Baruch Institute for Marine and Coastal Sciences, Univ of South Carolina — EPA/NOAA/NASA CISNet Partnership The Coastal Intensive Site Network (CISNet) was developed by the U.S. Environmental Protection Agency (EPA), National Oceanic and...
Baruch Institute for Marine and Coastal Sciences, Univ of South Carolina — EPA/NOAA/NASA CISNet Partnership The Coastal Intensive Site Network (CISNet) was developed by the U.S. Environmental Protection Agency (EPA), National Oceanic and...
77 FR 10183 - Reissuance of Nationwide Permits
2012-02-21
... Civil Works Program (Engineer Circular 1165- 2-211). The current Engineer Circular applies to Corps..., Corps of Engineers Reissuance of Nationwide Permits; Notice #0;#0;Federal Register / Vol. 77 , No. 34..., Corps of Engineers RIN 0710-AA71 Reissuance of Nationwide Permits AGENCY: Army Corps of Engineers, DoD...
32 CFR 101.1 - Reissuance and purpose.
2010-07-01
... PARTICIPATION IN RESERVE TRAINING PROGRAMS § 101.1 Reissuance and purpose. This part establishes: (a) The criteria and training requirements for satisfactory participation by members of the Reserve components of... 32 National Defense 1 2010-07-01 2010-07-01 false Reissuance and purpose. 101.1 Section 101.1...
Hydrostatic pressure effect on Tsub(c) of Basub(0.9)Ksub(0.1)Pbsub(0.75)Bisub(0.25)O3
International Nuclear Information System (INIS)
Chu, C.W.; Huang, S.; Sleight, A.W.
1976-01-01
The superconducting transition temperature of Basub(0.9)Ksub(0.1)Pbsub(0.75)Bisub(0.25)O 3 has been found to be suppressed smoothly by the application of hydrostatic pressure at a rate of -(2.9 +- 0.2) x 10 -5 kbar -1 up to 15 kbar. The implications of these results are discussed. (author)
2012-02-15
... determined that reissuance of this general permit is not likely to adversely affect Essential Fish Habitat... that issuance of the permit has no adverse effect to Essential Fish Habitat. Coastal Zone Management... initiated section 7 consultations in accordance with the Endangered Species Act with the U.S. Fish and...
2011-05-09
...EPA proposes to re-issue a permit authorizing the National Science Foundation (NSF) to dispose of ice piers in ocean waters. Permit re-issuance is necessary because the current permit has expired. EPA does not propose changes to the content of the permit because ocean disposal under the terms of the previous permit will continue to meet the ocean disposal criteria.
Bruce Sims; Jim Piatt; Lee Johnson; Carol Purchase; John Phillips
1996-01-01
Personnel on the Santa Fe National Forest used methodologies adapted from Bevenger and King (1995) to collect base line particle size data on streams within grazing allotments currently scheduled for permit reissuance. This information was used to determine the relative current health of the watersheds as well as being used in the development of potential alternatives...
Energy Technology Data Exchange (ETDEWEB)
Kossi, S. EL., E-mail: safwene666@hotmail.com [Laboratoire de la Matiére Condensée et des Nanosciences, Département de Physique, Faculté des Sciences University de Monastir, 5019 (Tunisia); Rhouma, F.I.H. [Laboratoire de la Matiére Condensée et des Nanosciences, Département de Physique, Faculté des Sciences University de Monastir, 5019 (Tunisia); Laboratoire de Photovoltaique, Centre de Recherches et des Tehnologies de l' Energie, BP Hammam-Lif 2050 (Tunisia); Dhahri, J. [Laboratoire de la Matiére Condensée et des Nanosciences, Département de Physique, Faculté des Sciences University de Monastir, 5019 (Tunisia); Khirouni, K. [Laboratoire de Physique des Matériaux et des Nanomatériaux Appliquée à L’environnement, Faculté des Sciences de Gabes Cité Erriadh, 6079 Gabes (Tunisia)
2014-05-01
This work studies structural and various electrical properties of polycrystalline La{sub 0.7}Sr{sub 0.25} Na{sub 0.05} Mn{sub 0.9}Ti{sub 0.1}O{sub 3} (LSNMTi), which were prepared by standard solid state reaction technique. The formation of a single phase rhombohedral structure of the composition was confirmed by the X-ray diffraction study. The electrical behavior of sintered pellets investigated by impedance spectra has shown frequency dependent behavior. Both conductivity and electric modulus formalisms have been used to study the relaxation dynamics of charge carriers. The variation of ac conductivity with frequency at different temperatures obeys the universal Jonscher's power law (σ{sub ac}αw).
Dielectric and impedance studies of Ba0.50(Na0.25Bi0.25)(Fe0.25Nb0.25)Ti0.50O3 ceramic
Yadav, Anjana; Chandra, K. P.; Kulkarni, A. R.; Prasad, K.
2018-05-01
Lead-free perovskite Ba0.50(Na0.25Bi0.25)(Fe0.25Nb0.25)Ti0.50O3 was prepared using conventional ceramic technique at 1130°C/4h in air atmosphere and characterized by X-ray diffraction, scanning electron microscopy, dielectric and impedance studies. XRD analysis of the compound indicated the formation of a single-phase cubic structure. SEM study was carried out to study the quality and purity of the compound. Compound showed very high dielectric constant (33700). Impedance analysis indicated the negative temperature coefficient of resistance character of the compound. Ac conductivity data followed Jonscher's law and correlated barrier hopping successfully explained the charge carrier transport mechanism in the system.
National Aeronautics and Space Administration — TMI/TRMM precipitation and uncertainty (TMPA) L3 3 hour 0.25 degree x 0.25 degree V001 provides estimates of accumulated precipitation from the Tropical Rainfall...
Lung cancer in never smokers Epidemiology and risk prediction models
McCarthy, William J.; Meza, Rafael; Jeon, Jihyoun; Moolgavkar, Suresh
2012-01-01
In this chapter we review the epidemiology of lung cancer incidence and mortality among never smokers/ nonsmokers and describe the never smoker lung cancer risk models used by CISNET modelers. Our review focuses on those influences likely to have measurable population impact on never smoker risk, such as secondhand smoke, even though the individual-level impact may be small. Occupational exposures may also contribute importantly to the population attributable risk of lung cancer. We examine the following risk factors in this chapter: age, environmental tobacco smoke, cooking fumes, ionizing radiation including radon gas, inherited genetic susceptibility, selected occupational exposures, preexisting lung disease, and oncogenic viruses. We also compare the prevalence of never smokers between the three CISNET smoking scenarios and present the corresponding lung cancer mortality estimates among never smokers as predicted by a typical CISNET model. PMID:22882894
A national neurological excellence centers network.
Pazzi, S; Cristiani, P; Cavallini, A
1998-02-01
The most relevant problems related to the management of neurological disorders are (i) the frequent hospitalization in nonspecialist departments, with the need for neurological consultation, and (ii) the frequent requests of GPs for highly specialized investigations that are very expensive and of little value in arriving at a correct diagnosis. In 1996, the Consorzio di Bioingegneria e Informatica Medica in Italy realized the CISNet project (in collaboration with the Consorzio Istituti Scientifici Neuroscienze e Tecnologie Biomediche and funded by the Centro Studi of the National Public Health Council) for the implementation of a national neurological excellence centers network (CISNet). In the CISNet project, neurologists will be able to give on-line interactive consultation and off-line consulting services identifying correct diagnostic/therapeutic procedures, evaluating the need for both examination in specialist centers and admission to specialized centers, and identifying the most appropriate ones.
International Nuclear Information System (INIS)
Lecce, Daniele Di; Verrelli, Roberta; Hassoun, Jusef
2016-01-01
Highlights: • New Li-ion batteries are reported. • LiFe 0.25 Mn 0.5 Co 0.25 PO 4 olivine is used as the cathode. • Either Sn-C or Sn-Fe 2 O 3 -C composites are used as anodes. • The electrode/electrolyte interfaces are monitored by EIS. • The systems are considered suitable for energy storage - Abstract: New Li-ion cells are formed by combining a LiFe 0.25 Mn 0.5 Co 0.25 PO 4 olivine cathode either with Sn-Fe 2 O 3 -C or with Sn-C composite anodes. These active materials exhibit electrochemical properties very attractive in view of practical use, including the higher working voltage of the LiFe 0.25 Mn 0.5 Co 0.25 PO 4 cathode with respect to conventional LiFePO 4 , as well as the remarkable capacity and rate capability of Sn-Fe 2 O 3 -C and Sn-C anodes. The stable electrode/electrolyte interfaces, demonstrated by electrochemical impedance spectroscopy, along with proper mass balancing and anode pre-lithiation, allow stable galvanostatic cycling of the full cells. The two batteries, namely Sn-Fe 2 O 3 -C/LiFe 0.25 Mn 0.5 Co 0.25 PO 4 and Sn-C/LiFe 0.25 Mn 0.5 Co 0.25 PO 4 , reversibly operate revealing promising electrochemical features in terms of delivered capacity, working voltage and stability, thus suggesting these electrodes combinations as suitable alternatives for an efficient energy storage.
International Nuclear Information System (INIS)
Roscha, V.
1994-01-01
This acceptance test report (ATR) has been prepared to establish the results of the field testing conducted on W-025 to demonstrate that the electrical/instrumentation systems functioned as intended by design. This is part of the RMW Land Disposal Facility
Hossain, Mohammad M.; Atanda, Luqman; Al-Khattaf, Sulaiman
2012-01-01
This communication reports a mechanism-based kinetics modelling for the dehydrogenation of ethylbenzene to styrene (ST) using Mg3Fe0.25Mn0.25Al0.5 catalyst. Physicochemical characterisation of the catalyst indicates that the presence of basic sites
National Aeronautics and Space Administration — The second release of Collection 3 OMI/Aura level-2G daily global gridded (0.25x0.25 deg) Aerosol data product OMAEROG (Version 003 has been made available to the...
National Aeronautics and Space Administration — The OMI-Aura level-2G daily global gridded (0.25x0.25 deg) near-UV Aerosol data product OMAERUVG based on the enhanced algorithm is available from the NASA Goddard...
National Lung Screening Trial: Questions and Answers
... the maximum time since quitting. CISNET models identified consensus strategies that were efficient, preventing the greatest number ... these abnormalities are not lung cancer; they are false-positives. However, these abnormalities − scars from smoking, areas ...
International Nuclear Information System (INIS)
Yang, Yujie; Wang, Fanhou; Shao, Juxiang; Huang, Duohui; Liu, Xiansong; Feng, Shuangjiu; Wen, Cuie
2015-01-01
Hexagonal ferrite Sr 0.75−x Ca 0.25 La x Fe 12−y Co y O 19 magnetic powder and magnets were synthesized according to a ceramic process. The phase compositions of the magnetic powder samples were determined by X-ray diffraction. There is a single magnetoplumbite phase in the samples with y/x from 0.3 to 0.6, and when y/x>0.6, the CoFe 2 O 4 phase is observed. The micrographs of the sintered magnets were observed by a field emission scanning electron microscopy. The magnets have formed the hexagonal structures and the particles are distributed inhomogeneously. The impact of Co/La ratios on magnetic properties of the magnets was studied systematically. The remanence, magnetic induction coercivity and maximum energy product of the magnets first increase with y/x from 0.3 to 0.6, and then decrease when y/x>0.6. However, the intrinsic coercivity of the magnets first increases with y/x from 0.3 to 0.9, and decreases when y/x>0.9. The rectangularity of the demagnetizing curves for the magnets decreases with increasing y/x. - Highlights: • Sr 0.75−x Ca 0.25 La x Fe 12−y Co y O 19 hexagonal ferrites were synthesized according to a ceramic process. • There is a single magnetoplumbite phase in the samples with y/x from 0.3 to 0.6, and when y/x is above 0.7, the CoFe 2 O 4 phase is observed. • B r , H cb and (BH) max of the magnets first increase with y/x from 0.3 to 0.6, and then, decrease when y/x continues to increase. • H cj of the magnets first increases with y/x from 0.3 to 0.9, and then, decreases when y/x is above 0.9. • The rectangularity of the demagnetizing curves for the magnets decreases with the increase of y/x
Rahaman, Md. D.; Nusrat, Tania; Maleque, Rumana; Hossain, A. K. M. Akther
2018-04-01
Polycrystalline Mg0.25Mn0.25Zn0.5-xSrxFe2O4 (0 ≤ x ≤ 0.20) ferrites were synthesized using the solid state reaction sintering at 1373 K and 1473 K for 4 h. The XRD patterns revealed the formation of single phase cubic spinel with Sr2FeO4 and SrFe12O19 as impurity phases. The decrement in the lattice parameter for Sr2+ substituted samples is attributed to the difference in ionic radii of cations. The crystallite size decreases with increase in Sr2+ content. Low frequency dielectric dispersion is attributed due to the Maxwell-Wagner interfacial polarization. The appearance of the peak in dielectric loss spectrum for x = 0.15 and 0.20 at 1373 K and x = 0.20 at 1473 K suggests the presence of relaxing dipoles. The loss peak shifts towards lower frequency side with Sr2+ content at 1373 K which is due to the strengthening of dipole-dipole interactions. The complex impedance spectra clearly revealed that the both grain and grain boundary effects on the electrical properties. A complex electric modulus spectrum indicates that a non-Debye type of conductivity relaxation exists. The saturation magnetization and remanence gradually decreases with Sr2+ substitution which may be due to the existence of non-magnetic phase in the space between the magnetic particles and the substitution of Zn2+ cation in Mg0.25Mn0.25Zn0.5Fe2O4 ferrite lattice by Sr2+ content. The permeability decreases significantly while the cut-off frequency increases with the Sr2+ content at 1373 K and decreases at 1473 K, obeying the Snoek's law. The decrease in permeability with Sr2+ content is attributed due to the decrease in magnetization because non-magnetic ions weaken the inter-site exchange interaction.
International Nuclear Information System (INIS)
Prathibha, G.; Rosaiah, P.; Reddy, B. Purusottam; Ganesh, K. Sivajee; Hussain, O. M.
2015-01-01
Lithium ion (Li-ion) batteries are currently the energy source of choice for cell phones, laptops, and other mobile electronic devices due to their balance of high energy density with high power density compared to other electrochemical energy carriers. In the present study, mixed hydroxide method is used to prepare Li[Ni 0.5 Co 0.25 Mn 0.25 ]O 2 from the precursors and analyze qualitatively and studied the electrochemical properties. The XRD spectrum exhibited predominant (003) orientation at 2θ =18.39 o corresponding to hexagonal layered structure of R3m symmetry with evaluated lattice parameters are a= 2.84 Å, c= 14.43 Å. Raman measurements were performed to understand the microstructure and vibrational modes of the prepared sample. From the electrochemical (EC) studies an initial discharge capacity of about 140 mAhg −1 with good cyclic stability was observed for the prepared sample in the potential range 0.0 −1.0V in aqueous medium
Directory of Open Access Journals (Sweden)
Geeta P Parikh
2014-01-01
Full Text Available Background and Aim: Percutaneous nephrolithotomy (PCNL is a common for managing renal calculi. Pain in the initial post operatie period is relieved by infiltration of local anaesthetic around the nephrostomy tract.We aimed to compare the analgesic efficacy of bupivacaine and ropivacaine. Methods: A total of 100 adult patients undergoing elective PCNL- under balanced general anaesthesia were randomly divided into bupivacaine group (Group B and ropivacaine group (Group R. After completion of procedure, 23G spinal needle was inserted at 6 and 12 O′clock position under ultrasonic guidance up to renal capsule along the nephrostomy tube. A volume of 10 ml of either 0.25% bupivacaine or 0.25% ropivacaine solution was infiltrated in each tract while withdrawing the needle. Post-operative pain was assessed using visual analogue scale (VAS and dynamic visual analogue scale (D-VAS for initial 24 h. Intravenous tramadol was given as rescue analgesia when VAS >4. Time to first rescue analgesic, number of doses and total amount of tramadol required in initial 24 h and side-effects were noted. Results: Visual analogue scale and D-VAS at 6 h and 8 h in Group B was significantly higher than Group R. Mean time to first rescue analgesia in Group R was significantly longer than Group B. Mean number of doses of tramadol and total consumption of tramadol in 24 h was less in Group R, though not statistically significant. Conclusion: Peritubal infiltration of 0.25% ropivacaine infiltration along the nephrostomy tract is more effective than 0.25% bupivacaine in alleviating initial post-operative pain after PCNL.
Directory of Open Access Journals (Sweden)
Dewi Ramadani
2014-08-01
Full Text Available Post operative pain for labioplasty can be prevented by bilateral infraorbital block. This study aimed to compare the effectiveness addition of pethidine 0.25 mg/kgBW and clonidine 1 µg/kgBW to bupivacaine 0.25% for postoperative analgesia using infraorbital block in paediatric labioplasty with a pain scale score face, leg, activity, cry, consolability (FLACC. The study was a single-blind randomized controlled trial from March to September 2013 involving 30 pediatric patients, physical status American Society of Anesthesiologist (ASA II, ages 3 months–1 year for labioplasty surgery with bilateral infraorbital block at Dr. Hasan Sadikin Hospital Bandung. Subjects were grouped into two groups: 15 subjects using adjuvant pethidine 0.25 mg/kgBW (BP and 15 subjects using adjuvant clonidine 1 ug/kgBW (BK. After induction of anesthesia, infraorbital block done 1 mL on each side of the face. Data were analyzed by t test, showed a highly significant difference (p<0.01 in BP group compared with BK, the average length of postoperative analgesia 1.828 minutes (30 hours vs 1072 minutes (18 hours. The conclusions is the addition of pethidine 0.25 mg/kgBW in bupivacaine 0.25% to infraorbital block in paediatric labioplasty provide postoperative analgesia longer than of clonidine 1 µg/kgBW.
0.25μm radiation tolerant technology for space applications
International Nuclear Information System (INIS)
Haddad, N.; Brady, F.; Scott, T.; Yoder, J.
1999-01-01
Lockheed Martin federal systems has developed a state-of-the-art radiation tolerant 0,25 μm CMOS capability that is compatible with commercial foundries as well as radiation hardened fabrication. A technology test chip was designed, fabricated and evaluated for performance, power and radiation hardness in order to validate the methodology and evaluate the technology. Testing results show that -) the active transistor threshold shift is negligible for 0.25 μm CMOS, -) the hardened STI (shallow trench isolation) can support Mega-rad applications, and -) the holding voltage is well beyond the operating voltage of 2.5 V. This technology is intended to support high density, high performance and low power space applications
16 CFR 0.9 - Organization structure.
2010-01-01
... 16 Commercial Practices 1 2010-01-01 2010-01-01 false Organization structure. 0.9 Section 0.9 Commercial Practices FEDERAL TRADE COMMISSION ORGANIZATION, PROCEDURES AND RULES OF PRACTICE ORGANIZATION § 0.9 Organization structure. The Federal Trade Commission comprises the following principal units...
Directory of Open Access Journals (Sweden)
Tassanee Lerksuthirat
Full Text Available Pythium insidiosum is a unique oomycete that can infect humans and animals. Patients with a P. insidiosum infection (pythiosis have high rates of morbidity and mortality. The pathogen resists conventional antifungal drugs. Information on the biology and pathogenesis of P. insidiosum is limited. Many pathogens secrete proteins, known as effectors, which can affect the host response and promote the infection process. Elicitins are secretory proteins and are found only in the oomycetes, primarily in Phytophthora and Pythium species. In plant-pathogenic oomycetes, elicitins function as pathogen-associated molecular pattern molecules, sterol carriers, and plant defense stimulators. Recently, we reported a number of elicitin-encoding genes from the P. insidiosum transcriptome. The function of elicitins during human infections is unknown. One of the P. insidiosum elicitin-encoding genes, ELI025, is highly expressed and up-regulated at body temperature. This study aims to characterize the biochemical, immunological, and genetic properties of the elicitin protein, ELI025. A 12.4-kDa recombinant ELI025 protein (rELI025 was expressed in Escherichia coli. Rabbit anti-rELI025 antibodies reacted strongly with the native ELI025 in P. insidiosum's culture medium. The detected ELI025 had two isoforms: glycosylated and non-glycosylated. ELI025 was not immunoreactive with sera from pythiosis patients. The region near the transcriptional start site of ELI025 contained conserved oomycete core promoter elements. In conclusion, ELI025 is a small, abundant, secreted glycoprotein that evades host antibody responses. ELI025 is a promising candidate for development of diagnostic and therapeutic targets for pythiosis.
Density-functional theory computer simulations of CZTS0.25Se0.75 alloy phase diagrams
International Nuclear Information System (INIS)
Chagarov, E.; Sardashti, K.; Kummel, A. C.; Haight, R.; Mitzi, D. B.
2016-01-01
Density-functional theory simulations of CZTS, CZTSe, and CZTS 0.25 Se 0.75 photovoltaic compounds have been performed to investigate the stability of the CZTS 0.25 Se 0.75 alloy vs. decomposition into CZTS, CZTSe, and other secondary compounds. The Gibbs energy for vibrational contributions was estimated by calculating phonon spectra and thermodynamic properties at finite temperatures. It was demonstrated that the CZTS 0.25 Se 0.75 alloy is stabilized not by enthalpy of formation but primarily by the mixing contributions to the Gibbs energy. The Gibbs energy gains/losses for several decomposition reactions were calculated as a function of temperature with/without intermixing and vibration contributions to the Gibbs energy. A set of phase diagrams was built in the multidimensional space of chemical potentials at 300 K and 900 K temperatures to demonstrate alloy stability and boundary compounds at various chemical conditions. It demonstrated for CZTS 0.25 Se 0.75 that the chemical potentials for stability differ between typical processing temperature (∼900 K) and operating temperature (300 K). This implies that as cooling progresses, the flux/concentration of S should be increased in MBE growth to maintain the CZTS 0.25 Se 0.75 in a thermodynamically stable state to minimize phase decomposition.
Density-functional theory computer simulations of CZTS0.25Se0.75 alloy phase diagrams
Chagarov, E.; Sardashti, K.; Haight, R.; Mitzi, D. B.; Kummel, A. C.
2016-08-01
Density-functional theory simulations of CZTS, CZTSe, and CZTS0.25Se0.75 photovoltaic compounds have been performed to investigate the stability of the CZTS0.25Se0.75 alloy vs. decomposition into CZTS, CZTSe, and other secondary compounds. The Gibbs energy for vibrational contributions was estimated by calculating phonon spectra and thermodynamic properties at finite temperatures. It was demonstrated that the CZTS0.25Se0.75 alloy is stabilized not by enthalpy of formation but primarily by the mixing contributions to the Gibbs energy. The Gibbs energy gains/losses for several decomposition reactions were calculated as a function of temperature with/without intermixing and vibration contributions to the Gibbs energy. A set of phase diagrams was built in the multidimensional space of chemical potentials at 300 K and 900 K temperatures to demonstrate alloy stability and boundary compounds at various chemical conditions. It demonstrated for CZTS0.25Se0.75 that the chemical potentials for stability differ between typical processing temperature (˜900 K) and operating temperature (300 K). This implies that as cooling progresses, the flux/concentration of S should be increased in MBE growth to maintain the CZTS0.25Se0.75 in a thermodynamically stable state to minimize phase decomposition.
Modeling the mechanism of CLN025 beta-hairpin formation
McKiernan, Keri A.; Husic, Brooke E.; Pande, Vijay S.
2017-09-01
Beta-hairpins are substructures found in proteins that can lend insight into more complex systems. Furthermore, the folding of beta-hairpins is a valuable test case for benchmarking experimental and theoretical methods. Here, we simulate the folding of CLN025, a miniprotein with a beta-hairpin structure, at its experimental melting temperature using a range of state-of-the-art protein force fields. We construct Markov state models in order to examine the thermodynamics, kinetics, mechanism, and rate-determining step of folding. Mechanistically, we find the folding process is rate-limited by the formation of the turn region hydrogen bonds, which occurs following the downhill hydrophobic collapse of the extended denatured protein. These results are presented in the context of established and contradictory theories of the beta-hairpin folding process. Furthermore, our analysis suggests that the AMBER-FB15 force field, at this temperature, best describes the characteristics of the full experimental CLN025 conformational ensemble, while the AMBER ff99SB-ILDN and CHARMM22* force fields display a tendency to overstabilize the native state.
Light source characterization and air movement under CIE S 025
DEFF Research Database (Denmark)
Thorseth, Anders; Bergen, A. S. J.
2017-01-01
In 2015, the International Commission on Illumination (CIE) published the standard CIE S 025/E:2015 Test Method for LED Lamps, LED Luminaires and LED Modules. This document contains a number of standard test conditions, including laboratory room preparation, environmental and electrical provisions...
Lifescience Database Archive (English)
Full Text Available FC (Link to library) FC-BS09 (Link to dictyBase) - - - Contig-U16215-1 FC-BS09Z (Li...nk to Original site) - - FC-BS09Z 626 - - - - Show FC-BS09 Library FC (Link to library) Clone ID FC-BS09 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-BS/FC-BS09Q.Seq.d/ Representative seq. ID FC-BS...09Z (Link to Original site) Representative DNA sequence >FC-BS09 (FC-BS09Q) /CSM/FC/FC-BS/FC-BS09Q.Seq....ignments: (bits) Value SSF360 (SSF360Q) /CSM/SS/SSF3-C/SSF360Q.Seq.d/ 854 0.0 FC-BS09 (FC-BS09Q) /CSM/FC/FC-BS/FC-BS
33 CFR 151.09 - Applicability.
2010-07-01
....09 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) POLLUTION... Pertains to Pollution from Ships Oil Pollution § 151.09 Applicability. (a) Except as provided in paragraph... the United States and is certificated for ocean service; (3) Is operated under the authority of the...
Lifescience Database Archive (English)
Full Text Available FC (Link to library) FC-AI09 (Link to dictyBase) - - - Contig-U16149-1 FC-AI09Z (Li...nk to Original site) - - FC-AI09Z 591 - - - - Show FC-AI09 Library FC (Link to library) Clone ID FC-AI09 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AI/FC-AI09Q.Seq.d/ Representative seq. ID FC-AI...09Z (Link to Original site) Representative DNA sequence >FC-AI09 (FC-AI09Q) /CSM/FC/FC-AI/FC-AI09Q.Seq....*tkl ik*ilifykiknnkkkkkk Frame B: ---gt*kvpeflailfkrmasrsvlwy*rcltkakkglkapqtltik
46 CFR 173.025 - Additional intact stability standards: Counterballasted vessels.
2010-10-01
...) SUBDIVISION AND STABILITY SPECIAL RULES PERTAINING TO VESSEL USE Lifting § 173.025 Additional intact stability standards: Counterballasted vessels. (a) Each vessel equipped to counterballast while lifting must be shown... loading and operation and at each combination of hook load and crane radius. (b) When doing the...
Anti-adipogenic effects of KD025 (SLx-2119), a ROCK2-specific inhibitor, in 3T3-L1 cells.
Diep, Duy Trong Vien; Hong, Kyungki; Khun, Triyeng; Zheng, Mei; Ul-Haq, Asad; Jun, Hee-Sook; Kim, Young-Bum; Chun, Kwang-Hoon
2018-02-06
Adipose tissue is a specialized organ that synthesizes and stores fat. During adipogenesis, Rho and Rho-associated kinase (ROCK) 2 are inactivated, which enhances the expression of pro-adipogenic genes and induces the loss of actin stress fibers. Furthermore, pan ROCK inhibitors enhance adipogenesis in 3T3-L1 cells. Here, we show that KD025 (formerly known as SLx-2119), a ROCK2-specific inhibitor, suppresses adipogenesis in 3T3-L1 cells partially through a ROCK2-independent mechanism. KD025 downregulated the expression of key adipogenic transcription factors PPARγ and C/EBPα during adipogenesis in addition to lipogenic factors FABP4 and Glut4. Interestingly, adipogenesis was blocked by KD025 during days 1~3 of differentiation; after differentiation terminated, lipid accumulation was unaffected. Clonal expansion occurred normally in KD025-treated cells. These results suggest that KD025 could function during the intermediate stage after clonal expansion. Data from depletion of ROCKs showed that KD025 suppressed cell differentiation partially independent of ROCK's activity. Furthermore, no further loss of actin stress fibers emerged in KD025-treated cells during and after differentiation compared to control cells. These results indicate that in contrast to the pro-adipogenic effect of pan-inhibitors, KD025 suppresses adipogenesis in 3T3-L1 cells by regulating key pro-adipogenic factors. This outcome further implies that KD025 could be a potential anti-adipogenic/obesity agent.
Compound list: 1% cholesterol + 0.25% sodium cholate [Open TG-GATEs
Lifescience Database Archive (English)
Full Text Available 1% cholesterol + 0.25% sodium cholate CH+DS-Na 00161 ftp://ftp.biosciencedbc.jp/arc...hive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/1%25_cholesterol_%2B_0.25%25_sodium_cholate.Rat.in_vivo.Liver.Repeat.zip ...
Energy Technology Data Exchange (ETDEWEB)
Prathibha, G.; Rosaiah, P.; Reddy, B. Purusottam; Ganesh, K. Sivajee; Hussain, O. M., E-mail: hussainsvu@gmail.com [Thin Films laboratory, Department of Physics, Sri Venkateswara University, Tirupati – 517502 (India)
2015-06-24
Lithium ion (Li-ion) batteries are currently the energy source of choice for cell phones, laptops, and other mobile electronic devices due to their balance of high energy density with high power density compared to other electrochemical energy carriers. In the present study, mixed hydroxide method is used to prepare Li[Ni{sub 0.5}Co{sub 0.25}Mn{sub 0.25}]O{sub 2} from the precursors and analyze qualitatively and studied the electrochemical properties. The XRD spectrum exhibited predominant (003) orientation at 2θ =18.39{sup o} corresponding to hexagonal layered structure of R3m symmetry with evaluated lattice parameters are a= 2.84 Å, c= 14.43 Å. Raman measurements were performed to understand the microstructure and vibrational modes of the prepared sample. From the electrochemical (EC) studies an initial discharge capacity of about 140 mAhg{sup −1} with good cyclic stability was observed for the prepared sample in the potential range 0.0 −1.0V in aqueous medium.
Effect of epidural 0.25% bupivacaine on somatosensory evoked potentials to dermatomal stimulation
DEFF Research Database (Denmark)
Lund, C; Hansen, O B; Kehlet, H
1989-01-01
The effect of lumbar epidural analgesia with similar volumes (about 25 ml) of 0.25% and 0.5% bupivacaine on early (less than 0.5 seconds) somatosensory evoked potentials (SEPs) to electrical stimulation of the S1, L1, and T10 dermatomes was examined in two groups of ten patients. Level of sensory...... analgesia to pinprick was T5.7 +/- 0.8 and T6.4 +/- 0.7 in the 0.25% and 0.5% bupivacaine group, respectively. Motor blockade was more pronounced in the 0.5% bupivacaine group (p less than 0.05). Despite similar analgesia to pinprick, SEPs were more reduced during 0.5% bupivacaine than during 0...
The novel ethylene-responsive factor CsERF025 affects the development of fruit bending in cucumber.
Wang, Chunhua; Xin, Ming; Zhou, Xiuyan; Liu, Chunhong; Li, Shengnan; Liu, Dong; Xu, Yuan; Qin, Zhiwei
2017-11-01
Overexpression of CsERF025 induces fruit bending by promoting the production of ethylene. Cucumber fruit bending critically affects cucumber quality, but the mechanism that causes fruit bending remains unclear. To better understand this mechanism, we performed transcriptome analyses on tissues from the convex (C1) and concave (C2) sides of bending and straight (S) fruit at 2 days post anthesis (DPA). We identified a total of 281 differentially expressed genes (DEGs) from both the convex and concave sides of bent fruit that showed significantly different expression profiles relative to straight fruits. Of these 281 DEGs, 196 were up-regulated (C1/S_C2/S) and 85 were down-regulated (C1/S_C2/S). Among the 196 up-regulated DEGs, the transcriptional levels of genes related to ethylene biosynthesis and signaling pathways were significantly higher in bending fruit compared with straight fruit. CsERF025 showed the largest difference in expression between bending and straight fruit. CsERF025 is an AP2/ERF gene encoding a protein that localizes to the nucleus. Overexpression of this gene increased the bending rate of cucumber fruits and increased the angle of bending. CsERF025 increased both the expression of ethylene biosynthesis-related genes and the production of ethylene. The application of exogenous 1-aminocyclopropane-l-carboxylic acid (ACC) to straight fruits from control plants promoted fruit bending. Thus, CsERF025 enhances the production of ethylene and thereby promotes fruit bending in cucumber.
Directory of Open Access Journals (Sweden)
Carlos Alberto Figueiredo Côrtes
2006-02-01
Full Text Available JUSTIFICATIVA E OBJETIVOS: Estudos clínicos com enantiômeros levógiros dos anestésicos locais demonstraram maior segurança em função de menor cardiotoxicidade. A deambulação da parturiente durante o trabalho de parto pode abreviar o trabalho de parto. Este estudo visou comparar a qualidade da anestesia e as repercussões maternas e fetais bem como a capacidade de deambulação e micção espontânea das parturientes com o emprego da bupivacaína a 0,25% e da bupivacaína com excesso enantiomérico de 50% (S75-R25 a 0,25%, associadas ao fentanil por via peridural contínua, no trabalho de parto. MÉTODO: Foram avaliadas 40 parturientes, estado físico ASA I e II, feto único, em trabalho de parto, submetidas a analgesia peridural contínua e divididas em dois grupos: no grupo I, receberam 8 mL (20 mg de bupivacaína (S75-R25 a 0,25% com epinefrina, associados a 100 µg de fentanil. No grupo II, receberam 8 mL (20 mg de bupivacaína racêmica a 0,25% com epinefrina, associados a 100 µg de fentanil. Foram avaliados os seguintes parâmetros: tempo de latência, nível de bloqueio sensitivo, grau de bloqueio motor, teste de Romberg, capacidade de deambulação e micção espontânea, duração do trabalho de parto e do período expulsivo, alterações hemodinâmicas e respiratórias maternas além da vitalidade dos recém-nascidos. RESULTADOS: Não houve diferença estatística significativa entre os grupos nos parâmetros avaliados. Todas as parturientes apresentaram força muscular com capacidade de deambulação, salvo no caso de indicação de cesariana (um caso do grupo II ou quando o parto aconteceu antes do tempo previsto para avaliação deste parâmetro (quatro casos do grupo I e cinco casos do grupo II. CONCLUSÕES: Tanto a bupivacaína racêmica quanto a bupivacaína (S75-R25 a 0,25% associadas ao fentanil mostraram ser boa opção para analgesia de parto.JUSTIFICATIVA Y OBJETIVOS: Estudios clínicos con enantiómeros lev
Registration of 'CP 09-2392' Sugarcane
CP 09-2392’ (Reg. No.____; PI _____) sugarcane, a complex hybrid of Saccharum spp, was developed through cooperative research conducted by the USDA-ARS, the University of Florida, and the Florida Sugar Cane League, Inc., and was released to growers in June 2016. ‘CP 09-2392’ was selected from a cro...
International Nuclear Information System (INIS)
Yang, Yujie; Liu, Xiansong; Jin, Dali
2014-01-01
Highlights: • Sr 0.45 Ca 0.25 La 0.30 Fe x Co 0.25 O 19 (10.45 ≤ x ≤ 12.25) hexaferrites were prepared by a conventional ceramic method. • The hexagonal structure is observed for the magnets and the particles are distributed evenly. • B r , H cb , H cj , and (BH) max of the magnets first increase with iron content (x) ranging from 10.45 to 11.05 and then decrease when iron content (x) ≥ 11.05. • When iron content (x) = 11.05, B r , H cb , H cj , and (BH) max of the magnets reach the maximum values. - Abstract: M-type ferrite Sr 0.45 Ca 0.25 La 0.30 Fe x Co 0.25 O 19 (10.45 ≤ x ≤ 12.25) magnetic powders and magnets were prepared by a conventional ceramic method. Phase components of the magnetic powders were examined by X-ray diffraction. There is only the magnetoplumbite-type phase in magnetic powders with iron content (x) ranging from 10.45 to 11.65. When iron content (x) ≥ 11.85, hematite (α-Fe 2 O 3 ) phase begins to occur. The morphology of the magnets was investigated by a field emission scanning electron microscopy. The magnets have formed a hexagonal structure and the particles are distributed evenly. Magnetic properties of the magnets and magnetic powders were measured by a permanent magnetic measuring equipment and a vibrating sample magnetometer, respectively. The remanence, intrinsic coercivity, magnetic induction coercivity, and maximum energy product first increase with iron content (x) of range 10.45–11.05 and then decrease when iron content (x) continues to increase. The magnetic properties at x = 11.05 reach the maximum values
Strain effects on electronic structure of Fe{sub 0.75}Ru{sub 0.25}Te
Energy Technology Data Exchange (ETDEWEB)
Winiarski, M.J., E-mail: M.Winiarski@int.pan.wroc.pl [Institute of Low Temperature and Structure Research, Polish Academy of Sciences, Okólna 2, 50-422, Wrocław (Poland); Samsel-Czekała, M. [Institute of Low Temperature and Structure Research, Polish Academy of Sciences, Okólna 2, 50-422, Wrocław (Poland); Ciechan, A. [Institute of Physics, Polish Academy of Sciences, al. Lotników 32/46, 02-668, Warsaw (Poland)
2017-01-15
Structural and electronic properties of a hypothetical Fe{sub 0.75}Ru{sub 0.25}Te alloy and the parent FeTe compound have been investigated from first principles within the density functional theory (DFT). For both systems the double-stripe antiferromagnetic ground state is predicted at ambient pressure. The incorporation of Ru atoms into FeTe in the nonmagnetic phase leads to a deep valley of density of states in the vicinity of the Fermi level and the DOS at the Fermi level is significantly diminished in the considered solid solution. The single-stripe antiferromagnetic phase in Fe{sub 0.75}Ru{sub 0.25}Te may be induced by tensile strain. These findings suggest that strained thin films of Fe{sub 1−x}Ru{sub x}Te are good candidates for new superconducting Fe-based materials. - Highlights: • Ru-doped FeTe systems are investigated by density-functional theory methods. • Structural and electronic properties of Fe{sub 0.75}Ru{sub 0.25}Te and parent FeTe are studied. • The double-stripe antiferromagnetic ground state is predicted for both systems. • The single-stripe antiferromagnetic phase may be induced by tensile strain. • Tensile strained Fe{sub 0.75}Ru{sub 0.25}Te is a candidate for a new Fe-based superconductor.
Correlation of Naturally Occurring HIV-1 Resistance to DEB025 with Capsid Amino Acid Polymorphisms
Directory of Open Access Journals (Sweden)
Brigitte Rosenwirth
2013-03-01
Full Text Available DEB025 (alisporivir is a synthetic cyclosporine with inhibitory activity against human immunodeficiency virus type-1 (HIV-1 and hepatitis C virus (HCV. It binds to cyclophilin A (CypA and blocks essential functions of CypA in the viral replication cycles of both viruses. DEB025 inhibits clinical HIV-1 isolates in vitro and decreases HIV-1 virus load in the majority of patients. HIV-1 isolates being naturally resistant to DEB025 have been detected in vitro and in nonresponder patients. By sequence analysis of their capsid protein (CA region, two amino acid polymorphisms that correlated with DEB025 resistance were identified: H87Q and I91N, both located in the CypA-binding loop of the CA protein of HIV-1. The H87Q change was by far more abundant than I91N. Additional polymorphisms in the CypA-binding loop (positions 86, 91 and 96, as well as in the N-terminal loop of CA were detected in resistant isolates and are assumed to contribute to the degree of resistance. These amino acid changes may modulate the conformation of the CypA-binding loop of CA in such a way that binding and/or isomerase function of CypA are no longer necessary for virus replication. The resistant HIV-1 isolates thus are CypA-independent.
Density-functional theory computer simulations of CZTS{sub 0.25}Se{sub 0.75} alloy phase diagrams
Energy Technology Data Exchange (ETDEWEB)
Chagarov, E.; Sardashti, K.; Kummel, A. C. [Departments of Chemistry and Biochemistry, University of California, San Diego, La Jolla, California 92093 (United States); Haight, R. [IBM T. J. Watson Research Center, P.O. Box 218, Yorktown Heights, New York 10598 (United States); Mitzi, D. B. [Departments of Mechanical Engineering and Materials Science, Duke University, Durham, North Carolina 27708 (United States)
2016-08-14
Density-functional theory simulations of CZTS, CZTSe, and CZTS{sub 0.25}Se{sub 0.75} photovoltaic compounds have been performed to investigate the stability of the CZTS{sub 0.25}Se{sub 0.75} alloy vs. decomposition into CZTS, CZTSe, and other secondary compounds. The Gibbs energy for vibrational contributions was estimated by calculating phonon spectra and thermodynamic properties at finite temperatures. It was demonstrated that the CZTS{sub 0.25}Se{sub 0.75} alloy is stabilized not by enthalpy of formation but primarily by the mixing contributions to the Gibbs energy. The Gibbs energy gains/losses for several decomposition reactions were calculated as a function of temperature with/without intermixing and vibration contributions to the Gibbs energy. A set of phase diagrams was built in the multidimensional space of chemical potentials at 300 K and 900 K temperatures to demonstrate alloy stability and boundary compounds at various chemical conditions. It demonstrated for CZTS{sub 0.25}Se{sub 0.75} that the chemical potentials for stability differ between typical processing temperature (∼900 K) and operating temperature (300 K). This implies that as cooling progresses, the flux/concentration of S should be increased in MBE growth to maintain the CZTS{sub 0.25}Se{sub 0.75} in a thermodynamically stable state to minimize phase decomposition.
Structural, magnetic and transport properties of Mn3.1Sn0.9 and Mn3.1Sn0.9N compounds
International Nuclear Information System (INIS)
Feng, W.J.; Li, D.; Ren, W.J.; Li, Y.B.; Li, W.F.; Li, J.; Zhang, Y.Q.; Zhang, Z.D.
2007-01-01
The cubic anti-perovskite Mn 3.1 Sn 0.9 N compound is prepared via nitrogenation of the hexagonal Mn 3.1 Sn 0.9 compound. A magnetic phase diagram of Mn 3.1 Sn 0.9 compound is constructed by analysis of data of its magnetic properties. For Mn 3.1 Sn 0.9 N compound, parasitic ferromagnetism exists in the temperature range of 5-370 K, besides a spin-reorientation at about 280 K. Mn 3.1 Sn 0.9 compound exhibits a metallic conducting behavior, while Mn 3.1 Sn 0.9 N displays a metal-nonmetal transition due to the electron localization caused by the static disorder. The differences of the physical properties between the both compounds, are discussed, in terms of the correlation of the hexagonal DO 19 and the cubic anti-perovskite structures, the reduction of the distances between Mn atoms, and the spin-pairing or charge transfer effect due to the electron donation by N 2p to Mn 3d states after introduction of N atoms into the interstitial sites of Mn 3.1 Sn 0.9 compound
Energy Technology Data Exchange (ETDEWEB)
Khader, S. Abdul, E-mail: khadersku@gmail.com; Sankarappa, T., E-mail: sankarappa@rediffmail.com [Department of Physics, Gulbarga University, Gulbarga-585106, Karnataka (India); Muneeswaran, M.; Giridharan, N. V. [Department of Physics, National Institute of Technology, Tiruchirapalli-620015 (India)
2016-05-06
The Particulate nano-composites of ferrite and ferroelectric phases having the general formula (x) Mg{sub 0.25}Cu{sub 0.25}Zn{sub 0.5}Fe{sub 2}O{sub 4} + (1-x) BaTiO{sub 3} (x=15%, 30% and 45%) were synthesized by sintering mixtures of highly ferroelectric BaTiO{sub 3} (BT) and highly magneto-strictive magnetic component Mg{sub 0.25}Cu{sub 0.25}Zn{sub 0.5}Fe{sub 2}O{sub 4}(MCZF). The presence of constituent phases of ferrite, ferroelectric and their composites were probed and confirmed by X-ray diffraction (XRD) studies. Surface morphology of the samples has been investigated using Field Emission Scanning Electron Microscope (FESEM). The variation of dielectric constant and dissipation factor as a function of frequency from 100 Hz to 1 MHz at room temperature were carried out using a Hioki LCR Hi-Tester. The dielectric constant and dielectric loss were found to decrease rapidly in the low frequency region and became almost constant in the high frequency region. The electrical conductivity deduced from the measured dielectric data has been thoroughly analyzed and found that the conduction mechanism in these composites is in conformity with small polaron hopping model. The ferroelectric properties of synthesized magneto-electric nano-composites were measured using P-E loop tracer.
Ultrafast quasiparticle dynamics of FeTe0.75Se0.25 superconductor
Directory of Open Access Journals (Sweden)
Katagiri T.
2013-03-01
Full Text Available The electron-phonon coupling constant (λ≈0.45 obtained from femtosecond pump-probe reflection measurements suggests that a phonon-mediated process cannot be the dominant mechanism for superconductivity of FeTe0.75Se0.25.
Aamodt, K.; Abeysekara, U.; Abrahantes Quintana, A.; Abramyan, A.; Adamova, D.; Aggarwal, M.M.; Aglieri Rinella, G.; Agocs, A.G.; Aguilar Salazar, S.; Ahammed, Z.; Ahmad, A.; Ahmad, N.; Ahn, S.U.; Akimoto, R.; Akindinov, A.; Aleksandrov, D.; Alessandro, B.; Alfaro Molina, R.; Alici, A.; Avina, E.Almaraz; Alme, J.; Alt, T.; Altini, V.; Altinpinar, S.; Andrei, C.; Andronic, A.; Anelli, G.; Angelov, V.; Anson, C.; Anticic, T.; Antinori, F.; Antinori, S.; Antipin, K.; Antonczyk, D.; Antonioli, P.; Anzo, A.; Aphecetche, L.; Appelshauser, H.; Arcelli, S.; Arceo, R.; Arend, A.; Armesto, N.; Arnaldi, R.; Aronsson, T.; Arsene, I.C.; Asryan, A.; Augustinus, A.; Averbeck, R.; Awes, T.C.; Aysto, J.; Azmi, M.D.; Bablok, S.; Bach, M.; Badala, A.; Baek, Y.W.; Bagnasco, S.; Bailhache, R.; Bala, R.; Baldisseri, A.; Baldit, A.; Ban, J.; Barbera, R.; Barnafoldi, G.G.; Barnby, L.; Barret, V.; Bartke, J.; Barile, F.; Basile, M.; Basmanov, V.; Bastid, N.; Bathen, B.; Batigne, G.; Batyunya, B.; Baumann, C.; Bearden, I.G.; Becker, B.; Belikov, I.; Bellwied, R.; Belmont-Moreno, E.; Belogianni, A.; Benhabib, L.; Beole, S.; Berceanu, I.; Bercuci, A.; Berdermann, E.; Berdnikov, Y.; Betev, L.; Bhasin, A.; Bhati, A.K.; Bianchi, L.; Bianchi, N.; Bianchin, C.; Bielcik, J.; Bielcikova, J.; Bilandzic, A.; Bimbot, L.; Biolcati, E.; Blanc, A.; Blanco, F.; Blanco, F.; Blau, D.; Blume, C.; Boccioli, M.; Bock, N.; Bogdanov, A.; Boggild, H.; Bogolyubsky, M.; Bohm, J.; Boldizsar, L.; Bombara, M.; Bombonati, C.; Bondila, M.; Borel, H.; Borshchov, V.; Borisov, A.; Bortolin, C.; Bose, S.; Bosisio, L.; Bossu, F.; Botje, M.; Bottger, S.; Bourdaud, G.; Boyer, B.; Braun, M.; Braun-Munzinger, P.; Bravina, L.; Bregant, M.; Breitner, T.; Bruckner, G.; Brun, R.; Bruna, E.; Bruno, G.E.; Budnikov, D.; Buesching, H.; Buncic, P.; Busch, O.; Buthelezi, Z.; Caffarri, D.; Cai, X.; Caines, H.; Camacho, E.; Camerini, P.; Campbell, M.; Canoa Roman, V.; Capitani, G.P.; Cara Romeo, G.; Carena, F.; Carena, W.; Carminati, F.; Casanova Diaz, A.; Caselle, M.; Castellanos, J.Castillo; Castillo Hernandez, J.F.; Catanescu, V.; Cattaruzza, E.; Cavicchioli, C.; Cerello, P.; Chambert, V.; Chang, B.; Chapeland, S.; Charpy, A.; Charvet, J.L.; Chattopadhyay, S.; Chattopadhyay, S.; Cherney, M.; Cheshkov, C.; Cheynis, B.; Chiavassa, E.; Chibante Barroso, V.; Chinellato, D.D.; Chochula, P.; Choi, K.; Chojnacki, M.; Christakoglou, P.; Christensen, C.H.; Christiansen, P.; Chujo, T.; Chuman, F.; Cicalo, C.; Cifarelli, L.; Cindolo, F.; Cleymans, J.; Cobanoglu, O.; Coffin, J.P.; Coli, S.; Colla, A.; Conesa Balbastre, G.; Conesa del Valle, Z.; Conner, E.S.; Constantin, P.; Contin, G.; Contreras, J.G.; Corrales Morales, Y.; Cormier, T.M.; Cortese, P.; Cortes Maldonado, I.; Cosentino, M.R.; Costa, F.; Cotallo, M.E.; Crescio, E.; Crochet, P.; Cuautle, E.; Cunqueiro, L.; Cussonneau, J.; Dainese, A.; Dalsgaard, H.H.; Danu, A.; Das, I.; Das, S.; Dash, A.; Dash, S.; de Barros, G.O.V.; De Caro, A.; de Cataldo, G.; de Cuveland, J.; De Falco, A.; De Gaspari, M.; de Groot, J.; De Gruttola, D.; de Haas, A.P.; De Marco, N.; De Pasquale, S.; De Remigis, R.; de Rooij, R.; de Vaux, G.; Delagrange, H.; Dellacasa, G.; Deloff, A.; Demanov, V.; Denes, E.; Deppman, A.; D'Erasmo, G.; Derkach, D.; Devaux, A.; Di Bari, D.; Di Giglio, C.; Di Liberto, S.; Di Mauro, A.; Di Nezza, P.; Dialinas, M.; Diaz, L.; Diaz, R.; Dietel, T.; Divia, R.; Djuvsland, O.; Dobretsov, V.; Dobrin, A.; Dobrowolski, T.; Donigus, B.; Dominguez, I.; Dordic, O.; Dubey, A.K.; Dubuisson, J.; Ducroux, L.; Dupieux, P.; Dutta Majumdar, A.K.; Dutta Majumdar, M.R.; Elia, D.; Emschermann, D.; Enokizono, A.; Espagnon, B.; Estienne, M.; Esumi, S.; Evans, D.; Evrard, S.; Eyyubova, G.; Fabjan, C.W.; Fabris, D.; Faivre, J.; Falchieri, D.; Fantoni, A.; Fasel, M.; Fateev, O.; Fearick, R.; Fedunov, A.; Fehlker, D.; Fekete, V.; Felea, D.; Fenton-Olsen, B.; Feofilov, G.; Fernandez Tellez, A.; Ferreiro, E.G.; Ferretti, A.; Ferretti, R.; Figueredo, M.A.S.; Filchagin, S.; Fini, R.; Fionda, F.M.; Fiore, E.M.; Floris, M.; Fodor, Z.; Foertsch, S.; Foka, P.; Fokin, S.; Formenti, F.; Fragiacomo, E.; Fragkiadakis, M.; Frankenfeld, U.; Frolov, A.; Fuchs, U.; Furano, F.; Furget, C.; Fusco Girard, M.; Gaardhoje, J.J.; Gadrat, S.; Gagliardi, M.; Gago, A.; Gallio, M.; Ganoti, P.; Ganti, M.S.; Garabatos, C.; Garcia Trapaga, C.; Gebelein, J.; Gemme, R.; Germain, M.; Gheata, A.; Gheata, M.; Ghidini, B.; Ghosh, P.; Giraudo, G.; Giubellino, P.; Gladysz-Dziadus, E.; Glasow, R.; Glassel, P.; Glenn, A.; Gomez Jimenez, R.; Gonzalez Santos, H.; Gonzalez-Trueba, L.H.; Gonzalez-Zamora, P.; Gorbunov, S.; Gorbunov, Y.; Gotovac, S.; Gottschlag, H.; Grabski, V.; Grajcarek, R.; Grelli, A.; Grigoras, A.; Grigoras, C.; Grigoriev, V.; Grigoryan, A.; Grigoryan, S.; Grinyov, B.; Grion, N.; Gros, P.; Grosse-Oetringhaus, J.F.; Grossiord, J.Y.; Grosso, R.; Guber, F.; Guernane, R.; Guerzoni, B.; Gulbrandsen, K.; Gulkanyan, H.; Gunji, T.; Gupta, A.; Gupta, R.; Gustafsson, H.A.; Gutbrod, H.; Haaland, O.; Hadjidakis, C.; Haiduc, M.; Hamagaki, H.; Hamar, G.; Hamblen, J.; Han, B.H.; Harris, J.W.; Hartig, M.; Harutyunyan, A.; Hasch, D.; Hasegan, D.; Hatzifotiadou, D.; Hayrapetyan, A.; Heide, M.; Heinz, M.; Helstrup, H.; Herghelegiu, A.; Hernandez, C.; Herrera Corral, G.; Herrmann, N.; Hetland, K.F.; Hicks, B.; Hiei, A.; Hille, P.T.; Hippolyte, B.; Horaguchi, T.; Hori, Y.; Hristov, P.; Hrivnacova, I.; Hu, S.; Huang, M.; Huber, S.; Humanic, T.J.; Hutter, D.; Hwang, D.S.; Ichou, R.; Ilkaev, R.; Ilkiv, I.; Inaba, M.; Innocenti, P.G.; Ippolitov, M.; Irfan, M.; Ivan, C.; Ivanov, A.; Ivanov, M.; Ivanov, V.; Iwasaki, T.; Jacholkowski, A.; Jacobs, P.; Jancurova, L.; Jangal, S.; Janik, R.; Jena, C.; Jena, S.; Jirden, L.; Jones, G.T.; Jones, P.G.; Jovanovic, P.; Jung, H.; Jung, W.; Jusko, A.; Kaidalov, A.B.; Kalcher, S.; Kalinak, P.; Kalisky, M.; Kalliokoski, T.; Kalweit, A.; Kamal, A.; Kamermans, R.; Kanaki, K.; Kang, E.; Kang, J.H.; Kapitan, J.; Kaplin, V.; Kapusta, S.; Karavichev, O.; Karavicheva, T.; Karpechev, E.; Kazantsev, A.; Kebschull, U.; Keidel, R.; Khan, M.M.; Khan, S.A.; Khanzadeev, A.; Kharlov, Y.; Kikola, D.; Kileng, B.; Kim, D.J.; Kim, D.S.; Kim, D.W.; Kim, H.N.; Kim, J.; Kim, J.H.; Kim, J.S.; Kim, M.; Kim, M.; Kim, S.H.; Kim, S.; Kim, Y.; Kirsch, S.; Kisel, I.; Kiselev, S.; Kisiel, A.; Klay, J.L.; Klein, J.; Klein-Bosing, C.; Kliemant, M.; Klovning, A.; Kluge, A.; Kniege, S.; Koch, K.; Kolevatov, R.; Kolojvari, A.; Kondratiev, V.; Kondratyeva, N.; Konevskih, A.; Kornas, E.; Kour, R.; Kowalski, M.; Kox, S.; Kozlov, K.; Kral, J.; Kralik, I.; Kramer, F.; Kraus, I.; Kravcakova, A.; Krawutschke, T.; Krivda, M.; Krumbhorn, D.; Krus, M.; Kryshen, E.; Krzewicki, M.; Kucheriaev, Y.; Kuhn, C.; Kuijer, P.G.; Kumar, L.; Kumar, N.; Kupczak, R.; Kurashvili, P.; Kurepin, A.; Kurepin, A.N.; Kuryakin, A.; Kushpil, S.; Kushpil, V.; Kutouski, M.; Kvaerno, H.; Kweon, M.J.; Kwon, Y.; La Rocca, P.; Lackner, F.; Ladron de Guevara, P.; Lafage, V.; Lal, C.; Lara, C.; Larsen, D.T.; Laurenti, G.; Lazzeroni, C.; Le Bornec, Y.; Le Bris, N.; Lee, H.; Lee, K.S.; Lee, S.C.; Lefevre, F.; Lenhardt, M.; Leistam, L.; Lehnert, J.; Lenti, V.; Leon, H.; Leon Monzon, I.; Leon Vargas, H.; Levai, P.; Li, X.; Li, Y.; Lietava, R.; Lindal, S.; Lindenstruth, V.; Lippmann, C.; Lisa, M.A.; Listratenko, O.; Liu, L.; Loginov, V.; Lohn, S.; Lopez, X.; Lopez Noriega, M.; Lopez-Ramirez, R.; Lopez Torres, E.; Lovhoiden, G.; Lozea Feijo Soares, A.; Lu, S.; Lunardon, M.; Luparello, G.; Luquin, L.; Lutz, J.R.; Ma, K.; Ma, R.; Madagodahettige-Don, D.M.; Maevskaya, A.; Mager, M.; Mahapatra, D.P.; Maire, A.; Makhlyueva, I.; Mal'Kevich, D.; Malaev, M.; Malagalage, K.J.; Maldonado Cervantes, I.; Malek, M.; Malkiewicz, T.; Malzacher, P.; Mamonov, A.; Manceau, L.; Mangotra, L.; Manko, V.; Manso, F.; Manzari, V.; Mao, Y.; Mares, J.; Margagliotti, G.V.; Margotti, A.; Marin, A.; Martashvili, I.; Martinengo, P.; Martinez Hernandez, M.I.; Martinez Davalos, A.; Martinez Garcia, G.; Maruyama, Y.; Marzari Chiesa, A.; Masciocchi, S.; Masera, M.; Masetti, M.; Masoni, A.; Massacrier, L.; Mastromarco, M.; Mastroserio, A.; Matthews, Z.L.; Matyja, A.; Mayani, D.; Mazza, G.; Mazzoni, M.A.; Meddi, F.; Menchaca-Rocha, A.; Mendez Lorenzo, P.; Meoni, M.; Mercado Perez, J.; Mereu, P.; Miake, Y.; Michalon, A.; Miftakhov, N.; Milosevic, J.; Minafra, F.; Mischke, A.; Miskowiec, D.; Mitu, C.; Mizoguchi, K.; Mlynarz, J.; Mohanty, B.; Molnar, L.; Mondal, M.M.; Montano Zetina, L.; Monteno, M.; Montes, E.; Morando, M.; Moretto, S.; Morsch, A.; Moukhanova, T.; Muccifora, V.; Mudnic, E.; Muhuri, S.; Muller, H.; Munhoz, M.G.; Munoz, J.; Musa, L.; Musso, A.; Nandi, B.K.; Nania, R.; Nappi, E.; Navach, F.; Navin, S.; Nayak, T.K.; Nazarenko, S.; Nazarov, G.; Nedosekin, A.; Nendaz, F.; Newby, J.; Nianine, A.; Nicassio, M.; Nielsen, B.S.; Nikolaev, S.; Nikolic, V.; Nikulin, S.; Nikulin, V.; Nilsen, B.S.; Nilsson, M.S.; Noferini, F.; Nomokonov, P.; Nooren, G.; Novitzky, N.; Nyatha, A.; Nygaard, C.; Nyiri, A.; Nystrand, J.; Ochirov, A.; Odyniec, G.; Oeschler, H.; Oinonen, M.; Okada, K.; Okada, Y.; Oldenburg, M.; Oleniacz, J.; Oppedisano, C.; Orsini, F.; Ortiz Velasquez, A.; Ortona, G.; Oskamp, C.J.; Oskarsson, A.; Osmic, F.; Osterman, L.; Ostrowski, P.; Otterlund, I.; Otwinowski, J.; Ovrebekk, G.; Oyama, K.; Ozawa, K.; Pachmayer, Y.; Pachr, M.; Padilla, F.; Pagano, P.; Paic, G.; Painke, F.; Pajares, C.; Pal, S.; Pal, S.K.; Palaha, A.; Palmeri, A.; Panse, R.; Papikyan, V.; Pappalardo, G.S.; Park, W.J.; Pastircak, B.; Pastore, C.; Paticchio, V.; Pavlinov, A.; Pawlak, T.; Peitzmann, T.; Pepato, A.; Pereira, H.; Peressounko, D.; Perez, C.; Perini, D.; Perrino, D.; Peryt, W.; Peschek, J.; Pesci, A.; Peskov, V.; Pestov, Y.; Peters, A.J.; Petracek, V.; Petridis, A.; Petris, M.; Petrov, P.; Petrovici, M.; Petta, C.; Peyre, J.; Piano, S.; Piccotti, A.; Pikna, M.; Pillot, P.; Pinazza, O.; Pinsky, L.; Pitz, N.; Piuz, F.; Platt, R.; Ploskon, M.; Pluta, J.; Pocheptsov, T.; Pochybova, S.; Podesta Lerma, P.L.M.; Poggio, F.; Poghosyan, M.G.; Polak, K.; Polichtchouk, B.; Polozov, P.; Polyakov, V.; Pommeresch, B.; Pop, A.; Posa, F.; Pospisil, V.; Potukuchi, B.; Pouthas, J.; Prasad, S.K.; Preghenella, R.; Prino, F.; Pruneau, C.A.; Pshenichnov, I.; Puddu, G.; Pujahari, P.; Pulvirenti, A.; Punin, A.; Punin, V.; Putis, M.; Putschke, J.; Quercigh, E.; Rachevski, A.; Rademakers, A.; Radomski, S.; Raiha, T.S.; Rak, J.; Rakotozafindrabe, A.; Ramello, L.; Ramirez Reyes, A.; Rammler, M.; Raniwala, R.; Raniwala, S.; Rasanen, S.S.; Rashevskaya, I.; Rath, S.; Read, K.F.; Real, J.S.; Redlich, K.; Renfordt, R.; Reolon, A.R.; Reshetin, A.; Rettig, F.; Revol, J.P.; Reygers, K.; Ricaud, H.; Riccati, L.; Ricci, R.A.; Richter, M.; Riedler, P.; Riegler, W.; Riggi, F.; Rivetti, A.; Rodriguez Cahuantzi, M.; Roed, K.; Rohrich, D.; Roman Lopez, S.; Romita, R.; Ronchetti, F.; Rosinsky, P.; Rosnet, P.; Rossegger, S.; Rossi, A.; Roukoutakis, F.; Rousseau, S.; Roy, C.; Roy, P.; Rubio-Montero, A.J.; Rui, R.; Rusanov, I.; Russo, G.; Ryabinkin, E.; Rybicki, A.; Sadovsky, S.; Safarik, K.; Sahoo, R.; Saini, J.; Saiz, P.; Sakata, D.; Salgado, C.A.; Salgueiro Domingues da Silva, R.; Salur, S.; Samanta, T.; Sambyal, S.; Samsonov, V.; Sandor, L.; Sandoval, A.; Sano, M.; Sano, S.; Santo, R.; Santoro, R.; Sarkamo, J.; Saturnini, P.; Scapparone, E.; Scarlassara, F.; Scharenberg, R.P.; Schiaua, C.; Schicker, R.; Schindler, H.; Schmidt, C.; Schmidt, H.R.; Schossmaier, K.; Schreiner, S.; Schuchmann, S.; Schukraft, J.; Schutz, Y.; Schwarz, K.; Schweda, K.; Scioli, G.; Scomparin, E.; Segato, G.; Semenov, D.; Senyukov, S.; Seo, J.; Serci, S.; Serkin, L.; Serradilla, E.; Sevcenco, A.; Sgura, I.; Shabratova, G.; Shahoyan, R.; Sharkov, G.; Sharma, N.; Sharma, S.; Shigaki, K.; Shimomura, M.; Shtejer, K.; Sibiriak, Y.; Siciliano, M.; Sicking, E.; Siddi, E.; Siemiarczuk, T.; Silenzi, A.; Silvermyr, D.; Simili, E.; Simonetti, G.; Singaraju, R.; Singh, R.; Singhal, V.; Sinha, B.C.; Sinha, T.; Sitar, B.; Sitta, M.; Skaali, T.B.; Skjerdal, K.; Smakal, R.; Smirnov, N.; Snellings, R.; Snow, H.; Sogaard, C.; Soloviev, A.; Soltveit, H.K.; Soltz, R.; Sommer, W.; Son, C.W.; Son, H.; Song, M.; Soos, C.; Soramel, F.; Soyk, D.; Spyropoulou-Stassinaki, M.; Srivastava, B.K.; Stachel, J.; Staley, F.; Stan, E.; Stefanek, G.; Stefanini, G.; Steinbeck, T.; Stenlund, E.; Steyn, G.; Stocco, D.; Stock, R.; Stolpovsky, P.; Strmen, P.; Suaide, A.A.P.; Subieta Vasquez, M.A.; Sugitate, T.; Suire, C.; Sumbera, M.; Susa, T.; Swoboda, D.; Symons, J.; Szanto de Toledo, A.; Szarka, I.; Szostak, A.; Szuba, M.; Tadel, M.; Tagridis, C.; Takahara, A.; Takahashi, J.; Tanabe, R.; Takaki, D.J.Tapia; Taureg, H.; Tauro, A.; Tavlet, M.; Tejeda Munoz, G.; Telesca, A.; Terrevoli, C.; Thader, J.; Tieulent, R.; Tlusty, D.; Toia, A.; Tolyhy, T.; Torcato de Matos, C.; Torii, H.; Torralba, G.; Toscano, L.; Tosello, F.; Tournaire, A.; Traczyk, T.; Tribedy, P.; Troger, G.; Truesdale, D.; Trzaska, W.H.; Tsiledakis, G.; Tsilis, E.; Tsuji, T.; Tumkin, A.; Turrisi, R.; Turvey, A.; Tveter, T.S.; Tydesjo, H.; Tywoniuk, K.; Ulery, J.; Ullaland, K.; Uras, A.; Urban, J.; Urciuoli, G.M.; Usai, G.L.; Vacchi, A.; Vala, M.; Valencia Palomo, L.; Vallero, S.; van den Brink, A.; van der Kolk, N.; Vyvre, P.Vande; van Leeuwen, M.; Vannucci, L.; Vargas, A.; Varma, R.; Vasiliev, A.; Vassiliev, I.; Vasileiou, M.; Vechernin, V.; Venaruzzo, M.; Vercellin, E.; Vergara, S.; Vernet, R.; Verweij, M.; Vetlitskiy, I.; Vickovic, L.; Viesti, G.; Vikhlyantsev, O.; Vilakazi, Z.; Villalobos Baillie, O.; Vinogradov, A.; Vinogradov, L.; Vinogradov, Y.; Virgili, T.; Viyogi, Y.P.; Vodopianov, A.; Voloshin, K.; Voloshin, S.; Volpe, G.; von Haller, B.; Vranic, D.; Vrlakova, J.; Vulpescu, B.; Wagner, B.; Wagner, V.; Wallet, L.; Wan, R.; Wang, D.; Wang, Y.; Watanabe, K.; Wen, Q.; Wessels, J.; Westerhoff, U.; Wiechula, J.; Wikne, J.; Wilk, A.; Wilk, G.; Williams, M.C.S.; Willis, N.; Windelband, B.; Xu, C.; Yang, C.; Yang, H.; Yasnopolskiy, S.; Yermia, F.; Yi, J.; Yin, Z.; Yokoyama, H.; Yoo, I-K.; Yuan, X.; Yurevich, V.; Yushmanov, I.; Zabrodin, E.; Zagreev, B.; Zalite, A.; Zampolli, C.; Zanevsky, Yu.; Zaporozhets, S.; Zarochentsev, A.; Zavada, P.; Zbroszczyk, H.; Zelnicek, P.; Zenin, A.; Zepeda, A.; Zgura, I.; Zhalov, M.; Zhang, X.; Zhou, D.; Zhou, S.; Zhu, J.; Zichichi, A.; Zinchenko, A.; Zinovjev, G.; Zoccarato, Y.; Zychacek, V.; Zynovyev, M.
2010-01-01
Charged-particle production was studied in proton-proton collisions collected at the LHC with the ALICE detector at centre-of-mass energies 0.9 TeV and 2.36 TeV in the pseudorapidity range |eta| < 1.4. In the central region (|eta| < 0.5), at 0.9 TeV, we measure charged-particle pseudorapidity density dNch/deta = 3.02 +- 0.01 (stat.) +0.08 -0.05 (syst.) for inelastic interactions, and dNch/deta = 3.58 +- 0.01 (stat.) +0.12 -0.12 (syst.) for non-single-diffractive interactions. At 2.36 TeV, we find dNch/deta = 3.77 +- 0.01 (stat.) +0.25 -0.12 (syst.) for inelastic, and dNch/deta = 4.43 +- 0.01 (stat.) +0.17 -0.12 (syst.) for non-single-diffractive collisions. The relative increase in charged-particle multiplicity from the lower to higher energy is 24.7% +- 0.5% (stat.) +5.7% -2.8% (syst.) for inelastic and 23.7% +- 0.5% (stat.) +4.6% -1.1% (syst.) for non-single-diffractive interactions. This increase is consistent with that reported by the CMS collaboration for non-single-diffractive events and larger th...
Diminuição da progressão da miopia com atropina 0,025%
Directory of Open Access Journals (Sweden)
Celso Marcelo da Cunha
Full Text Available Resumo Objetivo: Demonstrar a eficácia do uso do colírio de atropina 0,025% em crianças míopes, no Brasil, para a diminuição da progressão da miopia. Métodos: Realizou-se estudo prospectivo em 60 pacientes do Hospital Geral Universitário e Oftalmocenter Santa Rosa - Cuiabá - MT, com idades entre 6 e 12 anos, com equivalente esférico da refração entre -1,00 a -6,00 DE, refração cilíndrica < -1,00 DC e taxa de progressão anual de 0,50 DE (ou maior. Efetuou-se exame oftalmológico geral, topografia corneana e a medida do diâmetro anteroposterior do globo ocular (DAP. Os pacientes foram divididos em dois grupos: em que o Grupo 1 recebeu colírio de atropina 0,025%, todas as noites, e prescreveu-se a refração total com lentes com antirreflexo de multicamadas; e, no Grupo 2, somente a refração total. Nova avaliação foi realizada dois anos após. O teste T Student pareado foi utilizado para comparações das refrações, DAP e ceratometrias, medidas no exame inicial e no exame com 2 anos de seguimento. Resultados: Das 60 crianças, 30 eram do Grupo 1 com idade média de 8,21 ± 1,72 anos, e as do grupo controle com idade média de 8,17 ± 1,73 anos. Quatorze (46,66% e 16 (53,33% eram do sexo masculino nos Grupos 1 e 2, respectivamente. O Grupo 1 revelou menor progressão da miopia (Grupo 1: 0,43 ± 0,19D, Grupo 2: 1,24 ± 0,37D e menor crescimento do DAP em relação ao grupo controle (Grupo 1: 0,19 ± 0,09mm, Grupo 2: 0,48 ± 0,12mm. Houve diferença estatisticamente significativa (P<0,05 entre o grupo tratado e o controle em relação à refração e ao crescimento DAP. A topografia não teve mudança estatisticamente significativa. Conclusão: A atropina em baixas concentrações foi eficaz em diminuir a progressão da miopia em 65% desta população estudada, por 2 anos. No entanto estudos com maior número de participantes e em diversas regiões do Brasil poderiam demonstrar melhor esse fato.
Hart-Davis, Guy
2010-01-01
If you want to get the very most out of the suite of iWork '09 applications, put this savvy Portable Genius guide to work. Want to create professional-quality documents? Make your spreadsheets powerful and unique? Deliver a persuasive presentation in person, on paper, or via the Internet? You'll find cool and useful Genius tips, full-color screenshots, and pages of easy-to-access shortcuts and tools that will save you loads of time and let you enjoy the iWork '09 applications to the max.
National Oceanic and Atmospheric Administration, Department of Commerce — Chemical, physical and profile oceanographic data were collected aboard the RYAN CHOUEST in the Gulf of Mexico from 2010-09-09 to 2010-09-15 in response to the...
National Oceanic and Atmospheric Administration, Department of Commerce — Chemical, physical and profile oceanographic data were collected aboard NOAA Ship Pisces in the Gulf of Mexico from 2010-09-09 to 2010-09-17 in response to the...
International Nuclear Information System (INIS)
Yan, Tao; Li, Mengmeng; Wang, Xiaodong; Sun, Meng; Liu, Hongye; Wei, Qin; Xu, Wenguo; Du, Bin
2015-01-01
Graphical abstract: - Highlights: • Novel PI/Zn 0.25 Cd 0.75 S composite showed enhanced activity in dye degradation. • The composites PIZCS-30 exhibited the best activity. • The heterojunction was in situ fabricated between PI and Zn 0.25 Cd 0.75 S. • The PI/Zn 0.25 Cd 0.75 S heterojunction facilitated the separation of electron–hole pairs. - Abstract: Novel organic–inorganic polyimide (PI)–Zn 0.25 Cd 0.75 S composites with high-efficiency visible light performance was prepared by a facile and template free hydrothermal method. The obtained composites were characterized by X-ray diffraction (XRD), Fourier transform infrared spectroscopy (FTIR), X-ray photo-electron spectroscopy (XPS), ultraviolet–visible diffuse reflection spectroscopy (DRS), scanning electron microscopy (SEM), and transmission electron microscopy (TEM). The XRD and SEM results revealed that the PI exhibited a high degree of polymerization. The DRS characterization showed that the light absorption exhibited regular shifts upon the change of PI/Zn 0.25 Cd 0.75 S mass ratio. The TEM results proved the in situ growth of finely distributed Zn 0.25 Cd 0.75 S nanoparticles on the surface of PI sheets. The as-prepared samples exhibited superior photocatalytic activity compared with PI and Zn 0.25 Cd 0.75 S toward the degradation of dyes under visible light irradiation. The electrochemical impedance spectroscopy (EIS) confirmed that the separation efficiency of electron–hole pairs was greatly improved for the formation of heterojunction. The activity enhancement of PI/Zn 0.25 Cd 0.75 S composites could be attributed to the interfacial electronic interaction and high migration efficiency of photo-induced carriers. A possible photodegradation mechanism was proposed for the degradation of dyes over PI/Zn 0.25 Cd 0.75 S composites
Stability and electronic properties of Cd0.75Mn0.25S and Cd0.75Mn0.25Se in B3 phase
Energy Technology Data Exchange (ETDEWEB)
Rani, Anita [Guru Nanak College for Girls, Sri Muktsar Sahib, Punjab (India); Kumar, Ranjan [Panjab University, Department of Physics, Chandigarh (India)
2015-08-15
We studied the structural, elastic, spin-polarized electronic band structures and magnetic properties of the diluted magnetic semiconductor Cd{sub 1-x}Mn{sub x}S and Cd{sub 1-x} Mn{sub x}Se in zinc blende phase (B3) for x = 0.25 using ab initio method. The calculations were performed by using density functional theory as implemented in the Spanish Initiative for Electronic Simulations with Thousands of Atoms code using local density approximation. Calculated electronic band structures and magnetic properties of Cd{sub 1-x}Mn{sub x}S are discussed in terms of contribution of Mn 3d{sup 5} 4s{sup 2}, Cd 4d{sup 10} 5s{sup 2}, S 3s{sup 2} 3p{sup 4} orbitals. The total magnetic moment is found to be 5.00 μ{sub b} for Cd{sub 1-x}Mn{sub x}S and Cd{sub 1-x}Mn{sub x}Se at x = 0.25. This value indicates that Mn atom adds no hole carrier to the perfect CdS crystal. We determine the spin-exchange splitting energies produced by Mn 3d states, s-d exchange constant N{sub 0}α, and p-d exchange constant N{sub 0}β. We found that Mn-doped systems are ferromagnetic. Calculated results are in good agreement with previous studies. (orig.)
Crystal structure of ethylenedioxytetrathiafulvalene-4,5-bis(thiolbenzoic acid 0.25-hydrate
Directory of Open Access Journals (Sweden)
Yuanyuan Zhang
2017-09-01
Full Text Available In the title compound (systematic name: 4,4′-{[2-(5,6-dihydro-[1,3]dithiolo[4,5-b][1,4]dioxin-2-ylidene-1,3-dithiole-4,5-diyl]bis(sulfanediyl}dibenzoic acid 0.25-hydrate, C22H14O6S6·0.25H2O, the tetrathiafulvalene (TTF core adopts a boat conformation, where the central S2C=CS2 plane makes dihedral angles of 31.34 (4 and 26.83 (6°, respectively, with the peripheral S2C=CS2 and S2C2O2 planes. In the crystal, the benzoic acid molecules are linked via O—H...O hydrogen bonds, forming inversion dimers with R22(8 motifs. The dimers are linked through weak C—H...O hydrogen bonds into a chain structure along [-101]. The chains stack along the a axis through S...S and S...C short contacts, forming layers parallel to the ac plane.
Directory of Open Access Journals (Sweden)
Lotte Coelmont
2010-10-01
Full Text Available DEB025/Debio 025 (Alisporivir is a cyclophilin (Cyp-binding molecule with potent anti-hepatitis C virus (HCV activity both in vitro and in vivo. It is currently being evaluated in phase II clinical trials. DEB025 binds to CypA, a peptidyl-prolyl cis-trans isomerase which is a crucial cofactor for HCV replication. Here we report that it was very difficult to select resistant replicons (genotype 1b to DEB025, requiring an average of 20 weeks (four independent experiments, compared to the typically <2 weeks with protease or polymerase inhibitors. This indicates a high genetic barrier to resistance for DEB025. Mutation D320E in NS5A was the only mutation consistently selected in the replicon genome. This mutation alone conferred a low-level (3.9-fold resistance. Replacing the NS5A gene (but not the NS5B gene from the wild type (WT genome with the corresponding sequence from the DEB025(res replicon resulted in transfer of resistance. Cross-resistance with cyclosporine A (CsA was observed, whereas NS3 protease and NS5B polymerase inhibitors retained WT-activity against DEB025(res replicons. Unlike WT, DEB025(res replicon replicated efficiently in CypA knock down cells. However, DEB025 disrupted the interaction between CypA and NS5A regardless of whether the NS5A protein was derived from WT or DEB025(res replicon. NMR titration experiments with peptides derived from the WT or the DEB025(res domain II of NS5A corroborated this observation in a quantitative manner. Interestingly, comparative NMR studies on two 20-mer NS5A peptides that contain D320 or E320 revealed a shift in population between the major and minor conformers. These data suggest that D320E conferred low-level resistance to DEB025 probably by reducing the need for CypA-dependent isomerisation of NS5A. Prolonged DEB025 treatment and multiple genotypic changes may be necessary to generate significant resistance to DEB025, underlying the high barrier to resistance.
40 CFR 61.09 - Notification of startup.
2010-07-01
... 40 Protection of Environment 8 2010-07-01 2010-07-01 false Notification of startup. 61.09 Section...) NATIONAL EMISSION STANDARDS FOR HAZARDOUS AIR POLLUTANTS General Provisions § 61.09 Notification of startup. (a) The owner or operator of each stationary source which has an initial startup after the effective...
National Oceanic and Atmospheric Administration, Department of Commerce — Chemical and physical oceanographic profile data were collected aboard the Arctic in the Gulf of Mexico from 2010-09-09 to 2010-09-14 in response to the Deepwater...
Hossain, Mohammad M.
2012-05-18
This communication reports a mechanism-based kinetics modelling for the dehydrogenation of ethylbenzene to styrene (ST) using Mg3Fe0.25Mn0.25Al0.5 catalyst. Physicochemical characterisation of the catalyst indicates that the presence of basic sites Mg2+O2- on the catalysts along with Fe3+ is responsible for the catalytic activity. The kinetics experiments are developed using a CREC Fluidised Riser Simulator. Based on the experimental observations and the possible mechanism of the various elementary steps, Langmuir-Hinshelwood type kinetics model are developed. To take into account of the possible catalyst deactivation a reactant conversion-based deactivation function is also introduced into the model. Parameters are estimated by fitting of the experimental data implemented in MATLAB. Results show that one site type Langmuir-Hinshelwood model appropriately describes the experimental data, with adequate statistical fitting indicators and also satisfied the thermodynamic restraints. The estimated heat of adsorptions of EB (64kJ/mole) is comparable to the values available in the literature. The activation energy for the formation of ST (85.5kJ/mole) found to be significantly lower than that of the cracking product benzene (136.6kJ/mole). These results are highly desirable in order to achieve high selectivity of the desired product ST. © 2012 Canadian Society for Chemical Engineering.
Exon: CBRC-MMUS-09-0206 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-MMUS-09-0206 gttcaataccaccaccaccaccaccaccaccaccaccaccactaccaccaccaccaccaccaccaccaccactaccaccaccaccacca...ccaccaccaccaccaccactaccaccaccaccaccaccaccaccaccatcaccactaccaccaccaccaccaccaccaccaccaccaccaccaccaccagggagaacaagcattcaa ...
Influence of Dy addition on the magnetocaloric effect of La0.67Ca0.33Mn0.9V0.1O3 ceramics
International Nuclear Information System (INIS)
Nisha, P.; Savitha Pillai, S.; Suresh, K.G.; Raama Varma, Manoj
2012-01-01
The influence of partial substitution of La by Dy on the magnetocaloric response of (La 1-x Dy x ) 0.67 Ca 0.33 Mn 0.9 V 0.1 O 3 , where x=0.03, 0.15 and 0.25 is studied. Rietveld refinement of X-ray diffraction pattern using GSAS method shows that the compounds adopt the orthorhombic structure with Pnma space group. The systematic change in lattice parameters and magnetic phase transition indicates the substitution effect of Dy. From the magnetization isotherms at different temperatures, magnetic entropy change close to their respective transition temperatures (T C ) has been evaluated. The maximum value of entropy change near T C is found to be about 4.8 J/kg K at 187.5 K for LCMVDy 0.03 , 2.45 J/kg K at 107.5 K for LCMVDy 0.15 and 2.15 J/kg K at 92.5 K for LCMVDy 0.25 at 4 T. Dy addition produces a reduction in T C and in magnitude of the magnetic entropy change. Even though the entropy change decreases with increasing Dy substitution the refrigerant temperature range, ΔT, is found to be 10 K for LCMVDy 0.03 , 31 K for LCMVDy 0.15 and 35 K for LCMVDy 0.25 compounds [90%] at 4 T. The field dependence of the magnetic entropy change is also analyzed showing the power law dependence, ΔS M ∞H n where n=0.75(2) for LCMVDy 0.03 , n=0.80(4) for LCMVDy 0.15 and n=0.92(8) for LCMVDy 0.25 compounds at their respective transition temperatures. The relative cooling power and its field dependance are also analyzed. - Highlights: → Studied magnetocaloric response of Dy substituted solid state synthesized LCMVO. → Studied the field dependence of the magnetic entropy change (ΔS M ∞H n ). → Studied the field dependence of Relative cooling power (RCP∞H 1+1/δ ). → Considerably large magnetocaloric effect and moderate relative cooling power.
International Nuclear Information System (INIS)
Doerr, R.J.; Abdel-Nabi, H.; Merchant, B.
1990-01-01
We investigated the utility of scanning with indium 111 labeled to monoclonal antibody in 13 patients after curative resection of colorectal cancer who had elevated carcinoembryonic antigen levels and negative results of clinical workup. Each patient received 1 mg of anti-carcinoembryonic antigen monoclonal antibody type ZCE 025 labeled with 5.5 mCi of 111 In, plus 9 to 39 mg of the same antibody unlabeled. Patients underwent scanning 3 to 7 days after infusion by planar and emission computed tomography. ZCE-025 monoclonal antibody imaging detected tumor recurrence or metastasis in 11 of 13 patients. In one patient the monoclonal antibody scan gave a true-negative result, and in one patient the monoclonal antibody scan failed to disclose a metachronous cecal primary. Tumor sites identified were the pelvis (2 patients), abdominal wall (2), retroperitoneum (1), lymph nodes (3); liver (2), bone (2), and lung (1). The accurate localization of colorectal carcinoma recurrences by means of 111 In ZCE-025 monoclonal antibody demonstrates the usefulness of this diagnostic agent in the setting of elevated carcinoembryonic antigen level and negative results of clinical and radiologic workup
Magnetic and magnetocaloric properties of HoCr0.75Fe0.25O3 compound
Kotnana, Ganesh; Babu, P. D.; Jammalamadaka, S. Narayana
2018-05-01
We report on the magnetic and magnetocaloric properties of HoCr0.75Fe0.25O3 compound around the Néel temperature (TN), which is due to Cr3+ ordering. Susceptibility (χ) vs. temperature (T) graph of HoCr0.75Fe0.25O3 compound infer two transitions due to the ordering of Cr3+ moments (TN ˜ 155 K) and Ho3+ moments (TNHo ˜ 8 K). Magnetic entropy (-ΔSM) value of 1.14 J kg-1 K-1 around 157.5 K with a magnetic field (H) of 90 kOe is attributed to antiferromagnetic (AFM) ordering of Cr3+ moments. A maximum value of adiabatic temperature (ΔTad) ˜ 0.41 K around TN is obtained and is found to increases with applied magnetic field. Negative slope for H/M vs. M2 graph is evident for HoCr0.75Fe0.25O3 compound below TN, which indicates the first order phase transition. Quantified values of -ΔSM and ΔTad open the way to explore rare earth orthochromites for the MCE properties and refrigeration applications.
DEFF Research Database (Denmark)
Cheng, Shiyang; Chatzichristodoulou, Christodoulos; Søgaard, Martin
2017-01-01
Pr. A series of compositions of PrxGd0.1Ce0.9-xO1.95-δ (x = 0, 0.02, 0.05, 0.08, 0.15, 0.25, 0.3 and 0.4) was prepared by solid state reaction. X-ray powder diffraction (XPD) indicates that Pr is completely dissolved in the fluorite structure up to 40 at.%. Pronounced nonlinear thermal expansion...... behavior was observed as a function of temperature, due to the simultaneous contributions of both thermal and chemical expansion. The electronic and ionic conductivities were measured as a function of temperature and oxygen partial pressure. Within the range from 10 to 15 at.% Pr, a drastic drop...
CRED Gridded Bathymetry of Nihoa Island (100-025) in the Northwestern Hawaiian Islands
National Oceanic and Atmospheric Administration, Department of Commerce — File 100-025b is a 60-m ASCII grid of depth data collected near Nihoa Island in the Northwestern Hawaiian Islands as of May 2003. This grid has been produced as part...
Crystal and magnetic structure of TbFe{sub 0.25}Ge{sub 2} compound
Energy Technology Data Exchange (ETDEWEB)
Gil, A., E-mail: a.gil@ajd.czest.pl [Faculty of Mathematics and Natural Sciences, Jan Długosz University in Częstochowa, Armii Krajowej 13/15, 42-200 Częstochowa (Poland); Hoser, A. [Helmholtz-Zentrum Berlin für Materialien und Energie GmbH, Hahn-Meitner-Platz 1, 14-109 Berlin (Germany); Penc, B.; Szytuła, A. [M. Smoluchowski Institute of Physics, Jagiellonian University, Reymonta 4, 30-059 Kraków (Poland)
2013-10-15
The crystal and magnetic structure of polycrystalline TbFe{sub 0.25}Ge{sub 2} sample have been determined. X-ray and neutron diffraction studies indicate that this compound has the orthorhombic CeNiSi{sub 2}-type crystal structure (space group Cmcm). The magnetic ordering, based on the neutron diffraction data in low temperature, is described by two components: a collinear antiferromagnetic G-type and a cosine-wave modulated one. In the collinear G-type structure the Tb magnetic moment is equal to 3.81(5) µ{sub B} and it is parallel to the c-axis. The modulated structure is described by the propagation vector k=(0.460(8), 0, 0.305(1)), the Tb magnetic moment equals 7.75(8) µ{sub B,} lies in b–c and forms an angle 23(2)° with the c-axis. The collinear component decreases to zero at 22.6 K while the modulated one at 190.8 K. - Highlights: • We determine crystal and magnetic structure of TbFe{sub 0.25}Ge{sub 2} compound. • We compare the results with other TbT{sub x}Ge{sub 2} compounds. • We observe the complex magnetic structure in TbFe{sub 0.25}Ge{sub 2} with two components: collinear and cosine-wave modulated. • T (3d) element have got significant influence on the interactions in Tb sublattice.
National Oceanic and Atmospheric Administration, Department of Commerce — Chemical and physical oceanographic profile data were collected aboard the HOS Davis in the Gulf of Mexico from 2010-09-09 to 2010-09-27 in response to the Deepwater...
Directory of Open Access Journals (Sweden)
Yenilen Troche Concepción
2010-06-01
Full Text Available El colirio de ketotifeno se indica para aliviar los signos y síntomas de las conjuntivitis alérgicas, por ser este un potente antihistamínico H1 que muestra cierta capacidad para inhibir la liberación de histamina y otros mediadores en mastocitos. El objetivo del presente trabajo consistió en realizar el desarrollo tecnológico del colirio de ketotifeno 0,025 %, de producción nacional teniendo en cuenta que es un medicamento muy utilizado en la "Operación Milagro", en la cual participa la República de Cuba, para lo que se hace un diseño y los estudios de preformulación. Se estudió además, las especificaciones de calidad de la formulación seleccionada, la estabilidad del producto y el tiempo de vigencia de este. Se realizó el estudio de estabilidad acelerado y por vida de estante, para lo cual se emplearon 3 lotes del producto a escala piloto. El colirio resultó estable física, química y microbiológicamente envasado en frascos de polietileno de baja densidad, por espacio de 12 meses a temperatura ambienteThe Ketotifen eyedrops is prescribed to relieve the signs and symptoms of allergic conjunctivitis due to it is a powerful H1 antihistaminic with certain ability to inhibit the histamine release and other mediators in the case of mast cells. The aim of present paper was to perform the technological development of 0.025 % eyedrops Ketotifen of national production considering that it is a drug very used in the "Operación Milagro" with participation of the Republic of Cuba and with its own design and the pre-formula. Also, we studied the selected formula specifications, the product stability and its expiry date. An accelerated stability study was conducted and by shelf life using 3 batches of pilot scale product. The eyedrops was physically, chemically and microbiologically stable when it is bottling in low-density polyethylene flasks during 12 months at room temperature.
Experiment data report for Semiscale Mod-1 test S-02-5 (blowdown heat transfer test)
International Nuclear Information System (INIS)
1975-12-01
Recorded test data are presented for Test S-02-5 of the Semiscale Mod-1 blowdown heat transfer test series. Test S-02-5 is one of several Semiscale Mod-1 experiments conducted to investigate the thermal and hydraulic phenomena accompanying a hypothesized loss-of-coolant accident in a water-cooled nuclear reactor system and to provide data for the assessment of the Loss-of-Fluid Test (LOFT) design basis. Test S-02-5 was conducted from an initial cold leg fluid temperature of 544 0 F and an initial pressure of 2,253 psia. A simulated double-ended offset shear cold leg break was used to investigate the system response to a depressurization transient with full core power (1.6 MW). An electrically heated core was used in the pressure vessel to simulate the effects of a nuclear core. System flow was set to achieve the full design core temperature differential of 66 0 F. The flow resistance of the intact loop was based on core area scaling. During system depressurization, core power was reduced from the initial level of 1.6 MW in such a manner as to simulate the surface heat flux response of the LOFT nuclear fuel rods until such time that departure from nucleate boiling occurs
Bilgihan, Kamil; Kalkanci, Ayse; Ozdemir, Huseyin Baran; Yazar, Reyhan; Karakurt, Funda; Yuksel, Erdem; Otag, Feza; Karabicak, Nilgun; Arikan-Akdagli, Sevtap
2016-08-01
Antifungal efficacy of photochemical cross-linking (PACK-CXL) with 0.1% and 0.25% riboflavin was evaluated with a comparative in vitro study. Candida albicans and Aspergillus fumigatus ATCC reference strains, Candida parapsilosis, Aspergillus fumigatus, Fusarium solani, Scedosporium apiospermum, and Alternaria alternata strains isolated from keratitis cases were chosen as targeted microorganisms. Unique "black plate method" was developed in polystyrene microplates. Riboflavin suspensions in 0.1% and 0.25% were separately added into inoculated wells. Non-inoculated wells were filled by black colored dye in order to protect treated wells from reflection of UV treatment. After ultraviolet A (UVA) treatment, each well was evaluated by microbiological culture in order to count viable fungal colonies. Fungal killing rate was calculated by comparing fungal counts (CFU/mL) before and after UVA application of riboflavin-added wells. Four different fungal inoculum concentrations of targeted microorganisms, including 10 4 , 10 3 , 10 2 , and 10 1 CFU/mL, were assayed. PACK-CXL with 0.25% riboflavin was found to be highly effective on fungal cells even in 10 4 CFU/mL of concentration. PACK-CXL appears as a promising treatment option for difficult-to-treat cases of fungal keratitis and 0.25% riboflavin concentration increases fungicidal effect of the procedure dramatically.
Thermal conductivity of (Np0.20Pu0.50Am0.25Cm0.05)O2−x solid solutions
International Nuclear Information System (INIS)
Nishi, Tsuyoshi; Takano, Masahide; Akabori, Mitsuo; Arai, Yasuo
2013-01-01
Highlights: • Thermal conductivity of (Np 0.20 Pu 0.50 Am 0.25 Cm 0.05 )O 2−x was evaluated. • Dependence of thermal conductivity on storage time was clarified. • Results were discussed with the lattice expansion model by self-irradiation. • After annealing at 1423 K in vacuum, thermal conductivity returned. -- Abstract: The authors prepared the sintered sample of (Np 0.20 Pu 0.50 Am 0.25 Cm 0.05 )O 2−x (2 − x = 1.98, 1.96) solid solution and evaluated the dependence of the thermal conductivity on storage time and temperature. The heat capacity of (Np 0.20 Pu 0.50 Am 0.25 Cm 0.05 )O 1.98 was measured between 324 and 1082 K by a drop calorimetry. The thermal diffusivity of (Np 0.20 Pu 0.50 Am 0.25 Cm 0.05 )O 1.98 was measured when the storage time became 48, 216, 720 and 1584 h and that of (Np 0.20 Pu 0.50 Am 0.25 Cm 0.05 )O 1.96 was measured when the storage time became 0,528 and 1386 h. In this study, the latter sample was annealed at 1423 K in vacuum with background pressure of less than 2.0 × 10 −4 Pa just after the measurement on the storage time, 1386 h. The thermal diffusivity of (Np 0.20 Pu 0.50 Am 0.25 Cm 0.05 )O 1.96 just after annealing returned to the values of the storage time, 0 h. This result reveals the thermal recovery behavior by annealing. The thermal conductivity of (Np 0.20 Pu 0.50 Am 0.25 Cm 0.05 )O 2−x was determined from the measured thermal diffusivity, heat capacity and bulk density. The thermal conductivity of (Np 0.20 Pu 0.50 Am 0.25 Cm 0.05 )O 2−x exponentially decreased with increasing storage time. This result suggested that the decrease of the thermal conductivity was attributed to the accumulation of lattice defects caused by self-irradiation
Oxygen adsorption on the Al0.25Ga0.75N (0001) surface: A first-principles study
Fu, Jiaqi; Song, Tielei; Liang, Xixia; Zhao, Guojun
2018-04-01
To understand the interaction mechanism for the oxygen adsorption on AlGaN surface, herein, we built the possible models of oxygen adsorption on Al0.25Ga0.75N (0001) surface. For different oxygen coverage, three kinds of adsorption site are considered. Then the favorable adsorption sites are characterized by first principles calculation for (2 × 2) supercell of Al0.25Ga0.75N (0001) surface. On basis of the optimal adsorption structures, our calculated results show that all the adsorption processes are exothermic, indicating that the (0001) surface orientation is active towards the adsorption of oxygen. The doping of Al is advantage to the adsorption of O atom. Additionally, the adsorption energy decreases with reducing the oxygen coverage, and the relationship between them is approximately linear. Owing to the oxygen adsorption, the surface states in the fundamental band gap are significant reduced with respect to the free Al0.25Ga0.75N (0001) surface. Moreover, the optical properties on different oxygen coverage are also discussed.
46 CFR 42.09-5 - All vessels-division into types.
2010-10-01
... 46 Shipping 2 2010-10-01 2010-10-01 false All vessels-division into types. 42.09-5 Section 42.09-5... BY SEA Load Line Assignments and Surveys-General Requirements § 42.09-5 All vessels—division into types. (a) For the purposes of this part, each vessel to which this part applies is either a Type “A” or...
OMI/Aura NO2 Cloud-Screened Total and Tropospheric Column Daily L3 Global 0.25deg Lat/Lon Grid V003
National Aeronautics and Space Administration — The OMI/Aura Level-3 Global Gridded(0.25x0.25 deg) Nitrogen Dioxide Product "OMNO2d" is now released (Jan 10, 2013) to the public from the NASA Goddard Earth...
International Nuclear Information System (INIS)
2009-01-01
The Pakistan Atomic Energy Commission (PAEC) annual report for the year 2008-09 has been compiled. The salient features of the activities of various Centers, Power Plants and different project have been explained. The activities are described under the topics as: highlights of various projects, nuclear power, engineering, physical sciences, biological sciences, nuclear materials, safety, human resource development, PAEC health services projects and publications. (A.B).
iMovie '09 & iDVD pocket genius
Hart-Davis, Guy
2010-01-01
If you want to get the very most out of iMovie '09 or iDVD, put this savvy Portable Genius to work. Want to quickly turn raw footage into a polished movie? Crop, rotate, or delete clips? Add background music or sound effects? Customize your iDVD themes? You'll find cool and useful Genius tips, insider secrets, full-color screenshots, and pages of easy-to-access shortcuts and tools that will save you loads of time and let you enjoy iMovie '09 and iDVD to the max.
DEFF Research Database (Denmark)
Kjellsson, Gøsta; Strandberg, Morten Tune
2012-01-01
"DMU har modtaget og vurderet de supplerende oplysninger (mail fra Skov- og Naturstyrelsen d. 07-09-2004) til ansøgningen om tilladelse til markedsføring af genetisk modificeret majs C/DE/02/09 (MON863 og MON863 x MON810). Vi har gennemgået oplysningerne i det tilsendte materiale for at se om de ...
17 CFR 210.12-09 - Valuation and qualifying accounts.
2010-04-01
... period Column C—Additions (1)—Charged to costs and expenses (2)—Charged to other accounts—describe Column... qualifying accounts and reserves by descriptive title. Group (a) those valuation and qualifying accounts... accounts. 210.12-09 Section 210.12-09 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION...
High mobility In0.75Ga0.25As quantum wells in an InAs phonon lattice
Chen, C.; Holmes, S. N.; Farrer, I.; Beere, H. E.; Ritchie, D. A.
2018-03-01
InGaAs based devices are great complements to silicon for CMOS, as they provide an increased carrier saturation velocity, lower operating voltage and reduced power dissipation (International technology roadmap for semiconductors (www.itrs2.net)). In this work we show that In0.75Ga0.25As quantum wells with a high mobility, 15 000 to 20 000 cm2 V-1 s-1 at ambient temperature, show an InAs-like phonon with an energy of 28.8 meV, frequency of 232 cm-1 that dominates the polar-optical mode scattering from ˜70 K to 300 K. The measured optical phonon frequency is insensitive to the carrier density modulated with a surface gate or LED illumination. We model the electron scattering mechanisms as a function of temperature and identify mechanisms that limit the electron mobility in In0.75Ga0.25As quantum wells. Background impurity scattering starts to dominate for temperatures <100 K. In the high mobility In0.75Ga0.25As quantum well, GaAs-like phonons do not couple to the electron gas unlike the case of In0.53Ga0.47As quantum wells.
THE SUBLUMINOUS AND PECULIAR TYPE Ia SUPERNOVA PTF 09dav
International Nuclear Information System (INIS)
Sullivan, M.; Ofek, E. O.; Blake, S.; Podsiadlowski, P.; Kasliwal, M. M.; Cooke, J.; Quimby, R.; Kulkarni, S. R.; Nugent, P. E.; Thomas, R. C.; Poznanski, D.; Howell, D. A.; Arcavi, I.; Gal-Yam, A.; Hook, I. M.; Mazzali, P.; Bildsten, L.; Bloom, J. S.; Cenko, S. B.; Law, N.
2011-01-01
PTF 09dav is a peculiar subluminous Type Ia supernova (SN) discovered by the Palomar Transient Factory (PTF). Spectroscopically, it appears superficially similar to the class of subluminous SN1991bg-like SNe, but it has several unusual features which make it stand out from this population. Its peak luminosity is fainter than any previously discovered SN1991bg-like SN Ia (M B ∼ -15.5), but without the unusually red optical colors expected if the faint luminosity were due to extinction. The photospheric optical spectra have very unusual strong lines of Sc II and Mg I, with possible Sr II, together with stronger than average Ti II and low velocities of ∼6000 km s -1 . The host galaxy of PTF09dav is ambiguous. The SN lies either on the extreme outskirts (∼41 kpc) of a spiral galaxy or in an very faint (M R ≥ -12.8) dwarf galaxy, unlike other 1991bg-like SNe which are invariably associated with massive, old stellar populations. PTF 09dav is also an outlier on the light-curve-width-luminosity and color-luminosity relations derived for other subluminous SNe Ia. The inferred 56 Ni mass is small (0.019 ± 0.003 M sun ), as is the estimated ejecta mass of 0.36 M sun . Taken together, these properties make PTF 09dav a remarkable event. We discuss various physical models that could explain PTF 09dav. Helium shell detonation or deflagration on the surface of a CO white dwarf can explain some of the features of PTF 09dav, including the presence of Sc and the low photospheric velocities, but the observed Si and Mg are not predicted to be very abundant in these models. We conclude that no single model is currently capable of explaining all of the observed signatures of PTF 09dav.
(E-N′-(4-Pyridylmethylene-4-(8-quinolyloxybutanohydrazide 0.25-hydrate
Directory of Open Access Journals (Sweden)
Jia-Ming Li
2009-02-01
Full Text Available The asymmetric unit of the title compound, C19H18N4O2·0.25H2O, contains two organic molecules and a solvent water molecule with 50% occupancy. The two molecules differ in their conformations: in one molecule it is (+gauche-trans-trans-(+gauche-trans, whereas in the other it is (−gauche-trans-trans-(−gauche-trans. The dihedral angles between the pyridine ring and the quinoline ring system are 67.4 (3 and 68.0 (2°. Molecules are linked into a supramolecular two-dimensional array via N—H...N hydrogen bonds, with each partially occupied water molecule connected via an O—H...O hydrogen bond. C—H...O interactions are also present.
Diode-pumped passively mode-locked Nd:LuVO4 laser with LT-In0.25Ga0.75As saturable absorber
International Nuclear Information System (INIS)
Li, T; Zhao, S; Li, Y; Zhuo, Z; Yang, K; Li, G; Li, D; Yu, Z
2009-01-01
A diode pumped passively mode-locked Nd:LuVO 4 laser with a low temperature (LT) In 0.25 Ga 0.75 As absorber is realized in this paper. An In 0.25 Ga 0.75 As single-quantum-well absorber, which is grown by use of the metal-organic chemical-vapor deposition technique, acts as nonlinear absorber and output coupler simultaneously. A special cavity is designed to keep the power density on In 0.25 Ga 0.75 As under its damage threshold. Both the Q-switched and continuous-wave (cw) mode locking operation are experimentally realized. An average output power of 5.9 W with pulse width of 4.9 ps is achieved at the pump power of 22 W, corresponding to an optical conversion efficiency of 26.8%
International Nuclear Information System (INIS)
Paliwal, U.; Swarkar, C. B.; Sharma, M. D.; Joshi, K. B.
2016-01-01
The optical, vibrational, structural and elasto-optic properties of quaternary II-VI alloys Zn_0_._2_5Cd_0_._7_5S_0_._2_5Se_0_._7_5, Zn_0_._2_5Cd_0_._7_5S_0_._5_0Se_0_._5_0 and Zn_0_._2_5Cd_0_._7_5S_0_._7_5Se_0_._2_5 are presented. Within the empirical pseudopotential method (EPM) the disorder effects are modeled via modified virtual crystal approximation (MVCA). The computed bandgaps and the refined form factors are utilized to evaluate optical, vibrational, structural and elasto-optic properties. The refractive index (n), static (ε_0) and high frequency dielectric (ε_∞) constants are calculated to reveal optical behavior of alloys. The longitudinal ω_L_O(0) and transverse ω_T_O(0) optical frequencies are obtained to see vibrational characteristics. Moreover, the elastic constants (c_i_j) and bulk moduli (B) are computed by combining the EPM with Harrison bond orbital model. The elasto-optic nature of alloys is examined by computing the photo-elastic constants. These values are significant with regard to the opto-electronic applications especially when no experimental data are available on this system.
Energy Technology Data Exchange (ETDEWEB)
Nishi, Tsuyoshi, E-mail: tsuyoshi.nishi.75@vc.ibaraki.ac.jp [Department of Materials Science and Engineering, College of Engineering, Ibaraki University, Hitachi, Ibaraki, 316-8511 (Japan); Hayashi, Hirokazu; Sato, Takumi; Takano, Masahide [Nuclear Science and Engineering Center, Japan Atomic Energy Agency, Tokai-mura, Ibaraki, 319-1195 (Japan)
2017-04-01
This study evaluated the dependence of the thermal conductivity of Zr{sub 0.70}Pu{sub 0.25}Cm{sub 0.05}N on storage time and temperature. The authors prepared sintered samples of Zr{sub 0.70}Pu{sub 0.25}Cm{sub 0.05}N solid solution and measured thermal diffusivity at storage times of 0, 24, 72, 144, 240, 408, 552, 816, 1,680, and 2064 h, from which it was determined that the thermal conductivity decreased exponentially with increasing storage time. This result suggests that the decrease of the thermal conductivity could be attributed to the accumulation of lattice defects from self-irradiation. To confirm the thermal recovery behavior of Zr{sub 0.70}Pu{sub 0.25}Cm{sub 0.05}N under annealing, thermal diffusivity was also measured just after annealing. The thermal conductivity of Zr{sub 0.70}Pu{sub 0.25}Cm{sub 0.05}N was determined to be larger than that of Zr{sub 0.58}Pu{sub 0.21}Cm{sub 0.21}N but smaller than that of Zr{sub 0.80}Pu{sub 0.10}Cm{sub 0.10}N. - Highlights: •The authors prepared Zr{sub 0.70}Pu{sub 0.25}Cm{sub 0.05}N and measured thermal diffusivity. •Dependence of thermal conductivity on storage time was clarified. •After annealing at 1423 K in vacuum, thermal conductivity was recovered.
DEFF Research Database (Denmark)
Basith, M. A.; Khan, F. A.; Ahmmad, Bashir
2015-01-01
that the strength of the exchange bias effect is tunable by the field cooling. The HEB values are also found to be dependent on the temperature. This magnetically tunable exchange bias obtained at temperatures up to 250K in Bi0.9Gd0.1Fe0.9Ti0.1O3 nanoparticles may be worthwhile for potential applications.......The exchange bias (EB) effect has been observed in magnetic Bi0.9Gd0.1Fe0.9Ti0.1O3 nanoparticles.The influence of magnetic field cooling on the exchange bias effect has also been investigated. The magnitude of the exchange bias field (HEB) increases with the cooling magnetic field, showing...
International Nuclear Information System (INIS)
Wang, Xiaodong; Yan, Tao; Liu, Xiaohuan; Ji, Pengge; Sun, Meng; Wei, Dong; Yan, Liangguo; Du, Bin
2016-01-01
Highlights: • Novel Melem/Zn 0.25 Cd 0.75 S composite showed enhanced activity in MO degradation. • The composites with melem content of 30 wt.% exhibited the best activity. • The heterojunction was in situ fabricated between melem and Zn 0.25 Cd 0.75 S. • The Melem/Zn 0.25 Cd 0.75 S heterojunction facilitated the separation of electron-hole pairs. - Abstract: Metal-free polymeric catalyst hold great promise owing to their abundant sources, low-cost fabrication and easy processibility. Melem, an important intermediate during condensation of melamine rings to graphitic carbon nitride (g-C 3 N 4 ), was synthesized by simple solid phase polymerization process. A novel Melem/Zn 0.25 Cd 0.75 S composite was fabricated through a facile one-step hydrothermal method. The as-products were characterized by X-ray diffraction (XRD), UV–vis DRS spectroscopy, fourier transform infrared spectroscopy (FTIR), transmission electron microscopy (TEM), high resolution transmission electron microscopy (HRTEM). The TEM and HRTEM results reveal that Zn 0.25 Cd 0.75 S nanoparticles and Melem closely contact with each other to form an intimate interface. The as-prepared composites exhibit significantly enhanced visible light photocatalytic performance for the degradation of Methyl orange (MO) and Bisphenol A (BPA), which could be attributed to the effective photo-induced charges transfer and separation in Melem/Zn 0.25 Cd 0.75 S composites. On the basis of radical scavenger experiments, superoxide radicals and holes are suggested to play a critical role in MO degradation over Melem/Zn 0.25 Cd 0.75 S heterojunctions. A possible mechanism for charge separation and transfer in the Melem/Zn 0.25 Cd 0.75 S composites was proposed to explain the enhanced photocatalytic performance.
Linear Fresnel zone plate based two-state alignment system for 0.25 micron x-ray lithography
International Nuclear Information System (INIS)
Chen, G.
1993-01-01
X-ray lithography has proven to be a cost effective and promising technique for fabricating Integrated Circuits (ICs) with minimum feature sizes of less than 0.25 μm. Since IC fabrication is a multilevel process, to preserve the functionality of devices, circuit patterns printed at each lithography level must match existing patterns on the wafer with an accuracy of less than 1/3 ∼ 1/5 of the minimum feature size. An alignment system is used to position the mask relative to the wafer so that mask circuit patterns can be printed on the wafer at the designed position. As the minimum printed feature size shrinks, the overlay requirements of a lithography tool become more stringent. A stepper for 0.25 μm feature device fabrication requires an overlay accuracy of 0.075 μm, of which only 0.05 μm (mean + 3σ) is allocated to its alignment system. This thesis presents the development of a linear Fresnel zone late based two-state alignment (TSA) method for a 0.25 μm x-ray lithography tool. The authors first analyze the overlay requirement in a lithography process and the error allocation to the alignment system for a 0.25 μ feature x-ray lithography tool. They then describe the principle of the two-state alignment, its computer simulation and the optimal alignment mark design. They carried out an optical bench test for the one-axes alignment setup and experimentally evaluated the performance of the system. They developed a three-axes TSA system and integrated the system with the ES-3 x-ray beamline to construct the CXrL aligner, an experimental x-ray exposure system in CXrL. They measured the alignment accuracy of the exposure system to be better than 0.035 μm (3σ) on both metal and dielectric alignment mark substrates. They also studied the effect of processing coatings on the alignment signal with different wafer mark substrates. They successfully printed the 0.5 μm gate level patterns for the first NMOS test chip at CXrL
Energy Technology Data Exchange (ETDEWEB)
Lee, Ryan K.L.; Griffith, James F.; Wang, D.F.; Yeung, David K.W. [The Chinese University of Hong Kong, Department of Imaging and Interventional Radiology, Prince Of Wales Hospital, Hong Kong, SAR (China); Shi, L. [The Chinese University of Hong Kong, Department of Medicine and Therapeutics, Division of Neurology, Hong Kong, SAR (China); Li, Edmund K.; Tam, L.S. [The Chinese University of Hong Kong, Department of Medicine, Division of Rheumatology, Prince Of Wales Hospital, Hong Kong, SAR (China)
2015-08-15
To compare the assessment of wrist synovitis severity, synovial volume and synovial perfusion parameters on a dedicated low-field (0.25-T) to that of a high-field (3-T) whole-body MR system in patients with rheumatoid arthritis (RA). Twenty-one patients (mean age 50.0 ± 9.8 years) with active RA were recruited prospectively. Dynamic contrast-enhanced MRI examination of the most severely affected wrist was performed at both 0.25 T and 3 T. Three MRI-derived parameters, synovitis severity (RAMRIS grade), synovial volume (ml{sup 3}) and synovial perfusion indices (maximum enhancement and enhancement slope), were compared. Comparing 0.25- and 3-T MRI, there was excellent agreement for semiquantitative assessment (r: 0.80, p < 0.00001) of synovitis (RAMRIS) as well as quantitative assessment (r: 0.94, p < 0.00001) of synovial volume. Good agreement for synovial Emax (r: 0.6, p = 0.002) and fair agreement (r: 0.5, p = 0.02) for synovial Eslope was found. Imaging of the RA wrist at 0.25 T yields excellent correlation with 3 T with regard to the synovitis activity score (RAMRIS) and synovial volume measurement. Fair to good correlation between low- (0.25-T) and high-field (3-T) MR systems was found for perfusion parameters, being better for Emax than for Eslope. (orig.)
4U 1907+09: an HMXB running away from the Galactic plane
Gvaramadze, V. V.; Röser, S.; Scholz, R.-D.; Schilbach, E.
2011-05-01
We report the discovery of a bow shock around the high-mass X-ray binary (HMXB) 4U 1907+09 using the Spitzer Space Telescope 24 μm data (after Vela X-1 the second example of bow shocks associated with HMXBs). The detection of the bow shock implies that 4U 1907+09 is moving through space with a high (supersonic) peculiar velocity. To confirm the runaway nature of 4U 1907+09, we measured its proper motion, which for an adopted distance to the system of 4 kpc corresponds to a peculiar transverse velocity of ≃ 160 ± 115 km s-1, meaning that 4U 1907+09 is indeed a runaway system. This also supports the general belief that most HMXBs possess high space velocities. The direction of motion of 4U 1907+09 inferred from the proper motion measurement is consistent with the orientation of the symmetry axis of the bow shock, and shows that the HMXB is running away from the Galactic plane. We also present the Spitzer images of the bow shock around Vela X-1 (a system similar to 4U 1907+09) and compare it with the bow shock generated by 4U 1907+09.
46 CFR 42.09-35 - Additional survey requirements for wood-hull vessels.
2010-10-01
... 46 Shipping 2 2010-10-01 2010-10-01 false Additional survey requirements for wood-hull vessels. 42.09-35 Section 42.09-35 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) LOAD LINES... Additional survey requirements for wood-hull vessels. (a) In addition to the requirements in § 42.09-25, the...
Hot pressing effect on (Bi 0.25 Sb 0.75 ) 2 Te 3 mechanical and ...
Indian Academy of Sciences (India)
Hot pressing effect on (Bi0.25Sb0.75)2Te3 mechanical and thermoelectric properties ... The crystal of this compound was prepared, pulverized in a particle size ratio of 64% ... microscopy and, for only once successful attempt, atomic force microscopy. The acquired images ensured to show homogeneous structures for hot ...
2012-05-07
... ENVIRONMENTAL PROTECTION AGENCY [FRL-9669-6] Underground Injection Control Program; Hazardous Waste Injection Restrictions; Petition for Exemption--Class I Hazardous Waste Injection; Diamond... reissuance of an exemption to the land disposal Restrictions, under the 1984 Hazardous and Solid Waste...
Directory of Open Access Journals (Sweden)
Ackerman S
2013-04-01
Full Text Available Stacey Ackerman,1 Francis D’Ambrosio Jr,2 Jack V Greiner,3 Linda Villanueva,4 Joseph B Ciolino,5 David A Hollander41Philadelphia Eye Associates, Philadelphia, PA, 2D’Ambrosio Eye Care, Lancaster, MA, 3Schepens Eye Research Institute, Massachusetts Eye and Ear Infirmary, Harvard Medical School, Boston, MA, 4Allergan, Inc, Irvine, CA, 5Massachusetts Eye and Ear Infirmary, Boston, MA, USABackground: The purpose of this study was to evaluate the efficacy and duration of action of once-daily dosing with alcaftadine 0.25% ophthalmic solution and olopatadine 0.2% ophthalmic solution as compared with placebo in the prevention of ocular itching, and to directly compare the efficacy of alcaftadine 0.25% with olopatadine 0.2% in the prevention of ocular itching associated with allergic conjunctivitis using the conjunctival allergen challenge model.Methods: Subjects with allergic conjunctivitis (n = 127 were enrolled in a multicenter, double-masked, randomized, active-controlled and placebo-controlled clinical trial. Using the conjunctival allergen challenge model, this study was conducted over the course of approximately 5 weeks. Subjects were randomized into one of three treatment arms: alcaftadine 0.25% ophthalmic solution, olopatadine 0.2% ophthalmic solution, or placebo. Study medications were administered twice over the course of the trial. The primary efficacy measure for the study was ocular itching evaluated by the subject at 3, 5, and 7 minutes post challenge. Secondary endpoints, measured at 7, 15, and 20 minutes post challenge, included conjunctival, ciliary, and episcleral redness, lid swelling, chemosis, and tearing. Duration of action was measured at 16 and 24 hours post-instillation of the study medication at visits 3 and 4, respectively.Results: For the primary measure of ocular itching, both actives, alcaftadine 0.25% and olopatadine 0.2%, were statistically superior to placebo at all three measured time points for both the 16-hour and
Bassan, Milan S; Sundaralingam, Praka; Fanning, Scott B; Lau, James; Menon, Jayaram; Ong, Evan; Rerknimitr, Rungsun; Seo, Dong-Wan; Teo, Eng Kiong; Wang, Hsiu-Po; Reddy, D Nageshwar; Goh, Khean Lee; Bourke, Michael J
2018-06-01
Wire-guided biliary cannulation has been demonstrated to improve cannulation rates and reduce post-ERCP pancreatitis (PEP), but the impact of wire caliber has not been studied. This study compares successful cannulation rates and ERCP adverse events by using a 0.025-inch and 0.035-inch guidewire. A randomized, single blinded, prospective, multicenter trial at 9 high-volume tertiary-care referral centers in the Asia-Pacific region was performed. Patients with an intact papilla and conventional anatomy who did not have malignancy in the head of the pancreas or ampulla and were undergoing ERCP were recruited. ERCP was performed by using a standardized cannulation algorithm, and patients were randomized to either a 0.025-inch or 0.035-inch guidewire. The primary outcomes of the study were successful wire-guided cannulation and the incidence of PEP. Overall successful cannulation and ERCP adverse events also were studied. A total of 710 patients were enrolled in the study. The primary wire-guided biliary cannulation rate was similar in 0.025-inch and 0.035-inch wire groups (80.7% vs 80.3%; P = .90). The rate of PEP between the 0.025-inch and the 0.035-inch wire groups did not differ significantly (7.8% vs 9.3%; P = .51). No differences were noted in secondary outcomes. Similar rates of successful cannulation and PEP were demonstrated in the use of 0.025-inch and 0.035-inch guidewires. (Clinical trial registration number: NCT01408264.). Copyright © 2018. Published by Elsevier Inc.
Crystal structure of Mo/sub 0.975/Ti/sub 0.025/O2 between 24 and 9000C
International Nuclear Information System (INIS)
Ghedira, M.; Do-Dinh, C.; Marezio, M.; Mercier, J.
1985-01-01
Structure of Mo/sub 0.975/Ti/sub 0.025/O 2 has been refined from single-crystal X-ray data at room temperature, 300, 500, 700, and 900 0 C. The variation of the lattice parameters as a function of temperature has been measured up to 1100 0 C. The existence of the Mo-Mo bonds of second order across the shared octahedral edge is confirmed. The bond strength-bond length method of Zachariasen gives the correct valence for the cations, but yields 2.168 for O(1) and 1.832 for O(2). These unreal charges are attributed to the presence of the Mo-Mo double bonds. The same calculation applied to the isostructural VO 2 gives the correct valences for all atoms. The structure of Mo/sub 0.975/Ti/sub 0.025/O 2 remains almost unchanged up to 900 0 C. The observed small variations indicate that at a temperature higher than 1100 0 C, Mo/sub 0.975/Ti/sub 0.025/O 2 should undergo a phase transition where the double bonds would become either single or be broken completely, in which case the tetragonal rutile structure would be obtained. 11 references, 2 figures, 5 tables
Power Systems Development Facility Gasification Test Run TC09
Energy Technology Data Exchange (ETDEWEB)
Southern Company Services
2002-09-30
This report discusses Test Campaign TC09 of the Kellogg Brown & Root, Inc. (KBR) Transport Gasifier train with a Siemens Westinghouse Power Corporation (Siemens Westinghouse) particle filter system at the Power Systems Development Facility (PSDF) located in Wilsonville, Alabama. The Transport Gasifier is an advanced circulating fluidized-bed gasifier designed to operate as either a combustor or a gasifier in air- or oxygen-blown mode of operation using a particulate control device (PCD). The Transport Gasifier was operated as a pressurized gasifier during TC09 in air- and oxygen-blown modes. Test Run TC09 was started on September 3, 2002, and completed on September 26, 2002. Both gasifier and PCD operations were stable during the test run, with a stable baseline pressure drop. The oxygen feed supply system worked well and the transition from air to oxygen was smooth. The gasifier temperature varied between 1,725 and 1,825 F at pressures from 125 to 270 psig. The gasifier operates at lower pressure during oxygen-blown mode due to the supply pressure of the oxygen system. In TC09, 414 hours of solid circulation and over 300 hours of coal feed were attained with almost 80 hours of pure oxygen feed.
Facilities Performance Indicators Report, 2008-09
Hills, Christina, Ed.
2010-01-01
This paper features another expanded Web-based Facilities Performance Indicators Report (FPI). The purpose of APPA's Facilities Performance Indicators is to provide a representative set of statistics about facilities in educational institutions. The 2008-09 iteration of the Web-based Facilities Performance Indicators Survey was posted and…
Bupivacaína 0,25% peridural, en la analgesia de parto: efectos hemodinámicos en la madre y feto
Directory of Open Access Journals (Sweden)
Silvia Arias
2006-09-01
Full Text Available Objetivo: Valorar la bupivacaína 0,25% por catéter epidural en el alivio del dolor de parto y efectos en la hemodinamia materna, progreso del parto y pH neonatal. Diseño: Estudio descriptivo, longitudinal, prospectivo. Lugar: Centro Obstétrico del Instituto Especializado Materno Perinatal, Lima, Perú, hospital de enseñanza universitaria. Pacientes: Sesenta parturientas en fase activa de trabajo de parto. Intervenciones: Se administró a las parturientas bupivacaína 0,25% 12 mL, vía catéter epidural, haciendo control del dolor con la escala visual análoga. Se registró la hemodinamia materno-fetal, pre y postanalgesia, dosis suplementaria de bupivacaína 0,25% 6 mL, trazado cardiotocográfico fetal, complicaciones. Se utilizó el programa estadístico SPSS 13,0. Principales medidas de resultados: Disminución del dolor, hemodinamia materna, pH neonatal. Resultados: La administración de bupivacaína 0,25% disminuyó significativamente el dolor (p < 0,001, prueba de Friedman, requiriendo 33 parturientas analgesia suplementaria (45 mg BPV prom.. La frecuencia basal fetal preanalgesia fue 142 lat/min y postanalgesia, 136 lat/min (t student p < 0,05; el dermatoma alcanzado fue T8, con duración promedio de 115 min; la satisfacción fue excelente en 50,1%. Se usó oxitocina en 88,3% (13,1mU/min, DE 3,2 mU/min, asociándose al acortamiento del tiempo de la fase activa en 2,42 h en primigestas y 1,55 h en multigestas; la cesárea fue necesaria en 11,7%, el PH neonatal promedio 7,24. Conclusiones: La analgesia epidural con bupivacaína 0,25% vía catéter es eficaz. La hemodinamia materna se mantiene, el latido cardiaco fetal desciende 12 latidos/min en promedio, la fase activa se acorta, estando relacionado al requerimiento de oxitocina.
Microwave loss mechanisms in Ba0.25Sr0.75TiO3 films
International Nuclear Information System (INIS)
Vorobiev, A.; Rundqvist, P.; Gevorgian, S.
2005-01-01
Trilayer Au(Pt)/Ba 0.25 Sr 0.75 TiO 3 /(Pt)Au thin film varactors are fabricated on high resistive Si substrate and characterized at dc, rf and microwave frequencies. In the frequency range of 10-45 GHz the varactors reveal relatively low losses, the loss tangent is less than 0.025 at 45 GHz. Due to the thick and highly conductive Pt/Au electrodes the metal losses are less than 10%. However, the loss tangent of the ferroelectric film is still 3-5 times higher than that in Ba 0.27 Sr 0.73 TiO 3 single crystal. The analysis of the dc field dependent loss tangent and permittivity in a wide frequency range show that these additional losses are mainly due to the charged defects. Extrapolation of measured low frequency (1 MHz) loss tangents to the microwave region using the power law ω 1/3 is in good agreement with the experiment. We assume that the oxygen vacancies within the grain boundaries of ferroelectric film act as charged defects and cause extrinsic microwave losses. The knowledge of the extrinsic loss mechanism and corresponding microstructure defects is useful in optimization of the varactor design, deposition, and/or annealing process and further improvement of the varactor performance
Unique dielectric features of a ceramic-semiconductor nanocomposite MgNb2O6 + 0.25Zn0.5Cd0.5S
Pukazhselvan, D.; Selvaraj, Nivas Babu; Bdikin, Igor; Saravanan, R. Sakthi Sudar; Jakka, Suresh Kumar; Soares, M. J.; Fagg, Duncan Paul
2017-12-01
The present communication deals with the optical/dielectric characteristics of MgNb2O6 + 0.25Zn0.5Cd0.5S nanocomposite (10-30 nm) mixture. Zn0.5Cd0.5S (size ∼10 nm) was synthesized by microwave assisted solvo-thermal method. Monophase magnesium niobate (MN) nanoparticles (10-20 nm) were synthesized in a single step by mechanochemical treatment of MgO + Nb2O5 under dry N2 atmosphere. The nanocomposite, MgNb2O6 + 0.25Zn0.5Cd0.5S, was prepared by mechanical admixing of MgNb2O6 and Zn0.5Cd0.5S taken in 4:1 molar ratio. The photoluminescence study shows violet, yellow and orange-red emissions by the MgNb2O6 + 0.25Zn0.5Cd0.5S composite. The observed dielectric constant value (ε) for MgNb2O6 + 0.25Zn0.5Cd0.5S is only 4.7, which is ∼5 times smaller than the ε value of MgNb2O6 while a dielectric loss for the composite being closer to zero ensures promising commercial applications.
Magnetic properties of Nd-deficient manganites Nd0.9-xCaxMnOy
International Nuclear Information System (INIS)
Troyanchuk, I.O.; Khomchenko, V.A.; Pastushonok, S.N.; Novitsky, O.A.; Pavlov, V.I.; Szymczak, H.
2006-01-01
X-ray diffraction and magnetic studies of neodymium deficient Nd 0.9-x Ca x MnO y (0= 0.9 MnO y samples have been prepared in the 2.85= g -orbitals of manganese ions. Composition with y=2.85 is antiferromagnet with T N =85K, whereas for more oxidized Nd 0.9 MnO y samples a coexistence of antiferromagnetic and ferromagnetic phases is suggested. Low-temperature magnetic phase transition which is accompanied by a negative magnetization appearance has been found in the Nd 0.9 MnO 2.90 compound. Magnetic behavior of Nd 0.9-x Ca x MnO y (0.1= 1-x Ca x MnO 3 series. Properties of the Nd 0.9-x Ca x MnO y (0=< x=<0.4) solid solutions are in agreement with a hypothesis according to which a part of Nd ions can be substituted by Mn ions
Vitreoscilla hemoglobin promotes Salecan production by Agrobacterium sp. ZX09.
Chen, Yun-mei; Xu, Hai-yang; Wang, Yang; Zhang, Jian-fa; Wang, Shi-ming
2014-11-01
Salecan is a novel exopolysaccharide produced by the strain Agrobacterium sp. ZX09, and it is composed of only glucose monomers. The unique chemical composition and excellent physicochemical properties make Salecan a promising material for applications in coagulation, lubrication, protection against acute liver injury, and alleviating constipation. In this study, we cloned the Vitreoscilla hemoglobin gene into a broad-host-range plasmid pCM158. Without antibiotic selection, there was negligible loss of the plasmid in the host Agrobacterium sp. ZX09 after one passage of cultivation. The expression of Vitreoscilla hemoglobin was demonstrated by carbon monoxide (CO) difference spectrum. The engineered strain Agrobacterium sp. ZX09 increased Salecan yield by 30%. The other physiological changes included its elevated respiration rate and cellular invertase activity.
Energy Technology Data Exchange (ETDEWEB)
Molak, A; Paluch, M; Pawlus, S; Klimontko, J; Ujma, Z; Gruszka, I [Institute of Physics, University of Silesia, ul. Uniwersytecka 4, PL-40-007 Katowice (Poland)
2005-05-07
Broadband dielectric spectroscopy is applied to investigate the electrical properties of disordered perovskite-like ceramics in a wide temperature range. From the x-ray diffraction analysis it was found that the newly obtained (Na{sub 0.75}Bi{sub 0.25}) (Mn{sub 0.25}Nb{sub 0.75})O{sub 3} ceramics consist of two chemically different phases. The major perovskite one has an orthorhombic structure described by the Pbcm space group (No 57, in yxz setting). The minor phase shows an orthorhombic symmetry, all-face-centred lattice F, with the lattice parameters a = 10.797(4) A, b = 7.601(3) A and c = 7.691(3) A. The electric modulus M{sup *} formalism used in the analysis enabled us to distinguish and separate the relaxation processes, dominated by marked conductivity in the {epsilon}{sup *}({omega}) representation. In the ceramics studied, the relaxation times are thermally activated and the dipole process has a clearly non-Debye behaviour. The relaxation process described with the use of the activation energy of approximately 0.4 eV and the characteristic relaxation time, {tau}{sub 0} = 1 x 10{sup -11} s, was found to be related to oxygen vacancies. The low frequency relaxation shows Debye behaviour with a slightly lower activation energy and a longer characteristic time.
2010-11-24
... mentoring, teaching, training, advice, and recommendations to senior military officers, staff, and students... Acquisition Regulation Supplement; Services of Senior Mentors (DFARS Case 2010-D025) AGENCY: Defense... policy on the services of senior mentors. DATES: Effective: November 24, 2010. FOR FURTHER INFORMATION...
First International Diagnosis Competition - DXC'09
Kurtoglu, tolga; Narasimhan, Sriram; Poll, Scott; Garcia, David; Kuhn, Lukas; deKleer, Johan; vanGemund, Arjan; Feldman, Alexander
2009-01-01
A framework to compare and evaluate diagnosis algorithms (DAs) has been created jointly by NASA Ames Research Center and PARC. In this paper, we present the first concrete implementation of this framework as a competition called DXC 09. The goal of this competition was to evaluate and compare DAs in a common platform and to determine a winner based on diagnosis results. 12 DAs (model-based and otherwise) competed in this first year of the competition in 3 tracks that included industrial and synthetic systems. Specifically, the participants provided algorithms that communicated with the run-time architecture to receive scenario data and return diagnostic results. These algorithms were run on extended scenario data sets (different from sample set) to compute a set of pre-defined metrics. A ranking scheme based on weighted metrics was used to declare winners. This paper presents the systems used in DXC 09, description of faults and data sets, a listing of participating DAs, the metrics and results computed from running the DAs, and a superficial analysis of the results.
Energy Technology Data Exchange (ETDEWEB)
Wang, Xiaodong [School of Civil Engineering and Architecture, University of Jinan, Jinan 250022 (China); Yan, Tao, E-mail: yantujn@163.com [School of Resources and Environment, University of Jinan, Jinan 250022 (China); Liu, Xiaohuan; Ji, Pengge [School of Civil Engineering and Architecture, University of Jinan, Jinan 250022 (China); Sun, Meng; Wei, Dong; Yan, Liangguo; Du, Bin [School of Resources and Environment, University of Jinan, Jinan 250022 (China)
2016-11-30
Highlights: • Novel Melem/Zn{sub 0.25}Cd{sub 0.75}S composite showed enhanced activity in MO degradation. • The composites with melem content of 30 wt.% exhibited the best activity. • The heterojunction was in situ fabricated between melem and Zn{sub 0.25}Cd{sub 0.75}S. • The Melem/Zn{sub 0.25}Cd{sub 0.75}S heterojunction facilitated the separation of electron-hole pairs. - Abstract: Metal-free polymeric catalyst hold great promise owing to their abundant sources, low-cost fabrication and easy processibility. Melem, an important intermediate during condensation of melamine rings to graphitic carbon nitride (g-C{sub 3}N{sub 4}), was synthesized by simple solid phase polymerization process. A novel Melem/Zn{sub 0.25}Cd{sub 0.75}S composite was fabricated through a facile one-step hydrothermal method. The as-products were characterized by X-ray diffraction (XRD), UV–vis DRS spectroscopy, fourier transform infrared spectroscopy (FTIR), transmission electron microscopy (TEM), high resolution transmission electron microscopy (HRTEM). The TEM and HRTEM results reveal that Zn{sub 0.25}Cd{sub 0.75}S nanoparticles and Melem closely contact with each other to form an intimate interface. The as-prepared composites exhibit significantly enhanced visible light photocatalytic performance for the degradation of Methyl orange (MO) and Bisphenol A (BPA), which could be attributed to the effective photo-induced charges transfer and separation in Melem/Zn{sub 0.25}Cd{sub 0.75}S composites. On the basis of radical scavenger experiments, superoxide radicals and holes are suggested to play a critical role in MO degradation over Melem/Zn{sub 0.25}Cd{sub 0.75}S heterojunctions. A possible mechanism for charge separation and transfer in the Melem/Zn{sub 0.25}Cd{sub 0.75}S composites was proposed to explain the enhanced photocatalytic performance.
Barcelona - Talent Latent 09 / Ahto Sooaru
Sooaru, Ahto
2010-01-01
Fotonäitusest "Talent Latent 09" Barcelonas Arts Santa Monica kunstikeskuses. Loetletud näitusel eksponeeritud fotode autorid. Pikemalt Rafael Milach'i (sünd. 1978), Lucia Ganieva, Javier Marquerie Thomas'i (sünd. 1986), Amaury da Cunha (sünd. 1976) töödest. Lühidalt ka teistest näitustest Arts Santa Monica kunstikeskuses
75 FR 82409 - Endangered Species; Receipt of Applications for Permit
2010-12-30
... reissuance of their permit for scientific research with two captive-born giant pandas (Ailuropoda melanoleuca... provisions of the USFWS Giant Panda Policy. The proposed research will cover all aspects of behavior, reproductive physiology, genetics, nutrition, and animal health and is a continuation of activities currently...
Energy Technology Data Exchange (ETDEWEB)
Panda, Niranjan [Driems Engineering College, Department of Physics, Cuttack (India); Pattanayak, Samita [College of Engineering and Technology, Department of Physics, Bhubaneswar (India); Choudhary, R.N.P. [Siksha ' O' Anusandhan University, Department of Physics, Bhubaneswar (India); Kumar, Ashok [National Physical Laboratory (CSIR), New Delhi (India)
2016-09-15
As lead zirconium titanate and bismuth ferrite (BFO), members of perovskite family, have high dielectric constant and ferroelectric/ferromagnetic phase transition temperature, they are used for many potential applications including random access memory, sensors. The present work describes the modifications in the ferroelectric behaviour of PZT doped BFO due to substitution of few molar percent of La on Fe-site. A thorough comparative investigation of the frequency and temperature response of dielectric permittivity, dielectric loss, electric modulus, complex impedance and ferroelectric properties of Bi{sub 0.5}Pb{sub 0.5}[Fe{sub (0.5-x)}La{sub x}(Zr{sub 0.25}Ti{sub 0.25})] O{sub 3}, where x = 0.0, 0.1, 0.2, 0.3 (hence forth called as BFPZLTO) compounds were studied in a wide frequency range 10 kHz to 1 MHz at temperature range 25-400 C using ac impedance spectroscopy and electric modulus analysis. The structural analysis of compound revealed the tetragonal phase with space group P4 mm at room temperature. Cole-Cole plots are used for interpretation of relaxation mechanism in the materials. The materials especially the compound with x = 0.3 found more suitable to be used in transducers, RAMs, flip-flop memories, etc., for electronics applications. (orig.)
High Temperature Deformation Behavior and Microstructure Evolution of Ti-4Al-4Fe-0.25Si Alloy
Energy Technology Data Exchange (ETDEWEB)
Won, Jong Woo; Lee, Yongmoon; Lee, Chong Soo [Pohang University of Science and Technology, Pohang (Korea, Republic of); Yeom, Jong-Taek [Korea Institute of Materials Science, Changwon (Korea, Republic of); Lee, Gi Yeong [KPCM Incorporated, Gyeongsan (Korea, Republic of)
2016-05-15
Hot deformation behavior of Ti-4Al-4Fe-0.25Si alloy with martensite microstructure was investigated by compression tests at temperatures of 1023 – 1173 K (α+β phase region) and strain rates of 10{sup -3} – 1 s{sup -1}. By analyzing the deformation behavior, plastic deformation instability parameters including strain rate sensitivity, deformation temperature sensitivity, efficiency of power dissipation, and Ziegler’s instability were evaluated as a function of deformation temperature and strain rate, and they were further examined by drawing deformation processing maps. The microstructure evolution was also studied to determine the deformation conditions under which equiaxed α phase was formed in the microstructure without remnants or kinked α phase platelets and shear bands, these last two of which cause severe cracks during post-forming process. Based on the combined results of the processing maps and the microstructure analysis, the optimum α+β forging conditions for Ti-4Al-4Fe-0.25Si alloy were determined.
Application of RADSAFE to Model Single Event Upset Response of a 0.25 micron CMOS SRAM
Warren, Kevin M.; Weller, Robert A.; Sierawski, Brian; Reed, Robert A.; Mendenhall, Marcus H.; Schrimpf, Ronald D.; Massengill, Lloyd; Porter, Mark; Wilkerson, Jeff; LaBel, Kenneth A.;
2006-01-01
The RADSAFE simulation framework is described and applied to model Single Event Upsets (SEU) in a 0.25 micron CMOS 4Mbit Static Random Access Memory (SRAM). For this circuit, the RADSAFE approach produces trends similar to those expected from classical models, but more closely represents the physical mechanisms responsible for SEU in the SRAM circuit.
Huang, Bo; Wang, S. R.; Liu, R. Z.; Ye, X. F.; Nie, H. W.; Sun, X. F.; Wen, T. L.
Perovskite-structure La 0.75Sr 0.25Cr 0.5Mn 0.5O 3- δ (LSCM) powders were prepared using a simple combustion process. Thermal analysis was carried out on the perovskite precursor to investigate the oxide-phase formation. The structural phase of the powders was determined by X-ray diffraction. These results showed that the decomposition of the precursors occurs in a two-step reaction and temperatures higher than 1100 °C are required for these decomposition reactions. For the electrochemical characterization, LSCM anode materials and (Pr 0.7Ca 0.3) 0.9MnO 3 (PCM) cathode materials were screen-printed on two sides of dense La 0.8Sr 0.2Ga 0.8Mg 0.2O 3 (LSGM) electrolyte layers prepared by tape casting with a thickness of about 600 μm, respectively. The morphology of the screen-printed La 0.75Sr 0.25Cr 0.5Mn 0.5O 3- δ perovskite thick films (65 μm) was investigated by field emission scanning electron microscope and showed a porous microstructure. In addition, fuel cell tests were carried out using humidified hydrogen or ethanol stream as fuel and oxygen as oxidant. The performance of the conventional electrolyte-supported cell LSCM/LSGM/PCM while operating on humidified hydrogen was modest with a maximum power density of 165, 99 and 62 mW cm -2 at 850, 800 and 750 °C, respectively, the corresponding values for the cell while operating on ethanol stream was 160, 101 and 58 mW cm -2, respectively. Cell stability tests indicate no significant degradation in performance has been observed after 60 h of cell testing when LSCM anode was exposed to ethanol steam at 750 °C, suggesting that carbon deposition was limited during cell operation.
Energy Technology Data Exchange (ETDEWEB)
Ramirez G, J. A.
2016-07-01
Magnesium and most of its mixtures have slow sorption-desorption kinetics of hydrogen, which limits their technological application and their viability from the economic view point. Recently, has been observed that by the synthesis of advanced materials, using the mechanical milling technique, positive changes in the kinetics are introduced. In order to improve the sorption-desorption hydrogen properties, in the present work a mixture consisting of Mg{sub 0.75}Ta{sub 0.25} was prepared using methanol as process control agent. To this end, the first methodological step was to carry out, by means of the mechanical milling technique, the synthesis of the mixture Mg{sub 0.75}Ta{sub 0.25} in a Spex type vibratory mill at times of 6, 12, 18 and 24 h. Subsequently, the material was characterized by different analytical techniques such as scanning electron microscopy with elemental analysis, X-ray diffraction and N{sub 2} physisorption analysis. Subsequently, hydrogen sorption experiments were carried out in a Parr reactor to evaluate the hydrogen storage capacity of the mixture, varying temperature parameters, pressure and time, in order to determine the optimal parameters of hydrogen sorption. The characterization of the hydrogen storage capacity was analyzed by the thermogravimetric analysis/differential scanning calorimetry technique coupled to a mass spectrometer. X ray diffraction analysis reveals that there is a mixture between the starting compounds, with an important refinement of the microstructure as a consequence of the mechanical milling process. The results of the hydrogen sorption tests at 1, 5 and 10 cycles showed that the storage of hydrogen in the Mg{sub 0.75}Ta{sub 0.25} mixture can be carried out at a temperature of 25 degrees Celsius with a pressure of 2 atm and a contact time of 1 h. (Author)
W.T. Hendriksen (Wouter); N. Silva (Nuno); H.J. Bootsma (Hester); C.E. Blue (Clare); G.K. Paterson (Gavin); A.R. Kerr (Alison); A.S. de Jong (Arjan); O.P. Kuipers (Oscar); P.W.M. Hermans (Peter); T.J. Mitchell
2007-01-01
textabstractRecent murine studies have demonstrated that the role of response regulator 09 (RR09) of Streptococcus pneumoniae in virulence is different in different strains. In the present study, we used a murine pneumonia model of infection to assess the virulence of a TIGR4 rr09 mutant, and we
Hendriksen, Wouter T.; Silva, Nuno; Bootsma, Hester J.; Blue, Clare E.; Paterson, Gavin K.; Kerr, Alison R.; de Jong, Anne; Kuipers, Oscar P.; Hermans, Peter W. M.; Mitchell, Tim J.
Recent murine studies have demonstrated that the role of response regulator 09 (RR09) of Streptococcus pneumoniae in virulence is different in different strains. In the present study, we used a murine pneumonia model of infection to assess the virulence of a TIGR4 rr09 mutant, and we found that
Unigene BLAST: CBRC-GGAL-09-0012 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-GGAL-09-0012 gnl|UG|Gga#S6698203 pnl1s.pk003.f8 chicken liver cDNA library Gallus gallus cDNA clone pnl...1s.pk003.f8 5' similar to histidine-rich glycoprotein - bovine (fragments), mRNA sequence /clone=pnl
National Oceanic and Atmospheric Administration, Department of Commerce — NODC maintains data in three NODC Standard Format Marine Mammal Data Sets: Marine Mammal Sighting and Census (F127); Marine Mammal Specimens (F025); Marine Mammal...
Homogeneous-inhomogeneous models of Ag x (Ge0.25Se0.75)100-x bulk glasses
International Nuclear Information System (INIS)
Arcondo, B.; Urena, M.A.; Piarristeguy, A.; Pradel, A.; Fontana, M.
2007-01-01
Ge-Se system presents an extensive glass forming composition range even when different metals (Ag, Sb, Bi) are added. In spite that the addition of Ag (up to 30 at%) to Ge-Se does not affect substantially the glass forming tendency, it impacts significantly on the transport properties. (Ge 0.25 Se 0.75 ) 100- x Ag x is a fast ionic conductor with x≥8 at% whereas it is a semiconductor for x 0.25 Se 0.75 ) 100- x Ag x bulk samples. These results appear to sustain this model. However previous structural and thermal studies oppose it. Moessbauer spectrometry on samples (0≤x≤25) containing 0.5 at% of 57 Fe is performed at T≤300 K. The main contribution to the glasses spectra correspond to low spin Fe 2+ in octahedral coordination and high spin Fe 2+ in distorted octahedral environments. The relative population of both sites changes continuously as Ag concentration varies denoting that the change in the transport behavior obeys to a percolation phenomenon. The low temperature results are discussed with the aim to throw light on the controversy about the homogeneity-inhomogeneity of the studied bulk glasses
Solidification Segregation and Homogenization Behavior of 1Cr-1.25Mo-0.25V Steel Ingot
Energy Technology Data Exchange (ETDEWEB)
Kim, Dong-Bae [Dae-gu Mechatronics and Materials Institute, Daegu (Korea, Republic of); Na, Young-Sang; Seo, Seong-Moon [Korea Institute of Materials Science, Changwon (Korea, Republic of); Lee, Je-Hyun [Changwon National University, Changwon (Korea, Republic of)
2016-09-15
As a first step to optimizing the homogenization heat treatment following high temperature upset forging, the solidification segregation and the homogenization behaviors of solute elements were quantitatively analyzed for 1Cr-1.25Mo-0.25V steel ingot by electron probe micro-analysis (EPMA). The random sampling approach, which was designed to generate continuous compositional profiles of each solute element, was employed to clarify the segregation and homogenization behaviors. In addition, ingot castings of lab-scale and a 16-ton-sized 1Cr-1.25Mo-0.25V steel were simulated using the finite element method in three dimensions to understand the size effect of the ingot on the microsegregation and its reduction during the homogenization heat treatment. It was found that the microsegregation in a large-sized ingot was significantly reduced by the promotion of solid state diffusion due to the extremely low cooling rate. On the other hand, from the homogenization point of view, increasing the ingot size causes a dramatic increase in the dendrite arm spacing, and hence the homogenization of microsegregation in a large-sized ingot appears to be practically difficult.
2013-07-25
... Public Convenience and Necessity and Foreign Air Carrier Permits Filed Under Subpart B (Formerly Subpart... Convenience and Necessity and Foreign Air Carrier Permits were filed under Subpart B (formerly Subpart Q) of... reissuance of Pinnacle's certificates of public convenience and necessity in the name of ``ENDEAVOR AIR, INC...
Blended 6-Hourly Sea Surface Wind Vectors and Wind Stress on a Global 0.25 Degree Grid (1987-2011)
National Oceanic and Atmospheric Administration, Department of Commerce — The Blended Global Sea Surface Winds products contain ocean surface wind vectors and wind stress on a global 0.25 degree grid, in multiple time resolutions of...
Bacillus velezensis CC09: A Potential 'Vaccine' for Controlling Wheat Diseases.
Kang, Xingxing; Zhang, Wanling; Cai, Xunchao; Zhu, Tong; Xue, Yarong; Liu, Changhong
2018-04-11
Biocontrol bacteria that can act like a "vaccine", stimulating plant resistance to pathogenic diseases, are still not fully elucidated. In this study, an endophytic bacterium, Bacillus velezensis CC09, labeled with green fluorescent protein, was tested for its colonization, migration, and expression of genes encoding iturin A synthetase within wheat tissues and organs as well as for protective effects against wheat take-all and spot blotch diseases. The results showed that strain CC09 not only formed biofilm on the root surface but was also widely distributed in almost every tissue, including the epidermis, cortex, and xylem vessels, and even migrated to stems and leaves, resulting in 66.67% disease-control efficacy (DCE) of take-all and 21.64% DCE of spot blotch. Moreover, the gene cluster encoding iturin A synthase under the control of the p itu promoter is expressed in B. velezensis CC09 in wheat tissues, which indicates that iturin A might contribute to the in-vivo antifungal activity and leads to the disease control. All these data suggested that strain CC09 can act like a 'vaccine' in the control of wheat diseases, with a single treatment inoculated on roots through multiple mechanisms.
Aespoe Hard Rock Laboratory. BIPS logging in borehole KAS09
Energy Technology Data Exchange (ETDEWEB)
Gustafsson, Jaana; Gustafsson, Christer (Malaa Geoscience AB (Sweden))
2010-01-15
This report includes the data gained in BIPS logging performed at the Aespoe Hard Rock Laboratory. The logging operation presented here includes BIPS logging in the core drilled borehole KAS09. The objective for the BIPS logging was to observe the condition of KAS09 in order to restore the borehole in the hydrogeological monitoring programme.All measurements were conducted by Malaa Geoscience AB on October 9th 2009. The objective of the BIPS logging is to achieve information of the borehole including occurrence of rock types as well as determination of fracture distribution and orientation. This report describes the equipment used as well as the measurement procedures and data gained. For the BIPS survey, the result is presented as images. The basic conditions of the BIPS logging for geological mapping and orientation of structures are satisfying for borehole KAS09, although induced affects from the drilling on the borehole walls limit the visibility
Aespoe Hard Rock Laboratory. BIPS logging in borehole KAS09
International Nuclear Information System (INIS)
Gustafsson, Jaana; Gustafsson, Christer
2010-01-01
This report includes the data gained in BIPS logging performed at the Aespoe Hard Rock Laboratory. The logging operation presented here includes BIPS logging in the core drilled borehole KAS09. The objective for the BIPS logging was to observe the condition of KAS09 in order to restore the borehole in the hydrogeological monitoring programme.All measurements were conducted by Malaa Geoscience AB on October 9th 2009. The objective of the BIPS logging is to achieve information of the borehole including occurrence of rock types as well as determination of fracture distribution and orientation. This report describes the equipment used as well as the measurement procedures and data gained. For the BIPS survey, the result is presented as images. The basic conditions of the BIPS logging for geological mapping and orientation of structures are satisfying for borehole KAS09, although induced affects from the drilling on the borehole walls limit the visibility
GAS payload no. G-025: Study of liquid sloshing behaviour in microgravity
Gilbert, C. R.
1986-01-01
The Get Away Special (GAS) G-025, which flew on shuttle Mission 51-G, examined the behavior of a liquid in a tank under microgravity conditions. The experiment is representative of phenomena occurring in satellite tanks with liquid propellants. A reference fluid in a hemispherical model tank will be subjected to linear acceleration inputs of known levels and frequencies, and the dynamic response of the tank liquid system was recorded. Preliminary analysis of the flight data indicates that the experiment functioned perfectly. The results will validate and refine mathematical models describing the dynamic characteristics of tank-fluid systems. This will in turn support the development of future spacecraft tanks, in particular the design of propellant management devices for surface tension tanks.
Annual North Dakota Elevator Marketing Report, 2008-09
2009-12-01
The Annual North Dakota Elevator Marketing Report for 2008-09 was prepared by Kimberly Vachal and Laurel Benson, : Upper Great Plains Transportation Institute. The authors gratefully acknowledge the assistance of the North Dakota : Grain Dealers Asso...
Clark, Josh
2009-01-01
With iWork '09: The Missing Manual, you'll quickly learn everything you need to know about Apple's incredible productivity programs, including the Pages word-processor, the Numbers spreadsheet, and the Keynote presentation program that Al Gore and Steve Jobs made famous. This book gives you crystal-clear and jargon-free explanations of iWork's capabilities, advantages, and limitations to help you produce stunning documents and cinema-quality digital presentations in no time.
2010-07-01
... 30 Mineral Resources 3 2010-07-01 2010-07-01 false Examination. 955.14 Section 955.14 Mineral... AND ON INDIAN LANDS § 955.14 Examination. (a) Certificate issuance or reissuance. After submitting an... examination, as provided in paragraph (b) of this section. (b) Administration and content. (1) On a regular...
75 FR 24571 - Designation of New Grantee
2010-05-05
...) has considered the application (filed 03/17/2010) submitted by the Southern California Logistics... the City of Victorville, which has accepted such reissuance subject to approval by the FTZ Board. Upon... recognizes the City of Victorville as the new grantee of Foreign-Trade Zone 243, subject to the FTZ Act and...
Espinoza Bernal, Flora Judith
2016-01-01
Introducción: La cirugía de miembro superior es un reto para el anestesiólogo por que amerita el dominio de técnicas de anestesia regional y manejo de complicaciones y analgesia en las primeras 48 horas. Objetivo: Comparar la eficacia anestésica entre bupivacaína al 0.25% + morfina y bupivacaína al 0.25% en bloqueo del plexo braquial para cirugía de miembro superior en el H.V.C.M, Cuenca 2014. Metodología: se diseñó un estudio clínico aleatorio simple ciego, para valorar el efecto de la...
Yingmin Zhu; Haijun Chen; Stephen Boulton; Fang Mei; Na Ye; Giuseppe Melacini; Jia Zhou; Xiaodong Cheng
2015-01-01
The cAMP signaling cascade is one of the most frequently targeted pathways for the development of pharmaceutics. A plethora of recent genetic and pharmacological studies suggest that exchange proteins directly activated by cAMP (EPACs) are implicated in multiple pathologies. Selective EPAC inhibitors have been recently developed. One specific inhibitor, ESI-09, has been shown to block EPAC activity and functions, as well as to recapitulate genetic phenotypes of EPAC knockout mice when applied...
Beck, Hylke E.; Van Dijk, Albert I.J.M.; Levizzani, Vincenzo; Schellekens, Jaap; Miralles, Diego G.; Martens, Brecht; De Roo, Ad
2017-01-01
Current global precipitation (P) datasets do not take full advantage of the complementary nature of satellite and reanalysis data. Here, we present Multi-Source Weighted-Ensemble Precipitation (MSWEP) version 1.1, a global P dataset for the period 1979-2015 with a 3-hourly temporal and 0.25° spatial
Saleem, Mohammed D; Negus, Deborah; Feldman, Steven R
2018-02-01
Traditionally, ointments were the vehicle of choice for psoriasis. Poor adherence of traditional vehicles limits the use of topical corticosteroids. Alternative formulations have gained popularity due to their ease of application, improved adherence and efficacy. To evaluate the efficacy of topical desoximetasone 0.25% spray formulation in extensive psoriasis. This multicenter, double-blinded, randomized trial compared twice daily topical 0.25% desoximetasone spray to placebo in subjects ≥18 with moderate to severe plaque psoriasis. Primary outcome of the study was the proportion of subjects in each group that achieved clinical success (Physician Global Assessment [PGA] of 0 or 1) and/or treatment success at (target lesion score of 0 or 1) day 28. One-hundred-and-twenty subjects were enrolled. At baseline, 75.0% and 73.3% of the treatment and placebo group had at least moderate PGA, respectively. Clinical success in the intended-to treat and placebo group was 30% and 5% (p = .0003), respectively; treatment success was 39% and 7% (p psoriasis treatments limits the ability to compare the results to other treatments. Topical desoximetasone spray provides rapid control of moderate to severe psoriasis lesions and may be considered for patients awaiting approval of biologicals. Clinical Trial was registered at clinicaltrial.gov: NCT01206387.
17 CFR 8.09 - Review of investigation report.
2010-04-01
... PROCEDURES FOR DISCIPLINARY, SUMMARY, AND MEMBERSHIP DENIAL ACTIONS Disciplinary Procedure § 8.09 Review of investigation report. The disciplinary committee shall promptly review each investigation report. In the event the disciplinary committee determines that additional investigation or evidence is needed, it shall...
OMI/Aura Surface UVB Irradiance and Erythemal Dose Daily L2 Global 0.25 deg Lat/Lon Grid V003
National Aeronautics and Space Administration — The Version 003 of Aura-OMI Spectral Surface UVB Irradiance and Erythemal Dose Level-2G data product (Daily level-2 data binned into global 0.25 deg Lat/Lon grids)...
NCBI nr-aa BLAST: CBRC-HSAP-09-0006 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-HSAP-09-0006 ref|ZP_00960995.1| pyruvate carboxylase [Roseovarius nubinhibens ...ISM] gb|EAP76566.1| pyruvate carboxylase [Roseovarius nubinhibens ISM] ZP_00960995.1 1.2 28% ...
Hydrogen storage properties in the Mg_0_._7_5Ta_0_._2_5 system prepared by mechanical milling
International Nuclear Information System (INIS)
Ramirez G, J. A.
2016-01-01
Magnesium and most of its mixtures have slow sorption-desorption kinetics of hydrogen, which limits their technological application and their viability from the economic view point. Recently, has been observed that by the synthesis of advanced materials, using the mechanical milling technique, positive changes in the kinetics are introduced. In order to improve the sorption-desorption hydrogen properties, in the present work a mixture consisting of Mg_0_._7_5Ta_0_._2_5 was prepared using methanol as process control agent. To this end, the first methodological step was to carry out, by means of the mechanical milling technique, the synthesis of the mixture Mg_0_._7_5Ta_0_._2_5 in a Spex type vibratory mill at times of 6, 12, 18 and 24 h. Subsequently, the material was characterized by different analytical techniques such as scanning electron microscopy with elemental analysis, X-ray diffraction and N_2 physisorption analysis. Subsequently, hydrogen sorption experiments were carried out in a Parr reactor to evaluate the hydrogen storage capacity of the mixture, varying temperature parameters, pressure and time, in order to determine the optimal parameters of hydrogen sorption. The characterization of the hydrogen storage capacity was analyzed by the thermogravimetric analysis/differential scanning calorimetry technique coupled to a mass spectrometer. X ray diffraction analysis reveals that there is a mixture between the starting compounds, with an important refinement of the microstructure as a consequence of the mechanical milling process. The results of the hydrogen sorption tests at 1, 5 and 10 cycles showed that the storage of hydrogen in the Mg_0_._7_5Ta_0_._2_5 mixture can be carried out at a temperature of 25 degrees Celsius with a pressure of 2 atm and a contact time of 1 h. (Author)
NCBI nr-aa BLAST: CBRC-GACU-09-0002 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-GACU-09-0002 ref|YP_594114.1| amidohydrolase [Deinococcus geothermalis DSM 113...00] gb|ABF44040.1| amidohydrolase [Deinococcus geothermalis DSM 11300] YP_594114.1 5.5 28% ...
The crystal structure of (Nb$_{0.75}$Cu$_{0.25}$)Sn$_{2}$ in the Cu-Nb-Sn system
Martin, Stefan; Nolze, Gert; Leineweber, Andreas; Leaux, Floriane; Scheuerlein, Christian
2017-01-01
During the processing of superconducting Nb$_{3}$Sn wire, several intermediate intermetallic phases including a previously encountered Cu-Nb-Sn phase show up. The yet unknown crystal structure of this phase is now identified by a combination of different experimental techniques and database search to be of the hexagonal NiMg2 type with a proposed composition of about (Nb0.75Cu0.25)Sn2. The structure determination started from an evaluation of the lattice parameters from EBSD Kikuchi patterns from quenched material suggesting hexagonal or orthorhombic symmetry. A database search then led to the hexagonal NiMg2 type structure, the presence of which was confirmed by a Rietveld analysis on the basis of high energy synchrotron X-ray powder diffraction data. Assuming a partial substitution of Nb in orthorhombic NbSn2 by Cu, the change of the valence electron concentration provokes a structural transformation from the CuMg2 type for NbSn2 to the NiMg2 type for (Nb0.75Cu0.25)Sn2. In the previous literature the (Nb0.7...
STUDY OF THE INSERTION AND EXTRACTION MECHANISM OF Li3Mn0.5Ti0.25O3
Directory of Open Access Journals (Sweden)
JINHE JIANG
2017-12-01
Full Text Available The metal oxide [Li3Mn0.5Ti0.25O3] was synthesized by solid state reaction crystallization method in certain temperature. It was an inverse spinel type compound metal oxide. The extraction/insertion reaction of this material was studied by X-ray, saturation exchange capacity value and distribution coefficient (Kd measurement value. In terms of its composition and chemical metrology, this inverse spinel material is very comprehensive; it is worth noting that it can be inserted or extracted by other substitutional ions and changes in lithium and oxygen stoichiometry while maintaining their crystal structure. The metal oxide [Li3Mn0.5Ti0.25O3] is inorganic Li+ exchanger which has an ion-memory capacity. It has high exchange selectivity ability for Li+. This metal oxide can be used to separate or extract Li+ in aqueous solution. The experimental result has confirmed inverse spinel type compound metal oxide which was treated by acid could attain 9.7 mmol‧g-1 Li+ exchanged capacity.
NCBI nr-aa BLAST: CBRC-GGAL-09-0008 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-GGAL-09-0008 ref|XP_001568166.1| proteophosphoglycan ppg4 [Leishmania brazilie...nsis] emb|CAM43270.1| proteophosphoglycan ppg4 [Leishmania braziliensis] XP_001568166.1 5e-61 23% ...
Percolative nature of A-site disordered La0.75Ca0.25-xSrxMnO3 manganites
DEFF Research Database (Denmark)
Venkatesh, R.; Yadam, Sankararao; Venkateshwarlu, D.
2015-01-01
Magnetic, resistive, and magnetoresistance measurements were used to investigate the percolative nature of A-site disordered La0.75Ca0.25-xSrxMnO3(x = 0, 0.10) manganites. La0.75Ca0.15Sr0.10MnO3 has an orthorhombic structure and second order magnetic phase transition indicates the presence of two...
International Nuclear Information System (INIS)
Chhaya, U.V.; Gadhvi, M.R.; Mistry, B.V.; Bhavsar, K.H.; Joshi, U.S.; Lakhani, V.K.; Modi, K.B.
2011-01-01
Cadmium substituted cobalt ferrite thin film with nominal composition Cd 0.25 Co 0.75 Fe 2 O 4 , has been grown on quartz substrate by chemical solution deposition and their structural and electrical properties have been investigated. Grazing incidence X-ray diffraction (XRD) confirmed single phase spine) structure with nanometer grain size. Atomic force microscopic analysis revealed uniform nano structured growth of about 70 nm average crystallite size. The XRD data have been used to determine the distribution of cations among the tetrahedral and octahedral sites of the spinel lattice and various structural parameters. The cation distribution determined from X-ray diffraction line intensity calculations revealed, 60% octahedral sites occupancy of Cd 2+ -ions in the composition. Four terminal I-V measurements show hysteretic curves, suggesting high resistance state (HRS) and low resistance state (LRS) in the film with polarity dependence. Maximum resistance ratio, R high /R low of 57% was observed at room temperature in the Ag/Cd 0.25 Co 0.75 Fe 2 O 4 /Ag planar structure. Observed resistance switching is attributed to combined effects, viz., in the LRS, the major fraction of cadmium occupation and electron exchange between Fe 3+ and Fe 2+ at the B-sites, whereas the HRS shows Schottky-like conduction mechanism at the Ag/Cd 0.25 Co 0.75 Fe 2 O 4 interface. (author)
Energy Technology Data Exchange (ETDEWEB)
Sandberg, Dan; Tolmachev, Vladimir; Olofsson, Helena; Carlsson, Joergen; Lindman, Henrik [Uppsala University, Department of Immunology, Genetics and Pathology, Uppsala (Sweden); Velikyan, Irina; Soerensen, Jens [Uppsala University, Section of Nuclear Medicine and PET, Department of Surgical Sciences, Uppsala (Sweden); Wennborg, Anders; Feldwisch, Joachim [Affibody AB, Solna (Sweden)
2017-08-15
In phase I/II-studies radiolabelled ABY-025 Affibody molecules identified human epidermal growth factor receptor 2 (HER2) expression in breast cancer metastases using PET and SPECT imaging. Here, we wanted to investigate the utility of a simple intra-image normalization using tumour-to-reference tissue-ratio (T/R) as a HER2 status discrimination strategy to overcome potential issues related to cross-calibration of scanning devices. Twenty-three women with pre-diagnosed HER2-positive/negative metastasized breast cancer were scanned with [{sup 111}In]-ABY-025 SPECT/CT (n = 7) or [{sup 68}Ga]-ABY-025 PET/CT (n = 16). Uptake was measured in all metastases and in normal spleen, lung, liver, muscle, and blood pool. Normal tissue uptake variation and T/R-ratios were established for various time points and for two different doses of injected peptide from a total of 94 whole-body image acquisitions. Immunohistochemistry (IHC) was used to verify HER2 expression in 28 biopsied metastases. T/R-ratios were compared to IHC findings to establish the best reference tissue for each modality and each imaging time-point. The impact of shed HER2 in serum was investigated. Spleen was the best reference tissue across modalities, followed by blood pool and lung. Spleen-T/R was highly correlated to PET SUV in metastases after 2 h (r = 0.96,
NCBI nr-aa BLAST: CBRC-MMUS-09-0186 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-MMUS-09-0186 ref|XP_001213909.1| predicted protein [Aspergillus terreus NIH262...4] gb|EAU35178.1| predicted protein [Aspergillus terreus NIH2624] XP_001213909.1 0.076 27% ...
NCBI nr-aa BLAST: CBRC-HSAP-09-0074 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-HSAP-09-0074 ref|XP_001564659.1| dynein heavy chain, putative [Leishmania brazil...iensis] emb|CAM38725.1| dynein heavy chain, putative [Leishmania braziliensis] XP_001564659.1 7.8 31% ...
Registration of ‘CP 09-1822’ Sugarcane
‘CP 09-1822’ (Reg. No. __; PI 686942 sugarcane (a complex hybrid of Saccharum spp.) was released in June 2016 for commercial cultivation on sand (mineral) soils in Florida. This cultivar was developed through a collaborative sugarcane cultivar development program of the USDA-ARS, the University of F...
Energy Technology Data Exchange (ETDEWEB)
Miah, M.J. [Department of Physics, Bangladesh University of Engineering and Technology (Bangladesh); Department of Physics, Comilla University, Comilla (Bangladesh); Khan, M.N.I. [Materials Science Division, Atomic Energy Center, Dhaka (Bangladesh); Hossain, A.K.M. Akther, E-mail: akmhossain@phy.buet.ac.bd [Department of Physics, Bangladesh University of Engineering and Technology (Bangladesh)
2016-03-01
Multiferroic xBa{sub 0.95}Sr{sub 0.05}TiO{sub 3}–(1−x)BiFe{sub 0.9}Gd{sub 0.1}O{sub 3} [xBST–(1−x)BFGO], where x=0.00−0.40, have been synthesized by the conventional solid-state reaction method. The crystalline phase, microstructure, relaxor behavior, ac conductivity, impedance spectroscopy, dc magnetic properties, complex initial permeability and magnetoelectric coefficient of these solid solutions have been investigated. The crystal structure is found to change from rhombohedral in BFGO rich compositions to cubic when x≥0.30. Room temperature dielectric properties are investigated within the frequency range from 1 kHz to 1 MHz and found to increase with BST content. The frequency dependence of high temperature dielectric measurements indicated that the composites with x≥0.20, exhibit relaxor ferroelectric behavior. The ac conductivity obeys the Jonscher’s universal power law and BST helps to enhance the electrical conductivity of the composites. Studies of impedance spectroscopy suggest that only grains have the contribution to the conductivity mechanism in this material. Magnetizations as a function of applied magnetic field measurements show weak ferromagnetism for 0.10≤x≤0.30 composites. The maximum value of remnant magnetization is found to be 0.565×10{sup 3} A/m (=0.08 emu/g) for x=0.25 which is better than previously reported BaTiO{sub 3}–BiFeO{sub 3} systems. The complex initial permeability is found to improve with the increase in BST concentration due to the reduction of oxygen vacancies. In addition, an enhanced magnetoelectric (ME) coupling is also observed and determined by the ME coefficient. The maximum value of ME coefficient is found to be 21.71×10{sup −4} V/A (=1.67 mV/cm Oe) for the x=0.25 composition. The BST–BFGO solid solutions show high-performance multiferroic properties and can be selected for further investigation. - Highlights: • Phase pure multiferroic xBa{sub 0.95}Sr{sub 0.05}TiO{sub 3}–(1−x)BiFe{sub 0.9
NCBI nr-aa BLAST: CBRC-RMAC-09-0022 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-RMAC-09-0022 ref|YP_026083.1| NADH dehydrogenase subunit 2 [Steinernema carpoc...apsae] gb|AAT00526.1| NADH dehydrogenase subunit 2 [Steinernema carpocapsae] YP_026083.1 1e-05 30% ...
Microstructural evolution of nanostructured Ti0.9Al0.1N prepared by reactive ball-milling
International Nuclear Information System (INIS)
Bhaskar, U.K.; Bid, S.; Pradhan, S.K.
2011-01-01
Research highlights: → Nanocrystalline stoichiometric Ti 0.9 Al 0.1 N powder has been prepared by ball-milling the 0.9 mol fraction of α-Ti (hcp) and 0.1 mol fraction of aluminum (fcc) powders under N 2 at room temperature. Initially, α-Ti phase partially transformed to the transient β-Ti phase and Ti 0.9 Al 0.1 N (fcc) phase is noticed to form after 3 h of milling. Nanocrystalline stoichiometric Ti 0.9 Al 0.1 N phase is formed after 7 h of milling. The main features which are observed in the present study are stated below: 1.During ball-milling of α-Ti, the α-Ti phase partially converted to transient cubic β-Ti phase within 1 h of milling. 2.Ti 0.9 Al 0.1 N (fcc) phase is noticed to form after 3 h of milling. Complete formation of Ti 0.9 Al 0.1 N (fcc) is obtained at 7 h of milling which is lesser than complete formation time (9 h) of TiN. Doping Al atoms accelerates the formation of (TiAl)N phase. 3.The particle size of Ti 0.9 Al 0.1 N decrease rapidly up to 3 h and then increase slightly due to agglomeration effect. 4.The particle size of Ti 0.9 Al 0.1 N estimated from X-ray is in good agreement with that measured from HRTEM. - Abstract: Nanocrystalline stoichiometric Ti 0.9 Al 0.1 N powder has been prepared by ball-milling the α-Ti (hcp) and aluminum (fcc) powders under N 2 at room temperature. Initially, α-Ti phase partially transformed to the transient cubic β-Ti phase and Ti 0.9 Al 0.1 N (fcc) phase is noticed to form after 3 h of milling. Nanocrystalline stoichiometric Ti 0.9 Al 0.1 N phase is formed after 7 h of milling. After 1 h of milling, all Al atoms are diffused into the α-Ti matrix. The transient β-Ti phase is noticed to form after 1 h of milling and disappears completely after 7 h of milling. Microstructure characterization of unmilled and ball-milled powders by analyzing XRD patterns employing the Rietveld structure refinement reveals the inclusion of Al and nitrogen atoms into the Ti lattice on the way to formation of Ti 0.9 Al 0.1 N
Registration of ‘CP 09-1430’ Sugarcane
‘CP 09-1430’ (Reg. No. ; PI 686940 sugarcane (a complex hybrid of Saccharum spp.) was developed and released (6 Jun. 2016) through cooperative research conducted by the USDA-ARS Sugarcane Field Station , Canal Point, the University of Florida, and the Florida Sugar Cane League, Inc. for use on ...
Study of electrical and magnetic properties of Pr0.6-xBixSr0.4MnO3 (x=0.20 and 0.25)
Daivajna, Mamatha D.; Rao, Ashok; Lin, W. J.; Kuo, Y. K.
2017-06-01
We have investigated the electrical and magnetic properties of Pr0.6-xBixSr0.4MnO3 (x=0.20 and 0.25) manganites. XRD data shows that the synthesized samples are single-phase and crystallize in the orthorhombic structure with Pnma space group. Resistivity measurements show that the sample with x=0.25 exhibits a thermally activated behavior for the entire temperature range. The magnetoresistance (MR) for the x=0.25 sample is as high as nearly 100% over a wide range of temperature, demonstrating its important technological application as a material for MR-based devices. From the magnetization measurements, two magnetic transitions viz. paramagnetic insulating to ferromagnetic metallic (PMI-FMM) transition at TC and the ferromagnetic metallic (FMM) to antiferromagnetic insulating (AFI) transition at Neel temperature TN were observe in both samples. The Curie temperature decreases with bismuth doping, while TN increases with Bi content. Most interestingly, the temperature variation of magnetization and resistivity shows hysteresis behavior across the transition for the x=0.20 sample.
Deuterium short-range order in Pd0.975Ag0.025D0.685 by diffuse neutron scattering
DEFF Research Database (Denmark)
Blaschko, O.; Klemencic, R.; Fratzl, P.
1983-01-01
By diffuse neutron scattering the D short-range order in a Pd0.975Ag0.025D0.685 crystal was investigated at 50 and 70K. The results are compared with the D ordering in the PdDx system previously investigated, and it is shown that the isointensity contours around the (1/2,1,0) point are similar...
The effect of charge carrier and doping site on thermoelectric properties of Mg2Sn0.75Ge0.25
International Nuclear Information System (INIS)
Saparamadu, Udara; Mao, Jun; Dahal, Keshab; Zhang, Hao; Tian, Fei; Song, Shaowei; Liu, Weishu; Ren, Zhifeng
2017-01-01
Mg 2 Sn 0.75 Ge 0.25 has been recently demonstrated to be a promising thermoelectric material for power generation in the temperature range from room temperature to 723 K because of the high power factor of ∼54 μW cm −1 K −2 upon Sb doping to the Sn site. The enhanced density of states effective mass and weak electron scattering from the alloying effect are believed to be the main reasons for the high power factor (PF) and hence high figure of merit (ZT). In this study, it is shown that the right choice of carrier donor also plays an important role in obtaining high power factor. The effect of carrier donors Y and La at Mg-site and Bi and P at Sn-site in Mg 2 Sn 0.75 Ge 0.25 is systematically investigated. It is found that charge donors at the Sn-site are much more effective than at the Mg-site in enhancing PF and ZT. Bi doped Mg 2 Sn 0.73 Bi 0.02 Ge 0.25 shows a peak ZT of ∼1.4 at 673 K, a peak PF of ∼54 μW cm −1 K −2 at 577 K, which resulted in an engineering figure of merit (ZT) eng of ∼0.76 and (PF) eng of ∼2.05 W m −1 K −1 for cold side fixed at 323 K and hot side at 723 K.
Res Sep 2014 Cover Tp 08.09.14.cdr
Indian Academy of Sciences (India)
Admin
2010). ISSN 0971-8044. Regn No.KRNAVBGE-340/2012-2014. Licenced to Post without prepayment No.6. Posted at MBC, GPO, Bangalore 560 001, 12.09.14. Registered with Registrar of Newspapers in India vide Regn. No. 66273/96.
NCBI nr-aa BLAST: CBRC-PTRO-09-0001 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-PTRO-09-0001 ref|ZP_01444684.1| hypothetical protein R2601_22801 [Roseovarius ...sp. HTCC2601] gb|EAU45065.1| hypothetical protein R2601_22801 [Roseovarius sp. HTCC2601] ZP_01444684.1 0.32 34% ...
Pithon, Matheus Melo; dos Santos, Rogerio Lacerda; Judice, Renata Lima Pasini; de Assuncao, Paulo Sergio; Restle, Luciana
2013-11-01
Sterilisation using peracetic acid (PAA) has been advocated for orthodontic elastic bands. However, cane-loaded elastomeric ligatures can also become contaminated during processing, packaging, and manipulation before placement in the oral cavity and are therefore susceptible, and possible causes, of cross-contamination. To test the hypothesis that 0.25% peracetic acid (PAA), following the sterilisation of elastomers, influences the cytotoxicity of elastomeric ligatures on L929 cell lines. Four hundred and eighty silver elastomeric ligatures were divided into 4 groups of 120 ligatures to produce, Group TP (latex natural, bulk pack, TP Orthodontics), Group M1 (Polyurethane, bulk pack, Morelli), Group M2 (Polyurethane, cane-loaded, Morelli) and Group U (Polyurethane, cane-loaded, Uniden). Of the 120 ligatures in each group, 100 were sterilised in 0.25% PAA at time intervals (N = 20) of 1 hour, 2 hours, 3 hours, 4 hours and 5 hours. The 20 remaining elastomeric ligatures in each group were not sterilised and served as controls. Cytotoxicity was assessed using L929 cell lines and a dye-uptake method. Analysis of variance (ANOVA), followed by the Tukey post hoc test (p < 0.05) determined statistical relevance. There was a significant difference between TP, Morelli and Uniden elastomerics (p < 0.05), but no difference between the two types of Morelli elastomerics at the 1 hour time interval. In addition, there was a significant difference between Group CC and the other groups assessed, except between Groups CC and TP at the 1 hour time interval. The non-sterilised elastomeric ligatures showed similar cell viability to that observed after 1 hour of standard sterilisation. PAA did not significantly influence the cytotoxicity of elastomeric ligatures after a sterilisation time of 1 hour and is therefore recommended for clinical use.
Experimental measurement of enthalpy increments of Th0.25Ce0.75O2
International Nuclear Information System (INIS)
Babu, R.; Balakrishnan, S.; Ananthasivan, K.; Nagarajan, K.
2013-01-01
Thorium has been suggested as an alternative fertile material for a nuclear fuel cycle, and an inert matrix for burning plutonium and for waste disposal. The third stage of India's nuclear power programme envisages utilization of thorium and plutonium as a fuel in Advanced Heavy Water Reactor (AHWR) and Accelerator Driven Sub-critical Systems (ADSS). Solid solutions of ThO 2 -PuO 2 are of importance because of coexistence of Th with Pu during the breeding cycle. CeO 2 is used as a PuO 2 analog due to similar ionic radii of cations and similar physico-chemical properties of the oxides. ThO 2 forms a homogeneous solid solution with the cubic fluorite structure when doped with Ce in the entire compositional range. In the development of mixed oxide nuclear fuels, knowledge of thermodynamic properties of thorium oxide and its mixtures has become extremely importance for understanding the fuel behavior during irradiation and for predicting the performance of the fuel under accidental conditions. Thermodynamic functions such as the enthalpy increment and heat capacity of the theria-ceria solid solution have not been measured experimentally. Hence, the enthalpy increments of thoria-ceria solid solutions, Th 0.25 Ce 0.75 O 2 by inverse drop calorimetry in the temperature range 523-1723 K have been measured. The measured enthalpy increments were fitted in to polynomial functions by using the least squares method and the other thermodynamic functions such as heat capacity, entropy and Gibbs energy functions were computed in the temperature range 298-1800 K. The reported thermodynamic functions for Th 0.25 Ce 0.75 O 2 forms the first experimental data and the heat capacity of (Th,Ce)O 2 solid solutions was shown to obey the Neumann-Kopp's rule. (author)
NCBI nr-aa BLAST: CBRC-MDOM-09-0050 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-MDOM-09-0050 ref|NP_001017377.1| progestin and adipoQ receptor family member I...V [Rattus norvegicus] gb|AAH92635.1| Progestin and adipoQ receptor family member IV [Rattus norvegicus] gb|EDM03772.1| progesti
Jasim, Kareem A.; Al-Khafaji, Raghad S.
2018-05-01
In this paper, there are three different high temperature superconductors which are Hg0.75Pb0.25Sr2-y BayCa2Cu3O8+δ with deferent weight fractions y = 0.10, 0.20 and 0.25 that have been prepared successfully by solid state reaction and the samples have been equipped with/without O2 flow. The optimum calcinations is 1073 K and the sintering process that has been achieved within 1128-1133 K. Transition temperature Tc has been found by using four probe technique through electrical resistivity measurements. The greatest Tc that has been found for Hg0.75Pb0.25Sr1.75 Ba0.25Ca2Cu3O8.31 is 115 oK. Oxygen content (O2) flow exhibits high-phased superconductors that is similar to the samples prepared without O2. Investigation of X-ray diffraction (XRD) is revealed (tetragonal structure) by the c-axis lattice parameter increasing of the samples substituted with Ba. It has been established, from the calculated results, that the Ba variation concentrations of all samples products a modification in the density (ρm), (c/a) and volume fraction (VPh(2223)).
Energy Technology Data Exchange (ETDEWEB)
Wjihi, Sarra [Unité de Recherche de Physique Quantique, 11 ES 54, Faculté des Science de Monastir (Tunisia); Dhaou, Houcine [Laboratoire des Etudes des Systèmes Thermiques et Energétiques (LESTE), ENIM, Route de Kairouan, 5019 Monastir (Tunisia); Yahia, Manel Ben; Knani, Salah [Unité de Recherche de Physique Quantique, 11 ES 54, Faculté des Science de Monastir (Tunisia); Jemni, Abdelmajid [Laboratoire des Etudes des Systèmes Thermiques et Energétiques (LESTE), ENIM, Route de Kairouan, 5019 Monastir (Tunisia); Lamine, Abdelmottaleb Ben, E-mail: abdelmottaleb.benlamine@gmail.com [Unité de Recherche de Physique Quantique, 11 ES 54, Faculté des Science de Monastir (Tunisia)
2015-12-15
Statistical physics treatment is used to study the desorption of hydrogen on LaNi{sub 4.75}Fe{sub 0.25}, in order to obtain new physicochemical interpretations at the molecular level. Experimental desorption isotherms of hydrogen on LaNi{sub 4.75}Fe{sub 0.25} are fitted at three temperatures (293 K, 303 K and 313 K), using a monolayer desorption model. Six parameters of the model are fitted, namely the number of molecules per site n{sub α} and n{sub β}, the receptor site densities N{sub αM} and N{sub βM}, and the energetic parameters P{sub α} and P{sub β}. The behaviors of these parameters are discussed in relationship with desorption process. A dynamic study of the α and β phases in the desorption process was then carried out. Finally, the different thermodynamical potential functions are derived by statistical physics calculations from our adopted model.
NCBI nr-aa BLAST: CBRC-TNIG-09-0033 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-TNIG-09-0033 ref|YP_001510423.1| hypothetical protein Franean1_6173 [Frankia s...p. EAN1pec] gb|ABW15517.1| hypothetical protein Franean1_6173 [Frankia sp. EAN1pec] YP_001510423.1 0.097 29% ...
NCBI nr-aa BLAST: CBRC-GACU-09-0004 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-GACU-09-0004 ref|XP_747491.1| K+ homeostasis protein Kha1, putative [Aspergill...us fumigatus Af293] gb|EAL85453.1| K+ homeostasis protein Kha1, putative [Aspergillus fumigatus Af293] XP_747491.1 0.53 28% ...
NCBI nr-aa BLAST: CBRC-RMAC-09-0031 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-RMAC-09-0031 ref|NP_000675.1| beta-1-adrenergic receptor [Homo sapiens] gb|AAA51667.1| beta-1-adrenergi...c receptor emb|CAI16920.1| adrenergic, beta-1-, receptor [Homo sapiens] NP_000675.1 0.0 97% ...
NCBI nr-aa BLAST: CBRC-TGUT-09-0014 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-TGUT-09-0014 ref|NP_000675.1| beta-1-adrenergic receptor [Homo sapiens] gb|AAA51667.1| beta-1-adrenergi...c receptor emb|CAI16920.1| adrenergic, beta-1-, receptor [Homo sapiens] NP_000675.1 1e-144 67% ...
NCBI nr-aa BLAST: CBRC-TNIG-09-0017 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-TNIG-09-0017 ref|NP_001025549.1| potassium voltage-gated channel, shaker-relat...ed subfamily, member 3 [Gallus gallus] gb|AAP94028.1| shaker subfamily potassium channel Kv1.3 [Gallus gallus] NP_001025549.1 0.0 83% ...
NCBI nr-aa BLAST: CBRC-PABE-09-0037 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-PABE-09-0037 ref|YP_890142.1| hypothetical protein MSMEG_5916 [Mycobacterium sme...gmatis str. MC2 155] gb|ABK71889.1| hypothetical protein MSMEG_5916 [Mycobacterium smegmatis str. MC2 155] YP_890142.1 0.033 36% ...
NCBI nr-aa BLAST: CBRC-GACU-09-0056 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-GACU-09-0056 sp|P48766|NAC1_CAVPO Sodium/calcium exchanger 1 precursor (Na(+)/Ca(2+)-exchange... protein 1) gb|AAA73904.1| sodium-calcium exchanger prf||2108269A Na/Ca exchanger P48766 0.0 68% ...
Undergraduate Education with the WIYN 0.9-m Telescope
Pilachowski, Catherine A.
2017-01-01
Several models have been explored at Indiana University Bloomington for undergraduate student engagement in astronomy using the WIYN 0.9-m telescope at Kitt Peak. These models include individual student research projects using the telescope, student observations as part of an observational techniques course for majors, and enrichment activities for non-science majors in general education courses. Where possible, we arrange for students to travel to the telescope. More often, we are able to use simple online tools such as Skype and VNC viewers to give students an authentic observing experience. Experiences with the telescope motivate students to learn basic content in astronomy, including the celestial sphere, the electromagnetic spectrum, telescopes and detectors, the variety of astronomical objects, date reduction processes, image analysis, and color image creation and appreciation. The WIYN 0.9-m telescope is an essential tool for our program at all levels of undergraduate education
Cashew apple bagasse as a source of sugars for ethanol production by Kluyveromyces marxianus CE025.
Rocha, Maria Valderez Ponte; Rodrigues, Tigressa Helena Soares; Melo, Vania M M; Gonçalves, Luciana R B; de Macedo, Gorete Ribeiro
2011-08-01
The potential of cashew apple bagasse as a source of sugars for ethanol production by Kluyveromyces marxianus CE025 was evaluated in this work. This strain was preliminarily cultivated in a synthetic medium containing glucose and xylose and was able to produce ethanol and xylitol at pH 4.5. Next, cashew apple bagasse hydrolysate (CABH) was prepared by a diluted sulfuric acid pretreatment and used as fermentation media. This hydrolysate is rich in glucose, xylose, and arabinose and contains traces of formic acid and acetic acid. In batch fermentations of CABH at pH 4.5, the strain produced only ethanol. The effects of temperature on the kinetic parameters of ethanol fermentation by K. marxianus CE025 using CABH were also evaluated. Maximum specific growth rate (μ(max)), overall yields of ethanol based on glucose consumption [Formula: see text] and based on glucose + xylose consumption (Y ( P/S )), overall yield of ethanol based on biomass (Y ( P/X )), and ethanol productivity (P (E)) were determined as a function of temperature. Best results of ethanol production were achieved at 30°C, which is also quite close to the optimum temperature for the formation of biomass. The process yielded 12.36 ± 0.06 g l(-1) of ethanol with a volumetric production rate of 0.257 ± 0.002 g l(-1) h(-1) and an ethanol yield of 0.417 ± 0.003 g g(-1) glucose.
NCBI nr-aa BLAST: CBRC-MMUS-09-0186 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-MMUS-09-0186 ref|ZP_01510169.1| ABC-2 type transporter, NodJ family [Burkholderia phytofirm...ans PsJN] gb|EAV05032.1| ABC-2 type transporter, NodJ family [Burkholderia phytofirmans PsJN] ZP_01510169.1 1.4 31% ...
NCBI nr-aa BLAST: CBRC-HSAP-09-0074 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-HSAP-09-0074 ref|XP_001558290.1| hypothetical protein BC1G_02954 [Botryotinia fuck...eliana B05.10] gb|EDN18805.1| hypothetical protein BC1G_02954 [Botryotinia fuckeliana B05.10] XP_001558290.1 2.7 34% ...
Corrosion of Dental Au-Ag-Cu-Pd Alloys in 0.9 % Sodium Chloride Solution
International Nuclear Information System (INIS)
Chiba, Atsushi; Kusayanagi, Yukiharu
2005-01-01
Two Au-Ag-Cu-Pd dental casting alloys (Au:12% and 20%) used. The test solutions used 0.9 % NaCl solution (isotonic sodium chloride solution), 0.9 % NaCl solution containing 1 % lactic acid, and 0.9 % NaCl solution containing 1 % lactic acid and 0.1 mol dm -3 Na 2 S. The surface of two samples in three sample solutions was not natural discoloration during one year. The alloy containing 12 % gold was easily alloyed and the composition was uniform comparing with the alloy containing 20 % gold. The rest potentials have not a little effect after three months. The kinds of metals could not definitely from the oxidation and reduction waves of metal on the cyclic voltammograms. The dissolutions of gold and palladium were 12 % Au sample in the 0.9 % NaCl solution containing 1 % lactic acid and 0.1 mol dm -3 Na 2 S. The pH of solution had an affect on dissolution of copper, and sulfur ion had an affect on dissolution of silver. The copper dissolved amount from 20 % gold sample was about 26 times comparing with that of 12 % gold sample in the 0.9 % solution containing 1 % lactic acid. Corrosion products were silver chloride and copper chloride in NaCl solution, and silver sulfide and copper sulfide in NaCl solution containing Na 2 S
NCBI nr-aa BLAST: CBRC-TNIG-09-0017 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-TNIG-09-0017 ref|NP_001079227.1| shaker-like potassium channel subunit Kv1.3B ...[Xenopus laevis] gb|AAK83378.1|AF395810_1 shaker-like potassium channel subunit Kv1.3B [Xenopus laevis] NP_001079227.1 0.0 86% ...
NCBI nr-aa BLAST: CBRC-TNIG-09-0033 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-TNIG-09-0033 ref|ZP_01901905.1| hypothetical protein RAZWK3B_08726 [Roseobacte...r sp. AzwK-3b] gb|EDM72321.1| hypothetical protein RAZWK3B_08726 [Roseobacter sp. AzwK-3b] ZP_01901905.1 0.13 31% ...
Weldability of thermally grain-refined Fe-12Ni-0.25Ti for cryogenic structural applications
International Nuclear Information System (INIS)
Williams, D.E.
1980-02-01
The weldability of a research alloy designed for structural use in liquid helium temperature, cryogenic environments was investigated. Plates of iron-12 weight percent nickel-0.25 weight percent titanium were grain refined by the four-step, grain refining thermal treatment developed for this alloy and welded with Inconel Number 92 weld wire using the Gas Metal Arc (GMA) welding process with argon-15% helium gas shielding. Both a single pass and a double-sided, 2 pass electron beam (EB) weld were also made without filler metal addition. Weldments were radiographed and sectioned and the charpy V-notch specimens removed were tested at liquid nitrogen and helium temperatures
Study of the 1.25Cr-1Mo-0.25V steel microstructure after a carburization phenomenon
Energy Technology Data Exchange (ETDEWEB)
Simonetti, S., E-mail: ssimonet@uns.edu.ar [Departamento de Fisica, Universidad Nacional del Sur, Av. Alem 1253, 8000 Bahia Blanca (Argentina); Departamentos de Ciencias Basicas e Ingenieria Mecanica, Universidad Tecnologica Nacional, 11 de Abril 461, 8000 Bahia Blanca (Argentina); Lanz, C. [Departamento de Ingenieria, Universidad Nacional del Sur, Av. Alem 1253, 8000 Bahia Blanca (Argentina); Brizuela, G.; Juan, A. [Departamento de Fisica, Universidad Nacional del Sur, Av. Alem 1253, 8000 Bahia Blanca (Argentina)
2010-08-20
We studied the changes in the structure and carbide particle size in 1.25Cr-1Mo-0.25V steel under 600 deg. C and 168 MPa, after 4000 h service. We used microscopy and microanalysis techniques to analyze the carbide particles. We performed a complementary theoretical study on the chemical bonding and electronic structure of the carbide-Fe matrix interaction. The results contribute to the understanding of the changes in the alloy microstructure caused by the carburization phenomenon.
22 CFR 231.09 - No acceleration of Eligible Notes.
2010-04-01
... Section 231.09 Foreign Relations AGENCY FOR INTERNATIONAL DEVELOPMENT ARAB REPUBLIC OF EGYPT LOAN GUARANTEES ISSUED UNDER THE EMERGENCY WARTIME SUPPLEMENTAL APPROPRIATIONS ACT OF 2003, PUBLIC LAW 108-11... have the right to pay any amounts in respect of the Eligible Notes other than in accordance with the...
NCBI nr-aa BLAST: CBRC-MDOM-09-0050 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-MDOM-09-0050 gb|EAW85442.1| progestin and adipoQ receptor family member IV, is...oform CRA_b [Homo sapiens] gb|EAW85444.1| progestin and adipoQ receptor family member IV, isoform CRA_b [Homo sapiens] EAW85442.1 3e-94 65% ...
XRD and HRTEM characterization of mechanosynthesized Ti{sub 0.9}W{sub 0.1}C cermet
Energy Technology Data Exchange (ETDEWEB)
Bandyopadhyay, S. [Department of Physics, The University of Burdwan, Golapbag, Burdwan 713104, West Bengal (India); Dutta, H. [Department of Physics, Vivekananda College, Burdwan 713103, West Bengal (India); Pradhan, S.K., E-mail: skp_bu@yahoo.com [Department of Physics, The University of Burdwan, Golapbag, Burdwan 713104, West Bengal (India)
2013-12-25
Highlights: •Cubic Ti{sub 0.9}W{sub 0.1}C is formed after 50 min of milling of α-Ti, W and graphite powders. •Nanocrystalline Ti{sub 0.9}W{sub 0.1}C with particle size ∼11 nm is obtained after 8 h milling. •Average particle size of Ti{sub 0.9}W{sub 0.1}C from XRD analysis and HRTEM is very close. •Formation of Ti{sub 0.9}W{sub 0.1}C is hindered as compared with TiC. -- Abstract: Elemental powder mixture of titanium, tungsten and graphite is milled by high energy planetary ball mill at a fixed ball to powder mass ratio (BPMR) for different duration to produce nanosized particles of Ti{sub 0.9}W{sub 0.1}C hard metal. Microstructure characterization in terms of lattice imperfections and phase quantification of ball-milled samples has been done primarily by analyzing the XRD pattern and employing Rietveld method of structure and microstructure refinement. After 8 h of ball-milling full formation of Ti{sub 0.9}W{sub 0.1}C is noticed without any contamination of other phase or milling media. TEM study of 8 h ball-milled sample gives direct supportive evidence of structural and microstructural evaluation by XRD pattern analysis. A comparative study of microstructural changes between TiC and Ti{sub 0.9}W{sub 0.1}C helps to understand the effect of addition of W as solute in Ti–C metal matrix.
International Nuclear Information System (INIS)
Roscha, V.
1994-01-01
The purpose of this report is to describe the definitive design of the Radioactive Mixed Waste (RMW) Non-Drag-Off disposal facility, Project W-025. This report presents a n of the major landfill design features and a discussion of how each of the criteria is addressed in the design. The appendices include laboratory test results, design drawings, and individual analyses that were conducted in support of the design. Revision 1 of this document incorporates design changes resulting from an increase in the required operating life of the W-025 landfill from 2 to 20 years. The rationale for these design changes is described in Golder Associates Inc. 1991a. These changes include (1) adding a 1.5-foot-thick layer of compacted admix directory-under the primary FML on the floor of the landfill to mitigate the effects of possible stress cracking in the primary flexible membrane liner (FML), and (2) increasing the operations layer thickness from two to three feet over the entire landfill area, to provide additional protection for the secondary admix layer against mechanical damage and the effects of freezing and desiccation. The design of the W-025 Landfill has also been modified in response to the results of the EPA Method 9090 chemical compatibility testing program (Golder Associates Inc. 1991b and 1991c), which was completed after the original design was prepared. This program consisted of testing geosynthetic materials and soil/bentonite admix with synthetic leachate having the composition expected during the life of the W-025 Landfill., The results of this program indicated that the polyester geotextile originally specified for the landfill might be susceptible to deterioration. On this basis, polypropylene geotextiles were substituted as a more chemically-resistant alternative. In addition, the percentage of bentonite in the admix was increased to provide sufficiently low permeability to the expected leachate
33 CFR 88.09 - Temporary exemption from light and shape requirements when operating under bridges.
2010-07-01
... and shape requirements when operating under bridges. 88.09 Section 88.09 Navigation and Navigable... Temporary exemption from light and shape requirements when operating under bridges. A vessel's navigation lights and shapes may be lowered if necessary to pass under a bridge. ...
Directory of Open Access Journals (Sweden)
Hsin-Ying Lee
2014-01-01
Full Text Available The Mg0.1Zn0.9O films were grown using atomic layer deposition (ALD system and applied to metal-semiconductor-metal ultraviolet photodetectors (MSM-UPDs as an active layer. To suppress the dangling bonds on the Mg0.1Zn0.9O surface, the photoelectrochemical (PEC treatment was used to passivate the Mg0.1Zn0.9O surface, which could reduce the dark current of the MSM-UPDs about one order. Beside, to increase more incident light into the Mg0.1Zn0.9O active layer of the MSM-UPDs, the 500-nm-diameter silica nanospheres were spin-coated on the Mg0.1Zn0.9O active layer to improve the antireflection capability at the wavelength of 340 nm. The reflectivity of the Mg0.1Zn0.9O films with silica nanospheres antireflection layer decreased about 7.0% in comparison with the Mg0.1Zn0.9O films without silica nanospheres. The photocurrent and UV-visible ratio of the passivated Mg0.1Zn0.9O MSM-UPDs with antireflection layer were enhanced to 5.85 μA and 1.44×104, respectively, at the bias voltage of 5 V. Moreover, the noise equivalent power and the specific detectivity of the passivated Mg0.1Zn0.9O MSM-UPDs with antireflection layer were decreased to 2.60×10-13 W and increased to 1.21×1012 cmHz1/2W−1, respectively, at the bias voltage of 5 V. According to the above mentions, the PEC treatment and silica nanospheres antireflection layer could effectively enhance the performance of Mg0.1Zn0.9O MSM-UPDs.
International Nuclear Information System (INIS)
Knizhnik, A.; Reisner, G.M.; Men, A.; Eckstein, Y.
1998-01-01
The 123 superconductor (Ca 0.1 La 0.9 )(Ba 1.6.5 La 0.35 )Cu 3 O y (c) has been prepared by the usual carbonate-oxide method. After oxygenation to the optimal oxygen doping of y=7.135, the maximal T c =57K. We prepared (c) also via reaction (1): 0.75La(La 0.25 Ba 1.75 )Cu 3 O 6.782 +0.25Ca 0.4 La 0.6 (La 0.65 Ba 1.35 )Cu 3 O 6.806 + 0.033O 2 (Ca 0. 1La 9 )(Ba 1.65 La 0.35 )Cu 3 ) 6.854 (1) The initial reagents are also superconductors. The first (a) has a maximal T c =57K, second (b) - 81K. In reference [1] we have shown that several isomers having the same general formula (c), may exist each having different ratios of the follow- ing possible unit cells: LaBa 2 Cu 3 O y , La(BaLa)Cu 3 O y , LaLa 2 Cu 3 O y , CaBa 2 Cu 3 O y , Ca(BaLa)Cu30 , CaLa2Cu30 . These isomers are formed at different temperatures of the preparation of (c) by carbonate-oxide method [1]. After the formation of compound (c) has been completed, further heating, even to higher temperatures, cannot change one isomer into another. Thus, there is no equilibrium between the (c) isomers and, if there also is no equilibrium in the cases of both isomers (a) and (b), then reaction (1) should not change the ratio of the unit cells. Each cell (i), which is present in (a) in concentration q i (a), should be present in (c) in concentration 0.75q i (a); analogously, each cell (i) which is present in (b) in concentration q i (b) should be present in (c) in concentration 0.25q i (b). According to the cluster component method, [2], T cmax = Σq i T i , where T i is T cmax of such a hypothetical sample, which contains cells (i) only. Thus the expected T cmax of (c), prepared via reaction (1), is: Σ0.75q i (a)T i + Σ0.25q i (b)T i = 0.75 x 57 + 0.25 x 81 = 63K, i.e. higher by 6 degrees than the T cmax of (c) prepared by the usual method. We studied reaction (1) via X-ray diffraction. XRD spectra showed that the intensity of the reagents peaks decrease with the time of the reaction and after 100 hours at 950 deg
ATLAS Monte Carlo tunes for MC09
The ATLAS collaboration
2010-01-01
This note describes the ATLAS tunes of underlying event and minimum bias description for the main Monte Carlo generators used in the MC09 production. For the main shower generators, pythia and herwig (with jimmy), the MRST LO* parton distribution functions (PDFs) were used for the first time in ATLAS. Special studies on the performance of these, conceptually new, PDFs for high pt physics processes at LHC energies are presented. In addition, a tune of jimmy for CTEQ6.6 is presented, for use with MC@NLO.
Energy Technology Data Exchange (ETDEWEB)
Gous, M.H., E-mail: gousph@hotmail.fr; Meddour, A., E-mail: a_meddour@yahoo.fr; Bourouis, Ch., E-mail: bourouisse_ch@yahoo.fr
2017-01-15
The objective of this work is to predict the structural, electronic, magnetic and elastic properties of Mg{sub 1−x}TM{sub x}S (TM=Mn, Fe, Co and Ni) compound in the zinc blende Ferromagnetic phase using first principal approach. The structural and elastic properties are performed using the generalized gradient approximation proposed by Wu and Cohen(WC-GGA). However, the electronic and magnetic properties have been performed using modified Becke-Johnson potential combined with the LDA correlation (mBJLDA). The results show that all compounds Mg{sub 1−x}Mn{sub x}S, Mg{sub 1−x}Fe{sub x}S and Mg{sub 1−x}Ni{sub x}S exhibit a half-metallic ferromagnetic character with 100% spin-polarization at the Fermi level, except Mg{sub 1−x}Co{sub x}S is a metal. For each compounds study here, the total magnetic momentum is an integer equal to magnetic moments of TM atom in their free space charge value. Due to the p–d hybridization, there is a small local magnetic moment on the Mg and S sites; whereas, the local magnetic moments of TM atom reduce from their free space charge value. In addition, we investigate the mechanical behavior of MgS and Mg{sub 1−x}TM{sub x}S; all compounds studied here are mechanically stable and exhibit a strong anisotropic behavior. - Highlights: • Our results could be a prediction for coming works. • According to our results of electronic properties: Mg{sub 0.75}Co{sub 0.25}S is metal. Mg{sub 0.75}Mn{sub 0.25}S, Mg{sub 0.75}Fe{sub 0.25}S and Mg{sub 0.75}Ni{sub 0.25}S exhibit half-metallic ferromagnetic behavior with 100% spin polarization at Fermi level. • We found that MgS and Mg{sub 0.75}TM{sub 0.25}S (TM=Mn, Fe, Co and Ni) compounds are mechanically stable, ductile materials and have an anisotropic Young's Modulus. • It is likely that these materials have a high Curie temperature.
Saeidi, Parviz; Nourbakhsh, Zahra
2018-04-01
Topological phase of Gd1-xYxAuPb (x = 0, 0.25, 0.5, 0.75, 1) alloys have been studied utilizing density function theory by WIEN2k code. The generalized gradient approximation (GGA), generalized gradient approximation plus Hubbard parameter (GGA + U), Modified Becke and Johnson (MBJ) and GGA Engel-vosko in the presence of spin orbit coupling have been used to investigate the topological band structure of Gd1-xYxAuPb alloys at zero pressure. The topological phase and band order of these alloys within GGA and GGA + U approaches under hydrostatic pressure are also investigated. We find that under hydrostatic pressure in some percentages of Gd1-xYxAuPb (x = 0, 0.25, 0.5, 0.75, 1) alloys in both GGA and GGA + U approaches, the trivial topological phase is converted into nontrivial topological phase. In addition, the band inversion strength versus lattice constant of these alloys is studied. Moreover, the schematic plan is represented in order to show the trivial and nontrivial topological phase of Gd1-xYxAuPb (x = 0, 0.25, 0.5, 0.75, 1) alloys in both GGA and GGA + U approaches.
NCBI nr-aa BLAST: CBRC-OLAT-09-0016 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-OLAT-09-0016 sp|P43141|ADB4C_MELGA Beta-4C adrenergic receptor (Beta-4C adreno...ceptor) (Beta-4C adrenoreceptor) gb|AAA62151.1| beta-4C-adrenergic receptor gb|AAA62150.1| adrenergic beta-4c receptor P43141 1e-107 51% ...
National Oceanic and Atmospheric Administration, Department of Commerce — Chemical, physical and profile oceanographic data were collected aboard the CAPE HATTERAS in the Gulf of Mexico from 2010-09-04 to 2010-09-15 in response to the...
National Oceanic and Atmospheric Administration, Department of Commerce — Chemical, physical and profile oceanographic data were collected aboard the RYAN CHOUEST in the Gulf of Mexico from 2010-09-04 to 2010-09-08 in response to the...
International Nuclear Information System (INIS)
Gómez, J A Mejía; Palacio, C A; García, G I Supelano; Vargas, C A Parra
2015-01-01
The production and the structural and magnetic characterization of the Bi 1-x Y x FeO 3 (x= 0, 0.25 and 0.3) system is reported in this work. The system was produced through the solid-state reaction technique. The morphological characterization obtained by scanning electron microscopy technique evidences the granular behavior. The structural properties were studied by means of X-ray diffraction technique. Magnetization measurements in function of temperature of the Bi 1-x Y x FeO 3 (x= 0, 0.25 and 0.3) system were performed with the magnetometer VSM by means of the Zero Field Cooled-Field Cooled method. The results obtained from all the techniques evidence the effect of yttrium on the physical properties of BiFeO 3 . (paper)
National Oceanic and Atmospheric Administration, Department of Commerce — Physical and profile oceanographic data were collected aboard the Brooks McCall in the Gulf of Mexico from 2010-09-02 to 2010-09-06 in response to the Deepwater...
Energy Technology Data Exchange (ETDEWEB)
Bandyopadhyay, S. [Department of Physics, The University of Burdwan, Golapbag, Burdwan, 713104, West Bengal (India); Dutta, H. [Department of Physics, Vivekananda College, Burdwan, 713103, West Bengal (India); Kar, T. [Department of Materials Science, Indian Association for the Cultivation of Science, Jadavpur, Kolkata, 700032, West Bengal (India); Pradhan, S.K., E-mail: skp_bu@yahoo.com [Department of Physics, The University of Burdwan, Golapbag, Burdwan, 713104, West Bengal (India)
2016-02-01
This article reports the synthesis and microstructure characterization of nanocrystalline Si{sub 0.9}Al{sub 0.1}C powder obtained by mechanical milling the mixture of Si, Al and graphite powders at room temperature under inert atmosphere. XRD patterns of ball-milled powders clearly reveal the nucleation of Si{sub 0.9}Al{sub 0.1}C phase after 5 h of milling and the stoichiometric cubic Si{sub 0.9}Al{sub 0.1}C is formed after 10 h of milling with crystallite size of ∼3 nm. Microstructure of ball-milled powders in terms of different lattice imperfections is characterized by employing both Rietveld's method of structure refinement using XRD data and high resolution transmission electron microscope (HRTEM). HRTEM micrographs of 10 h milled powder substantiate the formation of nanocrystalline Si{sub 0.9}Al{sub 0.1}C compound without any contamination and confirm the findings of Rietveld analysis using XRD data. - Highlights: • Cubic Si{sub 0.9}Al{sub 0.1}C is formed after 5 h of milling of Si, Al and graphite powders. • Nanocrystalline Si{sub 0.9}Al{sub 0.1}C with particle size ∼3 nm is obtained after 10 h milling. • Average particle size of Si{sub 0.9}Al{sub 0.1}C from XRD analysis and HRTEM is very close.
Perovskite-based heterostructures integrating ferromagnetic-insulating La0.1Bi0.9MnO3
Gajek, M.; Bibes, M.; Barthélémy, A.; Varela, M.; Fontcuberta, J.
2005-05-01
We report on the growth of thin films and heterostructures of the ferromagnetic-insulating perovskite La0.1Bi0.9MnO3. We show that the La0.1Bi0.9MnO3 perovskite grows single phased, epitaxially, and with a single out-of-plane orientation either on SrTiO3 substrates or onto strained La2/3Sr1/3MnO3 and SrRuO3 ferromagnetic-metallic buffer layers. We discuss the magnetic properties of the La0.1Bi0.9MnO3 films and heterostructures in view of their possible potential as magnetoelectric or spin-dependent tunneling devices.
NCBI nr-aa BLAST: CBRC-PABE-09-0018 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-PABE-09-0018 ref|NP_005276.2| G protein-coupled receptor 7 [Homo sapiens] gb|AAH69117.1| Neuropeptides... B/W receptor 1 [Homo sapiens] gb|AAI07102.1| Neuropeptides B/W receptor 1 [Homo sap...iens] gb|EAW86722.1| neuropeptides B/W receptor 1 [Homo sapiens] NP_005276.2 0.0 100% ...
National Oceanic and Atmospheric Administration, Department of Commerce — Imagery, laboratory analysis and sediment analysis oceanographic data were collected aboard the GYRE in the Gulf of Mexico from 2010-09-13 to 2010-09-16 in response...
Energy Technology Data Exchange (ETDEWEB)
Liu, Yuanfeng; Makongo, Julien P.A. [Laboratory for Emerging Energy and Electronic Materials, Department of Materials Science and Engineering, University of Michigan, Ann Arbor, MI 48109 (United States); Page, Alexander [Department of Physics, University of Michigan, Ann Arbor, MI 48109 (United States); Sahoo, Pranati [Laboratory for Emerging Energy and Electronic Materials, Department of Materials Science and Engineering, University of Michigan, Ann Arbor, MI 48109 (United States); Uher, Ctirad [Department of Physics, University of Michigan, Ann Arbor, MI 48109 (United States); Stokes, Kevin [The Advanced Materials Research Institute, Department of Physics, University of New Orleans, New Orleans, LA 70148 (United States); Poudeu, Pierre F.P., E-mail: ppoudeup@umich.edu [Laboratory for Emerging Energy and Electronic Materials, Department of Materials Science and Engineering, University of Michigan, Ann Arbor, MI 48109 (United States)
2016-02-15
Energy filtering of charge carriers in a semiconducting matrix using atomically coherent nanostructures can lead to a significant improvement of the thermoelectric figure of merit of the resulting composite. In this work, several half-Heusler/full-Heusler (HH/FH) nanocomposites with general compositions Zr{sub 0.25}Hf{sub 0.75}Ni{sub 1+x}Sn{sub 1−y}Sb{sub y} (0≤x≤0.15 and y=0.005, 0.01 and 0.025) were synthesized in order to investigate the behavior of extrinsic carriers at the HH/FH interfaces. Electronic transport data showed that energy filtering of carriers at the HH/FH interfaces in Zr{sub 0.25}Hf{sub 0.75}Ni{sub 1+x}Sn{sub 1−y}Sb{sub y} samples strongly depends on the doping level (y value) as well as the energy levels occupied by impurity states in the samples. For example, it was found that carrier filtering at HH/FH interfaces is negligible in Zr{sub 0.25}Hf{sub 0.75}Ni{sub 1+x}Sn{sub 1−y}Sb{sub y} (y=0.01 and 0.025) composites where donor states originating from Sb dopant dominate electronic conduction. However, we observed a drastic decrease in the effective carrier density upon introduction of HH/FH interfaces for the mechanically alloyed Zr{sub 0.25}Hf{sub 0.75}Ni{sub 1+x}Sn{sub 0.995}Sb{sub 0.005} samples where donor states from unintentional Fe impurities contribute the largest fraction of conduction electrons. This work demonstrates the ability to synergistically integrate the concepts of doping and energy filtering through nanostructuring for the optimization of electronic transport in semiconductors. - Graphical abstract: Electronic transport in semiconducting half-Heusler (HH) matrices containing full-Heusler (FH) nanoinclusions strongly depends on the energy distribution of impurity states within the HH matrix with respect to the magnitude of the potential energy barrier at the HH/FH interfaces. - Highlights: • Coherent nanostructures enhanced thermoelectric behavior of half-Heusler alloys. • Nanostructures act as energy filter of
Cephradine as corrosion inhibitor for copper in 0.9% NaCl solution
Tasić, Žaklina Z.; Petrović Mihajlović, Marija B.; Radovanović, Milan B.; Simonović, Ana T.; Antonijević, Milan M.
2018-05-01
The effect of (6R,7R)-7-[[(2R)-2-amino-2-cyclohexa-1,4-dien-1-ylacetyl]amino]-3-methyl-8-oxo-5-thia-1-azobicyclo[4.2.0]oct-2-ene-2-carboxylic acid (cephradine) on corrosion behavior of copper in 0.9% NaCl solution was investigated. The electrochemical methods including the open circuit potential measurements, potentiodynamic polarization and electrochemical impedance spectroscopy measurements, scanning electron microscopy with energy dispersive X-ray spectroscopy and quantum chemical calculations were used for this investigation. According to the results obtained by potentiodynamic polarization, cephradine acts as mixed type inhibitor. Also, the results obtained by electrochemical impedance spectroscopy indicate that cephradine provides good copper protection in 0.9% NaCl solution. The inhibition efficiency of cephradine increases with increasing its concentration. The scanning electron microscopy with energy dispersive X-ray spectroscopy confirms that a protective layer is formed on the copper surface due to the adsorption of cephradine on the active sites on the copper surface. Adsorption of cephradine in 0.9% NaCl solution follows the Langmuir adsorption isotherm. Quantum chemical calculations are in agreement with results obtained by electrochemical measurements.
Structural and magnetic properties of (Co1-xNix)Cr2O4 (x = 0.5, 0.25) nanoparticles
Mohanty, P.; Prinsloo, A. R. E.; Doyle, B. P.; Carleschi, E.; Sheppard, C. J.
2018-05-01
Nanoparticles of (Co1-xNix)Cr2O4, with x = 0.5 and 0.25, were prepared utilizing the sol-gel technique, in order to investigate the effect of Ni substitution at the Co site. The crystal structure of the prepared samples was identified using X-ray diffraction. Transmission electron microscopy images indicate a non-uniform distribution in particle sizes. Temperature dependent magnetization measurements as a function of probing field demonstrate different magnetic transition temperatures to that of both the parent compounds. The magnetization as a function of applied magnetic field shows a wasp-waist like feature for (Co0.5Ni0.5)Cr2O4 nanoparticles measured at 10 K, which is absent in both NiCr2O4 and CoCr2O4. This feature diminished for other measurement temperatures below the Curie temperature and was also absent at all temperatures for the (Co0.75Ni0.25)Cr2O4 nanoparticles. X-ray photoemission spectroscopy results show that the Ni cations prefers the 3+ and Co the 2+ oxidation states, while that of Cr was found to be 3+. However, mixed oxidation states were observed for Ni and Co in both samples, which can influence the magnetic properties.
International Nuclear Information System (INIS)
Makongo, Julien P.A.; Misra, Dinesh K.; Salvador, James R.; Takas, Nathan J.; Wang, Guoyu; Shabetai, Michael R.; Pant, Aditya; Paudel, Pravin; Uher, Ctirad; Stokes, Kevin L.; Poudeu, Pierre F.P.
2011-01-01
Bulk Zr 0.25 Hf 075 NiSn half-Heusler (HH) nanocomposites containing various mole fractions of full-Heusler (FH) inclusions were prepared by solid state reaction of pre-synthesized HH alloy with elemental Ni at 1073 K. The microstructures of spark plasma sintered specimens of the HH/FH nanocomposites were investigated using transmission electron microscopy and their thermoelectric properties were measured from 300 K to 775 K. The formation of coherent FH inclusions into the HH matrix arises from solid-state Ni diffusion into vacant sites of the HH structure. HH(1-y)/FH(y) composites with mole fraction of FH inclusions below the percolation threshold, y∼0.2, show increased electrical conductivity, reduced Seebeck coefficient and increased total thermal conductivity arising from gradual increase in the carrier concentration for composites. A drastic reduction (∼55%) in κ l was observed for the composite with y=0.6 and is attributed to enhanced phonon scattering due to mass fluctuations between FH and HH, and high density of HH/FH interfaces. - Graphical abstract: Large reduction in the lattice thermal conductivity of bulk nanostructured half-Heusler/full-Heusler (Zr 0.25 Hf 075 NiSn/ Zr 0.25 Hf 075 Ni 2 Sn) composites, obtained by solid-state diffusion at 1073 K of elemental Ni into vacant sites of the half-Heusler structure, arising from the formation of regions of spinodally decomposed HH and FH phases with a spatial composition modulation of ∼2 nm. Highlights: → Bulk composites from solid state transformation of half-Heusler matrix through Ni diffusion. → Formation of coherent phase boundaries between half-Heusler matrix and full-Heusler inclusion. → Alteration of thermal and electronic transports with increasing full-Heusler inclusion. → Enhanced phonon scattering at half-Heusler/ full-Heusler phase boundaries.
Directory of Open Access Journals (Sweden)
Xinya Xu
2017-02-01
Full Text Available Four new compounds (1–4, including two brevianamides and two mycochromenic acid derivatives along with six known compounds were isolated from the deep-sea-derived fungus Penicillium brevicompactum DFFSCS025. Their structures were elucidated by spectroscopic analysis. Moreover, the absolute configurations of 1 and 2 were determined by quantum chemical calculations of the electronic circular dichroism (ECD spectra. Compound 9 showed moderate cytotoxicity against human colon cancer HCT116 cell line with IC50 value of 15.6 μM. In addition, 3 and 5 had significant antifouling activity against Bugula neritina larval settlement with EC50 values of 13.7 and 22.6 μM, respectively. The NMR data of 6, 8, and 9 were assigned for the first time.
Energy Technology Data Exchange (ETDEWEB)
Rani, Anita [Guru Nanak College for Girls, Sri Muktsar Sahib Punjab-152026 (India); Kaur, Kulwinder; Kumar, Ranjan [Department of Physics, Panjab University Chandigarh-160014 (India); Dhiman, Shobna [Department of Applied Science, PEC, University of Technology, Chandigarh-160011 (India)
2016-05-23
In this paper we present the results obtained from first principle calculations of the effect of hydrostatic pressure on the structural and electronic properties of Cd{sub 1-x}Cr{sub x}S diluted magnetic semiconductor in Zinc Blende (B3) phase at x=0.25. High pressure behavior of Cd{sub 1-x}Cr{sub x}S has been investigated between 0 GPa to 100 GPa The calculations have been performed using Density functional theory as implemented in the Spanish Initiative for Electronic Simulations with Thousands of Atoms code using local density approximation as exchange-correlation (XC) potential. Calculated electronic band structures of Cd{sub 1-x}Cr{sub x}S are discussed in terms of contribution of Cr 3d{sup 5} 4s{sup 1}, Cd 4d{sup 10} 5s{sup 2}, S 3s{sup 2} 3p{sup 4} orbital’s. Study of band structures shows half-metallic ferromagnetic nature of Cd{sub 0.75}Cr{sub 0.25}S with 100% spin polarization. Under application of external pressure, the valence band and conduction band are shifted upward which leads to modification of electronic structure.
National Oceanic and Atmospheric Administration, Department of Commerce — Chemical, physical, profile and laboratory analysis oceanographic data were collected aboard the OCEAN VERITAS in the Gulf of Mexico from 2010-09-11 to 2010-09-13 in...
National Oceanic and Atmospheric Administration, Department of Commerce — Chemical, physical, profile and laboratory analysis oceanographic data were collected aboard the OCEAN VERITAS in the Gulf of Mexico from 2010-09-03 to 2010-09-07 in...
National Oceanic and Atmospheric Administration, Department of Commerce — Chemical, physical, profile and laboratory analysis oceanographic data were collected aboard the RYAN CHOUEST in the Gulf of Mexico from 2010-09-15 to 2010-09-22 in...
National Oceanic and Atmospheric Administration, Department of Commerce — Chemical, physical, profile and laboratory analysis oceanographic data were collected aboard the RYAN CHOUEST in the Gulf of Mexico from 2010-09-23 to 2010-09-28 in...
Abdelhamid, Bassant Mohamed; Omar, Heba
2018-05-28
Prolonged postoperative analgesia with early motor recovery for early rehabilitation is a challenge in regional block. The purpose of this study is to evaluate the effect of adding 20 mg nalbuphine to 25 ml of 0.25% levobupivacaine in supraclavicular brachial plexus block. One hundred thirty-five (135) patients scheduled for hand and forearm surgeries with supraclavicular block were randomly allocated into three equal groups. Group L received 25 ml of 0.5% levobupivacaine + 1 ml normal saline; group H received 25 ml of 0.25% levobupivacaine + 1 ml normal saline; and group N received 25 ml of 0.25% levobupivacaine + 1 ml (20 mg) nalbuphine. Onset time and duration of sensory and motor block, and time to first analgesic dose were recorded. Sensory block onset was comparable between the three groups. Motor block onset in group L and group N was comparable (13.16 ± 3.07 and 13.84 ± 3.05 min, respectively) and was shorter than that in group H (15.71 ± 2 0.91 min). Sensory block duration in group L and group N was comparable (522.22 ± 69.57 and 533.78 ± 66.03 min, respectively) and was longer than that in group H (342.67 ± 92.80 min). Motor block duration in group N and group H was comparable (272.00 ± 59.45 and 249.78 ± 66.01 min, respectively) and was shorter than that in group L (334.67 ± 57.90 min). Time to first analgesic dose was significantly longer in group N (649.78 ± 114.76 min) than that of group L and group H (575.56 ± 96.85 and 375.56 ± 84.49 min, respectively) and longer in group L when compared to group H. Adding 20 mg nalbuphine to 25 ml of 0.25% levobupivacaine in supraclavicular block provided prolonged duration of sensory block with similar duration of motor block.
International Nuclear Information System (INIS)
Santhosh, P. N.; Goldberger, J.; Woodward, P. M.; Vogt, T.; Lee, W. P.; Epstein, A. J.
2000-01-01
Phase transitions on the electron-doped side of the Ca 1-x Bi x MnO 3 system (x≤0.25) have been investigated using high-resolution synchrotron x-ray and neutron powder-diffraction techniques, electrical transport and magnetic susceptibility measurements. At room temperature all samples investigated were single phase, paramagnetic conductors (ρ 3 (space group Pnma). The Mn-O-Mn angles remain nearly constant from x=0 to x=0.25, while the Mn-O distances steadily increase with the Mn 3+ content. Three distinct phases are observed at 25 K. The first one, observed from 0.15≥x≥0.03, is characterized by the absence of charge and orbital ordering, a canted G-type antiferromagnetic spin structure, and delocalized electron transport. The second phase, observed from 0.25≥x≥0.12 (single phase at x=0.18), is characterized by pronounced orbital ordering, a C-type antiferromagnetic spin structure, and insulating behavior. The third low-temperature phase, observed for x≥0.20, is characterized by orbital and magnetic ordering similar to the Wigner crystal structure previously observed for Ca 0.67 La 0.33 MnO 3 , but with a 4axbx2c unit cell. The most striking feature of the phase diagram is the wide compositional range over which low-temperature phase separation is observed. Only those samples with x<0.12 and x=0.18 did not undergo phase separation upon cooling. We show that this behavior cannot be attributed to compositional variations, and therefore, propose that anisotropic strain interactions between crystallites may be partially responsible for this behavior
Energy Technology Data Exchange (ETDEWEB)
NONE
2009-07-01
Book of Abstracts contains short descriptions of presentations 3 lectures and 105 posters presented during ChemSession'09 - 6{sup th} Warsaw Seminar of the PhD Students in Chemistry. Several posters were devoted to the radiochemistry, radiochemical analysis, radiation chemistry and radiobiology. Some posters on the material science dealing with materials important to nuclear sciences can be also found.
76 FR 41501 - Notice of Intent To Award Affordable Care Act (ACA) Funding, EH09-907
2011-07-14
... network expansion and enhancement. Funding is appropriated under the Affordable Care Act (Pub. L. 111-148... Intent To Award Affordable Care Act (ACA) Funding, EH09-907 AGENCY: Centers for Disease Control and... in their FY 2011 applications submitted under funding opportunity EH09-907, ``National Environmental...
Superconducting nanowire single photon detectors fabricated from an amorphous Mo0.75Ge0.25 thin film
International Nuclear Information System (INIS)
Verma, V. B.; Lita, A. E.; Vissers, M. R.; Marsili, F.; Pappas, D. P.; Mirin, R. P.; Nam, S. W.
2014-01-01
We present the characteristics of superconducting nanowire single photon detectors (SNSPDs) fabricated from amorphous Mo 0.75 Ge 0.25 thin-films. Fabricated devices show a saturation of the internal detection efficiency at temperatures below 1 K, with system dark count rates below 500 cps. Operation in a closed-cycle cryocooler at 2.5 K is possible with system detection efficiencies exceeding 20% for SNSPDs which have not been optimized for high detection efficiency. Jitter is observed to vary between 69 ps at 250 mK and 187 ps at 2.5 K using room temperature amplifiers.
Energy Technology Data Exchange (ETDEWEB)
Li Rong [Nano-science and Nano-technology Research Center, School of Materials Science and Engineering, Shanghai University, Shanghai 200444 (China); UCCS: Unite de Catalyse et de Chimie du Solide - UMR CNRS 8181, ENSCL, Batiment C7, BP 90108, 59652 Villeneuve d' Ascq Cedex (France); Zhen Qiang, E-mail: zhenqiang@263.ne [Nano-science and Nano-technology Research Center, School of Materials Science and Engineering, Shanghai University, Shanghai 200444 (China); Drache, Michel; Rubbens, Annick; Vannier, Rose-Noelle [UCCS: Unite de Catalyse et de Chimie du Solide - UMR CNRS 8181, ENSCL, Batiment C7, BP 90108, 59652 Villeneuve d' Ascq Cedex (France)
2010-04-02
(Bi{sub 2}O{sub 3}){sub 0.75}(Dy{sub 2}O{sub 3}){sub 0.25} nanopowder was prepared by reverse chemical titration co-precipitation method. The reaction mechanism during the precipitation process was discussed by thermodynamic analysis. Thermal decomposition behavior of the precursor was investigated using X-ray diffractometry and TG-MS analysis. The precursor was calcined at 500 {sup o}C for 3 h to obtain (Bi{sub 2}O{sub 3}){sub 0.75}(Dy{sub 2}O{sub 3}){sub 0.25} nanopowder. Using the nanopowder, pellets with relative density higher than 94% were obtained at 700 {sup o}C for 2 h by pressureless sintering, and the grains remained at the nano-scale with size of 72 nm.
Energy Technology Data Exchange (ETDEWEB)
Huang, Bo; Wang, S.R.; Liu, R.Z.; Ye, X.F.; Nie, H.W.; Sun, X.F.; Wen, T.L. [Shanghai Institute of Ceramics, Chinese Academy of Sciences (SICCAS), 1295 Dingxi Road, Shanghai 200050 (China)
2007-05-01
Perovskite-structure La{sub 0.75}Sr{sub 0.25}Cr{sub 0.5}Mn{sub 0.5}O{sub 3-{delta}} (LSCM) powders were prepared using a simple combustion process. Thermal analysis was carried out on the perovskite precursor to investigate the oxide-phase formation. The structural phase of the powders was determined by X-ray diffraction. These results showed that the decomposition of the precursors occurs in a two-step reaction and temperatures higher than 1100 C are required for these decomposition reactions. For the electrochemical characterization, LSCM anode materials and (Pr{sub 0.7}Ca{sub 0.3}){sub 0.9}MnO{sub 3} (PCM) cathode materials were screen-printed on two sides of dense La{sub 0.8}Sr{sub 0.2}Ga{sub 0.8}Mg{sub 0.2}O{sub 3} (LSGM) electrolyte layers prepared by tape casting with a thickness of about 600 {mu}m, respectively. The morphology of the screen-printed La{sub 0.75}Sr{sub 0.25}Cr{sub 0.5}Mn{sub 0.5}O{sub 3-{delta}} perovskite thick films (65 {mu}m) was investigated by field emission scanning electron microscope and showed a porous microstructure. In addition, fuel cell tests were carried out using humidified hydrogen or ethanol stream as fuel and oxygen as oxidant. The performance of the conventional electrolyte-supported cell LSCM/LSGM/PCM while operating on humidified hydrogen was modest with a maximum power density of 165, 99 and 62 mW cm{sup -2} at 850, 800 and 750 C, respectively, the corresponding values for the cell while operating on ethanol stream was 160, 101 and 58 mW cm{sup -2}, respectively. Cell stability tests indicate no significant degradation in performance has been observed after 60 h of cell testing when LSCM anode was exposed to ethanol steam at 750 C, suggesting that carbon deposition was limited during cell operation. (author)
A 0.9-V 12-bit 40-MSPS Pipeline ADC for Wireless Receivers
Ito, Tomohiko; Itakura, Tetsuro
A 0.9-V 12-bit 40-MSPS pipeline ADC with I/Q amplifier sharing technique is presented for wireless receivers. To achieve high linearity even at 0.9-V supply, the clock signals to sampling switches are boosted over 0.9V in conversion stages. The clock-boosting circuit for lifting these clocks is shared between I-ch ADC and Q-ch ADC, reducing the area penalty. Low supply voltage narrows the available output range of the operational amplifier. A pseudo-differential (PD) amplifier with two-gain-stage common-mode feedback (CMFB) is proposed in views of its wide output range and power efficiency. This ADC is fabricated in 90-nm CMOS technology. At 40MS/s, the measured SNDR is 59.3dB and the corresponding effective number of bits (ENOB) is 9.6. Until Nyquist frequency, the ENOB is kept over 9.3. The ADC dissipates 17.3mW/ch, whose performances are suitable for ADCs for mobile wireless systems such as WLAN/WiMAX.
Directory of Open Access Journals (Sweden)
Alireza Kamali
2016-11-01
Full Text Available Pain is a complex medical problem that its inadequate postoperative control has adverse effects on patients’ physiological, metabolic and mental status. Adding new supplements will lead to an increased duration of analgesia. The purpose of this study was to compare the addition of neostigmine and ketamine to bupivacaine 0.25% for epidural analgesia increasing duration of postoperative analgesia. In this double blind clinical trial, 90 patients over 50 years candidated for elective hip surgery with ASA class I, II were randomly divided to three groups: neostigmine, ketamine and control groups. All patients received epidural with bupivacaine 0.25% by 2cc/segment. Furthermore, 60 micrograms neostigmine was added in first group and 40 mg ketamine was used for group II. Level of postoperative pain based on VAS and duration of analgesia and amount of analgesic was determined and compared across the three groups. The mean of pain score at 6 and 12 hours after surgery was significantly lower in the ketamine group than the other groups and in neostigmine group was less than placebo (P ≤ 0.01. The mean of duration of postoperative analgesia in the ketamine group was significantly higher than the other groups and in neostigmine group was more than placebo (P ≤ 0.01. The mean dose of analgesic (pethedin was the least in the ketamine group (P ≤ 0.001. Neostigmine and ketamine with bupivacaine 0.25% for epidural anesthesia increased the duration of analgesia during the postoperative period and reduced analgesic consumption that about ketamine was more than neostigmine.
Effect of beam condition in variable-shaped electron-beam direct writing for 0.25 μm and below
International Nuclear Information System (INIS)
Hirasawa, S.; Nakajima, K.; Tamura, T.; Aizaki, N.
1993-01-01
The effect of incident electron-beam conditions, which are acceleration voltage and beam blur of variable-shaped electron-beam direct writing, is investigated using the deposited energy distribution to realize a fine pattern of ≤0.25 μm in trilayer resist process. The deposited energy distribution is calculated using a three-dimensional Monte Carlo method. In a trilayer resist system, a thin bottom resist layer can be used, because the contrast value derived from the Monte Carlo calculation is independent of the bottom layer thickness. The beam blur of 0.05 μm does not degrade 0.25 μm line-and-space (L/S) patterns, but seriously degrades 0.1 μm L/S patterns. Higher acceleration voltage is effective for improving the contrast. At lower acceleration voltage, the slope of the deposited energy profile defined at the resist bottom is mainly influenced by electron scattering. On the other hand, at higher acceleration voltage, the slope of deposited energy profile mainly depends on the beam blur. The 0.1 μm L/S patterns are expected to be resolved at 30 kV when there is less than 0.02 μm beam blur with trilayer resist system. The possibility of using a single layer resist process for 0.1 μm L/S pattern will be barely realized at the conditions of 50 kV and 0.02 μm beam blur
2008-09 National Rivers and Streams Assessment Fish Tissue Data Dictionary
The Office of Science and Technology (OST) is providing the fish tissue results from the 2008-09 National Rivers and Streams Assessment (NRSA). This document includes the “data dictionary” for Mercury, Selenium, PBDEs, PCBs, Pesticides and PFCs.
Design and fabrication of a 025 mum Rad-Hard ASIC for ALICE ITS data acquisition system
Falchieri, D; Gandolfi, E
2003-01-01
This paper explains the design and the realization of a digital Rad- Hard chip. The design is a part of the Large Hadron Collider (LHC), A Large Ion Collider Experiment (ALICE) at CERN. The chip has been designed in VHDL-Verilog language and implemented in 0.25 mum CMOS 3- metal Rad-Hard CERN library. It is composed of 10 kgates, 84 I/O pads out of the 100 total pads, it is clocked at 40MHz, it is pad-limited and the whole die area is 4 multiplied by 4mm **2. The chip has been tested over 20 packaged samples and it has been proved that 12 out of 20 chips work well.
Secular changes in intakes of foods among New Zealand adults from 1997 to 2008/09.
Smith, Claire; Gray, Andrew R; Mainvil, Louise A; Fleming, Elizabeth A; Parnell, Winsome R
2015-12-01
To examine changes in the food choices of New Zealand (NZ) adults, between the 1997 National Nutrition Survey (NNS97) and the 2008/09 NZ Adult Nutrition Survey (2008/09 NZANS). The 2008/09 NZANS and the NNS97 were cross-sectional surveys of NZ adults (aged 15 years and over). Dietary intake data were collected using a computer-based 24 h diet recall. Logistic regression models were used to examine changes over time in the percentage reporting each food group, with survey year, sex and age group (19-30 years, 31-50 years, 51-70 years, ≥71 years) as the variables. NZ households. Adults aged 19 years and over (NNS97, n 4339; 2008/09 NZANS, n 3995). In the 2008/09 NZANS compared with NNS97, males and females were less likely to report consuming bread, potatoes, beef, vegetables, breakfast cereal, milk, cheese, butter, pies, biscuits, cakes and puddings, and sugar/confectionery (all Psnacks and snack bars (e.g., crisps, extruded snacks, muesli bars; P=0.007) and pasta and pasta dishes (P=0.017). Although food choices were associated with sex and age group, there were few differential changes between the surveys by sex or age group. For all age groups there was a shift in the percentage who reported consuming the traditional NZ foods, namely bread, beef, potatoes and vegetables, towards more rice and rice dishes. Declines in the consumption of butter, pies, biscuits, cakes and puddings are congruent with current dietary guidelines.
International Nuclear Information System (INIS)
Cheng Cuixia; Tan Long; Hu Anzheng; Liu Haowen; Huang Xintang
2010-01-01
Research highlights: → In this paper, for the first time, rheological phase method, a simple and effective route, was applied to synthesis high capacity cathode material LiNi 0.65 Co 0.25 Mn 0.1 O 2 . → All of the results obtained by X-ray diffraction spectrometer, X-ray photoelectron spectrometer, charge-discharge tests and electrochemical impedance spectroscopy show that the rheological phase production have better properties than that of the report. - Abstract: Rheological phase (RP) method has been successfully applied to synthesize a promising cathode material LiNi 0.65 Co 0.25 Mn 0.1 O 2 . X-ray diffraction, X-ray photoelectron spectroscopy, inductively coupled plasma and transmission electron microscope are used to investigate the structure, composition and morphology, respectively. XRD result shows that the as-prepared powder has a layered α-NaFeO 2 structure. XPS pattern reveals that the Ni ions have valences of 2+ and 3+, and the Co and Mn are 3+, 4+, respectively. The electrode consisting of the obtained powder presents the better electrochemical properties, which is attributed to the fewer amounts of Ni 2+ ions and the smaller particles. All the results suggest that the rheological phase method is a promising technique for the preparation of LiNi 0.65 Co 0.25 Mn 0.1 O 2 cathode material of lithium-ion batteries.
National Oceanic and Atmospheric Administration, Department of Commerce — Chemical, physical, profile and laboratory analysis oceanographic data were collected aboard the Brooks McCall in the Gulf of Mexico from 2010-09-07 to 2010-09-11 in...
National Oceanic and Atmospheric Administration, Department of Commerce — Chemical and physical oceanographic profile data were collected aboard the Wes Bordelon in the Gulf of Mexico from 2010-09-05 to 2010-09-13 in response to the...
National Oceanic and Atmospheric Administration, Department of Commerce — Chemical and physical oceanographic profile data were collected aboard the BUNNY BORDELON in the Gulf of Mexico from 2010-09-05 to 2010-09-13 in response to the...
National Oceanic and Atmospheric Administration, Department of Commerce — Chemical and physical oceanographic profile data were collected aboard the Rachel Bordelon in the Gulf of Mexico from 2010-09-04 to 2010-09-13 in response to the...
Dinga, J N; Gamua, S D; Titanji, V P K
2017-08-01
It has been shown that covalently linking two antigens could enhance the immunogenicity of the chimeric construct. To prioritize such a chimera for malaria vaccine development, it is necessary to demonstrate that naturally acquired antibodies against the chimera are associated with protection from malaria. Here, we probe the ability of a chimeric construct of UB05 and UB09 antigens (UB05-09) to better differentiate between acquired immune protection and susceptibility to malaria. In a cross-sectional study, recombinant UB05-09 chimera and the constituent antigens were used to probe for specific antibodies in the plasma from children and adults resident in a malaria-endemic zone, using the enzyme-linked immunosorbent assay (ELISA). Anti-UB05-09 antibody levels doubled that of its constituent antigens, UB09 and UB05, and this correlated with protection against malaria. The presence of enhanced UB05-09-specific antibody correlated with the absence of fever and parasitaemia, which are the main symptoms of malaria infection. The chimera is more effective in detecting and distinguishing acquired protective immunity against malaria than any of its constituents taken alone. Online B-cell epitope prediction tools confirmed the presence of B-cell epitopes in the study antigens. UB05-09 chimera is a marker of protective immunity against malaria that needs to be studied further. © 2017 John Wiley & Sons Ltd.
National Oceanic and Atmospheric Administration, Department of Commerce — Chemical and physical oceanographic profile data were collected aboard the JACK FITZ in the Gulf of Mexico from 2010-09-04 to 2010-09-12 in response to the Deepwater...
Solidification of Bi2Sr2Ca1Cu2Oy and Bi2Sr1.75Ca0.25CuOy
International Nuclear Information System (INIS)
Holesinger, T.G.; Miller, D.J.; Viswanathan, H.K.; Chumbley, L.S.
1993-01-01
The solidification processes for the compositions Bi 2 Sr 2 CaCu 2 O y (2212) and Bi 2 Sr 1.75 Ca 0.25 CuO y (2201) were determined as a function of oxygen partial pressure. During solidification in argon, the superconducting phases were generally not observed to form for either composition. In both cases, the solidus is lowered to approximately 750 degree C. Solidification of Bi 2 Sr 1.75 Ca 0.25 CuO y in Ar resulted in a divorced eutectic structure of Bi 2 Sr 2-x Ca x O y (22x) and Cu 2 O while solidification of Bi 2 Sr 2 CaCu 2 O y in Ar resulted in a divorced eutectic structure of Bi 2 Sr 3-x Ca x O y (23x) and Cu 2 O. Solidification of Bi 2 Sr 1.75 Ca 0.25 CuO y in O 2 resulted in large grains of 2201 interspersed with small regions containing the eutectic structure of 22x and CuO/Cu 2 O. Solidification of Bi 2 Sr 2 CaCu 2 O y in partial pressures of 1%, 20%, and 100% oxygen resulted in multiphase samples consisting of 2212, 2201, some alkaline-earth cuprates, and both divorced eutectic structures found during solidification in Ar. For both compositions, these latter structures can be attributed to oxygen deficiencies present in the melt regardless of the overpressure of oxygen. These eutectic structures are unstable and convert into the superconducting phases during subsequent anneals in oxygen. The formation process of the 2212 phase during solidification from the melt was determined to proceed through an intermediate state involving the 2201 phase
High School Longitudinal Study of 2009 (HSLS:09): Base-Year Data File Documentation. NCES 2011-328
Ingels, Steven J.; Pratt, Daniel J.; Herget, Deborah R.; Burns, Laura J.; Dever, Jill A.; Ottem, Randolph; Rogers, James E.; Jin, Ying; Leinwand, Steve
2011-01-01
The High School Longitudinal Study of 2009 (HSLS:09) is the fifth in a series of National Center for Education Statistics (NCES) secondary longitudinal studies. The core research questions for HSLS:09 explore secondary to postsecondary transition plans and the evolution of those plans; the paths into and out of science, technology, engineering,…
National Collegiate Athletic Association (NJ1), 2009
2009-01-01
This report marks the completion of the 2008-09 reporting cycle and the fourth year of the Division III Financial Aid Reporting Program. The report examines findings for all reporting institutions from each of the four reporting cycles, and details the outcomes of the Division III Financial Aid Committee's 2008-09 review process. Four calculations…
Spin-glass-like dynamics of ferromagnetic clusters in La0.75Ba0.25CoO3
International Nuclear Information System (INIS)
Kumar, Devendra
2014-01-01
We report a magnetization study of the compound La 0.75 Ba 0.25 CoO 3 where the Ba 2+ doping is just above the critical limit for percolation of ferromagnetic clusters. The field cooled and zero-field cooled (ZFC) magnetization exhibit thermomagnetic irreversibility and the ac susceptibility shows a frequency dependent peak at the ferromagnetic ordering temperature (T C ≈ 203 K) of the clusters. These features indicate the presence of a non-equilibrium state below T C . For the non-equilibrium state, the dynamic scaling of the imaginary part of the ac susceptibility and the static scaling of the nonlinear susceptibility clearly establish a spin-glass-like cooperative freezing of ferromagnetic clusters at 200.9(2) K. The assertion of the occurrence of spin-glass-like freezing of ferromagnetic clusters is further substantiated by ZFC ageing and memory experiments. We also observe certain dynamical features which are not present in a typical spin glass, such as: the initial magnetization after ZFC ageing first increases and then decreases with the waiting time; and there is an imperfect recovery of relaxation in negative temperature cycling experiments. This imperfect recovery transforms to perfect recovery for concurrent field cycling. Our analysis suggests that these additional dynamical features have their origin in the inter-cluster exchange interaction and cluster size distribution. The inter-cluster exchange interaction above the magnetic percolation level gives a superferromagnetic state in some granular thin films, but our results show the absence of a typical superferromagnetic-like state in La 0.75 Ba 0.25 CoO 3 . (paper)
International Nuclear Information System (INIS)
Lisesivdin, S B; Demirezen, S; Kasap, M; Ozcelik, S; Caliskan, M D; Ozbay, E; Yildiz, A
2008-01-01
Hall effect measurements on unintentionally doped Al 0.25 Ga 0.75 N/GaN/AlN heterostructures grown by metal organic chemical vapor deposition (MOCVD) were carried out as a function of temperature (20–300 K) and magnetic field (0–1.4 T). Magnetic-field-dependent Hall data are analyzed using the quantitative mobility spectrum analysis (QMSA) technique. The QMSA technique successfully separated electrons in the 2D electron gas (2DEG) at the Al 0.25 Ga 0.75 N/GaN interface from other 2D and 3D conduction mechanisms of the samples. 2DEG mobilities, carrier densities and conductivities of the investigated samples are compared at room temperature and low temperature (20 K). For a detailed investigation of the 2DEG-related growth parameters, the scattering analyses of the extracted 2DEG were carried out for all of the samples. Using the results of the scattering analyses, the relation between the growth and scattering parameters was investigated. Increments in the interface roughness (IFR) are reported with the increased GaN buffer growth temperatures. In addition, a linear relation between the deformation potential and interface roughness (IFR) scattering is pointed out for the investigated samples, which may lead to a better understanding of the mechanism of IFR scattering
International Nuclear Information System (INIS)
Su, Y.D.; Hu, C.Q.; Wen, M.; Wang, C.; Liu, D.S.; Zheng, W.T.
2009-01-01
We investigated the effects of both bias voltage and annealing on the structure and mechanical properties of WC 0.75 N 0.25 thin films, deposited on Si (1 0 0) substrates by a direct current reactive magnetron sputtering system, in which the negative substrate bias voltage (V b ) was varied from floating (-1.6 V) to -200 V, and the deposited films were annealed at 800 deg. C for 2 h. The X-ray photoelectron spectroscopy and selected area electron diffraction analyses, along with the density-functional theory (DFT) calculations on the electronic structure, showed that WC 0.75 N 0.25 films were a single-phase of carbonitrides. After annealing, a significant decrease in hardness for the films was observed, being a result of point-defect annihilation as V b was in the range of floating to -120 V. However, when V b was in the range of -160 to -200 V, the hardness increased from ∼37 GPa for the as-deposited film to a maximum of ∼43 GPa for the annealed one. This increase in hardness after annealing might be attributed to age-hardening.
National Oceanic and Atmospheric Administration, Department of Commerce — NODC Accession 0113914 includes chemical, discrete sample, physical and profile data collected from METEOR in the North Atlantic Ocean from 1997-08-15 to 1997-09-09...
National Oceanic and Atmospheric Administration, Department of Commerce — NODC Accession 0115700 includes chemical, discrete sample, physical and profile data collected from KNORR in the South Pacific Ocean from 1992-09-01 to 1992-09-15...
Hong Kong domestic health spending: financial years 1989/90 to 2008/09.
Tin, K Y K; Tsoi, P K O; Lee, Y H; Tsui, E L H; Lam, D W S; Chui, A W M; Lo, S V
2012-08-01
This report presents the latest estimates of Hong Kong domestic health spending for financial years 1989/90 to 2008/09, cross-stratified and categorised by financing source, provider and function. Total expenditure on health (TEH) was HK$84,391 million in financial year 2008/09, which represents an increase of HK$5030 million or 6.3% over the preceding year. Amid the financial tsunami in late 2008, TEH grew faster relative to gross domestic product (GDP) leading to a marked increase as a percentage of GDP from 4.8% in 2007/08 to 5.1% in 2008/09. During the period 1989/90 to 2008/09, TEH per capita (at constant 2009 prices) grew at an average annual rate of 4.9%, which was faster than that of per capita GDP by 2.0 percentage points. 6.4% when compared with 2007/08, reaching HK$41 257 million and HK$43 134 million, respectively. Consequently, public and private shares of total health expenditure remained the same in the 2 years at 48.9% and 51.1%, respectively. Regarding private spending, the most important source of health financing was out-of-pocket payments by households (35.4% of TEH), followed by employer-provided group medical benefits (7.5%) and private insurance (6.4%). During the period, a growing number of households (mostly in middle to high-income groups) subscribed to pre-payment plans for financing health care. As such, private insurance has taken on an increasingly important role for financing private spending. Of the HK$84 391 million total health expenditure in 2008/09, current expenditure comprised HK$81 186 million (96.2%), whereas HK$3206 million (3.8%) was for capital expenses (ie investment in medical facilities). Analysed by health care function, services for curative care accounted for the largest share of total health spending (66.1%), which was made up of ambulatory services (32.8%), in-patient curative care (28.8%), day patient hospital services (3.9%) and home care (0.5%). Notwithstanding the small share of total spending for day patient
Simulated use of premixed 0.25% isoflurane in 50% nitrous oxide and 50% oxygen.
Ross, J A; Tunstall, M E
2002-12-01
Isoflurane (0.25%) in premixed nitrous oxide and oxygen, 50/50, v/v (IN(2)O), has been suggested for pain relief in labour. Possible phase separation of the mixture was studied during simulated administration. A sinusoidal pump set at stroke volume of 2 litres and a rate of 20-22 bpm and cycling for 1 min in three was used to simulate breathing during the painful contractions of labour. The temperature inside a 10-litre capacity cylinder did not drecrease sufficiently to cause separation of the gas mixture. Temperature in the demand valve decreased to -15.5 degrees C and this caused a small amount of liquid formation within the valve. Accordingly, the inspired concentration during the first breath of mixture in a cycle could be transiently as high as 0.55%. The concentration observed at the patient connection after the first breath varied between 0.17 and 0.28%. The system delivered a clinically acceptable performance although further development to avoid liquid condensation is needed.
Saravana Kumar, P.; Balachandran, C.; Duraipandiyan, V.; Ramasamy, D.; Ignacimuthu, S.; Al-Dhabi, Naif Abdullah
2015-02-01
The application of microorganisms for the synthesis of nanoparticles as an eco-friendly and promising approach is welcome due to its non-toxicity and simplicity. The aim of this study was to synthesize silver nanoparticle using Streptomyces sp. (09 PBT 005). 09 PBT 005 was isolated from the soil sample of the agriculture field in Vengodu, Thiruvannamalai district, Tamil Nadu, India. 09 PBT 005 was subjected to molecular characterization by 16S rRNA sequence analysis. It was found that 09 PBT 005 belonged to Streptomyces sp. The isolate Streptomyces sp. 09 PBT 005 was inoculated in fermentation medium and incubated at 30 ºC for 12 days in different pH conditions. The 0.02 molar concentration showed good antibacterial activity against Gram-positive and Gram-negative bacteria at pH-7. The synthesis of silver nanoparticles was investigated by UV-Vis spectroscopy, scanning electron microscopy and Fourier Transform Infrared analysis. The synthesized AgNPs sizes were found to be in the dimensions ranging between 198 and 595 nm. The cytotoxicity of the synthesized nanoparticles was studied against A549 adenocarcinoma lung cancer cell line. It showed 83.23 % activity at 100 μl with IC 50 value of 50 μl. This method will be useful in the biosynthesis of nanoparticles.
First-principles study of electronic properties of Si doped FeSe{sub 0.9} alloys
Energy Technology Data Exchange (ETDEWEB)
Kumar, Sandeep, E-mail: sandeep@phy.iitb.ac.in; Singh, Prabhakar P. [Department of Physics, Indian Institute of Technology Bombay, Powai, Mumbai 400076 (India)
2016-05-23
We have performed first-principles study of electronic and superconducting properties of FeSe{sub 0.9-x}Si{sub x} (x = 0.0, 0.05) alloys using Korringa-Kohn-Rostoker Atomic Sphere Approximation within the coherent potential approximation (KKR-ASA-CPA). In our calculations, we used the local density approximation (LDA) for the exchange correlation potential. Our calculations show that these alloys are nonmagnetic in nature. We found that the substitution of Si at Se site into FeSe{sub 0.9} made subtle affects in the electronic structure with respect to the parent FeSe. The results have been analyzed in terms of changes in the density of states (DOS), band structures, Fermi surfaces and the superconducting transition temperature of FeSe{sub 0.9} and FeSe{sub 0.85}Si{sub 0.05} alloys.
45% power saving in a 0.25μm BiCMOS 10Gb/s 50Ω-terminated packaged active-load laser driver
DEFF Research Database (Denmark)
Ayranci, E.; Christensen, K.; Andreani, Pietro
2007-01-01
A 0.25μm BiCMOS laser driver based on active loads allows operation at 10Gb/s while drawing 5mA from a 1.8V supply. The design guarantees the correct matching of the driver outputs without the use of physical 50Ω load resistors. This enables a theoretical current consumption reduction of 50% (45...
International Nuclear Information System (INIS)
Tarburton, J.P.; Halpern, S.E.; Hagan, P.L.; Sudora, E.; Chen, A.; Fridman, D.M.; Pfaff, A.E.
1990-01-01
Studies were performed to determine in vitro and in vivo effects of acetylation on Fab' fragments of ZCE-025, a monoclonal anti-CEA antibody. Isoelectric focusing revealed a drop in isoelectric point of 1.7 pI units following acetylation. Biodistribution studies of acetylated and nonacetylated [111In]Fab' were performed in normal BALB/c mice and in nude mice bearing the T-380 CEA-producing human colon tumor. The acetylated fragments remained in the vascular compartment longer and had significantly diminished renal uptake of 111In compared to controls. While acetylation itself effected a 50% drop in immunoreactivity, tumor uptake of the acetylated and nonacetylated 111In-labeled Fab' fragments was comparable, with the exception of one data point, through 72 h
National Oceanic and Atmospheric Administration, Department of Commerce — Chemical and physical oceanographic profile data were collected aboard the Specialty Diver I in the Gulf of Mexico from 2010-09-10 to 2010-09-15 in response to the...
National Oceanic and Atmospheric Administration, Department of Commerce — Chemical and physical oceanographic profile data were collected aboard the Meg L. Skansi in the Gulf of Mexico from 2010-09-04 to 2010-09-13 in response to the...
Spin glass behavior in nanogranular La0.25Ca0.75MnO3 manganites
International Nuclear Information System (INIS)
2UB, Universitat de Barcelona, Martí i Franquès 1, planta 3, edifici nou, 08028 Barcelona (Spain))" data-affiliation=" (Grup de Magnetisme, Dept. Física Fonamental, Facultat de Física, Universitat de Barcelona, Martí i Franquès 1, planta 4, edifici nou, 08028 Barcelona (Spain); Institut de Nanociència i Nanotecnologia IN2UB, Universitat de Barcelona, Martí i Franquès 1, planta 3, edifici nou, 08028 Barcelona (Spain))" >Fernández-Martínez, Antoni; 2UB, Universitat de Barcelona, Martí i Franquès 1, planta 3, edifici nou, 08028 Barcelona (Spain))" data-affiliation=" (Grup de Magnetisme, Dept. Física Fonamental, Facultat de Física, Universitat de Barcelona, Martí i Franquès 1, planta 4, edifici nou, 08028 Barcelona (Spain); Institut de Nanociència i Nanotecnologia IN2UB, Universitat de Barcelona, Martí i Franquès 1, planta 3, edifici nou, 08028 Barcelona (Spain))" >García-Santiago, Antoni; 2UB, Universitat de Barcelona, Martí i Franquès 1, planta 3, edifici nou, 08028 Barcelona (Spain))" data-affiliation=" (Grup de Magnetisme, Dept. Física Fonamental, Facultat de Física, Universitat de Barcelona, Martí i Franquès 1, planta 4, edifici nou, 08028 Barcelona (Spain); Institut de Nanociència i Nanotecnologia IN2UB, Universitat de Barcelona, Martí i Franquès 1, planta 3, edifici nou, 08028 Barcelona (Spain))" >Hernàndez, Joan Manel; Zhang, Tao
2014-01-01
The magnetic properties of two nanogranular La 0.25 Ca 0.75 MnO 3 manganites with different average grain sizes have been studied. Besides the well-known exchange bias effect and the appearance of ferromagnetic clusters in the grains of both samples, the results show the occurrence of an antiferromagnetic transition and spin-glass properties. Both samples are described as core–shell magnetic systems, whose main difference is found in the interface between the outer ferromagnetic and the inner antiferromagnetic phases of the grains. - Highlights: • Nanogranular manganites show antiferromagnetism in magnetic measurements. • Exchange bias effect was observed in magnetic hysteresis cycles. • Spin-glass properties were detected at low temperatures. • A core-shell model was applied to describe the results in both samples. • These features have nothing to do with usual properties of nanoparticle manganites
Palanisamy, Manikandan; Kim, Hyun Woo; Heo, Seongwoo; Lee, Eungje; Kim, Youngsik
2017-03-29
Sodium-ion batteries are now close to replacing lithium-ion batteries because they provide superior alternative energy storage solutions that are in great demand, particularly for large-scale applications. To that end, the present study is focused on the properties of a new type of dual-electrode material, Na 0.5 Ni 0.25 Mn 0.75 O 2 , synthesized using a mixed hydroxy-carbonate route. Cyclic voltammetry confirms that redox couples, at high and low voltage ranges, are facilitated by the unique features and properties of this dual-electrode, through sodium ion deintercalation/intercalation into the layered Na 0.5 Ni 0.25 Mn 0.75 O 2 material. This material provides superior performance for Na-ion batteries, as evidenced by the fabricated sodium cell that yielded initial charge-discharge capacities of 125/218 mAh g -1 in the voltage range of 1.5-4.4 V at 0.5 C. At a low voltage range (1.5-2.6 V), the anode cell delivered discharge-charge capacities of 100/99 mAh g -1 with 99% capacity retention, which corresponds to highly reversible redox reaction of the Mn 4+/3+ reduction and the Mn 3+/4+ oxidation observed at 1.85 and 2.06 V, respectively. The symmetric Na-ion cell, fabricated using Na 0.5 Ni 0.25 Mn 0.75 O 2 , yielded initial charge-discharge capacities of 196/187 μAh at 107 μA. These results encourage the further development of new types of futuristic sodium-ion-battery-based energy storage systems.
Generation of KCL025 research grade human embryonic stem cell line carrying a mutation in NF1 gene
Directory of Open Access Journals (Sweden)
Heema Hewitson
2016-03-01
Full Text Available The KCL025 human embryonic stem cell line was derived from an embryo donated for research that carried an autosomal dominant mutation in the NF1 gene encoding neurofibromin (c.3739–3742 ΔTTTG. Mutations in this gene have been linked to neurofibromatosis type 1, juvenile myelomonocytic leukemia and Watson syndrome. The ICM was isolated using laser microsurgery and plated on γ-irradiated human foreskin fibroblasts. Both the derivation and cell line propagation were performed in an animal product-free environment. Pluripotent state and differentiation potential were confirmed by in vitro assays.
Piezoresistance of Silicon and Strained Si0.9Ge0.1
DEFF Research Database (Denmark)
Richter, Jacob; Hansen, Ole; Larsen, A. Nylandsted
2005-01-01
We present experimentally obtained results of the piezoresistive effect in p-type silicon and strained Si0.9Ge0.1. Today, strained Si1-xGex is used for high speed electronic devices. This paper investigates if this area of use can be expanded to also cover piezoresistive micro electro mechanical...... systems (MEMS) devices. The measurements are performed on microfabricated test chips where resistors are defined in layers grown by molecular beam epitaxy on (0 0 1) silicon substrates. A uniaxial stress along the [1 1 0] direction is applied to the chip, with the use of a four point bending fixture....... The investigation covers materials with doping levels of N-A = 10(18) cm(-3) and NA = 1019 cm(-3), respectively. The results show that the pi(66) piezoresistive coefficient in strained Si0.9Ge0.1 is approximately 30% larger than the comparable pi(44) piezoresistive coefficient in silicon at a doping level of N...
Oxygen permeation and stability of La 0.4Ca 0.6Fe 1-xCo xO 3-δ ( x = 0, 0.25, 0.5) membranes
Diethelm, S.; Van herle, J.; Middleton, P. H.; Favrat, D.
Three perovskite-type compounds of composition La 0.4Ca 0.6Fe 1- xCo xO 3- δ ( x=0, 0.25 and 0.5) were investigated for use as oxygen separation membranes for the partial oxidation (POX) of methane to syngas. Special attention was given to the question of their stability in real operating conditions. A permeation set-up was specially designed to measure oxygen fluxes through these materials when placed in a strong pO 2 gradient. It also facilitated testing the long-term stability of the specimen. Permeation measurements performed in an air/argon gradient between 800 and 1000 °C showed that the highest fluxes were obtained with the highest content of cobalt (La 0.4Ca 0.6Fe 0.5Co 0.5O 3- δ ≅ La 0.4Ca 0.6Fe 0.75Co 0.25O 3- δ > La 0.4Ca 0.6FeO 3- δ). In addition, comparison between the fluxes of samples of different thickness gave clear evidence of surface limitations in the oxygen transport. The long-term stability test showed opposite trends: only the two lowest Co containing compounds ( x=0 and 0.25) sustained an air/(Ar+H 2) gradient over more than 600 h. The other ( x=0.5) broke shortly after the introduction of H 2. In the presence of H 2, the oxygen flux was increased by a factor 10 compared to Ar and reached 0.83 μmol/cm 2 s for La 0.4Ca 0.6Fe 0.75Co 0.25O 3- δ at 900 °C. Post-operation SEM examination of the cross-section and both surfaces revealed that the surface exposed to H 2 had started to decompose resulting in the formation of a thin porous layer but the bulk of the material remained unchanged.
Altered response to A(H1N1)pnd09 vaccination in pregnant women
DEFF Research Database (Denmark)
Bischoff, Anne Louise; Følsgaard, Nilofar Vahman; Carson, Charlotte Giwercman
2013-01-01
BACKGROUND: Pregnant women were suspected to be at particular risk when H1N1pnd09 influenza became pandemic in 2009. Our primary objective was to compare the immune responses conferred by MF59®-adjuvanted vaccine (Focetria®) in H1N1pnd09-naïve pregnant and non-pregnant women. The secondary aims...... were to compare influences of dose and adjuvant on the immune response. METHODS: The study was nested in the Copenhagen Prospective Studies on Asthma in Childhood (COPSAC2010) pregnancy cohort in 2009-2010 and conducted as a single-blinded block-randomised [1∶1∶1] controlled clinical trial in pregnant...... women after gestational week 20: (1) 7.5 µg H1N1pnd09 antigen with MF59-adjuvant (Pa7.5 µg); (2) 3.75 µg antigen half MF59-adjuvanted (Pa3.75 µg); (3) 15 µg antigen unadjuvanted (P15 µg); and in non-pregnant women receiving (4) 7.5 µg antigen full adjuvanted (NPa7.5 µg). Blood samples were collected...
NCBI nr-aa BLAST: CBRC-PTRO-09-0020 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-PTRO-09-0020 ref|NP_000671.2| alpha-1A-adrenergic receptor isoform 1 [Homo sap...iens] sp|P35348|ADA1A_HUMAN Alpha-1A adrenergic receptor (Alpha 1A-adrenoceptor) (Alpha 1A-adrenoreceptor) (Alpha-1C adrenergic... receptor) (Alpha adrenergic receptor 1c) gb|AAB60353.1| adrenergic alpha-1c receptor pro...tein dbj|BAC05926.1| seven transmembrane helix receptor [Homo sapiens] gb|AAQ91331.1| adrenergic
Bismuth-doped La1.75Sr0.25NiO4+: δ as a novel cathode material for solid oxide fuel cells
Zhu, Zhesheng; Li, Mei; Xia, Changrong; Bouwmeester, Henny J.M.
2017-01-01
Bismuth has been doped into mixed ionic-electronic conducting La1.75Sr0.25NiO4+δ (LSN) with the 2D K2NiF4-type structure to evaluate its influence on various properties of the host material, which include its potential use as a SOFC cathode. X-ray powder diffraction indicates that LSN retains its
Paauwe, J J; Thomassen, B J; Weterings, J; van Rossum, E; Ausems, M E
2008-09-01
Femoral nerve blockade is recommended for analgesia following total knee arthroplasty. Following implementation of this type of postoperative analgesia in our hospital we found that active mobilization the day after surgery, may be difficult due to insufficient quadriceps muscle strength. We therefore designed a pilot study comparing the effect of ropivacaine 0.1%, 0.05% or 0.025% on the patient's postoperative rehabilitation and analgesia. Three groups of 12 patients received bolus doses of ropivacaine via their femoral nerve catheters for postoperative analgesia. The ability to actively mobilize, quadriceps muscle strength, pain VAS-scores and patient's satisfaction were measured during in the first three postoperative days. There were no significant differences in the patient's ability to actively mobilize and the pain VAS-scores. The overall satisfaction of the patients with the pain treatment was significantly better (p = 0.049) in the 0.1% compared with the 0.025% group. This pilot-study demonstrated no advantage associated with the use of a ropivacaine concentration less than 0.1%.
Diseño de una formulación de ketotifeno 0,025 % colirio
Directory of Open Access Journals (Sweden)
Yenilen Troche Concepción
Full Text Available El colirio de ketotifeno se indica para aliviar los signos y síntomas de las conjuntivitis alérgicas, por ser este un potente antihistamínico H1 que muestra cierta capacidad para inhibir la liberación de histamina y otros mediadores en mastocitos. El objetivo del presente trabajo consistió en realizar el desarrollo tecnológico del colirio de ketotifeno 0,025 %, de producción nacional teniendo en cuenta que es un medicamento muy utilizado en la "Operación Milagro", en la cual participa la República de Cuba, para lo que se hace un diseño y los estudios de preformulación. Se estudió además, las especificaciones de calidad de la formulación seleccionada, la estabilidad del producto y el tiempo de vigencia de este. Se realizó el estudio de estabilidad acelerado y por vida de estante, para lo cual se emplearon 3 lotes del producto a escala piloto. El colirio resultó estable física, química y microbiológicamente envasado en frascos de polietileno de baja densidad, por espacio de 12 meses a temperatura ambiente
Energy Technology Data Exchange (ETDEWEB)
Daivajna, Mamatha D. [Department of Physics, Manipal Institute of Technology, Manipal University, Manipal 576104 (India); Rao, Ashok, E-mail: ashokanu_rao@rediffmail.com [Department of Physics, Manipal Institute of Technology, Manipal University, Manipal 576104 (India); Lin, W.J. [Department of Physics, National Dong-Hwa University, Hualien 974, Taiwan (China); Kuo, Y.K., E-mail: ykkuo@mail.ndhu.edu.tw [Department of Physics, National Dong-Hwa University, Hualien 974, Taiwan (China)
2017-06-01
We have investigated the electrical and magnetic properties of Pr{sub 0.6-x}Bi{sub x}Sr{sub 0.4}MnO{sub 3} (x=0.20 and 0.25) manganites. XRD data shows that the synthesized samples are single-phase and crystallize in the orthorhombic structure with Pnma space group. Resistivity measurements show that the sample with x=0.25 exhibits a thermally activated behavior for the entire temperature range. The magnetoresistance (MR) for the x=0.25 sample is as high as nearly 100% over a wide range of temperature, demonstrating its important technological application as a material for MR-based devices. From the magnetization measurements, two magnetic transitions viz. paramagnetic insulating to ferromagnetic metallic (PMI-FMM) transition at T{sub C} and the ferromagnetic metallic (FMM) to antiferromagnetic insulating (AFI) transition at Neel temperature T{sub N} were observe in both samples. The Curie temperature decreases with bismuth doping, while T{sub N} increases with Bi content. Most interestingly, the temperature variation of magnetization and resistivity shows hysteresis behavior across the transition for the x=0.20 sample.
International Nuclear Information System (INIS)
Palcheva, R.; Olsbye, U.; Palcut, M.; Rauwel, P.; Tyuliev, G.; Velinov, N.; Fjellvåg, H.H.
2015-01-01
Graphical abstract: - Highlights: • Perovskites type-oxide La 0.75 Sr 0.25 (Fe 0.8 Co 0.2 ) 1−x Ga x O 3-δ (x = 0.1, 0.25, 0.4) prepared by the sol–gel citrate method. • Bulk and surface analysis to determine catalysts composition evolution. • Anaerobic catalytic partial oxidation of methane to syngas at 600 °C in a pulse apparatus over Rh promoted perovskites. • The catalysts showed high stability and selectivity. - Abstract: Synthesis gas production via selective oxidation of methane at 600 °C in a pulse reaction over La 0.75 Sr 0.25 (Fe 0.8 Co 0.2 ) 1−x Ga x O 3-δ (x = 0.1, 0.25, 0.4) perovskite-supported rhodium catalysts, was investigated. The perovskite oxides were prepared by sol–gel citrate method and characterized by X-ray Diffraction (XRD), Moessbauer Spectroscopy (MS), Temperature Programmed Reduction (TPR-H 2 ), X-ray Photoelectron Spectroscopy (XPS) and High Resolution Transmission Electron Microscopy (HRTEM). According to XRD analysis, the synthesized samples were a single perovskite phase. The perovskite structure of Ga substituted samples remained stable after TPR-H 2 , as confirmed by XRD. Data of MS identified Fe 3+ ions in two distinctive coordination environments, and Fe 4+ ions. The Rh 2 O 3 thin overlayer was detected by the HRTEM for the Rh impregnated perovskite oxides. During the interaction of methane with oxidized perovskite-supported Rh (0.5 wt.%) catalysts, besides CO, H 2 , and surface carbon, CO 2 and H 2 O were formed. The Rh perovskite catalyst with x = 0.25 gallium exhibits the highest catalytic activity of 83% at 600 °C. The CO selectivity was affected by the reducibility of La 0.75 Sr 0.25 (Fe 0.8 Co 0.2 ) 1−x Ga x O 3-δ perovskite materials.
International Nuclear Information System (INIS)
Demont, A.; Hebert, S.; Pelloquin, D.; Maignan, A.
2008-01-01
The second member of the Ruddlesden-Popper series, n=2 in Sr n+1 Co n O 3n+1 , has been stabilized by substituting cerium for strontium leading to the pure compound Sr 2.75 Ce 0.25 Co 2 O 7-δ . The oxygen vacancies of this phase can be partially filled by a post-annealing oxidizing treatment with δ decreasing from 1.1 to 0.3 for the as-prepared and oxidized phases, respectively. As the samples are oxidized from δ∼1.1 to 0.3, the a and b unit cell parameters decrease from 3.836 to 3.815 A and from 20.453 to 20.047 A, respectively. Despite the average value of the cobalt valence state, V Co ∼+3.5, obtained in the oxidized Sr 2.75 Ce +4 0.25 Co 2 O 6.7 phase, a clear ferromagnetic state wit T C =175 K and M S =0.8 μB/Co is reached. - Graphical abstract: Temperature dependence of the magnetic susceptibility of as-prepared and PO 2 annealing Sr 2.75 Ce 0.25 Co 2 O 7-δ RP2-type structures
Directory of Open Access Journals (Sweden)
Jack V Greiner
2011-01-01
Full Text Available Jack V Greiner1,2, Kimberly Edwards-Swanson3, Avner Ingerman41Schepens Eye Research Institute, Boston, MA; 2Department of Ophthalmology, Harvard Medical School, Boston, MA; 3Johnson & Johnson Consumer and Personal Products Worldwide, Skillman, NJ; 4Ora Inc, Andover, MA, USAPurpose: To evaluate the effectiveness of alcaftadine 0.05%, 0.1%, and 0.25% ophthalmic solutions in treating the signs and symptoms of allergic conjunctivitis when compared with olopatadine hydrochloride 0.1% and placebo using the conjunctival allergen challenge (CAC model.Methods: One hundred and seventy subjects were randomized and 164 subjects completed all visits. CAC was performed to determine and confirm subjects’ eligibility at visits 1 and 2, respectively. The CAC was repeated at visit 3 (day 0 ± 3, 16 hours after study medication instillation, and at visit 4 (day 14 ± 3, 15 minutes after instillation. Ocular itching and conjunctival redness were evaluated after an allergen challenge, along with several secondary endpoints.Results: Alcaftadine 0.25% and olopatadine 0.1% treatments exhibited significantly lower mean scores compared with placebo for ocular itching and conjunctival redness at visits 3 and 4. Most adverse events were self-limiting and mild in severity. No serious treatment-related adverse events occurred.Conclusion: Treatment with alcaftadine 0.25% ophthalmic solution resulted in mean differences of >1 unit (ocular itching and approximately >1 unit (conjunctival redness, which was significant (P < 0.001 compared with placebo treatment. All doses of alcaftadine were safe and well tolerated in the population studied.Keywords: alcaftadine, allergic conjunctivitis, conjunctival allergen challenge
Erdoğan Arı, Dilek; Yıldırım Ar, Arzu; Karadoğan, Firdevs; Özcabı, Yetkin; Koçoğlu, Ayşegül; Kılıç, Fatih; Akgün, Fatma Nur
2016-02-01
To evaluate the effectiveness of 0.125% bupivacaine compared to 0.25% bupivacaine for ultrasound-guided transversus abdominis plane (TAP) block in patients undergoing open inguinal hernia repair. Randomized, double-blind study. Educational and research hospital. Forty adult patients of American Society of Anesthesiologists physical status I-III undergoing elective primary unilateral open inguinal hernia repair under spinal anesthesia. Patients in group I received 20 mL of 0.25% bupivacaine, whereas patients in group II received 20 mL of 0.125% bupivacaine for TAP block at the end of the surgery. Pain intensity was assessed at rest and during coughing using 10-cm visual analog scale score at 5, 15, 30, and 45 minutes and 1, 2, 4, 6, 12, and 24 hours after TAP block. Morphine consumption and time to first morphine requirement were recorded. Visual analog scale scores at rest and during coughing were not significantly different between groups at all time points measured. Twenty-four hours of morphine consumption (7.72±7.33 mg in group I and 6.06±5.20 mg in group II; P=.437) and time to first morphine requirement (182.35±125.16 minutes in group I and 143.21±87.28 minutes in group II; P=.332) were not different between groups. 0.125% Bupivacaine provides similar analgesic effect compared to 0.25% bupivacaine for ultrasound-guided TAP block in patients undergoing open inguinal hernia repair. Copyright © 2016 Elsevier Inc. All rights reserved.
Synthesis, Magnetization, and Electrical Transport Properties of Mn3Zn0.9Cu0.1N
Directory of Open Access Journals (Sweden)
Y. Yin
2013-01-01
Full Text Available We synthesized Mn3Zn0.9Cu0.1N by solid state reaction, and magnetic as well as electrical transport properties were investigated. It is found that Mn3Zn0.9Cu0.1N exhibits a first-order antiferromagnetism (AFM to paramagnetic (PM transition with the Néel temperature TN ~163 K, and substitution of Cu for Zn would favor ferromagnetism (FM state and weaken AFM ground state, leading to a convex curvature character of M(T curve. With high external fields 10 kOe–50 kOe, magnetic transition remains a robust AFM-PM feature while FM phase is completely suppressed. Thermal hysteresis of M(T under 500 Oe is also suppressed when the magnetic field exceeds 10 kOe. Mn3Zn0.9Cu0.1N exhibits a good metallic behavior except for a slope change around TN, which is closely related to AFM-PM magnetic transition. Compared with the first differential of resistivity with respect to temperature for (dρ/dTMn3ZnN in transition temperature range, the absolute value of (dρ/dTMn3Zn0.9Cu0.1N is much lower which is close to zero.
Directory of Open Access Journals (Sweden)
Heidi G. Rodriguez-Ramirez
2014-01-01
Full Text Available In 2009, a new influenza A (H1N1 virus affected many persons around the world. There is an urgent need for finding biomarkers to distinguish between influenza A (H1N1pdm09 and seasonal influenza virus. We investigated these possible biomarkers in the lung of fatal cases of confirmed influenza A (H1N1pdm09. Cytokines (inflammatory and anti-inflammatory and cellular markers (macrophages and lymphocytes subpopulation markers were analyzed in lung tissue from both influenza A (H1N1pdm09 and seasonal influenza virus. High levels of IL-17, IFN-γ, and TNF-α positive cells were identical in lung tissue from the influenza A (H1N1pdm09 and seasonal cases when compared with healthy lung tissue (P<0.05. Increased IL-4+ cells, and CD4+ and CD14+ cells were also found in high levels in both influenza A (H1N1pdm09 and seasonal influenza virus (P<0.05. Low levels of CD206+ cells (marker of alternatively activated macrophages marker in lung were found in influenza A (H1N1pdm09 when compared with seasonal influenza virus (P<0.05, and the ratio of CD206/CD14+ cells was 2.5-fold higher in seasonal and noninfluenza group compared with influenza A (H1N1pdm09 (P<0.05. In conclusion, CD206+ cells differentiate between influenza A (H1N1pdm09 and seasonal influenza virus in lung tissue of fatal cases.
Peru : Country Program Evaluation for the World Bank Group, 2003-09
Independent Evaluation Group
2011-01-01
Since 2003, Peru has emerged as an open, rapidly growing economy. Over the review period of 2003-09, successive governments adopted policy platforms aimed at maintaining macroeconomic stability, furthering the private sector supply response, broadening participation in growth, improving social service delivery, and strengthening public institutions. The World Bank Group (WBG) supported each of ...
Emergence of influenza A (H1N1) PDM09 in the remote Islands of India--a molecular approach.
Muruganandam, N; Bhattacharya, D; Chaaithanya, I K; Bhattacharya, H; Reesu, R; Maile, A; Bharathi, G S J; Sugunan, A P; Vijayachari, P
2015-01-01
A disease outbreak of A (H1N1) PDM09 was reported in Andaman and Nicobar islands in 2009 with an attack rate of 33.5% among settler population and 26.3% among the aboriginal Nicobarese tribe. During the ongoing outbreak of A (H1N1) PDM09 disease in different parts of the world, a subject working in Dubai city of Saudi Arabia, came to Port Blair, following which the pandemic triggered for the first time in these Islands. During the period August 2009 to January 2011, 30 confirmed cases of Influenza A (H1N1) PDM09 virus infection was detected. To understand the genetic relationship, the NA gene sequences of the viruses were phylogenetically analysed together along with the virus sequence isolated from other parts of the world. Formation of multiple clusters were observed, with the sequences of Andaman Islands, mainland India, Mexico, Saudi Arabia and few other counties clustering together. The sequence analysis data revealed that there was no specific mutation conferring resistance to oseltamivir among the Andaman A (H1N1) PDM09 virus isolates. The result of phylogenetic analysis have also revealed that the A (H1N1) PDM09 virus might have spread in these remote Islands of India via the subject from Saudi Arabia/Dubai. A (H1N1) PDM09 Influenza outbreak have highlighted the need to strengthen the region-specific pandemic preparedness plans and surveillance strategies.
Hydrogen absorption-desorption properties of Ti0.32Cr0.43V0.25 alloy
International Nuclear Information System (INIS)
Cho, Sung-Wook; Shim, Gunchoo; Choi, Good-Sun; Park, Choong-Nyeon; Yoo, Jeong-Hyun; Choi, Jeon
2007-01-01
Ti 0.32 Cr 0.43 V 0.25 alloy specimens were heat treated, and its various hydrogen storage properties were measured at 303 K to examine its potential as a hydrogen storage material. The heat treatment improved not only the total and the effective hydrogen storage capacities, but also the plateau flatness. The heat of hydride formation was approximately -36 kJ/mol H 2 . The effective hydrogen storage capacity remained at approximately 2 wt% after 1000 cycles of pressure swing cyclic tests. The hydrogen storage capacity could be recovered almost to the initial state by reactivating the alloy. The hydrogen absorption rate increased with the repetition of cycling for the first several cycles and remained almost constant afterward. At the 504th cycle, more than 98% of the hydrogen was absorbed within the first 2 min. X-ray diffraction (XRD) patterns showed that the crystal structure of the alloy became more amorphous as the number of cycles increased
DEFF Research Database (Denmark)
Escudier, Bernard; Motzer, Robert J; Sharma, Padmanee
2017-01-01
BACKGROUND: Response patterns to nivolumab differ from those seen with other approved targeted therapies. OBJECTIVE: To investigate the efficacy of nivolumab in previously treated patients with advanced renal cell carcinoma who were treated beyond (Response Evaluation Criteria In Solid Tumors......) RECIST progression. DESIGN, SETTING, AND PARTICIPANTS: This was a subgroup analysis of patients treated with nivolumab in the phase 3 CheckMate 025 study. Patients continuing to tolerate therapy and exhibiting investigator-assessed clinical benefit were eligible to be treated beyond RECIST progression...... (TBP) and received therapy for ≥4 wk after first progression; patients not treated beyond RECIST progression (NTBP) received 0 wk to Nivolumab 3mg/kg intravenously every 2 wk. RESULTS AND LIMITATIONS: Of 406 nivolumab-treated patients, 316 (78...
Energy Technology Data Exchange (ETDEWEB)
Verma, V. B.; Lita, A. E.; Vissers, M. R.; Marsili, F.; Pappas, D. P.; Mirin, R. P.; Nam, S. W. [National Institute of Standards and Technology, 325 Broadway, Boulder, Colorado 80305 (United States)
2014-07-14
We present the characteristics of superconducting nanowire single photon detectors (SNSPDs) fabricated from amorphous Mo{sub 0.75}Ge{sub 0.25} thin-films. Fabricated devices show a saturation of the internal detection efficiency at temperatures below 1 K, with system dark count rates below 500 cps. Operation in a closed-cycle cryocooler at 2.5 K is possible with system detection efficiencies exceeding 20% for SNSPDs which have not been optimized for high detection efficiency. Jitter is observed to vary between 69 ps at 250 mK and 187 ps at 2.5 K using room temperature amplifiers.
Coinfection with influenza A(H1N1)pdm09 and dengue virus in fatal cases.
Perdigão, Anne Carolinne Bezerra; Ramalho, Izabel Letícia Cavalcante; Guedes, Maria Izabel Florindo; Braga, Deborah Nunes Melo; Cavalcanti, Luciano Pamplona Góes; Melo, Maria Elisabeth Lisboa de; Araújo, Rafael Montenegro de Carvalho; Lima, Elza Gadelha; Silva, Luciene Alexandre Bié da; Araújo, Lia de Carvalho; Araújo, Fernanda Montenegro de Carvalho
2016-09-01
We report on four patients with fatal influenza A(H1N1)pdm09 and dengue virus coinfections. Clinical, necropsy and histopathologic findings presented in all cases were characteristic of influenza-dengue coinfections, and all were laboratory-confirmed for both infections. The possibility of influenza and dengue coinfection should be considered in locations where these two viruses' epidemic periods coincide to avoid fatal outcomes. Dengue is a mosquito-borne viral infection caused by one of the four dengue viruses (DENV-1 to 4). Each of these viruses is capable of causing nonspecific febrile illnesses, classic dengue fever and dengue haemorrhagic fever (Gubler 1998). As a result, dengue is often difficult to diagnose clinically, especially because peak dengue season often coincides with that of other common febrile illnesses in tropical regions (Chacon et al. 2015). In April 2009, a new virus, influenza A/H1N1/pandemic (FluA/H1N1/09pdm), caused a severe outbreak in Mexico. The virus quickly spread throughout the world, and in June 2009, the World Health Organization declared a pandemic (WHO 2010). In Brazil, the first laboratory confirmed case of FluA/H1N1/09pdm was in July 2009 (Pires Neto et al. 2013). The state of Ceará, in Northeast Brazil, is a dengue endemic area. In this state, the virus influenza A(H1N1)pdm09 has circulated since 2009, and through the first half of 2012, 11 deaths caused by the virus were confirmed (Pires Neto et al. 2013). The influenza and dengue seasons in Ceará overlap, which led to diagnostic difficulties. We report four cases of laboratory-confirmed coinfection of deadly influenza A(H1N1)pdm09 with DENV, which occurred during the dengue and influenza season in 2012 and 2013 in Ceará.
Coinfection with influenza A(H1N1pdm09 and dengue virus in fatal cases
Directory of Open Access Journals (Sweden)
Anne Carolinne Bezerra Perdigão
2016-01-01
Full Text Available Abstract We report on four patients with fatal influenza A(H1N1pdm09 and dengue virus coinfections. Clinical, necropsy and histopathologic findings presented in all cases were characteristic of influenza-dengue coinfections, and all were laboratory-confirmed for both infections. The possibility of influenza and dengue coinfection should be considered in locations where these two viruses’ epidemic periods coincide to avoid fatal outcomes. Dengue is a mosquito-borne viral infection caused by one of the four dengue viruses (DENV-1 to 4. Each of these viruses is capable of causing nonspecific febrile illnesses, classic dengue fever and dengue haemorrhagic fever (Gubler 1998. As a result, dengue is often difficult to diagnose clinically, especially because peak dengue season often coincides with that of other common febrile illnesses in tropical regions (Chacon et al. 2015. In April 2009, a new virus, influenza A/H1N1/pandemic (FluA/H1N1/09pdm, caused a severe outbreak in Mexico. The virus quickly spread throughout the world, and in June 2009, the World Health Organization declared a pandemic (WHO 2010. In Brazil, the first laboratory confirmed case of FluA/H1N1/09pdm was in July 2009 (Pires Neto et al. 2013. The state of Ceará, in Northeast Brazil, is a dengue endemic area. In this state, the virus influenza A(H1N1pdm09 has circulated since 2009, and through the first half of 2012, 11 deaths caused by the virus were confirmed (Pires Neto et al. 2013. The influenza and dengue seasons in Ceará overlap, which led to diagnostic difficulties. We report four cases of laboratory-confirmed coinfection of deadly influenza A(H1N1pdm09 with DENV, which occurred during the dengue and influenza season in 2012 and 2013 in Ceará.
Gefenaite, G.; Tacken, M.; Bos, J.; Stirbu-Wagner, I.; Korevaar, J.C.; Stolk, R.P.; Wolters, B.; Bijl, M.; Postma, M.J.; Wilschut, J.; Nichol, K.L.; Hak, E.
2013-01-01
Introduction: Because of variability in published A(H1N1)pdm09 influenza vaccine effectiveness estimates, we conducted a study in the adults belonging to the risk groups to assess the A(H1N1)pdm09 MF59-adjuvanted influenza vaccine effectiveness. Methods: VE against influenza and/or pneumonia was
Denson, D D; Crews, J C; Grummich, K W; Stirm, E J; Sue, C A
1991-03-01
The stability of methadone hydrochloride in 0.9% sodium chloride injection in flexible polyvinyl chloride containers was studied. Commercially available methadone hydrochloride 20 mg/mL and 25-mL single-dose bags of 0.9% sodium chloride injection were used. Six samples each were prepared at methadone hydrochloride concentrations of 1, 2, and 5 mg/mL. The solutions were stored at room temperature and were not protected from light. Immediately after preparation and after two, three, and four weeks of storage, each of the 18 samples was divided into three aliquots, each of which was analyzed in duplicate for methadone hydrochloride concentration by gas chromatography. There was less than 10% change in methadone hydrochloride concentration in any sample throughout the four-week study period. Methadone hydrochloride at concentrations of 1, 2, and 5 mg/mL prepared in commercially available flexible polyvinyl chloride containers of 0.9% sodium chloride injection and stored at room temperature without deliberate protection from light is stable for at least four weeks.
Low cycle fatigue behaviour of Ti-6Al-5Zr-0.5Mo-0.25Si alloy at room temperature
International Nuclear Information System (INIS)
Nag, Anil Kumar; Praveen, K.V.U.; Singh, Vakil
2006-01-01
Low cycle fatigue (LCF) behaviour of the near α titanium alloy, Ti-6Al-5Zr-0.5Mo-0.25Si (LT26A), was investigated in the (α+ β) as well as β treated conditions at room temperature. LCF tests were carried out under total strain controlled mode in the range of Δε t /2: from ± 0.60% to ± 1.40%. The alloy shows cyclic softening in both the conditions. Also it exhibits dual slope Coffin-Manson (C-M) relationship in both the treated conditions. (author)
Synthesis and electrical characterization of BaZr0.9Ho0.1O3-δ electrolyte ceramic for IT - SOFCs
Saini, Deepash S.; Singh, Lalit K.; Bhattacharya, D.
2018-04-01
A cost-effective modified combustion method using citric acid and glycine has recently been developed to synthesize high quality, and nanosized BaZr0.9Ho0.1O3 ceramic powder. BaZr0.9Ho0.1O3-δ ceramic powder was characterized by X-ray diffraction (XRD), high-resolution transmission electron microscopy (HRTEM) and field emission scanning electron microscopy (FESEM). XRD pattern of BaZr0.9Ho0.1O3-δ ceramic sintered at 1600 °C has shown that pure phase of BaZr0.9Ho0.1O3-δ with cubic Pm3¯m space group symmetry. The transmission electron microscopic investigation has shown that the particle size of the powder calcined at 1100 °C was in the range 30-80 nm. The FESEM image of sintered pellet at 1600 °C for 4 h reveals porous nature of BaZr0.9Ho0.1O3-δ with 83.7 relative density. Impedance analysis reveal three type relaxations in the temperature range 250 °C to 500 °C as studied at different frequencies over 100 Hz to 1 MHz in air. The grain boundary conductivity of BaZr0.9Ho0.1O3-δ ceramic is found lower then grain (bulk) conductivity due to core-space charge layer behavior in grain boundary.
Emergence of influenza A (H1N1 PDM09 in the remote Islands of India - A molecular approach
Directory of Open Access Journals (Sweden)
N Muruganandam
2015-01-01
Full Text Available Background: A disease outbreak of A (H1N1 PDM09 was reported in Andaman and Nicobar islands in 2009 with an attack rate of 33.5% among settler population and 26.3% among the aboriginal Nicobarese tribe. During the ongoing outbreak of A (H1N1 PDM09 disease in different parts of the world, a subject working in Dubai city of Saudi Arabia, came to Port Blair, following which the pandemic triggered for the first time in these Islands. Materials and Methods: During the period August 2009 to January 2011, 30 confirmed cases of Influenza A (H1N1 PDM09 virus infection was detected. To understand the genetic relationship, the NA gene sequences of the viruses were phylogenetically analysed together along with the virus sequence isolated from other parts of the world. Result: Formation of multiple clusters were observed, with the sequences of Andaman Islands, mainland India, Mexico, Saudi Arabia and few other counties clustering together. The sequence analysis data revealed that there was no specific mutation conferring resistance to oseltamivir among the Andaman A (H1N1 PDM09 virus isolates. The result of phylogenetic analysis have also revealed that the A (H1N1 PDM09 virus might have spread in these remote Islands of India via the subject from Saudi Arabia/Dubai. Conclusion: A (H1N1 PDM09 Influenza outbreak have highlighted the need to strengthen the region-specific pandemic preparedness plans and surveillance strategies.
Radon measurements at IC-09 well of Chingshui geothermal field (Taiwan): A case study
International Nuclear Information System (INIS)
Chen, Y.; Kuo, T.; Fan, K.; Liang, H.; Tsai, C.; Chiang, C.; Su, C.
2011-01-01
Radon concentration was monitored during the flow tests of well IC-09 at the Chingshui geothermal field. The radon concentration was found to increase from 54 ± 29 to 983 ± 65 Bq/m 3 as a step function of production time, or cumulative production. The observed radon behavior can be explained by a radial composite model with the carbonate scales deposited in the skin zone near the well. The radius of skin zone near well IC-09 can be estimated with radon data at about 20 m using a plug flow model. Monitoring natural radon during the well flow tests is a helpful tracer to diagnose the formation damage near the well.
Raman spectroscopic studies of Nd{sub 0.75}Sm{sub 0.25}GaO{sub 3} single crystals
Energy Technology Data Exchange (ETDEWEB)
Nithya, R., E-mail: nithya@igcar.gov.in; Ravindran, T. R. [Materials Science Group, Indira Gandhi Centre for Atomic Research, Kalpakkam-603102, TN (India); Daniel, D. J. [Centre for Crystal Growth, SSN College of Engineering, Kalavakkam-603110, TN (India)
2015-06-24
Single crystals of Nd{sub 1-x}Sm{sub x}GaO{sub 3} (x= 0 and 0.25) were grown by a four mirror IR image furnace using floating zone technique. The crystals are characterized by X-ray diffraction and Raman spectroscopic measurements. NGO adopts orthorhombic structure with Pbnm symmetry and samarium substituted compound also exhibited the same structure as that of the pristine compound without secondary phases. Polarized Raman spectra are measured at ambient temperature in a back scattering geometry. Spectra exhibit low intensity first-order Raman bands. In addition, several high intensity second-order Raman bands have been observed in the frequency range 2000 to 4000 cm{sup −1}.
Viswanathan, E.; Sundareswari, M.; Jayalakshmi, D. S.; Manjula, M.; Krishnaveni, S.
2017-09-01
First principles calculations are carried out in order to analyze the structural, electronic, mechanical, thermal and optical properties of BP and BAs compounds by ternary alloying with nitrogen namely B(P,As)1-xNx (x = 0.25, 0.5, 0.75) alloys at ambient condition. Thereby we report the mechanical and thermal properties of B(P,As)1-xNx (x = 0.25, 0.5, 0.75) alloys namely bulk modulus, shear modulus, Young's modulus, hardness, ductile-brittle nature, elastic wave velocity, Debye temperature, melting point, etc.; optical properties of B(P)1-xNx (x = 0.25, 0.5, 0.75) and B(As)1-xNx (x = 0.25, 0.75) alloys namely the dielectric function of real and imaginary part, refractive index, extinction coefficient and reflectivity and the hardness profile of the parent compounds BP and BAs under compression. The charge density plot, density of states histograms and band structures are plotted and discussed for all the ternary alloys of the present study. The calculated results agree very well with the available literature. Analysis of the present study reveals that the ternary alloy combinations namely BP.25N.75 and BAs.25N.75 could be superhard materials; hardness of BP and BAs increases with compression.
Subcellular Localization of Cadmium in Chlorella vulgaris Beijerinck Strain Bt-09
Directory of Open Access Journals (Sweden)
P.B. Lintongan
2004-06-01
Full Text Available Growth response curves of Chlorella vulgaris Beijerinck strain Bt-09 to sublethal concentrations of cadmium were evaluated. The growth responses of this microalgal isolate was determined through analysis of chlorophyll a levels. Cadmium was effectively taken up by the cells as determined by Flame Atomic Absorption Spectrophotometry (F-AAS. Subcellular fractionation was undertaken to locate sites that accumulate cadmium.
Outcomes of influenza A(H1N1)pdm09 virus infection
DEFF Research Database (Denmark)
Lynfield, Ruth; Davey, Richard; Dwyer, Dominic E
2014-01-01
BACKGROUND: Data from prospectively planned cohort studies on risk of major clinical outcomes and prognostic factors for patients with influenza A(H1N1)pdm09 virus are limited. In 2009, in order to assess outcomes and evaluate risk factors for progression of illness, two cohort studies were...
Energy Technology Data Exchange (ETDEWEB)
Pransisco, Prengki, E-mail: prengkipransisco@gmail.com, E-mail: afza@petronas.com.my; Shafie, Afza, E-mail: prengkipransisco@gmail.com, E-mail: afza@petronas.com.my [Department of Fundamental and Applied Sciences, Universiti Teknologi PETRONAS, Bandar Seri Iskandar, 31750 Tronoh, Perak (Malaysia); Guan, Beh Hoe, E-mail: beh.hoeguan@petronas.com.my
2014-10-24
This paper examines the effect of calcination process on the structural and magnetic properties material nanostructure composite of Ni{sub 0Ð}œ‡{sub 5}Zn{sub 0Ð}œ‡{sub 25}Cu{sub 0.25} Fe{sub 2}O{sub 4} ferrites. The samples were successfully prepared by sol-gel method at different calcination temperature, which are 600°C, 700°C, 800°C and 900°C. Morphological investigation, average crystallite size and microstructure of the material were examined by using X-ray diffraction (XRD) and confirmed by high resolution transmission electron microscope (HRTEM) and field emission scanning electron microscope (FESEM). The effects of calcination temperature on the magnetic properties were calculated by using vibrating sample magnetometer (VSM). The XRD result shows single-phase cubic spinel structure with interval average size 5.9-38 nm, and grain size microstructure of the material was increasing with temperature increases. The highest magnetization saturation was reached at a temperature 800°C with value 53.89 emu/g, and the value coercive force (Hc) was inversely with the grain size.
A Decade-Bandwidth Distributed Power Amplifier MMIC Using 0.25 μm GaN HEMT Technology
Directory of Open Access Journals (Sweden)
Dong-Hwan Shin
2017-10-01
Full Text Available This study presents a 2–20 GHz monolithic distributed power amplifier (DPA using a 0.25 μm AlGaN/GaN on SiC high electron mobility transistor (HEMT technology. The gate width of the HEMT was selected after considering the input capacitance of the unit cell that guarantees decade bandwidth. To achieve high output power using small transistors, a 12-stage DPA was designed with a nonuniform drain line impedance to provide optimal output power matching. The maximum operating frequency of the proposed DPA is above 20 GHz, which is higher than those of other DPAs manufactured with the same gate-length process. The measured output power and power-added efficiency of the DPA monolithic microwave integrated circuit (MMIC are 35.3–38.6 dBm and 11.4%–31%, respectively, for 2–20 GHz.
Oxygen permeation modelling of perovskites
van Hassel, Bart A.; van Hassel, B.A.; Kawada, Tatsuya; Sakai, Natsuko; Yokokawa, Harumi; Dokiya, Masayuki; Bouwmeester, Henricus J.M.
1993-01-01
A point defect model was used to describe the oxygen nonstoichiometry of the perovskites La0.75Sr0.25CrO3, La0.9Sr0.1FeO3, La0.9Sr0.1CoO3 and La0.8Sr0.2MnO3 as a function of the oxygen partial pressure. Form the oxygen vacancy concentration predicte by the point defect model, the ionic conductivity
Energy Technology Data Exchange (ETDEWEB)
Asensio de Lucas, E.; Alvarez-Serrano, I. [Depto. Quimica Inorganica I, Facultad Ciencias Quimicas, Universidad Complutense de Madrid, E-28040 Madrid (Spain); Cuello, G.J. [Institut Laue-Langevin, 6 rue Jules Horowitz, F-38042 Grenoble (France); Garcia-Hernandez, M. [Instituto de Ciencia de Materiales de Madrid, CSIC, E-28049 Cantoblanco, Madrid (Spain); Lopez, M.L., E-mail: marisal@quim.ucm.es [Depto. Quimica Inorganica I, Facultad Ciencias Quimicas, Universidad Complutense de Madrid, E-28040 Madrid (Spain); Pico, C.; Veiga, M.L. [Depto. Quimica Inorganica I, Facultad Ciencias Quimicas, Universidad Complutense de Madrid, E-28040 Madrid (Spain)
2012-05-05
Graphical abstract: Enhancement of localization phenomena driven by covalency in the BiSrMn{sub 1.75}Ti{sub 0.25}O{sub 6} manganite. The CO/OO phenomena and magnetic clusters (Mn{sub 4}) stabilization at temperatures up to 520 K in BiSrMn{sub 1.75}Ti{sub 0.25}O{sub 6} are connected to a structural transition. The observed enhancement of electronic localization is interpreted considering covalent effects of Ti{sup 4+} and Bi{sup 3+} cations as the main driving force. Highlights: Black-Right-Pointing-Pointer The structural, electronic and magnetic behaviour of the new SrBiMn{sub 1.75}Ti{sub 0.25}O{sub 6} manganite is reported. Black-Right-Pointing-Pointer A structural transition above 520 K takes place, coinciding with relevant changes in the transport properties. Black-Right-Pointing-Pointer The electronic behavior is interpreted in terms of a remarkably high orbital and charge ordering temperature and cluster models. Black-Right-Pointing-Pointer The observed features are explained considering a scenario in which bonds covalence is enhanced by the Bi{sup 3+} and Ti{sup 4+} cations. - Abstract: Manganites are materials that show remarkable phenomena related to charge orbital ordering (CO/OO) and it is extremely important to understand the fundamental nature of this behaviour. This paper reports on the structural, electronic and magnetic behaviour of the new SrBiMn{sub 1.75}Ti{sub 0.25}O{sub 6} manganite and the dependence of these properties with temperature. A detailed structural analysis has been carried out by electron, X-ray, neutron diffraction between 4 and 700 K. The electron diffraction patterns obtained at room temperature (RT) evidence that the average structure (a{approx}b{approx}{radical}(2)a{sub p} and c {approx} 2a{sub p}) presents a modulation that doubles the a and c lattice parameters. A very high charge ordering (CO) transition temperature of 510 K, similar to that found for the non-doped material, SrBiMn{sub 2}O{sub 6}, is observed. Above this
Cai, Xun-Chao; Liu, Chang-Hong; Wang, Bao-Tong; Xue, Ya-Rong
2017-03-01
Bacillus velezensis CC09, which was isolated from healthy leaves of Cinnamomum camphora and previously identified as Bacillus amyloliquefaciens CC09, shows great potential as a new biocontrol agent, in control of many phytopathogenic diseases. To extend our understanding of the potential antifungal capacities, we did a whole genome analysis of strain CC09. Result shows that strain CC09 has a relatively large genome size (4.17Mb) with an average GC content of 46.1%, and 4021 predicted genes. Thirteen secondary metabolites encoding clusters have been identified within the genome of B. velezensis CC09 using genome mining technique. Data of comparative genomic analysis indicated that 3 of the clusters are conserved by all strains of B. velezensis, B. amyloliquefaciens and B. subtilis 168, 9 by B. velezensis and B. amyloliquefaciens, and 2 by all strains of B. velezensis. Another 2 clusters encoding NRPS (Non-Ribosomal Peptide Synthetases) and NRPS-TransATPKS (NRPS and trans-Acyl Transferase Polyketide Synthetases) respectively are observed only in 15 B. velezensis strains, which might lead to the synthesis of novel bioactive compounds and could be explored as antimicrobial agents in the future. These clusters endow B. velezensis CC09 with strong and broad antimicrobial activities, for example, in control of wheat powdery mildew disease. Moreover, our data further confirmed the taxonomy of strain CC09 is a member of B. velezensis rather than a strain of B. amyloliquefaciens based on core genome sequence analysis using phylogenomic approach. Copyright © 2016 Elsevier GmbH. All rights reserved.
NCBI nr-aa BLAST: CBRC-MMUS-09-0191 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-MMUS-09-0191 ref|NP_000854.1| 5-hydroxytryptamine (serotonin) receptor 1B [Hom...o sapiens] ref|NP_001009102.1| 5-hydroxytryptamine (serotonin) receptor 1B [Pan troglodytes] sp|P28222|5HT1B...HT-1B) (Serotonin receptor 1B) (5-HT1B) gb|AAA58675.1| serotonin 1Db receptor gb|AAA36029.1| serotonin recep...tor gb|AAA36030.1| 5-hyroxytryptamine 1D receptor dbj|BAA01763.1| serotonin 1B receptor [Homo sapiens] gb|AAA60316.1| serotonin... 1D receptor emb|CAB51537.1| 5-hydroxytryptamine (serotonin) r
NCBI nr-aa BLAST: CBRC-GACU-09-0018 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-GACU-09-0018 ref|NP_000669.1| alpha-1D-adrenergic receptor [Homo sapiens] sp|P...25100|ADA1D_HUMAN Alpha-1D adrenergic receptor (Alpha 1D-adrenoceptor) (Alpha 1D-adrenoreceptor) (Alpha-1A adrenergic... receptor) (Alpha adrenergic receptor 1a) gb|AAB60351.1| adrenergic alpha-1a receptor protein gb|AAB59487.1| alpha 1a/d adre...nergic receptor dbj|BAA06222.1| alpha1A/D adrenergic rec...eptor [Homo sapiens] emb|CAH70478.1| adrenergic, alpha-1D-, receptor [Homo sapiens] emb|CAC00601.2| adrenergic
NCBI nr-aa BLAST: CBRC-MMUS-09-0013 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-MMUS-09-0013 ref|NP_005950.1| melatonin receptor 1B [Homo sapiens] sp|P49286|M...TR1B_HUMAN Melatonin receptor type 1B (Mel-1B-R) (Mel1b melatonin receptor) gb|AAC50612.1| Mel1b-melatonin r...eceptor dbj|BAA92315.1| melatonin 1b receptor [Homo sapiens] gb|AAS00461.1| melatonin receptor 1B [Homo sapi...ens] gb|AAH69163.1| Melatonin receptor 1B [Homo sapiens] gb|EAW66891.1| melatonin receptor 1B [Homo sapiens] NP_005950.1 1e-164 80% ...
Energy Technology Data Exchange (ETDEWEB)
Herrera-Pérez, G., E-mail: guillermo.herrera@cimav.edu.mx, E-mail: damasio.morales@cimav.edu.mx [Centro de Investigación en Materiales Avanzados (CIMAV), S. C. Miguel de Cervantes 120, Chihuahua 31136, Chihuahua (Mexico); Physics of Materials Department, Centro de Investigación en Materiales Avanzados (CIMAV), S. C. Miguel de Cervantes 120, Chihuahua 31136, Chihuahua (Mexico); Morales, D., E-mail: guillermo.herrera@cimav.edu.mx, E-mail: damasio.morales@cimav.edu.mx; Paraguay-Delgado, F.; Reyes-Rojas, A.; Fuentes-Cobas, L. E. [Physics of Materials Department, Centro de Investigación en Materiales Avanzados (CIMAV), S. C. Miguel de Cervantes 120, Chihuahua 31136, Chihuahua (Mexico); Borja-Urby, R. [Centro de Nanociencias Micro y Nanotecnologías, Instituto Politécnico Nacional, 07300 México City (Mexico)
2016-09-07
This work presents the identification of inter-band transitions in the imaginary part of the dielectric function (ε{sub 2}) derived from the Kramers–Kronig analysis for [Ba{sub 0.9}Ca{sub 0.1}](Ti{sub 0.9}Zr{sub 0.1})O{sub 3} (BCZT) nanocrystals synthesized by the modified Pechini method. The analysis started with the chemical identification of the atoms that conform BCZT in the valence loss energy region of a high energy-resolution of electron energy loss spectroscopy. The indirect band energy (E{sub g}) was determined in the dielectric response function. This result is in agreement with the UV-Vis technique, and it obtained an optical band gap of 3.16 eV. The surface and volume plasmon peaks were observed at 13.1 eV and 26.2 eV, respectively. The X-ray diffraction pattern and the Rietveld refinement data of powders heat treated at 700 °C for 1 h suggest a tetragonal structure with a space group (P4 mm) with the average crystal size of 35 nm. The average particle size was determined by transmission electron microscopy.
Electronic structure of Rh-based CuRh0.9Mg0.1O2 oxide thermoelectrics
Vilmercati, P.; Martin, E.; Cheney, C. Parks; Bondino, F.; Magnano, E.; Parmigiani, F.; Sasagawa, T.; Mannella, N.
2013-03-01
The electronic structure of the Rh-based CuRh0.9Mg0.1O2 oxide thermoelectric compound has been studied with a multitechnique approach consisting of photoemission, x-ray absorption, and x-ray emission spectroscopies. The data indicate that the region of the valence band in the proximity of the Fermi level is dominated by Rh-derived states. These findings outline the importance of the electronic structure of the Rh ions for the large thermoelectric power in CuRh0.9Mg0.1O2 at high temperature.
Deformation Behavior of Al0.25CoCrFeNi High-Entropy Alloy after Recrystallization
Directory of Open Access Journals (Sweden)
Jinxiong Hou
2017-03-01
Full Text Available Cold rolling with subsequent annealing can be used to produce the recrystallized structure in high entropy alloys (HEAs. The Al0.25CoCrFeNi HEAs rolled to different final thickness (230, 400, 540, 800, 1000, 1500 μm are prepared to investigate their microstructure evolutions and mechanical behaviors after annealing. Only the single face-centered cubic phase was obtained after cold rolling and recrystallization annealing at 1100 °C for 10 h. The average recrystallized grain size in this alloy after annealing ranges from 92 μm to 136 μm. The annealed thin sheets show obviously size effects on the flow stress and formability. The yield strength and tensile strength decrease as t/d (thickness/average grain diameter ratio decreases until the t/d approaches 2.23. In addition, the stretchability (formability decreases with the decrease of the t/d ratio especially when the t/d ratio is lower than about 6. According to the present results, yield strength can be expressed as a function of the t/d ratio.
Energy Technology Data Exchange (ETDEWEB)
Bouwens, R. J.; Labbé, I.; Franx, M.; Smit, R. [Leiden Observatory, Leiden University, NL-2300 RA Leiden (Netherlands); Illingworth, G. D.; Oesch, P. A.; Gonzalez, V.; Magee, D. [UCO/Lick Observatory, University of California, Santa Cruz, CA 95064 (United States); Van Dokkum, P. G. [Department of Astronomy, Yale University, New Haven, CT 06520 (United States); Trenti, M. [Institute of Astronomy, University of Cambridge, Madingley Road, Cambridge CB3 0HA (United Kingdom)
2014-10-01
We measure the UV-continuum slope β for over 4000 high-redshift galaxies over a wide range of redshifts z ∼ 4-8 and luminosities from the HST HUDF/XDF, HUDF09-1, HUDF09-2, ERS, CANDELS-N, and CANDELS-S data sets. Our new β results reach very faint levels at z ∼ 4 (–15.5 mag: 0.006 L{sub z=3}{sup ∗}), z ∼ 5 (–16.5 mag: 0.014 L{sub z=3}{sup ∗}), and z ∼ 6 and z ∼ 7 (–17 mag: 0.025 L{sub z=3}{sup ∗}). Inconsistencies between previous studies led us to conduct a comprehensive review of systematic errors and develop a new technique for measuring β that is robust against biases that arise from the impact of noise. We demonstrate, by object-by-object comparisons, that all previous studies, including our own and those done on the latest HUDF12 data set, suffered from small systematic errors in β. We find that after correcting for the systematic errors (typically Δβ ∼ 0.1-0.2) all β results at z ∼ 7 from different groups are in excellent agreement. The mean β we measure for faint (–18 mag: 0.1 L{sub z=3}{sup ∗}) z ∼ 4, z ∼ 5, z ∼ 6, and z ∼ 7 galaxies is –2.03 ± 0.03 ± 0.06 (random and systematic errors), –2.14 ± 0.06 ± 0.06, –2.24 ± 0.11 ± 0.08, and –2.30 ± 0.18 ± 0.13, respectively. Our new β values are redder than we have reported in the past, but bluer than other recent results. Our previously reported trend of bluer β's at lower luminosities is confirmed, as is the evolution to bluer β's at high redshifts. β appears to show only a mild luminosity dependence faintward of M {sub UV,AB} ∼ –19 mag, suggesting that the mean β asymptotes to ∼–2.2 to –2.4 for faint z ≥ 4 galaxies. At z ∼ 7, the observed β's suggest non-zero, but low dust extinction, and they agree well with values predicted in cosmological hydrodynamical simulations.
International Nuclear Information System (INIS)
Bouwens, R. J.; Labbé, I.; Franx, M.; Smit, R.; Illingworth, G. D.; Oesch, P. A.; Gonzalez, V.; Magee, D.; Van Dokkum, P. G.; Trenti, M.
2014-01-01
We measure the UV-continuum slope β for over 4000 high-redshift galaxies over a wide range of redshifts z ∼ 4-8 and luminosities from the HST HUDF/XDF, HUDF09-1, HUDF09-2, ERS, CANDELS-N, and CANDELS-S data sets. Our new β results reach very faint levels at z ∼ 4 (–15.5 mag: 0.006 L z=3 ∗ ), z ∼ 5 (–16.5 mag: 0.014 L z=3 ∗ ), and z ∼ 6 and z ∼ 7 (–17 mag: 0.025 L z=3 ∗ ). Inconsistencies between previous studies led us to conduct a comprehensive review of systematic errors and develop a new technique for measuring β that is robust against biases that arise from the impact of noise. We demonstrate, by object-by-object comparisons, that all previous studies, including our own and those done on the latest HUDF12 data set, suffered from small systematic errors in β. We find that after correcting for the systematic errors (typically Δβ ∼ 0.1-0.2) all β results at z ∼ 7 from different groups are in excellent agreement. The mean β we measure for faint (–18 mag: 0.1 L z=3 ∗ ) z ∼ 4, z ∼ 5, z ∼ 6, and z ∼ 7 galaxies is –2.03 ± 0.03 ± 0.06 (random and systematic errors), –2.14 ± 0.06 ± 0.06, –2.24 ± 0.11 ± 0.08, and –2.30 ± 0.18 ± 0.13, respectively. Our new β values are redder than we have reported in the past, but bluer than other recent results. Our previously reported trend of bluer β's at lower luminosities is confirmed, as is the evolution to bluer β's at high redshifts. β appears to show only a mild luminosity dependence faintward of M UV,AB ∼ –19 mag, suggesting that the mean β asymptotes to ∼–2.2 to –2.4 for faint z ≥ 4 galaxies. At z ∼ 7, the observed β's suggest non-zero, but low dust extinction, and they agree well with values predicted in cosmological hydrodynamical simulations.
Directory of Open Access Journals (Sweden)
Germana Bancone
Full Text Available Primaquine is the only drug consistently effective against mature gametocytes of Plasmodium falciparum. The transmission blocking dose of primaquine previously recommended was 0.75 mg/kg (adult dose 45 mg but its deployment was limited because of concerns over haemolytic effects in patients with glucose-6-phosphate dehydrogenase (G6PD deficiency. G6PD deficiency is an inherited X-linked enzymatic defect that affects an estimated 400 million people around the world with high frequencies (15-20% in populations living in malarious areas. To reduce transmission in low transmission settings and facilitate elimination of P. falciparum, the World Health Organization now recommends adding a single dose of 0.25 mg/kg (adult dose 15 mg to Artemisinin-based Combination Therapies (ACTs without G6PD testing. Direct evidence of the safety of this low dose is lacking. Adverse events and haemoglobin variations after this treatment were assessed in both G6PD normal and deficient subjects in the context of targeted malaria elimination in a malaria endemic area on the North-Western Myanmar-Thailand border where prevalence of G6PD deficiency (Mahidol variant approximates 15%.The tolerability and safety of primaquine (single dose 0.25 mg base/kg combined with dihydroartemisinin-piperaquine (DHA-PPQ given three times at monthly intervals was assessed in 819 subjects. Haemoglobin concentrations were estimated over the six months preceding the ACT + primaquine rounds of mass drug administration. G6PD deficiency was assessed with a phenotypic test and genotyping was performed in male subjects with deficient phenotypes and in all females. Fractional haemoglobin changes in relation to G6PD phenotype and genotype and primaquine round were assessed using linear mixed-effects models. No adverse events related to primaquine were reported during the trial. Mean fractional haemoglobin changes after each primaquine treatment in G6PD deficient subjects (-5.0%, -4.2% and -4
Extended stability of intravenous 0.9% sodium chloride solution after prolonged heating or cooling.
Puertos, Enrique
2014-03-01
The primary objective of this study was to evaluate the stability and sterility of an intravenous 0.9% sodium chloride solution that had been cooled or heated for an extended period of time. Fifteen sterile 1 L bags of 0.9% sodium chloride solution were randomly selected for this experiment. Five bags were refrigerated at an average temperature of 5.2°C, 5 bags were heated at an average temperature of 39.2°C, and 5 bags were stored at an average room temperature of 21.8°C to serve as controls. All samples were protected from light and stored for a period of 199 days prior to being assayed and analyzed for microbial and fungal growth. There was no clinically significant difference in the mean sodium values between the refrigerated samples, the heated samples, and the control group. There were no signs of microbial or fungal growth for the duration of the study. A sterile intravenous solution of 0.9% sodium chloride that was heated or cooled remained stable and showed no signs of microbial or fungal growth for a period of 199 days. This finding will allow hospitals and emergency medical technicians to significantly extend the expiration date assigned to these fluids and therefore obviate the need to change out these fluids every 28 days as recommended by the manufacturer.
Influenza A (H1N1pdm09)-Related Critical Illness and Mortality in Mexico and Canada, 2014.
Dominguez-Cherit, Guillermo; De la Torre, Alethse; Rishu, Asgar; Pinto, Ruxandra; Ñamendys-Silva, Silvio A; Camacho-Ortiz, Adrián; Silva-Medina, Marco Antonio; Hernández-Cárdenas, Carmen; Martínez-Franco, Michel; Quesada-Sánchez, Alejandro; López-Gallegos, Guadalupe Celia; Mosqueda-Gómez, Juan L; Rivera-Martinez, Norma E; Campos-Calderón, Fernando; Rivero-Sigarroa, Eduardo; Hernández-Gilsoul, Thierry; Espinosa-Pérez, Lourdes; Macías, Alejandro E; Lue-Martínez, Dolores M; Buelna-Cano, Christian; Ramírez-García Luna, Ana-Sofía; Cruz-Ruiz, Nestor G; Poblano-Morales, Manuel; Molinar-Ramos, Fernando; Hernandez-Torre, Martin; León-Gutiérrez, Marco Antonio; Rosaldo-Abundis, Oscar; Baltazar-Torres, José Ángel; Stelfox, Henry T; Light, Bruce; Jouvet, Philippe; Reynolds, Steve; Hall, Richard; Shindo, Nikki; Daneman, Nick; Fowler, Robert A
2016-10-01
The 2009-2010 influenza A (H1N1pdm09) pandemic caused substantial morbidity and mortality among young patients; however, mortality estimates have been confounded by regional differences in eligibility criteria and inclusion of selected populations. In 2013-2014, H1N1pdm09 became North America's dominant seasonal influenza strain. Our objective was to compare the baseline characteristics, resources, and treatments with outcomes among critically ill patients with influenza A (H1N1pdm09) in Mexican and Canadian hospitals in 2014 using consistent eligibility criteria. Observational study and a survey of available healthcare setting resources. Twenty-one hospitals, 13 in Mexico and eight in Canada. Critically ill patients with confirmed H1N1pdm09 during 2013-2014 influenza season. None. The main outcome measures were 90-day mortality and independent predictors of mortality. Among 165 adult patients with H1N1pdm09-related critical illness between September 2013 and March 2014, mean age was 48.3 years, 64% were males, and nearly all influenza was community acquired. Patients were severely hypoxic (median PaO2-to-FIO2 ratio, 83 mm Hg), 97% received mechanical ventilation, with mean positive end-expiratory pressure of 14 cm H2O at the onset of critical illness and 26.7% received rescue oxygenation therapy with prone ventilation, extracorporeal life support, high-frequency oscillatory ventilation, or inhaled nitric oxide. At 90 days, mortality was 34.6% (13.9% in Canada vs 50.5% in Mexico, p Mexico (odds ratio, 7.76 [95% CI, 2.02-27.35]). ICUs in Canada generally had more beds, ventilators, healthcare personnel, and rescue oxygenation therapies. Influenza A (H1N1pdm09)-related critical illness still predominantly affects relatively young to middle-aged patients and is associated with severe hypoxemic respiratory failure. The local critical care system and available resources may be influential determinants of patient outcome.
Kaasaaitamine. Riigikohtu kriminaalkolleegiumi otsus asjas 3-1-1-97-09 / Jaan Sootak
Sootak, Jaan, 1948-
2009-01-01
Riigikohtu lahendist 3-1-1-97-09: I. V. kaitsja vandeadvokaat Aivar Ennoki kassatsioon Tallinna Ringkonnakohtu 15. juuni 2009. a kohtuotsuse peale kriminaalasjas I. V. süüdistuses KarS § 200 lg 2 p 7 - § 22 lg 3; § 215 lg 2 p 3 - § 22 lg 3 järgi
2010-07-01
... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Safety Zone and Regulated Navigation Area, Chicago Sanitary and Ship Canal, Romeoville, IL. 165.T09-1080 Section 165.T09-1080 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) PORTS AND WATERWAYS SAFETY REGULATED NAVIGATION AREAS AND LIMITED...
International Nuclear Information System (INIS)
Troche Concepcion, Yenilen; Romero Diaz, Jacqueline Aylema; Garcia Penna, Caridad M
2010-01-01
The Ketotiphen eyedrop is prescribed to relief the signs and symptoms of allergic conjunctivitis due to its potent H 1a ntihistaminic effect showing some ability to inhibit the histamine release and other mediators in cases of mastocytosis. The aim of present paper was to develop and validate an analytical method for the high-performance liquid chromatography, to quality control and the stability studies of 0.025 % eyedrop Ketotiphen. Method was based on active principle separation by means of a Lichrosorb RP-18 (5 μm) (250 x 4 mm), with UV detection to 296 nm using a mobile phase including a non-gasified mixture of methanol:buffer-phosphate (75:25; pH 8.5) adding 1 mL of Isopropanol by each 1 000 mL of the previous mixture at a 1.2 mL/min flow velocity. The analytical method was linear, accurate, specific and exact during the study concentrations
Rossi, C; Hess, S; Eckl, R W; di Lena, A; Bruno, A; Thomas, O; Poggi, A
2006-03-01
Treatment with anticoagulant drugs has shown potential inhibitory effect on tumor invasion, although the relationship with clotting inhibition was not clear. The aim of our study was to evaluate the potential antitumor activity of MCM09, a newly developed, active site-directed, small molecule inhibitor of factor Xa (FXa) [WO0216312], and to relate the findings to anticlotting potency. MCM09 (0.1-10 mg kg(-1)) or heparin (H; 10 mg kg(-1)) was injected intravenously (i.v.), with 5 x 10(4) B16-BL6 melanoma cells, in C57BL/6 mice. Mice were killed after 18 days, to count lung colonies. Ex vivo anticoagulant activity was measured by activated partial thromboplastin time (APTT) on mouse plasma. MCM09, a selective inhibitor of FXa (IC-50 = 2.4 nm against human FXa), inhibited in a dose-dependent manner B16-BL6 melanoma lung colonies in mice. Mean lung metastasis number was 20.9 +/- 4.8 in controls (n = 10), 1.2 +/- 0.4 in mice treated with H, 10 mg kg(-1) i.v. (P < 0.01), 0.9 +/- 0.3, 9.2 +/- 2.2 and 15.5 +/- 2.6 in mice treated with MCM09, at 10 (P < 0.01), 1 (P < 0.05) and 0.1 mg kg(-1) i.v. (ns), respectively. MCM09 (10 mg kg(-1) i.v.) significantly prolonged APTT (57.1 +/- 10.2 s) 30 min after i.v. injection when compared with controls (25.3 +/- 1.6 s; P < 0.05). Lung colonies were 74.2-72.6% reduced by MCM09 (10 mg kg(-1)) given 60 or 120 min before cells, but not by MCM09 given 60 min thereafter, suggesting a direct cell interaction as a mechanism underlying antitumor activity.
Gefenaite, Giedre; Tacken, Margot; Bos, Jens; Stirbu-Wagner, Irina; Korevaar, Joke C.; Stolk, Ronald P.; Wolters, Bert; Bijl, Marc; Postma, Maarten J.; Wilschut, Jan; Nichol, Kristin L.; Hak, Eelko
Background: Because of variability in published A(H1N1)pdm09 influenza vaccine effectiveness estimates, we aimed to assess the effectiveness of MF59-adjuvanted A(H1N1)pdm09 vaccine in a matched case-control study. Objectives: We aimed to assess the effectiveness of MF59- adjuvanted A(H1N1)pdm09
Analysis of failed ramps during the RHIC FY09 run
Energy Technology Data Exchange (ETDEWEB)
Minty, M. [Brookhaven National Lab. (BNL), Upton, NY (United States). Collider-Accelerator Dept.
2014-08-15
The Relativistic Heavy Ion Collider (RHIC) is a versatile accelerator that supports operation with polarized protons of up to 250 GeV and ions with up to 100 GeV/nucleon. During any running period, various operating scenarios with different particle species, beam energies or accelerator optics are commissioned. In this report the beam commissioning periods for establishing full energy beams (ramp development periods) from the FY09 run are summarized and, for the purpose of motivating further developments, we analyze the reasons for all failed ramps.
Analysis of failed ramps during the RHIC FY09 run
International Nuclear Information System (INIS)
Minty, M.
2014-01-01
The Relativistic Heavy Ion Collider (RHIC) is a versatile accelerator that supports operation with polarized protons of up to 250 GeV and ions with up to 100 GeV/nucleon. During any running period, various operating scenarios with different particle species, beam energies or accelerator optics are commissioned. In this report the beam commissioning periods for establishing full energy beams (ramp development periods) from the FY09 run are summarized and, for the purpose of motivating further developments, we analyze the reasons for all failed ramps.
Glinz, Martin; Heymans, Patrick; Persson, Anne; Sindre, Guttorm; Aurum, Aybüke; Madhavji, Nazim; Madhavji, N.; Paech, Barbara; Regev, Gil; Wieringa, Roelf J.
This report summarizes the presentations and discussions at REFSQ’09, the 15th International Working Conference on Requirements Engineering: Foundation for Software Quality which was held on June 8-9, 2009 in Amsterdam, The Netherlands.
NCBI nr-aa BLAST: CBRC-MDOM-09-0050 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-MDOM-09-0050 ref|NP_689554.2| progestin and adipoQ receptor family member IV [...Homo sapiens] sp|Q8N4S7|PAQR4_HUMAN RecName: Full=Progestin and adipoQ receptor family member 4; AltName: Full=Progesti...n and adipoQ receptor family member IV gb|AAH33703.1| Progestin and adipoQ receptor family member... IV [Homo sapiens] gb|AAR08370.1| progestin and adipoQ receptor family member IV ...[Homo sapiens] gb|EAW85441.1| progestin and adipoQ receptor family member IV, isoform CRA_a [Homo sapiens] gb|EAW85443.1| progesti
Su, Yan; Zhao, Yong S; Li, Lu L; Qin, Chuan Y; Wu, Fan; Geng, Nan N; Lei, Jian S
2014-01-01
This study investigated the transport properties of nanoscale zero-valent iron (Fe(0)) (nZVI) carried by three vehicles: water, sodium dodecyl sulfate (SDS) solution, and SDS foam. Batch experiments were conducted to assess the sedimentation capability of nZVI particles in these three vehicles. Column experiments were conducted to investigate the transport properties of nZVI in porous media formed with different sizes of sand (0.25 mm to 0.5 mm, 0.5 mm to 0.9 mm, and 0.9 mm to 1.4 mm). Three main results were obtained. First, the batch experiments revealed that the stabilities of nZVI particles in SDS solution and SDS foam were improved, compared with that of nZVI particles in water. Moreover, the sedimentation of nZVI in foam was closely associated with the foam drainage volume. The nZVI content in foam was similar to that in the original foaming suspension, and the nZVI particle distribution in foam became significantly more uniform at a stirring speed of 3000 r/min. Second, the transport of nZVI was enhanced by foam compared with water and SDS solution for 0.25 mm to 0.5 mm diameter sand. For sand with diameters of 0.5 mm to 0.9 mm and 0.9 mm to 1.4 mm, the mobility of nZVI carried by SDS solution was optimal, followed by that of nZVI carried by foam and water. Thus, the mobility of nZVI in finer sand was significantly enhanced by foam, compared with that in coarse sand. In contrast, compared with the bare nZVI suspension and nZVI-laden foam, the spatial distribution of nZVI particles carried by SDS solution was significantly uniform along the column length. Third, the SDS concentration significantly influenced the migration of nZVI in porous media. The enhancement in the migration of nZVI carried by SDS solution was greater at an SDS dose of 0.25% compared with that at the other three doses (0.2%, 0.5%, and 1%) for sand with a 0.25 mm to 0.5 mm diameter. Increased SDS concentrations positively affected the transport of nZVI by foam for sand with a
Results of the radiological survey at 133 Maywood Avenue, Maywood, New Jersey (MJ025)
International Nuclear Information System (INIS)
Foley, R.D.; Carrier, R.F.; Floyd, L.M.; Crutcher, J.W.
1989-10-01
Maywood Chemical Works (MCW) of Maywood, New Jersey, generated process wastes and residues associated with the production and refining of thorium and thorium compounds from monazite ores from 1916 to 1956. MCW supplied rare earth metals and thorium compounds to the Atomic Energy Commission and various other government agencies from the late 1940s to the mid-1950s. Area residents used the sandlike waste from this thorium extraction process mixed with tea and cocoa leaves as mulch in their yards. Some of these contaminated wastes were also eroded from the site into Lodi Brook. At the request of the US Department of Energy (DOE), a group from Oak Ridge National Laboratory conducts investigative radiological surveys of properties in the vicinity of MCW to determine whether a property is contaminated with radioactive residues, principally 232 Th, derived from the MCW site. The survey typically includes direct measurement of gamma radiation levels and soil sampling for radionuclide analyses. The survey of this site, 133 Maywood Avenue, Maywood, New Jersey (MJ025), was conducted during 1987. The survey results demonstrate that all radionuclide concentrations and measurements conform to DOE remedial action criteria. All values are at or below typical background values found in northern New Jersey. 5 refs., 2 figs., 3 tabs
PHOBOS AS A D-TYPE CAPTURED ASTEROID, SPECTRAL MODELING FROM 0.25 TO 4.0 μm
Energy Technology Data Exchange (ETDEWEB)
Pajola, M.; Magrin, S.; Bertini, I.; Barbieri, C. [Center of Studies and Activities for Space, CISAS, ' G. Colombo' , University of Padova, I-35131 Padova (Italy); Lazzarin, M.; La Forgia, F. [Department of Physics and Astronomy, University of Padova, I-35131 Padova (Italy); Dalle Ore, C. M. [Carl Sagan Center, SETI Institute, Mountain View, CA 94043 (United States); Cruikshank, D. P.; Roush, T. L., E-mail: maurizio.pajola@studenti.unipd.it, E-mail: maurizio.pajola@gmail.com, E-mail: Maurizio.Pajola@jpl.nasa.gov [NASA Ames Research Center, Moffett Field, CA 94035 (United States)
2013-11-10
This paper describes the spectral modeling of the surface of Phobos in the wavelength range between 0.25 and 4.0 μm. We use complementary data to cover this spectral range: the OSIRIS (Optical, Spectroscopic, and Infrared Remote Imaging System on board the ESA Rosetta spacecraft) reflectance spectrum that Pajola et al. merged with the VSK-KRFM-ISM (Videospectrometric Camera (VSK)-Combined Radiometer and Photometer for Mars (KRFM)-Imaging Spectrometer for Mars (ISM) on board the USSR Phobos 2 spacecraft) spectra by Murchie and Erard and the IRTF (NASA Infrared Telescope Facility, Hawaii, USA) spectra published by Rivkin et al. The OSIRIS data allow the characterization of an area of Phobos covering from 86.°8 N to 90° S in latitude and from 126° W to 286° W in longitude. This corresponds chiefly to the trailing hemisphere, but with a small sampling of the leading hemisphere as well. We compared the OSIRIS results with the Trojan D-type asteroid 624 Hektor and show that the overall slope and curvature of the two bodies over the common wavelength range are very similar. This favors Phobos being a captured D-type asteroid as previously suggested. We modeled the OSIRIS data using two models, the first one with a composition that includes organic carbonaceous material, serpentine, olivine, and basalt glass, and the second one consisting of Tagish Lake meteorite and magnesium-rich pyroxene glass. The results of these models were extended to longer wavelengths to compare the VSK-KRFM-ISM and IRTF data. The overall shape of the second model spectrum between 0.25 and 4.0 μm shows curvature and an albedo level that match both the OSIRIS and Murchie and Erard data and the Rivkin et al. data much better than the first model. The large interval fit is encouraging and adds weight to this model, making it our most promising fit for Phobos. Since Tagish Lake is commonly used as a spectral analog for D-type asteroids, this provides additional support for compositional
PHOBOS AS A D-TYPE CAPTURED ASTEROID, SPECTRAL MODELING FROM 0.25 TO 4.0 μm
International Nuclear Information System (INIS)
Pajola, M.; Magrin, S.; Bertini, I.; Barbieri, C.; Lazzarin, M.; La Forgia, F.; Dalle Ore, C. M.; Cruikshank, D. P.; Roush, T. L.
2013-01-01
This paper describes the spectral modeling of the surface of Phobos in the wavelength range between 0.25 and 4.0 μm. We use complementary data to cover this spectral range: the OSIRIS (Optical, Spectroscopic, and Infrared Remote Imaging System on board the ESA Rosetta spacecraft) reflectance spectrum that Pajola et al. merged with the VSK-KRFM-ISM (Videospectrometric Camera (VSK)-Combined Radiometer and Photometer for Mars (KRFM)-Imaging Spectrometer for Mars (ISM) on board the USSR Phobos 2 spacecraft) spectra by Murchie and Erard and the IRTF (NASA Infrared Telescope Facility, Hawaii, USA) spectra published by Rivkin et al. The OSIRIS data allow the characterization of an area of Phobos covering from 86.°8 N to 90° S in latitude and from 126° W to 286° W in longitude. This corresponds chiefly to the trailing hemisphere, but with a small sampling of the leading hemisphere as well. We compared the OSIRIS results with the Trojan D-type asteroid 624 Hektor and show that the overall slope and curvature of the two bodies over the common wavelength range are very similar. This favors Phobos being a captured D-type asteroid as previously suggested. We modeled the OSIRIS data using two models, the first one with a composition that includes organic carbonaceous material, serpentine, olivine, and basalt glass, and the second one consisting of Tagish Lake meteorite and magnesium-rich pyroxene glass. The results of these models were extended to longer wavelengths to compare the VSK-KRFM-ISM and IRTF data. The overall shape of the second model spectrum between 0.25 and 4.0 μm shows curvature and an albedo level that match both the OSIRIS and Murchie and Erard data and the Rivkin et al. data much better than the first model. The large interval fit is encouraging and adds weight to this model, making it our most promising fit for Phobos. Since Tagish Lake is commonly used as a spectral analog for D-type asteroids, this provides additional support for compositional
Autogenous shrinkage of Ducorit S5R ASTM C 1698-09 test method
DEFF Research Database (Denmark)
Damkilde, Lars
The report deals with experimental measurement of autogenous shrinkage of Ducorit S5R according to the test method ASTM C 1698-09. This test method measures the bulk strain of a sealed cementitious specimen, at constant temperature and not subjected to external forces, from the time of final...
International Nuclear Information System (INIS)
Xu Lin; Luo Mingfang; Li Wangliang; Wei Xuetuan; Xie Keng; Liu Lijun; Jiang Chengying; Liu Huizhou
2011-01-01
Research highlights: → Growing cells have high Cr (VI) resistant and reducing ability aerobically. → Resting cells show strong anaerobic-reduction potential. → Acetate can highly stimulate both aerobic and anaerobic reduction process. - Abstract: A novel Cr (VI) resistant bacterial strain LSSE-09, identified as Pannonibacter phragmitetus, was isolated from industrial sludge. It has strong aerobic and anaerobic Cr (VI)-reduction potential under alkaline conditions. At 37 o C and pH 9.0, growing cells of strain LSSE-09 could completely reduce 100 and 1000 mg L -1 Cr (VI)-Cr (III) within 9 and 24 h, respectively under aerobic condition. Resting cells showed higher anaerobic reduction potential with the rate of 1.46 mg g -1 (dryweight) min -1 , comparing with their aerobic reduction rate, 0.21 mg g -1 min -1 . External electron donors, such as lactate, acetate, formate, pyruvate, citrate and glucose could highly increase the reduction rate, especially for aerobic reduction. The presence of 3000 mg L -1 acetate enhanced anaerobic and aerobic Cr (VI)-reduction rates up to 9.47 mg g -1 min -1 and 4.42 mg g -1 min -1 , respectively, which were 5 and 20 times faster than those without it. Strain LSSE-09 retained high activities over six batch cycles and NO 3 - and SO 4 2- had slightly negative effects on Cr (VI)-reduction rates. The results suggest that strain LSSE-09 has potential application for Cr (VI) detoxification in alkaline wastewater.
4,4′,6,6′-Tetra-tert-butyl-2,2′-[1,3-diazinane-1,3-diylbis(methylene]diphenol 0.25-hydrate
Directory of Open Access Journals (Sweden)
Manman Zhang
2012-07-01
Full Text Available The title compound, C34H54N2O2·0.25H2O, the organic molecule, a potential tetradentate ligand with a bulky phenolic donor, has overall mirror symmetry. A partially occupied water molecule of solvation is present in the lattice. The six-membered 1,3-diazinane ring displays a chair conformation. An intramolecular O—H...N hydrogen bond ocurs. In the crystal, molecules are linked by O—H...O interactions.
Temperature dependence of Raman spectra of Basub(0.25)Srsub(0.75)Nbsub(2)Osub(6) crystal
International Nuclear Information System (INIS)
Rustamov, Kh.Sh.; Gorelik, V.S.; Kuz'minov, Yu.S.; Peregudov, G.V.; Sushchinskij, M.M.
1976-01-01
The nature of the changes is studied in the Raman spectra in a crystal of Basub(x)Srsub(1-x)Nasub(2)Osub(6) (x=0.25) with the temperature range of 80 to 373 K. Normal procedure was applied with the use of an argon laser (Λ=4880 A) and a DFS-12 spectrometer. It has been established that at low temperatures the spectrum becomes more clear-cut; in the low-frequency range some sharp lines appear in the immediate vicinity of the exciting line. On heating of the crystal one observes a redistribution of the intensity in the Raman spectrum and a general displacement of the low-frequency Raman spectrum and a general displacement of the low-frequency Raman spectrum toward the exciting line. The nature of the frequency shifts some Raman maxima was investigated, and certain anomalies were observed in the vicinity of the phase transition point
Doping effects on the relaxation of frustration and magnetic properties of YMn0.9Cu0.1O3
Xiao, L. X.; Xia, Z. C.; Wang, X.; Ni, Y.; Yu, W.; Shi, L. R.; Jin, Z.; Xiao, G. L.
2017-12-01
The crystal structure and magnetic properties of hexagonal YMn0.9Cu0.1O3 single crystal are systematically investigated. The refinement results of XRD show the lattice constant decreases, which is unusually due to the doped Cu2+ ion has a larger ionic radius than the Mn3+ ions. The XPS results show that the coexistence of Mn2+, Mn3+ and Mn4+ ions in YMn0.9Cu0.1O3 single crystal. Magnetization measurements show that Cu doped YMn0.9Cu0.1O3 and parent YMnO3 have almost the same antiferromagnetic transition temperature TN, which indicates the AFM interaction is robust in the geometry frustrated system. Because doping directly destroy some of the Mn3+ ions nets, the relaxation of frustration of Mn in-plane 2D triangular geometry network leads to the significantly decrease of Mn3+ ions AFM interaction. In addition, the coexistence and competition between the ferromagnetic and antiferromagnetic interactions among the Mn2+, Mn3+ and Mn4+ ions lead to a complicated and irreversible magnetization behavior in YMn0.9Cu0.1O3 single crystal.
Crystal structure and optical absorption spectra of Ga0.5Fe0.5InS3 and Ga0.5Fe0.25In1.25S3 crystals
International Nuclear Information System (INIS)
Gusejnov, G.G.; Musaeva, N.N.; Kyazumov, M.G.; Asadova, I.B.; Aliev, O.M.
2003-01-01
Single crystals of Ga 0.5 Fe 0.5 InS 3 are grown by the method of chemical gas-transport reactions and those of Ga 0.5 Fe 0.25 In 1.25 S 3 - by Bridgman method. X-ray diffraction studies reveal that they crystallize in trigonal and rhombohedral systems with lattice parameters of a = 3.796 x 2 A, c = 12.210 A, P3m1; a = 3.786 x 2 A, c = 36.606 A, R3m, respectively. An optical absorption edge in a wide range of photon energy and an energy gap width are determined: E g = 1.885 eV for Ga 0.5 Fe 0.5 InS 3 and E g 1.843 eV for Ga 0.5 Fe 0.25 In 1.25 S 3 [ru
Gupta, Aditya K; Lynde, Charles W; Kunynetz, Rod A W; Amin, Smita; Choi, Ken; Goldstein, Eric
2003-01-01
Combination treatments for acne vulgaris, such as Benzamycin (3% erythromycin/5% benzoyl peroxide) and Stievamycin (0.025% tretinoin/erythromycin 4%), reduce bacterial growth, which contributes to the inflammatory lesions typical of adolescent acne, and also decrease the epidermal cell compaction which may form the characteristic noninflammatory comedone. Both agents contain erythromycin to reduce the growth of Propionibacterium acnes in skin. Benzoyl peroxide has antibiotic activity as well as anticomedogenic properties. Tretinoin may increase the turnover of epidermal cells and loosen the cells compacted to form comedones. A combination preparation containing the two antibiotics may reduce the development of resistance; the combination preparation containing tretinoin and erythromycin will have an antibiotic effect as well as acting on differentiation. This multicenter, randomized, double-blind, parallel group study compared the effectiveness of 3% erythromycin/5% benzoyl peroxide and 0.025% tretinoin/erythromycin 4%, each applied twice daily in patients with moderate acne vulgaris. Overall physician and patient ratings of severity of acne symptoms were performed at baseline and at weeks 2, 4, 8, and 12. At baseline the two treatment groups had similar disease severity. The number of papules, pustules, and comedones was reduced in both treatment groups at week 12, and the reductions were not significantly different between the two comparators. Global physician rating of improvement was significantly higher in the 3% erythromycin/5% benzoyl peroxide group compared with the 0.025% tretinoin/erythromycin 4% group; however, there was no significant difference in global patient ratings between the two treatment groups. An aggregate score was produced, for both physician rating and patient rating, by adding up individual symptom severity ratings. Compared with 0.025% tretinoin/erythromycin 4%, 3% erythromycin/5% benzoyl peroxide provided significantly greater reduction
Multiaxial creep of fine grained 0.5Cr-0.5Mo-0.25V and coarse grained 1Cr-0.5Mo steels
International Nuclear Information System (INIS)
Browne, R.J.; Flewitt, P.E.J.; Lonsdale, D.
1991-01-01
To explore the multiaxial creep response of materials used for electrical power generating plant, two steels, a fine grained 0.5Cr-0.5Mo-0.25V steel in a normalised and tempered condition with high creep ductility and a coarse grained 1Cr-0.5Mo steel in a quenched and tempered condition with low uniaxial creep ductility, have been selected. A range of multiaxial stress testing techniques which span the stress states that would allow identification of any technique dependent variables has been used. The deformation and failure of the normalised and tempered 0.5Cr-0.5Mo-0.25V steel for a range of multiaxial test techniques and, therefore, stress states may be described by an equivalent stress criterion. The results from the multiaxial tests carried out on the fully bainitic 1Cr-0.5Mo steel show that the multiaxial stress rupture criterion (MSRC) varies with stress state; at high triaxiality (notch), it is controlled by the maximum principal stress, whereas at low triaxiality (shear) it is dependent on both maximum principal stress and equivalent stress. Furthermore, a simple description of stress state based on maximum principal and equivalent stress does not define this uniquely, since the MSRC derived from uniaxial and torsion testing does not describe the failure of notch, tube, or double shear tests. (author)
Complete Genome Sequence of the Endophytic Biocontrol Strain Bacillus velezensis CC09
Cai, Xunchao; Kang, Xingxing; Xi, Huan; Liu, Changhong; Xue, Yarong
2016-01-01
Bacillus velezensis is a heterotypic synonym of B. methylotrophicus, B. amyloliquefaciens subsp. plantarum, and Bacillus oryzicola, and has been used to control plant fungal diseases. In order to fully understand the genetic basis of antimicrobial capacities, we did a complete genome sequencing of the endophytic B.?velezensis strain CC09. Genes tightly associated with biocontrol ability, including nonribosomal peptide synthetases, polyketide synthetases, iron acquisition, colonization, and vo...
Compatibility of butorphanol and droperidol in 0.9% sodium chloride injection.
Chen, Fu-Chao; Fang, Bao-Xia; Li, Peng; Yang, Jin-Guo; Zhou, Ben-Hong
2013-03-15
The compatibility and stability of butorphanol tartrate and droperidol in polyvinyl chloride (PVC) bags and glass bottles stored at 4°C and 25°C for up to 15 days were studied. Admixtures were assessed initially and for 15 days after preparation in PVC bags and glass bottles using 0.9% sodium chloride injection as a diluent and stored at 4°C and 25°C. The initial drug concentrations were 0.08 mg/mL for butorphanol tartrate and 0.05 mg/mL for droperidol. Samples were withdrawn from each container immediately after preparation and at predetermined intervals (2, 4, 8, 24, 48, 72, 120, 168, 240, and 360 hours after preparation). The solutions were visually inspected for precipitation, cloudiness, and discoloration at each sampling interval. Drug concentrations were determined using a validated high-pressure liquid chromatography method. After 15 days of storage, all formulations tested retained >98% of the initial concentrations of both drugs. The drug mixtures were clear in appearance, and no color change or precipitation was observed. Throughout this period, pH values remained stable. Admixtures of butorphanol tartrate 0.08 mg/mL and droperidol 0.05 mg/mL in 0.9% sodium chloride injection were stable for at least 360 hours when stored in PVC bags or glass bottles at 4°C and 25°C and protected from light.
Interannual variability of chlrophyll concentration in the eastern Arabian Sea
Digital Repository Service at National Institute of Oceanography (India)
Karanje, S.
.325 Chlorophyll Conce n tra t ion (m g/m * *3) 0.2 0.29 0.28 0.26 0.26 0.23 0.26 0.22 0.3 0.25 0.075 0.091 0.097 0.09 0.098 0.079 0.088 0.07 0.085 0.087 Chlorophyll Concentration (January)1998-2007 Legend Mean_Plot 1 SD_Plot 2 Mean_Fit 1: Linear Period... Mean_Fit 1: Linear Chlorophyll Concentration (February) 1998-2007 Monthly mean chlorophyll in March during 1998 to 2007 1998 1999 2000 2001 2002 2003 2004 2005 2006 2007 Year 0.025 0.05 0.075 0.1 0.125 0.15 0.175 0.2 0.225 0.25 C h l o ro p...
2000-01-01
The CARIOCA front-end is an amplifier discriminator chip, using 0.25mm CMOS technology, developed with a very fast and low noise preamplifier. This prototype was designed to have input impedance below 10W. Measurements showed a peaking time of 14ns and noise of 450e- at zero input capacitance, with a noise slope of 37.4 e-/pF. The sensitivity of 8mV/fC remains almost unchanged up to a detector capacitance of 120pF.
Dosimetry in the region of 0.25 Mrad and 25 Mrad using cellulose triacetate films (CTA)
International Nuclear Information System (INIS)
Dafferner, J.M.
1978-01-01
The dosimetric characteristics of a cellulose triacetate dosimetric film (CTA) from different places of origin, recently placed on the market to be used in dosimetry, are investigated. The charge in the optical absorption in the ultraviolet region induced by gamma radiation of Co-60 is found to be a linear behavior with the absorbed total dose, within a range of 0.25 to 25 Megarad. For the spectrophotometric reading the wavelength of 290 nm was chosen for the French CTA film, while 294 nm was used for the Japanese one. The response of the film is stable in time after the irradiation. By means of an adequate and careful handling the response does not change. One must always maintain, in practical usage, the same conditions of irradiation and the spectrophotometric reading used in the calibration. This film appears well suited for monitoring and control the dose of industrial irradiation process such as: process that involve application of chemical effects undergo by polymers when irradiated (polymerization), radiosterilization of medical products and equipments, food sterillization etc. (Author) [pt
Spin glass behavior in nanogranular La{sub 0.25}Ca{sub 0.75}MnO{sub 3} manganites
Energy Technology Data Exchange (ETDEWEB)
Fernández-Martínez, Antoni [Grup de Magnetisme, Dept. Física Fonamental, Facultat de Física, Universitat de Barcelona, Martí i Franquès 1, planta 4, edifici nou, 08028 Barcelona (Spain); Institut de Nanociència i Nanotecnologia IN" 2UB, Universitat de Barcelona, Martí i Franquès 1, planta 3, edifici nou, 08028 Barcelona (Spain); García-Santiago, Antoni, E-mail: agarciasan@ub.edu [Grup de Magnetisme, Dept. Física Fonamental, Facultat de Física, Universitat de Barcelona, Martí i Franquès 1, planta 4, edifici nou, 08028 Barcelona (Spain); Institut de Nanociència i Nanotecnologia IN" 2UB, Universitat de Barcelona, Martí i Franquès 1, planta 3, edifici nou, 08028 Barcelona (Spain); Hernàndez, Joan Manel [Grup de Magnetisme, Dept. Física Fonamental, Facultat de Física, Universitat de Barcelona, Martí i Franquès 1, planta 4, edifici nou, 08028 Barcelona (Spain); Institut de Nanociència i Nanotecnologia IN" 2UB, Universitat de Barcelona, Martí i Franquès 1, planta 3, edifici nou, 08028 Barcelona (Spain); Zhang, Tao [Key Laboratory of Materials Physics, Institute of Solid State Physics, Chinese Academy of Sciences, Hefei 230031 (China)
2014-06-01
The magnetic properties of two nanogranular La{sub 0.25}Ca{sub 0.75}MnO{sub 3} manganites with different average grain sizes have been studied. Besides the well-known exchange bias effect and the appearance of ferromagnetic clusters in the grains of both samples, the results show the occurrence of an antiferromagnetic transition and spin-glass properties. Both samples are described as core–shell magnetic systems, whose main difference is found in the interface between the outer ferromagnetic and the inner antiferromagnetic phases of the grains. - Highlights: • Nanogranular manganites show antiferromagnetism in magnetic measurements. • Exchange bias effect was observed in magnetic hysteresis cycles. • Spin-glass properties were detected at low temperatures. • A core-shell model was applied to describe the results in both samples. • These features have nothing to do with usual properties of nanoparticle manganites.
Directory of Open Access Journals (Sweden)
YUPING MA
2016-01-01
Full Text Available ABSTRACT A soil isolate, Penicillium janthinellum sw09 has been found to produce significant amounts of an extracellular pectinase subsequently characterized as exo-polygalacturonase (exo-PG. By optimizing growth conditions, P. janthinellum sw09 produced high amount of exo-PG (16.54 units/mL. The crude enzyme was purified by gel filtration chromatography and two exo-PG activity peaks (designated as PGI and PGII were revealed. On SDS-PAGE analysis, purified PGII using DEAE-Sepharose FF column, was found to be a single band with a molecular mass of 66.2 kDa. The purified PGII exhibited maximal activity at the temperature of 45 oC and pH 5.0. The stability profiles show that PGII is more stable in the pH range of 4.0-8.0 and below 60 oC. The Km and Vmax for the enzyme was 1.74 mg/mL and 18.08 μmol/ (mL•min, respectively. Due to this enzymatic characterization, this pectinase is an attractive candidate for applications in degradation of pectin.
Directory of Open Access Journals (Sweden)
Yenilen Troche Concepción
2010-09-01
Full Text Available El colirio de ketotifeno se indica para aliviar los signos y síntomas de las conjuntivitis alérgicas, por ser este un potente antihistamínico H1 que muestra cierta capacidad para inhibir la liberación de histamina y otros mediadores en mastocitos. En este trabajo se desarrolló y validó un método analítico por cromatografía líquida de alta resolución, para el control de la calidad y los estudios de estabilidad del ketotifeno colirio 0,025 %. El método se basó en la separación del principio activo a través una columna cromatográfica Lichrosorb RP-18 (5 µm (250 x 4 mm, con detección ultravioleta a 296 nm, para lo cual se empleó una fase móvil compuesta por una mezcla desgasificada de metanol:buffer fosfato (75:25; pH 8,5 y se le añadió 1 mL de isopropanol por cada 1 000 mL de la mezcla anterior, con una velocidad de flujo de 1,2 mL/min. El método analítico resultó lineal, preciso, específico y exacto en el intervalo de concentraciones estudiadas.The Ketotiphen eyedrop is prescribed to relief the signs and symptoms of allergic conjunctivitis due to its potent H1 antihistaminic effect showing some ability to inhibit the histamine release and other mediators in cases of mastocytosis. The aim of present paper was to develop and validate an analytical method for the high-performance liquid chromatography, to quality control and the stability studies of 0.025 % eyedrop Ketotiphen. Method was based on active principle separation by means of a Lichrosorb RP-18 (5 µm (250 x 4 mm, with UV detection to 296 nm using a mobile phase including a non-gasified mixture of methanol:buffer-phosphate (75:25; pH 8.5 adding 1 mL of Isopropanol by each 1 000 mL of the previous mixture at a 1.2 mL/min flow velocity. The analytical method was linear, accurate, specific and exact during the study concentrations.
Directory of Open Access Journals (Sweden)
Rajasekar Thirunavukkarasu
2013-08-01
Full Text Available Objective: Fresh marine seaweeds Gracilaria edulis, Gracillaria verrcosa, Acanthospora spicifera, Ulva facita, Ulva lacta (U. lacta, Kappaphycus spicifera, Sargassum ilicifolium, Sargassum wightii (S. wightii, Padina tetramatica and Padina gymonospora were collected from Mandapam (Rameshwaram, Tamil Nadu of South East coast of India and were screened for antibacterial activity. Methods: All the collected seaweeds were extracted by using five different solvent (methanol, isopropanol, acetone, chloroform, diethyl ether to study their extracts against fish pathogenic bacteria V. alginolyticus (VA09 purchased from MTCC. And minimum inhibition carried out by using Resazurin micro-titre assay. Crude extract of S. wightii analysied by FTIR. Results: The methanolic extract of S. wightii produced a maximum zone of inhibition (1.95±0.11 cm, isopropanol extract maximum inhibition was produced by S. wightii (1.93±0.78 cm, Acetone extract of Gracilaria verrcosa showed maximum zone of inhibition (1.36±0.05 cm, chloroform extract of S. wightii produced a maximum zone (1.56±0.25 cm and diethyl ether extract of S. wightii produced maximum zone of inhibition(1.86±0.11 cm. Based on the antibacterial activity S. wightii, U. lacta and Padina tetramatica showed best antibacterial activity against Vibrio harveyi. In this three seaweeds were taken for MIC study. The S. wightii methanolic extract, U. lacta diethyl ether extract and Padina tetramatica methanolic extract showed a higher MIC values, and despectively were 25 mg/mL, 50 mg/mL and 50 mg/mL. FTIR result showed that mostly phenolic compounds were present in the S. wightii. Conclusions: Based on the FTIR result S. wightii have high amount of phenolic compound. Phenolic compound have the good antimicrobial activity. The results clearly show that seaweed S. wightii is an interesting source for biologically active compounds that may be applied for prophylaxis and therapy of bacterial fish diseases and it should
Broadband electron spin resonance in a nanosized La{sub 0.25}Ca{sub 0.75}MnO{sub 3} manganite
Energy Technology Data Exchange (ETDEWEB)
Fernàndez-Martínez, Antoni; García-Santiago, Antoni, E-mail: agarciasan@ub.edu; Hernàndez, Joan Manel [Grup de Magnetisme, Departament de Física Fonamental, Facultat de Física, Universitat de Barcelona, Martí i Franquès 1, planta 4, 08028 Barcelona (Spain); Institut de Nanociència i Nanotecnologia IN2UB, Universitat de Barcelona, Martí i Franquès 1, planta 3, edifici nou, 08028 Barcelona (Spain); Zhang, Tao [Key Laboratory of Materials Physics, Institute of Solid State Physics, Chinese Academy of Sciences, Hefei 230031 (China)
2014-08-07
The microwave response of a nanogranular La{sub 0.25}Ca{sub 0.75}MnO{sub 3} manganite has been studied by means of broadband electron spin resonance experiments performed in a commercial magnetic properties measurement system magnetometer using two purpose-built probes. The results concur with the hydrodynamic model for spin-glass systems and allow to determine the gyromagnetic ratio and the effective uniaxial magnetic anisotropy constant in a wide range of temperatures. The thermal behavior of both magnitudes provides information about structural transitions and magnetic interactions within the nanosized grains that make the sample. The experiments enable to corroborate the validity of the applied model in this kind of magnetic systems.
Structure and delayed failure behaviour of 0.25C-Ni-Cr-Mo-V steel
International Nuclear Information System (INIS)
Kang, C.H.; Maeng, S.C.
1980-01-01
Delayed failure behaviour of the different transformation structures of 0.25C-2.5Ni-2.5Cr-0.5Mo-0.1V low alloy steel has been studied. The studied microstructures are martensite, lower bainite, and mixed structure of 50% martensite and 50% lower bainite. All these structures have been tempered at 450 deg C for 40 min to have the same tensile strength level of 143 kg/mm 2 . Delayed failure testing has been carried out with cantilever bend tester, in distilled water at 25 deg C. By comparing K 1 sub(scc) values, lower bainitic structure has shown the highest value, although it is only slightly higher than that of the martensitic structure. Mixed structure has the lowest resistance to delayed failure. The fracture modes of both martensitic and mixed structures have been observed as intergranular. In the martensitic structure, however, it is noticeable that there is a larger amount of ductile tearing between intergranular facets. The fracture mode of lower bainitic structure is the mixed topography of microplastic tearing and microvoid coalescence. The above experimental results are discussed in terms of Oriani's decohesion theory of hydrogen embrittlement. The lowest resistance of the mixed structure to delayed failure may be due to the enhanced decohesion by hydrogen at the phase boundaries of martensite and lower bainite. (author)
RESEARCH OF SYNERGETIC RELIABILITY OF PEARLITE-REDUCED STRUCTURAL STEEL 09G2FB
Directory of Open Access Journals (Sweden)
Gustov Yuriy Ivanovich
2012-10-01
Full Text Available The primary objective of the research is the synergetic reliability of perlite-reduced structural steel 09G2FB exposed to various thermal and mechanical treatments. In the aftermath of the above exposure, the steel in question has proved to assume a set of strength-related and plastic mechanical properties (σσδ and ψ.
International Nuclear Information System (INIS)
Ezzati, S. Noushin; Rabbani, Mahboubeh; Leblanc, Roger M.; Asadi, Ebadullah; Ezzati, S. Mohammad H.; Rahimi, Rahmatollah; Azodi-Deilami, Saman
2015-01-01
In this contribution, Ni/Mn doped Barium Strontium Ferrite nanoparticles (Ba 0.25 Sr 0.75 Fe 11 (Ni 0.5 Mn 0.5 )O 19 ) and conducting polyaniline/Ba 0.25 Sr 0.75 Fe 11 (Ni 0.5 Mn 0.5 )O 19 nanocomposite were fabricated successfully through sol–gel method and in-situ polymerization technique, respectively. Field emission scanning electron microscope (FESEM), Energy-dispersive X-ray spectroscopy analysis (EDX), X-ray powder diffraction (XRD), Mössbauer spectroscopic measurements and Fourier transform infrared spectroscope (FT-IR) analyses were adopted to confirm the composition, morphology and structure of materials. The obtained results revealed the formation of hexagonal M-type rod-shape ferrite with average particle size of about 45 nm (according to XRD data, using Debye–Scherre formula). The saturation magnetization of ferrite nanoparticles and PANI/Ferrite nanocomposite reported 44.03 and 9.85 emu/g, respectively, using vibrant sample magnetometer (VSM). Standard four-point-probe technique was employed to measure the conductivity of samples. Also optical characteristic of samples was examined by means of UV–Vis and Diffuse Reflectance Spectra (DRS) techniques which proved the formation of conducting coating of emeraldine on the surface of magnetic nanoparticles. Also the UV–vis studies indicated that the ferrite nanoparticles have an optical band gap of 1.8 eV while the values of 1.65 and 2.66 eV obtained for PANI/Ferrite nanocomposite. Finally, the microwave absorption properties of prepared nanoferrite and nanocomposite at different thicknesses (2, 3 and 4 mm) were determined at the X-band (8–12 GHz) using vector network analyzer (VNA). In this study, minimum reflection loss of −21.68 dB and maximum available bandwidth of 4.8 GHz were obtained for PANI/Ferrite (20 wt% ferrite) at the frequency of 10.6 GHz. The results suggested the fabricated nanocomposite could be a suitable candidate for decreasing radar signature. - Highlights: • Polyaniline
International Nuclear Information System (INIS)
Yang, Mingzhu; Chang, Benkang; Wang, Meishan
2015-01-01
Highlights: • Adsorption energy of Cs adsorption on Al 0.25 Ga 0.75 N(0 0 0 1) surface increases as the increasing of Cs coverage. • Electrons transfer from Cs adatoms to substrate during Cs adsorption process, meanwhile the transfer efficiency decreases as Cs coverage increases. • The length of Ga-N bond in the first and second bilayers increases after Cs adsorption. • There appear new energy bands at −25 to −23 eV and −14 to −10 eV, which were induced by Cs 5s and Cs 5p state electrons respectively. - Abstract: We investigate cesium adsorption on Al 0.25 Ga 0.75 N(0 0 0 1) surface at different coverages using first principle method based on density functional theory. Adsorption energies, atomic structure, Mulliken charge distribution, electron transfer, band structures, and density of states of the adsorption systems corresponding to different Cs coverages were obtained. Total-energy calculations show that cesium adsorption on Al 0.25 Ga 0.75 N(0 0 0 1) surface is more and more difficult as the increase of cesium coverage. A single cesium adatom is preferred to locate at the top of Ga atom (T Ga ). Meanwhile, it is not the most stable configuration when two cesium atoms were located on the top of two Ga neighbors at the same time. This is mainly because the distance of Cs adatoms is so small that repulsive force between adatoms rises. At low coverage, electrons transfer from Cs adatom to Ga atoms on the topmost and second topmost bilayers. Meanwhile, the efficiency of electron transfer decreases as the increasing of Cs coverage. There appear new bands at −25 to −23 eV and −14 to −10 eV, which were caused by Cs 5s and Cs 5p state electrons. Under the joint effect of Cs 5s and 5p state electrons, density of states at Fermi level increases, and the adsorption surfaces show more metal properties. Electrons transferring from Cs adatoms to Al 0.25 Ga 0.75 N substrate induces dipole moment, which is useful to lower work function. What is more
Advanced Power Batteries for Renewable Energy Applications 3.09
Energy Technology Data Exchange (ETDEWEB)
Shane, Rodney [East Penn Manufacturing Company, Inc., Lyon Station, PA (United States)
2011-12-01
This report describes the research that was completed under project title Advanced Power Batteries for Renewable Energy Applications 3.09, Award Number DE-EE0001112. The report details all tasks described in the Statement of Project Objectives (SOPO). The SOPO includes purchasing of test equipment, designing tooling, building cells and batteries, testing all variables and final evaluation of results. The SOPO is included. There were various types of tests performed during the project, such as; gas collection, float current monitoring, initial capacity, high rate partial state of charge (HRPSoC), hybrid pulse power characterization (HPPC), high rate capacity, corrosion, software modeling and solar life cycle tests. The grant covered a period of two years starting October 1, 2009 and ending September 30, 2011.
FY09 recycling opportunity assessment for Sandia National Laboratories/New Mexico.
Energy Technology Data Exchange (ETDEWEB)
McCord, Samuel Adam
2010-07-01
This Recycling Opportunity Assessment (ROA) is a revision and expansion of the FY04 ROA. The original 16 materials are updated through FY08, and then 56 material streams are examined through FY09 with action items for ongoing improvement listed for most. In addition to expanding the list of solid waste materials examined, two new sections have been added to cover hazardous waste materials. Appendices include energy equivalencies of materials recycled, trends and recycle data, and summary tables of high, medium, and low priority action items.
Directory of Open Access Journals (Sweden)
Patrícia Prado Faria
2011-12-01
Full Text Available The fundamental role of knowledge creation is to serve as a reference for practitioners and for researchers. Therefore, the comprehension of the knowledge status referring to a certain subject, in a certain moment, is necessary for science evolution. This article is a bibliometric research, studying the state of art of the articles approved for publication in 2007-09 Enanpads in its Consumer Behaviour theme of interest in the Marketing Academic Division. The quantitative distribution of the articles was studied, along with the number of authors by article, the institutions that took part in the congresses considering their geographic region, their state and their capital origin, the frequency of the researchers´ participation, their affiliation, and methodological aspects of the articles. Among the various conclusions brought by this research, it was found that the referred theme remains important in the congress, that the government schools of southern and southeastern Brazil have a predominant presence, and that the quantitative approach remains dominant for researchersO papel fundamental da produção do conhecimento é o de servir de referência para praticantes e para estudiosos. Portanto, a compreensão do estado de conhecimento sobre determinado tema, em determinado momento, é necessária ao processo de evolução da ciência. Este artigo contribui com levantamento bibliométrico na área de Marketing, pesquisando o estado da arte dos trabalhos aprovados nos Enanpads do triênio 2007-09 na Divisão Acadêmica Marketing, especificamente no tema de interesse Comportamento do Consumidor. Foram avaliados a distribuição quantitativa dos trabalhos, o número de autores por trabalho, as instituições participantes dos eventos, suas representatividades estaduais, regionais e por origem do capital, a intensidade da participação dos pesquisadores por instituição de afiliação, e aspectos metodológicos dos artigos apresentados. Dentre as
He, Jie; Figueroa, Deborah A; Lim, Tze-Peng; Chow, Diana S; Tam, Vincent H
2010-07-15
The stability of polymyxin B sulfate in infusion bags containing 0.9% sodium chloride injection stored at 4 and 25 degrees C was studied. Seven manufacturing batches of polymyxin B from different sources were tested. The products were reconstituted in sterile water for injection, diluted in infusion bags containing 0.9% sodium chloride injection, and stored at room temperature (25 degrees C) or under refrigeration (4 degrees C). Samples were withdrawn at the same time on days 0, 1, 2, 3, 5, and 7. A modified microbiological assay was used to determine the concentrations, as indicated by zones of inhibition, of polymyxin B. Bordetella bronchiseptica served as the reference organism. Stability was defined as retention of >90% of the initial concentration. The decomposition kinetics of polymyxin B in 0.9% sodium chloride injection were evaluated by plotting the polymyxin B concentration remaining versus time. On average, the samples retained over 90% of their initial concentration for up to two days at both storage temperatures. All samples retained over 90% of their initial concentration at 24 hours. The decomposition kinetics of polymyxin B in infusion bags containing 0.9% sodium chloride injection exhibited pseudo-first-order kinetics, with rate constants of 0.024-0.075 day(-1) at 25 degrees C and 0.022-0.043 day(-1) at 4 degrees C (p > 0.05). Polymyxin B was stable for at least one day when stored at 4 or 25 degrees C in infusion bags containing 0.9% sodium chloride injection. Stability did not differ significantly between the two storage temperatures.
Development of 650 MHz (β=0.9) single-cell SCRF cavity
International Nuclear Information System (INIS)
Bagre, M.; Jain, V.; Yedle, A.; Maurya, T.; Yadav, A.; Puntambekar, A.; Goswami, S.G.; Choudhary, R.S.; Sandha, S.; Dwivedi, J.; Kane, G.V.; Mahawar, A.; Mohania, P.; Shrivastava, P.; Sharma, S.; Gupta, R.; Sharma, S.D.; Joshi, S.C.; Mistri, K.K.; Prakash, P.N.
2013-01-01
Raja Ramanna Centre for Advanced Technology has initiated the work on development of Superconducting Radio Frequency (SCRF) cavities and associated technologies as part of R and D activities for upcoming Spallation Neutron Source (SNS) project involving superconducting Linear Accelerator (LINAC). It is planned to use 650 MHz SCRF cavities for the medium and high energy section of the proposed LINAC. Under Indian Institution Fermilab Collaboration (IIFC), Raja Ramanna Centre for Advanced Technology is also working on development of 650 MHz (β=0.9) SCRF cavities proposed to be used in the high energy section of Project-X at FNAL. The work has been initiated with design and development of 650 MHz single cell SCRF cavity. FE analysis was done to estimate change in frequency with temperature as well as to estimate the frequency of the cavity at different cavity manufacturing stages. The development cycle comprises of design and manufacturing of forming tooling, machining, welding and RF measurement fixtures as well as design for manufacturing. The half-cell and beam tubes forming and machining of all parts were done using in-house facilities. The Electron beam welding was carried out at Inter-University Accelerator Centre (IUAC), New Delhi under a MoU. One 650 MHz single cell SCRF cavity has been recently manufactured. In this paper we present the development efforts on manufacturing and pre-qualification of 650 MHz (β=0.9) single cell SCRF cavity. (author)
THE FERMI-GBM X-RAY BURST MONITOR: THERMONUCLEAR BURSTS FROM 4U 0614+09
International Nuclear Information System (INIS)
Linares, M.; Chakrabarty, D.; Connaughton, V.; Bhat, P. N.; Briggs, M. S.; Preece, R.; Jenke, P.; Kouveliotou, C.; Wilson-Hodge, C. A.; Van der Horst, A. J.; Camero-Arranz, A.; Finger, M.; Paciesas, W. S.; Beklen, E.; Von Kienlin, A.
2012-01-01
Thermonuclear bursts from slowly accreting neutron stars (NSs) have proven difficult to detect, yet they are potential probes of the thermal properties of the NS interior. During the first year of a systematic all-sky search for X-ray bursts using the Gamma-ray Burst Monitor aboard the Fermi Gamma-ray Space Telescope we have detected 15 thermonuclear bursts from the NS low-mass X-ray binary 4U 0614+09 when it was accreting at nearly 1% of the Eddington limit. We measured an average burst recurrence time of 12 ± 3 days (68% confidence interval) between 2010 March and 2011 March, classified all bursts as normal duration bursts and placed a lower limit on the recurrence time of long/intermediate bursts of 62 days (95% confidence level). We discuss how observations of thermonuclear bursts in the hard X-ray band compare to pointed soft X-ray observations and quantify such bandpass effects on measurements of burst radiated energy and duration. We put our results for 4U 0614+09 in the context of other bursters and briefly discuss the constraints on ignition models. Interestingly, we find that the burst energies in 4U 0614+09 are on average between those of normal duration bursts and those measured in long/intermediate bursts. Such a continuous distribution in burst energy provides a new observational link between normal and long/intermediate bursts. We suggest that the apparent bimodal distribution that defined normal and long/intermediate duration bursts during the last decade could be due to an observational bias toward detecting only the longest and most energetic bursts from slowly accreting NSs.
Harada, M.; Sayanagi, K.; Kasaya, T.; Sawa, T.; Goto, T.; Tada, N.; Ichihara, H.; Asada, M.; Nakajima, T.; Isezaki, N.
2009-12-01
Detailed information on subsurface structure under seafloor is necessary for the estimation of seabed resources such as the hydrothermal deposit and methane hydrate. Although advantages of geophysical exploration near seafloor are expected for the seabed resource survey, efficient method has not been well-established. The authors started a project to develop exploration tools for seabed resources under the financial support of MEXT-Japan. We carry out research and development mainly regarding measurement of the magnetic field with high-resolution and high-sampling rate electric exploration devices with accurately controlled active source signals. Developed tools will be mounted underwater platforms such as deep-tow system, ROV (remotely operated vehicle), and AUV (autonomous undersea vehicle). We carried out the research cruise (vessel: JAMSTEC R/V YOKOSUKA YK09-09, cruise period: 19-29 July 2009, area surveyed: Kumano-nada, off Kii Peninsula, Japan) to investigate the performance of developed equipments for magnetic exploration. We mounted an Overhauser and two flux-gate magnetometers on the deep-tow and the AUV URASHIMA. To inspect the efficiency of equipments, it is better to measure the magnetic anomaly which is caused by known magnetic source. Therefore, we made a magnetic target which is consisted of 50 neodymium magnets. Before the navigation, the magnetic target was put under water and its position was measured by the acoustic method. The depth of target is about 2,050 meters, and the measurement was performed in the circle of a radius of about 300 meters. The vehicles were navigated at heights of 25 meters for AUV, and about 15 meters for deep-tow. Each of underwater navigation was practiced for two times. Both performances were carried out successfully, which means that we detected the significant magnetic anomalies caused by the target. We will be able to estimate three-dimensional distribution of anomalous magnetic field, and the source property of
Directory of Open Access Journals (Sweden)
Taylor Brandão Schnaider
2002-04-01
Full Text Available JUSTIFICATIVA E OBJETIVOS: Em estudo com células endoteliais de veias umbilicais humanas expostas à indometacina, foi observado aumento da atividade pró-coagulante. Estudo em coelhos comprovou a presença de trombose nas veias auriculares após administração de tenoxicam com seu diluente ou de seu diluente isolado. Não foram encontrados estudos na literatura consultada que tenham avaliado o endotélio venoso após a administração do tenoxicam, em seres humanos. O objetivo desta pesquisa foi avaliar se o tenoxicam com cloreto de sódio a 0,9% (NaCl a 0,9% provoca alterações no endotélio venoso de coelhos, como as observadas quando associado ao seu diluente (água bidestilada. MÉTODO: Noventa coelhos (2.000 - 3.500 g foram distribuídos aleatoriamente em dois grupos: Controle, com administração de NaCl a 0,9%; Experimento, com tenoxicam (20 mg associado à água bidestilada ou ao NaCl a 0,9%. O volume injetado nos dois grupos foi constante de 2 ml. A anestesia foi induzida com maleato de acepromazina, cloridrato de cetamina e cloridrato de xilazina, sendo a punção das veias auriculares caudais direita e esquerda realizada com agulha tipo borboleta 27G. Os animais foram mantidos no biotério por 6 h, 12 h e 24 h, novamente anestesiados e submetidos à eutanásia, sendo então realizada exérese das aurículas em sua base e posterior avaliação microscópica das veias. RESULTADOS: Observou-se trombose no grupo Experimento, numa porcentagem de 19,4% após administração do tenoxicam com água bidestilada e 22,2% após administração do tenoxicam com NaCl a 0,9%. No grupo Controle, em que foi injetado somente NaCl a 0,9%, nenhuma das veias apresentou trombose. CONCLUSÕES: Os resultados encontrados permitem concluir que o tenoxicam, com água bidestilada ou com solução de cloreto de sódio a 0,9%, produziu trombose nas veias em que foi injetado.JUSTIFICATIVA Y OBJETIVOS: En estudio con células endoteliales de venas umbilicales
Directory of Open Access Journals (Sweden)
Eduardo Azziz-Baumgartner
Full Text Available INTRODUCTION: While there is much information about the burden of influenza A(H1N1pdm09 in North America, little data exist on its burden in South America. METHODS: During April to December 2009, we actively searched for persons with severe acute respiratory infection and influenza-like illness (ILI in three sentinel cities. A proportion of case-patients provided swabs for influenza testing. We estimated the number of case-patients that would have tested positive for influenza by multiplying the number of untested case-patients by the proportion who tested positive. We estimated rates by dividing the estimated number of case-patients by the census population after adjusting for the proportion of case-patients with missing illness onset information and ILI case-patients who visited physicians multiple times for one illness event. RESULTS: We estimated that the influenza A(H1N1pdm09 mortality rate per 100,000 person-years (py ranged from 1.5 among persons aged 5-44 years to 5.6 among persons aged ≥ 65 years. A(H1N1pdm09 hospitalization rates per 100,000 py ranged between 26.9 among children aged <5 years to 41.8 among persons aged ≥ 65 years. Influenza A(H1N1pdm09 ILI rates per 100 py ranged between 1.6 among children aged <5 to 17.1 among persons aged 45-64 years. While 9 (53% of 17 influenza A(H1N1pdm09 decedents with available data had obesity and 7 (17% of 40 had diabetes, less than 4% of surviving influenza A(H1N1pdm09 case-patients had these pre-existing conditions (p ≤ 0.001. CONCLUSION: Influenza A(H1N1pdm09 caused a similar burden of disease in Argentina as in other countries. Such disease burden suggests the potential value of timely influenza vaccinations.
APAN, Alpaslan; SARI, Filiz; EKMEKÇİ, Alp Burak
2010-01-01
To compare postoperative analgesia provided by single shot "3-in-1" femoral nerve blockade using 0.25% or 0.375% levobupivacaine in preceding with spinal anesthesia for unilateral total knee replacement surgery. Materials and methods: Forty consenting patients undergoing unilateral total knee arthroplasty were included in this prospective randomized study. Spinal anesthesia was achieved with 15 mg plain bupivacaine at the L3-4 or L4-5 interspace. After resolution of the sp...
Godet , Sylvain; Tournier , Éric; Llopis , Olivier; Cathelin , Andreia; Juyon , Julien
2009-01-01
4 pages; International audience; The design and realization of an ultra-low noise operational amplifier is presented. Its applications are integrated low-frequency noise measurements in electronic devices and on-chip phase-noise measurement circuit. This paper discusses the SiGe:C BiCMOS 0.25 µm design improvements used for low noise applications. The proposed three-stage operational amplifier uses parallel bipolar transistor connection as input differential pair for low noise behavior. This ...
Anion Binding by Meta Ureido-substituted Thiacalix[4]arenes
Czech Academy of Sciences Publication Activity Database
Kundrát, O.; Eigner, V.; Cuřínová, Petra; Kroupa, J.; Lhoták, P.
2011-01-01
Roč. 67, č. 43 (2011), s. 8367-8372 ISSN 0040-4020 R&D Projects: GA ČR GA203/09/0691; GA AV ČR IAAX08240901 Institutional support: RVO:67985858 Keywords : calixarene * meta nitration * recognition Subject RIV: CC - Organic Chemistry Impact factor: 3.025, year: 2011
International Nuclear Information System (INIS)
Ross, S.B.; Oegren, S.-O.; Renyi, A.L.
1976-01-01
The inhibition of the uptake of 3 H-(-)-noradrenaline (NA), 3 H-dopamine and 14 C-5-hydroxytryptamine (5-HT) in mouse brain slices by (Z)-3-dimethylamino-1-(4-bromophenyl)-1-(3-pyridyl)propene(H 102/09), desipramine and chlorimipramine and their releasing effect on the 3 H-amines previously accumulated in the slices were examined. The interactions with reserpine produced hypothermia and sedation and the 5-hydroxytryptophan (5-HTP) syndrome in mice were also studied. Due to the poor inhibitory activity on the NA uptake H 102/09 was a more selective inhii.or of the 5-HT uptake than was chlorimipramine, particularly after administration in vivo, where it was as potent as chlorimipramine (ED50=19μmol/kg intraperitoneally). In vitro chlorimipramine was 6 to 12 times more active than H 102/09. Desipramine was a very selective inhibitor of the NA uptake in vitro and in vivo. The compounds were generally more potent in inhibiting the uptake than in releasing the amines. However, in striatal slices the inhibition of DA uptake could be due to the releasing effect since the difference in potencies were small. The effect of desipramine on 5-HT uptake and that of H102/09 on NA uptake could also involve a release component. The 5-HTP syndrome was potentiated by H 102/09 and chlorimipramine but not by desipramine. The reserpine hypothermia but not the sedation was potently antagonized and reversed by desipramine and by chlorimipramine at high doses but not by H 102/09, suggested that NA but not 5-HT is involved in the hypothermic action of reserpine. (author)
Kennedy, Emma-Kate
2015-01-01
A key principle upon which the Revised Special Educational Needs and Disability (SEND) Code of Practice 0-25 (2015) is based is children's involvement in decision-making that affects them, and a significant change is the removal of the term "behaviour" and an emphasis on social, emotional and mental health (SEMH) needs. To ensure that…
Energy Technology Data Exchange (ETDEWEB)
Palcheva, R., E-mail: radost@ic.bas.bg [InGAP Centre for Research-based Innovation, SMN, University of Oslo, PO Box 1033, Blindern, Oslo 0315 Norway (Norway); Olsbye, U.; Palcut, M. [InGAP Centre for Research-based Innovation, SMN, University of Oslo, PO Box 1033, Blindern, Oslo 0315 Norway (Norway); Rauwel, P. [Department of Physics, SMN, University of Oslo, PO Box B 1048 Blindern, Oslo 0316 (Norway); Tyuliev, G.; Velinov, N. [Institute of Catalysis, Bulgarian Academy of Sciences, G. Bonchev Str., Bldg. 11, Sofia 1113 (Bulgaria); Fjellvåg, H.H. [InGAP Centre for Research-based Innovation, SMN, University of Oslo, PO Box 1033, Blindern, Oslo 0315 Norway (Norway)
2015-12-01
Graphical abstract: - Highlights: • Perovskites type-oxide La{sub 0.75}Sr{sub 0.25}(Fe{sub 0.8}Co{sub 0.2}){sub 1−x}Ga{sub x}O{sub 3-δ} (x = 0.1, 0.25, 0.4) prepared by the sol–gel citrate method. • Bulk and surface analysis to determine catalysts composition evolution. • Anaerobic catalytic partial oxidation of methane to syngas at 600 °C in a pulse apparatus over Rh promoted perovskites. • The catalysts showed high stability and selectivity. - Abstract: Synthesis gas production via selective oxidation of methane at 600 °C in a pulse reaction over La{sub 0.75}Sr{sub 0.25}(Fe{sub 0.8}Co{sub 0.2}){sub 1−x}Ga{sub x}O{sub 3-δ} (x = 0.1, 0.25, 0.4) perovskite-supported rhodium catalysts, was investigated. The perovskite oxides were prepared by sol–gel citrate method and characterized by X-ray Diffraction (XRD), Moessbauer Spectroscopy (MS), Temperature Programmed Reduction (TPR-H{sub 2}), X-ray Photoelectron Spectroscopy (XPS) and High Resolution Transmission Electron Microscopy (HRTEM). According to XRD analysis, the synthesized samples were a single perovskite phase. The perovskite structure of Ga substituted samples remained stable after TPR-H{sub 2}, as confirmed by XRD. Data of MS identified Fe{sup 3+} ions in two distinctive coordination environments, and Fe{sup 4+} ions. The Rh{sub 2}O{sub 3} thin overlayer was detected by the HRTEM for the Rh impregnated perovskite oxides. During the interaction of methane with oxidized perovskite-supported Rh (0.5 wt.%) catalysts, besides CO, H{sub 2}, and surface carbon, CO{sub 2} and H{sub 2}O were formed. The Rh perovskite catalyst with x = 0.25 gallium exhibits the highest catalytic activity of 83% at 600 °C. The CO selectivity was affected by the reducibility of La{sub 0.75}Sr{sub 0.25}(Fe{sub 0.8}Co{sub 0.2}){sub 1−x}Ga{sub x}O{sub 3-δ} perovskite materials.
HIV-1 and its gp120 inhibits the influenza A(H1N1)pdm09 life cycle in an IFITM3-dependent fashion.
Mesquita, Milene; Fintelman-Rodrigues, Natalia; Sacramento, Carolina Q; Abrantes, Juliana L; Costa, Eduardo; Temerozo, Jairo R; Siqueira, Marilda M; Bou-Habib, Dumith Chequer; Souza, Thiago Moreno L
2014-01-01
HIV-1-infected patients co-infected with A(H1N1)pdm09 surprisingly presented benign clinical outcome. The knowledge that HIV-1 changes the host homeostatic equilibrium, which may favor the patient resistance to some co-pathogens, prompted us to investigate whether HIV-1 infection could influence A(H1N1)pdm09 life cycle in vitro. We show here that exposure of A(H1N1)pdm09-infected epithelial cells to HIV-1 viral particles or its gp120 enhanced by 25% the IFITM3 content, resulting in a decrease in influenza replication. This event was dependent on toll-like receptor 2 and 4. Moreover, knockdown of IFITM3 prevented HIV-1 ability to inhibit A(H1N1)pdm09 replication. HIV-1 infection also increased IFITM3 levels in human primary macrophages by almost 100%. Consequently, the arrival of influenza ribonucleoproteins (RNPs) to nucleus of macrophages was inhibited, as evaluated by different approaches. Reduction of influenza RNPs entry into the nucleus tolled A(H1N1)pdm09 life cycle in macrophages earlier than usual, limiting influenza's ability to induce TNF-α. As judged by analysis of the influenza hemagglutin (HA) gene from in vitro experiments and from samples of HIV-1/A(H1N1)pdm09 co-infected individuals, the HIV-1-induced reduction of influenza replication resulted in delayed viral evolution. Our results may provide insights on the mechanisms that may have attenuated the clinical course of Influenza in HIV-1/A(H1N1)pdm09 co-infected patients during the recent influenza form 2009/2010.
HIV-1 and its gp120 inhibits the influenza A(H1N1pdm09 life cycle in an IFITM3-dependent fashion.
Directory of Open Access Journals (Sweden)
Milene Mesquita
Full Text Available HIV-1-infected patients co-infected with A(H1N1pdm09 surprisingly presented benign clinical outcome. The knowledge that HIV-1 changes the host homeostatic equilibrium, which may favor the patient resistance to some co-pathogens, prompted us to investigate whether HIV-1 infection could influence A(H1N1pdm09 life cycle in vitro. We show here that exposure of A(H1N1pdm09-infected epithelial cells to HIV-1 viral particles or its gp120 enhanced by 25% the IFITM3 content, resulting in a decrease in influenza replication. This event was dependent on toll-like receptor 2 and 4. Moreover, knockdown of IFITM3 prevented HIV-1 ability to inhibit A(H1N1pdm09 replication. HIV-1 infection also increased IFITM3 levels in human primary macrophages by almost 100%. Consequently, the arrival of influenza ribonucleoproteins (RNPs to nucleus of macrophages was inhibited, as evaluated by different approaches. Reduction of influenza RNPs entry into the nucleus tolled A(H1N1pdm09 life cycle in macrophages earlier than usual, limiting influenza's ability to induce TNF-α. As judged by analysis of the influenza hemagglutin (HA gene from in vitro experiments and from samples of HIV-1/A(H1N1pdm09 co-infected individuals, the HIV-1-induced reduction of influenza replication resulted in delayed viral evolution. Our results may provide insights on the mechanisms that may have attenuated the clinical course of Influenza in HIV-1/A(H1N1pdm09 co-infected patients during the recent influenza form 2009/2010.
Process margin enhancement for 0.25-μm metal etch process
Lee, Chung Y.; Ma, Wei Wen; Lim, Eng H.; Cheng, Alex T.; Joy, Raymond; Ross, Matthew F.; Wong, Selmer S.; Marlowe, Trey
2000-06-01
This study evaluates electron beam stabilization of UV6, a positive tone Deep-UV (DUV) resist from Shipley, for a 0.25 micrometer metal etch application. Results are compared between untreated resist and resist treated with different levels of electron beam stabilization. The electron beam processing was carried out in an ElectronCureTM flood electron beam exposure system from Honeywell International Inc., Electron Vision. The ElectronCureTM system utilizes a flood electron beam source which is larger in diameter than the substrate being processed, and is capable of variable energy so that the electron range is matched to the resist film thickness. Changes in the UV6 resist material as a result of the electron beam stabilization are monitored via spectroscopic ellipsometry for film thickness and index of refraction changes and FTIR for analysis of chemical changes. Thermal flow stability is evaluated by applying hot plate bakes of 150 degrees Celsius and 200 degrees Celsius, to patterned resist wafers with no treatment and with an electron beam dose level of 2000 (mu) C/cm2. A significant improvement in the thermal flow stability of the patterned UV6 resist features is achieved with the electron beam stabilization process. Etch process performance of the UV6 resist was evaluated by performing a metal pattern transfer process on wafers with untreated resist and comparing these with etch results on wafers with different levels of electron beam stabilization. The etch processing was carried out in an Applied Materials reactor with an etch chemistry including BCl3 and Cl2. All wafers were etched under the same conditions and the resist was treated after etch to prevent further erosion after etch but before SEM analysis. Post metal etch SEM cross-sections show the enhancement in etch resistance provided by the electron beam stabilization process. Enhanced process margin is achieved as a result of the improved etch resistance, and is observed in reduced resist side
Ueda, Yu; Odunayo, Adesola; Mann, F A
2013-01-01
To determine whether heparinized saline would be more effective in maintaining the patency of peripheral IV catheters in dogs compared to 0.9% sodium chloride. Prospective blinded randomized study. University Veterinary Teaching Hospital. Thirty healthy purpose bred dogs, intended for use in the junior surgery laboratory, were utilized. The dogs were randomized into 1 of 3 groups, 2 treatment groups and a control group. An 18-Ga cephalic catheter was placed in the cephalic vein of each dog. Each dog in the treatment group had their catheter flushed with either 10 IU/mL heparinized saline or 0.9% sodium chloride every 6 hours for 42 hours. The dogs in the control group did not have their catheters flushed until the end of the study period. Immediately prior to flushing catheters, each catheter was evaluated for patency by aspiration of blood and the catheter site was evaluated for phlebitis. All dogs in the heparinized saline and 0.9% sodium chloride group had catheters that flushed easily at each evaluation point. More dogs in the saline group had catheters from which blood could not be aspirated, but there was no significant difference between these groups. All dogs in the control group had catheters that flushed easily at the end of the assigned 6 hour interval except in 1 dog. Phlebitis was not detected in any dog. Flushes of 0.9% sodium chloride were found to be as effective as 10 IU/mL heparinized saline flushes in maintaining patency of 18-Ga peripheral venous catheters in dogs for up to 42 hours. For peripheral catheters placed with the intention of performing serial blood draws, heparinized flushes may be warranted. © Veterinary Emergency and Critical Care Society 2013.
Grave, Kari; Greko, Christina; Kvaale, Mari K; Torren-Edo, Jordi; Mackay, David; Muller, Arno; Moulin, Gerard
2012-12-01
To identify trends and patterns of sales of veterinary antimicrobial agents in nine European countries during 2005-09 in order to document the situation. Existing sales data, in tonnes of active ingredients, of veterinary antimicrobial agents by class were collected from nine European countries in a standardized manner for the years 2005-09 (one country for 2006-09). A population correction unit (PCU) is introduced as a proxy for the animal population potentially treated with antimicrobial agents. The sales data are expressed as mg of active substance/PCU. Data coverage was reported to be 98%-100% for the nine countries. Overall, sales of veterinary antimicrobials agents, in mg/PCU, declined during the reporting period in the nine countries. Substantial differences in the sales patterns and in the magnitude of sales of veterinary antimicrobial agents, expressed as mg/PCU, between the nine countries are observed. The major classes sold were penicillins, sulphonamides and tetracyclines. The sales accounted for by the various veterinary antimicrobial agents have changed substantially for most countries. An increase in the sales of third- and fourth-generation cephalosporins and fluoroquinolones were observed for the majority of the countries. Through re-analysis of existing data by application of a harmonized approach, an overall picture of the trends in the sales of veterinary antimicrobial agents in the nine countries was obtained. Notable differences in trends in sales between the countries were observed. Further studies, preferably including data by animal species, are needed to understand the factors that explain these observations.
Abdallah, F. B.; Benali, A.; Triki, M.; Dhahri, E.; Graça, M. P. F.; Valente, M. A.
2018-05-01
The effect of annealing temperature on the structure, morphology and dielectric properties of La0.75Ba0.25FeO3 compound prepared by the sol-gel method was investigated. The increase of the annealing temperature from 900 to 1100 °C, promotes an increase of the average grain size value. Two dielectric relaxations are detected using the dielectric modulus formalism, attributed to grain and grain boundary relaxations. This behavior was confirmed by both Nyquist and Argand's plots of dielectric impedance and Modulus results at different measuring temperatures. The ac conductivity could be described by Jonscher's power law revealing the presence of both overlapping large polaron tunneling and non-overlapping small polaron tunneling mechanisms.
Directory of Open Access Journals (Sweden)
Fengyan Zhang
2013-01-01
Full Text Available CuIn0.75Ga0.25S2 (CIGS thin film solar cells have been successfully fabricated using CIGS Wurtzite phase nanoparticles for the first time. The structure of the cell is Glass/Mo/CIGS/CdS/ZnO/ZnO:Al/Ag. The light absorption layer is made from CIGS Wurtzite phase nanoparticles that are formed from single-source precursors through a microwave irradiation. The Wurtzite phase nanoparticles were converted to Chalcopyrite phase film through a single-step annealing process in the presence of argon and sulfur at 450°C. The solar cell made from Wurtzite phase nanoparticles showed 1.6% efficiency and 0.42 fill factor.
Park, Sin Young; Cheong, Won Jo
2016-05-01
Tiny polyether ether ketone encased monolith frits have been prepared by modified catalytic sulfonation of the inner surface of polyether ether tubing (1.6 mm od, 0.25 mm id) followed by modified formation of organic monolith and cutting of the tubing into slices. The frit was placed below the central hole of the column outlet union and supported by a combination of a silica capillary (0.365 mm od, 0.05 mm id) and a polyether ether ketone sleeve (1.6 mm od, 0.38 mm id) tightened with a nut and a ferrule when the column was packed to prevent sinking of the frit element into the union hole (0.25 mm opening) otherwise. The column packed this way with the frits investigated in this study has shown better separation performance owing to the reduced frit volume in comparison to the column packed with a commercial stainless-steel screen frit. This study establishes the strategy of disposable microcolumns in which cheap disposable frits are used whenever the column is re-packed to yield columns of even better chromatographic performance than the columns with commercial frits. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
De Zafra, R. L.; Mallison, W. H.; Emmons, L. K.; Koller, D.
1991-01-01
The cooling capacity of a recently purchased RMC-Cryosystems Model LTS 4.5-025 closed-cycle He refrigerator was measured over the range 4-35 K. It is found that the nominal cooling capacity of 250 mW is only met or exceeded over a narrow temperature range around 4.3 + or - 0.5 K, and that, above this range, there exists a considerable region of much lower cooling capacity, not exceeding about 100 mW. It is believed that this behavior results from use of a fixed-aperture Joule-Thompson expansion valve, and might be alleviated if the J-T valve could be adjusted to compensate for changing flow within the 5-20 K temperature range. Present performance may severely limit or prevent effective use in applications where an irreducible heat inflow exists which is greater than about 100 mW, yet substantially less than the quoted capacity at about 4 K.
EDS'09: 13th International Conference on Elastic & Diffractive Scattering
CERN. Geneva
2009-01-01
The series of International Conferences on Elastic and Diffractive Scattering was founded in 1985 in the picturesque old French town of Blois, famous for its XIV - XVIIth century château, inside of which the first meeting took place. Since then, meetings have been organised every two years in different places of the world: New York (1987), Evanston (1989), Isola d'Elba (1991), Providence (1993), Blois (1995), Seoul (1997), Protvino (1999), Prague (2001), Helsinki (2003), Blois (2005) and Hamburg (2007). The conference will focus on the most recent experimental and theoretical results in particle physics with an emphasis on Quantum Chromodynamics (QCD). http://cern.ch/eds09/ The conference agenda is now full. No further contributions can be accepted.
Directory of Open Access Journals (Sweden)
Albert P. Soran
2010-04-01
Full Text Available The title complex, [SbBr0.33Cl0.67(C9H13N(C9H12N]Br0.75Cl0.25, exhibits substitutional disorder of both halogen atoms in the asymmetric unit, however, with different occupancies. Thus, the halogen atom bonded to Sb has 0.67 (4 occupancy for Cl and 0.33 (4 for Br, while the anionic halogen atom shows 0.75 (4 occupancy for Br and 0.25 (4 for Cl. An N—H...Cl/Br hydrogen bond is established between the cation and the halide anion. The coordination geometry of the Sb center in the cation is distorted pseudo-trigonal-bipyramidal as a result of the strong intramolecular N→Sb coordination trans to the Sb—Cl/Br bond. The pendant arm on the second ligand is twisted away from the metal center. The compound crystallizes as a racemate, i.e. a mixture of (RN2,CSb1 and (SN2,ASb1 isomers with respect to planar chirality induced by the coordinating N atom and chelate-induced Sb chirality. These isomers are associated through Cphenyl—H...Cl/Br hydrogen bonds, forming a three-dimensional architecture.
Complete Genome Sequence of the Endophytic Biocontrol Strain Bacillus velezensis CC09.
Cai, Xunchao; Kang, Xingxing; Xi, Huan; Liu, Changhong; Xue, Yarong
2016-09-29
Bacillus velezensis is a heterotypic synonym of B. methylotrophicus, B. amyloliquefaciens subsp. plantarum, and Bacillus oryzicola, and has been used to control plant fungal diseases. In order to fully understand the genetic basis of antimicrobial capacities, we did a complete genome sequencing of the endophytic B. velezensis strain CC09. Genes tightly associated with biocontrol ability, including nonribosomal peptide synthetases, polyketide synthetases, iron acquisition, colonization, and volatile organic compound synthesis were identified in the genome. Copyright © 2016 Cai et al.
International Nuclear Information System (INIS)
Lazuta, A.V.; Ryzhov, V.A.; Smirnov, O.P.; Kiselev, I.A.; Chernenkov, Yu.P.; Borisov, S.A.; Troaynchuk, I.O.; Khalyavin, D.D.
2006-01-01
Results of structural neutron diffraction study and electron spin resonance (ESR) measurements are presented for insulating Nd 1-x Ba x MnO 3 (x=0.25) with the Curie temperature T C ∼129K. Its pseudocubic structure reveals the definite distortions to a lower symmetry. Detailed analysis of the data is performed in the frame of Pbnm space group in a temperature range 4.2-300K. The compound is found to exhibit the Jahn-Teller (JT) transition at T JT ∼250K. Character of the coherent JT distortions and their temperature evolution differ from those of the x=0.23 manganite. The ESR results correspond to behavior of a 3D isotropic ferromagnet above T*∼143K (τ*∼0.12= C )/T C ). It is shown that an anisotropic exchange coupling of the Mn and Nd magnetic moments may give a substantial contribution in ESR linewidth masking its critical enhancement. The different temperature treatments (slow/fast cooling/heating with/without external magnetic field) of the sample reveal a temperature hysteresis of the ESR spectra below T* indicating an anomalous response in the paramagnetic region. The study of the magnetic phase transition in the x=0.23 and 0.25 NdBa manganites suggests a change in its character from the second to first order at T*. The conventional free energy including the magnetization and magnetic field failed to describe this first-order transition. The unconventional critical behavior is attributed to an orbital liquid metallic phase that begins to coexist with the initial orbital-ordered phases below T*
ChemSession'09 - 6. Warsaw Seminar of the PhD Students in Chemistry - Abstracts
International Nuclear Information System (INIS)
2009-01-01
Book of Abstracts contains short descriptions of presentations 3 lectures and 105 posters presented during ChemSession'09 - 6 th Warsaw Seminar of the PhD Students in Chemistry. Several posters were devoted to the radiochemistry, radiochemical analysis, radiation chemistry and radiobiology. Some posters on the material science dealing with materials important to nuclear sciences can be also found
Energy Technology Data Exchange (ETDEWEB)
Gao, R.L. [School of Metallurgy and Materials Engineering, Chongqing University of Science and Technology, Chongqing 401331 (China); Xu, Z.Y., E-mail: zhyxu@nim.ac.cn [National Institute of Metrology, Beijing 100029 (China); Wang, L.C. [State Key Laboratory for Magnetism, Institute of Physics, Chinese Academy of Sciences, Beijing 100190 (China); Dong, Q.Y.; Zhang, Y. [Department of Physics, Capital Normal University, Beijing 100048 (China); Liu, F.H. [National Space Science Center, Beijing 100190 (China); Mo, Z.J. [School of material Science and Engineering, Hebei University of Technology, Tianjin 300401 (China); Niu, E. [State Key Laboratory for Magnetism, Institute of Physics, Chinese Academy of Sciences, Beijing 100190 (China); Fu, C.L.; Cai, W.; Chen, G.; Deng, X.L. [School of Metallurgy and Materials Engineering, Chongqing University of Science and Technology, Chongqing 401331 (China)
2015-05-15
Highlights: • Antiferromagnetic material RCu{sub x}Ge{sub 2} of high purity was prepared. • Large MCE as −10.2 J/kg K and −10.5 J/kg K for RCu{sub x}Ge{sub 2} (Ho, Er) was obtained for field change of 0–50 kOe. • The RCu{sub x}Ge{sub 2} compounds with variable x had different transition temperature which made them suitable for ‘table-like’ magnetocaloric refrigerant. - Abstract: Magnetic properties and magnetocaloric effect (MCE) of HoCu{sub 0.33}Ge{sub 2} and ErCu{sub 0.25}Ge{sub 2} compounds have been investigated. The compounds were determined to be antiferromagnetic with the Néel temperatures T{sub N} = 9 K and 3.9 K, respectively. The critical transition magnetic fields for the metamagnetic transition from antiferromagnetic to ferromagnetic state below T{sub N} were determined to be 10 kOe for HoCu{sub 0.33}Ge{sub 2} at 5 K and 6 kOe for ErCu{sub 0.25}Ge{sub 2} at 2 K. Large MCE with the maximal values of magnetic entropy changes (ΔS{sub M}) as −10.2 J/kg K at 10.5 K were found in HoCu{sub 0.33}Ge{sub 2} for field changes of 0–70 kOe and −10.5 J/kg K at 5.5 K in ErCu{sub 0.25}Ge{sub 2} for field changes of 0–50 kOe, respectively. The large ΔS{sub M} around T{sub N} as well as no hysteresis loss made RCu{sub x}Ge{sub 2} competitive candidates as low temperature magnetic refrigerant.
Exploring Dust around HD 142527 down to 0.″025 (4 au) Using SPHERE/ZIMPOL
Energy Technology Data Exchange (ETDEWEB)
Avenhaus, H.; Quanz, S. P.; Schmid, H. M.; Szulágyi, J.; Bazzon, A. [ETH Zurich, Institute for Astronomy, Wolfgang-Pauli-Str. 27, CH-8093, Zurich (Switzerland); Dominik, C.; Stolker, T. [Anton Pannekoek Institute for Astronomy, University of Amsterdam, Science Park 904, 1098 XH Amsterdam (Netherlands); Ginski, C.; De Boer, J. [Leiden Observatory, Leiden University, P.O. Box 9513, 2300 RA Leiden (Netherlands); Garufi, A. [Universidad Autonónoma de Madrid, Dpto. Física Teórica, Módulo 15, Facultad de Ciencias, Campus de Cantoblanco, E-28049 Madrid (Spain); Zurlo, A. [Millennium Nucleus “Protoplanetary Disk”, Departamento de Astronomía, Universidad de Chile, Casilla 36-D, Santiago (Chile); Hagelberg, J.; Benisty, M.; Ménard, F. [Univ. Grenoble Alpes, CNRS, IPAG, F-38000 Grenoble (France); Henning, T. [Max-Planck-Institut fur Astronomie, Königstuhl 17, D-69117 Heidelberg (Germany); Meyer, M. R. [Department of Astronomy, University of Michigan, 1085 S. University, Ann Arbor, MI 48109 (United States); Baruffolo, A. [INAF Osservatorio Astronomico di Padova, Vicolo dell’Osservatorio 5, I-35122 Padova (Italy); Beuzit, J. L. [Université Grenoble Alpes, IPAG, F-38000 Grenoble (France); Costille, A.; Dohlen, K., E-mail: havenhaus@gmail.com [Aix Marseille Université, CNRS, LAM (Laboratoire d’Astrophysique de Marseille) UMR 7326, F-13388, Marseille (France); and others
2017-07-01
We have observed the protoplanetary disk of the well-known young Herbig star HD 142527 using ZIMPOL polarimetric differential imaging with the very broad band (∼600–900 nm) filter. We obtained two data sets in 2015 May and 2016 March. Our data allow us to explore dust scattering around the star down to a radius of ∼0.″025 (∼4 au). The well-known outer disk is clearly detected at higher resolution than before and shows previously unknown substructures, including spirals going inward into the cavity. Close to the star, dust scattering is detected at high signal-to-noise ratio, but it is unclear whether the signal represents the inner disk, which has been linked to the two prominent local minima in the scattering of the outer disk that are interpreted as shadows. An interpretation of an inclined inner disk combined with a dust halo is compatible with both our and previous observations, but other arrangements of the dust cannot be ruled out. Dust scattering is also present within the large gap between ∼30 and ∼140 au. The comparison of the two data sets suggests rapid evolution of the inner regions of the disk, potentially driven by the interaction with the close-in M-dwarf companion, around which no polarimetric signal is detected.
The melting mechanism in binary Pd0.25Ni0.75 nanoparticles: molecular dynamics simulations
Domekeli, U.; Sengul, S.; Celtek, M.; Canan, C.
2018-02-01
The melting mechanism for Pd0.25Ni0.75 alloy nanoparticles (NPs) was investigated using molecular dynamics (MD) simulations with quantum Sutton-Chen many-body potentials. NPs of six different sizes ranging from 682 to 22,242 atoms were studied to observe the effect of size on the melting point. The melting temperatures of the NPs were estimated by following the changes in both the thermodynamic and structural quantities such as the total energy, heat capacity and Lindemann index. We also used a thermodynamics model to better estimate the melting point and to check the accuracy of MD simulations. We observed that the melting points of the NPs decreased as their sizes decreased. Although the MD simulations for the bulk system yielded higher melting temperatures because of the lack of a seed for the liquid phase, the melting temperatures determined for both the bulk material and the NPs are in good agreement with those predicted from the thermodynamics model. The melting mechanism proceeds in two steps: firstly, a liquid-like shell is formed in the outer regions of the NP with increasing temperature. The thickness of the liquid-like shell increases with increasing temperature until the shell reaches a critical thickness. Then, the entire Pd-Ni NP including core-related solid-like regions melts at once.
National Oceanic and Atmospheric Administration, Department of Commerce — XBT data were collected from the USCGC CAMPBELL in support of the Integrated Global Ocean Services System (IGOSS). Data were collected by the US Coast Guard from 09...
National Oceanic and Atmospheric Administration, Department of Commerce — XBT data were collected from the USCGC CAMPBELL in support of the Integrated Global Ocean Services System (IGOSS). Data were collected by the US Coast Guard from 09...
Energy Technology Data Exchange (ETDEWEB)
Tedesco, J.C.G., E-mail: tedesco.jcg@gmail.com [Instituto de Física “Gleb Wataghin”, Universidade Estadual de Campinas—UNICAMP, 13083-859 Campinas, SP (Brazil); Pires, M.J.M. [Instituto de Ciência e Tecnologia—ICT, Universidade Federal dos Vales do Jequitinhonha e Mucuri—UFVJM, 39100-000 Diamantina, MG (Brazil); Carvalho, A. Magnus G. [Divisão de Metrologia de Materiais (DIMAT), INMETRO, 25250-020 Duque de Caxias, RJ (Brazil); Sousa, V.S.R. de [Instituto de Física “Armando Dias Tavares”, Universidade do Estado do Rio de Janeiro—UERJ, 20550-013 Rio de Janeiro, RJ (Brazil); Cardoso, L.P.; Coelho, A.A. [Instituto de Física “Gleb Wataghin”, Universidade Estadual de Campinas—UNICAMP, 13083-859 Campinas, SP (Brazil)
2013-08-15
The magnetic behavior of pseudobinary Pr{sub 0.7}Tb{sub 0.3}Al{sub 2} and Pr{sub 0.75}Tb{sub 0.25}Al{sub 2} compounds was studied, and a predominant ferrimagnetic ordering was observed. Noteworthy characteristics such as negative magnetization, compensation points and exchange-bias-like (EB-like) effect were found. This EB-like effect was observed at temperatures below the compensation points. The effect is somewhat different from the one already studied in similar systems combining light and heavy rare earths. The results indicate that the EB-like effect characteristics are related to the conduction electron magnetic polarization and an induced unidirectional anisotropy present in these compounds. - Highlights: ► Ferrimagnetic behavior is observed in Pr{sub 0.7}Tb{sub 0.3}Al{sub 2} and Pr{sub 0.75}Tb{sub 0.25}Al{sub 2} materials. ► Magnetic data indicate a strong unidirectional anisotropy in studied materials. ► Studied materials present the exchange-bias-like effect. ► Exchange-bias-like effect explained in analogy with the known mechanism of thin films.
Energy Technology Data Exchange (ETDEWEB)
Yang, Mingzhu [Institute of Electronic Engineering and Optical Technology, Nanjing University of Science and Technology, Nanjing, Jiangsu 210094 (China); Chang, Benkang, E-mail: bkchang@mail.njust.edu.cn [Institute of Electronic Engineering and Optical Technology, Nanjing University of Science and Technology, Nanjing, Jiangsu 210094 (China); Wang, Meishan [Institute of Physics and Optoelectronic Engineering, Ludong University, Yantai, Shandong 264025 (China)
2015-01-30
Highlights: • Adsorption energy of Cs adsorption on Al{sub 0.25}Ga{sub 0.75}N(0 0 0 1) surface increases as the increasing of Cs coverage. • Electrons transfer from Cs adatoms to substrate during Cs adsorption process, meanwhile the transfer efficiency decreases as Cs coverage increases. • The length of Ga-N bond in the first and second bilayers increases after Cs adsorption. • There appear new energy bands at −25 to −23 eV and −14 to −10 eV, which were induced by Cs 5s and Cs 5p state electrons respectively. - Abstract: We investigate cesium adsorption on Al{sub 0.25}Ga{sub 0.75}N(0 0 0 1) surface at different coverages using first principle method based on density functional theory. Adsorption energies, atomic structure, Mulliken charge distribution, electron transfer, band structures, and density of states of the adsorption systems corresponding to different Cs coverages were obtained. Total-energy calculations show that cesium adsorption on Al{sub 0.25}Ga{sub 0.75}N(0 0 0 1) surface is more and more difficult as the increase of cesium coverage. A single cesium adatom is preferred to locate at the top of Ga atom (T{sub Ga}). Meanwhile, it is not the most stable configuration when two cesium atoms were located on the top of two Ga neighbors at the same time. This is mainly because the distance of Cs adatoms is so small that repulsive force between adatoms rises. At low coverage, electrons transfer from Cs adatom to Ga atoms on the topmost and second topmost bilayers. Meanwhile, the efficiency of electron transfer decreases as the increasing of Cs coverage. There appear new bands at −25 to −23 eV and −14 to −10 eV, which were caused by Cs 5s and Cs 5p state electrons. Under the joint effect of Cs 5s and 5p state electrons, density of states at Fermi level increases, and the adsorption surfaces show more metal properties. Electrons transferring from Cs adatoms to Al{sub 0.25}Ga{sub 0.75}N substrate induces dipole moment, which is useful to
Lifescience Database Archive (English)
Full Text Available 0.025 tr|A6BIV0|A6BIV0_9FIRM Putative uncharacterized protein OS=Dorea... 39 0.36 tr|B6K130|B6K130_SCHJP Shuttle craft...SEENSGETEDNSEEEDKAEDLSSGE 721 >tr|B6K130|B6K130_SCHJP Shuttle craft like transcri
Magnetic-entropy change in Mn1.1Fe0.9P0.7As0.3-xGe x
International Nuclear Information System (INIS)
Tegus, O.; Fuquan, B.; Dagula, W.; Zhang, L.; Brueck, E.; Si, P.Z.; Boer, F.R. de; Buschow, K.H.J.
2005-01-01
We have studied the magnetic properties and magnetic-entropy changes of Mn 1.1 Fe 0.9 P 0.7 As 0.3-x Ge x compounds with x = 0, 0.05, 0.1, 0.15 and 0.3. X-ray diffraction (XRD) study shows all the compounds crystallize in the Fe 2 P-type structure. Magnetic measurements show that the Curie temperature increases from 150 K for Mn 1.1 Fe 0.9 P 0.7 As 0.3 to 380 K for Mn 1.1 Fe 0.9 P 0.7 Ge 0.3 . A field-induced first-order magnetic phase transition is observed above the Curie temperature for the compounds with x up to 0.15. There exists an optimal composition in which the first-order phase transition is the sharpest. The optimal composition for this system is x = 0.1. The maximal magnetic-entropy change derived from the magnetization data is about 40 J/(kg K) for a field change from 0 to 3 T
International Nuclear Information System (INIS)
Manekar, Meghmalhar; Roy, S B
2011-01-01
We present the results of magnetocaloric effect (MCE) measurements on Fe 0.975 Ni 0.025 Rh. The MCE is estimated using both the isothermal field-dependent magnetization and the temperature-dependent magnetization in constant magnetic fields. We find a very large effective refrigerant capacity of nearly 492.8 J kg -1 , with the hot end at about 307 K, which is reproducible over many field cycles. We compare this refrigerant capacity with those of two well known systems, namely Gd 5 Ge 1.9 Si 2 Fe 0.1 and MnFeP 0.45 As 0.55 , which show a large MCE near room temperature, and also with our earlier results on the parent Fe-Rh alloy. The large effective refrigerant capacity in our sample is one of the largest achieved yet at room temperature with a significant improvement over the parent Fe-Rh system. (fast track communication)
Yen, Chia-Sheng; Choy, Cheuk-Sing; Huang, Wei-Jan; Huang, Shiu-Wen; Lai, Pin-Ye; Yu, Meng-Chieh; Shiue, Ching; Hsu, Ya-Fen; Hsu, Ming-Jen
2018-01-01
Growing evidence shows that hydroxamate-based compounds exhibit broad-spectrum pharmacological properties including anti-tumor activity. However, the precise mechanisms underlying hydroxamate derivative-induced cancer cell death remain incomplete understood. In this study, we explored the anti-tumor mechanisms of a novel aliphatic hydroxamate-based compound, WMJ-J-09, in FaDu head and neck squamous cell carcinoma (HNSCC) cells. WMJ-J-09 induced G2/M cell cycle arrest and apoptosis in FaDu cells. These actions were associated with liver kinase B1 (LKB1), AMP-activated protein kinase (AMPK) and p38 mitogen-activated protein kinase (p38MAPK) activation, transcription factor p63 phosphorylation, as well as modulation of p21 and survivin. LKB1-AMPK-p38MAPK signaling blockade reduced WMJ-J-09's enhancing effects in p63 phosphorylation, p21 elevation and survivin reduction. Moreover, WMJ-J-09 caused an increase in α-tubulin acetylation and interfered with microtubule assembly. Furthermore, WMJ-J-09 suppressed the growth of subcutaneous FaDu xenografts in vivo . Taken together, WMJ-J-09-induced FaDu cell death may involve LKB1-AMPK-p38MAPK-p63-survivin signaling cascade. HDACs inhibition and disruption of microtubule assembly may also contribute to WMJ-J-09's actions in FaDu cells. This study suggests that WMJ-J-09 may be a potential lead compound and warrant the clinical development in the treatment of HNSCC.
International Nuclear Information System (INIS)
Nobile, A.; Dropinski, S.C.; Edwards, J.M.; Rivera, G.; Margevicius, R.W.; Sebring, R.J.; Olson, R. E.; Tanner, D.L.
2004-01-01
Beryllium-copper alloy (Be0.9%Cu) ICF capsules are being developed for the pursuit of thermonuclear ignition at the National Ignition Facility (NIF). Success of this capsule material requires that its shock propagation and radiation burnthrough characteristics be accurately understood. To this end, experiments are being conducted to measure the shock propagation and radiation burnthrough properties of Be0.9%Cu alloy. These experiments involve measurements on small Be0.9%Cu wedge, step and flat samples. Samples are mounted on 1.6-mm-diameter x 1.2-mm-length hohlraums that are illuminated by the OMEGA laser at the University of Rochester. X-rays produced by the hohlraum drive the sample. A streaked optical pyrometer detects breakout of the shock produced by the X-ray pulse. In this paper we describe synthesis of the alloy material, fabrication and characterization of samples, and assembly of the targets. Samples were produced from Be0.9%Cu alloy that was synthesized by hot isostatic pressing of Be powder and copper flake. Samples were 850 μm diameter disks with varying thickness in the case of wedge and step samples, and uniform thickness in the case of flat samples. Sample thickness varied in the range 10-90 μm. Samples were prepared by precision lathe machining and electric discharge machining. The samples were characterized by a Veeco white light interferometer and an optical thickness measurement device that simultaneously measured the upper and lower surface contours of samples using two confocal laser probes. Several campaigns with these samples have been conducted over the past two years
32 CFR 253.1 - Reissuance and purpose.
2010-07-01
...) MISCELLANEOUS ASSIGNMENT OF AMERICAN NATIONAL RED CROSS AND UNITED SERVICE ORGANIZATIONS, INC., EMPLOYEES TO...”) employees and United Service Organizations, Inc. (USO), staff for the purpose of determining the security acceptability of such personnel for assignment to duty with the Military Services. ...
77 FR 58532 - Reissuance of Nationwide Permits
2012-09-21
...., Washington, DC 20314-1000. FOR FURTHER INFORMATION CONTACT: Mr. David Olson at 202-761-4922 or by email at david.b.olson@usace.army.mil or access the U.S. Army Corps of Engineers Regulatory Home Page at http...
PREFACE: International Conference on Computing in High Energy and Nuclear Physics (CHEP'09)
Gruntorad, Jan; Lokajicek, Milos
2010-11-01
The 17th International Conference on Computing in High Energy and Nuclear Physics (CHEP) was held on 21-27 March 2009 in Prague, Czech Republic. CHEP is a major series of international conferences for physicists and computing professionals from the worldwide High Energy and Nuclear Physics community, Computer Science, and Information Technology. The CHEP conference provides an international forum to exchange information on computing experience and needs for the community, and to review recent, ongoing and future activities. Recent conferences were held in Victoria, Canada 2007, Mumbai, India in 2006, Interlaken, Switzerland in 2004, San Diego, USA in 2003, Beijing, China in 2001, Padua, Italy in 2000. The CHEP'09 conference had 600 attendees with a program that included plenary sessions of invited oral presentations, a number of parallel sessions comprising 200 oral and 300 poster presentations, and an industrial exhibition. We thanks all the presenters, for the excellent scientific content of their contributions to the conference. Conference tracks covered topics on Online Computing, Event Processing, Software Components, Tools and Databases, Hardware and Computing Fabrics, Grid Middleware and Networking Technologies, Distributed Processing and Analysis and Collaborative Tools. The conference included excursions to Prague and other Czech cities and castles and a banquet held at the Zofin palace in Prague. The next CHEP conference will be held in Taipei, Taiwan on 18-22 October 2010. We would like thank the Ministry of Education Youth and Sports of the Czech Republic and the EU ACEOLE project for the conference support, further to commercial sponsors, the International Advisory Committee, the Local Organizing Committee members representing the five collaborating Czech institutions Jan Gruntorad (co-chair), CESNET, z.s.p.o., Prague Andrej Kugler, Nuclear Physics Institute AS CR v.v.i., Rez Rupert Leitner, Charles University in Prague, Faculty of Mathematics and
Dicty_cDB: Contig-U16031-1 [Dicty_cDB
Lifescience Database Archive (English)
Full Text Available iella... 54 4e-09 2 ( EX122338 ) BR106168 mature green leaf cDNA library KHLM Bra...a napus Root library Brassica napu... 50 7e-08 3 ( DV185277 ) CT047_B04_CT047_3700_91.ab1 C. tentans tissue cul... 3 ( EH423460 ) OL6023R Brassica oleracea var. alboglabra leaf cD... 54 3e-09 3 ( EX128986 ) BR112816 ovule and silique cDNA library..... 44 6e-07 3 ( EC773501 ) EST 9997 Guarana fruits cDNA library Paullinia cu... 58 6e-07 3 ( EV830362 ) TTSA...visiae chromosome IV reading frame ORF YDR025w. 52 1e-09 3 ( EX054146 ) BR038790 floral buds cDNA library
“Pesting”-like oxidation phenomenon of p-type filled skutterudite Ce{sub 0.9}Fe{sub 3}CoSb{sub 12}
Energy Technology Data Exchange (ETDEWEB)
Qiu, Pengfei [State Key Laboratory of High Performance Ceramic and Superfine Microstructure, Shanghai Institute of Ceramics, Chinese Academy of Sciences, 1295 DingXi Road, Shanghai 200050 (China); Xia, Xugui; Huang, Xiangyang; Gu, Ming [CAS Key Laboratory of Materials for Energy Conversion, Shanghai Institute of Ceramics, Chinese Academy of Sciences, 1295 DingXi Road, Shanghai 200050 (China); Qiu, Yuting [State Key Laboratory of High Performance Ceramic and Superfine Microstructure, Shanghai Institute of Ceramics, Chinese Academy of Sciences, 1295 DingXi Road, Shanghai 200050 (China); Chen, Lidong, E-mail: chenlidong@mail.sic.ac.cn [State Key Laboratory of High Performance Ceramic and Superfine Microstructure, Shanghai Institute of Ceramics, Chinese Academy of Sciences, 1295 DingXi Road, Shanghai 200050 (China)
2014-11-05
Highlights: • Ce{sub 0.9}Fe{sub 3}Co{sub 1}Sb{sub 12} exhibits “pesting”-like oxidation phenomenon at high temperature. • The highest oxidation rate of Ce{sub 0.9}Fe{sub 3}Co{sub 1}Sb{sub 12} appears around 800 K. • Severe periodically oxide layer peeling-off behavior is observed around 800 K. • The co-existence of Fe and Co is responsible for the poor oxidation resistance. - Abstract: Oxidation behavior of p-type filled skutterudite Ce{sub 0.9}Fe{sub 3}CoSb{sub 12} in air was investigated and the oxidation mechanism was discussed in this study. Ce{sub 0.9}Fe{sub 3}CoSb{sub 12} exhibits interesting “pesting”-like oxidation phenomenon around 800 K. The bulk sample completely disintegrates into a crowd of plate-like particles under this temperature range after only 24 h exposure in air. However, this abnormal oxidation phenomenon is not observed at temperature below 750 K or above 850 K. This result is consistent with the thermogravimetry and derivative thermogravimetry measurements which show that the oxidation rate for Ce{sub 0.9}Fe{sub 3}CoSb{sub 12} around 800 K is the highest among 650–900 K. Microstructure observations suggest that this “pesting”-like oxidation is related with the severe periodically oxide layer peeling-off behavior around 800 K, which makes the Ce{sub 0.9}Fe{sub 3}CoSb{sub 12} samples are easy to be oxidized because the fresh substrate surface is always exposed to high concentration oxygen atmosphere. X-ray diffraction and X-ray photoelectron spectroscopy measurements indicated that in the oxide scale the direct contact of Fe{sup 3+}-oxide and CoSb{sub 2}O{sub 4} which possess different formation/growth rate and volume expansion coefficient should be responsible for this peculiar oxide layer peeling-off behavior around 800 K. This work can serve as an important reference for the designation of M{sub y}Fe{sub 4−x}Co{sub x}Sb{sub 12}-based skutterudite thermoelectric device.
Energy Technology Data Exchange (ETDEWEB)
Yurchenko, N.Yu. [Laboratory of Bulk Nanostructured Materials, Belgorod State University, Belgorod 308015 (Russian Federation); Stepanov, N.D., E-mail: stepanov@bsu.edu.ru [Laboratory of Bulk Nanostructured Materials, Belgorod State University, Belgorod 308015 (Russian Federation); Shaysultanov, D.G. [Laboratory of Bulk Nanostructured Materials, Belgorod State University, Belgorod 308015 (Russian Federation); Tikhonovsky, M.A. [National Science Center “Kharkov Institute of Physics and Technology”, NAS of Ukraine, Kharkov, 61108 (Ukraine); Salishchev, G.A. [Laboratory of Bulk Nanostructured Materials, Belgorod State University, Belgorod 308015 (Russian Federation)
2016-11-15
In present study, structure and mechanical properties of the Al{sub x}CrNbTiVZr (x = 0; 0.25; 0.5; 1) high-entropy alloys after arc melting and annealing at 1200 °C for 24 h are investigated. The CrNbTiVZr alloy is composed of body centered cubic (bcc) and C15 (face centered cubic) Laves phases while the Al{sub x}CrNbTiVZr (x = 0.25; 0.5; 1) alloys consist of bcc and two C14 (hexagonal close packed) Laves phases with different chemical compositions. Thermodynamic modeling predicts existence of two phases – bcc and C15 Laves phase and broadening of single bcc phase field due to Al addition. The density of the alloys decreases with the increase of Al content. The alloys are found to be extremely brittle at room temperature and 600 °C. The alloys have high strength at temperatures of 800–1000 °C. For example, yield strength at 800 °C increases from 440 MPa for the CrNbTiVZr alloy to 1250 MPa for the AlCrNbTiVZr alloy. The experimental phase composition of the Al{sub x}CrNbTiVZr alloys is compared with predicted equilibrium phases and the factors governing the transformation of C15 to C14 Laves phases due to Al addition to the CrNbTiVZr alloy analyzed. Specific properties of the alloys are compared with other high-entropy alloys and commercial Ni-based superalloys. - Highlights: •Al{sub x}CrNbTiVZr (x = 0; 0.25; 0.5; 1) alloys are arc melted and annealed at 1200 °C. •The CrNbTiVZr alloy has bcc and C15 Laves phases. •The Al-containing alloys are composed of bcc and two C14 Laves phases. •The alloys demonstrate high specific strength at temperatures of 800 °C and 1000 °C. •The strength of the alloys increases in proportion with increase of Al content.
DEFF Research Database (Denmark)
Eriksen, L; Grønbaek, M; Helge, J W
2016-01-01
cardiorespiratory fitness than women, depending on age, and cardiorespiratory fitness decreased by 0.26 and 0.23 mL/min/kg per year in men and women, respectively. Cardiorespiratory fitness was higher among participants who reported a high level of physical activity in leisure time compared with participants who...... fitness was estimated in 16 025 individuals aged 18-91 years from validated cycle ergometer exercise tests. Level of leisure time physical activity (sedentary, light, moderate, and vigorous) and daily sitting time in hours was obtained from a self-administered questionnaire. Men had 20-33% higher......Our aim was to provide up-to-date cardiorespiratory fitness reference data for adults of all ages and to investigate associations between cardiores-piratory fitness and leisure time physical activity as well as sitting time. In the Danish Health Examination Survey 2007-2008, cardiorespiratory...
McCluskey, Susan V; Sztajnkrycer, Matthew D; Jenkins, Donald A; Zietlow, Scott P; Berns, Kathleen S; Park, Myung S
2014-01-01
Tranexamic acid has recently been demonstrated to decrease all-cause mortality and deaths due to hemorrhage in trauma patients. The optimal administration of tranexamic acid is within one hour of injury, but not more than three hours from the time of injury. To aid with timely administration, a premixed solution of 1 gram tranexamic acid and 0.9% sodium chloride was proposed to be stocked as a medication in both the aeromedical transport helicopters and Emergency Department at Mayo Clinic Hospital--Rochester Saint Marys Campus. Since no published stability data exists for tranexamic acid diluted with 0.9% sodium chloride, this study was undertaken to determine the stability of tranexamic acid diluted with 0.9% sodium chloride while being stored in two types of containers. Stability was determined through the use of a stability-indicating high-performance liquid reverse phase chromatography assay, pH, and visual tests. Tranexamic acid solutions of 1 gram in 0.9% sodium chloride 65 mL were studied at predetermined intervals for 90 days in ethylene/propylene copolymer plastic containers, protected from light, and at both controlled room and refrigerated temperatures. Tranexamic acid solutions of 1 gram in 0.9% sodium chloride 50 mL were studied at predetermined intervals for 180 days in clear Type 1 borosilicate glass vials sealed with intact elastomeric, Flourotec-coated stoppers, stored protected from light at controlled room temperature. Solutions stored in the ethylene/propylene copolymer plastic containers at both storage temperatures maintained at least 98% of initial potency throughout the 90-day study period. Solutions stored in glass vials at controlled room temperature maintained at least 92% of initial potency throughout the 180-day study period. Visual and pH tests revealed stable, clear, colorless, and particulate-free solutions throughout the respective study periods.
Energy Technology Data Exchange (ETDEWEB)
Gusejnov, G G; Musaeva, N N; Kyazumov, M G [NAN Azerbajdzhana, Inst. Fiziki, Baku (Azerbaijan); Asadova, I B; Aliev, O M [NAN Azerbajdzhana, Inst. Neorganicheskoj i Fizicheskoj Khimii, Baku (Azerbaijan)
2003-09-01
Single crystals of Ga{sub 0.5}Fe{sub 0.5}InS{sub 3} are grown by the method of chemical gas-transport reactions and those of Ga{sub 0.5}Fe{sub 0.25}In{sub 1.25}S{sub 3} - by Bridgman method. X-ray diffraction studies reveal that they crystallize in trigonal and rhombohedral systems with lattice parameters of a = 3.796 x 2 A, c = 12.210 A, P3m1; a = 3.786 x 2 A, c = 36.606 A, R3m, respectively. An optical absorption edge in a wide range of photon energy and an energy gap width are determined: E{sub g} = 1.885 eV for Ga{sub 0.5}Fe{sub 0.5}InS{sub 3} and E{sub g} 1.843 eV for Ga{sub 0.5}Fe{sub 0.25}In{sub 1.25}S{sub 3}.
Mazza, G; Anghinolfi, F; Martínez, M I; Rivetti, A; Rotondo, F
2004-01-01
In this paper we present a 32 channel ASIC prototype for the readout of the silicon drift detectors (SDDs) of the ALICE experiment. The ASIC integrates on the same substrate 32 transimpedance amplifiers, a 32 x 256 cell analogue memory and 16 successive approximation 10 bit A/D converters. The circuit amplifies and samples at 40 MS/s the input signal in a continuous way. When an external trigger signal validates the acquisition, the sampling is stopped and the data are digitized at lower speed (0.5 MS/s). The chip has been designed and fabricated in a commercial 0.25 mum CMOS technology. It has been extensively tested both on a bench and connected with a detector in several beam tests. In this paper both design issues and test results are presented. The radiation tolerance of the design has been increased by special layout techniques. Total dose irradiation tests are also presented.
Barium titanate nanocomposite capacitor FY09 year end report.
Energy Technology Data Exchange (ETDEWEB)
Stevens, Tyler E.; DiAntonio, Christopher Brian; Yang, Pin; Chavez, Tom P.; Winter, Michael R.; Monson, Todd C.; Roesler, Alexander William; Fellows, Benjamin D.
2009-11-01
This late start RTBF project started the development of barium titanate (BTO)/glass nanocomposite capacitors for future and emerging energy storage applications. The long term goal of this work is to decrease the size, weight, and cost of ceramic capacitors while increasing their reliability. Ceramic-based nanocomposites have the potential to yield materials with enhanced permittivity, breakdown strength (BDS), and reduced strain, which can increase the energy density of capacitors and increase their shot life. Composites of BTO in glass will limit grain growth during device fabrication (preserving nanoparticle grain size and enhanced properties), resulting in devices with improved density, permittivity, BDS, and shot life. BTO will eliminate the issues associated with Pb toxicity and volatility as well as the variation in energy storage vs. temperature of PZT based devices. During the last six months of FY09 this work focused on developing syntheses for BTO nanoparticles and firing profiles for sintering BTO/glass composite capacitors.
Charged-particle multiplicities in proton–proton collisions at $\\sqrt{s} = 0.9$ to 8 TeV
Adam, Jaroslav; Adamova, Dagmar; Akindinov, Alexander; Bjelogrlic, Sandro; Blair, Justin Thomas; Blau, Dmitry; Blume, Christoph; Bock, Friederike; Bogdanov, Alexey; Boggild, Hans; Boldizsar, Laszlo; Bombara, Marek; Book, Julian Heinz; Alam, Sk Noor; Borel, Herve
2017-01-01
A detailed study of pseudorapidity densities and multiplicity distributions of primary charged particles produced in proton–proton collisions, at $\\sqrt{s} =$ 0.9, 2.36, 2.76, 7 and 8 TeV, in the pseudorapidity range $|\\eta |
2018-05-09T06:49:17Z https://www.ajol.info/index.php/index/oai oai ...
African Journals Online (AJOL)
article/48419 2018-05-09T06:49:17Z wajm:ART Reported Occupational Hazards and Illnesses among Hairdressers in Ibadan, ... BACKGROUND: Hairdressers work in small scale enterprises with little or no health supervision in the workplace.
Baumüller, E; Schaller, S J; Chiquito Lama, Y; Frick, C G; Bauhofer, T; Eikermann, M; Fink, H; Blobner, M
2015-05-01
A train-of-four ratio (TOFR) ≥0.9 measured by quantitative neuromuscular monitoring is accepted as an indication of sufficient neuromuscular recovery for extubation, even though many postsynaptic acetylcholine receptors may still be inhibited. We investigated whether antagonism with sugammadex after spontaneous recovery to TOFR≥0.9 further improves muscle function or subjective well-being. Following recovery to TOFR≥0.9 and emergence from anaesthesia, 300 patients randomly received either sugammadex 1.0 mg kg(-1) or placebo. Fine motor function (Purdue Pegboard Test) and maximal voluntary grip strength were measured before and after surgery (before and after test drug administration). At discharge from the postanaesthesia care unit, well-being was assessed with numerical analogue scales and the Quality-of-Recovery Score 40 (QoR-40). Patients' fine motor function [6 (sd 4) vs 15 (3) pegs (30 s)(-1), Psugammadex or placebo, motor function was significantly improved in both groups but did not reach the preoperative level. There was no difference between groups at any time. Global well-being was unaffected (QoR-40: placebo, 174 vs 185; sugammadex, 175 vs 186, P>0.05). Antagonizing rocuronium at TOF≥0.9 with sugammadex 1.0 mg kg(-) (1) did not improve patients' motor function or well-being when compared with placebo. Our data support the view that TOFR≥0.9 measured by electromyography signifies sufficient recovery of neuromuscular function. The trial is registered at ClinicalTrials.gov (NCT01101139). © The Author 2014. Published by Oxford University Press on behalf of the British Journal of Anaesthesia. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Mezinárodní konference ENHR 09 – Prague Changing Housing Markets: Integration and Segmentation
Czech Academy of Sciences Publication Activity Database
Lux, Martin; Vojtková, Michaela
2009-01-01
Roč. 45, č. 5 (2009), s. 1141-1142 ISSN 0038-0288. [ENHR 09 Prague: Changing Housing Markets : Integration and Segmentation. Praha, 28.06.2009-01.07.2009] Institutional research plan: CEZ:AV0Z70280505 Keywords : international conference * housing * integration Subject RIV: AO - Sociology, Demography Impact factor: 0.562, year: 2009 www.enhr2009.cz
Konishi, Hiroaki; Hirano, Tatsumi; Takamatsu, Daiko; Gunji, Akira; Feng, Xiaoliang; Furutsuki, Sho; Okumura, Takefumi; Terada, Shohei
2018-02-01
The effect of chemical treatment using (NH4)2SO4 on the electrochemical properties of Li1.2Ni0.2Mn0.6O2 and Li1.2Ni0.25Mn0.55O2 was investigated. The treatment was effective in improving the Coulombic efficiency and discharge capacity of a Li1.2Ni0.2Mn0.6O2 cathode, but treatment with too much (NH4)2SO4 degraded the cathode's electrochemical performance. The effect of (NH4)2SO4 treatment on the charge-discharge reaction mechanism of Li1.2Ni0.2Mn0.6O2 was investigated by evaluating reaction potential, particle configuration, and oxidation state of transition metal. The experimental results indicated that the changes in the electrochemical performance of the treated cathodes were attributed to the changes in the surface state and of the element contributing to the redox reaction. Treatment with an appropriate amount of (NH4)2SO4 also improved the electrochemical performance of the high-nickel-content lithium-rich layer-structured cathode material Li1.2Ni0.25Mn0.55O2.
Czech Academy of Sciences Publication Activity Database
Kozáková, Hana; Schwarzer, Martin; Tučková, Ludmila; Šrůtková, Dagmar; Czarnowska, E.; Rosiak, I.; Hudcovic, Tomáš; Schabussova, I.; Hermanová, Petra; Zákostelská, Zuzana; Aleksandrzak-Piekarczyk, T.; Koryszewska-Baginska, A.; Tlaskalová-Hogenová, Helena; Cukrowska, B.
2016-01-01
Roč. 13, č. 2 (2016), s. 251-262 ISSN 1672-7681 R&D Projects: GA ČR(CZ) GAP304/11/1252; GA ČR GA303/09/0449; GA MŠk 7AMB15AT025 Institutional support: RVO:61388971 Keywords : allergic sensitization * germ-free * intestinal barrier Subject RIV: EC - Immunology Impact factor: 5.897, year: 2016
Characterization of Rn-222 production in Campo do Cercado C/09 Pocos de Caldas, Minas Gerais State
International Nuclear Information System (INIS)
Pereira, E.B.
1977-01-01
A systematic study for correlating the Rn-222 escape with the main geochemical and mineralogical factors for understanding of some change processes from uranium deposits in Campo do Cercado C-09 in Pocos de Caldas, Minas Gerais State is described. (author)
2018-02-21T09:46:29Z https://www.ajol.info/index.php/index/oai oai ...
African Journals Online (AJOL)
article/55713 2018-02-21T09:46:29Z ajrh:ART HIV/AIDS - Related Stigma and Discrimination in Nigeria: Review of Research Studies and future directions for Prevention Strategies Monjok, E Smesny, A Essien, EJ HIV/AIDS, Stigma, ...
Directory of Open Access Journals (Sweden)
I. K. Tastra
2012-05-01
Full Text Available High moisture of fresh cassava root (65-75 % wet basis need appropriate post harvest handling that can reduce lossesdue to delayed drying process. To accelerate drying process, a cassava chipper (MPB-09 was modified and evaluated for chipping fresh cassava root. This machine included hopper, horizontal chipping cylinder, 5.5 hp gasoline engine, belt, pulley, frame and cover. The performance evaluation of the cassava chipper was done using the combination of four type chipping cylinder (3, 4, 5 and 6 knife and three level chipping cylinder speed (400, 500, 600 Rpm. Regression analysis and homogeneity test of the regression coefficient was used to evaluate the the performance of the cassava chipper. Based on the optimum combination of the type of chipping cylinder and its speed, financial analysis was conducted to evaluate its feasibility. The optimum effective capacity of MPB-09 chipper was at horizontal chipping cylinder with 6 knife and rotation speed 600 rpm. At effective capacity 2.5 t/hour, investment cost Rp 7,500,000 /unit, effective working hours 160 hours/years, two operator cost Rp 200,000 /day and chipping cost Rp 50 /kg chip ; the unit cost (BP was Rp 22 /kg chip; the break-even point (BEP was 90.3 t chip/year; the pay back periodl (PBP was0.7 years; the net present value (NPV was Rp 24,473,739; the benefit cost ratio (B/C was 1.8 and the internal rate of return (IRR was 149.8 %. Based on the results of the financial analysis. it was concluded that MPB-09 chipper was feasible to be applied at farm level. ABSTRAK Kadar air umbi ubikayu yang tinggi (65-70 % bb saat panen memerlukan penanganan yang cepat guna mengurangisusut mutu akibat keterlambatan proses pengeringan. Untuk mempercepat proses pengeringan telah dilakukan modifikasi mesin penyawut (MPB-09 dengan komponen pisau sawut masing-masing sebanyak 3, 4, 5 dan 6 buah per piringan dan dievaluasi kinerjanya pada putaran 400, 500 dan 600 Rpm. Evaluasi kinerja mesin MPB
Directory of Open Access Journals (Sweden)
Dudek Magdalena
2016-03-01
Full Text Available In this paper, the impact of partial substitution of calcium for barium in (Ba1-xCax (M0.9Y0.1 O3, M = Ce, Zr on physicochemical properties of the powders and sintered samples was investigated. The powders, with various contents of calcium (x = 0, 0.02, 0.05, 0.1, were prepared by means of thermal decomposition of organometallic precursors containing EDTA. All of the BaCeO3-based powders synthesised at 1100 °C were monophasic with a rhombohedral structure, however, completely cubic BaZrO3-based solid solutions were obtained at 1200 °C. A study of the sinterability of BaZr0.9Y0.1O3 and BaCe0.9Y0.1O3-based pellets was performed under non-isothermal conditions within a temperature range of 25 to 1200 °C. The partial substitution of barium for calcium in the (Ba1-xCax (M0.9Y0.1 O3, M = Ce, Zr solid solution improved the sinterability of the samples in comparison to the initial BaCe0.9Y0.1O3 or BaZr0.9Y0.1O3. The relative density of calcium-modified BaCe0.9Y0.1O3-based samples reached approximately 95 to 97 % after sintering at 1500 °C for 2 h in air. The same level of relative density was achieved after sintering calcium-modified BaZr0.9Y0.1O3 at 1600 °C for 2 h. Analysis of the electrical conductivity from both series of investigated materials showed that the highest ionic conductivity, in air and wet 5 % H2 in Ar, was attained for the compositions of x = 0.02 to 0.05 (Ba1-xCax(M0.9Y0.1O3, M = Zr, Ce. The oxygen reduction reaction on the interface Pt│BaM0.9Y0.1O3, M = Ce, Zr was investigated using Pt microelectrodes. Selected samples of (Ba1-xCax (M0.9Y0.1O3, M = Zr, Ce were tested as ceramic electrolytes in hydrogen-oxygen solid oxide fuel cells operating at temperatures of 700 to 850 °C.
Digital amateur observations of Venus at 0.9μm
Kardasis, E.
2017-09-01
Venus atmosphere is extremely dynamic, though it is very difficult to observe any features on it in the visible and even in the near-IR range. Digital observations with planetary cameras in recent years routinely produce high-quality images, especially in the near-infrared (0.7-1μm), since IR wavelengths are less influenced by Earth's atmosphere and Venus's atmosphere is partially transparent in this spectral region. Continuous observations over a few hours may track dark atmospheric features in the dayside and determine their motion. In this work we will present such observations and some dark-feature motion measurements at 0.9μm. Ground-based observations at this wavelength are rare and are complementary to in situ observations by JAXA's Akatsuki orbiter, that studies the atmospheric dynamics of Venus also in this band with the IR1 camera.
Mechanical analysis of a $\\beta=0.09 $ 162.5MHz taper HWR cavity
Fan, Peiliang; Zhu, Feng; Zhong, Hutianxiang; Quan, Shengwen; Liu, Kexin
2015-01-01
One superconducting taper-type half-wave resonator (HWR) with frequency of 162.5MHz, \\b{eta} of 0.09 has been developed at Peking University, which is used to accelerate high current proton ($\\sim$ 100mA) and $D^{+}$($\\sim$ 50mA). The radio frequency (RF) design of the cavity has been accomplished. Herein, we present the mechanical analysis of the cavity which is also an important aspect in superconducting cavity design. The frequency shift caused by bath helium pressure and Lorenz force, and...
Screening for Influenza A(H1N1)pdm09, Auckland International Airport, New Zealand
Hale, Michael J.; Baker, Michael G.
2012-01-01
Entry screening for influenza A(H1N1)pdm09 at Auckland International Airport, New Zealand, detected 4 cases, which were later confirmed, among 456,518 passengers arriving April 27–June 22, 2009. On the basis of national influenza surveillance data, which suggest that ≈69 infected travelers passed through the airport, sensitivity for screening was only 5.8%. PMID:22516105
2018-05-09T13:20:33Z https://www.ajol.info/index.php/all/oai oai:ojs ...
African Journals Online (AJOL)
article/67957 2018-05-09T13:20:33Z ajtcam:ART Medicinal Plants Traditionally Used In Mali for Dysmenorrhea Sanogo, R Dysmenorrhea; Maytenus senegalensis; Stereospermum kunthianum; Trichilia emetica; Mali Dysmenorrhea is painful ...
Charged particle multiplicities in pp interactions at sqrt(s) = 0.9, 2.36, and 7 TeV
Energy Technology Data Exchange (ETDEWEB)
Khachatryan, V. [Yerevan Physics Institute (Aremenia); et al.,
2011-01-01
Measurements of primary charged hadron multiplicity distributions are presented for non-single-diffractive events in proton-proton collisions at centre-of-mass energies of sqrt(s) = 0.9, 2.36, and 7 TeV, in five pseudorapidity ranges from |eta|<0.5 to |eta|<2.4. The data were collected with the minimum-bias trigger of the CMS experiment during the LHC commissioning runs in 2009 and the 7 TeV run in 2010. The multiplicity distribution at sqrt(s) = 0.9 TeV is in agreement with previous measurements. At higher energies the increase of the mean multiplicity with sqrt(s) is underestimated by most event generators. The average transverse momentum as a function of the multiplicity is also presented. The measurement of higher-order moments of the multiplicity distribution confirms the violation of Koba-Nielsen-Olesen scaling that has been observed at lower energies.
Charged particle multiplicities in pp interactions at $\\sqrt{s}$ = 0.9, 2.36, and 7 TeV
Khachatryan, Vardan; Tumasyan, Armen; Adam, Wolfgang; Bergauer, Thomas; Dragicevic, Marko; Erö, Janos; Fabjan, Christian; Friedl, Markus; Fruehwirth, Rudolf; Ghete, Vasile Mihai; Hammer, Josef; Haensel, Stephan; Hartl, Christian; Hoch, Michael; Hörmann, Natascha; Hrubec, Josef; Jeitler, Manfred; Kasieczka, Gregor; Kiesenhofer, Wolfgang; Krammer, Manfred; Liko, Dietrich; Mikulec, Ivan; Pernicka, Manfred; Rohringer, Herbert; Schöfbeck, Robert; Strauss, Josef; Taurok, Anton; Teischinger, Florian; Waltenberger, Wolfgang; Walzel, Gerhard; Widl, Edmund; Wulz, Claudia-Elisabeth; Mossolov, Vladimir; Shumeiko, Nikolai; Suarez Gonzalez, Juan; Benucci, Leonardo; Ceard, Ludivine; Cerny, Karel; De Wolf, Eddi A.; Janssen, Xavier; Maes, Thomas; Mucibello, Luca; Ochesanu, Silvia; Roland, Benoit; Rougny, Romain; Selvaggi, Michele; Van Haevermaet, Hans; Van Mechelen, Pierre; Van Remortel, Nick; Adler, Volker; Beauceron, Stephanie; Blekman, Freya; Blyweert, Stijn; D'Hondt, Jorgen; Devroede, Olivier; Kalogeropoulos, Alexis; Maes, Joris; Maes, Michael; Tavernier, Stefaan; Van Doninck, Walter; Van Mulders, Petra; Van Onsem, Gerrit Patrick; Villella, Ilaria; Charaf, Otman; Clerbaux, Barbara; De Lentdecker, Gilles; Dero, Vincent; Gay, Arnaud; Hammad, Gregory Habib; Hreus, Tomas; Marage, Pierre Edouard; Thomas, Laurent; Vander Velde, Catherine; Vanlaer, Pascal; Wickens, John; Costantini, Silvia; Grunewald, Martin; Klein, Benjamin; Marinov, Andrey; Ryckbosch, Dirk; Thyssen, Filip; Tytgat, Michael; Vanelderen, Lukas; Verwilligen, Piet; Walsh, Sinead; Zaganidis, Nicolas; Basegmez, Suzan; Bruno, Giacomo; Caudron, Julien; De Favereau De Jeneret, Jerome; Delaere, Christophe; Demin, Pavel; Favart, Denis; Giammanco, Andrea; Grégoire, Ghislain; Hollar, Jonathan; Lemaitre, Vincent; Liao, Junhui; Militaru, Otilia; Ovyn, Severine; Pagano, Davide; Pin, Arnaud; Piotrzkowski, Krzysztof; Quertenmont, Loic; Schul, Nicolas; Beliy, Nikita; Caebergs, Thierry; Daubie, Evelyne; Alves, Gilvan; De Jesus Damiao, Dilson; Pol, Maria Elena; Henrique Gomes E Souza, Moacyr; Carvalho, Wagner; Da Costa, Eliza Melo; De Oliveira Martins, Carley; Fonseca De Souza, Sandro; Mundim, Luiz; Nogima, Helio; Oguri, Vitor; Prado Da Silva, Wanda Lucia; Santoro, Alberto; Silva Do Amaral, Sheila Mara; Sznajder, Andre; Torres Da Silva De Araujo, Felipe; De Almeida Dias, Flavia; Ferreira Dias, Marco Andre; Tomei, Thiago; De Moraes Gregores, Eduardo; Da Cunha Marinho, Franciole; Novaes, Sergio F.; Padula, Sandra; Darmenov, Nikolay; Dimitrov, Lubomir; Genchev, Vladimir; Iaydjiev, Plamen; Piperov, Stefan; Rodozov, Mircho; Stoykova, Stefka; Sultanov, Georgi; Tcholakov, Vanio; Trayanov, Rumen; Vankov, Ivan; Dyulendarova, Milena; Hadjiiska, Roumyana; Kozhuharov, Venelin; Litov, Leander; Marinova, Evelina; Mateev, Matey; Pavlov, Borislav; Petkov, Peicho; Bian, Jian-Guo; Chen, Guo-Ming; Chen, He-Sheng; Jiang, Chun-Hua; Liang, Dong; Liang, Song; Wang, Jian; Wang, Jian; Wang, Xianyou; Wang, Zheng; Yang, Min; Zang, Jingjing; Zhang, Zhen; Ban, Yong; Guo, Shuang; Li, Wenbo; Mao, Yajun; Qian, Si-Jin; Teng, Haiyun; Zhu, Bo; Cabrera, Andrés; Gomez Moreno, Bernardo; Ocampo Rios, Alberto Andres; Osorio Oliveros, Andres Felipe; Sanabria, Juan Carlos; Godinovic, Nikola; Lelas, Damir; Lelas, Karlo; Plestina, Roko; Polic, Dunja; Puljak, Ivica; Antunovic, Zeljko; Dzelalija, Mile; Brigljevic, Vuko; Duric, Senka; Kadija, Kreso; Morovic, Srecko; Attikis, Alexandros; Fereos, Reginos; Galanti, Mario; Mousa, Jehad; Nicolaou, Charalambos; Ptochos, Fotios; Razis, Panos A.; Rykaczewski, Hans; Assran, Yasser; Mahmoud, Mohammed; Hektor, Andi; Kadastik, Mario; Kannike, Kristjan; Müntel, Mait; Raidal, Martti; Rebane, Liis; Azzolini, Virginia; Eerola, Paula; Czellar, Sandor; Härkönen, Jaakko; Heikkinen, Mika Aatos; Karimäki, Veikko; Kinnunen, Ritva; Klem, Jukka; Kortelainen, Matti J.; Lampén, Tapio; Lassila-Perini, Kati; Lehti, Sami; Lindén, Tomas; Luukka, Panja-Riina; Mäenpää, Teppo; Tuominen, Eija; Tuominiemi, Jorma; Tuovinen, Esa; Ungaro, Donatella; Wendland, Lauri; Banzuzi, Kukka; Korpela, Arja; Tuuva, Tuure; Sillou, Daniel; Besancon, Marc; Dejardin, Marc; Denegri, Daniel; Fabbro, Bernard; Faure, Jean-Louis; Ferri, Federico; Ganjour, Serguei; Gentit, François-Xavier; Givernaud, Alain; Gras, Philippe; Hamel de Monchenault, Gautier; Jarry, Patrick; Locci, Elizabeth; Malcles, Julie; Marionneau, Matthieu; Millischer, Laurent; Rander, John; Rosowsky, André; Shreyber, Irina; Titov, Maksym; Verrecchia, Patrice; Baffioni, Stephanie; Beaudette, Florian; Bianchini, Lorenzo; Bluj, Michal; Broutin, Clementine; Busson, Philippe; Charlot, Claude; Dobrzynski, Ludwik; Granier de Cassagnac, Raphael; Haguenauer, Maurice; Miné, Philippe; Mironov, Camelia; Ochando, Christophe; Paganini, Pascal; Porteboeuf, Sarah; Sabes, David; Salerno, Roberto; Sirois, Yves; Thiebaux, Christophe; Wyslouch, Bolek; Zabi, Alexandre; Agram, Jean-Laurent; Andrea, Jeremy; Besson, Auguste; Bloch, Daniel; Bodin, David; Brom, Jean-Marie; Cardaci, Marco; Chabert, Eric Christian; Collard, Caroline; Conte, Eric; Drouhin, Frédéric; Ferro, Cristina; Fontaine, Jean-Charles; Gelé, Denis; Goerlach, Ulrich; Greder, Sebastien; Juillot, Pierre; Karim, Mehdi; Le Bihan, Anne-Catherine; Mikami, Yoshinari; Van Hove, Pierre; Fassi, Farida; Mercier, Damien; Baty, Clement; Beaupere, Nicolas; Bedjidian, Marc; Bondu, Olivier; Boudoul, Gaelle; Boumediene, Djamel; Brun, Hugues; Chanon, Nicolas; Chierici, Roberto; Contardo, Didier; Depasse, Pierre; El Mamouni, Houmani; Falkiewicz, Anna; Fay, Jean; Gascon, Susan; Ille, Bernard; Kurca, Tibor; Le Grand, Thomas; Lethuillier, Morgan; Mirabito, Laurent; Perries, Stephane; Sordini, Viola; Tosi, Silvano; Tschudi, Yohann; Verdier, Patrice; Xiao, Hong; Roinishvili, Vladimir; Anagnostou, Georgios; Edelhoff, Matthias; Feld, Lutz; Heracleous, Natalie; Hindrichs, Otto; Jussen, Ruediger; Klein, Katja; Merz, Jennifer; Mohr, Niklas; Ostapchuk, Andrey; Perieanu, Adrian; Raupach, Frank; Sammet, Jan; Schael, Stefan; Sprenger, Daniel; Weber, Hendrik; Weber, Martin; Wittmer, Bruno; Ata, Metin; Bender, Walter; Erdmann, Martin; Frangenheim, Jens; Hebbeker, Thomas; Hinzmann, Andreas; Hoepfner, Kerstin; Hof, Carsten; Klimkovich, Tatsiana; Klingebiel, Dennis; Kreuzer, Peter; Lanske, Dankfried; Magass, Carsten; Masetti, Gianni; Merschmeyer, Markus; Meyer, Arnd; Papacz, Paul; Pieta, Holger; Reithler, Hans; Schmitz, Stefan Antonius; Sonnenschein, Lars; Steggemann, Jan; Teyssier, Daniel; Bontenackels, Michael; Davids, Martina; Duda, Markus; Flügge, Günter; Geenen, Heiko; Giffels, Manuel; Haj Ahmad, Wael; Heydhausen, Dirk; Kress, Thomas; Kuessel, Yvonne; Linn, Alexander; Nowack, Andreas; Perchalla, Lars; Pooth, Oliver; Rennefeld, Jörg; Sauerland, Philip; Stahl, Achim; Thomas, Maarten; Tornier, Daiske; Zoeller, Marc Henning; Aldaya Martin, Maria; Behrenhoff, Wolf; Behrens, Ulf; Bergholz, Matthias; Borras, Kerstin; Cakir, Altan; Campbell, Alan; Castro, Elena; Dammann, Dirk; Eckerlin, Guenter; Eckstein, Doris; Flossdorf, Alexander; Flucke, Gero; Geiser, Achim; Glushkov, Ivan; Hauk, Johannes; Jung, Hannes; Kasemann, Matthias; Katkov, Igor; Katsas, Panagiotis; Kleinwort, Claus; Kluge, Hannelies; Knutsson, Albert; Krücker, Dirk; Kuznetsova, Ekaterina; Lange, Wolfgang; Lohmann, Wolfgang; Mankel, Rainer; Marienfeld, Markus; Melzer-Pellmann, Isabell-Alissandra; Meyer, Andreas Bernhard; Mnich, Joachim; Mussgiller, Andreas; Olzem, Jan; Parenti, Andrea; Raspereza, Alexei; Raval, Amita; Schmidt, Ringo; Schoerner-Sadenius, Thomas; Sen, Niladri; Stein, Matthias; Tomaszewska, Justyna; Volyanskyy, Dmytro; Walsh, Roberval; Wissing, Christoph; Autermann, Christian; Bobrovskyi, Sergei; Draeger, Jula; Enderle, Holger; Gebbert, Ulla; Kaschube, Kolja; Kaussen, Gordon; Klanner, Robert; Mura, Benedikt; Naumann-Emme, Sebastian; Nowak, Friederike; Pietsch, Niklas; Sander, Christian; Schettler, Hannes; Schleper, Peter; Schröder, Matthias; Schum, Torben; Schwandt, Joern; Srivastava, Ajay Kumar; Stadie, Hartmut; Steinbrück, Georg; Thomsen, Jan; Wolf, Roger; Bauer, Julia; Buege, Volker; Chwalek, Thorsten; De Boer, Wim; Dierlamm, Alexander; Dirkes, Guido; Feindt, Michael; Gruschke, Jasmin; Hackstein, Christoph; Hartmann, Frank; Heindl, Stefan Michael; Heinrich, Michael; Held, Hauke; Hoffmann, Karl-Heinz; Honc, Simon; Kuhr, Thomas; Martschei, Daniel; Mueller, Steffen; Müller, Thomas; Niegel, Martin; Oberst, Oliver; Oehler, Andreas; Ott, Jochen; Peiffer, Thomas; Piparo, Danilo; Quast, Gunter; Rabbertz, Klaus; Ratnikov, Fedor; Renz, Manuel; Saout, Christophe; Scheurer, Armin; Schieferdecker, Philipp; Schilling, Frank-Peter; Schott, Gregory; Simonis, Hans-Jürgen; Stober, Fred-Markus Helmut; Troendle, Daniel; Wagner-Kuhr, Jeannine; Zeise, Manuel; Zhukov, Valery; Ziebarth, Eva Barbara; Daskalakis, Georgios; Geralis, Theodoros; Kesisoglou, Stilianos; Kyriakis, Aristotelis; Loukas, Demetrios; Manolakos, Ioannis; Markou, Athanasios; Markou, Christos; Mavrommatis, Charalampos; Petrakou, Eleni; Gouskos, Loukas; Mertzimekis, Theodoros; Panagiotou, Apostolos; Evangelou, Ioannis; Foudas, Costas; Kokkas, Panagiotis; Manthos, Nikolaos; Papadopoulos, Ioannis; Patras, Vaios; Triantis, Frixos A.; Aranyi, Attila; Bencze, Gyorgy; Boldizsar, Laszlo; Debreczeni, Gergely; Hajdu, Csaba; Horvath, Dezso; Kapusi, Anita; Krajczar, Krisztian; Laszlo, Andras; Sikler, Ferenc; Vesztergombi, Gyorgy; Beni, Noemi; Molnar, Jozsef; Palinkas, Jozsef; Szillasi, Zoltan; Veszpremi, Viktor; Raics, Peter; Trocsanyi, Zoltan Laszlo; Ujvari, Balazs; Bansal, Sunil; Beri, Suman Bala; Bhatnagar, Vipin; Dhingra, Nitish; Jindal, Monika; Kaur, Manjit; Kohli, Jatinder Mohan; Mehta, Manuk Zubin; Nishu, Nishu; Saini, Lovedeep Kaur; Sharma, Archana; Singh, Anil; Singh, Jas Bir; Singh, Supreet Pal; Ahuja, Sudha; Bhattacharya, Satyaki; Choudhary, Brajesh C.; Gupta, Pooja; Jain, Sandhya; Jain, Shilpi; Kumar, Ashok; Shivpuri, Ram Krishen; Choudhury, Rajani Kant; Dutta, Dipanwita; Kailas, Swaminathan; Kataria, Sushil Kumar; Mohanty, Ajit Kumar; Pant, Lalit Mohan; Shukla, Prashant; Suggisetti, Praveenkumar; Aziz, Tariq; Guchait, Monoranjan; Gurtu, Atul; Maity, Manas; Majumder, Devdatta; Majumder, Gobinda; Mazumdar, Kajari; Mohanty, Gagan Bihari; Saha, Anirban; Sudhakar, Katta; Wickramage, Nadeesha; Banerjee, Sudeshna; Dugad, Shashikant; Mondal, Naba Kumar; Arfaei, Hessamaddin; Bakhshiansohi, Hamed; Etesami, Seyed Mohsen; Fahim, Ali; Hashemi, Majid; Jafari, Abideh; Khakzad, Mohsen; Mohammadi, Abdollah; Mohammadi Najafabadi, Mojtaba; Paktinat Mehdiabadi, Saeid; Safarzadeh, Batool; Zeinali, Maryam; Abbrescia, Marcello; Barbone, Lucia; Calabria, Cesare; Colaleo, Anna; Creanza, Donato; De Filippis, Nicola; De Palma, Mauro; Dimitrov, Anton; Fedele, Francesca; Fiore, Luigi; Iaselli, Giuseppe; Lusito, Letizia; Maggi, Giorgio; Maggi, Marcello; Manna, Norman; Marangelli, Bartolomeo; My, Salvatore; Nuzzo, Salvatore; Pacifico, Nicola; Pierro, Giuseppe Antonio; Pompili, Alexis; Pugliese, Gabriella; Romano, Francesco; Roselli, Giuseppe; Selvaggi, Giovanna; Silvestris, Lucia; Trentadue, Raffaello; Tupputi, Salvatore; Zito, Giuseppe; Abbiendi, Giovanni; Benvenuti, Alberto; Bonacorsi, Daniele; Braibant-Giacomelli, Sylvie; Capiluppi, Paolo; Castro, Andrea; Cavallo, Francesca Romana; Cuffiani, Marco; Dallavalle, Gaetano-Marco; Fabbri, Fabrizio; Fanfani, Alessandra; Fasanella, Daniele; Giacomelli, Paolo; Giunta, Marina; Grandi, Claudio; Marcellini, Stefano; Meneghelli, Marco; Montanari, Alessandro; Navarria, Francesco; Odorici, Fabrizio; Perrotta, Andrea; Rossi, Antonio; Rovelli, Tiziano; Siroli, Gianni; Travaglini, Riccardo; Albergo, Sebastiano; Cappello, Gigi; Chiorboli, Massimiliano; Costa, Salvatore; Tricomi, Alessia; Tuve, Cristina; Barbagli, Giuseppe; Ciulli, Vitaliano; Civinini, Carlo; D'Alessandro, Raffaello; Focardi, Ettore; Frosali, Simone; Gallo, Elisabetta; Genta, Chiara; Lenzi, Piergiulio; Meschini, Marco; Paoletti, Simone; Sguazzoni, Giacomo; Tropiano, Antonio; Benussi, Luigi; Bianco, Stefano; Colafranceschi, Stefano; Fabbri, Franco; Piccolo, Davide; Fabbricatore, Pasquale; Musenich, Riccardo; Benaglia, Andrea; Cerati, Giuseppe Benedetto; De Guio, Federico; Di Matteo, Leonardo; Ghezzi, Alessio; Malberti, Martina; Malvezzi, Sandra; Martelli, Arabella; Massironi, Andrea; Menasce, Dario; Moroni, Luigi; Paganoni, Marco; Pedrini, Daniele; Ragazzi, Stefano; Redaelli, Nicola; Sala, Silvano; Tabarelli de Fatis, Tommaso; Tancini, Valentina; Buontempo, Salvatore; Carrillo Montoya, Camilo Andres; Cimmino, Anna; De Cosa, Annapaola; De Gruttola, Michele; Fabozzi, Francesco; Iorio, Alberto Orso Maria; Lista, Luca; Merola, Mario; Noli, Pasquale; Paolucci, Pierluigi; Azzi, Patrizia; Bacchetta, Nicola; Bellan, Paolo; Biasotto, Massimo; Bisello, Dario; Branca, Antonio; Carlin, Roberto; Checchia, Paolo; Conti, Enrico; De Mattia, Marco; Dorigo, Tommaso; Fanzago, Federica; Gasparini, Fabrizio; Giubilato, Piero; Gresele, Ambra; Lacaprara, Stefano; Lazzizzera, Ignazio; Margoni, Martino; Meneguzzo, Anna Teresa; Nespolo, Massimo; Perrozzi, Luca; Pozzobon, Nicola; Ronchese, Paolo; Simonetto, Franco; Torassa, Ezio; Tosi, Mia; Vanini, Sara; Ventura, Sandro; Zotto, Pierluigi; Zumerle, Gianni; Baesso, Paolo; Berzano, Umberto; Riccardi, Cristina; Torre, Paola; Vitulo, Paolo; Viviani, Claudio; Biasini, Maurizio; Bilei, Gian Mario; Caponeri, Benedetta; Fanò, Livio; Lariccia, Paolo; Lucaroni, Andrea; Mantovani, Giancarlo; Menichelli, Mauro; Nappi, Aniello; Santocchia, Attilio; Servoli, Leonello; Taroni, Silvia; Valdata, Marisa; Volpe, Roberta; Azzurri, Paolo; Bagliesi, Giuseppe; Bernardini, Jacopo; Boccali, Tommaso; Broccolo, Giuseppe; Castaldi, Rino; D'Agnolo, Raffaele Tito; Dell'Orso, Roberto; Fiori, Francesco; Foà, Lorenzo; Giassi, Alessandro; Kraan, Aafke; Ligabue, Franco; Lomtadze, Teimuraz; Martini, Luca; Messineo, Alberto; Palla, Fabrizio; Palmonari, Francesco; Sarkar, Subir; Segneri, Gabriele; Serban, Alin Titus; Spagnolo, Paolo; Tenchini, Roberto; Tonelli, Guido; Venturi, Andrea; Verdini, Piero Giorgio; Barone, Luciano; Cavallari, Francesca; Del Re, Daniele; Di Marco, Emanuele; Diemoz, Marcella; Franci, Daniele; Grassi, Marco; Longo, Egidio; Organtini, Giovanni; Palma, Alessandro; Pandolfi, Francesco; Paramatti, Riccardo; Rahatlou, Shahram; Amapane, Nicola; Arcidiacono, Roberta; Argiro, Stefano; Arneodo, Michele; Biino, Cristina; Botta, Cristina; Cartiglia, Nicolo; Castello, Roberto; Costa, Marco; Demaria, Natale; Graziano, Alberto; Mariotti, Chiara; Marone, Matteo; Maselli, Silvia; Migliore, Ernesto; Mila, Giorgia; Monaco, Vincenzo; Musich, Marco; Obertino, Maria Margherita; Pastrone, Nadia; Pelliccioni, Mario; Romero, Alessandra; Ruspa, Marta; Sacchi, Roberto; Sola, Valentina; Solano, Ada; Staiano, Amedeo; Trocino, Daniele; Vilela Pereira, Antonio; Ambroglini, Filippo; Belforte, Stefano; Cossutti, Fabio; Della Ricca, Giuseppe; Gobbo, Benigno; Montanino, Damiana; Penzo, Aldo; Heo, Seong Gu; Chang, Sunghyun; Chung, Jin Hyuk; Kim, Dong Hee; Kim, Gui Nyun; Kim, Ji Eun; Kong, Dae Jung; Park, Hyangkyu; Son, Dohhee; Son, Dong-Chul; Kim, Jaeho; Kim, Jae Yool; Song, Sanghyeon; Choi, Suyong; Hong, Byung-Sik; Jo, Mihee; Kim, Hyunchul; Kim, Ji Hyun; Kim, Tae Jeong; Lee, Kyong Sei; Moon, Dong Ho; Park, Sung Keun; Rhee, Han-Bum; Seo, Eunsung; Shin, Seungsu; Sim, Kwang Souk; Choi, Minkyoo; Kang, Seokon; Kim, Hyunyong; Park, Chawon; Park, Inkyu; Park, Sangnam; Ryu, Geonmo; Choi, Young-Il; Choi, Young Kyu; Goh, Junghwan; Lee, Jongseok; Lee, Sungeun; Seo, Hyunkwan; Yu, Intae; Bilinskas, Mykolas Jurgis; Grigelionis, Ignas; Janulis, Mindaugas; Martisiute, Dalia; Petrov, Pavel; Sabonis, Tomas; Castilla Valdez, Heriberto; De La Cruz Burelo, Eduard; Lopez-Fernandez, Ricardo; Sánchez Hernández, Alberto; Villasenor-Cendejas, Luis Manuel; Carrillo Moreno, Salvador; Vazquez Valencia, Fabiola; Salazar Ibarguen, Humberto Antonio; Casimiro Linares, Edgar; Morelos Pineda, Antonio; Reyes-Santos, Marco A.; Allfrey, Philip; Krofcheck, David; Tam, Jason; Butler, Philip H.; Doesburg, Robert; Silverwood, Hamish; Ahmad, Muhammad; Ahmed, Ijaz; Asghar, Muhammad Irfan; Hoorani, Hafeez R.; Khan, Wajid Ali; Khurshid, Taimoor; Qazi, Shamona; Cwiok, Mikolaj; Dominik, Wojciech; Doroba, Krzysztof; Kalinowski, Artur; Konecki, Marcin; Krolikowski, Jan; Frueboes, Tomasz; Gokieli, Ryszard; Górski, Maciej; Kazana, Malgorzata; Nawrocki, Krzysztof; Romanowska-Rybinska, Katarzyna; Szleper, Michal; Wrochna, Grzegorz; Zalewski, Piotr; Almeida, Nuno; David Tinoco Mendes, Andre; Faccioli, Pietro; Ferreira Parracho, Pedro Guilherme; Gallinaro, Michele; Sá Martins, Pedro; Musella, Pasquale; Nayak, Aruna; Ribeiro, Pedro Quinaz; Seixas, Joao; Silva, Pedro; Varela, Joao; Wöhri, Hermine Katharina; Belotelov, Ivan; Bunin, Pavel; Finger, Miroslav; Finger Jr., Michael; Golutvin, Igor; Kamenev, Alexey; Karjavin, Vladimir; Kozlov, Guennady; Lanev, Alexander; Moisenz, Petr; Palichik, Vladimir; Perelygin, Victor; Shmatov, Sergey; Smirnov, Vitaly; Volodko, Anton; Zarubin, Anatoli; Bondar, Nikolai; Golovtsov, Victor; Ivanov, Yury; Kim, Victor; Levchenko, Petr; Murzin, Victor; Oreshkin, Vadim; Smirnov, Igor; Sulimov, Valentin; Uvarov, Lev; Vavilov, Sergey; Vorobyev, Alexey; Andreev, Yuri; Gninenko, Sergei; Golubev, Nikolai; Kirsanov, Mikhail; Krasnikov, Nikolai; Matveev, Viktor; Pashenkov, Anatoli; Toropin, Alexander; Troitsky, Sergey; Epshteyn, Vladimir; Gavrilov, Vladimir; Kaftanov, Vitali; Kossov, Mikhail; Krokhotin, Andrey; Lychkovskaya, Natalia; Safronov, Grigory; Semenov, Sergey; Stolin, Viatcheslav; Vlasov, Evgueni; Zhokin, Alexander; Boos, Edouard; Dubinin, Mikhail; Dudko, Lev; Ershov, Alexander; Gribushin, Andrey; Kodolova, Olga; Lokhtin, Igor; Obraztsov, Stepan; Petrushanko, Sergey; Sarycheva, Ludmila; Savrin, Viktor; Snigirev, Alexander; Andreev, Vladimir; Azarkin, Maksim; Dremin, Igor; Kirakosyan, Martin; Rusakov, Sergey V.; Vinogradov, Alexey; Azhgirey, Igor; Bitioukov, Sergei; Grishin, Viatcheslav; Kachanov, Vassili; Konstantinov, Dmitri; Korablev, Andrey; Krychkine, Victor; Petrov, Vladimir; Ryutin, Roman; Slabospitsky, Sergey; Sobol, Andrei; Tourtchanovitch, Leonid; Troshin, Sergey; Tyurin, Nikolay; Uzunian, Andrey; Volkov, Alexey; Adzic, Petar; Djordjevic, Milos; Krpic, Dragomir; Milosevic, Jovan; Aguilar-Benitez, Manuel; Alcaraz Maestre, Juan; Arce, Pedro; Battilana, Carlo; Calvo, Enrique; Cepeda, Maria; Cerrada, Marcos; Colino, Nicanor; De La Cruz, Begona; Diez Pardos, Carmen; Fernandez Bedoya, Cristina; Fernández Ramos, Juan Pablo; Ferrando, Antonio; Flix, Jose; Fouz, Maria Cruz; Garcia-Abia, Pablo; Gonzalez Lopez, Oscar; Goy Lopez, Silvia; Hernandez, Jose M.; Josa, Maria Isabel; Merino, Gonzalo; Puerta Pelayo, Jesus; Redondo, Ignacio; Romero, Luciano; Santaolalla, Javier; Willmott, Carlos; Albajar, Carmen; Codispoti, Giuseppe; de Trocóniz, Jorge F; Cuevas, Javier; Fernandez Menendez, Javier; Folgueras, Santiago; Gonzalez Caballero, Isidro; Lloret Iglesias, Lara; Vizan Garcia, Jesus Manuel; Brochero Cifuentes, Javier Andres; Cabrillo, Iban Jose; Calderon, Alicia; Chamizo Llatas, Maria; Chuang, Shan-Huei; Duarte Campderros, Jordi; Felcini, Marta; Fernandez, Marcos; Gomez, Gervasio; Gonzalez Sanchez, Javier; Gonzalez Suarez, Rebeca; Jorda, Clara; Lobelle Pardo, Patricia; Lopez Virto, Amparo; Marco, Jesus; Marco, Rafael; Martinez Rivero, Celso; Matorras, Francisco; Munoz Sanchez, Francisca Javiela; Piedra Gomez, Jonatan; Rodrigo, Teresa; Ruiz Jimeno, Alberto; Scodellaro, Luca; Sobron Sanudo, Mar; Vila, Ivan; Vilar Cortabitarte, Rocio; Abbaneo, Duccio; Auffray, Etiennette; Auzinger, Georg; Baillon, Paul; Ball, Austin; Barney, David; Bell, Alan James; Benedetti, Daniele; Bernet, Colin; Bialas, Wojciech; Bloch, Philippe; Bocci, Andrea; Bolognesi, Sara; Breuker, Horst; Brona, Grzegorz; Bunkowski, Karol; Camporesi, Tiziano; Cano, Eric; Cerminara, Gianluca; Christiansen, Tim; Coarasa Perez, Jose Antonio; Covarelli, Roberto; Curé, Benoît; D'Enterria, David; Dahms, Torsten; De Roeck, Albert; Duarte Ramos, Fernando; Elliott-Peisert, Anna; Funk, Wolfgang; Gaddi, Andrea; Gennai, Simone; Georgiou, Georgios; Gerwig, Hubert; Gigi, Dominique; Gill, Karl; Giordano, Domenico; Glege, Frank; Gomez-Reino Garrido, Robert; Gouzevitch, Maxime; Govoni, Pietro; Gowdy, Stephen; Guiducci, Luigi; Hansen, Magnus; Harvey, John; Hegeman, Jeroen; Hegner, Benedikt; Henderson, Conor; Hoffmann, Hans Falk; Honma, Alan; Innocente, Vincenzo; Janot, Patrick; Karavakis, Edward; Lecoq, Paul; Leonidopoulos, Christos; Lourenco, Carlos; Macpherson, Alick; Maki, Tuula; Malgeri, Luca; Mannelli, Marcello; Masetti, Lorenzo; Meijers, Frans; Mersi, Stefano; Meschi, Emilio; Moser, Roland; Mozer, Matthias Ulrich; Mulders, Martijn; Nesvold, Erik; Nguyen, Matthew; Orimoto, Toyoko; Orsini, Luciano; Perez, Emmanuelle; Petrilli, Achille; Pfeiffer, Andreas; Pierini, Maurizio; Pimiä, Martti; Polese, Giovanni; Racz, Attila; Rolandi, Gigi; Rommerskirchen, Tanja; Rovelli, Chiara; Rovere, Marco; Sakulin, Hannes; Schäfer, Christoph; Schwick, Christoph; Segoni, Ilaria; Sharma, Archana; Siegrist, Patrice; Simon, Michal; Sphicas, Paraskevas; Spiga, Daniele; Spiropulu, Maria; Stöckli, Fabian; Stoye, Markus; Tropea, Paola; Tsirou, Andromachi; Tsyganov, Andrey; Veres, Gabor Istvan; Vichoudis, Paschalis; Voutilainen, Mikko; Zeuner, Wolfram Dietrich; Bertl, Willi; Deiters, Konrad; Erdmann, Wolfram; Gabathuler, Kurt; Horisberger, Roland; Ingram, Quentin; Kaestli, Hans-Christian; König, Stefan; Kotlinski, Danek; Langenegger, Urs; Meier, Frank; Renker, Dieter; Rohe, Tilman; Sibille, Jennifer; Starodumov, Andrei; Bortignon, Pierluigi; Caminada, Lea; Chen, Zhiling; Cittolin, Sergio; Dissertori, Günther; Dittmar, Michael; Eugster, Jürg; Freudenreich, Klaus; Grab, Christoph; Hervé, Alain; Hintz, Wieland; Lecomte, Pierre; Lustermann, Werner; Marchica, Carmelo; Martinez Ruiz del Arbol, Pablo; Meridiani, Paolo; Milenovic, Predrag; Moortgat, Filip; Nef, Pascal; Nessi-Tedaldi, Francesca; Pape, Luc; Pauss, Felicitas; Punz, Thomas; Rizzi, Andrea; Ronga, Frederic Jean; Sala, Leonardo; Sanchez, Ann - Karin; Sawley, Marie-Christine; Stieger, Benjamin; Tauscher, Ludwig; Thea, Alessandro; Theofilatos, Konstantinos; Treille, Daniel; Urscheler, Christina; Wallny, Rainer; Weber, Matthias; Wehrli, Lukas; Weng, Joanna; Aguiló, Ernest; Amsler, Claude; Chiochia, Vincenzo; De Visscher, Simon; Favaro, Carlotta; Ivova Rikova, Mirena; Millan Mejias, Barbara; Regenfus, Christian; Robmann, Peter; Schmidt, Alexander; Snoek, Hella; Wilke, Lotte; Chang, Yuan-Hann; Chen, Kuan-Hsin; Chen, Wan-Ting; Dutta, Suchandra; Go, Apollo; Kuo, Chia-Ming; Li, Syue-Wei; Lin, Willis; Liu, Ming-Hsiung; Liu, Zong-kai; Lu, Yun-Ju; Wu, Jing-Han; Yu, Shin-Shan; Bartalini, Paolo; Chang, Paoti; Chang, You-Hao; Chang, Yu-Wei; Chao, Yuan; Chen, Kai-Feng; Hou, George Wei-Shu; Hsiung, Yee; Kao, Kai-Yi; Lei, Yeong-Jyi; Lu, Rong-Shyang; Shiu, Jing-Ge; Tzeng, Yeng-Ming; Wang, Minzu; Adiguzel, Aytul; Bakirci, Mustafa Numan; Cerci, Salim; Dozen, Candan; Dumanoglu, Isa; Eskut, Eda; Girgis, Semiray; Gökbulut, Gül; Güler, Yalcin; Gurpinar, Emine; Hos, Ilknur; Kangal, Evrim Ersin; Karaman, Turker; Kayis Topaksu, Aysel; Nart, Alisah; Önengüt, Gülsen; Ozdemir, Kadri; Ozturk, Sertac; Polatöz, Ayse; Sogut, Kenan; Tali, Bayram; Topakli, Huseyin; Uzun, Dilber; Vergili, Latife Nukhet; Vergili, Mehmet; Zorbilmez, Caglar; Akin, Ilina Vasileva; Aliev, Takhmasib; Bilmis, Selcuk; Deniz, Muhammed; Gamsizkan, Halil; Guler, Ali Murat; Ocalan, Kadir; Ozpineci, Altug; Serin, Meltem; Sever, Ramazan; Surat, Ugur Emrah; Yildirim, Eda; Zeyrek, Mehmet; Deliomeroglu, Mehmet; Demir, Durmus; Gülmez, Erhan; Halu, Arda; Isildak, Bora; Kaya, Mithat; Kaya, Ozlem; Özbek, Melih; Ozkorucuklu, Suat; Sonmez, Nasuf; Levchuk, Leonid; Bell, Peter; Bostock, Francis; Brooke, James John; Cheng, Teh Lee; Clement, Emyr; Cussans, David; Frazier, Robert; Goldstein, Joel; Grimes, Mark; Hansen, Maria; Hartley, Dominic; Heath, Greg P.; Heath, Helen F.; Huckvale, Benedickt; Jackson, James; Kreczko, Lukasz; Metson, Simon; Newbold, Dave M.; Nirunpong, Kachanon; Poll, Anthony; Senkin, Sergey; Smith, Vincent J.; Ward, Simon; Basso, Lorenzo; Bell, Ken W.; Belyaev, Alexander; Brew, Christopher; Brown, Robert M.; Camanzi, Barbara; Cockerill, David J.A.; Coughlan, John A.; Harder, Kristian; Harper, Sam; Kennedy, Bruce W.; Olaiya, Emmanuel; Petyt, David; Radburn-Smith, Benjamin Charles; Shepherd-Themistocleous, Claire; Tomalin, Ian R.; Womersley, William John; Worm, Steven; Bainbridge, Robert; Ball, Gordon; Ballin, Jamie; Beuselinck, Raymond; Buchmuller, Oliver; Colling, David; Cripps, Nicholas; Cutajar, Michael; Davies, Gavin; Della Negra, Michel; Fulcher, Jonathan; Futyan, David; Guneratne Bryer, Arlo; Hall, Geoffrey; Hatherell, Zoe; Hays, Jonathan; Iles, Gregory; Karapostoli, Georgia; Lyons, Louis; Magnan, Anne-Marie; Marrouche, Jad; Nandi, Robin; Nash, Jordan; Nikitenko, Alexander; Papageorgiou, Anastasios; Pesaresi, Mark; Petridis, Konstantinos; Pioppi, Michele; Raymond, David Mark; Rompotis, Nikolaos; Rose, Andrew; Ryan, Matthew John; Seez, Christopher; Sharp, Peter; Sparrow, Alex; Tapper, Alexander; Tourneur, Stephane; Vazquez Acosta, Monica; Virdee, Tejinder; Wakefield, Stuart; Wardrope, David; Whyntie, Tom; Barrett, Matthew; Chadwick, Matthew; Cole, Joanne; Hobson, Peter R.; Khan, Akram; Kyberd, Paul; Leslie, Dawn; Martin, William; Reid, Ivan; Teodorescu, Liliana; Hatakeyama, Kenichi; Bose, Tulika; Carrera Jarrin, Edgar; Clough, Andrew; Fantasia, Cory; Heister, Arno; St. John, Jason; Lawson, Philip; Lazic, Dragoslav; Rohlf, James; Sperka, David; Sulak, Lawrence; Avetisyan, Aram; Bhattacharya, Saptaparna; Chou, John Paul; Cutts, David; Esen, Selda; Ferapontov, Alexey; Heintz, Ulrich; Jabeen, Shabnam; Kukartsev, Gennadiy; Landsberg, Greg; Narain, Meenakshi; Nguyen, Duong; Segala, Michael; Speer, Thomas; Tsang, Ka Vang; Borgia, Maria Assunta; Breedon, Richard; Calderon De La Barca Sanchez, Manuel; Cebra, Daniel; Chauhan, Sushil; Chertok, Maxwell; Conway, John; Cox, Peter Timothy; Dolen, James; Erbacher, Robin; Friis, Evan; Ko, Winston; Kopecky, Alexandra; Lander, Richard; Liu, Haidong; Maruyama, Sho; Miceli, Tia; Nikolic, Milan; Pellett, Dave; Robles, Jorge; Schwarz, Thomas; Searle, Matthew; Smith, John; Squires, Michael; Tripathi, Mani; Vasquez Sierra, Ricardo; Veelken, Christian; Andreev, Valeri; Arisaka, Katsushi; Cline, David; Cousins, Robert; Deisher, Amanda; Duris, Joseph; Erhan, Samim; Farrell, Chris; Hauser, Jay; Ignatenko, Mikhail; Jarvis, Chad; Plager, Charles; Rakness, Gregory; Schlein, Peter; Tucker, Jordan; Valuev, Vyacheslav; Babb, John; Clare, Robert; Ellison, John Anthony; Gary, J William; Giordano, Ferdinando; Hanson, Gail; Jeng, Geng-Yuan; Kao, Shih-Chuan; Liu, Feng; Liu, Hongliang; Luthra, Arun; Nguyen, Harold; Pasztor, Gabriella; Satpathy, Asish; Shen, Benjamin C.; Stringer, Robert; Sturdy, Jared; Sumowidagdo, Suharyo; Wilken, Rachel; Wimpenny, Stephen; Andrews, Warren; Branson, James G.; Dusinberre, Elizabeth; Evans, David; Golf, Frank; Holzner, André; Kelley, Ryan; Lebourgeois, Matthew; Letts, James; Mangano, Boris; Muelmenstaedt, Johannes; Padhi, Sanjay; Palmer, Christopher; Petrucciani, Giovanni; Pi, Haifeng; Pieri, Marco; Ranieri, Riccardo; Sani, Matteo; Sharma, Vivek; Simon, Sean; Tu, Yanjun; Vartak, Adish; Würthwein, Frank; Yagil, Avraham; Barge, Derek; Bellan, Riccardo; Campagnari, Claudio; D'Alfonso, Mariarosaria; Danielson, Thomas; Geffert, Paul; Incandela, Joe; Justus, Christopher; Kalavase, Puneeth; Koay, Sue Ann; Kovalskyi, Dmytro; Krutelyov, Vyacheslav; Lowette, Steven; Mccoll, Nickolas; Pavlunin, Viktor; Rebassoo, Finn; Ribnik, Jacob; Richman, Jeffrey; Rossin, Roberto; Stuart, David; To, Wing; Vlimant, Jean-Roch; Bornheim, Adolf; Bunn, Julian; Chen, Yi; Gataullin, Marat; Kcira, Dorian; Litvine, Vladimir; Ma, Yousi; Mott, Alexander; Newman, Harvey B.; Rogan, Christopher; Timciuc, Vladlen; Traczyk, Piotr; Veverka, Jan; Wilkinson, Richard; Yang, Yong; Zhu, Ren-Yuan; Akgun, Bora; Carroll, Ryan; Ferguson, Thomas; Iiyama, Yutaro; Jang, Dong Wook; Jun, Soon Yung; Liu, Yueh-Feng; Paulini, Manfred; Russ, James; Terentyev, Nikolay; Vogel, Helmut; Vorobiev, Igor; Cumalat, John Perry; Dinardo, Mauro Emanuele; Drell, Brian Robert; Edelmaier, Christopher; Ford, William T.; Heyburn, Bernadette; Luiggi Lopez, Eduardo; Nauenberg, Uriel; Smith, James; Stenson, Kevin; Ulmer, Keith; Wagner, Stephen Robert; Zang, Shi-Lei; Agostino, Lorenzo; Alexander, James; Chatterjee, Avishek; Das, Souvik; Eggert, Nicholas; Fields, Laura Johanna; Gibbons, Lawrence Kent; Heltsley, Brian; Hopkins, Walter; Khukhunaishvili, Aleko; Kreis, Benjamin; Kuznetsov, Valentin; Nicolas Kaufman, Gala; Patterson, Juliet Ritchie; Puigh, Darren; Riley, Daniel; Ryd, Anders; Shi, Xin; Sun, Werner; Teo, Wee Don; Thom, Julia; Thompson, Joshua; Vaughan, Jennifer; Weng, Yao; Winstrom, Lucas; Wittich, Peter; Biselli, Angela; Cirino, Guy; Winn, Dave; Abdullin, Salavat; Albrow, Michael; Anderson, Jacob; Apollinari, Giorgio; Atac, Muzaffer; Bakken, Jon Alan; Banerjee, Sunanda; Bauerdick, Lothar A.T.; Beretvas, Andrew; Berryhill, Jeffrey; Bhat, Pushpalatha C.; Bloch, Ingo; Borcherding, Frederick; Burkett, Kevin; Butler, Joel Nathan; Chetluru, Vasundhara; Cheung, Harry; Chlebana, Frank; Cihangir, Selcuk; Demarteau, Marcel; Eartly, David P.; Elvira, Victor Daniel; Fisk, Ian; Freeman, Jim; Gao, Yanyan; Gottschalk, Erik; Green, Dan; Gunthoti, Kranti; Gutsche, Oliver; Hahn, Alan; Hanlon, Jim; Harris, Robert M.; Hirschauer, James; Hooberman, Benjamin; James, Eric; Jensen, Hans; Johnson, Marvin; Joshi, Umesh; Khatiwada, Rakshya; Kilminster, Benjamin; Klima, Boaz; Kousouris, Konstantinos; Kunori, Shuichi; Kwan, Simon; Limon, Peter; Lipton, Ron; Lykken, Joseph; Maeshima, Kaori; Marraffino, John Michael; Mason, David; McBride, Patricia; McCauley, Thomas; Miao, Ting; Mishra, Kalanand; Mrenna, Stephen; Musienko, Yuri; Newman-Holmes, Catherine; O'Dell, Vivian; Popescu, Sorina; Pordes, Ruth; Prokofyev, Oleg; Saoulidou, Niki; Sexton-Kennedy, Elizabeth; Sharma, Seema; Soha, Aron; Spalding, William J.; Spiegel, Leonard; Tan, Ping; Taylor, Lucas; Tkaczyk, Slawek; Uplegger, Lorenzo; Vaandering, Eric Wayne; Vidal, Richard; Whitmore, Juliana; Wu, Weimin; Yang, Fan; Yumiceva, Francisco; Yun, Jae Chul; Acosta, Darin; Avery, Paul; Bourilkov, Dimitri; Chen, Mingshui; Di Giovanni, Gian Piero; Dobur, Didar; Drozdetskiy, Alexey; Field, Richard D.; Fisher, Matthew; Fu, Yu; Furic, Ivan-Kresimir; Gartner, Joseph; Goldberg, Sean; Kim, Bockjoo; Klimenko, Sergey; Konigsberg, Jacobo; Korytov, Andrey; Kropivnitskaya, Anna; Kypreos, Theodore; Matchev, Konstantin; Mitselmakher, Guenakh; Muniz, Lana; Pakhotin, Yuriy; Prescott, Craig; Remington, Ronald; Schmitt, Michael; Scurlock, Bobby; Sellers, Paul; Skhirtladze, Nikoloz; Wang, Dayong; Yelton, John; Zakaria, Mohammed; Ceron, Cristobal; Gaultney, Vanessa; Kramer, Laird; Lebolo, Luis Miguel; Linn, Stephan; Markowitz, Pete; Martinez, German; Rodriguez, Jorge Luis; Adams, Todd; Askew, Andrew; Bandurin, Dmitry; Bochenek, Joseph; Chen, Jie; Diamond, Brendan; Gleyzer, Sergei V; Haas, Jeff; Hagopian, Sharon; Hagopian, Vasken; Jenkins, Merrill; Johnson, Kurtis F.; Prosper, Harrison; Sekmen, Sezen; Veeraraghavan, Venkatesh; Baarmand, Marc M.; Dorney, Brian; Guragain, Samir; Hohlmann, Marcus; Kalakhety, Himali; Ralich, Robert; Vodopiyanov, Igor; Adams, Mark Raymond; Anghel, Ioana Maria; Apanasevich, Leonard; Bai, Yuting; Bazterra, Victor Eduardo; Betts, Russell Richard; Callner, Jeremy; Cavanaugh, Richard; Dragoiu, Cosmin; Garcia-Solis, Edmundo Javier; Gerber, Cecilia Elena; Hofman, David Jonathan; Khalatyan, Samvel; Lacroix, Florent; O'Brien, Christine; Silvestre, Catherine; Smoron, Agata; Strom, Derek; Varelas, Nikos; Akgun, Ugur; Albayrak, Elif Asli; Bilki, Burak; Cankocak, Kerem; Clarida, Warren; Duru, Firdevs; Lae, Chung Khim; McCliment, Edward; Merlo, Jean-Pierre; Mermerkaya, Hamit; Mestvirishvili, Alexi; Moeller, Anthony; Nachtman, Jane; Newsom, Charles Ray; Norbeck, Edwin; Olson, Jonathan; Onel, Yasar; Ozok, Ferhat; Sen, Sercan; Wetzel, James; Yetkin, Taylan; Yi, Kai; Barnett, Bruce Arnold; Blumenfeld, Barry; Bonato, Alessio; Eskew, Christopher; Fehling, David; Giurgiu, Gavril; Gritsan, Andrei; Guo, Zijin; Hu, Guofan; Maksimovic, Petar; Rappoccio, Salvatore; Swartz, Morris; Tran, Nhan Viet; Whitbeck, Andrew; Baringer, Philip; Bean, Alice; Benelli, Gabriele; Grachov, Oleg; Murray, Michael; Noonan, Daniel; Radicci, Valeria; Sanders, Stephen; Wood, Jeffrey Scott; Zhukova, Victoria; Bolton, Tim; Chakaberia, Irakli; Ivanov, Andrew; Makouski, Mikhail; Maravin, Yurii; Shrestha, Shruti; Svintradze, Irakli; Wan, Zongru; Gronberg, Jeffrey; Lange, David; Wright, Douglas; Baden, Drew; Boutemeur, Madjid; Eno, Sarah Catherine; Ferencek, Dinko; Gomez, Jaime; Hadley, Nicholas John; Kellogg, Richard G.; Kirn, Malina; Lu, Ying; Mignerey, Alice; Rossato, Kenneth; Rumerio, Paolo; Santanastasio, Francesco; Skuja, Andris; Temple, Jeffrey; Tonjes, Marguerite; Tonwar, Suresh C.; Twedt, Elizabeth; Alver, Burak; Bauer, Gerry; Bendavid, Joshua; Busza, Wit; Butz, Erik; Cali, Ivan Amos; Chan, Matthew; Dutta, Valentina; Everaerts, Pieter; Gomez Ceballos, Guillelmo; Goncharov, Maxim; Hahn, Kristan Allan; Harris, Philip; Kim, Yongsun; Klute, Markus; Lee, Yen-Jie; Li, Wei; Loizides, Constantinos; Luckey, Paul David; Ma, Teng; Nahn, Steve; Paus, Christoph; Roland, Christof; Roland, Gunther; Rudolph, Matthew; Stephans, George; Sumorok, Konstanty; Sung, Kevin; Wenger, Edward Allen; Xie, Si; Yang, Mingming; Yilmaz, Yetkin; Yoon, Sungho; Zanetti, Marco; Cole, Perrie; Cooper, Seth; Cushman, Priscilla; Dahmes, Bryan; De Benedetti, Abraham; Dudero, Phillip Russell; Franzoni, Giovanni; Haupt, Jason; Klapoetke, Kevin; Kubota, Yuichi; Mans, Jeremy; Rekovic, Vladimir; Rusack, Roger; Sasseville, Michael; Singovsky, Alexander; Cremaldi, Lucien Marcus; Godang, Romulus; Kroeger, Rob; Perera, Lalith; Rahmat, Rahmat; Sanders, David A; Summers, Don; Bloom, Kenneth; Bose, Suvadeep; Butt, Jamila; Claes, Daniel R.; Dominguez, Aaron; Eads, Michael; Keller, Jason; Kelly, Tony; Kravchenko, Ilya; Lazo-Flores, Jose; Lundstedt, Carl; Malbouisson, Helena; Malik, Sudhir; Snow, Gregory R.; Baur, Ulrich; Godshalk, Andrew; Iashvili, Ia; Kharchilava, Avto; Kumar, Ashish; Smith, Kenneth; Alverson, George; Barberis, Emanuela; Baumgartel, Darin; Boeriu, Oana; Chasco, Matthew; Kaadze, Ketino; Reucroft, Steve; Swain, John; Wood, Darien; Zhang, Jinzhong; Anastassov, Anton; Kubik, Andrew; Odell, Nathaniel; Ofierzynski, Radoslaw Adrian; Pollack, Brian; Pozdnyakov, Andrey; Schmitt, Michael; Stoynev, Stoyan; Velasco, Mayda; Won, Steven; Antonelli, Louis; Berry, Douglas; Hildreth, Michael; Jessop, Colin; Karmgard, Daniel John; Kolb, Jeff; Kolberg, Ted; Lannon, Kevin; Luo, Wuming; Lynch, Sean; Marinelli, Nancy; Morse, David Michael; Pearson, Tessa; Ruchti, Randy; Slaunwhite, Jason; Valls, Nil; Warchol, Jadwiga; Wayne, Mitchell; Ziegler, Jill; Bylsma, Ben; Durkin, Lloyd Stanley; Gu, Jianhui; Hill, Christopher; Killewald, Phillip; Kotov, Khristian; Ling, Ta-Yung; Rodenburg, Marissa; Williams, Grayson; Adam, Nadia; Berry, Edmund; Elmer, Peter; Gerbaudo, Davide; Halyo, Valerie; Hebda, Philip; Hunt, Adam; Jones, John; Laird, Edward; Lopes Pegna, David; Marlow, Daniel; Medvedeva, Tatiana; Mooney, Michael; Olsen, James; Piroué, Pierre; Quan, Xiaohang; Saka, Halil; Stickland, David; Tully, Christopher; Werner, Jeremy Scott; Zuranski, Andrzej; Acosta, Jhon Gabriel; Huang, Xing Tao; Lopez, Angel; Mendez, Hector; Oliveros, Sandra; Ramirez Vargas, Juan Eduardo; Zatserklyaniy, Andriy; Alagoz, Enver; Barnes, Virgil E.; Bolla, Gino; Borrello, Laura; Bortoletto, Daniela; Everett, Adam; Garfinkel, Arthur F.; Gecse, Zoltan; Gutay, Laszlo; Jones, Matthew; Koybasi, Ozhan; Laasanen, Alvin T.; Leonardo, Nuno; Liu, Chang; Maroussov, Vassili; Merkel, Petra; Miller, David Harry; Neumeister, Norbert; Potamianos, Karolos; Shipsey, Ian; Silvers, David; Svyatkovskiy, Alexey; Yoo, Hwi Dong; Zablocki, Jakub; Zheng, Yu; Jindal, Pratima; Parashar, Neeti; Boulahouache, Chaouki; Cuplov, Vesna; Ecklund, Karl Matthew; Geurts, Frank J.M.; Liu, Jinghua H.; Morales, Jafet; Padley, Brian Paul; Redjimi, Radia; Roberts, Jay; Zabel, James; Betchart, Burton; Bodek, Arie; Chung, Yeon Sei; de Barbaro, Pawel; Demina, Regina; Eshaq, Yossof; Flacher, Henning; Garcia-Bellido, Aran; Goldenzweig, Pablo; Gotra, Yury; Han, Jiyeon; Harel, Amnon; Miner, Daniel Carl; Orbaker, Douglas; Petrillo, Gianluca; Vishnevskiy, Dmitry; Zielinski, Marek; Bhatti, Anwar; Demortier, Luc; Goulianos, Konstantin; Lungu, Gheorghe; Mesropian, Christina; Yan, Ming; Atramentov, Oleksiy; Barker, Anthony; Duggan, Daniel; Gershtein, Yuri; Gray, Richard; Halkiadakis, Eva; Hidas, Dean; Hits, Dmitry; Lath, Amitabh; Panwalkar, Shruti; Patel, Rishi; Richards, Alan; Rose, Keith; Schnetzer, Steve; Somalwar, Sunil; Stone, Robert; Thomas, Scott; Cerizza, Giordano; Hollingsworth, Matthew; Spanier, Stefan; Yang, Zong-Chang; York, Andrew; Asaadi, Jonathan; Eusebi, Ricardo; Gilmore, Jason; Gurrola, Alfredo; Kamon, Teruki; Khotilovich, Vadim; Montalvo, Roy; Nguyen, Chi Nhan; Pivarski, James; Safonov, Alexei; Sengupta, Sinjini; Tatarinov, Aysen; Toback, David; Weinberger, Michael; Akchurin, Nural; Bardak, Cemile; Damgov, Jordan; Jeong, Chiyoung; Kovitanggoon, Kittikul; Lee, Sung Won; Mane, Poonam; Roh, Youn; Sill, Alan; Volobouev, Igor; Wigmans, Richard; Yazgan, Efe; Appelt, Eric; Brownson, Eric; Engh, Daniel; Florez, Carlos; Gabella, William; Johns, Willard; Kurt, Pelin; Maguire, Charles; Melo, Andrew; Sheldon, Paul; Velkovska, Julia; Arenton, Michael Wayne; Balazs, Michael; Boutle, Sarah; Buehler, Marc; Conetti, Sergio; Cox, Bradley; Francis, Brian; Hirosky, Robert; Ledovskoy, Alexander; Lin, Chuanzhe; Neu, Christopher; Yohay, Rachel; Gollapinni, Sowjanya; Harr, Robert; Karchin, Paul Edmund; Mattson, Mark; Milstène, Caroline; Sakharov, Alexandre; Anderson, Michael; Bachtis, Michail; Bellinger, James Nugent; Carlsmith, Duncan; Dasu, Sridhara; Efron, Jonathan; Gray, Lindsey; Grogg, Kira Suzanne; Grothe, Monika; Hall-Wilton, Richard; Herndon, Matthew; Klabbers, Pamela; Klukas, Jeffrey; Lanaro, Armando; Lazaridis, Christos; Leonard, Jessica; Lomidze, David; Loveless, Richard; Mohapatra, Ajit; Parker, William; Reeder, Don; Ross, Ian; Savin, Alexander; Smith, Wesley H.; Swanson, Joshua; Weinberg, Marc
2011-01-01
Measurements of primary charged hadron multiplicity distributions are presented for non-single-diffractive events in proton-proton collisions at centre-of-mass energies of sqrt(s) = 0.9, 2.36, and 7 TeV, in five pseudorapidity ranges from |eta|<0.5 to |eta|<2.4. The data were collected with the minimum-bias trigger of the CMS experiment during the LHC commissioning runs in 2009 and the 7 TeV run in 2010. The multiplicity distribution at sqrt(s) = 0.9 TeV is in agreement with previous measurements. At higher energies the increase of the mean multiplicity with sqrt(s) is underestimated by most event generators. The average transverse momentum as a function of the multiplicity is also presented. The measurement of higher-order moments of the multiplicity distribution confirms the violation of Koba-Nielsen-Olesen scaling that has been observed at lower energies.
Singlet ground-state fluctuations in praseodymium observed by muon spin relaxation in PrP and PrP0.9
International Nuclear Information System (INIS)
Noakes, D R; Waeppling, R; Kalvius, G M; Jr, M F White; Stronach, C E
2005-01-01
Muon spin relaxation (μSR) in the singlet ground-state compounds PrP and PrP 0.9 reveals the unusual situation of a Lorentzian local field distribution with fast-fluctuation-limit strong-collision dynamics, a case that does not show motional narrowing. Contrary to publications by others, where PrP 0.9 was asserted to have vacancy-induced spin-glass freezing, no spin-glass freezing is seen in PrP 0.9 or PrP down to ≤100mK. This was confirmed by magnetization measurements on these same samples. In both compounds, the muon spin relaxation rate does increase as temperature decreases, demonstrating increasing strength of the paramagnetic response. A Monte Carlo model of fluctuations of Pr ions out of their crystalline-electric-field singlet ground states into their magnetic excited states (and back down again) produces the strong-collision-dynamic Lorentzian relaxation functions observed at each individual temperature but not the observed temperature dependence. This model contains no exchange interaction, and so predicts decreasing paramagnetic response as the temperature decreases, contrary to the temperature dependence observed. Comparison of the simulations to the data suggests that the exchange interaction is causing the system to approach magnetic freezing (by mode softening), but fails to complete the process
Nandenha, J.; Isidoro, R.A.; Dresch, M.A.; Fernandes, V.C.; Aricó, B.; Santiago, E.I.; Rothenberg, G.; Oliveira, W.S.; Linardi, M.
2012-01-01
The nanophase material (powder) of Ce0.9W0.1O2 was synthesized via coprecipitation of oxalates of cerium (IV) and tungsten cations. Pt-Ce0.9W0.1O2 (2 wt% Pt) was prepared by an alcohol-reduction process using H2PtCl6.6H2O as source of Pt, Ce0.9W0.1O2 as support and ethylene glycol as solvent and
Optical conductivity of Ni1 − xPtx alloys (0
Directory of Open Access Journals (Sweden)
Lina S. Abdallah
2014-01-01
Full Text Available Using spectroscopic ellipsometry and Drude-Lorentz oscillator fitting, we determined the dielectric function and optical conductivity versus photon energy from 0.76 to 6.6 eV of 10 nm thick Ni1 − xPtx alloy (0
A 55Mn NMR Study of the La0.75Sr0.25MnO3 Nanoparticles
International Nuclear Information System (INIS)
Kapusta, Cz.; Rybicki, D.; Sikora, M.
2005-01-01
We report on a 55 Mn NMR study of the La 0.75 Sr 0.25 MnO 3 nanoparticles with the average grain size of 33 nm and 114 nm at 4.2 K and at the applied field 0, 0.2 and 0.5 T. A dominant signal from the double exchange (DE) controlled metallic ferromagnetic interior of the grains as well as a small signal from insulating ferromagnetic surface regions of the grains are observed. The DE resonant line shows a frequency shift in the applied field according to a full gyromagnetic ratio and a value of the demagnetizing field much smaller than 0.2 T is obtained. In both samples studied a two-exponential nuclear spin-spin (T 2 ) relaxation is observed at zero field, whereas a single-exponential relaxation is observed at the applied field of 0.5 T. For the sample with larger grains a higher NMR enhancement is observed, which indicates a higher magnetic susceptibility of the sample at the NMR frequencies. A comparison to the NMR data obtained on a bulk material is made. The results are discussed in terms of the influence of the grain size and on the presence of domain walls or other magnetic inhomogeneities and on the magnetic anisotropy
A 55Mn NMR study of the La0.75Sr0.25MnO3 nanoparticles
International Nuclear Information System (INIS)
Rybicki, D.; Sikora, M.; Kapusta, Cz.; Riedi, P.C.; Jirak, Z.; Knizek, K.; Marysko, M.; Pollert, E.; Veverka, P.
2006-01-01
We report on a 55 Mn NMR study of the La 0.75 Sr 0.25 MnO 3 nanoparticles of the average grain size 33 nm and 114 nm at 4.2 K and 77 K and at applied field of 0, 0.2 and 0.5T. A dominant signal from the double exchange (DE) controlled metallic ferromagnetic interior of the grains as well as a small signal from insulating ferromagnetic regions is observed. From a comparison with bulk magnetization measurement the thickness of the nonferromagnetic outer layer of the grains and the amount of the ferromagnetic insulating phase was determined. The relative amount of these phases with respect to the ferromagnetic metallic phase increases with decreasing grain size. The DE line in the NMR spectrum shows a frequency shift with applied field according to a full 55 Mn gyromagnetic ratio. A value of the demagnetizing field close to zero is obtained, which indicates a single domain state of the nanoparticles. For the sample with larger grains a higher NMR enhancement is observed, which indicates a higher magnetic susceptibility of the sample at the NMR frequencies. A comparison with the NMR data obtained on a microcrystalline material is made. (copyright 2006 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)
Directory of Open Access Journals (Sweden)
Alvaro A. Rodriguez
2018-01-01
Full Text Available The corrosion behavior of high-entropy alloys (HEAs CoCrFeNi2 and CoCrFeNi2Mo0.25 was investigated in 3.5 wt. percent sodium chloride (NaCl at 25°C by electrochemical methods. Their corrosion parameters were compared to those of HASTELLOY® C-276 (UNS N10276 and stainless steel 316L (UNS 31600 to assess the suitability of HEAs for potential industrial applications in NaCl simulating seawater type environments. The corrosion rates were calculated using corrosion current determined from electrochemical experiments for each of the alloys. In addition, potentiodynamic polarization measurements can indicate active, passive, and transpassive behavior of the metal as well as potential susceptibility to pitting corrosion. Cyclic voltammetry (CV can confirm the alloy susceptibility to pitting corrosion. Electrochemical impedance spectroscopy (EIS elucidates the corrosion mechanism under studied conditions. The results of the electrochemical experiments and scanning electron microscopy (SEM analyses of the corroded surfaces revealed general corrosion on alloy CoCrFeNi2Mo0.25 and HASTELLOY C-276 and pitting corrosion on alloy CoCrFeNi2 and stainless steel 316L.
High-rate deformation and fracture of steel 09G2S
Balandin, Vl. Vas.; Balandin, Vl. Vl.; Bragov, A. M.; Igumnov, L. A.; Konstantinov, A. Yu.; Lomunov, A. K.
2014-11-01
The results of experimental and theoretical studies of steel 09G2S deformation and fracture laws in a wide range of strain rates and temperature variations are given. The dynamic deformation curves and the ultimate characteristics of plasticity in high-rate strain were determined by the Kolsky method in compression, extension, and shear tests. The elastoplastic properties and spall strength were studied by using the gaseous gun of calibre 57 mm and the interferometer VISAR according to the plane-wave experiment technique. The data obtained by the Kolsky method were used to determine the parameters of the Johnson-Cook model which, in the framework of the theory of flow, describes how the yield surface radius depends on the strain, strain rate, and temperature.
Verification testing of the Terre Hill Concrete Products Terre Kleen™ 09 was conducted on a 1.27 acre portion of the City of Harrisburg, Pennsylvania Department of Public Works facility. The Terre Kleen™ devices combines primary and secondary chambers, baffles, a screen, and incl...
2018-05-09T12:11:53Z https://www.ajol.info/index.php/all/oai oai:ojs ...
African Journals Online (AJOL)
article/7559 2018-05-09T12:11:53Z ajns:ART HYDROCEPHALIE: UN CAS RARE DE TOXOPLAMOSE CEREBRALE DANS LE CADRE D\\'UN SYNDROME D\\'IMMUNO-DEFICIENCE ACQUISE Djientcheu, Vincent de Paul; Neurosurgery Unit, ...
Khachatryan, Vardan; Tumasyan, Armen; Adam, Wolfgang; Bergauer, Thomas; Dragicevic, Marko; Ero, Janos; Friedl, Markus; Fruehwirth, Rudolf; Ghete, Vasile Mihai; Hammer, Josef; Haensel, Stephan; Hoch, Michael; Hormann, Natascha; Hrubec, Josef; Jeitler, Manfred; Kasieczka, Gregor; Krammer, Manfred; Liko, Dietrich; Mikulec, Ivan; Pernicka, Manfred; Rohringer, Herbert; Schofbeck, Robert; Strauss, Josef; Taurok, Anton; Teischinger, Florian; Waltenberger, Wolfgang; Walzel, Gerhard; Widl, Edmund; Wulz, Claudia-Elisabeth; Mossolov, Vladimir; Shumeiko, Nikolai; Suarez Gonzalez, Juan; Benucci, Leonardo; De Wolf, Eddi A.; Hashemi, Majid; Janssen, Xavier; Maes, Thomas; Mucibello, Luca; Ochesanu, Silvia; Rougny, Romain; Selvaggi, Michele; Van Haevermaet, Hans; Van Mechelen, Pierre; Van Remortel, Nick; Adler, Volker; Beauceron, Stephanie; D'Hondt, Jorgen; Devroede, Olivier; Kalogeropoulos, Alexis; Maes, Joris; Mozer, Matthias Ulrich; Tavernier, Stefaan; Van Doninck, Walter; Van Mulders, Petra; Villella, Ilaria; Chabert, Eric Christian; Charaf, Otman; Clerbaux, Barbara; De Lentdecker, Gilles; Dero, Vincent; Gay, Arnaud; Hammad, Gregory Habib; Marage, Pierre Edouard; Vander Velde, Catherine; Vanlaer, Pascal; Wickens, John; Grunewald, Martin; Klein, Benjamin; Marinov, Andrey; Ryckbosch, Dirk; Thyssen, Filip; Tytgat, Michael; Vanelderen, Lukas; Verwilligen, Piet; Walsh, Sinead; Basegmez, Suzan; Bruno, Giacomo; Caudron, Julien; Cortina Gil, Eduardo; De Favereau De Jeneret, Jerome; Delaere, Christophe; Demin, Pavel; Favart, Denis; Giammanco, Andrea; Gregoire, Ghislain; Hollar, Jonathan; Lemaitre, Vincent; Militaru, Otilia; Ovyn, Severine; Piotrzkowski, Krzysztof; Quertenmont, Loic; Schul, Nicolas; Beliy, Nikita; Caebergs, Thierry; Daubie, Evelyne; Herquet, Philippe; Alves, Gilvan; Pol, Maria Elena; Henrique Gomes e Souza, Moacyr; Carvalho, Wagner; Melo Da Costa, Eliza; De Jesus Damiao, Dilson; De Oliveira Martins, Carley; Fonseca De Souza, Sandro; Mundim, Luiz; Oguri, Vitor; Santoro, Alberto; Silva Do Amaral, Sheila Mara; Sznajder, Andre; Torres Da Silva De Araujo, Felipe; De Almeida Dias, Flavia; Dias, Marco Andre Ferreira; Tomei, Thiago; De Moraes Gregores, Eduardo; Da Cunha Marinho, Franciole; Novaes, Sergio F.; Padula, Sandra; Damgov, Jordan; Darmenov, Nikolay; Dimitrov, Lubomir; Genchev, Vladimir; Iaydjiev, Plamen; Piperov, Stefan; Stoykova, Stefka; Sultanov, Georgi; Trayanov, Rumen; Vankov, Ivan; Hadjiiska, Roumyana; Kozhuharov, Venelin; Litov, Leandar; Mateev, Matey; Pavlov, Borislav; Petkov, Peicho; Chen, Guo-Ming; Chen, He-Sheng; Jiang, Chun-Hua; Liang, Dong; Liang, Song; Meng, Xiangwei; Tao, Junquan; Wang, Jian; Wang, Xianyou; Wang, Zheng; Zang, Jingjing; Zhang, Zhen; Ban, Yong; Guo, Shuang; Hu, Zhen; Mao, Yajun; Qian, Si-Jin; Teng, Haiyun; Zhu, Bo; Andres Carrillo Montoya, Camilo; Gomez Moreno, Bernardo; Andres Ocampo Rios, Alberto; Sanabria, Juan Carlos; Godinovic, Nikola; Lelas, Karlo; Plestina, Roko; Polic, Dunja; Puljak, Ivica; Antunovic, Zeljko; Dzelalija, Mile; Brigljevic, Vuko; Duric, Senka; Kadija, Kreso; Morovic, Srecko; Attikis, Alexandros; Fereos, Reginos; Galanti, Mario; Mousa, Jehad; Papadakis, Antonakis; Ptochos, Fotios; Razis, Panos A.; Tsiakkouri, Demetra; Zinonos, Zinonas; Hektor, Andi; Kadastik, Mario; Kannike, Kristjan; Muntel, Mait; Raidal, Martti; Rebane, Liis; Eerola, Paula; Czellar, Sandor; Harkonen, Jaakko; Heikkinen, Mika Aatos; Karimaki, Veikko; Kinnunen, Ritva; Klem, Jukka; Kortelainen, Matti J.; Lampen, Tapio; Lassila-Perini, Kati; Lehti, Sami; Linden, Tomas; Luukka, Panja-Riina; Maenpaa, Teppo; Tuominen, Eija; Tuominiemi, Jorma; Tuovinen, Esa; Ungaro, Donatella; Wendland, Lauri; Banzuzi, Kukka; Korpela, Arja; Tuuva, Tuure; Sillou, Daniel; Besancon, Marc; Dejardin, Marc; Denegri, Daniel; Descamps, Julien; Fabbro, Bernard; Faure, Jean-Louis; Ferri, Federico; Ganjour, Serguei; Gentit, Francois-Xavier; Givernaud, Alain; Gras, Philippe; Hamel de Monchenault, Gautier; Jarry, Patrick; Locci, Elizabeth; Malcles, Julie; Marionneau, Matthieu; Millischer, Laurent; Rander, John; Rosowsky, Andre; Rousseau, Delphine; Titov, Maksym; Verrecchia, Patrice; Baffioni, Stephanie; Bianchini, Lorenzo; Broutin, Clementine; Busson, Philippe; Charlot, Claude; Dobrzynski, Ludwik; Elgammal, Sherif; Granier de Cassagnac, Raphael; Haguenauer, Maurice; Mine, Philippe; Paganini, Pascal; Sirois, Yves; Thiebaux, Christophe; Zabi, Alexandre; Agram, Jean-Laurent; Besson, Auguste; Bloch, Daniel; Bodin, David; Brom, Jean-Marie; Cardaci, Marco; Conte, Eric; Drouhin, Frederic; Ferro, Cristina; Fontaine, Jean-Charles; Gele, Denis; Goerlach, Ulrich; Greder, Sebastien; Juillot, Pierre; Le Bihan, Anne-Catherine; Mikami, Yoshinari; Ripp-Baudot, Isabelle; Speck, Joaquim; Van Hove, Pierre; Baty, Clement; Bedjidian, Marc; Bondu, Olivier; Boudoul, Gaelle; Boumediene, Djamel; Brun, Hugues; Chanon, Nicolas; Chierici, Roberto; Contardo, Didier; Depasse, Pierre; El Mamouni, Houmani; Fassi, Farida; Fay, Jean; Gascon, Susan; Ille, Bernard; Kurca, Tibor; Le Grand, Thomas; Lethuillier, Morgan; Mirabito, Laurent; Perries, Stephane; Tosi, Silvano; Tschudi, Yohann; Verdier, Patrice; Xiao, Hong; Roinishvili, Vladimir; Anagnostou, Georgios; Edelhoff, Matthias; Feld, Lutz; Heracleous, Natalie; Hindrichs, Otto; Jussen, Ruediger; Klein, Katja; Merz, Jennifer; Mohr, Niklas; Ostapchuk, Andrey; Pandoulas, Demetrios; Perieanu, Adrian; Raupach, Frank; Sammet, Jan; Schael, Stefan; Sprenger, Daniel; Weber, Hendrik; Weber, Martin; Wittmer, Bruno; Actis, Oxana; Bender, Walter; Biallass, Philipp; Erdmann, Martin; Frangenheim, Jens; Hebbeker, Thomas; Hinzmann, Andreas; Hoepfner, Kerstin; Hof, Carsten; Kirsch, Matthias; Klimkovich, Tatsiana; Kreuzer, Peter; Lanske, Dankfried; Merschmeyer, Markus; Meyer, Arnd; Pieta, Holger; Reithler, Hans; Schmitz, Stefan Antonius; Sowa, Michael; Steggemann, Jan; Teyssier, Daniel; Zeidler, Clemens; Bontenackels, Michael; Davids, Martina; Duda, Markus; Flugge, Gunter; Geenen, Heiko; Giffels, Manuel; Haj Ahmad, Wael; Heydhausen, Dirk; Kress, Thomas; Kuessel, Yvonne; Linn, Alexander; Nowack, Andreas; Perchalla, Lars; Pooth, Oliver; Sauerland, Philip; Stahl, Achim; Thomas, Maarten; Tornier, Daiske; Zoeller, Marc Henning; Aldaya Martin, Maria; Behrens, Ulf; Borras, Kerstin; Campbell, Alan; Castro, Elena; Dammann, Dirk; Eckerlin, Guenter; Flossdorf, Alexander; Flucke, Gero; Geiser, Achim; Hauk, Johannes; Jung, Hannes; Kasemann, Matthias; Katkov, Igor; Kleinwort, Claus; Kluge, Hannelies; Knutsson, Albert; Kuznetsova, Ekaterina; Lange, Wolfgang; Lohmann, Wolfgang; Mankel, Rainer; Marienfeld, Markus; Meyer, Andreas Bernhard; Mnich, Joachim; Olzem, Jan; Parenti, Andrea; Schmidt, Ringo; Schoerner-Sadenius, Thomas; Sen, Niladri; Stein, Matthias; Volyanskyy, Dmytro; Wissing, Christoph; Autermann, Christian; Draeger, Jula; Eckstein, Doris; Enderle, Holger; Gebbert, Ulla; Kaschube, Kolja; Kaussen, Gordon; Klanner, Robert; Mura, Benedikt; Naumann-Emme, Sebastian; Nowak, Friederike; Sander, Christian; Schleper, Peter; Schroder, Matthias; Schum, Torben; Stadie, Hartmut; Steinbruck, Georg; Thomsen, Jan; Wolf, Roger; Bauer, Julia; Blum, Peter; Buege, Volker; Cakir, Altan; Chwalek, Thorsten; Daeuwel, Daniel; De Boer, Wim; Dierlamm, Alexander; Dirkes, Guido; Feindt, Michael; Frey, Martin; Gruschke, Jasmin; Hackstein, Christoph; Hartmann, Frank; Heinrich, Michael; Hoffmann, Karl-heinz; Honc, Simon; Kuhr, Thomas; Martschei, Daniel; Mueller, Steffen; Muller, Thomas; Niegel, Martin; Oberst, Oliver; Oehler, Andreas; Ott, Jochen; Peiffer, Thomas; Piparo, Danilo; Quast, Gunter; Rabbertz, Klaus; Renz, Manuel; Sabellek, Andreas; Saout, Christophe; Scheurer, Armin; Schieferdecker, Philipp; Schilling, Frank-Peter; Schott, Gregory; Simonis, Hans-Jurgen; Stober, Fred-Markus; Wagner-Kuhr, Jeannine; Zeise, Manuel; Zhukov, Valery; Ziebarth, Eva Barbara; Daskalakis, Georgios; Geralis, Theodoros; Karafasoulis, Konstantinos; Kyriakis, Aristoteles; Loukas, Demitrios; Markou, Athanasios; Markou, Christos; Mavrommatis, Charalampos; Petrakou, Eleni; Zachariadou, Aikaterini; Agapitos, Antonis; Gouskos, Loukas; Katsas, Panagiotis; Panagiotou, Apostolos; Saganis, Konstantinos; Xaxiris, Evangelos; Evangelou, Ioannis; Kokkas, Panagiotis; Manthos, Nikolaos; Papadopoulos, Ioannis; Triantis, Frixos A.; Aranyi, Attila; Bencze, Gyorgy; Boldizsar, Laszlo; Debreczeni, Gergely; Hajdu, Csaba; Horvath, Dezso; Kapusi, Anita; Krajczar, Krisztian; Laszlo, Andras; Sikler, Ferenc; Vesztergombi, Gyorgy; Beni, Noemi; Molnar, Jozsef; Palinkas, Jozsef; Szillasi, Zoltan; Veszpremi, Viktor; Raics, Peter; Trocsanyi, Zoltan Laszlo; Ujvari, Balazs; Bansal, Sunil; Beri, Suman Bala; Bhatnagar, Vipin; Jindal, Monika; Kaur, Manjit; Kohli, Jatinder Mohan; Mehta, Manuk Zubin; Nishu, Nishu; Saini, Lovedeep Kaur; Sharma, Archana; Sharma, Richa; Singh, Anil; Singh, Jas Bir; Singh, Supreet Pal; Ahuja, Sudha; Bhattacharya, Satyaki; Chauhan, Sushil; Choudhary, Brajesh C.; Gupta, Pooja; Jain, Sandhya; Jain, Shilpi; Kumar, Ashok; Ranjan, Kirti; Shivpuri, Ram Krishen; Choudhury, Rajani Kant; Dutta, Dipanwita; Kailas, Swaminathan; Kataria, Sushil Kumar; Mohanty, Ajit Kumar; Pant, Lalit Mohan; Shukla, Prashant; Suggisetti, Praveenkumar; Aziz, Tariq; Guchait, Monoranjan; Gurtu, Atul; Maity, Manas; Majumder, Devdatta; Majumder, Gobinda; Mazumdar, Kajari; Nayak, Aruna; Saha, Anirban; Sudhakar, Katta; Wickramage, Nadeesha; Banerjee, Sudeshna; Dugad, Shashikant; Mondal, Naba Kumar; Arfaei, Hessamaddin; Bakhshiansohi, Hamed; Fahim, Ali; Jafari, Abideh; Mohammadi Najafabadi, Mojtaba; Moshaii, Ahmad; Paktinat Mehdiabadi, Saeid; Zeinali, Maryam; Felcini, Marta; Abbrescia, Marcello; Barbone, Lucia; Colaleo, Anna; Creanza, Donato; De Filippis, Nicola; De Palma, Mauro; Dimitrov, Anton; Fedele, Francesca; Fiore, Luigi; Iaselli, Giuseppe; Lusito, Letizia; Maggi, Giorgio; Maggi, Marcello; Manna, Norman; Marangelli, Bartolomeo; My, Salvatore; Nuzzo, Salvatore; Pierro, Giuseppe Antonio; Polese, Giovanni; Pompili, Alexis; Pugliese, Gabriella; Romano, Francesco; Roselli, Giuseppe; Selvaggi, Giovanna; Silvestris, Lucia; Tupputi, Salvatore; Zito, Giuseppe; Abbiendi, Giovanni; Bonacorsi, Daniele; Braibant-Giacomelli, Sylvie; Capiluppi, Paolo; Cavallo, Francesca Romana; Codispoti, Giuseppe; Cuffiani, Marco; Dallavalle, Gaetano-Marco; Fabbri, Fabrizio; Fanfani, Alessandra; Fasanella, Daniele; Giacomelli, Paolo; Giunta, Marina; Grandi, Claudio; Marcellini, Stefano; Masetti, Gianni; Montanari, Alessandro; Navarria, Francesco; Odorici, Fabrizio; Perrotta, Andrea; Rossi, Antonio; Rovelli, Tiziano; Siroli, Gianni; Travaglini, Riccardo; Albergo, Sebastiano; Chiorboli, Massimiliano; Costa, Salvatore; Potenza, Renato; Tricomi, Alessia; Tuve, Cristina; Barbagli, Giuseppe; Broccolo, Giuseppe; Ciulli, Vitaliano; Civinini, Carlo; D'Alessandro, Raffaello; Focardi, Ettore; Frosali, Simone; Gallo, Elisabetta; Genta, Chiara; Landi, Gregorio; Lenzi, Piergiulio; Meschini, Marco; Paoletti, Simone; Sguazzoni, Giacomo; Tropiano, Antonio; Bianco, Stefano; Colafranceschi, Stefano; Fabbri, Franco; Piccolo, Davide; Fabbricatore, Pasquale; Musenich, Riccardo; Benaglia, Andrea; Cerati, Giuseppe Benedetto; De Guio, Federico; Ghezzi, Alessio; Govoni, Pietro; Malberti, Martina; Malvezzi, Sandra; Martelli, Arabella; Menasce, Dario; Miccio, Vincenzo; Moroni, Luigi; Negri, Pietro; Paganoni, Marco; Pedrini, Daniele; Pullia, Antonino; Ragazzi, Stefano; Redaelli, Nicola; Sala, Silvano; Salerno, Roberto; Tabarelli de Fatis, Tommaso; Tancini, Valentina; Taroni, Silvia; Cimmino, Anna; De Gruttola, Michele; Fabozzi, Francesco; Iorio, Alberto Orso Maria; Lista, Luca; Noli, Pasquale; Paolucci, Pierluigi; Azzi, Patrizia; Bacchetta, Nicola; Bellan, Paolo; Biasotto, Massimo; Carlin, Roberto; Checchia, Paolo; De Mattia, Marco; Dorigo, Tommaso; Fanzago, Federica; Gasparini, Fabrizio; Giubilato, Piero; Gonella, Franco; Gresele, Ambra; Gulmini, Michele; Lacaprara, Stefano; Lazzizzera, Ignazio; Maron, Gaetano; Mattiazzo, Serena; Meneguzzo, Anna Teresa; Passaseo, Marina; Pegoraro, Matteo; Pozzobon, Nicola; Ronchese, Paolo; Torassa, Ezio; Tosi, Mia; Vanini, Sara; Ventura, Sandro; Zotto, Pierluigi; Baesso, Paolo; Berzano, Umberto; Pagano, Davide; Ratti, Sergio P.; Riccardi, Cristina; Torre, Paola; Vitulo, Paolo; Viviani, Claudio; Biasini, Maurizio; Bilei, Gian Mario; Caponeri, Benedetta; Fano, Livio; Lariccia, Paolo; Lucaroni, Andrea; Mantovani, Giancarlo; Nappi, Aniello; Santocchia, Attilio; Servoli, Leonello; Volpe, Roberta; Azzurri, Paolo; Bagliesi, Giuseppe; Bernardini, Jacopo; Boccali, Tommaso; Bocci, Andrea; Castaldi, Rino; Dell'Orso, Roberto; Dutta, Suchandra; Fiori, Francesco; Foa, Lorenzo; Gennai, Simone; Giassi, Alessandro; Kraan, Aafke; Ligabue, Franco; Lomtadze, Teimuraz; Martini, Luca; Messineo, Alberto; Palla, Fabrizio; Palmonari, Francesco; Sarkar, Subir; Segneri, Gabriele; Serban, Alin Titus; Spagnolo, Paolo; Tenchini, Roberto; Tonelli, Guido; Venturi, Andrea; Verdini, Piero Giorgio; Barone, Luciano; Cavallari, Francesca; del Re, Daniele; Di Marco, Emanuele; Diemoz, Marcella; Franci, Daniele; Grassi, Marco; Longo, Egidio; Organtini, Giovanni; Palma, Alessandro; Pandolfi, Francesco; Paramatti, Riccardo; Rahatlou, Shahram; Rovelli, Chiara; Amapane, Nicola; Arcidiacono, Roberta; Argiro, Stefano; Arneodo, Michele; Biino, Cristina; Borgia, Maria Assunta; Botta, Cristina; Cartiglia, Nicolo; Castello, Roberto; Costa, Marco; Dellacasa, Giulio; Demaria, Natale; Graziano, Alberto; Mariotti, Chiara; Marone, Matteo; Maselli, Silvia; Migliore, Ernesto; Mila, Giorgia; Monaco, Vincenzo; Musich, Marco; Obertino, Maria Margherita; Pastrone, Nadia; Romero, Alessandra; Ruspa, Marta; Sacchi, Roberto; Solano, Ada; Staiano, Amedeo; Trocino, Daniele; Vilela Pereira, Antonio; Ambroglini, Filippo; Belforte, Stefano; Cossutti, Fabio; Della Ricca, Giuseppe; Gobbo, Benigno; Penzo, Aldo; Chang, Sunghyun; Chung, Jin Hyuk; Kim, Dong Hee; Kim, Gui Nyun; Kong, Dae Jung; Park, Hyangkyu; Son, Dong-Chul; Kim, Jaeho; Song, Sanghyeon; Jung, Seung Yong; Hong, Byung-Sik; Kim, Hyunchul; Kim, Ji Hyun; Lee, Kyong Sei; Moon, Dong Ho; Park, Sung Keun; Rhee, Han-Bum; Sim, Kwang Souk; Kim, Jangho; Choi, Minkyoo; Park, In Kyu; Choi, Suyong; Choi, Young-Il; Choi, Young Kyu; Goh, Junghwan; Jo, Youngkwon; Kwon, Jeongteak; Lee, Jongseok; Lee, Sungeun; Janulis, Mindaugas; Martisiute, Dalia; Petrov, Pavel; Sabonis, Tomas; Castilla Valdez, Heriberto; Sanchez Hernandez, Alberto; Carrillo Moreno, Salvador; Ibarguen, Humberto Antonio Salazar; Casimiro Linares, Edgar; Morelos Pineda, Antonio; Allfrey, Philip; Krofcheck, David; Aumeyr, Thomas; Butler, Philip H.; Signal, Tony; Williams, Jennifer C.; Ahmad, Muhammad; Ahmed, Ijaz; Asghar, Muhammad Irfan; Hoorani, Hafeez R.; Khan, Wajid Ali; Khurshid, Taimoor; Qazi, Shamona; Cwiok, Mikolaj; Dominik, Wojciech; Doroba, Krzysztof; Konecki, Marcin; Krolikowski, Jan; Frueboes, Tomasz; Gokieli, Ryszard; Gorski, Maciej; Kazana, Malgorzata; Nawrocki, Krzysztof; Szleper, Michal; Wrochna, Grzegorz; Zalewski, Piotr; Almeida, Nuno; Bargassa, Pedrame; David Tinoco Mendes, Andre; Faccioli, Pietro; Ferreira Parracho, Pedro Guilherme; Gallinaro, Michele; Musella, Pasquale; Ribeiro, Pedro Quinaz; Seixas, Joao; Silva, Pedro; Varela, Joao; Wohri, Hermine Katharina; Altsybeev, Igor; Belotelov, Ivan; Bunin, Pavel; Finger, Miroslav; Finger, Michael, Jr.; Golutvin, Igor; Kamenev, Alexey; Karjavin, Vladimir; Kozlov, Guennady; Lanev, Alexander; Moisenz, Petr; Palichik, Vladimir; Perelygin, Victor; Shmatov, Sergey; Smirnov, Vitaly; Vishnevskiy, Alexander; Volodko, Anton; Zarubin, Anatoli; Ivanov, Yury; Kim, Victor; Levchenko, Petr; Obrant, Gennady; Shcheglov, Yury; Shchetkovskiy, Alexander; Smirnov, Igor; Sulimov, Valentin; Vavilov, Sergey; Vorobyev, Alexey; Andreev, Yuri; Gninenko, Sergei; Golubev, Nikolai; Karneyeu, Anton; Kirsanov, Mikhail; Krasnikov, Nikolai; Matveev, Viktor; Pashenkov, Anatoli; Toropin, Alexander; Troitsky, Sergey; Epshteyn, Vladimir; Gavrilov, Vladimir; Ilina, Natalia; Kaftanov, Vitali; Kossov, Mikhail; Krokhotin, Andrey; Kuleshov, Sergey; Oulianov, Alexei; Safronov, Grigory; Semenov, Sergey; Shreyber, Irina; Stolin, Viatcheslav; Vlasov, Evgueni; Zhokin, Alexander; Boos, Edouard; Dubinin, Mikhail; Dudko, Lev; Ershov, Alexander; Gribushin, Andrey; Kodolova, Olga; Lokhtin, Igor; Petrushanko, Sergey; Sarycheva, Ludmila; Savrin, Viktor; Vardanyan, Irina; Dremin, Igor; Kirakosyan, Martin; Konovalova, Nina; Rusakov, Sergey V.; Vinogradov, Alexey; Azhgirey, Igor; Bitioukov, Sergei; Datsko, Kirill; Kachanov, Vassili; Konstantinov, Dmitri; Krychkine, Victor; Petrov, Vladimir; Ryutin, Roman; Slabospitsky, Sergey; Sobol, Andrei; Sytine, Alexandre; Tourtchanovitch, Leonid; Troshin, Sergey; Tyurin, Nikolay; Uzunian, Andrey; Volkov, Alexey; Adzic, Petar; Djordjevic, Milos; Maletic, Dimitrije; Puzovic, Jovan; Aguilar-Benitez, Manuel; Alcaraz Maestre, Juan; Arce, Pedro; Battilana, Carlo; Calvo, Enrique; Cepeda, Maria; Cerrada, Marcos; Chamizo Llatas, Maria; Colino, Nicanor; De La Cruz, Begona; Diez Pardos, Carmen; Fernandez Bedoya, Cristina; Fernandez Ramos, Juan Pablo; Ferrando, Antonio; Flix, Jose; Fouz, Maria Cruz; Garcia-Abia, Pablo; Gonzalez Lopez, Oscar; Goy Lopez, Silvia; Hernandez, Jose M.; Josa, Maria Isabel; Merino, Gonzalo; Pelayo, Jesus Puerta; Romero, Luciano; Santaolalla, Javier; Willmott, Carlos; Albajar, Carmen; de Troconiz, Jorge F.; Cuevas, Javier; Fernandez Menendez, Javier; Gonzalez Caballero, Isidro; Iglesias, Lara Lloret; Vizan Garcia, Jesus Manuel; Cabrillo, Iban Jose; Calderon, Alicia; Chuang, Shan-Huei; Diaz Merino, Irma; Diez Gonzalez, Carlos; Duarte Campderros, Jordi; Fernandez, Marcos; Gomez, Gervasio; Gonzalez Sanchez, Javier; Gonzalez Suarez, Rebeca; Jorda, Clara; Pardo, Patricia Lobelle; Lopez Virto, Amparo; Marco, Jesus; Marco, Rafael; Martinez Rivero, Celso; Martinez Ruiz del Arbol, Pablo; Matorras, Francisco; Rodrigo, Teresa; Jimeno, Alberto Ruiz; Scodellaro, Luca; Sanudo, Mar Sobron; Vila, Ivan; Vilar Cortabitarte, Rocio; Abbaneo, Duccio; Auffray, Etiennette; Baillon, Paul; Ball, Austin; Barney, David; Beaudette, Florian; Beccati, Barbara; Bell, Alan James; Bellan, Riccardo; Benedetti, Daniele; Bernet, Colin; Bialas, Wojciech; Bloch, Philippe; Bolognesi, Sara; Bona, Marcella; Breuker, Horst; Bunkowski, Karol; Camporesi, Tiziano; Cano, Eric; Cattai, Ariella; Cerminara, Gianluca; Christiansen, Tim; Coarasa Perez, Jose Antonio; Covarelli, Roberto; Cure, Benoit; Dahms, Torsten; De Roeck, Albert; Elliott-Peisert, Anna; Funk, Wolfgang; Gaddi, Andrea; Gerwig, Hubert; Gigi, Dominique; Gill, Karl; Giordano, Domenico; Glege, Frank; Gowdy, Stephen; Guiducci, Luigi; Gutleber, Johannes; Hartl, Christian; Harvey, John; Hegner, Benedikt; Henderson, Conor; Hoffmann, Hans Falk; Honma, Alan; Huhtinen, Mika; Innocente, Vincenzo; Janot, Patrick; Lecoq, Paul; Leonidopoulos, Christos; Lourenco, Carlos; Macpherson, Alick; Maki, Tuula; Malgeri, Luca; Mannelli, Marcello; Masetti, Lorenzo; Meijers, Frans; Meridiani, Paolo; Mersi, Stefano; Meschi, Emilio; Moser, Roland; Mulders, Martijn; Noy, Matthew; Orimoto, Toyoko; Orsini, Luciano; Perez, Emmanuelle; Petrilli, Achille; Pfeiffer, Andreas; Pierini, Maurizio; Pimia, Martti; Racz, Attila; Rolandi, Gigi; Rovere, Marco; Ryjov, Vladimir; Sakulin, Hannes; Schafer, Christoph; Schlatter, Wolf-Dieter; Schwick, Christoph; Segoni, Ilaria; Sharma, Archana; Siegrist, Patrice; Simon, Michal; Sphicas, Paraskevas; Spiga, Daniele; Spiropulu, Maria; Stockli, Fabian; Traczyk, Piotr; Tropea, Paola; Tsirou, Andromachi; Istvan Veres, Gabor; Vichoudis, Paschalis; Voutilainen, Mikko; Zeuner, Wolfram Dietrich; Bertl, Willi; Deiters, Konrad; Erdmann, Wolfram; Gabathuler, Kurt; Horisberger, Roland; Ingram, Quentin; Kaestli, Hans-Christian; Konig, Stefan; Kotlinski, Danek; Langenegger, Urs; Meier, Frank; Renker, Dieter; Rohe, Tilman; Sibille, Jennifer; Starodumov, Andrei; Caminada, Lea; Casella, Maria Chiara; Chen, Zhiling; Cittolin, Sergio; Dambach, Sarah; Dissertori, Gunther; Dittmar, Michael; Eggel, Christina; Eugster, Jurg; Freudenreich, Klaus; Grab, Christoph; Herve, Alain; Hintz, Wieland; Lecomte, Pierre; Lustermann, Werner; Marchica, Carmelo; Milenovic, Predrag; Moortgat, Filip; Nardulli, Alessandro; Nessi-Tedaldi, Francesca; Pape, Luc; Pauss, Felicitas; Punz, Thomas; Rizzi, Andrea; Ronga, Frederic Jean; Sala, Leonardo; Sanchez, Ann-Karin; Sawley, Marie-Christine; Schinzel, Dietrich; Sordini, Viola; Stieger, Benjamin; Tauscher, Ludwig; Thea, Alessandro; Theofilatos, Konstantinos; Treille, Daniel; Trub, Peter; Weber, Matthias; Wehrli, Lukas; Weng, Joanna; Amsler, Claude; Chiochia, Vincenzo; De Visscher, Simon; Rikova, Mirena Ivova; Regenfus, Christian; Robmann, Peter; Rommerskirchen, Tanja; Schmidt, Alexander; Snoek, Hella; Tsirigkas, Dimitrios; Wilke, Lotte; Chang, Yuan-Hann; Chen, E.Augustine; Chen, Wan-Ting; Go, Apollo; Kuo, Chia-Ming; Li, Syue-Wei; Lin, Willis; Liu, Ming-Hsiung; Wu, Jing-Han; Bartalini, Paolo; Chang, Paoti; Chang, You-Hao; Chao, Yuan; Chen, Kai-Feng; Hou, George Wei-Shu; Hsiung, Yee; Lei, Yeong-Jyi; Lin, Sheng-wen; Lu, Rong-Shyang; Shiu, Jing-Ge; Tzeng, Yeng-ming; Ueno, Koji; Wang, Chin-chi; Wang, Minzu; Adiguzel, Aytul; Ayhan, Aydin; Bakirci, Mustafa Numan; Cerci, Salim; Demir, Zahide; Dozen, Candan; Dumanoglu, Isa; Eskut, Eda; Girgis, Semiray; Gurpinar, Emine; Karaman, Turker; Kayis Topaksu, Aysel; Onengut, Gulsen; Ozdemir, Kadri; Ozturk, Sertac; Polatoz, Ayse; Sahin, Ozge; Sengul, Ozden; Sogut, Kenan; Tali, Bayram; Topakli, Huseyin; Uzun, Dilber; Vergili, Latife Nukhet; Vergili, Mehmet; Akin, Ilina Vasileva; Aliev, Takhmasib; Bilmis, Selcuk; Deniz, Muhammed; Gamsizkan, Halil; Guler, Ali Murat; Ocalan, Kadir; Serin, Meltem; Sever, Ramazan; Surat, Ugur Emrah; Zeyrek, Mehmet; Deliomeroglu, Mehmet; Demir, Durmus; Gulmez, Erhan; Halu, Arda; Isildak, Bora; Kaya, Mithat; Kaya, Ozlem; Ozkorucuklu, Suat; Sonmez, Nasuf; Levchuk, Leonid; Bell, Peter; Bostock, Francis; Brooke, James John; Cheng, Teh Lee; Cussans, David; Frazier, Robert; Goldstein, Joel; Hansen, Maria; Heath, Greg P.; Heath, Helen F.; Hill, Christopher; Huckvale, Benedickt; Jackson, James; Kreczko, Lukasz; Mackay, Catherine Kirsty; Metson, Simon; Newbold, Dave M.; Nirunpong, Kachanon; Smith, Vincent J.; Ward, Simon; Basso, Lorenzo; Bell, Ken W.; Brew, Christopher; Brown, Robert M.; Camanzi, Barbara; Cockerill, David J.A.; Coughlan, John A.; Harder, Kristian; Harper, Sam; Kennedy, Bruce W.; Shepherd-Themistocleous, Claire; Tomalin, Ian R.; Womersley, William John; Worm, Steven; Bainbridge, Robert; Ball, Gordon; Ballin, Jamie; Beuselinck, Raymond; Buchmuller, Oliver; Colling, David; Cripps, Nicholas; Davies, Gavin; Della Negra, Michel; Foudas, Costas; Fulcher, Jonathan; Futyan, David; Hall, Geoffrey; Hays, Jonathan; Iles, Gregory; Karapostoli, Georgia; Lyons, Louis; MacEvoy, Barry C.; Magnan, Anne-Marie; Marrouche, Jad; Nash, Jordan; Nikitenko, Alexander; Papageorgiou, Anastasios; Pesaresi, Mark; Petridis, Konstantinos; Pioppi, Michele; Raymond, David Mark; Rompotis, Nikolaos; Rose, Andrew; Ryan, Matthew John; Seez, Christopher; Sharp, Peter; Stoye, Markus; Tapper, Alexander; Tourneur, Stephane; Vazquez Acosta, Monica; Virdee, Tejinder; Wakefield, Stuart; Wardrope, David; Whyntie, Tom; Barrett, Matthew; Chadwick, Matthew; Cole, Joanne; Hobson, Peter R.; Khan, Akram; Kyberd, Paul; Leslie, Dawn; Reid, Ivan; Teodorescu, Liliana; Bose, Tulika; Clough, Andrew; Heister, Arno; St. John, Jason; Lawson, Philip; Lazic, Dragoslav; Rohlf, James; Sulak, Lawrence; Andrea, Jeremy; Avetisyan, Aram; Bhattacharya, Saptaparna; Chou, John Paul; Cutts, David; Esen, Selda; Kukartsev, Gennadiy; Landsberg, Greg; Narain, Meenakshi; Nguyen, Duong; Speer, Thomas; Tsang, Ka Vang; Breedon, Richard; Calderon de la Barca Sanchez, Manuel; Cebra, Daniel; Chertok, Maxwell; Conway, John; Cox, Peter Timothy; Dolen, James; Erbacher, Robin; Friis, Evan; Ko, Winston; Kopecky, Alexandra; Lander, Richard; Liu, Haidong; Maruyama, Sho; Miceli, Tia; Nikolic, Milan; Pellett, Dave; Robles, Jorge; Searle, Matthew; Smith, John; Squires, Michael; Tripathi, Mani; Vasquez Sierra, Ricardo; Veelken, Christian; Andreev, Valeri; Arisaka, Katsushi; Cline, David; Cousins, Robert; Erhan, Samim; Farrell, Chris; Hauser, Jay; Ignatenko, Mikhail; Jarvis, Chad; Rakness, Gregory; Schlein, Peter; Tucker, Jordan; Valuev, Vyacheslav; Wallny, Rainer; Babb, John; Chandra, Avdhesh; Clare, Robert; Ellison, John Anthony; Gary, J.William; Hanson, Gail; Jeng, Geng-Yuan; Kao, Shih-Chuan; Liu, Feng; Liu, Hongliang; Luthra, Arun; Nguyen, Harold; Shen, Benjamin C.; Stringer, Robert; Sturdy, Jared; Wilken, Rachel; Wimpenny, Stephen; Andrews, Warren; Branson, James G.; Dusinberre, Elizabeth; Evans, David; Golf, Frank; Holzner, Andre; Kelley, Ryan; Lebourgeois, Matthew; Letts, James; Mangano, Boris; Muelmenstaedt, Johannes; Norman, Matthew; Padhi, Sanjay; Petrucciani, Giovanni; Pi, Haifeng; Pieri, Marco; Ranieri, Riccardo; Sani, Matteo; Sharma, Vivek; Simon, Sean; Vartak, Adish; Wurthwein, Frank; Yagil, Avraham; Barge, Derek; Blume, Michael; Campagnari, Claudio; D'Alfonso, Mariarosaria; Danielson, Thomas; Garberson, Jeffrey; Incandela, Joe; Justus, Christopher; Kalavase, Puneeth; Koay, Sue Ann; Kovalskyi, Dmytro; Krutelyov, Vyacheslav; Lamb, James; Lowette, Steven; Pavlunin, Viktor; Rebassoo, Finn; Ribnik, Jacob; Richman, Jeffrey; Rossin, Roberto; Stuart, David; To, Wing; Vlimant, Jean-Roch; Witherell, Michael; Apresyan, Artur; Bornheim, Adolf; Bunn, Julian; Gataullin, Marat; Litvine, Vladimir; Ma, Yousi; Newman, Harvey B.; Rogan, Christopher; Timciuc, Vladlen; Veverka, Jan; Wilkinson, Richard; Yang, Yong; Zhu, Ren-Yuan; Akgun, Bora; Carroll, Ryan; Ferguson, Thomas; Jang, Dong Wook; Jun, Soon Yung; Paulini, Manfred; Russ, James; Terentyev, Nikolay; Vogel, Helmut; Vorobiev, Igor; Cumalat, John Perry; Dinardo, Mauro Emanuele; Drell, Brian Robert; Ford, William T.; Heyburn, Bernadette; Luiggi Lopez, Eduardo; Nauenberg, Uriel; Stenson, Kevin; Ulmer, Keith; Wagner, Stephen Robert; Zang, Shi-Lei; Agostino, Lorenzo; Alexander, James; Blekman, Freya; Cassel, David; Chatterjee, Avishek; Das, Souvik; Eggert, Nicholas; Gibbons, Lawrence Kent; Heltsley, Brian; Hopkins, Walter; Khukhunaishvili, Aleko; Kreis, Benjamin; Patterson, Juliet Ritchie; Puigh, Darren; Ryd, Anders; Shi, Xin; Sun, Werner; Teo, Wee Don; Thom, Julia; Vaughan, Jennifer; Weng, Yao; Wittich, Peter; Biselli, Angela; Cirino, Guy; Winn, Dave; Albrow, Michael; Apollinari, Giorgio; Atac, Muzaffer; Bakken, Jon Alan; Banerjee, Sunanda; Bauerdick, Lothar A.T.; Beretvas, Andrew; Berryhill, Jeffrey; Bhat, Pushpalatha C.; Binkley, Morris; Bloch, Ingo; Borcherding, Frederick; Burkett, Kevin; Butler, Joel Nathan; Chetluru, Vasundhara; Cheung, Harry; Chlebana, Frank; Cihangir, Selcuk; Demarteau, Marcel; Eartly, David P.; Elvira, Victor Daniel; Fisk, Ian; Freeman, Jim; Gottschalk, Erik; Green, Dan; Gutsche, Oliver; Hahn, Alan; Hanlon, Jim; Harris, Robert M.; James, Eric; Jensen, Hans; Johnson, Marvin; Joshi, Umesh; Klima, Boaz; Kousouris, Konstantinos; Kunori, Shuichi; Kwan, Simon; Limon, Peter; Lueking, Lee; Lykken, Joseph; Maeshima, Kaori; Marraffino, John Michael; Mason, David; McBride, Patricia; McCauley, Thomas; Miao, Ting; Mishra, Kalanand; Mrenna, Stephen; Musienko, Yuri; Newman-Holmes, Catherine; O'Dell, Vivian; Popescu, Sorina; Prokofyev, Oleg; Sexton-Kennedy, Elizabeth; Sharma, Seema; Smith, Richard P.; Soha, Aron; Spalding, William J.; Spiegel, Leonard; Tan, Ping; Taylor, Lucas; Tkaczyk, Slawek; Uplegger, Lorenzo; Vaandering, Eric Wayne; Vidal, Richard; Whitmore, Juliana; Wu, Weimin; Yumiceva, Francisco; Yun, Jae Chul; Acosta, Darin; Avery, Paul; Bourilkov, Dimitri; Chen, Mingshui; Piero Di Giovanni, Gian; Dobur, Didar; Drozdetskiy, Alexey; Field, Richard D.; Fu, Yu; Furic, Ivan-Kresimir; Gartner, Joseph; Kim, Bockjoo; Klimenko, Sergey; Konigsberg, Jacobo; Korytov, Andrey; Kotov, Khristian; Kropivnitskaya, Anna; Kypreos, Theodore; Matchev, Konstantin; Mitselmakher, Guenakh; Pakhotin, Yuriy; Piedra Gomez, Jonatan; Prescott, Craig; Rapsevicius, Valdas; Remington, Ronald; Schmitt, Michael; Scurlock, Bobby; Wang, Dayong; Yelton, John; Zakaria, Mohammed; Ceron, Cristobal; Gaultney, Vanessa; Kramer, Laird; Lebolo, Luis Miguel; Linn, Stephan; Markowitz, Pete; Martinez, German; Luis Rodriguez, Jorge; Adams, Todd; Askew, Andrew; Chen, Jie; Dharmaratna, Welathantri G.D.; Diamond, Brendan; Gleyzer, Sergei V.; Haas, Jeff; Hagopian, Sharon; Hagopian, Vasken; Jenkins, Merrill; Johnson, Kurtis F.; Prosper, Harrison; Sekmen, Sezen; Baarmand, Marc M.; Guragain, Samir; Hohlmann, Marcus; Kalakhety, Himali; Mermerkaya, Hamit; Ralich, Robert; Vodopiyanov, Igor; Adams, Mark Raymond; Anghel, Ioana Maria; Apanasevich, Leonard; Bazterra, Victor Eduardo; Betts, Russell Richard; Callner, Jeremy; Cavanaugh, Richard; Dragoiu, Cosmin; Garcia-Solis, Edmundo Javier; Gerber, Cecilia Elena; Hofman, David Jonathan; Khalatian, Samvel; Mironov, Camelia; Shabalina, Elizaveta; Smoron, Agata; Varelas, Nikos; Akgun, Ugur; Albayrak, Elif Asli; Bilki, Burak; Cankocak, Kerem; Chung, Kwangzoo; Clarida, Warren; Duru, Firdevs; Lae, Chung Khim; McCliment, Edward; Merlo, Jean-Pierre; Mestvirishvili, Alexi; Moeller, Anthony; Nachtman, Jane; Newsom, Charles Ray; Norbeck, Edwin; Olson, Jonathan; Onel, Yasar; Ozok, Ferhat; Sen, Sercan; Wetzel, James; Yetkin, Taylan; Yi, Kai; Barnett, Bruce Arnold; Blumenfeld, Barry; Bonato, Alessio; Eskew, Christopher; Fehling, David; Giurgiu, Gavril; Gritsan, Andrei; Guo, Zijin; Hu, Guofan; Maksimovic, Petar; Rappoccio, Salvatore; Swartz, Morris; Tran, Nhan Viet; Baringer, Philip; Bean, Alice; Benelli, Gabriele; Grachov, Oleg; Murray, Michael; Radicci, Valeria; Sanders, Stephen; Wood, Jeffrey Scott; Zhukova, Victoria; Bandurin, Dmitry; Barfuss, Anne-fleur; Bolton, Tim; Chakaberia, Irakli; Kaadze, Ketino; Maravin, Yurii; Shrestha, Shruti; Svintradze, Irakli; Wan, Zongru; Gronberg, Jeffrey; Lange, David; Wright, Douglas; Baden, Drew; Boutemeur, Madjid; Eno, Sarah Catherine; Ferencek, Dinko; Hadley, Nicholas John; Kellogg, Richard G.; Kirn, Malina; Rossato, Kenneth; Rumerio, Paolo; Santanastasio, Francesco; Skuja, Andris; Temple, Jeffrey; Tonjes, Marguerite; Tonwar, Suresh C.; Twedt, Elizabeth; Alver, Burak; Bauer, Gerry; Bendavid, Joshua; Busza, Wit; Butz, Erik; Cali, Ivan Amos; Chan, Matthew; D'Enterria, David; Everaerts, Pieter; Gomez Ceballos, Guillelmo; Goncharov, Maxim; Hahn, Kristian Allan; Harris, Philip; Kim, Yongsun; Klute, Markus; Lee, Yen-Jie; Li, Wei; Loizides, Constantinos; Luckey, Paul David; Ma, Teng; Nahn, Steve; Paus, Christoph; Roland, Christof; Roland, Gunther; Rudolph, Matthew; Stephans, George; Sumorok, Konstanty; Sung, Kevin; Wenger, Edward Allen; Wyslouch, Bolek; Xie, Si; Yilmaz, Yetkin; Yoon, Sungho; Zanetti, Marco; Cole, Perrie; Cooper, Seth; Cushman, Priscilla; Dahmes, Bryan; De Benedetti, Abraham; Dudero, Phillip Russell; Franzoni, Giovanni; Haupt, Jason; Klapoetke, Kevin; Kubota, Yuichi; Mans, Jeremy; Petyt, David; Rekovic, Vladimir; Rusack, Roger; Sasseville, Michael; Singovsky, Alexander; Cremaldi, Lucien Marcus; Godang, Romulus; Kroeger, Rob; Perera, Lalith; Rahmat, Rahmat; Sanders, David A.; Sonnek, Peter; Summers, Don; Bloom, Kenneth; Bose, Suvadeep; Butt, Jamila; Claes, Daniel R.; Dominguez, Aaron; Eads, Michael; Keller, Jason; Kelly, Tony; Kravchenko, Ilya; Lazo-Flores, Jose; Lundstedt, Carl; Malbouisson, Helena; Malik, Sudhir; Snow, Gregory R.; Baur, Ulrich; Iashvili, Ia; Kharchilava, Avto; Kumar, Ashish; Smith, Kenneth; Strang, Michael; Alverson, George; Barberis, Emanuela; Baumgartel, Darin; Boeriu, Oana; Reucroft, Steve; Swain, John; Wood, Darien; Anastassov, Anton; Kubik, Andrew; Ofierzynski, Radoslaw Adrian; Pozdnyakov, Andrey; Schmitt, Michael; Stoynev, Stoyan; Velasco, Mayda; Won, Steven; Antonelli, Louis; Berry, Douglas; Hildreth, Michael; Jessop, Colin; Karmgard, Daniel John; Kolb, Jeff; Kolberg, Ted; Lannon, Kevin; Lynch, Sean; Marinelli, Nancy; Morse, David Michael; Ruchti, Randy; Valls, Nil; Warchol, Jadwiga; Wayne, Mitchell; Ziegler, Jill; Bylsma, Ben; Durkin, Lloyd Stanley; Gu, Jianhui; Killewald, Phillip; Ling, Ta-Yung; Williams, Grayson; Adam, Nadia; Berry, Edmund; Elmer, Peter; Gerbaudo, Davide; Halyo, Valerie; Hunt, Adam; Jones, John; Laird, Edward; Lopes Pegna, David; Marlow, Daniel; Medvedeva, Tatiana; Mooney, Michael; Olsen, James; Piroue, Pierre; Stickland, David; Tully, Christopher; Werner, Jeremy Scott; Zuranski, Andrzej; Acosta, Jhon Gabriel; Huang, Xing Tao; Lopez, Angel; Mendez, Hector; Oliveros, Sandra; Ramirez Vargas, Juan Eduardo; Zatzerklyaniy, Andriy; Alagoz, Enver; Barnes, Virgil E.; Bolla, Gino; Borrello, Laura; Bortoletto, Daniela; Everett, Adam; Garfinkel, Arthur F.; Gecse, Zoltan; Gutay, Laszlo; Jones, Matthew; Koybasi, Ozhan; Laasanen, Alvin T.; Leonardo, Nuno; Liu, Chang; Maroussov, Vassili; Merkel, Petra; Miller, David Harry; Neumeister, Norbert; Potamianos, K.; Sedov, Alexey; Shipsey, Ian; Silvers, David; Yoo, Hwi Dong; Zheng, Yu; Jindal, Pratima; Parashar, Neeti; Cuplov, Vesna; Ecklund, Karl Matthew; Geurts, Frank J.M.; Liu, Jinghua H.; Matveev, Mikhail; Morales, Jafet; Padley, Brian Paul; Redjimi, Radia; Roberts, Jay; Betchart, Burton; Bodek, Arie; Chung, Yeon Sei; de Barbaro, Pawel; Demina, Regina; Flacher, Henning; Garcia-Bellido, Aran; Gotra, Yury; Han, Jiyeon; Harel, Amnon; Korjenevski, Sergey; Miner, Daniel Carl; Orbaker, Douglas; Petrillo, Gianluca; Vishnevskiy, Dmitry; Zielinski, Marek; Bhatti, Anwar; Demortier, Luc; Goulianos, Konstantin; Hatakeyama, Kenichi; Lungu, Gheorghe; Mesropian, Christina; Yan, Ming; Atramentov, Oleksiy; Gershtein, Yuri; Halkiadakis, Eva; Hits, Dmitry; Lath, Amitabh; Rose, Keith; Schnetzer, Steve; Somalwar, Sunil; Stone, Robert; Thomas, Scott; Cerizza, Giordano; Hollingsworth, Matthew; Spanier, Stefan; Yang, Zong-Chang; York, Andrew; Asaadi, Jonathan; Eusebi, Ricardo; Gilmore, Jason; Gurrola, Alfredo; Kamon, Teruki; Khotilovich, Vadim; Nguyen, Chi Nhan; Pivarski, James; Safonov, Alexei; Sengupta, Sinjini; Toback, David; Weinberger, Michael; Akchurin, Nural; Jeong, Chiyoung; Lee, Sung Won; Roh, Youn; Sill, Alan; Volobouev, Igor; Wigmans, Richard; Yazgan, Efe; Brownson, Eric; Engh, Daniel; Florez, Carlos; Johns, Willard; Kurt, Pelin; Sheldon, Paul; Arenton, Michael Wayne; Balazs, Michael; Buehler, Marc; Conetti, Sergio; Cox, Bradley; Hirosky, Robert; Ledovskoy, Alexander; Neu, Christopher; Yohay, Rachel; Gollapinni, Sowjanya; Gunthoti, Kranti; Harr, Robert; Karchin, Paul Edmund; Mattson, Mark; Anderson, Michael; Bachtis, Michail; Bellinger, James Nugent; Carlsmith, Duncan; Dasu, Sridhara; Efron, Jonathan; Flood, Kevin; Gray, Lindsey; Grogg, Kira Suzanne; Grothe, Monika; Hall-Wilton, Richard; Klabbers, Pamela; Klukas, Jeffrey; Lanaro, Armando; Lazaridis, Christos; Leonard, Jessica; Lomidze, David; Loveless, Richard; Mohapatra, Ajit; Reeder, Don; Savin, Alexander; Smith, Wesley H.; Swanson, Joshua; Weinberg, Marc
2010-01-01
Measurements of inclusive charged-hadron transverse-momentum and pseudorapidity distributions are presented for proton-proton collisions at sqrt(s) = 0.9 and 2.36 TeV. The data were collected with the CMS detector during the LHC commissioning in December 2009. For non-single-diffractive interactions, the average charged-hadron transverse momentum is measured to be 0.46 +/- 0.01 (stat.) +/- 0.01 (syst.) GeV/c at 0.9 TeV and 0.50 +/- 0.01 (stat.) +/- 0.01 (syst.) GeV/c at 2.36 TeV, for pseudorapidities between -2.4 and +2.4. At these energies, the measured pseudorapidity densities in the central region, dN(charged)/d(eta) for |eta| < 0.5, are 3.48 +/- 0.02 (stat.) +/- 0.13 (syst.) and 4.47 +/- 0.04 (stat.) +/- 0.16 (syst.), respectively. The results at 0.9 TeV are in agreement with previous measurements and confirm the expectation of near equal hadron production in p-pbar and pp collisions. The results at 2.36 TeV represent the highest-energy measurements at a particle collider to date.
Harb, Moussab; Cavallo, Luigi
2016-01-01
By applying calculations based on density functional theory, and on density functional perturbation theory, together with generalized gradient approximation-Perdew–Burke–Emzerho and screened Coulomb hybrid HSE06 functionals, we predict novel and suitable fundamental parameters of the stable monoclinic Ta0.75V0.25ON semiconductor for solar water splitting. In addition to its predicted bandgap of 2.0 eV in the required zone for solar-driven water splitting, this material reveals a high visible-light absorption coefficient, high static dielectric constant, high hole and electron mobilities along the [001] and [010] crystallographic directions, relatively low exciton binding energy, and suitable band edge energy levels for oxidizing water and reducing protons. The optical, charge-carrier transport, and redox features predicted for this material are found to be considerably better than those obtained for Ta3N5, which is the most common semiconductor photocatalyst used in visible-light-driven water splitting.
Harb, Moussab
2016-11-29
By applying calculations based on density functional theory, and on density functional perturbation theory, together with generalized gradient approximation-Perdew–Burke–Emzerho and screened Coulomb hybrid HSE06 functionals, we predict novel and suitable fundamental parameters of the stable monoclinic Ta0.75V0.25ON semiconductor for solar water splitting. In addition to its predicted bandgap of 2.0 eV in the required zone for solar-driven water splitting, this material reveals a high visible-light absorption coefficient, high static dielectric constant, high hole and electron mobilities along the [001] and [010] crystallographic directions, relatively low exciton binding energy, and suitable band edge energy levels for oxidizing water and reducing protons. The optical, charge-carrier transport, and redox features predicted for this material are found to be considerably better than those obtained for Ta3N5, which is the most common semiconductor photocatalyst used in visible-light-driven water splitting.
Mazza, G; Anelli, G; Anghinolfi, F; Martínez, M I; Rotondo, F
2004-01-01
In this paper we present a 32 channel ASIC prototype for the readout of the Silicon Drift Detectors (SDDs) of the ALICE experiment. The ASIC integrates on the same chip 32 transimpedance amplifiers, a 32*256 cells analogue memory and 16 successive approximation 10 bit A /D converters. The circuit amplifies and samples at 40 MS/s the input signal in a continuous way; when an external trigger signal validates the acquisition, the sampling is stopped and the data are digitized at lower speed (0.5 MS/s). The chip has been designed and fabricated in a commercial. 0.25 mu m CMOS technology. It has been extensively tested both on a bench and connected with the detector in several beam tests. In this paper both design issues and test results are presented. The commercial technology used for the design has been yield radiation tolerant with special layout techniques. Total dose irradiation tests are also presented. (13 refs).
Pressure effect on the transport properties of superconducting Li0.9MobO17bronze
International Nuclear Information System (INIS)
Filippini, C.E.; Boujida, M.; Marcus, J.; Schlenker, C.; Beille, J.
1989-01-01
The electrical resistivity of Li 0.9 Mo 6 O 17 single crystal has been studied between 1.5 K and 300 K under hydrostatic pressures up to 20 k bar. A large increase of the superconducting transition temperature, from 1.7 K to 2.5 K, is associated to a sharp decease of the temperature T m of the electronic, probably CDW instability
Characterization of Ce0.9Gd0.1O1.95 powders synthesized by spray drying
DEFF Research Database (Denmark)
Blennow Tullmar, Peter; Chen, Weiwu; Lundberg, Mats
2009-01-01
Ce0.9Gd0.1O1.95 powders were synthesized by spray drying and successive calcinations. The phase purity, BET surface area, and particle morphology of as-sprayed and calcined powders were characterized. After calcination above 300 °C, the powders were single phase and showed a BET surface area of 68...
Directory of Open Access Journals (Sweden)
Katia Corrêa de Oliveira Santos
Full Text Available ABSTRACT Compared to previous years, seasonal influenza activity commenced early in São Paulo State, Brazil, Southern hemisphere during the 2016 year. In order to investigate the genetic pattern of influenza A(H1N1pdm09 in the State of Sao Paulo a total of 479 respiratory samples, collected in January by Sentinel Surveillance Units, were screened by real-time RT-PCR. A total of 6 Influenza viruses A(H1N1pdm09 presenting ct values ≤ 30 were sequenced following phylogenetic analysis. The present study identified the circulation of the new 6B.1 subgroup (A/Sao Paulo/10-118/2016 and A/Sao Paulo/3032/2016. In addition, influenza A(H1N1pdm09 group 6B has also been identified during January in the State of Sao Paulo. Despite amino acid changes and changes in potential glycosylation motifs, 6B.1 viruses were well inhibited by the reference ferret antiserum against A/California/07/2009 virus, the A(H1N1pdm09 component of the vaccine for the 2016 influenza season.
2018-03-19T03:09:40Z https://www.ajol.info/index.php/all/oai oai:ojs ...
African Journals Online (AJOL)
article/83194 2018-03-19T03:09:40Z joafss:ART Urban forests and sustainable livelihoods in port Harcourt City, Nigeria Larinde, SL Ogunniyan, DJ Biodiversity conservation; sustainable development; urbanization; urban forestry Depletion of the ...
2018-05-09T18:56:27Z https://www.ajol.info/index.php/all/oai oai:ojs ...
African Journals Online (AJOL)
article/20961 2018-05-09T18:56:27Z bcse:ART CONSTITUENTS OFERYTHRINA SIGMOIDEA Ndom, Jean Claude; Department of Chemistry, Faculty of Science, University of Douala, P.O. Box 24157, Douala, Cameroon Kouam, ; Department of ...
Effect of Sb and Si doping on the superconducting properties of FeSe0.9
International Nuclear Information System (INIS)
Sudesh,; Rani, S.; Varma, G.D.
2013-01-01
Highlights: ► We synthesized all the samples using two-step solid state reaction method. ► Si and Sb doping is done at the Se site of the compound FeSe 0.9 . ► H c2 (0) is calculated with GL-Fit and also using WHH model. ► Behavior of activation energy is studied with applied field. -- Abstract: In the present work, we have studied the effect of doping Sb and Si at the Se-site of FeSe 0.9 on the superconducting properties, such as transition temperature (T c ), upper critical field (H c2 ) and irreversibility field (H irr ). The polycrystalline samples have been synthesized via two step solid state reaction route with nominal compositions Fe[Se 1−x (Sb/Si) x ] 0.9 (x = 0.0, 0.05, 0.10, 0.15 and 0.20). The X-ray diffraction results show the presence of tetragonal α-FeSe phase with the P4/nmm space group symmetry in all the samples. The highest superconducting onset temperatures, T c onset ∼9.42Kand9.20K, respectively, for Si and Sb doped samples have been found for x = 0.05. The temperature dependence of H c2 (T) and H irr (T) have been calculated from the magnetoresistance data using the criteria of 90% and 10% of normal state resistivity (ρ n ) values, respectively. The values of H c2 (0) estimated from Werthamer–Helfand–Hohenberg (WHH) and Ginzburg–Landau (GL) theories are found to follow the same trends and maximum H c2 (0) is found for the composition x = 0.10 for both the Si and Sb doped samples. The irreversibility field, H irr and activation energy, U 0 have also been calculated to study the vortex motion behavior of the samples. A clear cut correlation between H irr and U 0 has been found
Macrì, Angelo; Vagge, Aldo; Salis, Annalisa; Fucile, Carmen; Marini, Valeria; Martelli, Antonietta; Giuffrida, Sebastiano; Iester, Michele; Damonte, Gianluca; Mattioli, Francesca
2017-04-01
The purpose of this study was to evaluate the aqueous humor concentrations of bromfenac ophthalmic solution 0.09 % in patients undergoing phacoemulsification. Patients requiring cataract extraction received one drop (50 µL) of bromfenac 0.09 % solution in the eye to be operated, before bedtime the day before surgery or the morning of the surgery. The last administration was recorded. At the time of paracentesis, an aqueous humor sample was collected with a 30-gauge needle attached to a TB syringe and was later analyzed by high-performance liquid chromatography for drug concentration. 188 treated volunteers and 48 control, untreated, subjects were included in the study. The mean aqueous concentration of bromfenac in the treated group was 37.60 ± 68.86 and 0 nM (nmol/L) in the control group (p < 0.0001). Correlation coefficient in bromfenac group between time elapsed from instillation and drug concentration was -0.16 (p not significant). Bromfenac showed properties of good penetration and stable concentration in aqueous humor up to about 12 h after instillation.
Impact of intrinsic parameter fluctuations on the performance of In0.75Ga0.25As implant free MOSFETs
International Nuclear Information System (INIS)
Seoane, N; Garcia-Loureiro, A; Aldegunde, M; Kalna, K; Asenov, A
2009-01-01
We investigate the level of statistical variability in implant free (IF) MOSFETs, which are one of the most promising candidates III–V channels implementation. We report results for the threshold voltage (V T ) fluctuations in aggressively scaled IF III–V MOSFETs induced by random discrete dopants in the δ-doping plane obtained using 3D drift–diffusion (D–D) device simulations. The D–D simulator is meticulously calibrated against results obtained from ensemble Monte Carlo device simulations. The simulated 30, 20 and 15 nm gate length In 0.75 Ga 0.25 As channel IF transistors exhibit threshold voltage standard deviations of 42, 58 and 61 mV, respectively, at a drain voltage of 0.1 V. At a drain voltage of 0.8 V, the threshold voltage standard deviations increase to 55, 71 and 81 mV, respectively. While the standard deviations of V T in the 30 and 20 nm IF MOSFETs are close to those observed in bulk Si MOSFETs with equivalent gate lengths, the threshold voltage standard deviation in the 15 nm gate length IF MOSFET is lower
Analog front-end cell designed in a commercial 025 mu m process for the ATLAS pixel detector at LHC
Blanquart, L; Comes, G; Denes, P; Einsweiler, Kevin F; Fischer, P; Mandelli, E; Meddeler, G; Peric, I; Richardson, J
2002-01-01
A new analog pixel front-end cell has been developed for the ATLAS detector at the future Large Hadron Collider (LHC) at the European Laboratory for Particle Physics (CERN). This analog cell has been submitted in two commercial 0.25 mu m CMOS processes (in an analog test chip format), using special layout techniques for radiation hardness purposes. It is composed of two cascaded amplifiers followed by a fast discriminator featuring a detection threshold within the range of 1000 to 10000 electrons. The first preamplifier has the principal role of providing a large bandwidth, low input impedance, and fast rise time in order to enhance the time-walk and crosstalk performance, whereas the second fully differential amplifier is aimed at delivering a sufficiently high-voltage gain for optimum comparison. A new do feedback concept renders the cell tolerant of sensor leakage current up to 300 nA and provides monitoring of this current. Two 5-bit digital-to-analog converters tolerant to single- event upset have been i...
Zöll, Klaus; Kahlenberg, Volker; Krüger, Hannes; Tropper, Peter
2018-02-01
In the course of a systematic study of a part of the quaternary system Fe2O3-CaO-Al2O3-MgO (FCAM) the previously unknown compound Ca2.38Mg2.09Fe3+10.61Fe2+1.59Al9.33O36 (FCAM-III) has been synthesized. By analogy with the so-called SFCA series [1-5], our investigation in the system of FCAM shows the existence of a stoichiometric homologous series M14+6nO20+8n, where M = Fe, Ca, Al, Mg and n = 1 or 2. In air, we can prove the formation of coexisting FCAM-III and FCAM-I solid solutions at 1400 °C. By increasing the temperature up to 1425 °C FCAM-I disappears completely and FCAM-III co-exists with magnesiumferrite and a variety of calcium iron oxides. At 1450 °C FCAM-III breaks down to a mixture of FCAM-I again as well as magnesioferrite and melt. Small single-crystals of FCAM-III up to 35 μm in size could be retrieved from the 1425 °C experiment and were subsequently characterized using electron microprobe analysis and synchroton X-ray single-crystal diffraction. Finally the Fe2+/Fetot ratio was calculated from the total iron content based on the crystal-chemical formula obtained from EMPA measurements and charge balance considerations. FCAM-III or Ca2.38Mg2.09Fe3+10.61Fe2+1.59Al9.33O36 has a triclinic crystal structure (space group P 1 ̅). The basic crystallographic data are: a = 10.223(22) Å, b = 10.316(21) Å, c = 14.203(15) Å, α = 93.473(50)°, β = 107.418(67)°, γ = 109.646(60)°, V = 1323.85(2) ų, Z = 1. Using Schreinemaker's technique to analyze the phase relations in the system Fe2O3-CaO-Al2O3-MgO it was possible to obtain the semi-quantitative stability relations between the participating phases and construct a topologically correct phase sequence as a function of T and fO2. The analysis shows that Ca2Al0.5Fe1.5O5 (C2A0.25F0.75) and CaAl1.5Fe2.5O7 (CA0.75F1.25) with higher calculated Fe2+ contents are preferably formed at lower oxygen fugacity and react to CaAl0.5Fe1.5O4 (CA0.25F0.75) by increasing fO2. Spinel-type magnesium
Madhuri Sailaja, J.; Murali, N.; Margarette, S. J.; Mammo, Tulu Wegayehu; Veeraiah, V.
2018-03-01
This paper is discussed Sr doping effect on the microstructure, chemical stability and conductivity of Ba1-xSrxCe0.65Zr0.25Pr0.1O3-δ (0 ≤ x ≤ 0.2) electrolyte prepared by sol-gel method. The lattice constants and unit cell volumes are found to decrease as Sr atomic percentage increased in accordance with the Vegard law, confirming the formation of solid solution with orthorhombic structure. Among them all the synthesized samples are showed a conductivity with different atmosphere values at 500 °C. Ba0.92Sr0.08Ce0.65Zr0.25Pr0.1O3-δ recorded highest conductivity with a value of 3.3 × 10-6 S/cm (dry air) & 3.41 × 10-6 S/cm (wet air with 3% relative humidity) at 500 °C due to its smaller lattice volume, larger grain size and lower activation energy that led to excessive increase in conductivity. All pellets exhibited good chemical stability when exposed to air and H2O atmospheres. This study elucidates that the composition will be a promising electrolyte material for use as SOFC at intermediate temperatures if Sr doping is limited to small amounts.
First reported detection of influenza A (H1N1)pdm09 in turkeys in the United Kingdom.
Reid, Scott M; Cox, William J; Ceeraz, Vanessa; Sutton, David; Essen, Steve C; Howard, Wendy A; Slomka, Marek J; Irvine, Richard M; Brown, Ian H
2012-12-01
We report the first occurrence of pandemic (H1N1) 2009 virus [A(H1N1)pdm09] infection on two epidemiologically linked turkey breeder premises in the United Kingdom during December 2010 and January 2011. Clinically, the birds showed only mild signs of disease, with the major presenting sign being an acute and marked reduction in egg production, leading to the prompt reporting of suspected avian notifiable disease for official investigation. Presence of A(H1N1)pdm09 infection in the United Kingdom turkey breeder flocks was confirmed by detailed laboratory investigations including virus isolation in embryonated specific pathogen-free fowls' eggs, two validated real-time reverse transcription-PCR tests, and nucleotide sequencing of the hemagglutinin and neuraminidase genes. These investigations revealed high nucleotide identity with currently circulating human A(H1N1)pdm09 strains, suggesting that human-to-poultry transmission (reverse zoonosis) was the most likely route of infection. Peak levels of human influenza-like illness community transmission also coincided with the onset of clinical signs in both affected turkey breeder flocks. This case demonstrated the value of the existing passive surveillance framework and associated veterinary and laboratory infrastructure that enables the detection and management of both exotic and new and emerging disease hazards and risks. The case also presents further evidence of the susceptibility of turkeys to infection with influenza A viruses of nonavian origin.
2018-04-24T21:09:20Z https://www.ajol.info/index.php/all/oai oai:ojs ...
African Journals Online (AJOL)
article/51016 2018-04-24T21:09:20Z ijdmr:ART Client's constraining factors to construction project management success in Nigeria: a systems analytical approach Nwachukwu, C.C Project success, Client's constraints, Factor analysis This study ...
2018-02-09T06:16:43Z https://www.ajol.info/index.php/all/oai oai:ojs ...
African Journals Online (AJOL)
article/31102 2018-02-09T06:16:43Z ajtcam:ART Pharmacological effects of Harpagophytum procumbens DC [Pedaliaceae] secondary root aqueous extract on isolated gastro-intestinal tract muscles of the chick, guinea-pig and rabbit. Mahomed ...
Directory of Open Access Journals (Sweden)
T. Sreenivasu
2016-12-01
Full Text Available The solid solutions of (1−x LaFeO3–xBaTiO3 (0.0≤x≤0.25 have been synthesized successfully by the conventional solid-state reaction method. Room temperature (RT X-ray diffraction studies reveal the stabilization of orthorhombic phase with Pbnm space group. Complete solubility in the perovskite series was demonstrated up to x=0.25. The dielectric permittivity shows colossal dielectric constant (CDC at RT. The doping of BaTiO3 in LaFeO3 exhibit pronounced CDC up to a composition x=0.15, further it starts to decrease. The frequency-dependent dielectric loss exhibits polaronic conduction, which can attribute to presence of multiple valence of iron. The relaxation frequency and polaronic conduction mechanism was shifted towards RT as function of x. Moreover, large magnetic moment with weak ferromagnetic behavior is observed in doped LaFeO3 solid solution, which might be the destruction of spin cycloid structure due to insertion of Ti in Fe–O–Fe network of LaFeO3.
DEFF Research Database (Denmark)
Bischoff, Anne Louise
2013-01-01
against H1N1pnd09 according to the EMEA criteria with a HI titre of 40 or greater. Women receiving the non-adjuvanted vaccine had significantly fewer local reactions but similar rates of systemic reactions as women receiving the adjuvanted vaccine. There were no reports of serious adverse events in any......Pregnant women experience increased influenza related morbidity and mortality during seasonal influenza epidemics, and even graver outcomes during influenza pandemics. Thus, even though the huge amount of data on clinical efficacy and effectiveness of influenza vaccine in pregnant women......, there is limited information on the details of the immunological responses to influenza immunization in pregnant versus non-pregnant. We had the unique opportunity to study the H1N1pnd09 vaccination of pregnant and non-pregnant women in our unselected, prospective, clinical pregnancy-cohort: the Copenhagen...
Oxygen permeation in thin, dense Ce0.9Gd0.1O 1.95- membranes II. experimental determination
DEFF Research Database (Denmark)
Chatzichristodoulou, Christodoulos; Søgaard, Martin; Glasscock, Julie
2011-01-01
Thin (∼30 m), dense Ce0.9Gd0.1O1.95- (CGO10) membranes (5 5 cm2+) supported on a porous NiO/YSZ substrate were fabricated by tape casting, wet powder spraying and lamination. A La 0.58Sr0.4Co0.2Fe0.8O 3-δ/Ce0.9Gd0.1O1.95- (LSCF/CGO10) composite cathode was applied by screen printing. Oxygen...... compartment. The performance of the membrane was also investigated under varying CH 4 and H2O gas mixtures at 1106 K. The oxygen flux increased with decreasing steam to carbon ratio and was found to exceed 10 N mL min-1 cm-2 of O2 for steam to carbon ratios below 4:3. Post-test analysis of the tested membrane...
Energy Technology Data Exchange (ETDEWEB)
Wang, Jinding [Hebei Key Laboratory of Applied Chemistry, Yanshan University, Qinhuangdao 066004 (China); Han, Shumin, E-mail: hanshm@ysu.edu.cn [State Key Laboratory of Metastable Materials, Science and Technology, Yanshan University, Qinhuangdao 066004 (China); Hebei Key Laboratory of Applied Chemistry, Yanshan University, Qinhuangdao 066004 (China); Li, Yuan; Liu, Jingjing [Hebei Key Laboratory of Applied Chemistry, Yanshan University, Qinhuangdao 066004 (China); Che, Linda [Desert Vista High School, Phoenix, AZ 85048 (United States); Zhang, Lu; Zhang, Junling [Hebei Key Laboratory of Applied Chemistry, Yanshan University, Qinhuangdao 066004 (China)
2014-01-05
Highlights: • Gd{sub 2}Co{sub 7} phase abundance increases with Nd substitution dramatically. • Nd substitution results in the depletion of the minor CaCu{sub 5}-type phase. • The equilibrium plateau is elevated and broadened with Nd substitution. -- Abstract: An investigation of the phase formation mechanism and electrochemical properties of the La{sub 0.75−x}Nd{sub x}Mg{sub 0.25}Ni{sub 3.3} (x = 0, 0.15) alloys has been conducted in this paper. As explored by Rietveld analysis of the XRD data, the La{sub 0.75}Mg{sub 0.25}Ni{sub 3.3} alloy is composed of Ce{sub 2}Ni{sub 7}-type and Gd{sub 2}Co{sub 7}-type phases accompanied by minor CaCu{sub 5}-type phase. The partial substitution Nd for La benefits the formation of Gd{sub 2}Co{sub 7}-type phase, indicating that the atoms with smaller radius favor the formation of the Gd{sub 2}Co{sub 7}-type phase. However, CaCu{sub 5}-type phase disappears with Nd substitution. Because part of the replaced La atoms transform into [A{sub 2}B{sub 4}] subunits with the Ni atoms, and the formed [A{sub 2}B{sub 4}] subunits crystallize with [AB{sub 5}] subunits to produce A{sub 2}B{sub 7}-type phase, resulting in the depletion of the minor CaCu{sub 5}-type phase. The electrochemical P–C isotherms present that the La{sub 0.60}Nd{sub 0.15}Mg{sub 0.25}Ni{sub 3.3} alloy only containing A{sub 2}B{sub 7}-type phase has one single plateau while the La{sub 0.75}Mg{sub 0.25}Ni{sub 3.3} alloy which contains minor LaNi{sub 5} phase has two plateaus. It is beneficial for the elevation of equilibrium plateau pressure ascribing to the contraction in cell volumes by Nd substitution. Electrochemical measurements show that the substitution of La by Nd improves the discharge capacity and the high rate dischargeability owing to the increase of A{sub 2}B{sub 7}-type phase abundance.
International Nuclear Information System (INIS)
Pan Fusheng; Yang Mingbo; Shen Jia; Wu Lu
2011-01-01
Research highlights: → Minor Zr and/or Sr additions can effectively refine the grains of the Mg-3Ce-1.2Mn-0.9Sc alloy. → Minor Zr and/or Sr additions can improve the tensile properties of the Mg-3Ce-1.2Mn-0.9Sc alloy. → Minor Zr and/or Sr additions can improve the creep properties of the Mg-3Ce-1.2Mn-0.9Sc alloy. - Abstract: The effects of minor Zr and Sr on the as-cast microstructure and mechanical properties of the Mg-3Ce-1.2Mn-0.9Sc (wt.%) alloy were investigated by using optical and electron microscopies, differential scanning calorimetry (DSC) analysis, and tensile and creep tests. The results indicate that adding minor Zr and/or Sr to the Mg-3Ce-1.2Mn-0.9Sc alloy does not cause an obvious change in the morphology and distribution of the Mg 12 Ce phase. However, the grains of the Zr and/or Sr-containing alloys are effectively refined. Among the Zr and/or Sr-containing alloys, the grains of the alloy with the addition of 0.5 wt.%Zr + 0.1 wt.%Sr are the finest, followed by the alloys with the additions of 0.5 wt.%Zr and 0.1 wt.%Sr, respectively. In addition, small additions of Zr and/or Sr can improve the tensile and creep properties of the Mg-3Ce-1.2Mn-0.9Sc alloy. Among the Zr and/or Sr-containing alloys, the alloy with the addition of 0.5 wt.%Zr + 0.1 wt.%Sr obtains the optimum tensile and creep properties.
2017-12-22T09:08:04Z https://www.ajol.info/index.php/all/oai oai:ojs ...
African Journals Online (AJOL)
article/61364 2017-12-22T09:08:04Z bcse:ART Pollution status of Tinishu Akaki River and its tributaries (Ethiopia) evaluated using physico-chemical parameters, major ions, and nutrients Melaku, Samuel; Laboratory of Analytical Chemistry, Gent ...
Charged-particle multiplicities in proton–proton collisions at √s=0.9 to 8 TeV
Adam, J.; Adamová, D.; Aggarwal, M. M.; Rinella, G. Aglieri; Agnello, M.; Agrawal, N.; Ahammed, Z.; Ahmed, I.A.M.; Ahn, S. U.; Aiola, S.; Akindinov, A.; Alam, S. N.; Aleksandrov, D.; Alessandro, B.; Alexandre, D.; Molina, R. Alfaro; Alici, A.; Alkin, A.; Almaraz, J. R. M.; Alme, J.; Alt, T.; Altinpinar, S.; Altsybeev, I.; Prado, C. Alves Garcia; Andrei, C.; Andronic, A.; Anguelov, V.; Anielski, J.; Antičić, T.; Antinori, F.; Antonioli, P.; Aphecetche, L.; Appelshäuser, H.; Arcelli, S.; Arnaldi, R.; Arnold, O. W.; Arsene, I. C.; Arslandok, M.; Audurier, B.; Augustinus, A.; Averbeck, R.; Azmi, M. D.; Badalà, A.; Baek, Y. W.; Bagnasco, S.; Bailhache, R.; Bala, R.; Baldisseri, A.; Baral, R. C.; Barbano, A. M.; Barbera, R.; Barile, F.; Barnaföldi, G. G.; Barnby, L. S.; Barret, V.; Bartalini, P.; Barth, K.; Bartke, J.; Bartsch, E.; Basile, M.; Bastid, N.; Basu, S.; Bathen, B.; Batigne, G.; Camejo, A. Batista; Batyunya, B.; Batzing, P. C.; Bearden, I. G.; Beck, H.; Bedda, C.; Behera, N. K.; Belikov, I.; Bellini, F.; Martinez, H. Bello; Bellwied, R.; Belmont, R.; Belmont-Moreno, E.; Belyaev, V.; Bencedi, G.; Beole, S.; Berceanu, I.; Bercuci, A.; Berdnikov, Y.; Berenyi, D.; Bertens, R. A.; Berzano, D.; Betev, L.; Bhasin, A.; Bhat, I. R.; Bhati, A. K.; Bhattacharjee, B.; Bhom, J.; Bianchi, L.; Bianchi, N.; Bianchin, C.; Bielčík, J.; Bielčíková, J.; Bilandzic, A.; Biswas, R.; Biswas, S.; Bjelogrlic, S.; Blair, J. T.; Blau, D.; Blume, C.; Bock, F.; Bogdanov, A.; Bøggild, H.; Boldizsár, L.; Bombara, M.; Book, J.; Borel, H.; Borissov, A.; Borri, M.; Bossú, F.; Botta, E.; Böttger, S.; Bourjau, C.; Braun-Munzinger, P.; Bregant, M.; Breitner, T.; Broker, T. A.; Browning, T. A.; Broz, M.; Brucken, E. J.; Bruna, E.; Bruno, G. E.; Budnikov, D.; Buesching, H.; Bufalino, S.; Buncic, P.; Busch, O.; Buthelezi, Z.; Butt, J. B.; Buxton, J. T.; Caffarri, D.; Cai, X.; Caines, H.; Diaz, L. Calero; Caliva, A.; Villar, E. Calvo; Camerini, P.; Carena, F.; Carena, W.; Carnesecchi, F.; Castellanos, J. Castillo; Castro, A. J.; Casula, E. A R; Sanchez, C. Ceballos; Cepila, J.; Cerello, P.; Cerkala, J.; Chang, B.; Chapeland, S.; Chartier, M.; Charvet, J. L.; Chattopadhyay, S.; Chattopadhyay, S.; Chelnokov, V.; Cherney, M.; Cheshkov, C.; Cheynis, B.; Barroso, V. Chibante; Chinellato, D. D.; Cho, Sukhee; Chochula, P.; Choi, K.; Chojnacki, M.; Choudhury, S.; Christakoglou, P.; Christensen, C. H.; Christiansen, P.; Chujo, T.; Chung, S. U.; Cicalo, C.; Cifarelli, L.; Cindolo, F.; Cleymans, J.; Colamaria, F.; Colella, D.; Collu, A.; Colocci, M.; Balbastre, G. Conesa; Del Valle, Z. Conesa; Connors, M. E.; Contreras, J. G.; Cormier, T. M.; Morales, Y. Corrales; Maldonado, I. Cortés; Cortese, P.; Cosentino, M. R.; Costa, F.; Crochet, P.; Albino, R. Cruz; Cuautle, E.; Cunqueiro, L.; Dahms, T.; Dainese, A.; Danu, A.; Das, D.; Das, I.; Das, S.; Dash, A.; Dash, S.; Dasgupta, S. S.; De Caro, A.; De Cataldo, G.; De Conti, C.; De Cuveland, J.; De Falco, A.; De Gruttola, D.; De Marco, N.; De Pasquale, S.; Deisting, A.; Deloff, A.; Dénes, E.; Deplano, C.; Dhankher, P.; Di Bari, D.; Di Mauro, A.; Di Nezza, P.; Corchero, M. A Diaz; Dietel, T.; Dillenseger, P.; Divià, R.; Djuvsland, O.; Dobrin, A.; Gimenez, D. Domenicis; Dönigus, B.; Dordic, O.; Drozhzhova, T.; Dubey, A. K.; Dubla, A.; Ducroux, L.; Dupieux, P.; Ehlers, R. J.; Elia, D.; Engel, H.; Epple, E.; Erazmus, B.; Erdemir, I.; Erhardt, F.; Espagnon, B.; Estienne, M.; Esumi, S.; Eum, J.; Evans, D.; Evdokimov, S.; Eyyubova, G.; Fabbietti, L.; Fabris, D.; Faivre, J.; Fantoni, A.; Fasel, M.; Feldkamp, L.; Feliciello, A.; Feofilov, G.; Ferencei, J.; Téllez, A. Fernández; Ferreiro, E. G.; Ferretti, A.; Festanti, A.; Feuillard, V. J. G.; Figiel, J.; Figueredo, M. A S; Filchagin, S.; Finogeev, D.; Fionda, F. M.; Fiore, E. M.; Fleck, M. G.; Floris, M.; Foertsch, S.; Foka, P.; Fokin, S.; Fragiacomo, E.; Francescon, A.; Frankenfeld, U.; Fuchs, U.; Furget, C.; Furs, A.; Girard, M. Fusco; Gaardhøje, J. J.; Gagliardi, M.; Gago, A. M.; Gallio, M.; Gangadharan, D. R.; Ganoti, P.; Gao, C.; Garabatos, C.; Garcia-Solis, E.; Gargiulo, C.; Gasik, P.; Gauger, E. F.; Germain, M.; Gheata, A.; Gheata, M.; Ghosh, P.; Ghosh, S. K.; Gianotti, P.; Giubellino, P.; Giubilato, P.; Gladysz-Dziadus, E.; Glässel, P.; Coral, D. M.Goméz; Ramirez, A. Gomez; Gonzalez, V; González-Zamora, P.; Gorbunov, S.; Görlich, L.; Gotovac, S.; Grabski, V.; Grachov, O. A.; Graczykowski, L. K.; Graham, K. L.; Grelli, A.; Grigoras, A.; Grigoras, C.; Grigoriev, V.; Grigoryan, A.; Grigoryan, S.; Grinyov, B.; Grion, N.; Gronefeld, J. M.; Grosse-Oetringhaus, J. F.; Grossiord, J. Y.; Grosso, R.; Guber, F.; Guernane, R.; Guerzoni, B.; Gulbrandsen, K.; Gunji, T.; Gupta, A.; Gupta, R.; Haake, R.; Haaland, O.; Hadjidakis, C.; Haiduc, M.; Hamagaki, H.; Hamar, G.; Harris, J. W.; Harton, A.; Hatzifotiadou, D.; Hayashi, S.; Heckel, S. T.; Heide, M.; Helstrup, H.; Herghelegiu, A.; Corral, G. Herrera; Hess, B. A.; Hetland, K. F.; Hillemanns, H.; Hippolyte, B.; Hosokawa, R.; Hristov, P.; Huang, M.; Humanic, T. J.; Hussain, N.; Hussain, T.; Hutter, D.; Hwang, D. S.; Ilkaev, R.; Inaba, M.; Ippolitov, M.; Irfan, M.; Ivanov, M.; Ivanov, V.; Izucheev, V.; Jachołkowski, A.; Jacobs, P. M.; Jadhav, M. B.; Jadlovska, S.; Jadlovsky, J.; Jahnke, C.; Jakubowska, M. J.; Jang, H. J.; Janik, M. A.; Jayarathna, P. H S Y; Jena, C.; Jena, S.; Bustamante, R. T Jimenez; Jones, P. G.; Jung, H.; Jusko, A.; Kalinak, P.; Kalweit, A.; Kamin, J.; Kang, J. H.; Kaplin, V.; Kar, S.; Uysal, A. Karasu; Karavichev, O.; Karavicheva, T.; Karayan, L.; Karpechev, E.; Kebschull, U.; Keidel, R.; Keijdener, D. L.D.; Keil, M.; Khan, M. Mohisin; Khan, P.M.; Khan, Shfaqat A.; Khanzadeev, A.; Kharlov, Y.; Kileng, B.; Kim, B.; Kim, D. W.; Kim, D. J.; Kim, D.-S.; Kim, H.; Kim, J. S.; Kim, M.; Kim, M.; Kim, S.; Kim, T.; Kirsch, S.; Kisel, I.; Kiselev, S.; Kisiel, A.; Kiss, G.; Klay, J. L.; Klein, C; Klein, J.; Klein-Bösing, C.; Klewin, S.; Kluge, A.; Knichel, M. L.; Knospe, A. G.; Kobayashi, T.; Kobdaj, C.; Kofarago, M.; Kollegger, T.; Kolojvari, A.; Kondratiev, V.; Kondratyeva, N.; Kondratyuk, E.; Konevskikh, A.; Kopcik, M.; Kour, M.; Kouzinopoulos, C.; Kovalenko, O.; Kovalenko, V.; Kowalski, M.L.; Meethaleveedu, G. Koyithatta; Králik, I.; Kravčáková, A.; Kretz, M.; Krivda, M.; Krizek, F.; Kryshen, E.; Krzewicki, M.; Kubera, A. M.; Kučera, V.; Kuhn, C.; Kuijer, P. G.; Kumar, A.; Kumar, J.; Kumar, L.; Kumar, S.; Kurashvili, P.; Kurepin, A.; Kurepin, A. B.; Kuryakin, A.; Kweon, M. J.; Kwon, Y.; La Pointe, S. L.; La Rocca, P.; De Guevara, P. Ladron; Fernandes, C. Lagana; Lakomov, I.; Langoy, R.; Lara, C.; Lardeux, A.; Lattuca, A.; Laudi, E.; Lea, R.; Leardini, L.; Lee, G. R.; Lee, S.; Lehas, F.; Lemmon, R. C.; Lenti, V.; Leogrande, E.; Monzón, I. León; Vargas, H. León; Leoncino, M.; Lévai, P.; Li, S.; Li, X.; Lien, J.; Lietava, R.; Lindal, S.; Lindenstruth, V.; Lippmann, C.; Lisa, M. A.; Ljunggren, H. M.; Lodato, D. F.; Loenne, P. I.; Loginov, V.; Loizides, C.; Lopez, X.; Torres, E. López; Lowe, A.; Luettig, P.; Lunardon, M.; Luparello, G.; Maevskaya, A.; Mager, M.; Mahajan, S.; Mahmood, S. M.; Maire, A.; Majka, R. D.; Malaev, M.; Cervantes, I. Maldonado; Malinina, L.; Mal’Kevich, D.; Malzacher, P.; Mamonov, A.; Manko, V.; Manso, F.; Manzari, V.; Marchisone, M.; Mareš, J.; Margagliotti, G. V.; Margotti, A.; Margutti, J.; Marín, Alicia; Markert, C.; Marquard, M.; Martin, N. A.; Blanco, J. Martin; Martinengo, P.; Martínez-Cabrera, H.I.; García, G. Martínez; Pedreira, M. Martinez; Mas, A.; Masciocchi, S.; Masera, M.; Masoni, A.; Massacrier, L.; Mastroserio, A.; Matyja, A.; mayer, C.; Mazer, J.; Mazzoni, M. A.; McDonald, D.; Meddi, F.; Melikyan, Y.; Menchaca-Rocha, A.; Meninno, E.; Pérez, J. Mercado; Meres, M.; Miake, Y.; Mieskolainen, M. M.; Mikhaylov, K.; Milano, L.; Milosevic, J.; Minervini, L. M.; Mischke, A.; Mishra, A. N.; Miśkowiec, D.; Mitra, J.; Mitu, C. M.; Mohammadi, N.; Mohanty, B.; Molnar, L.; Zetina, L. Montaño; Montes, E.; De Godoy, D. A Moreira; Moreno, L. A. P.; Moretto, S.; Morreale, A.; Morsch, A.; Muccifora, V.; Mudnic, E.; Mühlheim, D.; Muhuri, S.; Mukherjee, M.; Mulligan, J. D.; Munhoz, M. G.; Munzer, R. H.; Murray, S.; Musa, L.; Musinsky, J.; Naik, B.; Nair, Rajiv; Nandi, B. K.; Nania, R.; Nappi, E.; Naru, M. U.; da Luz, H. Natal; Nattrass, C.; Nayak, K.; Nayak, T. K.; Nazarenko, S.; Nedosekin, A.; Nellen, L.; Ng, F.; Nicassio, M.; Niculescu, M.; Niedziela, J.; Nielsen, B. S.; Nikolaev, S.; Nikulin, S.; Nikulin, V.; Noferini, F.; Nomokonov, P.; Nooren, G.; Noris, J. C. C.; Norman, J.; Nyanin, A.; Nystrand, J.; Oeschler, H.; Oh, S.; Oh, S. K.; Ohlson, A.; Okatan, A.; Okubo, T.; Olah, L.; Oleniacz, J.; Da Silva, A. C.Oliveira; Oliver, M. H.; Onderwaater, J.; Oppedisano, C.; Orava, R.; Velasquez, A. Ortiz; Oskarsson, A.; Otwinowski, J.; Oyama, K.; Ozdemir, M.; Pachmayer, Y.; Pagano, P.; Paić, G.; Pal, S. K.; Pan, J.; Pandey, A. K.; Papcun, P.; Papikyan, V.; Pappalardo, G. S.; Pareek, P.; Park, J.-W.; Parmar, S.; Passfeld, A.; Paticchio, V.; Patra, R. N.; Paul, B.; Peitzmann, T.; Da Costa, H. Pereira; Filho, E. Pereira De Oliveira; Peresunko, D.; Lara, C. E Pérez; Lezama, E. Perez; Peskov, V.; Pestov, Y.; Petráček, V.; Petrov, V.; Petrovici, M.; Petta, C.; Piano, S.; Pikna, M.; Pillot, P.; Pinazza, O.; Pinsky, L.; Piyarathna, D. B.; oskoń, M. P.; Planinic, M.; Pluta, J.; Pochybova, S.; Podesta-Lerma, P. L M; Poghosyan, M. G.; Polichtchouk, B.; Poljak, N.; Poonsawat, W.; Pop, A.; Porteboeuf-Houssais, S.; Porter, J.; Pospisil, J.; Prasad, S. K.; Preghenella, R.; Prino, F.; Pruneau, C. A.; Pshenichnov, I.; Puccio, M.; Puddu, G.; Pujahari, P.; Punin, V.; Putschke, J.; Qvigstad, H.; Rachevski, A.; Raha, S.; Rajput, S.; Rak, J.; Rakotozafindrabe, A.; Ramello, L.; Rami, F.; Raniwala, R.; Raniwala, S.; Räsänen, S.; Rascanu, B. T.; Rathee, D.; Read, K. F.; Redlich, K.; Reed, R. J.; Rehman, A.; Reichelt, P.; Reidt, F.; Ren, X.; Renfordt, R.; Reolon, A. R.; Reshetin, A.; Revol, J. P.; Reygers, K.; Riabov, V.; Ricci, R. A.; Richert, T.; Richter, M.; Riedler, P.; Riegler, W.; Riggi, F.; Ristea, C.; Rocco, E.; Cahuantzi, M. Rodríguez; Manso, A. Rodriguez; Røed, K.; Rogochaya, E.; Rohr, D.; Röhrich, D.; Romita, R.; Ronchetti, F.; Ronflette, L.; Rosnet, P.; Rossi, A.; Roukoutakis, F.; Roy, A.; Roy, C.; Roy, P.; Montero, A. J Rubio; Rui, R.; Russo, R.; Ryabinkin, E.; Ryabov, Y.; Rybicki, A.; Sadovsky, S.; Šafařík, K.; Sahlmuller, B.; Sahoo, P.; Sahoo, R.; Sahoo, S.; Sahu, P. K.; Saini, J.; Sakai, S.; Saleh, M. A.; Salzwedel, J.; Sambyal, S.; Samsonov, V.; Šándor, L.; Sandoval, A.; Sano, M.; Sarkar, D.; Scapparone, E.; Scarlassara, F.; Schiaua, C.; Schicker, R.; Schmidt, C.; Schmidt, H. R.; Schuchmann, S.; Schukraft, J.; Schulc, M.; Schuster, T.; Schutz, Y.; Schwarz, K.; Schweda, K.; Scioli, G.; Scomparin, E.; Scott, R.; Šefčík, M.; Seger, J. E.; Sekiguchi, Y.; Sekihata, D.; Selyuzhenkov, I.; Senosi, K.; Senyukov, S.; Serradilla, E.; Sevcenco, A.; Shabanov, A.; Shabetai, A.; Shadura, O.; Shahoyan, R.; Shangaraev, A.; Sharma, A.; Sharma, M.; Sharma, M.; Sharma, N.; Shigaki, K.; Shtejer, K.; Sibiriak, Y.; Siddhanta, S.; Sielewicz, K. M.; Siemiarczuk, T.; Silvermyr, D.; Silvestre, C.; Simatovic, G.; Simonetti, G.; Singaraju, R.; Singh, R; Singha, S.; Singhal, V.; Sinha, B. C.; Sinha, T.; Sitar, B.; Sitta, M.; Skaali, T. B.; Slupecki, M.; Smirnov, N.; Snellings, R. J.M.; Snellman, T. W.; Søgaard, C.; Song, J.; Song, M.; Song, Z.; Soramel, F.; Sorensen, S.; Sozzi, F.; Spacek, M.; Spiriti, E.; Sputowska, I.; Spyropoulou-Stassinaki, M.; Stachel, J.; Stan, I.; Stefanek, G.; Stenlund, E.; Steyn, G.; Stiller, J. H.; Stocco, D.; Strmen, P.; Suaide, A. A P; Sugitate, T.; Suire, C.; Suleymanov, M.; Suljic, M.; Sultanov, R.; Šumbera, M.; Szabo, A.; De Toledo, A. Szanto; Szarka, I.; Szczepankiewicz, A.; Szymanski, M.; Tabassam, U.; Takahashi, J.; Tambave, G. J.; Tanaka, N.; Tangaro, M. A.; Tarhini, M.; Tariq, M.; Tarzila, M. G.; Tauro, A.; Muñoz, G. Tejeda; Telesca, A.; Terasaki, K.; Terrevoli, C.; Teyssier, B.; Thäder, J.; Thomas, D.; Tieulent, R.; Timmins, A. R.; Toia, A.; Trogolo, S.; Trombetta, G.; Trubnikov, V.; Trzaska, W. H.; Tsuji, T.; Tumkin, A.; Turrisi, R.; Tveter, T. S.; Ullaland, K.; Uras, A.; Usai, G. L.; Utrobicic, A.; Vajzer, M.; Vala, M.; Palomo, L. Valencia; Vallero, S.; Van Der Maarel, J.; Van Hoorne, J. W.; van Leeuwen, M.; Vanat, T.; Vyvre, P. Vande; Varga, D.; Vargas, A.; Vargyas, M.; Varma, R.; Vasileiou, M.; Vasiliev, A.; Vauthier, A.; Vechernin, V.; Veen, A. M.; Veldhoen, M.; Velure, A.; Venaruzzo, M.; Vercellin, E.; Limón, S. Vergara; Vernet, R.; Verweij, M.; Vickovic, L.; Viesti, G.; Viinikainen, J.; Vilakazi, Z.; Baillie, O. Villalobos; Tello, A. Villatoro; Vinogradov, A.; Vinogradov, L.; Vinogradov, Y.; Virgili, T.; Vislavicius, V.; Viyogi, Y. P.; Vodopyanov, A.; Völkl, M. A.; Voloshin, K.; Voloshin, S. A.; Volpe, G.; Haller, B.; Vorobyev, I.; Vranic, D.; Vrláková, J.; Vulpescu, B.; Vyushin, A.; Wagner, B.; Wagner, J.; Wang, H.; Wang, M.; Watanabe, D.; Watanabe, Y.; Weber, M.; Weber, S. G.; Weiser, D. F.; Wessels, J. P.; Westerhoff, U.; Whitehead, A. M.; Wiechula, J.; Wikne, J.; Wilde, M.; Wilk, G.; Wilkinson, J.; Williams, M. C S; Windelband, B.; Winn, M.; Yaldo, C. G.; Yang, H.; Yang, P.; Yano, S.; Yasar, C.; Yin, Z.; Yokoyama, H.; Yoo, I. K.; Yoon, J. H.; Yurchenko, V.; Yushmanov, I.; Zaborowska, A.; Zaccolo, V.; Zaman, A.; Zampolli, C.; Zanoli, H. J. C.; Zaporozhets, S.; Zardoshti, N.; Zarochentsev, A.; Závada, P.; Zaviyalov, N.; Zbroszczyk, H.; Zgura, I. S.; Zhalov, M.; Zhang, H.; Zhang, X.; Zhang, Y.; Zhang, C.; Zhang, Z.; Zhao, C.; Zhigareva, N.; Zhou, D.; Zhou, Y.; Zhou, Z.; Zhu, H.; Zhu, J.; Zichichi, A.; Zimmermann, A.; Zimmermann, M. B.; Zinovjev, G.; Zyzak, M.
2017-01-01
A detailed study of pseudorapidity densities and multiplicity distributions of primary charged particles produced in proton–proton collisions, at s= 0.9, 2.36, 2.76, 7 and 8 TeV, in the pseudorapidity range | η| < 2 , was carried out using the ALICE detector. Measurements were obtained for three
Oxygen stabilized zirconium-vanadium-iron alloy
International Nuclear Information System (INIS)
Gruen, D.M.; Mendelsohn, M.H.
1982-01-01
An oxygen stabilized intermetallic compound having the formula (Zrsub(1-x)Tisub(x))sub(2-u)(Vsub(1-y)Fesub(y))Osub(z) where x = 0.0 to 0.9, y = 0.01 to 0.9, z = 0.25 to 0.5 and u = 0 to 1. The compound is capable of reversibly sorbing hydrogen at temperatures from -196 deg C to 200 deg C at pressures down to 10 - 6 torr. The compound is suitable for use as a hydrogen getter in low pressure, high temperature applications such as magnetic confinement fusion devices, and the iron content may be substituted by nickel, cobalt or manganese. (author)
Oxygen stabilized zirconium-vanadium-iron alloy
International Nuclear Information System (INIS)
Gruen, D.M.; Mendelsohn, M.H.
1982-01-01
An oxygen stabilized intermetallic compound having the formula (Zrsub(1-x)Tisub(x))sub(2-u)(Vsub(1-y)Fesub(y))Osub(z) where x=0.0 to 0.9, y=0.01 to 0.9, z=0.25 to 0.5 and u=0 to 1. The compound is capable of reversibly sorbing hydrogen at temperatures from -196 0 C to 200 0 C at pressures down to 10 - 6 torr. The compound is suitable for use as a hydrogen getter in low pressure, high temperature applications such as magnetic confinement fusion devices, and the iron content may be substituted by nickel, cobalt or manganese. (author)
Levels of total mercury in marine organisms from Adriatic Sea, Italy.
Perugini, Monia; Visciano, Pierina; Manera, Maurizio; Zaccaroni, Annalisa; Olivieri, Vincenzo; Amorena, Michele
2009-08-01
The presence of total mercury in fish, crustacean and cephalopod from Adriatic Sea, was investigated. The highest concentrations were observed in decreasing order in: Norway lobster (0.97 +/- 0.24 mg/kg; mean +/- SE), European hake (0.59 +/- 0.14 mg/kg), red mullet (0.48 +/- 0.09 mg/kg), blue whiting (0.38 +/- 0.09 mg/kg), Atlantic mackerel (0.36 +/- 0.08 mg/kg) and European flying squid (0.25 +/- 0.03 mg/kg). A significant difference (p fish and fishery products can exceed the maximum levels and stress the need of more information for consumers in particular for people that eat large amount of fish.
2018-03-28T09:54:35Z https://www.ajol.info/index.php/all/oai oai:ojs ...
African Journals Online (AJOL)
article/86823 2018-03-28T09:54:35Z eamj:ART The prevalence of glucose intolerance among antenatal clients at Kenyatta National Hospital at, 24-36 weeks of gestation Adelaide, B Ogutu, Omondi- Mutungi, A Objectives: To determine the ...
DEFF Research Database (Denmark)
Lundgren, Jens Dilling; Barton, S E; Lazzarin, A
1995-01-01
This study examined the factors associated with the development of a first episode of Pneumocystis carinii pneumonia (PCP) in 5,025 patients with AIDS, including 1,976 patients with primary PCP at the time of AIDS diagnosis and 635 with primary PCP occurring subsequently. Compared with untreated...... patients, patients treated with zidovudine were at similar risk of developing PCP during the first year of therapy but were at greater risk after longer intervals of treatment. The following factors were associated with an increased risk of PCP (either at the time of AIDS diagnosis or thereafter): lack...... of primary PCP prophylaxis, male homosexuality/bisexuality, diagnosis of AIDS in northern Europe, and CD4 cell count below 200 x 10(6)/L at the time of AIDS diagnosis. Patients with severe weight loss had a 60% higher risk of developing PCP during follow-up than those without such weight loss. Thus...
Flisiak, Robert; Horban, Andrzej; Gallay, Philippe; Bobardt, Michael; Selvarajah, Suganya; Wiercinska-Drapalo, Alicja; Siwak, Ewa; Cielniak, Iwona; Higersberger, Jozef; Kierkus, Jarek; Aeschlimann, Christian; Grosgurin, Pierre; Nicolas-Métral, Valérie; Dumont, Jean-Maurice; Porchet, Hervé; Crabbé, Raf; Scalfaro, Pietro
2008-03-01
Debio-025 is an oral cyclophilin (Cyp) inhibitor with potent anti-hepatitis C virus activity in vitro. Its effect on viral load as well as its influence on intracellular Cyp levels was investigated in a randomized, double-blind, placebo-controlled study. Mean hepatitis C viral load decreased significantly by 3.6 log(10) after a 14-day oral treatment with 1200 mg twice daily (P CypB) levels in peripheral blood mononuclear cells decreased from 67 +/- 6 (standard error) ng/mg protein (baseline) to 5 +/- 1 ng/mg protein at day 15 (P CypB levels, coinciding with the decrease in hepatitis C viral load. These are the first preliminary human data supporting the hypothesis that CypB may play an important role in hepatitis C virus replication and that Cyp inhibition is a valid target for the development of anti-hepatitis C drugs.
An Assessment of Malaysian Monetary Policy During the Global Financial Crisis of 2008-09
Selim Elekdag; Subir Lall; Harun Alp
2012-01-01
Malaysia was hit hard by the global financial crisis of 2008-09. Anticipating the downturn that would follow the episode of extreme financial turbulence, Bank Negara Malaysia (BNM) let the exchange rate depreciate as capital flowed out, and preemptively cut the policy rate by 150 basis points. Against this backdrop, this paper tries to quantify how much deeper the recession would have been without the BNM's monetary policy response. Taking the most intense year of the crisis as our baseline (...
Elyana, E.; Mohamed, Z.; Kamil, S. A.; Supardan, S. N.; Chen, S. K.; Yahya, A. K.
2018-02-01
Ru doping in charge-ordered Pr0.75Na0.25Mn1-xRuxO3 (x = 0-0.1) manganites was studied to investigate its effect on structure, electrical transport, magnetic properties, and magnetotransport properties. DC electrical resistivity (ρ), magnetic susceptibility, and χ' measurements showed that sample x = 0 exhibits insulating behavior within the entire temperature range and antiferromagnetic (AFM) behavior below the charge-ordering (CO) transition temperature TCO of 221 K. Ru4+ substitution (x>0.01) suppressed the CO state, which resulted in the revival of paramagnetic to ferromagnetic (FM) transition at the Curie temperature Tc, increasing from 120 K (x = 0.01) to 193 K (x = 0.1). Deviation from the Curie-Weiss law above Tc in the 1/χ' versus T plot for x = 0.01 doped samples indicated the existence of Griffiths phase with Griffith temperature at 169 K. Electrical resistivity measurements showed that Ru4+ substitution increased the metallic-to-insulating transition temperature TMI from 144 K (x = 0.01) to 192 K (x = 0.05) due to enhanced double-exchange mechanism, but TMI decreased to 176 K (x = 0.1) probably due to the existence of AFM clusters within the FM domain. The present work also discussed the possible theoretical models at the resistivity curve of Pr0.75Na0.25Mn1-xRuxO3 (x = 0-0.1) for the entire temperature range.
International Nuclear Information System (INIS)
Aparnadevi, M.; Barik, S.K.; Mahendiran, R.
2012-01-01
We investigated magnetocaloric effect in La 0.45 Pr 0.25 Ca 0.3 MnO 3 by direct methods (changes in temperature and latent heat) and indirect method (magnetization isotherms). This compound undergoes a first-order paramagnetic to ferromagnetic transition with T C =200 K upon cooling. The paramagnetic phase becomes unstable and it transforms into a ferromagnetic phase under the application of magnetic field, which results in a field-induced metamagnetic transition (FIMMT). The FIMMT is accompanied by release of latent heat and temperature of the sample as evidenced from differential scanning calorimetry and thermal analysis experiments. A large magnetic entropy change of ΔS m =−7.2 J kg −1 K −1 at T=212.5 K and refrigeration capacity of 228 J kg −1 are found for a field change of ΔH=5 T. It is suggested that destruction of magnetic polarons and growth of ferromagnetic phase accompanied by a lattice volume change with increasing magnetic field is responsible for the large magnetocaloric effect in this compound. - Highlights: ► We report magnetic entropy change measured by indirect and direct methods in La 0.45 Pr 0.25 Ca 0.3 MnO 3. ► Anomalous field-induced induced metamagnetic transition is found in the paramagnetic state. ► A large reversible magnetic entropy change (ΔS m =7.2 J kg −1 K −1 for ΔH=5 T). ► A large refrigeration capacity (RC=228 J kg −1 ). ► Collapse of magnetic polarons is suggested as possible origin of the large MCE.
Unusual antiferromagnetic structure of YbCo{sub 2}Si{sub 2}
Energy Technology Data Exchange (ETDEWEB)
Mufti, N. [Max-Planck-Institut fuer Chemische Physik fester Stoffe, Dresden (Germany); Department of Physics, State University of Malang, Malang (Indonesia); Kaneko, K. [Max-Planck-Institut fuer Chemische Physik fester Stoffe, Dresden (Germany); Quantum Beam Science Center, Japan Atomic Energy Agency, Tokai (Japan); Hoser, A. [Helmholtz-Zentrum Berlin fuer Materialien und Energie, Berlin (Germany); Gutmann, M. [ISIS Neutron and Muon Source, Rutherford Appleton Laboratory, Didcot (United Kingdom); Geibel, C.; Stockert, O. [Max-Planck-Institut fuer Chemische Physik fester Stoffe, Dresden (Germany); Krellner, C. [Max-Planck-Institut fuer Chemische Physik fester Stoffe, Dresden (Germany); Physikalisches Institut, Goethe-Universitaet Frankfurt, Frankfurt (Germany)
2016-07-01
We report on extensive powder and single crystal neutron diffraction experiments to study the magnetic structure in YbCo{sub 2}Si{sub 2} below the Neel temperature T{sub N} = 1.7 K in detail. Representation analysis has been used to find the possible magnetic structure models compatible with the experiments. Two different magnetically ordered phases can clearly be distinguished. At lowest temperatures a commensurate magnetic structure with a propagation vector k{sub 1} = (0.25 0.25 1) and equal moments or about 1.4 μ{sub B}/Yb is found, while the intermediate phase (T > 0.9 K) is characterized by an incommensurate amplitude-modulated magnetic structure with k{sub 2} = (0.25 0.086 1). The magnetic structure in YbCo{sub 2}Si{sub 2} is in stark contrast to all other compounds of the RCo{sub 2}Si{sub 2} family (R = rare earth element) likely due to some itineracy of the Yb 4f states being responsible for the magnetism.
Galindo, Danielle; Villanueva, Linda; Nguyen, Cathy; Patel, Milan; Borbridge, Lisa; Attar, Mayssa; Schiffman, Rhett M.; Hollander, David A.
2011-01-01
Abstract Purpose Anti-inflammatory activity of topical nonsteroidal anti-inflammatory drugs is mediated by suppression of cyclooxygenase (COX) isoenzymes. This study compared ocular penetration and inflammation suppression of topical ketorolac 0.45% and bromfenac 0.09% ophthalmic solutions in a rabbit model. Methods At hour 0, 36 rabbits received ketorolac 0.45%, bromfenac 0.09%, or an artificial tear 3 times once every 20 min. Half of the rabbits in each group then received intravenous injections of lipopolysaccharide (LPS) and fluorescein isothiocyanate (FITC)–dextran at hour 1, and the other half at hour 10. Aqueous and iris-ciliary body (ICB) samples were collected in the former group at hour 2 (peak) and in the latter group at hour 11 (trough) An additional group of 6 animals received only FITC-dextran, and samples were collected 1 h later. Peak and trough nonsteroidal anti-inflammatory drug concentrations were compared with previously determined half-maximal inhibitory concentrations (IC50) for COX isoenzymes. Results Peak and trough aqueous and ICB concentrations of ketorolac were at least 7-fold or greater than those of bromfenac. At peak levels, both ketorolac 0.45% and bromfenac 0.09% significantly inhibited LPS-induced aqueous prostaglandin E2 and FITC-dextran elevation (P < 0.01). At trough, both study drugs significantly inhibited LPS-induced aqueous prostaglandin E2 elevation (P < 0.05), but only ketorolac 0.45% significantly reduced LPS-induced aqueous FITC-dextran elevation (P < 0.01). Aqueous and ICB ketorolac concentrations exceeded its IC50 for COX-1 and COX-2 at peak and trough. Aqueous and ICB bromfenac levels exceeded its IC50 for COX-2 at peak and trough, but not for COX-1 at trough aqueous levels and peak and trough ICB levels. Conclusions Both ketorolac 0.45% and bromfenac 0.09% effectively suppressed inflammation at peak. At trough, only ketorolac 0.45% effectively suppressed inflammation as measured by FITC
International Nuclear Information System (INIS)
Ruff, Andrea J.; Marshall, Philip J.; Treu, Tommaso; Auger, Matthew W.; Gavazzi, Raphael; Brault, Florence
2011-01-01
We present a joint gravitational lensing and stellar-dynamical analysis of 11 early-type galaxies (median deflector redshift z d = 0.5) from Strong Lenses in the Legacy Survey (SL2S). Using newly measured redshifts and stellar velocity dispersions from Keck spectroscopy with lens models from Paper I, we derive the total mass-density slope inside the Einstein radius for each of the 11 lenses. The average total density slope is found to be (γ') = 2.16 +0.09 -0.09 (ρ tot ∝r -γ ' ), with an intrinsic scatter of 0.25 +0.10 -0.07 . We also determine the dark matter fraction for each lens within half the effective radius, R eff /2, and find the average-projected dark matter mass fraction to be 0.42 +0.08 -0.08 with a scatter of 0.20 +0.09 -0.07 for a Salpeter initial mass function. By combining the SL2S results with those from the Sloan Lens ACS Survey (median z d = 0.2) and the Lenses Structure and Dynamics Survey (median z d = 0.8), we investigate cosmic evolution of γ' and find a mild trend ∂(γ')/∂z d = -0.25 +0.10 -0.12 . This suggests that the total density profile of massive galaxies has become slightly steeper over cosmic time. If this result is confirmed by larger samples, it would indicate that dissipative processes played some role in the growth of massive galaxies since z ∼ 1.
2018-04-21T09:34:52Z https://www.ajol.info/index.php/all/oai oai:ojs ...
African Journals Online (AJOL)
article/74716 2018-04-21T09:34:52Z ifep:ART Gambling behaviour of university students in south-western Nigeria Oyebisi, EO Alao, KA Popoola, BI Given the stridency with which gambling advertisement is used to lure adolescents and young ...
2018-05-07T09:18:01Z https://www.ajol.info/index.php/all/oai oai:ojs ...
African Journals Online (AJOL)
article/95678 2018-05-07T09:18:01Z ajb:ART Effects of extremely low frequency electromagnetic fields on growth, cytogenetic, protein content and antioxidant system of Zea mays L. Shabrangi, A Majd, A Sheidai, M Zea mays, cytogenetic, protein ...
2018-05-09T10:48:32Z https://www.ajol.info/index.php/all/oai oai:ojs ...
African Journals Online (AJOL)
... 2018-05-09T10:48:31Z nslj:ART Relevance of School Library Media Centre on social ... Pius Olatunji The study detailed the vital nature of the school library media centre ... Nigerian School Library Journal; Vol 9 (2010) 0331-8214 eng ...
2018-04-21T09:26:25Z https://www.ajol.info/index.php/all/oai oai:ojs ...
African Journals Online (AJOL)
article/92486 2018-04-21T09:26:25Z lhr:ART Beyond “The Way of God:” Missionaries, Colonialism and Smallpox in Abeokuta Oduntan, BO Abeokuta, Colonial Medicine, Smallpox, Sopono. This article explores the ways the people of Abeokuta ...
2018-05-05T09:36:53Z https://www.ajol.info/index.php/all/oai oai:ojs ...
African Journals Online (AJOL)
article/54669 2018-05-05T09:36:53Z ai:ART Federalism and conflicts in Ethiopia Maru, M Since 1991, Ethiopia has been implementing an ethno-linguistic federal system. This system established nine ethnically based regional states. In this article ...
2018-04-30T01:42:09Z https://www.ajol.info/index.php/all/oai oai:ojs ...
African Journals Online (AJOL)
article/98916 2018-04-30T01:42:09Z nvj:ART Detection of Rabies Antigen in the Brain Tissues of Apparetly Healthy Dogs Slaughteres in Ogoja - Cross River State, Nigeria Isek, TI Umoh, JU Dzikwi, AA Rabies antigen, slaughtered dogs, Ogoja, ...
2018-05-05T09:34:45Z https://www.ajol.info/index.php/all/oai oai:ojs ...
African Journals Online (AJOL)
article/75463 2018-05-05T09:34:45Z pamj:ART Knowledge of HIV/AIDS and use of mandatory premarital HIV testing as a prerequisite for marriages among religious leaders in Sokoto, North Western Nigeria Umar, SA Oche, OM Knowledge, ...
2018-04-30T09:12:25Z https://www.ajol.info/index.php/all/oai oai:ojs ...
African Journals Online (AJOL)
article/83143 2018-04-30T09:12:25Z nifoj:ART Enrichment of Noodles with Soy Flour and Carrot Powder Adegunwa, MO Bakare, HA Akinola, OF Noodles, cassava, soy flour, carrot, carotenoids Noodles were produced from four flour blends of ...
2018-05-09T18:54:11Z https://www.ajol.info/index.php/all/oai oai:ojs ...
African Journals Online (AJOL)
article/92203 2018-05-09T18:54:11Z lwati:ART The Impact of Emotional Intelligence and Self-Efficacy on the Malleability of Job Performance and Job Involvement of Prison Personnel in Nigeria Mwantu, EN Agbo, PO Ngwama, JC Emotional ...
Energy Technology Data Exchange (ETDEWEB)
Pereira, W.S. [Industrias Nucleares do Brasil (SR/FCN/INB), Itatiaia, RJ (Brazil). Servico de Radioprotecao. Fabrica do Combustivel Nuclear; Kelecom, A. [Universidade Federal Fluminense (LARARA-PLS/GETA/UFF), Niteroi, RJ (Brazil). Lab. de Radiobiologia e Radiometria Pedro Lopes dos Santos. Grupo de Estudos em Temas Ambientais
2015-07-01
The Ore Treatment Unit (UTM) is a mine and closed uranium plant, located in Caldas, Minas Gerais, Brazil. It has a radioactive material disposal composed primarily of pie II and mesothorium. It is stored in six sheds designated C-01, C-02, C-05, C-06, C-07 and C-09. This study aims to present the high flow area monitoring program and results obtained in 2009. The threshold derived from concentration in the air was 0.25 Bq m{sup -3}. The average of the activity concentrations in 2009 were: for C-01 1.17 Bq m{sup -3}; C-02 0.006 Bq m{sup -3}; C-05 1.98 Bq m{sup -3}; C-06 2.14 Bq m{sup -3}; C-07 0.34 Bq m{sup -3} and C-09 0,025 Bq m{sup -3}. Such values indicate that the control stay is an important factor in occupational workers' control, as well as the use of EPI's and behavioral care, besides radioprotection training to allow the access to the areas. No worker, supervisor or visitor reached the limit research.
Oxygen permeation in thin, dense Ce0.9Gd0.1O 1.95- membranes I. Model study
DEFF Research Database (Denmark)
Chatzichristodoulou, Christodoulos; Søgaard, Martin; Hendriksen, Peter Vang
2011-01-01
at the feed and permeate side of the membrane, related to the gaseous oxygen reduction and fuel oxidation, respectively, as well as the gas conversion and gas diffusion resistances in the porous support structure at the permeate side. The temperature and oxygen activity dependence of the oxide ionic...... was analyzed by a separation of the various losses. The chemical expansion of Ce 0.9Gd0.1O1.95-δ under operation was estimated from the calculated oxygen activity and nonstoichiometry profiles inside the membrane. © 2011 The Electrochemical Society.......A model of a supported planar Ce0.9Gd0.1O 1.95-δ oxygen membrane in a plug-flow setup was constructed and a sensitivity analysis of its performance under varying operating conditions and membrane parameters was performed. The model takes into account the driving force losses at the catalysts...
International Nuclear Information System (INIS)
Pavlinov, L.V.; Evstratov, V.D.
1982-06-01
By means of the radioisotope process and the method of a planning matrix for factor experiments quantitative values have been found for the influence of alloys of chromium molybdenum, niobium, vanadium, titanium on the decarbonization of low alloy pearlitic steels in sodium at temperatures of 500 to 800 0 C. It has been proved that of all alloys with a concentration of 1 to 3% Cr, 1 to 2% Mo, 0 to 1% Nb, 0 to 0.25% V, and 0 to 0.25% Ti, which had been studied, the alloys of iron with 1-3% Cr and 1% Mo showed the greatest tendency for decarbonization in sodium where the carbon concentration decreases from 0.01 to 0.02% at the surface. An increase of the concentration of molybdenum and especially of niobium and titanium leads to a decrease of the decarbonization tendency of steel because the surface concentration of carbon remains at the level of 0.08 to 0.09% in alloys which contain up to 1% niobium and in complex alloy steels with up to 1% niobium, 0.25% vanadium, and 0.25% titanium. (orig.) [de
Energy Technology Data Exchange (ETDEWEB)
Cui, Xinyu; Gu, Hongmei [School of Public Health, Mudanjiang Medical University, Mudanjiang, Heilongjiang Province (China); Yin, Yuanyuan; Guan, Yue [Hongqi Hospital, Mudanjiang Medical University, Mudanjiang, Heilongjiang Province (China); Rong, Shengzhong; Yin, Yongkui; Chen, Yingying [School of Public Health, Mudanjiang Medical University, Mudanjiang, Heilongjiang Province (China); Wu, Qunhong; Hao, Yanhua [Department of Social Medicine, School of Health Management, Harbin Medical University, Harbin, Heilongjiang Province (China); Li, Miaojing, E-mail: limiaojing@aliyun.com [School of Public Health, Mudanjiang Medical University, Mudanjiang, Heilongjiang Province (China)
2015-04-15
Highlights: • Cu{sub 0.91}In{sub 0.09}S microspheres were deposited on TiO{sub 2} NTs by a photodeposition method. • The average diameter of Cu{sub 0.91}In{sub 0.09}S microspheres is 600 nm. • The TiO{sub 2} NTs/CIS shows high photocurrents and visible photocatalytic activity. - Abstract: TiO{sub 2} nanotube arrays sensitized with Cu{sub 0.91}In{sub 0.09}S microspheres (TiO{sub 2} NTs/CIS) were successfully fabricated by a two-step process of anodization and followed by an in situ photodeposition method. The structural investigation by scanning electron microscopy and transmission electron microscopy indicated that the Cu{sub 0.91}In{sub 0.09}S microspheres with average diameter of 600 nm grew on the surface of the TiO{sub 2} nanotubes. The TiO{sub 2} NTs/CIS exhibited more excellent photoelectrochemical properties and photocatalytic activities than those of TiO{sub 2} NTs under visible light irradiation, and the corresponding electron transformation was proposed in detail.
DEFF Research Database (Denmark)
Jensen, Brian Sveistrup; Khafaji, M. M.; Johansen, T. K.
2012-01-01
/Fmax of 180/220 GHz. The accumulator architecture omits the pre-skewing registers of the pipeline, thereby lowering both power consumption and circuit complexity. Some limitations to this design are discussed and the necessary equations for determining the phase jump encountered each time the control word...... (synthesised frequency) is changed are presented. For many applications employing signal processing after detection, this phase shift can then be corrected for. Compared to a full pipeline architecture (omitting the input circuitry for the most significant bit, as is customary for such designs......This article presents a 20 GHz, 12-bit pipeline accumulator with a reduced number of registers, suitable for direct digital synthesiser (DDS) applications. The accumulator is implemented in the IHP SG25H1 (0.25 μm) SiGe:C technology featuring heterojunction bipolar transistors (HBTs) with Ft...
DEFF Research Database (Denmark)
Jensen, Brian Sveistrup; Khafaji, M. Mahdi; Johansen, Tom Keinicke
2012-01-01
/Fmax of 180/220 GHz respectively. The accumulator architecture omits the pre-skewing registers of the pipeline, thereby lowering both power consumption and circuit complexity. Some limitations to this design are discussed and the necessary equations for determining the phase jump encountered each time......This article presents a 20 GHz, 12-bit pipeline accumulator with a reduced number of registers, suitable for direct digital synthesizer (DDS) applications. The accumulator is implemented in the IHP SG25H1 (0.25um) SiGe:C technology featuring heterojunction bipolar transistors (HBT) with Ft...... the control word (synthesized frequency) is changed are presented. For many applications employing signal processing after detection, this phase shift can then be corrected for. Compared to a full pipeline architecture, the implemented 12-bit accumulator reduces the number of registers by 55% and the power...
Microstructure and properties of 13Cr5Ni1Mo0.025Nb0.09V0.06N super martensitic stainless steel
Energy Technology Data Exchange (ETDEWEB)
Ma, X.P.; Wang, L.J. [Key Laboratory for Anisotropy and Texture of Materials, Northeastern University, Shenyang 110819 (China); Liu, C.M., E-mail: cmliu@mail.neu.edu.cn [Key Laboratory for Anisotropy and Texture of Materials, Northeastern University, Shenyang 110819 (China); Subramanian, S.V. [Department of Materials Science and Engineering, McMaster University, Hamilton, L8S-4L7 (Canada)
2012-03-30
Highlights: Black-Right-Pointing-Pointer Characterization of the microstructures of a commercial martenistic stainless steel. Black-Right-Pointing-Pointer Excess N content causes the occurrence of coarse carbo-nitride and Cr{sub 2}N. Black-Right-Pointing-Pointer Correlation of microstructures with mechanical and corrosion properties. Black-Right-Pointing-Pointer The poor pitting resistance is due to Cr rich precipitates. - Abstract: The morphological microstructure, the density and dispersion of high angle boundaries, morphology and micro chemical composition of precipitates and the volume fraction of retained austenite of a commercial super martensitic stainless steel (SMSS) normalized and tempered at various temperatures were characterized by optical microscope, scanning electron microscope (SEM), electron backscattered diffraction (EBSD), transmission electron microscope (TEM) and X-ray diffraction (XRD) in the light of equilibrium phase diagram of the alloy calculated using Thermo-Calc software. The mechanical properties and pitting corrosion resistance were determined to correlate with microstructures. Two kinds of morphology of precipitate were observed in tempered commercial super martensitic stainless. Besides the globular Nb and V rich carbo-nitride precipitates, rod-like Cr rich nitrides were formed due to excess N content. While high density of high angle boundaries and precipitates contribute to strength properties, the dislocation softening of the matrix and retained austenite from tempering restore the ductility and impact toughness properties. The poor resistance to pitting corrosion is attributed to the occurrence of Cr rich precipitates. It is demonstrated that by lowering the nitrogen content and adding niobium, the Cr rich precipitates can be suppressed and the mechanical properties and resistance to pitting corrosion can be significantly improved.
Microstructure and properties of 13Cr5Ni1Mo0.025Nb0.09V0.06N super martensitic stainless steel
International Nuclear Information System (INIS)
Ma, X.P.; Wang, L.J.; Liu, C.M.; Subramanian, S.V.
2012-01-01
Highlights: ► Characterization of the microstructures of a commercial martenistic stainless steel. ► Excess N content causes the occurrence of coarse carbo-nitride and Cr 2 N. ► Correlation of microstructures with mechanical and corrosion properties. ► The poor pitting resistance is due to Cr rich precipitates. - Abstract: The morphological microstructure, the density and dispersion of high angle boundaries, morphology and micro chemical composition of precipitates and the volume fraction of retained austenite of a commercial super martensitic stainless steel (SMSS) normalized and tempered at various temperatures were characterized by optical microscope, scanning electron microscope (SEM), electron backscattered diffraction (EBSD), transmission electron microscope (TEM) and X-ray diffraction (XRD) in the light of equilibrium phase diagram of the alloy calculated using Thermo-Calc software. The mechanical properties and pitting corrosion resistance were determined to correlate with microstructures. Two kinds of morphology of precipitate were observed in tempered commercial super martensitic stainless. Besides the globular Nb and V rich carbo-nitride precipitates, rod-like Cr rich nitrides were formed due to excess N content. While high density of high angle boundaries and precipitates contribute to strength properties, the dislocation softening of the matrix and retained austenite from tempering restore the ductility and impact toughness properties. The poor resistance to pitting corrosion is attributed to the occurrence of Cr rich precipitates. It is demonstrated that by lowering the nitrogen content and adding niobium, the Cr rich precipitates can be suppressed and the mechanical properties and resistance to pitting corrosion can be significantly improved.
2018-03-20T08:36:09Z https://www.ajol.info/index.php/all/oai oai:ojs ...
African Journals Online (AJOL)
article/75816 2018-03-20T08:36:09Z ijard:ART An Overview of Benefits of Organic Agriculture as a Climate Change Adaptation and Mitigation Strategy for Nigeria Korie, OC Eze, CC Lemchi, JI Ibekwe, UC Orebiyi, JS Obasi, PC Ohajianya, DO Eze ...
2018-05-05T09:36:39Z https://www.ajol.info/index.php/all/oai oai:ojs ...
African Journals Online (AJOL)
article/15613 2018-05-05T09:36:39Z dai:ART Plasma Lipid Profile and Target Organ Effect of Theobromine Extracts from Cocoa in Wistar Rats Eteng, M. U.; Department of Biochemistry, College of Medical Sciences, University of Calabar, P. M. B. ...
Electromagnetic design of a β=0.9, 650 MHz elliptic superconducting radio frequency cavity
International Nuclear Information System (INIS)
Jana, Arup Ratan; Kumar, V.
2011-01-01
We have recently performed two-dimensional (2D) electromagnetic design studies of a β=0.9, 650 MHz, elliptic superconducting radio frequency (SCRF) cavity using electromagnetic field solver code SUPERFISH. We have evolved the design starting from the design parameters of β=1, 1300 MHz, TESLA design SCRF cavity and then scaled it for the β=0.9 and 650 MHz case. The design has been optimized for minimizing the SCRF cavity power loss. One of the important parameters in the design of such elliptic SCRF cavities is the wall angle, which is defined as the vertical angle made by the common tangent to the iris and equator ellipses. Generally, there is a constraint on the minimum value of the wall angle, which is decided by the mechanical considerations, ease of chemical cleaning etc. In our optimization studies, we have first explored the case when there is no such constraint on wall angle. We find that from the point of view of low cavity power dissipation, the optimized design has a re-entrant geometry, where the wall angle is negative. We then perform design optimization, keeping the constraint that the wall angle should be greater than 5 degree. Keeping this constraint, we find that our optimized design parameters for the single cell match closely with the design parameters reported for Project-X. We discuss the results of 2D electromagnetic field calculations for this design using SUPERFISH. In the next, we have performed the design studies of the multi-cell β=0.9, 650 MHz, elliptic SCRF cavity. The design parameters of end-cells are optimized such that the frequency of the end-cell is matched to that of mid-cells. We have studied all the normal modes for the multi-cell cavity. The frequency of different normal modes is also calculated using a finite element code ANSYS and results are compared with those obtained using SUPERFISH. The field flatness, which is an important design criterion, is also studied. For multi-cell cavity, another important aspect is the cell
National Research Council Canada - National Science Library
Vittori, Jay
1999-01-01
This study is an Air Force doctrinaire's account of the development of Joint Publication 3-09, Doctrine for Joint Fire Support, the most controversial joint military doctrine publication ever produced...
Enhancement of magnetocaloric effect by external hydrostatic pressure in MnNi0.75Fe0.25Ge alloy
Mandal, K.; Dutta, P.; Dasgupta, P.; Pramanick, S.; Chatterjee, S.
2018-06-01
A systematic investigation on the structural and magnetic properties of an Fe-doped MnNiGe alloy with nominal composition MnNi0.75Fe0.25Ge has been performed. Temperature dependent x-ray diffraction studies indicate a clear structural phase transition (martensitic type) from the high temperature hexagonal austenite phase (space group P63/mmc) to the low temperature orthorhombic martensite phase (space group Pnma). Interestingly, about 1.4% of the high temperature hexagonal phase has been observed at 15 K, which is well below the martensitic phase transition (MPT) temperature. The studied alloy is found to be ferromagnetic in nature at the lowest temperature of measurement and the saturation moment increases in the presence of external hydrostatic pressure (P). In addition, it shows a significantly large conventional (negative) magnetocaloric effect with an adiabatic entropy change () of about ‑16.2 J kg‑1 K‑1 around the MPT for a magnetic field changing from 0 → 5 T. The most interesting observation is the ∼40.1% increase in the peak value of on application of 6 kbar of external P. A considerable increment in the refrigeration capacity has also been noted with the applied P.
Ling, Yihan; Xie, Huixin; Liu, Zijing; Du, Xiaoni; Chen, Hui; Ou, Xuemei; Zhao, Ling; Budiman, Riyan Achmad
2018-03-01
For the sake of improving the electrochemical activity and chromium tolerance of the K2NiF4-type oxide, La2NiO4+δ (LNO), with nonnucleation agents like Mn and Sr elements, the electrochemical performance and degradation were comparatively studied at two cathodes La2Ni0.9Fe0.1O4+δ (LNF) and LNF-40wt%Gd0.1Ce0.9O1.95 (LNF-GDC) on the GDC electrolyte, where 5wt%Cr2O3 incorporation provides Cr-containing atmosphere. Compared with non-doped LNO, LNF shows a higher interstitial oxygen concentration (δ = 0.298) and a lower electrical conductivity, where bivalent Ni ion, {Ni}_{Ni}^{ × } , and trivalent Ni ion, {Ni}_{Ni}^{ \\cdot } , and trivalent Fe ion on Ni-site, {Fe}_{Ni}^{ \\cdot } , were observed from the XPS measurements. LNF-GDC shows greatly reduced interfacial polarization resistances (Rp), which are only half of those of LNF, indicating a better electrochemical performance. More importantly, no significant degradation of LNF-GDC in performance has been observed under exposure of Cr-containing atmosphere at 700 °C for 350 h, while Rp of LNF increased by nearly 20%, suggesting LNF by GDC incorporation can enhance the electrochemical performance as well as chromium tolerance for intermediate temperature solid oxide fuel cells (IT-SOFCs).
Recent trends in television tip over-related injuries among children aged 0-9 years.
Murray, K J; Griffin, R; Rue, L W; McGwin, G
2009-08-01
To describe recent trends in television tip over-related injuries among children aged 0-9 years, and to compare injury rates with sales of newer digital televisions. Digital television sales data were obtained from marketing data provided by the Television Bureau of Advertising. Data regarding television tip over-related injuries among children aged 0-9 years were obtained from the 1998-2007 National Electronic Injury Surveillance System. A Wald chi(2) test, estimated from logistic analysis, was used to determine whether the distribution of injury types differed by age group. Pearson's correlation was used to estimate the association between digital television sales and television tip over-related injuries. An estimated 42 122 (95% CI 35 199 to 49 122) injuries from television tip-overs were treated in US emergency departments from 1998 to 2007. The injury rate was highest for children aged 1-4 years (18.6/100 000). A majority of injuries (63.9%) involved the head and neck for children under 1 year of age, while a higher proportion of injuries among children aged 1-4 involved the hip and lower extremity (42.9% and 31.0%, respectively), and shoulder and upper extremity (16.8%) for children aged 5-9. A strong, positive correlation was observed between television sales and annual injury rates (r = 0.89, pdigital television sales were strongly correlated with increased injury rates, the lack of information regarding the type of television involved prevents inference regarding causation.
Directory of Open Access Journals (Sweden)
Андрій Ігорович Семененко
2015-06-01
Full Text Available For today there are no clear recommendations on infusion therapy at the disease and injuries of brain, and infusion preparations are commonly used empirically. Within the framework of the complex study of an influence of the different infusion remedies on brain at an experimental ischemia of brain, an aim of this work is to investigate how the 0,9 % solution of NaCl influences on the dynamics of cognitive functions and neurological status of the rats with an acute cerebral ischemia at the course medical introduction into an animal organism.Methods. Experiments were carried out on 60 white rats-males. An acute disturbance of cerebral blood circulation (ADCBC was modeled by means of the two-sided dressing of internal carotid arteries. The 0,9 % solution of NаСІ was injected intravenously in catheterized thigh vein 2,5 ml/kg 2 times/day (5 ml/kg for a day. The first introduction was carried out in 30 minutes after ADCBC and then every day in 12 hours during 7 days. The control groups consist of intact rats that received 0,9 % NаСІ and animals with a model ischemia without treatment.Neurological deficiency in animals was defined on the scale stroke-index McGrow C. P. The dynamics of position-finding activity was assessed in experiment “an open field”. An assessment of animal capacity to training and memorization of an aversive stimulus was studied in the test of conditioned response of passive avoidance. The results were processed using the program StatPlus 2009.Results. The study showed that bilateral carotid occlusion in rats without treatment is followed not only by the high animal lethality but also by the development of a hard neurological symptomatology and then by essential disturbance of mnestic functions in animals that survived during the recovery period of model insult (р<0,01.The study of lethality dynamics, neurological status, behavioral responses in rats with ADCBC on the model of bilateral carotid occlusion showed that the
Energy Technology Data Exchange (ETDEWEB)
Xu, Lei; Xie, Hongde, E-mail: xiehongde@suda.edu.cn; Pu, Yinfu; Huang, Yanlin [Soochow University, State and Local Joint Engineering Laboratory for Novel Functional Polymeric Materials, College of Chemistry, Chemical Engineering and Materials Science (China); Qin, Lin; Seo, Hyo Jin, E-mail: hjseo@pknu.ac.kr [Pukyong National University, Department of Physics and Interdisciplinary Program of Biomedical, Mechanical & Electrical Engineering (Korea, Republic of)
2017-01-15
La(Ni{sub 0.75}W{sub 0.25})O{sub 3} perovskite oxide was prepared via the sol–gel Pechini route. The pure crystalline phase was verified via X-ray diffraction measurements and Rietveld structure refinements. Some measurements were applied to characterize the surface of the nanoparticles such as transmission electron microscopy, scanning electron microscope, energy-dispersive X-ray spectroscopy, specific surface area, and X-ray photo-electron spectroscopy measurements. The optical measurement confirmed that this perovskite oxide can absorb the visible light presenting low band energy of 2.41 eV. The d–d allowed transitions in Ni{sup 2+}-O octahedral have great contributions to the narrow band-gap. The Ni{sup 2+}-containing perovskite was applied as a photocatalyst showing the desirable photodegradation ability for methylene blue solutions under the excitation of visible-light. The photocatalysis activities were discussed in the relationship with its special perovskite-type structure such as the NiO{sub 6} color centers and multivalent cation ions etc.
International Nuclear Information System (INIS)
Wu, Ling; Lu, JiaJia; Wei, Gui; Wang, Pengfei; Ding, Hao; Zheng, Junwei; Li, Xiaowei; Zhong, Shengkui
2014-01-01
Highlights: • xLiMn 0.9 Fe 0.1 PO4·yLi 3 V 2 (PO 4 ) 3 /C composites are prepared by a solid-state method. • The addition of Li 3 V 2 (PO 4 ) 3 can improve the properties of LiMn 0.9 Fe 0.1 PO 4 . • Mutual doping occurrs between the LiMn 0.9 Fe 0.1 PO 4 and Li 3 V 2 (PO 4 ) 3 phases. • 5LiMn 0.9 Fe 0.1 PO 4 ·Li 3 V 2 (PO 4 ) 3 /C shows the best electrochemical properties. - Abstract: The xLiMn 0.9 Fe 0.1 PO 4 ·yLi 3 V 2 (PO 4 ) 3 /C (x:y=1:0, 9:1 5:1, 3:1, 1:1 and 0:1) cathode materials are synthesized by a ball–milling and post–calcination method. XRD results reveal that the xLiMn 0.9 Fe 0.1 PO 4 ·yLi 3 V 2 (PO 4 ) 3 /C (x,y≠0) composites are composed of LiMn 0.9 Fe 0.1 PO 4 and Li 3 V 2 (PO 4 ) 3 phases, and no impurities are detected. In LiMn 0.9 Fe 0.1 PO 4 –Li 3 V 2 (PO 4 ) 3 system, most of the manganese, iron and vanadium elements in the raw materials tend to form the two major phases, and only small amounts of V, Mn and Fe as dopants enter into the lattice of LiMn 0.9 Fe 0.1 PO 4 and Li 3 V 2 (PO 4 ) 3 . Electrochemical tests show that the xLiMn 0.9 Fe 0.1 PO 4 ·yLi 3 V 2 (PO 4 ) 3 /C (x,y≠0) composites exhibit much better performance than the single LiMn 0.9 Fe 0.1 PO 4 /C. Among the samples, 5LiMn 0.9 Fe 0.1 PO 4 ·Li 3 V 2 (PO 4 ) 3 /C shows the best electrochemical performance. The sample delivers the specific capacities of 158.1, 140.7 and 100.2 mAh g −1 at 0.05, 1 and 4 C rates in the potential range of 2.5–4.5 V, and exhibits very long and flat discharge plateau around 4.0 V up to 1 C rate. The sample also shows good cycling performance at various C–rates
Laser shock peening of steam turbine blade for enhanced service life
Indian Academy of Sciences (India)
2014-02-13
Feb 13, 2014 ... study to develop indigenous LSP process for enhanced service life ... DINX10Cr- 0.08–0.13 11.5–12.5 2.2–2.8 0.1–0.5 1.6–1.8 0.6–0.9 0.25–0.4 Balance ... LSP is done by scanning the taped surface of the work piece with a ...
Preparation of new 18alpha-oleanane alcohols: synthesis, characterization, and cytotoxic activity
Czech Academy of Sciences Publication Activity Database
Kvasnica, Miroslav; Rudovská, I.; Hajduch, M.; Šarek, J.
2010-01-01
Roč. 141, č. 2 (2010), s. 233-244 ISSN 0026-9247 R&D Projects: GA AV ČR KAN200200651 Grant - others:GA ČR(CZ) GP203/05/P025; GA ČR(CZ) GA305/09/1216 Institutional research plan: CEZ:AV0Z40550506 Keywords : reduction * hydride * ketone * configuration * cytotoxicity Subject RIV: CC - Organic Chemistry Impact factor: 1.356, year: 2010
2010-12-17
... 95113. The financing is contemplated for working capital and general operating purposes. The financing... SMALL BUSINESS ADMINISTRATION Emergence Capital Partners SBIC, L.P. License No. 09/79-0454; Notice... hereby given that Emergence Capital Partners SBIC, L.P., 160 Bovet Road, Suite 300, San Mateo, CA 94402...
2011-01-10
... financing is contemplated for working capital and general operating purposes. The financing is brought... SMALL BUSINESS ADMINISTRATION Emergence Capital Partners SBIC, L.P. License No. 09/79-0454; Notice... hereby given that Emergence Capital Partners SBIC, L.P., 160 Bovet Road, Suite 300, San Mateo, CA 94402...
77 FR 64992 - Ocean Transportation Intermediary License Reissuances
2012-10-24
..., Kenner, LA 70062. Date Reissued: August 15, 2012. License No.: 020088N. Name: Hal-Mari International... 91754. Date Reissued: September 5, 2012. License No.: 019372F. Name: Hal-Mari International Logistics...
77 FR 43600 - Ocean Transportation Intermediary License Reissuances
2012-07-25
.... License No.: 017267NF. Name: Just In Time Services, Inc. Address: 11380 NW 34th Street, Suite 100, Doral... to section 40901 of the Shipping Act of 1984 (46 U.S.C. 40101). License No.: 016201N. Name: Delta...
77 FR 1937 - Ocean Transportation Intermediary License; Reissuance
2012-01-12
... 515. License No. Name/Address Date reissued 004365F Logistics Management International, November 10, 2011. Inc., 600 Rinehart Road, Suite 1012, Lake Mary, FL 32746. 019085NF Hanjin Logistics, Inc., 80...
75 FR 12749 - Ocean Transportation Intermediary License Reissuances
2010-03-17
... Logistics, Inc., February 13, 2010. One Cross Island Plaza, Suite 203-G, Rosedale, NY 11422. 018250F.... 021870N AKM International, LLC, 301 February 19, 2010. Varick Street, Jersey City, NJ 07302. Sandra L...
75 FR 28252 - Ocean Transportation Intermediary License; Reissuance
2010-05-20
... 515. License No. Name/Address Date reissued 004662N Sanyo Logistics Corporation, 3625 Del April 8..., 2010. Drive, Midland City, AL 36350. 017845N Uniworld Express, Inc., 520 Carson Plaza April 24, 2010...
76 FR 2383 - Ocean Transportation Intermediary License Reissuance
2011-01-13
.... 021694N Wheelsky Logistics, Inc., November 19, 2010. 14515 East Don Julian Road, City of Industry, CA... City, CA 91780. 018525N Valu Freight Consolidators, November 19, 2010. Inc., 1325 NW 21th Street, Miami...
76 FR 76411 - Ocean Transportation Intermediary License; Reissuance
2011-12-07
... Customs October 28, 2011. Brokers, 1386 Salford, Houston, TX 77032. 017582F Trans Global Logistics, Inc., 1 Conan Drive, Midland City, AL 36350. Sandra L. Kusumoto, Director, Bureau of Certification and...
76 FR 10593 - Ocean Transportation Intermediary License Reissuance
2011-02-25
... 515. License No. Name/Address Date reissued 004094NF All Transport, Inc., 8369 NW. December 24, 2010... Export Corporation dba, December 28, 2010. Encargo Lines dba Encargo Logistics, 10800 NW. 103rd Street...
75 FR 76466 - Ocean Transportation Intermediary License Reissuance
2010-12-08
... Hollins Ferry Road, Halethorpe, MD 21227. 020253NF Concord October 22, 2010. International Transport, Inc... Logistics, Inc. October 30, 2010. dba LTH Express, 837 East Sandhill Avenue Carson, CA 90746. 021890F Empire Global October 31, 2010. Logistics, LLC, 160- 51 Rockaway Blvd., Suite 206, Jamaica, NY 11434. Sandra L...
78 FR 57633 - Ocean Transportation Intermediary License Reissuances
2013-09-19
...: International Transport Services, Inc. Address: 19987 Commerce Parkway, Cleveland, OH 44130. Date Reissued...: July 4, 2013. License No.: 024023N. Name: OES Logistics, Inc. Address: 10900 E. 183rd Street, 130...
National Oceanic and Atmospheric Administration, Department of Commerce — NODC Accession 0112323 includes chemical, discrete sample, physical and profile data collected from WAKATAKA MARU in the North Pacific Ocean from 2003-09-05 to...
Directory of Open Access Journals (Sweden)
Schnaider Taylor Brandão
2002-01-01
Full Text Available Objetivo: Avaliar, pela morfometria, se o tenoxicam com água bidestilada (diluente ou com cloreto de sódio a 0,9% (NaCl 0,9% provoca alterações no endotélio venoso. Métodos: Foram utilizados 90 coelhos (Oryctolagus cuniculus, brancos, da linhagem Nova Zelândia, machos, com idade acima de 10 semanas, com peso variando entre 2000 e 3500 gramas, divididos em dois grupos denominados Experimento e Controle, que foram observados nos tempos de 6h, 12h e 24h. Administrou-se nas venae auriculares dextra e sinistra, tenoxicam com seu diluente ou com NaCl 0,9% no grupo Experimento e NaCl 0,9% no grupo Controle. Para análise estatística dos resultados foi aplicada a análise de variância a um critério: a em separado para cada grupo (Tenoxicam/NaCl 0,9%, Tenoxicam/Diluente e NaCl 0,9%, para comparar as medidas médias dos diâmetros dos núcleos das células endoteliais obtidas nos períodos de observação de 6h, 12h e 24h. Resultados: Observou-se que não ocorreram diferenças significantes entre as medidas médias dos diâmetros nucleares encontradas nos períodos de eutanásia de 6, 12 e 24h, em separado para cada grupo. As medidas médias dos diâmetros nucleares do grupo Controle foram significantemente maiores do que as observadas no grupo Experimento. Conclusão: O tenoxicam, com água bidestilada ou com cloreto de sódio a 0,9%, reduziu os diâmetros dos núcleos das células endoteliais nas venae em que foi injetado.
Hirsnik, Erkki, 1982-
2010-01-01
Riigikohtu lahendist 3-1-1-104-09: Edelaraudtee Infrastruktuuri AS kaitsja vandeadvokaat Leonid Tolstovi kassatsioon Pärnu Maakohtu 4. juuni 2009. a kohtuotsuse peale Edelaraudtee Infrastruktuuri AS väärteoasjas looduskaitseseaduse § 71 lg 2 järgi
Energy Technology Data Exchange (ETDEWEB)
Lim, Sang-Soon [Center for Electronic Materials, Korea Institute of Science and Technology, Seoul 136-791 (Korea, Republic of); Department of Materials Science and Engineering, Yonsei University, Seoul 120-749 (Korea, Republic of); Kim, Ju-Heon [High Temp. Energy Materials Research Center, Korea Institute of Science and Technology, Seoul 136-791 (Korea, Republic of); Kwon, Beomjin; Kim, Seong Keun [Center for Electronic Materials, Korea Institute of Science and Technology, Seoul 136-791 (Korea, Republic of); Park, Hyung-Ho [Department of Materials Science and Engineering, Yonsei University, Seoul 120-749 (Korea, Republic of); Lee, Ki-Suk; Baik, Jeong Min [School of Materials and Science Engineering, UNIST, Ulsan 689-798 (Korea, Republic of); KIST-UNIST Ulsan Center for Convergent Materials, UNIST, Ulsan 689-798 (Korea, Republic of); Choi, Won Jun [Center for Opto-Electronic Materials and Devices, Korea Institute of Science and Technology, Seoul 136-791 (Korea, Republic of); Kim, Dong-Ik [High Temp. Energy Materials Research Center, Korea Institute of Science and Technology, Seoul 136-791 (Korea, Republic of); Hyun, Dow-Bin; Kim, Jin-Sang [Center for Electronic Materials, Korea Institute of Science and Technology, Seoul 136-791 (Korea, Republic of); Baek, Seung-Hyub, E-mail: shbaek77@kist.re.kr [Center for Electronic Materials, Korea Institute of Science and Technology, Seoul 136-791 (Korea, Republic of); KIST-UNIST Ulsan Center for Convergent Materials, UNIST, Ulsan 689-798 (Korea, Republic of); Department of Nanomaterials Science and Technology, Korea University of Science and Technology, Daejeon, 305-333 (Korea, Republic of)
2016-09-05
As a field-assisted technique, spark plasma sintering (SPS) enables densification of specimens in a very short period of time compared to other sintering techniques. For high performance thermoelectric material synthesis, SPS is widely used to fabricate nanograin-structured thermoelectric materials by rapidly densifying the nanopowders suppressing grain growth. However, the microstructural evolution behavior of thermoelectric materials by SPS, another important process during sintering, has been rarely studied. Here, we explore SPS as a tool to control the microstructure by long-time SPS. Using p-type (Bi{sub 0.25}Sb{sub 0.75}){sub 2}Te{sub 3} thermoelectric materials as a model system, we systematically vary SPS temperature and time to understand the correlations between SPS conditions, microstructural evolution, and the thermoelectric properties. Our results show that the relatively low eutectic temperature (∼420 °C) and the existence of volatile tellurium (Te) are critical factors to determine both microstructure and thermoelectric property. In the liquid-phase sintering regime, rapid evaporation of Te leads to a strong dependence of thermoelectric property on SPS time. On the other hand, in the solid-phase sintering regime, there is a weak dependence on SPS time. The optimum thermoelectric figure-of-merit (Z) of 2.93 × 10{sup −3}/K is achieved by SPS at 500 °C for 30 min. Our results will provide an insight on the optimization of SPS conditions for materials containing volatile elements with low eutectic temperature. - Highlights: • Spark plasma sintering (SPS) is used to synthesize the thermoelectric (Bi{sub 0.25}Sb{sub 0.75}){sub 2}Te{sub 3}. • Liquid phase and volatile element are a key for the microstructure and thermoelectric property. • Thermoelectric figure-of-merit of 2.9 × 10{sup −3}/K is achieved at 500 °C for 30 min.
Improvement of Fructanohydrolase Production in Aspergillus niger SL-09 by Sucrose Ester
Directory of Open Access Journals (Sweden)
Xiang-Yang Ge
2006-01-01
Full Text Available The influence of carbon sources, nitrogen sources, and the addition of sucrose ester on fructanohydrolase production was investigated. The enzyme production varied depending on the carbon source. Apart from that, it was found that the enzyme activities formed by Aspergillus niger SL-09 were enhanced dramatically by the addition of sucrose ester S-770 to the medium. The effect of sucrose ester on enzyme production was also studied on molecular level, and it was confirmed that the transcription was activated by the addition of sucrose ester to the medium. The response surface methodology (RSM was used to optimize the composition for the production of fructanohydrolase, and the enzyme activities were enhanced more than 7-fold than those obtained in the basal medium.
Uday Bhasker, S.; Choudary, G. S. V. R. K.; Reddy, M. V. Ramana
2018-05-01
The ever growing applications and ever evolving challenges of magnetic nano particles has been motivating the researchers from various disciplines towards this area of magnetic nano particles. Cation substitutional effect on the magnetic structure of the nanoparticles forms a crucial aspect in their applications. Here the environmentally benign auto combustion method was employed to synthesize chromium substituted nickel cobalt ferrite (Ni0.75Co0.25Fe2-xCrxO4; x = 0, 0.10, 0.15) nano particles, from aqueous metal nitrate solutions. Chromium substitution has shown its effect on the structural, magnetic and electrical properties of Ni0.75Co0.25Fe2O4. Structural and phase analysis of the prepared samples show increased phase purity of ferrite sample with increasing Cr substitution. The TEM (Transmission Electron Microscope) image confirms the nano size of the particles, EDS (Energy dispersive X-ray Spectroscopy) has supported the stoichiometry of the prepared samples and FTIR (Fourier-transform infrared spectroscopic) analysis confirms the spinel structure and also suggests cation redistributions with chromium substitution. VSM (Vibrational Sample Magnetometer) is used to study the magnetic properties through magnetic hysteresis (M-H) loop and magnetic Hopkinson effect. All samples show hysteresis and show reduction in magnetic properties with increase in chromium content. The thermo magnetic study shows Hopkinson peak(s) in the magnetization vs. temperature (M-T) graph and also shows variation in the nature of Hopkinson peak with chromium substitution. Possible reasons for the changes in the nature of the peak are discussed.
2010-10-14
... ENVIRONMENTAL PROTECTION AGENCY [FRL-9213-6] Availability of FY 09 Grantee Performance Evaluation... (EPA). ACTION: Notice of availability; Clean Air Act Section 105 grantee performance evaluation reports...-year evaluations of eight state air pollution control programs (Alabama Department of Environmental...
Directory of Open Access Journals (Sweden)
Leny Yuliati
2014-05-01
Full Text Available Background: The hydrothermal method was used as a new approach to prepare a series of Ag-doped Cd0.1Zn0.9S photocatalysts. The effect of Ag doping on the properties and photocatalytic activity of Cd0.1Zn0.9S was studied for the hydrogen production from water reduction under visible light irradiation.Results: Compared to the series prepared by the co-precipitation method, samples prepared by the hydrothermal method performed with a better photocatalytic activity. The sample with the optimum amount of Ag doping showed the highest hydrogen production rate of 3.91 mmol/h, which was 1.7 times higher than that of undoped Cd0.1Zn0.9S. With the Ag doping, a red shift in the optical response was observed, leading to a larger portion of the visible light absorption than that of without doping. In addition to the larger absorption in the visible-light region, the increase in photocatalytic activity of samples with Ag doping may also come from the Ag species facilitating electron–hole separation.Conclusion: This study demonstrated that Ag doping is a promising way to enhance the activity of Cd0.1Zn0.9S photocatalyst.
2018-05-09T08:04:19Z https://www.ajol.info/index.php/all/oai oai:ojs ...
African Journals Online (AJOL)
article/24359 2018-05-09T08:04:19Z ajfm:ART Equity and VAT in Tanzania. Mugoya, Patrick KD It is normally argued that Value Added Tax (VAT) is essentially regressive in the sense that all consumers pay the same amount of the tax per unit of ...
Directory of Open Access Journals (Sweden)
Su YL
2015-09-01
Full Text Available Yinglan Su, Zhongjun Zhang, Yaoxian Zhang, Hanwei Li, Wei Shi Anesthesia Department, The Shenzhen People’s Hospital, The Secondary Clinical Medical College of Jinan University, Shenzhen, Guangdong, People’s Republic of China Background: The purpose of this study was to evaluate the use of different concentrations of ropivacaine in ultrasound-guided regional anesthesia with regard to postoperative analgesic and patient’s satisfaction in elderly patients undergoing inguinal hernioplasty in the People’s Republic of China. Methods: A total of 60 patients (>75 years of age who scheduled inguinal hernioplasty at the Shenzhen People’s Hospital from December 2013 to March 2015 were randomly assigned to three groups: 0.25% ropivacaine (n=20, 0.5% ropivacaine (n=20, and 0.75% ropivacaine (n=20. Ultrasound-guided regional anesthesia was performed before every surgery. Non-invasive blood pressure and heart rate were recorded before the operation, during the first 5 minutes of the surgical procedure, and 5 minutes after the operation of the patients, and compared between the groups. Incidence of adverse reactions, postoperative Visual Analog Scale score, and analgesic effect were also recorded and analyzed. Results: The surgical procedure and anesthesia was performed successfully in all patients. Patients with high-dose ropivacaine (0.5% and 0.75% in ultrasound-guided regional anesthesia exhibited lower arterial pressure and lower heart rate during the operation when compared to low-dose group. The interquartile range of Visual Analog Scale scores in both group C (0.75% ropivacaine and group B (0.5% ropivacaine were significantly lower (P<0.05 than in group A (0.25% ropivacaine. Accordingly, the interquartile range of satisfactory scores in both group C (0.75% ropivacaine and group B (0.5% ropivacaine were significantly higher (P<0.05 than in group A (0.25% ropivacaine. More cases in high-dose groups reported abnormal skin sensation; however, it
National Oceanic and Atmospheric Administration, Department of Commerce — Current meter components data were collected from FIXED PLATFORMS from 09 November 1977 to 20 February 1990. Data were collected by the Maritime Safety Agency;...
Yu, Rongrong
2015-01-01
The present study explored the direct influences of teacher classroom practices, including teacher support, conceptual teaching, and procedural teaching, on 9th grade students' mathematics achievement, and the indirect influences of these teacher variables on student mathematics achievement through students' mathematics self-efficacy and interest in mathematics courses. The base year data of High School Longitudinal Study of 2009 (HSLS: 09) was used for this study. Structural equation modelin...
DEFF Research Database (Denmark)
Gil Cuesta, Julita; Aavitsland, Preben; Englund, Hélène
2016-01-01
During the 2009/10 influenza A(H1N1)pdm09 pandemic, the five Nordic countries adopted different approaches to pandemic vaccination. We compared pandemic vaccination strategies and severe influenza outcomes, in seasons 2009/10 and 2010/11 in these countries with similar influenza surveillance...... systems. We calculated the cumulative pandemic vaccination coverage in 2009/10 and cumulative incidence rates of laboratory confirmed A(H1N1)pdm09 infections, intensive care unit (ICU) admissions and deaths in 2009/10 and 2010/11. We estimated incidence risk ratios (IRR) in a Poisson regression model...... with the other countries. In 2010/11 Denmark had a significantly higher cumulative incidence of A(H1N1)pdm09 ICU admissions (IRR: 2.4; 95% confidence interval (CI): 1.9-3.0) and deaths (IRR: 8.3; 95% CI: 5.1-13.5). Compared with Denmark, the other countries had higher pandemic vaccination coverage...
Fast helicity switching of x-ray circular polarization at beamline P09 at PETRA III
Energy Technology Data Exchange (ETDEWEB)
Strempfer, J., E-mail: Joerg.Strempfer@desy.de; Mardegan, J. R. L.; Francoual, S.; Veiga, L. S. I.; Spitzbart, T.; Zink, H. [Deutsches Elektronen Synchrotron (DESY), Notkestrasse 85, 22603 Hamburg (Germany); Bouchenoire, L. [XMaS, ESRF, 6 rue Jules Horowitz, BP220, Grenoble 38043 (France); Department of Physics, University of Liverpool, Liverpool, L69 7ZE (United Kingdom)
2016-07-27
At the resonant scattering and diffraction beamline P09 at PETRA III/DESY, polarization manipulation in the X-ray energy range 3-13 keV is possible using wave-plates. Recently, fast flipping of circular polarization helicity using the Raspberry Pi controlled FPGA (PiLC) device developed at DESY and dedicated piezo-electric flippers has been commissioned. Functionality of the PiLC for XMCD and first XMCD measurements at the Fe K-and Dy-L{sub 3} absorption edges are presented.
DEFF Research Database (Denmark)
Davey, Richard T; Lynfield, Ruth; Dwyer, Dominic E
2013-01-01
Prospective studies establishing the temporal relationship between the degree of inflammation and human influenza disease progression are scarce. To assess predictors of disease progression among patients with influenza A(H1N1)pdm09 infection, 25 inflammatory biomarkers measured at enrollment wer...
2018-05-06T09:36:03Z https://www.ajol.info/index.php/all/oai oai:ojs ...
African Journals Online (AJOL)
... 2018-05-06T09:36:03Z ifep:ART Memory and Digit Span Experiment among Psychology Students in Lagos State, Nigeria Adewuyi, TDO Ayenibiowo, KO Memory, Digit Span and Psychology Students. The study was an experimental field that investigated short-term memory and digit span among the psychology students ...