WorldWideScience

Sample records for citrate synthase gene

  1. Citrate-release-mediated aluminum resistance is coupled to the inducible expression of mitochondrial citrate synthase gene in Paraserianthes falcataria.

    Science.gov (United States)

    Osawa, Hiroki; Kojima, Katsumi

    2006-05-01

    Aluminum (Al) resistance in some leguminous plants is achieved by enhanced citrate release from roots. Enhancement requires several hours for complete activation and is postulated to involve Al-responsive genes or components. We examined the mechanism of Al-induced citrate release by studying the relationship between citrate release and expression of the mitochondrial citrate synthase (mCS) gene in three leguminous trees. Root elongation in Leucaena leucocephala (Lam.) de Wit was arrested within 24 h by 30 microM Al, whereas root elongation in Paraserianthes falcataria (L.) Neilson and Acacia mangium Willd. was inhibited mangium maintained enhanced release and accumulation of citrate for at least 28 days in response to Al treatment. Aluminum increased the accumulation of mCS transcripts in P. falcataria roots, but not in L. leucocephala roots, and thus up-regulation decreased following removal of Al. Lanthanum did not alter the expression level of mCS. Aluminum increased mCS activity concomitantly with enhanced mCS gene expression in P. falcataria, whereas it did not affect mCS activity in L. leucocephala. Aluminum content in root apices of P. falcataria was increased by cycloheximide, supporting the idea that de novo synthesis of proteins is a prerequisite for Al resistance. Our findings suggest that Al-inducible expression of mCS coupled with enhanced citrate release mediates Al resistance in P. falcataria. PMID:16452070

  2. Molecular Cloning and Characterization of Citrate Synthase Gene in Rice( Oryza sativa)

    Institute of Scientific and Technical Information of China (English)

    ZHANG Shan-shan; MING Feng; LU Qun; GUO Bin; SHEN Da-leng

    2005-01-01

    The full-length OsCS encoding citrate synthase was isolated from rice (Oryza sativa L. subsp. japonica). OsCS is 1477-bp long and encodes a 474 amino acid polypeptide. Its putative protein sequence is highly identical to Daucus carota, Nicotiana tabacum,Beta vulgaris subsp., Arabidopsis thaliana, and Citrus junos (>70%). The deduced amino-terminal sequence of OsCS showes characteristics of mitochondrial targeting signal. Southern blot analysis using ORF of the OsCS as the probe indicated that this gene exists in multiple copies in rice genome. The band with predicated size of 82 kD was detected by Western blot after being induced by 0.4 mmol/L IPTG.

  3. Mitochondrial citrate synthase crystals: novel finding in Sengers syndrome caused by acylglycerol kinase (AGK) mutations.

    Science.gov (United States)

    Siriwardena, Komudi; Mackay, Nevena; Levandovskiy, Valeriy; Blaser, Susan; Raiman, Julian; Kantor, Paul F; Ackerley, Cameron; Robinson, Brian H; Schulze, Andreas; Cameron, Jessie M

    2013-01-01

    We report on two families with Sengers syndrome and mutations in the acylglycerol kinase gene (AGK). In the first family, two brothers presented with vascular strokes, lactic acidosis, cardiomyopathy and cataracts, abnormal muscle cell histopathology and mitochondrial function. One proband had very abnormal mitochondria with citrate synthase crystals visible in electron micrographs, associated with markedly high citrate synthase activity. Exome sequencing was used to identify mutations in the AGK gene in the index patient. Targeted sequencing confirmed the same homozygous mutation (c.3G>A, p.M1I) in the brother. The second family had four affected members, of which we examined two. They also presented with similar clinical symptoms, but no strokes. Postmortem heart and skeletal muscle tissues showed low complex I, III and IV activities in the heart, but normal in the muscle. Skin fibroblasts showed elevated lactate/pyruvate ratios and low complex I+III activity. Targeted sequencing led to identification of a homozygous c.979A>T, p.K327* mutation. AGK is located in the mitochondria and phosphorylates monoacylglycerol and diacylglycerol to lysophosphatidic acid and phosphatidic acid. Disruption of these signaling molecules affects the mitochondria's response to superoxide radicals, resulting in oxidative damage to mitochondrial DNA, lipids and proteins, and stimulation of cellular detoxification pathways. High levels of manganese superoxide dismutase protein were detected in all four affected individuals, consistent with increased free radical damage. Phosphatidic acid is also involved in the synthesis of phospholipids and its loss will result in changes to the lipid composition of the inner mitochondrial membrane. These effects manifest as cataract formation in the eye, respiratory chain dysfunction and cardiac hypertrophy in heart tissue. These two pedigrees confirm that mutation of AGK is responsible for the severe neonatal presentation of Sengers syndrome. The

  4. Lactate Dehydrogenase and Citrate Synthase activity in cardiac and skeletal muscle of lowland and highland tinamous

    OpenAIRE

    Aira, Naomi

    2013-01-01

    Tinamous (Tinamidae) have the smallest heart in relation to body mass compared to any other flying bird today (Bishop 1997). This means that heart size is likely to restrict aerobic metabolism. Tinamous inhabit areas from sea level to 4800 m a.s.l., which means that the high altitude living species, Nothoprocta ornata (NO), is exposed to hypoxia. In this study the activity of the two metabolic enzymes Lactate Dehydrogenase (LDH) and Citrate Synthase (CS) was measured and the ratio between the...

  5. Citrate synthase proteins in extremophilic organisms: Studies within a structure-based model

    OpenAIRE

    Rozycki, Bartosz; Cieplak, Marek

    2015-01-01

    We study four citrate synthase homodimeric proteins within a structure-based coarse-grained model. Two of these proteins come from thermophilic bacteria, one from a cryophilic bacterium and one from a mesophilic organism; three are in the closed and two in the open conformations. Even though the proteins belong to the same fold, the model distinguishes the properties of these proteins in a way which is consistent with experiments. For instance, the thermophilic proteins are more stable thermo...

  6. Improved L-lysine production with Corynebacterium glutamicum and systemic insight into citrate synthase flux and activity.

    Science.gov (United States)

    van Ooyen, Jan; Noack, Stephan; Bott, Michael; Reth, Alexander; Eggeling, Lothar

    2012-08-01

    We here developed a series of Corynebacterium glutamicum strains with gradual decreased specific citrate synthase (CS) activity and quantified in a multifaceted approach the consequences of residual activity on the transcriptome, metabolome, and fluxome level as well as on L-lysine formation and growth. We achieved an intended gradual L-lysine yield increase and recognized and overcame further new limitations in the L-lysine biosynthesis pathway to result in a strain with the highest yield reported so far when assayed under comparable conditions. As a non-intended outcome, a detailed flux analysis revealed an almost constant flux through CS at 10% remaining CS activity, whereas the metabolome data revealed an increase in the oxaloacetate and acetyl-CoA concentrations. Hence reduced CS activity is apparently efficiently buffered by increased concentrations of CS substrates, implying a certain robustness of the central metabolism in response of the imposed gene expressions. PMID:22392073

  7. Enhanced citrate production through gene insertion in Aspergillus niger

    DEFF Research Database (Denmark)

    Jongh, Wian de; Nielsen, Jens

    2007-01-01

    The effect of inserting genes involved in the reductive branch of the tricarboxylic acid (TCA) cycle on citrate production by Aspergillus niger was evaluated. Several different genes were inserted individually and in combination, i.e. malate dehydrogenase (mdh2) from Saccharomyces cerevisiae, two...

  8. An active site–tail interaction in the structure of hexahistidine-tagged Thermoplasma acidophilum citrate synthase

    OpenAIRE

    Murphy, Jesse R.; Donini, Stefano; Kappock, T. Joseph

    2015-01-01

    Citrate synthase from the thermophilic euryarchaeon T. acidophilum fused to a hexahistidine tag was purified and biochemically characterized. The structure of the unliganded enzyme at 2.2 Å resolution contains tail–active site contacts in half of the active sites.

  9. Deletion of the Aconitase Gene in Corynebacterium glutamicum Causes Strong Selection Pressure for Secondary Mutations Inactivating Citrate Synthase▿†

    Science.gov (United States)

    Baumgart, Meike; Mustafi, Nurije; Krug, Andreas; Bott, Michael

    2011-01-01

    The aconitase gene acn of Corynebacterium glutamicum is regulated by four transcriptional regulators, indicating that the synthesis of this enzyme is carefully controlled. To understand the causes for this elaborate regulation, the properties of the Δacn-1 deletion mutant were analyzed in detail. The mutant was glutamate auxotrophic in glucose minimal medium, showed a strong growth defect, and secreted large amounts of acetate. None of these phenotypes could be complemented by plasmid-encoded aconitase, suggesting the presence of a secondary mutation. In fact, a point mutation within the gltA gene encoding citrate synthase was identified that caused the instability of the protein and an almost complete lack of its enzymatic activity. Subsequently, 27 further, independent Δacn clones were isolated, and 15 of them were found to contain distinct mutations in gltA, causing the loss of citrate synthase activity. A similar result was observed for mutants lacking the isocitrate dehydrogenase gene icd. In this case, 8 of 24 Δicd clones contained additional mutations in gltA. Indirect evidence was obtained that elevated intracellular citrate concentrations could be the cause of this selection pressure. Accordingly, the careful control of aconitase synthesis might have evolved due to the necessity to avoid inhibitory cytoplasmic citrate levels on the one hand and to prevent the excessive synthesis of an oxygen-sensitive protein requiring both iron and sulfur on the other hand. PMID:21984793

  10. Citrate Accumulation-Related Gene Expression and/or Enzyme Activity Analysis Combined With Metabolomics Provide a Novel Insight for an Orange Mutant.

    Science.gov (United States)

    Guo, Ling-Xia; Shi, Cai-Yun; Liu, Xiao; Ning, Dong-Yuan; Jing, Long-Fei; Yang, Huan; Liu, Yong-Zhong

    2016-01-01

    'Hong Anliu' (HAL, Citrus sinensis cv. Hong Anliu) is a bud mutant of 'Anliu' (AL), characterized by a comprehensive metabolite alteration, such as lower accumulation of citrate, high accumulation of lycopene and soluble sugars in fruit juice sacs. Due to carboxylic acid metabolism connects other metabolite biosynthesis and/or catabolism networks, we therefore focused analyzing citrate accumulation-related gene expression profiles and/or enzyme activities, along with metabolic fingerprinting between 'HAL' and 'AL'. Compared with 'AL', the transcript levels of citrate biosynthesis- and utilization-related genes and/or the activities of their respective enzymes such as citrate synthase, cytosol aconitase and ATP-citrate lyase were significantly higher in 'HAL'. Nevertheless, the mitochondrial aconitase activity, the gene transcript levels of proton pumps, including vacuolar H(+)-ATPase, vacuolar H(+)-PPase, and the juice sac-predominant p-type proton pump gene (CsPH8) were significantly lower in 'HAL'. These results implied that 'HAL' has higher abilities for citrate biosynthesis and utilization, but lower ability for the citrate uptake into vacuole compared with 'AL'. Combined with the metabolites-analyzing results, a model was then established and suggested that the reduction in proton pump activity is the key factor for the low citrate accumulation and the comprehensive metabolite alterations as well in 'HAL'. PMID:27385485

  11. Citrate Accumulation-Related Gene Expression and/or Enzyme Activity Analysis Combined With Metabolomics Provide a Novel Insight for an Orange Mutant

    Science.gov (United States)

    Guo, Ling-Xia; Shi, Cai-Yun; Liu, Xiao; Ning, Dong-Yuan; Jing, Long-Fei; Yang, Huan; Liu, Yong-Zhong

    2016-01-01

    ‘Hong Anliu’ (HAL, Citrus sinensis cv. Hong Anliu) is a bud mutant of ‘Anliu’ (AL), characterized by a comprehensive metabolite alteration, such as lower accumulation of citrate, high accumulation of lycopene and soluble sugars in fruit juice sacs. Due to carboxylic acid metabolism connects other metabolite biosynthesis and/or catabolism networks, we therefore focused analyzing citrate accumulation-related gene expression profiles and/or enzyme activities, along with metabolic fingerprinting between ‘HAL’ and ‘AL’. Compared with ‘AL’, the transcript levels of citrate biosynthesis- and utilization-related genes and/or the activities of their respective enzymes such as citrate synthase, cytosol aconitase and ATP-citrate lyase were significantly higher in ‘HAL’. Nevertheless, the mitochondrial aconitase activity, the gene transcript levels of proton pumps, including vacuolar H+-ATPase, vacuolar H+-PPase, and the juice sac-predominant p-type proton pump gene (CsPH8) were significantly lower in ‘HAL’. These results implied that ‘HAL’ has higher abilities for citrate biosynthesis and utilization, but lower ability for the citrate uptake into vacuole compared with ‘AL’. Combined with the metabolites-analyzing results, a model was then established and suggested that the reduction in proton pump activity is the key factor for the low citrate accumulation and the comprehensive metabolite alterations as well in ‘HAL’. PMID:27385485

  12. Evaluation of the role of mitochondrial citrate synthase, mitochondrial and cytosolic isoforms of isocitrate dehydrogenase in tomato leaf metabolism

    OpenAIRE

    Sienkiewicz-Porzucek, Agata

    2010-01-01

    Der Citratzyklus (TCA) ist einer der bedeutendsten Stoffwechselwege für alle lebenden Organismen. Trotz der zentralen Rolle dieses Prozesses im Pflanzenmetabolismus ist er nur relativ wenig untersucht worden. In dieser Arbeit berichte ich über die Produktion und die funktionale Analyse von Tomatenpflanzen (Solanum lycopersicum), die unabhängig eine leicht eingeschränkte Aktivität der mitochondrialen Citrat-Synthase (CS) und zweier Isocitrat-dehydrogenasen (mitochondriale NAD-IDH und cytosoli...

  13. Inhibition of flower formation by antisense repression of mitochondrial citrate synthase in transgenic potato plants leads to a specific disintegration of the ovary tissues of flowers.

    OpenAIRE

    Landschütze, V; Willmitzer, L; Müller-Röber, B

    1995-01-01

    The tricarboxylic acid (TCA) cycle constitutes a major component of the mitochondrial metabolism of eucaryotes, including higher plants. To analyze the importance of this pathway, we down-regulated mitochondrial citrate synthase (mCS; EC 4.1.3.7), the first enzyme of the TCA cycle, in transgenic potato plants using an antisense RNA approach. Several transformants were identified with reduced citrate synthase activity (down to approximately 6% of wild-type activity). These plants were indistin...

  14. Citrate synthase proteins in extremophilic organisms: Studies within a structure-based model

    Energy Technology Data Exchange (ETDEWEB)

    Różycki, Bartosz, E-mail: rozycki@ifpan.edu.pl; Cieplak, Marek [Institute of Physics, Polish Academy of Sciences, Al. Lotników 32/46, 02-668 Warsaw (Poland)

    2014-12-21

    We study four citrate synthase homodimeric proteins within a structure-based coarse-grained model. Two of these proteins come from thermophilic bacteria, one from a cryophilic bacterium and one from a mesophilic organism; three are in the closed and two in the open conformations. Even though the proteins belong to the same fold, the model distinguishes the properties of these proteins in a way which is consistent with experiments. For instance, the thermophilic proteins are more stable thermodynamically than their mesophilic and cryophilic homologues, which we observe both in the magnitude of thermal fluctuations near the native state and in the kinetics of thermal unfolding. The level of stability correlates with the average coordination number for amino acid contacts and with the degree of structural compactness. The pattern of positional fluctuations along the sequence in the closed conformation is different than in the open conformation, including within the active site. The modes of correlated and anticorrelated movements of pairs of amino acids forming the active site are very different in the open and closed conformations. Taken together, our results show that the precise location of amino acid contacts in the native structure appears to be a critical element in explaining the similarities and differences in the thermodynamic properties, local flexibility, and collective motions of the different forms of the enzyme.

  15. Citrate synthase proteins in extremophilic organisms: Studies within a structure-based model

    Science.gov (United States)

    RóŻycki, Bartosz; Cieplak, Marek

    2014-12-01

    We study four citrate synthase homodimeric proteins within a structure-based coarse-grained model. Two of these proteins come from thermophilic bacteria, one from a cryophilic bacterium and one from a mesophilic organism; three are in the closed and two in the open conformations. Even though the proteins belong to the same fold, the model distinguishes the properties of these proteins in a way which is consistent with experiments. For instance, the thermophilic proteins are more stable thermodynamically than their mesophilic and cryophilic homologues, which we observe both in the magnitude of thermal fluctuations near the native state and in the kinetics of thermal unfolding. The level of stability correlates with the average coordination number for amino acid contacts and with the degree of structural compactness. The pattern of positional fluctuations along the sequence in the closed conformation is different than in the open conformation, including within the active site. The modes of correlated and anticorrelated movements of pairs of amino acids forming the active site are very different in the open and closed conformations. Taken together, our results show that the precise location of amino acid contacts in the native structure appears to be a critical element in explaining the similarities and differences in the thermodynamic properties, local flexibility, and collective motions of the different forms of the enzyme.

  16. Citrate synthase proteins in extremophilic organisms: Studies within a structure-based model

    International Nuclear Information System (INIS)

    We study four citrate synthase homodimeric proteins within a structure-based coarse-grained model. Two of these proteins come from thermophilic bacteria, one from a cryophilic bacterium and one from a mesophilic organism; three are in the closed and two in the open conformations. Even though the proteins belong to the same fold, the model distinguishes the properties of these proteins in a way which is consistent with experiments. For instance, the thermophilic proteins are more stable thermodynamically than their mesophilic and cryophilic homologues, which we observe both in the magnitude of thermal fluctuations near the native state and in the kinetics of thermal unfolding. The level of stability correlates with the average coordination number for amino acid contacts and with the degree of structural compactness. The pattern of positional fluctuations along the sequence in the closed conformation is different than in the open conformation, including within the active site. The modes of correlated and anticorrelated movements of pairs of amino acids forming the active site are very different in the open and closed conformations. Taken together, our results show that the precise location of amino acid contacts in the native structure appears to be a critical element in explaining the similarities and differences in the thermodynamic properties, local flexibility, and collective motions of the different forms of the enzyme

  17. The tomato terpene synthase gene family

    NARCIS (Netherlands)

    V. Falara; T.A. Akhtar; T.T.H. Nguyen; E.A. Spyropoulou; P.M. Bleeker; I. Schauvinhold; Y. Matsuba; M.E. Bonini; A.L. Schilmiller; R.L. Last; R.C. Schuurink; E. Pichersky

    2011-01-01

    Compounds of the terpenoid class play many roles in the interactions of plants with their environment, such as attracting pollinators and defending the plant against pests. We show here that the genome of Solanum lycopersicum (cultivated tomato) contains 40 terpene synthase (TPS) genes, including 28

  18. The tomato terpene synthase gene family

    OpenAIRE

    Falara, V.; Akhtar, T.A.; NGUYEN, T. T. H.; Spyropoulou, E.A.; Bleeker, P.M.; Schauvinhold, I.; Matsuba, Y.; Bonini, M.E.; Schilmiller, A.L.; Last, R.L.; Schuurink, R. C.; Pichersky, E

    2011-01-01

    Compounds of the terpenoid class play many roles in the interactions of plants with their environment, such as attracting pollinators and defending the plant against pests. We show here that the genome of Solanum lycopersicum (cultivated tomato) contains 40 terpene synthase (TPS) genes, including 28 which are functional or potentially functional. Of these 28 TPS genes, 25 were expressed in at least some parts of the plant. The enzymatic functions of eight of the TPS proteins were previously r...

  19. An active site–tail interaction in the structure of hexahistidine-tagged Thermoplasma acidophilum citrate synthase

    Energy Technology Data Exchange (ETDEWEB)

    Murphy, Jesse R.; Donini, Stefano; Kappock, T. Joseph, E-mail: kappock@purdue.edu [Purdue University, 175 South University Street, West Lafayette, IN 47907-2063 (United States)

    2015-09-23

    Citrate synthase from the thermophilic euryarchaeon T. acidophilum fused to a hexahistidine tag was purified and biochemically characterized. The structure of the unliganded enzyme at 2.2 Å resolution contains tail–active site contacts in half of the active sites. Citrate synthase (CS) plays a central metabolic role in aerobes and many other organisms. The CS reaction comprises two half-reactions: a Claisen aldol condensation of acetyl-CoA (AcCoA) and oxaloacetate (OAA) that forms citryl-CoA (CitCoA), and CitCoA hydrolysis. Protein conformational changes that ‘close’ the active site play an important role in the assembly of a catalytically competent condensation active site. CS from the thermoacidophile Thermoplasma acidophilum (TpCS) possesses an endogenous Trp fluorophore that can be used to monitor the condensation reaction. The 2.2 Å resolution crystal structure of TpCS fused to a C-terminal hexahistidine tag (TpCSH6) reported here is an ‘open’ structure that, when compared with several liganded TpCS structures, helps to define a complete path for active-site closure. One active site in each dimer binds a neighboring His tag, the first nonsubstrate ligand known to occupy both the AcCoA and OAA binding sites. Solution data collectively suggest that this fortuitous interaction is stabilized by the crystalline lattice. As a polar but almost neutral ligand, the active site–tail interaction provides a new starting point for the design of bisubstrate-analog inhibitors of CS.

  20. An active site–tail interaction in the structure of hexahistidine-tagged Thermoplasma acidophilum citrate synthase

    International Nuclear Information System (INIS)

    Citrate synthase from the thermophilic euryarchaeon T. acidophilum fused to a hexahistidine tag was purified and biochemically characterized. The structure of the unliganded enzyme at 2.2 Å resolution contains tail–active site contacts in half of the active sites. Citrate synthase (CS) plays a central metabolic role in aerobes and many other organisms. The CS reaction comprises two half-reactions: a Claisen aldol condensation of acetyl-CoA (AcCoA) and oxaloacetate (OAA) that forms citryl-CoA (CitCoA), and CitCoA hydrolysis. Protein conformational changes that ‘close’ the active site play an important role in the assembly of a catalytically competent condensation active site. CS from the thermoacidophile Thermoplasma acidophilum (TpCS) possesses an endogenous Trp fluorophore that can be used to monitor the condensation reaction. The 2.2 Å resolution crystal structure of TpCS fused to a C-terminal hexahistidine tag (TpCSH6) reported here is an ‘open’ structure that, when compared with several liganded TpCS structures, helps to define a complete path for active-site closure. One active site in each dimer binds a neighboring His tag, the first nonsubstrate ligand known to occupy both the AcCoA and OAA binding sites. Solution data collectively suggest that this fortuitous interaction is stabilized by the crystalline lattice. As a polar but almost neutral ligand, the active site–tail interaction provides a new starting point for the design of bisubstrate-analog inhibitors of CS

  1. Trichinella pseudospiralis vs. T. spiralis thymidylate synthase gene structure and T. pseudospiralis thymidylate synthase retrogene sequence

    OpenAIRE

    Jagielska, Elżbieta; Płucienniczak, Andrzej; Dąbrowska, Magdalena; Dowierciał, Anna; Rode, Wojciech

    2014-01-01

    Background Thymidylate synthase is a housekeeping gene, designated ancient due to its role in DNA synthesis and ubiquitous phyletic distribution. The genomic sequences were characterized coding for thymidylate synthase in two species of the genus Trichinella, an encapsulating T. spiralis and a non-encapsulating T. pseudospiralis. Methods Based on the sequence of parasitic nematode Trichinella spiralis thymidylate synthase cDNA, PCR techniques were employed. Results Each of the respective gene...

  2. An active site–tail interaction in the structure of hexahistidine-tagged Thermoplasma acidophilum citrate synthase

    Science.gov (United States)

    Murphy, Jesse R.; Donini, Stefano; Kappock, T. Joseph

    2015-01-01

    Citrate synthase (CS) plays a central metabolic role in aerobes and many other organisms. The CS reaction comprises two half-reactions: a Claisen aldol condensation of acetyl-CoA (AcCoA) and oxaloacetate (OAA) that forms citryl-CoA (CitCoA), and CitCoA hydrolysis. Protein conformational changes that ‘close’ the active site play an important role in the assembly of a catalytically competent condensation active site. CS from the thermoacidophile Thermoplasma acidophilum (TpCS) possesses an endogenous Trp fluorophore that can be used to monitor the condensation reaction. The 2.2 Å resolution crystal structure of TpCS fused to a C-terminal hexahistidine tag (TpCSH6) reported here is an ‘open’ structure that, when compared with several liganded TpCS structures, helps to define a complete path for active-site closure. One active site in each dimer binds a neighboring His tag, the first nonsubstrate ligand known to occupy both the AcCoA and OAA binding sites. Solution data collectively suggest that this fortuitous interaction is stabilized by the crystalline lattice. As a polar but almost neutral ligand, the active site–tail interaction provides a new starting point for the design of bisubstrate-analog inhibitors of CS. PMID:26457521

  3. An active site-tail interaction in the structure of hexahistidine-tagged Thermoplasma acidophilum citrate synthase.

    Science.gov (United States)

    Murphy, Jesse R; Donini, Stefano; Kappock, T Joseph

    2015-10-01

    Citrate synthase (CS) plays a central metabolic role in aerobes and many other organisms. The CS reaction comprises two half-reactions: a Claisen aldol condensation of acetyl-CoA (AcCoA) and oxaloacetate (OAA) that forms citryl-CoA (CitCoA), and CitCoA hydrolysis. Protein conformational changes that `close' the active site play an important role in the assembly of a catalytically competent condensation active site. CS from the thermoacidophile Thermoplasma acidophilum (TpCS) possesses an endogenous Trp fluorophore that can be used to monitor the condensation reaction. The 2.2 Å resolution crystal structure of TpCS fused to a C-terminal hexahistidine tag (TpCSH6) reported here is an `open' structure that, when compared with several liganded TpCS structures, helps to define a complete path for active-site closure. One active site in each dimer binds a neighboring His tag, the first nonsubstrate ligand known to occupy both the AcCoA and OAA binding sites. Solution data collectively suggest that this fortuitous interaction is stabilized by the crystalline lattice. As a polar but almost neutral ligand, the active site-tail interaction provides a new starting point for the design of bisubstrate-analog inhibitors of CS. PMID:26457521

  4. Gene deletion of cytosolic ATP: citrate lyase leads to altered organic acid production in Aspergillus niger

    DEFF Research Database (Denmark)

    Meijer, Susan Lisette; Nielsen, Michael Lynge; Olsson, Lisbeth;

    2009-01-01

    factory platform for production of chemicals. Using molecular biology techniques, this study focused on metabolic engineering of A. niger to manipulate its organic acid production in the direction of succinic acid. The gene target for complete gene deletion was cytosolic ATP: citrate lyase (acl), which...

  5. Genome-wide identification of citrus ATP-citrate lyase genes and their transcript analysis in fruits reveals their possible role in citrate utilization.

    Science.gov (United States)

    Hu, Xiao-Mei; Shi, Cai-Yun; Liu, Xiao; Jin, Long-Fei; Liu, Yong-Zhong; Peng, Shu-Ang

    2015-02-01

    ATP-citrate lyase (ACL, EC4.1.3.8) catalyzes citrate to oxaloacetate and acetyl-CoA in the cell cytosol, and has important roles in normal plant growth and in the biosynthesis of some secondary metabolites. We identified three ACL genes, CitACLα1, CitACLα2, and CitACLβ1, in the citrus genome database. Both CitACLα1 and CitACLα2 encode putative ACL α subunits with 82.5 % amino acid identity, whereas CitACLβ1 encodes a putative ACL β subunit. Gene structure analysis showed that CitACLα1 and CitACLα2 had 12 exons and 11 introns, and CitACLβ1 had 16 exons and 15 introns. CitACLα1 and CitACLβ1 were predominantly expressed in flower, and CitACLα2 was predominantly expressed in stem and fibrous roots. As fruits ripen, the transcript levels of CitACLα1, CitACLβ1, and/or CitACLα2 in cultivars 'Niuher' and 'Owari' increased, accompanied by significant decreases in citrate content, while their transcript levels decreased significantly in 'Egan No. 1' and 'Iyokan', although citrate content also decreased. In 'HB pummelo', in which acid content increased as fruit ripened, and in acid-free pummelo, transcript levels of CitACLα2, CitACLβ1, and/or CitACLα1 increased. Moreover, mild drought stress and ABA treatment significantly increased citrate contents in fruits. Transcript levels of the three genes were significantly reduced by mild drought stress, and the transcript level of only CitACLβ1 was significantly reduced by ABA treatment. Taken together, these data indicate that the effects of ACL on citrate use during fruit ripening depends on the cultivar, and the reduction in ACL gene expression may be attributed to citrate increases under mild drought stress or ABA treatment. PMID:25120169

  6. Aluminum-activated citrate and malate transporters encoded by distinct Al tolerance genes function independently in Arabidopsis

    Science.gov (United States)

    Aluminum (Al) -activated malate and citrate exudation from roots plays an important role in conferring Al tolerance to many plant species. Here, we report on the identification and characterization of AtMATE, the gene encoding an Al-activated root citrate efflux transporter that functions in Arabid...

  7. Effects of tamoxifen citrate on gene expression during nuclear chromatin condensation in male rats

    Institute of Scientific and Technical Information of China (English)

    Mukhtar Aleem; Varsha Padwal; Jyoti Choudhari; Nafisa Balasinor; Priyanka Parte; Manjeet Gill-Sharma

    2005-01-01

    Aim: To evaluate the effects of tamoxifen citrate on gene expression during nuclear chromatin condensation in male decondensation, acridine orange (AO) dye uptake, concentration of thiol-groups, levels and/or expression of transition proteins 1, 2 (TP1, TP2), protamine 1 (P1), cyclic AMP response element modulator-τ (CREMτ), androgenbinding protein (ABP) and cyclic adenosine 3', 5' monophosphate (cAMP) were evaluated after 60 days of exposure in adult male rats. Controls received the vehicle. Results: Tamoxifen citrate enhanced the rates of chromatin decondensation, increased AO dye uptake and reduced free thiols in caput epididymal sperms and reduced the levels of TP1, TP2, P1, and CREMτ in the testis, while cAMP was unaffected. P1 deposition was absent in the sperm. The transcripts of TP1, TP2 were increased, of P1 and ABP decreased, while those of CREMτ unaffected in the testis.Conclusion: Tamoxifen citrate reduced caput epididymal sperm chromatin compaction by reducing the testicular levels of proteins TP1, TP2 and P1 and the CREMτ involved in chromatin condensation during spermiogenesis.Tamoxifen citrate affects the expression of these genes at both the transcriptional and post-transcriptional levels.

  8. Isolation and expression of the Pneumocystis carinii thymidylate synthase gene

    DEFF Research Database (Denmark)

    Edman, U; Edman, J C; Lundgren, B;

    1989-01-01

    The thymidylate synthase (TS) gene from Pneumocystis carinii has been isolated from complementary and genomic DNA libraries and expressed in Escherichia coli. The coding sequence of TS is 891 nucleotides, encoding a 297-amino acid protein of Mr 34,269. The deduced amino acid sequence is similar t...... into plasmid vectors under control of the lac and tac promoters. These constructs direct the synthesis of catalytically active enzyme to the extent of 2% of total soluble protein....

  9. Chromosomal localization of the human and mouse hyaluronan synthase genes

    Energy Technology Data Exchange (ETDEWEB)

    Spicer, A.P.; McDonald, J.A. [Mayo Clinic Scottsdale, AZ (United States); Seldin, M.F. [Univ. of California Davis, CA (United States)] [and others

    1997-05-01

    We have recently identified a new vertebrate gene family encoding putative hyaluronan (HA) synthases. Three highly conserved related genes have been identified, designated HAS1, HAS2, and HAS3 in humans and Has1, Has2, and Has3 in the mouse. All three genes encode predicted plasma membrane proteins with multiple transmembrane domains and approximately 25% amino acid sequence identity to the Streptococcus pyogenes HA synthase, HasA. Furthermore, expression of any one HAS gene in transfected mammalian cells leads to high levels of HA biosynthesis. We now report the chromosomal localization of the three HAS genes in human and in mouse. The genes localized to three different positions within both the human and the mouse genomes. HAS1 was localized to the human chromosome 19q13.3-q13.4 boundary and Has1 to mouse Chr 17. HAS2 was localized to human chromosome 8q24.12 and Has2 to mouse Chr 15. HAS3 was localized to human chromosome 16q22.1 and Has3 to mouse Chr 8. The map position for HAS1 reinforces the recently reported relationship between a small region of human chromosome 19q and proximal mouse chromosome 17. HAS2 mapped outside the predicted critical region delineated for the Langer-Giedion syndrome and can thus be excluded as a candidate gene for this genetic syndrome. 33 refs., 2 figs.

  10. The relationship between skeletal muscle mitochondrial citrate synthase activity and whole body oxygen uptake adaptations in response to exercise training

    DEFF Research Database (Denmark)

    Vigelsø Hansen, Andreas; Andersen, Nynne Bjerre; Dela, Flemming

    2014-01-01

    changes in CS activity is often assumed. However, this relationship and absolute values of CS and maximal oxygen uptake (V.O2max) has never been assessed across different studies. A systematic PubMed search on literature published from 1983 to 2013 was performed. The search profile included: citrate...... CS activity. 70 publications with 97 intervention groups were included. There was a positive (r = 0.45) correlation (P < 0.001) between the relative change in V.O2max and the relative change in CS activity. All reported absolute values of CS and V.O2max did not correlate (r =- 0.07, n = 148, P = 0.......4). Training induced changes in whole body oxidative capacity is matched by changes in muscle CS activity in a nearly 1:1 relationship. Absolute values of CS across different studies cannot be compared unless a standardized analytical method is used by all laboratories...

  11. Development of a biomarker for Geobacter activity and strain composition: Proteogenomic analysis of the citrate synthase protein during bioremediation of U(VI)

    Energy Technology Data Exchange (ETDEWEB)

    Wilkins, M.J.; Callister, S.J.; Miletto, M.; Williams, K.H.; Nicora, C.D.; Lovley, D.R.; Long, P.E.; Lipton, M.S.

    2010-02-15

    Monitoring the activity of target microorganisms during stimulated bioremediation is a key problem for the development of effective remediation strategies. At the US Department of Energy's Integrated Field Research Challenge (IFRC) site in Rifle, CO, the stimulation of Geobacter growth and activity via subsurface acetate addition leads to precipitation of U(VI) from groundwater as U(IV). Citrate synthase (gltA) is a key enzyme in Geobacter central metabolism that controls flux into the TCA cycle. Here, we utilize shotgun proteomic methods to demonstrate that the measurement of gltA peptides can be used to track Geobacter activity and strain evolution during in situ biostimulation. Abundances of conserved gltA peptides tracked Fe(III) reduction and changes in U(VI) concentrations during biostimulation, whereas changing patterns of unique peptide abundances between samples suggested sample-specific strain shifts within the Geobacter population. Abundances of unique peptides indicated potential differences at the strain level between Fe(III)-reducing populations stimulated during in situ biostimulation experiments conducted a year apart at the Rifle IFRC. These results offer a novel technique for the rapid screening of large numbers of proteomic samples for Geobacter species and will aid monitoring of subsurface bioremediation efforts that rely on metal reduction for desired outcomes.

  12. Novel terpenes generated by heterologous expression of bacterial terpene synthase genes in an engineered Streptomyces host

    OpenAIRE

    YAMADA, YUUKI; Arima, Shiho; Nagamitsu, Tohru; Johmoto, Kohei; Uekusa, Hidehiro; Eguchi, Tadashi; Shin’ya, Kazuo; Cane, David E.; Ikeda, Haruo

    2015-01-01

    Mining of bacterial genome data has revealed numerous presumptive terpene synthases. Heterologous expression of several putative terpene synthase genes in an engineered Streptomyces host has revealed 13 newly discovered terpenes whose GC-MS and NMR data did not match any known compounds in the spectroscopic databases. Each of the genes encoding the corresponding terpene synthases were silent in their parent microorganisms. Heterologous expression and detailed NMR spectroscopic analysis allowe...

  13. Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis.

    Science.gov (United States)

    Noar, Roslyn D; Daub, Margaret E

    2016-01-01

    Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity) for six of the PKS sequences. One of the PKS sequences was not similar (banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that they may encode polyketides important in pathogenicity. PMID:27388157

  14. Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis.

    Directory of Open Access Journals (Sweden)

    Roslyn D Noar

    Full Text Available Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity for six of the PKS sequences. One of the PKS sequences was not similar (< 60% similarity to sequences in any of the 103 genomes, suggesting that it encodes a unique compound. Comparison of the M. fijiensis PKS sequences with those of two other banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that

  15. Characterization of citrate utilization in Corynebacterium glutamicum by transcriptome and proteome analysis.

    Science.gov (United States)

    Polen, Tino; Schluesener, Daniela; Poetsch, Ansgar; Bott, Michael; Wendisch, Volker F

    2007-08-01

    Corynebacterium glutamicum grows aerobically on a variety of carbohydrates and organic acids as single or combined sources of carbon and energy. To characterize the citrate utilization in C. glutamicum on a genomewide scale, a comparative analysis was carried out by combining transcriptome and proteome analysis. In cells grown on citrate, transcriptome analysis revealed highest expression changes for two different citrate-uptake systems encoded by citM and tctCBA, whereas genes encoding uptake systems for the glucose- (ptsG), sucrose- (ptsS) and fructose- (ptsF) specific PTS components and permeases for gluconate (gntP) and glutamate (gluC) displayed decreased mRNA levels in citrate-grown cells. This pattern was also observed when cells grown in Luria-Bertani (LB) medium plus citrate were compared with cells grown in LB medium, indicating some kind of catabolite repression. Genes encoding enzymes of the tricarboxylic acid cycle (aconitase, succinyl-CoA synthetase, succinate dehydrogenase and fumarase), malic enzyme, PEP carboxykinase, gluconeogenic glyceraldehyde-3-phosphate dehydrogenase and ATP synthase displayed increased expression in cells grown on citrate. Accordingly, proteome analysis revealed elevated protein levels of these enzymes and showed a good correlation with the mRNA levels. In conclusion, this study revealed the citrate stimulon in C. glutamicum and the regulated central metabolic genes when grown on citrate. PMID:17559405

  16. Inibição da atividade da citrato sintase cerebral em um modelo animal de sepse Inhibition of brain citrate synthase activity in an animal model of sepsis

    Directory of Open Access Journals (Sweden)

    Giselli Scaini

    2011-06-01

    fisiopatologia desta doença.OBJECTIVE: An extensive body of evidence from experimental studies indicates that sepsis is associated with increased reactive oxygen species production, depletion of antioxidants, and accumulation of markers of oxidative stress. Moreover, mitochondrial dysfunction has been implicated in the pathogenesis of multiple organ dysfunction syndrome (MODS. Citrate synthase is an enzyme localized in the mitochondrial matrix and an important component of the Krebs cycle; consequently, citrate synthase has been used as a quantitative enzyme marker for the presence of intact mitochondria. Thus, we investigated citrate synthase activity in the brains of rats submitted to a cecal ligation puncture model of sepsis. METHODS: At several times points (3, 6, 12, 24 and 48 hours after the cecal ligation puncture operation, six rats were killed by decapitation. Their brains were removed, and the hippocampus, striatum, cerebellum, cerebral cortex and prefrontal cortex were dissected and used to determine citrate synthase activity. RESULTS: We found that citrate synthase activity in the prefrontal cortex was inhibited 12, 24 and 48 hours after cecal ligation puncture. In the cerebral cortex, citrate synthase activity was inhibited 3, 12, 24 and 48 hours after cecal ligation puncture. Citrate synthase was not affected in the hippocampus, striatum or cerebellum up to 48 hours after cecal ligation puncture. CONCLUSION: Considering that energy impairment due to mitochondrial dysfunction in sepsis has been well described and that oxidative stress plays a crucial role in sepsis development, we believe that energy impairment may also be involved in these processes. If citrate synthase inhibition also occurs in a sepsis model, it is tempting to speculate that a reduction in brain metabolism may be related to the pathophysiology of this disease.

  17. All members in the sphingomyelin synthase gene family have ceramide phosphoethanolamine synthase activity[S

    OpenAIRE

    Ding, Tingbo; Kabir, Inamul; Li, Yue; Lou, Caixia; Yazdanyar, Amirfarbod; Xu, Jiachen; Dong, Jibin; Zhou, Hongwen; Park, Taesik; Boutjdir, Mohamed; Li, Zhiqiang; Jiang, Xian-Cheng

    2015-01-01

    Sphingomyelin synthase-related protein (SMSr) synthesizes the sphingomyelin analog ceramide phosphoethanolamine (CPE) in cells. Previous cell studies indicated that SMSr is involved in ceramide homeostasis and is crucial for cell function. To further examine SMSr function in vivo, we generated Smsr KO mice that were fertile and had no obvious phenotypic alterations. Quantitative MS analyses of plasma, liver, and macrophages from the KO mice revealed only marginal changes in CPE and ceramide a...

  18. Application of a Colorimetric Assay to Identify Putative Ribofuranosylaminobenzene 5'-Phosphate Synthase Genes Expressed with Activity in Escherichia coli

    Directory of Open Access Journals (Sweden)

    Bechard Matthew E.

    2003-01-01

    Full Text Available Tetrahydromethanopterin (H4MPT is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H4MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H4MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase. Given the importance of RFAP synthase in H4MPT biosynthesis, the identification of putative RFAP synthase genes and measurement of RFAP synthase activity would provide an indication of the presence of H4MPT in untested microorganisms. Investigation of putative archaeal RFAP synthase genes has been hampered by the tendency of the resulting proteins to form inactive inclusion bodies in Escherichia coli. The current work describes a colorimetric assay for measuring RFAP synthase activity, and two modified procedures for expressing recombinant RFAP synthase genes to produce soluble, active enzyme. By lowering the incubation temperature during expression, RFAP synthase from Archaeoglobus fulgidus was produced in E. coli and purified to homogeneity. The production of active RFAP synthase from Methanothermobacter thermautotrophicus was achieved by coexpression of the gene MTH0830 with a molecular chaperone. This is the first direct biochemical identification of a methanogen gene that codes for an active RFAP synthase.

  19. Modified cellulose synthase gene from Arabidopsis thaliana confers herbicide resistance to plants

    Science.gov (United States)

    Somerville, Chris R.; Scheible, Wolf

    2007-07-10

    Cellulose synthase ("CS"), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl)phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

  20. Studies on the chalcone synthase gene of two higher plants: petroselinum hortense and matthiola incana

    Energy Technology Data Exchange (ETDEWEB)

    Hemleben, V.; Frey, M.; Rall, S.; Koch, M.; Kittel, M.; Kreuzaler, F.; Ragg, H.; Fautz, E.; Hahlbrock, K.

    1982-01-01

    Two higher plant systems are presented which allow to study coordinated gene expression of the light-induced metabolic pathway of flavonoid biosynthesis: tissue culture cells of Petroselinum hortense (Apiaceae) and different developmental stages of various genotypes of Matthiola incana (Brassicaceae). The gene structure of the chalcone synthase is mainly studied. A cDNA clone (pLF56) of parsley has been constructed and characterized conferring the chalcone synthase gene sequence. Strong cross hybridization between the parsley cDNA and Matthiola DNA allowed to identify a HindIII fragment (6000 bp) identical in size for parsley and different Matthiola wild type lines and a mutant line.

  1. Chemical analysis of a genome wide polyketide synthase gene deletion library in Aspergillus nidulans

    DEFF Research Database (Denmark)

    Larsen, Thomas Ostenfeld; Klejnstrup, Marie Louise; Nielsen, Jakob Blæsbjerg;

    predicted to encode polyketide synthases have been individually been deleted. This presentation will highlight our recent linking of secondary metabolites in A. nidulans to genes, and in particular describe some recent work on characterization of ANID_6448 and associated genes responsible for biosynthesis...

  2. Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase

    DEFF Research Database (Denmark)

    Krath, Britta N.; Hove-Jensen, Bjarne

    The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca...

  3. Dihydropteroate Synthase and Novel Dihydrofolate Reductase Gene Mutations in Strains of Pneumocystis jirovecii from South Africa

    OpenAIRE

    Robberts, F. J. L.; Chalkley, L J; Weyer, K.; Goussard, P.; Liebowitz, L. D.

    2005-01-01

    Dihydropteroate synthase (DHPS) gene mutations have raised concerns about emerging sulfonamide resistance in Pneumocystis jirovecii. DHPS and dihydrofolate reductase (DHFR) gene products were amplified in clinical specimens from South African patients. One of 53 DHPS genes sequenced contained the double mutation Thr55Ala Pro57Ser. DHFR gene mutations detected were Ala67Val and the new mutations Arg59Gly and C278T.

  4. Isolation and partial characterization of the gene for goose fatty acid synthase.

    Science.gov (United States)

    Kameda, K; Goodridge, A G

    1991-01-01

    Fatty acid synthase is regulated by diet and hormones, with regulation being primarily transcriptional. In chick embryo hepatocytes in culture, triiodothyronine stimulates accumulation of enzyme and transcription of the gene. Since the 5'-flanking region of this gene is likely involved in hormonal regulation of its expression, we have isolated and partially characterized an avian fatty acid synthase gene. A genomic DNA library was constructed in a cosmid vector and screened with cDNA clones that contained sequence complementary to the 3' end of goose fatty acid synthase mRNA. A genomic clone (approximately 35 kilobase pairs (kb] was isolated, and a 6.5-kb EcoRI fragment thereof contained DNA complementary to the 3' noncoding region of fatty acid synthase mRNA. Additional cosmid libraries were screened with 5' fragments of previously isolated genomic clones, resulting in the isolation of five overlapping cosmid DNAs. The entire region of cloned DNA spans approximately 105 kb. Exon-containing fragments were identified by hybridization with end-labeled poly(A)+ RNA and by hybridization of labeled exon-containing genomic DNA fragments to fatty acid synthase mRNA. A new set of cDNA clones spanning approximately 3.2 kb was isolated from a lambda-ZAP goose liver cDNA library using the 5'-most exon-containing fragment of the 5'-most genomic DNA clone. This region of mRNA contains a 5'-untranslated sequence and a continuous open reading frame which includes a region that codes for the essential cysteine of the beta-ketoacyl synthase domain. The entire fatty acid synthase gene spans about 50 kb. The 5' 15 kb of the gene contain 7 exons. S1 nuclease and primer extension analyses were used to identify a single site for initiation of transcription, 174 nucleotides upstream from the putative translation initiation codon. Putative "TATA" and "CCAAT" boxes are located 28 and 60 base pairs (bp), respectively, upstream of the site of initiation of transcription. The 5'-flanking 597

  5. The chsA gene, encoding a class-I chitin synthase from Ampelomyces quisqualis.

    Science.gov (United States)

    Weiss, N; Sztejnberg, A; Yarden, O

    1996-02-01

    Degenerate oligodeoxyribonucleotide primers, designed on the basis of conserved regions of the chitin synthase gene family, were used to amplify a fragment of the Ampelomyces quisqualis (Aq) chsA gene. Subsequently, the PCR product was used as a probe in order to identify and isolate genomic clones harboring the entire chsA gene. Aq chsA is 2786-nt long, has one intron and encodes a 910-amino-acid polypeptide belonging to the class-I chitin synthases. Low-stringency Southern hybridizations to Aq genomic DNA provided evidence for the presence of additional DNA fragments resembling chsA in the fungal genome, suggesting the presence of a multigene family of chitin synthases in Aq. PMID:8626074

  6. Citrus PH5-like H+-ATPase genes: identification and transcript analysis to investigate their possible relationship with citrate accumulation in fruits

    OpenAIRE

    Shi, Cai-Yun; Song, Rui-Qin; Hu, Xiao-Mei; Liu, Xiao; Jin, Long-Fei; Liu, Yong-Zhong

    2015-01-01

    PH5 is a petunia gene that encodes a plasma membrane H+-ATPase and determines the vacuolar pH. The citrate content of fruit cell vacuoles influences citrus organoleptic qualities. Although citrus could have PH5-like homologs that are involved in citrate accumulation, the details are still unknown. In this study, extensive data-mining with the PH5 sequence and PCR amplification confirmed that there are at least eight PH5-like genes (CsPH1-8) in the citrus genome. CsPHs have a molecular mass of...

  7. Functional analyses of cellulose synthase genes in flax (Linum usitatissimum) by virus-induced gene silencing.

    Science.gov (United States)

    Chantreau, Maxime; Chabbert, Brigitte; Billiard, Sylvain; Hawkins, Simon; Neutelings, Godfrey

    2015-12-01

    Flax (Linum usitatissimum) bast fibres are located in the stem cortex where they play an important role in mechanical support. They contain high amounts of cellulose and so are used for linen textiles and in the composite industry. In this study, we screened the annotated flax genome and identified 14 distinct cellulose synthase (CESA) genes using orthologous sequences previously identified. Transcriptomics of 'primary cell wall' and 'secondary cell wall' flax CESA genes showed that some were preferentially expressed in different organs and stem tissues providing clues as to their biological role(s) in planta. The development for the first time in flax of a virus-induced gene silencing (VIGS) approach was used to functionally evaluate the biological role of different CESA genes in stem tissues. Quantification of transcript accumulation showed that in many cases, silencing not only affected targeted CESA clades, but also had an impact on other CESA genes. Whatever the targeted clade, inactivation by VIGS affected plant growth. In contrast, only clade 1- and clade 6-targeted plants showed modifications in outer-stem tissue organization and secondary cell wall formation. In these plants, bast fibre number and structure were severely impacted, suggesting that the targeted genes may play an important role in the establishment of the fibre cell wall. Our results provide new fundamental information about cellulose biosynthesis in flax that should facilitate future plant improvement/engineering. PMID:25688574

  8. Phylogenetic analysis of uroporphyrinogen III synthase (UROS) gene

    OpenAIRE

    Shaik, Abjal Pasha; Alsaeed, Abbas H; Sultana, Asma

    2012-01-01

    The uroporphyrinogen III synthase (UROS) enzyme (also known as hydroxymethylbilane hydrolyase) catalyzes the cyclization of hydroxymethylbilane to uroporphyrinogen III during heme biosynthesis. A deficiency of this enzyme is associated with the very rare Gunther's disease or congenital erythropoietic porphyria, an autosomal recessive inborn error of metabolism. The current study investigated the possible role of UROS (Homo sapiens [EC: 4.2.1.75; 265 aa; 1371 bp mRNA; Entrez Pubmed ref NP_0003...

  9. Energy-dependent inactivation of citrate lyase in Enterobacter aerogenes.

    Science.gov (United States)

    Kulla, H; Gottschalk, G

    1977-12-01

    Enterobacter aerogenes was grown in continous culture with ammonia as the growth-limiting substrate, and changes in citrate lyase and citrate synthase activities were monitored after growth shifts from anaerobic growth on citrate to aerobic growth on citrate, aerobic growth on glucose, anaerobic growth on glucose, and anaerobic growth on glucose plus nitrate. Citrate lyase was inactivated during aerobic growth on glucose and during anaerobic growth with glucose plus nitrate. Inactivation did not occur during anaerobic growth on glucose, and as a result of the simultaneous presence of citrate lyase and citrate synthase, growth difficulties were observed. Citrate lyase inactivation consisted of deacetylation of the enzyme. The corresponding deacetylase could not be demonstrated in cell extracts, and it is concluded that, as in a number of other inactivations, electron transport to oxygen or nitrate was required for inactivation. PMID:924971

  10. A cryptic type I polyketide synthase (cpk) gene cluster in Streptomyces coelicolor A3(2)

    OpenAIRE

    Pawlik, Krzysztof; Kotowska, Magdalena; Chater, Keith F.; Kuczek, Katarzyna; Takano, Eriko

    2007-01-01

    The chromosome of Streptomyces coelicolor A3(2), a model organism for the genus Streptomyces, contains a cryptic type I polyketide synthase (PKS) gene cluster which was revealed when the genome was sequenced. The ca. 54-kb cluster contains three large genes, cpkA, cpkB and cpkC, encoding the PKS subunits. In silico analysis showed that the synthase consists of a loading module, five extension modules and a unique reductase as a terminal domain instead of a typical thioesterase. All acyltransf...

  11. Isoflavone synthase genes in legumes and non-leguminous plants

    Czech Academy of Sciences Publication Activity Database

    Pičmanová, Martina; Koblovská, R.; Lapčík, O.; Honys, David

    Washington, D.C: IEEE Computer Society, 2012 - (Sloan, K.), s. 344-347 ISBN 978-0-7695-4706-0. [International Conference on Biomedical Engineering and Biotechnology /2012/. Macau (CN), 28.05.2012-30.05.2012] R&D Projects: GA ČR GA525/09/0994; GA ČR(CZ) GAP501/11/1462; GA MŠk(CZ) OC10054 Institutional support: RVO:61389030 Keywords : legumes * non-leguminous plants * isoflavone synthase Subject RIV: EF - Botanics

  12. PCR cloning of Polyhydroxybutyrate Synthase Gene (phbC) from Aeromonashydrophila

    International Nuclear Information System (INIS)

    Plastic wastes are considered to be severe environmental contaminantscausing waste disposal problems. Widespread use of biodegradable plastics isone of the solutions, but it is limited by high production cost. A polymerasechain reaction (PCR) protocol was developed for the specific for the specificdetection and isolation of full-length gene coding for polyhydroxybutyrate(PBH). (PCR) strategy using (PHB) primers resulted in the amplification of(DNA) fragments with the expected size from all isolated bacteria (PBH)synthase gene was cloned directly from Aeromonas hydrophila genome for thefirst time. The clonec fragment was named (phbCAh) gene exhibits similarly to(PHB) synthase genes of Alcaligenes latus and Pseudomonas oleovorans (97%),Alcaligenes sp. (81%) and Comamonas acidovorans (84%). (author)

  13. Allotopic Expression of a Gene Encoding FLAG Tagged-subunit 8 of Yeast Mitochondrial ATP Synthase

    Directory of Open Access Journals (Sweden)

    I MADE ARTIKA

    2006-03-01

    Full Text Available Subunit 8 of yeast mitochondrial ATP synthase is a polypeptide of 48 amino acids encoded by the mitochondrial ATP8 gene. A nuclear version of subunit 8 gene has been designed to encode FLAG tagged-subunit 8 fused with a mitochondrial signal peptide. The gene has been cloned into a yeast expression vector and then expressed in a yeast strain lacking endogenous subunit 8. Results showed that the gene was successfully expressed and the synthesized FLAG tagged-subunit 8 protein was imported into mitochondria. Following import, the FLAG tagged-subunit 8 protein assembled into functional mitochondrial ATP synthase complex. Furthermore, the subunit 8 protein could be detected using anti-FLAG tag monoclonal antibody.

  14. Chromosome mapping of the GD3 synthase gene (SIAT8) in human and mouse

    Energy Technology Data Exchange (ETDEWEB)

    Matsuda, Yoichi; Saito, Toshiyuki [National Inst. of Radiological Sciences, Chiba (Japan); Nara, Kiyomitsu [Tokyo Metropolitan Inst. of Medical Science (Japan)] [and others

    1996-02-15

    This article reports on the genetic mapping of the human and mouse GD3 synthase gene (SIAT8) using fluorescence in situ hybridization and interspecific backcross analysis. The human gene was localized to human chromosome 12p12.1-p11.2; the mouse homologue was localized to mouse chromosome 6, which has been shown to be syntenic with the short arm of human chromosome 12, suggesting a common evolution. 16 refs., 1 fig.

  15. Cloning and verification of the Lactococcus lactis pyrG gene and characterization of the gene product, CTP synthase

    DEFF Research Database (Denmark)

    Wadskov-Hansen, Steen Lyders Lerche; Willemoës, M.; Martinussen, Jan;

    2001-01-01

    The pyrG gene of Lactococcus lactis subsp. cremoris, encoding CTP synthase, has been cloned and sequenced. It is flanked upstream by an open reading frame showing homology to several aminotransferases and downstream by an open reading frame of unknown function. L. lactis strains harboring disrupted...

  16. Modified cellulose synthase gene from 'Arabidopsis thaliana' confers herbicide resistance to plants

    Energy Technology Data Exchange (ETDEWEB)

    Somerville, Chris R.; Scieble, Wolf

    2000-10-11

    Cellulose synthase ('CS'), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl) phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

  17. Isolation and Molecular Characterization of 1-Aminocyclopropane-1-carboxylic Acid Synthase Genes in Hevea brasiliensis

    Directory of Open Access Journals (Sweden)

    Jia-Hong Zhu

    2015-02-01

    Full Text Available Ethylene is an important factor that stimulates Hevea brasiliensis to produce natural rubber. 1-Aminocyclopropane-1-carboxylic acid synthase (ACS is a rate-limiting enzyme in ethylene biosynthesis. However, knowledge of the ACS gene family of H. brasiliensis is limited. In this study, nine ACS-like genes were identified in H. brasiliensis. Sequence and phylogenetic analysis results confirmed that seven isozymes (HbACS1–7 of these nine ACS-like genes were similar to ACS isozymes with ACS activity in other plants. Expression analysis results showed that seven ACS genes were differentially expressed in roots, barks, flowers, and leaves of H. brasiliensis. However, no or low ACS gene expression was detected in the latex of H. brasiliensis. Moreover, seven genes were differentially up-regulated by ethylene treatment. These results provided relevant information to help determine the functions of the ACS gene in H. brasiliensis, particularly the functions in regulating ethylene stimulation of latex production.

  18. Mutations in the dihydropteroate synthase gene of Pneumocystis jiroveci isolates from Portuguese patients with Pneumocystis pneumonia

    DEFF Research Database (Denmark)

    Costa, M C; Helweg-Larsen, J; Lundgren, Bettina; Antunes, F; Matos, O

    2003-01-01

    The aim of this study was to evaluate the frequency of mutations of the P. jiroveci dihydropteroate synthase (DHPS) gene in an immunocompromised Portuguese population and to investigate the possible association between DHPS mutations and sulpha exposure. In the studied population, DHPS gene...... mutations were not significantly more frequent in patients exposed to sulpha drugs compared with patients not exposed (P=0.390). The results of this study suggest that DHPS gene mutations are frequent in the Portuguese immunocompromised population but do not seem associated with previous sulpha exposure...

  19. Transcriptional Modulation of Squalene Synthase Genes in Barley Treated with PGPR

    Directory of Open Access Journals (Sweden)

    Anam eYousaf

    2015-09-01

    Full Text Available Phytosterol contents and food quality of plant produce is directly associated with transcription of gene Squalene Synthase (SS. In current study, barley plants were treated with different rhizobacterial strains under semi controlled (27±3°C greenhouse conditions in order to modulate expression of SS gene. Plant samples were analysed through semi-quantitative PCR to evaluate effect of rhizobacterial application on transcriptional status of squalene synthase. Results revealed that among four SS genes (i.e. SSA, SS1, SS2 and SS3, the most expressive gene was SSA; while, SS2 was screened out as the second best induced gene due to Acetobacter aceti. The most efficient bacterial strain which recorded maximum gene expression was A. aceti AC8. Moreover, AC7 was reported as the least efficient bacterial species for inducing SS gene expression. AC8 enhanced the share of SSA and SS2 up to 43% and 31%, respectively. The study also described ribosomal sequence of the most efficient bacterial strain AC8, which was used to determine its phylogenetic relationships with other microbial strains. The study would be helpful to improve quality of plant produce by modulating transcription of SS genes.

  20. IDENTIFICATION AND CHARACTERIZATION OF THE SUCROSE SYNTHASE 2 GENE (Sus2 IN DURUM WHEAT

    Directory of Open Access Journals (Sweden)

    Mariateresa eVolpicella

    2016-03-01

    Full Text Available Sucrose transport is the central system for the allocation of carbon resources in vascular plants. Sucrose synthase, which reversibly catalyzes sucrose synthesis and cleavage, represents a key enzyme in the control of the flow of carbon into starch biosynthesis. In the present study the genomic identification and characterization of the Sus2-2A and Sus2-2B genes coding for sucrose synthase in durum wheat (cultivars Ciccio and Svevo is reported. The genes were analyzed for their expression in different tissues and at different seed maturation stages, in four tetraploid wheat genotypes (Svevo, Ciccio, Primadur and 5-BIL42. The activity of the encoded proteins was evaluated by specific activity assays on endosperm extracts and their structure established by modelling approaches. The combined results of SUS2 expression and activity levels were then considered in the light of their possible involvement in starch yield.

  1. Polymorphisms in nitric oxide synthase and endothelin genes among children with obstructive sleep apnea

    OpenAIRE

    Chatsuriyawong, Siriporn; Gozal, David; Kheirandish-Gozal, Leila; Bhattacharjee, Rakesh; Khalyfa, Ahamed A.; Wang, Yang; Sukhumsirichart, Wasana; Khalyfa, Abdelnaby

    2013-01-01

    Background Obstructive sleep apnea (OSA) is associated with adverse and interdependent cognitive and cardiovascular consequences. Increasing evidence suggests that nitric oxide synthase (NOS) and endothelin family (EDN) genes underlie mechanistic aspects of OSA-associated morbidities. We aimed to identify single nucleotide polymorphisms (SNPs) in the NOS family (3 isoforms), and EDN family (3 isoforms) to identify potential associations of these SNPs in children with OSA. Methods A pediatric ...

  2. Coexpression of glutamine synthetase and carbamoylphosphate synthase I genes in pancreatic hepatocytes of rat.

    OpenAIRE

    Yeldandi, A. V.; X. D. Tan; Dwivedi, R S; Subbarao, V; Smith, D. D.; Scarpelli, D. G.; Rao, M S; Reddy, J K

    1990-01-01

    In the mammalian liver the distribution of ammonia-detoxifying enzymes, glutamine synthetase (GS) and carbamoylphosphate synthase I (ammonia) (CPS-I), is mutually exclusive in that these enzymes are expressed in two distinct populations of hepatocytes that are zonally demarcated in the liver acinus. In the present study we examined the distribution of GS and CPS-I in pancreatic hepatocytes to ascertain if the expression of these two genes in these hepatocytes is also mutually exclusive. Multi...

  3. The Polyketide Synthase Gene pks4 of Trichoderma reesei Provides Pigmentation and Stress Resistance

    OpenAIRE

    Atanasova, Lea; Knox, Benjamin P.; Kubicek, Christian P.; Druzhinina, Irina S.; Baker, Scott E.

    2013-01-01

    Species of the fungal genus Trichoderma (Hypocreales, Ascomycota) are well-known for their production of various secondary metabolites. Nonribosomal peptides and polyketides represent a major portion of these products. In a recent phylogenomic investigation of Trichoderma polyketide synthase (PKS)-encoding genes, the pks4 from T. reesei was shown to be an orthologue of pigment-forming PKSs involved in synthesis of aurofusarin and bikaverin in Fusarium spp. In this study, we show that deletion...

  4. Diversifying Selection on Flavanone 3-Hydroxylase and Isoflavone Synthase Genes in Cultivated Soybean and Its Wild Progenitors

    OpenAIRE

    Hao Cheng; Jiao Wang; Shanshan Chu; Hong-Lang Yan; Deyue Yu

    2013-01-01

    Soybean isoflavone synthase (IFS) and flavanone 3-hydroxylase (F3H) are two key enzymes catalyzing the biosynthesis of isoflavonoids and flavonoids, both of which play diverse roles in stress responses. However, little is known about the evolutionary pattern of these genes in cultivated soybean and its wild progenitors. Herein, we investigated the nucleotide polymorphisms in Isoflavone synthase (IFS1, IFS2) and Flavanone 3-hydroxylase (F3H2) genes from 33 soybean accessions, including 17 cult...

  5. Hydroxymethylbilane synthase: Complete genomic sequence and amplifiable polymorphisms in the human gene

    Energy Technology Data Exchange (ETDEWEB)

    Yoo, Hanwook; Warner, C.A.; Chen, Chiahsiang; Desnick, R.J. (Mount Sinai School of Medicine, New York, NY (United States))

    1993-01-01

    Acute intermittent porphyria (AIP), an autosomal dominant inborn error of heme biosynthesis, results from the half-normal activity of the heme biosynthetic enzyme hydroxymethylbilane synthase (HMB-synthase). Heterozygous individuals are prone to life-threatening acute neurologic attacks, which are precipitated by certain drugs and other metabolic, hormonal, and nutritional factors. Since the biochemical diagnosis of heterozygous individuals has been problematic, recent efforts have focused on the identification of mutations and diagnostically useful restriction fragment length polymorphisms (RFLPS) in the HMB-synthase gene. To facilitate these endeavors, the human HMB-synthase gene, including 1.1 kb of the 5[prime] flanking region, was isolated and completely sequenced in both orientations. The 10,024-bp gene contained 15 exons ranging in size from 39 to 438 bp and 14 introns ranging from 87 to 2913 bp. All intron/exon boundaries conformed to the GT/AG consensus rule. There were six Alu repetitive elements, one of the J and five of the Sa subfamilies. Analysis of the 1. I -kb 5[prime]flanking region revealed putative regulatory elements for the housekeeping promoter including AP1, AP4, SP1, TRE, ENH, and CAC. This region contained 10 HpaII sites and had an overall GC content of 54%. Three new polymorphic sites were identified by the single-strand conformation polymorphism (SSCP) technique, a common BsmAI site in intron 3 (3581 A/G), a common HinfI RFLP in intron 10 (7064 C/A), and a rare MnlI site in intron 14 (7998G/A). The allele frequencies of five previously known and the new polymorphic sites in a normal Caucasian population indicated that the intron 1 and intron 3 RFLPs were in linkage disequilibrium; however, the Hint I site segregated independently. 54 refs., 6 figs., 3 tabs.

  6. Cloning and transformation analysis of isoflavone synthase gene into Minshan Trifolium pratense.

    Science.gov (United States)

    Hu, H H; Jing, C Q; Liu, R; Li, W D; Feng, H G

    2015-01-01

    The aim of this study was to clone the isoflavone synthase (IFS) gene and establish the recombinant Minshan Trifolium pratense. The IFS gene was cloned from the callus of Minshan T. pratense using reverse transcription-polymerase chain reaction. The plant expression vector pRI101-AN-IFS was constructed and introduced into Agrobacterium tumefaciens strain LBA4404, and then screened under cephalosporin. IFS expression was detected by reverse transcription-polymerase chain reaction. The IFS gene was cloned successfully. Sequence analysis indicated that IFS gene had high homology with similar genes from other plants. The IFS-overexpressing callus was obtained by introducing the LBA4404-harboring IFS-pRI101-AN-IFS vector into T. pratense calluses. PMID:26345862

  7. Artificial citrate operon confers mineral phosphate solubilization ability to diverse fluorescent pseudomonads.

    Science.gov (United States)

    Adhikary, Hemanta; Sanghavi, Paulomi B; Macwan, Silviya R; Archana, Gattupalli; Naresh Kumar, G

    2014-01-01

    Citric acid is a strong acid with good cation chelating ability and can be very efficient in solubilizing mineral phosphates. Only a few phosphate solubilizing bacteria and fungi are known to secrete citric acids. In this work, we incorporated artificial citrate operon containing NADH insensitive citrate synthase (gltA1) and citrate transporter (citC) genes into the genome of six-plant growth promoting P. fluorescens strains viz., PfO-1, Pf5, CHAO1, P109, ATCC13525 and Fp315 using MiniTn7 transposon gene delivery system. Comprehensive biochemical characterization of the genomic integrants and their comparison with plasmid transformants of the same operon in M9 minimal medium reveals the highest amount of ∼7.6±0.41 mM citric and 29.95±2.8 mM gluconic acid secretion along with ∼43.2±3.24 mM intracellular citrate without affecting the growth of these P. fluorescens strains. All genomic integrants showed enhanced citric and gluconic acid secretion on Tris-Cl rock phosphate (TRP) buffered medium, which was sufficient to release 200-1000 µM Pi in TRP medium. This study demonstrates that MPS ability could be achieved in natural fluorescent pseudomonads by incorporation of artificial citrate operon not only as plasmid but also by genomic integration. PMID:25259527

  8. Artificial citrate operon confers mineral phosphate solubilization ability to diverse fluorescent pseudomonads.

    Directory of Open Access Journals (Sweden)

    Hemanta Adhikary

    Full Text Available Citric acid is a strong acid with good cation chelating ability and can be very efficient in solubilizing mineral phosphates. Only a few phosphate solubilizing bacteria and fungi are known to secrete citric acids. In this work, we incorporated artificial citrate operon containing NADH insensitive citrate synthase (gltA1 and citrate transporter (citC genes into the genome of six-plant growth promoting P. fluorescens strains viz., PfO-1, Pf5, CHAO1, P109, ATCC13525 and Fp315 using MiniTn7 transposon gene delivery system. Comprehensive biochemical characterization of the genomic integrants and their comparison with plasmid transformants of the same operon in M9 minimal medium reveals the highest amount of ∼7.6±0.41 mM citric and 29.95±2.8 mM gluconic acid secretion along with ∼43.2±3.24 mM intracellular citrate without affecting the growth of these P. fluorescens strains. All genomic integrants showed enhanced citric and gluconic acid secretion on Tris-Cl rock phosphate (TRP buffered medium, which was sufficient to release 200-1000 µM Pi in TRP medium. This study demonstrates that MPS ability could be achieved in natural fluorescent pseudomonads by incorporation of artificial citrate operon not only as plasmid but also by genomic integration.

  9. Nitrate Protects Cucumber Plants Against Fusarium oxysporum by Regulating Citrate Exudation.

    Science.gov (United States)

    Wang, Min; Sun, Yuming; Gu, Zechen; Wang, Ruirui; Sun, Guomei; Zhu, Chen; Guo, Shiwei; Shen, Qirong

    2016-09-01

    Fusarium wilt causes severe yield losses in cash crops. Nitrogen plays a critical role in the management of plant disease; however, the regulating mechanism is poorly understood. Using biochemical, physiological, bioinformatic and transcriptome approaches, we analyzed how nitrogen forms regulate the interactions between cucumber plants and Fusarium oxysporum f. sp. cucumerinum (FOC). Nitrate significantly suppressed Fusarium wilt compared with ammonium in both pot and hydroponic experiments. Fewer FOC colonized the roots and stems under nitrate compared with ammonium supply. Cucumber grown with nitrate accumulated less fusaric acid (FA) after FOC infection and exhibited increased tolerance to chemical FA by decreasing FA absorption and transportation in shoots. A lower citrate concentration was observed in nitrate-grown cucumbers, which was associated with lower MATE (multidrug and toxin compound extrusion) family gene and citrate synthase (CS) gene expression, as well as lower CS activity. Citrate enhanced FOC spore germination and infection, and increased disease incidence and the FOC population in ammonium-treated plants. Our study provides evidence that nitrate protects cucumber plants against F. oxysporum by decreasing root citrate exudation and FOC infection. Citrate exudation is essential for regulating disease development of Fusarium wilt in cucumber plants. PMID:27481896

  10. Adaptive evolution of the chrysanthemyl diphosphate synthase gene involved in irregular monoterpene metabolism

    Directory of Open Access Journals (Sweden)

    Liu Ping-Li

    2012-11-01

    Full Text Available Abstract Background Chrysanthemyl diphosphate synthase (CDS is a key enzyme in biosynthetic pathways producing pyrethrins and irregular monoterpenes. These compounds are confined to plants of the tribe Anthemideae of the Asteraceae, and play an important role in defending the plants against herbivorous insects. It has been proposed that the CDS genes arose from duplication of the farnesyl diphosphate synthase (FDS gene and have different function from FDSs. However, the duplication time toward the origin of CDS and the evolutionary force behind the functional divergence of the CDS gene are still unknown. Results Two duplication events were detected in the evolutionary history of the FDS gene family in the Asteraceae, and the second duplication led to the origin of CDS. CDS occurred after the divergence of the tribe Mutisieae from other tribes of Asteraceae but before the birth of the Anthemideae tribe. After its origin, CDS accumulated four mutations in sites homologous to the substrate-binding and catalysis sites of FDS. Of these, two sites were involved in the binding of the nucleophilic substrate isopentenyl diphosphate in FDS. Maximum likelihood analyses showed that some sites in CDS were under positive selection and were scattered throughout primary sequences, whereas in the three-dimensional structure model they clustered in the large central cavity. Conclusion Positive selection associated with gene duplication played a major role in the evolution of CDS.

  11. Differential expression of biphenyl synthase gene family members in fire-blight-infected apple 'Holsteiner Cox'.

    Science.gov (United States)

    Chizzali, Cornelia; Gaid, Mariam M; Belkheir, Asma K; Hänsch, Robert; Richter, Klaus; Flachowsky, Henryk; Peil, Andreas; Hanke, Magda-Viola; Liu, Benye; Beerhues, Ludger

    2012-02-01

    Fire blight, caused by the bacterium Erwinia amylovora, is a devastating disease of apple (Malus × domestica). The phytoalexins of apple are biphenyls and dibenzofurans, whose carbon skeleton is formed by biphenyl synthase (BIS), a type III polyketide synthase. In the recently published genome sequence of apple 'Golden Delicious', nine BIS genes and four BIS gene fragments were detected. The nine genes fall into four subfamilies, referred to as MdBIS1 to MdBIS4. In a phylogenetic tree, the BIS amino acid sequences from apple and Sorbus aucuparia formed an individual cluster within the clade of the functionally diverse type III polyketide synthases. cDNAs encoding MdBIS1 to MdBIS4 were cloned from fire-blight-infected shoots of apple 'Holsteiner Cox,' heterologously expressed in Escherichia coli, and functionally analyzed. Benzoyl-coenzyme A and salicoyl-coenzyme A were the preferred starter substrates. In response to inoculation with E. amylovora, the BIS3 gene was expressed in stems of cv Holsteiner Cox, with highest transcript levels in the transition zone between necrotic and healthy tissues. The transition zone was the accumulation site of biphenyl and dibenzofuran phytoalexins. Leaves contained transcripts for BIS2 but failed to form immunodetectable amounts of BIS protein. In cell cultures of apple 'Cox Orange,' expression of the BIS1 to BIS3 genes was observed after the addition of an autoclaved E. amylovora suspension. Using immunofluorescence localization under a confocal laser-scanning microscope, the BIS3 protein in the transition zone of stems was detected in the parenchyma of the bark. Dot-shaped immunofluorescence was confined to the junctions between neighboring cortical parenchyma cells. PMID:22158676

  12. Automating gene library synthesis by structure-based combinatorial protein engineering: examples from plant sesquiterpene synthases.

    Science.gov (United States)

    Dokarry, Melissa; Laurendon, Caroline; O'Maille, Paul E

    2012-01-01

    Structure-based combinatorial protein engineering (SCOPE) is a homology-independent recombination method to create multiple crossover gene libraries by assembling defined combinations of structural elements ranging from single mutations to domains of protein structure. SCOPE was originally inspired by DNA shuffling, which mimics recombination during meiosis, where mutations from parental genes are "shuffled" to create novel combinations in the resulting progeny. DNA shuffling utilizes sequence identity between parental genes to mediate template-switching events (the annealing and extension of one parental gene fragment on another) in PCR reassembly reactions to generate crossovers and hence recombination between parental genes. In light of the conservation of protein structure and degeneracy of sequence, SCOPE was developed to enable the "shuffling" of distantly related genes with no requirement for sequence identity. The central principle involves the use of oligonucleotides to encode for crossover regions to choreograph template-switching events during PCR assembly of gene fragments to create chimeric genes. This approach was initially developed to create libraries of hybrid DNA polymerases from distantly related parents, and later developed to create a combinatorial mutant library of sesquiterpene synthases to explore the catalytic landscapes underlying the functional divergence of related enzymes. This chapter presents a simplified protocol of SCOPE that can be integrated with different mutagenesis techniques and is suitable for automation by liquid-handling robots. Two examples are presented to illustrate the application of SCOPE to create gene libraries using plant sesquiterpene synthases as the model system. In the first example, we outline how to create an active-site library as a series of complex mixtures of diverse mutants. In the second example, we outline how to create a focused library as an array of individual clones to distil minimal combinations of

  13. Promoter regulatory domain identification of cassava starch synthase IIb gene in transgenic tobacco.

    Science.gov (United States)

    Guan, Zhihui; Chen, Xin; Xie, Hairong; Wang, Wenquan

    2016-05-01

    Soluble starch synthase is a key enzyme in the starch biosynthesis pathway, and its enzyme activity significantly influences starch components in cassava storage root. However, studies on the regulation mechanism of soluble starch synthase gene are rare. In this study, we cloned the 5' flanking sequence of the MeSSIIb gene and predicted the distribution of cis-elements. The region from -453 to -1 was considered the primary core promoter by the quantitative detection of GUS activity in transgenic tobacco plants containing 5' truncated promoters fused with the GUS gene. Analysis results clarified that the region from -531 to -454 significantly repressed promoter activity. The region from -453 to -388 was a repressive domain of ethylene, and some unknown drought responsive cis-elements were located in the region from -387 to -1. These findings will provide useful information on the functional assay and transcriptional regulation mechanisms of the MeSSIIb gene. PMID:26919397

  14. Cloning and sequence analysis of putative type II fatty acid synthase genes from Arachis hypogaea L.

    Indian Academy of Sciences (India)

    Meng-Jun Li; Ai-Qin Li; Han Xia; Chuan-Zhi Zhao; Chang-Sheng Li; Shu-Bo Wan; Yu-Ping Bi; Xing-Jun Wang

    2009-06-01

    The cultivated peanut is a valuable source of dietary oil and ranks fifth among the world oil crops. Plant fatty acid biosynthesis is catalysed by type II fatty acid synthase (FAS) in plastids and mitochondria. By constructing a full-length cDNA library derived from immature peanut seeds and homology-based cloning, candidate genes of acyl carrier protein (ACP), malonyl-CoA:ACP transacylase, -ketoacyl-ACP synthase (I, II, III), -ketoacyl-ACP reductase, -hydroxyacyl-ACP dehydrase and enoyl-ACP reductase were isolated. Sequence alignments revealed that primary structures of type II FAS enzymes were highly conserved in higher plants and the catalytic residues were strictly conserved in Escherichia coli and higher plants. Homologue numbers of each type II FAS gene expressing in developing peanut seeds varied from 1 in KASII, KASIII and HD to 5 in ENR. The number of single-nucleotide polymorphisms (SNPs) was quite different in each gene. Peanut type II FAS genes were predicted to target plastids except ACP2 and ACP3. The results suggested that peanut may contain two type II FAS systems in plastids and mitochondria. The type II FAS enzymes in higher plants may have similar functions as those in E. coli.

  15. Diversity of benzyl- and alkylsuccinate synthase genes in hydrocarbon-impacted environments and enrichment cultures.

    Science.gov (United States)

    Callaghan, Amy V; Davidova, Irene A; Savage-Ashlock, Kristen; Parisi, Victoria A; Gieg, Lisa M; Suflita, Joseph M; Kukor, Jerome J; Wawrik, Boris

    2010-10-01

    Hydrocarbon-degrading microorganisms play an important role in the natural attenuation of spilled petroleum in a variety of anoxic environments. The role of benzylsuccinate synthase (BSS) in aromatic hydrocarbon degradation and its use as a biomarker for field investigations are well documented. The recent discovery of alkylsuccinate synthase (ASS) allows the opportunity to test whether its encoding gene, assA, can serve as a comparable biomarker of anaerobic alkane degradation. Degenerate assA- and bssA-targeted PCR primers were designed in order to survey the diversity of genes associated with aromatic and aliphatic hydrocarbon biodegradation in petroleum-impacted environments and enrichment cultures. DNA was extracted from an anaerobic alkane-degrading isolate (Desulfoglaeba alkenexedens ALDC), hydrocarbon-contaminated river and aquifer sediments, a paraffin-degrading enrichment, and a propane-utilizing mixed culture. Partial assA and bssA genes were PCR amplified, cloned, and sequenced, yielding several novel clades of assA genes. These data expand the range of alkane-degrading conditions for which relevant gene sequences are available and indicate that considerable diversity of assA genes can be found in hydrocarbon-impacted environments. The detection of genes associated with anaerobic alkane degradation in conjunction with the in situ detection of alkylsuccinate metabolites was also demonstrated. Comparable molecular signals of assA/bssA were not found when environmental metagenome databases of uncontaminated sites were searched. These data confirm that the assA gene is a useful biomarker for anaerobic alkane metabolism. PMID:20504044

  16. ATP synthase of yeast mitochondria. Isolation of subunit j and disruption of the ATP18 gene.

    Science.gov (United States)

    Arnold, I; Pfeiffer, K; Neupert, W; Stuart, R A; Schägger, H

    1999-01-01

    The subunit composition of the mitochondrial ATP synthase from Saccharomyces cerevisiae was analyzed using blue native gel electrophoresis and high resolution SDS-polyacrylamide gel electrophoresis. We report here the identification of a novel subunit of molecular mass of 6,687 Da, termed subunit j (Su j). An open reading frame of 127 base pairs (ATP18), which encodes for Su j, was identified on chromosome XIII. Su j does not display sequence similarity to ATP synthase subunits from other organisms. Data base searches, however, identified a potential homolog from Schizosaccharomyces pombe with 51% identity to Su j of S. cerevisiae. Su j, a small protein of 59 amino acid residues, has the characteristics of an integral inner membrane protein with a single transmembrane segment. Deletion of the ATP18 gene encoding Su j led to a strain (Deltasu j) completely deficient in oligomycin-sensitive ATPase activity and unable to grow on nonfermentable carbon sources. The presence of Su j is required for the stable expression of subunits 6 and f of the F0 membrane sector. In the absence of Su j, spontaneously arising rho- cells were observed that lacked also ubiquinol-cytochrome c reductase and cytochrome c oxidase activities. We conclude that Su j is a novel and essential subunit of yeast ATP synthase. PMID:9867807

  17. A transgenic wheat with a stilbene synthase gene resistant to powdery mildew obtained by biolistic method

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    Stilbene, a kind of phytoalexin, plays an important role in resistance to fungal and bacterial infection in plants. It strongly inhibits the growth of fungi and sprout of spore. Stilbene synthase gene (Vst1) obtained from grapevine has been transferred into common spring wheat Jinghong 5 by using the biolistic transformation method. Five transgenic plants (T0) were obtained from the bombarded 2014 immature embryos. One immune plantlet and 3 plantlets with mid-resistance to powdery mildew were identified from the transgenic plants of T3 generation which came from 2 T0 transgenic plants.

  18. Evaluating the Effect of Expressing a Peanut Resveratrol Synthase Gene in Rice

    OpenAIRE

    Zheng, Shigang; Zhao, Shanchang; Li, Zhen; Wang, Qingguo; Yao, Fangyin; Yang, Lianqun; Pan, Jiaowen; Liu, Wei

    2015-01-01

    Resveratrol (Res) is a type of natural plant stilbenes and phytoalexins that only exists in a few plant species. Studies have shown that the Res could be biosynthesized and accumulated within plants, once the complete metabolic pathway and related enzymes, such as the key enzyme resveratrol synthase (RS), existed. In this study, a RS gene named PNRS1 was cloned from the peanut, and the activity was confirmed in E. coli. Using transgenic approach, the PNRS1 transgenic rice was obtained. In T3 ...

  19. Isolation and Characterization of D-Myo-Inositol-3-Phosphate Synthase Gene Family Members in Soybean

    OpenAIRE

    Good, Laura Lee

    2001-01-01

    The objective of this research was to isolate genes encoding isoforms of the enzyme D-myo-inositol 3-phosphate synthase (MIPS, E.C. 5.5.1.4) from soybean and to characterize their expression, especially with respect to their involvement in phytic acid biosynthesis. A MIPS-homologous cDNA, designated GmMIPS1, was isolated via PCR using total RNA from developing seeds. Southern blot analysis and examination of MIPS-homologous soybean EST sequences suggested that GmMIPS1 is part of a multigene...

  20. Molecular cloning and seasonal expression of oyster glycogen phosphorylase and glycogen synthase genes

    OpenAIRE

    Bacca, Helene; Huvet, Arnaud; Fabioux, Caroline; Daniel, Jean-yves; Delaporte, Maryse; Pouvreau, Stephane; van Wormhoudt, A.; Moal, Jeanne

    2005-01-01

    To investigate the control at the mRNA level of glycogen metabolism in the cupped oyster Crassostrea gigas, we report in the present paper the cloning and characterization of glycogen phosphorylase and synthase cDNAs (Cg-GPH and Cg-GYS, respectively, transcripts of main enzymes for glycogen use and storage), and their first expression profiles depending on oyster tissues and seasons. A strong expression of both genes was observed in the labial palps and the gonad in accordance with specific c...

  1. An anther-specific chalcone synthase-like gene D5 related to rice pollen development

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    It was shown in a previous analysis that D5 gene from rice (Oryza sativa L.) was an anther-specific gene encoding a chalcone synthase-related protein. In this study, D5 gene was found specifically expressed in tapetum cells as well as in the peripheral cells of the vascular bundle of rice anthers by RNA in situ hybridization. In order to study its function, D5 was transformed into rice in both sense and antisense directions driven by a rice Actin 1 promoter. It has been observed that the pollen grains from the antisense D5 transgenic rice plants are abnormal, indicating that D5 plays a critical role in rice pollen development.

  2. Cloning,Characterization,and Gene Annotation of Cellulose Synthase Genes from Arabidopsis thaliana

    Institute of Scientific and Technical Information of China (English)

    BALASUBRAMANI G; AMUDHA J; KATEGERI I S; KHADI B M

    2008-01-01

    @@ The mechanistic basis of cellulose biosynthesis in plants has gained ground during last decade or so.The isolation of plant eDNA clones encoding cotton homologs of the bacterial cellulose synthase catalytic subunit was a significant achievement,which promises the elucidation of cellulose biosynthesis.

  3. CcpA-independent regulation of expression of the Mg2+-citrate transporter gene citM by arginine metabolism in Bacillus subtilis

    NARCIS (Netherlands)

    Warner, JB; Magni, C; Lolkema, JS; Warner, Jessica B.

    2003-01-01

    Transcriptional regulation of the Mg2+ -citrate transporter, CitM, the main citrate uptake system of Bacillus subtilis, was studied during growth in rich medium. Citrate in the growth medium was required for induction under all growth conditions. In Luria-Bertani medium containing citrate, citM expr

  4. Gene structure, phylogeny and expression profile of the sucrose synthase gene family in cacao (Theobroma cacao L.).

    Science.gov (United States)

    Li, Fupeng; Hao, Chaoyun; Yan, Lin; Wu, Baoduo; Qin, Xiaowei; Lai, Jianxiong; Song, Yinghui

    2015-09-01

    In higher plants, sucrose synthase (Sus, EC 2.4.1.13) is widely considered as a key enzyme involved in sucrose metabolism. Although, several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, to date detailed information about the Sus genes is lacking for cacao. This study reports the identification of six novel Sus genes from economically important cacao tree. Analyses of the gene structure and phylogeny of the Sus genes demonstrated evolutionary conservation in the Sus family across cacao and other plant species. The expression of cacao Sus genes was investigated via real-time PCR in various tissues, different developmental phases of leaf, flower bud and pod. The Sus genes exhibited distinct but partially redundant expression profiles in cacao, with TcSus1, TcSus5 and TcSus6, being the predominant genes in the bark with phloem, TcSus2 predominantly expressing in the seed during the stereotype stage. TcSus3 and TcSus4 were significantly detected more in the pod husk and seed coat along the pod development, and showed development dependent expression profiles in the cacao pod. These results provide new insights into the evolution, and basic information that will assist in elucidating the functions of cacao Sus gene family. PMID:26440085

  5. Gene structure, phylogeny and expression profile of the sucrose synthase gene family in cacao (Theobroma cacao L.)

    Indian Academy of Sciences (India)

    Fupeng Li; Chaoyun Hao; Lin Yan; Baoduo Wu; Xiaowei Qin; Jianxiong Lai; Yinghui Song

    2015-09-01

    In higher plants, sucrose synthase (Sus, EC 2.4.1.13) is widely considered as a key enzyme involved in sucrose metabolism. Although, several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, to date detailed information about the Sus genes is lacking for cacao. This study reports the identification of six novel Sus genes from economically important cacao tree. Analyses of the gene structure and phylogeny of the Sus genes demonstrated evolutionary conservation in the Sus family across cacao and other plant species. The expression of cacao Sus genes was investigated via real-time PCR in various tissues, different developmental phases of leaf, flower bud and pod. The Sus genes exhibited distinct but partially redundant expression profiles in cacao, with TcSus1, TcSus5 and TcSus6, being the predominant genes in the bark with phloem, TcSus2 predominantly expressing in the seed during the stereotype stage. TcSus3 and TcSus4 were significantly detected more in the pod husk and seed coat along the pod development, and showed development dependent expression profiles in the cacao pod. These results provide new insights into the evolution, and basic information that will assist in elucidating the functions of cacao Sus gene family.

  6. The gene controlling marijuana psychoactivity: molecular cloning and heterologous expression of Delta1-tetrahydrocannabinolic acid synthase from Cannabis sativa L.

    Science.gov (United States)

    Sirikantaramas, Supaart; Morimoto, Satoshi; Shoyama, Yoshinari; Ishikawa, Yu; Wada, Yoshiko; Shoyama, Yukihiro; Taura, Futoshi

    2004-09-17

    Delta(1)-tetrahydrocannabinolic acid (THCA) synthase is the enzyme that catalyzes oxidative cyclization of cannabigerolic acid into THCA, the precursor of Delta(1)-tetrahydrocannabinol. We cloned a novel cDNA (GenBank trade mark accession number AB057805) encoding THCA synthase by reverse transcription and polymerase chain reactions from rapidly expanding leaves of Cannabis sativa. This gene consists of a 1635-nucleotide open reading frame, encoding a 545-amino acid polypeptide of which the first 28 amino acid residues constitute the signal peptide. The predicted molecular weight of the 517-amino acid mature polypeptide is 58,597 Da. Interestingly, the deduced amino acid sequence exhibited high homology to berberine bridge enzyme from Eschscholtzia californica, which is involved in alkaloid biosynthesis. The liquid culture of transgenic tobacco hairy roots harboring the cDNA produced THCA upon feeding of cannabigerolic acid, demonstrating unequivocally that this gene encodes an active THCA synthase. Overexpression of the recombinant THCA synthase was achieved using a baculovirus-insect expression system. The purified recombinant enzyme contained covalently attached FAD cofactor at a molar ratio of FAD to protein of 1:1. The mutant enzyme constructed by changing His-114 of the wild-type enzyme to Ala-114 exhibited neither absorption characteristics of flavoproteins nor THCA synthase activity. Thus, we concluded that the FAD binding residue is His-114 and that the THCA synthase reaction is FAD-dependent. This is the first report on molecular characterization of an enzyme specific to cannabinoid biosynthesis. PMID:15190053

  7. Endothelial nitric oxide synthase gene polymorphisms (G894T in diabetes mellitus in Egypt

    Directory of Open Access Journals (Sweden)

    El-baz1 ; Farouk2; Tag Eldin2; Ezat2

    2010-06-01

    Full Text Available Objective: Diabetic nephropathy (DN is one of the major microvascular complications of diabetes. Genetic predisposition has been implicated in DN. The eNOS protein synthesizes nitric oxide constitutively via a reaction including the conversion of L-arginine to L-citrulline, which involves the transfer of five electrons provided by nicotinamide adenine dinucleotide phosphate The aim of this study is to evaluate the association of G894T polymorphisms of endothelial nitric oxide synthase(eNOS gene with the development of diabetic nephropathy (DN among Egyptian patients with type 1,2 diabetes mellitus in Egypt. Methods: Study subjects comprised 86 patients of type 2 diabetes with nephropathy,23 patients of type 1 diabetes with nephropathy and 46 patients of type 2 diabetes without nephropathy. G894T genotypes was determined by SSP- PCR analysis. Results: Mutant T allele, GT and TT genotypes of G894TSNP had no significant frequencies in type 1,2 diabetic patients with nephropathy compared to those without nephropathy.. Conclusion: These findings indicate that G894T polymorphism of eNOS gene may be not considered as genetic risk factors for DN among Egyptian type1, 2 diabetic patients. Abbreviations: T2DM: type 2 diabetes mellitus ­ DN: diabetic nephropathy eNOS : Endothelial nitric oxide synthase:­ SNP: single nucleotide polymorphism- SSP-PCR: sequence specific primer- polymerase chain reaction

  8. A New Farnesyl Diphosphate Synthase Gene from Taxus media Rehder: Cloning, Characterization and Functional Complementation

    Institute of Scientific and Technical Information of China (English)

    Zhi-Hua Liao; Min Chen; Yi-Fu Gong; Zhu-Gang Li; Kai-Jing Zuo; Peng Wang; Feng Tan; Xiao-Fen Sun; Ke-Xuan Tang

    2006-01-01

    Farnesyl diphosphate synthase (FPS; EC 2.5.1.10) catalyzes the production of 15-carbon farnesyl diphosphate which is a branch-point intermediate for many terpenoids. This reaction is considered to be a ratelimiting step in terpenoid biosynthesis. Here we report for the first time the cloning of a new full-length cDNA encoding farnesyl diphosphate synthase from a gymnosperm plant species, Taxus media Rehder,designated as TmFPS1. The full-length cDNA of TmFPS1 (GenBank accession number: AY461811) was 1 464bp with a 1 056-bp open reading frame encoding a 351-amino acid polypeptide with a calculated molecular weight of 40.3 kDa and a theoretical pl of 5.07. Bioinformatic analysis revealed that TmFPS1 contained all five conserved domains of prenyltransferases, and showed homology to other FPSs of plant origin. Phylogenetic analysis showed that farnesyl diphosphate synthases can be divided into two groups: one of prokaryotic origin and the other of eukaryotic origin. TmFPS1 was grouped with FPSs of plant origin. Homologybased structural modeling showed that TmFPS1 had the typical spatial structure of FPS, whose most prominent structural feature is the arrangement of 13 core helices around a large central cavity in which the catalytic reaction takes place. Our bioinformatic analysis strongly suggests that TmFPS1 is a functional gene. Southern blot analysis revealed that TmFPS1 belongs to a small FPS gene family in T. media. Northern blot analysis indicated that TmFPS1 is expressed in all tested tissues, including the needles, stems and roots of T. media. Subsequently, functional complementation with TmFPS1 in a FPS-deficient mutant yeast demonstrated that TmFPS1 did encode farnesyl diphosphate synthase, which rescued the yeast mutant.This study will be helpful in future investigations aiming at understanding the detailed role of FPS in terpenoid biosynthesis flux control at the molecular genetic level.

  9. Lanosterol Synthase Gene Polymorphisms and Changes in Endogenous Ouabain in the Response to Low Sodium Intake.

    Science.gov (United States)

    Lanzani, Chiara; Gatti, Guido; Citterio, Lorena; Messaggio, Elisabetta; Delli Carpini, Simona; Simonini, Marco; Casamassima, Nunzia; Zagato, Laura; Brioni, Elena; Hamlyn, John M; Manunta, Paolo

    2016-02-01

    Circulating levels of endogenous ouabain (EO), a vasopressor hormone of adrenocortical origin, are increased by sodium depletion. Furthermore, lanosterol synthase, an enzyme involved in cholesterol biosynthesis, has a missense polymorphism (rs2254524 V642L) that affects EO biosynthesis in adrenocortical cells. Here, we investigated the hypothesis that lanosterol synthase rs2254524 alleles in vivo impact the blood pressure (BP) and EO responses evoked by a low dietary Na intake (mEq/d, 2 weeks) among patients with mild essential hypertension. During the low salt diet, the declines in both systolic BP (SBP: -8.7±1.7 versus -3.0±1.5; P=0.013) and diastolic BP (DBP: -5.1±0.98 versus -1.4±0.94 mm Hg; PmEq/mm Hg/24 h; P=0.028). In addition, BP rose in ≈25% of the patients in response to the low salt diet and this was associated with increased circulating EO. Lanosterol synthase gene polymorphisms influence both the salt sensitivity of BP and changes in circulating EO in response to a low salt diet. The response of BP and EO to the low salt diet is markedly heterogeneous. Approximately 25% of patients experienced adverse effects, that is, increased BP and EO when salt intake was reduced and may be at increased long-term risk. The augmented response of EO to the low salt diet further supports the view that adrenocortical function is abnormal in some essential hypertensives. PMID:26667413

  10. Associations between nitric oxide synthase genes and exhaled NO-related phenotypes according to asthma status.

    Directory of Open Access Journals (Sweden)

    Emmanuelle Bouzigon

    Full Text Available BACKGROUND: The nitric oxide (NO pathway is involved in asthma, and eosinophils participate in the regulation of the NO pool in pulmonary tissues. We investigated associations between single nucleotide polymorphisms (SNPs of NO synthase genes (NOS and biological NO-related phenotypes measured in two compartments (exhaled breath condensate and plasma and blood eosinophil counts. METHODOLOGY: SNPs (N = 121 belonging to NOS1, NOS2 and NOS3 genes were genotyped in 1277 adults from the French Epidemiological study on the Genetics and Environment of Asthma (EGEA. Association analyses were conducted on four quantitative phenotypes: the exhaled fraction of NO (Fe(NO, plasma and exhaled breath condensate (EBC nitrite-nitrate levels (NO2-NO3 and blood eosinophils in asthmatics and non-asthmatics separately. Genetic heterogeneity of these phenotypes between asthmatics and non-asthmatics was also investigated. PRINCIPAL FINDINGS: In non-asthmatics, after correction for multiple comparisons, we found significant associations of Fe(NO levels with three SNPs in NOS3 and NOS2 (P ≤ 0.002, and of EBC NO2-NO3 level with NOS2 (P = 0.002. In asthmatics, a single significant association was detected between Fe(NO levels and one SNP in NOS3 (P = 0.004. Moreover, there was significant heterogeneity of NOS3 SNP effect on Fe(NO between asthmatics and non-asthmatics (P = 0.0002 to 0.005. No significant association was found between any SNP and NO2-NO3 plasma levels or blood eosinophil counts. CONCLUSIONS: Variants in NO synthase genes influence Fe(NO and EBC NO2-NO3 levels in adults. These genetic determinants differ according to asthma status. Significant associations were only detected for exhaled phenotypes, highlighting the critical relevance to have access to specific phenotypes measured in relevant biological fluid.

  11. Evaluating the Effect of Expressing a Peanut Resveratrol Synthase Gene in Rice

    Science.gov (United States)

    Li, Zhen; Wang, Qingguo; Yao, Fangyin; Yang, Lianqun; Pan, Jiaowen; Liu, Wei

    2015-01-01

    Resveratrol (Res) is a type of natural plant stilbenes and phytoalexins that only exists in a few plant species. Studies have shown that the Res could be biosynthesized and accumulated within plants, once the complete metabolic pathway and related enzymes, such as the key enzyme resveratrol synthase (RS), existed. In this study, a RS gene named PNRS1 was cloned from the peanut, and the activity was confirmed in E. coli. Using transgenic approach, the PNRS1 transgenic rice was obtained. In T3 generation, the Res production and accumulation were further detected by HPLC. Our data revealed that compared to the wild type rice which trans-resveratrol was undetectable, in transgenic rice, the trans-resveratrol could be synthesized and achieved up to 0.697 μg/g FW in seedlings and 3.053 μg/g DW in seeds. Furthermore, the concentration of trans-resveratrol in transgenic rice seedlings could be induced up to eight or four-fold higher by ultraviolet (UV-C) or dark, respectively. Simultaneously, the endogenous increased of Res also showed the advantages in protecting the host plant from UV-C caused damage or dark-induced senescence. Our data indicated that Res was involved in host-defense responses against environmental stresses in transgenic rice. Here the results describes the processes of a peanut resveratrol synthase gene transformed into rice, and the detection of trans-resveratrol in transgenic rice, and the role of trans-resveratrol as a phytoalexin in transgenic rice when treated by UV-C and dark. These findings present new outcomes of transgenic approaches for functional genes and their corresponding physiological functions, and shed some light on broadening available resources of Res, nutritional improvement of crops, and new variety cultivation by genetic engineering. PMID:26302213

  12. Evaluating the Effect of Expressing a Peanut Resveratrol Synthase Gene in Rice.

    Directory of Open Access Journals (Sweden)

    Shigang Zheng

    Full Text Available Resveratrol (Res is a type of natural plant stilbenes and phytoalexins that only exists in a few plant species. Studies have shown that the Res could be biosynthesized and accumulated within plants, once the complete metabolic pathway and related enzymes, such as the key enzyme resveratrol synthase (RS, existed. In this study, a RS gene named PNRS1 was cloned from the peanut, and the activity was confirmed in E. coli. Using transgenic approach, the PNRS1 transgenic rice was obtained. In T3 generation, the Res production and accumulation were further detected by HPLC. Our data revealed that compared to the wild type rice which trans-resveratrol was undetectable, in transgenic rice, the trans-resveratrol could be synthesized and achieved up to 0.697 μg/g FW in seedlings and 3.053 μg/g DW in seeds. Furthermore, the concentration of trans-resveratrol in transgenic rice seedlings could be induced up to eight or four-fold higher by ultraviolet (UV-C or dark, respectively. Simultaneously, the endogenous increased of Res also showed the advantages in protecting the host plant from UV-C caused damage or dark-induced senescence. Our data indicated that Res was involved in host-defense responses against environmental stresses in transgenic rice. Here the results describes the processes of a peanut resveratrol synthase gene transformed into rice, and the detection of trans-resveratrol in transgenic rice, and the role of trans-resveratrol as a phytoalexin in transgenic rice when treated by UV-C and dark. These findings present new outcomes of transgenic approaches for functional genes and their corresponding physiological functions, and shed some light on broadening available resources of Res, nutritional improvement of crops, and new variety cultivation by genetic engineering.

  13. Cloning and Expression of the PHA Synthase Gene From a Locally Isolated Chromobacterium sp. USM2

    Directory of Open Access Journals (Sweden)

    Bhubalan, K.

    2010-01-01

    Full Text Available Chromobacterium sp. USM2, a locally isolated bacterium was found to synthesize poly(3-hydroxybutyrate-co-3-hydroxyvalerate, P(3HB-co-3HV copolymer with high 3HV monomer composition. The PHA synthase gene was cloned and expressed in Cupriavidus necator PHB¯4 to investigate the possibilities of incorporating other monomer. The recombinant successfully incorporated 3-hydroxyhexanoate (3HHx monomer when fed with crude palm kernel oil (CPKO as the sole carbon source. Approximately 63 ± 2 wt% of P(3HB-co-3HHx copolymer with 4 mol% of 3HHx was synthesized from 5 g/L of oil after 48 h of cultivation. In addition, P(3HB-co-3HV-co-3HHx terpolymer with 9 mol% 3HV and 4 mol% 3HHx could be synthesized with a mixture of CPKO and sodium valerate. The presence of 3HV and 3HHx monomers in the copolymer and terpolymer was further confirmed with +H-NMR analysis. This locally isolated PHA synthase has demonstrated its ability to synthesize P(3HB-co-3HHx copolymer from a readily available and renewable carbon source; CPKO, without the addition of 3HHx precursors.

  14. Amplification and diversity analysis of keto synthase domains of putative polyketide synthase genes in Aspergillus ochraceus and Aspergillus carbonarius producers of ochratoxin A

    International Nuclear Information System (INIS)

    The diversity of polyketide synthase (PKS) genes in Aspergillus ochraceus NRRL 3174 and Aspergil- lus carbonarius 2Mu134 has been investigated using different primer pairs previously developed for the ketosynthase (KS) domain of fungal PKSs. Nine different KS domain sequences in A. ochraceus NRRL 3174 as well as five different KS domain sequences in A. carbonarius 2Mu134 have been identified. The identified KS fragments were distributed in five different clusters on the phylogenetic tree, indicating that they most probably represent PKSs responsible for different functions. (author)

  15. Citrus PH5-like H+-ATPase genes: identification and transcript analysis to investigate their possible relationship with citrate accumulation in fruits

    Directory of Open Access Journals (Sweden)

    Cai-Yun eShi

    2015-03-01

    Full Text Available PH5 is a petunia gene that encodes a plasma membrane H+-ATPase and determines the vacuolar pH. The citrate content of fruit cell vacuoles influences citrus organoleptic qualities. Although citrus could have PH5-like homologs that are involved in citrate accumulation, the details are still unknown. In this study, extensive data-mining with the PH5 sequence and PCR amplification confirmed that there are at least eight PH5-like genes (CsPH1-8 in the citrus genome. CsPHs have a molecular mass of approximately 100 kDa, and they have high similarity to PhPH5, AtAHA10 or AtAHA2 (from 64.6% to 80.9%. They contain 13-21 exons and 12-20 introns and were evenly distributed into four subgroups of the P3A-subfamily (CsPH1, CsPH2, and CsPH3 in Group I, CsPH4 and CsPH5 in Group II, CsPH6 in Group IV, and CsPH7 and CsPH8 in Group III together with PhPH5. A transcript analysis showed that CsPH1, 3, and 4 were predominantly expressed in mature leaves, whereas CsPH2 and 7 were predominantly expressed in roots, CsPH5 and 6 were predominantly expressed in flowers, and CsPH8 was predominantly expressed in fruit juice sacs. Moreover, the CsPH transcript profiles differed between orange and pummelo, as well as between high-acid and low-acid cultivars. The low-acid orange ‘Honganliu’ exhibits low transcript levels of CsPH3, CsPH4, CsPH5, and CsPH8, whereas the acid-free pummelo has only a low transcript level of CsPH8. In addition, ABA injection increased the citrate content significantly, which was accompanied by the obvious induction of CsPH2, 6, 7, and 8 transcript levels. Taken together, we suggest that CsPH8 seems likely to regulate citrate accumulation in the citrus fruit vacuole.

  16. Chalcone synthase genes from milk thistle (Silybum marianum): isolation and expression analysis.

    Science.gov (United States)

    Sanjari, Sepideh; Shobbar, Zahra Sadat; Ebrahimi, Mohsen; Hasanloo, Tahereh; Sadat-Noori, Seyed-Ahmad; Tirnaz, Soodeh

    2015-12-01

    Silymarin is a flavonoid compound derived from milk thistle (Silybum marianum) seeds which has several pharmacological applications. Chalcone synthase (CHS) is a key enzyme in the biosynthesis of flavonoids; thereby, the identification of CHS encoding genes in milk thistle plant can be of great importance. In the current research, fragments of CHS genes were amplified using degenerate primers based on the conserved parts of Asteraceae CHS genes, and then cloned and sequenced. Analysis of the resultant nucleotide and deduced amino acid sequences led to the identification of two different members of CHS gene family,SmCHS1 and SmCHS2. Third member, full-length cDNA (SmCHS3) was isolated by rapid amplification of cDNA ends (RACE), whose open reading frame contained 1239 bp including exon 1 (190 bp) and exon 2 (1049 bp), encoding 63 and 349 amino acids, respectively. In silico analysis of SmCHS3 sequence contains all the conserved CHS sites and shares high homology with CHS proteins from other plants.Real-time PCR analysis indicated that SmCHS1 and SmCHS3 had the highest transcript level in petals in the early flowering stage and in the stem of five upper leaves, followed by five upper leaves in the mid-flowering stage which are most probably involved in anthocyanin and silymarin biosynthesis. PMID:26690515

  17. Chalcone synthase genes from milk thistle (Silybum marianum): isolation and expression analysis

    Indian Academy of Sciences (India)

    Sepideh Sanjari; Zahra Sadat Shobbar; Mohsen Ebrahimi; Tahereh Hasanloo; Seyed-Ahmad Sadat-Noor; Soodeh Tirnaz

    2015-12-01

    Silymarin is a flavonoid compound derived from milk thistle (Silybum marianum) seeds which has several pharmacological applications. Chalcone synthase (CHS) is a key enzyme in the biosynthesis of flavonoids; thereby, the identification of encoding genes in milk thistle plant can be of great importance. In the current research, fragments of genes were amplified using degenerate primers based on the conserved parts of Asteraceae genes, and then cloned and sequenced. Analysis of the resultant nucleotide and deduced amino acid sequences led to the identification of two different members of gene family, 1 and 2. Third member, full-length cDNA (3) was isolated by rapid amplification of cDNA ends (RACE), whose open reading frame contained 1239 bp including exon 1 (190 bp) and exon 2 (1049 bp), encoding 63 and 349 amino acids, respectively. In silico analysis of SmCHS3 sequence contains all the conserved CHS sites and shares high homology with CHS proteins from other plants. Real-time PCR analysis indicated that 1 and 3 had the highest transcript level in petals in the early flowering stage and in the stem of five upper leaves, followed by five upper leaves in the mid-flowering stage which are most probably involved in anthocyanin and silymarin biosynthesis.

  18. Molecular cloning and expression of a novel trehalose synthase gene from Enterobacter hormaechei

    Directory of Open Access Journals (Sweden)

    Yue Ming

    2009-06-01

    Full Text Available Abstract Background Trehalose synthase (TreS which converts maltose to trehalose is considered to be a potential biocatalyst for trehalose production. This enzymatic process has the advantage of simple reaction and employs an inexpensive substrate. Therefore, new TreS producing bacteria with suitable enzyme properties are expected to be isolated from extreme environment. Results Six TreS producing strains were isolated from a specimen obtained from soil of the Tibetan Plateau using degenerate PCR. A novel treS gene from Enterobacter hormaechei was amplified using thermal asymmetric interlaced PCR. The gene contained a 1626 bp open reading frame encoding 541 amino acids. The gene was expressed in Escherichia coli, and the recombinant TreS was purified and characterized. The purified TreS had a molecular mass of 65 kDa and an activity of 18.5 U/mg. The optimum temperature and pH for the converting reaction were 37°C and 6, respectively. Hg2+, Zn2+, Cu2+and SDS inhibited the enzyme activity at different levels whereas Mn2+ showed an enhancing effect by 10%. Conclusion In this study, several TreS producing strains were screened from a source of soil bacteria. The characterization of the recombinant TreS of Enterobacter hormaechei suggested its potential application. Consequently, a strategy for isolation of TreS producing strains and cloning of novel treS genes from natural sources was demonstrated.

  19. Molecular cloning and expression profiling of a chalcone synthase gene from Lamiophlomis rotata

    Indian Academy of Sciences (India)

    Qiao Feng; Geng Gui-Gong; Zeng Yang; Xie Hui-Chun; Jin Lan; Shang Jun; Chen Zhi

    2015-06-01

    Lamiophlomis rotata is a renowned Chinese medicinal plant. Chalcone synthase (CHS) is important in flavonoid and isoflavonoid biosynthesis, catalysing the formation of naringenin chalcone in plants. A full-length cDNA encoding the CHS gene was cloned from L. rotata based on the highly conserved CHS gene sequences of Labiatae plants. A blast search showed its homology (named LrCHS) with other CHS genes of Labiate plants. The full-length genomic DNA of LrCHS was 2026 bp with one intron of 651 bp, two exons of 178 bp and 998 bp, flanked by a 73 bp $5'$-UTR and a 126 bp $3'$-UTR. The cDNA sequence of the LrCHS gene had an 1176 bp open reading frame encoding a 391 amino acid protein of 42,798 Da. The CHS protein predicted from L. rotata showed 79–86% identity with CHS of other plant species. We conducted a phylogenetic analysis of nine families containing 48 plants and L. rotata based on the full amino acid sequences of CHS proteins. Consequently, LrCHS was located in the Labiatae branch. Additionally, we examined LrCHS gene expression patterns in different tissues by quantitative real-time PCR with specific primers. The expression analysis showed preferential expression of LrCHS in flowers and leaves during the flowering stage. Total flavonoid content and CHS gene expression exhibited similar patterns during L. rotata organ development. In agreement with its function as an elicitor-responsive gene, LrCHS expression was coordinated by methyl jasmonate and UV light, and induced between 6 and 18 h. These results provide a molecular basis for additional functional studies of LrCHS in L. rotata.

  20. Phylogenetic diversification of glycogen synthase kinase 3/SHAGGY-like kinase genes in plants

    Directory of Open Access Journals (Sweden)

    Soltis Pamela S

    2006-02-01

    Full Text Available Abstract Background The glycogen synthase kinase 3 (GSK3/SHAGGY-like kinases (GSKs are non-receptor serine/threonine protein kinases that are involved in a variety of biological processes. In contrast to the two members of the GSK3 family in mammals, plants appear to have a much larger set of divergent GSK genes. Plant GSKs are encoded by a multigene family; analysis of the Arabidopsis genome revealed the existence of 10 GSK genes that fall into four major groups. Here we characterized the structure of Arabidopsis and rice GSK genes and conducted the first broad phylogenetic analysis of the plant GSK gene family, covering a taxonomically diverse array of algal and land plant sequences. Results We found that the structure of GSK genes is generally conserved in Arabidopsis and rice, although we documented examples of exon expansion and intron loss. Our phylogenetic analyses of 139 sequences revealed four major clades of GSK genes that correspond to the four subgroups initially recognized in Arabidopsis. ESTs from basal angiosperms were represented in all four major clades; GSK homologs from the basal angiosperm Persea americana (avocado appeared in all four clades. Gymnosperm sequences occurred in clades I, III, and IV, and a sequence of the red alga Porphyra was sister to all green plant sequences. Conclusion Our results indicate that (1 the plant-specific GSK gene lineage was established early in the history of green plants, (2 plant GSKs began to diversify prior to the origin of extant seed plants, (3 three of the four major clades of GSKs present in Arabidopsis and rice were established early in the evolutionary history of extant seed plants, and (4 diversification into four major clades (as initially reported in Arabidopsis occurred either just prior to the origin of the angiosperms or very early in angiosperm history.

  1. Mutational Analysis of Pneumocystis jirovecii Dihydropteroate Synthase and Dihydrofolate Reductase Genes in HIV-Infected Patients in China

    OpenAIRE

    Deng, Xilong; Zhuo, Li; Lan, Yun; Dai, Zhaoxia; Chen, Wan-shan; Cai, Weiping; Kovacs, Joseph A.; Ma, Liang; Tang, Xiaoping

    2014-01-01

    We investigated Pneumocystis jirovecii dihydropteroate synthase (DHPS) and dihydrofolate reductase (DHFR) genes for mutations in 25 Chinese HIV-infected patients with P. jirovecii pneumonia. We identified DHPS mutations in 3 (12%) patients and DHFR mutations in 1 (4%) patient. The prevalence of DHPS and DHFR mutations in China remains low, as it does in other developing countries.

  2. Effect of estrogen on gene expression of fatty acid synthase in periosteum

    Institute of Scientific and Technical Information of China (English)

    ZHENG Rui-min; LIN Shou-qing; LIU Yong; HUANG Man-ting; GONG Wei-yan; WU Zhi-hong

    2009-01-01

    Background Estrogen deficiency contributes to postmenopausal osteoporosis.Periosteum might be a potential target of estrogen,but the underlying mechanism at gene level is far from being elucidated.The objective of this study was to investigate the correlation between estrogen and fatty acid synthase(FAS)expression in periosteum.Methods Human periosteum cells were cultured in vitro.Expressed genes in the substrated cDNA library were verified using semi-quantitative PCR and real-time PCR.The expression of FAS in periosteum of ovarectomized(OVX)SD rats was investigated.Results FAS gene was most significantly expressed in the subtracted cDNA library of periosteal cells screened by semi-quantitative PCR.Low FAS expression was verified by real-time PCR in the estrogen exposed human periosteum rather than in the control.The estradiol levels were(20.81±12.62)pg/ml,(19.64±4.35)pg/ml and(13.47+1.84)pg/ml in the sham group,the control,and the OVX group,respectively.The estradiol levels in the OVX group was significantly lower(P=0.0386).The FAS gene expression in periosteum in the OVX group,sham group,and control group was 3.09±1.97,1.33±0.47 and 1.51±1.32,respectively.The gene expression in the OVX group was significantly higher (P=0.0372).Conclusion Estrogen modulates FAS gene expression in in vitro human perisoteum as well as in in vivo rat periosteum.

  3. Expression of an (E)-β-farnesene synthase gene from Asian peppermint in tobacco affected aphid infestation

    OpenAIRE

    Xiudao Yu; Yongjun Zhang; Youzhi Ma; Zhaoshi Xu; Genping Wang; Lanqin Xia

    2013-01-01

    Aphids are major agricultural pests that cause significant yield losses in crop plants each year. (E)-β-farnesene (EβF) is the main or only component of an alarm pheromone involved in chemical communication within aphid species and particularly in the avoidance of predation. EβF also occurs in the essential oil of some plant species, and is catalyzed by EβF synthase. By using oligonucleotide primers designed from the known sequence of an EβF synthase gene from black peppermint (Mentha × piper...

  4. Cloning and Characterization of Farnesyl Diphosphate Synthase Gene Involved in Triterpenoids Biosynthesis from Poria cocos

    Directory of Open Access Journals (Sweden)

    Jianrong Wang

    2014-12-01

    Full Text Available Poria cocos (P. cocos has long been used as traditional Chinese medicine and triterpenoids are the most important pharmacologically active constituents of this fungus. Farnesyl pyrophosphate synthase (FPS is a key enzyme of triterpenoids biosynthesis. The gene encoding FPS was cloned from P. cocos by degenerate PCR, inverse PCR and cassette PCR. The open reading frame of the gene is 1086 bp in length, corresponding to a predicted polypeptide of 361 amino acid residues with a molecular weight of 41.2 kDa. Comparison of the P. cocos FPS deduced amino acid sequence with other species showed the highest identity with Ganoderma lucidum (74%. The predicted P. cocos FPS shares at least four conserved regions involved in the enzymatic activity with the FPSs of varied species. The recombinant protein was expressed in Pichia pastoris and purified. Gas chromatography analysis showed that the recombinant FPS could catalyze the formation of farnesyl diphosphate (FPP from geranyl diphosphate (GPP and isopentenyl diphosphate (IPP. Furthermore, the expression profile of the FPS gene and content of total triterpenoids under different stages of development and methyl jasmonate treatments were determined. The results indicated that there is a positive correlation between the activity of FPS and the amount of total triterpenoids produced in P. cocos.

  5. Identification of genes encoding granule-bound starch synthase involved in amylose metabolism in banana fruit.

    Directory of Open Access Journals (Sweden)

    Hongxia Miao

    Full Text Available Granule-bound starch synthase (GBSS is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage.

  6. Relationship Between Polymorphism of Cystathionine beta Synthase Gene and Congenital Heart Disease in Chinese Nuclear Families

    Institute of Scientific and Technical Information of China (English)

    XIAO-MING SONG; XIAO-YING ZHENG; WEN-LI ZHU; LEI HUANG; YONG LI

    2006-01-01

    Objective To study the relationship between polymorphism of cystathionine beta synthase (CBS) gene and development of congenital heart disease (CHD). Methods One hundred and twenty-seven CHD case-parent triads were recruited from Liaoning Province as patient group, and 129 healthy subjects without family history of birth defect were simultaneously recruited as control group together with their biological parents. For all subjects the polymorphism of CBS gene G919A locus was examined by PCR-ARMS method. Results The frequencies of three genotypes (w/w, w/m, and m/m) in control group were 27.2%, 58.4%, and 14.4%, respectively, with no significant difference in gender. A significant difference in the allele frequency was found between CHD patients and controls, the wild allele frequency was 67.9% in patients and 55.7% in controls.CHD parents' genotype distribution was significantly different from that in controls. Further comparison of each type of CHD showed that genotype frequencies in several CHD subtypes were significantly different from those in their corresponding controls. The results of TDT analysis showed that no allele transmission disequilibrium existed in CHD nuclear families.Conclusions CBS gene G919A mutation is associated with the development of CHD, and the mutated allele may decrease the risk of CHD.

  7. Molecular identity and gene expression of aldosterone synthase cytochrome P450

    International Nuclear Information System (INIS)

    11β-Hydroxylase (CYP11B1) of bovine adrenal cortex produced corticosterone as well as aldosterone from 11-deoxycorticosterone in the presence of the mitochondrial P450 electron transport system. CYP11B1s of pig, sheep, and bullfrog, when expressed in COS-7 cells, also performed corticosterone and aldosterone production. Since these CYP11B1s are present in the zonae fasciculata and reticularis as well as in the zona glomerulosa, the zonal differentiation of steroid production may occur by the action of still-unidentified factor(s) on the enzyme-catalyzed successive oxygenations at C11- and C18-positions of steroid. In contrast, two cDNAs, one encoding 11β-hydroxylase and the other encoding aldosterone synthase (CYP11B2), were isolated from rat, mouse, hamster, guinea pig, and human adrenals. The expression of CYP11B1 gene was regulated by cyclic AMP (cAMP)-dependent signaling, whereas that of CYP11B2 gene by calcium ion-signaling as well as cAMP-signaling. Salt-inducible protein kinase, a cAMP-induced novel protein kinase, was one of the regulators of CYP11B2 gene expression

  8. Callose Synthase Family Genes Involved in the Grapevine Defense Response to Downy Mildew Disease.

    Science.gov (United States)

    Yu, Ying; Jiao, Li; Fu, Shufang; Yin, Ling; Zhang, Yali; Lu, Jiang

    2016-01-01

    The deposition of callose is a common plant defense response to intruding pathogens and part of the plant's innate immunity. In this study, eight grapevine callose synthase (CalS) genes were identified and characterized. To investigate biological function of CalS in grapevine against the infection of Plasmopara viticola, expression patterns of grapevine CalS family genes were analyzed among resistant/susceptible cultivars. After P. viticola infection, expression of CalS1, 3, 7, 8, 9, 10, and 11 were significantly modified among the grapevine cultivars. For example, the expression of CalS1 and CalS10 were greatly increased in downy mildew (DM)-immune Muscadinia rotundifolia 'Carlos' and 'Noble'. Transient expression assay with promoters of the CalS1 and CalS10 genes confirmed that they were regulated by the oomycete pathogen P. viticola. CalS1 promoter activity was also significantly up-regulated by ABA in DM-immune M. rotundifolia 'Noble', but down-regulated in DM-susceptible Vitis vinifera 'Chardonnay'. The CalS1 promoter, however, was also down-regulated by GA in 'Chardonnay', but not affected in 'Noble'. The promoter activity of CalS10 was significantly up-regulated by GA in 'Chardonnay', but not regulated by ABA at all. It is proposed that CalS1 and CalS10 were involved in grapevine defense against DM disease. PMID:26474330

  9. Genomic Distance between Thymidylate Synthase and Dihydrofolate Reductase Genes Does Not Correlate With Phylogenetic Evolution in Bacteria

    OpenAIRE

    Vitor Hugo Moreau

    2010-01-01

    Problem statement: Dihydrofolate Reductase (DHFR) and Thymidylate Synthase (TS) exist as bifunctional enzymes coded into unique polypeptide chain in protozoans. Bifunctional DHFR-TS is associated with an increase in the enzymatic activity by channeling the substrate between the active sites. In some bacteria, DHFR and TS genes are neighbors in the genome, whereas in others, they are located millions of base pairs apart. Gene neighboring gained importance in evolution because it was found to p...

  10. Acid sphingomyelinase gene knockout ameliorates hyperhomocysteinemic glomerular injury in mice lacking cystathionine-β-synthase.

    Directory of Open Access Journals (Sweden)

    Krishna M Boini

    Full Text Available Acid sphingomyelinase (ASM has been implicated in the development of hyperhomocysteinemia (hHcys-induced glomerular oxidative stress and injury. However, it remains unknown whether genetically engineering of ASM gene produces beneficial or detrimental action on hHcys-induced glomerular injury. The present study generated and characterized the mice lacking cystathionine β-synthase (Cbs and Asm mouse gene by cross breeding Cbs(+/- and Asm(+/- mice. Given that the homozygotes of Cbs(-/-/Asm(-/- mice could not survive for 3 weeks. Cbs(+/-/Asm(+/+, Cbs(+/-/Asm(+/- and Cbs(+/-/Asm(-/- as well as their Cbs wild type littermates were used to study the role of Asm(-/- under a background of Cbs(+/- with hHcys. HPLC analysis revealed that plasma Hcys level was significantly elevated in Cbs heterozygous (Cbs(+/- mice with different copies of Asm gene compared to Cbs(+/+ mice with different Asm gene copies. Cbs(+/-/Asm(+/+ mice had significantly increased renal Asm activity, ceramide production and O(2.(- level compared to Cbs(+/+/Asm(+/+, while Cbs(+/-/Asm(-/- mice showed significantly reduced renal Asm activity, ceramide production and O(2.(- level due to increased plasma Hcys levels. Confocal microscopy demonstrated that colocalization of podocin with ceramide was much lower in Cbs(+/-/Asm(-/- mice compared to Cbs(+/-/Asm(+/+ mice, which was accompanied by a reduced glomerular damage index, albuminuria and proteinuria in Cbs(+/-/Asm(-/- mice. Immunofluorescent analyses of the podocin, nephrin and desmin expression also illustrated less podocyte damages in the glomeruli from Cbs(+/-/Asm(-/- mice compared to Cbs(+/-/Asm(+/+ mice. In in vitro studies of podocytes, hHcys-enhanced O(2.(- production, desmin expression, and ceramide production as well as decreases in VEGF level and podocin expression in podocytes were substantially attenuated by prior treatment with amitriptyline, an Asm inhibitor. In conclusion, Asm gene knockout or corresponding enzyme

  11. Endothelial nitric oxide synthase gene polymorphism is associated with sickle cell disease patients in India.

    Science.gov (United States)

    Nishank, Sudhansu Sekhar; Singh, Mendi Prema Shyam Sunder; Yadav, Rajiv; Gupta, Rasik Bihari; Gadge, Vijay Sadashiv; Gwal, Anil

    2013-12-01

    Patients with sickle cell disease (SCD) produce significantly low levels of plasma nitric oxide (NO) during acute vaso-occlusive crisis. In transgenic sickle cell mice, NO synthesized by endothelial nitric oxide synthase (eNOS) enzyme of vascular endothelial cells has been found to protect the mice from vaso-occlusive events. Therefore, the present study aims to explore possible association of eNOS gene polymorphism as a potential genetic modifier in SCD patients. A case control study involving 150 SCD patients and age- and ethnicity-matched 150 healthy controls were genotyped by PCR-restriction fragment length polymorphism techniques for three important eNOS gene polymorphisms-eNOS 4a/b, eNOS 894G>T and eNOS -786T>C. It was observed that SCD patients had significantly higher frequencies of mutant alleles besides heterozygous and homozygous mutant genotypes of these three eNOS gene polymorphisms and low levels of plasma nitrite (NO2) as compared with control groups. The SCD severe group had significantly lower levels of plasma NO2 and higher frequencies of mutant alleles of these three SNPs of eNOS gene in contrast to the SCD mild group of patients. Haplotype analysis revealed that frequencies of one mutant haplotype '4a-T-C' (alleles in order of eNOS 4a/b, eNOS 894G>T and eNOS -786T>C) were significantly high in the severe SCD patients (Phaplotype '4b-G-T' was found to be significantly high (P<0.0001) in the SCD mild patients, which indicates that eNOS gene polymorphisms are associated with SCD patients in India and may act as a genetic modifier of the phenotypic variation of SCD patients. PMID:24088668

  12. UVB-irradiated keratinocytes induce melanoma-associated ganglioside GD3 synthase gene in melanocytes via secretion of tumor necrosis factor α and interleukin 6

    International Nuclear Information System (INIS)

    Highlights: • Melanocytes showed low ST8SIA1 and high B3GALT4 levels in contrast with melanomas. • Direct UVB irradiation of melanocytes did not induce ganglioside synthase genes. • Culture supernatants of UVB-irradiated keratinocytes induced ST8SIA1 in melanocytes. • TNFα and IL-6 secreted from keratinocytes enhanced ST8SIA1 expression in melanocytes. • Inflammatory cytokines induced melanoma-related ST8SIA1 in melanocytes. - Abstract: Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes

  13. UVB-irradiated keratinocytes induce melanoma-associated ganglioside GD3 synthase gene in melanocytes via secretion of tumor necrosis factor α and interleukin 6

    Energy Technology Data Exchange (ETDEWEB)

    Miyata, Maiko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Sugiura, Kazumitsu [Department of Dermatology, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Furukawa, Koichi, E-mail: koichi@med.nagoya-u.ac.jp [Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Furukawa, Keiko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan)

    2014-03-07

    Highlights: • Melanocytes showed low ST8SIA1 and high B3GALT4 levels in contrast with melanomas. • Direct UVB irradiation of melanocytes did not induce ganglioside synthase genes. • Culture supernatants of UVB-irradiated keratinocytes induced ST8SIA1 in melanocytes. • TNFα and IL-6 secreted from keratinocytes enhanced ST8SIA1 expression in melanocytes. • Inflammatory cytokines induced melanoma-related ST8SIA1 in melanocytes. - Abstract: Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes.

  14. Transcriptome mining, functional characterization, and phylogeny of a large terpene synthase gene family in spruce (Picea spp.

    Directory of Open Access Journals (Sweden)

    Dullat Harpreet K

    2011-03-01

    Full Text Available Abstract Background In conifers, terpene synthases (TPSs of the gymnosperm-specific TPS-d subfamily form a diverse array of mono-, sesqui-, and diterpenoid compounds, which are components of the oleoresin secretions and volatile emissions. These compounds contribute to defence against herbivores and pathogens and perhaps also protect against abiotic stress. Results The availability of extensive transcriptome resources in the form of expressed sequence tags (ESTs and full-length cDNAs in several spruce (Picea species allowed us to estimate that a conifer genome contains at least 69 unique and transcriptionally active TPS genes. This number is comparable to the number of TPSs found in any of the sequenced and well-annotated angiosperm genomes. We functionally characterized a total of 21 spruce TPSs: 12 from Sitka spruce (P. sitchensis, 5 from white spruce (P. glauca, and 4 from hybrid white spruce (P. glauca × P. engelmannii, which included 15 monoterpene synthases, 4 sesquiterpene synthases, and 2 diterpene synthases. Conclusions The functional diversity of these characterized TPSs parallels the diversity of terpenoids found in the oleoresin and volatile emissions of Sitka spruce and provides a context for understanding this chemical diversity at the molecular and mechanistic levels. The comparative characterization of Sitka spruce and Norway spruce diterpene synthases revealed the natural occurrence of TPS sequence variants between closely related spruce species, confirming a previous prediction from site-directed mutagenesis and modelling.

  15. Insertional mutagenesis and characterization of a polyketide synthase gene (PKS1) required for melanin biosynthesis in Bipolaris oryzae.

    Science.gov (United States)

    Moriwaki, Akihiro; Kihara, Junichi; Kobayashi, Tsutomu; Tokunaga, Toshiko; Arase, Sakae; Honda, Yuichi

    2004-09-01

    A polyketide synthase gene named PKS1, involved in the melanin biosynthesis pathway of the phytopathogenic fungus Bipolaris oryzae, was isolated using restriction enzyme-mediated integration. Sequence analysis showed that the PKS1 encodes a putative protein that has 2155 amino acids and significant similarity to other fungal polyketide synthases. Targeted disruption of the PKS1 gene showed that it is necessary for melanin biosynthesis in B. oryzae. Northern blot analysis showed that PKS1 transcripts were specifically enhanced by near-ultraviolet radiation (300-400 nm) and that its temporal transcriptional patterns were similar to those of THR1 and SCD1 genes involved in the melanin biosynthesis pathway of B. oryzae. PMID:15336395

  16. Genes encoding the alpha, gamma, delta, and four F0 subunits of ATP synthase constitute an operon in the cyanobacterium Anabaena sp. strain PCC 7120.

    OpenAIRE

    McCarn, D F; R A Whitaker; Alam, J; Vrba, J M; Curtis, S E

    1988-01-01

    A cluster of genes encoding subunits of ATP synthase of Anabaena sp. strain PCC 7120 was cloned, and the nucleotide sequences of the genes were determined. This cluster, denoted atp1, consists of four F0 genes and three F1 genes encoding the subunits a (atpI), c (atpH), b' (atpG), b (atpF), delta (atpD), alpha (aptA), and gamma (atpC) in that order. Closely linked upstream of the ATP synthase subunit genes is an open reading frame denoted gene 1, which is equivalent to the uncI gene of Escher...

  17. Homologous cloning, characterization and expression of a new halophyte phytochelatin synthase gene in Suaeda salsa

    Science.gov (United States)

    Cong, Ming; Zhao, Jianmin; Lü, Jiasen; Ren, Zhiming; Wu, Huifeng

    2016-01-01

    The halophyte Suaeda salsa can grow in heavy metal-polluted areas along intertidal zones having high salinity. Since phytochelatins can eff ectively chelate heavy metals, it was hypothesized that S. salsa possessed a phytochelatin synthase (PCS) gene. In the present study, the cDNA of PCS was obtained from S. salsa (designated as SsPCS) using homologous cloning and the rapid amplification of cDNA ends (RACE). A sequence analysis revealed that SsPCS consisted of 1 916 bp nucleotides, encoding a polypeptide of 492 amino acids with one phytochelatin domain and one phytochelatin C domain. A similarity analysis suggested that SsPCS shared up to a 58.6% identity with other PCS proteins and clustered with PCS proteins from eudicots. There was a new kind of metal ion sensor motif in its C-terminal domain. The SsPCS transcript was more highly expressed in elongated and fibered roots and stems (P mercury exposure significantly enhanced the mRNA expression of SsPCS (P metal sensing capability than the first PCS from Thellungiella halophila. This study provided a new view of halophyte PCS genes in heavy metal tolerance.

  18. Evolution of mustard (Brassica juncea Coss) subspecies in China: evidence from the chalcone synthase gene.

    Science.gov (United States)

    Chen, F B; Liu, H F; Yao, Q L; Fang, P

    2016-01-01

    To explore the phylogenetic relationship, genome donor, and evolutionary history of the polyploid mustard (Brassica juncea) from China, eighty-one sequences of the chalcone synthase gene (Chs) were analyzed in 43 individuals, including 34 B. juncea, 2 B. rapa, 1 B. nigra, 2 B. oleracea, 1 B. napus, 1 B. carinata, and 2 Raphanus sativus. A maximum likelihood analysis showed that sequences from B. juncea were separated into two well-supported groups in accordance with the A and B genomes, whereas the traditional phenotypic classification of B. juncea was not wholly supported by the molecular results. The SplitsTree analysis recognized four distinct groups of Brassicaceae, and the median-joining network analysis recognized four distinct haplotypes of Chs. The estimates of Tajima's D, Fu and Li's D, and Fu and Li's F statistic for the Chs gene in the B genome were negative, while those in the A genome were significant. The results indicated that 1) the Chs sequences revealed a high level of sequence variation in Chinese mustard, 2) both tree and reticulate evolutions existed, and artificial selection played an important role in the evolution of Chinese mustard, 3) the original parental species of Chinese mustard are B. rapa var. sinapis arvensis and B. nigra (derived from China), 4) nucleotide variation in the B genome was higher than that in the A genome, and 5) cultivated mustard evolved from wild mustard, and China is one of the primary origins of B. juncea. PMID:27173323

  19. Nitric Oxide Synthase Type III Overexpression By Gene Therapy Exerts Antitumoral Activity In Mouse Hepatocellular Carcinoma

    Directory of Open Access Journals (Sweden)

    Raúl González

    2015-08-01

    Full Text Available Hepatocellular carcinoma develops in cirrhotic liver. The nitric oxide (NO synthase type III (NOS-3 overexpression induces cell death in hepatoma cells. The study developed gene therapy designed to specifically overexpress NOS-3 in cultured hepatoma cells, and in tumors derived from orthotopically implanted tumor cells in fibrotic livers. Liver fibrosis was induced by CCl4 administration in mice. Hepa 1-6 cells were used for in vitro and in vivo experiments. The first generation adenovirus was designed to overexpress NOS-3 (or GFP and luciferase cDNA under the regulation of murine alpha-fetoprotein (AFP and Rous Sarcoma Virus (RSV promoters, respectively. Both adenoviruses were administered through the tail vein two weeks after orthotopic tumor cell implantation. AFP-NOS-3/RSV-Luciferase increased oxidative-related DNA damage, p53, CD95/CD95L expression and caspase-8 activity in cultured Hepa 1-6 cells. The increased expression of CD95/CD95L and caspase-8 activity was abolished by l-NAME or p53 siRNA. The tail vein infusion of AFP-NOS- 3/RSV-Luciferase adenovirus increased cell death markers, and reduced cell proliferation of established tumors in fibrotic livers. The increase of oxidative/nitrosative stress induced by NOS-3 overexpression induced DNA damage, p53, CD95/CD95L expression and cell death in hepatocellular carcinoma cells. The effectiveness of the gene therapy has been demonstrated in vitro and in vivo.

  20. Nonribosomal peptide synthase gene clusters for lipopeptide biosynthesis in Bacillus subtilis 916 and their phenotypic functions.

    Science.gov (United States)

    Luo, Chuping; Liu, Xuehui; Zhou, Huafei; Wang, Xiaoyu; Chen, Zhiyi

    2015-01-01

    Bacillus cyclic lipopeptides (LPs) have been well studied for their phytopathogen-antagonistic activities. Recently, research has shown that these LPs also contribute to the phenotypic features of Bacillus strains, such as hemolytic activity, swarming motility, biofilm formation, and colony morphology. Bacillus subtilis 916 not only coproduces the three families of well-known LPs, i.e., surfactins, bacillomycin Ls (iturin family), and fengycins, but also produces a new family of LP called locillomycins. The genome of B. subtilis 916 contains four nonribosomal peptide synthase (NRPS) gene clusters, srf, bmy, fen, and loc, which are responsible for the biosynthesis of surfactins, bacillomycin Ls, fengycins, and locillomycins, respectively. By studying B. subtilis 916 mutants lacking production of one, two, or three LPs, we attempted to unveil the connections between LPs and phenotypic features. We demonstrated that bacillomycin Ls and fengycins contribute mainly to antifungal activity. Although surfactins have weak antifungal activity in vitro, the strain mutated in srfAA had significantly decreased antifungal activity. This may be due to the impaired productions of fengycins and bacillomycin Ls. We also found that the disruption of any LP gene cluster other than fen resulted in a change in colony morphology. While surfactins and bacillomycin Ls play very important roles in hemolytic activity, swarming motility, and biofilm formation, the fengycins and locillomycins had little influence on these phenotypic features. In conclusion, B. subtilis 916 coproduces four families of LPs which contribute to the phenotypic features of B. subtilis 916 in an intricate way. PMID:25362061

  1. Polymorphism of thymidylate synthase gene associated with its protein expression in human colon cancer

    Institute of Scientific and Technical Information of China (English)

    Kai-Huan Yu; Wei-Xing Wang; You-Ming Ding; Hui Li; Ze-Sheng Wang

    2008-01-01

    AIM: To correlate the polymorphisms in the 5'-untranslated region with thymidylate synthase (TS) protein expression in Han Chinese colonic neoplasms.METHODS: Adenocarcinoma samples were from 68 patients who received no treatment before surgery. Tandem repeat length of TS gene was determined by PCR amplification of genomic DNA. Intratumoral TS protein expression was studied immunohistochemically in corresponding sections from paraffin-embedded primary foci. Immunoreactivity was semiquantitatively evaluated by immunoreactivity score (IRS).RESULTS: Double-(2R) and triple-repeated (3R) sequences of the TS gene were found in the cancer tissues. Three genotypes of TS were found: 2R/2R (n = 6), 2R/3R (n = 22) and 3R/3R (n = 40). Patients who were homozygous for triple-repeated (3R/3R) sequences showed significantly higher IRS of TS than patients who were homozygous for double-repeated (2R/2R) sequences or heterozygous patients (2R/3R): 5.73 ± 3.25 vs 2.17 ± 1.47 or 3.77 ± 2.64, P = 0.008 or P = 0.015. But no statistical significance of IRS in cancer tissues was observed between 2R/3R genotype and 2R/2R genotype.CONCLUSION: There is a relationship between TS genotype and TS protein expression in clinical specimens. The data might offer an advantage for selection of Chinese cancer patients to receive fluoropyrimidines treatment.

  2. Cloning and characterization of the nicotianamine synthase gene in Eruca vesicaria subsp sativa.

    Science.gov (United States)

    Huang, B L; Cheng, C; Zhang, G Y; Su, J J; Zhi, Y; Xu, S S; Cai, D T; Zhang, X K; Huang, B Q

    2015-01-01

    Nicotianamine (NA) is a ubiquitous metabolite in plants that bind heavy metals, is crucial for metal homeostasis, and is also an important metal chelator that facilitates long-distance metal transport and sequestration. NA synthesis is catalyzed by the enzyme nicotianamine synthase (NAS). Eruca vesicaria subsp sativa is highly tolerant to Ni, Pb, and Zn. In this study, a gene encoding EvNAS was cloned and characterized in E. vesicaria subsp sativa. The full-length EvNAS cDNA sequence contained a 111-bp 5'-untranslated region (UTR), a 155-bp 3'-UTR, and a 966-bp open reading frame encoding 322-amino acid residues. The EvNAS genomic sequence contained no introns, which is similar to previously reported NAS genes. The deduced translation of EvNAS contained a well-conserved NAS domain (1-279 amino acids) and an LIKI-CGEAEG box identical to some Brassica NAS and to the LIRL-box in most plant NAS, which is essential for DNA binding. Phylogenetic analysis indicated that EvNAS was most closely related to Brassica rapa NAS3 within the Cruciferae, followed by Thlaspi NAS1, Camelina NAS3, and Arabidopsis NAS3. A reverse transcription-polymerase chain reaction indicated that EvNAS expression was greatest in the leaves, followed by the flower buds and hypocotyls. EvNAS was moderately expressed in the roots. PMID:26782459

  3. Effects of starch synthase IIa gene dosage on grain, protein and starch in endosperm of wheat.

    Science.gov (United States)

    Konik-Rose, Christine; Thistleton, Jenny; Chanvrier, Helene; Tan, Ihwa; Halley, Peter; Gidley, Michael; Kosar-Hashemi, Behjat; Wang, Hong; Larroque, Oscar; Ikea, Joseph; McMaugh, Steve; Regina, Ahmed; Rahman, Sadequr; Morell, Matthew; Li, Zhongyi

    2007-11-01

    Starch synthases (SS) are responsible for elongating the alpha-1,4 glucan chains of starch. A doubled haploid population was generated by crossing a line of wheat, which lacks functional ssIIa genes on each genome (abd), and an Australian wheat cultivar, Sunco, with wild type ssIIa alleles on each genome (ABD). Evidence has been presented previously indicating that the SGP-1 (starch granule protein-1) proteins present in the starch granule in wheat are products of the ssIIa genes. Analysis of 100 progeny lines demonstrated co-segregation of the ssIIa alleles from the three genomes with the SGP-1 proteins, providing further evidence that the SGP-1 proteins are the products of the ssIIa genes. From the progeny lines, 40 doubled haploid lines representing the eight possible genotypes for SSIIa (ABD, aBD, AbD, ABd, abD, aBd, Abd, abd) were characterized for their grain weight, protein content, total starch content and starch properties. For some properties (chain length distribution, pasting properties, swelling power, and gelatinization properties), a progressive change was observed across the four classes of genotypes (wild type, single nulls, double nulls and triple nulls). However, for other grain properties (seed weight and protein content) and starch properties (total starch content, granule morphology and crystallinity, granule size distribution, amylose content, amylose-lipid dissociation properties), a statistically significant change only occurred for the triple nulls, indicating that all three genes had to be missing or inactive for a change to occur. These results illustrate the importance of SSIIa in controlling grain and starch properties and the importance of amylopectin fine structure in controlling starch granule properties in wheat. PMID:17721773

  4. Presence of two transcribed malate synthase genes in an n-alkane-utilizing yeast, Candida tropicalis.

    Science.gov (United States)

    Hikida, M; Atomi, H; Fukuda, Y; Aoki, A; Hishida, T; Teranishi, Y; Ueda, M; Tanaka, A

    1991-12-01

    The presence of two genomic DNA regions encoding malate synthase (MS) was shown by Southern blot analysis of the genomic DNA from an n-alkane-assimilating yeast, Candida tropicalis, using a partial MS cDNA probe, in accordance with the fact that two types of partial MS cDNAs have previously been isolated. This was also confirmed by the restriction mapping of the two genes screened from the yeast lambda EMBL library. Nucleotide sequence analysis of the respective genomic DNAs, named MS-1 gene and MS-2 gene, revealed that both regions encoding MS had the same length of 1,653 base pairs, corresponding to 551 amino acids (molecular mass of MS-1, 62,448 Da; MS-2, 62,421 Da). Although 29 nucleotide pairs differed in the sequences of the coding regions, the number of amino acid replacements was only one: 159Asn (MS-1)----159Ser (MS-2). In the 5'-flanking regions, there were replacements of four nucleotide pairs, deletion of one pair, and insertion of four pairs. In spite of the fact that two genomic genes were present and transcribed, RNA blot analysis demonstrated that only one band (about 2 kb) was observable even when the carbon sources in the cultivation medium were changed. A comparison of the amino acid sequences was made with MSs of rape (Brassica napus L.), cucumber seed, pumpkin seed, Escherichia coli, and Hansenula polymorpha. A high homology was observed among these enzymes, the results indicating that the protein structure was relatively well conserved through the evolution of the molecule.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:1794980

  5. IDENTIFICATION AND HORMONE INDUCTION OF PUTATIVE CHITIN SYNTHASE GENES AND SPLICE VARIANTS IN Leptinotarsa decemlineata (SAY).

    Science.gov (United States)

    Shi, Ji-Feng; Mu, Li-Li; Guo, Wen-Chao; Li, Guo-Qing

    2016-08-01

    Chitin synthase (ChS) plays a critical role in chitin synthesis and excretion. In this study, two ChS genes (LdChSA and LdChSB) were identified in Leptinotarsa decemlineata. LdChSA contains two splicing variants, LdChSAa and LdChSAb. Within the first, second, and third larval instars, the mRNA levels of LdChSAa, LdChSAb, and LdChSB coincide with the peaks of circulating 20-hydroxyecdysone (20E) and juvenile hormone (JH). In vitro culture of midguts and an in vivo bioassay revealed that 20E and an ecdysteroid agonist halofenozide stimulated the expression of the three LdChSs. Conversely, a reduction of 20E by RNA interference (RNAi) of an ecdysteroidogenesis gene LdSHD repressed the expression of these LdChSs, and ingestion of halofenozide by LdSHD RNAi larvae rescued the repression. Moreover, disruption of 20E signaling by RNAi of LdEcR, LdE75, LdHR3, and LdFTZ-F1 reduced the expression levels of these genes. Similarly, in vitro culture and an in vivo bioassay showed that exogenous JH and a JH analog methoprene activated the expression of the three LdChSs, whereas a decrease in JH by RNAi of a JH biosynthesis gene LdJHAMT downregulated these LdChSs. It seems that JH upregulates LdChSs at the early stage of each instar, whereas a 20E pulse triggers the transcription of LdChSs during molting in L. decemlineata. PMID:27030662

  6. Development of radiation-inducible promoters for use in nitric oxide synthase gene therapy of cancer

    International Nuclear Information System (INIS)

    Full text: The free radical nitric oxide (NO) at nM concentrations performs multiple signaling roles that are essential for survival. These processes are regulated via the enzymes nNOS and eNOS, but another isoform, inducible nitric oxide synthase (iNOS) is capable of generating much higher concentrations (mM) over longer periods, resulting in the generation of very toxic species such as peroxynitrite. At high concentrations NO has many of the characteristics of an ideal anticancer molecule: it is cytotoxic (pro-apoptotic via peroxynitrite), it is a potent chemical radiosensitizer, it is anti-angiogenic and anti-metastatic. Thus, we see iNOS gene therapy as a strategy for targeting the generation of high concentrations of NO to tumours for therapeutic benefit. iNOS gene therapy should be used in combination with radiotherapy; so it is logical that the use of a radiation-inducible promoter should be part of the targeting strategy. We have tested several candidate promoters in vitro and in vivo. The WAF1 promoter has many of the properties desirable for therapeutic use including: rapid 3-4 fold induction at X-ray doses of 2 and 4Gy and no significant leakiness. WAF1 also has the advantage of being inducible by hypoxia and by the final product, NO. We have also tested the synthetic CArG promoter and demonstrated that, in addition to a high level of radiation inducibility, it is also inducible by NO. We have also been able to demonstrate potent radiosensitization (SER 2.0-2.5) in tumour cells in vitro and in vivo using iNOS gene transfer with constitutive or radiation-inducible promoters. We have also tested the use of iNOS gene therapy in combination with cisplatin and shown significant enhancement

  7. Characterization of two trpE genes encoding anthranilate synthase α-subunit in Azospirillum brasilense

    International Nuclear Information System (INIS)

    The previous report from our laboratory has recently identified a new trpE gene (termed trpE 2) which exists independently in Azospirillum brasilense Yu62. In this study, amplification of trpE(G) (termed trpE 1(G) here) confirmed that there are two copies of trpE gene, one trpE being fused into trpG while the other trpE existed independently. This is First report to suggest that two copies of the trpE gene exist in this bacterium. Comparison of the nucleotide sequence demonstrated that putative leader peptide, terminator, and anti-terminator were found upstream of trpE 1(G) while these sequence features did not exist in front of trpE 2. The β-galactosidase activity of an A. brasilense strain carrying a trpE 2-lacZ fusion remained constant at different tryptophan concentrations, but the β-galactosidase activity of the same strain carrying a trpE 1(G)-lacZ fusion decreased as the tryptophan concentration increased. These data suggest that the expression of trpE 1(G) is regulated at the transcriptional level by attenuation while trpE 2 is constantly expressed. The anthranilate synthase assays with trpE 1(G)- and trpE 2- mutants demonstrated that TrpE1(G) fusion protein is feedback inhibited by tryptophan while TrpE2 protein is not. We also found that both trpE 1(G) and trpE 2 gene products were involved in IAA synthesis

  8. Regulation of RNA-dependent RNA polymerase 1 and isochorismate synthase gene expression in Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Lydia J R Hunter

    Full Text Available BACKGROUND: RNA-dependent RNA polymerases (RDRs function in anti-viral silencing in Arabidopsis thaliana and other plants. Salicylic acid (SA, an important defensive signal, increases RDR1 gene expression, suggesting that RDR1 contributes to SA-induced virus resistance. In Nicotiana attenuata RDR1 also regulates plant-insect interactions and is induced by another important signal, jasmonic acid (JA. Despite its importance in defense RDR1 regulation has not been investigated in detail. METHODOLOGY/PRINCIPAL FINDINGS: In Arabidopsis, SA-induced RDR1 expression was dependent on 'NON-EXPRESSER OF PATHOGENESIS-RELATED GENES 1', indicating regulation involves the same mechanism controlling many other SA- defense-related genes, including pathogenesis-related 1 (PR1. Isochorismate synthase 1 (ICS1 is required for SA biosynthesis. In defensive signal transduction RDR1 lies downstream of ICS1. However, supplying exogenous SA to ics1-mutant plants did not induce RDR1 or PR1 expression to the same extent as seen in wild type plants. Analysing ICS1 gene expression using transgenic plants expressing ICS1 promoter:reporter gene (β-glucuronidase constructs and by measuring steady-state ICS1 transcript levels showed that SA positively regulates ICS1. In contrast, ICS2, which is expressed at lower levels than ICS1, is unaffected by SA. The wound-response hormone JA affects expression of Arabidopsis RDR1 but jasmonate-induced expression is independent of CORONATINE-INSENSITIVE 1, which conditions expression of many other JA-responsive genes. Transiently increased RDR1 expression following tobacco mosaic virus inoculation was due to wounding and was not a direct effect of infection. RDR1 gene expression was induced by ethylene and by abscisic acid (an important regulator of drought resistance. However, rdr1-mutant plants showed normal responses to drought. CONCLUSIONS/SIGNIFICANCE: RDR1 is regulated by a much broader range of phytohormones than previously thought

  9. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    Science.gov (United States)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  10. Polymorphism of Methionine Synthase Gene in Nuclear Families of Congenital Heart Disease

    Institute of Scientific and Technical Information of China (English)

    WEN-LI ZHU; JUN CHENG; JING-JING DAO; RU-BING ZHAO; LI-YING YAN; SHU-QING LI; AND YONG LI

    2004-01-01

    Objective To investgate the relation of methionine synthase (MS) gene variation with congenital heart disease (CHD) phenotype. Methods One hundred and ninety three CHD patients (94 males and 99 females) and their biological parents (nuclear families) in Liaoning Province were selected as the case group, and another 104 normal persons (60 males and 44 females) and their parents without family history of birth defects as the control group. For all subjects the polymorphism of MS gene A2756G locus was examined by PCR-RFLP method. Results In offspring of the control group the frequencies of MS genotype (+/-) and allele (+) were 10.7% and 5.3%, without existence of homozygote. The MS genotype distribution and allele frequencies of CHD patients and their mothers were not significantly different from the control (P > 0.05). The frequency of allele (+)in case fathers (5.0 %) was apparently lower than that in the control (9.1%, P=0.060), and the odds ratio (OR) was 0.53 (95% CI: 0.25-1.09). There was no difference in parents' genotype combination between the two groups, and in genotype distribution among different types of CHD. Analysis of genetic transmission indicated that mutation allele (+) existed transmission disequilibrium in CHD nuclear families. The percentage of allele (+) transmitted from parents was lower than that allele (-)with OR 0.26 (95% CI: 0.11-0.60). Conclusion MS gene variation in parents is associated with occurrence of CHD in offspring, and mutation allele (+) in parents may be related with the decrease of CHD risk in offspring.

  11. Thymidylate synthase gene amplification in human colon cancer cell lines resistant to 5-fluorouracil.

    Science.gov (United States)

    Copur, S; Aiba, K; Drake, J C; Allegra, C J; Chu, E

    1995-05-17

    A series of 5-fluorouracil (5-FU)-resistant human colon H630 cancer cell lines were established by continuous exposure of cells to 5-FU. The concentration of 5-FU required to inhibit cell proliferation by 50% (IC50) in the parent colon line (H630) was 5.5 microM. The 5-FU IC50 values for the resistant H630-R1, H630-R10, and H630-R cell lines were 11-, 29-, and 27-fold higher than that for the parent H630 cell line. Using both the radioenzymatic 5-fluoro-2'-deoxyuridine-5'-monophosphate (FdUMP) binding and catalytic assays for measurement of thymidylate synthase (TS) enzyme activity, there was significantly increased TS activity in resistant H630-R1 (13- and 23-fold), H630-R10 (37- and 40-fold), and H630-R (24- and 34-fold) lines, for binding and catalytic assays, respectively, compared with the parent H630 line. The level of TS protein, as determined by western immunoblot analysis, was increased markedly in resistant H630-R1 (23-fold), H630-R10 (33-fold), and H630-R (26-fold) cells. Northern analysis revealed elevations in TS mRNA levels in H630-R1 (18-fold), H630-R10 (39-fold), and H630-R (36-fold) cells relative to parent H630 cells. Although no major rearrangements of the TS gene were noted by Southern analysis, there was significant amplification of the TS gene in 5-FU-resistant cells, which was confirmed by DNA slot blot analysis. These studies demonstrate that continuous exposure of human colon cancer cells to 5-FU leads to TS gene amplification and overexpression of TS protein with resultant development of fluoropyrimidine resistance. PMID:7763285

  12. Epidemiology and clinical relevanceof Pneumocystis jirovecii Frenkel, 1976 dihydropteroate synthase gene mutations*

    Directory of Open Access Journals (Sweden)

    Matos O.

    2010-09-01

    Full Text Available A review was conducted to examine the published works that studied the prevalence of Pneumocystis jirovecii dihydropteroate synthase (DHPS mutations in patients with P. jirovecii pneumonia (PcP, in develop and developing countries, and that focused the problem of the possible association of these mutations with exposure to sulpha or sulphone drugs and their influence in the PcP outcome. Studies conducted in United States of America presented higher P. jirovecii mutations rates, in comparison with European countries, and in developing countries, lower rates of DHPS mutations were reported, due to limited use of sulpha drugs. A significant association was reported between the use of sulpha or sulphone agents for PcP prophylaxis in HIV-infected patients and the presence of DHPS mutations. However these mutations were also detected in PcP patients who were not currently receiving sulpha or sulphone agents. The outcome and mortality of HIV-infected patients with PcP harbouring DHPS gene mutations were related primarily to the underlying severity of illness and the initial severity of PcP, more than to the presence of mutations.

  13. Molecular characterization and expression analyses of an anthocyanin synthase gene from Magnolia sprengeri Pamp.

    Science.gov (United States)

    Shi, Shou-Guo; Li, Shan-Ju; Kang, Yong-Xiang; Liu, Jian-Jun

    2015-01-01

    Anthocyanin synthase (ANS), which catalyzes the conversion of colorless leucoanthocyanins into colored anthocyanins, is a key enzyme in the anthocyanin biosynthetic pathway. It plays important roles in plant development and defense. An ANS gene designated as MsANS was cloned from Magnolia sprengeri using rapid amplification of complementary DNA (cDNA) ends technology. The full-length MsANS is 1171-bp long and contains a 1080-bp open reading frame encoding a 360 amino acid polypeptide. In a sequence alignment analysis, the deduced MsANS protein showed high identity to ANS proteins from other plants: Prunus salicina var. cordata (74 % identity), Ampelopsis grossedentata (74 % identity), Pyrus communis (73 % identity), and Prunus avium (73 % identity). A structural analysis showed that MsANS belongs to 2-oxoglutarate (2OG)- and ferrous iron-dependent oxygenase family because it contains three binding sites for 2OG. Real-time quantitative polymerase chain reaction analyses showed that the transcript level of MsANS was 26-fold higher in red petals than in white petals. The accumulation of anthocyanins in petals of white, pink, and red M. sprengeri flowers was analyzed by HPLC. The main anthocyanin was cyanidin-3-o-glucoside chloride, and the red petals contained the highest concentration of this pigment. PMID:25315387

  14. Isolation and characterization of the trehalose-6-phosphate synthase gene from Locusta migratoria manflensis

    Institute of Scientific and Technical Information of China (English)

    Shu-Yan Cui; Yu-Xian Xia

    2009-01-01

    Trehalose plays an important role in protecting organisms from various stresses.Trehalose-6-phosphate synthase (TPS) is the key enzyme in trehalose synthesis, but in in-sects only a few TPS genes have been identified and their function has not been well characterized. To better understand the function of TPS in insects, a complete TPS com-plementary DNA (eDNA) clone was obtained from the fat body of the locust Locusta migratoria manilensis (GenBank accession number: EU 131894). The full-length cDNA is 2 806 bp, including an open reading frame of 2 442 bp, which encodes an 813 amino acids protein with a calculated molecular weight of 91 976 Daltons and an isoelectric point of 6.14. The deduced amino acid sequence is highly similar to other published insect TPS and its C-terminal also has a region homologous to trehalose phosphate phsophatase (TPP).Semi-quantitative analysis indicated that the TPS transcript was expressed not only in fat body, but also in gut, hemolymph and leg muscle. These data may facilitate studies of TPS function in insects and improve our understanding of trehalose metabolism.

  15. RNA Interference-mediated Silencing of Phytochelatin Synthase Gene Reduce Cadmium Accumulation in Rice Seeds

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    Phytochelatins (PCs) play an important role in heavy metal resistance and accumulation. To reduce the accumulation of cadmium (Cd) in rice seeds, the expression of phytochelatin synthase (PCS) gene OsPCS1 was suppressed by RNA interference (RNAi). A hairpin construct of a PCS fragment was designed in the pRNAi-OsPCS1 under the control of ZMM1, a seed-specific promoter from maize. The construct was introduced into rice (japonica) through Agrobacterium tumefaciens. The RNAi rice plantlets were selected and cultivated in pots exposured to 10 mg/kg Cd. The transcriptional level of OsPCS1 declined in seeds of some RNAi rice compared to the wild type. As a result Cd accumulation was reduced by about half in the seeds of RNAi rice. As expected, no apparent difference of growth appeared between RNAi and wild-type plants. The results suggest that this new approach can be used to control heavy metal accumulation in crops.

  16. Borna disease virus P protein inhibits nitric oxide synthase gene expression in astrocytes

    International Nuclear Information System (INIS)

    Borna disease virus (BDV) is one of the potential infectious agents involved in the development of central nervous system (CNS) diseases. Neurons and astrocytes are the main targets of BDV infection, but little is known about the roles of BDV infection in the biological effects of astrocytes. Here we reported that BDV inhibits the activation of inducible nitric oxide synthase (iNOS) in murine astrocytes induced by bacterial LPS and PMA. To determine which protein of BDV is responsible for the regulation of iNOS expression, we co-transfected murine astrocytes with reporter plasmid iNOS-luciferase and plasmid expressing individual BDV proteins. Results from analyses of reporter activities revealed that only the phosphoprotein (P) of BDV had an inhibitory effect on the activation of iNOS. In addition, P protein inhibits nitric oxide production through regulating iNOS expression. We also reported that the nuclear factor kappa B (NF-κB) binding element, AP-1 recognition site, and interferon-stimulated response element (ISRE) on the iNOS promoter were involved in the repression of iNOS gene expression regulated by the P protein. Functional analysis indicated that sequences from amino acids 134 to 174 of the P protein are necessary for the regulation of iNOS. These data suggested that BDV may suppress signal transduction pathways, which resulted in the inhibition of iNOS activation in astrocytes

  17. The Phytoene synthase gene family of apple (Malus x domestica) and its role in controlling fruit carotenoid content

    OpenAIRE

    Ampomah-Dwamena, C.; Driedonks, N.J.W.; Lewis, D; Shumskaya, M.; Chen, X Y; Wurtzel, E.T.; Espley, R.V.; Allan, A.C.

    2015-01-01

    Background Carotenoid compounds play essential roles in plants such as protecting the photosynthetic apparatus and in hormone signalling. Coloured carotenoids provide yellow, orange and red colour to plant tissues, as well as offering nutritional benefit to humans and animals. The enzyme phytoene synthase (PSY) catalyses the first committed step of the carotenoid biosynthetic pathway and has been associated with control of pathway flux. We characterised four PSY genes found in the apple genom...

  18. Nucleotide Variability in the 5-Enolpyruvylshikimate-3-Phosphate Synthase Gene from Eleusine indica (L.) Gaertn

    OpenAIRE

    J.L. Chong; R. Wickneswari; Ismail, B. S.; S. Salmijah

    2008-01-01

    This study reports the results of the partial DNA sequence analysis of the 5-enolpyruvyl-shikimate-3-phosphate synthase (EPSPS) gene in glyphosate-resistant (R) and glyphosate-susceptible (S) biotypes of Eleusine indica (L.) Gaertn from Peninsular Malaysia. Sequencing results revealed point mutation at nucleotide position 875 in the R biotypes of Bidor, Chaah and Temerloh. In the Chaah R population, substitution of cytosine (C) to adenine (A) resulted in the change of threonine (Thr106) to pr...

  19. Molecular Cloning, Expression, and Characterization of the Genes Encoding the Two Essential Protein Components of Micrococcus luteus B-P 26 Hexaprenyl Diphosphate Synthase

    OpenAIRE

    Shimizu, Naoto; Koyama, Tanetoshi; Ogura, Kyozo

    1998-01-01

    The structural genes encoding the two essential components A and B of hexaprenyl diphosphate synthase, which produce the precursor of the prenyl side chain of menaquinone-6, were cloned from Micrococcus luteus B-P 26.

  20. Expression of an (E-β-farnesene synthase gene from Asian peppermint in tobacco affected aphid infestation

    Directory of Open Access Journals (Sweden)

    Xiudao Yu

    2013-10-01

    Full Text Available Aphids are major agricultural pests that cause significant yield losses in crop plants each year. (E-β-farnesene (EβF is the main or only component of an alarm pheromone involved in chemical communication within aphid species and particularly in the avoidance of predation. EβF also occurs in the essential oil of some plant species, and is catalyzed by EβF synthase. By using oligonucleotide primers designed from the known sequence of an EβF synthase gene from black peppermint (Mentha × piperita, two cDNA sequences, MaβFS1 and MaβFS2, were isolated from Asian peppermint (Mentha asiatica. Expression pattern analysis showed that the MaβFS1 gene exhibited higher expression in flowers than in roots, stems and leaves at the transcriptional level. Overexpression of MaβFS1 in tobacco plants resulted in emission of pure EβF ranging from 2.62 to 4.85 ng d− 1 g− 1 of fresh tissue. Tritrophic interactions involving peach aphids (Myzus persicae, and predatory lacewing (Chrysopa septempunctata larvae demonstrated that transgenic tobacco expressing MaβFS1 had lower aphid infestation. This result suggested that the EβF synthase gene from Asian peppermint could be a good candidate for genetic engineering of agriculturally important crop plants.

  1. Expression of an(E)-β-farnesene synthase gene from Asian peppermint in tobacco affected aphid infestation

    Institute of Scientific and Technical Information of China (English)

    Xiudao; Yu; Yongjun; Zhang; Youzhi; Ma; Zhaoshi; Xu; Genping; Wang; Lanqin; Xia

    2013-01-01

    Aphids are major agricultural pests that cause significant yield losses in crop plants each year.(E)-β-farnesene(EβF) is the main or only component of an alarm pheromone involved in chemical communication within aphid species and particularly in the avoidance of predation. EβF also occurs in the essential oil of some plant species, and is catalyzed by EβF synthase. By using oligonucleotide primers designed from the known sequence of an EβF synthase gene from black peppermint(Mentha × piperita), two cDNA sequences, MaβFS1 and MaβFS2, were isolated from Asian peppermint(Mentha asiatica). Expression pattern analysis showed that the MaβFS1 gene exhibited higher expression in flowers than in roots, stems and leaves at the transcriptional level. Overexpression of MaβFS1 in tobacco plants resulted in emission of pure EβF ranging from 2.62 to 4.85 ng d-1g-1of fresh tissue. Tritrophic interactions involving peach aphids(Myzus persicae), and predatory lacewing(Chrysopa septempunctata) larvae demonstrated that transgenic tobacco expressing MaβFS1 had lower aphid infestation. This result suggested that the EβF synthase gene from Asian peppermint could be a good candidate for genetic engineering of agriculturally important crop plants.

  2. Functional analysis of the Phycomyces carRA gene encoding the enzymes phytoene synthase and lycopene cyclase.

    Directory of Open Access Journals (Sweden)

    Catalina Sanz

    Full Text Available Phycomyces carRA gene encodes a protein with two domains. Domain R is characterized by red carR mutants that accumulate lycopene. Domain A is characterized by white carA mutants that do not accumulate significant amounts of carotenoids. The carRA-encoded protein was identified as the lycopene cyclase and phytoene synthase enzyme by sequence homology with other proteins. However, no direct data showing the function of this protein have been reported so far. Different Mucor circinelloides mutants altered at the phytoene synthase, the lycopene cyclase or both activities were transformed with the Phycomyces carRA gene. Fully transcribed carRA mRNA molecules were detected by Northern assays in the transformants and the correct processing of the carRA messenger was verified by RT-PCR. These results showed that Phycomyces carRA gene was correctly expressed in Mucor. Carotenoids analysis in these transformants showed the presence of ß-carotene, absent in the untransformed strains, providing functional evidence that the Phycomyces carRA gene complements the M. circinelloides mutations. Co-transformation of the carRA cDNA in E. coli with different combinations of the carotenoid structural genes from Erwinia uredovora was also performed. Newly formed carotenoids were accumulated showing that the Phycomyces CarRA protein does contain lycopene cyclase and phytoene synthase activities. The heterologous expression of the carRA gene and the functional complementation of the mentioned activities are not very efficient in E. coli. However, the simultaneous presence of both carRA and carB gene products from Phycomyces increases the efficiency of these enzymes, presumably due to an interaction mechanism.

  3. Molecular cloning and characterization of three isoprenyl diphosphate synthase genes from alfalfa.

    Science.gov (United States)

    Sun, Yan; Long, Ruicai; Kang, Junmei; Zhang, Tiejun; Zhang, Ze; Zhou, He; Yang, Qingchuan

    2013-02-01

    Isoprenoid is the precursor for the biosynthesis of saponins, abscisic acid, gibberellins, chlorophylls and many other products in plants. Saponins are an important group of bioactive plant natural products. The alfalfa (Medicago sativa L.) saponins are glycosides of different triterpene aglycones and possess many biological activities. We isolated three genes (MsFPPS, MsGPPS and MsGGPPS) encoding isoprenyl diphosphate synthases (IDS) from alfalfa via a homology-based PCR approach. The enzyme activity assay of purified recombined MsFPPS and MsGGPPS expressed in Escherichia coli indicated that they all had IDS activity. Expression analysis of the three genes in different alfalfa tissues using real time PCR displayed that they were expressed in all tissues although they had a different expression patterns. MsFPPS and MsGPS displayed a significant increase in transcript level in response to methyl jasmonate, but the transcript level of MsGGPPS decreased obviously. To elucidate the functions of the three IDSs, their overexpression driven by a constitutive cauliflower mosaic virus-35S promoter in tobacco plants was applied and analyzed. The T(0) transgenic plants of MsFPPS showed high levels of squalene content when compared with control. However, no differences were detected in T(0) transgenic plants of MsGPPS and MsGGPPS. In addition, the overexpression of MsFPPS induced senescence response in transgenic plant leaves. This result may indicate that MsFPPS performs a role not only in phytosterol and triterpene biosynthesis, but also in growth regulation. PMID:23238915

  4. Citrat og nyresten

    DEFF Research Database (Denmark)

    Osther, P J

    1993-01-01

    Citrate is an important naturally occurring inhibitor of calcium stone formation in urine. Urinary citrate excretion was examined in 43 consecutive patients with recurrent idiopathic calcium nephrolithiasis and in 50 normal controls by a specific enzymatic technique. Hypocitraturia (<1.6 mmol/24h...

  5. Wounding stimulates ALLENE OXIDE SYNTHASE gene and increases the level of jasmonic acid in Ipomoea nil cotyledons

    Directory of Open Access Journals (Sweden)

    Emilia Wilmowicz

    2016-03-01

    Full Text Available Allene oxide synthase (AOS encodes the first enzyme in the lipoxygenase pathway, which is responsible for jasmonic acid (JA formation. In this study we report the molecular cloning and characterization of InAOS from Ipomoea nil. The full-length gene is composed of 1662 bp and encodes for 519 amino acids. The predicted InAOS contains PLN02648 motif, which is evolutionarily conserved and characteristic for functional enzymatic proteins. We have shown that wounding led to a strong stimulation of the examined gene activity in cotyledons and an increase in JA level, which suggest that this compound may be a modulator of stress responses in I. nil.

  6. Sequence of the bchG gene from Chloroflexus aurantiacus: relationship between chlorophyll synthase and other polyprenyltransferases

    Science.gov (United States)

    Lopez, J. C.; Ryan, S.; Blankenship, R. E.

    1996-01-01

    The sequence of the Chloroflexus aurantiacus open reading frame thought to be the C. aurantiacus homolog of the Rhodobacter capsulatus bchG gene is reported. The BchG gene product catalyzes esterification of bacteriochlorophyllide a by geranylgeraniol-PPi during bacteriochlorophyll a biosynthesis. Homologs from Arabidopsis thaliana, Synechocystis sp. strain PCC6803, and C. aurantiacus were identified in database searches. Profile analysis identified three related polyprenyltransferase enzymes which attach an aliphatic alcohol PPi to an aromatic substrate. This suggests a broader relationship between chlorophyll synthases and other polyprenyltransferases.

  7. Multiple resistance to sulfonylureas and imidazolinones conferred by an acetohydroxyacid synthase gene with separate mutations for selective resistance.

    Science.gov (United States)

    Hattori, J; Rutledge, R; Labbé, H; Brown, D; Sunohara, G; Miki, B

    1992-03-01

    The acetohydroxyacid synthase (AHAS) gene from the Arabidopsis thaliana mutant line GH90 carrying the imidazolinone resistance allele imr1 was cloned. Expression of the AHAS gene under the control of the CaMV 35S promoter in transgenic tobacco resulted in selective imidazolinone resistance, confirming that the single base-pair change found near the 3' end of the coding region of this gene is responsible for imidazolinone resistance. A chimeric AHAS gene containing both the imr1 mutation and the csr1 mutation, responsible for selective resistance to sulfonylurea herbicides, was constructed. It conferred on transgenic tobacco plants resistance to both sulfonylurea and imidazolinone herbicides. The data illustrate that a multiple-resistance phenotype can be achieved in an AHAS gene through combinations of separate mutations, each of which individually confers resistance to only one class of herbicides. PMID:1557022

  8. Transcripts for genes encoding soluble acid invertase and sucrose synthase accumulate in root tip and cortical cells containing mycorrhizal arbuscules.

    Science.gov (United States)

    Blee, Kristopher A; Anderson, Anne J

    2002-09-01

    Arbuscule formation by the arbuscular mycorrhizal fungus Glomus intraradices (Schenck & Smith) was limited to cortical cells immediately adjacent to the endodermis. Because these cortical cells are the first to intercept photosynthate exiting the vascular cylinder, transcript levels for sucrose metabolizing-enzymes were compared between mycorrhizal and non-mycorrhizal roots. The probes corresponded to genes encoding a soluble acid invertase with potential vacuolar targeting, which we generated from Phaseolus vulgaris roots, a Rhizobium-responsive sucrose synthase of soybean and a cell wall acid invertase of carrot. Transcripts in non-mycorrhizal roots were developmentally regulated and abundant in the root tips for all three probes but in differentiated roots of P. vulgaris they were predominantly located in phloem tissues for sucrose synthase or the endodermis and phloem for soluble acid invertase. In mycorrhizal roots increased accumulations of transcripts for sucrose synthase and vacuolar invertase were both observed in the same cortical cells bearing arbuscules that fluoresce. There was no effect on the expression of the cell wall invertase gene in fluorescent carrot cells containing arbuscules. Thus, it appears that presence of the fungal hyphae in the fluorescent arbusculated cell stimulates discrete alterations in expression of sucrose metabolizing enzymes to increase the sink potential of the cell. PMID:12175013

  9. Isolation of developing secondary xylem specific cellulose synthase genes and their expression profiles during hormone signalling in Eucalyptus tereticornis

    Indian Academy of Sciences (India)

    Balachandran Karpaga Raja Sundari; Modhumita Ghosh Dasgupta

    2014-08-01

    Cellulose synthases (CesA) represent a group of -1, 4 glycosyl transferases involved in cellulose biosynthesis. Recent reports in higher plants have revealed that two groups of CesA gene families exist, which are associated with either primary or secondary cell wall deposition. The present study aimed at identifying developing secondary xylem specific cellulose synthase genes from Eucalyptus tereticornis, a species predominantly used in paper and pulp industries in the tropics. The differential expression analysis of the three EtCesA genes using qRT-PCR revealed 49 to 87 fold relative expression in developing secondary xylem tissues. Three full length gene sequences of EtCesA1, EtCesA2 and EtCesA3 were isolated with the size of 2940, 3114 and 3123 bp, respectively. Phytohormone regulation of all three EtCesA genes were studied by exogenous application of gibberellic acid, naphthalene acetic acid, indole acetic acid and 2, 4-epibrassinolide in internode tissues derived from three-month-old rooted cuttings. All three EtCesA transcripts were upregulated by indole acetic acid and gibberellic acid. This study demonstrates that the increased cellulose deposition in the secondary wood induced by hormones can be attributed to the upregulation of xylem specific CesAs.

  10. Polymorphisms in the endothelial nitric oxide synthase gene in thalidomide embryopathy.

    Science.gov (United States)

    Vianna, Fernanda Sales Luiz; Fraga, Lucas Rosa; Tovo-Rodrigues, Luciana; Tagliani-Ribeiro, Alice; Biondi, Flavia; Maximino, Claudia Marques; Sanseverino, Maria Teresa Vieira; Hutz, Mara Helena; Schuler-Faccini, Lavínia

    2013-11-30

    Thalidomide is one of the most potent teratogens known to humans. It is currently used for many clinical situations such as treatment of leprosy reactions and multiple myeloma. However, the teratogenic mechanisms by which it produces morphological defects still remain unclear. One of the hypotheses is the blockage of angiogenesis by reduction of nitric oxide (NO). In this study, we evaluated two functional polymorphisms of the endothelial nitric oxide synthase (eNOS) gene which is a constitutively expressed enzyme responsible for production of NO. The promoter -786T>C exon 7 (896G>T) polymorphisms were genotyped using real-time PCR for 28 individuals with thalidomide embryopathy (TE), 27 first-degree relatives of these individuals, and 68 individuals from the general population. Their allele, genotypic, and haplotypic frequencies were compared. A significant difference was observed in the -786T>C polymorphism genotypes (p=0.03) between the groups affected by TE and those unaffected (non-relatives). The TT genotype of the 896G>T polymorphism was observed in 10.7% of those affected and 2.9% of those unaffected, but the difference was not statistically significant (p=0.09). The haplotypic analysis indicated that the wild haplotype -786T/896G was distributed differently in the affected and unaffected groups (p=0.004). These results indicate that the individuals with TE have a higher frequency of alleles associated with lower expression of eNOS, indicating that this may be a genotype susceptible to TE. PMID:24055736

  11. Pneumocystis jiroveci dihydropteroate synthase gene mutations among colonized individuals and Pneumocystis pneumonia patients from Spain.

    Science.gov (United States)

    Friaza, Vicente; Morilla, Rubén; Respaldiza, Nieves; de la Horra, Carmen; Calderón, Enrique J

    2010-11-01

    Cotrimoxazole, an association of trimethoprim and sulfamethoxazole, and dapsone, are mainstays for the prophylaxis and treatment of Pneumocystis pneumonia (PcP). The inability to culture Pneumocystis prevents routine susceptibility testing and detection of drug resistance. Instead, molecular techniques have been used to detect Pneumocystis jiroveci dihydropteroate synthase (DHPS) mutations that cause sulfa resistance in other microorganisms. The most frequent DHPS mutations occur at nucleotide positions 165 and 171, which lead to an amino acid change at positions 55 and 57. Several studies suggest that these mutations are associated with the failure of chemoprophylaxis for PcP. The aim was to establish the frequency and characteristics of P jiroveci DHPS mutations among colonized individuals and PcP patients from Spain. A total of 50 colonized individuals and 25 PcP patients were studied. DHPS polymorphisms were identified by restriction fragment length polymorphism assay. The analysis provided a rate of 28% of DHPS gene mutations in our population, with the presence of all possible polymorphisms described. The presence of mutations was higher in PcP patients than in colonized subjects (40% vs 22%), probably because of the chemoprophylaxis used in PcP patients. The comparison between patients with and without DHPS mutations did not show statistical differences due to age, sex, steroid use, sulfa drug exposure, or smoking. A high rate of DHPS mutations in our area of Spain, not only confined to patients previously exposed to sulfa drugs, is shown in this study. As well as PcP patients, colonized individuals who harbor P jiroveci strains with DHPS mutations could play a major role in the transmission cycle of these mutations, representing a reservoir and source of infection for susceptible individuals. Further research is thus warranted to assess the true scope of the problem and to design rational preventive strategies. PMID:21084778

  12. Citrus nobiletin suppresses inducible nitric oxide synthase gene expression in interleukin-1β-treated hepatocytes

    International Nuclear Information System (INIS)

    Highlights: •Nobiletin is a polymethoxylated flavone that is abundant in citrus peels. •Nobiletin is a major constituent of the Citrus unshiu peel extract. •Nobiletin suppresses induction of NO and reduces iNOS expression in hepatocytes. •Nobiletin reduces the iNOS promoter activity and the DNA-binding activity of NF-κB. -- Abstract: Background: Nobiletin is a polymethoxylated flavone that is abundant in the peels of citrus fruits, such as Citrus unshiu (Satsuma mandarin) and Citrus sinensis. The dried peels of C. unshiu (chinpi) have been included in several formulae of Japanese Kampo medicines. Nobiletin may suppress the induction of inducible nitric oxide synthase (iNOS), which synthesizes the inflammatory mediator nitric oxide (NO) in hepatocytes. Methods: A C. unshiu peel (CUP) extract was prepared. Primary cultured rat hepatocytes were treated with the CUP extract or nobiletin in the presence of interleukin 1β (IL-1β), which induces iNOS expression. NO production and iNOS gene expression were analyzed. Results: High-performance liquid chromatography analyses revealed that the nobiletin content in the CUP extract was 0.14%. Nobiletin dose-dependently reduced the NO levels and decreased iNOS expression at the protein, mRNA and antisense transcript levels. Flavone, which does not contain any methoxy groups, also suppressed iNOS induction. Nobiletin reduced the transcriptional activity of iNOS promoter-luciferase constructs and the DNA-binding activity of nuclear factor κB (NF-κB) in the nuclei. Conclusions: The suppression of iNOS induction by nobiletin suggests that nobiletin may be responsible for the anti-inflammatory effects of citrus peels and have a therapeutic potential for liver diseases

  13. Citrus nobiletin suppresses inducible nitric oxide synthase gene expression in interleukin-1β-treated hepatocytes

    Energy Technology Data Exchange (ETDEWEB)

    Yoshigai, Emi [Department of Biomedical Sciences, College of Life Sciences, Kusatsu, Shiga (Japan); Ritsumeikan Global Innovation Research Organization (R-GIRO), Kusatsu, Shiga (Japan); Machida, Toru [Department of Biomedical Sciences, College of Life Sciences, Kusatsu, Shiga (Japan); Okuyama, Tetsuya [Ritsumeikan Global Innovation Research Organization (R-GIRO), Kusatsu, Shiga (Japan); Mori, Masatoshi; Murase, Hiromitsu; Yamanishi, Ryota [Department of Biomedical Sciences, College of Life Sciences, Kusatsu, Shiga (Japan); Okumura, Tadayoshi [Research Organization of Science and Technology, Ritsumeikan University, Kusatsu, Shiga (Japan); Department of Surgery, Kansai Medical University, Hirakata, Osaka (Japan); Ikeya, Yukinobu [Department of Pharmacy, College of Pharmaceutical Sciences, Ritsumeikan University, Kusatsu, Shiga (Japan); Nishino, Hoyoku [Ritsumeikan Global Innovation Research Organization (R-GIRO), Kusatsu, Shiga (Japan); Department of Biochemistry, Kyoto Prefectural University of Medicine, Kyoto (Japan); Nishizawa, Mikio, E-mail: nishizaw@sk.ritsumei.ac.jp [Department of Biomedical Sciences, College of Life Sciences, Kusatsu, Shiga (Japan)

    2013-09-13

    Highlights: •Nobiletin is a polymethoxylated flavone that is abundant in citrus peels. •Nobiletin is a major constituent of the Citrus unshiu peel extract. •Nobiletin suppresses induction of NO and reduces iNOS expression in hepatocytes. •Nobiletin reduces the iNOS promoter activity and the DNA-binding activity of NF-κB. -- Abstract: Background: Nobiletin is a polymethoxylated flavone that is abundant in the peels of citrus fruits, such as Citrus unshiu (Satsuma mandarin) and Citrus sinensis. The dried peels of C. unshiu (chinpi) have been included in several formulae of Japanese Kampo medicines. Nobiletin may suppress the induction of inducible nitric oxide synthase (iNOS), which synthesizes the inflammatory mediator nitric oxide (NO) in hepatocytes. Methods: A C. unshiu peel (CUP) extract was prepared. Primary cultured rat hepatocytes were treated with the CUP extract or nobiletin in the presence of interleukin 1β (IL-1β), which induces iNOS expression. NO production and iNOS gene expression were analyzed. Results: High-performance liquid chromatography analyses revealed that the nobiletin content in the CUP extract was 0.14%. Nobiletin dose-dependently reduced the NO levels and decreased iNOS expression at the protein, mRNA and antisense transcript levels. Flavone, which does not contain any methoxy groups, also suppressed iNOS induction. Nobiletin reduced the transcriptional activity of iNOS promoter-luciferase constructs and the DNA-binding activity of nuclear factor κB (NF-κB) in the nuclei. Conclusions: The suppression of iNOS induction by nobiletin suggests that nobiletin may be responsible for the anti-inflammatory effects of citrus peels and have a therapeutic potential for liver diseases.

  14. Heterologous expression and product identification of Colletotrichum lagenarium polyketide synthase encoded by the PKS1 gene involved in melanin biosynthesis.

    Science.gov (United States)

    Fujii, I; Mori, Y; Watanabe, A; Kubo, Y; Tsuji, G; Ebizuka, Y

    1999-08-01

    The Colletotrichum lagenarium PKS1 gene was expressed in the heterologous fungal host, Aspergillus oryzae, under the starch-inducible alpha-amylase promoter to identify the direct product of polyketide synthase (PKS) encoded by the PKS1 gene. The main compound produced by an A. oryzae transformant was isolated and characterized to be 1,3,6,8-tetrahydroxynaphthalene (T4HN) as its tetraacetate. Since the PKS1 gene was cloned from C. lagenarium to complement the nonmelanizing albino mutant, T4HN was assumed to be an initial biosynthetic intermediate, and thus the product of the PKS reaction, but had not been isolated from the fungus. The production of T4HN by the PKS1 transformant unambiguously identified the gene to encode a PKS of pentaketide T4HN. In addition, tetraketide orsellinic acid and pentaketide isocoumarin were isolated, the latter being derived from a pentaketide monocyclic carboxylic acid, as by-products of the PKS1 PKS reaction. Production of the pentaketide carboxylic acid provided insights into the mechanism for the PKS1 polyketide synthase reaction to form T4HN. PMID:10501004

  15. pks63787, a Polyketide Synthase Gene Responsible for the Biosynthesis of Benzenoids in the Medicinal Mushroom Antrodia cinnamomea.

    Science.gov (United States)

    Yu, Po-Wei; Chang, Ya-Chih; Liou, Ruey-Fen; Lee, Tzong-Huei; Tzean, Shean-Shong

    2016-06-24

    Antrodia cinnamomea, a unique resupinate basidiomycete endemic to Taiwan, has potent medicinal activities. The reddish basidiocarps and mycelia generally exhibit abundant metabolites and higher biological activity. To investigate the pigments of A. cinnamomea, polyketide synthase (PKS) genes were characterized based on its partially deciphered genome and the construction of a fosmid library. Furthermore, a gene disruption platform was established via protoplast transformation and homologous recombination. Of four putative polyketide synthase genes, pks63787 was selected and disrupted in the monokaryotic wild-type (wt) strain f101. Transformant Δpks63787 was deficient in the synthesis of several aromatic metabolites, including five benzenoids and two benzoquinone derivatives. Based on these results, a biosynthetic pathway for benzenoid derivatives was proposed. The pks63787 deletion mutant not only displayed a reduced red phenotype compared to the wt strain but also displayed less 1,1-biphenyl-2-picrylhydrazyl free radical scavenging activity. This finding suggests that PKS63787 is responsible for the biosynthesis of pigments and metabolites related to the antioxidant activity of A. cinnamomea. The present study focuses on the functional characterization of the PKS gene, the fluctuations of its profile of secondary metabolites, and interpretation of the biosynthesis of benzenoids. PMID:27227778

  16. Identification of the trehalose-6-phosphate synthase gene family in winter wheat and expression analysis under conditions of freezing stress

    Indian Academy of Sciences (India)

    D. W. Xie; X. N. Wang; L. S. Fu; J. Sun; W. Zheng; Z. F. Li

    2015-03-01

    Trehalose plays an important role in metabolic regulation and abiotic stress tolerance in plants. Trehalose contents are potentially modulated by trehalose-6-phosphate synthase (TPS), which is a key enzyme in the trehalose biosynthetic pathway. Using available wheat expressed sequence tag sequence information from NCBI and two wheat genome databases, we identified 12 wheat TPS genes and performed a comprehensive study on their structural, evolutionary and functional properties. The estimated divergence time of wheat TPS gene pairs and wheat–rice orthologues suggested that wheat and rice have a common ancestor. The number of TPS genes in the wheat genome was estimated to be at least 12, which is close to the number found in rice, Arabidopsis and soybean. Moreover, it has been reported earlier in other plants that TPS genes respond to abiotic stress, however, our study mainly analysed the TPS gene family under freezing conditions in winter wheat, and determined that most of the TPS gene expression in winter wheat was induced by freezing conditions, which further suggested that wheat TPS genes were involved in winter wheat freeze-resistance signal transduction pathways. Taken together, the current study represents the first comprehensive study of TPS genes in winter wheat and provides a foundation for future functional studies of this important gene family in Triticeae.

  17. Polyketide genes in the marine sponge Plakortis simplex: a new group of mono-modular type I polyketide synthases from sponge symbionts

    OpenAIRE

    Della Sala, Gerardo; Hochmuth, Thomas; Costantino, Valeria; Teta, Roberta; Gerwick, William; Gerwick, Lena; Piel, Jörn; Mangoni, Alfonso

    2013-01-01

    Summary Sponge symbionts are a largely unexplored source of new and unusual metabolic pathways. Insights into the distribution and function of metabolic genes of sponge symbionts are crucial to dissect and exploit their biotechnological potential. Screening of the metagenome of the marine sponge Plakortis simplex led to the discovery of the swf family, a new group of mono-modular type I polyketide synthase/fatty acid synthase (PKS/FAS) specifically associated with sponge symbionts. Two differ...

  18. Ethylene Production and 1-Aminocyclopropane-1-Carboxylate (ACC) Synthase Gene Expression in Tomato(Lycopsicon esculentum Mill.) Leaves Under Enhanced UV-B Radiation

    Institute of Scientific and Technical Information of China (English)

    Lizhe An; Xunling Wang; Xiaofeng Xu; Hongguan Tang; Manxiao Zhang; Zongdong Hou; Yanhong Liu; Zhiguang Zhao; Huyuan Feng; Shijian Xu

    2006-01-01

    Tomato (Lycopsicon esculentum Mill.) plants grown in a greenhouse were irradiated with two different levels of UV-B, namely 8.82 (T1) and 12.6 kJ/m2 per day (T2). Ethylene production, 1-aminocyclopropane-1carboxylate (ACC) content, 1-(malonylamino) cyclopvopane-1-carboxylic acid (MACC) content, gene expression of ACC synthase (EC 4.4.1.14), and ACC oxidase activity in tomato leaves were determined. The results indicated that ACC content, the activity of ACC synthase and ACC oxidase, and ethylene production increased continuously under low doses of UV-B radiation, whereas at high doses of radiation these parameters increased during the first 12 d and then started to decrease. The MACC content increased continuously over 18 d under both doses of UV-B irradiation. The changes in ACC content, ACC synthase activity,ACC oxidase activity, the transcriptional level of the ACC synthase gene, and ethylene production were consistent with each other, suggesting that ACC synthase was the key enzyme in ethylene biosynthesis and that ethylene production in tomato leaf tissues under UV-B radiation could be regulated by the expression of the ACC synthase gene. The results also indicate that the change in ethylene metabolism may be an adaptive mechanism to enhanced UV-B radiation.

  19. Association of Polymorphism of Neuronal Nitric Oxide Synthase Gene with Risk to Parkinson's Disease.

    Science.gov (United States)

    Gupta, Satya Prakash; Kamal, Ritul; Mishra, Sarad Kumar; Singh, Maneesh Kumar; Shukla, Rakesh; Singh, Mahendra Pratap

    2016-07-01

    Environmental factors are implicated in aging as well as genetic predisposition-induced Parkinson's disease (PD) pathogenesis. Wrongdoers increase oxidative stress and nitrosative burden, which eventually degenerate the nigrostriatal dopaminergic neurons. Inhibition of the expression of nitric oxide synthase (NOS), an enzyme responsible for nitric oxide (NO) biosynthesis, prevents the demise of the nigrostriatal dopaminergic neurons. Polymorphism of NOS is thus expected to alter PD susceptibility. The study therefore aimed to examine an association of neuronal NOS (nNOS) gene polymorphism with nitrite, an indicator of nitrosative load; lipid peroxidation, an index of oxidative stress and PD susceptibility. An age-matched case-control study was performed in the north Indian residents enrolled at the Neurology Department of the King George's Medical University, Lucknow, India. While nNOS exon 29 TT variant genotype [odds ratio (OR) = 2.20, 95 % CI = 1.08-5.34, P = 0.040], combined TT and CT variants [OR = 1.68, 95 % CI = 1.05-2.69, P = 0.031] and T allele [OR = 1.58, 95 % CI = 1.10-2.28, P = 0.014] were found to be significantly associated with PD susceptibility, no association between nNOS exon 18 [OR for TT carriers = 1.97, 95 % CI = 0.89-4.20, P = 0.09 and OR for T allele = 1.35, 95 % CI = 0.94-1.93, P = 0.098] and PD risk was observed. Lipid peroxidation was augmented in all patients irrespective of their genotype. While genotype independent increase in nitrite content was observed in PD patients of exon 29 polymorphic groups, only heterozygous variant genotype of exon 18 was associated with augmentation in nitrite level as compared with respective control. The results obtained thus demonstrate that selected nNOS polymorphisms do not significantly contribute to PD risk in north Indian population. PMID:26081147

  20. Cloning and characterization of novel methylsalicylic acid synthase gene involved in the biosynthesis of isoasperlactone and asperlactone in Aspergillus westerdijkiae

    International Nuclear Information System (INIS)

    Aspergillus westerdijkiae is the main producer of several biologically active polyketide metabolites including isoasperlactone and asperlactone. A 5298 bp polyketide synthase gene ''aomsas'' has been cloned in Aspergillus westerdijkiae by using gene walking approach and RACE-PCR. The predicted amino acid sequence of aomsas shows an identity of 40-56% with different methylsalicylic acid synthase genes found in Byssochlamys nivea, P. patulum, A. terreus and Streptomyces viridochromogenes. Based on the reverse transcription PCR and kinetic secondary metabolites production studies, aomsas expression was found to be associated with the biosynthesis of isoasperlactone and asperlactone. Moreover an aomsas knockout mutant ''aomsas'' of A. westerdijkiae, not only lost the capacity to produce isoasperlactone and asperlactone, but also 6-methylsalicylic acid. The genetically complemented mutant aomsas restored the biosynthesis of all the missing metabolites. Chemical complementation through the addition of 6-methylsalicylic acid, aspyrone and diepoxide to growing culture of aomsas mutant revealed that these compounds play intermediate roles in the biosynthesis of asperlactone and isoasperlactone. (author)

  1. Relationships between endothelial nitric oxide synthase gene polymorphisms and osteoporosis in postmenopausal women

    Institute of Scientific and Technical Information of China (English)

    Shun-zhi LIU; Hong YAN; Wei-kun HOU; Peng XU; Juan TUN; Li-fang TIAN; Bo-feng ZHU; Jie MA; She-min LU

    2009-01-01

    Objective: To investigate the relationships between endothelial nitric oxide synthases (eNOS) G894T and 27 bp-variable number tandem repeat (VNTR) gene polymorphisms and osteoporosis in the postmenopausal women of Chinese Han nationality. Methods: In the present study, 281 postmenopausal women from Xi'an urban area in West China were recruited, and divided into osteoporosis, osteopenia, and normal groups according to the diagnostic criteria of osteoporosis proposed by World Health Organization (WHO). The bone mineral density (BMD) values of lumbar vertebrae and left hips were determined by QDR-2000 dual energy X-ray absorptiometry. Blood samples were tested for plasma biochemical indicators including testosterone, estradiol, calcitonin, osteocalcin, and procollagen type I amino-terminal propeptide by enzyme-linked immunosorbent assay (ELISA), tartrate-resistant acid phosphatase by spectrophotometric method, and the content of nitric oxide by Griess method. Genome DNA was extracted from whole blood, and G894T polymorphism of eNOS gene was analyzed by using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method and 27 bp-VNTR polymorphism of eNOS gene was genotyped by PCR method. Then the relationships between genotypes and biochemical indicators, genotypes and osteoporosis, and haplotypes and osteoporosis were analyzed. Results: The average BMD values of the femoral neck, ward's triangle and lumbar vertebrae 1~4 (L1~L4) in the subjects with T/T genotype in eNOS G894T locus were significantly higher than those in the subjects with G/T and G/G genotypes (P<0.05). The average BMD of the femoral neck in the subjects with a/a genotype of eNOS 27 bp-VNTR locus was evidently higher than that in the subjects with b/b genotype (P<0.05). The plasma testosterone and osteocalcin concentrations in the subjects of eNOS G894T G/T genotype were evidently higher than those in the subjects of other genotypes (P<0.05); the plasma estradiol

  2. Agrobacterium mediated transfer of a mutant Arabidopsis acetolactate synthase gene confers resistance to chlorsulfuron in chicory (Cichorium intybus L.).

    Science.gov (United States)

    Vermeulen, A; Vaucheret, H; Pautot, V; Chupeau, Y

    1992-06-01

    Leaf discs of C. intybus were inoculated with an Agrobacterium tumefaciens strain harboring a neomycin phosphotransferase (neo) gene for kanamycin resistance and a mutant acetolactate synthase gene (csr1-1) from Arabidopsis thaliana conferring resistance to sulfonylurea herbicides. A regeneration medium was optimized which permitted an efficient shoot regeneration from leaf discs. Transgenic shoots were selected on rooting medium containing 100 mg/l kanamycin sulfate. Integration of the csr1-1 gene into genomic DNA of kanamycin resistant chicory plants was confirmed by Southern blot hybridizations. Analysis of the selfed progenies (S1 and S2) of two independent transformed clones showed that kanamycin and chlorsulfuron resistances were inherited as dominant Mendelian traits. The method described here for producing transformed plants will allow new opportunities for chicory breeding. PMID:24203132

  3. Gastrointestinal citrate absorption in nephrolithiasis

    Science.gov (United States)

    Fegan, J.; Khan, R.; Poindexter, J.; Pak, C. Y.

    1992-01-01

    Gastrointestinal absorption of citrate was measured in stone patients with idiopathic hypocitraturia to determine if citrate malabsorption could account for low urinary citrate. Citrate absorption was measured directly from recovery of orally administered potassium citrate (40 mEq.) in the intestinal lavage fluid, using an intestinal washout technique. In 7 stone patients citrate absorption, serum citrate levels, peak citrate concentration in serum and area under the curve were not significantly different from those of 7 normal subjects. Citrate absorption was rapid and efficient in both groups, with 96 to 98% absorbed within 3 hours. The absorption of citrate was less efficient from a tablet preparation of potassium citrate than from a liquid preparation, probably due to a delayed release of citrate from wax matrix. However, citrate absorption from solid potassium citrate was still high at 91%, compared to 98% for a liquid preparation. Thus, hypocitraturia is unlikely to be due to an impaired gastrointestinal absorption of citrate in stone patients without overt bowel disease.

  4. Cloning and Expression of Poly(hydroxyalkanoate) Synthase Genes from Photosynthetic bacterium Allochromatium vinosum ATCC 35206

    Science.gov (United States)

    Poly(hydroxyalkanoate) (PHA) synthases catalyze the polymerization of beta-hydroxy fatty acids to form PHA biopolyesters. These enzymes are grouped into four classes (classes I to IV) based on their subunit composition and substrate specificity. Since PHA biopolymers are naturally synthesized by b...

  5. COMPLEMENTATION OF THE AMYLOSE-FREE STARCH MUTANT OF POTATO (SOLANUM-TUBEROSUM) BY THE GENE ENCODING GRANULE-BOUND STARCH SYNTHASE

    NARCIS (Netherlands)

    VANDERLEIJ, FR; VISSER, RGF; OOSTERHAVEN, K; VANDERKOP, DAM; JACOBSEN, E; FEENSTRA, WJ

    1991-01-01

    Agrobacterium rhizogenes-mediated introduction of the wild-type allele of the gene encoding granule-bound starch synthase (GBSS) into the amylose-free starch mutant amf of potato leads to restoration of GBSS activity and amylose synthesis, which demonstrates that Amf is the structural gene for GBSS.

  6. Genetic Diversity of Polyketide Synthase/Nonribosomal Peptide Synthetase Genes in Isolates of the Barley Net Blotch Fungus Pyrenophora teres f. teres

    Science.gov (United States)

    Polyketide synthases (PKSs) and nonribosomal peptide synthetases (NRPSs) are multifunctional enzymes responsible for biosynthesis of diverse small molecules (e.g., mycotoxins and phytotoxins) in filamentous ascomycetes. Both PKS and NRPS genes are present in fungal genomes as large gene families but...

  7. Characterization of the Saccharomyces cerevisiae ARG7 gene encoding ornithine acetyltransferase, an enzyme also endowed with acetylglutamate synthase activity.

    Science.gov (United States)

    Crabeel, M; Abadjieva, A; Hilven, P; Desimpelaere, J; Soetens, O

    1997-12-01

    We have cloned by functional complementation and characterized the yeast ARG7 gene encoding mitochondrial ornithine acetyltransferase, the enzyme catalyzing the fifth step in arginine biosynthesis. While forming ornithine, this enzyme regenerates acetylglutamate, also produced in the first step by the ARG2-encoded acetylglutamate synthase. Interestingly, total deletion of the genomic ARG7 ORF resulted in an arginine-leaky phenotype, indicating that yeast cells possess an alternative route for generating ornithine from acetylornithine. Yeast ornithine acetyltransferase has been purified and characterized previously as a heterodimer of two subunits proposed to derive from a single precursor protein [Liu, Y-S., Van Heeswijck R., Hoj, P. & Hoogenraad, N. (1995) Eur. J. Biochem. 228, 291-296]; those authors further suggested that the internal processing of Arg7p, which is a mitochondrial enzyme, might occur in the matrix, while the leader peptide would be of the non-cleavable-type. The characterization of the gene (a) establishes that Arg7p is indeed encoded by a single gene, (b) demonstrates the existence of a cleaved mitochondrial prepeptide of eight residues, and (c) shows that the predicted internal processing site is unlike the mitochondrial proteolytic peptidase target sequence. Yeast Arg7p shares between 32-43% identity in pairwise comparisons with the ten analogous bacterial ArgJ enzymes characterized. Among these evolutionarily related enzymes, some but not all appear bifunctional, being able to produce acetylglutamate not only from acetylornithine but also from acetyl-CoA, thus catalyzing the same reaction as the apparently unrelated acetylglutamate synthase. We have addressed the question of the bifunctionality of the eucaryotic enzyme, showing that overexpressed ARG7 can complement yeast arg2 and Escherichia coli argA mutations (affecting acetylglutamate synthase). Furthermore, Arg7p-linked acetylglutamate synthase activity was measurable in an assay. The

  8. Cloning and Characterization of a Salt Tolerance-Associated Gene Encoding Trehalose-6-Phosphate Synthase in Sweetpotato

    Institute of Scientific and Technical Information of China (English)

    JIANG Tao; ZHAI Hong; WANG Fei-bing; ZHOU Hua-nan; SI Zeng-zhi; HE Shao-zhen; LIU Qing-chang

    2014-01-01

    Trehalose plays an important role in metabolic regulation and abiotic stress tolerance in a variety of organisms. In plants, its biosynthesis is catalyzed by two key enzymes:trehalose-6-phosphate synthase (TPS) and trehalose-6-phosphate phosphatase (TPP). In the present study, a TPS gene, named IbTPS, was ifrst isolated from sweetpotato (Ipomoea batatas (L.) Lam.) cv. Lushu 3 by rapid ampliifcation of cDNA ends (RACE). The open reading frame (ORF) contained 2 580 nucleotides encoding 859 amino acids with a molecular weight of 97.433 kDa and an isoelectric point (pI) of 5.7. The deduced amino acid sequence showed high identities with TPS of other plants. Real-time quantitative PCR analysis revealed that the expression level of IbTPS gene was signiifcantly higher in stems of Lushu 3 than in its leaves and roots. Subcellular localization analysis in onion epidermal cells indicated that IbTPS gene was located in the nucleus. Transgenic tobacco (cv. Wisconsin 38) plants over-expressing IbTPS gene exhibited signiifcantly higher salt tolerance compared with the control plant. Trehalose and proline content was found to be signiifcantly more accumulated in transgenic tobacco plants than in the wild-type and several stress tolerance related genes were up-regulated. These results suggest that IbTPS gene may enhance salt tolerance of plants by increasing the amount of treahalose and proline and regulating the expression of stress tolerance related genes.

  9. A WDR Gene Is a Conserved Member of a Chitin Synthase Gene Cluster and Influences the Cell Wall in Aspergillus nidulans

    Science.gov (United States)

    Guerriero, Gea; Silvestrini, Lucia; Obersriebnig, Michael; Hausman, Jean-Francois; Strauss, Joseph; Ezcurra, Inés

    2016-01-01

    WD40 repeat (WDR) proteins are pleiotropic molecular hubs. We identify a WDR gene that is a conserved genomic neighbor of a chitin synthase gene in Ascomycetes. The WDR gene is unique to fungi and plants, and was called Fungal Plant WD (FPWD). FPWD is within a cell wall metabolism gene cluster in the Ascomycetes (Pezizomycotina) comprising chsD, a Chs activator and a GH17 glucanase. The FPWD, AN1556.2 locus was deleted in Aspergillus nidulans strain SAA.111 by gene replacement and only heterokaryon transformants were obtained. The re-annotation of Aspergilli genomes shows that AN1556.2 consists of two tightly linked separate genes, i.e., the WDR gene and a putative beta-flanking gene of unknown function. The WDR and the beta-flanking genes are conserved genomic neighbors localized within a recently identified metabolic cell wall gene cluster in genomes of Aspergilli. The heterokaryons displayed increased susceptibility to drugs affecting the cell wall, and their phenotypes, observed by optical, confocal, scanning electron and atomic force microscopy, suggest cell wall alterations. Quantitative real-time PCR shows altered expression of some cell wall-related genes. The possible implications on cell wall biosynthesis are discussed. PMID:27367684

  10. Characterization and transcription studies of a phytochelatin synthase gene from the solitary tunicate Ciona intestinalis exposed to cadmium

    Energy Technology Data Exchange (ETDEWEB)

    Franchi, Nicola [Department of Biology, University of Padova, Padova (Italy); Department of Biological, Chemical, Pharmaceutical Science and Technology, University of Palermo, Palermo (Italy); Piccinni, Ester [Department of Biology, University of Padova, Padova (Italy); Ferro, Diana [Department of Biology, University of Padova, Padova (Italy); Institute for Evolution and Biodiversity, Westfälische Wilhelms-Universität, Münster (Germany); Basso, Giuseppe [Department of Woman and Child Health, University of Padova, Padova (Italy); Spolaore, Barbara [CRIBI Biotechnology Centre, University of Padova, Padova (Italy); Department of Pharmaceutical and Pharmacological Sciences, University of Padova, Padova (Italy); Santovito, Gianfranco, E-mail: gianfranco.santovito@unipd.it [Department of Biology, University of Padova, Padova (Italy); Ballarin, Loriano [Department of Biology, University of Padova, Padova (Italy)

    2014-07-01

    Highlights: • Ciona intestinalis have a functional phytochelatin synthase (PCS) gene (cipcs). • CiPCS amino acid sequence is phylogentically related to other metazoan PCSs. • CiPCS catalyze the synthesis of PC2. • cipcs are mostly transcribed in circulating hemocytes, in both tunic and blood lacunae. • Cadmium exposure results in a significant increase of cipcs and cipcna transcription. - Abstract: The major thiol-containing molecules involved in controlling the level of intracellular ROS in eukaryotes, acting as a nonenzymatic detoxification system, are metallothioneins (MTs), glutathione (GSH) and phytochelatins (PCs). Both MTs and GSH are well-known in the animal kingdom. PC was considered a prerogative of the plant kingdom but, in 2001, a phytochelatin synthase (PCS) gene was described in the nematode Caenorhabditis elegans; additional genes encoding this enzyme were later described in the earthworm Eisenia fetida and in the parasitic nematode Schistosoma mansoni but scanty data are available, up to now, for Deuterostomes. Here, we describe the molecular characteristics and transcription pattern, in the presence of Cd, of a PCS gene from the invertebrate chordate Ciona intestinalis, a ubiquitous solitary tunicate and demonstrate the presence of PCs in tissue extracts. We also studied mRNA localization by in situ hybridization. In addition, we analyzed the behavior of hemocytes and tunic cells consequent to Cd exposure as well as the transcription pattern of the Ciona orthologous for proliferating cell nuclear antigen (PCNA), usually considered a proliferation marker, and observed that cell proliferation occurs after 96 h of Cd treatment. This matches the hypothesis of Cd-induced cell proliferation, as already suggested by previous data on the expression of a metallothionein gene in the same animal.

  11. Characterization and transcription studies of a phytochelatin synthase gene from the solitary tunicate Ciona intestinalis exposed to cadmium

    International Nuclear Information System (INIS)

    Highlights: • Ciona intestinalis have a functional phytochelatin synthase (PCS) gene (cipcs). • CiPCS amino acid sequence is phylogentically related to other metazoan PCSs. • CiPCS catalyze the synthesis of PC2. • cipcs are mostly transcribed in circulating hemocytes, in both tunic and blood lacunae. • Cadmium exposure results in a significant increase of cipcs and cipcna transcription. - Abstract: The major thiol-containing molecules involved in controlling the level of intracellular ROS in eukaryotes, acting as a nonenzymatic detoxification system, are metallothioneins (MTs), glutathione (GSH) and phytochelatins (PCs). Both MTs and GSH are well-known in the animal kingdom. PC was considered a prerogative of the plant kingdom but, in 2001, a phytochelatin synthase (PCS) gene was described in the nematode Caenorhabditis elegans; additional genes encoding this enzyme were later described in the earthworm Eisenia fetida and in the parasitic nematode Schistosoma mansoni but scanty data are available, up to now, for Deuterostomes. Here, we describe the molecular characteristics and transcription pattern, in the presence of Cd, of a PCS gene from the invertebrate chordate Ciona intestinalis, a ubiquitous solitary tunicate and demonstrate the presence of PCs in tissue extracts. We also studied mRNA localization by in situ hybridization. In addition, we analyzed the behavior of hemocytes and tunic cells consequent to Cd exposure as well as the transcription pattern of the Ciona orthologous for proliferating cell nuclear antigen (PCNA), usually considered a proliferation marker, and observed that cell proliferation occurs after 96 h of Cd treatment. This matches the hypothesis of Cd-induced cell proliferation, as already suggested by previous data on the expression of a metallothionein gene in the same animal

  12. Functional genomics reveals that a compact terpene synthase gene family can account for terpene volatile production in apple.

    Science.gov (United States)

    Nieuwenhuizen, Niels J; Green, Sol A; Chen, Xiuyin; Bailleul, Estelle J D; Matich, Adam J; Wang, Mindy Y; Atkinson, Ross G

    2013-02-01

    Terpenes are specialized plant metabolites that act as attractants to pollinators and as defensive compounds against pathogens and herbivores, but they also play an important role in determining the quality of horticultural food products. We show that the genome of cultivated apple (Malus domestica) contains 55 putative terpene synthase (TPS) genes, of which only 10 are predicted to be functional. This low number of predicted functional TPS genes compared with other plant species was supported by the identification of only eight potentially functional TPS enzymes in apple 'Royal Gala' expressed sequence tag databases, including the previously characterized apple (E,E)-α-farnesene synthase. In planta functional characterization of these TPS enzymes showed that they could account for the majority of terpene volatiles produced in cv Royal Gala, including the sesquiterpenes germacrene-D and (E)-β-caryophyllene, the monoterpenes linalool and α-pinene, and the homoterpene (E)-4,8-dimethyl-1,3,7-nonatriene. Relative expression analysis of the TPS genes indicated that floral and vegetative tissues were the primary sites of terpene production in cv Royal Gala. However, production of cv Royal Gala floral-specific terpenes and TPS genes was observed in the fruit of some heritage apple cultivars. Our results suggest that the apple TPS gene family has been shaped by a combination of ancestral and more recent genome-wide duplication events. The relatively small number of functional enzymes suggests that the remaining terpenes produced in floral and vegetative and fruit tissues are maintained under a positive selective pressure, while the small number of terpenes found in the fruit of modern cultivars may be related to commercial breeding strategies. PMID:23256150

  13. Functional Genomics Reveals That a Compact Terpene Synthase Gene Family Can Account for Terpene Volatile Production in Apple1[W

    Science.gov (United States)

    Nieuwenhuizen, Niels J.; Green, Sol A.; Chen, Xiuyin; Bailleul, Estelle J.D.; Matich, Adam J.; Wang, Mindy Y.; Atkinson, Ross G.

    2013-01-01

    Terpenes are specialized plant metabolites that act as attractants to pollinators and as defensive compounds against pathogens and herbivores, but they also play an important role in determining the quality of horticultural food products. We show that the genome of cultivated apple (Malus domestica) contains 55 putative terpene synthase (TPS) genes, of which only 10 are predicted to be functional. This low number of predicted functional TPS genes compared with other plant species was supported by the identification of only eight potentially functional TPS enzymes in apple ‘Royal Gala’ expressed sequence tag databases, including the previously characterized apple (E,E)-α-farnesene synthase. In planta functional characterization of these TPS enzymes showed that they could account for the majority of terpene volatiles produced in cv Royal Gala, including the sesquiterpenes germacrene-D and (E)-β-caryophyllene, the monoterpenes linalool and α-pinene, and the homoterpene (E)-4,8-dimethyl-1,3,7-nonatriene. Relative expression analysis of the TPS genes indicated that floral and vegetative tissues were the primary sites of terpene production in cv Royal Gala. However, production of cv Royal Gala floral-specific terpenes and TPS genes was observed in the fruit of some heritage apple cultivars. Our results suggest that the apple TPS gene family has been shaped by a combination of ancestral and more recent genome-wide duplication events. The relatively small number of functional enzymes suggests that the remaining terpenes produced in floral and vegetative and fruit tissues are maintained under a positive selective pressure, while the small number of terpenes found in the fruit of modern cultivars may be related to commercial breeding strategies. PMID:23256150

  14. Expression in Arabidopsis of a Strawberry Linalool Synthase Gene Under the Control of the Inducible Potato P12 Promoter

    Institute of Scientific and Technical Information of China (English)

    YANG Li-mei; Per Mercke; Joop J A van Loon; FANG Zhi-yuan; Marcel Dicke; Maarten A Jongsma

    2008-01-01

    To investigate the role of inducible linalool in Arabidopsis-insect interactions, the FANESl linalool synthase (LIS) cDNA from strawberry with plastid targeting and a synthetic intron (LIS') was placed under the control of the wound inducible proteinase inhibitor 2 (PI2) promoter from potato. The construct pBin-PP12-LIS' was transformed to Arabidopsis thaliana ecotype Columbia O. Kanamycin resistant T0 seedlings were confirmed for the presence and transcription of the LIS' gene by PCR analysis on genomic DNA and by RT-PCR analysis on RNA. Genomic and RT-PCR products were sequenced to confirm correct splicing of the synthetic intron. The expression of active linalool synthase by the PP12-LIS' gene construct in the transgenic lines was assessed by measuring linalool emission using solid phase micro-extraction (SPME) GC-MS measurements after induction with methyl jasmonate. Among 30 tested independent T2 transgenic lines, 10 exhibited linalool production.Linalool expression could be induced by methyl jasmonate treatment, but not by diamondback moth larvae.

  15. T-786c Polymorphism in nitric oxide synthase 3 gene and Nitrit Oxide Level of Diabetic Retinopathy in Javanese Population

    Directory of Open Access Journals (Sweden)

    Putri Widelia Welkriana

    2015-11-01

    Full Text Available AbstractComplication of retinopathy in type 2 DM is caused of lower level of NO. Nitric oxide level is synthesizedfrom L-arginin in reaction that catalyze Nitric oxide synthase (NOS 3. The T-786C mutation in NOS 3 genedecreases the expression of nitric oxide synthase (NOS 3 so decreases NO synthesis. To investigate theassociation between T-786C polymorphism in NOS 3 gene with NO level of diabetic retinopathy patients. Thisstudy was a case control study, consist of 40 patient of type 2 diabetic with DR (case group and 40 patient oftype 2 diabetic without DR (control group of Javanese ethnic. The genotyping of T-786C polymorphism wasperformed by PCR-RLFP. Level of NO was measured by spectrophotometry. Chi square test and odd ratiowere used to analyze the association of the T-786C polymorphism in NOS 3 gene with DR. Differences ofNO level between TT and TC genotypes were analyzed using independent t test. The distribution of T-786Cpolymorphism in NOS 3 gene of DR subjects showed that frequency of TT genotype was 22.5% and TC genotypewas 77.5%. Non DR subjects showed the frequency of TT genotype was 50% and TC genotype was 50%, (p=0.011. Frequency of T allele in DR group was 61.25% and C allele was 38.75%, and frequency of T allele in nonDR group was 75% and C allele was 25%, (p= 0.62. Odd ratio of TC genotype was 3.444(CI; 95% : 0.964-3.735and C allele was 1.898 (CI; 95% : 1.310-9.058. The NO level of TC genotype was 1.43+0.126 and TT genotypewas 11.27+5.87 (p=0.000. Level of NO between RD and non RD showed not different significantly (p=0.160for retinopathy. The T-786C polymorphism of NOS 3 gene is risk factor for retinopathy in type 2 DiabetesMellitus. Individual with TC genotype of NOS 3 gene has lower level of NO than TT genotype.Keywords : Diabetic Retinopathy, Polymorphism, Nitric Oxide, Nitric Oxide Synthase.

  16. Association of Thymidylate Synthase Gene Polymorphisms with Stavudine Triphosphate Intracellular Levels and Lipodystrophy▿

    OpenAIRE

    Domingo, Pere (Domingo Pedrol); Cabeza, M. Carmen; Pruvost, Alain; Torres, Ferran; Salazar, Juliana; del Mar Gutierrez, M.; Mateo, M. Gracia; Fontanet, Angels; Fernandez, Irene; Domingo, Joan C.; Villarroya, Francesc; Vidal, Francesc; Baiget, Montserrat

    2011-01-01

    The antiviral activity and toxicity of stavudine (d4T) depend on its triphosphate metabolite, stavudine triphosphate (d4T-TP). Therefore, modifications in intracellular levels of d4T-TP may change the toxicity profile of stavudine. d4T-TP intracellular levels in peripheral blood mononuclear cells were determined with a prominence liquid chromatograph connected to a triple-quadruple mass spectrometer. Polymorphisms in the thymidylate synthase (TS), methylenetetrahydrofolate reductase (MTHFR), ...

  17. Normal Responses to Restraint Stress in Mice Lacking the Gene for Neuronal Nitric Oxide Synthase

    OpenAIRE

    WEISSMAN, BEN A.; Sottas, Chantal M.; HOLMES, MICHAEL; Zhou, Ping; Iadecola, Costantino; HARDY, DIANNE O.; Ge, Ren-Shan; Hardy, Matthew P

    2009-01-01

    The hormonal changes associated with immobilization stress (IMO) include a swift increase in corticosterone (CORT) concentration and a decrease in circulating testosterone (T) levels. There is evidence that the production of the short-lived neuromodulator nitric oxide (NO) is increased during stress in various tissues, including the brain. NO also suppresses the biosynthesis of T. Both the inducible and the neuronal isoforms of NO synthase (iNOS and nNOS, respectively) have been implicated in...

  18. Factors influencing gene silencing of granule-bound starch synthase in potato

    OpenAIRE

    Heilersig, H.J.B.

    2005-01-01

    In the past, antisense RNA technology was used to modify the composition of potato tuber starch. Potato starch comprises amylose and amylopectin, polymers of glucose. Amylose production in potato is completely dependent on the presence of granule-bound starch synthase I (GBSSI). Inhibition of GBSSI has been achieved by transformation with antisense and sense GBSSI constructs. However, the percentages of transformants showing strong silencing were relatively low which implicated that large num...

  19. [Full-length cDNA cloning of flavonol synthase genes of Carthamus tinctorius and construction plant expression vector].

    Science.gov (United States)

    Yang, Wen-ting; Liu, Xiu-ming; Wan, Qiu; Yao, Na; Wang, Nan; Zhang, Xue-meng; Jiao, Zhong-da; Li, Hai-yan; Li, Xiao-kun

    2015-02-01

    Flavonol synthase (FLS) is one of the key enzymes in flavonoids metabolic pathways. In this study, middle sequence was obtained from Carthamus tinctorius transcriptome sequencing results. Full-length cDNAs of FLS was cloned from petals of C. tinctorius to FLS by using RT-PCR and RACE technology. Its full-length cDNA was 1,201 bp, with an open reading frame of 1,101 bp and 336 encoded amino acids. The phylogenetic analysis showed that, FLS gene encoded amino acids in C. tinctorius were highly homologous with amino acids in congeneric Compositae species, especially Rudbeckia laciniata. The pBASTA-FLS plant expression vector was successfully built by the molecular biology method, which lays a foundation for further studying biology functions of the gene and biosynthesis mechanism of flavonoids. PMID:26137682

  20. Congenital erythropoietic porphyria with two mutations of the uroporphyrinogen III synthase gene (Cys73Arg, Thr228Met

    Directory of Open Access Journals (Sweden)

    Zoran Gucev

    2011-01-01

    Full Text Available Congenital erythropoietic porphyria (CEP is an autosomal recessive inborn error of metabolism that results from the markedly deficient activity of uroporphyrinogen III synthase (UROS. We describe a 14-year-old girl with red urine since infancy, progressive blistering and scarring of the skin, and moderate hemolytic anemia. After years of skin damage, her face is mutilated; she has a bald patch on the scalp, hypertrichosis of the neck, areas of skin darkening, and limited joint movements of the hands. Total urine excretion and fecal total porphyrin were both markedly raised above normal levels. Sequencing of the UROS gene identified two mutations causing CEP (Cys73Arg, Thr228Met. The patient lesions are progressing. Bone marrow transplantation and/or gene therapy are proposed as the next steps in her treatment. In brief, we describe a CEP with confirmed two pathogenic mutations, severe phenotype and discuss the various treatment options available.

  1. Likelihood analysis of the chalcone synthase genes suggests the role of positive selection in morning glories (Ipomoea).

    Science.gov (United States)

    Yang, Ji; Gu, Hongya; Yang, Ziheng

    2004-01-01

    Chalcone synthase (CHS) is a key enzyme in the biosynthesis of flavonoides, which are important for the pigmentation of flowers and act as attractants to pollinators. Genes encoding CHS constitute a multigene family in which the copy number varies among plant species and functional divergence appears to have occurred repeatedly. In morning glories (Ipomoea), five functional CHS genes (A-E) have been described. Phylogenetic analysis of the Ipomoea CHS gene family revealed that CHS A, B, and C experienced accelerated rates of amino acid substitution relative to CHS D and E. To examine whether the CHS genes of the morning glories underwent adaptive evolution, maximum-likelihood models of codon substitution were used to analyze the functional sequences in the Ipomoea CHS gene family. These models used the nonsynonymous/synonymous rate ratio (omega = d(N)/ d(S)) as an indicator of selective pressure and allowed the ratio to vary among lineages or sites. Likelihood ratio test suggested significant variation in selection pressure among amino acid sites, with a small proportion of them detected to be under positive selection along the branches ancestral to CHS A, B, and C. Positive Darwinian selection appears to have promoted the divergence of subfamily ABC and subfamily DE and is at least partially responsible for a rate increase following gene duplication. PMID:14743314

  2. Sequence analysis of the chitin synthase A gene of the Dutch elm pathogen Ophiostoma novo-ulmi indicates a close association with the human pathogen Sporothrix schenckii.

    Science.gov (United States)

    Hintz, W E

    1999-09-01

    Degenerate oligonucleotide primers were designed according to conserved regions of the chitin synthase gene family and used to amplify a 621 basepair (bp) fragment from genomic DNA of Ophiostoma novo-ulmi, the causal agent of Dutch elm disease. The amplification product was used as a hybridization probe to screen a library of genomic DNA sequences and to retrieve a full-length chitin synthase gene (chsA). The putative coding region of the gene was 2619 bp long, lacked introns, and encoded a polypeptide of 873 amino acids. Based on the similarity of the predicted amino acid sequence to the full-length chsC gene of Aspergillus nidulans and chsA gene of Ampelomyces quisqualis, the O. novo-ulmi chsA was classified as a Class I chitin synthase. The phylogenies constructed, according to a subregion of all available chitin synthases, showed that O. novo-ulmi consistently clustered most closely with the human pathogen Sporothrix schenckii, recently classified as a member of the mitosporic Ophiostomataceae. Disruption of the chsA gene locus had no obvious effects on the growth or morphology of the fungus. PMID:10524253

  3. Association of Variable Number of Tandem Repeats in Endothelial Nitric Oxide Synthase Gene with Coronary Artery Disease

    Directory of Open Access Journals (Sweden)

    S Salimi

    2006-08-01

    Full Text Available Endo-derived nitric oxide (NO is synthesized from L-arginine by endothelium nitric oxide synthase (eNOS. Since reduced NO synthesis has been implicated in the development of coronary atherosclerosis; we hypothesized that polymorphisms of NOS gene might be associated with increased susceptibility to this disorder and coronary artery disease (CAD. We studied the 27 base pair tandem repeat polymorphism in intron4 of the endothelial nitric oxide synthase (eNOS gene in 141 unrelated CAD patients with positive coronary angiograms in Shahid Rajaee Heart Hospital and 159 age matched control subjects without a history of symptomatic CAD. The study protocol was approved by the Iran University of Medical Sciences Ethics Committee. The eNOS gene intron4a/b VNTR polymorphism was analyzed by polymerase chain reaction. The plasma lipids levels and other risk factors were also determined. The genotype frequencies for eNOS4b/b, eNOS4a/b and eNOS4a/a were 68.8, 29.1 and 2.1% in CAD subjects, and 81, 18.4 and 0.6 % in control subjects, respectively. The genotype frequencies differed significantly between the two groups (χ²= 6.38 P= 0.041. The frequency of the allele was 16.7% in CAD subjects and 9.8% in control subjects and was significantly higher in the patients (χ²= 6.18 P= 0.013, odds ratio=1.84. Plasma lipids, except HDL-C were also remarkablely increased in CAD group.

  4. Hydrocellular foam dressing promotes wound healing along with increases in hyaluronan synthase 3 and PPARα gene expression in epidermis.

    Directory of Open Access Journals (Sweden)

    Takumi Yamane

    Full Text Available BACKGROUND: Hydrocellular foam dressing, modern wound dressing, induces moist wound environment and promotes wound healing: however, the regulatory mechanisms responsible for these effects are poorly understood. This study was aimed to reveal the effect of hydrocellular foam dressing on hyaluronan, which has been shown to have positive effects on wound healing, and examined its regulatory mechanisms in rat skin. METHODOLOGY/PRINCIPAL FINDINGS: We created two full-thickness wounds on the dorsolateral skin of rats. Each wound was covered with either a hydrocellular foam dressing or a film dressing and hyaluronan levels in the periwound skin was measured. We also investigated the mechanism by which the hydrocellular foam dressing regulates hyaluronan production by measuring the gene expression of hyaluronan synthase 3 (Has3, peroxisome proliferator-activated receptor α (PPARα, and CD44. Hydrocellular foam dressing promoted wound healing and upregulated hyaluronan synthesis, along with an increase in the mRNA levels of Has3, which plays a primary role in hyaluronan synthesis in epidermis. In addition, hydrocellular foam dressing enhanced the mRNA levels of PPARα, which upregulates Has3 gene expression, and the major hyaluronan receptor CD44. CONCLUSIONS/SIGNIFICANCE: These findings suggests that hydrocellular foam dressing may be beneficial for wound healing along with increases in hyaluronan synthase 3 and PPARα gene expression in epidermis. We believe that the present study would contribute to the elucidation of the mechanisms underlying the effects of hydrocellular foam dressing-induced moist environment on wound healing and practice evidence-based wound care.

  5. Parallel evolution of the glycogen synthase 1 (muscle) gene Gys1 between Old World and New World fruit bats (Order: Chiroptera).

    Science.gov (United States)

    Fang, Lu; Shen, Bin; Irwin, David M; Zhang, Shuyi

    2014-10-01

    Glycogen synthase, which catalyzes the synthesis of glycogen, is especially important for Old World (Pteropodidae) and New World (Phyllostomidae) fruit bats that ingest high-carbohydrate diets. Glycogen synthase 1, encoded by the Gys1 gene, is the glycogen synthase isozyme that functions in muscles. To determine whether Gys1 has undergone adaptive evolution in bats with carbohydrate-rich diets, in comparison to insect-eating sister bat taxa, we sequenced the coding region of the Gys1 gene from 10 species of bats, including two Old World fruit bats (Pteropodidae) and a New World fruit bat (Phyllostomidae). Our results show no evidence for positive selection in the Gys1 coding sequence on the ancestral Old World and the New World Artibeus lituratus branches. Tests for convergent evolution indicated convergence of the sequences and one parallel amino acid substitution (T395A) was detected on these branches, which was likely driven by natural selection. PMID:25001420

  6. The Cer-cqu gene cluster determines three key players in a β-diketone synthase polyketide pathway synthesizing aliphatics in epicuticular waxes

    DEFF Research Database (Denmark)

    Schneider, Lizette Marais; Adamski, Nikolai M.; Christensen, Caspar Elo;

    2016-01-01

    identification of mutants in their synthesis or transport. The present study discloses three such Eceriferum (cer) genes in barley - Cer-c, Cer-q and Cer-u - known to be tightly linked and functioning in a biochemical pathway forming dominating amounts of β-diketone and hydroxy-β-diketones plus some esterified...... five candidates, of which three were missing in apparent cer-cqu triple mutants. Sequencing more than 50 independent mutants for each gene confirmed their identification. Cer-c is a chalcone synthase-like polyketide synthase, designated diketone synthase (DKS), Cer-q is a lipase/carboxyl transferase...... affect overall protein structure or specific active site residues. The rich diversity of identified mutations will facilitate future studies of three key enzymes involved in synthesis of plant apoplast waxes....

  7. Functional genomic analysis supports conservation of function among cellulose synthase-like a gene family members and suggests diverse roles of mannans in plants

    DEFF Research Database (Denmark)

    Liepman, Aaron H; Nairn, C Joseph; Willats, William G T;

    2007-01-01

    Mannan polysaccharides are widespread among plants, where they serve as structural elements in cell walls, as carbohydrate reserves, and potentially perform other important functions. Previous work has demonstrated that members of the cellulose synthase-like A (CslA) family of glycosyltransferases...... from Arabidopsis (Arabidopsis thaliana), guar (Cyamopsis tetragonolobus), and Populus trichocarpa catalyze beta-1,4-mannan and glucomannan synthase reactions in vitro. Mannan polysaccharides and homologs of CslA genes appear to be present in all lineages of land plants analyzed to date. In many plants......, the CslA genes are members of extended multigene families; however, it is not known whether all CslA proteins are glucomannan synthases. CslA proteins from diverse land plant species, including representatives of the mono- and dicotyledonous angiosperms, gymnosperms, and bryophytes, were produced in...

  8. Alfalfa Cellulose synthase gene expression under abiotic stress: a Hitchhiker's guide to RT-qPCR normalization.

    Directory of Open Access Journals (Sweden)

    Gea Guerriero

    Full Text Available Abiotic stress represents a serious threat affecting both plant fitness and productivity. One of the promptest responses that plants trigger following abiotic stress is the differential expression of key genes, which enable to face the adverse conditions. It is accepted and shown that the cell wall senses and broadcasts the stress signal to the interior of the cell, by triggering a cascade of reactions leading to resistance. Therefore the study of wall-related genes is particularly relevant to understand the metabolic remodeling triggered by plants in response to exogenous stresses. Despite the agricultural and economical relevance of alfalfa (Medicago sativa L., no study, to our knowledge, has addressed specifically the wall-related gene expression changes in response to exogenous stresses in this important crop, by monitoring the dynamics of wall biosynthetic gene expression. We here identify and analyze the expression profiles of nine cellulose synthases, together with other wall-related genes, in stems of alfalfa plants subjected to different abiotic stresses (cold, heat, salt stress at various time points (e.g. 0, 24, 72 and 96 h. We identify 2 main responses for specific groups of genes, i.e. a salt/heat-induced and a cold/heat-repressed group of genes. Prior to this analysis we identified appropriate reference genes for expression analyses in alfalfa, by evaluating the stability of 10 candidates across different tissues (namely leaves, stems, roots, under the different abiotic stresses and time points chosen. The results obtained confirm an active role played by the cell wall in response to exogenous stimuli and constitute a step forward in delineating the complex pathways regulating the response of plants to abiotic stresses.

  9. Glycogen Synthase Kinase-3 regulates IGFBP-1 gene transcription through the Thymine-rich Insulin Response Element

    Directory of Open Access Journals (Sweden)

    Marquez Rodolfo

    2004-09-01

    Full Text Available Abstract Background Hepatic expression of several gene products involved in glucose metabolism, including phosphoenolpyruvate carboxykinase (PEPCK, glucose-6-phosphatase (G6Pase and insulin-like growth factor binding protein-1 (IGFBP-1, is rapidly and completely inhibited by insulin. This inhibition is mediated through the regulation of a DNA element present in each of these gene promoters, that we call the Thymine-rich Insulin Response Element (TIRE. The insulin signalling pathway that results in the inhibition of these gene promoters requires the activation of phosphatidylinositol 3-kinase (PI 3-kinase. However, the molecules that connect PI 3-kinase to these gene promoters are not yet fully defined. Glycogen Synthase Kinase 3 (GSK-3 is inhibited following activation of PI 3-kinase. We have shown previously that inhibitors of GSK-3 reduce the activity of two TIRE-containing gene promoters (PEPCK and G6Pase, whose products are required for gluconeogenesis. Results In this report we demonstrate that in H4IIE-C3 cells, four distinct classes of GSK-3 inhibitor mimic the effect of insulin on a third TIRE-containing gene, IGFBP-1. We identify the TIRE as the minimum requirement for inhibition by these agents, and demonstrate that the target of GSK-3 is unlikely to be the postulated TIRE-binding protein FOXO-1. Importantly, overexpression of GSK-3 in cells reduces the insulin regulation of TIRE activity as well as endogenous IGFBP-1 expression. Conclusions These results implicate GSK-3 as an intermediate in the pathway from the insulin receptor to the TIRE. Indeed, this is the first demonstration of an absolute requirement for GSK-3 inhibition in insulin regulation of gene transcription. These data support the potential use of GSK-3 inhibitors in the treatment of insulin resistant states such as Type 2 diabetes mellitus, but suggest that it will be important to identify all TIRE-containing genes to assess potential side effects of these agents.

  10. Botrytis cinerea virulence is drastically reduced after disruption of chitin synthase class III gene (Bcchs3a).

    Science.gov (United States)

    Soulié, Marie-Christine; Perino, Claude; Piffeteau, Annie; Choquer, Mathias; Malfatti, Pierrette; Cimerman, Agnès; Kunz, Caroline; Boccara, Martine; Vidal-Cros, Anne

    2006-08-01

    Botrytis cinerea is an important phytopathogenic fungus requiring new methods of control. Chitin biosynthesis, which involves seven classes of chitin synthases, could be an attractive target. A fragment encoding one of the class III enzymes was used to disrupt the corresponding Bcchs3a gene in the B. cinerea genome. The resulting mutant exhibited a 39% reduction in its chitin content and an 89% reduction in its in vitro chitin synthase activity, compared with the wild-type strain. Bcchs3a mutant was not affected in its growth in liquid medium, neither in its production of sclerotia, micro- and macroconidia. In contrast, the mutant Bcchs3a was severely impaired in its growth on solid medium. Counterbalancing this defect in radial growth, Bcchs3a mutant presented a large increase in hyphal ramification, resulting in an enhanced aerial growth. Observations by different techniques of microscopy revealed a thick extracellular matrix around the hyphal tips. Moreover, Bcchs3a mutant had a largely reduced virulence on Vitis vinifera and Arabidopsis thaliana leaves. PMID:16882034

  11. Molecular cloning and sequence analysis of the Plasmodium falciparum dihydrofolate reductase-thymidylate synthase gene.

    OpenAIRE

    Bzik, D J; Li, W B; Horii, T; Inselburg, J

    1987-01-01

    Genomic DNA clones that coded for the bifunctional dihydrofolate reductase (DHFR) and thymidylate synthase (TS) (DHFR-TS) activities from a pyrimethamine-sensitive strain of Plasmodium falciparum were isolated and sequenced. The deduced DHFR-TS protein contained 608 amino acids (71,682 Da). The coding region for DHFR-TS contained no intervening sequences and had a high A + T content (75%). The DHFR domain, in the amino-terminal portion of the protein, was joined by a 94-amino acid junction se...

  12. Inducible nitric oxide synthase gene methylation and parkinsonism in manganese-exposed welders

    Science.gov (United States)

    Nielsen, Susan Searles; Checkoway, Harvey; Criswell, Susan R.; Farin, Federico M.; Stapleton, Patricia L.; Sheppard, Lianne; Racette, Brad A.

    2015-01-01

    Introduction Neurologist-assessed parkinsonism signs are prevalent among workers exposed to manganese (Mn)-containing welding fume. Neuroinflammation may possibly play a role. Inducible nitric oxide synthase, coded by NOS2, is involved in inflammation, and particulate exposure increases the gene’s expression through methylation of CpG sites in the 5′ region. Methods We assessed DNA methylation at three CpG sites in the NOS2 exon 1 from blood from 201 welders. All were non-Hispanic Caucasian men 25–65 years old who were examined by a neurologist specializing in movement disorders. We categorized the workers according to their Unified Parkinson Disease Rating Scale motor subsection 3 (UPDRS3) scores as parkinsonism cases (UPDRS3 ≥ 15; n = 49), controls (UPDRS3 < 6; n = 103), or intermediate (UPDRS3 ≥6 to <15; n = 49). Results While accounting for age, examiner and experimental plate, parkinsonism cases had lower mean NOS2 methylation than controls (p-value for trend = 0.04), specifically at CpG site 8329 located in an exonic splicing enhancer of NOS2 (p-value for trend = 0.07). These associations were not observed for the intermediate UPDRS3 group (both p-value for trend ≥ 0.59). Conclusions Inflammation mediated by inducible nitric oxide synthase may possibly contribute to the association between welding fume and parkinsonism, but requires verification in a longitudinal study. PMID:25634431

  13. Widespread occurrence and genomic context of unusually small polyketide synthase genes in microbial consortia associated with marine sponges.

    Science.gov (United States)

    Fieseler, Lars; Hentschel, Ute; Grozdanov, Lubomir; Schirmer, Andreas; Wen, Gaiping; Platzer, Matthias; Hrvatin, Sinisa; Butzke, Daniel; Zimmermann, Katrin; Piel, Jörn

    2007-04-01

    Numerous marine sponges harbor enormous amounts of as-yet-uncultivated bacteria in their tissues. There is increasing evidence that these symbionts play an important role in the synthesis of protective metabolites, many of which are of great pharmacological interest. In this study, genes for the biosynthesis of polyketides, one of the most important classes of bioactive natural products, were systematically investigated in 20 demosponge species from different oceans. Unexpectedly, the sponge metagenomes were dominated by a ubiquitously present, evolutionarily distinct, and highly sponge-specific group of polyketide synthases (PKSs). Open reading frames resembling animal fatty acid genes were found on three corresponding DNA regions isolated from the metagenomes of Theonella swinhoei and Aplysina aerophoba. Their architecture suggests that methyl-branched fatty acids are the metabolic product. According to a phylogenetic analysis of housekeeping genes, at least one of the PKSs belongs to a bacterium of the Deinococcus-Thermus phylum. The results provide new insights into the chemistry of sponge symbionts and allow inference of a detailed phylogeny of the diverse functional PKS types present in sponge metagenomes. Based on these qualitative and quantitative data, we propose a significantly simplified strategy for the targeted isolation of biomedically relevant PKS genes from complex sponge-symbiont associations. PMID:17293531

  14. Coordinated responses of phytochelatin synthase and metallothionein genes in black mangrove, Avicennia germinans, exposed to cadmium and copper

    Energy Technology Data Exchange (ETDEWEB)

    Gonzalez-Mendoza, Daniel [Departamento de Recursos del Mar, Cinvestav-Unidad Merida, Merida, Yucatan (Mexico); Moreno, Adriana Quiroz [Unidad de biotecnologia, CICY, Merida, Yucatan (Mexico); Zapata-Perez, Omar [Departamento de Recursos del Mar, Cinvestav-Unidad Merida, Merida, Yucatan (Mexico)]. E-mail: ozapata@mda.cinvestav.mx

    2007-08-01

    To evaluate the role of phytochelatins and metallothioneins in heavy metal tolerance of black mangrove Avicennia germinans, 3-month-old seedlings were exposed to cadmium or copper for 30 h, under hydroponic conditions. Degenerate Mt2 and PCS primers were synthesized based on amino acid and nucleotide alignment sequences reported for Mt2 and PCS in other plant species found in GenBank. Total RNA was isolated from A. germinans leaves and two partial fragments of metallothionein and phytochelatin synthase genes were isolated. Gene expression was evaluated with reverse transcripatase-polymerase chain reaction (RT-PCR) amplification technique. Temporal analysis showed that low Cd{sup 2+} and Cu{sup 2+} concentrations caused a slight (but not significant) increase in AvMt2 expression after a 16 h exposure time, while AvPCS expression showed a significant increase under the same conditions but only after 4 h. Results strongly suggest that the rapid increase in AvPCS expression may contribute to Cd{sup 2+} and Cu{sup 2+} detoxification. Moreover, we found that A. germinans has the capacity to over-express both genes (AvMt2 and AvPCS), which may constitute a coordinated detoxification response mechanism targeting non-essential metals. Nonetheless, our results confirm that AvPCS was the most active gene involved in the regulation of essential metals (e.g., Cu{sup 2+}) in A. germinans leaves.

  15. The glycogen synthase 2 gene (Gys2) displays parallel evolution between Old World and New World fruit bats.

    Science.gov (United States)

    Qian, Yamin; Fang, Tao; Shen, Bin; Zhang, Shuyi

    2014-01-01

    Frugivorous and nectarivorous bats rely largely on hepatic glycogenesis and glycogenolysis for postprandial blood glucose disposal and maintenance of glucose homeostasis during short time starvation, respectively. The glycogen synthase 2 encoded by the Gys2 gene plays a critical role in liver glycogen synthesis. To test whether the Gys2 gene has undergone adaptive evolution in bats with carbohydrate-rich diets in relation to their insect-eating sister taxa, we sequenced the coding region of the Gys2 gene in a number of bat species, including three Old World fruit bats (OWFBs) (Pteropodidae) and two New World fruit bats (NWFBs) (Phyllostomidae). Our results showed that the Gys2 coding sequences are highly conserved across all bat species we examined, and no evidence of positive selection was detected in the ancestral branches leading to OWFBs and NWFBs. Our explicit convergence test showed that posterior probabilities of convergence between several branches of OWFBs, and the NWFBs were markedly higher than that of divergence. Three parallel amino acid substitutions (Q72H, K371Q, and E666D) were detected among branches of OWFBs and NWFBs. Tests for parallel evolution showed that two parallel substitutions (Q72H and E666D) were driven by natural selection, while the K371Q was more likely to be fixed randomly. Thus, our results suggested that the Gys2 gene has undergone parallel evolution on amino acid level between OWFBs and NWFBs in relation to their carbohydrate metabolism. PMID:24258790

  16. Transformation of Brassica napus canola cultivars with Arabidopsis thaliana acetohydroxyacid synthase genes and analysis of herbicide resistance.

    Science.gov (United States)

    Miki, B L; Labbé, H; Hattori, J; Ouellet, T; Gabard, J; Sunohara, G; Charest, P J; Iyer, V N

    1990-10-01

    A survey of selected crop species and weeds was conducted to evaluate the inhibition of the enzyme acetohydroxyacid synthase (AHAS) and seedling growth in vitro by the sulfonylurea herbicides chlorsulfuron, DPX A7881, DPX L5300, DPX M6316 and the imidazolinone herbicides AC243,997, AC263,499, AC252,214. Particular attention was given to the Brassica species including canola cultivars and cruciferous weeds such as B. kaber (wild mustard) and Thlaspi arvense (stinkweed). Transgenic lines of B. napus cultivars Westar and Profit, which express the Arabidopsis thaliana wild-type AHAS gene or the mutant gene csr1-1 at levels similar to the resident AHAS genes, were generated and compared. The mutant gene was essential for resistance to the sulfonylurea chlorsulfuron but not to DPX A7881, which appeared to be tolerated by certain Brassica species. Cross-resistance to the imidazolinones did not occur. The level of resistance to chlorsulfuron in transgenic canola greatly exceeded the levels that were toxic to the Brassica species or cruciferous weeds. Direct selection of transgenic lines with chlorsulfuron sprayed at field levels under greenhouse conditions was achieved. PMID:24221001

  17. Glycosylation defects and virulence phenotypes of Leishmania mexicana phosphomannomutase and dolicholphosphate-mannose synthase gene deletion mutants.

    Science.gov (United States)

    Garami, A; Mehlert, A; Ilg, T

    2001-12-01

    Leishmania parasites synthesize an abundance of mannose (Man)-containing glycoconjugates thought to be essential for virulence to the mammalian host and for viability. These glycoconjugates include lipophosphoglycan (LPG), proteophosphoglycans (PPGs), glycosylphosphatidylinositol (GPI)-anchored proteins, glycoinositolphospholipids (GIPLs), and N-glycans. A prerequisite for their biosynthesis is an ample supply of the Man donors GDP-Man and dolicholphosphate-Man. We have cloned from Leishmania mexicana the gene encoding the enzyme phosphomannomutase (PMM) and the previously described dolicholphosphate-Man synthase gene (DPMS) that are involved in Man activation. Surprisingly, gene deletion experiments resulted in viable parasite lines lacking the respective open reading frames (DeltaPMM and DeltaDPMS), a result against expectation and in contrast to the lethal phenotype observed in gene deletion experiments with fungi. L. mexicana DeltaDPMS exhibits a selective defect in LPG, protein GPI anchor, and GIPL biosynthesis, but despite the absence of these structures, which have been implicated in parasite virulence and viability, the mutant remains infectious to macrophages and mice. By contrast, L. mexicana DeltaPMM are largely devoid of all known Man-containing glycoconjugates and are unable to establish an infection in mouse macrophages or the living animal. Our results define Man activation leading to GDP-Man as a virulence pathway in Leishmania. PMID:11689705

  18. β-Glucan synthase gene overexpression and β-glucans overproduction in Pleurotus ostreatus using promoter swapping.

    Directory of Open Access Journals (Sweden)

    Ran Chai

    Full Text Available Mushroom β-glucans are potent immunological stimulators in medicine, but their productivities are very low. In this study, we successfully improved its production by promoter engineering in Pleurotus ostreatus. The promoter for β-1,3-glucan synthase gene (GLS was replaced by the promoter of glyceraldehyde-3-phosphate dehydrogenase gene of Aspergillus nidulans. The homologous recombination fragment for swapping GLS promoter comprised five segments, which were fused by two rounds of combined touchdown PCR and overlap extension PCR (TD-OE PCR, and was introduced into P. ostreatus through PEG/CaCl2-mediated protoplast transformation. The transformants exhibited one to three fold higher transcription of GLS gene and produced 32% to 131% higher yield of β-glucans than the wild type. The polysaccharide yields had a significant positive correlation to the GLS gene expression. The infrared spectra of the polysaccharides all displayed the typical absorption peaks of β-glucans. This is the first report of successful swapping of promoters in filamentous fungi.

  19. Hypoxia-induced endothelial NO synthase gene transcriptional activation is mediated through the tax-responsive element in endothelial cells.

    Science.gov (United States)

    Min, Jiho; Jin, Yoon-Mi; Moon, Je-Sung; Sung, Min-Sun; Jo, Sangmee Ahn; Jo, Inho

    2006-06-01

    Although hypoxia is known to induce upregulation of endothelial NO synthase (eNOS) gene expression, the underlying mechanism is largely unclear. In this study, we show that hypoxia increases eNOS gene expression through the binding of phosphorylated cAMP-responsive element binding (CREB) protein (pCREB) to the eNOS gene promoter. Hypoxia (1% O2) increased both eNOS expression and NO production, peaking at 24 hours, in bovine aortic endothelial cells, and these increases were accompanied by increases in pCREB. Treatment with the protein kinase A inhibitor H-89 or transfection with dominant-negative inhibitor of CREB reversed the hypoxia-induced increases in eNOS expression and NO production, with concomitant inhibition of the phosphorylation of CREB induced by hypoxia, suggesting an involvement of protein kinase A/pCREB-mediated pathway. To map the regulatory elements of the eNOS gene responsible for pCREB binding under hypoxia, we constructed an eNOS gene promoter (-1600 to +22 nucleotides) fused with a luciferase reporter gene [pGL2-eNOS(-1600)]. Hypoxia (for 24-hour incubation) increased the promoter activity by 2.36+/-0.18-fold in the bovine aortic endothelial cells transfected with pGL2-eNOS(-1600). However, progressive 5'-deletion from -1600 to -873 completely attenuated the hypoxia-induced increase in promoter activity. Electrophoretic mobility shift, anti-pCREB antibody supershift, and site-specific mutation analyses showed that pCREB is bound to the Tax-responsive element (TRE) site, a cAMP-responsive element-like site, located at -924 to -921 of the eNOS promoter. Our data demonstrate that the interaction between pCREB and the Tax-responsive element site within the eNOS promoter may represent a novel mechanism for the mediation of hypoxia-stimulated eNOS gene expression. PMID:16651461

  20. Molecular cloning and expression levels of the monoterpene synthase gene (ZMM1 in Cassumunar ginger (Zingiber montanum (Koenig Link ex Dietr.

    Directory of Open Access Journals (Sweden)

    Bua-In Saowaluck

    2014-01-01

    Full Text Available Cassumunar ginger (Zingiber montanum (Koenig Link ex Dietr. is a native Thai herb with a high content and large variety of terpenoids in its essential oil. Improving the essential oil content and quality of cassumunar ginger is difficult for a breeder due to its clonally propagated nature. In this research, we describe the isolation and expression level of the monoterpene synthase gene that controls the key step of essential oil synthesis in this plant and evaluate the mechanical wounding that may influence the transcription level of the monoterpene synthase gene. To isolate the gene, the selected clones from DNA derived from young leaves were sequenced and analyzed and the monoterpene synthase gene from cassumunar ginger (ZMM1 was identified. The ZMM1 CDS containing 1 773 bp (KF500399 is predicted to encode a protein of 590 amino acids. The deduced amino acid sequence is 40-74% identical with known sequences of other angiosperm monoterpene synthases belonging to the isoprenoid biosynthesis C1 superfamily. A transcript of ZMM1 was detected almost exclusively in the leaves and was related to leaf wounding. The results of this research offer insight into the control of monoterpene synthesis in this plant. This finding can be applied to breeding programs or crop management of cassumunar ginger for better yield and quality of essential oil.

  1. Structural and functional changes of mitochondrial ATP synthase caused by mtDNA 9205delTA mutation in ATP6 gene

    Czech Academy of Sciences Publication Activity Database

    Ješina, Pavel; Tesařová, M.; Fornůsková, D.; Vojtíšková, Alena; Pecina, Petr; Kaplanová, Vilma; Hansíková, H.; Zeman, J.; Houštěk, Josef

    2006-01-01

    Roč. 29, S1 (2006), s. 117-117. ISSN 0141-8955. [International Congress of Inborn Errors of Metabolism /10./. 12.09.2006-16.09.2006, Chiba] R&D Projects: GA MZd NR7790 Institutional research plan: CEZ:AV0Z50110509 Keywords : ATP synthase * ATP6 gene * mitochondria Subject RIV: CE - Biochemistry

  2. Nitric oxide synthase, calcitonin gene-related peptide and NK-1 receptor mechanisms are involved in GTN-induced neuronal activation

    DEFF Research Database (Denmark)

    Ramachandran, Roshni; Bhatt, Deepak Kumar; Ploug, Kenneth Beri; Hay-Schmidt, Anders; Jansen-Olesen, Inger; Gupta, Saurabh; Olesen, Jes

    2014-01-01

    BACKGROUND AND AIM: Infusion of glyceryltrinitrate (GTN), a nitric oxide (NO) donor, in awake, freely moving rats closely mimics a universally accepted human model of migraine and responds to sumatriptan treatment. Here we analyse the effect of nitric oxide synthase (NOS) and calcitonin gene...

  3. Development of genome-specific primers for homoeologous genes in allopolyploid species: the waxy and starch synthase II genes in allohexaploid wheat (Triticum aestivum L. as examples

    Directory of Open Access Journals (Sweden)

    Brûlé-Babel Anita

    2010-05-01

    Full Text Available Abstract Background In allopolypoid crops, homoeologous genes in different genomes exhibit a very high sequence similarity, especially in the coding regions of genes. This makes it difficult to design genome-specific primers to amplify individual genes from different genomes. Development of genome-specific primers for agronomically important genes in allopolypoid crops is very important and useful not only for the study of sequence diversity and association mapping of genes in natural populations, but also for the development of gene-based functional markers for marker-assisted breeding. Here we report on a useful approach for the development of genome-specific primers in allohexaploid wheat. Findings In the present study, three genome-specific primer sets for the waxy (Wx genes and four genome-specific primer sets for the starch synthase II (SSII genes were developed mainly from single nucleotide polymorphisms (SNPs and/or insertions or deletions (Indels in introns and intron-exon junctions. The size of a single PCR product ranged from 750 bp to 1657 bp. The total length of amplified PCR products by these genome-specific primer sets accounted for 72.6%-87.0% of the Wx genes and 59.5%-61.6% of the SSII genes. Five genome-specific primer sets for the Wx genes (one for Wx-7A, three for Wx-4A and one for Wx-7D could distinguish the wild type wheat and partial waxy wheat lines. These genome-specific primer sets for the Wx and SSII genes produced amplifications in hexaploid wheat, cultivated durum wheat, and Aegilops tauschii accessions, but failed to generate amplification in the majority of wild diploid and tetraploid accessions. Conclusions For the first time, we report on the development of genome-specific primers from three homoeologous Wx and SSII genes covering the majority of the genes in allohexaploid wheat. These genome-specific primers are being used for the study of sequence diversity and association mapping of the three homoeologous Wx

  4. The organ-specific expression of terpene synthase genes contributes to the terpene hydrocarbon composition of chamomile essential oils

    Directory of Open Access Journals (Sweden)

    Irmisch Sandra

    2012-06-01

    Full Text Available Abstract Background The essential oil of chamomile, one of the oldest and agronomically most important medicinal plant species in Europe, has significant antiphlogistic, spasmolytic and antimicrobial activities. It is rich in chamazulene, a pharmaceutically active compound spontaneously formed during steam distillation from the sesquiterpene lactone matricine. Chamomile oil also contains sesquiterpene alcohols and hydrocarbons which are produced by the action of terpene synthases (TPS, the key enzymes in constructing terpene carbon skeletons. Results Here, we present the identification and characterization of five TPS enzymes contributing to terpene biosynthesis in chamomile (Matricaria recutita. Four of these enzymes were exclusively expressed in above-ground organs and produced the common terpene hydrocarbons (−-(E-β-caryophyllene (MrTPS1, (+-germacrene A (MrTPS3, (E-β-ocimene (MrTPS4 and (−-germacrene D (MrTPS5. A fifth TPS, the multiproduct enzyme MrTPS2, was mainly expressed in roots and formed several Asteraceae-specific tricyclic sesquiterpenes with (−-α-isocomene being the major product. The TPS transcript accumulation patterns in different organs of chamomile were consistent with the abundance of the corresponding TPS products isolated from these organs suggesting that the spatial regulation of TPS gene expression qualitatively contribute to terpene composition. Conclusions The terpene synthases characterized in this study are involved in the organ-specific formation of essential oils in chamomile. While the products of MrTPS1, MrTPS2, MrTPS4 and MrTPS5 accumulate in the oils without further chemical alterations, (+-germacrene A produced by MrTPS3 accumulates only in trace amounts, indicating that it is converted into another compound like matricine. Thus, MrTPS3, but also the other TPS genes, are good markers for further breeding of chamomile cultivars rich in pharmaceutically active essential oils.

  5. An Arabidopsis callose synthase

    DEFF Research Database (Denmark)

    Ostergaard, Lars; Petersen, Morten; Mattsson, Ole;

    2002-01-01

    unclear whether callose synthases can also produce cellulose and whether plant cellulose synthases may also produce beta-1,3-glucans. We describe here an Arabidopsis gene, AtGsl5, encoding a plasma membrane-localized protein homologous to yeast beta-1,3-glucan synthase whose expression partially......Beta-1,3-glucan polymers are major structural components of fungal cell walls, while cellulosic beta-1,4-glucan is the predominant polysaccharide in plant cell walls. Plant beta-1,3-glucan, called callose, is produced in pollen and in response to pathogen attack and wounding, but it has been...

  6. Proto-oncogene FBI-1 (Pokemon) and SREBP-1 synergistically activate transcription of fatty-acid synthase gene (FASN).

    Science.gov (United States)

    Choi, Won-Il; Jeon, Bu-Nam; Park, Hyejin; Yoo, Jung-Yoon; Kim, Yeon-Sook; Koh, Dong-In; Kim, Myung-Hwa; Kim, Yu-Ri; Lee, Choong-Eun; Kim, Kyung-Sup; Osborne, Timothy F; Hur, Man-Wook

    2008-10-24

    FBI-1 (Pokemon/ZBTB7A) is a proto-oncogenic transcription factor of the BTB/POZ (bric-à-brac, tramtrack, and broad complex and pox virus zinc finger) domain family. Recent evidence suggested that FBI-1 might be involved in adipogenic gene expression. Coincidentally, expression of FBI-1 and fatty-acid synthase (FASN) genes are often increased in cancer and immortalized cells. Both FBI-1 and FASN are important in cancer cell proliferation. SREBP-1 is a major regulator of many adipogenic genes, and FBI-1 and SREBP-1 (sterol-responsive element (SRE)-binding protein 1) interact with each other directly via their DNA binding domains. FBI-1 enhanced the transcriptional activation of SREBP-1 on responsive promoters, pGL2-6x(SRE)-Luc and FASN gene. FBI-1 and SREBP-1 synergistically activate transcription of the FASN gene by acting on the proximal GC-box and SRE/E-box. FBI-1, Sp1, and SREBP-1 can bind to all three SRE, GC-box, and SRE/E-box. Binding competition among the three transcription factors on the GC-box and SRE/E-box appears important in the transcription regulation. FBI-1 is apparently changing the binding pattern of Sp1 and SREBP-1 on the two elements in the presence of induced SREBP-1 and drives more Sp1 binding to the proximal promoter with less of an effect on SREBP-1 binding. The changes induced by FBI-1 appear critical in the synergistic transcription activation. The molecular mechanism revealed provides insight into how proto-oncogene FBI-1 may attack the cellular regulatory mechanism of FASN gene expression to provide more phospholipid membrane components needed for rapid cancer cell proliferation. PMID:18682402

  7. Effect of deletion of chitin synthase genes on mycelial morphology and culture viscosity in Aspergillus oryzae.

    Science.gov (United States)

    Müller, Christian; Hansen, Kim; Szabo, Peter; Nielsen, Jens

    2003-03-01

    The objective of this study was to quantify the effect of disrupting two chitin synthases, chsB and csmA, on the morphology and rheology during batch cultivation of Aspergillus oryzae. The rheological properties were characterized in batch cultivations at different biomass concentrations (from 3.4-22.5 g kg(-1) biomass) and the power-law model adequately described the rheological properties. In the cultivations there were pellets, clumps, and freely dispersed hyphal elements. The different morphological fractions were quantified using image analysis. The apparent viscosity of the fermentation broth was significantly affected by the biomass concentration, the morphology, and also by pH. The chsB disruption strain had lower consistency index K values for all biomass concentrations investigated, which is a desirable trait for industrial Aspergillus fermentations. PMID:12514801

  8. Molecular cloning and sequence analysis of the Plasmodium falciparum dihydrofolate reductase-thymidylate synthase gene.

    Science.gov (United States)

    Bzik, D J; Li, W B; Horii, T; Inselburg, J

    1987-12-01

    Genomic DNA clones that coded for the bifunctional dihydrofolate reductase (DHFR) and thymidylate synthase (TS) (DHFR-TS) activities from a pyrimethamine-sensitive strain of Plasmodium falciparum were isolated and sequenced. The deduced DHFR-TS protein contained 608 amino acids (71,682 Da). The coding region for DHFR-TS contained no intervening sequences and had a high A + T content (75%). The DHFR domain, in the amino-terminal portion of the protein, was joined by a 94-amino acid junction sequence to the TS domain in the carboxyl-terminal portion of the protein. The TS domain was more conserved than the DHFR domain and both P. falciparum domains were more homologous to eukaryotic than to prokaryotic forms of the enzymes. Predicted secondary structures of the DHFR and TS domains were nearly identical to the structures identified in other DHFR and TS enzymes. PMID:2825189

  9. Exposure to Diflubenzuron Results in an Up-Regulation of a Chitin Synthase 1 Gene in Citrus Red Mite, Panonychus citri (Acari: Tetranychidae)

    OpenAIRE

    Wen-Kai Xia; Tian-Bo Ding; Jin-Zhi Niu; Chong-Yu Liao; Rui Zhong; Wen-Jia Yang; Bin Liu; Wei Dou; Jin-Jun Wang

    2014-01-01

    Chitin synthase synthesizes chitin, which is critical for the arthropod exoskeleton. In this study, we cloned the cDNA sequences of a chitin synthase 1 gene, PcCHS1, in the citrus red mite, Panonychus citri (McGregor), which is one of the most economically important pests of citrus worldwide. The full-length cDNA of PcCHS1 contains an open reading frame of 4605 bp of nucleotides, which encodes a protein of 1535 amino acid residues with a predicted molecular mass of 175.0 kDa. A phylogenetic ...

  10. Synthesis and characterization of biomimetic citrate-based biodegradable composites.

    Science.gov (United States)

    Tran, Richard T; Wang, Liang; Zhang, Chang; Huang, Minjun; Tang, Wanjin; Zhang, Chi; Zhang, Zhongmin; Jin, Dadi; Banik, Brittany; Brown, Justin L; Xie, Zhiwei; Bai, Xiaochun; Yang, Jian

    2014-08-01

    Natural bone apatite crystals, which mediate the development and regulate the load-bearing function of bone, have recently been associated with strongly bound citrate molecules. However, such understanding has not been translated into bone biomaterial design and osteoblast cell culture. In this work, we have developed a new class of biodegradable, mechanically strong, and biocompatible citrate-based polymer blends (CBPBs), which offer enhanced hydroxyapatite binding to produce more biomimetic composites (CBPBHAs) for orthopedic applications. CBPBHAs consist of the newly developed osteoconductive citrate-presenting biodegradable polymers, crosslinked urethane-doped polyester and poly (octanediol citrate), which can be composited with up to 65 wt % hydroxyapatite. CBPBHA networks produced materials with a compressive strength of 116.23 ± 5.37 MPa comparable to human cortical bone (100-230 MPa), and increased C2C12 osterix gene and alkaline phosphatase gene expression in vitro. The promising results above prompted an investigation on the role of citrate supplementation in culture medium for osteoblast culture, which showed that exogenous citrate supplemented into media accelerated the in vitro phenotype progression of MG-63 osteoblasts. After 6 weeks of implantation in a rabbit lateral femoral condyle defect model, CBPBHA composites elicited minimal fibrous tissue encapsulation and were well integrated with the surrounding bone tissues. The development of citrate-presenting CBPBHA biomaterials and preliminary studies revealing the effects of free exogenous citrate on osteoblast culture shows the potential of citrate biomaterials to bridge the gap in orthopedic biomaterial design and osteoblast cell culture in that the role of citrate molecules has previously been overlooked. PMID:23996976

  11. Role of Plant Fatty acid Elongase (3 keto acyl-CoA Synthase gene in Cuticular Wax Biosynthesis

    Directory of Open Access Journals (Sweden)

    Uppala Lokesh

    2013-12-01

    Full Text Available Plant surfaces are ensheathed by cuticular wax, amorphous intra-cuticular embedded in cutin polymer and crystalloid epi-cuticular that imparts a whitish appearance, confers drought resistance by reducing stomatal transpiration and also protects from U.V Radiation, phytophagous insects etc. Very long chain fatty acids acts as precursors for cuticular wax bio-synthesis. Wax bio-synthesis begins with fatty acid synthesis in the plastid (de novo synthesis of C16 and C18 and elongation of fatty acids in endoplasmic reticulum (C20 – C34 by four distinct enzymes 3-ketoacyl-CoA synthase, 3-ketoacyl-CoA reductase, 3-hydroxacyl-CoA dehydratase, trans-2,3-enoyl-CoA reductase (KCS, KCR, HCD, ECR. The KCS, a fatty acid elongase, determines the chain length and substrate specificity of the condensation reaction, a rate limiting step and the subsequent elongated products alkanes, aldehydes, primary alcohols, secondary alcohols, ketones and wax esters. 21 KCS genes were annotated in Arabidopsis thaliana Genome of which some KCSs were identified involved in cuticle formation (CER6 (CUT1, KCS1, KCS2, (DAISY, KCS20 and FDH.The current review will focus on the bio-chemical, genetic and molecular approaches on KCSs genes, predominantly KCS1 in plants particularly useful in identifying and characterizing gene products involved in wax bio-synthesis, secretion and function for developing transgenic crops that combat various stresses. INTRODUCTION

  12. Rhizobacteria activates (+)-δ-cadinene synthase genes and induces systemic resistance in cotton against beet armyworm (Spodoptera exigua).

    Science.gov (United States)

    Zebelo, Simon; Song, Yuanyuan; Kloepper, Joseph W; Fadamiro, Henry

    2016-04-01

    Gossypol is an important allelochemical produced by the subepidermal glands of some cotton varieties and important for their ability to respond to changing biotic stress by exhibiting antibiosis against some cotton pests. Plant growth-promoting rhizobacteria (PGPR) are root-colonizing bacteria that increase plant growth and often elicit defence against plant pathogens and insect pests. Little is known about the effect of PGPR on cotton plant-insect interactions and the potential biochemical and molecular mechanisms by which PGPR enhance cotton plant defence. Here, we report that PGPR (Bacillus spp.) treated cotton plants showed significantly higher levels of gossypol compared with untreated plants. Similarly, the transcript levels of the genes (i.e. (+)-δ-cadinene synthase gene family) involved in the biosynthesis of gossypol were higher in PGPR-treated plants than in untreated plants. Furthermore, the levels of jasmonic acid, an octadecanoid-derived defence-related phytohormone and the transcript level of jasmonic acid responsive genes were higher in PGPR-treated plants than in untreated plants. Most intriguingly, Spodoptera exigua showed reduced larval feeding and development on PGPR-treated plants. These findings demonstrate that treatment of plants with rhizobacteria may induce significant biochemical and molecular changes with potential ramifications for plant-insect interactions. PMID:26715260

  13. Cloning and characterization of the gene encoding β-amyrin synthase in the glycyrrhizic acid biosynthetic pathway in Glycyrrhiza uralensis

    Directory of Open Access Journals (Sweden)

    Honghao Chen

    2013-12-01

    Full Text Available Glycyrrhiza uralensis is considered to be one of the most important herbs in traditional Chinese medicine due to its numerous pharmacological effects particularly its ability to relieve cough and act as a mucolytic. Based on previous research, these effects are mediated by a number of active ingredients, especially glycyrrhizic acid (GA. In the present study, a gene encoding β-amyrin synthase (β-AS involved in GA biosynthesis in G. uralensis has been cloned and expressed in Saccharomyces cerevisiae. The cloned enzyme showed similar activity to native enzymes isolated from other Glycyrrhiza species to catalyze the conversion of 2,3-oxidosqualene into β-amyrin. In fact the β-AS gene is particularly important in the GA biosynthetic pathway in G. uralensis. The complete sequence of the enzyme was determined and a phylogenetic tree based on the β-AS gene of G. uralensis and 20 other species was created. This showed that Glycyrrhiza glabra had the closest kinship with G. uralensis. The results of this work will be useful in determining how to improve the efficacy of G. uralensis by improving its GA content and in exploring the biosynthesis of GA in vitro.

  14. Geranyl diphosphate synthase from mint

    Science.gov (United States)

    Croteau, Rodney Bruce; Wildung, Mark Raymond; Burke, Charles Cullen; Gershenzon, Jonathan

    1999-01-01

    A cDNA encoding geranyl diphosphate synthase from peppermint has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID No:1) is provided which codes for the expression of geranyl diphosphate synthase (SEQ ID No:2) from peppermint (Mentha piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for geranyl diphosphate synthase or for a base sequence sufficiently complementary to at least a portion of the geranyl diphosphate synthase DNA or RNA to enable hybridization therewith (e.g., antisense geranyl diphosphate synthase RNA or fragments of complementary geranyl diphosphate synthase DNA which are useful as polymerase chain reaction primers or as probes for geranyl diphosphate synthase or related genes). In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding geranyl diphosphate synthase. Thus, systems and methods are provided for the recombinant expression of geranyl diphosphate synthase that may be used to facilitate the production, isolation and purification of significant quantities of recombinant geranyl diphosphate synthase for subsequent use, to obtain expression or enhanced expression of geranyl diphosphate synthase in plants in order to enhance the production of monoterpenoids, to produce geranyl diphosphate in cancerous cells as a precursor to monoterpenoids having anti-cancer properties or may be otherwise employed for the regulation or expression of geranyl diphosphate synthase or the production of geranyl diphosphate.

  15. Geranyl diphosphate synthase from mint

    Energy Technology Data Exchange (ETDEWEB)

    Croteau, R.B.; Wildung, M.R.; Burke, C.C.; Gershenzon, J.

    1999-03-02

    A cDNA encoding geranyl diphosphate synthase from peppermint has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID No:1) is provided which codes for the expression of geranyl diphosphate synthase (SEQ ID No:2) from peppermint (Mentha piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for geranyl diphosphate synthase or for a base sequence sufficiently complementary to at least a portion of the geranyl diphosphate synthase DNA or RNA to enable hybridization therewith (e.g., antisense geranyl diphosphate synthase RNA or fragments of complementary geranyl diphosphate synthase DNA which are useful as polymerase chain reaction primers or as probes for geranyl diphosphate synthase or related genes). In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding geranyl diphosphate synthase. Thus, systems and methods are provided for the recombinant expression of geranyl diphosphate synthase that may be used to facilitate the production, isolation and purification of significant quantities of recombinant geranyl diphosphate synthase for subsequent use, to obtain expression or enhanced expression of geranyl diphosphate synthase in plants in order to enhance the production of monoterpenoids, to produce geranyl diphosphate in cancerous cells as a precursor to monoterpenoids having anti-cancer properties or may be otherwise employed for the regulation or expression of geranyl diphosphate synthase or the production of geranyl diphosphate. 5 figs.

  16. Tobacco streak virus (strain dahlia) suppresses post-transcriptional gene silencing of flavone synthase II in black dahlia cultivars and causes a drastic flower color change.

    OpenAIRE

    Deguchi, Ayumi; Tatsuzawa, Fumi; Hosokawa, Munetaka; Doi, Motoaki; Ohno, Sho

    2015-01-01

    Tobacco streak virus suppressed post-transcriptional gene silencing and caused a flower color change in black dahlias, which supported the role of cyanidin-based anthocyanins for black flower appearance. Black flower color of dahlia (Dahlia variabilis) has been attributed, in part, to the high accumulation of cyanidin-based anthocyanins that occurs when flavone synthesis is reduced because of post-transcriptional gene silencing (PTGS) of flavone synthase II (DvFNS). There are also purple-flow...

  17. The Gene CBO0515 from Clostridium botulinum Strain Hall A Encodes the Rare Enzyme N5-(Carboxyethyl) Ornithine Synthase, EC 1.5.1.24▿

    Science.gov (United States)

    Thompson, John; Hill, Karen K.; Smith, Theresa J.; Pikis, Andreas

    2010-01-01

    Sequencing of the genome of Clostridium botulinum strain Hall A revealed a gene (CBO0515), whose putative amino acid sequence was suggestive of the rare enzyme N5-(1-carboxyethyl) ornithine synthase. To test this hypothesis, CBO0515 has been cloned, and the encoded polypeptide was purified and characterized. This unusual gene appears to be confined to proteolytic strains assigned to group 1 of C. botulinum. PMID:19933367

  18. Enhanced expression and differential inducibility of soybean chalcone synthase genes by supplemental UV-B in dark-grown seedlings

    International Nuclear Information System (INIS)

    By developing gene-specific RT-PCR and using filters to allow transmission down to 290 nm (UV-B+) or blocking all radiation below 320 nm (UV-B(-)), the effect of UV-B+ and UV-B- light on expression of each of the presently known seven members of soybean chalcone synthase (CHS) gene family in dark-grown seedlings was analyzed. Dark expression was detectable already in 18 h dark-germinating embryos, with progressive increases on successive days, suggesting that chs belongs to a class of genes expressed very early during germination, and that the expression at this stage is either constitutive or induced by non-light-dependent factors present in the seed or made available following imbibition. Exposure of 18 h dark-germinating embryos to UV-B- or to UV-B+ light did not lead to an increase in chs signal. However, the 24 h dark-germinating embryos showed a distinct effect of UV-B+, interestingly coinciding with the stage when the head of seedlings was in the process of being pushed up above ground by stem elongation, suggesting the possibility of a developmental switch modulating the appearance of UV-B response. The response to UV-B- was most prominent in chs1 and almost silent in chs2, while the up-regulation by UV-B+ was most prominent in chs5 and chs6 and much less so in chs2. Interestingly, chs2 was noted to be the only member of the Gmchs gene family devoid of H-box, raising the possibility that the H-box may be a good indicator of the photo-inducibility of a chs gene. (author)

  19. The crtE gene in Erwinia herbicola encodes geranylgeranyl diphosphate synthase.

    OpenAIRE

    Math, S K; Hearst, J E; Poulter, C. D.

    1992-01-01

    A cluster of genes essential for the biosynthesis of carotenoids in Erwinia herbicola has been isolated and characterized [Armstrong, G.A., Alberti, M. & Hearst, J. E. (1990) Proc. Natl. Acad. Sci. USA 87, 9975-9979]. Related gene clusters are found in other carotenoid-producing bacteria. Two of these genes, crtB and crtE, have been assigned to enzymes responsible for conversion of geranylgeranyl diphosphate (GGPP) to prephytoene diphosphate and prephytoene diphosphate to phytoene, respective...

  20. Characterization and functional analysis of a chitin synthase gene (HcCS1) identified from the freshwater pearlmussel Hyriopsis cumingii.

    Science.gov (United States)

    Zheng, H F; Bai, Z Y; Lin, J Y; Wang, G L; Li, J L

    2015-01-01

    The triangle sail mussel, Hyriopsis cumingii, is the most important freshwater pearl mussel in China. However, the mechanisms underlying its chitin-mediated shell and nacre formation remain largely unknown. Here, we characterized a chitin synthase (CS) gene (HcCS1) in H. cumingii, and analyzed its possible physiological function. The complete ORF sequence of HcCS1 contained 6903 bp, encoding a 2300-amino acid protein (theoretical molecular mass = 264 kDa; isoelectric point = 6.22), and no putative signal peptide was predicted. A myosin motor head domain, a CS domain, and 12 transmembrane domains were found. The predicted spatial structures of the myosin head and CS domains were similar to the electron microscopic structure of the heavy meromyosin subfragment of chicken smooth muscle myosin and the crystal structure of bacterial cellulose synthase, respectively. This structural similarity indicates that the functions of these two domains might be conserved. Quantitative reverse transcription PCR results showed that HcCS1 was present in all detected tissues, with the highest expression levels detected in the mantle. The HcCS1 transcripts in the mantle were upregulated following shell damage from 12 to 24 h post-damage, and they peaked (approximately 1.5-fold increase) at 12 h after shell damage. These findings suggest that HcCS1 was involved in shell regeneration, and that it might participate in shell and nacre formation in this species via chitin synthesis. HcCS1 might also dynamically regulate chitin deposition during the process of shell and nacre formation with the help of its conserved myosin head domain. PMID:26782579

  1. Cobalamin-Independent Methionine Synthase (MetE): A Face-to-Face Double Barrel that Evolved by Gene Duplication

    Energy Technology Data Exchange (ETDEWEB)

    Pejcha, Robert; Ludwig, Martha L. (Michigan)

    2010-03-08

    Cobalamin-independent methionine synthase (MetE) catalyzes the transfer of a methyl group from methyltetrahydrofolate to L-homocysteine (Hcy) without using an intermediate methyl carrier. Although MetE displays no detectable sequence homology with cobalamin-dependent methionine synthase (MetH), both enzymes require zinc for activation and binding of Hcy. Crystallographic analyses of MetE from T. maritima reveal an unusual dual-barrel structure in which the active site lies between the tops of the two ({beta}{alpha}){sub 8} barrels. The fold of the N-terminal barrel confirms that it has evolved from the C-terminal polypeptide by gene duplication; comparisons of the barrels provide an intriguing example of homologous domain evolution in which binding sites are obliterated. The C-terminal barrel incorporates the zinc ion that binds and activates Hcy. The zinc-binding site in MetE is distinguished from the (Cys){sub 3}Zn site in the related enzymes, MetH and betaine-homocysteine methyltransferase, by its position in the barrel and by the metal ligands, which are histidine, cysteine, glutamate, and cysteine in the resting form of MetE. Hcy associates at the face of the metal opposite glutamate, which moves away from the zinc in the binary E {center_dot} Hcy complex. The folate substrate is not intimately associated with the N-terminal barrel; instead, elements from both barrels contribute binding determinants in a binary complex in which the folate substrate is incorrectly oriented for methyl transfer. Atypical locations of the Hcy and folate sites in the C-terminal barrel presumably permit direct interaction of the substrates in a ternary complex. Structures of the binary substrate complexes imply that rearrangement of folate, perhaps accompanied by domain rearrangement, must occur before formation of a ternary complex that is competent for methyl transfer.

  2. Cobalamin-independent methionine synthase (MetE: a face-to-face double barrel that evolved by gene duplication.

    Directory of Open Access Journals (Sweden)

    Robert Pejchal

    2005-02-01

    Full Text Available Cobalamin-independent methionine synthase (MetE catalyzes the transfer of a methyl group from methyltetrahydrofolate to L-homocysteine (Hcy without using an intermediate methyl carrier. Although MetE displays no detectable sequence homology with cobalamin-dependent methionine synthase (MetH, both enzymes require zinc for activation and binding of Hcy. Crystallographic analyses of MetE from T. maritima reveal an unusual dual-barrel structure in which the active site lies between the tops of the two (betaalpha(8 barrels. The fold of the N-terminal barrel confirms that it has evolved from the C-terminal polypeptide by gene duplication; comparisons of the barrels provide an intriguing example of homologous domain evolution in which binding sites are obliterated. The C-terminal barrel incorporates the zinc ion that binds and activates Hcy. The zinc-binding site in MetE is distinguished from the (Cys(3Zn site in the related enzymes, MetH and betaine-homocysteine methyltransferase, by its position in the barrel and by the metal ligands, which are histidine, cysteine, glutamate, and cysteine in the resting form of MetE. Hcy associates at the face of the metal opposite glutamate, which moves away from the zinc in the binary E.Hcy complex. The folate substrate is not intimately associated with the N-terminal barrel; instead, elements from both barrels contribute binding determinants in a binary complex in which the folate substrate is incorrectly oriented for methyl transfer. Atypical locations of the Hcy and folate sites in the C-terminal barrel presumably permit direct interaction of the substrates in a ternary complex. Structures of the binary substrate complexes imply that rearrangement of folate, perhaps accompanied by domain rearrangement, must occur before formation of a ternary complex that is competent for methyl transfer.

  3. Cobalamin-Independent Methionine Synthase (MetE): A Face-to-Face Double Barrel that Evolved by Gene Duplication

    International Nuclear Information System (INIS)

    Cobalamin-independent methionine synthase (MetE) catalyzes the transfer of a methyl group from methyltetrahydrofolate to L-homocysteine (Hcy) without using an intermediate methyl carrier. Although MetE displays no detectable sequence homology with cobalamin-dependent methionine synthase (MetH), both enzymes require zinc for activation and binding of Hcy. Crystallographic analyses of MetE from T. maritima reveal an unusual dual-barrel structure in which the active site lies between the tops of the two (βα)8 barrels. The fold of the N-terminal barrel confirms that it has evolved from the C-terminal polypeptide by gene duplication; comparisons of the barrels provide an intriguing example of homologous domain evolution in which binding sites are obliterated. The C-terminal barrel incorporates the zinc ion that binds and activates Hcy. The zinc-binding site in MetE is distinguished from the (Cys)3Zn site in the related enzymes, MetH and betaine-homocysteine methyltransferase, by its position in the barrel and by the metal ligands, which are histidine, cysteine, glutamate, and cysteine in the resting form of MetE. Hcy associates at the face of the metal opposite glutamate, which moves away from the zinc in the binary E · Hcy complex. The folate substrate is not intimately associated with the N-terminal barrel; instead, elements from both barrels contribute binding determinants in a binary complex in which the folate substrate is incorrectly oriented for methyl transfer. Atypical locations of the Hcy and folate sites in the C-terminal barrel presumably permit direct interaction of the substrates in a ternary complex. Structures of the binary substrate complexes imply that rearrangement of folate, perhaps accompanied by domain rearrangement, must occur before formation of a ternary complex that is competent for methyl transfer.

  4. Relationship between gene expression of nitric oxide synthase and androgens in rat corpus cavernosum

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    Objective To cladfy the dependence of neural nitric oxide synthase mRNA (nNOSmRNA) and endothelial nitric oxide synthase mRNA (eNOSmRNA) on androgens (testosterone [T] and dihydrotestosterone [DHT]). Methods 160 male Sprague Dawley (SD) rats were divided into Groups A (56 rats, 5 weeks old), B (50 rets,10 weeks old) and C (54 rats, 58 weeks old). Groups A, B and C were all subdivided respectively into five Subgroups. Subgroup 1: intact osntrels; Subgroup 2: castrated; Subgroup 3: castrated with testosterone ubdecanoate 25 mg/kg·mon-1, intramuscular injection, Subgroup 4: castrated with testosterone undecanoate 50 mg/kg·mon-1, intramuscular injection and Subgroup 5: treated with finaeteride 4.5 mg/kg·day-1, orally. Four and ten weeks after treatments described above, one half of the rats were killed. Serum samples were token for measurements of T, free testosterone (FT) and DHT by raclioimmunoassay. Penile samples were treated with liquid nitrogen and then stored at-80℃. nNOSmRNA and eNOSmRNA were detected by semiquantitative reveres-transcription polymerase chain reaction (RT-PCR) and Dot blot. Resulte There was no significant difference between Subgroup 1 and Subgroup 2 or Subgroup 5 in all Groups A, B and C. The expression of penile eNOSmRNA of Group A was significantly increased (4 weeks model) (P<0.05) or increased (10 weeks model) (P>0.05) in Subgroup 2 or 5 compared with those in Subgroup 1.There wes no significant difference between Subgroup 1 and Subgroup 2 or Subgroup 5 of Group B in 4 weeks model (P>0.05). There was an elevation when animals were castrated or treated with finasteride in the 10 weeks model.The expreseion of penile eNOSmRNA of Group C was significantly increased (10 weeks model) (P<0.05) or increased (4 weeks model) in Subgroup 2 compared with those in Subgroup 1.The production of eNOSmRNA in Subgroup 5 was also increased (including 4- and 10-week models). When T was supplied for castration, the penile eNOSmRNA was desreased to

  5. Dynamic modulation of thymidylate synthase gene expression and fluorouracil sensitivity in human colorectal cancer cells.

    Directory of Open Access Journals (Sweden)

    Kentaro Wakasa

    Full Text Available Biomarkers have revolutionized cancer chemotherapy. However, many biomarker candidates are still in debate. In addition to clinical studies, a priori experimental approaches are needed. Thymidylate synthase (TS expression is a long-standing candidate as a biomarker for 5-fluorouracil (5-FU treatment of cancer patients. Using the Tet-OFF system and a human colorectal cancer cell line, DLD-1, we first constructed an in vitro system in which TS expression is dynamically controllable. Quantitative assays have elucidated that TS expression in the transformant was widely modulated, and that the dynamic range covered 15-fold of the basal level. 5-FU sensitivity of the transformant cells significantly increased in response to downregulated TS expression, although being not examined in the full dynamic range because of the doxycycline toxicity. Intriguingly, our in vitro data suggest that there is a linear relationship between TS expression and the 5-FU sensitivity in cells. Data obtained in a mouse model using transformant xenografts were highly parallel to those obtained in vitro. Thus, our in vitro and in vivo observations suggest that TS expression is a determinant of 5-FU sensitivity in cells, at least in this specific genetic background, and, therefore, support the possibility of TS expression as a biomarker for 5-FU-based cancer chemotherapy.

  6. Genes encoding chavicol/eugenol synthase from the creosote bush Larrea tridentata

    Science.gov (United States)

    Lewis, Norman G.; Davin, Laurence B.; Kim, Sung -Jin; Vassao, Daniel Giddings; Patten, Ann M.; Eichinger, Dietmar

    2015-09-15

    Particular aspects provide novel methods for redirecting carbon allocation in plants or cell culture from lignification to inherently more useful and tractable materials, and to facilitate the generation of, e.g., biofuels from the remaining plant ro culture biomass. Particular aspects provided novel methods for converting monolignols into allyl/propenyl phenols, and for chavicol/eugenol formation or production. Additional aspects relate to the discovery of novel chavicol/eugenol synthases that convert p-coumaryl/coniferyl alcohol esters into chavicol/eugenol, and to novel compositions (e.g., novel proteins and nucleic acids encoding same), and novel methods using same for producing or forming chavicol/eugenol and other derivatives in cell culture and/or genetically modified plants, and for re-engineering the composition of plant biomass. Particular aspects provide novel methods for generation in culture or in planta of liquid/combustible allyl/propenyl phenols, and these phenolic products are utilized for (non-ethanol) biofuel/bioenergy purposes, while the remaining plant biomass facilitates the generation of other biofuels.

  7. Relationship of endothelial nitric oxide synthase gene polymorphism with blood pressure,lipid profile and blood glucose level

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    To study the relationship of the polymorphism of endothelial nitric oxide synthase(eNOS)gene and blood pressure,lipid profiles and blood glucose level.By using PCR-RFLP,the eNOS Glu298Asp gene polymorphism was detected in 184 patients with essential hypertension and 196 matched healthy individuals with normal blood pressure.Taking into account eNOS Glu298Asp polymorphisms,the relationship of blood pressure with triglycerides(TG),total cholesterol(TC),high density lipoprotein(HDL),low density lipoprotein(LDL)and blood glucose level was analyzed.The distribution of eNOS Glu298Asp polymorphism had no significant difference between different blood pressure groups and gender groups,but there was a significant difference between different age groups,diastolic blood pressure groups or BMI groups(P<0.05).Asp/Asp genotype significantly increased the risk of hypertension in individuals with serum TC above 5.4 mmol/L(P=0.03,OR=2.65).eNOSGlu298Asp polymorphism and serum lipid could synergistically modulate the blood pressure,eNOS Asp/Asp genotype could significantly increase the risk of hypertension in individuals with serum TC over 5.4 mmol/L,eNOS Glu298Asp in combination with serum TC could be used to predict the risk of hypertension.

  8. Structural analysis of the promoter of tomato 1-aminocyclopropane-1-carboxylate synthase 6 gene(Le-ACS6)

    Institute of Scientific and Technical Information of China (English)

    LIN JingYu; FAN Rong; WAN XiaoRong; CHARNG Yeeyung; WANG NingNing

    2007-01-01

    Ethylene plays an important role in the regulation of many growth and developmental processes of higher plants. In tomato, Le-ACS6, a member of the ACC synthase multigene family involved in system 1 ethylene biosynthesis during fruit ripening, is subject to negative feedback regulation by ethylene. To identify the cis-elements that are responsible for the negative feedback control, we established an in vitro transient assay system employing particle bombardment on mature-green tomato fruit pericarp to examine the expression of a luciferase (LUC) reporter gene driven by a 5'-serially deleted Le-ACS6 promoter. The results localized putative cis-elements required for negative ethylene-response between -347 and -266 upstream from the translational start site ATG. Several lines of stable transformation of the Le-ACS6 promoter and GUS reporter fusion gene containing internal deletion from -347 to -266 were generated. The expression pattern of the GUS reporter showed that removal of the nucleotides from -347 to -266 completely eliminated the response of the Le-ACS6 promoter to exogenous ethylene.

  9. Expression of the Grifola frondosa Trehalose Synthase Gene and Improvement of Drought-Tolerance in Sugarcane (Saccharum officinarum L.)

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    Trehalose is a nonreducing disaccharide of glucose that functions as a protectant in the stabilization of biological structures and enhances stress tolerance to abiotic stresses in organisms. We report here the expression of a Grifola frondosa trehalose synthase (TSase) gene for improving drought tolerance in sugarcane (Saccharum officinarum L.). The expression of the transgene was under the control of two tandem copies of the CaMV35S promoter and transferred into sugarcane by Agrobacterium tumefaciens EHA105. The transgenic plants accumulated high levels of trehalose, up to 8.805-12.863 mg/g fresh weight, whereas it was present at undetectable level in nontransgenic plants. It has been reported that transgenic plants transformed with Escherichia coli TPS (trehalose-6-phosphatesynthase) and/or TPP (trehalose-6-phosphate phosphatase) are severely stunted and have root morphologic alterations. Interestingly, our transgenic sugarcane plants had no obvious morphological changes and no growth inhibition in the field. Trehalose accumulation in 35S-35S: TSase plants resulted in increased drought tolerance, as shown by the drought and the drought physiological indexes, such as the rate of bound water/free water, plasma membrane permeability, malondialdehyde content, chlorophyll a and b contents,and activity of SOD and POD of the excised leaves. These results suggest that transgenic plants transformed with the TSase gene can accumulate high levels of trehalose and have enhanced tolerance to drought.

  10. Exclusion of the neuronal nitric oxide synthase gene and the human achaete-scute homologue 1 gene as candidate loci for spinal cerebellar ataxia 2 (SCA2)

    Energy Technology Data Exchange (ETDEWEB)

    Twells, R.; Xu, W. [Imperial College, London (United Kingdom)]|[Institute of Animal Physiology and Genetics Research, Babraham, Cambridge (United Kingdom); Ball, D. [Johns Hopkins Univ. School of Medicine, Baltimore, MD (United States)] [and others

    1994-09-01

    The autosomal dominant ataxias are a heterogeneous group of disorders, characterized by progressive degeneration of the cerebellum, pons and inferior olives, as well as the spinal cord. We previously mapped the spinal cerebellar ataxia 2 locus (SCA2) to chromosome 12q23-24.1 in a large Cuban founder population, flanked by the markers D12S58 and PLA2. Anticipation is a common feature of this disorder and therefore we have examined genes in this region which contain trinucleotide repeat motifs as candidate loci for SCA2. The neuronal nitric oxide synthase gene (NOS) has recently been assigned to chromosome 12q24.2-24.3 by fluorescent in situ hybridization. Neuronal NOS is responsible for the production of nitric oxide, a neurotransmitter expressed in high levels in the cerebellum as well as other regions of the nervous system. We report here the identification and analysis of an (AAT){sub n} repeat motif in an intronic region of the neuronal NOS gene, genetic mapping data and its exclusion from being involved in SCA2. We also report the exclusion of the human achaete-scute homologue 1 gene (HASH1), instrumental in neurosensory development in mouse, from being involved in SCA2 by the analysis of a proximal (CAG){sub n} repeat motif in the Cuban pedigrees, and its genetic location on chromosome 12q.

  11. The role of sugars and sugar metabolism genes (sucrose synthase) in arabidopsis thaliana seed development

    OpenAIRE

    Odunlami, Benjamin Oladipo

    2009-01-01

    Seed development in Arabidopsis thaliana, has been studied at several levels. However, little has been done to study the role of sugar metabolism genes in seed pod development in this species. As the fertilized egg progresses to a mature seed, the sugars composition during different stages of the developing changes. These changes are related to metabolic processes in the developing seeds, but also to the activity of sucrose- converting and transporting genes, active at the interphase between ...

  12. Normal responses to restraint stress in mice lacking the gene for neuronal nitric oxide synthase.

    Science.gov (United States)

    Weissman, Ben A; Sottas, Chantal M; Holmes, Michael; Zhou, Ping; Iadecola, Costantino; Hardy, Dianne O; Ge, Ren-Shan; Hardy, Matthew P

    2009-01-01

    The hormonal changes associated with immobilization stress (IMO) include a swift increase in corticosterone (CORT) concentration and a decrease in circulating testosterone (T) levels. There is evidence that the production of the short-lived neuromodulator nitric oxide (NO) is increased during stress in various tissues, including the brain. NO also suppresses the biosynthesis of T. Both the inducible and the neuronal isoforms of NO synthase (iNOS and nNOS, respectively) have been implicated in this suppression, but the evidence has not been conclusive. We used adult wild-type (WT) and nNOS knockout male mice (nNOS-/-) to assess the respective roles of CORT and nNOS-derived NO in stress mediated inhibition of T production. Animals were assigned to either basal control or 3-hour IMO groups. No difference in basal plasma and testicular T levels were observed between WT and nNOS-/-, although testicular weights of mutant mice were slightly lower compared to WT animals. The plasma contents of luteinizing hormone (LH) and CORT in unstressed mice of both genotypes were similar. Exposure to 3 hours of IMO increased plasma CORT and decreased T concentrations in mice of both genotypes. However, comparable levels of plasma LH and testicular nitrite and nitrate (NOx), NO stable metabolites, were detected in control and stressed WT and nNOS-/- mice. Adrenal concentrations of NOx declined after IMO, but the reduction was not statistically significant. These findings implicate CORT rather than NO generated by nNOS in the rapid stress-induced suppression of circulating T. PMID:19304728

  13. Study of exon 12 polymorphism of the human thromboxane synthase (CYP5A1) gene in Egyptian stroke patients

    International Nuclear Information System (INIS)

    Thromboxane synthase (CYP5A1) catalyzes the conversion of prostaglandin H2 to thromboxane A2, a potent mediator of platelet aggregation, vasoconstriction and bronchoconstriction. It has been implicated in the patho-physiological process of a variety of diseases, such as atherosclerosis, myocardial infarction, stroke and asthma. On the basis of the hypothesis that variations of the CYP5A1 gene may play an important role in human diseases, we performed screening for the prevalence of exon12 polymorphism of the human Thromboxane synthase (CYP5A1) gene among Egyptian normal and stroke patients. Using sequence-specific PCR, we examined the allelic prevalence in 70 Egyptian patients with ischemic strokes and in 70 controls. In addition, we compared the CYP5A1 allelic prevalence in 30 patients with stroke recurrence despite Aspirin use, in comparison with patients who have not experienced recurrent stroke while taking Aspirin. The frequencies of the CYP5A1*9 mutant (substitution of guanine by adenine near the heme-binding catalytic domain) and of the wild-type allele were 0.197(19.7%) and 0.803 (80.3%) respectively; they did not differ significantly between stroke patients and controls. The CYP5A1*9 mutant was significantly more prevalent among stroke patients with history of previous cerebrovascular attacks; even after adjusting for the common risk factors for cardiovascular disease (odds ratio (OR)1.73, 95%, confidence interval ( CI) 1.10-2.73; p=0.017). Among stroke patients, the presence of the CYP5A1 wild type allele was more frequent among the hypertensives (OR 1.68, 95% CI, 1.01-2.79; p=0.045), and less frequent among the diabetics (OR 0.55, 95%, CI 0.36-0.84; p=0.006). Also among stroke patients, the CYP5A1*9 mutant was significantly more prevalent among those, who failed secondary Aspirin prophylaxis compared to those with successful secondary Aspirin prophylaxis (OR 1.49, 95%, CI 1.06-2.11). This study provides evidence for high prevalence of the CYP5A1*9 mutant

  14. Polymorphisms in thymidylate synthase gene and susceptibility to breast cancer in a Chinese population: a case-control analysis

    Directory of Open Access Journals (Sweden)

    Liu Jiyong

    2006-05-01

    Full Text Available Abstract Background Accumulative evidence suggests that low folate intake is associated with increased risk of breast cancer. Polymorphisms in genes involved in folate metabolism may influence DNA methylation, nucleotide synthesis, and thus individual susceptibility to cancer. Thymidylate synthase (TYMS is a key enzyme that participates in folate metabolism and catalyzes the conversion of dUMP to dTMP in the process of DNA synthesis. Two potentially functional polymorphisms [a 28-bp tandem repeat in the TYMS 5'-untranslated enhanced region (TSER and a 6-bp deletion/insertion in the TYMS 3'-untranslated region (TS 3'-UTR] were suggested to be correlated with alteration of thymidylate synthase expression and associated with cancer risk. Methods To test the hypothesis that polymorphisms of the TYMS gene are associated with risk of breast cancer, we genotyped these two polymorphisms in a case-control study of 432 incident cases with invasive breast cancer and 473 cancer-free controls in a Chinese population. Results We found that the distribution of TS3'-UTR (1494del6 genotype frequencies were significantly different between the cases and controls (P = 0.026. Compared with the TS3'-UTR del6/del6 wild-type genotype, a significantly reduced risk was associated with the ins6/ins6 homozygous variant genotype (adjusted OR = 0.58, 95% CI = 0.35–0.97 but not the del6/ins6 genotype (OR = 1.09, 95% CI = 0.82–1.46. Furthermore, breast cancer risks associated with the TS3'-UTR del6/del6 genotype were more evident in older women, postmenopausal subjects, individuals with a younger age at first-live birth and individuals with an older age at menarche. However, there was no evidence for an association between the TSER polymorphism and breast cancer risks. Conclusion These findings suggest that the TS3'-UTR del6 polymorphism may play a role in the etiology of breast cancer. Further larger population-based studies as well as functional evaluation of the

  15. Phylogeny reconstruction in the Caesalpinieae grade (Leguminosae) based on duplicated copies of the sucrose synthase gene and plastid markers.

    Science.gov (United States)

    Manzanilla, Vincent; Bruneau, Anne

    2012-10-01

    The Caesalpinieae grade (Leguminosae) forms a morphologically and ecologically diverse group of mostly tropical tree species with a complex evolutionary history. This grade comprises several distinct lineages, but the exact delimitation of the group relative to subfamily Mimosoideae and other members of subfamily Caesalpinioideae, as well as phylogenetic relationships among the lineages are uncertain. With the aim of better resolving phylogenetic relationships within the Caesalpinieae grade, we investigated the utility of several nuclear markers developed from genomic studies in the Papilionoideae. We cloned and sequenced the low copy nuclear gene sucrose synthase (SUSY) and combined the data with plastid trnL and matK sequences. SUSY has two paralogs in the Caesalpinieae grade and in the Mimosoideae, but occurs as a single copy in all other legumes tested. Bayesian and maximum likelihood phylogenetic analyses suggest the two nuclear markers are congruent with plastid DNA data. The Caesalpinieae grade is divided into four well-supported clades (Cassia, Caesalpinia, Tachigali and Peltophorum clades), a poorly supported clade of Dimorphandra Group genera, and two paraphyletic groups, one with other Dimorphandra Group genera and the other comprising genera previously recognized as the Umtiza clade. A selection analysis of the paralogs, using selection models from PAML, suggests that SUSY genes are subjected to a purifying selection. One of the SUSY paralogs, under slightly stronger positive selection, may be undergoing subfunctionalization. The low copy SUSY gene is useful for phylogeny reconstruction in the Caesalpinieae despite the presence of duplicate copies. This study confirms that the Caesalpinieae grade is an artificial group, and highlights the need for further analyses of lineages at the base of the Mimosoideae. PMID:22699157

  16. Association study of the endothelial nitric oxide synthase gene polymorphisms with essential hypertension in northern Han Chinese

    Institute of Scientific and Technical Information of China (English)

    ZHAO Qi; SU Shao-yong; CHEN Shu-feng; LI Biao; GU Dong-feng

    2006-01-01

    Background Nitric oxide (NO) synthesized by endothelial nitric oxide synthase (eNOS) plays an important role in both the regulation of endothelial function and the control of blood pressure. Up to now, there has been conflicting data regarding the association between three clinically relevant polymorphisms (T-786C, intron4b/a and G894T) of the eNOS gene and essential hypertension.Methods To examine the contribution of the three eNOS gene polymorphisms to the development of hypertension in the northern Han Chinese, a case-control study including 503 hypertensive cases and 490 age-,gender-, and area-matched controls recruited from the International Collaborative Study of Cardiovascular Disease in Asia (InterASIA) was conducted. Genotyping was performed by polymerase chain reaction (PCR) or PCR-restriction fragment length polymorphism (RFLP).Results The T-786C and intron4b/a polymorphisms were observed in significant linkage disequilibrium (D'=0.87, P<0.001). The minor allele frequencies of these three polymorphisms in healthy controls were much lower than those of Caucasians (9.3% vs 39.6%-42.0%, 8.9% vs 15.0%- 16.0% and 10.9% vs 34.5%-34.9%for -786C, intron4a and 894T, respectively). Genotype distributions and allele frequencies of the three polymorphisms did not differ between cases and controls (all P > 0.05). In addition, none of the eight estimated haplotypes significantly increased or decreased the risk of hypertension before or after adjustment for several known risk factors.Conclusion The study results suggest that the three eNOS gene polymorphisms are unlikely to be major genetic susceptibility factors for essential hypertension in the northern Han Chinese population.

  17. Enrichment of carotenoids in flaxseed (Linum usitatissimum) by metabolic engineering with introduction of bacterial phytoene synthase gene crtB.

    Science.gov (United States)

    Fujisawa, Masaki; Watanabe, Mio; Choi, Song-Kang; Teramoto, Maki; Ohyama, Kanji; Misawa, Norihiko

    2008-06-01

    Linseed flax (Linum usitatissimum L.) is an industrially important oil crop, which includes large amounts of alpha-linolenic acid (18:3) and lignan in its seed oil. We report here the metabolic engineering of flax plants to increase carotenoid amount in seeds. Agrobacterium-mediated transformation of flax was performed to express the phytoene synthase gene (crtB) derived from the soil bacterium Pantoea ananatis (formerly called Erwinia uredovora 20D3) under the control of the cauliflower mosaic virus (CaMV) 35S constitutive promoter or the Arabidopsis thaliana fatty acid elongase 1 gene (FAE1) seed-specific promoter. As a result, eight transgenic flax plants were generated. They formed orange seeds (embryos), in which phytoene, alpha-carotene, and beta-carotene were newly accumulated in addition to increased amounts of lutein, while untransformed flax plants formed light-yellow seeds, in which only lutein was detected. Interestingly, despite the control of the CaMV 35S promoter, the expression of crtB was not observed in the leaves but in the seeds in the transgenic flax plants. Total carotenoid amounts in these seeds were 65.4-156.3 microg/g fresh weight, which corresponded to 7.8- to 18.6-fold increase, compared with those of untransformed controls. These results suggest that the flux of phytoene synthesis from geranylgeranyl diphosphate was first promoted by the expressed crtB gene product (CrtB), and then phytoene was consecutively decomposed to the downstream metabolites alpha-carotene, beta-carotene, and lutein, as catalyzed by endogenous carotenoid biosynthetic enzymes in seeds. The transgenic flaxseeds enriched with the carotenoids could be valuable as nutritional sources for human health. PMID:18640603

  18. Endothelial Nitric Oxide Synthase (eNOS) Gene Polymorphism is Associated with Age Onset of Menarche in Sickle Cell Disease Females of India

    OpenAIRE

    Nishank, Sudhansu Sekhar

    2013-01-01

    Background and Objective Females with sickle cell disease (SCD) often show late onset of menarche. In transgenic sickle cell mouse, deficiency of gene encoding endothelial nitric oxide synthase (eNOS) has been reported to be associated with late onset of menarche. Thus to explore the possible association of eNOS gene polymorphism with age of onset of menarche in SCD females, 3 important eNOS gene polymorphisms- eNOS 4a/b, eNOS 894G>T (rs1799983) and eNOS-786 T>C (rs2070744) and plasma nitrite...

  19. ENDOTHELIAL NITRIC OXIDE SYNTHASE (ENOS) GENE POLYMORPHISM IS ASSOCIATED WITH AGE ONSET OF MENARCHE IN SICKLE CELL DISEASE FEMALES OF INDIA

    OpenAIRE

    Sudhansu Sekhar Nishank

    2013-01-01

    ABSTRACT   Background and Objective :  Females with sickle cell disease (SCD) often show late onset of menarche. In transgenic sickle cell mouse, deficiency of gene encoding endothelial nitric oxide synthase (eNOS) has been reported to be associated with late onset of menarche. Thus to explore the possible association of eNOS gene polymorphism with age of onset of menarche in SCD females, 3 important eNOS gene polymorphism- eNOS 4a/b, eNOS 894G>T and eNOS-786 T>C  and  plasma ...

  20. Production of copolyesters of 3-hydroxybutyrate and medium-chain-length 3-hydroxyalkanoates by E. coli containing an optimized PHA synthase gene

    Directory of Open Access Journals (Sweden)

    Gao Xue

    2012-09-01

    Full Text Available Abstract Background Microbial polyhydroxyalkanoates (PHA are biopolyesters consisting of diverse monomers. PHA synthase PhaC2Ps cloned from Pseudomonas stutzeri 1317 is able to polymerize short-chain-length (scl 3-hydroxybutyrate (3HB monomers and medium-chain-length (mcl 3-hydroxyalkanoates (3HA with carbon chain lengths ranging from C6 to C12. However, the scl and mcl PHA production in Escherichia coli expressing PhaC2Ps is limited with very low PHA yield. Results To improve the production of PHA with a wide range of monomer compositions in E. coli, a series of optimization strategies were applied on the PHA synthase PhaC2Ps. Codon optimization of the gene and mRNA stabilization with a hairpin structure were conducted and the function of the optimized PHA synthase was tested in E. coli. The transcript was more stable after the hairpin structure was introduced, and western blot analysis showed that both codon optimization and hairpin introduction increased the protein expression level. Compared with the wild type PhaC2Ps, the optimized PhaC2Ps increased poly-3-hydroxybutyrate (PHB production by approximately 16-fold to 30% of the cell dry weight. When grown on dodecanoate, the recombinant E. coli harboring the optimized gene phaC2PsO with a hairpin structure in the 5’ untranslated region was able to synthesize 4-fold more PHA consisting of 3HB and medium-chain-length 3HA compared to the recombinant harboring the wild type phaC2Ps. Conclusions The levels of both PHB and scl-mcl PHA in E. coli were significantly increased by series of optimization strategies applied on PHA synthase PhaC2Ps. These results indicate that strategies including codon optimization and mRNA stabilization are useful for heterologous PHA synthase expression and therefore enhance PHA production.

  1. Cloning and Characterisation of the Gene Encoding 3-Hydroxy-3-Methylglutaryl-CoA Synthase in Tripterygium wilfordii

    Directory of Open Access Journals (Sweden)

    Yu-Jia Liu

    2014-11-01

    Full Text Available Tripterygium wilfordii is a traditional Chinese medical plant used to treat rheumatoid arthritis and cancer. The main bioactive compounds of the plant are diterpenoids and triterpenoids. 3-Hydroxy-3-methylglutaryl-CoA synthase (HMGS catalyses the reaction of acetoacetyl-CoA to 3-hydroxy-3-methylglutaryl-CoA, which is the first committed enzyme in the mevalonate (MVA pathway. The sequence information of HMGS in Tripterygium wilfordii is a basic resource necessary for studying the terpenoids in the plant. In this paper, full-length cDNA encoding HMGS was isolated from Tripterygium wilfordii (abbreviated TwHMGS, GenBank accession number: KM978213. The full length of TwHMGS is 1814 bp, and the gene encodes a protein with 465 amino acids. Sequence comparison revealed that TwHMGS exhibits high similarity to HMGSs of other plants. The tissue expression patterns revealed that the expression level of TwHMGS is highest in the stems and lowest in the roots. Induced expression of TwHMGS can be induced by MeJA, and the expression level is highest 4 h after induction. The functional complement assays in the YML126C knockout yeast demonstrated that TwHMGS participates in yeast terpenoid biosynthesis.

  2. A Sweetpotato Geranylgeranyl Pyrophosphate Synthase Gene, IbGGPS, Increases Carotenoid Content and Enhances Osmotic Stress Tolerance in Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Wei Chen

    Full Text Available Sweetpotato highly produces carotenoids in storage roots. In this study, a cDNA encoding geranylgeranyl phyrophosphate synthase (GGPS, named IbGGPS, was isolated from sweetpotato storage roots. Green fluorescent protein (GFP was fused to the C-terminus of IbGGPS to obtain an IbGGPS-GFP fusion protein that was transiently expressed in both epidermal cells of onion and leaves of tobacco. Confocal microscopic analysis determined that the IbGGPS-GFP protein was localized to specific areas of the plasma membrane of onion and chloroplasts in tobacco leaves. The coding region of IbGGPS was cloned into a binary vector under the control of 35S promoter and then transformed into Arabidopsis thaliana to obtain transgenic plants. High performance liquid chromatography (HPLC analysis showed a significant increase of total carotenoids in transgenic plants. The seeds of transgenic and wild-type plants were germinated on an agar medium supplemented with polyethylene glycol (PEG. Transgenic seedlings grew significantly longer roots than wild-type ones did. Further enzymatic analysis showed an increased activity of superoxide dismutase (SOD in transgenic seedlings. In addition, the level of malondialdehyde (MDA was reduced in transgenics. qRT-PCR analysis showed altered expressions of several genes involved in the carotenoid biosynthesis in transgenic plants. These data results indicate that IbGGPS is involved in the biosynthesis of carotenoids in sweetpotato storage roots and likely associated with tolerance to osmotic stress.

  3. Identification of genes coding for putative wax ester synthase/diacylglycerol acyltransferase enzymes in terrestrial and marine environments.

    Science.gov (United States)

    Lanfranconi, Mariana P; Alvarez, Adrián F; Alvarez, Héctor M

    2015-12-01

    Synthesis of neutral lipids such as triacylglycerols (TAG) and wax esters (WE) is catalyzed in bacteria by wax ester synthase/diacylglycerol acyltransferase enzymes (WS/DGAT). We investigated the diversity of genes encoding this enzyme in contrasting natural environments from Patagonia (Argentina). The content of petroleum hydrocarbons in samples collected from oil-producing areas was measured. PCR-based analysis covered WS/DGAT occurrence in marine sediments and soil. No product was obtained in seawater samples. All clones retrieved from marine sediments affiliated with gammaproteobacterial sequences and within them, most phylotypes formed a unique cluster related to putative WS/DGAT belonging to marine OM60 clade. In contrast, soils samples contained phylotypes only related to actinomycetes. Among them, phylotypes affiliated with representatives largely or recently reported as oleaginous bacteria, as well as with others considered as possible lipid-accumulating bacteria based on the analysis of their annotated genomes. Our study shows for the first time that the environment could contain a higher variety of ws/dgat than that reported from bacterial isolates. The results of this study highlight the relevance of the environment in a natural process such as the synthesis and accumulation of neutral lipids. Particularly, both marine sediments and soil may serve as a useful source for novel WS/DGAT with biotechnological interest. PMID:26228353

  4. Functional analyses of a flavonol synthase - like gene from Camellia nitidissima reveal its roles in flavonoid metabolism during floral pigmentation

    Indian Academy of Sciences (India)

    Xing-Wen Zhou; Zheng-Qi Fan; Yue Chen; Yu-Lin Zhu; Ji-Yuan Li; Heng-Fu Yin

    2013-09-01

    The flavonoids metabolic pathway plays central roles in floral coloration, in which anthocyanins and flavonols are derived from common precursors, dihydroflavonols. Flavonol synthase (FLS) catalyses dihydroflavonols into flavonols, which presents a key branch of anthocyanins biosynthesis. The yellow flower of Camellia nitidissima Chi. is a unique feature within the genus Camellia, which makes it a precious resource for breeding yellow camellia varieties. In this work, we characterized the secondary metabolites of pigments during floral development of C. nitidissima and revealed that accumulation of flavonols correlates with floral coloration. We first isolated CnFLS1 and showed that it is a FLS of C. nitidissima by gene family analysis. Second, expression analysis during floral development and different floral organs indicated that the expression level of CnFLS1 was regulated by developmental cues, which was in agreement with the accumulating pattern of flavonols. Furthermore, over-expression of CnFLS1 in Nicotiana tabacum altered floral colour into white or light yellow, and metabolic analysis showed significant increasing of flavonols and reducing of anthocyanins in transgenic plants. Our work suggested CnFLS1 plays critical roles in yellow colour pigmentation and is potentially a key point of genetic engineering toward colour modification in Camellia.

  5. Tumor necrosis factor alpha augments nitric oxide-dependent macrophage cytotoxicity against Entamoeba histolytica by enhanced expression of the nitric oxide synthase gene.

    OpenAIRE

    Lin, J. Y.; Seguin, R; K. Keller; Chadee, K

    1994-01-01

    Nitric oxide (NO measured as nitrite, NO2-) is the major effector molecule produced by activated macrophages for in vitro cytotoxicity against Entamoeba histolytica trophozoites. In this study, we determine whether tumor necrosis factor alpha (TNF-alpha) produced by activated bone marrow-derived macrophages (BMM) is involved in the induction of the inducible NO synthase gene (mac-NOS) for NO-dependent amebicidal activity. TNF-alpha alone did not directly induce macrophage NO2- production to k...

  6. Molecular characterization of a cellulose synthase gene (AaxmCesA1) isolated from an Acacia auriculiformis x Acacia mangium hybrid

    OpenAIRE

    Yong, Seok Yien Christina; Wickneswari, Ratnam

    2012-01-01

    Cellulose is the major component of plant cell walls, providing mechanical strength to the structural framework of plants. In association with lignin, hemicellulose, protein and pectin, cellulose forms the strong yet flexible bio-composite tissue of wood. Wood formation is an essential biological process and is of significant importance to the cellulosic private sector industry. Cellulose synthase genes encode the catalytic subunits of a large protein complex responsible for the biogenesis of...

  7. Cloning, Sequencing, and Functional Analysis of an Iterative Type I Polyketide Synthase Gene Cluster for Biosynthesis of the Antitumor Chlorinated Polyenone Neocarzilin in “Streptomyces carzinostaticus”

    OpenAIRE

    OTSUKA, Miyuki; Ichinose, Koji; Fujii, Isao; Ebizuka, Yutaka

    2004-01-01

    Neocarzilins (NCZs) are antitumor chlorinated polyenones produced by “Streptomyces carzinostaticus” var. F-41. The gene cluster responsible for the biosynthesis of NCZs was cloned and characterized. DNA sequence analysis of a 33-kb region revealed a cluster of 14 open reading frames (ORFs), three of which (ORF4, ORF5, and ORF6) encode type I polyketide synthase (PKS), which consists of four modules. Unusual features of the modular organization is the lack of an obvious acyltransferase domain ...

  8. Identification of Select Fumonisin Forming Fusarium Species Using PCR Applications of the Polyketide Synthase Gene and its Relationship to Fumonisin Production in vitro

    OpenAIRE

    Mary Scruggs; Leigh Hawkins; Rowena Kelley; Peter Ma; Sonya Baird; Paul Williams; Gary Windham; Hamed K. Abbas; Richard Baird

    2008-01-01

    A polymerase chain reaction (PCR) based diagnostic assay was used to develop markers for detection of Fusarium verticillioides (=F. moniliforme), a fumonisin producing fungus in maize tissues. Species-specific primers were designed based on sequence data from the polyketide synthase (PKS) gene (FUM1- previously FUM5) responsible for fumonisin production in fungi. Four sets of oligonucleotide primers were tested for their specificity using 24 strains of F. verticillioides, 10 F. proliferatum, ...

  9. Gene delivery using calcium phosphate nanoparticles: Optimization of the transfection process and the effects of citrate and poly(l-lysine) as additives.

    Science.gov (United States)

    Khan, Mohammed A; Wu, Victoria M; Ghosh, Shreya; Uskoković, Vuk

    2016-06-01

    Despite the long history of nanoparticulate calcium phosphate (CaP) as a non-viral transfection agent, there has been limited success in attempts to optimize its properties for transfection comparable in efficiency to that of viral vectors. Here we focus on the optimization of: (a) CaP nanoparticle precipitation conditions, predominantly supersaturation and Ca/P molar ratios; (b) transfection conditions, mainly the concentrations of the carrier and plasmid DNA; (c) the presence of surface additives, including citrate anion and cationic poly(l-lysine) (PLL). CaP nanoparticles significantly improved transfection with plasmid DNA encoding enhanced green fluorescent protein (eGFP) in pre-osteoblastic MC3T3-E1 cells compared to a commercial non-viral carrier. At the same time they elicited significantly lesser cytotoxicity than the commercial carrier. Plasmid DNA acted as a nucleation promoter, decreasing the nucleation lag time of metastable CaP solutions and leading to a higher rate of nucleation and a lower size of the precipitated particles. The degree of supersaturation (DS) of 15 was found to be more optimal for transfection than that of 12.5 or 17.5 and higher. Because CaP particles precipitated at DS 15 were spherical, while DS 17.5 and 21 yielded acicular particles, it was concluded that spherical particle morphologies were more conducive to transfection than the anisotropic ones. Even though the yield at DS 15 was 10 and 100 times lower than that at DS 17.5 and 21, respectively, transfection rates were higher using CaP nanoparticle colloids prepared at DS 15 than using those made at higher or lower DS, indicating that the right particle morphology can outweigh the difference in the amount of the carrier, even when this difference is close to 100×. In contrast to the commercial carrier, the concentration of CaP-pDNA delivered to the cells was directly proportional to the transfection rate. Osteosarcoma K7M2 cells were four times more easily transfectable with

  10. Mutations in Plasmodium falciparum dihydrofolate reductase and dihydropteroate synthase genes in Senegal

    OpenAIRE

    D. Ndiaye; Daily, J. P.; Sarr, O.; Ndir, O.; Gaye, O.; Mboup, S.; Wirth, D F

    2005-01-01

    Senegal recently (2004) switched to sulfadoxine-pyrimethamine (SP) with amodiaquine as first line therapy for malaria in response to increasing chloroquine resistance. In anticipation of emerging resistance to SP as a result of this change in drug pressure, we set out to define the baseline prevalence of SP-associated mutations in the dhfr and dhps genes in P. falciparum using geographically diverse and longitudinally collected samples. A total of 153 blood samples were analyzed from patients...

  11. Volatile emissions of scented Alstroemeria genotypes are dominated by terpenes, and a myrcene synthase gene is highly expressed in scented Alstroemeria flowers.

    Science.gov (United States)

    Aros, Danilo; Gonzalez, Veronica; Allemann, Rudolf K; Müller, Carsten T; Rosati, Carlo; Rogers, Hilary J

    2012-04-01

    Native to South America, Alstroemeria flowers are known for their colourful tepals, and Alstroemeria hybrids are an important cut flower. However, in common with many commercial cut flowers, virtually all the commercial Alstroemeria hybrids are not scented. The cultivar 'Sweet Laura' is one of very few scented commercial Alstroemeria hybrids. Characterization of the volatile emission profile of these cut flowers revealed three major terpene compounds: (E)-caryophyllene, humulene (also known as α-caryophyllene), an ocimene-like compound, and several minor peaks, one of which was identified as myrcene. The profile is completely different from that of the parental scented species A. caryophyllaea. Volatile emission peaked at anthesis in both scented genotypes, coincident in cv. 'Sweet Laura' with the maximal expression of a putative terpene synthase gene AlstroTPS. This gene was preferentially expressed in floral tissues of both cv. 'Sweet Laura' and A. caryophyllaea. Characterization of the AlstroTPS gene structure from cv. 'Sweet Laura' placed it as a member of the class III terpene synthases, and the predicted 567 amino acid sequence placed it into the subfamily TPS-b. The conserved sequences R(28)(R)X(8)W and D(321)DXXD are the putative Mg(2+)-binding sites, and in vitro assay of AlstroTPS expressed in Escherichia coli revealed that the encoded enzyme possesses myrcene synthase activity, consistent with a role for AlstroTPS in scent production in Alstroemeria cv. 'Sweet Laura' flowers. PMID:22268153

  12. Small RNA Derived from the Virulence Modulating Region of the Potato spindle tuber viroid Silences callose synthase Genes of Tomato Plants.

    Science.gov (United States)

    Adkar-Purushothama, Charith Raj; Brosseau, Chantal; Giguère, Tamara; Sano, Teruo; Moffett, Peter; Perreault, Jean-Pierre

    2015-08-01

    The tomato (Solanum lycopersicum) callose synthase genes CalS11-like and CalS12-like encode proteins that are essential for the formation of callose, a major component of pollen mother cell walls; these enzymes also function in callose formation during pathogen infection. This article describes the targeting of these callose synthase mRNAs by a small RNA derived from the virulence modulating region of two Potato spindle tuber viroid variants. More specifically, viroid infection of tomato plants resulted in the suppression of the target mRNAs up to 1.5-fold, depending on the viroid variant used and the gene targeted. The targeting of these mRNAs by RNA silencing was validated by artificial microRNA experiments in a transient expression system and by RNA ligase-mediated rapid amplification of cDNA ends. Viroid mutants incapable of targeting callose synthase mRNAs failed to induce typical infection phenotypes, whereas a chimeric viroid obtained by swapping the virulence modulating regions of a mild and a severe variant of Potato spindle tuber viroid greatly affected the accumulation of viroids and the severity of disease symptoms. These data provide evidence of the silencing of multiple genes by a single small RNA derived from a viroid. PMID:26290537

  13. Small RNA Derived from the Virulence Modulating Region of the Potato spindle tuber viroid Silences callose synthase Genes of Tomato Plants[OPEN

    Science.gov (United States)

    Adkar-Purushothama, Charith Raj; Brosseau, Chantal; Giguère, Tamara; Sano, Teruo; Moffett, Peter; Perreault, Jean-Pierre

    2015-01-01

    The tomato (Solanum lycopersicum) callose synthase genes CalS11-like and CalS12-like encode proteins that are essential for the formation of callose, a major component of pollen mother cell walls; these enzymes also function in callose formation during pathogen infection. This article describes the targeting of these callose synthase mRNAs by a small RNA derived from the virulence modulating region of two Potato spindle tuber viroid variants. More specifically, viroid infection of tomato plants resulted in the suppression of the target mRNAs up to 1.5-fold, depending on the viroid variant used and the gene targeted. The targeting of these mRNAs by RNA silencing was validated by artificial microRNA experiments in a transient expression system and by RNA ligase-mediated rapid amplification of cDNA ends. Viroid mutants incapable of targeting callose synthase mRNAs failed to induce typical infection phenotypes, whereas a chimeric viroid obtained by swapping the virulence modulating regions of a mild and a severe variant of Potato spindle tuber viroid greatly affected the accumulation of viroids and the severity of disease symptoms. These data provide evidence of the silencing of multiple genes by a single small RNA derived from a viroid. PMID:26290537

  14. Cloning, characterisation and comparative analysis of a starch synthase IV gene in wheat: functional and evolutionary implications

    Directory of Open Access Journals (Sweden)

    Broglie Karen E

    2008-09-01

    Full Text Available Abstract Background Starch is of great importance to humans as a food and biomaterial, and the amount and structure of starch made in plants is determined in part by starch synthase (SS activity. Five SS isoforms, SSI, II, III, IV and Granule Bound SSI, have been identified, each with a unique catalytic role in starch synthesis. The basic mode of action of SSs is known; however our knowledge of several aspects of SS enzymology at the structural and mechanistic level is incomplete. To gain a better understanding of the differences in SS sequences that underscore their specificity, the previously uncharacterised SSIVb from wheat was cloned and extensive bioinformatics analyses of this and other SSs sequences were done. Results The wheat SSIV cDNA is most similar to rice SSIVb with which it shows synteny and shares a similar exon-intron arrangement. The wheat SSIVb gene was preferentially expressed in leaf and was not regulated by a circadian clock. Phylogenetic analysis showed that in plants, SSIV is closely related to SSIII, while SSI, SSII and Granule Bound SSI clustered together and distinctions between the two groups can be made at the genetic level and included chromosomal location and intron conservation. Further, identified differences at the amino acid level in their glycosyltransferase domains, predicted secondary structures, global conformations and conserved residues might be indicative of intragroup functional associations. Conclusion Based on bioinformatics analysis of the catalytic region of 36 SSs and 3 glycogen synthases (GSs, it is suggested that the valine residue in the highly conserved K-X-G-G-L motif in SSIII and SSIV may be a determining feature of primer specificity of these SSs as compared to GBSSI, SSI and SSII. In GBSSI, the Ile485 residue may partially explain that enzyme's unique catalytic features. The flexible 380s Loop in the starch catalytic domain may be important in defining the specificity of action for each

  15. Developmental evolution of flowering plant pollen tube cell walls: callose synthase (CalS gene expression patterns

    Directory of Open Access Journals (Sweden)

    Abercrombie Jason M

    2011-07-01

    Full Text Available Abstract Background A number of innovations underlie the origin of rapid reproductive cycles in angiosperms. A critical early step involved the modification of an ancestrally short and slow-growing pollen tube for faster and longer distance transport of sperm to egg. Associated with this shift are the predominantly callose (1,3-β-glucan walls and septae (callose plugs of angiosperm pollen tubes. Callose synthesis is mediated by callose synthase (CalS. Of 12 CalS gene family members in Arabidopsis, only one (CalS5 has been directly linked to pollen tube callose. CalS5 orthologues are present in several monocot and eudicot genomes, but little is known about the evolutionary origin of CalS5 or what its ancestral function may have been. Results We investigated expression of CalS in pollen and pollen tubes of selected non-flowering seed plants (gymnosperms and angiosperms within lineages that diverged below the monocot/eudicot node. First, we determined the nearly full length coding sequence of a CalS5 orthologue from Cabomba caroliniana (CcCalS5 (Nymphaeales. Semi-quantitative RT-PCR demonstrated low CcCalS5 expression within several vegetative tissues, but strong expression in mature pollen. CalS transcripts were detected in pollen tubes of several species within Nymphaeales and Austrobaileyales, and comparative analyses with a phylogenetically diverse group of sequenced genomes indicated homology to CalS5. We also report in silico evidence of a putative CalS5 orthologue from Amborella. Among gymnosperms, CalS5 transcripts were recovered from germinating pollen of Gnetum and Ginkgo, but a novel CalS paralog was instead amplified from germinating pollen of Pinus taeda. Conclusion The finding that CalS5 is the predominant callose synthase in pollen tubes of both early-diverging and model system angiosperms is an indicator of the homology of their novel callosic pollen tube walls and callose plugs. The data suggest that CalS5 had transient expression

  16. Coincidence of cleavage sites of intron endonuclease I-TevI and critical sequences of the host thymidylate synthase gene.

    Science.gov (United States)

    Edgell, David R; Stanger, Matthew J; Belfort, Marlene

    2004-11-01

    To maximize spread of their host intron or intein, many homing endonucleases recognize nucleotides that code for important and conserved amino acid residues of the target gene. Here, we examine the cleavage requirements for I-TevI, which binds a stretch of thymidylate synthase (TS) DNA that codes for functionally critical residues in the TS active site. Using an in vitro selection scheme, we identified two base-pairs in the I-TevI cleavage site region as important for cleavage efficiency. These were confirmed by comparison of I-TevI cleavage efficiencies on mutant and on wild-type substrates. We also showed that nicking of the bottom strand by I-TevI is not affected by mutation of residues surrounding the bottom-strand cleavage site, unlike other homing endonucleases. One of these two base-pairs is universally conserved in all TS sequences, and is identical with a previously identified cleavage determinant of I-BmoI, a related GIY-YIG endonuclease that binds a homologous stretch of TS-encoding DNA. The other base-pair is conserved only in a subset of TS genes that includes the I-TevI, but not the I-BmoI, target sequence. Both the I-TevI and I-BmoI cleavage site requirements correspond to functionally critical residues involved in an extensive hydrogen bond network within the TS active site. Remarkably, these cleavage requirements correlate with TS phylogeny in bacteria, suggesting that each endonuclease has individually adapted to efficiently cleave distinct TS substrates. PMID:15491609

  17. Association of endothelial nitric oxide synthase gene polymorphisms with coronary artery disease: an updated meta-analysis and systematic review.

    Directory of Open Access Journals (Sweden)

    Himanshu Rai

    Full Text Available Several association studies of endothelial nitric oxide synthase (NOS3 gene polymorphisms with respect to coronary artery disease (CAD have been published in the past two decades. However, their association with the disease, especially among different ethnic subgroups, still remains controversial. This prompted us to conduct a systematic review and an updated structured meta-analysis, which is the largest so far (89 articles, 132 separate studies, and a sample size of 69,235, examining association of three polymorphic forms of the NOS3 gene (i.e. Glu298Asp, T786-C and 27 bp VNTR b/a with CAD. In a subgroup analysis, we tested their association separately among published studies originating predominantly from European, Middle Eastern, Asian, Asian-Indian and African ancestries. The pooled analysis confirmed the association of all the three selected SNP with CAD in three different genetic models transcending all ancestries worldwide. The Glu298Asp polymorphism showed strongest association (OR range = 1.28-1.52, and P<0.00001 for all comparisons, followed by T786-C (OR range = 1.34-1.42, and P<0.00001 for all comparisons and 4b/a, (OR range = 1.19-1.41, and P ≤ 0.002 for all comparisons in our pooled analysis. Subgroup analysis revealed that Glu298Asp (OR range = 1.54-1.87, and P<0.004 for all comparisons and 4b/a (OR range = 1.71-3.02, and P<0.00001 for all comparisons have highest degree of association amongst the Middle Easterners. On the other hand, T786-C and its minor allele seem to carry a highest risk for CAD among subjects of Asian ancestry (OR range = 1.61-1.90, and P ≤ 0.01 for all comparisons.

  18. The role of the erythroid-specific delta-aminolevulinate synthase gene expression in erythroid heme synthesis.

    Science.gov (United States)

    Meguro, K; Igarashi, K; Yamamoto, M; Fujita, H; Sassa, S

    1995-08-01

    Using antisense technology, the effects of suppressed gene expression of the erythroid-specific delta-aminolevulinate (ALA) synthase (ALAS-E) on heme synthesis, expression of mRNAs encoding an erythroid-specific transcription factor NF-E2, other heme pathway enzymes, and beta-globin were examined in murine erythroleukemia (MEL) cells. In MEL cells in which an antisense ALAS-E RNA was expressed (AS clone), sense ALAS-E mRNA levels in both untreated and dimethylsulfoxide (DMSO)-treated cells were decreased compared with their respective controls. Heme synthesis in AS clones was decreased in proportion to the suppressed levels of ALAS-E mRNA. In addition, mRNAs for ALA dehydratase, porphobilinogen deaminase, ferrochelatase (FeC), and beta-globin were also decreased in AS clones. There was a strong correlation between the level of ALAS-E mRNA and most of the mRNAs of the heme pathway enzymes and beta-globin. There was a decrease in the mRNA level of p45, but not of mafK, which are the large and the small subunits of NF-E2, respectively, in AS clones. Treatment of AS cells with hemin and ALA in the presence of DMSO partially restored the suppressed mRNA levels for beta-globin and FeC and heme content, respectively. These findings thus indicate that heme formation, which is determined by the level of ALAS-E, plays an essential role on gene expression of many proteins necessary for erythroid development. PMID:7620186

  19. Genomic structure and sequence polymorphism of E,E-alphafarnesene synthase gene in apples (Malus domestica Borkh.)

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    Primer pairs were designed to amplify the genomic DNA sequence of the alpha-farnesene synthase (AFS) gene by PCR.The PCR products were sequenced,spliced and compared to Cdna sequences in the GenBank (accession No.AY182241).The genomic sequence and intron-exon organization of the AFS gene were thus obtained.The AFS genomic sequence has been registered in the GenBank (accession No.DQ901739).It has 6 introns and 7 exons,encoding a protein of 576 amino acids.The sizes of the 6 introns were 108 bp,113 bp,>1000 bp,125 bp,220 bp and 88 bp,and their phases were 0,1,2,2,0,0,respectively.The sizes of the deduced amino acids of the 7 exons were 57,89,127,73,48,83 and 99,respectively.The AFS protein contained three motifs:the RR(X8)W motif encoded by a sequence in exon 1,and the RxR motif and DDxxD motif encoded by two sequences in exon 4.After comparing the AFS genomic sequence (accession No.DQ901739) to the Cdna sequence (accession No.AY523409) in the GenBank,it was found that there were 6 single-nucleotide polymorphisms between the two sequences,four of which caused mutations at the amino acid level.Interestingly,one amino acid mutation (291R→G) was found in the RxR motif,and further investigation is needed to determine whether the alpha-farnesene synthesis ability and superficial scald susceptibility of apples are influenced by this amino acid mutation and other mutations.

  20. Overexpression of a Potato Sucrose Synthase Gene in Cotton Accelerates Leaf Expansion,Reduces Seed Abortion, and Enhances Fiber Production

    Institute of Scientific and Technical Information of China (English)

    Shou-Min Xu; Elizabeth Brill; Danny J.Llewellyn; Robert T.Furbank; Yong-Ling Ruan

    2012-01-01

    Sucrose synthase (Sus) is a key enzyme in the breakdown of sucrose and is considered a biochemical marker for sink strength,especially in crop species,based on mutational and gene suppression studies.It remains elusive,however,whether,or to what extent,increase in Sus activity may enhance sink development.We aimed to address this question by expressing a potato Sus gene in cotton where Sus expression has been previously shown to be critical for normal seed and fiber development.Segregation analyses at T1 generation followed by studies in homozygous progeny lines revealed that increased Sus activity in cotton (1) enhanced leaf expansion with the effect evident from young leaves emerging from shoot apex; (2) improved early seed development,which reduced seed abortion,hence enhanced seed set,and (3) promoted fiber elongation.In young leaves of Sus overexpressing lines,fructose concentrations were significantly increased whereas,in elongating fibers,both fructose and glucose levels were increased.Since hexoses contribute little to osmolality in leaves,in contrast to developing fibers,it is concluded that high Sus activity promotes leaf development independently of osmotic regulation,probably through sugar signaling.The analyses also showed that doubling the Sus activity in 0-d cotton seeds increased their fresh weight by about 30%.However,further increase in Sus activity did not lead to any further increase in seed weight,indicating an upper limit for the Sus overexpression effect.Finally,based on the observed additive effect on fiber yield from increased fiber length and seed number,a new strategy is proposed to increase cotton fiber yield by improving seed development as a whole,rather than solely focusing on manipulating fiber growth.

  1. Effect of Dexamethasone on Nitric Oxide Synthase and Caspase-3 Gene Expressions in Endotoxemia in Neonate Rat Brain

    Institute of Scientific and Technical Information of China (English)

    HUA WANG; YU-BIN WU; XIU-HUA DU

    2005-01-01

    Objective To investigate the gene and protein expressions of three isoforms of nitric oxide synthase (NOS) and gene expression of Caspase-3, and effect of dexamethasone on them in neonatal rats with lipopolysaccharide (LPS)-induced endotoxemic brain damage. Methods Expressions of the three isoforms of NOS and caspase-3 mRNA in the brain were investigated by RT-PCR in postnatal 7-day wistar rats with acute endotoxemia by intraperitoneal administration of LPS. Regional distributions of NOSs were examined by immunohistochemical technique. Results nNOS and Caspase-3 mRNA were obviously detected. eNOS mRNA was faintly expressed, but iNOS mRNA was undetectable in the control rat brain. The expressions of NOS mRNA of three isoforms were weak 2 h after LPS (5 mg/mg) delivery, peaked at 6 h, and thereafter, reduced gradually up to 24 h. The expression intensity was in the order of nNOS> iNOS> eNOS. Widespread nNOS, scattered eNOS distribution and negative iNOS were identified in the control rat brain and all isoforms of NOS could be induced by LPS which reached the apex at 24 h in the order of nNOS> iNOS> eNOS as detected by immunostaining. Although Caspase-3 mRNA could be found in all groups, DNA fragmentation was only seen at 6 h and 24 h. The expressions of NOS and Caspase-3 mRNA were inhibited in the rat brain when dexamethasone was administrated. Conclusion LPS-induced NO production induces apoptosis of neurons through mechanism involving the Caspase-3 activation, which may play an important role in the pathogenesis of brain damage during endotoxemia, and neuro-protective effects of dexamethasone may be partially realized by inhibiting the expression of NOS mRNA.

  2. Chalcone Synthase (CHS) Gene Suppression in Flax Leads to Changes in Wall Synthesis and Sensing Genes, Cell Wall Chemistry and Stem Morphology Parameters.

    Science.gov (United States)

    Zuk, Magdalena; Działo, Magdalena; Richter, Dorota; Dymińska, Lucyna; Matuła, Jan; Kotecki, Andrzej; Hanuza, Jerzy; Szopa, Jan

    2016-01-01

    The chalcone synthase (CHS) gene controls the first step in the flavonoid biosynthesis. In flax, CHS down-regulation resulted in tannin accumulation and reduction in lignin synthesis, but plant growth was not affected. This suggests that lignin content and thus cell wall characteristics might be modulated through CHS activity. This study investigated the possibility that CHS affects cell wall sensing as well as polymer content and arrangement. CHS-suppressed and thus lignin-reduced plants showed significant changes in expression of genes involved in both synthesis of components and cell wall sensing. This was accompanied by increased levels of cellulose and hemicellulose. CHS-reduced flax also showed significant changes in morphology and arrangement of the cell wall. The stem tissue layers were enlarged averagely twofold compared to the control, and the number of fiber cells more than doubled. The stem morphology changes were accompanied by reduction of the crystallinity index of the cell wall. CHS silencing induces a signal transduction cascade that leads to modification of plant metabolism in a wide range and thus cell wall structure. PMID:27446124

  3. Chalcone Synthase (CHS) Gene Suppression in Flax Leads to Changes in Wall Synthesis and Sensing Genes, Cell Wall Chemistry and Stem Morphology Parameters

    Science.gov (United States)

    Zuk, Magdalena; Działo, Magdalena; Richter, Dorota; Dymińska, Lucyna; Matuła, Jan; Kotecki, Andrzej; Hanuza, Jerzy; Szopa, Jan

    2016-01-01

    The chalcone synthase (CHS) gene controls the first step in the flavonoid biosynthesis. In flax, CHS down-regulation resulted in tannin accumulation and reduction in lignin synthesis, but plant growth was not affected. This suggests that lignin content and thus cell wall characteristics might be modulated through CHS activity. This study investigated the possibility that CHS affects cell wall sensing as well as polymer content and arrangement. CHS-suppressed and thus lignin-reduced plants showed significant changes in expression of genes involved in both synthesis of components and cell wall sensing. This was accompanied by increased levels of cellulose and hemicellulose. CHS-reduced flax also showed significant changes in morphology and arrangement of the cell wall. The stem tissue layers were enlarged averagely twofold compared to the control, and the number of fiber cells more than doubled. The stem morphology changes were accompanied by reduction of the crystallinity index of the cell wall. CHS silencing induces a signal transduction cascade that leads to modification of plant metabolism in a wide range and thus cell wall structure. PMID:27446124

  4. Proto-oncogene FBI-1 (Pokemon) and SREBP-1 Synergistically Activate Transcription of Fatty-acid Synthase Gene (FASN)*S⃞

    OpenAIRE

    Choi, Won-Il; Jeon, Bu-Nam; Park, Hyejin; Yoo, Jung-Yoon; Kim, Yeon-Sook; Koh, Dong-In; Kim, Myung-Hwa; Kim, Yu-Ri; Lee, Choong-Eun; Kim, Kyung-Sup; Osborne, Timothy F.; Hur, Man-Wook

    2008-01-01

    FBI-1 (Pokemon/ZBTB7A) is a proto-oncogenic transcription factor of the BTB/POZ (bric-à-brac, tramtrack, and broad complex and pox virus zinc finger) domain family. Recent evidence suggested that FBI-1 might be involved in adipogenic gene expression. Coincidentally, expression of FBI-1 and fatty-acid synthase (FASN) genes are often increased in cancer and immortalized cells. Both FBI-1 and FASN are important in cancer cell proliferation. SREBP-1 is a major regulator of...

  5. A novel 3-base deletion (IVS3+2_4delTGG of the hydroxymethylbilane synthase gene in a Brazilian patient with acute intermittent porphyria

    Directory of Open Access Journals (Sweden)

    Georgina Severo Ribeiro

    2007-01-01

    Full Text Available Acute intermittent porphyria (AIP, OMIM 176000 is an autosomal dominant metabolic disease caused by mutations in the gene encoding hydroxymethylbilane synthase (HMBS; EC 4.3.1.8; formely named porphobilinogen deaminase, PBGD, mapped to chromosome 11q23.3. We describe a novel mutation of the HMBS gene, a de novo 3-base deletion in the splicing donor site of intron 3 (IVS3+2_4delTGG in a woman affected by AIP. RT-PCR analysis revealed an abnormal HMBS mRNA, compatible with exon 3 skipping.

  6. Atypical expression of mitochondrial 3-hydroxy-3-methylglutaryl-CoA synthase in subcutaneous adipose tissue of male rats.

    Science.gov (United States)

    Thumelin, S; Kohl, C; Girard, J; Pégorier, J P

    1999-06-01

    The mRNAs encoding mitochondrial 3-hydroxy-3-methylglutaryl-CoA synthase (mtHMG-CoA synthase), the rate limiting enzyme in ketone body production, are highly expressed in subcutaneous (SC) and, to a lesser extent, in peri-epididymal (PE) rat adipose tissues. This atypical mtHMG-CoA synthase gene expression is dependent on the age (from 9 weeks of age) and sex (higher in male than in female) of the rats. In contrast, the expression of mtHMG-CoA synthase in SC adipose deposit is independent of the nutritional state (fed versus starved) or of the thermic environment (24 degrees C versus 4 degrees C). The expression of mtHMG-CoA synthase is suppressed in SC fat pads of castrated male rats whereas treatment of castrated rats with testosterone restores a normal level of expression. Moreover, testosterone injection induces the expression mtHMG-CoA synthase in SC adipose tissue of age-matched females. The presence of the mtHMG-CoA synthase immunoreactive protein confers to mitochondria isolated from SC adipose deposits, the capacity to produce ketone bodies at a rate similar to that found in liver mitochondria (SC = 13.7 +/- 0.7, liver = 16.4 +/- 1.4 nmol/min/mg prot). mtHMG-CoA synthase is expressed in the stromal vascular fraction (SVF) whatever the adipose deposit considered. While acetyl-CoA carboxylase (ACC) is only expressed in mature adipocytes, the other lipogenic enzymes, fatty acid synthase (FAS) and citrate cleavage enzyme (CCE), are expressed both in SVF cells and mature adipocytes. The expression of lipogenic enzyme genes is markedly reduced in adipocytes but not in SVF cells isolated from 48-h starved male rats. When SVF is subfractionated, mtHMG-CoA synthase mRNAs are mainly recovered in two fractions containing poorly digested structures such as microcapillaries whereas the lowest expression is found in the pre-adipocyte fraction. Interestingly, FAS and CCE mRNAs co-segregate with mtHMG-CoA synthase mRNA. The possible physiological relevance of such

  7. An intron in the thymidylate synthase gene of Bacillus bacteriophage beta 22: evidence for independent evolution of a gene, its group I intron, and the intron open reading frame.

    Science.gov (United States)

    Bechhofer, D H; Hue, K K; Shub, D A

    1994-11-22

    The thymidylate synthase gene (thy) (EC 2.1.1.45) of Bacillus subtilis bacteriophage beta 22 has a self-splicing, group I intron inserted into a highly conserved region of the coding sequence. The intron is very similar to one that is inserted 21 bp further downstream in the homologous thymidylate synthase gene (td) of Escherichia coli bacteriophage T4. In contrast, the amino acid sequences of the bacteriophage thymidylate synthases are highly divergent. The beta 22 intron has a fragmentary open reading frame (ORF) that encodes a putative helix-turn-helix DNA-binding motif, similar to one at the carboxyl terminus of the homing endonuclease (I-TevI) encoded by the T4 td intron. The td ORF and the thy ORF fragments are inserted into different regions of their respective intron structures. These results suggest that the thymidylate synthase genes, their introns, and their respective intron-ORFs all have separate evolutionary histories and that the acquisition of the intron could not have occurred by a simple homing event. PMID:7972121

  8. Molecular characterization of glutathione S-transferase, endothelial nitric oxide synthase and Vitamin D receptor genes in breast cancer cases

    Directory of Open Access Journals (Sweden)

    Rizk El-Baz(1; Azza Ismail(2 ; Maher Amer(2; Mai Elshahat(3; Amira Kazamel(2; Ahmad Settin

    2012-10-01

    Full Text Available Background: Enzymes of the Glutathione S-transferase system (GST modulate the effects of exposure to several cytotoxic and genotoxic agents. Nitric oxide (NO is constitutively synthesized in the endothelium by endothelial nitric oxide synthase (eNOS and acts as a pleiotropic regulator involved in carcinogenesis. Vitamin D levels may influence breast cancer development. The vitamin D receptor (VDR is a crucial mediator for the cellular effects of vitamin D and additionally interacts with other cell-signaling pathways that influence cancer development. Objectives: To check for the association of polymorphisms of GST, eNOS3 and VDR genes with the susceptibility and severity of breast cancer in Egyptian cases. Subjects: This work included 100 cases with breast cancer and 100 healthy individuals. The mean age of cases was 48.31±11.40 years. They included 100 females.Methods: DNA was amplified using PCR-RFLP for detection of polymorphisms related to eNOS3 and VDR , also DNA was amplified using PCR-SSP for detection of polymorphisms related to GST and calculating the odds ratios and their 95% confidence intervals.Results: Total cases showed high significant frequency of eNOS3-786 CC (P<0.05, OR=18.58 genotypes, GSTT1(null (OR = 2.68; CI 95%=1.51-4.75; p=0.001. These were considered risk genotypes for disease susceptibility. On the other hand, total cases showed low significant frequency with homozygosity for eNOS3-786 TT (P=0.01 and the GSTT1 gene was present in 42.0% of the cancers and in 66.0% of controls (OR = 0.37; CI 95%= 0.21-0.66; p=0.001. These may be considered low risk genotypes. No significant difference in frequencies of null and present genotypes of GSTM1 and VDR FOKI in total cases compared to controls. Conclusions: Polymorphisms related to eNOS3-786, GSTT1 and VDR FOKI genes may be considered genetic markers for BC among Egyptian cases. This may have potential impact on family counselling as well as future management plans.

  9. Down regulation of ethylene biosynthesis in apples. Cloning and sequencing of the partial ACC synthase gene in the McIntosh cultivar

    International Nuclear Information System (INIS)

    Ethylene is a plant hormone that regulates many aspects of plant growth, development and senescence. 1-aminocyclopropane-1-carboxylate (ACC) synthase has been identified as the key enzyme in the biosynthesis of ethylene. Down regulation of ethylene biosynthesis via transformation with the antisense ACC synthase gene (as has already been proved with tomato) might lengthen the storability of apple. To produce the antisense gene of the apple, RNA was isolated from the McIntosh cultivar and the cDNA synthesized. The cDNA template was amplified by polymerase chain reaction (PCR) using ACC specific primers that have been found to be highly conserved in several plant species. PCR resulted in a 1.1 kb DNA band, which was cloned and sequenced. Sequenced analysis of the McIntosh clones (K1, G1, G2, G3, G4) showed a similarity of 63.5-71.6% with the apple ACC synthase known so far and found comparable homology with the ACC syntheses of other plant species in the databank. 8 refs, 2 tabs

  10. Jinggangmycin increases fecundity of the brown planthopper, Nilaparvata lugens (Stål) via fatty acid synthase gene expression.

    Science.gov (United States)

    Li, Lei; Jiang, Yiping; Liu, Zongyu; You, Linlin; Wu, You; Xu, Bing; Ge, Linquan; Stanley, David; Song, Qisheng; Wu, Jincai

    2016-01-01

    The antibiotic jinggangmycin (JGM) is mainly used in controlling the rice sheath blight, Rhizoctonia solani, in China. JGM also enhances reproduction of the brown planthopper (BPH), Nilaparvata lugens (Stål). To date, however, molecular mechanisms of the enhancement are unclear. Our related report documented the influence of foliar JGM sprays on ovarian protein content. Here, we used isobaric tags for relative and absolute quantitation (iTRAQ) protocols to analyze ovarian proteins of BPH females following JGM spray (JGM-S) and topical application (JGM-T). We recorded changes in expression of 284 proteins (142↑ and 142↓) in JGM-S compared to the JGM-S control group (S-control); 267 proteins were differentially expressed (130↑ and 137↓) in JGM-T compared to the JGM-T control group (T-control), of which, 22 proteins were up-regulated in both groups. Comparing the JGM-S to the JGM-T group, 114 proteins were differentially expressed (62↑ and 52↓). Based on the biological significance of fatty acids, pathway annotation and enrichment analysis, we designed a dsRNA construct to silence a gene encoding fatty acid synthase (FAS). FAS was more highly expressed in JGM-S vs S-control and JGM-S vs JGM-T groups. The dsFAS treatment reduced fecundity by about 46% and reduced ovarian and fat body fatty acid concentrations in JGM-S-treated females relative to controls. We infer FAS provides critically needed fatty acids to support JGM-enhanced fecundity in BPH. PMID:26388431

  11. Nitric oxide synthase inhibitors can antagonize neurogenic and calcitonin gene-related peptide induced dilation of dural meningeal vessels

    Science.gov (United States)

    Akerman, S; Williamson, D J; Kaube, H; Goadsby, P J

    2002-01-01

    The detailed pathophysiology of migraine is beginning to be understood and is likely to involve activation of trigeminovascular afferents. Clinically effective anti-migraine compounds are believed to have actions that include peripheral inhibition of calcitonin gene-related peptide (CGRP) release from trigeminal neurones, or preventing dural vessel dilation, or both. CGRP antagonists can block both neurogenic and CGRP-induced dural vessel dilation. Nitric oxide (NO) can induce headache in migraine patients and often triggers a delayed migraine. The initial headache is thought to be caused via a direct action of the NO–cGMP pathway that causes vasodilation by vascular smooth muscle relaxation, while the delayed headache is likely to be a result of triggering trigeminovascular activation. Nitric oxide synthase (NOS) inhibitors are effective in the treatment of acute migraine. The present studies used intravital microscopy to examine the effects of specific NOS inhibitors on neurogenic dural vasodilation (NDV) and CGRP-induced dilation. The non-specific and neuronal NOS (nNOS) inhibitors were able to partially inhibit NDV, while the non-specific and endothelial NOS (eNOS) inhibitors were able to partially inhibit the CGRP induced dilation. There was no effect of the inducible NOS (iNOS) inhibitor. The data suggest that the delayed headache response triggered by NO donors in humans may be due, in part, to increased nNOS activity in the trigeminal system that causes CGRP release and dural vessel dilation. Further, eNOS activity in the endothelium causes NO production and smooth muscle relaxation by direct activation of the NO–cGMP pathway, and may be involved in the initial headache response. PMID:12183331

  12. In vivo gene transfer of endothelial nitric oxide synthase decreases portal pressure in anaesthetised carbon tetrachloride cirrhotic rats

    Science.gov (United States)

    Van de Casteele, M; Omasta, A; Janssens, S; Roskams, T; Desmet, V; Nevens, F; Fevery, J

    2002-01-01

    Background: Portal hypertension in cirrhosis results from enhanced intrahepatic resistance to an augmented inflow. The former is partly due to an imbalance between intrahepatic vasoconstriction and vasodilatation. Enhanced endothelin-1 and decreased activity of hepatic constitutive endothelial nitric oxide synthase (NOS 3) was reported in carbon tetrachloride (CCl4) cirrhotic rat liver. Aims: To study whether an increase in hepatic NOS 3 could be obtained in the CCl4 cirrhotic rat liver by in vivo cDNA transfer and to investigate a possible effect on portal pressure. Methods: Hepatic NOS 3 immunohistochemistry and western blotting were used to measure the amount of NOS 3 protein. Recombinant adenovirus, carrying cDNA encoding human NOS 3, was injected into the portal vein of CCl4 cirrhotic rats. Cirrhotic controls received carrier buffer, naked adenovirus, or adenovirus carrying the lac Z gene. Results: NOS 3 immunoreactivity and amount of protein (western blotting) were significantly decreased in CCl4 cirrhotic livers. Following cDNA transfer, NOS 3 expression and the amount of protein were partially restored. Portal pressure was 11.4 (1.6) mm Hg in untreated cirrhotic (n=9) and 11.8 (0.6) in lac Z transfected (n=4) cirrhotic rats but was reduced to 7.8 (1.0) mm Hg (n=9) five days after NOS 3 cDNA transfer. No changes were observed in systemic haemodynamics, in liver tests or urinary nitrates, or in NOS 3 expression in lung or kidney, indicating a highly selective transfer. Conclusions: NOS 3 cDNA transfer to cirrhotic rat liver is feasible and the increase in hepatic NOS 3 leads to a marked decrease in portal hypertension without systemic effects. These data indicate a major haemodynamic role of intrahepatic NOS 3 in the pathogenesis of portal hypertension in CCl4 cirrhosis. PMID:12171971

  13. Novel alleles of 31-bp VNTR polymorphism in the human cystathionine -synthase (CBS) gene were detected in healthy Asians

    Indian Academy of Sciences (India)

    Yik-Yuen Gan; Chuan-Fei Chen

    2010-12-01

    A 31-bp variable number of tandem repeats (VNTR) polymorphism of the cystathionine -synthase (CBS) gene was earlier reported in Caucasians of predominantly European descent and Indo–Caucasoid populations.We report here for the first time, the detection of allele 20, which was absent in Caucasian and Indo–Caucasoid populations, as a common allele present in Singaporean Chinese (6.25%), Indians (11.7%), and Malays (11.5%). Hence, allele 20 might be a specific allele for Asian populations. A relatively common allele 19 found in the Caucasian and Indo–Caucasoid populations (10.4%–10.6%) was absent in the Asian samples of this study. Therefore, allele 19 might be a specific allele for the Caucasian populations. A novel and rare allele 13, which was not reported before in the Caucasian and Indo–Caucasoid populations, was found in 0.5% of Singaporean Chinese as genotype 13/17 heterozygotes. The presence of alleles 13 and 20 were verified by DNA sequencing. There were five new genotypes (13/17, 16/20, 17/20, 18/20 and 20/20) not reported before in the Caucasian and Indo–Caucasoid populations, detected in this study. Nine genotypes (15/18, 16/18, 16/21, 17/19, 18/19, 18/21, 19/19, 19/21 and 21/21) which were present in the Caucasian and/or Indo–Caucasoid populations were absent in this study. Our results showed that CBS 31-bp VNTR polymorphism has a distinct genetic difference in allele and genotype frequencies between the European Caucasians, Indo–Caucasoid and Asian populations.

  14. Expression of Biphenyl Synthase Genes and Formation of Phytoalexin Compounds in Three Fire Blight-Infected Pyrus communis Cultivars

    Science.gov (United States)

    Chizzali, Cornelia; Swiddan, Asya K.; Abdelaziz, Sahar; Gaid, Mariam; Richter, Klaus; Fischer, Thilo C.; Liu, Benye; Beerhues, Ludger

    2016-01-01

    Pear (Pyrus communis) is an economically important fruit crop. Drops in yield and even losses of whole plantations are caused by diseases, most importantly fire blight which is triggered by the bacterial pathogen Erwinia amylovora. In response to the infection, biphenyls and dibenzofurans are formed as phytoalexins, biosynthesis of which is initiated by biphenyl synthase (BIS). Two PcBIS transcripts were cloned from fire blight-infected leaves and the encoded enzymes were characterized regarding substrate specificities and kinetic parameters. Expression of PcBIS1 and PcBIS2 was studied in three pear cultivars after inoculation with E. amylovora. Both PcBIS1 and PcBIS2 were expressed in ‘Harrow Sweet’, while only PcBIS2 transcripts were detected in ‘Alexander Lucas’ and ‘Conference’. Expression of the PcBIS genes was observed in both leaves and the transition zone of the stem; however, biphenyls and dibenzofurans were only detected in stems. The maximum phytoalexin level (~110 μg/g dry weight) was observed in the transition zone of ‘Harrow Sweet’, whereas the concentrations were ten times lower in ‘Conference’ and not even detectable in ‘Alexander Lucas’. In ‘Harrow Sweet’, the accumulation of the maximum phytoalexin level correlated with the halt of migration of the transition zone, whereby the residual part of the shoot survived. In contrast, the transition zones of ‘Alexander Lucas’ and ‘Conference’ advanced down to the rootstock, resulting in necrosis of the entire shoots. PMID:27410389

  15. Tetrahydrodipicolinate N-succinyltransferase and dihydrodipicolinate synthase from Pseudomonas aeruginosa: structure analysis and gene deletion.

    Directory of Open Access Journals (Sweden)

    Robert Schnell

    Full Text Available The diaminopimelic acid pathway of lysine biosynthesis has been suggested to provide attractive targets for the development of novel antibacterial drugs. Here we report the characterization of two enzymes from this pathway in the human pathogen Pseudomonas aeruginosa, utilizing structural biology, biochemistry and genetics. We show that tetrahydrodipicolinate N-succinyltransferase (DapD from P. aeruginosa is specific for the L-stereoisomer of the amino substrate L-2-aminopimelate, and its D-enantiomer acts as a weak inhibitor. The crystal structures of this enzyme with L-2-aminopimelate and D-2-aminopimelate, respectively, reveal that both compounds bind at the same site of the enzyme. Comparison of the binding interactions of these ligands in the enzyme active site suggests misalignment of the amino group of D-2-aminopimelate for nucleophilic attack on the succinate moiety of the co-substrate succinyl-CoA as the structural basis of specificity and inhibition. P. aeruginosa mutants where the dapA gene had been deleted were viable and able to grow in a mouse lung infection model, suggesting that DapA is not an optimal target for drug development against this organism. Structure-based sequence alignments, based on the DapA crystal structure determined to 1.6 Å resolution revealed the presence of two homologues, PA0223 and PA4188, in P. aeruginosa that could substitute for DapA in the P. aeruginosa PAO1ΔdapA mutant. In vitro experiments using recombinant PA0223 protein could however not detect any DapA activity.

  16. Biosynthesis of Akaeolide and Lorneic Acids and Annotation of Type I Polyketide Synthase Gene Clusters in the Genome of Streptomyces sp. NPS554

    Directory of Open Access Journals (Sweden)

    Tao Zhou

    2015-01-01

    Full Text Available The incorporation pattern of biosynthetic precursors into two structurally unique polyketides, akaeolide and lorneic acid A, was elucidated by feeding experiments with 13C-labeled precursors. In addition, the draft genome sequence of the producer, Streptomyces sp. NPS554, was performed and the biosynthetic gene clusters for these polyketides were identified. The putative gene clusters contain all the polyketide synthase (PKS domains necessary for assembly of the carbon skeletons. Combined with the 13C-labeling results, gene function prediction enabled us to propose biosynthetic pathways involving unusual carbon-carbon bond formation reactions. Genome analysis also indicated the presence of at least ten orphan type I PKS gene clusters that might be responsible for the production of new polyketides.

  17. Regulation of Aerobic Energy Metabolism in Podospora anserina by Two Paralogous Genes Encoding Structurally Different c-Subunits of ATP Synthase

    Science.gov (United States)

    Sellem, Carole H.; di Rago, Jean-Paul; Lasserre, Jean-Paul; Ackerman, Sharon H.; Sainsard-Chanet, Annie

    2016-01-01

    Most of the ATP in living cells is produced by an F-type ATP synthase. This enzyme uses the energy of a transmembrane electrochemical proton gradient to synthesize ATP from ADP and inorganic phosphate. Proton movements across the membrane domain (FO) of the ATP synthase drive the rotation of a ring of 8–15 c-subunits, which induces conformational changes in the catalytic part (F1) of the enzyme that ultimately promote ATP synthesis. Two paralogous nuclear genes, called Atp9-5 and Atp9-7, encode structurally different c-subunits in the filamentous fungus Podospora anserina. We have in this study identified differences in the expression pattern for the two genes that correlate with the mitotic activity of cells in vegetative mycelia: Atp9-7 is transcriptionally active in non-proliferating (stationary) cells while Atp9-5 is expressed in the cells at the extremity (apex) of filaments that divide and are responsible for mycelium growth. When active, the Atp9-5 gene sustains a much higher rate of c-subunit synthesis than Atp9-7. We further show that the ATP9-7 and ATP9-5 proteins have antagonist effects on the longevity of P. anserina. Finally, we provide evidence that the ATP9-5 protein sustains a higher rate of mitochondrial ATP synthesis and yield in ATP molecules per electron transferred to oxygen than the c-subunit encoded by Atp9-7. These findings reveal that the c-subunit genes play a key role in the modulation of ATP synthase production and activity along the life cycle of P. anserina. Such a degree of sophistication for regulating aerobic energy metabolism has not been described before. PMID:27442014

  18. Citrate-Stabilized Gold Nanorods

    OpenAIRE

    Mehtala, Jonathan G; Zemlyanov, Dmitry Y.; Max, Joann P.; Kadasala, Naveen; Zhao, Shou; Wei, Alexander

    2014-01-01

    Stable aqueous dispersions of citrate-stabilized gold nanorods (cit-GNRs) have been prepared in scalable fashion by surfactant exchange from cetyltrimethylammonium bromide (CTAB)-stabilized GNRs, using polystyrenesulfonate (PSS) as a detergent. The surfactant exchange process was monitored by infrared spectroscopy, surface-enhanced Raman scattering (SERS), and X-ray photoelectron spectroscopy (XPS). The latter established the quantitative displacement of CTAB (by PSS) and of PSS (by citrate)....

  19. Stable transformation of Toxoplasma gondii based on a pyrimethamine resistant trifunctional dihydrofolate reductase-cytosine deaminase-thymidylate synthase gene that confers sensitivity to 5-fluorocytosine.

    Science.gov (United States)

    Fox, B A; Belperron, A A; Bzik, D J

    1999-01-01

    To improve genetic models available for the analysis of apicomplexan protozoan parasites, bacterial sequences encoding the 427 amino acid cytosine deaminase (CD) gene were fused, in-frame, to an engineered linker domain of the high level pyrimethamine resistant form of the parasite bifunctional dihydrofolate reductase-thymidylate synthase (DHFR-TS) gene. Toxoplasma gondii was transformed with the plasmid containing the fused pyrimethamine resistant dihydrofolate reductase-cytosine deaminase-thymidylate synthase (DHFRm2m3-CD-TS) gene and parasites were selected in a high level of pyrimethamine. Transfected parasites that acquired resistance to pyrimethamine were cloned and evaluated for expression of the CD genetic marker. CD transgenic parasites acquired a high sensitivity to 5-fluorocytosine due to the intraparasitic conversion of this non-toxic prodrug to the cytotoxic compound 5-fluorouracil. Exogenously supplied cytosine or uracil rescued the growth of CD transgenic T. gondii parasites that were cultured in the presence of cytotoxic concentrations of 5-fluorouracil or 5-fluorocytosine. Bacterial CD fused to the pyrimethamine resistant DHFR-TS marker provides a novel genetic tool for new positive and negative genetic selection strategies in several protozoan parasites. An advantage of the CD genetic marker is that it is derived from a bacterial gene and can therefore be used in nearly any parasite genetic background for negative selection. This novel system should facilitate new approaches for the development of improved model genetic systems for the biological investigation of apicomplexan parasites. PMID:10029312

  20. Unchanged gene expression of glycogen synthase in muscle from patients with NIDDM following sulphonylurea-induced improvement of glycaemic control

    DEFF Research Database (Denmark)

    Vestergaard, H; Lund, S; Bjørbaek, C; Pedersen, O

    1995-01-01

    treatment. Ten obese patients with NIDDM were studied before and after 8 weeks of treatment with a weight-maintaining diet in combination with the sulphonylurea gliclazide. Gliclazide treatment was associated with significant reductions in HbA1C (p=0.001) and fasting plasma glucose (p=0.005) as well as...... metabolism (p=0.02) was demonstrated in teh gliclazide-treated patients when compared to pre-treatment values. In biopsies obtained from vastus lateralis muscle during insulin infusion, the half-maximal activation of glycogen synthase was achieved at a significantly lower concentration of the allosteric...... activator glucose 6-phosphate (p=0.01). However, despite significant increases in both insulin-stimulated non-oxidative glucose metabolism and muscle glycogen synthase activation in gliclazide-treated patients no changes were found in levels of glycogen synthase mRNA or immunoreactive protein in muscle. In...

  1. Acute intermittent porphyria: A single-base deletion and a nonsense mutation in the human hydroxymethylbilane synthase gene, predicting truncations of the enzyme polypeptide

    Energy Technology Data Exchange (ETDEWEB)

    Lee, G.L.; Astrin, K.H.; Desnick, R.J. [Mount Sinai School of Medicine, New York, NY (United States)

    1995-08-28

    Acute intermittent porphyria (AIP) is an autosomal-dominant inborn error of metabolism that results from the half-normal activity of the third enzyme in the heme biosynthetic pathway, hydroxymethylbilane synthase (HMB-synthase). AIP is an ecogenetic condition, since the life-threatening acute attacks are precipitated by various factors, including drugs, alcohol, fasting, and certain hormones. Biochemical diagnosis is problematic, and the identification of mutations in the HMB-synthase gene provides accurate detection of presymptomatic heterozygotes, permitting avoidance of the acute precipitating factors. By direct solid-phase sequencing, two mutations causing AIP were identified, an adenine deletion at position 629 in exon 11(629delA), which alters the reading frame and predicts premature truncation of the enzyme protein after amino acid 255, and a nonsense mutation in exon 12 (R225X). These mutations were confirmed by either restriction enzyme analysis or family studies of symptomatic patients, permitting accurate presymptomatic diagnosis of affected relatives. 29 refs., 2 figs.

  2. Nitric Oxide Synthase Gene Transfer Overcomes the Inhibition of Wound Healing by Sulfur Mustard in a Human Keratinocyte In Vitro Model

    OpenAIRE

    Hiroshi Ishida; Radharaman Ray; Jack Amnuaysirikul; Keiko Ishida; Prabhati Ray

    2012-01-01

    Sulfur mustard (SM) is a chemical warfare agent that causes extensive skin injury. Previously we reported that SM exposure resulted in suppression of inducible nitric oxide synthase (iNOS) expression to inhibit the healing of scratch wounds in a cultured normal human epidermal keratinocyte (NHEK) model. Based on this finding, the present study was to use adenovirus-mediated gene transfer of iNOS to restore the nitric oxide (NO) supply depleted by exposure to SM and to evaluate the effect of N...

  3. Molecular cloning and expression profile of ß-ketoacyl-acp synthase gene from tung tree (Vernicia fordii Hemsl.)

    Science.gov (United States)

    Tung tree (Vernicia fordii) is an important woody oil tree. Tung tree seeds contain 50-60% oil with approximately 80 mole a-eleostearic acid (9cis, 11trans, 13trans octadecatrienoic acid). Fatty acid synthesis is catalyzed by the concerted action of acetyl-CoA carboxylase and fatty acid synthase, a ...

  4. Enhancement of Aminoacylase Activity by Sodium Citrate

    Institute of Scientific and Technical Information of China (English)

    于范利; 曹志方; 李森; 周海梦

    2001-01-01

    Kidney and other tissues of animals and humans have a high concentration of citrate which is an important intermediate substance in the citrate cycle. Citrate may play an important physiological role in metabolism. In this paper, we studied the interaction of the sodium salt of citrate with aminoacylase which is an important enzyme in metabolism and found sodium citrate can enhance the activity of aminoacylase. The maximum enzyme activity induced by sodium citrate increased approximately 3 folds over the enzyme activity without sodium citrate. The initial reaction rates (Ⅴ) for different concentrations of sodium citrate were obtained, showing that sodium citrate is a non-competitive activator. The result of the ANS binding fluorescence measurements for aminoacylase indicated that increasing sodium citrate concentrations markedly increased the ANS binding fluorescence with a blue shift of the emission spectra peak. This suggests the formation of more hydrophobic regions. Aggregates formed quickly when aminoacylase was incubated with sodium citrate (0.3 mol/L) and guanidinium chloride (0- 3. 5 mol/L). Aminoacylase lost enzyme activity in the guanidinium chloride more quickly in the presence of sodium citrate than in the absence of sodium citrate. The intrinsic fluorescence emission intensity decreased more quickly and the red shift of the emission spectra peak was larger than that without sodium citrate.

  5. Molecular characterization of a cellulose synthase gene (AaxmCesA1) isolated from an Acacia auriculiformis x Acacia mangium hybrid.

    Science.gov (United States)

    Yong, Seok Yien Christina; Wickneswari, Ratnam

    2013-01-01

    Cellulose is the major component of plant cell walls, providing mechanical strength to the structural framework of plants. In association with lignin, hemicellulose, protein and pectin, cellulose forms the strong yet flexible bio-composite tissue of wood. Wood formation is an essential biological process and is of significant importance to the cellulosic private sector industry. Cellulose synthase genes encode the catalytic subunits of a large protein complex responsible for the biogenesis of cellulose in higher plants. The hybrid Acacia auriculiformis x Acacia mangium represents an important source of tree cellulose for forest-based product manufacturing, with enormous economic potential. In this work, we isolate the first cellulose synthase gene, designated AaxmCesA1, from this species. The isolated full-length AaxmCesA1 cDNA encodes a polypeptide of 1,064 amino acids. Sequence analyses revealed that AaxmCesA1 cDNA possesses the key motif characteristics of a CesA protein. AaxmCesA1 shares more than 75 % amino acid sequence identity with CesA proteins from other plant species. Subsequently, the full-length AaxmCesA1 gene of 7,389 bp with partial regulatory and 13 intron regions was also isolated. Relative gene expression analysis by quantitative PCR in different tissues of the Acacia hybrid, suggests the involvement of the AaxmCesA1 gene in primary cell wall synthesis of rapidly dividing young root cells. Similarity analyses using Blast algorithms also suggests a role in primary cell wall deposition in the Acacia hybrid. Southern analysis predicts that AaxmCesA1 is a member of a multigene family with at least two isoforms in the genome of the Acacia hybrid. PMID:24415841

  6. Pharmacogenetic Study in Rectal Cancer Patients Treated With Preoperative Chemoradiotherapy: Polymorphisms in Thymidylate Synthase, Epidermal Growth Factor Receptor, GSTP1, and DNA Repair Genes

    Energy Technology Data Exchange (ETDEWEB)

    Paez, David, E-mail: dpaez@santpau.cat [Department of Medical Oncology, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Salazar, Juliana; Pare, Laia [Centre for Biomedical Network Research on Rare Diseases, Barcelona (Spain); Department of Genetics, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Pertriz, Lourdes [Department of Radiotherapy, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Targarona, Eduardo [Department of Surgery, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Rio, Elisabeth del [Centre for Biomedical Network Research on Rare Diseases, Barcelona (Spain); Department of Genetics, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Barnadas, Agusti; Marcuello, Eugenio [Department of Medical Oncology, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Baiget, Montserrat [Centre for Biomedical Network Research on Rare Diseases, Barcelona (Spain); Department of Genetics, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain)

    2011-12-01

    Purpose: Several studies have been performed to evaluate the usefulness of neoadjuvant treatment using oxaliplatin and fluoropyrimidines for locally advanced rectal cancer. However, preoperative biomarkers of outcome are lacking. We studied the polymorphisms in thymidylate synthase, epidermal growth factor receptor, glutathione S-transferase pi 1 (GSTP1), and several DNA repair genes to evaluate their usefulness as pharmacogenetic markers in a cohort of 128 rectal cancer patients treated with preoperative chemoradiotherapy. Methods and Materials: Blood samples were obtained from 128 patients with Stage II-III rectal cancer. DNA was extracted from the peripheral blood nucleated cells, and the genotypes were analyzed by polymerase chain reaction amplification and automated sequencing techniques or using a 48.48 dynamic array on the BioMark system. The germline polymorphisms studied were thymidylate synthase, (VNTR/5 Prime UTR, 2R G>C single nucleotide polymorphism [SNP], 3R G>C SNP), epidermal growth factor receptor (Arg497Lys), GSTP1 (Ile105val), excision repair cross-complementing 1 (Asn118Asn, 8092C>A, 19716G>C), X-ray repair cross-complementing group 1 (XRCC1) (Arg194Trp, Arg280His, Arg399Gln), and xeroderma pigmentosum group D (Lys751Gln). The pathologic response, pathologic regression, progression-free survival, and overall survival were evaluated according to each genotype. Results: The Asterisk-Operator 3/ Asterisk-Operator 3 thymidylate synthase genotype was associated with a greater response rate (pathologic complete remission and microfoci residual tumor, 59% in Asterisk-Operator 3/ Asterisk-Operator 3 vs. 35% in Asterisk-Operator 2/ Asterisk-Operator 2 and Asterisk-Operator 2/ Asterisk-Operator 3; p = .013). For the thymidylate synthase genotype, the median progression-free survival was 103 months for the Asterisk-Operator 3/ Asterisk-Operator 3 patients and 84 months for the Asterisk-Operator 2/ Asterisk-Operator 2 and Asterisk-Operator 2/ Asterisk

  7. Pharmacogenetic Study in Rectal Cancer Patients Treated With Preoperative Chemoradiotherapy: Polymorphisms in Thymidylate Synthase, Epidermal Growth Factor Receptor, GSTP1, and DNA Repair Genes

    International Nuclear Information System (INIS)

    Purpose: Several studies have been performed to evaluate the usefulness of neoadjuvant treatment using oxaliplatin and fluoropyrimidines for locally advanced rectal cancer. However, preoperative biomarkers of outcome are lacking. We studied the polymorphisms in thymidylate synthase, epidermal growth factor receptor, glutathione S-transferase pi 1 (GSTP1), and several DNA repair genes to evaluate their usefulness as pharmacogenetic markers in a cohort of 128 rectal cancer patients treated with preoperative chemoradiotherapy. Methods and Materials: Blood samples were obtained from 128 patients with Stage II-III rectal cancer. DNA was extracted from the peripheral blood nucleated cells, and the genotypes were analyzed by polymerase chain reaction amplification and automated sequencing techniques or using a 48.48 dynamic array on the BioMark system. The germline polymorphisms studied were thymidylate synthase, (VNTR/5′UTR, 2R G>C single nucleotide polymorphism [SNP], 3R G>C SNP), epidermal growth factor receptor (Arg497Lys), GSTP1 (Ile105val), excision repair cross-complementing 1 (Asn118Asn, 8092C>A, 19716G>C), X-ray repair cross-complementing group 1 (XRCC1) (Arg194Trp, Arg280His, Arg399Gln), and xeroderma pigmentosum group D (Lys751Gln). The pathologic response, pathologic regression, progression-free survival, and overall survival were evaluated according to each genotype. Results: The ∗3/∗3 thymidylate synthase genotype was associated with a greater response rate (pathologic complete remission and microfoci residual tumor, 59% in ∗3/∗3 vs. 35% in ∗2/∗2 and ∗2/∗3; p = .013). For the thymidylate synthase genotype, the median progression-free survival was 103 months for the ∗3/∗3 patients and 84 months for the ∗2/∗2 and ∗2/∗3 patients (p = .039). For XRCC1 Arg399Gln SNP, the median progression-free survival was 101 months for the G/G, 78 months for the G/A, and 31 months for the A/A patients (p = .048). Conclusions: The thymidylate

  8. Diversification of genes encoding granule-bound starch synthase in monocots and dicots is marked by multiple genome-wide duplication events.

    Science.gov (United States)

    Cheng, Jun; Khan, Muhammad Awais; Qiu, Wen-Ming; Li, Jing; Zhou, Hui; Zhang, Qiong; Guo, Wenwu; Zhu, Tingting; Peng, Junhua; Sun, Fengjie; Li, Shaohua; Korban, Schuyler S; Han, Yuepeng

    2012-01-01

    Starch is one of the major components of cereals, tubers, and fruits. Genes encoding granule-bound starch synthase (GBSS), which is responsible for amylose synthesis, have been extensively studied in cereals but little is known about them in fruits. Due to their low copy gene number, GBSS genes have been used to study plant phylogenetic and evolutionary relationships. In this study, GBSS genes have been isolated and characterized in three fruit trees, including apple, peach, and orange. Moreover, a comprehensive evolutionary study of GBSS genes has also been conducted between both monocots and eudicots. Results have revealed that genomic structures of GBSS genes in plants are conserved, suggesting they all have evolved from a common ancestor. In addition, the GBSS gene in an ancestral angiosperm must have undergone genome duplication ∼251 million years ago (MYA) to generate two families, GBSSI and GBSSII. Both GBSSI and GBSSII are found in monocots; however, GBSSI is absent in eudicots. The ancestral GBSSII must have undergone further divergence when monocots and eudicots split ∼165 MYA. This is consistent with expression profiles of GBSS genes, wherein these profiles are more similar to those of GBSSII in eudicots than to those of GBSSI genes in monocots. In dicots, GBSSII must have undergone further divergence when rosids and asterids split from each other ∼126 MYA. Taken together, these findings suggest that it is GBSSII rather than GBSSI of monocots that have orthologous relationships with GBSS genes of eudicots. Moreover, diversification of GBSS genes is mainly associated with genome-wide duplication events throughout the evolutionary course of history of monocots and eudicots. PMID:22291904

  9. Polyketide genes in the marine sponge Plakortis simplex: a new group of mono-modular type I polyketide synthases from sponge symbionts.

    Science.gov (United States)

    Della Sala, Gerardo; Hochmuth, Thomas; Costantino, Valeria; Teta, Roberta; Gerwick, William; Gerwick, Lena; Piel, Jörn; Mangoni, Alfonso

    2013-12-01

    Sponge symbionts are a largely unexplored source of new and unusual metabolic pathways. Insights into the distribution and function of metabolic genes of sponge symbionts are crucial to dissect and exploit their biotechnological potential. Screening of the metagenome of the marine sponge Plakortis simplex led to the discovery of the swf family, a new group of mono-modular type I polyketide synthase/fatty acid synthase (PKS/FAS) specifically associated with sponge symbionts. Two different examples of the swf cluster were present in the metagenome of P. simplex. A third example of the cluster is present in the previously sequenced genome of a poribacterium from the sponge Aplysina aerophoba but was formerly considered orthologous to the wcb/rkp cluster. The swf cluster was also found in six additional species of sponges. Therefore, the swf cluster represents the second group of mono-modular PKS, after the supA family, to be widespread in marine sponges. The putative swf operon consists of swfA (type I PKS/FAS), swfB (reductase and sulphotransferase domains) and swfC (radical S-adenosylmethionine, or radical SAM). Activation of the acyl carrier protein (ACP) domain of the SwfA protein to its holo-form by co-expression with Svp is the first functional proof of swf type genes in marine sponges. However, the precise biosynthetic role of the swf clusters remains unknown. PMID:24249289

  10. Cloning and enzymology analysis of farnesyl pyrophosphate synthase gene from a superior strain of Artemisia annua L

    Institute of Scientific and Technical Information of China (English)

    2003-01-01

    A cDNA(af1) encoding farnesyl pyrophosphate synthase AaFPS1 (FPS, EC2.5.1.1/EC2.5.1.10) from a high yield Artemisia annua strain 025 has been cloned from its cDNA library. Sequence analysis showed that the cDNA encoded a protein of 343 amino acid (aa) residues with molecular weight of 39 kD. Deduced aa sequence of the cDNA was similar to FPS from other plants, yeast and mammals, containing 5 conserved domains found in both prenyl transferase and polyprenyl synthase. The expression of the cDNA in Escherichia coli showed measurable specific activity of FPS in vitro. The enzyme was purified by ion exchange chromatography and its kinetics was measured. These results would further promote the molecular regulation of artemisinin biosynthesis.

  11. Mitochondrial ATP synthase deficiency due to a mutation in the ATP5E gene for the F1 e subunit

    Czech Academy of Sciences Publication Activity Database

    Mayr, J. A.; Havlíčková, Vendula; Zimmermann, F.; Magler, I.; Kaplanová, Vilma; Ješina, Pavel; Pecinová, Alena; Nůsková, Hana; Koch, J.; Sperl, W.; Houštěk, Josef

    2010-01-01

    Roč. 19, č. 17 (2010), s. 3430-3439. ISSN 0964-6906 R&D Projects: GA MZd(CZ) NS9759; GA MŠk(CZ) 1M0520 Grant ostatní: Univerzita Karlova(CZ) 97807 Institutional research plan: CEZ:AV0Z50110509 Keywords : ATP-synthase * ATP5E * disease Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 8.058, year: 2010

  12. Molecular characterization of glutathione S-transferase, endothelial nitric oxide synthase and Vitamin D receptor genes in breast cancer cases

    OpenAIRE

    Rizk El-Baz(1); Azza Ismail(2) ; Maher Amer(2); Mai Elshahat(3); Amira Kazamel(2); Ahmad Settin

    2012-01-01

    Background: Enzymes of the Glutathione S-transferase system (GST) modulate the effects of exposure to several cytotoxic and genotoxic agents. Nitric oxide (NO) is constitutively synthesized in the endothelium by endothelial nitric oxide synthase (eNOS) and acts as a pleiotropic regulator involved in carcinogenesis. Vitamin D levels may influence breast cancer development. The vitamin D receptor (VDR) is a crucial mediator for the cellular effects of vitamin D and additionally interacts with o...

  13. Transcriptome mining, functional characterization, and phylogeny of a large terpene synthase gene family in spruce (Picea spp.)

    OpenAIRE

    Dullat Harpreet K; Hamberger Britta; Jancsik Sharon; Ralph Steven G; Weisshaar Sabrina; Keeling Christopher I; Bohlmann Jörg

    2011-01-01

    Abstract Background In conifers, terpene synthases (TPSs) of the gymnosperm-specific TPS-d subfamily form a diverse array of mono-, sesqui-, and diterpenoid compounds, which are components of the oleoresin secretions and volatile emissions. These compounds contribute to defence against herbivores and pathogens and perhaps also protect against abiotic stress. Results The availability of extensive transcriptome resources in the form of expressed sequence tags (ESTs) and full-length cDNAs in sev...

  14. Multiple phenotypic changes in mice after knockout of the B3gnt5 gene, encoding Lc3 synthase--a key enzyme in lacto-neolacto ganglioside synthesis

    Directory of Open Access Journals (Sweden)

    McLendon Roger E

    2010-11-01

    Full Text Available Abstract Background Ganglioside biosynthesis occurs through a multi-enzymatic pathway which at the lactosylceramide step is branched into several biosynthetic series. Lc3 synthase utilizes a variety of galactose-terminated glycolipids as acceptors by establishing a glycosidic bond in the beta-1,3-linkage to GlcNaAc to extend the lacto- and neolacto-series gangliosides. In order to examine the lacto-series ganglioside functions in mice, we used gene knockout technology to generate Lc3 synthase gene B3gnt5-deficient mice by two different strategies and compared the phenotypes of the two null mouse groups with each other and with their wild-type counterparts. Results B3gnt5 gene knockout mutant mice appeared normal in the embryonic stage and, if they survived delivery, remained normal during early life. However, about 9% developed early-stage growth retardation, 11% died postnatally in less than 2 months, and adults tended to die in 5-15 months, demonstrating splenomegaly and notably enlarged lymph nodes. Without lacto-neolacto series gangliosides, both homozygous and heterozygous mice gradually displayed fur loss or obesity, and breeding mice demonstrated reproductive defects. Furthermore, B3gnt5 gene knockout disrupted the functional integrity of B cells, as manifested by a decrease in B-cell numbers in the spleen, germinal center disappearance, and less efficiency to proliferate in hybridoma fusion. Conclusions These novel results demonstrate unequivocally that lacto-neolacto series gangliosides are essential to multiple physiological functions, especially the control of reproductive output, and spleen B-cell abnormality. We also report the generation of anti-IgG response against the lacto-series gangliosides 3'-isoLM1 and 3',6'-isoLD1.

  15. The barley genome sequence assembly reveals three additional members of the CslF (1,3;1,4-β-glucan synthase gene family.

    Directory of Open Access Journals (Sweden)

    Miriam Schreiber

    Full Text Available An important component of barley cell walls, particularly in the endosperm, is (1,3;1,4-β-glucan, a polymer that has proven health benefits in humans and that influences processability in the brewing industry. Genes of the cellulose synthase-like (Csl F gene family have been shown to be involved in (1,3;1,4-β-glucan synthesis but many aspects of the biosynthesis are still unclear. Examination of the sequence assembly of the barley genome has revealed the presence of an additional three HvCslF genes (HvCslF11, HvCslF12 and HvCslF13 which may be involved in (1,3;1,4-β-glucan synthesis. Transcripts of HvCslF11 and HvCslF12 mRNA were found in roots and young leaves, respectively. Transient expression of these genes in Nicotiana benthamiana resulted in phenotypic changes in the infiltrated leaves, although no authentic (1,3;1,4-β-glucan was detected. Comparisons of the CslF gene families in cereals revealed evidence of intergenic recombination, gene duplications and translocation events. This significant divergence within the gene family might be related to multiple functions of (1,3;1,4-β-glucans in the Poaceae. Emerging genomic and global expression data for barley and other cereals is a powerful resource for characterising the evolution and dynamics of complete gene families. In the case of the CslF gene family, the results will contribute to a more thorough understanding of carbohydrate metabolism in grass cell walls.

  16. Regulatory Citrate Lyase Mutants of Salmonella typhimurium

    OpenAIRE

    Kulla, Hans G.

    1983-01-01

    Citrate lyase, the key enzyme of anaerobic citrate catabolism, could not be deleted from Salmonella typhimurium. The only class of mutants found had a mode of covalent regulation that strongly resembled the Escherichia coli system: citrate lyase was only active, i.e., acetylated, when a cosubstrate was present.

  17. Regulatory citrate lyase mutants of Salmonella typhimurium.

    Science.gov (United States)

    Kulla, H G

    1983-01-01

    Citrate lyase, the key enzyme of anaerobic citrate catabolism, could not be deleted from Salmonella typhimurium. The only class of mutants found had a mode of covalent regulation that strongly resembled the Escherichia coli system: citrate lyase was only active, i.e., acetylated, when a cosubstrate was present. PMID:6336740

  18. 21 CFR 582.5449 - Manganese citrate.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Manganese citrate. 582.5449 Section 582.5449 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL... Supplements 1 § 582.5449 Manganese citrate. (a) Product. Manganese citrate. (b) Conditions of use....

  19. 21 CFR 184.1449 - Manganese citrate.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Manganese citrate. 184.1449 Section 184.1449 Food... Specific Substances Affirmed as GRAS § 184.1449 Manganese citrate. (a) Manganese citrate (Mn3(C6H5O7)2, CAS... manganese carbonate from manganese sulfate and sodium carbonate solutions. The filtered and...

  20. Benzalacetone Synthase

    Directory of Open Access Journals (Sweden)

    Ikuro eAbe

    2012-03-01

    Full Text Available Benzalacetone synthase, from the medicinal plant Rheum palmatum (Polygonaceae (RpBAS, is a plant-specific chalcone synthase (CHS superfamily of type III polyketide synthase (PKS. RpBAS catalyzes the one-step, decarboxylative condensation of 4-coumaroyl-CoA with malonyl-CoA to produce the C6-C4 benzalacetone scaffold. The X-ray crystal structures of RpBAS confirmed that the diketide-forming activity is attributable to the characteristic substitution of the conserved active-site "gatekeeper" Phe with Leu. Furthermore, the crystal structures suggested that RpBAS employs novel catalytic machinery for the thioester bond cleavage of the enzyme-bound diketide intermediate and the final decarboxylation reaction to produce benzalacetone. Finally, by exploiting the remarkable substrate tolerance and catalytic versatility of RpBAS, precursor-directed biosynthesis efficiently generated chemically and structurally divergent, unnatural novel polyketide scaffolds. These findings provided a structural basis for the functional diversity of the type III PKS enzymes.

  1. Aluminum resistance in common bean (Phaseolus vulgaris) involves induction and maintenance of citrate exudation from root apices.

    Science.gov (United States)

    Rangel, Andrés Felipe; Rao, Idupulapati Madhusudana; Braun, Hans-Peter; Horst, Walter Johannes

    2010-02-01

    Two common bean (Phaseolus vulgaris L.) genotypes differing in aluminum (Al) resistance, Quimbaya (Al-resistant) and VAX-1 (Al-sensitive) were grown in hydroponics for up to 25 h with or without Al, and several parameters related to the exudation of organic acids anions from the root apex were investigated. Al treatment enhanced the exudation of citrate from the root tips of both genotypes. However, its dynamic offers the most consistent relationship between Al-induced inhibition of root elongation and Al accumulation in and exclusion from the root apices. Initially, in both genotypes the short-term (4 h) Al-injury period was characterized by the absence of citrate efflux independent of the citrate content of the root apices, and reduction of cytosolic turnover of citrate conferred by a reduced Nicotinamide adenine dinucleotide phosphate-isocitrate dehydrogenase (EC 1.1.1.42) activity. Transient recovery from initial Al stress (4-12 h) was found to be dependent mainly on the capacity to utilize internal citrate pools (Al-resistant genotype Quimbaya) or enhanced citrate synthesis [increased activities of NAD-malate dehydrogenase (EC 1.1.1.37) and ATP-phosphofructokinase (EC 2.7.1.11) in Al-sensitive VAX-1]. Sustained recovery from Al stress through citrate exudation in genotype Quimbaya after 24 h Al treatment relied on restoring the internal citrate pool and the constitutive high activity of citrate synthase (CS) (EC 4.1.3.7) fuelled by high phosphoenolpyruvate carboxylase (EC 4.1.1.31) activity. In the Al-sensitive genotype VAX-1 the citrate exudation and thus Al exclusion and root elongation could not be maintained coinciding with an exhaustion of the internal citrate pool and decreased CS activity. PMID:20053183

  2. Effects of a subconvulsive dose of kainic acid on the gene expressions of the arginine vasopressin, oxytocin and neuronal nitric oxide synthase in the rat hypothalamus.

    Science.gov (United States)

    Yoshimura, Mitsuhiro; Ohkubo, Jun-ichi; Hashimoto, Hirofumi; Matsuura, Takanori; Maruyama, Takashi; Onaka, Tatsushi; Suzuki, Hideaki; Ueta, Yoichi

    2015-10-01

    Arginine vasopressin (AVP) synthesis in the hypothalamo-neurohypophysial system (HNS) is up-regulated by kainic acid (KA)-induced seizure in rats. However, it remains unknown whether a subconvulsive dose of KA affects the HNS. Here we examined the effects of subcutaneous (s.c.) administration of a low dose of KA (4 mg/kg) on the gene expressions of the AVP, oxytocin (OXT) and neuronal nitric oxide synthase (nNOS) in the supraoptic (SON) and paraventricular nuclei (PVN) of the rat hypothalamus, using in situ hybridization histochemistry. The expression of the AVP gene in the SON and PVN was judged to be up-regulated in KA-treated rats in comparison with saline-treated rats as controls. Next, the expression of the OXT gene was significantly increased in the SON at 6-24h and in the PVN at 6 and 12h after s.c. administration of KA. Finally, the expression of the nNOS gene was significantly increased in the SON and PVN at 3 and 6h after s.c. administration of KA. These results suggest that up-regulation of the gene expressions of the AVP, OXT and nNOS in the rat hypothalamus may be differentially affected by peripheral administration of a subconvulsive dose of KA. PMID:26003742

  3. Starch phosphorylation in potato tubers is influenced by allelic variation in the genes encoding glucan water dikinase, starch branching enzymes I and II, and starch synthase III

    Directory of Open Access Journals (Sweden)

    Margaret Ann Carpenter

    2015-03-01

    Full Text Available Starch phosphorylation is an important aspect of plant metabolism due to its role in starch degradation. Moreover, the degree of phosphorylation of starch determines its physicochemical properties and is therefore relevant for industrial uses of starch. Currently, starch is chemically phosphorylated to increase viscosity and paste stability. Potato cultivars with elevated starch phosphorylation would make this process unnecessary, thereby bestowing economic and environmental benefits. Starch phosphorylation is a complex trait which has been previously shown by antisense gene repression to be influenced by a number of genes including those involved in starch synthesis and degradation. We have used an association mapping approach to discover genetic markers associated with the degree of starch phosphorylation. A diverse collection of 193 potato lines was grown in replicated field trials, and the levels of starch phosphorylation at the C6 and C3 positions of the glucosyl residues were determined by mass spectrometry of hydrolyzed starch from tubers. In addition, the potato lines were genotyped by amplicon sequencing and microsatellite analysis, focusing on candidate genes known to be involved in starch synthesis. As potato is an autotetraploid, genotyping included determination of allele dosage. Significant associations (p<0.001 were found with SNPs in the glucan water dikinase (GWD, starch branching enzyme I (SBEI and the starch synthase III (SSIII genes, and with a SSR allele in the SBEII gene. SNPs in the GWD gene were associated with C6 phosphorylation, whereas polymorphisms in the SBEI and SBEII genes were associated with both C6 and C3 phosphorylation and the SNP in the SSIII gene was associated with C3 phosphorylation. These allelic variants have potential as genetic markers for starch phosphorylation in potato.

  4. Exposure to Diflubenzuron Results in an Up-Regulation of a Chitin Synthase 1 Gene in Citrus Red Mite, Panonychus citri (Acari: Tetranychidae

    Directory of Open Access Journals (Sweden)

    Wen-Kai Xia

    2014-02-01

    Full Text Available Chitin synthase synthesizes chitin, which is critical for the arthropod exoskeleton. In this study, we cloned the cDNA sequences of a chitin synthase 1 gene, PcCHS1, in the citrus red mite, Panonychus citri (McGregor, which is one of the most economically important pests of citrus worldwide. The full-length cDNA of PcCHS1 contains an open reading frame of 4605 bp of nucleotides, which encodes a protein of 1535 amino acid residues with a predicted molecular mass of 175.0 kDa. A phylogenetic analysis showed that PcCHS1 was most closely related to CHS1 from Tetranychus urticae. During P. citri development, PcCHS1 was constantly expressed in all stages but highly expressed in the egg stage (114.8-fold higher than in the adult. When larvae were exposed to diflubenzuron (DFB for 6 h, the mite had a significantly high mortality rate, and the mRNA expression levels of PcCHS1 were significantly enhanced. These results indicate a promising use of DFB to control P. citri, by possibly acting as an inhibitor in chitin synthesis as indicated by the up-regulation of PcCHS1 after exposure to DFB.

  5. Exposure to diflubenzuron results in an up-regulation of a chitin synthase 1 gene in citrus red mite, Panonychus citri (Acari: Tetranychidae).

    Science.gov (United States)

    Xia, Wen-Kai; Ding, Tian-Bo; Niu, Jin-Zhi; Liao, Chong-Yu; Zhong, Rui; Yang, Wen-Jia; Liu, Bin; Dou, Wei; Wang, Jin-Jun

    2014-01-01

    Chitin synthase synthesizes chitin, which is critical for the arthropod exoskeleton. In this study, we cloned the cDNA sequences of a chitin synthase 1 gene, PcCHS1, in the citrus red mite, Panonychus citri (McGregor), which is one of the most economically important pests of citrus worldwide. The full-length cDNA of PcCHS1 contains an open reading frame of 4605 bp of nucleotides, which encodes a protein of 1535 amino acid residues with a predicted molecular mass of 175.0 kDa. A phylogenetic analysis showed that PcCHS1 was most closely related to CHS1 from Tetranychus urticae. During P. citri development, PcCHS1 was constantly expressed in all stages but highly expressed in the egg stage (114.8-fold higher than in the adult). When larvae were exposed to diflubenzuron (DFB) for 6 h, the mite had a significantly high mortality rate, and the mRNA expression levels of PcCHS1 were significantly enhanced. These results indicate a promising use of DFB to control P. citri, by possibly acting as an inhibitor in chitin synthesis as indicated by the up-regulation of PcCHS1 after exposure to DFB. PMID:24590130

  6. Metabolic Engineering of Plant-derived (E)-β-farnesene Synthase Genes for a Novel Type of Aphid-resistant Genetically Modified Crop Plants

    Institute of Scientific and Technical Information of China (English)

    Xiu-Dao Yu; John Pickett; You-Zhi Ma; Toby Bruce; Johnathan Napier; Huw D.Jones; Lan-Qin Xia

    2012-01-01

    Aphids are major agricultural pests that cause significant yield losses of crop plants each year.Excessive dependence on insecticides for long-term aphid control is undesirable because of the development of insecticide resistance,the potential negative effects on non-target organisms and environmental pollution.Transgenic crops engineered for resistance to aphids via a non-toxic mode of action could be an efficient alternative strategy.(E)-β-Farnesene (EβF) synthases catalyze the formation of EβF,which for many pest aphids is the main component of the alarm pheromone involved in the chemical communication within these species.EβF can also be synthesized by certain plants but is then normally contaminated with inhibitory compounds.Engineering of crop plants capable of synthesizing and emitting EβF could cause repulsion of aphids and also the attraction of natural enemies that use EβF as a foraging cue,thus minimizing aphid infestation.In this review,the effects of aphids on host plants,plants' defenses against aphid herbivory and the recruitment of natural enemies for aphid control in an agricultural setting are briefly introduced.Furthermore,the plant-derived EβF synthase genes cloned to date along with their potential roles in generating novel aphid resistance via genetically modified approaches are discussed.

  7. Molecular Cloning, Characterization and mRNA Expression of a Chitin Synthase 2 Gene from the Oriental Fruit Fly, Bactrocera dorsalis (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Kang-Kang Xu

    2013-08-01

    Full Text Available Chitin synthase (CHS, a potential target for eco-friendly insecticides, plays an essential role in chitin formation in insects. In this study, a full-length cDNA encoding chitin synthase 2 (BdCHS2 was cloned and characterized in the oriental fruit fly, Bactrocera dorsalis. The BdCHS2 cDNA had 4417 nucleotides, containing an open reading frame of 4122 nucleotides, which encoded 1373 amino acid residues with a predicted molecular weight of 158.5 kDa. Phylogenetic analysis with other insect CHSs suggested that BdCHS2 belongs to insect CHS2. The BdCHS2 transcript was predominately found in midgut but was detected at low levels in fat body, Malpighian tubules, integument, and trachea. Moreover, BdCHS2 was expressed in all developmental stages, and highly expressed in the feeding stages. There was a positive relationship between BdCHS2 expression and total chitin content during development. Furthermore, both the gene expression and chitin content in midgut decreased when the insect was fed for 24 h, then starved for 24 h, while they increased dramatically and rapidly under the condition of starvation for 24 h then feeding for 24 h. These results suggest that BdCHS2 may play an important role in regulating chitin content of the midgut, and subsequently affect the growth and development of B. dorsalis.

  8. Modulation of inducible nitric oxide synthase gene expression in RAW 264.7 murine macrophages by Pacific ciguatoxin

    OpenAIRE

    Kumar-Roine, Shilpa; Matsui, Mariko; Chinain, M. (Mireille); Laurent, Dominique; Pauillac, S

    2008-01-01

    To investigate the possible involvement of the nitric oxide radical (NO) in ciguatera fish poisoning (CFP), the in vitro effects of the main Pacific ciguatoxin (P-CTX-1B) and bacterial lipopolysaccharide (LPS) were comparatively studied on neuroblastoma Neuro-2a and on macrophage RAW 264.7 cell lines. NO accumulation was quantified by measuring nitrite levels in cellular supernatant using Griess reagent while the up-regulation of inducible nitric oxide synthase (iNOS) at the mRNA level was qu...

  9. Endothelial Nitric Oxide Synthase (−786T>C) and Endothelin-1 (5665G>T) Gene Polymorphisms as Vascular Dysfunction Risk Factors in Sickle Cell Anemia

    Science.gov (United States)

    Vilas-Boas, Wendell; Figueiredo, Camylla V. B.; Pitanga, Thassila N.; Carvalho, Magda O. S.; Santiago, Rayra P.; Santana, Sânzio S.; Guarda, Caroline C.; Zanette, Angela M. D.; Cerqueira, Bruno A. V.; Gonçalves, Marilda S.

    2016-01-01

    Sickle cell anemia (SCA) patients have vascular complications, and polymorphisms in endothelin-1 (ET-1) and endothelial nitric oxide synthase (eNOS) genes were associated with ET-1 and nitric oxide disturbance. We investigate the association of ET-1 5665G>T and eNOS −786T>C polymorphisms with soluble adhesion molecules (sVCAM-1 and sICAM-1), biochemical markers, and medical history. We studied 101 SCA patients; carriers of eNOS minor allele (C) had the highest levels of sVCAM-1, and carriers of ET-1 minor allele had more occurrence of acute chest syndrome (ACS). The multivariate analysis suggested the influence of the ET-1 gene on ACS outcome and an association of the eNOS gene with upper respiratory tract infection. We suggest that eNOS and ET-1 gene polymorphisms can influence SCA pathophysiology and that eNOS variant in SCA patients might be important to nitric oxide activity and vascular alteration. We found an association of the ET-1 minor allele in ACS, showing the importance of genetic screening in SCA. PMID:27486304

  10. High Trap Formation and Low Metabolite Production by Disruption of the Polyketide Synthase Gene Involved in the Biosynthesis of Arthrosporols from Nematode-Trapping Fungus Arthrobotrys oligospora.

    Science.gov (United States)

    Xu, Zi-Fei; Wang, Bai-Le; Sun, Hong-Kai; Yan, Ni; Zeng, Zhi-Jun; Zhang, Ke-Qin; Niu, Xue-Mei

    2015-10-21

    A group of morphology regulatory arthrosporol metabolites have been recently characterized from carnivorous fungus Arthrobotrys oligospora that can develop trapping networks to capture their prey. A combination of genetic manipulation and chemical analyses was applied to characterize the function of one polyketide synthase (PKS) gene AOL_s00215g283 in A. oligospora, which was putatively involved in the production of 6-methylsalicylic acid. High-performance liquid chromatography analysis showed that the disruption of the PKS gene not only led to the total loss of the arthrosporol A but also resulted in significant reduction in the production of secondary metabolites in the cultural broth of the mutant ΔAOL_s00215g283 strain. Interestingly, the mutant strain displayed significant increases in the trap formation and the nematicidal activity by 10 and 2 times, respectively, higher than the wild-type strain. These findings revealed a pathogenicity-related biosynthetic gene of this agriculturally important biological agent and have implications for establishment of efficient fungal biocontrol agents. PMID:26422178

  11. Construction of eukaryotic expression vector encoding ATP synthase lipid-binding protein-like protein gene of Sj and its expression in HeLa cells

    Institute of Scientific and Technical Information of China (English)

    Ouyang Danming; Hu Yongxuan; Li Mulan; Zeng Xiaojun; He Zhixiong; Yuan Caijia

    2008-01-01

    Objective: To clone and construct the recombinant plasmid containing ATP synthase lipid-binding protein-like protein gene of Schistosoma japonicum,(SjAslp) and transfer it into mammalian cells to express the objective protein. Methods: By polymerase chain reaction (PCR) technique, SjAslp was amplified from the constructed recombinant plasmid pBCSK+/SjAslp, and inserted into cloning vector pUCm-T. Then, SjAslp was subcloned into an eukaryotic expression vector pcDNA3.1(+). After identifying it by PCR, restrictive enzymes digestion and DNA sequencing, the recombinant plasmid was transfected into HeLa cells using electroporation, and the expression of the recombinant protein was analyzed by immunocytochemical assay. Resnlts: The specific gene fragment of 558 bp was successfully amplified. The DNA vaccine of SjAslp was successfully constructed. Immunocytochemical assay showed that SjAslp was expressed in the cytoplasm of HeLa cells. Conclusion: SjAslp gene can be expressed in eukaryotic system, which lays the foundation for development of the SjAslp DNA vaccine against schitosomiasis.

  12. Genome mining of the sordarin biosynthetic gene cluster from Sordaria araneosa Cain ATCC 36386: characterization of cycloaraneosene synthase and GDP-6-deoxyaltrose transferase.

    Science.gov (United States)

    Kudo, Fumitaka; Matsuura, Yasunori; Hayashi, Takaaki; Fukushima, Masayuki; Eguchi, Tadashi

    2016-07-01

    Sordarin is a glycoside antibiotic with a unique tetracyclic diterpene aglycone structure called sordaricin. To understand its intriguing biosynthetic pathway that may include a Diels-Alder-type [4+2]cycloaddition, genome mining of the gene cluster from the draft genome sequence of the producer strain, Sordaria araneosa Cain ATCC 36386, was carried out. A contiguous 67 kb gene cluster consisting of 20 open reading frames encoding a putative diterpene cyclase, a glycosyltransferase, a type I polyketide synthase, and six cytochrome P450 monooxygenases were identified. In vitro enzymatic analysis of the putative diterpene cyclase SdnA showed that it catalyzes the transformation of geranylgeranyl diphosphate to cycloaraneosene, a known biosynthetic intermediate of sordarin. Furthermore, a putative glycosyltransferase SdnJ was found to catalyze the glycosylation of sordaricin in the presence of GDP-6-deoxy-d-altrose to give 4'-O-demethylsordarin. These results suggest that the identified sdn gene cluster is responsible for the biosynthesis of sordarin. Based on the isolated potential biosynthetic intermediates and bioinformatics analysis, a plausible biosynthetic pathway for sordarin is proposed. PMID:27072286

  13. Expression of agsA, one of five 1,3-α-d-glucan synthase-encoding genes in Aspergillus niger, is induced in response to cell wall stress

    NARCIS (Netherlands)

    Damveld, R.A.; Kuyk, P.A. van; Arentshorst, M.; Klis, F.M.; Hondel, C.A.M.J.J. van den; Ram, A.F.J.

    2005-01-01

    1,3-α-d-Glucan is an important component of the cell wall of filamentous fungi. We have identified a family of five 1,3-α-d-glucan synthase-encoding genes in Aspergillus niger. The agsA gene was sequenced and the predicted protein sequence indicated that the overall domain structure of 1,3-α-d-gluca

  14. Genetic Transformation of Tobacco with the Trehalose Synthase Gene from Grifola frondosa Fr. Enhances the Resistance to Drought and Salt in Tobacco

    Institute of Scientific and Technical Information of China (English)

    Shu-Zhen ZHANG; Ben-Peng YANG; Cui-Lian FENG; Huo-Long TANG

    2005-01-01

    Trehalose is a non-reducing disaccharide of glucose that functions as a protectant in the stabilization of biological structures and enhances the tolerance of organisms to abiotic stress. In the present study, we report on the expression of the Grifolafrondosa Fr. trehalose synthase (TSase) gene for manipulating abiotic stress tolerance in tobacco (Nicotiana tabaccum L.). The expression of the transgene was under the control of two tandem copies of the CaMV35S promoter and was transferred into tobacco by Agrobacterium tumefaciens EHA105. Compared with non-transgenic plants, transgenic plants were able to accumulate high levels of products of trehalose, which were increased up to 2.126-2.556 mg/g FW, although levels were undetectable in non-transgenic plants. This level of trehalose in transgenic plants was 400-fold higher than that of transgenic tobacco plants cotransformed with Escherichia coli TPS and TPP on independent expression cassettes, twofold higher than that of transgenic rice plants transformed with a bifunctional fusion gene (TPSP) of the trehalose-6-phosphate (T-6-P) synthase (TPS) and T-6-P phosphatase (TPP) of E. coli, and 12-fold higher than that of transgenic tobacco plants transformed the yeast TPS1 gene.It has been reported that transgenic plants with E. coli TPS and/or TPP were severely stunted and had morphological alterations of their roots. Interestingly, our transgenic plants have obvious morphological changes, including thick and deep-coloured leaves, but show no growth inhibition; moreover, these morphological changes can restore to normal type in T2 progenies. Trehalose accumulation in 35S-35S:TSase plants resulted in increased tolerance to drought and salt, as shown by the results of tests on drought, salt tolerance, and drought physiological indices, such as water content in excised leaves, malondialdehyde content, chlorophyll a and b contents, and the activity of superoxide dismutase and peroxidase in excised leaves. These results

  15. Biosynthesis of P(3HB-co-3HV-co-3HHp terpolymer by Cupriavidus necator PHB-4 transformant harboring the highly active PHA synthase gene of Chromobacterium sp. USM2

    Directory of Open Access Journals (Sweden)

    Rathi, D-N.

    2013-01-01

    Full Text Available Aims: This study evaluates potentials of Cupriavidus necator PHB4 transformant harboring the highly activepolyhydroxyalkanoate synthase gene (phaC of a locally isolated Chromobacterium sp. USM2 for its ability toincorporate 3-hydroxyheptanoate (3HHp monomer.Methodology and results: A mixture of fructose and sodium heptanoate fed to the culture gave rise to poly(3-hydroxybutyrate-co-3-hydroxyvalerate-co-3-hydroxyheptanoate, [P(3HB-co-3HV-co-3HHp] terpolymer synthesis, withtraces of 3HHp monomers confirmed through gas chromatography (GC, proton (1H and carbon (13C NMR spectra.Conclusion, significance and impact of study: This study has revealed that the PHA synthase of Chromobacteriumsp. USM2 has a broad range of substrate specificity. The synthase is able to polymerize 3-hydroxyalkanoate monomershaving 4–7 carbon atoms.

  16. Interrupted thymidylate synthase gene of bacteriophages T2 and T6 and other potential self-splicing introns in the T-even bacteriophages

    International Nuclear Information System (INIS)

    Southern hybridization analyses of procaryotic DNA from Escherchia coli, λ bacteriophage, and T1 to T7 phages were carried out. The hybridization probes used consisted of DNA restriction fragments derived from the T4 phage intron-containing thymidylate synthase gene (td) and short synthetic oligodeoxynucleotides defining specific exon and intron regions of the gene. It was shown that intact as well as restricted DNA from the T-even phages hybridized not only to both T4 phage td intron- and exon-specific probes but also to probes defining the td 5' (exon I-intron) and 3' (intron-exon II) presplice junctions. These data strongly suggest that, analogous to the T4 phage, only the T2 and T6 phages among the procaryotes tested contain interrupted td genes. The td intervening sequence in each phage is roughly 1 kilobase pair (kb) in size and interrupts the td gene at a site analogous to that in the T4 phage. This was confirmed by data from Northern (RNA) hybridization analysis of td-specific in vitro transcripts of these phage DNAs. [α-32P]GTP in vitro labeling of total RNA from T4 phage-infected cells produced five species of labeled RNAs that were 1, 0.9, 0.83, 0.75, and 0.6 kb in size. Only the 1-, 0.9-, and 0.75-kb species were labeled in RNA from T2- or T6-infected cells. The commonly present 1-kb RNA is the excised td intron, which exists in both linear and circular forms in the respective T-even-phage-infected cells, while the 0.6-kb RNA unique to T4 may be the excised intron derived from the ribonucleotide reductase small subunit gene (nrdB) of the phage. The remaining labeled RNA species are likely candidates for other self-splicing introns

  17. Ferric Citrate Transport of Escherichia coli: Functional Regions of the FecR Transmembrane Regulatory Protein

    OpenAIRE

    Welz, Dietrich; Braun, Volkmar

    1998-01-01

    Transcription of the ferric citrate transport genes of Escherichia coli is induced by ferric citrate bound to the outer membrane receptor FecA. Additional ferric citrate-specific regulatory proteins are FecR in the cytoplasmic membrane and the FecI sigma factor in the cytoplasm. To further understand the assumed FecR-mediated signal transduction across the cytoplasmic membrane, the transmembrane topology of FecR (317 amino acids) was determined with hybrid proteins containing portions of FecR...

  18. In vitro tolerance to Botrytis cinerea of grapevine 41B rootstock in transgenic plants expressing the stilbene synthase Vst1 gene under the control of a pathogen‐inducible PR 10 promoterIn vitro tolerance to Botrytis cinerea of grapevine 41B rootstock in transgenic plants expressing the stilbene synthase Vst1 gene under the control of a pathogen‐inducible PR 10 promoter

    OpenAIRE

    Coutos-Thévenot, Pierre; Poinssot, Benoît; Bonomelli, A.; Yean, H.; Breda, C; Buffard, D; Esnault, R.; Hain, R; Boulay, M.

    2001-01-01

    Resveratrol is a major phytoalexin in grapevine but its synthesis in response to phytopathogen attack decreases with grape berry ripening, A chimeric gene combining an alfalfa PR 10 promoter and Vst1 (Vitis stilbene synthase 1) gene was introduced into the genome of 41B rootstock, Transgenic plants were analysed for resveratrol production in leaves infected with Botrytis using an in vitro test. Among the 50 transgenic lines analysed, some exhibited a production lower than the non-transgenic c...

  19. The T -786C, G894T, and Intron 4 VNTR (4a/b) Polymorphisms of the Endothelial Nitric Oxide Synthase Gene in Prostate Cancer Cases.

    Science.gov (United States)

    Diler, S B; Öden, A

    2016-02-01

    In previously conducted some studies it has been revealed that nitric oxide (NO) and nitric oxide synthase (NOS) system play a significant role in carcinogenesis. Nitric oxide (NO) is regulated by endothelial nitric oxide synthase (eNOS) enzyme which is one of the isoenzymes of NO synthase (NOS). In this study we have tried to come to a conclusion about whether eNOS gene T -786C, G894T and Intron 4 VNTR (4a/b) polymorphisms might be considered as a risk factor causing prostate cancer (PCa) or not. A total of 200 subjects were included in this research. 84 patients with PCa (mean age 70.0 ± 6.4) and 116 healthy controls (mean age 69.9 ± 7.5) were recruited in this case-control study. Genomic DNA was extracted using the QIAamp DNA Blood Mini Kit (QIAGEN GmbH, Maryland, USA), according to the manufacturer's guidelines. The T-786C, G894T and Intron 4 VNTR (4a/b) polymorphisms were amplified using polymerase chain reation (PCR), detected by restriction fragment length polymorphism (RFLP). For T -786C polymorphism CC genotype [odds ratio (OR): 0.34, 95% confidence interval (CI): 0.15-0.78, P = 0.009)] and allele frequency (OR: 0.631, CI: 0.421-0.946, P = 0.026) is significant for control. In patients with PCa eNOS G894T polymorphism, both GT (OR: 0.069, CI: 0.027-0.174; P = 0.0001) and TT (OR: 0.040, CI: 0.013-0.123; P = = 0.0001) genotype distribution, and also T allele frequency (OR: 0.237, CI: 0.155-0.362, P = 0.0001) were considered significant statistically. While genotype distribution for the other polymorphism eNOS, intron 4 VNTR (4a/b), is insignificant statistically, "a" allele frequency was found out to be significant (OR: 2.223, CI: 1.311-3.769, P = 0.003). In this study we indicated that genotype and allele frequencies of eNOS T -786C and G894T polymorphisms are statistically significant in patients with PCa. eNOS T -786C and G894T polymorphisms may be associated with PCa susceptibility in the Turkish population. In contrast, intron 4 VNTR (4a

  20. Cloning and Sequence Analyzing of Chalcone Synthase Gene in Loropetalum chinense var.Rubrum%红花檵木CHS基因的克隆与序列分析

    Institute of Scientific and Technical Information of China (English)

    许威; 于晓英; 陈己任; 符红艳; 胡博文; 陈彦斌; 李达

    2013-01-01

    查尔酮合酶(chalcone synthase,CHS)是进入类黄酮和花色素苷次生代谢的第1个关键酶.根据植物查尔酮合成酶保守区序列设计引物,以红花檵木Loropetalurn chinense var.Rubrum)大叶红的嫩叶为材料,用RT-PCR方法,分离得到了一个查尔酮合成酶基因的eDNA(GenBank登录号为JQ609678),将该基因命名为Lc vrCHS1.该序列长927 bp,编码232个氨基酸残基.其核苷酸序列与GenBank已登录的同样来源的核桃、山茶属植物CHS序列同源性达83%,与其他科植物(绣球花、葡萄、桃、马铃薯、甘草、领春木属)CHS序列同源性也达到80%以上;其编码的氨基酸序列与山茶属、葡萄、鳄梨、洋梨、沙梨、映山红CHS基因编码的氨基酸序列同样具有高度同源性,同源性高达98%.%Chalcone synthase (chalcone synthase, CHS) is the key enzyme that catalyzes the first step in flavonoids biosynthesis and anthocyanins secondary metabolites. A full-length cDNA encoding CHS was cloned from the young leaves of Loropetalurn chinense var. rubrum by RT-PCR using specific primers based on the highly conserved sequences of plant CHS that had already known. Blast search revealed that it was a new gene, and was named as LcvrCHSl (GenBank accession: JQ609678). The sequence was 927 bp, encoding 232 amino acid residues. It had 83% sequence homology with walnut and camellia that had been logged in GenBank; with other genus plants (hydrangea, grapes, peaches, potatoes, licorice, Euptelea genus), CHS sequence homology was also more than 80%; with other plants (camellia, grapes, avocados, bartlett pear, sand pear, azalea), CHS sequence also had high homology, up to 98% homology.

  1. Citrate pharmacokinetics and calcium levels during high-flux dialysis with regional citrate anticoagulation

    OpenAIRE

    Kozik-Jaromin, Justyna; Nier, Volker; Heemann, Uwe; Kreymann, Bernhard; Böhler, Joachim

    2009-01-01

    Background. Regional citrate anticoagulation is a very effective anticoagulation method for haemodialysis. However, it is not widely used, primarily due to the risk of hypocalcaemia. We studied citrate and calcium kinetics to better understand safety aspects of this anticoagulation method. Methods. During 15 haemodialysis treatments with a calcium-free dialysis solution, citrate was infused pre-dialyser and calcium was substituted post-dialyser. Systemic and extracorporeal citrate and calcium...

  2. Targeting a polyketide synthase gene for Aspergillus carbonarius quantification and ochratoxin A assessment in grapes using real-time PCR

    International Nuclear Information System (INIS)

    Aspergillus carbonarius is an ochratoxin producing fungus that has been considered to be responsible of the ochratoxin A (OTA) contamination in grapes and wine. In order to monitor and quantify A. carbonarius, a specific primer pair Ac12RLOTAF/Ac12RLOTAR has been designed from the acyltransferase (AT) domain of the polyketide synthase sequence Ac12RL3 to amplify 141 bp PCR product. Among the mycotoxigenic fungi tested, only A. carbonarius gave a positive result. This specific primer pair was also successfully employed in real-time PCR conjugated with SYBR Green I dye for the direct quantification of this fungus in grape samples. A positive correlation (R2 = 0.81) was found between A. carbonarius DNA content and OTA concentration in 72 grape samples, allowing for the estimation of the potential risk from OTA contamination. Consequently, this work offers a quick alternative to conventional methods of OTA quantification and mycological detection and quantification of A. carbonarius in grapes. (author)

  3. Expression characteristics of CS-ACS1, CS-ACS2 and CS-ACS3, three members of the 1-aminocyclopropane-1-carboxylate synthase gene family in cucumber (Cucumis sativus L.) fruit under carbon dioxide stress.

    Science.gov (United States)

    Mathooko, F M; Mwaniki, M W; Nakatsuka, A; Shiomi, S; Kubo, Y; Inaba, A; Nakamura, R

    1999-02-01

    We investigated the expression pattern of three 1-aminocyclopropane-1-carboxylate (ACC) synthase genes, CS-ACS1, CS-ACS2 and CS-ACS3 in cucumber (Cucumis sativus L.) fruit under CO2 stress. CO2 stress-induced ethylene production paralleled the accumulation of only CS-ACS1 transcripts which disappeared upon withdrawal of CO2. Cycloheximide inhibited the CO2 stress-induced ethylene production but superinduced the accumulation of CS-ACS1 transcript. At higher concentrations, cycloheximide also induced the accumulation of CS-ACS2 and CS-ACS3 transcripts. In the presence of CO2 and cycloheximide, the accumulation of CS-ACS2 transcript occurred within 1 h, disappeared after 3 h and increased greatly upon withdrawal of CO2. Inhibitors of protein kinase and types 1 and 2A protein phosphatases which inhibited and stimulated, respectively, CO2 stress-induced ethylene production had little effect on the expression of these genes. The results presented here identify CS-ACS1 as the main ACC synthase gene responsible for the increased ethylene biosynthesis in cucumber fruit under CO2 stress and suggest that this gene is a primary response gene and its expression is under negative control since it is expressed by treatment with cycloheximide. The results further suggest that the regulation of CO2 stress-induced ethylene biosynthesis by reversible protein phosphorylation does not result from enhanced ACC synthase transcription. PMID:10202812

  4. Identification and function of a polyketide synthase gene responsible for 1,8-dihydroxynaphthalene-melanin pigment biosynthesis in Ascochyta rabiei.

    Science.gov (United States)

    Akamatsu, Hajime O; Chilvers, Martin I; Stewart, Jane E; Peever, Tobin L

    2010-08-01

    Ascochyta rabiei produces and accumulates one of the well-known fungal polyketides, 1,8-dihydroxynaphthalene-melanin pigment (DHN-melanin), in asexual and sexual fruiting bodies. Degenerate PCR primers were used to isolate an ArPKS1 of A. rabiei encoding a polypeptide with high similarity to polyketide synthase (PKS) involved in biosynthesis of DHN-melanin in other ascomycetous fungi. Site-directed mutagenesis of ArPKS1 in A. rabiei generated melanin-deficient pycnidial mutants but caused no significant reduction of pathogenicity to chickpea. Pycnidiospores in ArPKS1-mutant pycnidia showed higher sensitivity to UV light exposure compared to pycnidiospores in melanized pycnidia of the wild-type progenitor isolate. Integration of an orthologous PKS1 gene from Bipolaris oryzae into the genome of the mutants complemented the dysfunctional ArPKS1 gene. This study demonstrated that A. rabiei uses a DHN-melanin pathway for pigmentation of pycnidia and this molecule may protect pycnidiospores from UV irradiation. PMID:20473673

  5. Increased enzyme production under liquid culture conditions in the industrial fungus Aspergillus oryzae by disruption of the genes encoding cell wall α-1,3-glucan synthase.

    Science.gov (United States)

    Miyazawa, Ken; Yoshimi, Akira; Zhang, Silai; Sano, Motoaki; Nakayama, Mayumi; Gomi, Katsuya; Abe, Keietsu

    2016-09-01

    Under liquid culture conditions, the hyphae of filamentous fungi aggregate to form pellets, which reduces cell density and fermentation productivity. Previously, we found that loss of α-1,3-glucan in the cell wall of the fungus Aspergillus nidulans increased hyphal dispersion. Therefore, here we constructed a mutant of the industrial fungus A. oryzae in which the three genes encoding α-1,3-glucan synthase were disrupted (tripleΔ). Although the hyphae of the tripleΔ mutant were not fully dispersed, the mutant strain did form smaller pellets than the wild-type strain. We next examined enzyme productivity under liquid culture conditions by transforming the cutinase-encoding gene cutL1 into A. oryzae wild-type and the tripleΔ mutant (i.e. wild-type-cutL1, tripleΔ-cutL1). A. oryzae tripleΔ-cutL1 formed smaller hyphal pellets and showed both greater biomass and increased CutL1 productivity compared with wild-type-cutL1, which might be attributable to a decrease in the number of tripleΔ-cutL1 cells under anaerobic conditions. PMID:27442340

  6. Phylogenetic diversity of culturable endophytic fungi in Dongxiang wild rice (Oryza rufipogon Griff), detection of polyketide synthase gene and their antagonistic activity analysis.

    Science.gov (United States)

    Wang, Ya; Gao, Bo Liang; Li, Xi Xi; Zhang, Zhi Bin; Yan, Ri Ming; Yang, Hui Lin; Zhu, Du

    2015-11-01

    The biodiversity of plant endophytic fungi is enormous, numerous competent endophytic fungi are capable of providing different forms of fitness benefits to host plants and also could produce a wide array of bioactive natural products, which make them a largely unexplored source of novel compounds with potential bioactivity. In this study, we provided a first insights into revealing the diversity of culturable endophytic fungi in Dongxiang wild rice (Oryza rufipogon Griff.) from China using rDNA-ITS phylogenetic analysis. Here, the potential of fungi in producing bioactive natural products was estimated based on the beta-ketosynthase detected in the polyketide synthase (PKS) gene cluster and on the bioassay of antagonistic activity against two rice phytopathogens Thanatephorus cucumeris and Xanthomonas oryzae. A total of 229 endophytic fungal strains were validated in 19 genera. Among the 24 representative strains, 13 strains displayedantagonistic activity against the phytopathogens. Furthermore, PKS genes were detected in 9 strains, indicating their potential for synthesising PKS compounds. Our study confirms the phylogenetic diversity of endophytic fungi in O. rufipogon G. and highlights that endophytic fungi are not only promising resources of biocontrol agents against phytopathogens of rice plants, but also of bioactive natural products and defensive secondary metabolites. PMID:26466878

  7. Genetic variants in inducible nitric oxide synthase gene are associated with the risk of radiation-induced lung injury in lung cancer patients receiving definitive thoracic radiation

    International Nuclear Information System (INIS)

    Background and purpose: Nitric oxide (NO), mainly synthesized by inducible nitric oxide synthase (NOS2) in pathological conditions, plays an important role in cytotoxicity, inflammation and fibrosis. Elevations in exhaled NO after thoracic radiation have been reported to predict radiation-induced lung injury (RILI). This study examined whether genetic variations in NOS2 gene is associated with the risk of RILI. Material and methods: A cohort of 301 patients between 2009 and 2011 were genotyped for 21 single nucleotide polymorphisms (SNPs) in the NOS2 gene by the Sequenom MassArray system. Kaplan–Meier cumulative probability was used to assess RILI risk and Cox proportional hazards analyses were performed to evaluate the effect of NOS2 genotypes on RILI. Results: Multivariate analysis found that three SNPs (rs2297518, rs1137933 and rs16949) in NOS2 were significantly associated with risk of RILI ⩾ 2 (P value = 0.001, 0.000092, 0.001, respectively) after adjusting for other covariates. Their associations were independent of radiation dose and mean lung dose. Further haplotype analysis indicated that the ATC haplotype of three SNPs is associated with reducing the risk of developing RILI. Conclusion: Our results demonstrate that genetic variants of NOS2 may serve as a reliable predictor of RILI in lung cancer patients treated with thoracic radiation

  8. Adenoviral gene transfer of endothelial nitric-oxide synthase (eNOS) partially restores normal pulmonary arterial pressure in eNOS-deficient mice

    Science.gov (United States)

    Champion, Hunter C.; Bivalacqua, Trinity J.; Greenberg, Stanley S.; Giles, Thomas D.; Hyman, Albert L.; Kadowitz, Philip J.

    2002-01-01

    It has been shown that mice deficient in the gene coding for endothelial nitric-oxide synthase (eNOS) have increased pulmonary arterial pressure and pulmonary vascular resistance. In the present study, the effect of transfer to the lung of an adenoviral vector encoding the eNOS gene (AdCMVeNOS) on pulmonary arterial pressure and pulmonary vascular resistance was investigated in eNOS-deficient mice. One day after intratracheal administration of AdCMVeNOS to eNOS−/− mice, there was an increase in eNOS protein, cGMP levels, and calcium-dependent conversion of l-arginine to l-citrulline in the lung. The increase in eNOS protein and activity in eNOS−/− mice was associated with a reduction in mean pulmonary arterial pressure and pulmonary vascular resistance when compared with values in eNOS-deficient mice treated with vehicle or a control adenoviral vector coding for β-galactosidase, AdCMVβgal. These data suggest that in vivo gene transfer of eNOS to the lung in eNOS−/− mice can increase eNOS staining, eNOS protein, calcium-dependent NOS activity, and cGMP levels and partially restore pulmonary arterial pressure and pulmonary vascular resistance to near levels measured in eNOS+/+ mice. Thus, the major finding in this study is that in vivo gene transfer of eNOS to the lung in large part corrects a genetic deficiency resulting from eNOS deletion and may be a useful therapeutic intervention for the treatment of pulmonary hypertensive disorders in which eNOS activity is reduced. PMID:12237402

  9. A myo-inositol-1-phosphate synthase gene, IbMIPS1, enhances salt and drought tolerance and stem nematode resistance in transgenic sweet potato.

    Science.gov (United States)

    Zhai, Hong; Wang, Feibing; Si, Zengzhi; Huo, Jinxi; Xing, Lei; An, Yanyan; He, Shaozhen; Liu, Qingchang

    2016-02-01

    Myo-inositol-1-phosphate synthase (MIPS) is a key rate limiting enzyme in myo-inositol biosynthesis. The MIPS gene has been shown to improve tolerance to abiotic stresses in several plant species. However, its role in resistance to biotic stresses has not been reported. In this study, we found that expression of the sweet potato IbMIPS1 gene was induced by NaCl, polyethylene glycol (PEG), abscisic acid (ABA) and stem nematodes. Its overexpression significantly enhanced stem nematode resistance as well as salt and drought tolerance in transgenic sweet potato under field conditions. Transcriptome and real-time quantitative PCR analyses showed that overexpression of IbMIPS1 up-regulated the genes involved in inositol biosynthesis, phosphatidylinositol (PI) and ABA signalling pathways, stress responses, photosynthesis and ROS-scavenging system under salt, drought and stem nematode stresses. Inositol, inositol-1,4,5-trisphosphate (IP3 ), phosphatidic acid (PA), Ca(2+) , ABA, K(+) , proline and trehalose content was significantly increased, whereas malonaldehyde (MDA), Na(+) and H2 O2 content was significantly decreased in the transgenic plants under salt and drought stresses. After stem nematode infection, the significant increase of inositol, IP3 , PA, Ca(2+) , ABA, callose and lignin content and significant reduction of MDA content were found, and a rapid increase of H2 O2 levels was observed, peaked at 1 to 2 days and thereafter declined in the transgenic plants. This study indicates that the IbMIPS1 gene has the potential to be used to improve the resistance to biotic and abiotic stresses in plants. PMID:26011089

  10. Over-expression of Catharanthus roseus tryptophan decarboxylase and strictosidine synthase in rol gene integrated transgenic cell suspensions of Vinca minor.

    Science.gov (United States)

    Verma, Priyanka; Sharma, Abhishek; Khan, Shamshad Ahmad; Shanker, Karuna; Mathur, Ajay K

    2015-01-01

    Tryptophan decarboxylase (TDC) and strictosidine synthase (STR) genes from Catharanthus roseus have been successfully over-expressed in the rol gene integrated cell suspensions of V. minor. Thirty seconds SAAT (sonication-assisted Agrobacterium transformation) treatment of plant cell suspension with LBA1119 having construct () generated three stable TDC + STR over-expressing cell lines--PVG1, PVG2, and PVG3. The transgenes were confirmed by β-glucuronidase GUS histochemical assay and PCR amplification of rol genes/GUS gene. All the three cell suspension lines were found to be slow growing. In comparison to the control cell suspensions (GI = 241.0 ± 5.8), PVG3 cell line registered a growth index (GI) of 208.0 ± 10.0 followed by PVG1 (GI = 140.0 ± 14.2) and PVG2 (GI = 85.0 ± 9.6). The PVG3 cell line was also up-scaled in the 5-l stirred tank bioreactor with GI of 745.6 ± 35.3 under optimized parameters. Only PVG3 line registered a twofold increase in total alkaloid content (2.1 ± 0.1% dry wt.) and showed vincamine presence (0.003 ± 0.001% dry wt.) which was further enhanced at the bioreactor level (2.7 ± 0.3 and 0.005 ± 0.001% dry wt., respectively). Real-time (RT) qPCR analysis of PVG3 showed more than sevenfold to eightfold increase in TDC and STR expression [relative quantity value (RQ) = 7.6 ± 0.8 (TDC); RQ = 8.5 ± 0.9 (STR)]. PMID:25106473

  11. Dermal exposure of Eisenia andrei earthworms: Effects of heavy metals on metallothionein and phytochelatin synthase gene expressions in coelomocytes.

    Science.gov (United States)

    Homa, Joanna; Rorat, Agnieszka; Kruk, Jerzy; Cocquerelle, Claude; Plytycz, Barbara; Vandenbulcke, Franck

    2015-06-01

    Parameters such as total number of coelomocytes, riboflavin content in coelomocytes, expression of genes implied in metal homeostasis, and detoxification mechanisms can be used as biomarkers to assess the impact of metals on annelids. Defense biomarkers (detoxification gene expressions and coelomocyte parameters) were investigated in the ecotoxicologically important species Eisenia andrei following in vivo exposure to 5 different metals (zinc, copper, nickel, lead, and cadmium) at known concentrations. Coelomocyte numbers and riboflavin content were not affected by metallic exposure, but metal-specific gene expression variations were evidenced. PMID:25693738

  12. Novel Structural and Functional Motifs in cellulose synthase (CesA) Genes of Bread Wheat (Triticum aestivum, L.)

    OpenAIRE

    Kaur, Simerjeet; Dhugga, Kanwarpal S; Gill, Kulvinder; Singh, Jaswinder

    2016-01-01

    Cellulose is the primary determinant of mechanical strength in plant tissues. Late-season lodging is inversely related to the amount of cellulose in a unit length of the stem. Wheat is the most widely grown of all the crops globally, yet information on its CesA gene family is limited. We have identified 22 CesA genes from bread wheat, which include homoeologs from each of the three genomes, and named them as TaCesAXA, TaCesAXB or TaCesAXD, where X denotes the gene number and the last suffix s...

  13. Disruption of Yarrowia lipolytica TPS1 gene encoding trehalose-6-P synthase does not affect growth in glucose but impairs growth at high temperature.

    Directory of Open Access Journals (Sweden)

    Carmen-Lisset Flores

    Full Text Available We have cloned the Yarrowia lipolytica TPS1 gene encoding trehalose-6-P synthase by complementation of the lack of growth in glucose of a Saccharomyces cerevisiae tps1 mutant. Disruption of YlTPS1 could only be achieved with a cassette placed in the 3' half of its coding region due to the overlap of its sequence with the promoter of the essential gene YlTFC1. The Yltps1 mutant grew in glucose although the Y. lipolytica hexokinase is extremely sensitive to inhibition by trehalose-6-P. The presence of a glucokinase, insensitive to trehalose-6-P, that constitutes about 80% of the glucose phosphorylating capacity during growth in glucose may account for the growth phenotype. Trehalose content was below 1 nmol/mg dry weight in Y. lipolytica, but it increased in strains expressing YlTPS1 under the control of the YlTEF1 promoter or with a disruption of YALI0D15598 encoding a putative trehalase. mRNA levels of YlTPS1 were low and did not respond to thermal stresses, but that of YlTPS2 (YALI0D14476 and YlTPS3 (YALI0E31086 increased 4 and 6 times, repectively, by heat treatment. Disruption of YlTPS1 drastically slowed growth at 35°C. Homozygous Yltps1 diploids showed a decreased sporulation frequency that was ascribed to the low level of YALI0D20966 mRNA an homolog of the S. cerevisiae MCK1 which encodes a protein kinase that activates early meiotic gene expression.

  14. Provitamin A Accumulation in Cassava (Manihot esculenta) Roots Driven by a Single Nucleotide Polymorphism in a Phytoene Synthase Gene[W

    Science.gov (United States)

    Welsch, Ralf; Arango, Jacobo; Bär, Cornelia; Salazar, Bertha; Al-Babili, Salim; Beltrán, Jesús; Chavarriaga, Paul; Ceballos, Hernan; Tohme, Joe; Beyer, Peter

    2010-01-01

    Cassava (Manihot esculenta) is an important staple crop, especially in the arid tropics. Because roots of commercial cassava cultivars contain a limited amount of provitamin A carotenoids, both conventional breeding and genetic modification are being applied to increase their production and accumulation to fight vitamin A deficiency disorders. We show here that an allelic polymorphism in one of the two expressed phytoene synthase (PSY) genes is capable of enhancing the flux of carbon through carotenogenesis, thus leading to the accumulation of colored provitamin A carotenoids in storage roots. A single nucleotide polymorphism present only in yellow-rooted cultivars cosegregates with colored roots in a breeding pedigree. The resulting amino acid exchange in a highly conserved region of PSY provides increased catalytic activity in vitro and is able to increase carotenoid production in recombinant yeast and Escherichia coli cells. Consequently, cassava plants overexpressing a PSY transgene produce yellow-fleshed, high-carotenoid roots. This newly characterized PSY allele provides means to improve cassava provitamin A content in cassava roots through both breeding and genetic modification. PMID:20889914

  15. cDNA cloning and expression analyses of phytoene synthase 1, phytoene desaturase and ζ-carotene desaturase genes from Solanum lycopersicum KKU-T34003

    Directory of Open Access Journals (Sweden)

    Krittaya Supathaweewat

    2013-10-01

    Full Text Available We report on the cloning of Psy1, Pds and Zds cDNAs encoding the enzymes responsible for lycopene biosynthesis,namely phytoene synthase 1 (PSY1, phytoene desaturase (PDS and -carotene desaturase (ZDS, respectively, from high-lycopene tomato cultivar, Solanum lycopersicum KKU-T34003. DNA sequence analyses showed that the complete openreading frames of Psy1, Pds and Zds cDNAs were 1,239, 1,752 and 1,767 base pairs in length and encoded proteins of 412,583 and 588 amino acids, respectively. Phylogenetic and the conserved domain analyses suggest that PSY1, PDS and ZDSfrom S. lycopersicum KKU-T34003 potentially have similar structures and biological functions to the corresponding proteinsfrom other plants. Gene expression studies showed that Psy1 was expressed only in the petal and the breaker fruit, whereasthe expressions of Pds and Zds were observed in the petal, the breaker fruit and the leaf. The highest expression level for allgenes was detected in the breaker-stage fruit, suggesting that carotenoid accumulation was developmentally regulated inthe chromoplast-containing tissues.

  16. Over-expression of BvMTSH, a fusion gene for maltooligosyltrehalose synthase and maltooligosyltrehalose trehalohydrolase, enhances drought tolerance in transgenic rice.

    Science.gov (United States)

    Joo, Joungsu; Choi, Hae Jong; Lee, Youn Hab; Lee, Sarah; Lee, Choong Hwan; Kim, Chung Ho; Cheong, Jong-Joo; Choi, Yang Do; Song, Sang Ik

    2014-01-01

    Plant abiotic stress tolerance has been modulated by engineering the trehalose synthesis pathway. However, many stress-tolerant plants that have been genetically engineered for the trehalose synthesis pathway also show abnormal development. The metabolic intermediate trehalose 6-phosphate has the potential to cause aberrations in growth. To avoid growth inhibition by trehalose 6-phosphate, we used a gene that encodes a bifunctional in-frame fusion (BvMTSH) of maltooligosyltrehalose synthase (BvMTS) and maltooligosyltrehalose trehalohydrolase (BvMTH) from the nonpathogenic bacterium Brevibacterium helvolum. BvMTS converts maltooligosaccharides into maltooligosyltrehalose and BvMTH releases trehalose. Transgenic rice plants that over-express BvMTSH under the control of the constitutive rice cytochrome c promoter (101MTSH) or the ABA-inducible Ai promoter (105MTSH) show enhanced drought tolerance without growth inhibition. Moreover, 101MTSH and 105MTSH showed an ABA-hyposensitive phenotype in the roots. Our results suggest that over-expression of BvMTSH enhances drought-stress tolerance without any abnormal growth and showes ABA hyposensitive phenotype in the roots. PMID:24209631

  17. Genome-wide identification and expression profile analysis of citrus sucrose synthase genes: investigation of possible roles in the regulation of sugar accumulation.

    Directory of Open Access Journals (Sweden)

    Mohammad Zahidul Islam

    Full Text Available Sucrose synthase (Sus (EC 2.4.1.13 is a key enzyme for the sugar accumulation that is critical to form fruit quality. In this study, extensive data-mining and PCR amplification confirmed that there are at least six Sus genes (CitSus1-6 in the citrus genome. Gene structure and phylogeny analysis showed an evolutionary consistency with other plant species. The six Sus genes contain 12-15 exons and 11-14 introns and were evenly distributed into the three plant Sus groups (CitSus1 and CitSus2 in the Sus I group, CitSus3 and CitSus6 in the Sus II group, and CitSus4 and CitSus5 in the Sus III group. Transcripts of these six CitSus genes were subsequently examined. For tissues and organs, CitSus1 and 2 were predominantly expressed in fruit juice sacs (JS whereas CitSus3 and 4 were predominantly expressed in early leaves (immature leaves, and CitSus5 and 6 were predominantly expressed in fruit JS and in mature leaves. During fruit development, CitSus5 transcript increased significantly and CitSus6 transcript decreased significantly in fruit JS. In the fruit segment membrane (SM, the transcript levels of CitSus2 and 5 were markedly higher and the abundant levels of CitSus3 and 6 gradually decreased. Moreover, transcript levels of CitSus1-4 examined were higher and the CitSus5 transcript level was lower in the fruit SM than in fruit JS, while CitSus6 had a similar transcript level in fruit JS and SM. In addition, transcripts of CitSus1-6 responded differently to dehydration in mature leaves or to mild drought stress in fruit JS and SM. Finally, the possible roles of Sus genes in the regulation of sugar accumulation are discussed; however, further study is required.

  18. Widespread Occurrence and Genomic Context of Unusually Small Polyketide Synthase Genes in Microbial Consortia Associated with Marine Sponges

    OpenAIRE

    Fieseler, L.; Hentschel, Ute; Grozdanov, L.; Schirmer, A; Wen, G; Platzer, M; Hrvatin, S.; Butzke, D.; Zimmermann, K.; Piel, J.

    2007-01-01

    Numerous marine sponges harbor enormous amounts of as-yet-uncultivated bacteria in their tissues. There is increasing evidence that these symbionts play an important role in the synthesis of protective metabolites, many of which are of great pharmacological interest. In this study, genes for the biosynthesis of polyketides, one of the most important classes of bioactive natural products, were systematically investigated in 20 demosponge species from different oceans. Unexpectedly, the sponge ...

  19. Attenuation of Mycobacterium tuberculosis by Disruption of a mas-Like Gene or a Chalcone Synthase-Like Gene, Which Causes Deficiency in Dimycocerosyl Phthiocerol Synthesis

    OpenAIRE

    Sirakova, Tatiana D.; Dubey, Vinod S.; Cynamon, Michael H.; Kolattukudy, Pappachan E.

    2003-01-01

    Tuberculosis is one of the leading preventable causes of death. Emergence of drug-resistant tuberculosis makes the discovery of new targets for antimycobacterial drugs critical. The unique mycobacterial cell wall lipids are known to play an important role in pathogenesis, and therefore the genes responsible for their biosynthesis offer potential new targets. To assess the possible role of some of the genes potentially involved in cell wall lipid synthesis, we disrupted a mas-like gene, msl7, ...

  20. Global gene expression during stringent response in Corynebacterium glutamicum in presence and absence of the rel gene encoding (pppGpp synthase

    Directory of Open Access Journals (Sweden)

    Kalinowski Jörn

    2006-09-01

    Full Text Available Background The stringent response is the initial reaction of microorganisms to nutritional stress. During stringent response the small nucleotides (pppGpp act as global regulators and reprogram bacterial transcription. In this work, the genetic network controlled by the stringent response was characterized in the amino acid-producing Corynebacterium glutamicum. Results The transcriptome of a C. glutamicum rel gene deletion mutant, unable to synthesize (pppGpp and to induce the stringent response, was compared with that of its rel-proficient parent strain by microarray analysis. A total of 357 genes were found to be transcribed differentially in the rel-deficient mutant strain. In a second experiment, the stringent response was induced by addition of DL-serine hydroxamate (SHX in early exponential growth phase. The time point of the maximal effect on transcription was determined by real-time RT-PCR using the histidine and serine biosynthetic genes. Transcription of all of these genes reached a maximum at 10 minutes after SHX addition. Microarray experiments were performed comparing the transcriptomes of SHX-induced cultures of the rel-proficient strain and the rel mutant. The differentially expressed genes were grouped into three classes. Class A comprises genes which are differentially regulated only in the presence of an intact rel gene. This class includes the non-essential sigma factor gene sigB which was upregulated and a large number of genes involved in nitrogen metabolism which were downregulated. Class B comprises genes which were differentially regulated in response to SHX in both strains, independent of the rel gene. A large number of genes encoding ribosomal proteins fall into this class, all being downregulated. Class C comprises genes which were differentially regulated in response to SHX only in the rel mutant. This class includes genes encoding putative stress proteins and global transcriptional regulators that might be

  1. Cloning, Expression Profiling and Functional Analysis of CnHMGS, a Gene Encoding 3-hydroxy-3-Methylglutaryl Coenzyme A Synthase from Chamaemelum nobile

    Directory of Open Access Journals (Sweden)

    Shuiyuan Cheng

    2016-03-01

    Full Text Available Roman chamomile (Chamaemelum nobile L. is renowned for its production of essential oils, which major components are sesquiterpenoids. As the important enzyme in the sesquiterpenoid biosynthesis pathway, 3-hydroxy-3-methylglutaryl coenzyme A synthase (HMGS catalyze the crucial step in the mevalonate pathway in plants. To isolate and identify the functional genes involved in the sesquiterpene biosynthesis of C. nobile L., a HMGS gene designated as CnHMGS (GenBank Accession No. KU529969 was cloned from C. nobile. The cDNA sequence of CnHMGS contained a 1377 bp open reading frame encoding a 458-amino-acid protein. The sequence of the CnHMGS protein was highly homologous to those of HMGS proteins from other plant species. Phylogenetic tree analysis revealed that CnHMGS clustered with the HMGS of Asteraceae in the dicotyledon clade. Further functional complementation of CnHMGS in the mutant yeast strain YSC6274 lacking HMGS activity demonstrated that the cloned CnHMGS cDNA encodes a functional HMGS. Transcript profile analysis indicated that CnHMGS was preferentially expressed in flowers and roots of C. nobile. The expression of CnHMGS could be upregulated by exogenous elicitors, including methyl jasmonate and salicylic acid, suggesting that CnHMGS was elicitor-responsive. The characterization and expression analysis of CnHMGS is helpful to understand the biosynthesis of sesquiterpenoid in C. nobile at the molecular level and also provides molecular wealth for the biotechnological improvement of this important medicinal plant.

  2. Heterooligomeric phosphoribosyl diphosphate synthase of Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Hove-Jensen, Bjarne

    2004-01-01

    The yeast Saccharomyces cerevisiae contains five phosphoribosyl diphosphate (PRPP) synthase-homologous genes (PRS1-5), which specify PRPP synthase subunits 1-5. Expression of the five S. cerevisiae PRS genes individually in an Escherichia coli PRPP-less strain (Deltaprs) showed that a single PRS...... gene product had no PRPP synthase activity. In contrast, expression of five pairwise combinations of PRS genes resulted in the formation of active PRPP synthase. These combinations were PRS1 PRS2, PRS1 PRS3, and PRS1 PRS4, as well as PRS5 PRS2 and PRS5 PRS4. None of the remaining five possible pairwise...... combinations of PRS genes appeared to produce active enzyme. Extract of an E. coli strain containing a plasmid-borne PRS1 gene and a chromosome-borne PRS3 gene contained detectable PRPP synthase activity, whereas extracts of strains containing PRS1 PRS2, PRS1 PRS4, PRS5 PRS2, or PRS5 PRS4 contained no...

  3. A critical update on endothelial nitric oxide synthase gene variations in women with idiopathic recurrent spontaneous abortion: genetic association study, systematic review and meta-analyses.

    Science.gov (United States)

    Pereza, N; Peterlin, B; Volk, M; Kapović, M; Ostojić, S

    2015-05-01

    A number of case-control studies investigated the association between idiopathic recurrent spontaneous abortion (IRSA) and variations in the gene encoding endothelial nitric oxide synthase (NOS3), but yielded contradictory results. Our aim was to test the association of the NOS3 variable number of tandem repeats (VNTR) in intron 4 and +894 G/T single-nucleotide polymorphism (SNP) with IRSA in Slovenian women (148 IRSA and 149 control women), conduct a systematic review of literature on the association between NOS3 gene variations and IRSA, and perform meta-analyses of studies that met the inclusion criteria, defined by virtue of the European Society for Human Reproduction and Embryology evidence-based guidelines for recurrent spontaneous abortion. Genotyping was performed using PCR and restriction fragment length polymorphism methods. The systematic review of literature (English language) was conducted using PubMed and Scopus databases, to 1 November 2014. We determined no association of IRSA with the VNTR in intron 4 and +894 G/T SNP in Slovenian women. Furthermore, 16 case-control studies were identified on the association between 15 NOS3 gene variations and IRSA. However, significant inconsistencies exist in the selection criteria of patients and controls between studies. The meta-analysis of VNTR in intron 4 was performed on five studies (894 patients, 944 controls), whereas the meta-analysis of +894 G/T SNP included six studies (1111 patients, 1121 controls). The association with IRSA was significant for the +894 G/T SNP under the dominant genetic model (GT+TT versus GG) based on fixed (odds ratio (OR) = 1.54, 95% confidence interval (CI) = 1.28-1.86, P = <0.01) and random effects models (OR = 1.54, 95% CI = 1.03-2.31, P = 0.03). In conclusion, the GT and TT genotypes of the +894 G/T SNP in women might contribute to a predisposition to IRSA. Additional genetic association and functional studies in different populations with larger numbers of participants and a

  4. Gene cloning, structural gene and promoter identification, and active assay of the phosphatidylcholine synthase of Pseudomonas sp. strain 593.

    Science.gov (United States)

    He, Huoguang; Wu, Bin; Xiong, Min; Li, Yang; Wu, Wenhua; Wang, Xingguo

    2011-10-01

    Pseudomonas sp. strain 593, a soil bacterium, is able to use exogenous choline to synthesize phosphatidylcholine via phosphatidylcholine synthase (Pcs). A 2020 bp DNA fragment that hybridized to a Pcs probe was cloned. This fragment contained a large open reading frame (ORF) with two potential ATG start sites that would encode for 293 and 231 amino acid proteins. Fragments containing the two ORFs encoded Pcs when they were inserted into the expression vector pET23a and expressed under the control of the T7 promoter in Escherichia coli BL21(DE3) pLysS. However, when the two ORFs were inserted into the cloning vector pMD18-T and expressed without control of the plasmid promoter in E. coli DH5α, only the larger clone exhibited Pcs activity. This suggested that the larger fragment contained a native promoter driving expression of the smaller ORF. A promoter activity assay, in which DNA fragments were inserted into the promoter-probe plasmid pCB182 and β-galactosidase activity of E. coli transformants was tested, demonstrated that a promoter is indeed present in the DNA region. All results together indicate that the 696 bp ORF, not the larger 897 bp ORF, encodes the Pcs in Pseudomonas sp. strain 593 and carries a promoter in front of its 5' terminus. PMID:21939372

  5. Mutant dihydrofolate reductase-thymidylate synthase genes in pyrimethamine-resistant Plasmodium falciparum with polymorphic chromosome duplications.

    Science.gov (United States)

    Tanaka, M; Gu, H M; Bzik, D J; Li, W B; Inselburg, J

    1990-08-01

    We have identified dihydrofolate reductase (DHFR) gene point mutations and chromosomal changes in pyrimethamine-resistant mutants selected in vitro of Plasmodium falciparum strain FCR3. A pyrimethamine-resistant derivative of the pyrimethamine-sensitive strain FCR3, FCR3-D8, that had been grown in the absence of pyrimethamine for an extended time, was grown in two concentrations of pyrimethamine, and surviving drug-resistant parasites were subcloned. One selected mutant, FCR3-D81, that grew at 1 X 10(-6) M pyrimethamine, contained a single point mutation in the DHFR domain which caused an amino acid change (Phe to Ser) at amino acid 223, whereas another mutant, FCR3-D85, that grew at 5 X 10(-6) M pyrimethamine had that same mutation and an additional point mutation that changed amino acid 54 (Asp to Asn). The selection of FCR3-D85, whose nucleotide sequence was identical to that previously reported for FCR3-D8, confirmed that the original FCR3-D8 parasite population had changed during extended growth in vitro in the absence of drug pressure. FCR3-D81 and FCR3-D85 cells contained different pairs of polymorphic chromosomes that hybridized to a DHFR-TS probe as well as to three other chromosome 4 specific DNAs, indicating that at least part of chromosome 4 had been duplicated and that these parasites were aneuploid with 15 rather than 14 chromosomes. The mutant DHFR-TS genes were diploid. We consider the roles of the polymorphic chromosome duplications and DHFR point mutation(s) as causes of pyrimethamine resistance. PMID:2233901

  6. A cluster of three genes (dapA, orf2, and dapB) of Brevibacterium lactofermentum encodes dihydrodipicolinate synthase, dihydrodipicolinate reductase, and a third polypeptide of unknown function.

    OpenAIRE

    Pisabarro, A; Malumbres, M; Mateos, L M; Oguiza, J A; Martín, J F

    1993-01-01

    The dapA and dapB genes, encoding, respectively, dihydrodipicolinate synthase and dihydrodipicolinate reductase, the two first enzymes of the lysine branch of the aspartic amino acid family, were cloned from the DNA of the amino acid-producing bacterium Brevibacterium lactofermentum. The two genes were clustered in a 3.5-kb Sau3AI-BamHI fragment but were separated by an open reading frame of 750 nucleotides. The protein encoded by this open reading frame had little similarity to any protein i...

  7. Optional exon in the 5'-untranslated region of 3-hydroxy-3-methylglutaryl coenzyme A synthase gene: conserved sequence and splicing pattern in humans and hamsters

    International Nuclear Information System (INIS)

    3-Hydroxy-3-methylglutaryl coenzyme A synthase (hydroxymethylglutaryl-CoA synthase, EC 4.1.3.5) is a negatively regulated enzyme in the synthetic pathway for cholesterol, isopentenyl tRNA, and other isoprenoids. The 5'-untranslated region of the mRNA for Chinese hamster hydroxymethylglutaryl-CoA synthase contains an optional exon of 59 nucleotides located 10 nucleotides upstream of the translation start site. About 50% of the mRNAs contain this exon, and the other 50% lack it owing to differential intron splicing. The authors show that the two transcripts are found in similar ratios in multiple tissues of the Syrian hamster, including the brain. The relative amounts of the two transcripts in brain and liver are constant from day 0 to day 75 of life. A similar alternative splicing pattern for hydroxymethylglutaryl-CoA synthase was observed in three human tissues: cultured fibroblasts, fetal adrenal gland, and fetal liver. A cDNA for human synthase had 90% homology to the hamster sequence in the region corresponding to the optional exon. This sequence contains a 20 out of 26 nucleotide match with the sequence immediately upstream of the initiator AUG codon in the mRNA for hamster hydroxymethylglutaryl-CoA reductase, the enzyme that follows the synthase in the isoprenoid biosynthetic pathway. These findings raise the possibility that the optional exon plays an important, conserved functional role in humans and hamsters

  8. Cadmium tolerance and phytochelatin content of Arabidopsis seedlings over-expressing the phytochelatin synthase gene AtPCS1

    Science.gov (United States)

    Brunetti, Patrizia; Zanella, Letizia; Proia, Alessandra; De Paolis, Angelo; Falasca, Giuseppina; Altamura, Maria Maddalena; Sanità di Toppi, Luigi; Costantino, Paolo; Cardarelli, Maura

    2011-01-01

    Previous studies demonstrated that expression of the Arabidopsis phytochelatin (PC) biosynthetic gene AtPCS1 in Nicotiana tabacum plants increases the Cd tolerance in the presence of exogenous glutathione (GSH). In this paper, the Cd tolerance of Arabidopsis plants over-expressing AtPCS1 (AtPCSox lines) has been analysed and the differences between Arabidopsis and tobacco are shown. Based on the analysis of seedling fresh weight, primary root length, and alterations in root anatomy, evidence is provided that, at relatively low Cd concentrations, the Cd tolerance of AtPCSox lines is lower than the wild type, while AtPCS1 over-expressing tobacco is more tolerant to Cd than the wild type. At higher Cd concentrations, Arabidopsis AtPCSox seedlings are more tolerant to Cd than the wild type, while tobacco AtPCS1 seedlings are as sensitive as the wild type. Exogenous GSH, in contrast to what was observed in tobacco, did not increase the Cd tolerance of AtPCSox lines. The PC content in wild-type Arabidopsis at low Cd concentrations is more than three times higher than in tobacco and substantial differences were also found in the PC chain lengths. These data indicate that the differences in Cd tolerance and in its dependence on exogenous GSH between Arabidopsis and tobacco are due to species-specific differences in the endogenous content of PCs and GSH and may be in the relative abundance of PCs of different length. PMID:21841172

  9. Cadmium tolerance and phytochelatin content of Arabidopsis seedlings over-expressing the phytochelatin synthase gene AtPCS1.

    Science.gov (United States)

    Brunetti, Patrizia; Zanella, Letizia; Proia, Alessandra; De Paolis, Angelo; Falasca, Giuseppina; Altamura, Maria Maddalena; Sanità di Toppi, Luigi; Costantino, Paolo; Cardarelli, Maura

    2011-11-01

    Previous studies demonstrated that expression of the Arabidopsis phytochelatin (PC) biosynthetic gene AtPCS1 in Nicotiana tabacum plants increases the Cd tolerance in the presence of exogenous glutathione (GSH). In this paper, the Cd tolerance of Arabidopsis plants over-expressing AtPCS1 (AtPCSox lines) has been analysed and the differences between Arabidopsis and tobacco are shown. Based on the analysis of seedling fresh weight, primary root length, and alterations in root anatomy, evidence is provided that, at relatively low Cd concentrations, the Cd tolerance of AtPCSox lines is lower than the wild type, while AtPCS1 over-expressing tobacco is more tolerant to Cd than the wild type. At higher Cd concentrations, Arabidopsis AtPCSox seedlings are more tolerant to Cd than the wild type, while tobacco AtPCS1 seedlings are as sensitive as the wild type. Exogenous GSH, in contrast to what was observed in tobacco, did not increase the Cd tolerance of AtPCSox lines. The PC content in wild-type Arabidopsis at low Cd concentrations is more than three times higher than in tobacco and substantial differences were also found in the PC chain lengths. These data indicate that the differences in Cd tolerance and in its dependence on exogenous GSH between Arabidopsis and tobacco are due to species-specific differences in the endogenous content of PCs and GSH and may be in the relative abundance of PCs of different length. PMID:21841172

  10. Anaphylaxis related to fentanyl citrate

    Directory of Open Access Journals (Sweden)

    Gaurav Singh Tomar

    2012-01-01

    Full Text Available Anaphylaxis is a fulminant, unexpected, immunoglobulin E-mediated allergic reaction that can be triggered by multiple agents. Common causative agents include neuromuscular blocking drugs, latex, antibiotics, colloids, hypnotics, and opioids. Fentanyl citrate, however, is an extremely unusual cause of anaphylaxis. Pulmonary edema, although uncommon in anaphylaxis, can be a prominent feature, as was in one of the patient. An adverse drug reaction is a noxious or unintended reaction to a drug that is administered in standard doses by the proper route for the purpose of prophylaxis, diagnosis, or treatment. Reactions are classified into two major subtypes: type A, which are dose dependent and predictable; and type B, which are not dose dependent and unpredictable. Unpredictable reactions include immune (allergic or no immune drug hypersensitivity reactions and are related to genetic susceptibilities or undefined mechanisms (formally called idiosyncratic and intolerance reactions. A drug allergy is always associated with an immune mechanism for which evidence of drug-specific antibodies or activated T lymphocytes can be shown. In the last few years, many novel drugs have entered clinical practice (i.e., biologic agents generating novel patterns of drug hypersensitivity reactions. As old drugs continue to be used, new clinical and biologic techniques enable improvement in the diagnosis of these reactions.

  11. Mean platelet volume measurement, EDTA or citrate?

    Science.gov (United States)

    Dastjerdi, Mansour Siavash; Emami, Tajolmolouk; Najafian, Alireza; Amini, Masoud

    2006-10-01

    Most laboratories use EDTA for anticoagulation of whole blood prior to automated cell counting but due to platelet swelling, mean platelet volume (MPV) values may increase with its use. MPV changes may be less with acid citrate based anticoagulation. As MPV is a marker of platelet function and its precise measurement is important in a number of clinical situations, this study was performed to assess if EDTA and citrate based anticoagulated blood samples can be used interchangeably for MPV measurement. In this cross sectional descriptive study, EDTA and citrate based anticoagulated blood samples of the same patients were assessed by auto-analyzer within 1 h of sampling. In the 61 evaluated patients, there was a close correlation between MPV as measured by EDTA and citrate, but mean MPV measured from EDTA samples was 0.66 fL (9%) more than citrate. There was also a significant negative correlation between platelets count and MPV by both methods. The results of our study reveal that MPV can be measured accurately by both methods of anticoagulation; EDTA and citrate if analysis be performed within 1 h of sampling. PMID:17607580

  12. Versatile Enzyme Expression and Characterization System for Aspergillus nidulans, with the Penicillium brevicompactum Polyketide Synthase Gene from the Mycophenolic Acid Gene Cluster as a Test Case

    DEFF Research Database (Denmark)

    Hansen, Bjarne Gram; Salomonsen, Bo; Nielsen, Morten Thrane;

    2011-01-01

    Assigning functions to newly discovered genes constitutes one of the major challenges en route to fully exploiting the data becoming available from the genome sequencing initiatives. Heterologous expression in an appropriate host is central in functional genomics studies. In this context, filamen...

  13. Preliminary X-ray crystallographic analysis of 2-methylcitrate synthase from Salmonella typhimurium

    International Nuclear Information System (INIS)

    2-Methylcitrate synthase from S. typhimurium was cloned, overexpressed, purified and crystallized. The crystals diffracted X-rays to 2.4 Å resolution and belonged to the triclinic space group P1 (unit-cell parameters a = 92.068, b = 118.159, c = 120.659 Å, α = 60.84, β = 67.77, γ = 81.92°). Self-rotation function calculations suggested the presence of a putative decamer of protein subunits in the asymmetric unit. Analysis of the genomic sequences of Escherichia coli and Salmonella typhimurium has revealed the presence of several homologues of the well studied citrate synthase (CS). One of these homologues has been shown to code for 2-methylcitrate synthase (2-MCS) activity. 2-MCS catalyzes one of the steps in the 2-methylcitric acid cycle found in these organisms for the degradation of propionate to pyruvate and succinate. In the present work, the gene coding for 2-MCS from S. typhimurium (StPrpC) was cloned in pRSET-C vector and overexpressed in E. coli. The protein was purified to homogeneity using Ni–NTA affinity chromatography. The purified protein was crystallized using the microbatch-under-oil method. The StPrpC crystals diffracted X-rays to 2.4 Å resolution and belonged to the triclinic space group P1, with unit-cell parameters a = 92.068, b = 118.159, c = 120.659 Å, α = 60.84, β = 67.77, γ = 81.92°. Computation of rotation functions using the X-ray diffraction data shows that the protein is likely to be a decamer of identical subunits, unlike CSs, which are dimers or hexamers

  14. Adolescent and adult responsiveness to the incentive value of cocaine reward in mice: role of neuronal nitric oxide synthase (nNOS) gene.

    Science.gov (United States)

    Balda, Mara A; Anderson, Karen L; Itzhak, Yossef

    2006-08-01

    A major concern in adolescent psychostimulant abuse is the long-term consequence of this practice, because early drug exposure may cause long-term adaptations, which render the organism more susceptible to drug abuse later in life. The incentive value of drug and natural reward in rodents is commonly assessed by the conditioned place preference (CPP) paradigm, which involves Pavlovian learning. The aims of the present study were to investigate: a) the acquisition, expression, maintenance and reinstatement of cocaine CPP from periadolescence (PD24-45) through adulthood (PD70); b) potential sexual dimorphism in adolescence and adulthood in response to cocaine-induced CPP; and c) the role of the neuronal nitric oxide synthase (nNOS) gene in long-term neural plasticity underlying responsiveness to cocaine and cocaine-associated cues. Adolescent wild type (WT) mice acquired significant cocaine (20 mg/kg) CPP that was maintained from PD24 through PD43. Upon extinction, CPP was reinstated in adulthood (PD70) following a priming injection of cocaine (5 mg/kg). In contrast, cocaine CPP acquired between PD26 and PD31 in adolescent nNOS knockout (KO) mice, was neither maintained nor reinstated by cocaine. There was no sexual dimorphism in adolescent WT and KO mice. Genotype differences and sexual dimorphism were observed in adult mice. Cocaine CPP in adult WT males (PD89-94) was maintained for 4 weeks post training, and subsequently reinstated by cocaine priming; the magnitude of CPP in adult WT males was lower than in female counterparts. CPP in adult KO males (PD88-93) was neither maintained nor reinstated by cocaine priming; in contrast, CPP in adult KO females was not significantly different from adult WT females. Results suggest that the nNOS gene is essential during adolescence of both sexes for the development of long-term neural plasticity underlying responsiveness to the incentive value of cocaine reward. Sexual dimorphism in response to cocaine CPP emerges in

  15. Methylation affects transposition and splicing of a large CACTA transposon from a MYB transcription factor regulating anthocyanin synthase genes in soybean seed coats.

    Directory of Open Access Journals (Sweden)

    Gracia Zabala

    Full Text Available We determined the molecular basis of three soybean lines that vary in seed coat color at the R locus which is thought to encode a MYB transcription factor. RM55-r(m is homozygous for a mutable allele (r(m that specifies black and brown striped seeds; RM30-R* is a stable black revertant isoline derived from the mutable line; and RM38-r has brown seed coats due to a recessive r allele shown to translate a truncated MYB protein. Using long range PCR, 454 sequencing of amplicons, and whole genome re-sequencing, we determined that the variegated RM55-r(m line had a 13 kb CACTA subfamily transposon insertion (designated TgmR* at a position 110 bp from the beginning of Intron2 of the R locus, Glyma09g36983. Although the MYB encoded by R was expressed at only very low levels in older seed coats of the black revertant RM30-R* line, it upregulated expression of anthocyanidin synthase genes (ANS2, ANS3 to promote the synthesis of anthocyanins. Surprisingly, the RM30-R* revertant also carried the 13 kb TgmR* insertion in Intron2. Using RNA-Seq, we showed that intron splicing was accurate, albeit at lower levels, despite the presence of the 13 kb TgmR* element. As determined by whole genome methylation sequencing, we demonstrate that the TgmR* sequence was relatively more methylated in RM30-R* than in the mutable RM55-r(m progenitor line. The stabilized and more methylated RM30-R* revertant line apparently lacks effective binding of a transposae to its subterminal repeats, thus allowing intron splicing to proceed resulting in sufficient MYB protein to stimulate anthocyanin production and thus black seed coats. In this regard, the TgmR* element in soybean resembles McClintock's Spm-suppressible and change-of-state alleles of maize. This comparison explains the opposite effects of the TgmR* element on intron splicing of the MYB gene in which it resides depending on the methylation state of the element.

  16. Physical training prevents body weight gain but does not modify adipose tissue gene expression

    OpenAIRE

    T.S. Higa; Bergamo, F.C.; F. Mazzucatto; Fonseca-Alaniz, M.H.; F.S. Evangelista

    2012-01-01

    The relationship of body weight (BW) with white adipose tissue (WAT) mass and WAT gene expression pattern was investigated in mice submitted to physical training (PT). Adult male C57BL/6 mice were submitted to two 1.5-h daily swimming sessions (T, N = 18), 5 days/week for 4 weeks or maintained sedentary (S, N = 15). Citrate synthase activity increased significantly in the T group (P < 0.05). S mice had a substantial weight gain compared to T mice (4.06 ± 0.43 vs 0.38 ± 0.28 g, P < 0.01). WAT ...

  17. Biochemistry: Acetohydroxyacid Synthase

    Directory of Open Access Journals (Sweden)

    Pham Ngoc Chien

    2010-02-01

    Full Text Available Acetohydroxyacid synthase (AHAS, EC 2.2.1.6; formerly known as acetolactate synthase, ALS is a thiamin-and FAD-dependent enzyme which catalyses the first common step in the biosynthesis of the branched-chain amino acids (BCAA isoleucine, leucine and valine. The enzyme is inhibited by several commercial herbicides and has been studied over the last 20 to 30 years. A short introductory note about acetohydroxyacid synthase has been provided.

  18. Sodium bicarbonate and sodium citrate: ergogenic aids?

    Science.gov (United States)

    Requena, Bernardo; Zabala, Mikel; Padial, Paulino; Feriche, Belén

    2005-02-01

    Numerous studies have used exogenous administration of sodium bicarbonate (NaHCO(3)) and sodium citrate (Na-citrate) in an attempt to enhance human performance. After ingestion of NaHCO(3) and Na-citrate, two observations have been made: (a) There was great individual variability in the ergogenic benefit reached, which can be attributed to the level of physical conditioning of the subjects and to their tolerance of the buffer substance; and (b) the subjects who had ingested NaHCO(3) and Na-citrate show higher levels of pH, bicarbonate, and lactate ions concentrations in their exercising blood than do the subjects who had ingested the placebo. A majority of the studies have suggested that the ingestion of both substances provides an ergogenic effect due to the establishment and maintenance of an elevated pH level during exercise. However, the exact mechanism by which the ergogenic effects occur has not been demonstrated conclusively. Sodium bicarbonate and Na-citrate seem to be effective in activities with a sufficient duration to generate a difference in the hydrogen ion gradient, characterized by a very high intensity and involving large muscular groups. However, in activities of equally high intensity, but with longer duration, the results obtained have been conflicting and inconclusive. PMID:15705037

  19. Identification of Select Fumonisin Forming Fusarium Species Using PCR Applications of the Polyketide Synthase Gene and its Relationship to Fumonisin Production in vitro

    Directory of Open Access Journals (Sweden)

    Mary Scruggs

    2008-04-01

    Full Text Available A polymerase chain reaction (PCR based diagnostic assay was used to develop markers for detection of Fusarium verticillioides (=F. moniliforme, a fumonisin producing fungus in maize tissues. Species-specific primers were designed based on sequence data from the polyketide synthase (PKS gene (FUM1- previously FUM5 responsible for fumonisin production in fungi. Four sets of oligonucleotide primers were tested for their specificity using 24 strains of F. verticillioides, 10 F. proliferatum, and 12 of other Fusarium species. In addition, 13 species of other fungal genera, from four phyla, were tested as negative controls. Among the four sets, primer set B consistently amplified a 419- bp fragment from the DNA 96% of all F. verticillioides strains and 83% of F. proliferatum. All other fungi tested were negative using primer set B. A total of 38% of the F. verticillioides strains grown on a selective liquid medium produced fumonisin and 92% formed the toxin on standard rice medium. When fumonisin formed in culture, PCR assay using primer set B detected every strain of F. verticillioides, but only amplified 80% of F. proliferatum strains that produced the toxin. PCR detection was consistent at 100 pg/μl concentration of genomic DNA from 4 F. verticillioides strains, but varied at 10 pg/μl. Two duplicate greenhouse tests using artificially inoculated maize plants, had greater levels of F. verticillioides detected after re-evaluting using primer set B than from culturing of the tissues. The molecular protocols described in this study requires only 1 day for completion compared to approximately 10 days for cultural work and morphological determination. In conclusion, conventional PCR assay using primer set B provides a sensitive and accurate detection assay that can be used as a primary or secondary confirmation method for identification and occurrence of F. verticillioides within the maize tissues. However, studies using primer set B for

  20. Long-term memory of visually cued fear conditioning: roles of the neuronal nitric oxide synthase gene and cyclic AMP response element-binding protein.

    Science.gov (United States)

    Kelley, J B; Anderson, K L; Altmann, S L; Itzhak, Y

    2011-02-01

    Nitric oxide (NO) produced by neuronal nitric oxide synthase (nNOS) has a role in late-phase long-term potentiation (LTP) and long-term memory (LTM) formation. Our recent studies implicated NO signaling in contextual and auditory cued fear conditioning. The present study investigated the role of NO signaling in visually cued fear conditioning. First, visually cued fear conditioning was investigated in wild-type (WT) and nNOS knockout (KO) mice. Second, the effects of pharmacological modulators of NO signaling on the acquisition of visually cued fear conditioning were investigated. Third, plasma levels of corticosterone were measured to determine a relationship between physiological and behavioral responses to fear conditioning. Fourth, levels of extracellular signal-related kinase (ERK1/2) and cyclic AMP response element binding protein (CREB) phosphorylation, downstream of NO signaling, were determined in the amygdala as potential correlates of fear learning. Mice underwent single or multiple (4) spaced trainings that consisted of a visual cue (blinking light) paired with footshock. WT mice acquired cued and contextual LTM following single and multiple trainings. nNOS KO mice acquired neither cued nor contextual LTM following a single training; however, multiple trainings improved contextual but not cued LTM. The selective nNOS inhibitor S-methyl-thiocitrulline (SMTC) impaired cued and contextual LTM in WT mice. The NO donor molsidomine recovered contextual LTM but had no effect on cued LTM in nNOS KO mice. Re-exposure to the visual cue 24 h posttraining elicited freezing response and a marked increase in plasma corticosterone levels in WT but not nNOS KO mice. The expression of CREB phosphorylation (Ser-133) was significantly higher in naive nNOS KO mice than in WT counterparts, and pharmacological modulators of NO had significant effects on levels of CREB phosphorylation and expression. These findings suggest that visual cue-dependent LTM is impaired in nNOS KO

  1. Chlorobium tepidum mutant lacking bacteriochlorophyll c made by inactivation of the bchK gene, encoding bacteriochlorophyll c synthase

    DEFF Research Database (Denmark)

    Frigaard, Niels-Ulrik; Voigt, Ginny D; Bryant, Donald A

    2002-01-01

    The gene encoding bacteriochlorophyll (BChl) c synthase was identified by insertional inactivation in the photosynthetic green sulfur bacterium Chlorobium tepidum and was named bchK. The bchK mutant of C. tepidum was rusty-orange in color and completely lacked BChl c. Because of the absence of the...... found in the wild type, the bchK mutant should prove valuable for future analyses of the photosynthetic reaction center and of the roles of BChl a in photosynthesis in green bacteria. An evolutionary implication of our findings is that the photosynthetic ancestor of green sulfur bacteria could have...

  2. Co-expression of the carbamoyl-phosphate synthase 1 gene and its long non-coding RNA correlates with poor prognosis of patients with intrahepatic cholangiocarcinoma

    Science.gov (United States)

    MA, SEN-LIN; LI, AI-JUN; HU, ZHAO-YANG; SHANG, FU-SHENG; WU, MENG-CHAO

    2015-01-01

    The mechanisms leading to high rates of malignancy and recurrence of human intrahepatic cholangiocarcinoma (ICC) remain unclear. It is difficult to diagnose and assess the prognosis of patients with ICC in the clinic due to the lack of specific biomarkers. In addition, long non-coding RNAs (lncRNAs) have been reported to serve important roles in certain types of tumorigenesis however a role in ICC remains to be reported. The aim of the current study was to screen for genes and lncRNAs that are abnormally expressed in ICC and to investigate their biological and clinicopathological significance in ICC. The global gene and lncRNA expression profiles in ICC were measured using bioinformatics analysis. Carbamoyl-phosphate synthase 1 (CPS1) and its lncRNA CPS1 intronic transcript 1 (CPS1-IT1) were observed to be upregulated in ICC. The expression of CPS1 and CPS1-IT1 was measured in 31 tissue samples from patients with ICC and a number of cell lines. The effects of CPS1 and CPS1-IT1 on the proliferation and apoptosis of the ICC-9810 cell line were measured. In addition, the clinicopathological features and survival rates of patients with ICC with respect to the gene and lncRNA expression status were analyzed. CPS1 and CPS1-IT1 were co-upregulated in ICC tissues compared with non-cancerous tissues. Knockdown of CPS1 andor CPS1-IT1 reduced the proliferation and increased the apoptosis of ICC-9810 cells. Additionally, clinical analysis indicated that CPS1 and CPS1-IT1 were associated with poor liver function and reduced survival rates when the relative expression values were greater than 4 in cancer tissues. The comparisons between the high CPS1 expression group and the low expression group indicated significant differences in international normalized ratio (P=0.048), total protein (P=0.049), indirect bilirubin (P=0.025), alkaline phosphatase (P=0.003) and disease-free survival (P=0.034). In addition, there were differential trends in CA19-9 (P=0.068), globulin (P=0

  3. Vibrational study of tamoxifen citrate polymorphism

    Science.gov (United States)

    Gamberini, M. C.; Baraldi, C.; Tinti, A.; Palazzoli, F.; Ferioli, V.

    2007-09-01

    The trans isomer of ( Z)-2-[ p-(1,2-diphenyl-butenyl)phenoxy]- N, N-dimethyletylamine (tamoxifen) is well known for its endocrine activity as an antiestrogenic agent. Its citrate salt, a widely used pharmaceutical agent, appears in three main polymorphic forms, two of which are well known (I and II) and another form not yet well evidenced. A vibrational study has been conducted for identifying the two known polymorphic forms of tamoxifen citrate (I and II) and for characterising the other form (form III) examined in this study. Other techniques for the characterization of the different polymorphs, such as XRDP, have been used.

  4. Virus-Induced Gene Silencing-Based Functional Analyses Revealed the Involvement of Several Putative Trehalose-6-Phosphate Synthase/Phosphatase Genes in Disease Resistance against Botrytis cinerea and Pseudomonas syringae pv. tomato DC3000 in Tomato

    Science.gov (United States)

    Zhang, Huijuan; Hong, Yongbo; Huang, Lei; Liu, Shixia; Tian, Limei; Dai, Yi; Cao, Zhongye; Huang, Lihong; Li, Dayong; Song, Fengming

    2016-01-01

    Trehalose and its metabolism have been demonstrated to play important roles in control of plant growth, development, and stress responses. However, direct genetic evidence supporting the functions of trehalose and its metabolism in defense response against pathogens is lacking. In the present study, genome-wide characterization of putative trehalose-related genes identified 11 SlTPSs for trehalose-6-phosphate synthase, 8 SlTPPs for trehalose-6-phosphate phosphatase and one SlTRE1 for trehalase in tomato genome. Nine SlTPSs, 4 SlTPPs, and SlTRE1 were selected for functional analyses to explore their involvement in tomato disease resistance. Some selected SlTPSs, SlTPPs, and SlTRE1 responded with distinct expression induction patterns to Botrytis cinerea and Pseudomonas syringae pv. tomato (Pst) DC3000 as well as to defense signaling hormones (e.g., salicylic acid, jasmonic acid, and a precursor of ethylene). Virus-induced gene silencing-mediated silencing of SlTPS3, SlTPS4, or SlTPS7 led to deregulation of ROS accumulation and attenuated the expression of defense-related genes upon pathogen infection and thus deteriorated the resistance against B. cinerea or Pst DC3000. By contrast, silencing of SlTPS5 or SlTPP2 led to an increased expression of the defense-related genes upon pathogen infection and conferred an increased resistance against Pst DC3000. Silencing of SlTPS3, SlTPS4, SlTPS5, SlTPS7, or SlTPP2 affected trehalose level in tomato plants with or without infection of B. cinerea or Pst DC3000. These results demonstrate that SlTPS3, SlTPS4, SlTPS5, SlTPS7, and SlTPP2 play roles in resistance against B. cinerea and Pst DC3000, implying the importance of trehalose and tis metabolism in regulation of defense response against pathogens in tomato. PMID:27540389

  5. Crystallization and preliminary X-ray analysis of beta-alanine synthase from the yeast Saccharomyces kluyveri

    DEFF Research Database (Denmark)

    Dobritzsch, D.; Gojkovic, Zoran; Andersen, Birgit;

    2003-01-01

    In eukaryotes and some bacteria, the third step of reductive pyrimidine catabolism is catalyzed by beta-alanine synthase (EC 3.5.1.6). Crystals of the recombinant enzyme from the yeast Saccharomyces kluyveri were obtained using sodium citrate as a precipitant. The crystals belong to space group P...

  6. Endometrial Receptivity Markers in Mice Stimulated With Raloxifene Versus Clomiphene Citrate and Natural Cycles.

    Science.gov (United States)

    Chen, Cairong; Yan, Qiuxia; Liu, Kunping; Zhou, Xiuqin; Xian, Yingjie; Liang, Dali; Zhao, Xiaoying; Guo, Xiaoyan; Quan, Song

    2016-06-01

    Ovulation induction therapy with clomiphene citrate can suppress endometrial receptivity. Raloxifene may be an alternative therapeutic for women with ovulatory disorders. This study aimed to compare the expression of endometrial receptivity markers, including homeobox gene 10 (HOXA10), integrin β3, and leukemia inhibitory factor (LIF), as well as pinopode production during the implantation window in mice stimulated with raloxifene and clomiphene citrate and natural cycles. Thirty-six 8-week-old female Kunming mice were randomly divided into 3 groups (n = 12) and administered daily raloxifene (22 mg/kg), clomiphene citrate (18 mg/kg), and normal saline (1 mL), respectively, by gavage. Two days later, mice were injected with 5 IU human chorionic gonadotropin and mated. Successfully mated female animals were identified with vaginal plugs designated gestation day 1. At day 4.5, pregnant donor mice were euthanized, and uterus samples were collected for immunohistochemistry, quantitative polymerase chain reaction, Western blot, and scanning electron microscopy analyses. Homeobox gene 10, integrin β3, and LIF messenger RNA (mRNA) and protein levels were significantly higher in the raloxifene-treated animals compared with the clomiphene citrate group (all P raloxifene and saline groups; however, in the clomiphene citrate-treated mice, fewer and poorly developed pinopodes were obtained. In mice, raloxifene had no effect on HOXA10, integrin β3, and LIF expression as well as pinopode production, suggesting it has no adverse effects on endometrial receptivity. Raloxifene may provide a viable alternative oral ovulation induction agent to clomiphene citrate. PMID:26603317

  7. Physicochemical action of potassium-magnesium citrate in nephrolithiasis

    Science.gov (United States)

    Pak, C. Y.; Koenig, K.; Khan, R.; Haynes, S.; Padalino, P.

    1992-01-01

    Effect of potassium-magnesium citrate on urinary biochemistry and crystallization of stone-forming salts was compared with that of potassium citrate at same dose of potassium in five normal subjects and five patients with calcium nephrolithiasis. Compared to the placebo phase, urinary pH rose significantly from 6.06 +/- 0.27 to 6.48 +/- 0.36 (mean +/- SD, p less than 0.0167) during treatment with potassium citrate (50 mEq/day for 7 days) and to 6.68 +/- 0.31 during therapy with potassium-magnesium citrate (containing 49 mEq K, 24.5 mEq Mg, and 73.5 mEq citrate per day). Urinary pH was significantly higher during potassium-magnesium citrate than during potassium citrate therapy. Thus, the amount of undissociated uric acid declined from 118 +/- 61 mg/day during the placebo phase to 68 +/- 54 mg/day during potassium citrate treatment and, more prominently, to 41 +/- 46 mg/day during potassium-magnesium citrate therapy. Urinary magnesium rose significantly from 102 +/- 25 to 146 +/- 37 mg/day during potassium-magnesium citrate therapy but not during potassium citrate therapy. Urinary citrate rose more prominently during potassium-magnesium citrate therapy (to 1027 +/- 478 mg/day from 638 +/- 252 mg/day) than during potassium citrate treatment (to 932 +/- 297 mg/day). Consequently, urinary saturation (activity product) of calcium oxalate declined significantly (from 1.49 x 10(-8) to 1.03 x 10(-8) M2) during potassium-magnesium citrate therapy and marginally (to 1.14 x 10(-8) M2) during potassium citrate therapy.(ABSTRACT TRUNCATED AT 250 WORDS).

  8. 21 CFR 184.1195 - Calcium citrate.

    Science.gov (United States)

    2010-04-01

    ... Food Chemicals Codex, 3d ed. (1981), pp. 49 and 50, which is incorporated by reference in accordance with 5 U.S.C. 552(a) and 1 CFR part 51. Copies are available from the National Academy Press, 2101... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Calcium citrate. 184.1195 Section 184.1195 Food...

  9. 21 CFR 184.1625 - Potassium citrate.

    Science.gov (United States)

    2010-04-01

    .... (b) The ingredient meets the specifications of the Food Chemicals Codex, 3d ed. (1981), p. 242, which is incorporated by reference in accordance with 5 U.S.C. 552(a) and 1 CFR part 51. Copies are... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Potassium citrate. 184.1625 Section 184.1625...

  10. 21 CFR 184.1751 - Sodium citrate.

    Science.gov (United States)

    2010-04-01

    ...) The ingredient meets the specifications of the Food Chemicals Codex, 3d ed. (1981), pp. 283-284, which is incorporated by reference in accordance with 5 U.S.C. 552(a) and 1 CFR part 51. Copies are... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Sodium citrate. 184.1751 Section 184.1751 Food...

  11. 14 N NQR spectrum of sildenafil citrate

    Science.gov (United States)

    Stephenson, David; Singh, Nadia

    2015-04-01

    The 14N nuclear quadrupole resonance (NQR) spectrum of sildenafil citrate tablets has been recorded allowing the quadrupole coupling constants and asymmetry parameters of all six unique nitrogen atoms in its structure to be determined. A density function calculation gives results that are largely in agreement with the experimental values.

  12. 14N NQR spectrum of sildenafil citrate

    International Nuclear Information System (INIS)

    The 14N nuclear quadrupole resonance (NQR) spectrum of sildenafil citrate tablets has been recorded allowing the quadrupole coupling constants and asymmetry parameters of all six unique nitrogen atoms in its structure to be determined. A density function calculation gives results that are largely in agreement with the experimental values

  13. Trans-chalcone and quercetin down-regulate fatty acid synthase gene expression and reduce ergosterol content in the human pathogenic dermatophyte Trichophyton rubrum

    OpenAIRE

    Bitencourt, Tamires Aparecida; Komoto, Tatiana Takahasi; Massaroto, Bruna Gabriele; Miranda, Carlos Eduardo Saraiva; Beleboni, Rene Oliveira; Marins, Mozart; Fachin, Ana Lúcia

    2013-01-01

    Background Fatty acid synthase (FAS) is a promising antifungal target due to its marked structural differences between fungal and mammalian cells. The aim of this study was to evaluate the antifungal activity of flavonoids described in the scientific literature as FAS inhibitors (quercetin, trans-chalcone, ellagic acid, luteolin, galangin, and genistein) against the dermatophyte Trichophyton rubrum and their effects on fatty acid and ergosterol synthesis. Methods The antifungal activity of th...

  14. 21 CFR 522.800 - Droperidol and fentanyl citrate injection.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Droperidol and fentanyl citrate injection. 522.800... § 522.800 Droperidol and fentanyl citrate injection. (a) Specifications. Droperidol and fentanyl citrate injection is a sterile solution containing 20 milligrams of droperidol and 0.4 milligram of fentanyl...

  15. 21 CFR 172.370 - Iron-choline citrate complex.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Iron-choline citrate complex. 172.370 Section 172... CONSUMPTION Special Dietary and Nutritional Additives § 172.370 Iron-choline citrate complex. Iron-choline citrate complex made by reacting approximately equimolecular quantities of ferric hydroxide, choline,...

  16. 21 CFR 573.580 - Iron-choline citrate complex.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Iron-choline citrate complex. 573.580 Section 573.580 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED... Food Additive Listing § 573.580 Iron-choline citrate complex. Iron-choline citrate complex made...

  17. Ventricular tachycardia after administration of sildenafil citrate: a case report

    Directory of Open Access Journals (Sweden)

    Rasmussen Jeppe G

    2007-08-01

    Full Text Available Abstract Background It has not previously been reported that sildenafil citrate causes malignant arrhythmias in humans. Case presentation A 41-year-old man developed sustained ventricular tachycardia following sildenafil citrate administration. Conclusion It cannot be dismissed that this patient experienced ventricular tachycardia as an adverse effect of sildenafil citrate administration.

  18. Ventricular tachycardia after administration of sildenafil citrate: a case report

    OpenAIRE

    Rasmussen Jeppe G; Toft Egon; Frøbert Ole

    2007-01-01

    Abstract Background It has not previously been reported that sildenafil citrate causes malignant arrhythmias in humans. Case presentation A 41-year-old man developed sustained ventricular tachycardia following sildenafil citrate administration. Conclusion It cannot be dismissed that this patient experienced ventricular tachycardia as an adverse effect of sildenafil citrate administration.

  19. Mapping of the genes encoding human inducible and endothelial nitrix oxide synthase (NOS2 and NOS3) to the pericentric region of chromosome 17 and to chromosome 7, respectively

    Energy Technology Data Exchange (ETDEWEB)

    Xu, W.; Liu, L.; Emson, P. (Babraham Institute, Cambridge (United Kingdom)); Charles, I.G.; Moncada, S. (Wellcome Research Labs., Kent (United Kingdom)); Gorman, P.; Sheer, D. (Imperial Cancer Research Fund, London (United Kingdom))

    1994-05-15

    Nitric oxide (NO) is an important molecular messenger regulating the functions of a wide variety of cells and tissues. NO is synthesized from L-arginine by a variety of isoforms of the enzyme nitric oxide synthase (NOS). The authors have used Southern blotting analysis on DNAs obtained from a panel of human-rodent hybrid cell lines to map the gene encoding the inducible NOS (NOS2) to chromosome 17cen-17q11 and the gene encoding the endothelial form of NOS (NOS3) to chromosome 7. Fluorescence in situ hybridization using a NOS2 probe gave several signals in the 17p11-q11 pericentromeric region. 10 refs., 2 figs., 1 tab.

  20. 百合花青素苷合成酶基因片段的克隆及表达分析%Molecular Cloning and Expression Analysis of Anthocyanidin Synthase Gene Fragment in Lilium

    Institute of Scientific and Technical Information of China (English)

    王瑜; 崔金腾; 张克中; 贾月慧

    2013-01-01

    In order to obtain anthocyanidin synthase (ANS) gene from Lilium. degenerate primers were designed based on sequences blast of ANS genes from other species, and the fragment of ANS gene in Lilium was cloned by homology cloning method. The gene fragment was 701 bp encoding 233 amino acid proteins. Sequence alignment revealed that, the deduced amino acid sequence was 86%, 81% and 77% identical to Tulipa gesnerian, Iris hollandica and Prunus avium, respectively. The ANS expressed at different levels with the highest in petal, the second in leaf and stem. However, there' s no expression in bulb. ANS fragment was successfully cloned from Lilium through this research. This lays a solid foundation for cloning the full length cDNA sequence.%为了克隆百合花青素苷合成酶基因(anthocyanidin synthase,ANS),通过已报道的其他物种的ANS基因保守序列设计简并引物,采用同源克隆的方法成功克隆得到了百合ANS基因片段,该片段长701 bp,编码233个氨基酸残基.根据蛋白比对结果,百合ANS基因编码的氨基酸序列与郁金香、荷兰鸢尾、甜樱桃的一致性分别为86%、81%、77%.采用半定量RT-PCR法分析表明,该基因在百合花瓣中的表达水平最高,叶和茎次之,鳞茎中不表达.本研究从百合中分离得到了ANS基因片段,为后续获得基因全长打下了基础.

  1. Genetic organization of the cellulose synthase operon in Acetobacter xylinum.

    OpenAIRE

    Wong, H C; Fear, A L; Calhoon, R D; Eichinger, G H; Mayer, R; Amikam, D; Benziman, M; Gelfand, D H; Meade, J H; Emerick, A W

    1990-01-01

    An operon encoding four proteins required for bacterial cellulose biosynthesis (bcs) in Acetobacter xylinum was isolated via genetic complementation with strains lacking cellulose synthase activity. Nucleotide sequence analysis indicated that the cellulose synthase operon is 9217 base pairs long and consists of four genes. The four genes--bcsA, bcsB, bcsC, and bcsD--appear to be translationally coupled and transcribed as a polycistronic mRNA with an initiation site 97 bases upstream of the co...

  2. Citrate Anticoagulation for CRRT in Children: Comparison with Heparin

    Directory of Open Access Journals (Sweden)

    Sara Nicole Fernández

    2014-01-01

    Full Text Available Regional anticoagulation with citrate is an alternative to heparin in continuous renal replacement therapies, which may prolong circuit lifetime and decrease hemorrhagic complications. A retrospective comparative cohort study based on a prospective observational registry was conducted including critically ill children undergoing CRRT. Efficacy, measured as circuit survival, and secondary effects of heparin and citrate were compared. 12 patients on CRRT with citrate anticoagulation and 24 patients with heparin anticoagulation were analyzed. Median citrate dose was 2.6 mmol/L. Median calcium dose was 0.16 mEq/kg/h. Median heparin dose was 15 UI/kg/h. Median circuit survival was 48 hours with citrate and 31 hours with heparin (P=0.028. 66.6% of patients treated with citrate developed mild metabolic alkalosis, which was directly related to citrate dose. There were no cases of citrate intoxication: median total calcium/ionic calcium index (CaT/I of 2.16 and a maximum CaT/I of 2.33, without metabolic acidosis. In the citrate group, 45.5% of patients developed hypochloremia and 27.3% hypomagnesemia. In the heparin group, 27.8% developed hypophosphatemia. Three patients were moved from heparin to citrate to control postoperatory bleeding. In conclusion citrate is a safe and effective anticoagulation method for CRRT in children and it achieves longer circuit survival than heparin.

  3. Citrate Anticoagulation for CRRT in Children: Comparison with Heparin

    Science.gov (United States)

    Fernández, Sara Nicole; Santiago, Maria José; López-Herce, Jesús; García, Miriam; Del Castillo, Jimena; Alcaraz, Andrés José; Bellón, Jose María

    2014-01-01

    Regional anticoagulation with citrate is an alternative to heparin in continuous renal replacement therapies, which may prolong circuit lifetime and decrease hemorrhagic complications. A retrospective comparative cohort study based on a prospective observational registry was conducted including critically ill children undergoing CRRT. Efficacy, measured as circuit survival, and secondary effects of heparin and citrate were compared. 12 patients on CRRT with citrate anticoagulation and 24 patients with heparin anticoagulation were analyzed. Median citrate dose was 2.6 mmol/L. Median calcium dose was 0.16 mEq/kg/h. Median heparin dose was 15 UI/kg/h. Median circuit survival was 48 hours with citrate and 31 hours with heparin (P = 0.028). 66.6% of patients treated with citrate developed mild metabolic alkalosis, which was directly related to citrate dose. There were no cases of citrate intoxication: median total calcium/ionic calcium index (CaT/I) of 2.16 and a maximum CaT/I of 2.33, without metabolic acidosis. In the citrate group, 45.5% of patients developed hypochloremia and 27.3% hypomagnesemia. In the heparin group, 27.8% developed hypophosphatemia. Three patients were moved from heparin to citrate to control postoperatory bleeding. In conclusion citrate is a safe and effective anticoagulation method for CRRT in children and it achieves longer circuit survival than heparin. PMID:25157369

  4. Genetic polymorphisms in vitamin D receptor, vitamin D-binding protein, Toll-like receptor 2, nitric oxide synthase 2, and interferon-γ genes and its association with susceptibility to tuberculosis

    Directory of Open Access Journals (Sweden)

    A.C.C.S. Leandro

    2009-04-01

    Full Text Available Mycobacterium tuberculosis kills more people than any other single pathogen, with an estimated one-third of the world's population being infected. Among those infected, only 10% will develop the disease. There are several demonstrations that susceptibility to tuberculosis is linked to host genetic factors in twins, family and associated-based case control studies. In the past years, there has been dramatic improvement in our understanding of the role of innate and adaptive immunity in the human host defense to tuberculosis. To date, attention has been paid to the role of genetic host and parasitic factors in tuberculosis pathogenesis mainly regarding innate and adaptive immune responses and their complex interactions. Many studies have focused on the candidate genes for tuberculosis susceptibility ranging from those expressed in several cells from the innate or adaptive immune system such as Toll-like receptors, cytokines (TNF-α, TGF-β, IFN-γ, IL-1b, IL-1RA, IL-12, IL-10, nitric oxide synthase and vitamin D, both nuclear receptors and their carrier, the vitamin D-binding protein (VDBP. The identification of possible genes that can promote resistance or susceptibility to tuberculosis could be the first step to understanding disease pathogenesis and can help to identify new tools for treatment and vaccine development. Thus, in this mini-review, we summarize the current state of investigation on some of the genetic determinants, such as the candidate polymorphisms of vitamin D, VDBP, Toll-like receptor, nitric oxide synthase 2 and interferon-γ genes, to generate resistance or susceptibility to M. tuberculosis infection.

  5. Identification of a 467 bp Promoter of Maize Phosphatidylinositol Synthase Gene (ZmPIS) Which Confers High-Level Gene Expression and Salinity or Osmotic Stress Inducibility in Transgenic Tobacco

    Science.gov (United States)

    Zhang, Hongli; Hou, Jiajia; Jiang, Pingping; Qi, Shoumei; Xu, Changzheng; He, Qiuxia; Ding, Zhaohua; Wang, Zhiwu; Zhang, Kewei; Li, Kunpeng

    2016-01-01

    Salinity and drought often affect plant growth and crop yields. Cloning and identification of salinity and drought stress inducible promoters is of great significance for their use in the genetic improvement of crop resistance. Previous studies showed that phosphatidylinositol synthase is involved in plant salinity and drought stress responses but its promoter has not been characterized by far. In the study, the promoter (pZmPIS, 1834 bp upstream region of the translation initiation site) was isolated from maize genome. To functionally validate the promoter, eight 5′ deletion fragments of pZmPIS in different lengths were fused to GUS to produce pZmPIS::GUS constructs and transformed into tobacco, namely PZ1–PZ8. The transcription activity and expression pattern obviously changed when the promoter was truncated. Previous studies have demonstrated that NaCl and PEG treatments are usually used to simulate salinity and drought treatments. The results showed that PZ1–PZ7 can respond well upon NaCl and PEG treatments, while PZ8 not. PZ7 (467 bp) displayed the highest transcription activity in all tissues of transgenic tobacco amongst 5′ deleted promoter fragments, which corresponds to about 20 and 50% of CaMV35S under normal and NaCl or PEG treatment, respectively. This implied that PZ7 is the core region of pZmPIS which confers high-level gene expression and NaCl or PEG inducible nature. The 113 bp segment between PZ7 and PZ8 (-467 to -355 bp) was considered as the key sequence for ZmPIS responding to NaCl or PEG treatment. GUS transient assay in tobacco leaves showed that this segment was sufficient for the NaCl or PEG stress response. Bioinformatic analysis revealed that the 113 bp sequence may contain new elements that are crucial for ZmPIS response to NaCl or PEG stress. These results promote our understanding on transcriptional regulation mechanism of ZmPIS and the characterized PZ7 promoter fragment would be an ideal candidate for the overexpression of

  6. Targeted isolation, sequence assembly and characterization of two white spruce (Picea glauca BAC clones for terpenoid synthase and cytochrome P450 genes involved in conifer defence reveal insights into a conifer genome

    Directory of Open Access Journals (Sweden)

    Ritland Carol

    2009-08-01

    Full Text Available Abstract Background Conifers are a large group of gymnosperm trees which are separated from the angiosperms by more than 300 million years of independent evolution. Conifer genomes are extremely large and contain considerable amounts of repetitive DNA. Currently, conifer sequence resources exist predominantly as expressed sequence tags (ESTs and full-length (FLcDNAs. There is no genome sequence available for a conifer or any other gymnosperm. Conifer defence-related genes often group into large families with closely related members. The goals of this study are to assess the feasibility of targeted isolation and sequence assembly of conifer BAC clones containing specific genes from two large gene families, and to characterize large segments of genomic DNA sequence for the first time from a conifer. Results We used a PCR-based approach to identify BAC clones for two target genes, a terpene synthase (3-carene synthase; 3CAR and a cytochrome P450 (CYP720B4 from a non-arrayed genomic BAC library of white spruce (Picea glauca. Shotgun genomic fragments isolated from the BAC clones were sequenced to a depth of 15.6- and 16.0-fold coverage, respectively. Assembly and manual curation yielded sequence scaffolds of 172 kbp (3CAR and 94 kbp (CYP720B4 long. Inspection of the genomic sequences revealed the intron-exon structures, the putative promoter regions and putative cis-regulatory elements of these genes. Sequences related to transposable elements (TEs, high complexity repeats and simple repeats were prevalent and comprised approximately 40% of the sequenced genomic DNA. An in silico simulation of the effect of sequencing depth on the quality of the sequence assembly provides direction for future efforts of conifer genome sequencing. Conclusion We report the first targeted cloning, sequencing, assembly, and annotation of large segments of genomic DNA from a conifer. We demonstrate that genomic BAC clones for individual members of multi-member gene

  7. Pyrolytic citrate synthesis and ozone annealing

    International Nuclear Information System (INIS)

    A pyrolytic procedure is described that via a citrate synthesis allowed us to obtain very fine grained YBCO powders that, after a first furnace thermal treatment in ozone, results already to contain a large amount of superconducting microcrystals. A second identical thermal treatment gives a final product strongly textured, as shown by magnetic torque measurements. Complementary structural and diamagnetic measurement show the high quality of these sintered pellets. The role covered by both the pyrolytic preparation and the ozone annealing are discussed

  8. Pyrolitic citrate synthesis and ozone annealing

    International Nuclear Information System (INIS)

    A pyrolytic procedure that via a citrate synthesis allowed to obtain very fine grained YBCO powders that, after a first furnace thermal treatment in ozone, result already to contain a large amount of superconducting microcystals is described. A second identical thermal treatment gives a final product strongly textured, as shown by magnetic torque measurements. Complementary structural and diamagnetic measurements show the high quality of these sintered pellets. The role covered by both the pyrolytic preparation and the ozone annealing are discussed

  9. Photodynamical Properties of Various Phthalocyanine Citrates

    Czech Academy of Sciences Publication Activity Database

    Drobek, M.; Klusoň, Petr; Hejda, S.; Krýsa, J.; Rakušan, J.

    Prague: ICT Prague Press, 2010 - (Krýsa, J.), s. 68 ISBN 978-80-7080-750-7. [European Meeting on Solar Chemistry and Photocatalysis: Environmental Applications /6./. Prague (CZ), 13.06.2010-16.06.2010] R&D Projects: GA AV ČR KAN400720701; GA MŠk 1M0577 Institutional research plan: CEZ:AV0Z40720504 Keywords : phthalocyanine citrates * photodynamical properties Subject RIV: CA - Inorganic Chemistry

  10. Sildenafil Citrate in Fetal Growth Restriction

    OpenAIRE

    Panda, Subrat; Das, Ananya; Md Nowroz, Hossain

    2014-01-01

    Background Pregnancies with early onset fetal growth restriction have poor perinatal outcome. Sildenafil citrate (PDE -5 inhibitor) as a vasodilator increases utero-placental blood flow and potentiates fetal growth. Case Presentation In this study, a case was examined and Sildenafil was administered for her. It was found that Sildenafil improved the uterine blood flow with a favorable fetal outcome at delivery. Conclusion Sildenafil, as a vasodilator has emerged as a potential management opti...

  11. Functional analysis of the citrate activator CitO from Enterococcus faecalis implicates a divalent metal in ligand binding

    Directory of Open Access Journals (Sweden)

    Victor S. Blancato

    2016-02-01

    Full Text Available The regulator of citrate metabolism, CitO, from Enterococcus faecalis belongs to the FCD family within the GntR superfamily. In the presence of citrate, CitO binds to cis-acting sequences located upstream of the cit promoters inducing the expression of genes involved in citrate utilization. The quantification of the molecular binding affinities, performed by isothermal titration calorimetry (ITC, indicated that CitO has a high affinity for citrate (KD= 1.2±0.2 µM, while it did not recognize other metabolic intermediates. Based on a structural model of CitO where a putative small molecule and a metal binding site were identified, it was hypothesized that the metal ion is required for citrate binding. In agreement with this model, citrate binding to CitO sharply decreased when the protein was incubated with EDTA. This effect was reverted by the addition of Ni2+, and Zn2+ to a lesser extent. Structure-based site-directed mutagenesis was conducted and it was found that changes to alanine in residues Arg97 and His191 resulted in decreased binding affinities for citrate, as determined by EMSA and ITC. Further assays using lacZ fusions confirmed that these residues in CitO are involved in sensing citrate in vivo. These results indicate that the molecular modifications induced by a ligand and a metal binding in the C-terminal domain of CitO are required for optimal DNA binding activity, and consequently, transcriptional activation.

  12. Cloning of cycloartenol synthase gene from Eleutherococcus senticosus and its expression analysis%刺五加环阿屯醇合酶基因的克隆及其表达分析

    Institute of Scientific and Technical Information of China (English)

    邢朝斌; 龙月红; 吴鹏; 何闪; 朱金丽; 李宝财

    2012-01-01

    目的 克隆刺五加的环阿屯醇合酶(cycloartenol synthase,CAS)基因,并对其进行生物信息学和表达分析.方法 采用cDNA末端快速扩增(rapid amplification of cDNA ends,RACE)技术克隆刺五加CAS基因的全长cDNA序列.运用生物信息学方法对该基因进行分析,预测其编码蛋白的结构与功能,并通过RT-PCR法检测CAS在不同生长发育时期和不同器官中的表达情况.结果 刺五加CAS基因的cDNA全长为2758bp,开放阅读框长2 277 bp,编码758个氨基酸的蛋白,包含三萜合成酶的标志性序列.CAS蛋白无跨膜区域,定位于细胞质中.RT-PCR的结果显示,刺五加CAS基因在各时期和器官中均有表达,但表达量具有显著差异(P<0.05).其中果实基本成熟期的表达量最高,是最低量萌芽期的1.56倍,各器官中,叶片的表达量最高,是最低量叶柄的1.37倍.结论 首次分离并报道了刺五加的CAS cDNA克隆,并证实其在不同生长发育时期和不同器官中的表达量不同,为进一步研究CAS对刺五加皂苷量的影响和表达调控奠定基础.%Objective To clone cycloartenol synthase (CAS) gene from Eleutherococcus senticosus and analyze its bioinformatics and expression. Methods CAS gene full length cDNA was cloned by rapid amplification of cDNA ends (RACE). CAS gene was analyzed by bioinformatics method, and the structure and function of CAS gene were deduced. The expression of CAS in different organs of E.senticosus at various growing periods was detected by RT-PCR. Results The full length of CAS gene cDNA was 2 758 bp containing a 2 277 bp open reading frame (ORF) that encoded a protein of 758 amino acids includinng triterpene synthase signature sequence. Without transmembrane domain, CAS gene was located in cytoplasm. RT-PCR result showed that CAS gene expressed in different organs of E. senticosus at various growing periods showed significant difference (P < 0.05). The highest content of the expression showed up when the

  13. CSD2, CSD3, and CSD4, genes required for chitin synthesis in Saccharomyces cerevisiae: the CSD2 gene product is related to chitin synthases and to developmentally regulated proteins in Rhizobium species and Xenopus laevis.

    OpenAIRE

    Bulawa, C E

    1992-01-01

    In Saccharomyces cerevisiae, chitin forms the primary division septum and the bud scar in the walls of vegetative cells. Three chitin synthetic activities have been detected. Two of them, chitin synthase I and chitin synthase II, are not required for synthesis of most of the chitin present in vivo. Using a novel screen, I have identified three mutations, designated csd2, csd3, and csd4, that reduce levels of chitin in vivo by as much as 10-fold without causing any obvious perturbation of cell...

  14. 番茄查尔酮合成酶基因的鉴定及生物信息学分析%Identification and Bioinformatics Analysis of Chalcone Synthase Genes in Tomato

    Institute of Scientific and Technical Information of China (English)

    阮美颖; 杨悦俭; 万红建; 叶青静; 王荣青; 姚祝平; 周国治; 俞锞; 袁伟; 刘云飞

    2013-01-01

      类黄酮(Flavonoids)是植物体内一类重要的次生代谢产物,它以结合态(黄酮苷)或自由态(黄酮苷元)形式存在于水果、蔬菜、豆类和茶叶等许多植物中,对植物的生长发育有着重要的调节作用。查尔酮合成酶(Chalcone synthase, CHS, EC2.3.1.74)是植物类黄酮合成途径的第一个关键酶,在调控类黄酮的生物合成以及类黄酮的成分起着决定作用。本研究基于番茄全基因组测序数据,利用生物信息学方法,鉴定了查尔酮合成酶基因家族成员,分析其内含子-外显子的结构特征、系统发育关系,序列结构的保守性以及染色体上的分布。研究表明:查尔酮合成酶(SlCHS)是含有8个成员的多家族基因,蛋白质序列编码位于160(SlCHS05)~438(SlCHS08)个氨基酸之间;相似性在33.7%(SlCHS02和SlCHS06)~92.0%(SlCHS04和SlCHS07)之间,表明这些序列之间具有较高的遗传多样性;此外,结构分析发现这些基因均含有较少的内含子(0~2个);序列比对表明这些基因具有较高的保守性;它们不均匀分布在番茄的1、5、6、9和12号染色体上。该研究不仅有助于未来了解该基因家族的进化起源提供参考,而且可为我们进一步分析该基因家族成员的功能奠定基础。%Flavonoids are a kind of important secondary metabolites in plants. Usually, it was found in fruits, vegetables, beans, tea and many other plants as combination (flavonoid glycosides) or free states (flavonoid glyco-sides) form. It has important role in regulating plant growth and development. Chalcone synthase, the first key synthase during the process of flavonoids synthesis, plays an important role in plant growth and development. Based on the whole tomato genome sequence, we investigated gene members of the chalcone synthase family with genome database and bioinformatics analysis. We identified 8 chalcone synthase genes with protein sequence length varying

  15. Characterization of cultivar differences in alcohol acyltransferase and 1-aminocyclopropane-1carboxylate synthase gene expression and volatile compound emission during apple fruit maturation and ripening

    Science.gov (United States)

    Alcohol acyl transferase (AAT) catalyzes the last step of volatile ester biosynthesis, and ethylene purportedly regulates AAT gene expression. In this study, expession patterns of four apple AAT genes and two ethylene biosynthesis genes were investigated in two apple cultivars with relatively high ...

  16. Analyses of C-Reactive Protein, Endothelial Nitric Oxide Synthase and Interleukin-6 Gene Polymorphisms in Adolescents with a Family History of Premature Coronary Artery Disease: A Pilot Study

    Science.gov (United States)

    Çelik, Ataç; Özçetin, Mustafa; Ateş, Ömer; Altunkaş, Fatih; Karaman, Kayıhan; Akar, İlker; İnce, İlker; Yalçın, Murat; Karayakalı, Metin; Ceyhan, Köksal; Koç, Fatih

    2015-01-01

    Background: Family history of premature atherosclerosis imposes a high risk to people. The relationship between atherosclerosis and gene polymorphisms of various biomarkers such as Endothelial Nitric Oxide Synthase (eNOS), C-Reactive Protein (CRP), and Interleukin-6 (IL-6) has shown in previous studies. Aims: The major aim of the study was to evaluate the CRP, eNOS, and IL-6 gene polymorphisms in a group of adolescents who have a parental history of early coronary artery disease (CAD). Study Design: Case-control study. Methods: Thirty-six volunteers with a father with obstructive CAD during the first four decades and 46 subjects with a father with normal coronary arteries documented with coronary angiography were included in the study. Polymerase chain reaction-restriction fragment length polymorphism techniques were used to analyze CRP, eNOS, and IL-6 polymorphisms. Results: We did not find any differences between the two groups with regard to age, sex, body mass index, renal functions, systolic and diastolic blood pressures, lipid profile, and fasting glucose, hemoglobin, and high sensitivity CRP. A significant difference was only observed in IL-6-572 G/C genotype distribution and allele frequency between two groups (Pc=0.036 OR=3.48 CI (95%) 1.17–10.32). Conclusion: The present study showed a significant association between the IL-6-572 G/C gene polymorphism (presence of C allele) and adolescents with a parental history of premature CAD. PMID:26740900

  17. Urinary Citrate: A view in Chronic Renal Failure

    Directory of Open Access Journals (Sweden)

    SANTHOSH KUMAR.N

    2013-12-01

    Full Text Available Aim & Objective: To evaluate the 24 hour urinary citrate levels in chronic renal failure and healthy controls and to define the role of urinary citrates in the chronic renal failures. Materials and Methods: The 24 hours urinary citrates, Blood urea, Serum creatinine, Na+, K+were evaluated in 25 chronic renal failure patients and25 healthy subjects taken as controls. In both groups participants were on their usual diet. In addition, none of the participant was taking any drugs that could interfere with the citrate excretion. Results: The mean 24 hour urinary citrate excretion in patients and healthy controls was 296.3 ± 8.543mg and 323.9 ± 4.304mg respectively. Using previously defined values of normal urinary citrates as more than 320 mg.The difference in 24 hour urinary citrateexcretion in all patients and healthy control was statistically significant (

    citrate excretion in recurrent renal failures and healthy controls. Uniformly low citrate excretion in patients indicates that low citrate levels may be a feature seen in predisposing factor for renal failure

  18. Research progress on nitric oxide synthase gene polymorphisms on systemic diseases and periodontitis%一氧化氮合成酶基因多态性在全身性疾病及牙周炎中的研究进展

    Institute of Scientific and Technical Information of China (English)

    侯海娟; 张洁

    2011-01-01

    一氧化氮合成酶(NOS)可分为3种:神经原性、内皮性和诱生性,NOS基因多态性主要表现在内皮性NOS.本文主要探讨NOS基因多态性与心血管疾病、糖尿病、牙周炎的密切关系.%Three isoforms of nitricoxide synthase (NOS) have been identified: Neuronal form, endothelial form, and inducible form. Endothelial nitric oxide synthase polymorphism is one of the most common forms. This review examines the association nitric oxide synthase gene polymorphisms and diseases including cardiovascular disease, diabetes and periodontitis.

  19. Conjugated Linoleic Acid (CLA) inhibits expression of the Spot 14 (THRSP) and fatty acid synthase genes and impairs the growth of human breast cancer and liposarcoma cells

    OpenAIRE

    Donnelly, Christina; Olsen, Arne M.; Lewis, Lionel D; Eisenberg, Burton L.; Eastman, Alan; Kinlaw, William B

    2009-01-01

    Spot 14 (THRSP, S14) is a nuclear protein involved in the regulation of genes required for fatty acid synthesis in normal and malignant mammary epithelial and adipose cells. Havartine and Bauman reported that conjugated linoleic acid (CLA) inhibits S14 gene expression in bovine mammary and mouse adipose tissues, and reduces milk fat production in cows. We hypothesized that CLA inhibits S14 gene expression in human breast cancer and liposarcoma cells, and that this will retard their growth. Ex...

  20. Crystallization of Δ{sup 1}-tetrahydrocannabinolic acid (THCA) synthase from Cannabis sativa

    Energy Technology Data Exchange (ETDEWEB)

    Shoyama, Yoshinari; Takeuchi, Ayako; Taura, Futoshi [Faculty of Pharmaceutical Sciences, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka 812-8582 (Japan); Tamada, Taro; Adachi, Motoyasu; Kuroki, Ryota [Neutron Science Research Center, Japan Atomic Energy Research Institute, 2-4 Shirakata-Shirane, Tokai, Ibaraki 319-1195 (Japan); Shoyama, Yukihiro; Morimoto, Satoshi, E-mail: morimoto@phar.kyushu-u.ac.jp [Faculty of Pharmaceutical Sciences, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka 812-8582 (Japan)

    2005-08-01

    Δ{sup 1}-Tetrahydrocannabinolic acid (THCA) synthase from C. sativa was crystallized. The crystal diffracted to 2.7 Å resolution with sufficient quality for further structure determination. Δ{sup 1}-Tetrahydrocannabinolic acid (THCA) synthase is a novel oxidoreductase that catalyzes the biosynthesis of the psychoactive compound THCA in Cannabis sativa (Mexican strain). In order to investigate the structure–function relationship of THCA synthase, this enzyme was overproduced in insect cells, purified and finally crystallized in 0.1 M HEPES buffer pH 7.5 containing 1.4 M sodium citrate. A single crystal suitable for X-ray diffraction measurement was obtained in 0.09 M HEPES buffer pH 7.5 containing 1.26 M sodium citrate. The crystal diffracted to 2.7 Å resolution at beamline BL41XU, SPring-8. The crystal belonged to the primitive cubic space group P432, with unit-cell parameters a = b = c = 178.2 Å. The calculated Matthews coefficient was approximately 4.1 or 2.0 Å{sup 3} Da{sup −1} assuming the presence of one or two molecules of THCA synthase in the asymmetric unit, respectively.

  1. Crystallization of Δ1-tetrahydrocannabinolic acid (THCA) synthase from Cannabis sativa

    International Nuclear Information System (INIS)

    Δ1-Tetrahydrocannabinolic acid (THCA) synthase from C. sativa was crystallized. The crystal diffracted to 2.7 Å resolution with sufficient quality for further structure determination. Δ1-Tetrahydrocannabinolic acid (THCA) synthase is a novel oxidoreductase that catalyzes the biosynthesis of the psychoactive compound THCA in Cannabis sativa (Mexican strain). In order to investigate the structure–function relationship of THCA synthase, this enzyme was overproduced in insect cells, purified and finally crystallized in 0.1 M HEPES buffer pH 7.5 containing 1.4 M sodium citrate. A single crystal suitable for X-ray diffraction measurement was obtained in 0.09 M HEPES buffer pH 7.5 containing 1.26 M sodium citrate. The crystal diffracted to 2.7 Å resolution at beamline BL41XU, SPring-8. The crystal belonged to the primitive cubic space group P432, with unit-cell parameters a = b = c = 178.2 Å. The calculated Matthews coefficient was approximately 4.1 or 2.0 Å3 Da−1 assuming the presence of one or two molecules of THCA synthase in the asymmetric unit, respectively

  2. Glycogen synthase kinase 3: more than a namesake

    OpenAIRE

    Rayasam, Geetha Vani; Tulasi, Vamshi Krishna; Sodhi, Reena; Davis, Joseph Alex; Ray, Abhijit

    2009-01-01

    Glycogen synthase kinase 3 (GSK3), a constitutively acting multi-functional serine threonine kinase is involved in diverse physiological pathways ranging from metabolism, cell cycle, gene expression, development and oncogenesis to neuroprotection. These diverse multiple functions attributed to GSK3 can be explained by variety of substrates like glycogen synthase, τ protein and β catenin that are phosphorylated leading to their inactivation. GSK3 has been implicated in various diseases such as...

  3. Aluminum-activated citrate and malate transporters from the MATE and ALMT families function independently to confer Arabidopsis aluminum tolerance

    Science.gov (United States)

    Aluminum (Al) activated root malate and citrate exudation plays an important role in Al tolerance in many plant species. Here, we report on the identification and characterization of AtMATE, a homolog of the recently discovered sorghum and barley Al tolerance genes, here shown to encode an Al-activ...

  4. Aluminum-activated citrate and malate transporters from the MATE and ALMT families function independently to confer Arabidopsis aluminum tolerance

    Science.gov (United States)

    Aluminum (Al) activated root malate and citrate exudation play an important role in Al tolerance in many plant species. AtALMT1, an Al-activated malate transporter, is a major contributor to Arabidopsis Al tolerance. Here, we demonstrate that a second, unrelated gene, AtMATE, encodes an Arabidopsi...

  5. Impact of L-Carnitine and Cinnamon on Insulin-Like Growth Factor-1 and Inducible Nitric Oxide Synthase Gene Expression in Heart and Brain of Insulin Resistant Rats

    Directory of Open Access Journals (Sweden)

    Mona A. Mohamed

    2010-01-01

    Full Text Available Problem statement: Evaluate the effects of daily administration of L-carnitine and cinnamon extract for two weeks on the expression of Insulin-like Growth Factor-1 (IGF-1 and inducible Nitric Oxide Synthase (iNOS genes in cardiac and brain tissues of rats with Insulin Resistance (IR. Approach: Rats were divided into 4 groups (8 animals each: Group (1 rats fed control diet (60% starch as control while groups (2, 3 and 4 fed high fructose diet (60% fructose. At the beginning of the 3rd week of feeding, rats of group (3 were treated with L-carnitine (300 mg kg-1 body weight/day, i.p. and animals of group (4 received a daily oral dose of cinnamon aqueous extract (0.5 mL rat-1. The animals were maintained in their respective groups for 4 weeks. Results: Feeding high fructose diet causes significant reduction in Insulin Receptor Substrate-1 (IRS-1 (amounted 30.65% and elevation in iNOS expression (reached 51% in the cardiac tissues as compared to control. In brain tissues, the IGF-1 mRNA was reduced in fructose loaded groups (28.81%. Administration of either L-carnitine or cinnamon extract significantly improves the expression of the cardiac studied genes but with no effects on the brain tissues. Conclusion: The present study illustrated that CE was more potent than L-carnitine in improving the IR.

  6. Endothelial Nitric Oxide Synthase T-786C Mutation, Prothrombin Gene Mutation (G-20210-A and Protein S Deficiency Could Lead to Myocardial Infarction in a Very Young Male Adult

    Directory of Open Access Journals (Sweden)

    Milka Klincheva

    2016-01-01

    Full Text Available INTRODUCTION: Myocardial infarction is a rare medical event in young people. The main reasons include congenital coronary abnormalities, coronary artery spasm, and coronary thrombosis due to hypercoagulable states (hereditary and acquired. AIM: We present a case of a young male adult with myocardial infarction caused by a combination of gene mutations and anticoagulation protein deficiency. CASE PRESENTATION: A 19 years old young man was admitted to our hospital complaining of chest pain during the last two weeks. The patient did not have any known cardiovascular risk factors, except a positive family anamnesis. Subacute inferior nonST segment myocardial infarction was diagnosed according to the patient’s history, electrocardiographic and laboratory findings. Coronary angiography revealed suboclusive thrombus in the proximal, medial and distal part of the right coronary artery (TIMI 2. Percutaneous coronary intervention was performed. Anticoagulant and antiagregant therapy (heparin, acetilsalicilic acid and clopidogrel according to protocol was started. The hospital stay was uneventful. Homozygous endothelial nitric oxid synthase (eNOS T-786-C mutation, heterozygote prothrombin gene mutation (G-20210-A, and protein S deficiency were verified from the thrombophilia testing. Other trombophilic tests were normal. Three months after discharge from hospital another coronary angiography was performed. It revealed normal coronary arteries. Four years after the attack, the patient is free of symptoms and another cardiovascular event. CONCLUSION: Combination of genetic mutations and anticoagulation protein deficiency could be a reasonable cause for myocardial infarction in a very young male adult without any other cardiovascular risk factors.

  7. Diffuse abdominal gallium-67 citrate uptake in salmonella infections

    International Nuclear Information System (INIS)

    Two pediatric patients with salmonella infections (one with typhoid fever and the second with salmonella C2 gastroenteritis), had a diffuse abdominal uptake of Ga-67 citrate. The possible explanation for this finding is discussed. Salmonella infection should be included as a cause in the differential diagnosis of diffuse accumulation of Ga-67 citrate

  8. Citrate increases glass transition temperature of vitrified sucrose preparations

    NARCIS (Netherlands)

    Kets, E.P.W.; Lipelaar, P.J.; Hoekstra, F.A.; Vromans, H.

    2004-01-01

    The aim of this study was to investigate the effect of sodium citrate on the properties of dried amorphous sucrose glasses. Addition of sodium citrate to a sucrose solution followed by freeze-drying or convective drying resulted in a glass transition temperature (T-g) that was higher than the well-s

  9. Injectable citrate-modified Portland cement for use in vertebroplasty.

    Science.gov (United States)

    Wynn-Jones, Gareth; Shelton, Richard M; Hofmann, Michael P

    2014-11-01

    The injectability of Portland cement (PC) with several citrate additives was investigated for use in clinical applications such as vertebroplasty (stabilization of a fractured vertebra with bone cement) using a syringe. A 2-wt % addition of sodium or potassium citrate with PC significantly improved cement injectability, decreased cement setting times from over 2 h to below 25 min, while increasing the compressive strength to a maximum of 125 MPa. Zeta-potential measurements indicated that the citrate anion was binding to one or more of the positively charged species causing charged repulsion between cement particles which dispersed aggregates and caused the liquefying effect of the anion. Analysis of the hydrating phases of PC indicated that the early strength producing PC phase (ettringite) developed within the first 2 h of setting following addition of the citrate anion, while this did not occur in the control cement (PC only). Within 24 h ettringite developed in PC as well as calcium-silicate-hydrate (C-S-H), the major setting phase of PC, whereas cements containing citrate did not develop this phase. The evidence suggested that in the presence of citrate the cements limited water supply appeared to be utilized for ettringite formation, producing the early strength of the citrate cements. The present study has demonstrated that it is possible to modify PC with citrate to both improve the injectability and crucially reduce the setting times of PC while improving the strength of the cement. PMID:24711245

  10. 21 CFR 520.622b - Diethylcarbamazine citrate syrup.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Diethylcarbamazine citrate syrup. 520.622b Section... Diethylcarbamazine citrate syrup. (a)(1) Specifications. Each milliliter of syrup contains 60 milligrams of... veterinarian. (b)(1) Specifications. Each milliliter of syrup contains 60 milligrams of...

  11. 21 CFR 520.622c - Diethylcarbamazine citrate chewable tablets.

    Science.gov (United States)

    2010-04-01

    ....622c, see the List of CFR Sections Affected, which appears in the Finding Aids section of the printed... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Diethylcarbamazine citrate chewable tablets. 520... Diethylcarbamazine citrate chewable tablets. (a) Specifications. Each chewable tablet contains 30, 45, 60, 120,...

  12. 21 CFR 520.622a - Diethylcarbamazine citrate tablets.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Diethylcarbamazine citrate tablets. 520.622a... Diethylcarbamazine citrate tablets. (a) Sponsors. (1) See 015579 in § 510.600(c) of this chapter for use of 50, 200, and 400 milligram tablets for prevention of heartworm disease in dogs and as an aid in the...

  13. 21 CFR 520.623 - Diethylcarbamazine citrate, oxibendazole chewable tablets.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Diethylcarbamazine citrate, oxibendazole chewable tablets. 520.623 Section 520.623 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND... § 520.623 Diethylcarbamazine citrate, oxibendazole chewable tablets. (a) Specifications. Each...

  14. Structural Basis for Norovirus Inhibition and Fucose Mimicry by Citrate

    Energy Technology Data Exchange (ETDEWEB)

    Hansman, Grant S.; Shahzad-ul-Hussan, Syed; McLellan, Jason S.; Chuang, Gwo-Yu; Georgiev, Ivelin; Shimoike, Takashi; Katayama, Kazuhiko; Bewley, Carole A.; Kwong, Peter D. (NIAID)

    2012-01-20

    Human noroviruses bind with their capsid-protruding domains to histo-blood-group antigens (HBGAs), an interaction thought to direct their entry into cells. Although human noroviruses are the major cause of gastroenteritis outbreaks, development of antivirals has been lacking, mainly because human noroviruses cannot be cultivated. Here we use X-ray crystallography and saturation transfer difference nuclear magnetic resonance (STD NMR) to analyze the interaction of citrate with genogroup II (GII) noroviruses. Crystals of citrate in complex with the protruding domain from norovirus GII.10 Vietnam026 diffracted to 1.4 {angstrom} and showed a single citrate bound at the site of HBGA interaction. The citrate interaction was coordinated with a set of capsid interactions almost identical to that involved in recognizing the terminal HBGA fucose, the saccharide which forms the primary conserved interaction between HBGAs and GII noroviruses. Citrate and a water molecule formed a ring-like structure that mimicked the pyranoside ring of fucose. STD NMR showed the protruding domain to have weak affinity for citrate (460 {mu}M). This affinity, however, was similar to the affinities of the protruding domain for fucose (460 {mu}M) and H type 2 trisaccharide (390 {mu}M), an HBGA shown previously to be specifically recognized by human noroviruses. Importantly, competition STD NMR showed that citrate could compete with HBGA for norovirus binding. Together, the results suggest that citrate and other glycomimetics have the potential to block human noroviruses from binding to HBGAs.

  15. 99mTc-Citrate versus 67Ga-citrate for the scintigraphic visualization of inflammatory lesions

    International Nuclear Information System (INIS)

    Citric acid was labeled with 99mTc with an efficiency of > 99%. The biodistribution of 99mTc-citrate was studied in mice with turpentine-induced abscesses in comparison to 67Ga-citrate. The max. abscess/muscle concentration ratios were 4.61 ± 1.92 (3 h) for 99mTc-citrate and 4.76 ± 2.04 (4 h) for 67Ga-citrate. Arthritis was induced in 10 rabbits by intra-articular injection of ovalbumin Scintigrams obtained 4 days later and at 3 h post-injection of 99mTc-citrate showed increased activity involving the synovium. The max. arthritic/contralateral knee ratio was 3.19 ± 1.29 (3 h) and 6.47 ± 3.71 (24 h) for 99mTc- and 67Ga-citrate, respectively. The blood clearance curve of 99mTc-citrate in rabbits was biexponential with a fast and a slow component, compared to mono-exponential clearance of 67Ga-citrate. In 10 patients with rheumatoid arthritis whole-body scintigrams and spot images of involved joints indicated localization of the tracer in inflamed tissues. The mean target-to-soft tissue ratios were 3.04 ± 0.81 and 4.95 ± 2.56 for 99mTc-citrate and 99mTc-MDP, respectively. Renal clearance of radioactivity was evident from the scintigrams. Our results demonstrated that 99mTc-citrate is effective as a radiopharmaceutical for the visualization of inflammatory lesions and may be preferred to 67Ga-citrate due to the ideal physical characteristics of the radionuclide, easy preparation, low cost, early accumulation and the preference for the renal route of excretion. (Author)

  16. Genetic variants in promoters and coding regions of the muscle glycogen synthase and the insulin-responsive GLUT4 genes in NIDDM

    DEFF Research Database (Denmark)

    Bjørbaek, C; Echwald, Søren Morgenthaler; Hubricht, P; Vestergaard, H; Hansen, Torben; Zierath, J; Pedersen, O

    1994-01-01

    '-untranslated region, and the coding region of the GLUT4 gene showed four polymorphisms, all single nucleotide substitutions, positioned at -581, 1, 30, and 582. None of the three changes in the regulatory region of the gene had any major influence on expression of the GLUT4 gene in muscle. The variant at 582......, -16, -43, -143, and -250. The three most common variants could be excluded for having major impact on allele-specific GS mRNA expression in muscle. Scanning of GS cDNA revealed one frequent silent polymorphism at codon 342. Moreover, SSCP analysis of approximately 900 bp of the promoter, the 5...... in the GLUT4 cDNA was a silent polymorphism at codon 130. Southern blotting of both gene loci did not detect any major abnormalities.(ABSTRACT TRUNCATED AT 250 WORDS)...

  17. DHEA and non-alcoholic fat liver disease: increased gene expression of peroxisome proliferation-activated receptor γ (PPARγ and fatty acid synthase (FAS

    Directory of Open Access Journals (Sweden)

    Felipe Natali Almeida

    2014-05-01

    Full Text Available Dehydroespiandrosterone (DHEA is associated with improvements in chronic degenerative diseases, including obesity, insulin resistance, and cardiovascular diseases. Nevertheless, it is observed an increase in its concentration in individuals with liver lipid infiltration, but it is not precise if this condition emerges as a cause or a consequence. In this way, we aimed to identify gene expression alterations in lipid and glucose liver metabolism markers, as well as oxidative stress markers. For this purpose, male Wistar rats, 12-14 months old were treated with subcutaneous injections of DHEA (only dose of 10 mg kg-1; and after 7 days, hepatic gene expression by PCR real time were performed for the following genes:  G6Pase, PEPCK, FAS, PPARγ, malic enzyme, ChREBP, LXR, catalase, GPx, iNOS, NADPH oxidase subunits and PCNA. We observed a tendency of reduction in G6Pase gene expression in treated group (p = 0.08. In addition, it was identified an increase in liver PPARγ and FAS gene expressions, two markers of increased activity of lipogenic pathway. We also observed an increase in iNOS gene expression, a known inductor of systemic and hepatic insulin resistance. In conclusion, our data indicates that the treatment with DHEA can be associated with the development of liver lipid infiltration and hepatic insulin resistance.

  18. Enhanced triterpene saponin biosynthesis and root nodulation in transgenic barrel medic (Medicago truncatula Gaertn.) expressing a novel beta-amyrin synthase (AsOXA1) gene.

    Science.gov (United States)

    Confalonieri, Massimo; Cammareri, Maria; Biazzi, Elisa; Pecchia, Paola; Fevereiro, Manuel Pedro Salema; Balestrazzi, Alma; Tava, Aldo; Conicella, Clara

    2009-02-01

    Triterpene saponins are a group of bioactive compounds abundant in the genus Medicago, and have been studied extensively for their biological and pharmacological properties. In this article, we evaluated the effects of the ectopic expression of AsOXA1 cDNA from Aster sedifolius on the production of triterpene saponins in barrel medic (Medicago truncatula Gaertn.). AsOXA1 cDNA encodes beta-amyrin synthase, a key enzyme involved in triterpene saponin biosynthesis. One of the four transgenic lines expressing AsOXA1 accumulated significantly larger amounts of some triterpenic compounds in leaf and root than did control plants. In particular, the leaf exhibited significantly higher levels of bayogenin, medicagenic acid and zanhic acid. The amounts of medicagenic acid and zanhic acid, which represent the core of the M. truncatula leaf saponins, were 1.7 and 2.1 times higher, respectively, than the amounts extracted from the control line. In root, the production of bayogenin, hederagenin, soyasapogenol E and 2beta-hydroxyoleanolic acid was increased significantly. The increase in the total amounts of triterpenic compounds observed in the leaves of transgenic lines correlated with the AsOXA1 expression level. Interestingly, the plants expressing AsOXA1 showed, under different growth conditions, improved nodulation when compared with the control line. Nodulation enhancement was also accompanied by a significant change in the soyasapogenol B content. Our results indicate that the ectopic expression of AsOXA1 in barrel medic leads to a greater accumulation of triterpene saponins and enhanced root nodulation. PMID:19055609

  19. Low prevalence of Pneumocystis pneumonia (PCP but high prevalence of pneumocystis dihydropteroate synthase (dhps gene mutations in HIV-infected persons in Uganda.

    Directory of Open Access Journals (Sweden)

    Steve M Taylor

    Full Text Available Pneumocystis jirovecii pneumonia (PCP is an important opportunistic infection in patients infected with HIV, but its burden is incompletely characterized in those areas of sub-Saharan Africa where HIV is prevalent. We explored the prevalence of both PCP in HIV-infected adults admitted with pneumonia to a tertiary-care hospital in Uganda and of putative P. jirovecii drug resistance by mutations in fungal dihydropteroate synthase (dhps and dihydrofolate reductase (dhfr. In 129 consecutive patients with sputum smears negative for mycobacteria, 5 (3.9% were diagnosed with PCP by microscopic examination of Giemsa-stained bronchoalveolar lavage fluid. Concordance was 100% between Giemsa stain and PCR (dhps and dhfr. PCP was more prevalent in patients newly-diagnosed with HIV (11.4% than in patients with known HIV (1.1%; p = 0.007. Mortality at 2 months after discharge was 29% overall: 28% among PCP-negative patients, and 60% (3 of 5 among PCP-positive patients. In these 5 fungal isolates and an additional 8 from consecutive cases of PCP, all strains harbored mutant dhps haplotypes; all 13 isolates harbored the P57S mutation in dhps, and 3 (23% also harbored the T55A mutation. No non-synonymous dhfr mutations were detected. PCP is an important cause of pneumonia in patients newly-diagnosed with HIV in Uganda, is associated with high mortality, and putative molecular evidence of drug resistance is prevalent. Given the reliability of field diagnosis in our cohort, future studies in sub-Saharan Africa can investigate the clinical impact of these genotypes.

  20. Signal transducers and activators of transcription 3 (STAT3) inhibits transcription of the inducible nitric oxide synthase gene by interacting with nuclear factor kappaB.

    Science.gov (United States)

    Yu, Zhiyuan; Zhang, Wenzheng; Kone, Bruce C

    2002-01-01

    Prolific generation of NO by inducible nitric oxide synthase (iNOS) can cause unintended injury to host cells during glomerulonephritis and other inflammatory diseases. While much is known about the mechanisms of iNOS induction, few transcriptional repressors have been found. We explored the role of signal transducers and activators of transcription 3 (STAT3) proteins in interleukin (IL)-1beta- and lipopolysaccharide (LPS)+interferon (IFN)-gamma-mediated iNOS induction in murine mesangial cells. Both stimuli induced rapid phosphorylation of STAT3 and sequence-specific STAT3 DNA-binding activity. Supershift assays with a STAT3 element probe demonstrated that nuclear factor kappaB (NF-kappaB) p65 and p50 complexed with STAT3 in the DNA-protein complex. The direct interaction of STAT3 and NF-kappaB p65 was verified in vivo by co-immunoprecipitation and in vitro by pull-down assays with glutathione S-transferase-NF-kappaB p65 fusion protein and in vitro -translated STAT3alpha. Overexpression of STAT3 dramatically inhibited IL-1beta- or LPS+IFN-gamma-mediated induction of iNOS promoter-luciferase constructs that contained the wild-type iNOS promoter or ones harbouring mutated STAT-binding elements. In tests of indirect inhibitory effects of STAT3, overexpression of STAT3 dramatically inhibited the activity of an NF-kappaB-dependent promoter devoid of STAT-binding elements without affecting NF-kappaB DNA-binding activity. Thus STAT3, via direct interactions with NF-kappaB p65, serves as a dominant-negative inhibitor of NF-kappaB activity to suppress indirectly cytokine induction of the iNOS promoter in mesangial cells. These results provide a new model for the termination of NO production by activated iNOS following exposure to pro-inflammatory stimuli. PMID:12057007

  1. Caffeine synthase and related methyltransferases in plants.

    Science.gov (United States)

    Misako, Kato; Kouichi, Mizuno

    2004-05-01

    Caffeine (1,3,7-trimethylxanthine) is a purine alkaloid present in high concentrations in tea and coffee and it is also found in a number of beverages such as coca cola. It is necessary to elucidate the caffeine biosynthetic pathway and to clone the genes related to the production of caffeine not only to determine the metabolism of the purine alkaloid but also to control the content of caffeine in tea and coffee. The available data support the operation of a xanthosine-->7-methylxanthosine-->7-methylxanthine-->theobromine-->caffeine pathway as the major route to caffeine. Since the caffeine biosynthetic pathway contains three S-adenosyl-L-methionine (SAM) dependent methylation steps, N-methyltransferases play important roles. This review focuses on the enzymes and genes involved in the methylation of purine ring. Caffeine synthase, the SAM-dependent methyltransferase involved in the last two steps of caffeine biosynthesis, was originally purified from young tea leaves (Camellia sinensis). The isolated cDNA, termed TCS1, consists of 1,483 base pairs and encodes a protein of 369 amino acids. Subsequently, the homologous genes that encode caffeine biosynthetic enzymes from coffee (Coffea arabica) were isolated. The recombinant proteins are classified into the three types on the basis of their substrate specificity i.e. 7-methylxanthosine synthase, theobromine synthase and caffeine synthase. The predicted amino acid sequences of caffeine biosynthetic enzymes derived from C. arabica exhibit more than 80% homology with those of the clones and but show only 40% homology with TCS1 derived from C. sinensis. In addition, they share 40% homology with the amino acid sequences of salicylic carboxyl methyltransferase, benzoic acid carboxyl methyltransferase and jasmonic acid carboxyl methyltransferase which belong to a family of motif B' methyltransferases which are novel plant methyltransferases with motif B' instead of motif B as the conserved region. PMID:14977590

  2. Class IV polyhydroxyalkanoate (PHA) synthases and PHA-producing Bacillus.

    Science.gov (United States)

    Tsuge, Takeharu; Hyakutake, Manami; Mizuno, Kouhei

    2015-08-01

    This review highlights the recent investigations of class IV polyhydroxyalkanoate (PHA) synthases, the newest classification of PHA synthases. Class IV synthases are prevalent in organisms of the Bacillus genus and are composed of a catalytic subunit PhaC (approximately 40 kDa), which has a PhaC box sequence ([GS]-X-C-X-[GA]-G) at the active site, and a second subunit PhaR (approximately 20 kDa). The representative PHA-producing Bacillus strains are Bacillus megaterium and Bacillus cereus; the nucleotide sequence of phaC and the genetic organization of the PHA biosynthesis gene locus are somewhat different between these two strains. It is generally considered that class IV synthases favor short-chain-length monomers such as 3-hydroxybutyrate (C4) and 3-hydroxyvalerate (C5) for polymerization, but can polymerize some unusual monomers as minor components. In Escherichia coli expressing PhaRC from B. cereus YB-4, the biosynthesized PHA undergoes synthase-catalyzed alcoholytic cleavage using endogenous and exogenous alcohols. This alcoholysis is thought to be shared among class IV synthases, and this reaction is useful not only for the regulation of PHA molecular weight but also for the modification of the PHA carboxy terminus. The novel properties of class IV synthases will open up the possibility for the design of new PHA materials. PMID:26135986

  3. Hybrid polyketide synthases

    Energy Technology Data Exchange (ETDEWEB)

    Fortman, Jeffrey L.; Hagen, Andrew; Katz, Leonard; Keasling, Jay D.; Poust, Sean; Zhang, Jingwei; Zotchev, Sergey

    2016-05-10

    The present invention provides for a polyketide synthase (PKS) capable of synthesizing an even-chain or odd-chain diacid or lactam or diamine. The present invention also provides for a host cell comprising the PKS and when cultured produces the even-chain diacid, odd-chain diacid, or KAPA. The present invention also provides for a host cell comprising the PKS capable of synthesizing a pimelic acid or KAPA, and when cultured produces biotin.

  4. Identifying the catalytic components of cellulose synthase and the maize mixed-linkage beta-glucan synthase

    Energy Technology Data Exchange (ETDEWEB)

    Nicholas C Carpita

    2009-04-20

    Five specific objectives of this project are to develop strategies to identify the genes that encode the catalytic components of "mixed-linkage" (1→3),(1→4)-beta-D-glucans in grasses, to determine the protein components of the synthase complex, and determine the biochemical mechanism of synthesis. We have used proteomic approaches to define intrinsic and extrinsic polypeptides of Golgi membranes that are associated with polysaccharide synthesis and trafficking. We were successful in producing recombinant catalytic domains of cellulose synthase genes and discovered that they dimerize upon concentration, indicating that two CesA proteins form the catalytic unit. We characterized a brittle stalk2 mutant as a defect in a COBRA-like protein that results in compromised lignin-cellulose interactions that decrease tissue flexibility. We used virus-induced gene silencing of barley cell wall polysaccharide synthesis by BSMV in an attempt to silence specific members of the cellulose synthase-like gene family. However, we unexpectedly found that regardless of the specificity of the target gene, whole gene interaction networks were silenced. We discovered the cause to be an antisense transcript of the cellulose synthase gene initiated small interfering RNAs that spread silencing to related genes.

  5. Identification of a negative response element in the human inducible nitric-oxide synthase (hiNOS) promoter: The role of NF-κB-repressing factor (NRF) in basal repression of the hiNOS gene

    Science.gov (United States)

    Feng, Xuesheng; Guo, Zhong; Nourbakhsh, Mahtab; Hauser, Hansjorg; Ganster, Ray; Shao, Lifang; Geller, David A.

    2002-01-01

    Although nuclear factor (NF)-κB plays a central role in mediating cytokine-stimulated human inducible nitric-oxide synthase (hiNOS) gene transcription, very little is known about the factors involved in silencing of the hiNOS promoter. NF-κB-repressing factor (NRF) interacts with a specific negative regulatory element (NRE) to mediate transcriptional repression of certain NF-κB responsive genes. By sequence comparison with the IFN-β and IL-8 promoters, we identified an NRE in the hiNOS promoter located at −6.7 kb upstream. In A549 and HeLa human cells, constitutive NRF mRNA expression is detected by RT-PCR. Gel shift assay showed constitutive NRF binding to the hiNOS NRE. Mutation of the −6.7-kb NRE site in the hiNOS promoter resulted in loss of NRF binding and increased basal but not cytokine-stimulated hiNOS transcription in promoter transfection experiments. Interestingly, overexpression of NRF suppressed both basal and cytokine-induced hiNOS promoter activity that depended on an intact cis-acting NRE motif. By using stably transformed HeLa cells with the tetracycline on/off expression system, reduction of cellular NRF by expressing antisense NRF increased basal iNOS promoter activity and resulted in constitutive iNOS mRNA expression. These data demonstrate that the transacting NRF protein is involved in constitutive silencing of the hiNOS gene by binding to a cis-acting NRE upstream in the hiNOS promoter. PMID:12381793

  6. The promoter activities of sucrose phosphate synthase genes in rice, OsSPS1 and OsSPS11, are controlled by light and circadian clock, but not by sucrose

    Directory of Open Access Journals (Sweden)

    Madoka eYonekura

    2013-03-01

    Full Text Available Although sucrose plays a role in sugar sensing and its signaling pathway, little is known about the regulatory mechanisms of the expressions of plant sucrose-related genes. Our previous study on the expression of the sucrose phosphate synthase gene family in rice (OsSPSs suggested the involvement of sucrose sensing and/or circadian rhythm in the transcriptional regulation of OsSPS. To examine whether the promoters of OsSPSs can be controlled by sugars and circadian clock, we produced transgenic rice plants harboring a promoter–luciferase construct for OsSPS1 or OsSPS11 and analyzed the changes in the promoter activities by monitoring bioluminescence from intact transgenic plants in real time. Transgenic plants fed sucrose, glucose, or mannitol under continuous light conditions showed no changes in bioluminescence intensity; meanwhile, the addition of sucrose increased the concentration of sucrose in the plants, and the mRNA levels of OsSPS remained constant. These results suggest that these OsSPS promoters may not be regulated by sucrose levels in the tissues. Next, we investigated the changes in the promoter activities under 12-h light/12-h dark cycles and continuous light conditions. Under the light–dark cycle, both OsSPS1 and OsSPS11 promoter activities were low in the dark and increased rapidly after the beginning of the light period. When the transgenic rice plants were moved to the continuous light condition, both POsSPS1::LUC and POsSPS11::LUC reporter plants exhibited circadian bioluminescence rhythms; bioluminescence peaked during the subjective day with a 27-h period: in the early morning as for OsSPS1 promoter and midday for OsSPS11 promoter. These results indicate that these OsSPS promoters are controlled by both light illumination and circadian clock and that the regulatory mechanism of promoter activity differs between the 2 OsSPS genes.

  7. Understanding structure, function, and mutations in the mitochondrial ATP synthase

    Directory of Open Access Journals (Sweden)

    Ting Xu

    2015-03-01

    Full Text Available The mitochondrial ATP synthase is a multimeric enzyme complex with an overall molecular weight of about 600,000 Da. The ATP synthase is a molecular motor composed of two separable parts: F1 and Fo. The F1 portion contains the catalytic sites for ATP synthesis and protrudes into the mitochondrial matrix. Fo forms a proton turbine that is embedded in the inner membrane and connected to the rotor of F1. The flux of protons flowing down a potential gradient powers the rotation of the rotor driving the synthesis of ATP. Thus, the flow of protons though Fo is coupled to the synthesis of ATP. This review will discuss the structure/function relationship in the ATP synthase as determined by biochemical, crystallographic, and genetic studies. An emphasis will be placed on linking the structure/function relationship with understanding how disease causing mutations or putative single nucleotide polymorphisms (SNPs in genes encoding the subunits of the ATP synthase, will affect the function of the enzyme and the health of the individual. The review will start by summarizing the current understanding of the subunit composition of the enzyme and the role of the subunits followed by a discussion on known mutations and their effect on the activity of the ATP synthase. The review will conclude with a summary of mutations in genes encoding subunits of the ATP synthase that are known to be responsible for human disease, and a brief discussion on SNPs.

  8. ATP-citrate lyase is required for production of cytosolic acetyl coenzyme A and development in Aspergillus nidulans.

    Science.gov (United States)

    Hynes, Michael J; Murray, Sandra L

    2010-07-01

    Acetyl coenzyme A (CoA) is a central metabolite in carbon and energy metabolism and in the biosynthesis of cellular molecules. A source of cytoplasmic acetyl-CoA is essential for the production of fatty acids and sterols and for protein acetylation, including histone acetylation in the nucleus. In Saccharomyces cerevisiae and Candida albicans acetyl-CoA is produced from acetate by cytoplasmic acetyl-CoA synthetase, while in plants and animals acetyl-CoA is derived from citrate via ATP-citrate lyase. In the filamentous ascomycete Aspergillus nidulans, tandem divergently transcribed genes (aclA and aclB) encode the subunits of ATP-citrate lyase, and we have deleted these genes. Growth is greatly diminished on carbon sources that do not result in cytoplasmic acetyl-CoA, such as glucose and proline, while growth is not affected on carbon sources that result in the production of cytoplasmic acetyl-CoA, such as acetate and ethanol. Addition of acetate restores growth on glucose or proline, and this is dependent on facA, which encodes cytoplasmic acetyl-CoA synthetase, but not on the regulatory gene facB. Transcription of aclA and aclB is repressed by growth on acetate or ethanol. Loss of ATP-citrate lyase results in severe developmental effects, with the production of asexual spores (conidia) being greatly reduced and a complete absence of sexual development. This is in contrast to Sordaria macrospora, in which fruiting body formation is initiated but maturation is defective in an ATP-citrate lyase mutant. Addition of acetate does not repair these defects, indicating a specific requirement for high levels of cytoplasmic acetyl-CoA during differentiation. Complementation in heterokaryons between aclA and aclB deletions for all phenotypes indicates that the tandem gene arrangement is not essential. PMID:20495057

  9. Characterization of Alcohol Acyl Transferase and 1-Aminocyclopropane-1-Carboxylate Synthase Gene Expression and Volatile Compound Emission during Apple Fruit Development and Ripening

    Science.gov (United States)

    Alcohol acyl transferase (AAT) catalyzes the last step of volatile ester biosynthesis, and in this study, expression of four apple AAT genes was investigated in the peel of two apple cultivars with relatively high (‘Golden Delicious’) or low (‘Granny Smith’) volatile ester production. All four AAT ...

  10. Thymidylate synthase, dihydropyrimidine dehydrogenase, ERCC1, and thymidine phosphorylase gene expression in primary and metastatic gastrointestinal adenocarcinoma tissue in patients treated on a phase I trial of oxaliplatin and capecitabine

    International Nuclear Information System (INIS)

    Over-expression of thymidylate synthase (TS) and dihydropyrimidine dehydrogenase (DPD) in tumor tissue is associated with insensitivity to 5-fluorouracil (5-FU). Over-expression of ERCC1 correlates with insensitivity to oxaliplatin (OX) therapy, while high thymidine phosphorylase (TP) levels predict for increased sensitivity to capecitabine (Xel). Biopsies of metastatic tumor were taken before OX (130 mg/m2 day 1) given with Xel (1200–3000 mg/m2 in two divided doses days 1–5 and 8–12) every 3-weeks. Micro-dissected metastatic and primary tumors were analyzed for relative gene expression by real-time quantitative polymerase chain reaction. The clinical protocol prospectively identified the molecular targets of interest that would be tested. Endpoints for the molecular analyses were correlation of median, first and third quartiles for relative gene expression of each target with response, time to treatment failure (TTF), and survival. Among 91 patients participating in this trial; 97% had colorectal cancer. The median number of prior chemotherapy regimens was 2, and most had prior 5-FU and irinotecan. In paired samples, median mRNA levels were significantly higher in metastatic versus primary tumor (-fold): TS (1.9), DPD (3.8), ERCC1 (2.1) and TP (1.6). A strong positive correlation was noted between DPD and TP mRNA levels in both primary (r = 0.693, p < 0.0005) and metastatic tissue (r = 0.697, p < 0.00001). There was an association between TS gene expression and responsive and stable disease: patients whose intratumoral TS mRNA levels were above the median value had significantly greater risk of early disease progression (43% vs 17%), but this did not translate into a significant difference in TTF. ERCC1 gene expression above the third quartile was associated with a shorter TTF (median 85 vs 162 days, p = 0.046). Patients whose TS mRNA levels in metastatic tumor tissue were below the median had a longer overall survival (median 417 vs 294 days, p = 0

  11. Role of Ga-67 citrate imaging in pancreatitis

    Energy Technology Data Exchange (ETDEWEB)

    Aburano, T.; Yokoyama, K.; Hisada, K.; Kakuma, K.; Ichiyanagi, K.

    1988-11-01

    Two patients with pancreatitis in whom an area of predominant uptake of Ga-67 citrate was demonstrated involving the entire pancreas are presented. Ultrasound and x-ray CT did not reveal any morphologic abnormalities in the pancreas, whereas Ga-67 citrate imaging indicated the presence of active inflammatory change. Ga-67 citrate imaging may be useful in confirming the diagnosis of acute pancreatitis or acute exacerbation of chronic pancreatitis based on clinical and laboratory data, especially when ultrasound and/or x-ray CT cannot reveal any morphologic abnormalities in the pancreas.

  12. Monoterpene synthases from common sage (Salvia officinalis)

    Energy Technology Data Exchange (ETDEWEB)

    Croteau, Rodney Bruce (Pullman, WA); Wise, Mitchell Lynn (Pullman, WA); Katahira, Eva Joy (Pullman, WA); Savage, Thomas Jonathan (Christchurch 5, NZ)

    1999-01-01

    cDNAs encoding (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase from common sage (Salvia officinalis) have been isolated and sequenced, and the corresponding amino acid sequences has been determined. Accordingly, isolated DNA sequences (SEQ ID No:1; SEQ ID No:3 and SEQ ID No:5) are provided which code for the expression of (+)-bornyl diphosphate synthase (SEQ ID No:2), 1,8-cineole synthase (SEQ ID No:4) and (+)-sabinene synthase SEQ ID No:6), respectively, from sage (Salvia officinalis). In other aspects, replicable recombinant cloning vehicles are provided which code for (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase, or for a base sequence sufficiently complementary to at least a portion of (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase. Thus, systems and methods are provided for the recombinant expression of the aforementioned recombinant monoterpene synthases that may be used to facilitate their production, isolation and purification in significant amounts. Recombinant (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase may be used to obtain expression or enhanced expression of (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase in plants in order to enhance the production of monoterpenoids, or may be otherwise employed for the regulation or expression of (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase, or the production of their products.

  13. 一株嗜热菌的分离、鉴定及海藻糖合成酶基因的克隆%Isolation and Identification of a Thermophile Bacterium and Cloning of Trehalose Synthase Gene

    Institute of Scientific and Technical Information of China (English)

    王慧荣; 韦宇拓; 黄日波

    2011-01-01

    从广西贺州市80℃热泉分离了一株嗜热菌TTH,生长温度范围在55℃~85℃,最适生长温度70℃左右,最高生长温度85℃,G+C物质的量分数为67.6%.对菌株TTH从形态、培养条件、16S rRNA基因序列和系统发育分析方面进行了研究,表明该菌株与3株嗜热栖热菌(Thermus thermophilus)的同源性达到98%,初步鉴定是嗜热栖热菌(Thermus thermophilus).克隆了该菌的海藻糖合成酶基因,它与菌株Thermus thermophilus RQ-1,Thermus caldophilus,Thermus thermophilus HB8,Thermus thermophilus的同源性达到87%.%A thermophile strain, designated as TTH, was isolated from 80℃ hot spring at Hezhou county in Guangxi province. It could grow at temperatures from 55℃ to 85℃, with the optimal temperature 70℃, the highest temperature 85℃ , and with 67. 6% molar content of the G + C. The researches which were based on the TTH morphological , culture conditions, 16S rDNA sequence, as well as the phylogenetic analysis show that the strain TTH has 98% sequence identity with three kinds of Thennus thermophilus. Therefore the strain is tentatively identified as Thermits thermophilus. Trehalose synthase gene of TTH was cloned and analyzed. It has 87% identity to the treS gene from Thermits thermophilus RQ-1, Thermits caldophilus, Thermits thermophilus HB8 and Thermits thermophilus.

  14. Effects of disrupting the polyketide synthase gene WdPKS1 in Wangiella [Exophiala] dermatitidis on melanin production and resistance to killing by antifungal compounds, enzymatic degradation, and extremes in temperature

    Directory of Open Access Journals (Sweden)

    Mandal Piyali

    2006-06-01

    Full Text Available Abstract Background Wangiella dermatitidis is a human pathogenic fungus that is an etiologic agent of phaeohyphomycosis. W. dermatitidis produces a black pigment that has been identified as a dihydroxynaphthalene melanin and the production of this pigment is associated with its virulence. Cell wall pigmentation in W. dermatitidis depends on the WdPKS1 gene, which encodes a polyketide synthase required for generating the key precursor for dihydroxynaphthalene melanin biosynthesis. Results We analyzed the effects of disrupting WdPKS1 on dihydroxynaphthalene melanin production and resistance to antifungal compounds. Transmission electron microscopy revealed that wdpks1Δ-1 yeast had thinner cell walls that lacked an electron-opaque layer compared to wild-type cells. However, digestion of the wdpks1Δ-1 yeast revealed small black particles that were consistent with a melanin-like compound, because they were acid-resistant, reacted with melanin-binding antibody, and demonstrated a free radical signature by electron spin resonance analysis. Despite lacking the WdPKS1 gene, the mutant yeast were capable of catalyzing the formation of melanin from L-3,4-dihyroxyphenylalanine. The wdpks1Δ-1 cells were significantly more susceptible to killing by voriconazole, amphotericin B, NP-1 [a microbicidal peptide], heat and cold, and lysing enzymes than the heavily melanized parental or complemented strains. Conclusion In summary, W. dermatitidis makes WdPKS-dependent and -independent melanins, and the WdPKS1-dependent deposition of melanin in the cell wall confers protection against antifungal agents and environmental stresses. The biological role of the WdPKS-independent melanin remains unclear.

  15. Novel family of terpene synthases evolved from trans-isoprenyl diphosphate synthases in a flea beetle.

    Science.gov (United States)

    Beran, Franziska; Rahfeld, Peter; Luck, Katrin; Nagel, Raimund; Vogel, Heiko; Wielsch, Natalie; Irmisch, Sandra; Ramasamy, Srinivasan; Gershenzon, Jonathan; Heckel, David G; Köllner, Tobias G

    2016-03-15

    Sesquiterpenes play important roles in insect communication, for example as pheromones. However, no sesquiterpene synthases, the enzymes involved in construction of the basic carbon skeleton, have been identified in insects to date. We investigated the biosynthesis of the sesquiterpene (6R,7S)-himachala-9,11-diene in the crucifer flea beetle Phyllotreta striolata, a compound previously identified as a male-produced aggregation pheromone in several Phyllotreta species. A (6R,7S)-himachala-9,11-diene-producing sesquiterpene synthase activity was detected in crude beetle protein extracts, but only when (Z,E)-farnesyl diphosphate [(Z,E)-FPP] was offered as a substrate. No sequences resembling sesquiterpene synthases from plants, fungi, or bacteria were found in the P. striolata transcriptome, but we identified nine divergent putative trans-isoprenyl diphosphate synthase (trans-IDS) transcripts. Four of these putative trans-IDSs exhibited terpene synthase (TPS) activity when heterologously expressed. Recombinant PsTPS1 converted (Z,E)-FPP to (6R,7S)-himachala-9,11-diene and other sesquiterpenes observed in beetle extracts. RNAi-mediated knockdown of PsTPS1 mRNA in P. striolata males led to reduced emission of aggregation pheromone, confirming a significant role of PsTPS1 in pheromone biosynthesis. Two expressed enzymes showed genuine IDS activity, with PsIDS1 synthesizing (E,E)-FPP, whereas PsIDS3 produced neryl diphosphate, (Z,Z)-FPP, and (Z,E)-FPP. In a phylogenetic analysis, the PsTPS enzymes and PsIDS3 were clearly separated from a clade of known coleopteran trans-IDS enzymes including PsIDS1 and PsIDS2. However, the exon-intron structures of IDS and TPS genes in P. striolata are conserved, suggesting that this TPS gene family evolved from trans-IDS ancestors. PMID:26936952

  16. Single amino acid substitutions in the enzyme acetolactate synthase confer resistance to the herbicide sulfometuron methyl

    OpenAIRE

    Yadav, Narendra; McDevitt, Raymond E.; Benard, Susan; Falco, S. Carl

    1986-01-01

    Sulfometuron methyl, a sulfonylurea herbicide, blocks growth of bacteria, yeast, and higher plants by inhibition of acetolactate synthase (EC 4.1.3.18), the first common enzyme in the biosynthesis of branched-chain amino acids. Spontaneous mutations that confer increased resistance to the herbicide were obtained in cloned genes for acetolactate synthase from Escherichia coli and Saccharomyces cerevisiae. The DNA sequence of a bacterial mutant gene and a yeast mutant gene revealed single nucle...

  17. Isolation and Characterization of Soybean Genes Involved in Phytic Acid Metabolism: Phytase and 1-L-myo-Inositol-1-Phosphate Synthase

    OpenAIRE

    Hegeman, Carla Elizabeth

    1999-01-01

    The objective of this research was to isolate and characterize soybean genes involved in phytic acid metabolism for use in genetic engineering strategies to improve phosphorus utilization. A soybean phytase from germinated cotyledons was purified 28,000-fold to apparent homogeneity and was determined to be a glycosylated homodimer with 70 kD subunits. Soybean phytase preferred phytate as substrate (Km = 60 mM) and was capable of removing of all six phosphate groups from phytate. The pH and ...

  18. Prenyldiphosphate synthases and gibberellin biosynthesis

    NARCIS (Netherlands)

    C.C.N. van Schie; M.A. Haring; R.C. Schuurink

    2013-01-01

    Gibberellins are derived from the diterpene precursor geranylgeranyl diphophosphate (GGPP). GGPP is converted to ent-kaurene, which contains the basic structure of gibberellins, in the plastids by the combined actions of copalyl diphosphate synthase (CPS) and ent-kaurene synthase (KS). Generally, ge

  19. Bacterial phytoene synthase: molecular cloning, expression, and characterization of Erwinia herbicola phytoene synthase.

    Science.gov (United States)

    Iwata-Reuyl, Dirk; Math, Shivanand K; Desai, Shrivallabh B; Poulter, C Dale

    2003-03-25

    Phytoene synthase (PSase) catalyzes the condensation of two molecules of geranylgeranyl diphosphate (GGPP) to give prephytoene diphosphate (PPPP) and the subsequent rearrangement of the cyclopropylcarbinyl intermediate to phytoene. These reactions constitute the first pathway specific step in carotenoid biosynthesis. The crtB gene encoding phytoene synthase was isolated from a plasmid containing the carotenoid gene cluster in Erwinia herbicola and cloned into an Escherichia coli expression system. Upon induction, recombinant phytoene synthase constituted 5-10% of total soluble protein. To facilitate purification of the recombinant enzyme, the structural gene for PSase was modified by site-directed mutagenesis to incorporate a C-terminal Glu-Glu-Phe (EEF) tripepetide to allow purification by immunoaffinity chromatography on an immobilized monoclonal anti-alpha-tubulin antibody YL1/2 column. Purified recombinant PSase-EEF gave a band at 34.5 kDa upon SDS-PAGE. Recombinant PSase-EEF was then purified to >90% homogeneity in two steps by ion-exchange and immunoaffinity chromatography. The enzyme required Mn(2+) for activity, had a pH optimum of 8.2, and was strongly stimulated by detergent. The concentration of GGPP needed for half-maximal activity was approximately 35 microM, and a significant inhibition of activity was seen at GGPP concentrations above 100 microM. The sole product of the reaction was 15,15'-Z-phytoene. PMID:12641468

  20. Injectable citrate-modified Portland cement for use in vertebroplasty

    OpenAIRE

    Wynn-Jones, Gareth; Shelton, Richard M.; Hofmann, Michael P

    2014-01-01

    The injectability of Portland cement (PC) with several citrate additives was investigated for use in clinical applications such as vertebroplasty (stabilization of a fractured vertebra with bone cement) using a syringe. A 2-wt % addition of sodium or potassium citrate with PC significantly improved cement injectability, decreased cement setting times from over 2 h to below 25 min, while increasing the compressive strength to a maximum of 125 MPa. Zeta-potential measurements indicated that the...

  1. Why sildenafil and sildenafil citrate monohydrate crystals are not stable?

    OpenAIRE

    Sawatdee, Somchai; Pakawatchai, Chaveng; Nitichai, Kwanjai; Srichana, Teerapol; PHETMUNG, Hirihattaya

    2015-01-01

    Sildenafil citrate was crystallized by various techniques aiming to determine the behavior and factors affecting the crystal growth. There are only 2 types of sildenafil obtaining from crystallization: sildenafil (1) and sildenafil citrate monohydrate (2). The used techniques were (i) crystallization from saturated solutions, (ii) addition of an antisolvent, (iii) reflux and (iv) slow solvent evaporation method. By pursuing these various methods, our work pointed that the best formation of cr...

  2. Increased Production of Fatty Acids and Triglycerides in Aspergillus oryzae by Enhancing Expressions of Fatty Acid Synthesis-Related Genes

    Energy Technology Data Exchange (ETDEWEB)

    Tamano, Koichi; Bruno, Kenneth S.; Karagiosis, Sue A.; Culley, David E.; Deng, Shuang; Collett, James R.; Umemura, Myco; Koike, Hideaki; Baker, Scott E.; Machida, Masa

    2013-01-01

    Microbial production of fats and oils is being developedas a means of converting biomass to biofuels. Here we investigate enhancing expression of enzymes involved in the production of fatty acids and triglycerides as a means to increase production of these compounds in Aspergillusoryzae. Examination of the A.oryzaegenome demonstrates that it contains twofatty acid synthases and several other genes that are predicted to be part of this biosynthetic pathway. We enhancedthe expressionof fatty acid synthesis-related genes by replacing their promoters with thepromoter fromthe constitutively highly expressedgene tef1. We demonstrate that by simply increasing the expression of the fatty acid synthasegenes we successfullyincreasedtheproduction of fatty acids and triglyceridesby more than two fold. Enhancement of expression of the fatty acid pathway genes ATP-citrate lyase and palmitoyl-ACP thioesteraseincreasedproductivity to a lesser extent.Increasing expression ofacetyl-CoA carboxylase caused no detectable change in fatty acid levels. Increases in message level for each gene were monitored usingquantitative real-time RT-PCR. Our data demonstrates that a simple increase in the abundance of fatty acid synthase genes can increase the detectable amount of fatty acids.

  3. Sandalwood Fragrance Biosynthesis Involves Sesquiterpene Synthases of Both the Terpene Synthase (TPS)-a and TPS-b Subfamilies, including Santalene Synthases*

    OpenAIRE

    Christopher G Jones; Moniodis, Jessie; Zulak, Katherine G.; Scaffidi, Adrian; Plummer, Julie A.; Ghisalberti, Emilio L.; Barbour, Elizabeth L.; Bohlmann, Jörg

    2011-01-01

    Sandalwood oil is one of the worlds most highly prized fragrances. To identify the genes and encoded enzymes responsible for santalene biosynthesis, we cloned and characterized three orthologous terpene synthase (TPS) genes SaSSy, SauSSy, and SspiSSy from three divergent sandalwood species; Santalum album, S. austrocaledonicum, and S. spicatum, respectively. The encoded enzymes catalyze the formation of α-, β-, epi-β-santalene, and α-exo-bergamotene from (E,E)-farnesyl diphosphate (E,E-FPP). ...

  4. Cloning and Expression of Allene Oxide Synthase Gene from Catharanthus roseus%长春花丙二烯氧化物合酶基因的克隆与表达

    Institute of Scientific and Technical Information of China (English)

    王名雪; 陆平; 许菲; 潘琪芳; 唐克轩; 赵静雅

    2012-01-01

    In this study, a full-length cDNA of allene oxide synthase (AOS) gene (named as CrAOS, JQ364955) was cloned from Catharanthus roseus. The gene was 2 118 bp in size containing an open reading frame (1638 bp) encoding 545 amino acids. Comparative and bioinformatic analysis revealed that the deduced protein of CrAOS was highly homologous to AOSs from other plant species. Southern blot analysis revealed that it was a low-copy gene. Real-time Quantitative PCR (qRT-PCR) analysis showed that CrAOS mRNA accumulated most abundantly in old leaves and least in young alabastrums. The qRT-PCR analysis revealed that wound, low temperature, methyl jasmonic acid, ethylene treatments significantly enhanced CrAOS transcript expression,and salicylic acid had no influence.%利用RT-PCR和RACE相结合的方法,从长春花中克隆了丙二烯氧化物合酶(AOS)基因.结果显示:长春花AOS基因(CrAOS) cDNA全长为2 118 bp,包括5 '和3'非翻译区,polyA尾和一个长1 638 bp的开放阅读框,其基因组中不含内含子;CrAOS基因编码的蛋白含545个氨基酸.多重比对表明CrAOS蛋白与其他的AOS蛋白具有较高的相似性,CrAOS蛋白序列中含有AOS家族应有的保守氨基酸残基.Southern杂交表明:CrAOS基因在长春花中为低拷贝.qRT-PCR结果显示:CrAOS在各个组织均有表达但表达量存在差异,在老叶中最高,在幼花中表达最低.对长春花幼苗进行不同处理,结果表明:伤害、低温、甲基茉莉酸、乙烯利处理等可使CrAOS基因表达量显著提高,水杨酸处理对基因表达影响不大.

  5. Increased production of wax esters in transgenic tobacco plants by expression of a fatty acid reductase:wax synthase gene fusion.

    Science.gov (United States)

    Aslan, Selcuk; Hofvander, Per; Dutta, Paresh; Sun, Chuanxin; Sitbon, Folke

    2015-12-01

    Wax esters are hydrophobic lipids consisting of a fatty acid moiety linked to a fatty alcohol with an ester bond. Plant-derived wax esters are today of particular concern for their potential as cost-effective and sustainable sources of lubricants. However, this aspect is hampered by the fact that the level of wax esters in plants generally is too low to allow commercial exploitation. To investigate whether wax ester biosynthesis can be increased in plants using transgenic approaches, we have here exploited a fusion between two bacterial genes together encoding a single wax ester-forming enzyme, and targeted the resulting protein to chloroplasts in stably transformed tobacco (Nicotiana benthamiana) plants. Compared to wild-type controls, transgenic plants showed both in leaves and stems a significant increase in the total level of wax esters, being eight-fold at the whole plant level. The profiles of fatty acid methyl ester and fatty alcohol in wax esters were related, and C16 and C18 molecules constituted predominant forms. Strong transformants displayed certain developmental aberrations, such as stunted growth and chlorotic leaves and stems. These negative effects were associated with an accumulation of fatty alcohols, suggesting that an adequate balance between formation and esterification of fatty alcohols is crucial for a high wax ester production. The results show that wax ester engineering in transgenic plants is feasible, and suggest that higher yields may become achieved in the near future. PMID:26138876

  6. Inhibition of JAK-STAT ERK/MAPK and Glycogen Synthase Kinase-3 Induces a Change in Gene Expression Profile of Bovine Induced Pluripotent Stem Cells

    Directory of Open Access Journals (Sweden)

    Luis F. Malaver-Ortega

    2016-01-01

    Full Text Available Pluripotent stem cells (PSCs fall in two states, one highly undifferentiated, the naïve state, and the primed state, characterized by the inability to contribute to germinal lineage. Several reports have demonstrated that these states can be modified by changes to the cell culture conditions. With the advent of nuclear reprogramming, bovine induced pluripotent stem cells (biPSCs have been generated. These cells represent examples of a transient-intermediate state of pluripotency with remarkable characteristics and biotechnological potential. Herein, we generated and characterized biPSC. Next, we evaluated different culture conditions for the ability to affect the expression of the set of core pluripotent transcription factors in biPSC. It was found that the use of 6-bromoindirubin-3-oxime and Sc1 inhibitors alone or in combination with 5-AzaC induced significantly higher levels of expression of endogenous REX1, OCT4, NANOG, and SOX2. Furthermore, LIF increased the levels of expression of OCT4 and REX1, compared with those cultured with LIF + bFGF. By contrast, bFGF decreased the levels of expression for both REX1 and OCT4. These results demonstrate that the biPSC gene expression profile is malleable by modification of the cell culture conditions well after nuclear reprogramming, and the culture conditions may determine their differentiation potential.

  7. Inhibition of JAK-STAT ERK/MAPK and Glycogen Synthase Kinase-3 Induces a Change in Gene Expression Profile of Bovine Induced Pluripotent Stem Cells.

    Science.gov (United States)

    Malaver-Ortega, Luis F; Sumer, Huseyin; Liu, Jun; Verma, Paul J

    2016-01-01

    Pluripotent stem cells (PSCs) fall in two states, one highly undifferentiated, the naïve state, and the primed state, characterized by the inability to contribute to germinal lineage. Several reports have demonstrated that these states can be modified by changes to the cell culture conditions. With the advent of nuclear reprogramming, bovine induced pluripotent stem cells (biPSCs) have been generated. These cells represent examples of a transient-intermediate state of pluripotency with remarkable characteristics and biotechnological potential. Herein, we generated and characterized biPSC. Next, we evaluated different culture conditions for the ability to affect the expression of the set of core pluripotent transcription factors in biPSC. It was found that the use of 6-bromoindirubin-3-oxime and Sc1 inhibitors alone or in combination with 5-AzaC induced significantly higher levels of expression of endogenous REX1, OCT4, NANOG, and SOX2. Furthermore, LIF increased the levels of expression of OCT4 and REX1, compared with those cultured with LIF + bFGF. By contrast, bFGF decreased the levels of expression for both REX1 and OCT4. These results demonstrate that the biPSC gene expression profile is malleable by modification of the cell culture conditions well after nuclear reprogramming, and the culture conditions may determine their differentiation potential. PMID:26880968

  8. Endothelial nitric oxide synthase gene polymorphism (Glu298Asp and development of pre-eclampsia: a case-control study and a meta-analysis

    Directory of Open Access Journals (Sweden)

    Sahemey Manpreet K

    2006-03-01

    Full Text Available Abstract Background Pre-eclampsia is thought to have an important genetic component. Recently, pre-eclampsia has been associated in some studies with carriage of a common eNOS gene Glu298Asp polymorphism, a variant that leads to the replacement of glutamic acid by aspartic acid at codon 298. Method Healthy women with singleton pregnancies were recruited from 7 district general hospitals in London, UK. Women at high risk of pre-eclampsia were screened by uterine artery Doppler velocimetry at 22–24 weeks of gestation and maternal blood was obtained to genotype the eNOS Glu298Asp polymorphism. Odds ratios (OR and 95%CI, using logistic regression methods, were obtained to evaluate the association between the Glu298Asp polymorphism and pre-eclampsia. A meta-analysis was then undertaken of all published studies up to November 2005 examining the association of eNOS Glu298Asp genotype and pre-eclampsia. Results 89 women with pre-eclampsia and 349 controls were included in the new study. The Glu298Asp polymorphism in a recessive model was not significantly associated with pre-eclampsia (adjusted-OR: 0.83 [95%CI: 0.30–2.25]; p = 0.7. In the meta-analysis, under a recessive genetic model (1129 cases & 2384 controls women homozygous for the Asp298 allele were not at significantly increased risk of pre-eclampsia (OR: 1.28 [95%CI: 0.76–2.16]; p = 0.34. A dominant model (1334 cases & 2894 controls was associated with no increase of risk of pre-eclampsia for women carriers of the Asp298 allele (OR: 1.12 [95%CI: 0.84–1.49]; p = 0.42. Conclusion From the data currently available, the eNOS Glu298Asp polymorphism is not associated with a significant increased risk of pre-eclampsia. However, published studies have been underpowered, much larger studies are needed to confirm or refute a realistic genotypic risk of disease, but which might contribute to many cases of pre-eclampsia in the population.

  9. Preparation of lead titanate zirconate from metal citrates

    International Nuclear Information System (INIS)

    Lead titanate zirconate (PZT) preparation from its metal constituent citrates have been investigated. Metal citrates were obtained by forced precipitation using a dehydration alcohol mixture. Salt solutions of lead nitrate and octahydrated zirconyl chloride, and titanium tetrachloride were treated separately with citric acid and ammonium hydroxide. Zirconium, titanium and lead oxides resulted from thermal decomposition of corresponding citrates at 5000 C, 4500 C and 2500 C, respectively. Lead titanate (PT) and lead zirconate (P Z) were obtained by calcining at 4500 C and 5000 C, respectively, after adequate heating of citrates mechanically mixed in ethyl ether. PZT samples were obtained with different starting stoichiometry. Rhombohedral PZT-1 53/47 sample was prepared from co precipitating zirconyl ammonium and ammonium lead citrates in presence of ethanolic titanium oxide dispersion, and calcinating at 8000 C. Rhombohedral PZT-q 52/48 sample was obtained from heating at 5000 C for 2 hours a mixture of metal citrates coprecipitated by dehydration mixture of acetone-ethanol-formic acid (2:1:0,06). Tetragonal PZT-m stoichiometry 53/47 sample were obtained by calcining at after 6000 C for 2 hours after heating a mechanically mixed metal citrates. PT phase arose at 4000 C. PZT-m powders obtained in a range of 4000 C-8000 C were isostatically pressed, and sintered at 11000 C and 12000 C in saturated Pb O atmosphere. Rhombohedral sintered PZT was obtained with 7,78 g.cm-3 at 12000 C. (author). 123 refs, 53 figs, 32 tabs

  10. Alkali absorption and citrate excretion in calcium nephrolithiasis

    Science.gov (United States)

    Sakhaee, K.; Williams, R. H.; Oh, M. S.; Padalino, P.; Adams-Huet, B.; Whitson, P.; Pak, C. Y.

    1993-01-01

    The role of net gastrointestinal (GI) alkali absorption in the development of hypocitraturia was investigated. The net GI absorption of alkali was estimated from the difference between simple urinary cations (Ca, Mg, Na, and K) and anions (Cl and P). In 131 normal subjects, the 24 h urinary citrate was positively correlated with the net GI absorption of alkali (r = 0.49, p < 0.001). In 11 patients with distal renal tubular acidosis (RTA), urinary citrate excretion was subnormal relative to net GI alkali absorption, with data from most patients residing outside the 95% confidence ellipse described for normal subjects. However, the normal relationship between urinary citrate and net absorbed alkali was maintained in 11 patients with chronic diarrheal syndrome (CDS) and in 124 stone-forming patients devoid of RTA or CDS, half of whom had "idiopathic" hypocitraturia. The 18 stone-forming patients without RTA or CDS received potassium citrate (30-60 mEq/day). Both urinary citrate and net GI alkali absorption increased, yielding a significantly positive correlation (r = 0.62, p < 0.0001), with the slope indistinguishable from that of normal subjects. Thus, urinary citrate was normally dependent on the net GI absorption of alkali. This dependence was less marked in RTA, confirming the renal origin of hypocitraturia. However, the normal dependence was maintained in CDS and in idiopathic hypocitraturia, suggesting that reduced citrate excretion was largely dietary in origin as a result of low net alkali absorption (from a probable relative deficiency of vegetables and fruits or a relative excess of animal proteins).

  11. Cellulose synthase complexes: structure and regulation

    Directory of Open Access Journals (Sweden)

    Lei eLei

    2012-04-01

    Full Text Available This review is to update the most recent progress on characterization of the composition, regulation, and trafficking of cellulose synthase complexes. We will highlight proteins that interact with cellulose synthases, e.g. cellulose synthase-interactive protein 1 (CSI1. The potential regulation mechanisms by which cellulose synthase interact with cortical microtubules in primary cell walls will be discussed.

  12. Identification and expression of isoflavone synthase, the key enzyme for biosynthesis of isoflavones in legumes.

    Science.gov (United States)

    Jung, W; Yu, O; Lau, S M; O'Keefe, D P; Odell, J; Fader, G; McGonigle, B

    2000-02-01

    Isoflavones have drawn much attention because of their benefits to human health. These compounds, which are produced almost exclusively in legumes, have natural roles in plant defense and root nodulation. Isoflavone synthase catalyzes the first committed step of isoflavone biosynthesis, a branch of the phenylpropanoid pathway. To identify the gene encoding this enzyme, we used a yeast expression assay to screen soybean ESTs encoding cytochrome P450 proteins. We identified two soybean genes encoding isoflavone synthase, and used them to isolate homologous genes from other leguminous species including red clover, white clover, hairy vetch, mung bean, alfalfa, lentil, snow pea, and lupine, as well as from the nonleguminous sugarbeet. We expressed soybean isoflavone synthase in Arabidopsis thaliana, which led to production of the isoflavone genistein in this nonlegume plant. Identification of the isoflavone synthase gene should allow manipulation of the phenylpropanoid pathway for agronomic and nutritional purposes. PMID:10657130

  13. Theoretical Study on Sulfur Dioxide Absorption with Citrate Solution

    Institute of Scientific and Technical Information of China (English)

    薛娟琴; 洪涛; 王召启; 李林波

    2006-01-01

    The citrate absorption of SO2 is currently one of the most successful and economic methods to harness sulfur dioxide pollution.In order to theoretically elucidate the mechanism of SO2 absorption by citrate solution and provide theoretical instruction for experiments and industrial process, the theory of multi-buffer solution, combined with computer numerical calculation methods, was applied to study the distribution parameters of the components of the citrate solution in the process of SO2 absorption and the following results were obtained: (1) HCi2- and H2Ci- in the citrate solution played the dominant role in the absorption and desorption processes; (2) Through the calculation for the buffer capacity of citrate solution, it was found that the pH of the absorption and desorption solution should be in the range of 2~8, while at pH=4.5 the buffer capacity reached its maximum. Some valuable parameters were obtained, which are instructive to the ensuing experiments and industrial design.

  14. Electrodeposition of Sn-Zn-Cu alloys from citrate solutions

    International Nuclear Information System (INIS)

    The first stage of this study involves the development of stable baths for electrodepositing Sn-Zn-Cu alloys; these developments are based on thermodynamic models of citrate baths and experiments exploring the stability of the baths. The effects of the sodium citrate (complexation agent) concentration and the pH of the solution on the stability of the baths were examined experimentally. The stability of the baths was determined through spectrophotometric analysis. Stable baths designed for the electrodeposition of Sn-Zn-Cu alloys were produced in the range of dominant citrate complexes with highly negative charge (the reduction process is strongly inhibited by high activation energy). Voltammetric studies and potentiostatic deposition were conducted to analyse the co-deposition of tin, zinc, and copper, and the co-evolution of hydrogen. The effect of the solution pH, the concentration of sodium citrate and the hydrodynamic conditions on the electrodeposition process and the composition of the deposits were examined. The deposits were analysed using chemical (μXRF) as also grain size and phase analysis (X-ray diffraction). The possibility of electrodepositing Sn-Zn-Cu alloys from citrate solutions was confirmed. The tin content of these coatings varied from 60 to 96 wt.%, the copper content varied from 3.5 to 20.5 wt.%, and the zinc content reached up to approximately 37.5 wt.%

  15. 农杆菌介导虎杖芪合酶基因遗传转化壶瓶枣的研究%Agrobacterium-Mediated Transformation of Resveratrol Synthase Gene (PcPKS5) into Huping Jujube (Zizyphus jujuba)

    Institute of Scientific and Technical Information of China (English)

    罗在柒; 郭辉力; 杨亚东; 杨明峰; 马兰青; 王有年

    2015-01-01

    synthase ( STS ) gene, PcPKS5,contains all functionally divergent plant specific type III PKSs and is involved in resveratrol synthesis. The resveratrol synthase genes are expressed in many transgenic crops such as rapeseed and wheat,successfully generating transgenic plants that have enhanced anti-fungal functions. To allow resveratrol accumulation in fruit organs and improve resistance of jujube to fungal pathogens,the PcPKS5 was transformed into Huping jujube under the control of the CaMV 35S promoter,and the obtained transgenic plants were tested if they increased resveratrol accumulation. This study aimed to assess the effects of heterologous overexpression of the resveratrol synthase gene ( PcPKS5 ) in Huping jujube plant resistance and nutritional quality. [Method]Stems with leaves and shoot tips of Huping jujube were infected with agrobacterium carrying PcPKS5 and GUS, and three positive plants were identified. [Result]The PcPKS5 gene previously cloned from Polygonum cuspidatum in our laboratory was amplified in the TOP10 bacterial strain and ligated to the pMD 18-T vector. Two primers were designed based on the gene bank sequence EU647245 and synthesized by Sangon Biotech Shanghai Co. Ltd. to clone the STS gene for plant expression plasmid construction. Agrobacterium strain EHA105 harboring the pCAMBIA3301-121 plasmid with the PcPKS5 genes controlled by the cauliflower mosaic virus ( CaMV) 35S promoter and termination sequences was used as the vector system for transformation. The infection lasted 15 min,a high percentage of GUS positive leaves was observed. The optimized conditions for transformation were 15 min infection and 2 days co-culture in the dark. The control bacterial concentration was OD600 0. 6 as well,and AS was added at 60 mg·L -1 . Experimental result showed that a total of 197 plants regenerated from nearly 20 000 buds were obtained during the glufosinate-ammonium resistance screening. However,only three actual resistant transgenic plants were

  16. 芹菜黄酮合成酶Ⅰ基因的克隆与序列分析%Cloning and sequence analysis of flavone synthase I gene in Apium graveo-lens

    Institute of Scientific and Technical Information of China (English)

    陈逸云; 王枫; 徐志胜; 谭国飞; 李梦瑶; 熊爱生

    2014-01-01

    The flavone synthase I gene (AgFS I), the key gene for flavonoids synthesis, was cloned from Apium graveolens cultivars Liuhehuangxinqin, Jinnanshiqin and Meiguoxiqin, respectively. The length of AgFS I gene was 1 616 bp, containing 359-bp intronⅠ and 190-bp intronⅡ. The AgFS I gene encodes 355 amino acids, belonging to the 20G-FeII Oxy superfamily. There were differences in 5 nucleotide sites and 5 amino acid sites among the three cultivars of Api-um graveolens. Multiple sequence alignment of AgFS Is with FSIs from other plants showed that FSⅠs were highly conser-vative. Phylogenetic tree revealed the AgFS Is had the closest relationship to Daucus carota and Cuminum cyminum, which belong to the Apiaceae. Amino acid sequence analyses indicate that AgFS I belong to the hydrophobic protein. The AgFS Is from three cultivars of Apium graveolens are similar in three dimentional structure.%选用3个芹菜材料六合黄心芹、津南实芹和美国西芹,分别从中克隆了合成黄酮类化合物的关键酶基因---芹菜黄酮合成酶I基因( AgFS I)。该基因全长均为1616 bp,含有359 bp的内含子I和190 bp的内含子II。芹菜AgFS I基因编码355个氨基酸,属于20G-FeII Oxy超级家族。序列分析结果显示,3种芹菜中AgFS I基因在核苷酸水平上有5个碱基的差异,编码的氨基酸有5个位点的差异。芹菜黄酮合成酶I( AgFS I)与其他来源植物的FSI氨基酸多重序列比对分析结果表明,该酶具有高度保守性。对AgFS I进行进化树分析,氨基酸序列的疏水性/亲水性分析,三级结构预测与分析,结果显示AgFS I与同属于伞形科的胡萝卜和孜然芹的FSI进化关系最近, AgFS I属于疏水性蛋白质,3种芹菜AgFS I的空间结构相似。

  17. Loss of LRPPRC causes ATP synthase deficiency.

    Science.gov (United States)

    Mourier, Arnaud; Ruzzenente, Benedetta; Brandt, Tobias; Kühlbrandt, Werner; Larsson, Nils-Göran

    2014-05-15

    Defects of the oxidative phosphorylation system, in particular of cytochrome-c oxidase (COX, respiratory chain complex IV), are common causes of Leigh syndrome (LS), which is a rare neurodegenerative disorder with severe progressive neurological symptoms that usually present during infancy or early childhood. The COX-deficient form of LS is commonly caused by mutations in genes encoding COX assembly factors, e.g. SURF1, SCO1, SCO2 or COX10. However, other mutations affecting genes that encode proteins not directly involved in COX assembly can also cause LS. The leucine-rich pentatricopeptide repeat containing protein (LRPPRC) regulates mRNA stability, polyadenylation and coordinates mitochondrial translation. In humans, mutations in Lrpprc cause the French Canadian type of LS. Despite the finding that LRPPRC deficiency affects the stability of most mitochondrial mRNAs, its pathophysiological effect has mainly been attributed to COX deficiency. Surprisingly, we show here that the impaired mitochondrial respiration and reduced ATP production observed in Lrpprc conditional knockout mouse hearts is caused by an ATP synthase deficiency. Furthermore, the appearance of inactive subassembled ATP synthase complexes causes hyperpolarization and increases mitochondrial reactive oxygen species production. Our findings shed important new light on the bioenergetic consequences of the loss of LRPPRC in cardiac mitochondria. PMID:24399447

  18. Phosphorylation of inhibitor-2 and activation of MgATP-dependent protein phosphatase by rat skeletal muscle glycogen synthase kinase

    International Nuclear Information System (INIS)

    Rat skeletal muscle contains a glycogen synthase kinase (GSK-M) which is not stimulated by Ca2+ or cAMP. This kinase has an apparent Mr of 62,000 and uses ATP but not GTP as a phosphoryl donor. GSK-M phosphorylated glycogen synthase at sites 2 and 3. It phosphorylated ATP-citrate lyase and activated MgATP-dependent phosphatase in the presence of ATP but not GTP. As expected, the kinase also phosphorylated phosphatase inhibitor 2 (I-2). Phosphatase incorporation reached approximately 0.3 mol/mol of I-2. Phosphopeptide maps were obtained by digesting 32P-labeled I-2 with trypsin and separating the peptides by reversed phase HPLC. Two partially separated 32P-labeled peaks were obtained when I-2 was phosphorylated with either GSK-M or glycogen synthase kinase 3 (GSK-3) and these peptides were different from those obtained when I-2 was phosphorylated with the catalytic subunit of cAMP-dependent protein kinase (CSU) or casein kinase II (CK-II). When I-2 was phosphorylated with GSK-M or GSK-3 and cleaved by CNBr, a single radioactive peak was obtained. Phosphoamino acid analysis showed that I-2 was phosphorylated by GSK-M or GSK-3 predominately in Thr whereas CSU and CK-II phosphorylated I-2 exclusively in Ser. These results indicate that GSK-M is similar to GSK-3 and to ATP-citrate lyase kinase. However, it appears to differ in Mr from ATP-citrate lyase kinase and it differs from GSK-3 in that it phosphorylates glycogen synthase at site 2 and it does not use GTP as a phosphoryl donor

  19. Phosphorylation of inhibitor-2 and activation of MgATP-dependent protein phosphatase by rat skeletal muscle glycogen synthase kinase

    Energy Technology Data Exchange (ETDEWEB)

    Hegazy, M.G.; Reimann, E.M.; Thysseril, T.J.; Schlender, K.K.

    1986-05-01

    Rat skeletal muscle contains a glycogen synthase kinase (GSK-M) which is not stimulated by Ca/sup 2 +/ or cAMP. This kinase has an apparent Mr of 62,000 and uses ATP but not GTP as a phosphoryl donor. GSK-M phosphorylated glycogen synthase at sites 2 and 3. It phosphorylated ATP-citrate lyase and activated MgATP-dependent phosphatase in the presence of ATP but not GTP. As expected, the kinase also phosphorylated phosphatase inhibitor 2 (I-2). Phosphatase incorporation reached approximately 0.3 mol/mol of I-2. Phosphopeptide maps were obtained by digesting /sup 32/P-labeled I-2 with trypsin and separating the peptides by reversed phase HPLC. Two partially separated /sup 32/P-labeled peaks were obtained when I-2 was phosphorylated with either GSK-M or glycogen synthase kinase 3 (GSK-3) and these peptides were different from those obtained when I-2 was phosphorylated with the catalytic subunit of cAMP-dependent protein kinase (CSU) or casein kinase II (CK-II). When I-2 was phosphorylated with GSK-M or GSK-3 and cleaved by CNBr, a single radioactive peak was obtained. Phosphoamino acid analysis showed that I-2 was phosphorylated by GSK-M or GSK-3 predominately in Thr whereas CSU and CK-II phosphorylated I-2 exclusively in Ser. These results indicate that GSK-M is similar to GSK-3 and to ATP-citrate lyase kinase. However, it appears to differ in Mr from ATP-citrate lyase kinase and it differs from GSK-3 in that it phosphorylates glycogen synthase at site 2 and it does not use GTP as a phosphoryl donor.

  20. Transmembrane segment (TMS) VIII of the Na+/citrate transporter CitS requires downstream TMS IX for insertion in the Escherichia coli membrane

    NARCIS (Netherlands)

    van Geest, M; Lolkema, JS

    1999-01-01

    The amino acid sequence of the sodium ion-dependent citrate transporter CitS of IL pneumoniae contains 12 hydrophobic stretches that could form membrane-spanning segments. A previous analysis of the membrane topology in Escherichia coli using the PhoA gene fusion technique indicated that only nine o

  1. Alkali absorption and citrate excretion in calcium nephrolithiasis

    Science.gov (United States)

    Sakhaee, K.; Williams, R. H.; Oh, M. S.; Padalino, P.; Adams-Huet, B.; Whitson, P.; Pak, C. Y.

    1993-01-01

    The role of net gastrointestinal (GI) alkali absorption in the development of hypocitraturia was investigated. The net GI absorption of alkali was estimated from the difference between simple urinary cations (Ca, Mg, Na, and K) and anions (Cl and P). In 131 normal subjects, the 24 h urinary citrate was positively correlated with the net GI absorption of alkali (r = 0.49, p mEq/day). Both urinary citrate and net GI alkali absorption increased, yielding a significantly positive correlation (r = 0.62, p reduced citrate excretion was largely dietary in origin as a result of low net alkali absorption (from a probable relative deficiency of vegetables and fruits or a relative excess of animal proteins).

  2. Adaptative biochemical pathways and regulatory networks in Klebsiella oxytoca BAS-10 producing a biotechnologically relevant exopolysaccharide during Fe(III-citrate fermentation

    Directory of Open Access Journals (Sweden)

    Gallo Giuseppe

    2012-11-01

    Full Text Available Abstract Background A bacterial strain previously isolated from pyrite mine drainage and named BAS-10 was tentatively identified as Klebsiella oxytoca. Unlikely other enterobacteria, BAS-10 is able to grow on Fe(III-citrate as sole carbon and energy source, yielding acetic acid and CO2 coupled with Fe(III reduction to Fe(II and showing unusual physiological characteristics. In fact, under this growth condition, BAS-10 produces an exopolysaccharide (EPS having a high rhamnose content and metal-binding properties, whose biotechnological applications were proven as very relevant. Results Further phylogenetic analysis, based on 16S rDNA sequence, definitively confirmed that BAS-10 belongs to K. oxytoca species. In order to rationalize the biochemical peculiarities of this unusual enterobacteriun, combined 2D-Differential Gel Electrophoresis (2D-DIGE analysis and mass spectrometry procedures were used to investigate its proteomic changes: i under aerobic or anaerobic cultivation with Fe(III-citrate as sole carbon source; ii under anaerobic cultivations using Na(I-citrate or Fe(III-citrate as sole carbon source. Combining data from these differential studies peculiar levels of outer membrane proteins, key regulatory factors of carbon and nitrogen metabolism and enzymes involved in TCA cycle and sugar biosynthesis or required for citrate fermentation and stress response during anaerobic growth on Fe(III-citrate were revealed. The protein differential regulation seems to ensure efficient cell growth coupled with EPS production by adapting metabolic and biochemical processes in order to face iron toxicity and to optimize energy production. Conclusion Differential proteomics provided insights on the molecular mechanisms necessary for anaeorobic utilization of Fe(III-citrate in a biotechnologically promising enterobacteriun, also revealing genes that can be targeted for the rational design of high-yielding EPS producer strains.

  3. Molecular evolution of dihydrouridine synthases

    Directory of Open Access Journals (Sweden)

    Kasprzak Joanna M

    2012-06-01

    Full Text Available Abstract Background Dihydrouridine (D is a modified base found in conserved positions in the D-loop of tRNA in Bacteria, Eukaryota, and some Archaea. Despite the abundant occurrence of D, little is known about its biochemical roles in mediating tRNA function. It is assumed that D may destabilize the structure of tRNA and thus enhance its conformational flexibility. D is generated post-transcriptionally by the reduction of the 5,6-double bond of a uridine residue in RNA transcripts. The reaction is carried out by dihydrouridine synthases (DUS. DUS constitute a conserved family of enzymes encoded by the orthologous gene family COG0042. In protein sequence databases, members of COG0042 are typically annotated as “predicted TIM-barrel enzymes, possibly dehydrogenases, nifR3 family”. Results To elucidate sequence-structure-function relationships in the DUS family, a comprehensive bioinformatic analysis was carried out. We performed extensive database searches to identify all members of the currently known DUS family, followed by clustering analysis to subdivide it into subfamilies of closely related sequences. We analyzed phylogenetic distributions of all members of the DUS family and inferred the evolutionary tree, which suggested a scenario for the evolutionary origin of dihydrouridine-forming enzymes. For a human representative of the DUS family, the hDus2 protein suggested as a potential drug target in cancer, we generated a homology model. While this article was under review, a crystal structure of a DUS representative has been published, giving us an opportunity to validate the model. Conclusions We compared sequences and phylogenetic distributions of all members of the DUS family and inferred the phylogenetic tree, which provides a framework to study the functional differences among these proteins and suggests a scenario for the evolutionary origin of dihydrouridine formation. Our evolutionary and structural classification of the DUS

  4. Efficacy of preventing hemodialysis catheter infections with citrate lock.

    Science.gov (United States)

    Silva, Jorge; Antunes, Jorge; Carvalho, Telmo; Ponce, Pedro

    2012-10-01

    Prevalent use of tunneled dialysis catheters can reach 30%. Infection remains the most serious catheter-related problem. Catheter locks are increasingly used for prevention, but are not yet recommended either by the Food and Drug Association or European Medicines Agency, on the basis of increasing bacterial resistance or lock toxicity. The aim was to test safety and effectiveness of citrate. A prospective, interventional study was conducted to assess the safety and efficacy of a 30% citrate lock in preventing catheter-related bacteremia (CRB). A total of 157 prevalent tunneled catheters were locked with citrate and prospectively followed during a 1-year period. The primary endpoint was first CRB diagnosed according to two of the diagnostic criteria for Catheter Infection of Centers for Disease Control and Prevention (CDC), namely definite and probable infection. The CDC criterion of possible but not proved infection was not considered. This citrate lock cohort (n = 157) had 10 episodes of CRB. We observed 0.49 CRB episodes/1000 patient-days and the mean infection-free catheter day was 130.6 ± 100.9. No clinically relevant adverse events were observed. No proved tunnel or exit site infection was observed and no patients died because of CRB. Catheter obstruction episodes were reported on 69 occasions out of 14 catheters. These results were compared with an historical cohort from a previous study of catheter locking with low-dose gentamicin and did not show significant difference in efficacy. Citrate lock is effective in preventing CRB. No toxicity was observed. The use of citrate lock may have advantages over antibiotic locks: no reported bacterial resistance, lower industrial cost, and less manipulation. PMID:22515732

  5. Formation of colloidal silver nanoparticles: Capping action of citrate

    International Nuclear Information System (INIS)

    Colloidal silver sols of long-time stability are formed in the γ-irradiation of 1.0 x 10-4 M AgClO4 solutions, which also contain 0.3 M 2-propanol, 2.5 x 10-2 M N2O, and sodium citrate in various concentrations. The reduction of Ag+ in these solutions is brought about by the 1-hydroxyalkyl radical generated in the radiolysis of 2-propanol; citrate does not act as a reductant but solely as a stabilizer of the colloidal particles formed. Its concentration is varied in the range from 5.0 x 10-5 to 1.5 x 10-3 M, and the size and size distribution of the silver particles are studied by electron microscopy. At low citrate concentration, partly agglomerated large particles are formed that have many imperfections. In an intermediate range (a few 10-4 M), well-separated particles with a rather narrow size distribution and little imperfections are formed, the size slightly decreasing with increasing citrate concentration. At high citrate concentrations, large lumps of coalesced silver particles are present, due to destabilization by the high ionic strength of the solution. These findings are explained by two growth mechanisms: condensation of small silver clusters (type-1 growth), and reduction of Ag+ on silver particles via radical-to-particle electron transfer (type-2 growth). The particles formed in the intermediate range of citrate concentration were studied by high-resolution electron microscopy and computer simulations. They constitute icosahedra and cuboctahedra

  6. Effect of sildenafil citrate on penile erection of rhesus macaques

    Institute of Scientific and Technical Information of China (English)

    Xun-BinHuang; Cheng-LiangXiong; Cheng-GaoYu; Jie-LingZhou; Ji-YunShen

    2004-01-01

    Aim: To examine the effect of sildenafil citrate on penile erection of male rhesus macaque. Methods:Twenty Macaca mulatta were divided into the sildenafil treated and the control groups of l0 animals each. The penile size, the corpus cavernosal electromyogram (EMG) and the intra-corpus cavernosal pressure (ICP) were determined. Results: The diameter of penis and the ICP were significantly increased and the corpus cavernosal EMG significantly reduced in the sildenafil group. Conclusion: Sildenafil citrate increases the penile size and ICP and reduces the corpus cavernosal EMG in male rhesus macaque. (Asian J Androl 2004 Sep; 6: 233-235)

  7. Gastric fluid pH in patients receiving sodium citrate.

    Science.gov (United States)

    Viegas, O J; Ravindran, R S; Shumacker, C A

    1981-07-01

    Gastric fluid pH was measured following induction of anesthesia and placement of an endotracheal tube in 30 surgical patients undergoing elective operations. None of the patients received an anticholinergic drug before surgery. Fifteen patients who had been given 15 ml of sodium citrate 15 to 20 minutes before induction of anesthesia had a mean pH of 6.2 +/- 0.8. The control group, which also consisted of 15 patients, had a mean pH of 2.1 +/- 1.4. The increase in gastric pH noted following sodium citrate would result in reduced pulmonary reaction should aspiration occur. PMID:7195668

  8. Co‑expression of the carbamoyl‑phosphate synthase 1 gene and its long non‑coding RNA correlates with poor prognosis of patients with intrahepatic cholangiocarcinoma.

    Science.gov (United States)

    Ma, Sen-Lin; Li, Ai-Jun; Hu, Zhao-Yang; Shang, Fu-Sheng; Wu, Meng-Chao

    2015-12-01

    The mechanisms leading to high rates of malignancy and recurrence of human intrahepatic cholangiocarcinoma (ICC) remain unclear. It is difficult to diagnose and assess the prognosis of patients with ICC in the clinic due to the lack of specific biomarkers. In addition, long non‑coding RNAs (lncRNAs) have been reported to serve important roles in certain types of tumorigenesis however a role in ICC remains to be reported. The aim of the current study was to screen for genes and lncRNAs that are abnormally expressed in ICC and to investigate their biological and clinicopathological significance in ICC. The global gene and lncRNA expression profiles in ICC were measured using bioinformatics analysis. Carbamoyl‑phosphate synthase 1 (CPS1) and its lncRNA CPS1 intronic transcript 1 (CPS1‑IT1) were observed to be upregulated in ICC. The expression of CPS1 and CPS1‑IT1 was measured in 31 tissue samples from patients with ICC and a number of cell lines. The effects of CPS1 and CPS1‑IT1 on the proliferation and apoptosis of the ICC‑9810 cell line were measured. In addition, the clinicopathological features and survival rates of patients with ICC with respect to the gene and lncRNA expression status were analyzed. CPS1 and CPS1‑IT1 were co‑upregulated in ICC tissues compared with non‑cancerous tissues. Knockdown of CPS1 andor CPS1‑IT1 reduced the proliferation and increased the apoptosis of ICC‑9810 cells. Additionally, clinical analysis indicated that CPS1 and CPS1‑IT1 were associated with poor liver function and reduced survival rates when the relative expression values were greater than 4 in cancer tissues. The comparisons between the high CPS1 expression group and the low expression group indicated significant differences in international normalized ratio (P=0.048), total protein (P=0.049), indirect bilirubin (P=0.025), alkaline phosphatase (P=0.003) and disease‑free survival (P=0.034). In addition, there were differential trends in CA19‑9

  9. An Unusual Chimeric Diterpene Synthase from Emericella variecolor and Its Functional Conversion into a Sesterterpene Synthase by Domain Swapping.

    Science.gov (United States)

    Qin, Bin; Matsuda, Yudai; Mori, Takahiro; Okada, Masahiro; Quan, Zhiyang; Mitsuhashi, Takaaki; Wakimoto, Toshiyuki; Abe, Ikuro

    2016-01-01

    Di- and sesterterpene synthases produce C20 and C25 isoprenoid scaffolds from geranylgeranyl pyrophosphate (GGPP) and geranylfarnesyl pyrophosphate (GFPP), respectively. By genome mining of the fungus Emericella variecolor, we identified a multitasking chimeric terpene synthase, EvVS, which has terpene cyclase (TC) and prenyltransferase (PT) domains. Heterologous gene expression in Aspergillus oryzae led to the isolation of variediene (1), a novel tricyclic diterpene hydrocarbon. Intriguingly, in vitro reaction with the enzyme afforded the new macrocyclic sesterterpene 2 as a minor product from dimethylallyl pyrophosphate (DMAPP) and isopentenyl pyrophosphate (IPP). The TC domain thus produces the diterpene 1 and the sesterterpene 2 from GGPP and GFPP, respectively. Notably, a domain swap of the PT domain of EvVS with that of another chimeric sesterterpene synthase, EvSS, successfully resulted in the production of 2 in vivo as well. Cyclization mechanisms for the production of these two compounds are proposed. PMID:26546087

  10. Engineering of the aspartate family biosynthetic pathway in barley (Hordeum vulgare L.) by transformation with heterologous genes encoding feed-back-insensitive aspartate kinase and dihydrodipicolinate synthase

    DEFF Research Database (Denmark)

    Brinch-Pedersen, Henrik; Galili, G; Knudsen, S;

    1996-01-01

    In prokaryotes and plants the synthesis of the essential amino acids lysine and threonine is predominantly regulated by feed-back inhibition of aspartate kinase (AK) and dihydrodipicolinate synthase (DHPS). In order to modify the flux through the aspartate family pathway in barley and enhance the...

  11. Hemodiafiltration using pre-dilutional on-line citrate dialysate: A new technique for regional citrate anticoagulation: A feasibility study

    Directory of Open Access Journals (Sweden)

    Radhouane Bousselmi

    2015-01-01

    Full Text Available A prospective, observational, feasibility study was carried out on four patients with end-stage renal failure undergoing bicarbonate hemodialysis to study the feasibility of an on-line hemodiafiltration technique using a citrate dialysate with pre-dilutional infusion of citrate as a technique for regional citrate anticoagulation. All patients had contraindication to systemic heparin anticoagulation. The dialysis technique consisted of an on-line hemodiafiltration with a citrate dialysate without calcium using a Fresenius 4008S dialysis machine and Fresenius Polysulfone F60 dialyzers. The infusion solution was procured directly from the dialysate and was infused into the arterial line. To avoid the risk of hypocalcemia, calcium gluconate was infused to the venous return line. The study was carried out in two stages. During the first stage, the citrate infusion rate was 80 mL/min and the calcium infusion rate was 9 mmol/h. At the second stage, the rates were 100 mL/min and 11 mmol/h, respectively. The primary endpoint of this study was the incidence of thrombosis in the extracorporeal blood circuit and/or the dialyzer. A total of 78 sessions were conducted. All the sessions were well tolerated clinically and there were no major incidents in any of the four patients. At the first stage of the study, there were five incidences of small clots in the venous blood chamber, an incidence of extracorporeal blood circuit thrombosis of 12.5%. At the second stage of the study, no cases of extracorporeal blood circuit or dialyzer thrombosis were noted. Hemodiafiltration with on-line citrate dialysate infusion to the arterial line is safe and allows an effective regional anticoagulation of the extracorporeal blood circuit without the need for systemic anticoagulation.

  12. Heterologous expression of pentalenene synthase (PSS) from Streptomyces UC5319 in Xanthophyllomyces dendrorhous

    NARCIS (Netherlands)

    Melillo, Elena; Muntendam, Remco; Quax, Wim J.; Kayser, Oliver

    2012-01-01

    For the first time, the pentalenene synthase (PSS) gene from Streptomyces UC5319 was expressed in Xanthophyllomyces dendrorhous, a native producer of astaxanthin. For the expression of the gene and the concurrent knock out of the native crtE or crtYB genes, two new vectors were engineered and used f

  13. Ferric Citrate Controls Phosphorus and Delivers Iron in Patients on Dialysis

    OpenAIRE

    Lewis, Julia B.; Sika, Mohammed; Koury, Mark J.; Chuang, Peale; Schulman, Gerald; Smith, Mark T.; Whittier, Frederick C.; Linfert, Douglas R.; Galphin, Claude M.; Athreya, Balaji P.; Nossuli, A. Kaldun Kaldun; Chang, Ingrid J.; Blumenthal, Samuel S.; Manley, John; Zeig, Steven

    2014-01-01

    Patients on dialysis require phosphorus binders to prevent hyperphosphatemia and are iron deficient. We studied ferric citrate as a phosphorus binder and iron source. In this sequential, randomized trial, 441 subjects on dialysis were randomized to ferric citrate or active control in a 52-week active control period followed by a 4-week placebo control period, in which subjects on ferric citrate who completed the active control period were rerandomized to ferric citrate or placebo. The primary...

  14. Polymeric architectures of bismuth citrate based on dimeric building blocks

    Institute of Scientific and Technical Information of China (English)

    2010-01-01

    Four bismuth complexes, (H2En)[Bi2(cit)2(H2O)4/3]·(H2O)x (1), (H2En)3[Bi2(cit)2Cl4]·(H2O)x (2), (HPy)2[Bi2(cit)2(H2O)8/5]·(H2O)x (3) and (H2En)[Bi2(cit)2](H2O)x (4) [cit = citrate4-; En = ethylenediamine; Py = pyridine] have been synthesized and crystallized. The crystal structures reveal that the basic building blocks in all of these complexes are bismuth citrate dimeric units which combine to form polymeric architectures. The embedded protonated ethylenediamine and pyridine moieties in the polymeric frameworks have been identified by X-ray crystallography and solid-state cross polarization/magic angle spinning (CP/MAS) 13C NMR. Based on the framework of complex 1, a structural model of a clinically used antiulcer drug, ranitidine bismuth citrate (RBC) was generated. The behavior of the protonated amine-bismuth citrate complexes in acidic aqueous solution has been studied by electrospray ionization-mass spectrometry (ESI-MS).

  15. Tumour imaging using technetium-99m-citrate

    International Nuclear Information System (INIS)

    Sixteen patients with soft tissue malignancy or fibroadenoma of the breast (Group A) were imaged using 99mTc-citrate. Majority of the patients (n=14) has new untreated lesions. Appreciable skeletal uptake of the tracer was serendipitously noticed in all cases. One of these had widespread bone metastases seen almost identically in 99mTc-citrate and 99mTc-MDP studies. Accordingly, 10 patients (Group B) having more than 40 malignant lesions on the bone scan underwent 99mTc-citrate study. In group A, accumulation of the tracer was seen in all malignant breast nodules and axillary lymphnode mass (n=4), medullary carcinoma of the thyroid along with its metastasis and a carcinoid (n=4) and an ovarian malignancy. Uptake and outflow pattern could differentiate fibroadenoma (n=3) from carcinoma of the breast. No significant uptake was seen in liver secondaries (n>10), lymphoma lesions (n=5), papillary carcinoma of thyroid, renal cell and embryonal cell carcinoma. In group B patients, the radiotracer accumulated well in the metastatic lesions while there was distinctly lesser uptake in normal/degenerated joints compared to the bone scan. The study shows potential of the tracer in imaging soft tissue malignancies. Bone scanning with 99mTc-citrate is an interesting possibility since mechanism of its uptake appears to be different to 99mTc-MDP. (author)

  16. {sup 14}N NQR spectrum of sildenafil citrate

    Energy Technology Data Exchange (ETDEWEB)

    Stephenson, David, E-mail: david.stephenson@sta.uwi.edu; Singh, Nadia [University of the West Indies, Chemistry Department (Trinidad and Tobago)

    2015-04-15

    The {sup 14}N nuclear quadrupole resonance (NQR) spectrum of sildenafil citrate tablets has been recorded allowing the quadrupole coupling constants and asymmetry parameters of all six unique nitrogen atoms in its structure to be determined. A density function calculation gives results that are largely in agreement with the experimental values.

  17. (捺)果实中花青素合成酶基因PsANS的克隆及原核表达分析%Identification and Prokaryotic Expression of Anthocyanidin Synthase Gene in Prunus salicina

    Institute of Scientific and Technical Information of China (English)

    姜翠翠; 陈桂信; 潘东明; 吕恃衡

    2011-01-01

    A cDNA encoded anthocyanidin synthase(ANS)was separated from a normalization and full-length cDNA library prepared previously with the ripe fruit of 'oil Lai' (Primus salicina)by gene special primers designed from ANS genes of other Rosaceae plants. The cDNA named PsANS was 1 478 bp in full length and encoded a protein with 358 amino acids. The deduced amino acid sequence shares 98%, 93% and 89% identity with those ANS from sweet cherry, apple and strawberry, respectively. Prokaryotic expression was conducted with the constructed vectors used PsANS and prokaryotic expression vector(pGEX-6P-l and pET-32a)in E.coli BL21. The obtained fusion protein had a molecular weight consistent with that expected, and it further confirmed that the PsANS obtained by this experiment encoded ANS of 'oil Lai'(Prunus salicina).%根据NCBI数据库中已知的蔷薇科植物花青素合成酶基因序列设计特异引物,从本实验室已经构建好的(捺)成熟果实均一化全长cDNA文库中筛选分离得到了一个编码花青素合成酶的cDNA:基因命名为PsA NS,登录号:JN560957.该cDNA长1 478 bp,包含137 bp 5′非编码区,267 bp 3′非编码区,开放阅读框长度为1 074 bp.PsA NS编码358个氨基酸,分子量为40.41 ku,理论等电点为5.35.经BLAST分析对比发现,PsA NS氨基酸序列与甜樱桃、苹果和草莓的ANS氨基酸同源性都很高,分别为98%、93%和89%.将PsA NS亚克隆到原核表达载体pGEX-6P-1和pET-32a上,在大肠杆菌BL21中经1mmol/LITPG诱导表达获得了(捺)PsA NS融合表达蛋白,其分子量大小与预期的一致,进一步确认本试验克隆得到的PsA NS为(捺)花青素合成酶基因.

  18. Enzyme Basis for pH Regulation of Citrate and Pyruvate Metabolism by Leuconostoc oenos

    NARCIS (Netherlands)

    Ramos, Ana; Lolkema, Juke S.; Konings, Wilhelmus; Santos, Helena

    1995-01-01

    Citrate and pyruvate metabolism by nongrowing cells of Leuconostoc oenos was investigated. 13C nuclear magnetic resonance (NMR) spectroscopy was used to elucidate the pathway of citrate breakdown and to probe citrate or pyruvate utilization, noninvasively, in living cell suspensions. The utilization

  19. 76 FR 19997 - Determination That FENTORA (Fentanyl Citrate) Buccal Tablet, 300 Micrograms, Was Not Withdrawn...

    Science.gov (United States)

    2011-04-11

    ... HUMAN SERVICES Food and Drug Administration Determination That FENTORA (Fentanyl Citrate) Buccal Tablet... determined that FENTORA (fentanyl citrate) buccal tablet, 300 micrograms (mcg), was not withdrawn from sale... drug applications (ANDAs) for fentanyl citrate buccal tablet, 300 mcg, if all other legal...

  20. Molecular cloning and functional expression of geranylgeranyl pyrophosphate synthase from Coleus forskohlii Briq

    Directory of Open Access Journals (Sweden)

    Kawamukai Makoto

    2004-11-01

    Full Text Available Abstract Background Isopentenyl diphosphate (IPP, a common biosynthetic precursor to the labdane diterpene forskolin, has been biosynthesised via a non-mevalonate pathway. Geranylgeranyl diphosphate (GGPP synthase is an important branch point enzyme in terpenoid biosynthesis. Therefore, GGPP synthase is thought to be a key enzyme in biosynthesis of forskolin. Herein we report the first confirmation of the GGPP synthase gene in Coleus forskohlii Briq. Results The open reading frame for full-length GGPP synthase encodes a protein of 359 amino acids, in which 1,077 nucleotides long with calculated molecular mass of 39.3 kDa. Alignments of C. forskohlii GGPP synthase amino acid sequences revealed high homologies with other plant GGPP synthases. Several highly conserved regions, including two aspartate-rich motifs were identified. Transient expression of the N-terminal region of C. forskohlii GGPP synthase-GFP fusion protein in tobacco cells demonstrated subcellular localization in the chloroplast. Carotenoid production was observed in Escherichia coli harboring pACCAR25ΔcrtE from Erwinia uredovora and plasmid carrying C. forskohlii GGPP synthase. These results suggested that cDNA encoded functional GGPP synthase. Furthermore, C. forskohlii GGPP synthase expression was strong in leaves, decreased in stems and very little expression was observed in roots. Conclusion This investigation proposed that forskolin was synthesised via a non-mevalonate pathway. GGPP synthase is thought to be involved in the biosynthesis of forskolin, which is primarily synthesised in the leaves and subsequently accumulates in the stems and roots.

  1. 一个新高产青蒿倍半萜合酶基因的克隆、表达和分析%Cloning, E. coli Expression and Molecular Analysis of a Novel Sesquiterpene Synthase Gene from Artemisia annua

    Institute of Scientific and Technical Information of China (English)

    刘彦; 叶和春; 李国凤

    2002-01-01

    A 1 886 bp full-length sesquiterpene synthase (AaSES) cDNA was cloned from a high-yield Artemisia annua L. strain 001 by a rapid amplification of cDNA end (RACE) strategy. AaSES is 59% identical to Artemisia cyclase cDNA clone cASC125, 50% identical to epi-cedrol synthase from A. annua, 48% identical to amorpha-4, 11-diene synthase from A. annua, 39% identical to the 5-epi-aristolechene synthase from tabacco, 38% identical to vetispiradiene synthase from H. muticus, 41% identical to the δ-cadinene synthase from cotton. The coding region of the cDNA was inserted into a procaryotic expression vector pET-30a and overexpressed in E. coli BL21(DE3). The cyclase proteins extracted from bacterial culture were found largely in an insoluble protein fraction. AaSES expresses in leaves, stems and flowers, not in roots as indicated by Northern blotting analysis.%用RACE方法从青蒿(Artemisia annua L.)高产株系001中克隆了一个新的1 886 bp的全长倍半萜合酶cDNA.克隆的倍半萜合酶氨基酸序列与烟草马兜铃烯合酶、莨菪岩兰螺旋二烯合酶、棉花杜松烯合酶的一致性分别为39%、38%和41%;与青蒿柏木脑合酶、紫穗槐二烯合酶和一个推测的倍半萜合酶克隆cASC125的一致性为50%、48%和59%.cDNA编码区序列被克隆进原核表达载体pET-30a,并在大肠杆菌(Escherichia coli)BL21(DE3)中诱导表达,但过量表达的蛋白主要是以不溶性蛋白形式存在.Northern blotting分析表明此基因在茎、叶和花中表达,在根中没有表达.

  2. Gene Expression Response of Trichophyton rubrum during Coculture on Keratinocytes Exposed to Antifungal Agents

    Science.gov (United States)

    Komoto, Tatiana Takahasi; Bitencourt, Tamires Aparecida; Silva, Gabriel; Beleboni, Rene Oliveira; Marins, Mozart; Fachin, Ana Lúcia

    2015-01-01

    Trichophyton rubrum is the most common causative agent of dermatomycoses worldwide, causing infection in the stratum corneum, nails, and hair. Despite the high prevalence of these infections, little is known about the molecular mechanisms involved in the fungal-host interaction, particularly during antifungal treatment. The aim of this work was to evaluate the gene expression of T. rubrum cocultured with keratinocytes and treated with the flavonoid trans-chalcone and the glycoalkaloid α-solanine. Both substances showed a marked antifungal activity against T. rubrum strain CBS (MIC = 1.15 and 17.8 µg/mL, resp.). Cytotoxicity assay against HaCaT cells produced IC50 values of 44.18 to trans-chalcone and 61.60 µM to α-solanine. The interaction of keratinocytes with T. rubrum conidia upregulated the expression of genes involved in the glyoxylate cycle, ergosterol synthesis, and genes encoding proteases but downregulated the ABC transporter TruMDR2 gene. However, both antifungals downregulated the ERG1 and ERG11, metalloprotease 4, serine proteinase, and TruMDR2 genes. Furthermore, the trans-chalcone downregulated the genes involved in the glyoxylate pathway, isocitrate lyase, and citrate synthase. Considering the urgent need for more efficient and safer antifungals, these results contribute to a better understanding of fungal-host interactions and to the discovery of new antifungal targets. PMID:26257814

  3. Gene Expression Response of Trichophyton rubrum during Coculture on Keratinocytes Exposed to Antifungal Agents

    Directory of Open Access Journals (Sweden)

    Tatiana Takahasi Komoto

    2015-01-01

    Full Text Available Trichophyton rubrum is the most common causative agent of dermatomycoses worldwide, causing infection in the stratum corneum, nails, and hair. Despite the high prevalence of these infections, little is known about the molecular mechanisms involved in the fungal-host interaction, particularly during antifungal treatment. The aim of this work was to evaluate the gene expression of T. rubrum cocultured with keratinocytes and treated with the flavonoid trans-chalcone and the glycoalkaloid α-solanine. Both substances showed a marked antifungal activity against T. rubrum strain CBS (MIC = 1.15 and 17.8 µg/mL, resp.. Cytotoxicity assay against HaCaT cells produced IC50 values of 44.18 to trans-chalcone and 61.60 µM to α-solanine. The interaction of keratinocytes with T. rubrum conidia upregulated the expression of genes involved in the glyoxylate cycle, ergosterol synthesis, and genes encoding proteases but downregulated the ABC transporter TruMDR2 gene. However, both antifungals downregulated the ERG1 and ERG11, metalloprotease 4, serine proteinase, and TruMDR2 genes. Furthermore, the trans-chalcone downregulated the genes involved in the glyoxylate pathway, isocitrate lyase, and citrate synthase. Considering the urgent need for more efficient and safer antifungals, these results contribute to a better understanding of fungal-host interactions and to the discovery of new antifungal targets.

  4. Valencene synthase from the heartwood of Nootka cypress (Callitropsis nootkatensis) for biotechnological production of valencene.

    Science.gov (United States)

    Beekwilder, Jules; van Houwelingen, Adèle; Cankar, Katarina; van Dijk, Aalt D J; de Jong, René M; Stoopen, Geert; Bouwmeester, Harro; Achkar, Jihane; Sonke, Theo; Bosch, Dirk

    2014-02-01

    Nootkatone is one of the major terpenes in the heartwood of the Nootka cypress Callitropsis nootkatensis. It is an oxidized sesquiterpene, which has been postulated to be derived from valencene. Both valencene and nootkatone are used for flavouring citrus beverages and are considered among the most valuable terpenes used at commercial scale. Functional evaluation of putative terpene synthase genes sourced by large-scale EST sequencing from Nootka cypress wood revealed a valencene synthase gene (CnVS). CnVS expression in different tissues from the tree correlates well with nootkatone content, suggesting that CnVS represents the first dedicated gene in the nootkatone biosynthetic pathway in C. nootkatensis The gene belongs to the gymnosperm-specific TPS-d subfamily of terpenes synthases and its protein sequence has low similarity to known citrus valencene synthases. In vitro, CnVS displays high robustness under different pH and temperature regimes, potentially beneficial properties for application in different host and physiological conditions. Biotechnological production of sesquiterpenes has been shown to be feasible, but productivity of microbial strains expressing valencene synthase from Citrus is low, indicating that optimization of valencene synthase activity is needed. Indeed, expression of CnVS in Saccharomyces cerevisiae indicated potential for higher yields. In an optimized Rhodobacter sphaeroides strain, expression of CnVS increased valencene yields 14-fold to 352 mg/L, bringing production to levels with industrial potential. PMID:24112147

  5. Characterization of three novel isoprenyl diphosphate synthases from the terpenoid rich mango fruit.

    Science.gov (United States)

    Kulkarni, Ram; Pandit, Sagar; Chidley, Hemangi; Nagel, Raimund; Schmidt, Axel; Gershenzon, Jonathan; Pujari, Keshav; Giri, Ashok; Gupta, Vidya

    2013-10-01

    Mango (cv. Alphonso) is popular due to its highly attractive, terpenoid-rich flavor. Although Alphonso is clonally propagated, its fruit-flavor composition varies when plants are grown in different geo-climatic zones. Isoprenyl diphosphate synthases catalyze important branch-point reactions in terpenoid biosynthesis, providing precursors for common terpenoids such as volatile terpenes, sterols and carotenoids. Two geranyl diphosphate synthases and a farnesyl diphosphate synthase were isolated from Alphonso fruits, cloned for recombinant expression and found to produce the respective products. Although, one of the geranyl diphosphate synthases showed high sequence similarity to the geranylgeranyl diphosphate synthases, it did not exhibit geranylgeranyl diphosphate synthesizing activity. When modeled, this geranyl diphosphate synthase and farnesyl diphosphate synthase structures were found to be homologous with the reference structures, having all the catalytic side chains appropriately oriented. The optimum temperature for both the geranyl diphosphate synthases was 40 °C and that for farnesyl diphosphate synthase was 25 °C. This finding correlated well with the dominance of monoterpenes in comparison to sesquiterpenes in the fruits of Alphonso mango in which the mesocarp temperature is higher during ripening than development. The absence of activity of these enzymes with the divalent metal ion other than Mg(2+) indicated their adaptation to the Mg(2+) rich mesocarp. The typical expression pattern of these genes through the ripening stages of fruits from different cultivation localities depicting the highest transcript levels of these genes in the stage preceding the maximum terpene accumulation indicated the involvement of these genes in the biosynthesis of volatile terpenes. PMID:23911730

  6. 土壤宏基因组文库的构建及格尔德霉素类PKS基因的初步筛选%Construction of a soil metagenomic library and preliminary screening of geldanamycin-like type-I polyketide synthase gene

    Institute of Scientific and Technical Information of China (English)

    林灵; 陈菲菲; 王以光; 赫卫清; 王相晶

    2011-01-01

    目的 构建土壤宏基因组文库并对格尔德霉素类I型聚酮合系(polyketide synthase,PKS)基因进行初步筛选研究.方法 直接提取土壤样品中宏基因组DNA,以Fosmid为载体,构建宏基因组文库.根据格尔德霉素的I型PKS基因的保守序列设计引物,使用菌落PCR方法直接筛选所获得的宏基因组文库.结果 成功构建了土壤宏基因组文库,获得约6800个克隆子,其平均插入片段在25kb以上,覆盖至少170Mb的基因组信息.通过PKS基因筛选,获得了新的PKS基因片段.结论 本文报道了土壤宏基因组文库的成功构建,并为利用宏基因组技术寻找新的聚酮类次级代谢产物的生物合成基因,以便于其异源表达或组合生物合成新的聚酮类次级代谢产物奠定基础.%Objective Construction of a soil metagenomic library and preliminary screening of geldanamycinlike type-Ⅰ polyketide synthase genes.Methods A metagenomic library was constructed by inserting the metagenomic DNA directly extracted from soil into Fosmid vector, and then transduced into E.coli EPI300.The primers for screening polyketide synthase (PKS) genes were designed according to the conserved region of geldanamycin type Ⅰ PKS genes.Colony-PCR was performed for screening the metagenomic library.Results A soil metagenomic library was constructed successfully, which was consisted of about 6800 clones containing over 25kb inserted exogenous DNA on average, and covered almost 170Mb genomic information.And a new PKS gene fragment was obtained by screening from metagenomic library.Conclusion The strategy for finding novel PKS gene using metagenomic-technology was reported in this study and could facilitate to heterologous expressing or combinatorial biosynthesis of novel polyketide secondary metabolites.

  7. Mycocerosic acid synthase exemplifies the architecture of reducing polyketide synthases.

    Science.gov (United States)

    Herbst, Dominik A; Jakob, Roman P; Zähringer, Franziska; Maier, Timm

    2016-03-24

    Polyketide synthases (PKSs) are biosynthetic factories that produce natural products with important biological and pharmacological activities. Their exceptional product diversity is encoded in a modular architecture. Modular PKSs (modPKSs) catalyse reactions colinear to the order of modules in an assembly line, whereas iterative PKSs (iPKSs) use a single module iteratively as exemplified by fungal iPKSs (fiPKSs). However, in some cases non-colinear iterative action is also observed for modPKSs modules and is controlled by the assembly line environment. PKSs feature a structural and functional separation into a condensing and a modifying region as observed for fatty acid synthases. Despite the outstanding relevance of PKSs, the detailed organization of PKSs with complete fully reducing modifying regions remains elusive. Here we report a hybrid crystal structure of Mycobacterium smegmatis mycocerosic acid synthase based on structures of its condensing and modifying regions. Mycocerosic acid synthase is a fully reducing iPKS, closely related to modPKSs, and the prototype of mycobacterial mycocerosic acid synthase-like PKSs. It is involved in the biosynthesis of C20-C28 branched-chain fatty acids, which are important virulence factors of mycobacteria. Our structural data reveal a dimeric linker-based organization of the modifying region and visualize dynamics and conformational coupling in PKSs. On the basis of comparative small-angle X-ray scattering, the observed modifying region architecture may be common also in modPKSs. The linker-based organization provides a rationale for the characteristic variability of PKS modules as a main contributor to product diversity. The comprehensive architectural model enables functional dissection and re-engineering of PKSs. PMID:26976449

  8. Functional analysis of the cellulose synthase-like genes CSLD1, CSLD2 and CSLD4 in tip-growing arabidopsis cells

    DEFF Research Database (Denmark)

    Bernal Giraldo, Adriana Jimena; Yoo, Cheol-Min; Mutwil, Marek;

    2008-01-01

    A reverse genetic approach was used to investigate the functions of three members of the cellulose synthase superfamily in Arabidopsis (Arabidopsis thaliana), CELLULOSE SYNTHASE-LIKE D1 (CSLD1), CSLD2, and CSLD4. CSLD2 is required for normal root hair growth but has a different role from that...... previously described for CSLD3 (KOJAK). CSLD2 is required during a later stage of hair development than CSLD3, and CSLD2 mutants produce root hairs with a range of abnormalities, with many root hairs rupturing late in development. Remarkably, though, it was often the case that in CSLD2 mutants, tip growth...... would resume after rupturing of root hairs. In silico, semiquantitative reverse transcription-polymerase chain reaction, and promoter-reporter construct analyses indicated that the expression of both CSLD2 and CSLD3 is elevated at reduced temperatures, and the phenotypes of mutants homozygous for...

  9. Microsatellite instability and the association with plasma homocysteine and thymidylate synthase in colorectal cancer

    DEFF Research Database (Denmark)

    Jensen, Lars Henrik; Lindebjerg, Jan; Crüger, Dorthe G.;

    2008-01-01

    The possible associations between microsatellite instability, homocysteine and thymidylate synthase were investigated in tumors and plasma from 130 patients with colorectal cancer. Other analyses included thymidylate synthase and 5,10-methylene-tetrahydrofolate reductase gene polymorphisms......, carcinoembryonic antigen, vitamin B12, and folate. Microsatellite instability of tumors was associated with higher levels of plasma homocysteine (p = 0.008) and higher protein expression of thymidylate synthase (p ... factors. CEA was not associated with neither homocysteine nor microsatellite instability. The data suggests that there is a more pronounced methyl unit deficiency in microsatellite instable tumors....

  10. Metformin-clomiphene citrate vs. clomiphene citrate alone: Polycystic ovarian syndrome

    Directory of Open Access Journals (Sweden)

    Aqueela Ayaz

    2013-01-01

    Full Text Available Background: Polycystic ovary syndrome (PCOS is the commonest endocrinopathy in women that is associated with reproductive and metabolic disorders. Objectives: We compared the ovulation and conception rates after the treatment with clomiphene citrate (CC alone and in combination with metformin in infertile patients presented with polycystic ovarian syndrome (PCOS. Materials and Methods: This randomized controlled trial of independent cases and controls was conducted at the Department of Obstetrics and Gynecology, Hera General Hospital, Makkah, Saudi Arabia from February 01 to December 31, 2008. The 42 subjects diagnosed as PCOS were divided into group A and B (21 subjects in each for management with CC + metformin and CC alone, respectively. Group A received 500 mg three times a day of metformin continuously from the first cycle for 6 months or till pregnancy was confirmed. In both groups CC was started at a dose of 50 mg from day-2 till day-6 of the menstrual cycle. The dose of CC was increased to 100 mg in second and 150 mg in third cycle, and then remained 150 mg for the remaining three cycles. With ovulation the dose of CC was unaltered in both groups. Data were analyzed using Statistical Package for the Social Sciences (SPSS version 16. Results: More than 50% females in both groups were had body mass index > 25. Group A achieved high rate of regular cycles, ovulation success, and conception than group B (71.4% vs. 38.1%; P = 0.03, (76.2% vs. 38.1%; P = 0.021, and (66.6% vs. 28.6%; P = 0.01, respectively. Conclusion: Management with metformin + CC increased the ovulation and conception rates.

  11. IMPROVING HEAVY METAL TOLERANCE OF YEAST BY TRANSFERRING A PHYTOCHELATIN SYNTHASE GENE FROM GARLIC%大蒜植物络合素合酶基因转化对酵母重金属抗性的提高

    Institute of Scientific and Technical Information of China (English)

    姜瑛楠; 冯保民; 张海燕; 麻密

    2005-01-01

    重金属污染是全球面临的亟待解决的生态问题.利用植物对重金属的富集作用来清除环境重金属污染即植物修复已成为重要的环境生物技术之一.这一技术的长远发展有赖于在重金属富集或耐受中起关键作用的基因的克隆和应用.植物络合素是植物体内一类重要的对重金属起螯合作用的多肽,其合成受植物络合素合酶的催化.该文取得了如下研究结果:1)通过原子吸收测定表明,在大蒜(Allium sativum)的根部可以积累3 000mg·kg-1的重金属镉;2)将克隆的大蒜植物络合素合酶基因(AsPCS)置于酵母表达启动子之下,构建酵母表达载体,并将其分别转入了因CUP1和acr3基因缺失而对重金属镉和砷敏感的酵母突变体菌株后,发现来自大蒜的AsPCS基因的表达使酵母CUP1缺失菌株对镉的耐受性提高了4倍,acr3缺失菌株对砷的耐受性提高了两倍;3)表达AsPCS基因酵母的生长模式证实了AsPCS基因的表达是酵母对重金属耐受性提高的原因.这些结果暗示,大蒜植物络合素合酶基因在大蒜对重金属的抗性及大蒜根部对镉的积累中起关键作用,可作为重要的基因元件应用到修复污染的植物基因工程中.%Remediation of soils contaminated by heavy metals is one of the most pressing environmental prob-lems facing the biosphere. Phytoremediation is a new biotechnique to clean environmental pollutants by plants,including heavy metals. In the long term, major improvements in phytoremediation will rely on the isolationand application of the genes from various plant, bacteria, and animal sources that can enhance metal accumu-lation. Phytochelatin is a type of polypeptide that combines heavy metals in plants, and its synthesis is regulat-ed by phytochelatin synthesase (PC synthase). In this study, we determined that the roots of garlic (Alliumgarlic (AsPCS) was constructed and transferred into heavy metal sensitive yeast mutant cells. The

  12. Production of technical-grade sodium citrate from glycerol-containing biodiesel waste by Yarrowia lipolytica.

    Science.gov (United States)

    Kamzolova, Svetlana V; Vinokurova, Natalia G; Lunina, Julia N; Zelenkova, Nina F; Morgunov, Igor G

    2015-10-01

    The production of technical-grade sodium citrate from the glycerol-containing biodiesel waste by Yarrowia lipolytica was studied. Batch experiments showed that citrate was actively produced within 144 h, then citrate formation decreased presumably due to inhibition of enzymes involved in this process. In contrast, when the method of repeated batch cultivation was used, the formation of citrate continued for more than 500 h. In this case, the final concentration of citrate in the culture liquid reached 79-82 g/L. Trisodium citrate was isolated from the culture liquid filtrate by the addition of a small amount of NaOH, so that the pH of the filtrate increased to 7-8. This simple and economic isolation procedure gave the yield of crude preparation containing trisodium citrate 5.5-hydrate up to 82-86%. PMID:26141285

  13. Enhanced Toxic Metal Accumulation in Engineered Bacterial Cells Expressing Arabidopsis thaliana Phytochelatin Synthase

    OpenAIRE

    Sauge-Merle, Sandrine; Cuiné, Stéphan; Carrier, Patrick; Lecomte-Pradines, Catherine; Luu, Doan-Trung; Peltier, Gilles

    2003-01-01

    Phytochelatins (PCs) are metal-binding cysteine-rich peptides, enzymatically synthesized in plants and yeasts from glutathione in response to heavy metal stress by PC synthase (EC 2.3.2.15). In an attempt to increase the ability of bacterial cells to accumulate heavy metals, the Arabidopsis thaliana gene encoding PC synthase (AtPCS) was expressed in Escherichia coli. A marked accumulation of PCs was observed in vivo together with a decrease in the glutathione cellular content. When bacterial ...

  14. Methionine synthase reductase deficiency results in adverse reproductive outcomes and congenital heart defects in mice

    OpenAIRE

    Deng, Liyuan; Elmore, C. Lee; Lawrance, Andrea K.; Matthews, Rowena G.; Rozen, Rima

    2008-01-01

    Low dietary folate and polymorphisms in genes of folate metabolism can influence risk for pregnancy complications and birth defects. Methionine synthase reductase (MTRR) is required for activation of methionine synthase, a folate- and vitamin B12-dependent enzyme. A polymorphism in MTRR (p.I22M), present in the homozygous state in 25% of many populations, may increase risk for neural tube defects. To examine the impact of MTRR deficiency on early development and congenital heart defects, we u...

  15. D-Amino acid oxidase-induced oxidative stress, 3-bromopyruvate and citrate inhibit angiogenesis, exhibiting potent anticancer effects.

    Science.gov (United States)

    El Sayed, S M; El-Magd, R M Abou; Shishido, Y; Yorita, K; Chung, S P; Tran, D H; Sakai, T; Watanabe, H; Kagami, S; Fukui, K

    2012-10-01

    Angiogenesis is critical for cancer growth and metastasis. Steps of angiogenesis are energy consuming, while vascular endothelial cells are highly glycolytic. Glioblastoma multiforme (GBM) is a highly vascular tumor and this enhances its aggressiveness. D-amino acid oxidase (DAO) is a promising therapeutic protein that induces oxidative stress upon acting on its substrates. Oxidative stress-energy depletion (OSED) therapy was recently reported (El Sayed et al., Cancer Gene Ther, 19, 1-18, 2012). OSED combines DAO-induced oxidative stress with energy depletion caused by glycolytic inhibitors such as 3-bromopyruvate (3BP), a hexokinase II inhibitor that depleted ATP in cancer cells and induced production of hydrogen peroxide. 3BP disturbs the Warburg effect and antagonizes effects of lactate and pyruvate (El Sayed et al., J Bioenerg Biomembr, 44, 61-79, 2012). Citrate is a natural organic acid capable of inhibiting glycolysis by targeting phosphofructokinase. Here, we report that DAO, 3BP and citrate significantly inhibited angiogenesis, decreased the number of vascular branching points and shortened the length of vascular tubules. OSED delayed the growth of C6/DAO glioma cells. 3BP combined with citrate delayed the growth of C6 glioma cells and decreased significantly the number and size of C6 glioma colonies in soft agar. Human GBM cells (U373MG) were resistant to chemotherapy e.g. cisplatin and cytosine arabinoside, while 3BP was effective in decreasing the viability and disturbing the morphology of U373MG cells. PMID:22802136

  16. Identification of a family of animal sphingomyelin synthases

    OpenAIRE

    Huitema, K.R.; van den Dikkenberg, J.; Brouwers, J.F.H.M.; Holthuis, J.C.M.

    2003-01-01

    Sphingomyelin (SM) is a major component of animal plasma membranes. Its production involves the transfer of phosphocholine from phosphatidylcholine onto ceramide, yielding diacylglycerol as a side product. This reaction is catalysed by SM synthase, an enzyme whose biological potential can be judged from the roles of diacylglycerol and ceramide as anti- and proapoptotic stimuli, respectively. SM synthesis occurs in the lumen of the Golgi as well as on the cell surface. As no gene for SM syntha...

  17. The N-Acetylglutamate Synthase Family: Structures, Function and Mechanisms

    OpenAIRE

    Dashuang Shi; Allewell, Norma M.; Mendel Tuchman

    2015-01-01

    N-acetylglutamate synthase (NAGS) catalyzes the production of N-acetylglutamate (NAG) from acetyl-CoA and l-glutamate. In microorganisms and plants, the enzyme functions in the arginine biosynthetic pathway, while in mammals, its major role is to produce the essential co-factor of carbamoyl phosphate synthetase 1 (CPS1) in the urea cycle. Recent work has shown that several different genes encode enzymes that can catalyze NAG formation. A bifunctional enzyme was identified in certain bacteria,...

  18. Unexpected link between polyketide synthase and calcium carbonate biomineralization

    OpenAIRE

    Hojo, Motoki; Omi, Ai; Hamanaka, Gen; Shindo, Kazutoshi; Shimada, Atsuko; Kondo, Mariko; Narita, Takanori; Kiyomoto, Masato; Katsuyama, Yohei; Ohnishi, Yasuo; Irie, Naoki; Takeda, Hiroyuki

    2015-01-01

    Introduction Calcium carbonate biominerals participate in diverse physiological functions. Despite intensive studies, little is known about how mineralization is initiated in organisms. Results We analyzed the medaka spontaneous mutant, ha, defective in otolith (calcareous ear stone) formation. ha lacks a trigger for otolith mineralization, and the causative gene was found to encode polyketide synthase (pks), a multifunctional enzyme mainly found in bacteria, fungi, and plant. Subsequent expe...

  19. Molecular cloning and nucleotide sequence for the complete coding region of human UMP synthase

    International Nuclear Information System (INIS)

    The last two steps in the de novo biosynthesis of UMP are catalyzed by orotate phosphoribosyltransferase and orotidine-5'-monophosphate decarboxylase. In mammals these two activities are found in a single, bifunctional protein called UMP synthase. A human T-lymphoblastic cell cDNA library constructed in λgt10 was screened with a UMP synthase-specific rat cDNA probe. Human UMP synthase cDNAs were isolated and then used to select UMP synthase gene fragments. The complete coding sequence of the mRNA for UMP synthase was determined by analysis of overlapping cDNA and genomic fragments. One of the cDNAs appears to have been synthesized from an incompletely or alternatively processed form of the UMP synthase mRNA. This cDNA lacks a poly(A) tail and has an extended 3'-nontranslated region that hybridizes with larger forms of the UMP synthase mRNA. The UMP synthase protein is composed of 480 amino acids with a molecular weight of 52,199. The two activities of UMP synthase reside in distinct domains encoded by the 3' and 5' halves of the mRNA. The COOH-terminal 258 amino acids of the human UMP synthase protein contain the orotidine-5'-monophosphate decarboxylase catalytic domain. This region is highly homologous to the mouse orotidine-5'-monophosphate decarboxylase sequence. The NH2-terminal 214 amino acids contain the OPRT domain. There is amino acid homology between this protein domain and specific regions of the Escherichia coli OPRT. The human OPRT domain also contains the putative catalytic site common to other human phosphoribosyltransferases

  20. Crystal structure of 5-enolpyruvylshikimate-3-phosphate (EPSP) synthase from the ESKAPE pathogen Acinetobacter baumannii.

    Science.gov (United States)

    Sutton, Kristin A; Breen, Jennifer; Russo, Thomas A; Schultz, L Wayne; Umland, Timothy C

    2016-03-01

    The enzyme 5-enolpyruvylshikimate-3-phosphate (EPSP) synthase catalyzes the sixth step of the seven-step shikimate pathway. Chorismate, the product of the pathway, is a precursor for the biosynthesis of aromatic amino acids, siderophores and metabolites such as folate, ubiquinone and vitamin K. The shikimate pathway is present in bacteria, fungi, algae, plants and apicomplexan parasites, but is absent in humans. The EPSP synthase enzyme produces 5-enolpyruvylshikimate 3-phosphate and phosphate from phosphoenolpyruvate and shikimate 3-phosphate via a transferase reaction, and is the target of the herbicide glyphosate. The Acinetobacter baumannii gene encoding EPSP synthase, aroA, has previously been demonstrated to be essential during host infection for the growth and survival of this clinically important drug-resistant ESKAPE pathogen. Prephenate dehydrogenase is also encoded by the bifunctional A. baumannii aroA gene, but its activity is dependent upon EPSP synthase since it operates downstream of the shikimate pathway. As part of an effort to evaluate new antimicrobial targets, recombinant A. baumannii EPSP (AbEPSP) synthase, comprising residues Ala301-Gln756 of the aroA gene product, was overexpressed in Escherichia coli, purified and crystallized. The crystal structure, determined to 2.37 Å resolution, is described in the context of a potential antimicrobial target and in comparison to EPSP synthases that are resistant or sensitive to the herbicide glyphosate. PMID:26919521