new irradiation basket to irradiate in BR2 copper/stainless steel joints and RAFM specimens with implanted helium at low dose

  6. Decommissioning of the BR3 PWR

    International Nuclear Information System (INIS)

    The objectives, programme and main achievements of SCK-CEN's decommissioning programme in 1997 are summarised. Particular emphasis is on the BR3 decommissioning project. In 1997, auxiliary equipment and loops were dismantled; concrete antimissile slabs were decontaminated; the radiology of the primary loop was modelled; the quality assurance procedure for dismantling loops and equipment were implemented; a method for the dismantling of the reactor pressure vessel was selected; and contaminated thermal insulation of the primary loop containing asbestos was removed

  7. Decommissioning of the BR3 PWR

    International Nuclear Information System (INIS)

    The dismantling and the decommissioning of nuclear installations at the end of their life-cycle is a new challenge to the nuclear industry. Different techniques and procedures for the dismantling of a nuclear power plant on an existing installation, the BR-3 pressurized-water reactor, are described. The scientific program, objectives, achievements in this research area at the Belgian Nuclear Research Centre SCK-CEN for 1997 are summarized

  8. Periodicity, Electronic Structures, and Bonding of Gold Tetrahalides [AuX4](-) (X = F, CI, Br, I, At, Uus)

    Energy Technology Data Exchange (ETDEWEB)

    Li, Wan-Lu; Li, Yong; Xu, Congqiao; Wang, Xue B.; Vorpagel, Erich R.; Li, Jun


    Systematic theoretical and experimental investigations have been performed to understand the periodicity and electronic structures of trivalent-gold halides using gold tetrahalides [AuX4]⁻ anions (X = F, Cl, Br, I, At, Uus). The [AuX4]⁻ (X = Cl, Br, I) anions were produced in gas phase and their negative-ion photoelectron spectra were obtained, which exhibited rich and well-resolved spectral peaks. We calculated the adiabatic as well as vertical electron detachment energies using density functional methods with scalar and spin-orbit coupling relativistic effects. The simulated photoelectron spectra based on these calculations are in good agreement with the experimental spectra. Our results show that the trivalent Au(III) oxidation state becomes progressively less stable while Au(I) is preferred when the halides become heavier along the Period Table. This trend reveals that the oxidation state of metals in complexes can be manipulated through ligand design

  9. SOFC brændselsceller i et intelligent elnet


    Hjelm, Johan


    SOFC brændselsceller kan være med til at skabe balance i elnettet i takt med at elproduktionen i stigende grad baseres på sol og vind. Brændselscellerne kan kobles til naturgasnettet og på sigt bruge forskellige former for VE-gasser som brændstof.

  10. BR2 reactor: medical and industrial applications

    International Nuclear Information System (INIS)

    The radioisotopes are produced for various applications in the nuclear medicine (diagnostic, therapy, palliation of metastatic bone pain), industry (radiography of welds, ...), agriculture (radiotracers, ...) and basic research. Due to the availability of high neutron fluxes (thermal neutron flux up to 1015 n/cm2.s), the BR2 reactor is considered as a major facility through its contribution for a continuous supply of products such 99Mo (99mTc), 131I, 133Xe, 192Ir, 186Re, 153Sm, 90Y, 32P, 188W (188Re), 203Hg, 82Br, 41Ar, 125I, 177Lu,89Sr, 60Co, 169Yb, 147Nd, and others. Neutron Transmutation Doped (NTD) silicon is produced for the semiconductor industry in the SIDONIE (Silicon Doping by Neutron Irradiation Experiment) facility, which is designed to continuously rotate and traverse the silicon through the neutron flux. These combined movements produce exceptional dopant homogeneity in batches of silicon measuring 4 and 5-inches in diameter by up to 750 mm in length. The main objectives of work performed were to provide a reliable and qualitative supply of radioisotopes and NTD-silicon to the customers in accordance with a quality system that has been certified to the requirements of the EN ISO 9001: 2000. This new Quality System Certificate has been obtained in November 2003 for the Production of radioisotopes for medical and industrial applications and the Production of Neutron Transmutation Doped (NTD) Silicon in the BR2 reactor

  11. Synthesis and structural characterization of luminescent inorganic materials of the type CS2NaErBr6 and CS2NaHoBr6

    International Nuclear Information System (INIS)

    The synthesis and structural characterization is described of two luminescent materials, with technological [1] and spectroscopic [2] interest, whose crystallographic charts have not been published in the literature. The synthesis of both systems: Cs2NaErBr6 and CS2NaHoBr6, was done using solid state reactions in a controlled environment. The thermal analyses DTA/TGA, applied with a temperature gradient of 10o C/min., established crystallization ranges of 490,4 oC to 545,4 oC, for the elpasolite CS2NaHoBr6 and 501oC to 556oC, for the structure CS2NaErBr6.. The heat vacuum treatments were carried out at 505 oC and 526 oC respectively, obtaining optimum crystallization. The structural characterization was performed with powdered X-ray diffraction (XRD). The range between 12o and 80o (2θ), was analyzed for 3352 points, measured steps of 0.02o (2θ using the Rietveld profile refining program. The following crystallographic parameters were established: a0 = 11,279(1), and 11,293(4) Angstroms, for the two structures analyzed, respectively. The relationship Rexp wp in both cases is highly accurate for the 32 test lines that were analyzed. The structures present cubic closed packing Cs1+ 3 Cl1-, with Ho3+ and Er3+ atoms, filling the octahedral holes. The test data obtained will be very useful for completing the mass of experimental data needed to develop the design engineering, with specific applications for luminescent devices

  12. 76 FR 46597 - Airworthiness Directives; Bombardier, Inc. Model CL-600-2A12 (CL-601) and CL-600-2B16 (CL-601-3A... (United States)


    .... Model CL-600-2A12 (CL- 601) and CL-600-2B16 (CL-601-3A, CL-601-3R, and CL-604 Variants) Airplanes... Bombardier, Inc. model-- Task(s)-- Initial compliance time (whichever occurs later)-- CL-600-2A12 (CL-601... icing. accumulation of 4,800 after the effective inclusive; and CL-600-2B16 (CL- total flight hours;...

  13. Proposed solar neutrino experiment using 81Br(nu,e-)81Kr

    International Nuclear Information System (INIS)

    It has now been shown that it is feasible to measure the 7Be neutrino source in the sun by using the reaction 81Br(nu,e-)81Kr in a radiochemical experiment. Such an experiment would be quite similar to the Davis, Cleveland, and Rowley method for measuring the 8B neutrino using 37Cl(nu,e-)37Ar except that the resonance ionization spectroscopy (RIS) method (instead of decay counting) would be employed to count the 2 x 105-yr 81Kr atoms

  14. Proposed solar neutrino experiment using 81Br(ν,e-)81Kr

    International Nuclear Information System (INIS)

    It has now been show that it is feasible to measure the 7Be neutrino source in the sun by using the reaction 81Br(ν,e-)81Kr in a radiochemical experiment. Such an experiment would be quite similar to the Davis, Cleveland, and Rowley method for measuring the 8B neutrino using 37Cl(ν,e-)37Ar except that the resonance ionization spectroscopy (RIS) method (instead of decay counting) would be employed to count the 2 x 105-yr 81Kr atoms

  15. A Capillary Electrophoresis Detection Scheme for Water-soluble Vitamins Based on Luminol - BrO- Chemiluminescence System

    Institute of Scientific and Technical Information of China (English)


    A novel chemiluminescence detection scheme has been developed for detecting water-soluble vitamins following capillary electrophoresis (CE) separation. This detection was based on the inhibitory effect of vitamins on the CL reaction between luminol and BrO- in basic aqueous solution. Detection of vitamins was accomplished with a borate-based background electrolyte at pH 9.2. The luminol was used as a component of the separation carrier electrolyte.

  16. First measurement of high energy 22.5 MeV gamma rays in a large LaBr3: Ce detector

    International Nuclear Information System (INIS)

    The recent discovery of Lanthanum-halide (LaX3:Ce) crystals is proving to be a major step forward in the continuing quest for an ideal scintillator for nuclear radiation detection. The production and marketing of the LaCl3: Ce and LaBr3: Ce crystals have resulted in a flurry of activities for their testing and characterisations. The very attractive and superior properties of LaBr3: Ce, namely, energy and timing resolution, stability, high efficiency etc. over most of the other scintillators open up a very wide usage of these scintillators in nuclear spectroscopy, astronomy, medical imaging, geological applications etc. As far nuclear spectroscopy is concerned the LaBr3: Ce and LaCl3: Ce scintillators demonstrate the capabilities to be used for the detection of both low and high energy gamma rays

  17. A hydrochemical investigation using 36Cl/Cl in groundwaters


    Metcalfe, R.


    This report describes 36Cl studies which were undertaken during the H14 financial year. 6 groundwater samples were collected for 36Cl analysis. The results of this study suggest that 36Cl data could potentially be useful for interpreting groundwater origins and flow paths.

  18. Synthesis and crystal structures of Cd[AlCl4]2 and Cd2[AlCl4]2

    International Nuclear Information System (INIS)

    Colorless single crystals of Cd[AlCl4]2 grow from the melt of CdCl2 and AlCl3 upon slow cooling from 250 0C. The crystal structure [monoclinic, P1a1, Z = 2, a = 1288.7(2), b = 660.2(1), c = 705.1(1) pm, β = 92.89(1)0] may be derived from hexagonally closest packed layers of Cl-. Octahedral and tetrahedral holes are filled with Cd2+ and Al3+ in a 1:2 ratio between all layers stacked in the [104] direction. Cd[GaCl4]2 and Cd[AlBr4]2 are isotypic. Reduction of Cd[AlCl4]2 with excess cadmium shot and slow cooling from 350 0C yields plate-like very moisture-sensitive, colorless single crystals of Cd2[AlCl4]2. The crystal structure [triclinic, C-1, Z = 2, a = 655.47(3), b = 1135.26(1), c = 935.23(6) pm, α = 89.70(2)0, β = 103.61(1)0, γ = 90.455(1)0] is built from slabs stacked in the [100] direction consisting of ethane-like [Cd2Cl6] units with a Cd-Cd distance of 256.1 pm sharing common vertices with [AlCl4] tetrahedra. (author)

  19. Dry storage of the BR3 spent fuel in the Castor BR3 cask

    Energy Technology Data Exchange (ETDEWEB)

    Ooms, L.; Massaut, V.; Noynaert, L. [SCK/CEN, B-2400 Mol (Belgium); Braeckeveldt, M. [Niras/Ondraf, B-1210 Brussels (Belgium)


    Twenty-five years of operation has resulted in an inventory of spent fuel with a wide variety in the BR3 nuclear pilot power plant. Studies were launched to evaluate all possible solutions for the BR3 experimental and 'exotic' spent fuel, i.e. reprocessing, dry storage in containers and dry storage in canisters. For the BR3 spent fuel the interim dry storage in Castor BR3 containers was chosen. The present paper describes in a first part the history and characteristics of the spent fuel. A second part handles with the different options, which were studied for the spent fuel evacuation. The last part focuses on the spent fuel preparation and the production of the Castor BR3. This project allowed the SCK-CEN to build up an important know-how in the field of spent fuel management, especially the management of research reactor fuel, which is very specific and not comparable with spent fuel of commercial nuclear power plants. (author)

  20. Communication: An unusual halogen-bonding motif: the LiBr···BrF dimer as a model system. (United States)

    McDowell, Sean A C; Joseph, Jerelle A


    A stable complex, LiBr···BrF, is predicted in which the negative Br atom of LiBr is anchored to the Br atom of BrF by a halogen bond, while the positively charged Li atom interacts with the lone pair electron density on the Br atom of BrF in a direction roughly perpendicular to the halogen bond. As far as we are aware, this is the first reported instance of an atom of one diatomic molecule (Br of BrF) being bonded to two different, oppositely charged atoms (Li and Br) of another diatomic molecule (LiBr). Other less stable dimers of LiBr and BrF were predicted and compared with this novel complex. PMID:23145710

  1. Vaatemerkin brändin vaikutus vaatteiden ostoon


    Orkamaa, Miro


    Opinnäytetyöni aiheena on tutkia, kuinka vaatemerkin brändi vaikuttaa vaatteiden ostamiseen Kemi-Tornion ammattikorkeakoulun opiskelijoiden keskuudessa. Opinnäytetyössäni pohdin kuluttajien ostokäyttäytymistä, itse ostoprosessia sekä brändiä, brändin merkitystä nyky-yhteiskunnassa ja brändikritiikkiä. Otan esimerkkejä brändeistä, jotka liittyvät vaateteollisuuteen ja ovat tunnettuja merkkejä. Tutkimusta varten suoritin kyselyn, jonka tavoitteena oli selvittää, kuinka paljon vaatemerkki j...

  2. Pulsed-Field Ultrasonic Experiments in the Quasi-2D Antiferromagnet Cs2CuBr4 (United States)

    Wolf, B.; Cong, P. T.; Krüger, N.; Ritter, F.; Assmus, W.; Lang, M.


    The magnetic insulators Cs2CuCl4 and Cs2CuBr4 are model systems for a frustrated quasi-two-dimensional triangular-lattice spin-1/2 Heisenberg antiferromagnet with a weak interlayer coupling. The quasi-two-dimensional character manifests itself in a broad maximum at T max in the magnetic susceptibility, which for Cs2CuCl4 has been found to mark the upper bound for a spin-liquid regime (R. Coldea et al. in Phys. Rev. B 68:134424, 2003). Motivated by the observation of characteristic B 2 dependencies in the elastic constants and ultrasound attenuation in the spin-liquid regime for this material, we look for corresponding signatures in the related Cs2CuBr4 compound at low temperatures T≤4.2 K and fields B≤50 T. We observe a softening of the elastic constant up to B s ˜32 T ( B∥ a) and a maximum in the sound attenuation at 0.86 B s . Both quantities exhibit the same characteristic B 2 dependence as found for Cs2CuCl4, suggesting the existence of a spin-liquid phase in Cs2CuBr4 as well.

  3. OClO and BrO observations in the volcanic plume of Mt. Etna - implications on the chemistry of chlorine and bromine species in volcanic plumes (United States)

    Gliss, J.; Bobrowski, N.; Vogel, L.; Pohler, D.; Platt, U.


    Spatial and temporal profiles of chlorine dioxide (OClO), bromine monoxide (BrO) and sulfur dioxide (SO2) of the volcanic plume at Mt. Etna, Italy, were investigated in September 2012 using Multi-Axis Differential Optical Absorption Spectroscopy (MAX-DOAS). OClO was detected in 119 individual measurements covering plume ages up to 6 min. BrO could be detected in 452 spectra up to 23 min downwind. The retrieved slant column densities (SCDs) reached maximum values of 2.0 × 1014 molecules cm-2 (OClO) and 1.1 × 1015 molecules cm-2 (BrO). Mean mixing ratios of BrO and OClO were estimated assuming a circular plume cross section. Furthermore, ClO mixing ratios were derived directly from the BrO and OClO-SCDs. Average abundances of BrO = 1.35 ppb, OClO = 300 ppt and ClO = 139 ppt were found in the young plume (plume age τ atmospheric lifetime of CH4, the impact of gaseous chlorine on the CH4 budget in the plume environment should nevertheless be relatively small due to plume dispersion (decreasing Cl concentrations) and ongoing mixing of the plume with the surrounding atmosphere (replenishing O3 and CH4). In addition, all spectra were analysed for signatures of IO, OIO and BrO. None of these species could be detected. Upper limits for IO/SO2, OIO/SO2 and OBrO/SO2 are 1.8 × 10-6, 2.0 × 10-5 and 1.1 × 10-5 respectively.

  4. In situ production of brGDGTs in Lake Lugano (United States)

    Weber, Yuki; Hopmans, Ellen C.; Schubert, Carsten; Simona, Marco; Sinninghe Damsté, Jaap S.; Lehmann, Moritz F.; Niemann, Helge


    Branched glycerol dialkyl glycerol tetraethers (brGDGTs) are bacterial membrane lipids that commonly occur in soils, as well as in sediments and suspended particulate matter (SPM) of lakes. The distribution of brGDGTs is related with temperature and pH, allowing their use as proxy indicators for the reconstruction of past climatic and environmental conditions. While transfer functions are well-established for brGDGTs derived from soils, still little is known about the links between the composition of aquatically produced brGDGTs and environmental parameters. Also the identity, ecology and carbon substrate of the aquatic source organisms are mostly unknown. We analyzed brGDGTs in the core- and intact polar lipid fractions of SPM from eutrophic Lake Lugano (Switzerland) using an advanced HPLC-MS method, capable of distinguishing between 5 methyl brGDGTs and the recently discovered 6 methyl brGDGT isomers. Our data show large variations in both the concentration and the relative abundances of brGDGTs throughout the water column, with most pronounced compositional changes right at the oxic/anoxic interface: A novel brGDGT isomer, which we discovered recently for the first time in sediments of another Swiss lake (Lake Hinterburg) and which is probably intrinsic to lacustrine environments, occurs exclusively in the anoxic monimolimnion but neither in the oxic mixolimnion nor in catchments soils of Lake Lugano. Furthermore, the brGDGT distribution in the lake's mixolimnion also differs from that in the catchment. This indicates that the brGDGTs present in the water column are dominantly autochthonous and that several distinct brGDGT-producing bacterial communities with different redox requirements can co-exist within the same lake system. Hence, our results provide new insights into the sources and distribution of brGDGTs in lacustrine environments, with important implications for the use of brGDGT-based proxies in paleolimnological studies.

  5. Constitutional Isomerism of BiW6Cl15: (BiCl)[W6Cl14] and (BiCl2)[W6Cl13


    Meyer, Hans-Juergen


    Abstract The compound (BiCl)[W6Cl14] was previously characterized as a product of the reduction of tungsten hexachloride with elemental bismuth. Another modification of BiW6Cl15 is now presented as (BiCl2)[W6Cl13], based on the results of an X-ray single crystal structure determination (space group P21/c, a = 1354.3(2) pm, b = 1234.4(2) pm, c = 1538.9(2) pm, and ? = 118.76(1) ?). The structure of (BiCl2)[W6Cl13] contains chains of [(W6Cl8i)Cl4aCl2/2a-a]- clusters bridged by chlorin...

  6. Influence of methoxy-substituents on the strength of BrBr type II halogen bonds in bromobenzoic acid (United States)

    Raffo, Pablo A.; Marcolongo, Juan P.; Funes, Alejandro V.; Slep, Leonardo D.; Baggio, Ricardo F.; Cukiernik, Fabio D.


    4-bromo-3,5-di(methoxy)benzoic acid (I) crystallizes in the monoclinic C2/c space group, a = 22.3405 (6) Å, b = 4.85142 (14) Å, c = 18.1583 (5) Å, β = 93.086 (2)°. The crystal structure shows head-to-head dimeric units linked via type II BrBr interactions as well as Br … π and weak H-bonding interactions. The whole structure exhibits features similar to those of the parent 4-bromobenzoic acid (II), most notably the overall geometrical features involved in the BrBr type II interactions. Both structures display comparable C-BrBr angles (θ1 = 98.3 and 91.6° and θ2 = 163.0 and 163.5° for (I) and (II) respectively), but the BrBr distance is significantly shorter in (I) (3.58 Å) than in (II) (3.81 Å). QM computations provide the magnitude of the intermolecular interactions present in both (I) and (II), and allow disclosing the individual covalent and electrostatic contributions to the Br⋯Br halogen bond in terms of interaction energies, electrostatic potentials, and a molecular orbital (MO) analysis.

  7. Randnahe Kopfbolzen im Brückenbau


    Raichle, Jochen


    Kopfbolzen stellen ein bewährtes und wirtschaftliches Verbindungsmittel zwischen einem Bauteil aus Stahl und einem Bauteil aus Beton dar. Die randnahen Kopfbolzen weisen gegenüber dem häufigen Fall der randfernen Kopfbolzen einen geringen Abstand der Bolzenachse zur Betonoberfläche auf. Dadurch ergibt sich bei randnahen Kopfbolzen gegenüber randfernen Kopfbolzen ein geändertes Trag- und Ermüdungsverhalten der Verbundfuge, das insbesondere in Hinblick auf Ermüdung und damit der Anwendung im Br...

  8. Present status of TCA/BR Tokamak

    International Nuclear Information System (INIS)

    The TCA tokamak is being partially reconstructed and reassembled in the Plasma Laboratory of The University of Sao Paulo, and afterwards it will be named TCA/BR. The first discharges are expected by June/July of next year. The main scientific objectives envisaged for the machine are: Alfven wave heating and current drive, confinement improvement, disruptions and turbulence. In this paper we also describe: (i) the present status of the project; (ii) the diagnostic system; (iii) the control and data acquisition system; (iv) the RF system for the excitation of Alfven waves, that are being developed, and also the results of predictive transport simulations of its performance. (author)

  9. Synthesis and structure of diorganotin dibromides, R2SnBr2 (R = 2,4,6-trimethylphenyl or 2,4,6-trimethylbenzyl): Hydrolysis of (2,4,6-Me3C6H2)2SnBr2

    Indian Academy of Sciences (India)

    Vadapalli Chandrasekhar; Ramalingam Thirumoorthi


    The reaction of SnBr4 with in situ generated 2,4,6-trimethylphenylmagnesium bromide afforded a mixture of (2,4,6-Me3C6H2)2SnBr2 (1) and (2,4,6-Me3C6H2)3SnBr (2) which could be separated from each other by their solubility differences in diethyl ether. On the other hand, the reaction of tin metal with 2,4,6-Me3C6H2CH2Br afforded (2,4,6-Me3C6H2CH2)2SnBr2 (3). Hydrolysis of the latter using triethylamine as the base afforded [{(2,4,6-Me3C6H2CH2)2Sn}2(-O)(Br)(-OH)]2.2CH2Cl2 (4) while the use of NaOH as the base afforded [{(2,4,6-Me3C6H2CH2)2Sn}2(-O)(OH)(-OH)]2.2CH2Cl2 (5). Compounds 4 and 5 are dimeric tetraorganodistannoxanes consisting of a central distannoxane (Sn2O2) motif.

  10. Ozone Depletion Potential of CH3Br. Appendix H (United States)

    Ko, Malcolm K. W.; Sze, Nien Dak; Scott, Courtney; Rodriguez, Jose M.; Weisenstein, Debra K.; Sander, Stanley P.


    The ozone depletion potential (ODP) of methyl bromide (CH3Br) can be determined by combining the model-calculated bromine efficiency factor (BEF) for CH3Br and its atmospheric lifetime. This paper examines how changes in several key kinetic data affect BEF. The key reactions highlighted in this study include the reaction of BrO + HO2, the absorption cross section of HOBr, the absorption cross section and the photolysis products of BrONO2, and the heterogeneous conversion of BrONO2 to HOBr and HNO3 on aerosol particles. By combining the calculated BEF with the latest estimate of 0.7 year for the atmospheric lifetime of CH3Br, the likely value of ODP for CH3Br is 0.39. The model-calculated concentration of HBr (approx. 0.3 pptv) in the lower stratosphere is substantially smaller than the reported measured value of about 1 pptv. Recent publications suggested models can reproduce the measured value if one assumes a yield for HBr from the reaction of BrO + OH or from the reaction of BrO + HO2. Although the evaluation concluded any substantial yield of HBr from BrO + HO2 is unlikely, for completeness, we calculate the effects of these assumed yields on BEF for CH3Br. Our calculations show that the effects are minimal: practically no impact for an assumed 1.3% yield of HBr from BrO + OH and 10% smaller for an assumed 0.6% yield from BrO + HO2.

  11. BR2 reactor: medical and industrial applications

    International Nuclear Information System (INIS)

    The radioisotopes are produced for various applications in the nuclear medicine (diagnostic, therapy, palliation of metastatic bone pain), industry (radiography of welds ...), agriculture (radiotracers ...) and basic research. Due to the availability of high neutron fluxes (thermal neutron flux up to 1015 n/cm2.s), the BR2 reactor is considered as a major facility through its contribution for a continuous supply of products such as 99Mo (99mTc), 131I, 133Xe, 192Ir, 186Re, 90Sm, 131Y, 32P, 188W (188Re), 203Hg, 82Br, 41Ar, 125I, 177Lu, 89Sr, 60Co, 169Yb, 147Nd, ... Neutron Transmutation Doped (NTD) silicon is produced for the semiconductor industry in the SIDONIE (Silicon Doping by Neutron Irradiation Experiment) facility, which is designed to continuously rotate and traverse the silicon through the neutron flux. These combined movements produce exceptional dopant homogeneity in batches of silicon measuring 4 and 5-inches in diameter by up to 750 mm in length

  12. Brändi ja sen kehittäminen : Bränditutkimus ja brändinkehittämisehdotuksia kauppakeskus Elolle


    Kumanto, Sofia


    Tämä työn tarkoituksena oli tutkia kauppakeskus Elon asiakkaiden brändimielikuvaa Elosta ja vastauksien perusteella koota brändinkehittämisehdotuksia. Tavoitteena on käyttää näitä tuloksia lisäämään kauppakeskus Elon johdon tietoa Elon brändistä heidän asiakkaiden näkökulmasta. Lisäksi tavoitteena on auttaa tämän tiedon ja työn sisältämien brändikehittämisehdotuksien pohjalta kehittämään Elon brändiä ja näin saada houkuteltua lisää asiakkaita kauppakeskukseen. Johdannossa esitellään kaup...

  13. Algunos aspectos demográficos, clínicos y de laboratorio en un grupo de pacientes con leptospirosis

    Directory of Open Access Journals (Sweden)

    Edilma Jaramillo


    Full Text Available La leptospirosis es una zoonosis de distribución mundial transmitida<br />por mamíferos domésticos y salvajes, cuya presentación clínica va desde un cuadro benigno hasta una falla multisitémica1-2. Nuestro objetivo fue describir el perfil sociodemográfico, clínico y de laboratorio de pacientes a los que se les hizo diagnóstico de leptospirosis.

  14. CL2QCD - Lattice QCD based on OpenCL

    CERN Document Server

    Philipsen, Owe; Sciarra, Alessandro; Bach, Matthias


    We present the Lattice QCD application CL2QCD, which is based on OpenCL and can be utilized to run on Graphic Processing Units as well as on common CPUs. We focus on implementation details as well as performance results of selected features. CL2QCD has been successfully applied in LQCD studies at finite temperature and density and is available at

  15. High 36Cl/Cl ratios in Chernobyl groundwater

    International Nuclear Information System (INIS)

    After the explosion of the Chernobyl Nuclear Power Plant in April 1986, contaminated material was buried in shallow trenches within the exclusion zone. A 90Sr plume was evidenced downgradient of one of these trenches, trench T22. Due to its conservative properties, 36Cl is investigated here as a potential tracer to determine the maximal extent of the contamination plume from the trench in groundwater. 36Cl/Cl ratios measured in groundwater, trench soil water and leaf leachates are 1–5 orders of magnitude higher than the theoretical natural 36Cl/Cl ratio. This contamination occurred after the Chernobyl explosion and currently persists. Trench T22 acts as an obvious modern point source of 36Cl, however other sources have to be involved to explain such contamination. 36Cl contamination of groundwater can be explained by dilution of trench soil water by uncontaminated water (rainwater or deep groundwater). With a plume extending further than that of 90Sr, radionuclide which is impacted by retention and decay processes, 36Cl can be considered as a suitable tracer of contamination from the trench in groundwater provided that modern release processes of 36Cl from trench soil are better characterized. - Highlights: • High 36Cl/Cl ratios measured in the Chernobyl Pilot Site groundwater. • Trench T22 acts as a modern source of groundwater contamination by 36Cl but other sources are involved. • Contamination results from dilution of a contaminated “T22” soil water with rainwater. • Processes involved in the modern release need to be investigated

  16. High (36)Cl/Cl ratios in Chernobyl groundwater. (United States)

    Roux, Céline; Le Gal La Salle, Corinne; Simonucci, Caroline; Van Meir, Nathalie; Fifield, L Keith; Diez, Olivier; Bassot, Sylvain; Simler, Roland; Bugai, Dmitri; Kashparov, Valery; Lancelot, Joël


    After the explosion of the Chernobyl Nuclear Power Plant in April 1986, contaminated material was buried in shallow trenches within the exclusion zone. A (90)Sr plume was evidenced downgradient of one of these trenches, trench T22. Due to its conservative properties, (36)Cl is investigated here as a potential tracer to determine the maximal extent of the contamination plume from the trench in groundwater. (36)Cl/Cl ratios measured in groundwater, trench soil water and leaf leachates are 1-5 orders of magnitude higher than the theoretical natural (36)Cl/Cl ratio. This contamination occurred after the Chernobyl explosion and currently persists. Trench T22 acts as an obvious modern point source of (36)Cl, however other sources have to be involved to explain such contamination. (36)Cl contamination of groundwater can be explained by dilution of trench soil water by uncontaminated water (rainwater or deep groundwater). With a plume extending further than that of (90)Sr, radionuclide which is impacted by retention and decay processes, (36)Cl can be considered as a suitable tracer of contamination from the trench in groundwater provided that modern release processes of (36)Cl from trench soil are better characterized. PMID:25128774

  17. Brändi mielikuvien luojana : Case:IKU


    Perkiö, Markus


    Brändi terminä on yleistynyt puhekielessä viimeisten vuosikymmenien aikana. Brändiä käytetään kuvaamaan esineitä, asioita, yrityksiä, ihmisiä tai ideologiaa. Tässä opinnäytetyössä perehdyttiin brändiin ilmiönä, brändin luomiseen sekä sen erottumiseen kilpailijoistaan. Opinnäytetyössä tarkasteltiin brändiä työkaluna uuden artistin esille tuomisessa kohderyhmälleen sekä suurelle yleisölle. Vaikka brändi termiä käytetään hyvin laajasti puhekielessä, se usein liitetään virheellisesti johonkin...

  18. Yrityksen brändi-imago ja -identiteetti


    Anttonen, Jaakko


    Tämä opinnäytetyö käsittelee brändiä, brändi-imagoa ja -identiteettiä. Opinnäytetyö tehtiin Viikko-Häme Oy:n toimeksiantona. Opinnäytetyön tutkimusongelma oli selvittää, millaisia sanomalehti Viikko-Hämeen tämänhetkiset brändi-imago ja brändi-identiteetti ovat ja miten niitä voisi kehittää. Brändi on yritys, tuote tai palvelu, jolla on jonkinlaista lisäarvoa kuluttajalle, minkä vuoksi se erottuu edukseen markkinoilla. Vahva ja tunnettu brändi herättää kuluttajassa luottamusta ja on näin lupau...

  19. SOFC brændselsceller i et intelligent elnet

    DEFF Research Database (Denmark)

    Hjelm, Johan


    SOFC brændselsceller kan være med til at skabe balance i elnettet i takt med at elproduktionen i stigende grad baseres på sol og vind. Brændselscellerne kan kobles til naturgasnettet og på sigt bruge forskellige former for VE-gasser som brændstof.......SOFC brændselsceller kan være med til at skabe balance i elnettet i takt med at elproduktionen i stigende grad baseres på sol og vind. Brændselscellerne kan kobles til naturgasnettet og på sigt bruge forskellige former for VE-gasser som brændstof....

  20. 75 FR 30740 - Airworthiness Directives; Bombardier, Inc. Model CL-600-2B16 (CL-604 Variants (Including CL-605... (United States)


    ... Procedures (44 FR 11034, February 26, 1979); and 3. Will not have a significant economic impact, positive or... Directives; Bombardier, Inc. Model CL-600-2B16 (CL- 604 Variants (Including CL-605 Marketing Variant... addition to Bombardier Inc. Models CL-600-2B19, CL-600-2C10 and CL-600-2D24. The latter three models...

  1. First measurement of the response matrix of a large LaBr3:Ce detector up to 30 MeV at the HIγS facility

    International Nuclear Information System (INIS)

    The invention of Lanthanum Halide detectors, namely, Lanthanum Bromide (LaBr3:Ce) and Lanthanum Chloride (LaCl3:Ce) has been one of the most significant recent developments in the field of scintillator detectors. The production and marketing of the LaCl3:Ce and LaBr3:Ce crystals have resulted in a flurry of activities for their testings and characterisations. The excellent energy resolution of LaBr3:Ce, ∼3% at 662 keV, is better than any other commercially available scintillator detector. The fast decay time of 35 ns, with no intense slow component and afterglow, leads to a time resolution of about a few hundred picoseconds. The high density of LaBr3:Ce (5.08 gm/cm2) and the high Z of Lanthanum result in higher detection efficiency than NaI(Tl). These highly attractive properties of LaBr3 make it suitable for both low and high energy gamma-rays spectroscopy

  2. Corrosion inhibition performance of a ionic liquid surfactant Br


    Jing LIU; Dishun ZHAO; LIU, RAN; Wang, Ming; Peibing REN


    In order to study the novel green organic mercury-substituting inhibitors, the ionic liquid surfactant 1-methyl-3-dodecyl imidazole bromide ( Br) is synthesized with N-methyl imidazole and 1-bromodecane as raw materials. The corrosion inhibition of Br for zinc in zinc-manganese batteries is investigated using electrochemical methods and weight loss methods. The results show that corrosion inhibition efficiency increases with the increase of the concentration of Br, and when the concentration ...

  3. Brüssel Euroopa pealinnaks? / Ülar Mark

    Index Scriptorium Estoniae

    Mark, Ülar, 1968-


    Brüsseli Euroopa kvartali planeerimisvõistlusest, mille peakorraldaja oli Brüsseli pealinna piirkond koos Brüsseli linna ja Euroopa Komisjoniga. Eestist osales žüriis arhitekt Ülar Mark. Meeskonna Atelier Christian de Portzamparc võidutööst ja teiste teise vooru pääsenud nelja meeskonna (JDS / Julien De Smedt Architects, OMA / Office for Metropolitan Architecture, Xaveer De Geyter Architect, Fletcher Priest Architects) töödest

  4. 76 FR 477 - Airworthiness Directives; Bombardier, Inc. Model CL-600-2A12 (CL-601) and CL-600-2B16 (CL-601-3A... (United States)


    ... Policies and Procedures (44 FR 11034, February 26, 1979); and 3. Will not have a significant economic.... Model CL-600-2A12 (CL- 601) and CL-600-2B16 (CL-601-3A, CL-601-3R, and CL-604 Variants) Airplanes AGENCY... applicability of the directive for CL-600-2A12 aircraft, serial numbers 3001 through 3066, and for CL-...

  5. 76 FR 66203 - Airworthiness Directives; Bombardier, Inc. Model CL-600-2B16 (CL-601-3A, CL-601-3R, and CL-604... (United States)


    ... Policies and Procedures (44 FR 11034, February 26, 1979); and 3. Will not have a significant economic.... Model CL-600-2B16 (CL- 601-3A, CL-601-3R, and CL-604 Variants) Airplanes AGENCY: Federal Aviation... Bombardier, Inc. Model CL-600-2B16 (CL- 601-3A, CL-601-3R, and CL-604 Variants) airplanes, certificated...

  6. Estimation of medium effects on equilibrium constants in moderate and high ionic strength solutions at elevated temperatures by using specific interaction theory (SIT): Interaction coefficients involving Cl, OH- and Ac- up to 200°C and 400 bars


    Xiong Yongliang


    Abstract In this study, a series of interaction coefficients of the Brønsted-Guggenheim-Scatchard specific interaction theory (SIT) have been estimated up to 200°C and 400 bars. The interaction coefficients involving Cl- estimated include ε(H+, Cl-), ε(Na+, Cl-), ε(Ag+, Cl-), ε(Na+, AgCl2 -), ε(Mg2+, Cl-), ε(Ca2+, Cl-), ε(Sr2+, Cl-), ε(Ba2+, Cl-), ε(Sm3+, Cl-), ε(Eu3+, Cl-), ε(Gd3+, Cl-), and ε(GdAc2+, Cl-). The interaction coefficients involving OH- estimated include ε(Li+, OH-), ε(K+, OH-),...

  7. Brändin rakentaminen : case Dressing Mimia


    Rinne, Helena


    Opinnäytetyö käsittelee sitä miten brändi rakennetaan ja mistä elementeistä brändikuva muodostuu. Tutkimuskohteena oli Dressing Mimia -tapahtuman brändikuva. Dressing Mimia -tapahtuma on poikkitaiteellinen muotinäytös ja cocktailtilaisuus, joka järjestetään kerran vuodessa Turussa. Työn tavoitteena oli selvittää millaisia mielikuvia tapahtuman asiakkailla on tapahtumasta sekä saada taustatietoa tapahtumassa kävijöistä. Tulosten perusteella voidaan kehittää Dressing Mimian brändiarvoa ja koota...

  8. Brändin kirkastaminen - esimerkki Aleksanterin teatteri


    Lautamo, Jussi


    Laurea-ammattikorkeakoulu Tiivistelmä Laurea Leppävaara Palvelujen tuottaminen ja johtaminen Lautamo, Jussi Brändin kirkastaminen – esimerkki Aleksanterin teatteri Vuosi 2011 Sivumäärä 57 Yrityksen brändi ja sen rakentaminen ovat tänä päivänä asioita, joita menestyvä yritys ei voi jättää huomioimatta. Yrityksen brändin määritteleminen ja sen esiintuominen voivat olla ratkaisevia asioita yrityksen menestyksen kannalta. Brändinsä kautta yritys edustaa itseään markki...

  9. BrO measurements over the Eastern North-Atlantic

    Directory of Open Access Journals (Sweden)

    M. Martin


    Full Text Available The aim of the work presented here was to detect BrO in the marine boundary layer over the Eastern North-Atlantic by Multi AXis-Differential Optical Absorption Spectroscopy (MAX-DOAS of scattered sunlight. With this technique, information about the concentration and the vertical profile of trace gases in the atmosphere can be gained. BrO can be formed in the marine atmosphere by degradation of biogenic organohalogens or by oxidation of bromide in sea salt aerosol. BrO influences the chemistry in marine air in many was, e.g. since it catalytically destroys ozone, changes the NO2/NO-ratio as well as the OH/HO2-ratio and oxidises DMS. However, the abundance and the significance of BrO in the marine atmosphere are not yet fully understood. <br>> We report on data collected during a ship cruise, which took place along the West African Coast in February 2007, within the framework of the Surface Ocean PRocesses in the ANthropocene project (SOPRAN. Tropospheric BrO could be detected during this cruise at peak mixing ratios of (10.2±3.7 ppt at an assumed layer height of 1 km on 18 February 2007. Furthermore, it was found that the mean BrO concentrations increased when cruising close to the African Coast suggesting that at least part of the BrO might have originated from the African coast.

  10. BrO measurements over the Eastern North-Atlantic

    Directory of Open Access Journals (Sweden)

    U. Platt


    Full Text Available The aim of the work presented here was to detect BrO in the marine boundary layer over the Eastern North-Atlantic by Multi AXis-Differential Optical Absorption Spectroscopy (MAX-DOAS of scattered sunlight. With this technique, information about the concentration and the vertical profile of trace gases in the atmosphere can be gained. BrO can be formed in the marine atmosphere by degradation of biogenic organohalogens or by oxidation of bromide in sea salt aerosol. BrO influences the chemistry in marine air in many ways, e.g. since it catalytically destroys ozone, changes the NO2/NO-ratio as well as the OH/HO2-ratio and oxidises DMS. However, the abundance and the significance of BrO in the marine atmosphere is not yet fully understood. <br>> We report on data collected during a ship cruise, which took place along the West African Coast in February 2007, within the framework of the Surface Ocean PRocesses in the ANthropocene project (SOPRAN. Tropospheric BrO could be detected during this cruise at peak mixing ratios of (10.2±3.7 ppt at an assumed layer height of 1 km on 18 February 2007. Furthermore, it was found that the mean BrO concentrations increased when cruising close to the African Coast suggesting that at least part of the BrO might have originated from there.

  11. Kvinnors upplevelser av att leva med bröstcancer


    Music, Sanela


    Bakgrund: Bröstcancer utgör en tredjedel av all cancer som kvinnor drabbas av. Tidigare studier indikerar att kvinnor upplever mycket starka känslor kring sjukdomen bröstcancer och att de har drabbats av den. Tanken av att förlora ett bröst är en av punkterna som bringar mycket ångest och lidande. Syfte: Syftet med studien är att belysa kvinnors upplevelser av att leva med bröstcancer. Metod: En litteraturstudie med självbiografiska böcker har utförts. Studiens syfte har besvarats genom att t...

  12. The structure, phase transition and molecular dynamics of [C(NH{sub 2}){sub 3}]{sub 3}[Sb{sub 2}Br{sub 9}

    Energy Technology Data Exchange (ETDEWEB)

    Szklarz, P [Faculty of Chemistry, University of Wroclaw, Joliot-Curie 14, 50-383 Wroclaw (Poland); Zaleski, J [Institute of Chemistry, University of Opole, Oleska 48, 45-951 Opole (Poland); Jakubas, R [Faculty of Chemistry, University of Wroclaw, Joliot-Curie 14, 50-383 Wroclaw (Poland); Bator, G [Faculty of Chemistry, University of Wroclaw, Joliot-Curie 14, 50-383 Wroclaw (Poland); Medycki, W [Institute of Molecular Physics, PAS, M Smoluchowskiego 17, 60-179 Poznan (Poland); Falinska, K [Institute of Molecular Physics, PAS, M Smoluchowskiego 17, 60-179 Poznan (Poland)


    The crystal structures of [C(NH{sub 2}){sub 3}]{sub 3}[Sb{sub 2}Br{sub 9}] (Gu{sub 3}Sb{sub 2}Br{sub 9}) at 300 K and of [C(NH{sub 2}){sub 3}]{sub 3}[Sb{sub 2}Cl{sub 9}] (Gu{sub 3}Sb{sub 2}Cl{sub 9}) at 90 and 300 K are determined. The compounds crystallize in the monoclinic space group: C 2/c. The structure is composed of Sb{sub 2}X{sub 9}{sup 3-} (X = Cl, Br) ions, which form two-dimensional layers through the crystal, and guanidinium cations. In Gu{sub 3}Sb{sub 2}Br{sub 9} the structural phase transformation of the first-order type is detected at 435/450 K (on cooling/heating) by the DSC and dilatometric techniques. The dielectric relaxation process in the frequency range between 75 kHz and 5 MHz over the low temperature phase indicates reorientations of weakly distorted guanidinium cations. The proton {sup 1}H NMR second-moment and spin-lattice relaxation time, T{sub 1}, temperature runs for the polycrystalline Gu{sub 3}Sb{sub 2}Br{sub 9} sample indicate a complex cation motion. A significant dynamical non-equivalence of two guanidinium cations was found. The possible mechanism of the phase transition in Gu{sub 3}Sb{sub 2}Br{sub 9} is discussed on the basis of the results presented.

  13. MTR fuel testing in BR2

    International Nuclear Information System (INIS)

    New fuel design for MTR 's requires to be qualified under representative conditions, that is geometry, neutron spectrum, heat flux and thermo hydraulic conditions. An irradiation device for fuel plates has been designed to derive the maximum benefit from the BR2 irradiation capacities. The fuel plates can be easily extracted from their support during a shutdown to undergo additional tests. One of these tests is the measurement of the thickness changes along the fuel plate. To that purpose, a facility in the reactor water pool has been designed to measure the fuel swelling with an accuracy of 5 μm using inductive probes. At SCK-CEN, the full range of destructive and non-destructive PIE can be performed, including γ-scanning, wet sipping, surface examination and other methods. (author)

  14. BR-100 spent fuel shipping cask development

    International Nuclear Information System (INIS)

    Continued public acceptance of commercial nuclear power is contingent to a large degree on the US Department of Energy (DOE) establishing an integrated waste management system for spent nuclear fuel. As part of the from-reactor transportation segment of this system, the B ampersand W Fuel Company (BWFC) is under contract to the DOE to develop a spent-fuel cask that is compatible with both rail and barge modes of transportation. Innovative design approaches were the keys to achieving a cask design that maximizes payload capacity and cask performance. The result is the BR-100, a 100-ton rail/barge cask with a capacity of 21 PWR or 52 BWR ten-year cooled, intact fuel assemblies. 3 figs

  15. Yrityksen brändin kehittäminen : Medbit Oy:n brändiuudistus


    Salminen, Valtteri


    Opinnäytetyö tehtiin toimeksiantona ICT-alalla toimivalle Medbit Oy:lle. Yritys teki brändiuudistuksen vuoden 2015 alkupuolella ja halusi selvittää, miten asiakkaat, yhteistyökumppanit ja henkilökunta ovat ottaneet uudistuksen vastaan. Opinnäytetyössä perehdyttiin bränditutkimuksen lisäksi tutkimuksen kannalta olennaisiin aiheisiin brändin teoriasta. Brändiä käsittelevän tietoperustan avulla selvitettiin, mitä brändillä tarkoitetaan, millainen on hyvä brändi ja mitä hyötyjä siitä on yrityksel...

  16. 76 FR 6536 - Airworthiness Directives; Bombardier, Inc. Model CL-215-1A10 (CL-215), CL-215-6B11 (CL-215T... (United States)


    ... products. That NPRM was published in the Federal Register on November 9, 2010 (75 FR 68728). That NPRM... Regulatory Policies and Procedures (44 FR 11034, February 26, 1979); and 3. Will not have a significant.... Model CL-215-1A10 (CL- 215), CL-215-6B11 (CL-215T Variant), and CL-215-6B11 (CL-415 Variant)...

  17. Structural and magnetic properties of the mixed quantum antiferromagnet Cs2CuCl4-xBrx

    International Nuclear Information System (INIS)

    The two compounds, Cs2CuCl4 and Cs2CuBr4, have been classified as quasi-two-dimensional quantum antiferromagnets. Cs2CuCl4 shows long-range magnetic order, which can be described as a Bose-Einstein condensation of magnons, i.e., delocalized triplet excitations, whereas the iso-structural compound Cs2CuBr4, exhibits plateaus in the magnetization, indicating the localization of triplets. Here we present a systematic study of the magnetic properties in the Cs2CuCl4-xBrx (0 ≤ x≤ 4) mixed system. All crystals were synthesized by a solution-growth method. Two structural variants - an A-type orthorhombic and a B-type tetragonal - were detected in this system depending on the growth conditions. A detailed structural phase diagram has been constructed, based on X-ray Rietveld refinement, SEM and thermal analysis. χ(T) measurements of crystals near the end members of the series reveal a broad maximum at Tmax indicative of quasi-2D short range correlations. While for the Cl-rich system 0≤x≤0.8, Tmax slightly increases with increasing Br-, a much stronger increase of observed for the Br-rich system for 2.8≤x≤4.0.

  18. Optical pump-probe processes in Nd 3+ doped KPb2Br5, RbPb2Br5, and KPb2CI5

    International Nuclear Information System (INIS)

    Recently, laser activity has been achieved in the low phonon energy, moisture-resistant bromide host crystals, neodymium-doped potassium lead bromide (Nd3+:KPb2Br5) and rubidium lead bromide (Nd3+:RbPb2Br5). Laser activity at 1.07 (micro)m was observed for both crystalline materials. Laser operation at the new wavelengths 1.18 (micro)m and 0.97 (micro)m resulting from the 4F5/2+2H9/2 → 4IJ transitions (J=13/2 and 11/2) in Nd:RPB was achieved for the first time in a solid state laser material. In this paper we present cw pump-probe spectra in order to discuss excited state absorption, reabsorption processes due to the long lived lower laser levels as well as possible depopulation mechanisms feasible for more efficient laser operation in these crystals. The bromides will be compared with potassium lead chloride (Nd3+:KPb2Cl5)

  19. OClO and BrO observations in the volcanic plume of Mt. Etna - implications on the chemistry of chlorine and bromine species in volcanic plumes (United States)

    Gliß, J.; Bobrowski, N.; Vogel, L.; Platt, U.


    mechanism in literature often referred to as "bromine explosion" and that OClO is formed in the "BrO + ClO"-reaction. BrO and OClO concentrations were estimated from the measured SCDs assuming a circular plume shape. In addition, mixing ratios of ClO were determined from the retrieved OClO and BrO-SCDs assuming chemical equilibrium between formation of OClO (BrO + ClO) and its destruction (photolysis). Mean abundances in the young plume (τBrO = 1.35 ppb, OClO = 300 ppt and ClO = 139 ppt with peak values of 600 ppt (OClO), 2.7 ppb (BrO) and 235 ppt (ClO) respectively. The prevailing Cl-atom concentrations in the plume could be estimated from the rate of increase of OClO and BrO in the young plume and the determined ClO and OClO concentrations. Values between 5.1 × 106 cm-3 (at 40 ppb O3) and 2.1 × 108 cm-3 (at 1 ppb O3) were found. Based on that, a potential - chlorine induced - depletion of tropospheric methane (CH4) in the plume was investigated. CH4-lifetimes between 13 h (at 1 ppb O3) and 23 days (at 40 ppb O3) were found. These are considerably small compared to the atmospheric lifetime of CH4. However, the impact of gaseous chlorine on the CH4-budget in the plume environment was assessed to be relatively small, mainly due to plume dispersion (decrease of Cl number densities) and permanent mixing of the plume with the surrounding atmosphere (net supply of O3 and CH4).

  20. In situ observations of BrO over Antarctica: ER-2 aircraft results from 54 degree S to 72 degree S latitude

    International Nuclear Information System (INIS)

    Bromine monoxide was observed in situ during nine flights of the NASA ER-2 aircraft from Punta Arenas, Chile (54 degree S latitude), to 72 degree S latitude over the Palmer Peninsula, Antarctica. The first flight for the BrO detection system was on August 28. The distribution of BrO inside the chemically perturbed region defined by greatly elevated ClO abundances was different from that found just outside. Inside, the BrO mixing ratio was 6.1 ± 1.1 pptv above the 440 K potential temperature surface. At high latitudes outside the chemically perturbed region, the BrO mixing ratio was 5.4 ± 1.4 pptv near the 450 K surface, but decreased to 2.9 ± 1.2 pptv at the 420 K surface. The abundance of BrO showed no discernable temporal trend during the course of the nine flights. Away from the south polar region, at latitudes between 47 degree S and 37 degree N and potential temperatures between 435 and 500 K (18.5- to 20.7-km altitude), the BrO mixing ratio was 0.5-3.0 pptv

  1. ClEST cluster :Cl_singleton2103 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton2103 brain ... protein 44 Cimex lectularius nuclear gene 353 CACCAAGAAAATTACAAGTTTCTGCAG ... ATTCCGAAGAACGTGTTTATGTGCTTTGTGAACCTATCAA mb13004 1 brain ... protein 44 [Culex quinquefasciatus] XP_001847023 8 ...

  2. ClEST cluster :Cl_singleton0405 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0405 isoform a Cimex lectularius nuclear gene 310 CACCGACGCCACTCAGAGAGGGAGAGCTAAGCAG ... GAAGATTCAAGACTCTGTACCGCTGCTAAAAGGCCGCCAG fb20013 1 brain ... peptide IDL-like protein [Tribolium castaneum] EFA ...

  3. ClEST cluster :Cl_singleton0355 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0355 acyl- synthetase long- isoform b Cimex lectularius nuclear gene 19...GGAAGGTGCATTGGGAGCAATAAAAGCGATCGCATTTGTCTGTGATATCATCACTTATCCAGTGTACCTTATTCTACAACGGCCATGGG fb18010 1 acyl-CoA synthetase [Gl

  4. ClEST cluster :Cl_singleton0763 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0763 aldo-keto reductase Cimex lectularius nuclear gene 591 CACCGGGTAGG...GTGAATAAAGGCTTAGTTAGGTCAATCGGACTATCCAATTTCAACAAAAGACAGATCGAAGATGTTT fs09012 1 aldo-keto reductase [Gl

  5. Dry storage of the BR3 spent fuel in the CASTOR BR3 cask

    International Nuclear Information System (INIS)

    The BR3 reactor was the first PWR plant installed in Europe. Started in 1962, BR3 was definitely shut down on June 30th, 1987. Used at the beginning of its life as a training device for commercial plant operators, it was also used during its whole life as test-reactor for new fuel types and assemblies. Most of the spent fuel was stored in the deactivation pool of the plant for more than 15 years. The reactor being now in decommissioning, it was decided to remove the spent fuel from the plant. After comparison of different solutions, the long term storage in dual purpose storage casks was selected in 1997. The selected CASTOR-BR3 cask is designed as a transport and storage cask for accommodating 30 spent fuel assemblies. As a type B(U) cask fitted with shock absorbers, it meets the transport requirements according to the IAEA guidelines and fulfils also the conditions for cask storage. (author)

  6. ESR spectrum and structure of BrF6

    International Nuclear Information System (INIS)

    The BrF6 radical has been obtained by γ irradiation of a mixture of BrF5 in SF6. The ESR spectrum was obtained and used to confirm the identity of the radical and to obtain hyperfine coupling constants. (AIP)

  7. Cl-, Na+, and H+ fluxes during the acidification of rabbit reticulocyte endocytic vesicles

    International Nuclear Information System (INIS)

    The ionic fluxes associated with the ATP-dependent acidification of endocytic vesicles were studied in a preparation isolated from rabbit reticulocytes enriched for transferrin-transferrin receptor complexes. No vesicle acidification was observed in the absence of intra- and extravesicular ions sucrose(in)/sucrose(out), while maximal acidification was observed with NaCl(in)/KCl(out).K+(in) was a poor substitute for Na+(in), and Cl-(out) could be replaced by other anions with the following efficacy of acidification: Cl- greater than Br- greater than I- greater than PO4(3-) greater than gluconate greater than SO4(2-). Flux studies using 36Cl- and 22Na+ showed that the vesicles had a permeability for Cl- and Na+, and that ATP-dependent H+ pumping was accompanied by a net influx of Cl- and a net efflux of Na+ provided that there was a Na+ concentration gradient. After 3 mins, the time necessary to maximal acidification, the electrical charge generated by the entrance of H+ was countered to about 45% by the Cl- influx and to about 42% by the Na+ efflux. These studies demonstrated that both Cl- and Na+ fluxes are necessary for optimal endocytic vesicle acidification

  8. A novel human Cl(-) channel family related to Drosophila flightless locus. (United States)

    Suzuki, Makoto; Mizuno, Atsuko


    Large conductance chloride (maxi-Cl(-)) currents have been recorded in some cells, but there is still little information on the molecular nature of the channel underlying this conductance. We report here that tweety, a gene located in Drosophila flightless, has a structure similar to those of known channels and that human homologues of tweety (hTTYH1-3) are novel maxi-Cl(-) channels. hTTYH3 mRNA was found to be distributed in excitable tissues. The whole cell current of hTTYH3 was large enough to be discriminated from the control but emerged only after treatment with ionomycin. Analysis of pore mutants suggested that positively charged amino acids contributed to anion selectivity. Like a maxi-Cl(-) channel in situ, the hTTYH3 single channel showed 26-picosiemen linear current voltage, complex kinetics, 4,4'-diisothiocyanato-stilbene-2,2'-disulfonic acid sensitivity, subconductance, and the permeability order of I(-) > Br(-) > Cl(-). Similarly, hTTYH2 encoded an ionomycin-induced maxi-Cl(-) channel, but TTYH1 encoded a Ca(2+)-independent and swelling-activated maxi-Cl(-) channel. Therefore, the hTTYH family encoded maxi-Cl(-) channels of mammals. Further studies on the hTTYH family should lead to the elucidation of physiological and pathophysiological roles of novel Cl(-) channel molecules. PMID:15010458

  9. Corrosion inhibition performance of a ionic liquid surfactant Br

    Directory of Open Access Journals (Sweden)

    Jing LIU


    Full Text Available In order to study the novel green organic mercury-substituting inhibitors, the ionic liquid surfactant 1-methyl-3-dodecyl imidazole bromide ( Br is synthesized with N-methyl imidazole and 1-bromodecane as raw materials. The corrosion inhibition of Br for zinc in zinc-manganese batteries is investigated using electrochemical methods and weight loss methods. The results show that corrosion inhibition efficiency increases with the increase of the concentration of Br, and when the concentration is higher than 8×10-3 mol/L, the inhibition efficiency tends to be stable. The polarization curve shows that Br belongs to mixed-type corrosion inhibitor. The thermodynamic parameters show that Br is spontaneously adsorbed on the zinc surface, forming a monomolecular adsorption layer, which fits with Langmuir adsorption isotherm with physical and chemical adsorption mechanism.

  10. Molecular symmetry and isostructural relations in crystal phases of trihalomethanes CHCl3, CHBrCl2, CHBr2Cl, and CHBr3. (United States)

    Dziubek, Kamil; Podsiadło, Marcin; Katrusiak, Andrzej


    Bromodichloromethane (CHBrCl(2)), dibromochloromethane (CHBr(2)Cl), and their parent trihalomethanes, chloroform (CHCl(3)) and bromoform (CHBr(3)), form an intriguing series of isostructural crystal phases, the sequence of which depends on the Br/Cl substitution and thermodynamic conditions. The phase behavior of these compounds has been studied by isobaric calorimetry and isothermal compression, and the crystal structure of CHBrCl(2) has been determined at 0.10 MPa/200 K, 0.73, 1.26, 2.53 GPa (all at 295 K), and that of CHBr(2)Cl at 0.43, 1.24 GPa (all at 295 K). CHBrCl(2) frozen by isobaric cooling at 0.10 MPa crystallizes in space group P1 with Z = 2, while its high-pressure polymorph in space group Pnma (Z = 4) is stable at 295 K from its freezing pressure at 0.48 to at least 2.53 GPa. At the freezing pressure of 0.29 GPa, CHBr(2)Cl crystallizes in space group P6(3), with Z = 2, and at 1.27 GPa, it transforms to the orthorhombic structure, space group Pnma (Z = 4); CHCl(3) has the identical symmetries, but their reverse sequence was observed. A subtle isostructural phase transition has been observed at 0.10 MPa and 214.9 K in CHBr(2)Cl. The relations between isostructural phases, their symmetry, and site occupation factors of halogen atoms observed in the low-temperature and high-pressure phases of trihalomethanes (CHCl(3), CHBrCl(2), CHBr(2)Cl, and CHBr(3)) have been explained by the directional character of electrostatic interactions between the molecules. A gradual ordering of the disordered Br and Cl atoms has been achieved in the compressed crystals, where the narrower volume of the atomic sites correlates with the increased occupancy of the smaller atom (chlorine). The molecular symmetry has been shown to control the molecular aggregation in the crystalline state, consistent with the crystal site-symmetry and the balance of electrostatic matching and dispersion forces between molecules. PMID:19743834

  11. First hydrothermal synthesis of Bi5O7Br and its photocatalytic properties for molecular oxygen activation and RhB degradation

    International Nuclear Information System (INIS)

    Graphical abstract: Bi5O7Br was firstly synthesized by via hydromel method and showed good photocatalytic properties for molecular oxygen activation and RhB degradation. - Highlights: • Bi5O7Br, a new BixOyXz semiconductor photocatalyst was firstly synthesized by via hydromel method. • As-synthesized Bi5O7Br can effectively activate molecular oxygen under UV–vis light irradiation. • The appearance of Bi5O7Br photocatalysis enriched the Bi-O-X photocatalysts. - Abstract: Comparing with BiOX (X = Cl, Br, I), BixOyXz as the newest bismuth-based photocatalysts have more appropriate conduction band position. And so, they can be used to active molecular oxygen. In this paper, Bi5O7Br, a new BixOyXz semiconductor photocatalyst was firstly synthesized by via hydromel method. It was characterized by X-ray diffraction (XRD), UV–visible diffused reflectance spectra (DRS), scanning electron microscope (SEM), X-ray photoelectron spectroscopy (XPS), transmission electron microscope (TEM) and the corresponding selected-area electron diffraction (SAED) pattern. It can be found that the crystal structure and morphology are same with Bi5O7I. The size of a single rod is about 2 μm in width and 50 μm in length. As-synthesized Bi5O7Br can effectively activate molecular oxygen to generate superoxide radical (O2• −) and hydroxyl radical (• OH) under UV–vis light irradiation. And it also showed high photocatalytic activity than BiOBr for the degradation of dyes. Thus, it can be seen, the appearance of Bi5O7Br photocatalysis enriched the bismuth-rich strategy of Bi-O-X photocatalysts

  12. Synchrotron x-ray powder diffraction study of the structural phase transition in CaBr2

    International Nuclear Information System (INIS)

    The structures of CaBr2 have been investigated using high resolution synchrotron powder x-ray diffraction methods between room temperature and 800 deg. C. At room temperature CaBr2 has an orthorhombic CaCl2-type structure (Pnnm Z=2) with a=6.8847(1), b=6.5806(1), and c=4.3477(1) A. Heating above 560 deg. C results in a continuous transition to a tetragonal rutile type structure (P42/mnm Z=2) with a=6.810 95(7) A and c=4.417 70(5) A at 650 deg. C. Investigation, through either spontaneous strain or octahedral tilt angle, suggests that the transition is close to second order in nature, although the contribution from the sixth order term in the Landau potential cannot be neglected

  13. Field induced order phenomena in the metamagnet Fe sub 1 sub - sub x Mg sub x Br sub 2

    CERN Document Server

    Petracic, O


    Metamagnets have been playing an important role as model systems in the physics of phase transitions for 30 years. Especially the isolating substances FeCl sub 2 and FeBr sub 2 have attracted much interest both in experimental and theoretical physics. In this thesis we focus on experimental investigations of Fe sub 1 sub - sub x Mg sub x Br sub 2 with x = 0 and 0.05. By SQUID-magnetometry, SQUID-susceptometry, elastic neutron scattering and calorimetry we studied the magnetic phase boundaries and especially the recently found new phase transition at H=H1(T) (Aruga Katori et al. 1996). Also we arrived to a physical understanding of the non-critical fluctuations at H=H-(T) in terms of a smeared 2-dimensional phase transition of the spin down sublattice.

  14. Hidden Brønsted acid catalysis: pathways of accidental or deliberate generation of triflic acid from metal triflates. (United States)

    Dang, Tuan Thanh; Boeck, Florian; Hintermann, Lukas


    The generation of a hidden Brønsted acid as a true catalytic species in hydroalkoxylation reactions from metal precatalysts has been clarified in case studies. The mechanism of triflic acid (CF(3)SO(3)H or HOTf) generation starting either from AgOTf in 1,2-dichloroethane (DCE) or from a Cp*RuCl(2)/AgOTf/phosphane combination in toluene has been elucidated. The deliberate and controlled generation of HOTf from AgOTf and cocatalytic amounts of tert-butyl chloride in the cold or from AgOTf in DCE at elevated temperatures results in a hidden Brønsted acid catalyst useful for mechanistic control experiments or for synthetic applications. PMID:22010906

  15. OpenCL programming guide

    CERN Document Server

    Munshi, Aaftab; Mattson, Timothy G; Fung, James; Ginsburg, Dan


    Using the new OpenCL (Open Computing Language) standard, you can write applications that access all available programming resources: CPUs, GPUs, and other processors such as DSPs and the Cell/B.E. processor. Already implemented by Apple, AMD, Intel, IBM, NVIDIA, and other leaders, OpenCL has outstanding potential for PCs, servers, handheld/embedded devices, high performance computing, and even cloud systems. This is the first comprehensive, authoritative, and practical guide to OpenCL 1.1 specifically for working developers and software architects. Written by five leading OpenCL authorities, OpenCL Programming Guide covers the entire specification. It reviews key use cases, shows how OpenCL can express a wide range of parallel algorithms, and offers complete reference material on both the API and OpenCL C programming language. Through complete case studies and downloadable code examples, the authors show how to write complex parallel programs that decompose workloads across many different devices. They...

  16. Evolución de la gestión clínica en cuidados intensivos. Reflexiones desde la perspectiva del especialista

    Directory of Open Access Journals (Sweden)

    Pérez Arancón, José Luis


    Full Text Available Not available<br>>Para un especialista la preparación clínica, diagnóstica y terapéutica eran el núcleo central de su formación. Además se hace preciso el aprendizaje de otras habilidades. Según el autor éstas se centran en dos aspectos: fundamentar científicamente las decisiones tomadas y adecuar sus costes en función de los objetivos a cubrir Ambas se sitúan en la base de lo que será la gestión clínica.

  17. Historia clínica


    Juan Martínez Hernández


    La historia clínica ha estado regulada hasta la actualidad por diferentes disposiciones legislativas con base en la Ley General de Sanidad 14/1986, de 25 de abril. Con la Ley 41/2002, de 14 de noviembre, básica y reguladora de la autonomía del paciente y de derechos y obligaciones en materia de información y documentación clínica, se actualizan los derechos y obligaciones de los pacientes o usuarios y profesionales, entre ellos los relativos a la historia clínica. En el pres...

  18. 76 FR 59067 - Airworthiness Directives; Bombardier, Inc. Model CL-600-2B16 (CL-601-3A, CL-601-3R, and CL-604... (United States)


    ... ``significant rule'' under the DOT Regulatory Policies and Procedures (44 FR 11034, February 26, 1979); and 3.... Model CL-600-2B16 (CL- 601-3A, CL-601-3R, and CL-604 Variants) Airplanes AGENCY: Federal Aviation...) events have occurred where the Air-Driven Generator (ADG) failed to provide power on CL-600-2B19...

  19. The BR-3 decommissioning project, Belgium

    International Nuclear Information System (INIS)

    BR-3 was a small 10 MW(e) PWR which was shut down in 1987 after 25 years of operation. It was selected as an EU pilot project for the research and development programme on decommissioning of nuclear installations. The decommissioning project started in 1989. The optimization of the management of waste material generated by decommissioning activities has always been an intensive task and the minimization of the radioactive waste a priority. Over the past 16 years, the factors influencing the management of waste have been constantly evolving in Belgium, steered mainly by the following changes in technologies, regulations and economic conditions: - The publication of the Royal Decree of 20 July 2001, establishing a legal frame on decommissioning and including a set of clearance levels; - The improvement of the instrumentation used for characterization; - The increase in the performance of decontamination techniques; - The cost increase of the waste disposal paths; - The implementation of international recommendations in areas such as environmental impact, waste categorization, human aspects, ethics, etc.; -The strengthening of the legislation related to industrial safety and environmental release; - The diminution of the background radiation level at the decommissioning site itself. The first part of this annex gives a description of relevant influencing factors in order to define the context in which the dismantling activities took place. The second part puts in perspective the strategy chosen for the management of the waste, recognizing the influencing factors. As mentioned in the scope of this report, the focus is LLW. High and intermediate level wastes for which disposal in dedicated repositories is assumed are outside the scope of this report. They are therefore not examined in detail here

  20. Selected Femme / Homme - brändin lanseeraus Suomen markkinoille


    Saarinen, Saila


    Tanskalaisomistuksessa oleva, kansainvälinen muotitalo Bestseller A/S lanseerasi uuden Selec-ted Femme / Homme - brändin Suomen markkinoille lokakuussa 2008. Tuotemerkin vali-koimiin kuuluu naisten ja miesten vaatteet, asusteet sekä jalkineet. Mallistoista on tuotteita arkeen ja juhlaan. Niissä yhdistyvät hyvän hinta laatu-suhteen lisäksi trendikkyys. Opinnäytetyössä tarkasteltiin brändin ensimmäisen unisex -myymälän lanseerausta kuluttajil-le. Työn tarkoitus oli tutkia uuden brändin ide...

  1. Bränditutkimus Etelä-Pohjanmaan Osuuspankille


    Jämbäck, Anna-Leena


    Opinnäytetyön tarkoituksena oli tutkia Etelä-Pohjanmaan Osuuspankin brändiä sen 20–30-vuotiaiden asiakkaiden näkökulmasta. Ensimmäisenä tavoitteena oli perehtyä brändeihin. Opinnäytetyön toisena tavoitteena oli bränditutkimuksen toteuttaminen EPOP:n 20–30-vuotiaille asiakkaille, jotta saataisiin selville millaiseksi se koetaan eri osa-alueilla sekä kokonaisuutena nuorten aikuisten keskuudessa. Kolmantena tavoitteena oli pohtia tutkimustulosten perusteella uusia ideoita organisaation markkinoi...

  2. Brøndby på Facebook


    Johansen, Louise Løvendahl; Petersen, Simon Boje


    Dette er en målgruppeanalyse af Brøndby IF's kommunikation på Facebook, som tager udgangspunkt i Brøndbyfans. Specialet bygger på teori om fællesskab og netværk, hvor teoretikerne Castells, Baumann, Luhmann, Jesper Tække m.fl. er brugt, som alle arbejder med Facebook som enten et netværks- eller fællesskabsmedie. Specialet analysere, hvorledes Brøndby IF formår at kommunikere hensigstsmæssigt til deres fans, og om Facebook kan bruges til genopbyggelse af supporterfællesskabet.

  3. Kolea AK/JPK : -brändin konseptisuunnittelu


    Koskilahti, Anni


    Opinnäytetyössä suunniteltiin valmis konsepti, perusteilla olevalle, Kolea – nimiselle vaatetusalan yritykselle ja brändille. Työssä käytettiin design managementin ja brändäyksen teorioita. Työn tavoitteena oli selventää design managementin mukainen kokonaisuus ja kehittää eheä konsepti vaatetusalan brändille. Työn toimintasuunnitelmaan ja sen kulkuun sovellettiin toimintatutkimuksen syklimallia. Opinnäytetyössä päätiedonhankintamenetelminä käytettiin havainnointia, haastatteluja ja benchm...

  4. Pathways for the OH + Cl2 → HOCl + Cl and HOCl + Cl → HCl + ClO Reactions. (United States)

    Wang, Hongyan; Qiu, Yudong; Czakó, Gábor; Schaefer, Henry F


    High level coupled-cluster theory, with spin-orbit coupling evaluated via the Breit-Pauli operator in the interacting-states approach, is used to investigate the OH radical reaction with Cl2 and the subsequent reaction HOCl + Cl. The entrance complex, transition state, and exit complex for both reactions have been determined using the CCSD(T) method with correlation consistent basis sets up to cc-pV6Z. Also reported are CCSDT computations. The OH + Cl2 reaction is predicted to be endothermic by 2.2 kcal/mol, compared to the best experiments, 2.0 kcal/mol. The above theoretical results include zero-point vibrational energy corrections and spin-orbit contributions. The activation energy (Ea) of the OH + Cl2 reaction predicted here, 2.3 kcal/mol, could be as much as 1 kcal/mol too high, but it falls among the four experimental Ea values, which span the range 1.1-2.5 kcal/mol. The exothermicity of the second reaction HOCl + Cl → HCl + ClO is 8.4 kcal/mol, compared to experiment 8.7 kcal/mol. The activation energy for latter reaction is unknown experimentally, but predicted here to be large, 11.5 kcal/mol. There are currently no experiments relevant to the theoretical entrance and exit complexes predicted here. PMID:25965106

  5. Historia clínica

    Directory of Open Access Journals (Sweden)

    Juan Martínez Hernández


    Full Text Available La historia clínica ha estado regulada hasta la actualidad por diferentes disposiciones legislativas con base en la Ley General de Sanidad 14/1986, de 25 de abril. Con la Ley 41/2002, de 14 de noviembre, básica y reguladora de la autonomía del paciente y de derechos y obligaciones en materia de información y documentación clínica, se actualizan los derechos y obligaciones de los pacientes o usuarios y profesionales, entre ellos los relativos a la historia clínica. En el presente artículo, se expone el contenido de la Ley 41/2002 y referencias a otras normas legislativas y fuentes bibliográficas. La Ley define la historia clínica, sus contenidos, funciones y usos, su soporte y conservación, aclara la propiedad de la historia clínica y recoge las características de acceso y custodia, así como la privacidad y confidencialidad de la historia clínica.

  6. Phase diagrams for the binary systems NdCl3-LiCl and PrCl3-LiCl

    International Nuclear Information System (INIS)

    Equilibrium diagrams for the binary systems NdCl3-LiCl and PrCl3-LiCl were studied over the temperature range 200-800degC by differential thermal analysis techniques. A peritectic was observed in the NdCl3-LiCl system. The eutectic occurred at 456±2degC and 30.7mol% NdCl3 and the peritectic occurred at 467±1degC. A single eutectic was observed in the PrCl3-LiCl system with no evidence of solid solution or compound formation. The eutectic occurred at 464±1degC and 30.6mol% PrCl3 in the PrCl3-LiCl system. Binary phase diagrams for the two systems were proposed from the DTA results. (author)

  7. Ab initio and DFT analysis of the low-lying electronic states of metal dihalides: quantum chemical calculations on the neutral BrMCl (M = Cu, Ag, Au). (United States)

    Atsumi, Michiko; Lindh, Roland; González, Leticia; Gourlaouen, Christophe; Daniel, Chantal


    The electronic configuration of the electronic ground and low-lying doublet excited states of neutral metal dihalides BrMCl (M = Cu, Ag, Au) has been investigated on the basis of CASSCF/CASPT2 methods taking into account scalar relativistic effects. A preliminary study of the electronic problem in BrAgCl, based on DFT and CASSCF/CASPT2 approaches and using various basis sets, namely relativistic all-electron basis sets, effective core potentials and ab initio model potentials (AIMP), as well as non-relativistic AIMP is discussed. It is shown that single-determinant methods are not flexible enough to describe the bonding of the neutral species in the electronic ground state regardless of the basis set. The failure to allocate the single electron of BrAgCl correlates with a wrong charge distribution within the complex, which is more accentuated when using pseudopotential basis sets. The inclusion of static and dynamic correlation effects by means of CASSCF/CASPT2 methods using large relativistic all-electron basis sets provides a correct qualitative picture of the electronic structure of the BrMCl series (M = Cu, Ag, Au). The spin unrestricted KS-DFT approach leads to a reasonable description of the degenerate electronic ground state ((2)Σ/(2)Π) bonding in these complexes with negligible spin contamination providing comparative spin densities in the series of molecules under investigation. PMID:23632776

  8. Carcinoma mucoepidermoide da traqueia mimetizando asma brônquica Mucoepidermoid carcinoma of the trachea mimicking asthma


    Ricardo Kalaf Mussi; Ivan Felizardo Contrera Toro; Mônica Corso Pereira


    Em casos de asma de início recente em que o controle clínico com tratamento habitual (corticosteroide e broncodilatador) é insatisfatório, é importante considerar outros diagnósticos, tais como insuficiência cardíaca congestiva, refluxo gastroesofágico ou outras formas de obstrução das vias aéreas. Relatamos o caso de uma paciente do sexo feminino com carcinoma mucoepidermoide da traqueia mimetizando um quadro de asma brônquica. A paciente apresentava tosse e sibilância, bem como espirometria...

  9. Equilibrium reconstruction in the TCA/Br tokamak; Reconstrucao do equilibrio no tokamak TCA/BR

    Energy Technology Data Exchange (ETDEWEB)

    Sa, Wanderley Pires de


    The accurate and rapid determination of the Magnetohydrodynamic (MHD) equilibrium configuration in tokamaks is a subject for the magnetic confinement of the plasma. With the knowledge of characteristic plasma MHD equilibrium parameters it is possible to control the plasma position during its formation using feed-back techniques. It is also necessary an on-line analysis between successive discharges to program external parameters for the subsequent discharges. In this work it is investigated the MHD equilibrium configuration reconstruction of the TCA/BR tokamak from external magnetic measurements, using a method that is able to fast determine the main parameters of discharge. The thesis has two parts. Firstly it is presented the development of an equilibrium code that solves de Grad-Shafranov equation for the TCA/BR tokamak geometry. Secondly it is presented the MHD equilibrium reconstruction process from external magnetic field and flux measurements using the Function Parametrization FP method. this method. This method is based on the statistical analysis of a database of simulated equilibrium configurations, with the goal of obtaining a simple relationship between the parameters that characterize the equilibrium and the measurements. The results from FP are compared with conventional methods. (author) 68 refs., 31 figs., 16 tabs.

  10. Translation, cultural adaptation to Brazil and validation of the venous leg ulcer quality of life questionnaire (VLU-QoL-Br)


    Renata Boldrin de Araújo; Maria Rita Parise Fortes; Luciana Patrícia Fernandes Abbade; Hélio Amante Miot


    Objective: translating the Venous leg ulcer quality of life questionnaire (VLU-QoL), and culturally adapting it to Brazilian Portuguese and validate it with patients at the Hospital das Clínicas of the Botucatu Medical School - Unesp. Methods: the questionnaire was translated by a professional translator and two dermatologists specialized in the area of venous ulcers (VU), reformulated in a meeting of the three translators. The construct (VLU-QoL-Br) was submitted to pre-interviews with t...

  11. Ca2+ transport properties of ionophores A23187, ionomycin, and 4-BrA23187 in a well defined model system.


    Erdahl, W L; Chapman, C J; Taylor, R.W.; Pfeiffer, D R


    Models for the electroneutral transport of Ca2+ by ionophores A23187, ionomycin, and 4-BrA23187 have been tested in a defined system comprised of 1-palmitoyl-2-oleoyl-sn-glycerophosphatidylcholine vesicles prepared by freeze-thaw extrusion. Quin-2-loaded and CaCl2-loaded vesicles were employed to allow the investigation of transport in both directions. Simultaneous or parallel measurements of H+ transport and membrane potential, respectively, indicate that for any of these ionophores, electro...

  12. 75 FR 68728 - Airworthiness Directives; Bombardier, Inc. Model CL-215-1A10 (CL-215), CL-215-6B11 (CL-215T... (United States)


    ... Procedures (44 FR 11034, February 26, 1979); and 3. Will not have a significant economic impact, positive or.... Model CL-215-1A10 (CL- 215), CL-215-6B11 (CL-215T Variant), and CL-215-6B11 (CL-415 Variant) Airplanes...: * * * * * Seven cases of on-ground hydraulic accumulator screw cap or end cap failure have been experienced on...

  13. 76 FR 41653 - Airworthiness Directives; Bombardier, Inc. Model CL-600-2A12 (CL-601) and CL-600-2B16 (CL-601-3A... (United States)


    ... products. That NPRM was published in the Federal Register on January 5, 2011 (76 FR 477). That NPRM...; 2. Is not a ``significant rule'' under the DOT Regulatory Policies and Procedures (44 FR 11034.... Model CL-600-2A12 (CL- 601) and CL-600-2B16 (CL-601-3A, CL-601-3R, and CL-604 Variants) Airplanes...

  14. ClEST cluster :Cl_singleton1875 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1875 beta-carotene -monooxygenase Cimex lectularius nuclear gene 443 CAGACGAAGACATGT ... CGCTTTATGGAAGTACAGATACAAGTGTGAAG mb05043 1 Retinal pigment ... epithelium-specific protein b [Danio rerio] AAH921 ...

  15. ClEST cluster :Cl_contig0243 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig0243 barrier-to-autointegration factor Cimex lectularius nuclear gene 428 ...TAATAAATACAGTATGATGTGCG fb29038 fs25084 mb23031 3 barrier to autointegration factor [Rhodnius prolixus] AEL79235 5.9E-56 GO:0003677 ...

  16. ClEST cluster :Cl_singleton0811 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0811 nuclear ... transcription factor gamma Cimex lectularius nuclear ... gene 506 GATGGTTGG ... GGGTACATACTGAGGATAACAAACGTCGAACTTTACAGCG fs11035 1 nuclear ... transcription factor Y gamma isoform 1 [Nasonia vi ...

  17. ClEST cluster :Cl_singleton1046 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1046 u2 small nuclear ... ribonucleoprotein a Cimex lectularius nuclear ... gene 633 TTGTTTG ... CGCTCACGAGC fs21006 1 PREDICTED: probable U2 small nuclear ... ribonucleoprotein A'-like [Bombus terrestris] XP_0 ...

  18. ClEST cluster :Cl_singleton1703 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1703 p8 nuclear ... protein Cimex lectularius nuclear ... gene 541 AGTCGTTCGACAACGTTCAAACAAT ... AACGGTTAAGCATTTGTACTTACGTTAT fw21041 1 DNA-binding nuclear ... protein p8 [Triatoma infestans] ABR27869 2.01616E- ...

  19. ClEST cluster :Cl_singleton2134 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton2134 rna-binding region ... rnp-1 domain-containing protein Cimex lectularius nuclear ge ... GTGTACCTTGCAAAAGTGATTTATCATC mb16086 1 RNA-binding region ... RNP-1 domain-containing protein [Dictyostelium dis ...

  20. ClEST cluster :Cl_singleton1569 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1569 b-cell ... receptor-associated protein 31-like Cimex lectularius nuclear gene 410 C ... CTCTGTTCCTCTCCATTGTGATTCGACGATTCGTGTCT fw16029 1 B-cell ... receptor-associated protein 31-like [Acyrthosiphon ...

  1. ClEST cluster :Cl_singleton2269 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton2269 germ cell -less protein Cimex lectularius nuclear gene 466 CACACACGCGCTTCATAAAAA ... TCAATATTCTTGA mb21032 1 PREDICTED: similar to germ cell -less protein [Tribolium castaneum] XP_967783 3.440 ...

  2. ClEST cluster :Cl_singleton0908 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0908 bone marrow stromal cell -derived ubiquitin-like protein Cimex lectularius nucle ... s15049 1 PREDICTED: similar to bone marrow stromal cell -derived ubiquitin-like protein [Tribolium castaneu ...

  3. ClEST cluster :Cl_singleton0360 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0360 cell ... cycle control protein 50a-like isoform 1 Cimex lectularius nuclear gene 41 ... ACAAAATGCATGAATGCCTTGTCACCAAC fb18030 1 PREDICTED: cell ... cycle control protein 50A-like isoform 2 [Nasonia ...

  4. ClEST cluster :Cl_contig0436 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig0436 lethal essential for life ... l2efl Cimex lectularius nuclear gene 432 TAAGAATCTCTCCCG ... GACGTTATT fs18066 fw18019 2 lethal(2)essential for life ... protein-like protein [Maconellicoccus hirsutus] AB ...

  5. ClEST cluster :Cl_singleton1657 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1657 pumilio ... 2 Cimex lectularius nuclear gene 590 TGATGATGAAAGATCAGTACGCCAATTATGTCGT ... ATATGATACATCAAATAAATTATTTGAGA fw20025 1 PREDICTED: pumilio ... homolog 2-like isoform 1 [Acyrthosiphon pisum] XP_ ...

  6. ClEST cluster :Cl_singleton2448 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton2448 probable gdp-fucose ... transporter-like Cimex lectularius nuclear gene 314 ACGAATT ... AAAGTTTTCCCTGTCA mb31096 1 PREDICTED: probable GDP-fucose ... transporter-like [Acyrthosiphon pisum] XP_00194993 ...

  7. ClEST cluster :Cl_singleton1765 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1765 rab11 family -interacting protein 4a-like Cimex lectularius nuclear gene 578 GGT ... GGCGAGGGTTTTGATGCTTGAAG fw23061 1 PREDICTED: rab11 family -interacting protein 4A-like isoform 1 [Acyrthosiph ...

  8. ClEST cluster :Cl_singleton0942 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0942 tbc1 domain family ... member 4-like Cimex lectularius nuclear gene 488 GCATTCGTATT ... CCACCATAAAGGAGCAA fs16074 1 PREDICTED: TBC1 domain family ... member 4-like [Acyrthosiphon pisum] XP_001947975 6 ...

  9. ClEST cluster :Cl_contig0251 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig0251 member ras oncogene family ... Cimex lectularius nuclear gene 413 GAGTGTGTAAACTTAAAATA ... 3 PREDICTED: similar to RAB18 member RAS oncogene family ... [Tribolium castaneum] XP_970378 2.6E-29 ...

  10. ClEST cluster :Cl_singleton0243 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0243 solute carrier family ... 35 member f5-like Cimex lectularius nuclear gene 403 GAAA ... AATAAAACTCCCAA fb12090 1 PREDICTED: solute carrier family ... 35 member F5-like [Nasonia vitripennis] XP_0016016 ...

  11. ClEST cluster :Cl_singleton1038 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1038 pleckstrin homology domain- family ... a (phosphoinositide binding specific) member ... : similar to pleckstrin homology domain-containing family ... A (phosphoinositide binding specific) member 3 [Tr ...

  12. ClEST cluster :Cl_singleton0344 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0344 l antigen family ... member 3 Cimex lectularius nuclear gene 461 CCAAGTAAAAATTTAAAT ... AGGGCAAATTATGGCTTCGCCCTCTATCTG fb17054 1 L antigen family ... member 3 isoform 1 [Nasonia vitripennis] NP_001155 ...

  13. ClEST cluster :Cl_singleton1438 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1438 sodium pump ... alpha subunit Cimex lectularius nuclear gene 282 GAGTCTGGTTCCAGTGCT ... ACTGGACTCACACACGCCAAAGCT fw09093 1 putative sodium pump ... alpha subunit [Danaus plexippus] EHJ73788 1.10687E ...

  14. ClEST cluster :Cl_singleton0353 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0353 sodium pump ... alpha subunit Cimex lectularius nuclear gene 155 GGCTGTCGGACCTCCACC ... CATAAAATATCTGTAGAAGAACTA fb18007 1 putative sodium pump ... alpha subunit [Danaus plexippus] EHJ73788 2.28502E ...

  15. ClEST cluster :Cl_singleton1521 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1521 Histone-lysine ... N-methyltransferase SETMAR Cimex lectularius nuclear gene 357 CT ... TTCATAAAGATATTTGAAAGTTTCGTTCAACT fw14041 1 Histone-lysine ... N-methyltransferase SETMAR [Harpegnathos saltator] ...

  16. ClEST cluster :Cl_contig0318 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig0318 histone-lysine ... n-methyltransferase setmar Cimex lectularius nuclear gene 571 TTTGA ... AATTTTCGAGTTTTTTCACTTTTC fw04055 mb08029 2 histone-lysine ... N-methyltransferase SETMAR [Bos taurus] NP_0010771 ...

  17. ClEST cluster :Cl_singleton1580 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1580 histone-lysine ... n-methyltransferase setmar-like Cimex lectularius nuclear gene 3 ... AGTACATTAACTCATCTTTTC fw17018 1 PREDICTED: histone-lysine ... N-methyltransferase SETMAR-like [Bombus terrestris ...

  18. ClEST cluster :Cl_singleton0551 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0551 rna-directed dna ... polymerase from mobile element jockey- partial Cimex lectulari ... CTATCTATCCCGTCTG fb26037 1 PREDICTED: RNA-directed DNA ... polymerase from mobile element jockey-like [Acyrth ...

  19. ClEST cluster :Cl_singleton1396 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1396 dna ... repair and recombination protein rad54b-like Cimex lectularius nuclear gene ... ACGATTACTATTTTTTTCCTTCGAGCCTT fw08090 1 PREDICTED: DNA ... repair and recombination protein RAD54B-like [Acyr ...

  20. ClEST cluster :Cl_singleton0669 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0669 n -adenine-specific dna ... methyltransferase 2-like Cimex lectularius nuclear gene ... GATGATAAAACTGTAAAAA fs03050 1 N-6 adenine-specific DNA ... methyltransferase 2 [Nasonia vitripennis] NP_00112 ...

  1. ClEST cluster :Cl_singleton1305 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1305 dna -directed rna polymerase ii kda polypeptide Cimex lectularius nuclear gene 4 ... TGAAGAAAGATTCAAAGAGGCGATCAAGGACAGGAAGGAA fw05060 1 DNA -directed RNA polymerase II 13.3 kda polypeptide [T ...

  2. ClEST cluster :Cl_singleton0185 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0185 dna -directed rna polymerases and iii subunit rpabc1-like Cimex lectularius nucl ... CTTCTGCTAAGCAATCACTCGTGGACATG fb10023 1 PREDICTED: DNA -directed RNA polymerases I II and III subunit RPAB ...

  3. ClEST cluster :Cl_singleton0563 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0563 dna -directed rna polymerases i and iii subunit rpac1 Cimex lectularius nuclear ... GTGAAATGCACTAAAAACCCACACTGCCG fb27031 1 PREDICTED: DNA -directed RNA polymerases I and III subunit RPAC1 [ ...

  4. ClEST cluster :Cl_singleton0580 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0580 rna-directed dna ... polymerase from mobile element jockey- partial Cimex lectulari ... ACCTTTATTAATCACATTCCGAGCCTA fb28040 1 RNA-directed DNA ... polymerase from mobile element jockey [Harpegnatho ...

  5. ClEST cluster :Cl_singleton0423 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0423 dna ... replication licensing factor mcm9-like Cimex lectularius nuclear gene 423 C ... CAAAGAAAGAGTGAGGCGTTAAATGCATC fb20074 1 PREDICTED: DNA ... replication licensing factor MCM9-like [Bos taurus ...

  6. ClEST cluster :Cl_singleton2256 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton2256 aminopeptidase -like Cimex lectularius nuclear gene 480 GTACACACTACACAGCACTGAGT ... TCACGTTTTCCCAAGACAAAGCTTG mb20082 1 PREDICTED: LOW QUALITY ... PROTEIN: putative aminopeptidase W07G4.4-like [Bom ...

  7. ClEST cluster :Cl_singleton0131 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0131 hemicentin 1 Cimex lectularius nuclear gene 552 TATCAGCACCAATTCCTTCAATTCCTGAAGA ... TACATGTGTCAGGGGAGCAACAAAG fb07055 1 PREDICTED: LOW QUALITY ... PROTEIN: hemicentin-1-like [Meleagris gallopavo] X ...

  8. ClEST cluster :Cl_singleton0993 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0993 low quality ... protein: wd repeat and fyve domain-containing protein 3-like Cimex ... GTGTTTCGCACGCCGCAGTGGTGGC fs18057 1 PREDICTED: LOW QUALITY ... PROTEIN: WD repeat and FYVE domain-containing prot ...

  9. ClEST cluster :Cl_singleton0484 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0484 protein polybromo-1 Cimex lectularius nuclear gene 500 GGGAGTCGTGAAGATGGTCGTGAA ... TAAGACTGACGAGTATGATGATATA fb23037 1 PREDICTED: LOW QUALITY ... PROTEIN: protein polybromo-1-like [Bombus terrestr ...

  10. ClEST cluster :Cl_singleton0415 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0415 ctp synthase Cimex lectularius nuclear gene 485 CGGTGAAACGTACGTTCTTGATGATGGAGGG ... CTTTCACCAGACCTCATTGTTTGCC fb20048 1 PREDICTED: LOW QUALITY ... PROTEIN: CTP synthase-like [Bombus impatiens] XP_0 ...

  11. ClEST cluster :Cl_contig0368 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig0368 astakine variant 1 Cimex lectularius nuclear gene 522 GAACAGTTTCAGTCGGCGACTGGTTGAC ... CAGTAAATAACTGTGAT fb05079 mb05073 2 PREDICTED: LOW QUALITY ... PROTEIN: astakine-like [Bombus terrestris] XP_0034 ...

  12. ClEST cluster :Cl_singleton0904 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0904 male -specific lethal 3 homolog Cimex lectularius nuclear gene 394 CTCGCAGGTTGAG ... GAATTCGACTTGGGATAGATTCGTTACCG fs15038 1 PREDICTED: male -specific lethal 3 homolog [Acyrthosiphon pisum] XP ...

  13. ClEST cluster :Cl_singleton1087 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1087 calreticulin Cimex lectularius nuclear gene 333 CGAAACCCAGCTCGAGACGATGAGGGCTCTT ... calreticulin [Rhodnius prolixus] ACI23246 4.17952E-42 ... GO:0006457 GO:0005783 GO:0051082 GO:0005509 ...

  14. ClEST cluster :Cl_contig0178 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig0178 transposase-like Cimex lectularius nuclear gene 625 AACTTCGTCAGAAAATAAAACTCTCTTCCA ... asGA2_TC010512 [Tribolium castaneum] EFA01186 1.5E-42 ... GO:0004803 GO:0015074 GO:0006313 GO:0003677 ...

  15. ClEST cluster :Cl_contig0085 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig0085 leucine aminopeptidase Cimex lectularius nuclear gene 650 ACTACTCAAAATTTTTGTTTCTGG ... 1 5 GJ21638 [Drosophila virilis] XP_002049525 2.0E-42 ... GO:0008238 GO:0007498 ...

  16. ClEST cluster :Cl_singleton2379 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton2379 tubulin polymerization ... promoting protein Cimex lectularius nuclear gene 406 AAA ... TTGCGGATTACAACAAATTCCTCGAGGATCTG mb25089 1 tubulin polymerization ... promoting protein [Triatoma matogrossensis] ADN299 ...

  17. ClEST cluster :Cl_singleton0582 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0582 stress -induced-phosphoprotein 1 Cimex lectularius nuclear gene 592 GGAAAAGGTTAT ... AAGGCACGAGAAATTATTCCCACCGATATTACATTTTACA fb28049 1 Stress -induced-phosphoprotein 1 [Acromyrmex echinatior] E ...

  18. ClEST cluster :Cl_singleton0472 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0472 oxidative stress -induced growth inhibitor 1 Cimex lectularius nuclear gene 476 ... CCGATTACCACAAGATATGGCAGATGATGA fb22084 1 Oxidative stress -induced growth inhibitor 1 [Camponotus floridanus] ...

  19. ClEST cluster :Cl_singleton1313 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1313 27 kda hemolymph ... Cimex lectularius nuclear gene 441 CCATTACGGCCGGGGAGAGTGGAATGA ... GAGGTGTTGATGAAAGAAATAA fw05075 1 PREDICTED: 27 kDa hemolymph ... protein-like [Acyrthosiphon pisum] XP_001947666 2. ...

  20. ClEST cluster :Cl_contig0283 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig0283 bladder cancer -associated Cimex lectularius nuclear gene 641 AGAGTCAGGATTGACTGTTTC ... TTAAAATATAAGC fb02042 fs13007 2 PREDICTED: bladder cancer -associated protein-like [Nasonia vitripennis] XP_0 ...

  1. ClEST cluster :Cl_contig0334 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig0334 1-acyl-sn-glycerol-3-phosphate ... acyltransferase Cimex lectularius nuclear gene 551 ... fw03026 fw07037 2 PREDICTED: 1-acyl-sn-glycerol-3-phosphate ... acyltransferase alpha-like isoform 2 [Acyrthosipho ...

  2. ClEST cluster :Cl_singleton0136 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0136 sodium-dependent phosphate ... transporter Cimex lectularius nuclear gene 573 GTACG ... TTTTTCAGCTCTGGCTGACAT fb07076 1 Putative inorganic phosphate ... cotransporter [Harpegnathos saltator] EFN85104 8.7 ...

  3. ClEST cluster :Cl_singleton1944 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1944 deoxyribose-phosphate ... aldolase Cimex lectularius nuclear gene 535 GATATCTGAAATG ... TG mb07072 1 PREDICTED: similar to 2-deoxyribose-5-phosphate ... aldolase homolog [Tribolium castaneum] XP_972358 7 ...

  4. ClEST cluster :Cl_singleton0117 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0117 phosphatidylinositol-4-phosphate ... 3-kinase c2 domain-containing beta polypeptide ... CAAAAG fb07013 1 PREDICTED: phosphatidylinositol-4-phosphate ... 3-kinase C2 domain-containing subunit alpha-like [ ...

  5. ClEST cluster :Cl_singleton2005 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton2005 glycerol-3-phosphate ... dehydrogenase Cimex lectularius nuclear gene 411 ATCGAGCTC ... GTATTGCTGATCTTGTCACCACTTGTTAC mb09081 1 glycerol-3-phosphate ... dehydrogenase [Drosophila ficusphila] BAB39756 2.6 ...

  6. ClEST cluster :Cl_singleton0341 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0341 ribose-phosphate ... pyrophosphokinase Cimex lectularius nuclear gene 379 TTCTATGTG ... TGCTGTTATTCCATATTTGCCCTATAGCAAGCA fb17043 1 ribose-phosphate ... pyrophosphokinase 1 2 [Culex quinquefasciatus] XP_ ...

  7. ClEST cluster :Cl_contig0206 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig0206 sodium-dependent phosphate ... transporter Cimex lectularius nuclear gene 554 TCTAGTCG ... 8 mb18034 3 PREDICTED: similar to sodium-dependent phosphate ... transporter [Tribolium castaneum] XP_001809051 9.4 ...

  8. ClEST cluster :Cl_singleton0167 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0167 sugar phosphate ... exchanger 2-like isoform 2 Cimex lectularius nuclear gene 506 C ... TATTCGCATACGCTGCATCAATG fb09027 1 PREDICTED: sugar phosphate ... exchanger 2-like isoform 2 [Apis mellifera] XP_397 ...

  9. ClEST cluster :Cl_singleton1124 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1124 glyceraldehyde-3-phosphate ... dehydrogenase Cimex lectularius nuclear gene 609 CTC ... TTTGAATTGTTA fs25045 1 PREDICTED: glyceraldehyde-3-phosphate ... dehydrogenase-like [Acyrthosiphon pisum] XP_001943 ...

  10. ClEST cluster :Cl_singleton0888 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0888 mannose-6-phosphate ... isomerase Cimex lectularius nuclear gene 314 GTTGGCTTGTGTGG ... AAGGAGTTGGCTGCTGTAC fs14088 1 PREDICTED: mannose-6-phosphate ... isomerase-like [Bombus impatiens] XP_003491147 1.3 ...

  11. ClEST cluster :Cl_singleton1290 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1290 glucose-6-phosphate ... 1-epimerase-like Cimex lectularius nuclear gene 605 AGAGGAA ... CGAATGTGGTCTCAGGAAG fw05014 1 PREDICTED: glucose-6-phosphate ... 1-epimerase-like [Apis mellifera] XP_003251860 4.4 ...

  12. ClEST cluster :Cl_singleton1771 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1771 inorganic phosphate ... cotransporter Cimex lectularius nuclear gene 540 GGTTTTAAAA ... AGGTCCGATT fw23080 1 PREDICTED: putative inorganic phosphate ... cotransporter-like isoform 2 [Acyrthosiphon pisum] ...

  13. ClEST cluster :Cl_singleton1772 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1772 myosin heavy chain Cimex lectularius nuclear gene 539 GAGTCAGACTCGCTCCAGCTCCCTC ... AACAAAGAAA fw23081 1 PREDICTED: myosin heavy chain muscle ... isoform 1 [Acyrthosiphon pisum] XP_001952092 5.076 ...

  14. ClEST cluster :Cl_contig0096 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig0096 muscle ... lim protein Cimex lectularius nuclear gene 588 AACTTGTTAGTGTGATAAAACCGTCGGC ... TCTGAATA fw01077 fw02081 fw16071 fw23005 fw24093 5 muscle ... LIM protein isoform 2 [Bombyx mori] NP_001037398 6 ...

  15. ClEST cluster :Cl_contig0487 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig0487 synaptic glycoprotein sc2 Cimex lectularius nuclear gene 366 GTTGTTTTATCTGATTCGGAG ... PREDICTED: steroid Alpha ReducTase family member (art -1)-like [Saccoglossus kowalevskii] XP_002732370 2. ...

  16. ClEST cluster :Cl_singleton0302 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0302 150 kda oxygen-regulated protein Cimex lectularius nuclear gene 290 CGATCGAGACT ... AAAGAGAAGGGGACAGTGGAGCTCCCAAG fb15026 1 PREDICTED: hypoxia ... up-regulated protein 1-like isoform 4 [Nasonia vit ...

  17. ClEST cluster :Cl_singleton0264 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0264 dnaj homolog subfamily a member 2 Cimex lectularius nuclear gene 633 GGACTTTTGA ... TGGCAGTAGAATGGCCAAAGAGATCAGGACAATGTGTAGT fb13059 1 molecular ... chaperone [Rhodnius prolixus] AEL79216 3.81379E-61 ...

  18. ClEST cluster :Cl_singleton0071 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0071 nucleosome-remodeling factor subunit nurf301 Cimex lectularius nuclear gene 605 ... GGCACCGTCATC fb05014 1 PREDICTED: similar to fetal alzheimer ... antigen falz [Tribolium castaneum] XP_001811424 2. ...

  19. ClEST cluster :Cl_singleton1298 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1298 nadh dehydrogenase Cimex lectularius nuclear gene 236 GAGTTCTAAGTCGTCTGGTCCTGAA ... TTTGAAAA fw05041 1 NADH dehydrogenase [ubiquinone] iron -sulfur protein 5 [Acyrthosiphon pisum] NP_00115530 ...

  20. ClEST cluster :Cl_contig0235 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig0235 tyrosine tryptophan ... Cimex lectularius nuclear gene 453 CGACCCTGATGGACGGTGGAAATTACA ... GACATTGCCT fb16033 fw14092 mb16034 3 phenylalanine-tryptophan ... hydroxylase [Gryllus bimaculatus] BAJ83477 2.8E-78 ...

  1. ClEST cluster :Cl_singleton0416 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0416 ornithine aminotransferase Cimex lectularius nuclear gene 438 TATC...CAGTTTGCCGAGTATATCACCCGTTATTT fb20049 1 PREDICTED: probable ornithine aminotransferase-like [Glycine max] XP_003531161 4.30167E-26 GO:0008483 ...

  2. ClEST cluster :Cl_singleton2093 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton2093 selenoprotein t Cimex lectularius nuclear gene 435 GAGAAGGAGATTCCG...GAGACGGGAAGAATA mb12059 1 selenoprotein T [Glossina morsitans morsitans] ADD19835 7.29481E-59 GO:0045454 GO:0008430 GO:0005575 ...

  3. ClEST cluster :Cl_contig0079 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig0079 death -associated protein Cimex lectularius nuclear gene 811 GAGTGATCATAGTGAGAACGGT ... ATTCTGTA fb07073 fb13017 fs15001 fw07030 mb18092 5 death -associated protein-like protein [Maconellicoccus h ...

  4. ClEST cluster :Cl_singleton1627 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1627 death -associated protein kinase 1 Cimex lectularius nuclear gene 571 TCCCAATGGG ... CCTACAGCGGAGT fw19023 1 PREDICTED: similar to DAP (Death -Associated Protein) Kinase homolog family member ( ...

  5. ClEST cluster :Cl_singleton0883 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0883 dehydrogenase domain protein Cimex lectularius nuclear gene 257 TCGATTACAACTGAA ... AAAAGGCTACTGACG fs14067 1 unnamed protein product [Azospirillum ... lipoferum 4B] YP_005037771 4.11457E-19 GO:0016616 ...

  6. ClEST cluster :Cl_singleton0781 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0781 membrane magnesium ... transporter 1-like Cimex lectularius nuclear gene 546 TCTAAA ... TACATGAATTGTTTAGTTTAATTATCTCTGT fs09088 1 Membrane magnesium ... transporter 1-B [Acromyrmex echinatior] EGI59871 6 ...

  7. LiikeAkatemian brändimielikuvan tutkiminen ja brändin kehittäminen


    Petäsnoro, Iida-Mari; Rajala, Emilia


    Toteutamme opinnäytetyömme Lapin ammattikorkeakoulussa Tornion kampuksella toimivalle LiikeAkatemialle, jossa opiskellaan käytännönläheisesti tiimiyrityksissä. Tavoitteenamme on tutkia LiikeAkatemian aikaisempaa brändimarkkinointia, ja sen vaikutusta nykyisen brändimielikuvan tilaan liiketalouden opettajien ja opiskelijoiden keskuudessa. Näiden tutkimustulosten perusteella esitämme brändin kehittämiseen liittyviä kehitysideoita. Työn teoreettinen viitekehys on koottu aiheeseen liittyvästä...

  8. Brüssel - unistus Euroopa pealinnast / Kristi Grishakov

    Index Scriptorium Estoniae

    Grishakov, Kristi


    Brüsseli linnaplaneerimise ajaloost, linnaehituslikest ja sotsiaalset laadi probleemidest, võimalikust tulevikust Euroopa pealinnana. Berlage Instituudi näitusest "A Vision for Brussels" Bozari kunstikeskuses

  9. GMO konverents Brüsselis / Nastja Pertsjonok

    Index Scriptorium Estoniae

    Pertsjonok, Nastja


    Brüsselis toimunud GMO-vabade piirkondade konverentsist, kus räägiti GMO-vabade piirkondade liikumisest, GMO-de lubamisest ja keelamisest ning hoiakutest nende suhtes Euroopa Liidus ja mujal maailmas

  10. Performance evaluation of LaBr3: Ce scintillator

    International Nuclear Information System (INIS)

    The cerium doped lanthanum bromide crystal (LaBr3: Ce) is a new kind of scintillator with many advantages such as good energy resolution, high light output, short decay time, good proportionality response. These properties make the LaBr3: Ce attractive substantial interest to use in the radiation detection. The energy resolution were investigated with Φ25 × 25 mm LaBr3: Ce coupled to a Hamamatsu R8900 photomultiplier tube. Energy resolution of 3.6% (FWHM) have been achieved for 511 keV photons (18F source) at room temperature. Decay time constant of 20 ns have been acquired with a Hamamatsu fast-time-response R9800 photomultiplier tube. The results approve the excellent characterizations of LaBr3: Ce and imply its enormous potentiality in the radiation detectors of gamma-ray spectroscopy and PET. (authors)

  11. Traian Brăileanu în documente (I

    Directory of Open Access Journals (Sweden)

    Radu-Florian Bruja


    Full Text Available A Romanian’s politician from Bukovina, Traian Brăileanu agreed the idea of possible activities of former political parties. Although he was a regional party, his activity was oriented to complete the unification and consolidation of Romania. Traian Brăileanu was a sociologist and doctor Professor at University of Cernăuţi. A polyglot, TraianBrăileanu has known the Greek and German’s philosophy. He has begun his political activity in People’s Party, then in League of National and Christian Protection and finally in The Legionary Movement. We bring bock into scientific circuit some documents from the personal records of Traian Brăileanu. This documents covering the period 1920-1921 on the ground of some investigations archirved by the author from Cernăuţi, Ukraina.

  12. BR2: Some aspects of structural mechanics

    International Nuclear Information System (INIS)

    This article discusses some of the important aspects of structural mechanics of BR2, namely: the follow-up of the beryllium matrix and of the reactor vessel and the seismic qualification. According the licence, a follow up program for the beryllium matrix is mandatory. This inspection is necessary because of the swelling of beryllium during irradiation. Due to this swelling, the individual beryllium blocks make contact between each other. This results in mechanical stresses and, because beryllium is a brittle material, cracks. At regular intervals inspection are made to evaluate the evolution of the swelling and the cracks. The maximum allowed neutron fluence is 6.4 1022 fast neutrons (energy more than 1 MeV) per cm2 . After this time the matrix has to be replaced. This has been done already twice. During the replacement an inspection of the reactor pressure vessel must be made. Last inspection was performed in 1996, using ultrasonic and eddy current inspections. On this occasion a fracture mechanics calculation was made and the minimum allowed fracture toughness of material was determined. Since very little information on irradiated aluminium 5052-O is available, a number of samples were cut out of a second wall around the vessel. This aluminium had received nearly the fluence. Out of the samples test pieces (tensile and charpy) were made. A number of them were tested immediately, while the other was loaded in the reactor for accelerated irradiation. In this way a material follow up program was started. This program still continues. During the period safety reassessment the authorities requested a seismic qualification. It was decided to make a full dynamic calculation, with input a 0.1g zero period peak ground acceleration and a regulatory guide 1.60 spectrum. The installation can withstand this earthquake, considered as a safe shutdown earthquake. A few structural reinforcements were necessary. The main ones were the primary piping outside the containment

  13. Kan lignin omdannes til flydende brændstof?

    DEFF Research Database (Denmark)

    Nielsen, Joachim Bachmann; Jensen, Anders; Felby, Claus;


    Ved en solvolytisk omdannelse af plantematerialet lignin til et flydende brændstof behandles det ved høj temperatur og højt tryk i et passende opløsningsmiddel. En sådan proces kan gennemføres ikke-katalytisk og være med til at skabe flydende brændsler baseret på vedvarende energikilder. Her...

  14. Influencia de la temperatura del clínker sobre su molturabilidad

    Directory of Open Access Journals (Sweden)

    Pospisil, Z.


    Full Text Available Not avaible<br>>El objeto del trabajo experimental que Z. Pospisil describe es demostrar que la disminución del rendimiento en la molienda del clínker no se debe tanto en la influencia de la temperatura, como a la carga electrostática que se engendra durante la pulverización del clínker. La necesidad de estudiar la cuestión se debe a que, generalmente, se muele clínker poco enfriado por ser muy limitadas las posibilidades de enfriarle en los silos. La molturación del clínker de cemento portland requiere un considerable consumo de energía. Para una producción anual, mundial, de 500 millones de toneladas, con un consumo específico de 35 kW/t, el consumo de energía es cercano a 18.000 millones de kW/h que corresponde al 0,5 % de la total producción mundial de electricidad.

  15. Application of TlBr to nuclear medicine imaging (United States)

    Cirignano, Leonard; Kim, Hadong; Kargar, Alireza; Churilov, Alexei V.; Ciampi, Guido; Higgins, William; Kim, Suyoung; Barber, Bradford; Haston, Kyle; Shah, Kanai


    Thallium bromide (TlBr) has been under development for room temperature gamma ray spectroscopy due to high density, high Z and wide bandgap of the material. Furthermore, its low melting point (460 °C), cubic crystal structure and congruent melting with no solid-solid phase transitions between the melting point and room temperature, TlBr can be grown by relatively simple melt based methods. As a result of improvements in material processing and detector fabrication over the last several years, TlBr with electron mobility-lifetime products (μeτe) in the mid 10-3 cm2/V range has been obtained. In this paper we are going to report on our unipolar charging TlBr results for the application as a small animal imaging. For SPECT application, about 5 mm thick pixellated detectors were fabricated and tested. About 1 % FWHM at 662 keV energy resolution was estimated at room temperature. By applying the depth correction technique, less than 1 % energy resolution was estimated. We are going to report the results from orthogonal strip TlBr detector for PET application. In this paper we also present our latest detector highlights and recent progress made in long term stability of TlBr detectors at or near room temperature. This work is being supported by the Domestic Nuclear Detection Office (DNDO) and the Department of Energy (DOE).

  16. Template synthesis of braided gold nanowires with gemini surfactant-HAuCl{sub 4} aggregates

    Energy Technology Data Exchange (ETDEWEB)

    Wang Wentao; Han Yuchun; Gao Mingyuan, E-mail:; Wang Yilin, E-mail: [Beijing National Laboratory for Molecular Sciences (BNLMS), Institute of Chemistry, Chinese Academy of Sciences, Key Laboratory of Colloid and Interface Science (China)


    One-dimensional braided gold nanowires with 40-50 nm in width and several micrometers in length which were fabricated by using cationic gemini surfactant hexamethylene-1,6-bis (dodecyl dimethylammonium bromide) (C{sub 12}C{sub 6}C{sub 12}Br{sub 2}). Through simply regulating the mole ratio of C{sub 12}C{sub 6}C{sub 12}Br{sub 2} to HAuCl{sub 4}, the morphology of the gold products changed into nanoparticles and nanowires. The CryoTEM images indicated that the C{sub 12}C{sub 6}C{sub 12}Br{sub 2}/HAuCl{sub 4} mixture formed spherical or fibrillar aggregates depending on the mole ratio of C{sub 12}C{sub 6}C{sub 12}Br{sub 2} to HAuCl{sub 4}, which performed as the versatile templates for morphology-controlled synthesis of the multiple gold nanomaterials. The HRTEM and SAED results suggested the nanowires and braided nanowires were polycrystalline. The gold nanostructure displayed a time-dependent growth process, i.e., first the nanoparticles arranged in one dimension, and then assembled into nanowires. Therefore, a template-directed aggregation and fusion process of nanoparticles is proposed for the formation of the one-dimensional gold nanomaterials. The braided nanowires exhibited a higher catalytic activity in the reduction of p-nitroaniline than that of the nanowires. This gemini surfactant-based template provides a versatile strategy for the morphology-controlled synthesis of gold nanomaterials, and may be applied for the synthesis of other noble-metal nanomaterials.

  17. Wavelength calculation of highly stripped ions S10+→S13+, Br23+, Br24+, Ge20+, Ge21+

    International Nuclear Information System (INIS)

    Wavelengths of highly stripped ions S10+ →S13+ , Br23+ , Br24+ , Ge20+ , Ge21+ are calculated by means of GRASP code. The calculations are performed based on multiconfiguration Dirac-Fock technique. Corrections to the energy levels due to the retarded Coulomb interaction (Breit interaction) and the polarization of the vacuum by the nuclear distribution and electron self-energy are included in a perturbation approximation. Comparisons with the new experimental data by CIAE group are presented

  18. Balloon-borne stratospheric BrO measurements: comparison with Envisat/SCIAMACHY BrO limb profiles


    Dorf, M.; H. Bösch; Butz, A.; Camy-Peyret, C.; Chipperfield, M. P.; Engel, A.; Goutail, F.; Grunow, K.; Hendrick, F.; Hrechanyy, S.; B. Naujokat; J.-P. Pommereau; Van Roozendael, M.; C. Sioris; F. Stroh


    For the first time, results of four stratospheric BrO profiling instruments, are presented and compared with reference to the SLIMCAT 3-dimensional chemical transport model (3-D CTM). Model calculations are used to infer a BrO profile validation set, measured by 3 different balloon sensors, for the new Envisat/SCIAMACHY (ENVIronment SATellite/SCanning Imaging Absorption spectroMeter for Atmospheric CHartographY) satellite instrument. The balloon observations include (a) balloon-borne in situ ...

  19. Balloon-borne stratospheric BrO measurements: comparison with Envisat/SCIAMACHY BrO limb profiles


    Dorf, M.; H. Bösch; Butz, A.; Camy-Peyret, C.; Chipperfield, M. P.; Engel, A.; Goutail, F.; Grunow, K.; Hendrick, F.; Hrechanyy, S.; B. Naujokat; J.-P. Pommereau; Van Roozendael, M.; C. Sioris; F. Stroh


    For the first time, results of all four existing stratospheric BrO profiling instruments, are presented and compared with reference to the SLIMCAT 3-dimensional chemical transport model (3-D CTM). Model calculations are used to infer a BrO profile validation set, measured by 3 different balloon sensors, for the new Envisat/SCIAMACHY (ENVIronment SATellite/SCanning Imaging Absorption spectroMeter for Atmospheric CHartographY) satellite instrument. The balloon observations include (a) balloon-b...

  20. Balloon-borne stratospheric BrO measurements: comparison with Envisat/SCIAMACHY BrO limb profiles


    Dorf, M.; H. Bösch; Butz, A.; Camy-Peyret, C.; Chipperfield, M. P.; Engel, A.; Goutail, F.; Grunow, K.; Hendrick, F.; Hrechanyy, S.; B. Naujokat; Pommereau, J.-P.; Van Roozendael, M.; C. Sioris; F. Stroh


    International audience For the first time, results of all four existing stratospheric BrO profiling instruments, are presented and compared with reference to the SLIMCAT 3-dimensional chemical transport model (3-D CTM). Model calculations are used to infer a BrO profile validation set, measured by 3 different balloon sensors, for the new Envisat/SCIAMACHY (ENVIronment SATellite/SCanning Imaging Absorption spectroMeter for Atmospheric CHartographY) satellite instrument. The balloon observat...