WorldWideScience

Sample records for cis-regulatory element zrs

  1. Preaxial polydactyly/triphalangeal thumb is associated with changed transcription factor-binding affinity in a family with a novel point mutation in the long-range cis-regulatory element ZRS

    DEFF Research Database (Denmark)

    Farooq, Muhammad; Troelsen, Jesper T; Boyd, Mette;

    2010-01-01

    A cis-regulatory sequence also known as zone of polarizing activity (ZPA) regulatory sequence (ZRS) located in intron 5 of LMBR1 is essential for expression of sonic hedgehog (SHH) in the developing posterior limb bud mesenchyme. Even though many point mutations causing preaxial duplication defec...

  2. Changes in Cis-regulatory Elements during Morphological Evolution

    Directory of Open Access Journals (Sweden)

    Yu-Lee Paul

    2012-10-01

    Full Text Available How have animals evolved new body designs (morphological evolution? This requires explanations both for simple morphological changes, such as differences in pigmentation and hair patterns between different Drosophila populations and species, and also for more complex changes, such as differences in the forelimbs of mice and bats, and the necks of amphibians and reptiles. The genetic changes and pathways involved in these evolutionary steps require identification. Many, though not all, of these events occur by changes in cis-regulatory (enhancer elements within developmental genes. Enhancers are modular, each affecting expression in only one or a few tissues. Therefore it is possible to add, remove or alter an enhancer without producing changes in multiple tissues, and thereby avoid widespread (pleiotropic deleterious effects. Ideally, for a given step in morphological evolution it is necessary to identify (i the change in phenotype, (ii the changes in gene expression, (iii the DNA region, enhancer or otherwise, affected, (iv the mutation involved, (v the nature of the transcription or other factors that bind to this site. In practice these data are incomplete for most of the published studies upon morphological evolution. Here, the investigations are categorized according to how far these analyses have proceeded.

  3. The identification of cis-regulatory elements: A review from a machine learning perspective.

    Science.gov (United States)

    Li, Yifeng; Chen, Chih-Yu; Kaye, Alice M; Wasserman, Wyeth W

    2015-12-01

    The majority of the human genome consists of non-coding regions that have been called junk DNA. However, recent studies have unveiled that these regions contain cis-regulatory elements, such as promoters, enhancers, silencers, insulators, etc. These regulatory elements can play crucial roles in controlling gene expressions in specific cell types, conditions, and developmental stages. Disruption to these regions could contribute to phenotype changes. Precisely identifying regulatory elements is key to deciphering the mechanisms underlying transcriptional regulation. Cis-regulatory events are complex processes that involve chromatin accessibility, transcription factor binding, DNA methylation, histone modifications, and the interactions between them. The development of next-generation sequencing techniques has allowed us to capture these genomic features in depth. Applied analysis of genome sequences for clinical genetics has increased the urgency for detecting these regions. However, the complexity of cis-regulatory events and the deluge of sequencing data require accurate and efficient computational approaches, in particular, machine learning techniques. In this review, we describe machine learning approaches for predicting transcription factor binding sites, enhancers, and promoters, primarily driven by next-generation sequencing data. Data sources are provided in order to facilitate testing of novel methods. The purpose of this review is to attract computational experts and data scientists to advance this field.

  4. Bounded search for de novo identification of degenerate cis-regulatory elements

    Directory of Open Access Journals (Sweden)

    Khetani Radhika S

    2006-05-01

    Full Text Available Abstract Background The identification of statistically overrepresented sequences in the upstream regions of coregulated genes should theoretically permit the identification of potential cis-regulatory elements. However, in practice many cis-regulatory elements are highly degenerate, precluding the use of an exhaustive word-counting strategy for their identification. While numerous methods exist for inferring base distributions using a position weight matrix, recent studies suggest that the independence assumptions inherent in the model, as well as the inability to reach a global optimum, limit this approach. Results In this paper, we report PRISM, a degenerate motif finder that leverages the relationship between the statistical significance of a set of binding sites and that of the individual binding sites. PRISM first identifies overrepresented, non-degenerate consensus motifs, then iteratively relaxes each one into a high-scoring degenerate motif. This approach requires no tunable parameters, thereby lending itself to unbiased performance comparisons. We therefore compare PRISM's performance against nine popular motif finders on 28 well-characterized S. cerevisiae regulons. PRISM consistently outperforms all other programs. Finally, we use PRISM to predict the binding sites of uncharacterized regulons. Our results support a proposed mechanism of action for the yeast cell-cycle transcription factor Stb1, whose binding site has not been determined experimentally. Conclusion The relationship between statistical measures of the binding sites and the set as a whole leads to a simple means of identifying the diverse range of cis-regulatory elements to which a protein binds. This approach leverages the advantages of word-counting, in that position dependencies are implicitly accounted for and local optima are more easily avoided. While we sacrifice guaranteed optimality to prevent the exponential blowup of exhaustive search, we prove that the error

  5. [Identification and mapping of cis-regulatory elements within long genomic sequences].

    Science.gov (United States)

    Akopov, S B; Chernov, I P; Vetchinova, A S; Bulanenkova, S S; Nikolaev, L G

    2007-01-01

    The publication of the human and other metazoan genome sequences opened up the possibility for mapping and analysis of genomic regulatory elements. Unfortunately, experimental data on genomic positions of such sequences as enhancers, silencers, insulators, transcription terminators, and replication origins are very limited, especially at the whole genome level. As most genomic regulatory elements (e.g., enhancers) are generally gene-, tissue-, or cell-specific, the prediction of these elements in silico is often ambiguous. Therefore, the development of high-throughput experimental approaches for identification and mapping of genomic functional elements is highly desirable. In this review we discuss novel approaches to high-throughput experimental identification of mammalian genomes cis-regulatory elements which is a necessary step toward the complete genome annotation. PMID:18240562

  6. Transcription of Mammalian cis-Regulatory Elements Is Restrained by Actively Enforced Early Termination.

    Science.gov (United States)

    Austenaa, Liv M I; Barozzi, Iros; Simonatto, Marta; Masella, Silvia; Della Chiara, Giulia; Ghisletti, Serena; Curina, Alessia; de Wit, Elzo; Bouwman, Britta A M; de Pretis, Stefano; Piccolo, Viviana; Termanini, Alberto; Prosperini, Elena; Pelizzola, Mattia; de Laat, Wouter; Natoli, Gioacchino

    2015-11-01

    Upon recruitment to active enhancers and promoters, RNA polymerase II (Pol II) generates short non-coding transcripts of unclear function. The mechanisms that control the length and the amount of ncRNAs generated by cis-regulatory elements are largely unknown. Here, we show that the adaptor protein WDR82 and its associated complexes actively limit such non-coding transcription. WDR82 targets the SET1 H3K4 methyltransferases and the nuclear protein phosphatase 1 (PP1) complexes to the initiating Pol II. WDR82 and PP1 also interact with components of the transcriptional termination and RNA processing machineries. Depletion of WDR82, SET1, or the PP1 subunit required for its nuclear import caused distinct but overlapping transcription termination defects at highly expressed genes and active enhancers and promoters, thus enabling the increased synthesis of unusually long ncRNAs. These data indicate that transcription initiated from cis-regulatory elements is tightly coordinated with termination mechanisms that impose the synthesis of short RNAs. PMID:26593720

  7. Identification of putative cis-regulatory elements in Cryptosporidium parvum by de novo pattern finding

    Directory of Open Access Journals (Sweden)

    Kissinger Jessica C

    2007-01-01

    Full Text Available Abstract Background Cryptosporidium parvum is a unicellular eukaryote in the phylum Apicomplexa. It is an obligate intracellular parasite that causes diarrhea and is a significant AIDS-related pathogen. Cryptosporidium parvum is not amenable to long-term laboratory cultivation or classical molecular genetic analysis. The parasite exhibits a complex life cycle, a broad host range, and fundamental mechanisms of gene regulation remain unknown. We have used data from the recently sequenced genome of this organism to uncover clues about gene regulation in C. parvum. We have applied two pattern finding algorithms MEME and AlignACE to identify conserved, over-represented motifs in the 5' upstream regions of genes in C. parvum. To support our findings, we have established comparative real-time -PCR expression profiles for the groups of genes examined computationally. Results We find that groups of genes that share a function or belong to a common pathway share upstream motifs. Different motifs are conserved upstream of different groups of genes. Comparative real-time PCR studies show co-expression of genes within each group (in sub-sets during the life cycle of the parasite, suggesting co-regulation of these genes may be driven by the use of conserved upstream motifs. Conclusion This is one of the first attempts to characterize cis-regulatory elements in the absence of any previously characterized elements and with very limited expression data (seven genes only. Using de novo pattern finding algorithms, we have identified specific DNA motifs that are conserved upstream of genes belonging to the same metabolic pathway or gene family. We have demonstrated the co-expression of these genes (often in subsets using comparative real-time-PCR experiments thus establishing evidence for these conserved motifs as putative cis-regulatory elements. Given the lack of prior information concerning expression patterns and organization of promoters in C. parvum we

  8. Lessons from Domestication: Targeting Cis-Regulatory Elements for Crop Improvement.

    Science.gov (United States)

    Swinnen, Gwen; Goossens, Alain; Pauwels, Laurens

    2016-06-01

    Domestication of wild plant species has provided us with crops that serve our human nutritional needs. Advanced DNA sequencing has propelled the unveiling of underlying genetic changes associated with domestication. Interestingly, many changes reside in cis-regulatory elements (CREs) that control the expression of an unmodified coding sequence. Sequence variation in CREs can impact gene expression levels, but also developmental timing and tissue specificity of expression. When genes are involved in multiple pathways or active in several organs and developmental stages CRE modifications are favored in contrast to mutations in coding regions, due to the lack of detrimental pleiotropic effects. Therefore, learning from domestication, we propose that CREs are interesting targets for genome editing to create new alleles for plant breeding.

  9. Characterization of Putative cis-Regulatory Elements in Genes Preferentially Expressed in Arabidopsis Male Meiocytes

    Directory of Open Access Journals (Sweden)

    Junhua Li

    2014-01-01

    Full Text Available Meiosis is essential for plant reproduction because it is the process during which homologous chromosome pairing, synapsis, and meiotic recombination occur. The meiotic transcriptome is difficult to investigate because of the size of meiocytes and the confines of anther lobes. The recent development of isolation techniques has enabled the characterization of transcriptional profiles in male meiocytes of Arabidopsis. Gene expression in male meiocytes shows unique features. The direct interaction of transcription factors (TFs with DNA regulatory sequences forms the basis for the specificity of transcriptional regulation. Here, we identified putative cis-regulatory elements (CREs associated with male meiocyte-expressed genes using in silico tools. The upstream regions (1 kb of the top 50 genes preferentially expressed in Arabidopsis meiocytes possessed conserved motifs. These motifs are putative binding sites of TFs, some of which share common functions, such as roles in cell division. In combination with cell-type-specific analysis, our findings could be a substantial aid for the identification and experimental verification of the protein-DNA interactions for the specific TFs that drive gene expression in meiocytes.

  10. Recurrent modification of a conserved cis-regulatory element underlies fruit fly pigmentation diversity.

    Directory of Open Access Journals (Sweden)

    William A Rogers

    2013-08-01

    Full Text Available The development of morphological traits occurs through the collective action of networks of genes connected at the level of gene expression. As any node in a network may be a target of evolutionary change, the recurrent targeting of the same node would indicate that the path of evolution is biased for the relevant trait and network. Although examples of parallel evolution have implicated recurrent modification of the same gene and cis-regulatory element (CRE, little is known about the mutational and molecular paths of parallel CRE evolution. In Drosophila melanogaster fruit flies, the Bric-à-brac (Bab transcription factors control the development of a suite of sexually dimorphic traits on the posterior abdomen. Female-specific Bab expression is regulated by the dimorphic element, a CRE that possesses direct inputs from body plan (ABD-B and sex-determination (DSX transcription factors. Here, we find that the recurrent evolutionary modification of this CRE underlies both intraspecific and interspecific variation in female pigmentation in the melanogaster species group. By reconstructing the sequence and regulatory activity of the ancestral Drosophila melanogaster dimorphic element, we demonstrate that a handful of mutations were sufficient to create independent CRE alleles with differing activities. Moreover, intraspecific and interspecific dimorphic element evolution proceeded with little to no alterations to the known body plan and sex-determination regulatory linkages. Collectively, our findings represent an example where the paths of evolution appear biased to a specific CRE, and drastic changes in function were accompanied by deep conservation of key regulatory linkages.

  11. Recurrent Modification of a Conserved Cis-Regulatory Element Underlies Fruit Fly Pigmentation Diversity

    Science.gov (United States)

    Rogers, William A.; Salomone, Joseph R.; Tacy, David J.; Camino, Eric M.; Davis, Kristen A.; Rebeiz, Mark; Williams, Thomas M.

    2013-01-01

    The development of morphological traits occurs through the collective action of networks of genes connected at the level of gene expression. As any node in a network may be a target of evolutionary change, the recurrent targeting of the same node would indicate that the path of evolution is biased for the relevant trait and network. Although examples of parallel evolution have implicated recurrent modification of the same gene and cis-regulatory element (CRE), little is known about the mutational and molecular paths of parallel CRE evolution. In Drosophila melanogaster fruit flies, the Bric-à-brac (Bab) transcription factors control the development of a suite of sexually dimorphic traits on the posterior abdomen. Female-specific Bab expression is regulated by the dimorphic element, a CRE that possesses direct inputs from body plan (ABD-B) and sex-determination (DSX) transcription factors. Here, we find that the recurrent evolutionary modification of this CRE underlies both intraspecific and interspecific variation in female pigmentation in the melanogaster species group. By reconstructing the sequence and regulatory activity of the ancestral Drosophila melanogaster dimorphic element, we demonstrate that a handful of mutations were sufficient to create independent CRE alleles with differing activities. Moreover, intraspecific and interspecific dimorphic element evolution proceeded with little to no alterations to the known body plan and sex-determination regulatory linkages. Collectively, our findings represent an example where the paths of evolution appear biased to a specific CRE, and drastic changes in function were accompanied by deep conservation of key regulatory linkages. PMID:24009528

  12. Putative cis-regulatory elements in genes highly expressed in rice sperm cells

    Directory of Open Access Journals (Sweden)

    Singh Mohan B

    2011-09-01

    Full Text Available Abstract Background The male germ line in flowering plants is initiated within developing pollen grains via asymmetric division. The smaller cell then becomes totally encased within a much larger vegetative cell, forming a unique "cell within a cell structure". The generative cell subsequently divides to give rise to two non-motile diminutive sperm cells, which take part in double fertilization and lead to the seed set. Sperm cells are difficult to investigate because of their presence within the confines of the larger vegetative cell. However, recently developed techniques for the isolation of rice sperm cells and the fully annotated rice genome sequence have allowed for the characterization of the transcriptional repertoire of sperm cells. Microarray gene expression data has identified a subset of rice genes that show unique or highly preferential expression in sperm cells. This information has led to the identification of cis-regulatory elements (CREs, which are conserved in sperm-expressed genes and are putatively associated with the control of cell-specific expression. Findings We aimed to identify the CREs associated with rice sperm cell-specific gene expression data using in silico prediction tools. We analyzed 1-kb upstream regions of the top 40 sperm cell co-expressed genes for over-represented conserved and novel motifs. Analysis of upstream regions with the SIGNALSCAN program with the PLACE database, MEME and the Mclip tool helped to find combinatorial sets of known transcriptional factor-binding sites along with two novel motifs putatively associated with the co-expression of sperm cell-specific genes. Conclusions Our data shows the occurrence of novel motifs, which are putative CREs and are likely targets of transcriptional factors regulating sperm cell gene expression. These motifs can be used to design the experimental verification of regulatory elements and the identification of transcriptional factors that regulate sperm cell

  13. Deciphering Cis-Regulatory Element Mediated Combinatorial Regulation in Rice under Blast Infected Condition.

    Science.gov (United States)

    Deb, Arindam; Kundu, Sudip

    2015-01-01

    Combinations of cis-regulatory elements (CREs) present at the promoters facilitate the binding of several transcription factors (TFs), thereby altering the consequent gene expressions. Due to the eminent complexity of the regulatory mechanism, the combinatorics of CRE-mediated transcriptional regulation has been elusive. In this work, we have developed a new methodology that quantifies the co-occurrence tendencies of CREs present in a set of promoter sequences; these co-occurrence scores are filtered in three consecutive steps to test their statistical significance; and the significantly co-occurring CRE pairs are presented as networks. These networks of co-occurring CREs are further transformed to derive higher order of regulatory combinatorics. We have further applied this methodology on the differentially up-regulated gene-sets of rice tissues under fungal (Magnaporthe) infected conditions to demonstrate how it helps to understand the CRE-mediated combinatorial gene regulation. Our analysis includes a wide spectrum of biologically important results. The CRE pairs having a strong tendency to co-occur often exhibit very similar joint distribution patterns at the promoters of rice. We couple the network approach with experimental results of plant gene regulation and defense mechanisms and find evidences of auto and cross regulation among TF families, cross-talk among multiple hormone signaling pathways, similarities and dissimilarities in regulatory combinatorics between different tissues, etc. Our analyses have pointed a highly distributed nature of the combinatorial gene regulation facilitating an efficient alteration in response to fungal attack. All together, our proposed methodology could be an important approach in understanding the combinatorial gene regulation. It can be further applied to unravel the tissue and/or condition specific combinatorial gene regulation in other eukaryotic systems with the availability of annotated genomic sequences and suitable

  14. Changes in cis-regulatory elements of a key floral regulator are associated with divergence of inflorescence architectures.

    Science.gov (United States)

    Kusters, Elske; Della Pina, Serena; Castel, Rob; Souer, Erik; Koes, Ronald

    2015-08-15

    Higher plant species diverged extensively with regard to the moment (flowering time) and position (inflorescence architecture) at which flowers are formed. This seems largely caused by variation in the expression patterns of conserved genes that specify floral meristem identity (FMI), rather than changes in the encoded proteins. Here, we report a functional comparison of the promoters of homologous FMI genes from Arabidopsis, petunia, tomato and Antirrhinum. Analysis of promoter-reporter constructs in petunia and Arabidopsis, as well as complementation experiments, showed that the divergent expression of leafy (LFY) and the petunia homolog aberrant leaf and flower (ALF) results from alterations in the upstream regulatory network rather than cis-regulatory changes. The divergent expression of unusual floral organs (UFO) from Arabidopsis, and the petunia homolog double top (DOT), however, is caused by the loss or gain of cis-regulatory promoter elements, which respond to trans-acting factors that are expressed in similar patterns in both species. Introduction of pUFO:UFO causes no obvious defects in Arabidopsis, but in petunia it causes the precocious and ectopic formation of flowers. This provides an example of how a change in a cis-regulatory region can account for a change in the plant body plan. PMID:26220938

  15. Changes in cis-regulatory elements of a key floral regulator are associated with divergence of inflorescence architectures.

    Science.gov (United States)

    Kusters, Elske; Della Pina, Serena; Castel, Rob; Souer, Erik; Koes, Ronald

    2015-08-15

    Higher plant species diverged extensively with regard to the moment (flowering time) and position (inflorescence architecture) at which flowers are formed. This seems largely caused by variation in the expression patterns of conserved genes that specify floral meristem identity (FMI), rather than changes in the encoded proteins. Here, we report a functional comparison of the promoters of homologous FMI genes from Arabidopsis, petunia, tomato and Antirrhinum. Analysis of promoter-reporter constructs in petunia and Arabidopsis, as well as complementation experiments, showed that the divergent expression of leafy (LFY) and the petunia homolog aberrant leaf and flower (ALF) results from alterations in the upstream regulatory network rather than cis-regulatory changes. The divergent expression of unusual floral organs (UFO) from Arabidopsis, and the petunia homolog double top (DOT), however, is caused by the loss or gain of cis-regulatory promoter elements, which respond to trans-acting factors that are expressed in similar patterns in both species. Introduction of pUFO:UFO causes no obvious defects in Arabidopsis, but in petunia it causes the precocious and ectopic formation of flowers. This provides an example of how a change in a cis-regulatory region can account for a change in the plant body plan.

  16. Identification of a cis-regulatory element by transient analysis of co-ordinately regulated genes

    Directory of Open Access Journals (Sweden)

    Allan Andrew C

    2008-07-01

    Full Text Available Abstract Background Transcription factors (TFs co-ordinately regulate target genes that are dispersed throughout the genome. This co-ordinate regulation is achieved, in part, through the interaction of transcription factors with conserved cis-regulatory motifs that are in close proximity to the target genes. While much is known about the families of transcription factors that regulate gene expression in plants, there are few well characterised cis-regulatory motifs. In Arabidopsis, over-expression of the MYB transcription factor PAP1 (PRODUCTION OF ANTHOCYANIN PIGMENT 1 leads to transgenic plants with elevated anthocyanin levels due to the co-ordinated up-regulation of genes in the anthocyanin biosynthetic pathway. In addition to the anthocyanin biosynthetic genes, there are a number of un-associated genes that also change in expression level. This may be a direct or indirect consequence of the over-expression of PAP1. Results Oligo array analysis of PAP1 over-expression Arabidopsis plants identified genes co-ordinately up-regulated in response to the elevated expression of this transcription factor. Transient assays on the promoter regions of 33 of these up-regulated genes identified eight promoter fragments that were transactivated by PAP1. Bioinformatic analysis on these promoters revealed a common cis-regulatory motif that we showed is required for PAP1 dependent transactivation. Conclusion Co-ordinated gene regulation by individual transcription factors is a complex collection of both direct and indirect effects. Transient transactivation assays provide a rapid method to identify direct target genes from indirect target genes. Bioinformatic analysis of the promoters of these direct target genes is able to locate motifs that are common to this sub-set of promoters, which is impossible to identify with the larger set of direct and indirect target genes. While this type of analysis does not prove a direct interaction between protein and DNA

  17. Creation of cis-regulatory elements during sea urchin evolution by co-option and optimization of a repetitive sequence adjacent to the spec2a gene.

    Science.gov (United States)

    Dayal, Sandeep; Kiyama, Takae; Villinski, Jeffrey T; Zhang, Ning; Liang, Shuguang; Klein, William H

    2004-09-15

    The creation, preservation, and degeneration of cis-regulatory elements controlling developmental gene expression are fundamental genome-level evolutionary processes about which little is known. Here, we identify critical differences in cis-regulatory elements controlling the expression of the sea urchin aboral ectoderm-specific spec genes. We found multiple copies of a repetitive sequence element termed RSR in genomes of species within the Strongylocentrotidae family, but RSRs were not detected in genomes of species outside Strongylocentrotidae. spec genes in Strongylocentrotus purpuratus are invariably associated with RSRs, and the spec2a RSR functioned as a transcriptional enhancer and displayed greater activity than did spec1 or spec2c RSRs. Single-base pair differences at two cis-regulatory elements within the spec2a RSR increased the binding affinities of four transcription factors, SpCCAAT-binding factor at one element and SpOtx, SpGoosecoid, and SpGATA-E at another. The cis-regulatory elements to which these four factors bound were recent evolutionary acquisitions that acted to either activate or repress transcription, depending on the cell type. These elements were found in the spec2a RSR ortholog in Strongylocentrotus pallidus but not in RSR orthologs of Strongylocentrotus droebachiensis or Hemicentrotus pulcherrimus. Our results indicated that a dynamic pattern of cis-regulatory element evolution exists for spec genes despite their conserved aboral ectoderm expression.

  18. Mutagenesis of GATA motifs controlling the endoderm regulator elt-2 reveals distinct dominant and secondary cis-regulatory elements.

    Science.gov (United States)

    Du, Lawrence; Tracy, Sharon; Rifkin, Scott A

    2016-04-01

    Cis-regulatory elements (CREs) are crucial links in developmental gene regulatory networks, but in many cases, it can be difficult to discern whether similar CREs are functionally equivalent. We found that despite similar conservation and binding capability to upstream activators, different GATA cis-regulatory motifs within the promoter of the C. elegans endoderm regulator elt-2 play distinctive roles in activating and modulating gene expression throughout development. We fused wild-type and mutant versions of the elt-2 promoter to a gfp reporter and inserted these constructs as single copies into the C. elegans genome. We then counted early embryonic gfp transcripts using single-molecule RNA FISH (smFISH) and quantified gut GFP fluorescence. We determined that a single primary dominant GATA motif located 527bp upstream of the elt-2 start codon was necessary for both embryonic activation and later maintenance of transcription, while nearby secondary GATA motifs played largely subtle roles in modulating postembryonic levels of elt-2. Mutation of the primary activating site increased low-level spatiotemporally ectopic stochastic transcription, indicating that this site acts repressively in non-endoderm cells. Our results reveal that CREs with similar GATA factor binding affinities in close proximity can play very divergent context-dependent roles in regulating the expression of a developmentally critical gene in vivo. PMID:26896592

  19. Shared Enhancer Activity in the Limbs and Phallus and Functional Divergence of a Limb-Genital cis-Regulatory Element in Snakes.

    Science.gov (United States)

    Infante, Carlos R; Mihala, Alexandra G; Park, Sungdae; Wang, Jialiang S; Johnson, Kenji K; Lauderdale, James D; Menke, Douglas B

    2015-10-12

    The amniote phallus and limbs differ dramatically in their morphologies but share patterns of signaling and gene expression in early development. Thus far, the extent to which genital and limb transcriptional networks also share cis-regulatory elements has remained unexplored. We show that many limb enhancers are retained in snake genomes, suggesting that these elements may function in non-limb tissues. Consistent with this, our analysis of cis-regulatory activity in mice and Anolis lizards reveals that patterns of enhancer activity in embryonic limbs and genitalia overlap heavily. In mice, deletion of HLEB, an enhancer of Tbx4, produces defects in hindlimbs and genitalia, establishing the importance of this limb-genital enhancer for development of these different appendages. Further analyses demonstrate that the HLEB of snakes has lost hindlimb enhancer function while retaining genital activity. Our findings identify roles for Tbx4 in genital development and highlight deep similarities in cis-regulatory activity between limbs and genitalia.

  20. Characterization of "cis"-regulatory elements ("c"RE) associated with mammary gland function

    Science.gov (United States)

    The Bos taurus genome assembly has propelled dairy science into a new era; still, most of the information encoded in the genome has not yet been decoded. The human Encyclopedia of DNA Elements (ENCODE) project has spearheaded the identification and annotation of functional genomic elements in the hu...

  1. An arthropod cis-regulatory element functioning in sensory organ precursor development dates back to the Cambrian

    Directory of Open Access Journals (Sweden)

    Simpson Pat

    2010-09-01

    Full Text Available Abstract Background An increasing number of publications demonstrate conservation of function of cis-regulatory elements without sequence similarity. In invertebrates such functional conservation has only been shown for closely related species. Here we demonstrate the existence of an ancient arthropod regulatory element that functions during the selection of neural precursors. The activity of genes of the achaete-scute (ac-sc family endows cells with neural potential. An essential, conserved characteristic of proneural genes is their ability to restrict their own activity to single or a small number of progenitor cells from their initially broad domains of expression. This is achieved through a process called lateral inhibition. A regulatory element, the sensory organ precursor enhancer (SOPE, is required for this process. First identified in Drosophila, the SOPE contains discrete binding sites for four regulatory factors. The SOPE of the Drosophila asense gene is situated in the 5' UTR. Results Through a manual comparison of consensus binding site sequences we have been able to identify a SOPE in UTR sequences of asense-like genes in species belonging to all four arthropod groups (Crustacea, Myriapoda, Chelicerata and Insecta. The SOPEs of the spider Cupiennius salei and the insect Tribolium castaneum are shown to be functional in transgenic Drosophila. This would place the origin of this regulatory sequence as far back as the last common ancestor of the Arthropoda, that is, in the Cambrian, 550 million years ago. Conclusions The SOPE is not detectable by inter-specific sequence comparison, raising the possibility that other ancient regulatory modules in invertebrates might have escaped detection.

  2. Identification and Characterization of a cis-Regulatory Element for Zygotic Gene Expression in Chlamydomonas reinhardtii.

    Science.gov (United States)

    Hamaji, Takashi; Lopez, David; Pellegrini, Matteo; Umen, James

    2016-01-01

    Upon fertilization Chlamydomonas reinhardtii zygotes undergo a program of differentiation into a diploid zygospore that is accompanied by transcription of hundreds of zygote-specific genes. We identified a distinct sequence motif we term a zygotic response element (ZYRE) that is highly enriched in promoter regions of C reinhardtii early zygotic genes. A luciferase reporter assay was used to show that native ZYRE motifs within the promoter of zygotic gene ZYS3 or intron of zygotic gene DMT4 are necessary for zygotic induction. A synthetic luciferase reporter with a minimal promoter was used to show that ZYRE motifs introduced upstream are sufficient to confer zygotic upregulation, and that ZYRE-controlled zygotic transcription is dependent on the homeodomain transcription factor GSP1. We predict that ZYRE motifs will correspond to binding sites for the homeodomain proteins GSP1-GSM1 that heterodimerize and activate zygotic gene expression in early zygotes. PMID:27172209

  3. FootprintDB: Analysis of Plant Cis-Regulatory Elements, Transcription Factors, and Binding Interfaces.

    Science.gov (United States)

    Contreras-Moreira, Bruno; Sebastian, Alvaro

    2016-01-01

    FootprintDB is a database and search engine that compiles regulatory sequences from open access libraries of curated DNA cis-elements and motifs, and their associated transcription factors (TFs). It systematically annotates the binding interfaces of the TFs by exploiting protein-DNA complexes deposited in the Protein Data Bank. Each entry in footprintDB is thus a DNA motif linked to the protein sequence of the TF(s) known to recognize it, and in most cases, the set of predicted interface residues involved in specific recognition. This chapter explains step-by-step how to search for DNA motifs and protein sequences in footprintDB and how to focus the search to a particular organism. Two real-world examples are shown where this software was used to analyze transcriptional regulation in plants. Results are described with the aim of guiding users on their interpretation, and special attention is given to the choices users might face when performing similar analyses. PMID:27557773

  4. RAR/RXR binding dynamics distinguish pluripotency from differentiation associated cis-regulatory elements.

    Science.gov (United States)

    Chatagnon, Amandine; Veber, Philippe; Morin, Valérie; Bedo, Justin; Triqueneaux, Gérard; Sémon, Marie; Laudet, Vincent; d'Alché-Buc, Florence; Benoit, Gérard

    2015-05-26

    In mouse embryonic cells, ligand-activated retinoic acid receptors (RARs) play a key role in inhibiting pluripotency-maintaining genes and activating some major actors of cell differentiation. To investigate the mechanism underlying this dual regulation, we performed joint RAR/RXR ChIP-seq and mRNA-seq time series during the first 48 h of the RA-induced Primitive Endoderm (PrE) differentiation process in F9 embryonal carcinoma (EC) cells. We show here that this dual regulation is associated with RAR/RXR genomic redistribution during the differentiation process. In-depth analysis of RAR/RXR binding sites occupancy dynamics and composition show that in undifferentiated cells, RAR/RXR interact with genomic regions characterized by binding of pluripotency-associated factors and high prevalence of the non-canonical DR0-containing RA response element. By contrast, in differentiated cells, RAR/RXR bound regions are enriched in functional Sox17 binding sites and are characterized with a higher frequency of the canonical DR5 motif. Our data offer an unprecedentedly detailed view on the action of RA in triggering pluripotent cell differentiation and demonstrate that RAR/RXR action is mediated via two different sets of regulatory regions tightly associated with cell differentiation status. PMID:25897113

  5. Evaluation of phylogenetic footprint discovery for predicting bacterial cis-regulatory elements and revealing their evolution

    Directory of Open Access Journals (Sweden)

    van Helden Jacques

    2008-01-01

    Full Text Available Abstract Background The detection of conserved motifs in promoters of orthologous genes (phylogenetic footprints has become a common strategy to predict cis-acting regulatory elements. Several software tools are routinely used to raise hypotheses about regulation. However, these tools are generally used as black boxes, with default parameters. A systematic evaluation of optimal parameters for a footprint discovery strategy can bring a sizeable improvement to the predictions. Results We evaluate the performances of a footprint discovery approach based on the detection of over-represented spaced motifs. This method is particularly suitable for (but not restricted to Bacteria, since such motifs are typically bound by factors containing a Helix-Turn-Helix domain. We evaluated footprint discovery in 368 Escherichia coli K12 genes with annotated sites, under 40 different combinations of parameters (taxonomical level, background model, organism-specific filtering, operon inference. Motifs are assessed both at the levels of correctness and significance. We further report a detailed analysis of 181 bacterial orthologs of the LexA repressor. Distinct motifs are detected at various taxonomical levels, including the 7 previously characterized taxon-specific motifs. In addition, we highlight a significantly stronger conservation of half-motifs in Actinobacteria, relative to Firmicutes, suggesting an intermediate state in specificity switching between the two Gram-positive phyla, and thereby revealing the on-going evolution of LexA auto-regulation. Conclusion The footprint discovery method proposed here shows excellent results with E. coli and can readily be extended to predict cis-acting regulatory signals and propose testable hypotheses in bacterial genomes for which nothing is known about regulation.

  6. Nutritional control of gene expression in Drosophila larvae via TOR, Myc and a novel cis-regulatory element

    Directory of Open Access Journals (Sweden)

    Grewal Savraj S

    2010-01-01

    Full Text Available Abstract Background Nutrient availability is a key determinant of eukaryotic cell growth. In unicellular organisms many signaling and transcriptional networks link nutrient availability to the expression of metabolic genes required for growth. However, less is known about the corresponding mechanisms that operate in metazoans. We used gene expression profiling to explore this issue in developing Drosophila larvae. Results We found that starvation for dietary amino acids (AA's leads to dynamic changes in transcript levels of many metabolic genes. The conserved insulin/PI3K and TOR signaling pathways mediate nutrition-dependent growth in Drosophila and other animals. We found that many AA starvation-responsive transcripts were also altered in TOR mutants. In contrast, although PI3K overexpression induced robust changes in the expression of many metabolic genes, these changes showed limited overlap with the AA starvation expression profile. We did however identify a strong overlap between genes regulated by the transcription factor, Myc, and AA starvation-responsive genes, particularly those involved in ribosome biogenesis, protein synthesis and mitochondrial function. The consensus Myc DNA binding site is enriched in promoters of these AA starvation genes, and we found that Myc overexpression could bypass dietary AA to induce expression of these genes. We also identified another sequence motif (Motif 1 enriched in the promoters of AA starvation-responsive genes. We showed that Motif 1 was both necessary and sufficient to mediate transcriptional responses to dietary AA in larvae. Conclusions Our data suggest that many of the transcriptional effects of amino acids are mediated via signaling through the TOR pathway in Drosophila larvae. We also find that these transcriptional effects are mediated through at least two mechanisms: via the transcription factor Myc, and via the Motif 1 cis-regulatory element. These studies begin to elucidate a nutrient

  7. Decoding a signature-based model of transcription cofactor recruitment dictated by cardinal cis-regulatory elements in proximal promoter regions.

    Directory of Open Access Journals (Sweden)

    Christopher Benner

    2013-11-01

    Full Text Available Genome-wide maps of DNase I hypersensitive sites (DHSs reveal that most human promoters contain perpetually active cis-regulatory elements between -150 bp and +50 bp (-150/+50 bp relative to the transcription start site (TSS. Transcription factors (TFs recruit cofactors (chromatin remodelers, histone/protein-modifying enzymes, and scaffold proteins to these elements in order to organize the local chromatin structure and coordinate the balance of post-translational modifications nearby, contributing to the overall regulation of transcription. However, the rules of TF-mediated cofactor recruitment to the -150/+50 bp promoter regions remain poorly understood. Here, we provide evidence for a general model in which a series of cis-regulatory elements (here termed 'cardinal' motifs prefer acting individually, rather than in fixed combinations, within the -150/+50 bp regions to recruit TFs that dictate cofactor signatures distinctive of specific promoter subsets. Subsequently, human promoters can be subclassified based on the presence of cardinal elements and their associated cofactor signatures. In this study, furthermore, we have focused on promoters containing the nuclear respiratory factor 1 (NRF1 motif as the cardinal cis-regulatory element and have identified the pervasive association of NRF1 with the cofactor lysine-specific demethylase 1 (LSD1/KDM1A. This signature might be distinctive of promoters regulating nuclear-encoded mitochondrial and other particular genes in at least some cells. Together, we propose that decoding a signature-based, expanded model of control at proximal promoter regions should lead to a better understanding of coordinated regulation of gene transcription.

  8. Integrative modeling of eQTLs and cis-regulatory elements suggests mechanisms underlying cell type specificity of eQTLs.

    Directory of Open Access Journals (Sweden)

    Christopher D Brown

    Full Text Available Genetic variants in cis-regulatory elements or trans-acting regulators frequently influence the quantity and spatiotemporal distribution of gene transcription. Recent interest in expression quantitative trait locus (eQTL mapping has paralleled the adoption of genome-wide association studies (GWAS for the analysis of complex traits and disease in humans. Under the hypothesis that many GWAS associations tag non-coding SNPs with small effects, and that these SNPs exert phenotypic control by modifying gene expression, it has become common to interpret GWAS associations using eQTL data. To fully exploit the mechanistic interpretability of eQTL-GWAS comparisons, an improved understanding of the genetic architecture and causal mechanisms of cell type specificity of eQTLs is required. We address this need by performing an eQTL analysis in three parts: first we identified eQTLs from eleven studies on seven cell types; then we integrated eQTL data with cis-regulatory element (CRE data from the ENCODE project; finally we built a set of classifiers to predict the cell type specificity of eQTLs. The cell type specificity of eQTLs is associated with eQTL SNP overlap with hundreds of cell type specific CRE classes, including enhancer, promoter, and repressive chromatin marks, regions of open chromatin, and many classes of DNA binding proteins. These associations provide insight into the molecular mechanisms generating the cell type specificity of eQTLs and the mode of regulation of corresponding eQTLs. Using a random forest classifier with cell specific CRE-SNP overlap as features, we demonstrate the feasibility of predicting the cell type specificity of eQTLs. We then demonstrate that CREs from a trait-associated cell type can be used to annotate GWAS associations in the absence of eQTL data for that cell type. We anticipate that such integrative, predictive modeling of cell specificity will improve our ability to understand the mechanistic basis of human

  9. The contribution of cis-regulatory elements to head-to-head gene pairs’ co-expression pattern

    Institute of Scientific and Technical Information of China (English)

    2009-01-01

    Transcription regulation is one of the most critical pipelines in biological process,in which cis-elements play the role as gene expression regulators.We attempt to deduce the principles underlying the co-expression of "head-to-head" gene pairs by analyzing activities or behaviors of the shared cis-elements.A network component analysis was performed to estimate the impact of cis-elements on gene promoters and their activities under different conditions.Our discoveries reveal how biological system uses those regulatory elements to control the expression pattern of "head-to-head" gene pairs and the whole transcription regulation system.

  10. Cis-regulatory element-based genome-wide identification of DREB1/CBF targets in Arabidopsis

    Institute of Scientific and Technical Information of China (English)

    Huan Zhao; Weizhong Liu; Yong Hu; Xianglin Liu; Yikun He

    2008-01-01

    Microarray analysis is used to identify transcriptional targets.However,the direct targets of transcription factors cannot be distin guished from indirect ones;further,genes with low-expression levels cannot be identified by this method.In the present study,we exploi the cis-element dehydration-responsive element(DRE)that is known to be responsible for the transcription of DRE binding factor](DREB1)targets in the promoter region of all Arabidopsis genes.Putative targets whose promoters contain the elements were verified by both microarray and reverse transcription-polymerase chain reaction(RT-PCR)analysis.Five new DREB 1/CBF direct targets were identified.Compared with traditional microarray analysis,our method is convenient and cost-effective for identifying the downstream targets of transcription factors.

  11. Distinct cis regulatory elements govern the expression of TAG1 in embryonic sensory ganglia and spinal cord.

    Science.gov (United States)

    Hadas, Yoav; Nitzan, Noa; Furley, Andrew J W; Kozlov, Serguei V; Klar, Avihu

    2013-01-01

    Cell fate commitment of spinal progenitor neurons is initiated by long-range, midline-derived, morphogens that regulate an array of transcription factors that, in turn, act sequentially or in parallel to control neuronal differentiation. Included among these are transcription factors that regulate the expression of receptors for guidance cues, thereby determining axonal trajectories. The Ig/FNIII superfamily molecules TAG1/Axonin1/CNTN2 (TAG1) and Neurofascin (Nfasc) are co-expressed in numerous neuronal cell types in the CNS and PNS - for example motor, DRG and interneurons - both promote neurite outgrowth and both are required for the architecture and function of nodes of Ranvier. The genes encoding TAG1 and Nfasc are adjacent in the genome, an arrangement which is evolutionarily conserved. To study the transcriptional network that governs TAG1 and Nfasc expression in spinal motor and commissural neurons, we set out to identify cis elements that regulate their expression. Two evolutionarily conserved DNA modules, one located between the Nfasc and TAG1 genes and the second directly 5' to the first exon and encompassing the first intron of TAG1, were identified that direct complementary expression to the CNS and PNS, respectively, of the embryonic hindbrain and spinal cord. Sequential deletions and point mutations of the CNS enhancer element revealed a 130bp element containing three conserved E-boxes required for motor neuron expression. In combination, these two elements appear to recapitulate a major part of the pattern of TAG1 expression in the embryonic nervous system.

  12. Distinct cis regulatory elements govern the expression of TAG1 in embryonic sensory ganglia and spinal cord.

    Directory of Open Access Journals (Sweden)

    Yoav Hadas

    Full Text Available Cell fate commitment of spinal progenitor neurons is initiated by long-range, midline-derived, morphogens that regulate an array of transcription factors that, in turn, act sequentially or in parallel to control neuronal differentiation. Included among these are transcription factors that regulate the expression of receptors for guidance cues, thereby determining axonal trajectories. The Ig/FNIII superfamily molecules TAG1/Axonin1/CNTN2 (TAG1 and Neurofascin (Nfasc are co-expressed in numerous neuronal cell types in the CNS and PNS - for example motor, DRG and interneurons - both promote neurite outgrowth and both are required for the architecture and function of nodes of Ranvier. The genes encoding TAG1 and Nfasc are adjacent in the genome, an arrangement which is evolutionarily conserved. To study the transcriptional network that governs TAG1 and Nfasc expression in spinal motor and commissural neurons, we set out to identify cis elements that regulate their expression. Two evolutionarily conserved DNA modules, one located between the Nfasc and TAG1 genes and the second directly 5' to the first exon and encompassing the first intron of TAG1, were identified that direct complementary expression to the CNS and PNS, respectively, of the embryonic hindbrain and spinal cord. Sequential deletions and point mutations of the CNS enhancer element revealed a 130bp element containing three conserved E-boxes required for motor neuron expression. In combination, these two elements appear to recapitulate a major part of the pattern of TAG1 expression in the embryonic nervous system.

  13. PlantPAN: Plant promoter analysis navigator, for identifying combinatorial cis-regulatory elements with distance constraint in plant gene groups

    Directory of Open Access Journals (Sweden)

    Huang Hsien-Da

    2008-11-01

    Full Text Available Abstract Background The elucidation of transcriptional regulation in plant genes is important area of research for plant scientists, following the mapping of various plant genomes, such as A. thaliana, O. sativa and Z. mays. A variety of bioinformatic servers or databases of plant promoters have been established, although most have been focused only on annotating transcription factor binding sites in a single gene and have neglected some important regulatory elements (tandem repeats and CpG/CpNpG islands in promoter regions. Additionally, the combinatorial interaction of transcription factors (TFs is important in regulating the gene group that is associated with the same expression pattern. Therefore, a tool for detecting the co-regulation of transcription factors in a group of gene promoters is required. Results This study develops a database-assisted system, PlantPAN (Plant Promoter Analysis Navigator, for recognizing combinatorial cis-regulatory elements with a distance constraint in sets of plant genes. The system collects the plant transcription factor binding profiles from PLACE, TRANSFAC (public release 7.0, AGRIS, and JASPER databases and allows users to input a group of gene IDs or promoter sequences, enabling the co-occurrence of combinatorial transcription factor binding sites (TFBSs within a defined distance (20 bp to 200 bp to be identified. Furthermore, the new resource enables other regulatory features in a plant promoter, such as CpG/CpNpG islands and tandem repeats, to be displayed. The regulatory elements in the conserved regions of the promoters across homologous genes are detected and presented. Conclusion In addition to providing a user-friendly input/output interface, PlantPAN has numerous advantages in the analysis of a plant promoter. Several case studies have established the effectiveness of PlantPAN. This novel analytical resource is now freely available at http://PlantPAN.mbc.nctu.edu.tw.

  14. Properties of non-coding DNA and identification of putative cis-regulatory elements in Theileria parva

    Directory of Open Access Journals (Sweden)

    Guo Xiang

    2008-12-01

    Full Text Available Abstract Background Parasites in the genus Theileria cause lymphoproliferative diseases in cattle, resulting in enormous socio-economic losses. The availability of the genome sequences and annotation for T. parva and T. annulata has facilitated the study of parasite biology and their relationship with host cell transformation and tropism. However, the mechanism of transcriptional regulation in this genus, which may be key to understanding fundamental aspects of its parasitology, remains poorly understood. In this study, we analyze the evolution of non-coding sequences in the Theileria genome and identify conserved sequence elements that may be involved in gene regulation of these parasitic species. Results Intergenic regions and introns in Theileria are short, and their length distributions are considerably right-skewed. Intergenic regions flanked by genes in 5'-5' orientation tend to be longer and slightly more AT-rich than those flanked by two stop codons; intergenic regions flanked by genes in 3'-5' orientation have intermediate values of length and AT composition. Intron position is negatively correlated with intron length, and positively correlated with GC content. Using stringent criteria, we identified a set of high-quality orthologous non-coding sequences between T. parva and T. annulata, and determined the distribution of selective constraints across regions, which are shown to be higher close to translation start sites. A positive correlation between constraint and length in both intergenic regions and introns suggests a tight control over length expansion of non-coding regions. Genome-wide searches for functional elements revealed several conserved motifs in intergenic regions of Theileria genomes. Two such motifs are preferentially located within the first 60 base pairs upstream of transcription start sites in T. parva, are preferentially associated with specific protein functional categories, and have significant similarity to know

  15. Identification of Predictive Cis-Regulatory Elements Using a Discriminative Objective Function and a Dynamic Search Space.

    Directory of Open Access Journals (Sweden)

    Rahul Karnik

    Full Text Available The generation of genomic binding or accessibility data from massively parallel sequencing technologies such as ChIP-seq and DNase-seq continues to accelerate. Yet state-of-the-art computational approaches for the identification of DNA binding motifs often yield motifs of weak predictive power. Here we present a novel computational algorithm called MotifSpec, designed to find predictive motifs, in contrast to over-represented sequence elements. The key distinguishing feature of this algorithm is that it uses a dynamic search space and a learned threshold to find discriminative motifs in combination with the modeling of motifs using a full PWM (position weight matrix rather than k-mer words or regular expressions. We demonstrate that our approach finds motifs corresponding to known binding specificities in several mammalian ChIP-seq datasets, and that our PWMs classify the ChIP-seq signals with accuracy comparable to, or marginally better than motifs from the best existing algorithms. In other datasets, our algorithm identifies novel motifs where other methods fail. Finally, we apply this algorithm to detect motifs from expression datasets in C. elegans using a dynamic expression similarity metric rather than fixed expression clusters, and find novel predictive motifs.

  16. Tissue-specific expression of the human alpha 1-antitrypsin gene is controlled by multiple cis-regulatory elements.

    Science.gov (United States)

    Shen, R F; Li, Y; Sifers, R N; Wang, H; Hardick, C; Tsai, S Y; Woo, S L

    1987-10-26

    Human alpha 1-antitrypsin (AAT) is expressed in the liver, and a 318 bp fragment immediately flanking the CAP site of the gene was found to be sufficient to drive the expression of a reporter gene (CAT) specifically in hepatoma cells. The enhancing activity however, was orientation-dependent. The DNA fragment was separated into a distal region and a proximal region. A "core enhancer" sequence GTGGTTTC is present within the distal region and is capable of activity enhancement in both orientations when complemented by the proximal region in the sense orientation. The results strongly suggest that there are multiple cis-acting elements in the human AAT gene that confer cell specificity for its expression. Nuclear proteins prepared from the hepatoma cells bound specifically to the proximal region in a band-shifting assay that was resistant to competition by the globin promoter DNA. Foot-printing analysis showed a protected domain within the proximal region that contains a nearly perfect palindromic sequence TGGTTAATATTCACCA, which may be important in the regulation of AAT expression in the liver. PMID:2823229

  17. Identification of Predictive Cis-Regulatory Elements Using a Discriminative Objective Function and a Dynamic Search Space.

    Science.gov (United States)

    Karnik, Rahul; Beer, Michael A

    2015-01-01

    The generation of genomic binding or accessibility data from massively parallel sequencing technologies such as ChIP-seq and DNase-seq continues to accelerate. Yet state-of-the-art computational approaches for the identification of DNA binding motifs often yield motifs of weak predictive power. Here we present a novel computational algorithm called MotifSpec, designed to find predictive motifs, in contrast to over-represented sequence elements. The key distinguishing feature of this algorithm is that it uses a dynamic search space and a learned threshold to find discriminative motifs in combination with the modeling of motifs using a full PWM (position weight matrix) rather than k-mer words or regular expressions. We demonstrate that our approach finds motifs corresponding to known binding specificities in several mammalian ChIP-seq datasets, and that our PWMs classify the ChIP-seq signals with accuracy comparable to, or marginally better than motifs from the best existing algorithms. In other datasets, our algorithm identifies novel motifs where other methods fail. Finally, we apply this algorithm to detect motifs from expression datasets in C. elegans using a dynamic expression similarity metric rather than fixed expression clusters, and find novel predictive motifs.

  18. Cis-Regulatory Elements Determine Germline Specificity and Expression Level of an Isopentenyltransferase Gene in Sperm Cells of Arabidopsis.

    Science.gov (United States)

    Zhang, Jinghua; Yuan, Tong; Duan, Xiaomeng; Wei, Xiaoping; Shi, Tao; Li, Jia; Russell, Scott D; Gou, Xiaoping

    2016-03-01

    Flowering plant sperm cells transcribe a divergent and complex complement of genes. To examine promoter function, we chose an isopentenyltransferase gene known as PzIPT1. This gene is highly selectively transcribed in one sperm cell morphotype of Plumbago zeylanica, which preferentially fuses with the central cell during fertilization and is thus a founding cell of the primary endosperm. In transgenic Arabidopsis (Arabidopsis thaliana), PzIPT1 promoter displays activity in both sperm cells and upon progressive promoter truncation from the 5'-end results in a progressive decrease in reporter production, consistent with occurrence of multiple enhancer sites. Cytokinin-dependent protein binding motifs are identified in the promoter sequence, which respond with stimulation by cytokinin. Expression of PzIPT1 promoter in sperm cells confers specificity independently of previously reported Germline Restrictive Silencer Factor binding sequence. Instead, a cis-acting regulatory region consisting of two duplicated 6-bp Male Gamete Selective Activation (MGSA) motifs occurs near the site of transcription initiation. Disruption of this sequence-specific site inactivates expression of a GFP reporter gene in sperm cells. Multiple copies of the MGSA motif fused with the minimal CaMV35S promoter elements confer reporter gene expression in sperm cells. Similar duplicated MGSA motifs are also identified from promoter sequences of sperm cell-expressed genes in Arabidopsis, suggesting selective activation is possibly a common mechanism for regulation of gene expression in sperm cells of flowering plants. PMID:26739233

  19. Deletion hotspots in AMACR promoter CpG island are cis-regulatory elements controlling the gene expression in the colon.

    Directory of Open Access Journals (Sweden)

    Xiang Zhang

    2009-01-01

    Full Text Available Alpha-methylacyl-coenzyme A racemase (AMACR regulates peroxisomal beta-oxidation of phytol-derived, branched-chain fatty acids from red meat and dairy products -- suspected risk factors for colon carcinoma (CCa. AMACR was first found overexpressed in prostate cancer but not in benign glands and is now an established diagnostic marker for prostate cancer. Aberrant expression of AMACR was recently reported in Cca; however, little is known about how this gene is abnormally activated in cancer. By using a panel of immunostained-laser-capture-microdissected clinical samples comprising the entire colon adenoma-carcinoma sequence, we show that deregulation of AMACR during colon carcinogenesis involves two nonrandom events, resulting in the mutually exclusive existence of double-deletion at CG3 and CG10 and deletion of CG12-16 in a newly identified CpG island within the core promoter of AMACR. The double-deletion at CG3 and CG10 was found to be a somatic lesion. It existed in histologically normal colonic glands and tubular adenomas with low AMACR expression and was absent in villous adenomas and all CCas expressing variable levels of AMACR. In contrast, deletion of CG12-16 was shown to be a constitutional allele with a frequency of 43% in a general population. Its prevalence reached 89% in moderately differentiated CCas strongly expressing AMACR but only existed at 14% in poorly differentiated CCas expressing little or no AMACR. The DNA sequences housing these deletions were found to be putative cis-regulatory elements for Sp1 at CG3 and CG10, and ZNF202 at CG12-16. Chromatin immunoprecipitation, siRNA knockdown, gel shift assay, ectopic expression, and promoter analyses supported the regulation by Sp1 and ZNF202 of AMACR gene expression in an opposite manner. Our findings identified key in vivo events and novel transcription factors responsible for AMACR regulation in CCas and suggested these AMACR deletions may have diagnostic/prognostic value for

  20. The role of cis regulatory evolution in maize domestication.

    Science.gov (United States)

    Lemmon, Zachary H; Bukowski, Robert; Sun, Qi; Doebley, John F

    2014-11-01

    Gene expression differences between divergent lineages caused by modification of cis regulatory elements are thought to be important in evolution. We assayed genome-wide cis and trans regulatory differences between maize and its wild progenitor, teosinte, using deep RNA sequencing in F1 hybrid and parent inbred lines for three tissue types (ear, leaf and stem). Pervasive regulatory variation was observed with approximately 70% of ∼17,000 genes showing evidence of regulatory divergence between maize and teosinte. However, many fewer genes (1,079 genes) show consistent cis differences with all sampled maize and teosinte lines. For ∼70% of these 1,079 genes, the cis differences are specific to a single tissue. The number of genes with cis regulatory differences is greatest for ear tissue, which underwent a drastic transformation in form during domestication. As expected from the domestication bottleneck, maize possesses less cis regulatory variation than teosinte with this deficit greatest for genes showing maize-teosinte cis regulatory divergence, suggesting selection on cis regulatory differences during domestication. Consistent with selection on cis regulatory elements, genes with cis effects correlated strongly with genes under positive selection during maize domestication and improvement, while genes with trans regulatory effects did not. We observed a directional bias such that genes with cis differences showed higher expression of the maize allele more often than the teosinte allele, suggesting domestication favored up-regulation of gene expression. Finally, this work documents the cis and trans regulatory changes between maize and teosinte in over 17,000 genes for three tissues.

  1. The role of cis regulatory evolution in maize domestication.

    Directory of Open Access Journals (Sweden)

    Zachary H Lemmon

    2014-11-01

    Full Text Available Gene expression differences between divergent lineages caused by modification of cis regulatory elements are thought to be important in evolution. We assayed genome-wide cis and trans regulatory differences between maize and its wild progenitor, teosinte, using deep RNA sequencing in F1 hybrid and parent inbred lines for three tissue types (ear, leaf and stem. Pervasive regulatory variation was observed with approximately 70% of ∼17,000 genes showing evidence of regulatory divergence between maize and teosinte. However, many fewer genes (1,079 genes show consistent cis differences with all sampled maize and teosinte lines. For ∼70% of these 1,079 genes, the cis differences are specific to a single tissue. The number of genes with cis regulatory differences is greatest for ear tissue, which underwent a drastic transformation in form during domestication. As expected from the domestication bottleneck, maize possesses less cis regulatory variation than teosinte with this deficit greatest for genes showing maize-teosinte cis regulatory divergence, suggesting selection on cis regulatory differences during domestication. Consistent with selection on cis regulatory elements, genes with cis effects correlated strongly with genes under positive selection during maize domestication and improvement, while genes with trans regulatory effects did not. We observed a directional bias such that genes with cis differences showed higher expression of the maize allele more often than the teosinte allele, suggesting domestication favored up-regulation of gene expression. Finally, this work documents the cis and trans regulatory changes between maize and teosinte in over 17,000 genes for three tissues.

  2. The Role of cis Regulatory Evolution in Maize Domestication

    Science.gov (United States)

    Lemmon, Zachary H.; Bukowski, Robert; Sun, Qi; Doebley, John F.

    2014-01-01

    Gene expression differences between divergent lineages caused by modification of cis regulatory elements are thought to be important in evolution. We assayed genome-wide cis and trans regulatory differences between maize and its wild progenitor, teosinte, using deep RNA sequencing in F1 hybrid and parent inbred lines for three tissue types (ear, leaf and stem). Pervasive regulatory variation was observed with approximately 70% of ∼17,000 genes showing evidence of regulatory divergence between maize and teosinte. However, many fewer genes (1,079 genes) show consistent cis differences with all sampled maize and teosinte lines. For ∼70% of these 1,079 genes, the cis differences are specific to a single tissue. The number of genes with cis regulatory differences is greatest for ear tissue, which underwent a drastic transformation in form during domestication. As expected from the domestication bottleneck, maize possesses less cis regulatory variation than teosinte with this deficit greatest for genes showing maize-teosinte cis regulatory divergence, suggesting selection on cis regulatory differences during domestication. Consistent with selection on cis regulatory elements, genes with cis effects correlated strongly with genes under positive selection during maize domestication and improvement, while genes with trans regulatory effects did not. We observed a directional bias such that genes with cis differences showed higher expression of the maize allele more often than the teosinte allele, suggesting domestication favored up-regulation of gene expression. Finally, this work documents the cis and trans regulatory changes between maize and teosinte in over 17,000 genes for three tissues. PMID:25375861

  3. Combining computational prediction of cis-regulatory elements with a new enhancer assay to efficiently label neuronal structures in the medaka fish.

    Directory of Open Access Journals (Sweden)

    Emmanuel Mongin

    Full Text Available The developing vertebrate nervous system contains a remarkable array of neural cells organized into complex, evolutionarily conserved structures. The labeling of living cells in these structures is key for the understanding of brain development and function, yet the generation of stable lines expressing reporter genes in specific spatio-temporal patterns remains a limiting step. In this study we present a fast and reliable pipeline to efficiently generate a set of stable lines expressing a reporter gene in multiple neuronal structures in the developing nervous system in medaka. The pipeline combines both the accurate computational genome-wide prediction of neuronal specific cis-regulatory modules (CRMs and a newly developed experimental setup to rapidly obtain transgenic lines in a cost-effective and highly reproducible manner. 95% of the CRMs tested in our experimental setup show enhancer activity in various and numerous neuronal structures belonging to all major brain subdivisions. This pipeline represents a significant step towards the dissection of embryonic neuronal development in vertebrates.

  4. A universal algorithm for genome-wide in silicio identification of biologically significant gene promoter putative cis-regulatory-elements; identification of new elements for reactive oxygen species and sucrose signaling in Arabidopsis.

    Science.gov (United States)

    Geisler, Matt; Kleczkowski, Leszek A; Karpinski, Stanislaw

    2006-02-01

    Short motifs of many cis-regulatory elements (CREs) can be found in the promoters of most Arabidopsis genes, and this raises the question of how their presence can confer specific regulation. We developed a universal algorithm to test the biological significance of CREs by first identifying every Arabidopsis gene with a CRE and then statistically correlating the presence or absence of the element with the gene expression profile on multiple DNA microarrays. This algorithm was successfully verified for previously characterized abscisic acid, ethylene, sucrose and drought responsive CREs in Arabidopsis, showing that the presence of these elements indeed correlates with treatment-specific gene induction. Later, we used standard motif sampling methods to identify 128 putative motifs induced by excess light, reactive oxygen species and sucrose. Our algorithm was able to filter 20 out of 128 novel CREs which significantly correlated with gene induction by either heat, reactive oxygen species and/or sucrose. The position, orientation and sequence specificity of CREs was tested in silicio by analyzing the expression of genes with naturally occurring sequence variations. In three novel CREs the forward orientation correlated with sucrose induction and the reverse orientation with sucrose suppression. The functionality of the predicted novel CREs was experimentally confirmed using Arabidopsis cell-suspension cultures transformed with short promoter fragments or artificial promoters fused with the GUS reporter gene. Our genome-wide analysis opens up new possibilities for in silicio verification of the biological significance of newly discovered CREs, and allows for subsequent selection of such CREs for experimental studies.

  5. Favorable genomic environments for cis-regulatory evolution: A novel theoretical framework.

    Science.gov (United States)

    Maeso, Ignacio; Tena, Juan J

    2016-09-01

    Cis-regulatory changes are arguably the primary evolutionary source of animal morphological diversity. With the recent explosion of genome-wide comparisons of the cis-regulatory content in different animal species is now possible to infer general principles underlying enhancer evolution. However, these studies have also revealed numerous discrepancies and paradoxes, suggesting that the mechanistic causes and modes of cis-regulatory evolution are still not well understood and are probably much more complex than generally appreciated. Here, we argue that the mutational mechanisms and genomic regions generating new regulatory activities must comply with the constraints imposed by the molecular properties of cis-regulatory elements (CREs) and the organizational features of long-range chromatin interactions. Accordingly, we propose a new integrative evolutionary framework for cis-regulatory evolution based on two major premises for the origin of novel enhancer activity: (i) an accessible chromatin environment and (ii) compatibility with the 3D structure and interactions of pre-existing CREs. Mechanisms and DNA sequences not fulfilling these premises, will be less likely to have a measurable impact on gene expression and as such, will have a minor contribution to the evolution of gene regulation. Finally, we discuss current comparative cis-regulatory data under the light of this new evolutionary model, and propose that the two most prominent mechanisms for the evolution of cis-regulatory changes are the overprinting of ancestral CREs and the exaptation of transposable elements.

  6. CREME: Cis-Regulatory Module Explorer for the Human Genome

    Energy Technology Data Exchange (ETDEWEB)

    Loots, G G; Sharan, R; Ovcharenko, I; Ben-Hur, A

    2004-02-11

    The binding of transcription factors to specific regulatory sequence elements is a primary mechanism for controlling gene transcription. Eukaryotic genes are often regulated by several transcription factors, whose binding sites are tightly clustered and form cis-regulatory modules. In this paper we present a web-server, CREME, for identifying and visualizing cis-regulatory modules in the promoter regions of a given set of potentially co-regulated genes. CREME relies on a database of putative transcription factor binding sites that have been annotated across the human genome using a library of position weight matrices and evolutionary conservation with the mouse and rat genomes. A search algorithm is applied to this dataset to identify combinations of transcription factors whose binding sites tend to co-occur in close proximity in the promoter regions of the input gene set. The identified cis-regulatory modules are statistically scored and significant combinations are reported and graphically visualized. Our web-server is available at http://creme.dcode.org/.

  7. Conserved cis-regulatory elements for DNA-binding-with-one-finger and homeo-domain-leucine-zipper transcription factors regulate companion cell-specific expression of the Arabidopsis thaliana SUCROSE TRANSPORTER 2 gene.

    Science.gov (United States)

    Schneidereit, Alexander; Imlau, Astrid; Sauer, Norbert

    2008-09-01

    The transition from young carbon-importing sink leaves of higher plants to mature carbon-exporting source leaves is paralleled by a complete reversal of phloem function. While sink-leaf phloem mediates the influx of reduced carbon from older source leaves and the release of this imported carbon to the sink-leaf mesophyll, source-leaf phloem catalyzes the uptake of photoassimilates into companion cells (CCs) and sieve elements (SEs) and the net carbon export from the leaf. Phloem loading in source leaves with sucrose, the main or exclusive transport form for fixed carbon in most higher plants, is catalyzed by plasma membrane-localized sucrose transporters. Consistent with the described physiological switch from sink to source, the promoter of the Arabidopsis AtSUC2 gene is active only in source-leaf CCs of Arabidopsis or of transgenic tobacco (Nicotiana tabacum). For the identification of regulatory elements involved in this companion cell-specific and source-specific gene expression, we performed detailed analyses of the AtSUC2 promoter by truncation and mutagenesis. A 126-bp promoter fragment was identified, which seems to contain these fragments and which drives AtSUC2-typical expression when combined with a 35S minimal promoter. Within this fragment, linker-scanning analyses revealed two cis-regulatory elements that were further characterized as putative binding sites for transcription factors of the DNA-binding-with-one-finger or the homeo-domain-leucine-zipper families. Similar or identical binding sites are found in other genes and in different plant species, suggesting an ancient regulatory mechanism for this important physiological switch. PMID:18551303

  8. NAC transcription factor genes: genome-wide identification, phylogenetic, motif and cis-regulatory element analysis in pigeonpea (Cajanus cajan (L.) Millsp.).

    Science.gov (United States)

    Satheesh, Viswanathan; Jagannadham, P Tej Kumar; Chidambaranathan, Parameswaran; Jain, P K; Srinivasan, R

    2014-12-01

    The NAC (NAM, ATAF and CUC) proteins are plant-specific transcription factors implicated in development and stress responses. In the present study 88 pigeonpea NAC genes were identified from the recently published draft genome of pigeonpea by using homology based and de novo prediction programmes. These sequences were further subjected to phylogenetic, motif and promoter analyses. In motif analysis, highly conserved motifs were identified in the NAC domain and also in the C-terminal region of the NAC proteins. A phylogenetic reconstruction using pigeonpea, Arabidopsis and soybean NAC genes revealed 33 putative stress-responsive pigeonpea NAC genes. Several stress-responsive cis-elements were identified through in silico analysis of the promoters of these putative stress-responsive genes. This analysis is the first report of NAC gene family in pigeonpea and will be useful for the identification and selection of candidate genes associated with stress tolerance. PMID:25108674

  9. Abundant raw material for cis-regulatory evolution in humans

    Science.gov (United States)

    Rockman, Matthew V.; Wray, Gregory A.

    2002-01-01

    Changes in gene expression and regulation--due in particular to the evolution of cis-regulatory DNA sequences--may underlie many evolutionary changes in phenotypes, yet little is known about the distribution of such variation in populations. We present in this study the first survey of experimentally validated functional cis-regulatory polymorphism. These data are derived from more than 140 polymorphisms involved in the regulation of 107 genes in Homo sapiens, the eukaryote species with the most available data. We find that functional cis-regulatory variation is widespread in the human genome and that the consequent variation in gene expression is twofold or greater for 63% of the genes surveyed. Transcription factor-DNA interactions are highly polymorphic, and regulatory interactions have been gained and lost within human populations. On average, humans are heterozygous at more functional cis-regulatory sites (>16,000) than at amino acid positions (human phenotypic variation.

  10. Deciphering cis-regulatory control in inflammatory cells.

    Science.gov (United States)

    Ghisletti, Serena; Natoli, Gioacchino

    2013-01-01

    In innate immune system cells, such as macrophages and dendritic cells, deployment of inducible gene expression programmes in response to microbes and danger signals requires highly precise regulatory mechanisms. The inflammatory response has to be tailored based on both the triggering stimulus and its dose, and it has to be unfolded in a kinetically complex manner that suits the different phases of the inflammatory process. Genomic characterization of regulatory elements in this context indicated that transcriptional regulators involved in macrophage specification act as pioneer transcription factors (TFs) that generate regions of open chromatin that enable the recruitment of TFs activated in response to external inputs. Therefore, competence for responses to a specific stimulus is programmed at an early stage of differentiation by factors involved in lineage commitment and maintenance of cell identity, which are responsible for the organization of a cell-type-specific cis-regulatory repertoire. The basic functional and organizational principles that regulate inflammatory gene expression in professional cells of the innate immune system provide general paradigms on the interplay between differentiation and environmental responses. PMID:23650641

  11. Using hexamers to predict cis-regulatory motifs in Drosophila

    Directory of Open Access Journals (Sweden)

    Kibler Dennis

    2005-10-01

    Full Text Available Abstract Background Cis-regulatory modules (CRMs are short stretches of DNA that help regulate gene expression in higher eukaryotes. They have been found up to 1 megabase away from the genes they regulate and can be located upstream, downstream, and even within their target genes. Due to the difficulty of finding CRMs using biological and computational techniques, even well-studied regulatory systems may contain CRMs that have not yet been discovered. Results We present a simple, efficient method (HexDiff based only on hexamer frequencies of known CRMs and non-CRM sequence to predict novel CRMs in regulatory systems. On a data set of 16 gap and pair-rule genes containing 52 known CRMs, predictions made by HexDiff had a higher correlation with the known CRMs than several existing CRM prediction algorithms: Ahab, Cluster Buster, MSCAN, MCAST, and LWF. After combining the results of the different algorithms, 10 putative CRMs were identified and are strong candidates for future study. The hexamers used by HexDiff to distinguish between CRMs and non-CRM sequence were also analyzed and were shown to be enriched in regulatory elements. Conclusion HexDiff provides an efficient and effective means for finding new CRMs based on known CRMs, rather than known binding sites.

  12. ChIP-Seq-Annotated Heliconius erato Genome Highlights Patterns of cis-Regulatory Evolution in Lepidoptera.

    Science.gov (United States)

    Lewis, James J; van der Burg, Karin R L; Mazo-Vargas, Anyi; Reed, Robert D

    2016-09-13

    Uncovering phylogenetic patterns of cis-regulatory evolution remains a fundamental goal for evolutionary and developmental biology. Here, we characterize the evolution of regulatory loci in butterflies and moths using chromatin immunoprecipitation sequencing (ChIP-seq) annotation of regulatory elements across three stages of head development. In the process we provide a high-quality, functionally annotated genome assembly for the butterfly, Heliconius erato. Comparing cis-regulatory element conservation across six lepidopteran genomes, we find that regulatory sequences evolve at a pace similar to that of protein-coding regions. We also observe that elements active at multiple developmental stages are markedly more conserved than elements with stage-specific activity. Surprisingly, we also find that stage-specific proximal and distal regulatory elements evolve at nearly identical rates. Our study provides a benchmark for genome-wide patterns of regulatory element evolution in insects, and it shows that developmental timing of activity strongly predicts patterns of regulatory sequence evolution.

  13. cis-Regulatory control of the initial neurogenic pattern of onecut gene expression in the sea urchin embryo.

    Science.gov (United States)

    Barsi, Julius C; Davidson, Eric H

    2016-01-01

    Specification of the ciliated band (CB) of echinoid embryos executes three spatial functions essential for postgastrular organization. These are establishment of a band about 5 cells wide which delimits and bounds other embryonic territories; definition of a neurogenic domain within this band; and generation within it of arrays of ciliary cells that bear the special long cilia from which the structure derives its name. In Strongylocentrotus purpuratus the spatial coordinates of the future ciliated band are initially and exactly determined by the disposition of a ring of cells that transcriptionally activate the onecut homeodomain regulatory gene, beginning in blastula stage, long before the appearance of the CB per se. Thus the cis-regulatory apparatus that governs onecut expression in the blastula directly reveals the genomic sequence code by which these aspects of the spatial organization of the embryo are initially determined. We screened the entire onecut locus and its flanking region for transcriptionally active cis-regulatory elements, and by means of BAC recombineered deletions identified three separated and required cis-regulatory modules that execute different functions. The operating logic of the crucial spatial control module accounting for the spectacularly precise and beautiful early onecut expression domain depends on spatial repression. Previously predicted oral ectoderm and aboral ectoderm repressors were identified by cis-regulatory mutation as the products of goosecoid and irxa genes respectively, while the pan-ectodermal activator SoxB1 supplies a transcriptional driver function.

  14. A primer on regression methods for decoding cis-regulatory logic

    Energy Technology Data Exchange (ETDEWEB)

    Das, Debopriya; Pellegrini, Matteo; Gray, Joe W.

    2009-03-03

    The rapidly emerging field of systems biology is helping us to understand the molecular determinants of phenotype on a genomic scale [1]. Cis-regulatory elements are major sequence-based determinants of biological processes in cells and tissues [2]. For instance, during transcriptional regulation, transcription factors (TFs) bind to very specific regions on the promoter DNA [2,3] and recruit the basal transcriptional machinery, which ultimately initiates mRNA transcription (Figure 1A). Learning cis-Regulatory Elements from Omics Data A vast amount of work over the past decade has shown that omics data can be used to learn cis-regulatory logic on a genome-wide scale [4-6]--in particular, by integrating sequence data with mRNA expression profiles. The most popular approach has been to identify over-represented motifs in promoters of genes that are coexpressed [4,7,8]. Though widely used, such an approach can be limiting for a variety of reasons. First, the combinatorial nature of gene regulation is difficult to explicitly model in this framework. Moreover, in many applications of this approach, expression data from multiple conditions are necessary to obtain reliable predictions. This can potentially limit the use of this method to only large data sets [9]. Although these methods can be adapted to analyze mRNA expression data from a pair of biological conditions, such comparisons are often confounded by the fact that primary and secondary response genes are clustered together--whereas only the primary response genes are expected to contain the functional motifs [10]. A set of approaches based on regression has been developed to overcome the above limitations [11-32]. These approaches have their foundations in certain biophysical aspects of gene regulation [26,33-35]. That is, the models are motivated by the expected transcriptional response of genes due to the binding of TFs to their promoters. While such methods have gathered popularity in the computational domain

  15. SMCis: An Effective Algorithm for Discovery of Cis-Regulatory Modules

    Science.gov (United States)

    Guo, Haitao; Huo, Hongwei; Yu, Qiang

    2016-01-01

    The discovery of cis-regulatory modules (CRMs) is a challenging problem in computational biology. Limited by the difficulty of using an HMM to model dependent features in transcriptional regulatory sequences (TRSs), the probabilistic modeling methods based on HMMs cannot accurately represent the distance between regulatory elements in TRSs and are cumbersome to model the prevailing dependencies between motifs within CRMs. We propose a probabilistic modeling algorithm called SMCis, which builds a more powerful CRM discovery model based on a hidden semi-Markov model. Our model characterizes the regulatory structure of CRMs and effectively models dependencies between motifs at a higher level of abstraction based on segments rather than nucleotides. Experimental results on three benchmark datasets indicate that our method performs better than the compared algorithms. PMID:27637070

  16. Conservation and evolution of cis-regulatory systems in ascomycete fungi.

    Directory of Open Access Journals (Sweden)

    Audrey P Gasch

    2004-12-01

    Full Text Available Relatively little is known about the mechanisms through which gene expression regulation evolves. To investigate this, we systematically explored the conservation of regulatory networks in fungi by examining the cis-regulatory elements that govern the expression of coregulated genes. We first identified groups of coregulated Saccharomyces cerevisiae genes enriched for genes with known upstream or downstream cis-regulatory sequences. Reasoning that many of these gene groups are coregulated in related species as well, we performed similar analyses on orthologs of coregulated S. cerevisiae genes in 13 other ascomycete species. We find that many species-specific gene groups are enriched for the same flanking regulatory sequences as those found in the orthologous gene groups fromS. cerevisiae, indicating that those regulatory systems have been conserved in multiple ascomycete species. In addition to these clear cases of regulatory conservation, we find examples of cis-element evolution that suggest multiple modes of regulatory diversification, including alterations in transcription factor-binding specificity, incorporation of new gene targets into an existing regulatory system, and cooption of regulatory systems to control a different set of genes. We investigated one example in greater detail by measuring the in vitro activity of the S. cerevisiae transcription factor Rpn4p and its orthologs from Candida albicans and Neurospora crassa. Our results suggest that the DNA binding specificity of these proteins has coevolved with the sequences found upstream of the Rpn4p target genes and suggest that Rpn4p has a different function in N. crassa.

  17. Brachyury, Foxa2 and the cis-Regulatory Origins of the Notochord.

    Directory of Open Access Journals (Sweden)

    Diana S José-Edwards

    2015-12-01

    Full Text Available A main challenge of modern biology is to understand how specific constellations of genes are activated to differentiate cells and give rise to distinct tissues. This study focuses on elucidating how gene expression is initiated in the notochord, an axial structure that provides support and patterning signals to embryos of humans and all other chordates. Although numerous notochord genes have been identified, the regulatory DNAs that orchestrate development and propel evolution of this structure by eliciting notochord gene expression remain mostly uncharted, and the information on their configuration and recurrence is still quite fragmentary. Here we used the simple chordate Ciona for a systematic analysis of notochord cis-regulatory modules (CRMs, and investigated their composition, architectural constraints, predictive ability and evolutionary conservation. We found that most Ciona notochord CRMs relied upon variable combinations of binding sites for the transcription factors Brachyury and/or Foxa2, which can act either synergistically or independently from one another. Notably, one of these CRMs contains a Brachyury binding site juxtaposed to an (AC microsatellite, an unusual arrangement also found in Brachyury-bound regulatory regions in mouse. In contrast, different subsets of CRMs relied upon binding sites for transcription factors of widely diverse families. Surprisingly, we found that neither intra-genomic nor interspecific conservation of binding sites were reliably predictive hallmarks of notochord CRMs. We propose that rather than obeying a rigid sequence-based cis-regulatory code, most notochord CRMs are rather unique. Yet, this study uncovered essential elements recurrently used by divergent chordates as basic building blocks for notochord CRMs.

  18. Massively parallel cis-regulatory analysis in the mammalian central nervous system.

    Science.gov (United States)

    Shen, Susan Q; Myers, Connie A; Hughes, Andrew E O; Byrne, Leah C; Flannery, John G; Corbo, Joseph C

    2016-02-01

    Cis-regulatory elements (CREs, e.g., promoters and enhancers) regulate gene expression, and variants within CREs can modulate disease risk. Next-generation sequencing has enabled the rapid generation of genomic data that predict the locations of CREs, but a bottleneck lies in functionally interpreting these data. To address this issue, massively parallel reporter assays (MPRAs) have emerged, in which barcoded reporter libraries are introduced into cells, and the resulting barcoded transcripts are quantified by next-generation sequencing. Thus far, MPRAs have been largely restricted to assaying short CREs in a limited repertoire of cultured cell types. Here, we present two advances that extend the biological relevance and applicability of MPRAs. First, we adapt exome capture technology to instead capture candidate CREs, thereby tiling across the targeted regions and markedly increasing the length of CREs that can be readily assayed. Second, we package the library into adeno-associated virus (AAV), thereby allowing delivery to target organs in vivo. As a proof of concept, we introduce a capture library of about 46,000 constructs, corresponding to roughly 3500 DNase I hypersensitive (DHS) sites, into the mouse retina by ex vivo plasmid electroporation and into the mouse cerebral cortex by in vivo AAV injection. We demonstrate tissue-specific cis-regulatory activity of DHSs and provide examples of high-resolution truncation mutation analysis for multiplex parsing of CREs. Our approach should enable massively parallel functional analysis of a wide range of CREs in any organ or species that can be infected by AAV, such as nonhuman primates and human stem cell-derived organoids.

  19. ChIP-Seq-Annotated Heliconius erato Genome Highlights Patterns of cis-Regulatory Evolution in Lepidoptera.

    Science.gov (United States)

    Lewis, James J; van der Burg, Karin R L; Mazo-Vargas, Anyi; Reed, Robert D

    2016-09-13

    Uncovering phylogenetic patterns of cis-regulatory evolution remains a fundamental goal for evolutionary and developmental biology. Here, we characterize the evolution of regulatory loci in butterflies and moths using chromatin immunoprecipitation sequencing (ChIP-seq) annotation of regulatory elements across three stages of head development. In the process we provide a high-quality, functionally annotated genome assembly for the butterfly, Heliconius erato. Comparing cis-regulatory element conservation across six lepidopteran genomes, we find that regulatory sequences evolve at a pace similar to that of protein-coding regions. We also observe that elements active at multiple developmental stages are markedly more conserved than elements with stage-specific activity. Surprisingly, we also find that stage-specific proximal and distal regulatory elements evolve at nearly identical rates. Our study provides a benchmark for genome-wide patterns of regulatory element evolution in insects, and it shows that developmental timing of activity strongly predicts patterns of regulatory sequence evolution. PMID:27626657

  20. ChIP-Seq-Annotated Heliconius erato Genome Highlights Patterns of cis-Regulatory Evolution in Lepidoptera

    Directory of Open Access Journals (Sweden)

    James J. Lewis

    2016-09-01

    Full Text Available Uncovering phylogenetic patterns of cis-regulatory evolution remains a fundamental goal for evolutionary and developmental biology. Here, we characterize the evolution of regulatory loci in butterflies and moths using chromatin immunoprecipitation sequencing (ChIP-seq annotation of regulatory elements across three stages of head development. In the process we provide a high-quality, functionally annotated genome assembly for the butterfly, Heliconius erato. Comparing cis-regulatory element conservation across six lepidopteran genomes, we find that regulatory sequences evolve at a pace similar to that of protein-coding regions. We also observe that elements active at multiple developmental stages are markedly more conserved than elements with stage-specific activity. Surprisingly, we also find that stage-specific proximal and distal regulatory elements evolve at nearly identical rates. Our study provides a benchmark for genome-wide patterns of regulatory element evolution in insects, and it shows that developmental timing of activity strongly predicts patterns of regulatory sequence evolution.

  1. Cis-regulatory Evolution of Chalcone-Synthase Expression in the Genus Arabidopsis

    OpenAIRE

    de Meaux, J. (Juliette); Pop, A.(National Institute for Physics and Nuclear Engineering, Bucharest, Romania); Mitchell-Olds, T.

    2006-01-01

    The contribution of cis-regulation to adaptive evolutionary change is believed to be essential, yet little is known about the evolutionary rules that govern regulatory sequences. Here, we characterize the short-term evolutionary dynamics of a cis-regulatory region within and among two closely related species, A. lyrata and A. halleri, and compare our findings to A. thaliana. We focused on the cis-regulatory region of chalcone synthase (CHS), a key enzyme involved in the synthesis of plant sec...

  2. Conserved cis-regulatory modules in promoters of genes encoding wheat high-molecular-weight glutenin subunits.

    Science.gov (United States)

    Ravel, Catherine; Fiquet, Samuel; Boudet, Julie; Dardevet, Mireille; Vincent, Jonathan; Merlino, Marielle; Michard, Robin; Martre, Pierre

    2014-01-01

    The concentration and composition of the gliadin and glutenin seed storage proteins (SSPs) in wheat flour are the most important determinants of its end-use value. In cereals, the synthesis of SSPs is predominantly regulated at the transcriptional level by a complex network involving at least five cis-elements in gene promoters. The high-molecular-weight glutenin subunits (HMW-GS) are encoded by two tightly linked genes located on the long arms of group 1 chromosomes. Here, we sequenced and annotated the HMW-GS gene promoters of 22 electrophoretic wheat alleles to identify putative cis-regulatory motifs. We focused on 24 motifs known to be involved in SSP gene regulation. Most of them were identified in at least one HMW-GS gene promoter sequence. A common regulatory framework was observed in all the HMW-GS gene promoters, as they shared conserved cis-regulatory modules (CCRMs) including all the five motifs known to regulate the transcription of SSP genes. This common regulatory framework comprises a composite box made of the GATA motifs and GCN4-like Motifs (GLMs) and was shown to be functional as the GLMs are able to bind a bZIP transcriptional factor SPA (Storage Protein Activator). In addition to this regulatory framework, each HMW-GS gene promoter had additional motifs organized differently. The promoters of most highly expressed x-type HMW-GS genes contain an additional box predicted to bind R2R3-MYB transcriptional factors. However, the differences in annotation between promoter alleles could not be related to their level of expression. In summary, we identified a common modular organization of HMW-GS gene promoters but the lack of correlation between the cis-motifs of each HMW-GS gene promoter and their level of expression suggests that other cis-elements or other mechanisms regulate HMW-GS gene expression.

  3. Conserved cis-regulatory modules in promoters of genes encoding wheat high-molecular-weight glutenin subunits

    Directory of Open Access Journals (Sweden)

    Catherine eRAVEL

    2014-11-01

    Full Text Available The concentration and composition of the gliadin and glutenin seed storage proteins (SSPs in wheat flour are the most important determinants of its end-use value. In cereals, the synthesis of SSPs is predominantly regulated at the transcriptional level by a complex network involving at least five cis-elements in gene promoters. The high-molecular-weight glutenin subunits (HMW-GS are encoded by two tightly linked genes located on the long arms of group 1 chromosomes. Here, we sequenced and annotated the HMW-GS gene promoters of 22 electrophoretic wheat alleles to identify putative cis-regulatory motifs. We focused on 24 motifs known to be involved in SSP gene regulation. Most of them were identified in at least one HMW-GS gene promoter sequence. A common regulatory framework was observed in all the HMW-GS gene promoters, as they shared conserved cis-regulatory modules including all the five motifs known to regulate the transcription of SSP genes. This common regulatory framework comprises a composite box made of the GATA motifs and GCN4-like Motifs (GLMs and was shown to be functional as the GLMs are able to bind a bZIP transcriptional factor SPA (Storage Protein Activator. In addition to this regulatory framework, each HMW-GS gene promoter had additional motifs organized differently. The promoters of most highly expressed x-type HMW-GS genes contain an additional box predicted to bind R2R3-MYB transcriptional factors. However, the differences in annotation between promoter alleles could not be related to their level of expression. In summary, we identified a common modular organization of HMW-GS gene promoters but the lack of correlation between the cis-motifs of each HMW-GS gene promoter and their level of expression suggests that other cis-elements or other mechanisms regulate HMW-GS gene expression.

  4. Deciphering cis-regulatory control in inflammatory cells

    OpenAIRE

    Ghisletti, Serena; Natoli, Gioacchino

    2013-01-01

    In innate immune system cells, such as macrophages and dendritic cells, deployment of inducible gene expression programmes in response to microbes and danger signals requires highly precise regulatory mechanisms. The inflammatory response has to be tailored based on both the triggering stimulus and its dose, and it has to be unfolded in a kinetically complex manner that suits the different phases of the inflammatory process. Genomic characterization of regulatory elements in this context indi...

  5. MotifCombinator: a web-based tool to search for combinations of cis-regulatory motifs

    Directory of Open Access Journals (Sweden)

    Tsunoda Tatsuhiko

    2007-03-01

    Full Text Available Abstract Background A combination of multiple types of transcription factors and cis-regulatory elements is often required for gene expression in eukaryotes, and the combinatorial regulation confers specific gene expression to tissues or environments. To reveal the combinatorial regulation, computational methods are developed that efficiently infer combinations of cis-regulatory motifs that are important for gene expression as measured by DNA microarrays. One promising type of computational method is to utilize regression analysis between expression levels and scores of motifs in input sequences. This type takes full advantage of information on expression levels because it does not require that the expression level of each gene be dichotomized according to whether or not it reaches a certain threshold level. However, there is no web-based tool that employs regression methods to systematically search for motif combinations and that practically handles combinations of more than two or three motifs. Results We here introduced MotifCombinator, an online tool with a user-friendly interface, to systematically search for combinations composed of any number of motifs based on regression methods. The tool utilizes well-known regression methods (the multivariate linear regression, the multivariate adaptive regression spline or MARS, and the multivariate logistic regression method for this purpose, and uses the genetic algorithm to search for combinations composed of any desired number of motifs. The visualization systems in this tool help users to intuitively grasp the process of the combination search, and the backup system allows users to easily stop and restart calculations that are expected to require large computational time. This tool also provides preparatory steps needed for systematic combination search – i.e., selecting single motifs to constitute combinations and cutting out redundant similar motifs based on clustering analysis. Conclusion

  6. Prediction of tissue-specific cis-regulatory modules using Bayesian networks and regression trees

    Directory of Open Access Journals (Sweden)

    Chen Xiaoyu

    2007-12-01

    Full Text Available Abstract Background In vertebrates, a large part of gene transcriptional regulation is operated by cis-regulatory modules. These modules are believed to be regulating much of the tissue-specificity of gene expression. Results We develop a Bayesian network approach for identifying cis-regulatory modules likely to regulate tissue-specific expression. The network integrates predicted transcription factor binding site information, transcription factor expression data, and target gene expression data. At its core is a regression tree modeling the effect of combinations of transcription factors bound to a module. A new unsupervised EM-like algorithm is developed to learn the parameters of the network, including the regression tree structure. Conclusion Our approach is shown to accurately identify known human liver and erythroid-specific modules. When applied to the prediction of tissue-specific modules in 10 different tissues, the network predicts a number of important transcription factor combinations whose concerted binding is associated to specific expression.

  7. Computational and molecular dissection of an X-box cis-Regulatory module

    OpenAIRE

    Warrington, Timothy Burton

    2015-01-01

    Ciliopathies are a class of human diseases marked by dysfunction of the cellular organelle, cilia. While many of the molecular components that make up cilia have been identified and studied, comparatively little is understood about the transcriptional regulation of genes encoding these components. The conserved transcription factor Regulatory Factor X (RFX)/DAF-19, which acts through binding to the cis-regulatory motif known as X-box, has been shown to regulate ciliary genes in many animals f...

  8. cis-Regulatory and Protein Evolution in Orthologous and Duplicate Genes

    OpenAIRE

    Castillo-Davis, Cristian I.; Hartl, Daniel L.; Achaz, Guillaume

    2004-01-01

    The relationship between protein and regulatory sequence evolution is a central question in molecular evolution. It is currently not known to what extent changes in gene expression are coupled with the evolution of protein coding sequences, or whether these changes differ among orthologs (species homologs) and paralogs (duplicate genes). Here, we develop a method to measure the extent of functionally relevant cis-regulatory sequence change in homologous genes, and validate it using microarray...

  9. Genome-wide de novo prediction of cis-regulatory binding sites in prokaryotes

    OpenAIRE

    Zhang, Shaoqiang; Xu, Minli; Li, Shan; Su, Zhengchang

    2009-01-01

    Although cis-regulatory binding sites (CRBSs) are at least as important as the coding sequences in a genome, our general understanding of them in most sequenced genomes is very limited due to the lack of efficient and accurate experimental and computational methods for their characterization, which has largely hindered our understanding of many important biological processes. In this article, we describe a novel algorithm for genome-wide de novo prediction of CRBSs with high accuracy. We desi...

  10. Conservation of shh cis-regulatory architecture of the coelacanth is consistent with its ancestral phylogenetic position

    Directory of Open Access Journals (Sweden)

    Lang Michael

    2010-11-01

    Full Text Available Abstract Background The modern coelacanth (Latimeria is the extant taxon of a basal sarcopterygian lineage and sister group to tetrapods. Apart from certain apomorphic traits, its morphology is characterized by a high degree of retention of ancestral vertebrate structures and little morphological change. An insight into the molecular evolution that may explain the unchanged character of Latimeria morphology requires the analysis of the expression patterns of developmental regulator genes and their cis-regulatory modules (CRMs. Results We describe the comparative and functional analysis of the sonic hedgehog (shh genomic region of Latimeria menadoensis. Several putative enhancers in the Latimeria shh locus have been identified by comparisons to sarcopterygian and actinopterygian extant species. Specific sequence conservation with all known actinopterygian enhancer elements has been detected. However, these elements are selectively missing in more recently diverged actinopterygian and sarcopterygian species. The functionality of the putative Latimeria enhancers was confirmed by reporter gene expression analysis in transient transgenic zebrafish and chick embryos. Conclusions Latimeria shh CRMs represent the ancestral set of enhancers that have emerged before the split of lobe-finned and ray-finned fishes. In contrast to lineage-specific losses and differentiations in more derived lineages, Latimeria shh enhancers reveal low levels of sequence diversification. High overall sequence conservation of shh conserved noncoding elements (CNE is consistent with the general trend of high levels of conservation of noncoding DNA in the slowly evolving Latimeria genome.

  11. Expression-guided in silico evaluation of candidate cis regulatory codes for Drosophila muscle founder cells.

    Directory of Open Access Journals (Sweden)

    Anthony A Philippakis

    2006-05-01

    Full Text Available While combinatorial models of transcriptional regulation can be inferred for metazoan systems from a priori biological knowledge, validation requires extensive and time-consuming experimental work. Thus, there is a need for computational methods that can evaluate hypothesized cis regulatory codes before the difficult task of experimental verification is undertaken. We have developed a novel computational framework (termed "CodeFinder" that integrates transcription factor binding site and gene expression information to evaluate whether a hypothesized transcriptional regulatory model (TRM; i.e., a set of co-regulating transcription factors is likely to target a given set of co-expressed genes. Our basic approach is to simultaneously predict cis regulatory modules (CRMs associated with a given gene set and quantify the enrichment for combinatorial subsets of transcription factor binding site motifs comprising the hypothesized TRM within these predicted CRMs. As a model system, we have examined a TRM experimentally demonstrated to drive the expression of two genes in a sub-population of cells in the developing Drosophila mesoderm, the somatic muscle founder cells. This TRM was previously hypothesized to be a general mode of regulation for genes expressed in this cell population. In contrast, the present analyses suggest that a modified form of this cis regulatory code applies to only a subset of founder cell genes, those whose gene expression responds to specific genetic perturbations in a similar manner to the gene on which the original model was based. We have confirmed this hypothesis by experimentally discovering six (out of 12 tested new CRMs driving expression in the embryonic mesoderm, four of which drive expression in founder cells.

  12. Rapid evolution of cis-regulatory sequences via local point mutations

    Science.gov (United States)

    Stone, J. R.; Wray, G. A.

    2001-01-01

    Although the evolution of protein-coding sequences within genomes is well understood, the same cannot be said of the cis-regulatory regions that control transcription. Yet, changes in gene expression are likely to constitute an important component of phenotypic evolution. We simulated the evolution of new transcription factor binding sites via local point mutations. The results indicate that new binding sites appear and become fixed within populations on microevolutionary timescales under an assumption of neutral evolution. Even combinations of two new binding sites evolve very quickly. We predict that local point mutations continually generate considerable genetic variation that is capable of altering gene expression.

  13. Genome-wide de novo prediction of cis-regulatory binding sites in prokaryotes

    Science.gov (United States)

    Zhang, Shaoqiang; Xu, Minli; Su, Zhengchang

    2009-01-01

    Although cis-regulatory binding sites (CRBSs) are at least as important as the coding sequences in a genome, our general understanding of them in most sequenced genomes is very limited due to the lack of efficient and accurate experimental and computational methods for their characterization, which has largely hindered our understanding of many important biological processes. In this article, we describe a novel algorithm for genome-wide de novo prediction of CRBSs with high accuracy. We designed our algorithm to circumvent three identified difficulties for CRBS prediction using comparative genomics principles based on a new method for the selection of reference genomes, a new metric for measuring the similarity of CRBSs, and a new graph clustering procedure. When operon structures are correctly predicted, our algorithm can predict 81% of known individual binding sites belonging to 94% of known cis-regulatory motifs in the Escherichia coli K12 genome, while achieving high prediction specificity. Our algorithm has also achieved similar prediction accuracy in the Bacillus subtilis genome, suggesting that it is very robust, and thus can be applied to any other sequenced prokaryotic genome. When compared with the prior state-of-the-art algorithms, our algorithm outperforms them in both prediction sensitivity and specificity. PMID:19383880

  14. Plasticity of the cis-regulatory input function of a gene.

    Directory of Open Access Journals (Sweden)

    Avraham E Mayo

    2006-04-01

    Full Text Available The transcription rate of a gene is often controlled by several regulators that bind specific sites in the gene's cis-regulatory region. The combined effect of these regulators is described by a cis-regulatory input function. What determines the form of an input function, and how variable is it with respect to mutations? To address this, we employ the well-characterized lac operon of Escherichia coli, which has an elaborate input function, intermediate between Boolean AND-gate and OR-gate logic. We mapped in detail the input function of 12 variants of the lac promoter, each with different point mutations in the regulator binding sites, by means of accurate expression measurements from living cells. We find that even a few mutations can significantly change the input function, resulting in functions that resemble Pure AND gates, OR gates, or single-input switches. Other types of gates were not found. The variant input functions can be described in a unified manner by a mathematical model. The model also lets us predict which functions cannot be reached by point mutations. The input function that we studied thus appears to be plastic, in the sense that many of the mutations do not ruin the regulation completely but rather result in new ways to integrate the inputs.

  15. In silico evolution of the hunchback gene indicates redundancy in cis-regulatory organization and spatial gene expression

    Science.gov (United States)

    Zagrijchuk, Elizaveta A.; Sabirov, Marat A.; Holloway, David M.; Spirov, Alexander V.

    2014-01-01

    Biological development depends on the coordinated expression of genes in time and space. Developmental genes have extensive cis-regulatory regions which control their expression. These regions are organized in a modular manner, with different modules controlling expression at different times and locations. Both how modularity evolved and what function it serves are open questions. We present a computational model for the cis-regulation of the hunchback (hb) gene in the fruit fly (Drosophila). We simulate evolution (using an evolutionary computation approach from computer science) to find the optimal cis-regulatory arrangements for fitting experimental hb expression patterns. We find that the cis-regulatory region tends to readily evolve modularity. These cis-regulatory modules (CRMs) do not tend to control single spatial domains, but show a multi-CRM/multi-domain correspondence. We find that the CRM-domain correspondence seen in Drosophila evolves with a high probability in our model, supporting the biological relevance of the approach. The partial redundancy resulting from multi-CRM control may confer some biological robustness against corruption of regulatory sequences. The technique developed on hb could readily be applied to other multi-CRM developmental genes. PMID:24712536

  16. RAR/RXR binding dynamics distinguish pluripotency from differentiation associated cis-regulatory elements

    OpenAIRE

    Chatagnon, Amandine; Veber, Philippe; Morin, Valérie; Bedo, Justin; Triqueneaux, Gérard; Sémon, Marie; Laudet, Vincent; D'Alché-Buc, Florence; Benoit, Gérard

    2015-01-01

    In mouse embryonic cells, ligand-activated retinoic acid receptors (RARs) play a key role in inhibiting pluripotency-maintaining genes and activating some major actors of cell differentiation. To investigate the mechanism underlying this dual regulation, we performed joint RAR/RXR ChIP-seq and mRNA-seq time series during the first 48 h of the RA-induced Primitive Endoderm (PrE) differentiation process in F9 embryonal carcinoma (EC) cells. We show here that this dual regulation is associated w...

  17. Shh and ZRS enhancer colocalisation is specific to the zone of polarising activity

    Science.gov (United States)

    Williamson, Iain; Lettice, Laura A.; Hill, Robert E.

    2016-01-01

    Limb-specific Shh expression is regulated by the (∼1 Mb distant) ZRS enhancer. In the mouse, limb bud-restricted spatiotemporal Shh expression occurs from ∼E10 to E11.5 at the distal posterior margin and is essential for correct autopod formation. Here, we have analysed the higher-order chromatin conformation of Shh in expressing and non-expressing tissues, both by fluorescence in situ hybridisation (FISH) and by chromosome conformation capture (5C). Conventional and super-resolution light microscopy identified significantly elevated frequencies of Shh/ZRS colocalisation only in the Shh-expressing regions of the limb bud, in a conformation consistent with enhancer-promoter loop formation. However, in all tissues and at all developmental stages analysed, Shh-ZRS spatial distances were still consistently shorter than those to a neural enhancer located between Shh and ZRS in the genome. 5C identified a topologically associating domain (TAD) over the Shh/ZRS genomic region and enriched interactions between Shh and ZRS throughout E11.5 embryos. Shh/ZRS colocalisation, therefore, correlates with the spatiotemporal domain of limb bud-specific Shh expression, but close Shh and ZRS proximity in the nucleus occurs regardless of whether the gene or enhancer is active. We suggest that this constrained chromatin configuration optimises the opportunity for the active enhancer to locate and instigate the expression of Shh. PMID:27402708

  18. Validation of skeletal muscle cis-regulatory module predictions reveals nucleotide composition bias in functional enhancers.

    Directory of Open Access Journals (Sweden)

    Andrew T Kwon

    2011-12-01

    Full Text Available We performed a genome-wide scan for muscle-specific cis-regulatory modules (CRMs using three computational prediction programs. Based on the predictions, 339 candidate CRMs were tested in cell culture with NIH3T3 fibroblasts and C2C12 myoblasts for capacity to direct selective reporter gene expression to differentiated C2C12 myotubes. A subset of 19 CRMs validated as functional in the assay. The rate of predictive success reveals striking limitations of computational regulatory sequence analysis methods for CRM discovery. Motif-based methods performed no better than predictions based only on sequence conservation. Analysis of the properties of the functional sequences relative to inactive sequences identifies nucleotide sequence composition can be an important characteristic to incorporate in future methods for improved predictive specificity. Muscle-related TFBSs predicted within the functional sequences display greater sequence conservation than non-TFBS flanking regions. Comparison with recent MyoD and histone modification ChIP-Seq data supports the validity of the functional regions.

  19. Maps of cis-Regulatory Nodes in Megabase Long Genome Segments are an Inevitable Intermediate Step Toward Whole Genome Functional Mapping.

    Science.gov (United States)

    Nikolaev, Lev G; Akopov, Sergey B; Chernov, Igor P; Sverdlov, Eugene D

    2007-04-01

    The availability of complete human and other metazoan genome sequences has greatly facilitated positioning and analysis of various genomic functional elements, with initial emphasis on coding sequences. However, complete functional maps of sequenced eukaryotic genomes should include also positions of all non-coding regulatory elements. Unfortunately, experimental data on genomic positions of a multitude of regulatory sequences, such as enhancers, silencers, insulators, transcription terminators, and replication origins are very limited, especially at the whole genome level. Since most genomic regulatory elements (e.g. enhancers) are generally gene-, tissue-, or cell-specific, the prediction of these elements by computational methods is difficult and often ambiguous. Therefore, the development of high-throughput experimental approaches for identifying and mapping genomic functional elements is highly desirable. At the same time, the creation of whole-genome map of hundreds of thousands of regulatory elements in several hundreds of tissue/cell types is presently far beyond our capabilities. A possible alternative for the whole genome approach is to concentrate efforts on individual genomic segments and then to integrate the data obtained into a whole genome functional map. Moreover, the maps of polygenic fragments with functional cis-regulatory elements would provide valuable data on complex regulatory systems, including their variability and evolution. Here, we reviewed experimental approaches to the realization of these ideas, including our own developments of experimental techniques for selection of cis-acting functionally active DNA fragments from large (megabase-sized) segments of mammalian genomes. PMID:18660850

  20. Maps of cis-Regulatory Nodes in Megabase Long Genome Segments are an Inevitable Intermediate Step Toward Whole Genome Functional Mapping

    Science.gov (United States)

    Nikolaev, Lev G; Akopov, Sergey B; Chernov, Igor P; Sverdlov, Eugene D

    2007-01-01

    The availability of complete human and other metazoan genome sequences has greatly facilitated positioning and analysis of various genomic functional elements, with initial emphasis on coding sequences. However, complete functional maps of sequenced eukaryotic genomes should include also positions of all non-coding regulatory elements. Unfortunately, experimental data on genomic positions of a multitude of regulatory sequences, such as enhancers, silencers, insulators, transcription terminators, and replication origins are very limited, especially at the whole genome level. Since most genomic regulatory elements (e.g. enhancers) are generally gene-, tissue-, or cell-specific, the prediction of these elements by computational methods is difficult and often ambiguous. Therefore, the development of high-throughput experimental approaches for identifying and mapping genomic functional elements is highly desirable. At the same time, the creation of whole-genome map of hundreds of thousands of regulatory elements in several hundreds of tissue/cell types is presently far beyond our capabilities. A possible alternative for the whole genome approach is to concentrate efforts on individual genomic segments and then to integrate the data obtained into a whole genome functional map. Moreover, the maps of polygenic fragments with functional cis-regulatory elements would provide valuable data on complex regulatory systems, including their variability and evolution. Here, we reviewed experimental approaches to the realization of these ideas, including our own developments of experimental techniques for selection of cis-acting functionally active DNA fragments from large (megabase-sized) segments of mammalian genomes. PMID:18660850

  1. Single nucleotide polymorphisms with cis-regulatory effects on long non-coding transcripts in human primary monocytes.

    Directory of Open Access Journals (Sweden)

    Jonas Carlsson Almlöf

    Full Text Available We applied genome-wide allele-specific expression analysis of monocytes from 188 samples. Monocytes were purified from white blood cells of healthy blood donors to detect cis-acting genetic variation that regulates the expression of long non-coding RNAs. We analysed 8929 regions harboring genes for potential long non-coding RNA that were retrieved from data from the ENCODE project. Of these regions, 60% were annotated as intergenic, which implies that they do not overlap with protein-coding genes. Focusing on the intergenic regions, and using stringent analysis of the allele-specific expression data, we detected robust cis-regulatory SNPs in 258 out of 489 informative intergenic regions included in the analysis. The cis-regulatory SNPs that were significantly associated with allele-specific expression of long non-coding RNAs were enriched to enhancer regions marked for active or bivalent, poised chromatin by histone modifications. Out of the lncRNA regions regulated by cis-acting regulatory SNPs, 20% (n = 52 were co-regulated with the closest protein coding gene. We compared the identified cis-regulatory SNPs with those in the catalog of SNPs identified by genome-wide association studies of human diseases and traits. This comparison identified 32 SNPs in loci from genome-wide association studies that displayed a strong association signal with allele-specific expression of non-coding RNAs in monocytes, with p-values ranging from 6.7×10(-7 to 9.5×10(-89. The identified cis-regulatory SNPs are associated with diseases of the immune system, like multiple sclerosis and rheumatoid arthritis.

  2. Mapping Association between Long-Range Cis-Regulatory Regions and Their Target Genes Using Comparative Genomics

    Science.gov (United States)

    Mongin, Emmanuel; Dewar, Ken; Blanchette, Mathieu

    In chordates, long-range cis-regulatory regions are involved in the control of transcription initiation (either as repressors or enhancers). They can be located as far as 1 Mb from the transcription start site of the target gene and can regulate more than one gene. Therefore, proper characterization of functional interactions between long-range cis-regulatory regions and their target genes remains problematic. We present a novel method to predict such interactions based on the analysis of rearrangements between the human and 16 other vertebrate genomes. Our method is based on the assumption that genome rearrangements that would disrupt the functional interaction between a cis-regulatory region and its target gene are likely to be deleterious. Therefore, conservation of synteny through evolution would be an indication of a functional interaction. We use our algorithm to classify a set of 1,406,084 putative associations from the human genome. This genome-wide map of interactions has many potential applications, including the selection of candidate regions prior to in vivo experimental characterization, a better characterization of regulatory regions involved in position effect diseases, and an improved understanding of the mechanisms and importance of long-range regulation.

  3. Bioinformatic analysis of cis-regulatory interactions between progesterone and estrogen receptors in breast cancer

    Directory of Open Access Journals (Sweden)

    Matloob Khushi

    2014-11-01

    Full Text Available Chromatin factors interact with each other in a cell and sequence-specific manner in order to regulate transcription and a wealth of publically available datasets exists describing the genomic locations of these interactions. Our recently published BiSA (Binding Sites Analyser database contains transcription factor binding locations and epigenetic modifications collected from published studies and provides tools to analyse stored and imported data. Using BiSA we investigated the overlapping cis-regulatory role of estrogen receptor alpha (ERα and progesterone receptor (PR in the T-47D breast cancer cell line. We found that ERα binding sites overlap with a subset of PR binding sites. To investigate further, we re-analysed raw data to remove any biases introduced by the use of distinct tools in the original publications. We identified 22,152 PR and 18,560 ERα binding sites (<5% false discovery rate with 4,358 overlapping regions among the two datasets. BiSA statistical analysis revealed a non-significant overall overlap correlation between the two factors, suggesting that ERα and PR are not partner factors and do not require each other for binding to occur. However, Monte Carlo simulation by Binary Interval Search (BITS, Relevant Distance, Absolute Distance, Jaccard and Projection tests by Genometricorr revealed a statistically significant spatial correlation of binding regions on chromosome between the two factors. Motif analysis revealed that the shared binding regions were enriched with binding motifs for ERα, PR and a number of other transcription and pioneer factors. Some of these factors are known to co-locate with ERα and PR binding. Therefore spatially close proximity of ERα binding sites with PR binding sites suggests that ERα and PR, in general function independently at the molecular level, but that their activities converge on a specific subset of transcriptional targets.

  4. Identification of High-Impact cis-Regulatory Mutations Using Transcription Factor Specific Random Forest Models.

    Directory of Open Access Journals (Sweden)

    Dmitry Svetlichnyy

    2015-11-01

    Full Text Available Cancer genomes contain vast amounts of somatic mutations, many of which are passenger mutations not involved in oncogenesis. Whereas driver mutations in protein-coding genes can be distinguished from passenger mutations based on their recurrence, non-coding mutations are usually not recurrent at the same position. Therefore, it is still unclear how to identify cis-regulatory driver mutations, particularly when chromatin data from the same patient is not available, thus relying only on sequence and expression information. Here we use machine-learning methods to predict functional regulatory regions using sequence information alone, and compare the predicted activity of the mutated region with the reference sequence. This way we define the Predicted Regulatory Impact of a Mutation in an Enhancer (PRIME. We find that the recently identified driver mutation in the TAL1 enhancer has a high PRIME score, representing a "gain-of-target" for MYB, whereas the highly recurrent TERT promoter mutation has a surprisingly low PRIME score. We trained Random Forest models for 45 cancer-related transcription factors, and used these to score variations in the HeLa genome and somatic mutations across more than five hundred cancer genomes. Each model predicts only a small fraction of non-coding mutations with a potential impact on the function of the encompassing regulatory region. Nevertheless, as these few candidate driver mutations are often linked to gains in chromatin activity and gene expression, they may contribute to the oncogenic program by altering the expression levels of specific oncogenes and tumor suppressor genes.

  5. Reverse saturable absorption and nonlinear refraction of ultrathin ZrS3 nanobelts

    Science.gov (United States)

    Wu, Jia-Jing; Tao, You-Rong; Wang, Jia-Nan; Wu, Zhong-Yu; Fan, Lei; Wu, Xing-Cai

    2016-05-01

    The nonlinear optical (NLO) properties of a ZrS3 nanobelt were measured with a 6.5 ns pulse laser at 532 nm. Its optical response to the incident light exhibits good optical absorptive and refractive effects, with the nonlinear absorption coefficient β = 4.42 × 10-10 m W-1 and the nonlinear refraction coefficient γ = 5.86 × 10-17 m2 W-1 for the ZrS3 nanobelt in ethanol dispersions at an input energy of 34.25 μJ. In addition, the β values and γ values have dependence on input energy. Results show that the ZrS3 nanobelts have an excellent reverse saturable absorption (RSA) performance in nanosecond pulses, demonstrating that ZrS3 nanobelts are an extraordinarily promising novel optical power limiting material. Meanwhile, compared to the pure ZrS3, graphene oxide (GO) and reduced graphene oxide (RGO), composites (ZrS3/GRO) exhibit an enhanced nonlinear absorption response at the same input energy.The nonlinear optical (NLO) properties of a ZrS3 nanobelt were measured with a 6.5 ns pulse laser at 532 nm. Its optical response to the incident light exhibits good optical absorptive and refractive effects, with the nonlinear absorption coefficient β = 4.42 × 10-10 m W-1 and the nonlinear refraction coefficient γ = 5.86 × 10-17 m2 W-1 for the ZrS3 nanobelt in ethanol dispersions at an input energy of 34.25 μJ. In addition, the β values and γ values have dependence on input energy. Results show that the ZrS3 nanobelts have an excellent reverse saturable absorption (RSA) performance in nanosecond pulses, demonstrating that ZrS3 nanobelts are an extraordinarily promising novel optical power limiting material. Meanwhile, compared to the pure ZrS3, graphene oxide (GO) and reduced graphene oxide (RGO), composites (ZrS3/GRO) exhibit an enhanced nonlinear absorption response at the same input energy. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr09268j

  6. Promoter analysis reveals cis-regulatory motifs associated with the expression of the WRKY transcription factor CrWRKY1 in Catharanthus roseus.

    Science.gov (United States)

    Yang, Zhirong; Patra, Barunava; Li, Runzhi; Pattanaik, Sitakanta; Yuan, Ling

    2013-12-01

    WRKY transcription factors (TFs) are emerging as an important group of regulators of plant secondary metabolism. However, the cis-regulatory elements associated with their regulation have not been well characterized. We have previously demonstrated that CrWRKY1, a member of subgroup III of the WRKY TF family, regulates biosynthesis of terpenoid indole alkaloids in the ornamental and medicinal plant, Catharanthus roseus. Here, we report the isolation and functional characterization of the CrWRKY1 promoter. In silico analysis of the promoter sequence reveals the presence of several potential TF binding motifs, indicating the involvement of additional TFs in the regulation of the TIA pathway. The CrWRKY1 promoter can drive the expression of a β-glucuronidase (GUS) reporter gene in native (C. roseus protoplasts and transgenic hairy roots) and heterologous (transgenic tobacco seedlings) systems. Analysis of 5'- or 3'-end deletions indicates that the sequence located between positions -140 to -93 bp and -3 to +113 bp, relative to the transcription start site, is critical for promoter activity. Mutation analysis shows that two overlapping as-1 elements and a CT-rich motif contribute significantly to promoter activity. The CrWRKY1 promoter is induced in response to methyl jasmonate (MJ) treatment and the promoter region between -230 and -93 bp contains a putative MJ-responsive element. The CrWRKY1 promoter can potentially be used as a tool to isolate novel TFs involved in the regulation of the TIA pathway. PMID:23979312

  7. A Hox Transcription Factor Collective Binds a Highly Conserved Distal-less cis-Regulatory Module to Generate Robust Transcriptional Outcomes.

    Science.gov (United States)

    Uhl, Juli D; Zandvakili, Arya; Gebelein, Brian

    2016-04-01

    cis-regulatory modules (CRMs) generate precise expression patterns by integrating numerous transcription factors (TFs). Surprisingly, CRMs that control essential gene patterns can differ greatly in conservation, suggesting distinct constraints on TF binding sites. Here, we show that a highly conserved Distal-less regulatory element (DCRE) that controls gene expression in leg precursor cells recruits multiple Hox, Extradenticle (Exd) and Homothorax (Hth) complexes to mediate dual outputs: thoracic activation and abdominal repression. Using reporter assays, we found that abdominal repression is particularly robust, as neither individual binding site mutations nor a DNA binding deficient Hth protein abolished cooperative DNA binding and in vivo repression. Moreover, a re-engineered DCRE containing a distinct configuration of Hox, Exd, and Hth sites also mediated abdominal Hox repression. However, the re-engineered DCRE failed to perform additional segment-specific functions such as thoracic activation. These findings are consistent with two emerging concepts in gene regulation: First, the abdominal Hox/Exd/Hth factors utilize protein-protein and protein-DNA interactions to form repression complexes on flexible combinations of sites, consistent with the TF collective model of CRM organization. Second, the conserved DCRE mediates multiple cell-type specific outputs, consistent with recent findings that pleiotropic CRMs are associated with conserved TF binding and added evolutionary constraints. PMID:27058369

  8. CisMiner: genome-wide in-silico cis-regulatory module prediction by fuzzy itemset mining.

    Directory of Open Access Journals (Sweden)

    Carmen Navarro

    Full Text Available Eukaryotic gene control regions are known to be spread throughout non-coding DNA sequences which may appear distant from the gene promoter. Transcription factors are proteins that coordinately bind to these regions at transcription factor binding sites to regulate gene expression. Several tools allow to detect significant co-occurrences of closely located binding sites (cis-regulatory modules, CRMs. However, these tools present at least one of the following limitations: 1 scope limited to promoter or conserved regions of the genome; 2 do not allow to identify combinations involving more than two motifs; 3 require prior information about target motifs. In this work we present CisMiner, a novel methodology to detect putative CRMs by means of a fuzzy itemset mining approach able to operate at genome-wide scale. CisMiner allows to perform a blind search of CRMs without any prior information about target CRMs nor limitation in the number of motifs. CisMiner tackles the combinatorial complexity of genome-wide cis-regulatory module extraction using a natural representation of motif combinations as itemsets and applying the Top-Down Fuzzy Frequent- Pattern Tree algorithm to identify significant itemsets. Fuzzy technology allows CisMiner to better handle the imprecision and noise inherent to regulatory processes. Results obtained for a set of well-known binding sites in the S. cerevisiae genome show that our method yields highly reliable predictions. Furthermore, CisMiner was also applied to putative in-silico predicted transcription factor binding sites to identify significant combinations in S. cerevisiae and D. melanogaster, proving that our approach can be further applied genome-wide to more complex genomes. CisMiner is freely accesible at: http://genome2.ugr.es/cisminer. CisMiner can be queried for the results presented in this work and can also perform a customized cis-regulatory module prediction on a query set of transcription factor binding

  9. A specific mutation in the distant sonic hedgehog (SHH) cis-regulator (ZRS) causes Werner mesomelic syndrome (WMS) while complete ZRS duplications underlie Haas type polysyndactyly and preaxial polydactyly (PPD) with or without triphalangeal thumb.

    Science.gov (United States)

    Wieczorek, Dagmar; Pawlik, Barbara; Li, Yun; Akarsu, Nurten A; Caliebe, Almuth; May, Klaus J W; Schweiger, Bernd; Vargas, Fernando R; Balci, Sevim; Gillessen-Kaesbach, Gabriele; Wollnik, Bernd

    2010-01-01

    Werner mesomelic syndrome (WMS) is an autosomal dominant disorder with unknown molecular etiology characterized by hypo- or aplasia of the tibiae in addition to the preaxial polydactyly (PPD) of the hands and feet and/or five-fingered hand with absence of thumbs. We show that point mutations of a specific nucleotide within the sonic hedgehog (SHH) regulatory region (ZRS) cause WMS. In a previously unpublished WMS family, we identified the causative G>A transition at position 404 of the ZRS, and in six affected family members of a second WMS family we found a 404G>C mutation of the ZRS. The 404G>A ZRS mutation is known as the "Cuban mutation" of PPD type II (PPD2). Interestingly, the index patient of that family had tibial hypoplasia as well. These data provide the first evidence that WMS is caused by a specific ZRS mutation, which leads to strong ectopic SHH expression. In contrast, we show that complete duplications of the ZRS region lead to type Haas polysyndactyly or triphalangeal thumb-polysyndactyly syndrome, but do not affect lower limb development. We suggest the term "ZRS-associated syndromes" and a clinical subclassification for the continuum of limb malformations caused by different molecular alterations of the ZRS.

  10. Mapping cis-Regulatory Domains in the Human Genome UsingMulti-Species Conservation of Synteny

    Energy Technology Data Exchange (ETDEWEB)

    Ahituv, Nadav; Prabhakar, Shyam; Poulin, Francis; Rubin, EdwardM.; Couronne, Olivier

    2005-06-13

    Our inability to associate distant regulatory elements with the genes that they regulate has largely precluded their examination for sequence alterations contributing to human disease. One major obstacle is the large genomic space surrounding targeted genes in which such elements could potentially reside. In order to delineate gene regulatory boundaries we used whole-genome human-mouse-chicken (HMC) and human-mouse-frog (HMF) multiple alignments to compile conserved blocks of synteny (CBS), under the hypothesis that these blocks have been kept intact throughout evolution at least in part by the requirement of regulatory elements to stay linked to the genes that they regulate. A total of 2,116 and 1,942 CBS>200 kb were assembled for HMC and HMF respectively, encompassing 1.53 and 0.86 Gb of human sequence. To support the existence of complex long-range regulatory domains within these CBS we analyzed the prevalence and distribution of chromosomal aberrations leading to position effects (disruption of a genes regulatory environment), observing a clear bias not only for mapping onto CBS but also for longer CBS size. Our results provide a genome wide data set characterizing the regulatory domains of genes and the conserved regulatory elements within them.

  11. Cis-regulatory programs in the development and evolution of vertebrate paired appendages.

    Science.gov (United States)

    Gehrke, Andrew R; Shubin, Neil H

    2016-09-01

    Differential gene expression is the core of development, mediating the genetic changes necessary for determining cell identity. The regulation of gene activity by cis-acting elements (e.g., enhancers) is a crucial mechanism for determining differential gene activity by precise control of gene expression in embryonic space and time. Modifications to regulatory regions can have profound impacts on phenotype, and therefore developmental and evolutionary biologists have increasingly focused on elucidating the transcriptional control of genes that build and pattern body plans. Here, we trace the evolutionary history of transcriptional control of three loci key to vertebrate appendage development (Fgf8, Shh, and HoxD/A). Within and across these regulatory modules, we find both complex and flexible regulation in contrast with more fixed enhancers that appear unchanged over vast timescales of vertebrate evolution. The transcriptional control of vertebrate appendage development was likely already incredibly complex in the common ancestor of fish, implying that subtle changes to regulatory networks were more likely responsible for alterations in phenotype rather than the de novo addition of whole regulatory domains. Finally, we discuss the dangers of relying on inter-species transgenesis when testing enhancer function, and call for more controlled regulatory swap experiments when inferring the evolutionary history of enhancer elements. PMID:26783722

  12. Evolving New Skeletal Traits by cis-Regulatory Changes in Bone Morphogenetic Proteins.

    Science.gov (United States)

    Indjeian, Vahan B; Kingman, Garrett A; Jones, Felicity C; Guenther, Catherine A; Grimwood, Jane; Schmutz, Jeremy; Myers, Richard M; Kingsley, David M

    2016-01-14

    Changes in bone size and shape are defining features of many vertebrates. Here we use genetic crosses and comparative genomics to identify specific regulatory DNA alterations controlling skeletal evolution. Armor bone-size differences in sticklebacks map to a major effect locus overlapping BMP family member GDF6. Freshwater fish express more GDF6 due in part to a transposon insertion, and transgenic overexpression of GDF6 phenocopies evolutionary changes in armor-plate size. The human GDF6 locus also has undergone distinctive regulatory evolution, including complete loss of an enhancer that is otherwise highly conserved between chimps and other mammals. Functional tests show that the ancestral enhancer drives expression in hindlimbs but not forelimbs, in locations that have been specifically modified during the human transition to bipedalism. Both gain and loss of regulatory elements can localize BMP changes to specific anatomical locations, providing a flexible regulatory basis for evolving species-specific changes in skeletal form. PMID:26774823

  13. Does positive selection drive transcription factor binding site turnover? A test with Drosophila cis-regulatory modules.

    Directory of Open Access Journals (Sweden)

    Bin Z He

    2011-04-01

    Full Text Available Transcription factor binding site(s (TFBS gain and loss (i.e., turnover is a well-documented feature of cis-regulatory module (CRM evolution, yet little attention has been paid to the evolutionary force(s driving this turnover process. The predominant view, motivated by its widespread occurrence, emphasizes the importance of compensatory mutation and genetic drift. Positive selection, in contrast, although it has been invoked in specific instances of adaptive gene expression evolution, has not been considered as a general alternative to neutral compensatory evolution. In this study we evaluate the two hypotheses by analyzing patterns of single nucleotide polymorphism in the TFBS of well-characterized CRM in two closely related Drosophila species, Drosophila melanogaster and Drosophila simulans. An important feature of the analysis is classification of TFBS mutations according to the direction of their predicted effect on binding affinity, which allows gains and losses to be evaluated independently along the two phylogenetic lineages. The observed patterns of polymorphism and divergence are not compatible with neutral evolution for either class of mutations. Instead, multiple lines of evidence are consistent with contributions of positive selection to TFBS gain and loss as well as purifying selection in its maintenance. In discussion, we propose a model to reconcile the finding of selection driving TFBS turnover with constrained CRM function over long evolutionary time.

  14. Comparative epigenomics in distantly related teleost species identifies conserved cis-regulatory nodes active during the vertebrate phylotypic period

    Science.gov (United States)

    Tena, Juan J.; González-Aguilera, Cristina; Fernández-Miñán, Ana; Vázquez-Marín, Javier; Parra-Acero, Helena; Cross, Joe W.; Rigby, Peter W.J.; Carvajal, Jaime J.; Wittbrodt, Joachim; Gómez-Skarmeta, José L.; Martínez-Morales, Juan R.

    2014-01-01

    The complex relationship between ontogeny and phylogeny has been the subject of attention and controversy since von Baer’s formulations in the 19th century. The classic concept that embryogenesis progresses from clade general features to species-specific characters has often been revisited. It has become accepted that embryos from a clade show maximum morphological similarity at the so-called phylotypic period (i.e., during mid-embryogenesis). According to the hourglass model, body plan conservation would depend on constrained molecular mechanisms operating at this period. More recently, comparative transcriptomic analyses have provided conclusive evidence that such molecular constraints exist. Examining cis-regulatory architecture during the phylotypic period is essential to understand the evolutionary source of body plan stability. Here we compare transcriptomes and key epigenetic marks (H3K4me3 and H3K27ac) from medaka (Oryzias latipes) and zebrafish (Danio rerio), two distantly related teleosts separated by an evolutionary distance of 115–200 Myr. We show that comparison of transcriptome profiles correlates with anatomical similarities and heterochronies observed at the phylotypic stage. Through comparative epigenomics, we uncover a pool of conserved regulatory regions (≈700), which are active during the vertebrate phylotypic period in both species. Moreover, we show that their neighboring genes encode mainly transcription factors with fundamental roles in tissue specification. We postulate that these regulatory regions, active in both teleost genomes, represent key constrained nodes of the gene networks that sustain the vertebrate body plan. PMID:24709821

  15. Network discovery pipeline elucidates conserved time-of-day-specific cis-regulatory modules.

    Directory of Open Access Journals (Sweden)

    Todd P Michael

    2008-02-01

    Full Text Available Correct daily phasing of transcription confers an adaptive advantage to almost all organisms, including higher plants. In this study, we describe a hypothesis-driven network discovery pipeline that identifies biologically relevant patterns in genome-scale data. To demonstrate its utility, we analyzed a comprehensive matrix of time courses interrogating the nuclear transcriptome of Arabidopsis thaliana plants grown under different thermocycles, photocycles, and circadian conditions. We show that 89% of Arabidopsis transcripts cycle in at least one condition and that most genes have peak expression at a particular time of day, which shifts depending on the environment. Thermocycles alone can drive at least half of all transcripts critical for synchronizing internal processes such as cell cycle and protein synthesis. We identified at least three distinct transcription modules controlling phase-specific expression, including a new midnight specific module, PBX/TBX/SBX. We validated the network discovery pipeline, as well as the midnight specific module, by demonstrating that the PBX element was sufficient to drive diurnal and circadian condition-dependent expression. Moreover, we show that the three transcription modules are conserved across Arabidopsis, poplar, and rice. These results confirm the complex interplay between thermocycles, photocycles, and the circadian clock on the daily transcription program, and provide a comprehensive view of the conserved genomic targets for a transcriptional network key to successful adaptation.

  16. Tissue-specific expression of the human alpha 1-antitrypsin gene is controlled by multiple cis-regulatory elements.

    OpenAIRE

    Shen, R F; Li, Y.; Sifers, R N; Wang, H.; Hardick, C; Tsai, S. Y.; Woo, S L

    1987-01-01

    Human alpha 1-antitrypsin (AAT) is expressed in the liver, and a 318 bp fragment immediately flanking the CAP site of the gene was found to be sufficient to drive the expression of a reporter gene (CAT) specifically in hepatoma cells. The enhancing activity however, was orientation-dependent. The DNA fragment was separated into a distal region and a proximal region. A "core enhancer" sequence GTGGTTTC is present within the distal region and is capable of activity enhancement in both orientati...

  17. Changes in cis-regulatory elements of a key floral regulator are associated with divergence of inflorescence architectures

    NARCIS (Netherlands)

    E. Kusters; S. Della Pina; R. Castel; E. Souer; R. Koes

    2015-01-01

    Higher plant species diverged extensively with regard to the moment (flowering time) and position (inflorescence architecture) at which flowers are formed. This seems largely caused by variation in the expression patterns of conserved genes that specify floral meristem identity (FMI), rather than ch

  18. Changes in cis-regulatory elements of a key floral regulator are associated with divergence of inflorescence architectures

    OpenAIRE

    Kusters, E.; Pina, Della, S.; Castel, R; Souer, E.; Koes, R

    2015-01-01

    Higher plant species diverged extensively with regard to the moment (flowering time) and position (inflorescence architecture) at which flowers are formed. This seems largely caused by variation in the expression patterns of conserved genes that specify floral meristem identity (FMI), rather than changes in the encoded proteins. Here, we report a functional comparison of the promoters of homologous FMI genes from Arabidopsis, petunia, tomato and Antirrhinum. Analysis of promoter-reporter cons...

  19. ModuleMiner - improved computational detection of cis-regulatory modules: are there different modes of gene regulation in embryonic development and adult tissues?

    OpenAIRE

    Van Loo, Peter; Aerts, Stein; Thienpont, Bernard; De Moor, Bart; Moreau, Yves; Marynen, Peter

    2008-01-01

    We present ModuleMiner, a novel algorithm for computationally detecting cis-regulatory modules (CRMs) in a set of co-expressed genes. ModuleMiner outperforms other methods for CRM detection on benchmark data, and successfully detects CRMs in tissue-specific microarray clusters and in embryonic development gene sets. Interestingly, CRM predictions for differentiated tissues exhibit strong enrichment close to the transcription start site, whereas CRM predictions for embryonic development gene s...

  20. An in vivo cis-regulatory screen at the type 2 diabetes associated TCF7L2 locus identifies multiple tissue-specific enhancers.

    Directory of Open Access Journals (Sweden)

    Daniel Savic

    Full Text Available Genome-wide association studies (GWAS have repeatedly shown an association between non-coding variants in the TCF7L2 locus and risk for type 2 diabetes (T2D, implicating a role for cis-regulatory variation within this locus in disease etiology. Supporting this hypothesis, we previously localized complex regulatory activity to the TCF7L2 T2D-associated interval using an in vivo bacterial artificial chromosome (BAC enhancer-trapping reporter strategy. To follow-up on this broad initial survey of the TCF7L2 regulatory landscape, we performed a fine-mapping enhancer scan using in vivo mouse transgenic reporter assays. We functionally interrogated approximately 50% of the sequences within the T2D-associated interval, utilizing sequence conservation within this 92-kb interval to determine the regulatory potential of all evolutionary conserved sequences that exhibited conservation to the non-eutherian mammal opossum. Included in this study was a detailed functional interrogation of sequences spanning both protective and risk alleles of single nucleotide polymorphism (SNP rs7903146, which has exhibited allele-specific enhancer function in pancreatic beta cells. Using these assays, we identified nine segments regulating various aspects of the TCF7L2 expression profile and that constitute nearly 70% of the sequences tested. These results highlight the regulatory complexity of this interval and support the notion that a TCF7L2 cis-regulatory disruption leads to T2D predisposition.

  1. ‘In silico expression analysis’, a novel PathoPlant web tool to identify abiotic and biotic stress conditions associated with specific cis-regulatory sequences

    Science.gov (United States)

    Machens, Fabian; Brill, Yuri; Romanov, Artyom; Bülow, Lorenz; Hehl, Reinhard

    2014-01-01

    Using bioinformatics, putative cis-regulatory sequences can be easily identified using pattern recognition programs on promoters of specific gene sets. The abundance of predicted cis-sequences is a major challenge to associate these sequences with a possible function in gene expression regulation. To identify a possible function of the predicted cis-sequences, a novel web tool designated ‘in silico expression analysis’ was developed that correlates submitted cis-sequences with gene expression data from Arabidopsis thaliana. The web tool identifies the A. thaliana genes harbouring the sequence in a defined promoter region and compares the expression of these genes with microarray data. The result is a hierarchy of abiotic and biotic stress conditions to which these genes are most likely responsive. When testing the performance of the web tool, known cis-regulatory sequences were submitted to the ‘in silico expression analysis’ resulting in the correct identification of the associated stress conditions. When using a recently identified novel elicitor-responsive sequence, a WT-box (CGACTTTT), the ‘in silico expression analysis’ predicts that genes harbouring this sequence in their promoter are most likely Botrytis cinerea induced. Consistent with this prediction, the strongest induction of a reporter gene harbouring this sequence in the promoter is observed with B. cinerea in transgenic A. thaliana. Database URL: http://www.pathoplant.de/expression_analysis.php. PMID:24727366

  2. A cis-regulatory sequence from a short intergenic region gives rise to a strong microbe-associated molecular pattern-responsive synthetic promoter.

    Science.gov (United States)

    Lehmeyer, Mona; Hanko, Erik K R; Roling, Lena; Gonzalez, Lilian; Wehrs, Maren; Hehl, Reinhard

    2016-06-01

    The high gene density in Arabidopsis thaliana leaves only relatively short intergenic regions for potential cis-regulatory sequences. To learn more about the regulation of genes harbouring only very short upstream intergenic regions, this study investigates a recently identified novel microbe-associated molecular pattern (MAMP)-responsive cis-sequence located within the 101 bp long intergenic region upstream of the At1g13990 gene. It is shown that the cis-regulatory sequence is sufficient for MAMP-responsive reporter gene activity in the context of its native promoter. The 3' UTR of the upstream gene has a quantitative effect on gene expression. In context of a synthetic promoter, the cis-sequence is shown to achieve a strong increase in reporter gene activity as a monomer, dimer and tetramer. Mutation analysis of the cis-sequence determined the specific nucleotides required for gene expression activation. In transgenic A. thaliana the synthetic promoter harbouring a tetramer of the cis-sequence not only drives strong pathogen-responsive reporter gene expression but also shows a high background activity. The results of this study contribute to our understanding how genes with very short upstream intergenic regions are regulated and how these regions can serve as a source for MAMP-responsive cis-sequences for synthetic promoter design. PMID:26833485

  3. 'In silico expression analysis', a novel PathoPlant web tool to identify abiotic and biotic stress conditions associated with specific cis-regulatory sequences.

    Science.gov (United States)

    Bolívar, Julio C; Machens, Fabian; Brill, Yuri; Romanov, Artyom; Bülow, Lorenz; Hehl, Reinhard

    2014-01-01

    Using bioinformatics, putative cis-regulatory sequences can be easily identified using pattern recognition programs on promoters of specific gene sets. The abundance of predicted cis-sequences is a major challenge to associate these sequences with a possible function in gene expression regulation. To identify a possible function of the predicted cis-sequences, a novel web tool designated 'in silico expression analysis' was developed that correlates submitted cis-sequences with gene expression data from Arabidopsis thaliana. The web tool identifies the A. thaliana genes harbouring the sequence in a defined promoter region and compares the expression of these genes with microarray data. The result is a hierarchy of abiotic and biotic stress conditions to which these genes are most likely responsive. When testing the performance of the web tool, known cis-regulatory sequences were submitted to the 'in silico expression analysis' resulting in the correct identification of the associated stress conditions. When using a recently identified novel elicitor-responsive sequence, a WT-box (CGACTTTT), the 'in silico expression analysis' predicts that genes harbouring this sequence in their promoter are most likely Botrytis cinerea induced. Consistent with this prediction, the strongest induction of a reporter gene harbouring this sequence in the promoter is observed with B. cinerea in transgenic A. thaliana. DATABASE URL: http://www.pathoplant.de/expression_analysis.php. PMID:24727366

  4. Characterization and application of a novel bioemulsifier in crude oil degradation by Acinetobacter beijerinckii ZRS.

    Science.gov (United States)

    Zhao, Yi-He; Chen, Li-Yuan; Tian, Zi-Jing; Sun, Yue; Liu, Jin-Biao; Huang, Lei

    2016-02-01

    Bioemulsifiers can be applicated in a variety of areas such as bioremediation and microbial-enhanced oil recovery. The present study was aimed at bioemulsifier production, optimization, stability studies, and applications of the bioemulsifier produced by one of these strains, Acinetobacter beijerinckii ZRS. When Acinetobacter beijerinckii ZRS is cultured with hexadecane as a carbon source, it produces a novel extracellular emulsifying agent that does not cause remarkable reductions in surface tension. In order to enhance bioemulsifier production, response surface methodology was applied to optimize the culture medium. The bioemulsifier was subjected to thin-layer chromatography, Fourier transform infrared spectroscopy (FTIR), gel filtration chromatography, matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF), and nuclear magnetic resonance (NMR), which allowed for the identification of a novel polymeric bioemulsifier. The bioemulsifier retained its properties at a wide range of pH values, high temperatures and high salinities (up to 5% [w⁄v] Na(+) and 24% Ca(2+)). To deduce the role of this bioemulsifier in a coastal zone oil spill, the propagation of oil-degrading bacteria on oil-coated grains of gravel immersed in seawater was investigated in beach-simulating tanks. The bioemulsifier played a positive role in the degradation of these hydrocarbons and increasing the light crude oil degradation rate of the bacterial strain from 37.5 to 58.3% within 56 days. Therefore, this bioemulsifier shows strong potential to be used for bioremediation of oil pollution in marine environments. PMID:26576943

  5. Genome-wide identification of enhancer elements.

    Science.gov (United States)

    Tulin, Sarah; Barsi, Julius C; Bocconcelli, Carlo; Smith, Joel

    2016-01-01

    We present a prospective genome-wide regulatory element database for the sea urchin embryo and the modified chromosome capture-related methodology used to create it. The method we developed is termed GRIP-seq for genome-wide regulatory element immunoprecipitation and combines features of chromosome conformation capture, chromatin immunoprecipitation, and paired-end next-generation sequencing with molecular steps that enrich for active cis-regulatory elements associated with basal transcriptional machinery. The first GRIP-seq database, available to the community, comes from S. purpuratus 24 hpf embryos and takes advantage of the extremely well-characterized cis-regulatory elements in this system for validation. In addition, using the GRIP-seq database, we identify and experimentally validate a novel, intronic cis-regulatory element at the onecut locus. We find GRIP-seq signal sensitively identifies active cis-regulatory elements with a high signal-to-noise ratio for both distal and intronic elements. This promising GRIP-seq protocol has the potential to address a rate-limiting step in resolving comprehensive, predictive network models in all systems.

  6. Microduplications encompassing the Sonic Hedgehog Limb Enhancer ZRS are Associated with Haas Type Polysyndactyly and Laurin-Sandrow Syndrome

    DEFF Research Database (Denmark)

    Lohan, Silke; Spielmann, Malte; Doelken, Sandra C;

    2014-01-01

    Laurin-Sandrow syndrome (LSS) is a rare autosomal dominant disorder characterized by polysyndactyly of hands and/or feet, mirror image duplication of the feet, nasal defects, and loss of identity between fibula and tibia. The genetic basis of LSS is currently unknown. LSS shows phenotypic overlap...... distinguished from HTS by the presence of mirror image polysyndactyly of the feet with duplication of the fibula. Our results expand the clinical phenotype of the ZRS-associated syndromes and suggest that smaller duplications (

  7. Cis-regulatory control of the nuclear receptor Coup-TF gene in the sea urchin Paracentrotus lividus embryo.

    Directory of Open Access Journals (Sweden)

    Lamprini G Kalampoki

    Full Text Available Coup-TF, an orphan member of the nuclear receptor super family, has a fundamental role in the development of metazoan embryos. The study of the gene's regulatory circuit in the sea urchin embryo will facilitate the placement of this transcription factor in the well-studied embryonic Gene Regulatory Network (GRN. The Paracentrotus lividus Coup-TF gene (PlCoup-TF is expressed throughout embryonic development preferentially in the oral ectoderm of the gastrula and the ciliary band of the pluteus stage. Two overlapping λ genomic clones, containing three exons and upstream sequences of PlCoup-TF, were isolated from a genomic library. The transcription initiation site was determined and 5' deletions and individual segments of a 1930 bp upstream region were placed ahead of a GFP reporter cassette and injected into fertilized P.lividus eggs. Module a (-532 to -232, was necessary and sufficient to confer ciliary band expression to the reporter. Comparison of P.lividus and Strongylocentrotus purpuratus upstream Coup-TF sequences, revealed considerable conservation, but none within module a. 5' and internal deletions into module a, defined a smaller region that confers ciliary band specific expression. Putative regulatory cis-acting elements (RE1, RE2 and RE3 within module a, were specifically bound by proteins in sea urchin embryonic nuclear extracts. Site-specific mutagenesis of these elements resulted in loss of reporter activity (RE1 or ectopic expression (RE2, RE3. It is proposed that sea urchin transcription factors, which bind these three regulatory sites, are necessary for spatial and quantitative regulation of the PlCoup-TF gene at pluteus stage sea urchin embryos. These findings lead to the future identification of these factors and to the hierarchical positioning of PlCoup-TF within the embryonic GRN.

  8. Different cis-Regulatory DNA Elements Mediate Developmental Stage- and Tissue-specific Expression of the Human COL2A1 Gene in Transgenic Mice

    OpenAIRE

    Leung, Keith K.H.; Ng, Ling Jim; Ho, Ken K.Y.; Tam, Patrick P L; Cheah, Kathryn S. E.

    1998-01-01

    Expression of the type II collagen gene (human COL2A1, mouse Col2a1) heralds the differentiation of chondrocytes. It is also expressed in progenitor cells of some nonchondrogenic tissues during embryogenesis. DNA sequences in the 5' flanking region and intron 1 are known to control tissue- specific expression in vitro, but the regulation of COL2A1 expression in vivo is not clearly understood. We have tested the regulatory activity of DNA sequences from COL2A1 on the expression of a lacZ repor...

  9. Comparative genome sequencing of Drosophila pseudoobscura: Chromosomal, gene, and cis-element evolution

    DEFF Research Database (Denmark)

    Richards, Stephen; Liu, Yue; Bettencourt, Brian R.;

    2005-01-01

    years (Myr) since the pseudoobscura/melanogaster divergence. Genes expressed in the testes had higher amino acid sequence divergence than the genome-wide average, consistent with the rapid evolution of sex-specific proteins. Cis-regulatory sequences are more conserved than random and nearby sequences......We have sequenced the genome of a second Drosophila species, Drosophila pseudoobscura, and compared this to the genome sequence of Drosophila melanogaster, a primary model organism. Throughout evolution the vast majority of Drosophila genes have remained on the same chromosome arm, but within each...... between the species-but the difference is slight, suggesting that the evolution of cis-regulatory elements is flexible. Overall, a pattern of repeat-mediated chromosomal rearrangement, and high coadaptation of both male genes and cis-regulatory sequences emerges as important themes of genome divergence...

  10. Identification of spontaneous mutations within the long-range limb-specific Sonic Hedgehog enhancer (ZRS) that alter Sonic Hedgehog expression in the chicken limb mutants oligozeugodactly and Silkie Breed

    Science.gov (United States)

    Maas, Sarah A.; Suzuki, Takayuki; Fallon, John F.

    2011-01-01

    The evolutionarily conserved, non-coding ~800 base-pair zone of polarizing activity (ZPA) regulatory sequence (ZRS) controls Shh expression in the posterior limb. We report that the chicken mutant oligozeugodactly (ozd), which lacks limb Shh expression, has a large deletion within the ZRS. Furthermore, the preaxial polydactylous, Silkie Breed chicken, which develops ectopic anterior limb Shh expression, has a single base-pair change within the ZRS. Using an in vivo reporter assay to examine enhancer function in the chick limb, we demonstrate that the wild-type ZRS drives β-galactosidase reporter expression in the ZPA of both wild-type and ozd limbs. The Silkie ZRS drives β-galactosidase in both posterior and anterior Shh domains in wild-type limb buds. These results support the hypothesis that the ZRS integrates positive and negative prepatterned regulatory inputs in the chicken model system and demonstrate the utility of the chicken limb as an efficient genetic system for gene regulatory studies. PMID:21509895

  11. A New Approach to Sequence Analysis Exemplified by Identification of cis-Elements in Abscisic Acid Inducible Promoters

    DEFF Research Database (Denmark)

    Busk, Peter Kamp; Hallin, Peter Fischer; Salomon, Jesper;

    Identification of cis-regulatory elements in DNA promoters by computational approaches are a great help in genome-wide elucidation of signal transduction, transcriptional regulation and gene expression. However, to accomplish this has proven a difficult problem in computational genomics in part due...... the sequences of known cis-elements for promoter prediction4. This is a computational alternative to genome-wide DNA array analysis of gene expression and can be used to confirm the importance of known promoter elements on a genome level. Unfortunately, this approach does not yield information about new cis...... to the redundant nature of cis-regulatory elements1. Moreover, promoter context and chromatin structure have an important influence on the function of cis-elements and does further complicate the identification of functional cis-elements2,3. A related computational approach to promoter studies is to use...

  12. Integration of Bioinformatics and Synthetic Promoters Leads to the Discovery of Novel Elicitor-Responsive cis-Regulatory Sequences in Arabidopsis1[C][W][OA

    Science.gov (United States)

    Koschmann, Jeannette; Machens, Fabian; Becker, Marlies; Niemeyer, Julia; Schulze, Jutta; Bülow, Lorenz; Stahl, Dietmar J.; Hehl, Reinhard

    2012-01-01

    A combination of bioinformatic tools, high-throughput gene expression profiles, and the use of synthetic promoters is a powerful approach to discover and evaluate novel cis-sequences in response to specific stimuli. With Arabidopsis (Arabidopsis thaliana) microarray data annotated to the PathoPlant database, 732 different queries with a focus on fungal and oomycete pathogens were performed, leading to 510 up-regulated gene groups. Using the binding site estimation suite of tools, BEST, 407 conserved sequence motifs were identified in promoter regions of these coregulated gene sets. Motif similarities were determined with STAMP, classifying the 407 sequence motifs into 37 families. A comparative analysis of these 37 families with the AthaMap, PLACE, and AGRIS databases revealed similarities to known cis-elements but also led to the discovery of cis-sequences not yet implicated in pathogen response. Using a parsley (Petroselinum crispum) protoplast system and a modified reporter gene vector with an internal transformation control, 25 elicitor-responsive cis-sequences from 10 different motif families were identified. Many of the elicitor-responsive cis-sequences also drive reporter gene expression in an Agrobacterium tumefaciens infection assay in Nicotiana benthamiana. This work significantly increases the number of known elicitor-responsive cis-sequences and demonstrates the successful integration of a diverse set of bioinformatic resources combined with synthetic promoter analysis for data mining and functional screening in plant-pathogen interaction. PMID:22744985

  13. Integration of bioinformatics and synthetic promoters leads to the discovery of novel elicitor-responsive cis-regulatory sequences in Arabidopsis.

    Science.gov (United States)

    Koschmann, Jeannette; Machens, Fabian; Becker, Marlies; Niemeyer, Julia; Schulze, Jutta; Bülow, Lorenz; Stahl, Dietmar J; Hehl, Reinhard

    2012-09-01

    A combination of bioinformatic tools, high-throughput gene expression profiles, and the use of synthetic promoters is a powerful approach to discover and evaluate novel cis-sequences in response to specific stimuli. With Arabidopsis (Arabidopsis thaliana) microarray data annotated to the PathoPlant database, 732 different queries with a focus on fungal and oomycete pathogens were performed, leading to 510 up-regulated gene groups. Using the binding site estimation suite of tools, BEST, 407 conserved sequence motifs were identified in promoter regions of these coregulated gene sets. Motif similarities were determined with STAMP, classifying the 407 sequence motifs into 37 families. A comparative analysis of these 37 families with the AthaMap, PLACE, and AGRIS databases revealed similarities to known cis-elements but also led to the discovery of cis-sequences not yet implicated in pathogen response. Using a parsley (Petroselinum crispum) protoplast system and a modified reporter gene vector with an internal transformation control, 25 elicitor-responsive cis-sequences from 10 different motif families were identified. Many of the elicitor-responsive cis-sequences also drive reporter gene expression in an Agrobacterium tumefaciens infection assay in Nicotiana benthamiana. This work significantly increases the number of known elicitor-responsive cis-sequences and demonstrates the successful integration of a diverse set of bioinformatic resources combined with synthetic promoter analysis for data mining and functional screening in plant-pathogen interaction. PMID:22744985

  14. Gene expression profiling of cultured human NF1 heterozygous (NF1+/-) melanocytes reveals downregulation of a transcriptional cis-regulatory network mediating activation of the melanocyte-specific dopachrome tautomerase (DCT) gene.

    Science.gov (United States)

    Boucneau, Joachim; De Schepper, Sofie; Vuylsteke, Marnik; Van Hummelen, Paul; Naeyaert, Jean-Marie; Lambert, Jo

    2005-08-01

    One of the major primary features of the neurocutaneous genetic disorder Neurofibromatosis type 1 are the hyperpigmentary café-au-lait macules where disregulation of melanocyte biology is supposed to play a key etiopathogenic role. To gain better insight into the possible role of the tumor suppressor gene NF1, a transcriptomic microarray analysis was performed on human NF1 heterozygous (NF1+/-) melanocytes of a Neurofibromatosis type 1 patient and NF1 wild type (NF1+/+) melanocytes of a healthy control patient, both cultured from normally pigmented skin and hyperpigmented lesional café-au-lait skin. From the magnitude of gene effects, we found that gene expression was affected most strongly by genotype and less so by lesional type. A total of 137 genes had a significant twofold or more up- (72) or downregulated (65) expression in NF1+/- melanocytes compared with NF1+/+ melanocytes. Melanocytes cultured from hyperpigmented café-au-lait skin showed 37 upregulated genes whereas only 14 were downregulated compared with normal skin melanocytes. In addition, significant genotype xlesional type interactions were observed for 465 genes. Differentially expressed genes were mainly involved in regulating cell proliferation and cell adhesion. A high number of transcription factor genes, among which a specific subset important in melanocyte lineage development, were downregulated in the cis-regulatory network governing the activation of the melanocyte-specific dopachrome tautomerase (DCT) gene. Although the results presented have been obtained with a restricted number of patients (one NF1 patient and one control) and using cDNA microarrays that may limit their interpretation, the data nevertheless addresses for the first time the effect of a heterozygous NF1 gene on the expression of the human melanocyte transcriptome and has generated several interesting candidate genes helpful in elucidating the etiopathology of café-au-lait macules in NF1 patients.

  15. Comparative genome sequencing of drosophila pseudoobscura: Chromosomal, gene and cis-element evolution

    Energy Technology Data Exchange (ETDEWEB)

    Richards, Stephen; Liu, Yue; Bettencourt, Brian R.; Hradecky, Pavel; Letovsky, Stan; Nielsen, Rasmus; Thornton, Kevin; Todd, Melissa J.; Chen, Rui; Meisel, Richard P.; Couronne, Olivier; Hua, Sujun; Smith, Mark A.; Bussemaker, Harmen J.; van Batenburg, Marinus F.; Howells, Sally L.; Scherer, Steven E.; Sodergren, Erica; Matthews, Beverly B.; Crosby, Madeline A.; Schroeder, Andrew J.; Ortiz-Barrientos, Daniel; Rives, Catherine M.; Metzker, Michael L.; Muzny, Donna M.; Scott, Graham; Steffen, David; Wheeler, David A.; Worley, Kim C.; Havlak, Paul; Durbin, K. James; Egan, Amy; Gill, Rachel; Hume, Jennifer; Morgan, Margaret B.; Miner, George; Hamilton, Cerissa; Huang, Yanmei; Waldron, Lenee; Verduzco, Daniel; Blankenburg, Kerstin P.; Dubchak, Inna; Noor, Mohamed A.F.; Anderson, Wyatt; White, Kevin P.; Clark, Andrew G.; Schaeffer, Stephen W.; Gelbart, William; Weinstock, George M.; Gibbs, Richard A.

    2004-04-01

    The genome sequence of a second fruit fly, D. pseudoobscura, presents an opportunity for comparative analysis of a primary model organism D. melanogaster. The vast majority of Drosophila genes have remained on the same arm, but within each arm gene order has been extensively reshuffled leading to the identification of approximately 1300 syntenic blocks. A repetitive sequence is found in the D. pseudoobscura genome at many junctions between adjacent syntenic blocks. Analysis of this novel repetitive element family suggests that recombination between offset elements may have given rise to many paracentric inversions, thereby contributing to the shuffling of gene order in the D. pseudoobscura lineage. Based on sequence similarity and synteny, 10,516 putative orthologs have been identified as a core gene set conserved over 35 My since divergence. Genes expressed in the testes had higher amino acid sequence divergence than the genome wide average consistent with the rapid evolution of sex-specific proteins. Cis-regulatory sequences are more conserved than control sequences between the species but the difference is slight, suggesting that the evolution of cis-regulatory elements is flexible. Overall, a picture of repeat mediated chromosomal rearrangement, and high co-adaptation of both male genes and cis-regulatory sequences emerges as important themes of genome divergence between these species of Drosophila.

  16. Regulatory elements of the floral homeotic gene AGAMOUS identified by phylogenetic footprinting and shadowing.

    Energy Technology Data Exchange (ETDEWEB)

    Hong, R. L., Hamaguchi, L., Busch, M. A., and Weigel, D.

    2003-06-01

    OAK-B135 In Arabidopsis thaliana, cis-regulatory sequences of the floral homeotic gene AGAMOUS (AG) are located in the second intron. This 3 kb intron contains binding sites for two direct activators of AG, LEAFY (LFY) and WUSCHEL (WUS), along with other putative regulatory elements. We have used phylogenetic footprinting and the related technique of phylogenetic shadowing to identify putative cis-regulatory elements in this intron. Among 29 Brassicaceae, several other motifs, but not the LFY and WUS binding sites previously identified, are largely invariant. Using reporter gene analyses, we tested six of these motifs and found that they are all functionally important for activity of AG regulatory sequences in A. thaliana. Although there is little obvious sequence similarity outside the Brassicaceae, the intron from cucumber AG has at least partial activity in A. thaliana. Our studies underscore the value of the comparative approach as a tool that complements gene-by-gene promoter dissection, but also highlight that sequence-based studies alone are insufficient for a complete identification of cis-regulatory sites.

  17. Close Sequence Comparisons are Sufficient to Identify Humancis-Regulatory Elements

    Energy Technology Data Exchange (ETDEWEB)

    Prabhakar, Shyam; Poulin, Francis; Shoukry, Malak; Afzal, Veena; Rubin, Edward M.; Couronne, Olivier; Pennacchio, Len A.

    2005-12-01

    Cross-species DNA sequence comparison is the primary method used to identify functional noncoding elements in human and other large genomes. However, little is known about the relative merits of evolutionarily close and distant sequence comparisons, due to the lack of a universal metric for sequence conservation, and also the paucity of empirically defined benchmark sets of cis-regulatory elements. To address this problem, we developed a general-purpose algorithm (Gumby) that detects slowly-evolving regions in primate, mammalian and more distant comparisons without requiring adjustment of parameters, and ranks conserved elements by P-value using Karlin-Altschul statistics. We benchmarked Gumby predictions against previously identified cis-regulatory elements at diverse genomic loci, and also tested numerous extremely conserved human-rodent sequences for transcriptional enhancer activity using reporter-gene assays in transgenic mice. Human regulatory elements were identified with acceptable sensitivity and specificity by comparison with 1-5 other eutherian mammals or 6 other simian primates. More distant comparisons (marsupial, avian, amphibian and fish) failed to identify many of the empirically defined functional noncoding elements. We derived an intuitive relationship between ancient and recent noncoding sequence conservation from whole genome comparative analysis, which explains some of these findings. Lastly, we determined that, in addition to strength of conservation, genomic location and/or density of surrounding conserved elements must also be considered in selecting candidate enhancers for testing at embryonic time points.

  18. Conserved Noncoding Elements in the Most Distant Genera of Cephalochordates: The Goldilocks Principle

    Science.gov (United States)

    Yue, Jia-Xing; Kozmikova, Iryna; Ono, Hiroki; Nossa, Carlos W.; Kozmik, Zbynek; Putnam, Nicholas H.; Yu, Jr-Kai; Holland, Linda Z.

    2016-01-01

    Cephalochordates, the sister group of vertebrates + tunicates, are evolving particularly slowly. Therefore, genome comparisons between two congeners of Branchiostoma revealed so many conserved noncoding elements (CNEs), that it was not clear how many are functional regulatory elements. To more effectively identify CNEs with potential regulatory functions, we compared noncoding sequences of genomes of the most phylogenetically distant cephalochordate genera, Asymmetron and Branchiostoma, which diverged approximately 120–160 million years ago. We found 113,070 noncoding elements conserved between the two species, amounting to 3.3% of the genome. The genomic distribution, target gene ontology, and enriched motifs of these CNEs all suggest that many of them are probably cis-regulatory elements. More than 90% of previously verified amphioxus regulatory elements were re-captured in this study. A search of the cephalochordate CNEs around 50 developmental genes in several vertebrate genomes revealed eight CNEs conserved between cephalochordates and vertebrates, indicating sequence conservation over >500 million years of divergence. The function of five CNEs was tested in reporter assays in zebrafish, and one was also tested in amphioxus. All five CNEs proved to be tissue-specific enhancers. Taken together, these findings indicate that even though Branchiostoma and Asymmetron are distantly related, as they are evolving slowly, comparisons between them are likely optimal for identifying most of their tissue-specific cis-regulatory elements laying the foundation for functional characterizations and a better understanding of the evolution of developmental regulation in cephalochordates. PMID:27412606

  19. PRE-1, a cis element sufficient to enhance cone- and rod- specific expression in differentiating zebrafish photoreceptors

    Directory of Open Access Journals (Sweden)

    Hurley James B

    2011-01-01

    Full Text Available Abstract Background Appropriate transcriptional regulation is required for cone photoreceptor development and integrity. To date, only a few cis-regulatory elements that control cone photoreceptor-specific expression have been characterised. The alpha-subunit of cone transducin (TαC is specifically expressed in cone photoreceptors and is required for colour vision. In order to better understand the molecular genetics controlling the initiation of cone photoreceptor-specific expression in vivo, we have utilised zebrafish to identify cis-regulatory elements in the upstream promoter region of the TαC gene. Results A 0.5 kb TαC promoter fragment is sufficient to direct cone-specific expression in transgenic larvae. Within this minimal promoter, we identify photoreceptor regulatory element-1 (PRE-1, a unique 41 bp sequence. PRE-1 specifically binds nuclear factors expressed in ocular tissue. PRE-1 is not required for cone-specific expression directed from a 2.5 kb TαC promoter. However, PRE-1-like sequences, with potential functional redundancy, are located in this 2.5 kb promoter. PRE-1-rho which has the highest sequence and structural homology to PRE-1 is located in the rhodopsin promoter. Surprisingly, PRE-1 and PRE-1-rho are functionally distinct. We demonstrate that PRE-1, but not PRE-1-rho, is sufficient to enhance expression from a heterologous UV cone promoter. PRE-1 is also sufficient to enhance expression from a heterologous rhodopsin promoter without altering its rod photoreceptor specificity. Finally, mutations in consensus E-box and Otx sites prevent PRE-1 from forming complexes with eye nuclear protein and enhancing photoreceptor expression. Conclusions PRE-1 is a novel cis-regulatory module that is sufficient to enhance the initiation of photoreceptor-specific gene expression in differentiating rod and cone photoreceptors.

  20. Structure of Proximal and Distant Regulatory Elements in the Human Genome

    Science.gov (United States)

    Ovcharenko, Ivan

    Clustering of multiple transcription factor binding sites (TFBSs) for the same transcription factor (TF) is a common feature of cis-regulatory modules in invertebrate animals, but the occurrence of such homotypic clusters of TFBSs (HCTs) in the human genome has remained largely unknown. To explore whether HCTs are also common in human and other vertebrates, we used known binding motifs for vertebrate TFs and a hidden Markov model-based approach to detect HCTs in the human, mouse, chicken, and fugu genomes, and examined their association with cis-regulatory modules. We found that evolutionarily conserved HCTs occupy nearly 2% of the human genome, with experimental evidence for individual TFs supporting their binding to predicted HCTs. More than half of promoters of human genes contain HCTs, with a distribution around the transcription start site in agreement with the experimental data from the ENCODE project. In addition, almost half of 487 experimentally validated developmental enhancers contain them as well - a number more than 25-fold larger than expected by chance. We also found evidence of negative selection acting on TFBSs within HCTs, as the conservation of TFBSs is stronger than the conservation of sequences separating them. The important role of HCTs as components of developmental enhancers is additionally supported by a strong correlation between HCTs and the binding of the enhancer-associated co-activator protein p300. Experimental validation of HCT-containing elements in both zebrafish and mouse suggest that HCTs could be used to predict both the presence of enhancers and their tissue specificity, and are thus a feature that can be effectively used in deciphering the gene regulatory code. In conclusion, our results indicate that HCTs are a pervasive feature of human cis-regulatory modules and suggest that they play an important role in gene regulation in the human and other vertebrate genomes.

  1. Patterns of cis regulatory variation in diverse human populations.

    Directory of Open Access Journals (Sweden)

    Barbara E Stranger

    Full Text Available The genetic basis of gene expression variation has long been studied with the aim to understand the landscape of regulatory variants, but also more recently to assist in the interpretation and elucidation of disease signals. To date, many studies have looked in specific tissues and population-based samples, but there has been limited assessment of the degree of inter-population variability in regulatory variation. We analyzed genome-wide gene expression in lymphoblastoid cell lines from a total of 726 individuals from 8 global populations from the HapMap3 project and correlated gene expression levels with HapMap3 SNPs located in cis to the genes. We describe the influence of ancestry on gene expression levels within and between these diverse human populations and uncover a non-negligible impact on global patterns of gene expression. We further dissect the specific functional pathways differentiated between populations. We also identify 5,691 expression quantitative trait loci (eQTLs after controlling for both non-genetic factors and population admixture and observe that half of the cis-eQTLs are replicated in one or more of the populations. We highlight patterns of eQTL-sharing between populations, which are partially determined by population genetic relatedness, and discover significant sharing of eQTL effects between Asians, European-admixed, and African subpopulations. Specifically, we observe that both the effect size and the direction of effect for eQTLs are highly conserved across populations. We observe an increasing proximity of eQTLs toward the transcription start site as sharing of eQTLs among populations increases, highlighting that variants close to TSS have stronger effects and therefore are more likely to be detected across a wider panel of populations. Together these results offer a unique picture and resource of the degree of differentiation among human populations in functional regulatory variation and provide an estimate for the transferability of complex trait variants across populations.

  2. Computational methods to dissect cis-regulatory transcriptional networks

    Indian Academy of Sciences (India)

    Vibha Rani

    2007-12-01

    The formation of diverse cell types from an invariant set of genes is governed by biochemical and molecular processes that regulate gene activity. A complete understanding of the regulatory mechanisms of gene expression is the major function of genomics. Computational genomics is a rapidly emerging area for deciphering the regulation of metazoan genes as well as interpreting the results of high-throughput screening. The integration of computer science with biology has expedited molecular modelling and processing of large-scale data inputs such as microarrays, analysis of genomes, transcriptomes and proteomes. Many bioinformaticians have developed various algorithms for predicting transcriptional regulatory mechanisms from the sequence, gene expression and interaction data. This review contains compiled information of various computational methods adopted to dissect gene expression pathways.

  3. Crystal Structure, Electronic Structure, and Photocatalytic Activity of Oxysulfides: La2Ta2ZrS2O8, La2Ta2TiS2O8, and La2Nb2TiS2O8.

    Science.gov (United States)

    Goto, Yosuke; Seo, Jeongsuk; Kumamoto, Kazunori; Hisatomi, Takashi; Mizuguchi, Yoshikazu; Kamihara, Yoichi; Katayama, Masao; Minegishi, Tsutomu; Domen, Kazunari

    2016-04-01

    The novel oxysulfides La2Ta2ZrS2O8 (LTZSO), La2Ta2TiS2O8 (LTTSO), and La2Nb2TiS2O8 (LNTSO) were synthesized, and their crystal structures, electronic structures, and photocatalytic activities for water splitting under visible light were investigated. Density functional theory calculations showed that these compounds are direct-band-gap semiconductors. Close to the conduction band minimum, the main contribution to the band structure comes from the d orbitals of Zr or Ti ions, while the region near the valence band maximum is associated with the 3p orbitals of S ions. The absorption-edge wavelength was determined to be 540 nm for LTZSO and 700 nm for LTTSO and LNTSO. An analysis of the crystal structure using synchrotron X-ray diffraction revealed that these compounds contained antisite defects at transition metal ion sites, and these were considered to be the origin of the broad absorption at wavelengths longer than that corresponding to band-gap excitation. LTZSO was revealed to be active in the oxygen evolution reaction from aqueous solution containing a sacrificial electron acceptor under visible-light illumination. This result was supported by the band alignment and flat-band potential determined by photoelectron spectroscopy and Mott-Schottky plots.

  4. Phylogeny based discovery of regulatory elements

    Directory of Open Access Journals (Sweden)

    Cohen Barak A

    2006-05-01

    Full Text Available Abstract Background Algorithms that locate evolutionarily conserved sequences have become powerful tools for finding functional DNA elements, including transcription factor binding sites; however, most methods do not take advantage of an explicit model for the constrained evolution of functional DNA sequences. Results We developed a probabilistic framework that combines an HKY85 model, which assigns probabilities to different base substitutions between species, and weight matrix models of transcription factor binding sites, which describe the probabilities of observing particular nucleotides at specific positions in the binding site. The method incorporates the phylogenies of the species under consideration and takes into account the position specific variation of transcription factor binding sites. Using our framework we assessed the suitability of alignments of genomic sequences from commonly used species as substrates for comparative genomic approaches to regulatory motif finding. We then applied this technique to Saccharomyces cerevisiae and related species by examining all possible six base pair DNA sequences (hexamers and identifying sequences that are conserved in a significant number of promoters. By combining similar conserved hexamers we reconstructed known cis-regulatory motifs and made predictions of previously unidentified motifs. We tested one prediction experimentally, finding it to be a regulatory element involved in the transcriptional response to glucose. Conclusion The experimental validation of a regulatory element prediction missed by other large-scale motif finding studies demonstrates that our approach is a useful addition to the current suite of tools for finding regulatory motifs.

  5. Control elements targeting Tgfb3 expression to the palatal epithelium are located intergenically and in introns of the upstream Ift43 gene

    Directory of Open Access Journals (Sweden)

    Jamie eLane

    2014-07-01

    Full Text Available Tgfb3 is strongly and specifically expressed in the epithelial tips of pre-fusion palatal shelves where it plays a critical non-redundant role in palatal fusion in both medial edge epithelial (MEE cells and in a thin layer of flattened peridermal cells that covers the MEE. It is not known how Tgfb3 expression is regulated in these specific cell types. Using comparative genomics and transgenic reporter assays, we have identified cis-regulatory elements that could control Tgfb3 expression during palatogenesis. Our results show that a 61-kb genomic fragment encompassing the Tgfb3 gene drives remarkably specific reporter expression in the MEE and adjacent periderm. Within this fragment, we identified two small, non-coding, evolutionarily conserved regions in intron 2 of the neighboring Ift43 gene, and a larger region in the intervening sequence between the Ift43 and Tgfb3 genes, each of which could target reporter activity to the tips of pre-fusion/fusing palatal shelves. Identification of the cis-regulatory sequences controlling spatio-temporal Tgfb3 expression in palatal shelves is a key step towards understanding upstream regulation of Tgfb3 expression during palatogenesis and should enable the development of improved tools to investigate palatal epithelial fusion.

  6. Transposable element recruitments in the mammalian placenta: impacts and mechanisms.

    Science.gov (United States)

    Emera, Deena; Wagner, Günter P

    2012-07-01

    Transposable elements (TEs) are mobile DNA elements found at high frequency in mammalian genomes. Although these elements are generally perceived as genomic parasites, they have the potential to influence host genome function in many beneficial ways. This article discusses the role TEs have played in the evolution of the placenta and pregnancy in viviparous mammals. Using examples from our own research and the literature, we argue that frequent recruitment of TEs, in particular of retroelements, has facilitated the extreme diversification of tissues at the maternal-fetal interface. We also discuss the mechanisms by which TEs have been recruited for functions during pregnancy. We argue that retroelements are pre-adapted to becoming cis-regulatory elements for host genomes because they need to utilize host regulatory signals for their own life cycle. However, although TEs contain some of the signals necessary for host functions upon insertion, they often require modification before acquiring a biological role in a host tissue. We discuss the process by which one TE was transformed into a promoter for prolactin expression in the endometrium, describing a model for TE domestication called 'epistatic capture'.

  7. Sequences upstream of the homologous cis-elements of the Adh adult enhancer of Drosophila are required for maximal levels of Adh gene transcription in adults of Scaptodrosophila lebanonensis.

    Science.gov (United States)

    Papaceit, Montserrat; Orengo, Dorcas; Juan, Elvira

    2004-01-01

    The evolution of cis-regulatory elements is of particular interest for our understanding of the evolution of gene regulation. The Adh gene of Drosophilidae shows interspecific differences in tissue-specific expression and transcript levels during development. In Scaptodrosophila lebanonensis adults, the level of distal transcripts is maximal between the fourth and eighth day after eclosion and is around five times higher than that in D. melanogaster Adh(S). To examine whether these quantitative differences are regulated by sequences lying upstream of the distal promoter, we performed in vitro deletion mutagenesis of the Adh gene of S. lebanonensis, followed by P-element-mediated germ-line transformation. All constructs included, as a cotransgene, a modified Adh gene of D. melanogaster (dAdh) in a fixed position and orientation that acted as a chromosomal position control. Using this approach, we have identified a fragment of 1.5 kb in the 5' region, 830 bp upstream of the distal start site, which is required to achieve maximal levels of distal transcript in S. lebanonensis. The presence of this fragment produces a 3.5-fold higher level of distal mRNA (as determined by real time quantitative PCR) compared with the D. melanogaster dAdh cotransgene. This region contains the degenerated end of a minisatellite sequence expanding farther upstream and does not correspond to the Adh adult enhancer (AAE) of D. melanogaster. Indeed, the cis-regulatory elements of the AAE have been identified by phylogenetic footprinting within the region 830 bp upstream of the distal start site of S. lebanonensis. Furthermore, the deletions Delta-830 and Delta-2358 yield the same pattern of tissue-specific expression, indicating that all tissue-specific elements are contained within the region 830 bp upstream of the distal start site. PMID:15166155

  8. Structural relationships between highly conserved elements and genes in vertebrate genomes.

    Directory of Open Access Journals (Sweden)

    Hong Sun

    Full Text Available Large numbers of sequence elements have been identified to be highly conserved among vertebrate genomes. These highly conserved elements (HCEs are often located in or around genes that are involved in transcription regulation and early development. They have been shown to be involved in cis-regulatory activities through both in vivo and additional computational studies. We have investigated the structural relationships between such elements and genes in six vertebrate genomes human, mouse, rat, chicken, zebrafish and tetraodon and detected several thousand cases of conserved HCE-gene associations, and also cases of HCEs with no common target genes. A few examples underscore the potential significance of our findings about several individual genes. We found that the conserved association between HCE/HCEs and gene/genes are not restricted to elements by their absolute distance on the genome. Notably, long-range associations were identified and the molecular functions of the associated genes do not show any particular overrepresentation of the functional categories previously reported. HCEs in close proximity are found to be linked with different set of gene/genes. The results reflect the highly complex correlation between HCEs and their putative target genes.

  9. Evolution of anterior Hox regulatory elements among chordates

    Directory of Open Access Journals (Sweden)

    Natale Alfonso

    2011-11-01

    Full Text Available Abstract Background The Hox family of transcription factors has a fundamental role in segmentation pathways and axial patterning of embryonic development and their clustered organization is linked with the regulatory mechanisms governing their coordinated expression along embryonic axes. Among chordates, of particular interest are the Hox paralogous genes in groups 1-4 since their expression is coupled to the control of regional identity in the anterior nervous system, where the highest structural diversity is observed. Results To investigate the degree of conservation in cis-regulatory components that form the basis of Hox expression in the anterior nervous system, we have used assays for transcriptional activity in ascidians and vertebrates to compare and contrast regulatory potential. We identified four regulatory sequences located near the CiHox1, CiHox2 and CiHox4 genes of the ascidian Ciona intestinalis which direct neural specific domains of expression. Using functional assays in Ciona and vertebrate embryos in combination with sequence analyses of enhancer fragments located in similar positions adjacent to Hox paralogy group genes, we compared the activity of these four Ciona cis-elements with a series of neural specific enhancers from the amphioxus Hox1-3 genes and from mouse Hox paralogous groups 1-4. Conclusions This analysis revealed that Kreisler and Krox20 dependent enhancers critical in segmental regulation of the hindbrain appear to be specific for the vertebrate lineage. In contrast, neural enhancers that function as Hox response elements through the action of Hox/Pbx binding motifs have been conserved during chordate evolution. The functional assays reveal that these Hox response cis-elements are recognized by the regulatory components of different and extant species. Together, our results indicate that during chordate evolution, cis-elements dependent upon Hox/Pbx regulatory complexes, are responsible for key aspects of

  10. Detection and characterization of regulatory elements using probabilistic conditional random field and hidden Markov models

    Institute of Scientific and Technical Information of China (English)

    Hongyan Wang; Xiaobo Zhou

    2013-01-01

    By altering the electrostatic charge of histones or providing binding sites to protein recognition molecules,Chromatin marks have been proposed to regulate gene expression,a property that has motivated researchers to link these marks to cis-regulatory elements.With the help of next generation sequencing technologies,we can now correlate one specific chromatin mark with regulatory elements (e.g.enhancers or promoters) and also build tools,such as hidden Markov models,to gain insight into mark combinations.However,hidden Markov models have limitation for their character of generative models and assume that a current observation depends only on a current hidden state in the chain.Here,we employed two graphical probabilistic models,namely the linear conditional random field model and multivariate hidden Markov model,to mark gene regions with different states based on recurrent and spatially coherent character of these eight marks.Both models revealed chromatin states that may correspond to enhancers and promoters,transcribed regions,transcriptional elongation,and low-signal regions.We also found that the linear conditional random field model was more effective than the hidden Markov model in recognizing regulatory elements,such as promoter-,enhancer-,and transcriptional elongation-associated regions,which gives us a better choice.

  11. Detection and characterization of regulatory elements using probabilistic conditional random field and hidden Markov models.

    Science.gov (United States)

    Wang, Hongyan; Zhou, Xiaobo

    2013-04-01

    By altering the electrostatic charge of histones or providing binding sites to protein recognition molecules, Chromatin marks have been proposed to regulate gene expression, a property that has motivated researchers to link these marks to cis-regulatory elements. With the help of next generation sequencing technologies, we can now correlate one specific chromatin mark with regulatory elements (e.g. enhancers or promoters) and also build tools, such as hidden Markov models, to gain insight into mark combinations. However, hidden Markov models have limitation for their character of generative models and assume that a current observation depends only on a current hidden state in the chain. Here, we employed two graphical probabilistic models, namely the linear conditional random field model and multivariate hidden Markov model, to mark gene regions with different states based on recurrent and spatially coherent character of these eight marks. Both models revealed chromatin states that may correspond to enhancers and promoters, transcribed regions, transcriptional elongation, and low-signal regions. We also found that the linear conditional random field model was more effective than the hidden Markov model in recognizing regulatory elements, such as promoter-, enhancer-, and transcriptional elongation-associated regions, which gives us a better choice. PMID:23237214

  12. Ancient Transposable Elements Transformed the Uterine Regulatory Landscape and Transcriptome during the Evolution of Mammalian Pregnancy

    Directory of Open Access Journals (Sweden)

    Vincent J. Lynch

    2015-02-01

    Full Text Available A major challenge in biology is determining how evolutionarily novel characters originate; however, mechanistic explanations for the origin of new characters are almost completely unknown. The evolution of pregnancy is an excellent system in which to study the origin of novelties because mammals preserve stages in the transition from egg laying to live birth. To determine the molecular bases of this transition, we characterized the pregnant/gravid uterine transcriptome from tetrapods to trace the evolutionary history of uterine gene expression. We show that thousands of genes evolved endometrial expression during the origins of mammalian pregnancy, including genes that mediate maternal-fetal communication and immunotolerance. Furthermore, thousands of cis-regulatory elements that mediate decidualization and cell-type identity in decidualized stromal cells are derived from ancient mammalian transposable elements (TEs. Our results indicate that one of the defining mammalian novelties evolved from DNA sequences derived from ancient mammalian TEs co-opted into hormone-responsive regulatory elements distributed throughout the genome.

  13. Discovery and analysis of evolutionarily conserved intronic splicing regulatory elements.

    Directory of Open Access Journals (Sweden)

    Gene W Yeo

    2007-05-01

    Full Text Available Knowledge of the functional cis-regulatory elements that regulate constitutive and alternative pre-mRNA splicing is fundamental for biology and medicine. Here we undertook a genome-wide comparative genomics approach using available mammalian genomes to identify conserved intronic splicing regulatory elements (ISREs. Our approach yielded 314 ISREs, and insertions of ~70 ISREs between competing splice sites demonstrated that 84% of ISREs altered 5' and 94% altered 3' splice site choice in human cells. Consistent with our experiments, comparisons of ISREs to known splicing regulatory elements revealed that 40%-45% of ISREs might have dual roles as exonic splicing silencers. Supporting a role for ISREs in alternative splicing, we found that 30%-50% of ISREs were enriched near alternatively spliced (AS exons, and included almost all known binding sites of tissue-specific alternative splicing factors. Further, we observed that genes harboring ISRE-proximal exons have biases for tissue expression and molecular functions that are ISRE-specific. Finally, we discovered that for Nova1, neuronal PTB, hnRNP C, and FOX1, the most frequently occurring ISRE proximal to an alternative conserved exon in the splicing factor strongly resembled its own known RNA binding site, suggesting a novel application of ISRE density and the propensity for splicing factors to auto-regulate to associate RNA binding sites to splicing factors. Our results demonstrate that ISREs are crucial building blocks in understanding general and tissue-specific AS regulation and the biological pathways and functions regulated by these AS events.

  14. Cis-acting elements in its 3' UTR mediate post-transcriptional regulation of KRAS.

    Science.gov (United States)

    Kim, Minlee; Kogan, Nicole; Slack, Frank J

    2016-03-15

    Multiple RNA-binding proteins and non-coding RNAs, such as microRNAs (miRNAs), are involved in post-transcriptional gene regulation through recognition motifs in the 3' untranslated region (UTR) of their target genes. The KRAS gene encodes a key signaling protein, and its messenger RNA (mRNA) contains an exceptionally long 3' UTR; this suggests that it may be subject to a highly complex set of regulatory processes. However, 3' UTR-dependent regulation of KRAS expression has not been explored in detail. Using extensive deletion and mutational analyses combined with luciferase reporter assays, we have identified inhibitory and stabilizing cis-acting regions within the KRAS 3' UTR that may interact with miRNAs and RNA-binding proteins, such as HuR. Particularly, we have identified an AU-rich 49-nt fragment in the KRAS 3' UTR that is required for KRAS 3' UTR reporter repression. This element contains a miR-185 complementary element, and we show that overexpression of miR-185 represses endogenous KRAS mRNA and protein in vitro. In addition, we have identified another 49-nt fragment that is required to promote KRAS 3' UTR reporter expression. These findings indicate that multiple cis-regulatory motifs in the 3' UTR of KRAS finely modulate its expression, and sequence alterations within a binding motif may disrupt the precise functions of trans-regulatory factors, potentially leading to aberrant KRAS expression. PMID:26930719

  15. Finding cis-regulatory modules in Drosophila using phylogenetic hidden Markov models

    DEFF Research Database (Denmark)

    Wong, Wendy S W; Nielsen, Rasmus

    2007-01-01

    MOTIVATION: Finding the regulatory modules for transcription factors binding is an important step in elucidating the complex molecular mechanisms underlying regulation of gene expression. There are numerous methods available for solving this problem, however, very few of them take advantage of th...

  16. Extensive conservation of ancient microsynteny across metazoans due to cis-regulatory constraints

    OpenAIRE

    Irimia, Manuel; Tena, Juan J.; Alexis, Maria S.; Fernandez-Miñan, Ana; Maeso, Ignacio; Bogdanović, Ozren; de la Calle-Mustienes, Elisa; Roy, Scott W; Gómez-Skarmeta, José L.; Fraser, Hunter B.

    2012-01-01

    The order of genes in eukaryotic genomes has generally been assumed to be neutral, since gene order is largely scrambled over evolutionary time. Only a handful of exceptional examples are known, typically involving deeply conserved clusters of tandemly duplicated genes (e.g., Hox genes and histones). Here we report the first systematic survey of microsynteny conservation across metazoans, utilizing 17 genome sequences. We identified nearly 600 pairs of unrelated genes that have remained tight...

  17. Cis-regulatory mechanisms of left/right asymmetric neuron-subtype specification in C. elegans

    OpenAIRE

    Etchberger, John F.; Eileen B Flowers; Poole, Richard J.; Bashllari, Enkelejda; Hobert, Oliver

    2008-01-01

    Anatomically and functionally defined neuron types are sometimes further classified into individual subtypes based on unique functional or molecular properties. To better understand how developmental programs controlling neuron type specification are mechanistically linked to programs controlling neuronal subtype specification, we have analyzed a neuronal subtype specification program that occurs across the left/right axis in the nervous system of the nematode C. elegans. A terminal selector ...

  18. Dissection of transcriptional and cis-regulatory control of differentiation in human pancreatic cancer.

    Science.gov (United States)

    Diaferia, Giuseppe R; Balestrieri, Chiara; Prosperini, Elena; Nicoli, Paola; Spaggiari, Paola; Zerbi, Alessandro; Natoli, Gioacchino

    2016-03-15

    The histological grade of carcinomas describes the ability of tumor cells to organize in differentiated epithelial structures and has prognostic and therapeutic impact. Here, we show that differential usage of the genomic repertoire of transcriptional enhancers leads to grade-specific gene expression programs in human pancreatic ductal adenocarcinoma (PDAC). By integrating gene expression profiling, epigenomic footprinting, and loss-of-function experiments in PDAC cell lines of different grade, we identified the repertoires of enhancers specific to high- and low-grade PDACs and the cognate set of transcription factors acting to maintain their activity. Among the candidate regulators of PDAC differentiation, KLF5 was selectively expressed in pre-neoplastic lesions and low-grade primary PDACs and cell lines, where it maintained the acetylation of grade-specific enhancers, the expression of epithelial genes such as keratins and mucins, and the ability to organize glandular epithelia in xenografts. The identification of the transcription factors controlling differentiation in PDACs will help clarify the molecular bases of its heterogeneity and progression. PMID:26769127

  19. Structure-aided prediction of mammalian transcription factor complexes in conserved non-coding elements

    KAUST Repository

    Guturu, H.

    2013-11-11

    Mapping the DNA-binding preferences of transcription factor (TF) complexes is critical for deciphering the functions of cis-regulatory elements. Here, we developed a computational method that compares co-occurring motif spacings in conserved versus unconserved regions of the human genome to detect evolutionarily constrained binding sites of rigid TF complexes. Structural data were used to estimate TF complex physical plausibility, explore overlapping motif arrangements seldom tackled by non-structure-aware methods, and generate and analyse three-dimensional models of the predicted complexes bound to DNA. Using this approach, we predicted 422 physically realistic TF complex motifs at 18% false discovery rate, the majority of which (326, 77%) contain some sequence overlap between binding sites. The set of mostly novel complexes is enriched in known composite motifs, predictive of binding site configurations in TF-TF-DNA crystal structures, and supported by ChIP-seq datasets. Structural modelling revealed three cooperativity mechanisms: direct protein-protein interactions, potentially indirect interactions and \\'through-DNA\\' interactions. Indeed, 38% of the predicted complexes were found to contain four or more bases in which TF pairs appear to synergize through overlapping binding to the same DNA base pairs in opposite grooves or strands. Our TF complex and associated binding site predictions are available as a web resource at http://bejerano.stanford.edu/complex.

  20. Bisphenol A activates the Nrf1/2-antioxidant response element pathway in HEK 293 cells.

    Science.gov (United States)

    Chepelev, Nikolai L; Enikanolaiye, Mutiat I; Chepelev, Leonid L; Almohaisen, Abdulrahman; Chen, Qixuan; Scoggan, Kylie A; Coughlan, Melanie C; Cao, Xu-Liang; Jin, Xiaolei; Willmore, William G

    2013-03-18

    Bisphenol A (BPA) is used in the production of polycarbonate plastics and epoxy resins for baby bottles, liners of canned food, and many other consumer products. Previously, BPA has been shown to reduce the activity of several antioxidant enzymes, which may contribute to oxidative stress. However, the underlying mechanism of the BPA-mediated effect upon antioxidant enzyme activity is unknown. Antioxidant and phase II metabolizing enzymes protect cells from oxidative stress and are transcriptionally activated by Nrf1 and Nrf2 factors through their cis-regulatory antioxidant response elements (AREs). In this work, we have assessed the effect of BPA on the Nrf1/2-ARE pathway in cultured human embryonic kidney (HEK) 293 cells. Surprisingly, glutathione and reactive oxygen species (ROS) assays revealed that BPA application created a more reduced intracellular environment in cultured HEK 293 cells. Furthermore, BPA increased the transactivation activity of ectopic Nrf1 and Nrf2 and increased the expression of ARE-target genes ho-1 and nqo1 at high (100-200 μM) BPA concentrations only. Our study suggests that BPA activates the Nrf1/2-ARE pathway at high (>10 μM) micromolar concentrations. PMID:23360430

  1. Genome-wide profiling of p63 DNA-binding sites identifies an element that regulates gene expression during limb development in the 7q21 SHFM1 locus.

    Directory of Open Access Journals (Sweden)

    Evelyn N Kouwenhoven

    2010-08-01

    Full Text Available Heterozygous mutations in p63 are associated with split hand/foot malformations (SHFM, orofacial clefting, and ectodermal abnormalities. Elucidation of the p63 gene network that includes target genes and regulatory elements may reveal new genes for other malformation disorders. We performed genome-wide DNA-binding profiling by chromatin immunoprecipitation (ChIP, followed by deep sequencing (ChIP-seq in primary human keratinocytes, and identified potential target genes and regulatory elements controlled by p63. We show that p63 binds to an enhancer element in the SHFM1 locus on chromosome 7q and that this element controls expression of DLX6 and possibly DLX5, both of which are important for limb development. A unique micro-deletion including this enhancer element, but not the DLX5/DLX6 genes, was identified in a patient with SHFM. Our study strongly indicates disruption of a non-coding cis-regulatory element located more than 250 kb from the DLX5/DLX6 genes as a novel disease mechanism in SHFM1. These data provide a proof-of-concept that the catalogue of p63 binding sites identified in this study may be of relevance to the studies of SHFM and other congenital malformations that resemble the p63-associated phenotypes.

  2. CONDOR: a database resource of developmentally associated conserved non-coding elements

    Directory of Open Access Journals (Sweden)

    Smith Sarah

    2007-08-01

    Full Text Available Abstract Background Comparative genomics is currently one of the most popular approaches to study the regulatory architecture of vertebrate genomes. Fish-mammal genomic comparisons have proved powerful in identifying conserved non-coding elements likely to be distal cis-regulatory modules such as enhancers, silencers or insulators that control the expression of genes involved in the regulation of early development. The scientific community is showing increasing interest in characterizing the function, evolution and language of these sequences. Despite this, there remains little in the way of user-friendly access to a large dataset of such elements in conjunction with the analysis and the visualization tools needed to study them. Description Here we present CONDOR (COnserved Non-coDing Orthologous Regions available at: http://condor.fugu.biology.qmul.ac.uk. In an interactive and intuitive way the website displays data on > 6800 non-coding elements associated with over 120 early developmental genes and conserved across vertebrates. The database regularly incorporates results of ongoing in vivo zebrafish enhancer assays of the CNEs carried out in-house, which currently number ~100. Included and highlighted within this set are elements derived from duplication events both at the origin of vertebrates and more recently in the teleost lineage, thus providing valuable data for studying the divergence of regulatory roles between paralogs. CONDOR therefore provides a number of tools and facilities to allow scientists to progress in their own studies on the function and evolution of developmental cis-regulation. Conclusion By providing access to data with an approachable graphics interface, the CONDOR database presents a rich resource for further studies into the regulation and evolution of genes involved in early development.

  3. Quantitative analysis of polycomb response elements (PREs at identical genomic locations distinguishes contributions of PRE sequence and genomic environment

    Directory of Open Access Journals (Sweden)

    Okulski Helena

    2011-03-01

    Full Text Available Abstract Background Polycomb/Trithorax response elements (PREs are cis-regulatory elements essential for the regulation of several hundred developmentally important genes. However, the precise sequence requirements for PRE function are not fully understood, and it is also unclear whether these elements all function in a similar manner. Drosophila PRE reporter assays typically rely on random integration by P-element insertion, but PREs are extremely sensitive to genomic position. Results We adapted the ΦC31 site-specific integration tool to enable systematic quantitative comparison of PREs and sequence variants at identical genomic locations. In this adaptation, a miniwhite (mw reporter in combination with eye-pigment analysis gives a quantitative readout of PRE function. We compared the Hox PRE Frontabdominal-7 (Fab-7 with a PRE from the vestigial (vg gene at four landing sites. The analysis revealed that the Fab-7 and vg PREs have fundamentally different properties, both in terms of their interaction with the genomic environment at each site and their inherent silencing abilities. Furthermore, we used the ΦC31 tool to examine the effect of deletions and mutations in the vg PRE, identifying a 106 bp region containing a previously predicted motif (GTGT that is essential for silencing. Conclusions This analysis showed that different PREs have quantifiably different properties, and that changes in as few as four base pairs have profound effects on PRE function, thus illustrating the power and sensitivity of ΦC31 site-specific integration as a tool for the rapid and quantitative dissection of elements of PRE design.

  4. Transuranium elements

    International Nuclear Information System (INIS)

    In this paper, the authors introduce this volume of historical and research papers on the transuranium elements by reviewing the period of discovery of elements 93 and beyond. Then the authors highlight the research achievements that focus on the unique properties of the 5f elements. Finally, the authors outline the technology and applications of transuranium elements and their radiobiology

  5. Human Papillomavirus Type 18 cis-Elements Crucial for Segregation and Latency.

    Science.gov (United States)

    Ustav, Mart; Castaneda, Fernando Rodriguez; Reinson, Tormi; Männik, Andres; Ustav, Mart

    2015-01-01

    Stable maintenance replication is characteristic of the latency phase of HPV infection, during which the viral genomes are actively maintained as extrachromosomal genetic elements in infected proliferating basal keratinocytes. Active replication in the S-phase and segregation of the genome into daughter cells in mitosis are required for stable maintenance replication. Most of our knowledge about papillomavirus genome segregation has come from studies of bovine papillomavirus type 1 (BPV-1), which have demonstrated that the E2 protein cooperates with cellular trans-factors and that E2 binding sites act as cis-regulatory elements in the viral genome that are essential for the segregation process. However, the genomic organization of the regulatory region in HPVs, and the properties of the viral proteins are different from those of their BPV-1 counterparts. We have designed a segregation assay for HPV-18 and used it to demonstrate that the E2 protein performs segregation in combination with at least two E2 binding sites. The cooperative binding of the E2 protein to two E2 binding sites is a major determinant of HPV-18 genome segregation, as demonstrated by the change in spacing between adjacent binding sites #1 and #2 in the HPV-18 Upstream Regulatory Region (URR). Duplication or triplication of the natural 4 bp 5'-CGGG-3' spacer between the E2 binding sites increased the cooperative binding of the E2 molecules as well as E2-dependent segregation. Removal of any spacing between these sites eliminated cooperative binding of the E2 protein and disabled segregation of the URR and HPV-18 genome. Transfer of these configurations of the E2 binding sites into viral genomes confirmed the role of the E2 protein and binding sites #1 and #2 in the segregation process. Additional analysis demonstrated that these sites also play an important role in the transcriptional regulation of viral gene expression from different HPV-18 promoters. PMID:26288015

  6. A biophysical model for identifying splicing regulatory elements and their interactions.

    Directory of Open Access Journals (Sweden)

    Ji Wen

    Full Text Available Alternative splicing (AS of precursor mRNA (pre-mRNA is a crucial step in the expression of most eukaryotic genes. Splicing factors (SFs play an important role in AS regulation by binding to the cis-regulatory elements on the pre-mRNA. Although many splicing factors (SFs and their binding sites have been identified, their combinatorial regulatory effects remain to be elucidated. In this paper, we derive a biophysical model for AS regulation that integrates combinatorial signals of cis-acting splicing regulatory elements (SREs and their interactions. We also develop a systematic framework for model inference. Applying the biophysical model to a human RNA-Seq data set, we demonstrate that our model can explain 49.1%-66.5% variance of the data, which is comparable to the best result achieved by biophysical models for transcription. In total, we identified 119 SRE pairs between different regions of cassette exons that may regulate exon or intron definition in splicing, and 77 SRE pairs from the same region that may arise from a long motif or two different SREs bound by different SFs. Particularly, putative binding sites of polypyrimidine tract-binding protein (PTB, heterogeneous nuclear ribonucleoprotein (hnRNP F/H and E/K are identified as interacting SRE pairs, and have been shown to be consistent with the interaction models proposed in previous experimental results. These results show that our biophysical model and inference method provide a means of quantitative modeling of splicing regulation and is a useful tool for identifying SREs and their interactions. The software package for model inference is available under an open source license.

  7. Cis-acting elements in its 3′ UTR mediate post-transcriptional regulation of KRAS

    Science.gov (United States)

    Kim, Minlee; Kogan, Nicole; Slack, Frank J.

    2016-01-01

    Multiple RNA-binding proteins and non-coding RNAs, such as microRNAs (miRNAs), are involved in post-transcriptional gene regulation through recognition motifs in the 3′ untranslated region (UTR) of their target genes. The KRAS gene encodes a key signaling protein, and its messenger RNA (mRNA) contains an exceptionally long 3′ UTR; this suggests that it may be subject to a highly complex set of regulatory processes. However, 3′ UTR-dependent regulation of KRAS expression has not been explored in detail. Using extensive deletion and mutational analyses combined with luciferase reporter assays, we have identified inhibitory and stabilizing cis-acting regions within the KRAS 3′ UTR that may interact with miRNAs and RNA-binding proteins, such as HuR. Particularly, we have identified an AU-rich 49-nt fragment in the KRAS 3′ UTR that is required for KRAS 3′ UTR reporter repression. This element contains a miR-185 complementary element, and we show that overexpression of miR-185 represses endogenous KRAS mRNA and protein in vitro. In addition, we have identified another 49-nt fragment that is required to promote KRAS 3′ UTR reporter expression. These findings indicate that multiple cis-regulatory motifs in the 3′ UTR of KRAS finely modulate its expression, and sequence alterations within a binding motif may disrupt the precise functions of trans-regulatory factors, potentially leading to aberrant KRAS expression. PMID:26930719

  8. Human Papillomavirus Type 18 cis-Elements Crucial for Segregation and Latency.

    Directory of Open Access Journals (Sweden)

    Mart Ustav

    Full Text Available Stable maintenance replication is characteristic of the latency phase of HPV infection, during which the viral genomes are actively maintained as extrachromosomal genetic elements in infected proliferating basal keratinocytes. Active replication in the S-phase and segregation of the genome into daughter cells in mitosis are required for stable maintenance replication. Most of our knowledge about papillomavirus genome segregation has come from studies of bovine papillomavirus type 1 (BPV-1, which have demonstrated that the E2 protein cooperates with cellular trans-factors and that E2 binding sites act as cis-regulatory elements in the viral genome that are essential for the segregation process. However, the genomic organization of the regulatory region in HPVs, and the properties of the viral proteins are different from those of their BPV-1 counterparts. We have designed a segregation assay for HPV-18 and used it to demonstrate that the E2 protein performs segregation in combination with at least two E2 binding sites. The cooperative binding of the E2 protein to two E2 binding sites is a major determinant of HPV-18 genome segregation, as demonstrated by the change in spacing between adjacent binding sites #1 and #2 in the HPV-18 Upstream Regulatory Region (URR. Duplication or triplication of the natural 4 bp 5'-CGGG-3' spacer between the E2 binding sites increased the cooperative binding of the E2 molecules as well as E2-dependent segregation. Removal of any spacing between these sites eliminated cooperative binding of the E2 protein and disabled segregation of the URR and HPV-18 genome. Transfer of these configurations of the E2 binding sites into viral genomes confirmed the role of the E2 protein and binding sites #1 and #2 in the segregation process. Additional analysis demonstrated that these sites also play an important role in the transcriptional regulation of viral gene expression from different HPV-18 promoters.

  9. An element

    Energy Technology Data Exchange (ETDEWEB)

    Nakamura, K.; Iidzima, K.

    1983-03-30

    An anode of a light metal is used in the element, along with an electrolyte which consists of an ether solvent and an ionogenic additive in the form of a salt of dithiocarbamic acid. The element has good discharge characteristics.

  10. Transuranium elements

    International Nuclear Information System (INIS)

    This paper reports that neutron irradiation of uranium, beginning in 1934, led to the reported discovery of such transuranium elements as eka-rhenium. After a few years of investigation these were correctly identified, in December 1938, as fission products. The first real transuranium elements, with atomic numbers 93 and 94 (neptumiun and plutionium), were discovered in 1940-1941. Plutomiun-239 was shown to be fission-able with slow neutrons, and chemical methods for its separation in quantity were developed. Not until it was recognized that transuranium elements should be part of a 14-member actinide series could elements 95 and 96 (americium and curium) be chemically identified after their nuclear synthesis. This new view was the key to the synthesis and identified after their nuclear synthesis. This new view was the key to the synthesis and identification of the next seven transuranium elements, resulting in the completion of the actinide series at element 103 in 1961. The transactinide elements could, according to the actinide concept, also be correctly placed in the periodic table, and the chemical properties of the first transactinide elements, elements 104 and 105 (rutherfordium and hafnium), confirm this point of view. Transuranium elements through number 109 are now known

  11. Identification and characterization of cis elements in the STAT3 gene regulating STAT3 alpha and STAT3 beta messenger RNA splicing.

    Science.gov (United States)

    Shao, H; Quintero, A J; Tweardy, D J

    2001-12-15

    Signal transducer and activator of transcription 3 (STAT3) is an oncogene and a critical regulator of multiple cell-fate decisions, including myeloid cell differentiation. Two isoforms of STAT3 have been identified: alpha (p92) and beta (p83). These differ structurally in their C-terminal transactivation domains, resulting in distinct functional activities. The cis genetic elements that regulate the ratio of alpha to beta messenger RNA (mRNA) are unknown. In this study, cloning, sequencing, and splicing analysis of the human and murine STAT3 genes revealed a highly conserved 5' donor site for generation of both alpha and beta mRNA and distinct branch-point sequences, polypyrimidine tracts, and 3' acceptor sites (ASs) for each. The beta 3' AS was found to be located 50 nucleotides downstream of the alpha 3' AS in exon 23. Two additional cryptic 3' ASs (delta and epsilon) were also identified. Thus, we identified for the first time the cis regulatory sequences responsible for generation of STAT3 alpha and STAT3 beta mRNA.

  12. Cis-regulatory control of the nodal gene, initiator of the sea urchin oral ectoderm gene network

    OpenAIRE

    Nam, Jongmin; Su, Yi-Hsien; Lee, Pei Yun; Robertson, Anthony J; Coffman, James A.; Davidson, Eric H.

    2007-01-01

    Expression of the nodal gene initiates the gene regulatory network which establishes the transcriptional specification of the oral ectoderm in the sea urchin embryo. This gene encodes a TGFβ ligand, and in Strongylocentrotus purpuratus its transcription is activated in the presumptive oral ectoderm at about the 30-cell stage. Thereafter Nodal signaling occurs among all cells of the oral ectoderm territory, and nodal expression is required for expression of oral ectoderm regulatory genes. The ...

  13. The meta-epigenomic structure of purified human stem cell populations is defined at cis-regulatory sequences

    Science.gov (United States)

    Zhao, Yong Mei; Golden, Aaron; Mar, Jessica C.; Einstein, Francine H.; Greally, John M.

    2014-01-01

    The mechanism and significance of epigenetic variability in the same cell type between healthy individuals are not clear. Here, we purify human CD34+ hematopoietic stem and progenitor cells (HSPCs) from different individuals and find that there is increased variability of DNA methylation at loci with properties of promoters and enhancers. The variability is especially enriched at candidate enhancers near genes transitioning between silent and expressed states, and encoding proteins with leukocyte differentiation properties. Our findings of increased variability at loci with intermediate DNA methylation values, at candidate “poised” enhancers, and at genes involved in HSPC lineage commitment suggest that CD34+ cell subtype heterogeneity between individuals is a major mechanism for the variability observed. Epigenomic studies performed on cell populations, even when purified, are testing collections of epigenomes, or meta-epigenomes. Our findings show that meta-epigenomic approaches to data analysis can provide insights into cell subpopulation structure. PMID:25327398

  14. A cis-regulatory antisense RNA represses translation in Vibrio cholerae through extensive complementarity and proximity to the target locus.

    Science.gov (United States)

    Chang, Howard; Replogle, John Michael; Vather, Naomi; Tsao-Wu, Maya; Mistry, Ronak; Liu, Jane M

    2015-01-01

    As with all facultative pathogens, Vibrio cholerae must optimize its cellular processes to adapt to different environments with varying carbon sources and to environmental stresses. More specifically, in order to metabolize mannitol, V. cholerae must regulate the synthesis of MtlA, a mannitol transporter protein produced exclusively in the presence of mannitol. We previously showed that a cis-acting small RNA (sRNA) expressed by V. cholerae, MtlS, appears to post-transcriptionally downregulate the expression of mtlA and is produced in the absence of mannitol. We hypothesized that since it is complementary to the 5' untranslated region (UTR) of mtlA mRNA, MtlS may affect synthesis of MtlA by forming an mtlA-MtlS complex that blocks translation of the mRNA through occlusion of its ribosome binding site. To test this hypothesis, we used in vitro translation assays in order to examine the role MtlS plays in mtlA regulation and found that MtlS is sufficient to suppress translation of transcripts harboring the 5' UTR of mtlA. However, in a cellular context, the 5' UTR of mtlA is not sufficient for targeted repression by endogenous MtlS; additional segments from the coding region of mtlA play a role in the ability of the sRNA to regulate translation of mtlA mRNA. Additionally, proximity of transcription sites between the sRNA and mRNA significantly affects the efficacy of MtlS.

  15. In planta analysis of a cis-regulatory cytokinin response motif in Arabidopsis and identification of a novel enhancer sequence.

    Science.gov (United States)

    Ramireddy, Eswarayya; Brenner, Wolfram G; Pfeifer, Andreas; Heyl, Alexander; Schmülling, Thomas

    2013-07-01

    The phytohormone cytokinin plays a key role in regulating plant growth and development, and is involved in numerous physiological responses to environmental changes. The type-B response regulators, which regulate the transcription of cytokinin response genes, are a part of the cytokinin signaling system. Arabidopsis thaliana encodes 11 type-B response regulators (type-B ARRs), and some of them were shown to bind in vitro to the core cytokinin response motif (CRM) 5'-(A/G)GAT(T/C)-3' or, in the case of ARR1, to an extended motif (ECRM), 5'-AAGAT(T/C)TT-3'. Here we obtained in planta proof for the functionality of the latter motif. Promoter deletion analysis of the primary cytokinin response gene ARR6 showed that a combination of two extended motifs within the promoter is required to mediate the full transcriptional activation by ARR1 and other type-B ARRs. CRMs were found to be over-represented in the vicinity of ECRMs in the promoters of cytokinin-regulated genes, suggesting their functional relevance. Moreover, an evolutionarily conserved 27 bp long T-rich region between -220 and -193 bp was identified and shown to be required for the full activation by type-B ARRs and the response to cytokinin. This novel enhancer is not bound by the DNA-binding domain of ARR1, indicating that additional proteins might be involved in mediating the transcriptional cytokinin response. Furthermore, genome-wide expression profiling identified genes, among them ARR16, whose induction by cytokinin depends on both ARR1 and other specific type-B ARRs. This together with the ECRM/CRM sequence clustering indicates cooperative action of different type-B ARRs for the activation of particular target genes. PMID:23620480

  16. A Survey of 6,300 Genomic Fragments for cis-Regulatory Activity in the Imaginal Discs of Drosophila melanogaster

    Directory of Open Access Journals (Sweden)

    Aurélie Jory

    2012-10-01

    Full Text Available Over 6,000 fragments from the genome of Drosophila melanogaster were analyzed for their ability to drive expression of GAL4 reporter genes in the third-instar larval imaginal discs. About 1,200 reporter genes drove expression in the eye, antenna, leg, wing, haltere, or genital imaginal discs. The patterns ranged from large regions to individual cells. About 75% of the active fragments drove expression in multiple discs; 20% were expressed in ventral, but not dorsal, discs (legs, genital, and antenna, whereas ∼23% were expressed in dorsal but not ventral discs (wing, haltere, and eye. Several patterns, for example, within the leg chordotonal organ, appeared a surprisingly large number of times. Unbiased searches for DNA sequence motifs suggest candidate transcription factors that may regulate enhancers with shared activities. Together, these expression patterns provide a valuable resource to the community and offer a broad overview of how transcriptional regulatory information is distributed in the Drosophila genome.

  17. PELTIER ELEMENTS

    CERN Document Server

    Tani, Laurits

    2015-01-01

    To control Peltier elements, temperature controller was used. I used TEC-1091 that was manufactured my Meerstetter Engineering. To gain control with the temperature controller, software had to be intalled on a controlling PC. There were different modes to control the Peltier: Tempererature controller to control temperature, Static current/voltage to control voltage and current and LIVE ON/OFF to auto-tune the controller respectively to the system. Also, since near the collision pipe there is much radiation, radiation-proof Peltier elements have to be used. To gain the best results, I had to find the most efficient Peltier elements and try to get their cold side to -40 degrees Celsius.

  18. Radiographic element

    International Nuclear Information System (INIS)

    Radiographic elements are disclosed having first and second silver halide emulsion layers comprised of a dispersing medium and radiation-sensitive silver halide grains, and a support interposed between said silver halide emulsion layers capable of transmitting radiation to which said second silver halide emulsion layer is responsive. These elements are characterized in that at least said first silver halide emulsion layer contains tabular silver halide grains and spectral sensitizing dye adsorbed to the surface of the grains. Crossover can be improved in relation to the imaging characteristics. (author)

  19. DNA element downstream of the κB site in the Lcn2 promoter is required for transcriptional activation by IκBζ and NF-κB p50.

    Science.gov (United States)

    Kohda, Akira; Yamazaki, Soh; Sumimoto, Hideki

    2014-08-01

    The nuclear protein IκBζ activates transcription of a subset of NF-κB-dependent innate immune genes such as Lcn2 encoding the antibacterial protein lipocalin-2. IκBζ functions as a coactivator via its interaction with NF-κB p50, which contains a DNA-binding Rel-homology domain but lacks a transcriptional activation domain. However cis-regulatory elements involved in IκBζ function have remained unknown. Here, we show that, although IκBζ by itself is unable to associate with the Lcn2 promoter, IκBζ interacts with the promoter via p50 binding to the NF-κB-binding site (κB site) and the interaction also requires the pyrimidine-rich site (CCCCTC) that localizes seven bases downstream of the κB site. The pyrimidine-rich site is also essential for IκBζ-mediated activation of the Lcn2 gene. Introduction of both sites into an IκBζ-independent gene culminates in IκBζ-p50-DNA complex formation and transcriptional activation. Furthermore, spacing between the two sites is crucial for both IκBζ-DNA interaction and IκBζ-mediated gene activation. Thus, the pyrimidine-rich IκBζ-responsive site plays an essential role in productive interaction of IκBζ with the p50-DNA complex.

  20. Radiographic element

    International Nuclear Information System (INIS)

    Radiographic elements are disclosed comprised of first and second silver halide emulsion layers separated by an interposed support capable of transmitting radiation to which the second image portion is responsive. At least the first imaging portion contains a silver halide emulsion in which thin tubular silver halide grains of intermediate aspect ratios (from 5:1 to 8:1) are present. Spectral sensitizing dye is adsorbed to the surface of the tubular grains. Increased photographic speeds can be realized at comparable levels of crossover. (author)

  1. Superheavy elements

    CERN Document Server

    Hofmann, S

    1999-01-01

    The outstanding aim of experimental investigations of heavy nuclei is the exploration of spherical 'SuperHeavy Elements' (SHEs). On the basis of the nuclear shell model, the next double magic shell-closure beyond sup 2 sup 0 sup 8 Pb is predicted at proton numbers between Z=114 and 126 and at neutron number N=184. All experimental efforts aiming at identifying SHEs (Z>=114) were negative so far. A highly sensitive search experiment was performed in November-December 1995 at SHIP. The isotope sup 2 sup 9 sup 0 116 produced by 'radiative capture' was searched for in the course of a 33 days irradiation of a sup 2 sup 0 sup 8 Pb target with sup 8 sup 2 Se projectiles, however, only cross-section limits were measured. Positive results were obtained in experiments searching for elements from 110 to 112 using cold fusion and the 1n evaporation channel. The produced isotopes were unambiguously identified by means of alpha-alpha correlations. Not fission, but alpha emission is the dominant decay mode. The measurement ...

  2. Paucity of chimeric gene-transposable element transcripts in the Drosophila melanogaster genome

    Directory of Open Access Journals (Sweden)

    Petrov Dmitri A

    2005-11-01

    Full Text Available Abstract Background Recent analysis of the human and mouse genomes has shown that a substantial proportion of protein coding genes and cis-regulatory elements contain transposable element (TE sequences, implicating TE domestication as a mechanism for the origin of genetic novelty. To understand the general role of TE domestication in eukaryotic genome evolution, it is important to assess the acquisition of functional TE sequences by host genomes in a variety of different species, and to understand in greater depth the population dynamics of these mutational events. Results Using an in silico screen for host genes that contain TE sequences, we identified a set of 63 mature "chimeric" transcripts supported by expressed sequence tag (EST evidence in the Drosophila melanogaster genome. We found a paucity of chimeric TEs relative to expectations derived from non-chimeric TEs, indicating that the majority (~80% of TEs that generate chimeric transcripts are deleterious and are not observed in the genome sequence. Using a pooled-PCR strategy to assay the presence of gene-TE chimeras in wild strains, we found that over half of the observed chimeric TE insertions are restricted to the sequenced strain, and ~15% are found at high frequencies in North American D. melanogaster populations. Estimated population frequencies of chimeric TEs did not differ significantly from non-chimeric TEs, suggesting that the distribution of fitness effects for the observed subset of chimeric TEs is indistinguishable from the general set of TEs in the genome sequence. Conclusion In contrast to mammalian genomes, we found that fewer than 1% of Drosophila genes produce mRNAs that include bona fide TE sequences. This observation can be explained by the results of our population genomic analysis, which indicates that most potential chimeric TEs in D. melanogaster are deleterious but that a small proportion may contribute to the evolution of novel gene sequences such as nested or

  3. Reference: OCTAMERMOTIFTAH3H4 [PLACE

    Lifescience Database Archive (English)

    Full Text Available OCTAMERMOTIFTAH3H4 Nakayama T, Sakamoto A, Yang P, Minami M, Fujimoto Y, Ito T, Iwa...buchi M Highly conserved hexamer, octamer and nonamer motifs are positive cis-regulatory elements of the whe

  4. Dynamic regulation of the transcription initiation landscape at single nucleotide resolution during vertebrate embryogenesis

    NARCIS (Netherlands)

    C. Nepal (Chirag); Y. Hadzhiev (Yavor); C. Previti (Christopher); V. Haberle (Vanja); N. Li (Nan); H. Takahashi (Hiroyuki); A.M. Suzuki (Ana Maria); Y. Sheng (Ying); R.F. Abdelhamid (Rehab); S. Anand (Santosh); P.A. Gehrig (Paola A.); A. Akalin (Altuna); C. Kockx (Christel); A. Van Der Sloot (Antoine); W.F.J. van IJcken (Wilfred); O. Armant (Olivier); S. Rastegar (Sepand); C. Watson (Craig); U. Strähle (Uwe); E. Stupka (Elia); P. Carninci (Piero); B. Lenhard (Boris); F. Müller (Ferenc)

    2013-01-01

    textabstractSpatiotemporal control of gene expression is central to animal development. Core promoters represent a previously unanticipated regulatory level by interacting with cis-regulatory elements and transcription initiation in different physiological and developmental contexts. Here, we provid

  5. Reference: SRENTTTO1 [PLACE

    Lifescience Database Archive (English)

    Full Text Available SRENTTTO1 Takeda S, Sugimoto K, Otsuki H, Hirochika H A 13-bp cis-regulatory elemen...t in the LTR promoter of the tobacco retrotransposon Tto1 is involved in responsiveness to tissue culture, w

  6. The Ekamanganese elements

    International Nuclear Information System (INIS)

    A recent study tends to revalidate the search for element 43 done in 1925. In ores with properties similar to the hypothetical chemical properties of the missing elements 43 and 75, the unknown elements were concentrated by chemical means. Roentgen-ray spectroscopy was applied in order to observe the characteristic Roentgen L lines for element 75 and K lines for element 43. Element 43 was observed in sperrylith, gadolinit, fergusonit and columbit. The name masurium was proposed. Similarly, element 75 was observed in tantalit, wolframit and platinit. The name rhenium was chosen. (MCB)

  7. Fuel element design handbook

    Energy Technology Data Exchange (ETDEWEB)

    Merckx, K.R.

    1958-09-01

    The economic development of nuclear reactors depends upon the integrated progress in the fields of reactor design, fuel element design, reactor operation, and fuel production and separation. Broad criteria, which restrict the fuel element design, are determined by the mutual consideration of the problems encountered in all the above fields. Hence, no stage of reactor design or operation is independent of the fuel element problem, nor can the fuel element designer disregard the interest of any one field. As an introduction to the fuel element design problem, this chapter describes how the general criteria for a fuel element are determined.

  8. Element-ary Development.

    Science.gov (United States)

    Schamp, Homer W., Jr.

    1989-01-01

    Describes the historic development of the periodic table from the four-element theory to the Lavoisier's table. Presents a table listing the old and new names of chemicals and the Lavoisier's table of elements. Lists two references. (YP)

  9. Data Element Registry Services

    Data.gov (United States)

    U.S. Environmental Protection Agency — Data Element Registry Services (DERS) is a resource for information about value lists (aka code sets / pick lists), data dictionaries, data elements, and EPA data...

  10. Rare (Earth Elements [score

    Directory of Open Access Journals (Sweden)

    Camilo Méndez

    2014-12-01

    Full Text Available Rare (Earth Elements is a cycle of works for solo piano. The cycle was inspired by James Dillon’s Book of Elements (Vol. I-V. The complete cycle will consist of 14 pieces; one for each selected rare (earth element. The chosen elements are Neodymium, Erbium, Tellurium, Hafnium, Tantalum, Technetium, Indium, Dysprosium, Lanthanium, Cerium, Europium, Terbium, Yttrium and Darmstadtium. These elements were selected due to their special atomic properties that in many cases make them extremely valuable for the development of new technologies, and also because of their scarcity. To date, only 4 works have been completed Yttrium, Technetium, Indium and Tellurium.

  11. The synthetic elements

    International Nuclear Information System (INIS)

    Prior to 1940, the heaviest element known was uranium, discovered in 1789. Since that time the elements 93 through 109 have been synthesized and identified and the elements 43, 61, 85, and 87 which were missing form the periodic tables of the 1930's have been discovered. The techniques and problems involved in these discoveries and the placement of the transuranium elements in the periodic table will be discussed. The production and positive identification of elements heavier than Md (Z=101), which have very short half-lives and can only be produced an atom-at-a-time, are very difficult and there have been controversies concerning their discovery. Some of the new methods which have been developed and used in these studies will be described. The prospects for production of still heavier elements will be considered

  12. Elements in biological AMS

    International Nuclear Information System (INIS)

    AMS (Accelerator Mass Spectrometry) provides high detection sensitivity for isotopes whose half-lives are between 10 years and 100 million years. 14C is the most developed of such isotopes and is used in tracing natural and anthropogenic organic compounds in the Earth's biosphere. Thirty-three elements in the main periodic table and 17 lanthanides or actinides have long lived isotopes, providing potential tracers for research in elemental biochemistry. Overlap of biologically interesting heavy elements and possible AMS tracers is discussed

  13. Finite element procedures

    CERN Document Server

    Bathe, Klaus-Jürgen

    2015-01-01

    Finite element procedures are now an important and frequently indispensable part of engineering analyses and scientific investigations. This book focuses on finite element procedures that are very useful and are widely employed. Formulations for the linear and nonlinear analyses of solids and structures, fluids, and multiphysics problems are presented, appropriate finite elements are discussed, and solution techniques for the governing finite element equations are given. The book presents general, reliable, and effective procedures that are fundamental and can be expected to be in use for a long time. The given procedures form also the foundations of recent developments in the field.

  14. Phase constitution and steam corrosion resistance of binary Zr-S alloys

    International Nuclear Information System (INIS)

    The solubility limit of sulfur in alpha zirconium is about 20 ppm. This value is similar to the sulfur content leading to the maximum improvement in creep strength. In amounts up to 850 ppm, sulfur also has an extremely beneficial effect on the steam corrosion resistance at 400 deg. C. Thus, while sulfur in solid solution markedly enhances creep strength, the presence of sulfide precipitates has an additional favorable influence on the corrosion behavior

  15. BSCW Unstructured Mixed Element Grids

    Data.gov (United States)

    National Aeronautics and Space Administration — Corase Grid: Quad Surface Faces= 9360 Tria Surface Faces= 128928 Nodes = 2869187 Total Elements = 9099201 Hex Elements = 0 Pent_5 Elements = 0 Pent_6 Elements =...

  16. Elements of life

    OpenAIRE

    Samuel, J.

    2004-01-01

    A Biography of J.M.W. Turner's life told through the use of the elements. A five screen video installation. This is the Main Screen which was complimented by four video screens to represent each element.Shown at the Community Pharmacy Gallery May 2004.

  17. A dry element

    Energy Technology Data Exchange (ETDEWEB)

    Kimura, T.; Ota, A.

    1983-08-11

    The agglomerate for the element is made from activated charcoal powder, an electrically conducting additive and a neutral electrolyte. The activated charcoal makes up 30 to 50 percent of the weight of the agglomerate. It is a mixture of hydrophobized and unhydrophobized powder in a ratio of 85 to 70 to 15 to 30. The element has high discharge characteristics.

  18. A battery element

    Energy Technology Data Exchange (ETDEWEB)

    Nakai, M.; Koboyasi, S.; Oisi, K.; Okadzaki, R.; Ota, A.

    1983-07-29

    An anode made of an alkaline or an alkaline earth metal and an electrolyte based on an organic solvent are used in the element. A mixture of Mn203 and Mn304 in a 9 to 1 to 3 to 7 ratio serves as the cathode. The element has a stable discharge curve at a nominal voltage of 1.5 volts.

  19. The solar element

    DEFF Research Database (Denmark)

    Kragh, Helge

    2009-01-01

    Apart from hydrogen, helium is the most abundant chemical element in the universe, and yet it was only discovered on the Earth in 1895. Its early history is unique because it encompasses astronomy as well as chemistry, two sciences which the spectroscope brought into contact during the second half...... of the nineteenth century. In the modest form of a yellow spectral line known as D3, 'helium' was sometimes supposed to exist in the Sun's atmosphere, an idea which is traditionally ascribed to J. Norman Lockyer. Did Lockyer discover helium as a solar element? How was the suggestion received by chemists, physicists...... elements might be different. The complex story of how helium became established as both a solar and terrestrial element involves precise observations as well as airy speculations. It is a story that is unique among the discovery histories of the chemical elements....

  20. Discovery of element 112

    Energy Technology Data Exchange (ETDEWEB)

    Hofmann, S. [GSI, Darmstadt (Germany)

    1996-12-31

    The new elements 110, 111, and 112 were synthesized and unambiguously identified in experiments at SHIP. Due to strong shell effects the dominant decay mode is not fission, but emission of alpha particles. Theoretical investigations predict that maximum shell effects should exist in nuclei near proton number 114 and neutron number 184. Measurements give hope that isotopes of element 114 close to the island of spherical Superheavy Elements could be produced by fusion reactions using {sup 118}Pb as target. systematic studies of the reaction cross-sections indicate that transfer of nucleons is the important process to initiate the fusion.

  1. System Elements Heterogeneity

    Directory of Open Access Journals (Sweden)

    Stanislav A. Kuja

    2013-01-01

    Full Text Available The paper deals with the features of the systematic approach development, shows that the systematic approach lacks the definition of system elements divisibility. This fact simplifies the system description. The article shows that, depending on the selection of the criterion of divisibility, different types of elements with different properties are got. Depending on the selection of the criterion of divisibility, the system structure becomes multidimensional. The paper recommends to indicate the criterion of the system divisibility during the systems research. It increases the certainty of the description of a complex system and characterizes the system elements.

  2. Flow Element Models

    DEFF Research Database (Denmark)

    Heiselberg, Per; Nielsen, Peter V.

    Air distribution in ventilated rooms is a flow process that can be divided into different elements such as supply air jets, exhaust flows, thermal plumes, boundary layer flows, infiltration and gravity currents. These flow elements are isolated volumes where the air movement is controlled...... by a restricted number of parameters, and the air movement is fairly independent of the general flow in the enclosure. In many practical situations, the most convenient· method is to design the air distribution system using flow element theory....

  3. Multi-Element Airfoil System

    Science.gov (United States)

    Turner, Travis L. (Inventor); Khorrami, Mehdi R. (Inventor); Lockard, David P. (Inventor); McKenney, Martin J. (Inventor); Atherley, Raymond D. (Inventor); Kidd, Reggie T. (Inventor)

    2014-01-01

    A multi-element airfoil system includes an airfoil element having a leading edge region and a skin element coupled to the airfoil element. A slat deployment system is coupled to the slat and the skin element, and is capable of deploying and retracting the slat and the skin element. The skin element substantially fills the lateral gap formed between the slat and the airfoil element when the slat is deployed. The system further includes an uncoupling device and a sensor to remove the skin element from the gap based on a critical angle-of-attack of the airfoil element. The system can alternatively comprise a trailing edge flap, where a skin element substantially fills the lateral gap between the flap and the trailing edge region of the airfoil element. In each case, the skin element fills a gap between the airfoil element and the deployed flap or slat to reduce airframe noise.

  4. Solar cell element

    Energy Technology Data Exchange (ETDEWEB)

    Nakano, Akihiko; Matsumoto, Hitoshi; Uda, Hiroshi; Komatsu, Yasumitsu; Ikegami, Kiyoharu.

    1989-05-18

    In the existing CdS/CdTe-based solar cell element, nothing is formed except the component effective for generating electromotive force and the components necessary for leading, collecting and extracting the generated electricity, hence even when the element shows deterioration of its performance during its usage, it has been difficult to analyze the above situation. In addition, it has also a defect that its characteristic such as the transfer efficiency in the neighborhood of its glass substrate in connection also with its manufacturing process. In order to solve the above problematical points, this invention proposes, with regard to a CdS-based solar cell element composed by forming a thin film on its substrate, to make a blank space on the above substrate and form thereon a thin film which composes the solar cell element concerned alone or in a piling up manner. 4 figs.

  5. Structural elements design manual

    CERN Document Server

    Draycott, Trevor

    2012-01-01

    Gives clear explanations of the logical design sequence for structural elements. The Structural Engineer says: `The book explains, in simple terms, and with many examples, Code of Practice methods for sizing structural sections in timber, concrete,masonry and steel. It is the combination into one book of section sizing methods in each of these materials that makes this text so useful....Students will find this an essential support text to the Codes of Practice in their study of element sizing'.

  6. Creativity Management Key Elements

    OpenAIRE

    Fuchs Ángeles, Rosa María; Franceso Tonetti, Federico Carlo

    2015-01-01

    Organizations are constantly looking towards innovation. In order to reach it they must foment creativity. This paper analyzes a series of elements considered in the organizational creativity management and proposes a model with the indispensable factors that organizations should consider to reach it. These elements are: culture and organizational environment, strategy, structure, communication, relation with customers, human resources (recruiting, training, job design, compensation, promotio...

  7. New roof element system

    DEFF Research Database (Denmark)

    Ditlev, Jesper; Rudbeck, Claus Christian

    1997-01-01

    The aim of the project has been to develop an element system for warm deck roofs which, from a thermal and economical point of view, can deal with the future demands for heat loss coefficients for low slope roofs.......The aim of the project has been to develop an element system for warm deck roofs which, from a thermal and economical point of view, can deal with the future demands for heat loss coefficients for low slope roofs....

  8. Atoms, molecules & elements

    CERN Document Server

    Graybill, George

    2007-01-01

    Young scientists will be thrilled to explore the invisible world of atoms, molecules and elements. Our resource provides ready-to-use information and activities for remedial students using simplified language and vocabulary. Students will label each part of the atom, learn what compounds are, and explore the patterns in the periodic table of elements to find calcium (Ca), chlorine (Cl), and helium (He) through hands-on activities.

  9. A battery element

    Energy Technology Data Exchange (ETDEWEB)

    Vatanabe, U.; Aoki, K.; Ito, K.; Ogava, K.; Okadzaki, R.

    1983-07-29

    An anode made of a light metal is used in the element, along with an anhydrous liquid electrolyte and a cathode made of CuC12(CFn)x or another material. The current tap of the anode is made from aluminum, gold, silver or another metal of the platinum group and the current tap may be coated with this metal. The thickness of the coating is 0.1 to 1 micrometer. The element has a long storage life.

  10. The Middle Pivot Element Algorithm

    OpenAIRE

    Anchala Kumari; Soubhik Chakraborty

    2012-01-01

    This paper is an improvement over the previous work on New Sorting Algorithm first proposed by Sundararajan and Chakraborty (2007). Here we have taken the pivot element as the middle element of the array. We call this improved version Middle Pivot Element Algorithm (MPA) and it is found that MPA is much faster than the two algorithms RPA (Random Pivot element Algorithm) and FPA (First Pivot element Algorithm) in which the pivot element was selected either randomly or as the first element, res...

  11. Solar energy - design element

    International Nuclear Information System (INIS)

    The main focus of this study is the theoretical examination of the possibilities of applying technological, functional, aesthetic and energy resources in elements of urban design. Designed solutions are treated as part of the overall optimization of architectural elements and urban space, in which technological development enables the use of certain energy potentials of elements of urban design. The paper presents student hypothetical design models of urban architectural elements with integrated photovoltaic modules. The analytical procedure was applied in the analysis of student work in a seminar of the first year of master studies at the Faculty of Architecture. The aim is to improve students' awareness of the need for proper handling of energy and the possibility of integration with other architectural elements. The research and the results have enabled further work on the sustainable development of architectural elements with a focus on the use of solar energy by promoting the modern design approach. Key words: PV module, teaching, solar energy, urban design

  12. Advanced finite element technologies

    CERN Document Server

    Wriggers, Peter

    2016-01-01

    The book presents an overview of the state of research of advanced finite element technologies. Besides the mathematical analysis, the finite element development and their engineering applications are shown to the reader. The authors give a survey of the methods and technologies concerning efficiency, robustness and performance aspects. The book covers the topics of mathematical foundations for variational approaches and the mathematical understanding of the analytical requirements of modern finite element methods. Special attention is paid to finite deformations, adaptive strategies, incompressible, isotropic or anisotropic material behavior and the mathematical and numerical treatment of the well-known locking phenomenon. Beyond that new results for the introduced approaches are presented especially for challenging nonlinear problems.

  13. Computing Heavy Elements

    CERN Document Server

    Schunck, N; Kortelainen, M; McDonnell, J; Moré, J; Nazarewicz, W; Pei, J; Sarich, J; Sheikh, J; Staszczak, A; Stoitsov, M; Wild, S M

    2011-01-01

    Reliable calculations of the structure of heavy elements are crucial to address fundamental science questions such as the origin of the elements in the universe. Applications relevant for energy production, medicine, or national security also rely on theoretical predictions of basic properties of atomic nuclei. Heavy elements are best described within the nuclear density functional theory (DFT) and its various extensions. While relatively mature, DFT has never been implemented in its full power, as it relies on a very large number (~ 10^9-10^12) of expensive calculations (~ day). The advent of leadership-class computers, as well as dedicated large-scale collaborative efforts such as the SciDAC 2 UNEDF project, have dramatically changed the field. This article gives an overview of the various computational challenges related to the nuclear DFT, as well as some of the recent achievements.

  14. Elemental analysis in biotechnology.

    Science.gov (United States)

    Hann, Stephan; Dernovics, Mihaly; Koellensperger, Gunda

    2015-02-01

    This article focuses on analytical strategies integrating atomic spectroscopy in biotechnology. The rationale behind developing such methods is inherently linked to unique features of the key technique in elemental analysis, which is inductively coupled plasma mass spectrometry: (1) the high sensitivity and selectivity of state of the art instrumentation, (2) the possibility of accurate absolute quantification even in complex matrices, (3) the capability of combining elemental detectors with chromatographic separation methods and the versatility of the latter approach, (4) the complementarity of inorganic and organic mass spectrometry, (5) the multi-element capability and finally (6) the capability of isotopic analysis. The article highlights the most recent bio-analytical developments exploiting these methodological advantages and shows the potential in biotechnological applications.

  15. Osteoporosis and trace elements

    DEFF Research Database (Denmark)

    Aaseth, J.; Boivin, G.; Andersen, Ole

    2012-01-01

    More than 200 million people are affected by osteoporosis worldwide, as estimated by 2 million annual hip fractures and other debilitating bone fractures (vertebrae compression and Colles' fractures). Osteoporosis is a multi-factorial disease with potential contributions from genetic, endocrine...... functional, exercise related and nutritional factors. Of particular considerations are calcium (Ca) status, vitamin D, fluoride, magnesium and other trace elements. Several trace elements such as zinc and copper are essential for normal development of the skeleton in humans and animals. Fluoride accumulates...... in new bone and results in a net gain in bone mass, but may be associated with a tissue of poor quality. Aluminum induces impairment of bone formation. Gallium and cadmium suppresses bone turnover. However, exact involvements of the trace elements in osteoporosis have not yet been fully clarified...

  16. An alkaline element

    Energy Technology Data Exchange (ETDEWEB)

    Arita, T.; Murakami, K.; Okha, K.

    1983-04-28

    A cathode with a dual layer active mass is installed in the disk shaped alkaline silver and zinc element. The first layer, which is turned towards the anode, contains 85 parts Ag2O, 5 parts electrolytic MnO2 and 10 parts graphite. The second layer, which contacts the bottom of the element, contains 35 parts Ag2O, 60 parts electrolytic MnO2 and 5 parts graphite. The electrical capacity of the first and second layers is 60 and 40, respectively. The first layer may be discharged with a high current density and the second layer with less current density. The element has high characteristics with comparatively low cost.

  17. Fuel Element Technical Manual

    Energy Technology Data Exchange (ETDEWEB)

    Burley, H.H. [ed.

    1956-08-01

    It is the purpose of the Fuel Element Technical Manual to Provide a single document describing the fabrication processes used in the manufacture of the fuel element as well as the technical bases for these processes. The manual will be instrumental in the indoctrination of personnel new to the field and will provide a single data reference for all personnel involved in the design or manufacture of the fuel element. The material contained in this manual was assembled by members of the Engineering Department and the Manufacturing Department at the Hanford Atomic Products Operation between the dates October, 1955 and June, 1956. Arrangement of the manual. The manual is divided into six parts: Part I--introduction; Part II--technical bases; Part III--process; Part IV--plant and equipment; Part V--process control and improvement; and VI--safety.

  18. Intelligent Elements for ISHM

    Science.gov (United States)

    Schmalzel, John L.; Morris, Jon; Turowski, Mark; Figueroa, Fernando; Oostdyk, Rebecca

    2008-01-01

    There are a number of architecture models for implementing Integrated Systems Health Management (ISHM) capabilities. For example, approaches based on the OSA-CBM and OSA-EAI models, or specific architectures developed in response to local needs. NASA s John C. Stennis Space Center (SSC) has developed one such version of an extensible architecture in support of rocket engine testing that integrates a palette of functions in order to achieve an ISHM capability. Among the functional capabilities that are supported by the framework are: prognostic models, anomaly detection, a data base of supporting health information, root cause analysis, intelligent elements, and integrated awareness. This paper focuses on the role that intelligent elements can play in ISHM architectures. We define an intelligent element as a smart element with sufficient computing capacity to support anomaly detection or other algorithms in support of ISHM functions. A smart element has the capabilities of supporting networked implementations of IEEE 1451.x smart sensor and actuator protocols. The ISHM group at SSC has been actively developing intelligent elements in conjunction with several partners at other Centers, universities, and companies as part of our ISHM approach for better supporting rocket engine testing. We have developed several implementations. Among the key features for these intelligent sensors is support for IEEE 1451.1 and incorporation of a suite of algorithms for determination of sensor health. Regardless of the potential advantages that can be achieved using intelligent sensors, existing large-scale systems are still based on conventional sensors and data acquisition systems. In order to bring the benefits of intelligent sensors to these environments, we have also developed virtual implementations of intelligent sensors.

  19. Elements of linear space

    CERN Document Server

    Amir-Moez, A R; Sneddon, I N

    1962-01-01

    Elements of Linear Space is a detailed treatment of the elements of linear spaces, including real spaces with no more than three dimensions and complex n-dimensional spaces. The geometry of conic sections and quadric surfaces is considered, along with algebraic structures, especially vector spaces and transformations. Problems drawn from various branches of geometry are given.Comprised of 12 chapters, this volume begins with an introduction to real Euclidean space, followed by a discussion on linear transformations and matrices. The addition and multiplication of transformations and matrices a

  20. Finite elements and approximation

    CERN Document Server

    Zienkiewicz, O C

    2006-01-01

    A powerful tool for the approximate solution of differential equations, the finite element is extensively used in industry and research. This book offers students of engineering and physics a comprehensive view of the principles involved, with numerous illustrative examples and exercises.Starting with continuum boundary value problems and the need for numerical discretization, the text examines finite difference methods, weighted residual methods in the context of continuous trial functions, and piecewise defined trial functions and the finite element method. Additional topics include higher o

  1. Finite element analysis

    CERN Document Server

    2010-01-01

    Finite element analysis is an engineering method for the numerical analysis of complex structures. This book provides a bird's eye view on this very broad matter through 27 original and innovative research studies exhibiting various investigation directions. Through its chapters the reader will have access to works related to Biomedical Engineering, Materials Engineering, Process Analysis and Civil Engineering. The text is addressed not only to researchers, but also to professional engineers, engineering lecturers and students seeking to gain a better understanding of where Finite Element Analysis stands today.

  2. Rocket propulsion elements

    CERN Document Server

    Sutton, George P

    2011-01-01

    The definitive text on rocket propulsion-now revised to reflect advancements in the field For sixty years, Sutton's Rocket Propulsion Elements has been regarded as the single most authoritative sourcebook on rocket propulsion technology. As with the previous edition, coauthored with Oscar Biblarz, the Eighth Edition of Rocket Propulsion Elements offers a thorough introduction to basic principles of rocket propulsion for guided missiles, space flight, or satellite flight. It describes the physical mechanisms and designs for various types of rockets' and provides an unders

  3. An alkaline element

    Energy Technology Data Exchange (ETDEWEB)

    Obi, F.

    1983-09-29

    A current tap pressed into the anode is installed in the central part of the top of the element. There is an internal top made of plastic under the top. There is a projection in the center of the top with an opening, through which the current tap is passed. The edge of the plastic top serves as an insulation lining between the metallic top and the body, which serves as the current tap for the cathode. A separator is placed between the anode and the cathode. Electrolyte leaks are prevented in the slotted disk elements.

  4. A saturation screen for cis-acting regulatory DNA in the Hox genes of Ciona intestinalis

    Energy Technology Data Exchange (ETDEWEB)

    Keys, David N.; Lee, Byung-in; Di Gregorio, Anna; Harafuji, Naoe; Detter, Chris; Wang, Mei; Kahsai, Orsalem; Ahn, Sylvia; Arellano, Andre; Zhang, Quin; Trong, Stephan; Doyle, Sharon A.; Satoh, Noriyuki; Satou, Yutaka; Saiga, Hidetoshi; Christian, Allen; Rokhsar, Dan; Hawkins, Trevor L.; Levine, Mike; Richardson, Paul

    2005-01-05

    A screen for the systematic identification of cis-regulatory elements within large (>100 kb) genomic domains containing Hox genes was performed by using the basal chordate Ciona intestinalis. Randomly generated DNA fragments from bacterial artificial chromosomes containing two clusters of Hox genes were inserted into a vector upstream of a minimal promoter and lacZ reporter gene. A total of 222 resultant fusion genes were separately electroporated into fertilized eggs, and their regulatory activities were monitored in larvae. In sum, 21 separable cis-regulatory elements were found. These include eight Hox linked domains that drive expression in nested anterior-posterior domains of ectodermally derived tissues. In addition to vertebrate-like CNS regulation, the discovery of cis-regulatory domains that drive epidermal transcription suggests that C. intestinalis has arthropod-like Hox patterning in the epidermis.

  5. Beam transport elements

    CERN Multimedia

    1965-01-01

    Two of the beam transport elements for the slow ejection system. On the left, a quadrupole 1.2 m long with a 5 cm aperture, capable of producing a gradient of 5000 gauss. On the right, a 1 m bending magnet with a 4 cm gap; its field is 20 000 gauss.

  6. NEUTRONIC REACTOR FUEL ELEMENT

    Science.gov (United States)

    Picklesimer, M.L.; Thurber, W.C.

    1961-01-01

    A chemically nonreactive fuel composition for incorporation in aluminum- clad, plate type fuel elements for neutronic reactors is described. The composition comprises a mixture of aluminum and uranium carbide particles, the uranium carbide particles containing at least 80 wt.% UC/sub 2/.

  7. Inside finite elements

    CERN Document Server

    Weiser, Martin

    2016-01-01

    All relevant implementation aspects of finite element methods are discussed in this book. The focus is on algorithms and data structures as well as on their concrete implementation. Theory is covered as far as it gives insight into the construction of algorithms. Throughout the exercises a complete FE-solver for scalar 2D problems will be implemented in Matlab/Octave.

  8. Elemental Chem Lab

    Science.gov (United States)

    Franco Mariscal, Antonio Joaquin

    2008-01-01

    This educative material uses the symbols of 45 elements to spell the names of 32 types of laboratory equipment usually found in chemical labs. This teaching material has been divided into three puzzles according to the type of the laboratory equipment: (i) glassware as reaction vessels or containers; (ii) glassware for measuring, addition or…

  9. Movies and Literary Elements.

    Science.gov (United States)

    Keller, Rodney D.

    1987-01-01

    Recommends using movie clips to stimulate students' interest in reading a novel as well as to teach elements of fiction such as plot, character, setting, symbol, irony, and theme. Describes each clip and provides study questions. Includes a listing of movies made from books. (NH)

  10. Production of transuranium elements

    International Nuclear Information System (INIS)

    The Radiochemical Engineering Development Center (REDC) has the programmatic responsibility for the Department of Energy's Transuranium Element Program. Principle elements from the program are einsteinium, berkelium, and fermium. Targets containing curium oxide mixed with aluminum powder are fabricated by the REDC and irradiated in the Oak Ridge National Laboratory (ORNL) High Flux Isotope Reactor. Following an irradiation period of 6-12 months, targets are returned to the REDC for chemical processing. Processing operations consists of aluminum dejacketing in a caustic-nitrate solution, filtration, acid dissolution, solvent extraction, anion exchange, and finally a cation exchange to recover the actinides. The processing operations take place in heavily shielded hot cell facilities and all operations are carried out remotely. The chemistry for the separations has been well established over the 26-yr. operating life of the facility

  11. ELEMENTS OF MARKETING

    OpenAIRE

    Ramakrishna Mohan Rao Munaga

    2014-01-01

    The marketing thinking starts with customer’s needs. Today the customer is on the driver’s seat. It is also because of the change in the demand supply equation. Now the demand is less than supply just reverse to the past times situation. Today each marketer wants to retain and satisfy the customer because of the intense competition. The marketing elements are Needs, Wants, Demands, Products, Value, Exchange, Transaction and Relationship, Market, Marketers.

  12. Quantum theory elements

    CERN Document Server

    Bates, David Robert

    1962-01-01

    Quantum Theory: A Treatise in Three Volumes, I: Elements focuses on the principles, methodologies, and approaches involved in quantum theory, including quantum mechanics, linear combinations, collisions, and transitions. The selection first elaborates on the fundamental principles of quantum mechanics, exactly soluble bound state problems, and continuum. Discussions focus on delta function normalization, spherically symmetric potentials, rectangular potential wells, harmonic oscillators, spherically symmetrical potentials, Coulomb potential, axiomatic basis, consequences of first three postula

  13. Nuclear reactor fuel elements

    International Nuclear Information System (INIS)

    A nuclear reactor fuel element comprising a column of vibration compacted fuel which is retained in consolidated condition by a thimble shaped plug. The plug is wedged into gripping engagement with the wall of the sheath by a wedge. The wedge material has a lower coefficient of expansion than the sheath material so that at reactor operating temperature the retainer can relax sufficient to accommodate thermal expansion of the column of fuel. (author)

  14. Nuclear fuel element

    Science.gov (United States)

    Meadowcroft, Ronald Ross; Bain, Alastair Stewart

    1977-01-01

    A nuclear fuel element wherein a tubular cladding of zirconium or a zirconium alloy has a fission gas plenum chamber which is held against collapse by the loops of a spacer in the form of a tube which has been deformed inwardly at three equally spaced, circumferential positions to provide three loops. A heat resistant disc of, say, graphite separates nuclear fuel pellets within the cladding from the plenum chamber. The spacer is of zirconium or a zirconium alloy.

  15. A sealing element

    Energy Technology Data Exchange (ETDEWEB)

    Obi, F.; Takada, K.

    1983-09-22

    A sealing lining made of a mixture of polyethylene or polypropylene with an additive which prevents destruction of the lining is used in the element. The content of the additive in the mixture is 10 to 30 percent by mass. The additive basically consists of polyethylene. Carboxyl groups are introduced into the polymer as an anion and sodium, potassium and molybdenum are introduced as the cation.

  16. The transuranium elements

    International Nuclear Information System (INIS)

    In this paper Seaborg's actinide hypothesis is traced from its beginnings to the present. The wealth of spectroscopic and magnetic data accumulated over the years leads to conclusions about the electronic structure of the actinides. These investigations include spectroscopic studies of gaseous atoms and ions, as well as of solutions and compounds, and magnetic susceptibility and electron spin resonance studies of metals, alloys, and compounds. Both experimental and theoretical studies have resulted in accurate values for spin-orbit coupling and crystal-field parameters for 5f electrons, for example, which can be compared with values characteristic of 4f electrons. For instance, the somewhat greater spatial extent of 5f versus 4f wave functions gives rise to 5f orbital participation in the bonding of actinide element organometallic compounds and leads to an extensive and intricate organometallic chemistry for this group of elements. The rich chemistry of Np and Pu provides new insights into electronic structure and the unique nature of 5f electrons yields exciting findings in the exploration of the chemistry of the actinide elements

  17. Helium the disappearing element

    CERN Document Server

    Sears, Wheeler M

    2015-01-01

    The subject of the book is helium, the element, and its use in myriad applications including MRI machines, particle accelerators, space telescopes, and of course balloons and blimps. It was at the birth of our Universe, or the Big Bang, where the majority of cosmic helium was created; and stellar helium production continues. Although helium is the second most abundant element in the Universe, it is actually quite rare here on Earth and only exists because of radioactive elements deep within the Earth. This book includes a detailed history of the discovery of helium, of the commercial industry built around it, how the helium we actually encounter is produced within the Earth, and the state of the helium industry today. The gas that most people associate with birthday party balloons is running out. “Who cares?” you might ask. Well, without helium, MRI machines could not function, rockets could not go into space, particle accelerators such as those used by CERN could not operate, fiber optic cables would not...

  18. The transuranium elements: From neptunium and plutonium to element 112

    Energy Technology Data Exchange (ETDEWEB)

    Hoffman, D.C. [California Univ., Berkeley, CA (United States)]|[Lawrence Livermore National Lab., CA (United States)

    1996-07-26

    Beginning in the 1930`s, both chemists and physicists became interested in synthesizing new artificial elements. The first transuranium element, Np, was synthesized in 1940. Over the past six decades, 20 transuranium elements have been produced. A review of the synthesis is given. The procedure of naming the heavy elements is also discussed. It appears feasible to produce elements 113 and 114. With the Berkeley Gas-filled Separator, it should be possible to reach the superheavy elements in the region of the spherical Z=114 shell, but with fewer neutrons than the N=184 spherical shell. 57 refs, 6 figs.

  19. Method of securing filter elements

    Energy Technology Data Exchange (ETDEWEB)

    Brown, Erik P.; Haslam, Jeffery L.; Mitchell, Mark A.

    2016-10-04

    A filter securing system including a filter unit body housing; at least one tubular filter element positioned in the filter unit body housing, the tubular filter element having a closed top and an open bottom; a dimple in either the filter unit body housing or the top of the tubular filter element; and a socket in either the filter unit body housing or the top of the tubular filter element that receives the dimple in either the filter unit body housing or the top of the tubular filter element to secure the tubular filter element to the filter unit body housing.

  20. Elements of analytical dynamics

    CERN Document Server

    Kurth, Rudolph; Stark, M

    1976-01-01

    Elements of Analytical Dynamics deals with dynamics, which studies the relationship between motion of material bodies and the forces acting on them. This book is a compilation of lectures given by the author at the Georgia and Institute of Technology and formed a part of a course in Topological Dynamics. The book begins by discussing the notions of space and time and their basic properties. It then discusses the Hamilton-Jacobi theory and Hamilton's principle and first integrals. The text concludes with a discussion on Jacobi's geometric interpretation of conservative systems. This book will

  1. Analytical elements of mechanics

    CERN Document Server

    Kane, Thomas R

    2013-01-01

    Analytical Elements of Mechanics, Volume 1, is the first of two volumes intended for use in courses in classical mechanics. The books aim to provide students and teachers with a text consistent in content and format with the author's ideas regarding the subject matter and teaching of mechanics, and to disseminate these ideas. The book opens with a detailed exposition of vector algebra, and no prior knowledge of this subject is required. This is followed by a chapter on the topic of mass centers, which is presented as a logical extension of concepts introduced in connection with centroids. A

  2. Elements of probability theory

    CERN Document Server

    Rumshiskii, L Z

    1965-01-01

    Elements of Probability Theory presents the methods of the theory of probability. This book is divided into seven chapters that discuss the general rule for the multiplication of probabilities, the fundamental properties of the subject matter, and the classical definition of probability. The introductory chapters deal with the functions of random variables; continuous random variables; numerical characteristics of probability distributions; center of the probability distribution of a random variable; definition of the law of large numbers; stability of the sample mean and the method of moments

  3. [Healthcare marketing elements].

    Science.gov (United States)

    Ameri, Cinzia; Fiorini, Fulvio

    2014-01-01

    Marketing puts its foundation on a few key concepts: need-demand, product-service, satisfaction, exchange, market, or business structure manufacturing / supply. The combination of these elements allows you to build an effective marketing strategy. Crucial in this respect is to remember the Porter matrix, which shows that for a correct analysis of the relevant market is necessary to refer to the "five forces at play", ie: customers, competitors, new entrants and substitutes threat. Another key lever for proper marketing oriented approach is the continuous and constant monitoring of the application, anticipating their dissatisfactions.

  4. [Healthcare marketing elements].

    Science.gov (United States)

    Ameri, Cinzia; Fiorini, Fulvio

    2014-01-01

    Marketing puts its foundation on a few key concepts: need-demand, product-service, satisfaction, exchange, market, or business structure manufacturing / supply. The combination of these elements allows you to build an effective marketing strategy. Crucial in this respect is to remember the Porter matrix, which shows that for a correct analysis of the relevant market is necessary to refer to the "five forces at play", ie: customers, competitors, new entrants and substitutes threat. Another key lever for proper marketing oriented approach is the continuous and constant monitoring of the application, anticipating their dissatisfactions. PMID:24777920

  5. Elements of energy conversion

    CERN Document Server

    Russell, Charles R

    2013-01-01

    Elements of Energy Conversion brings together scattered information on the subject of energy conversion and presents it in terms of the fundamental thermodynamics that apply to energy conversion by any process. Emphasis is given to the development of the theory of heat engines because these are and will remain most important power sources. Descriptive material is then presented to provide elementary information on all important energy conversion devices. The book contains 10 chapters and opens with a discussion of forms of energy, energy sources and storage, and energy conversion. This is foll

  6. Extractability of risk elements and nutrition elements from ash

    OpenAIRE

    Hrma, Jiří

    2012-01-01

    The thesis „Extractability of risk elements and nutrition elements from ash“ studies the determination of physicochemical properties of ash and compares the mobility of heavy metals and nutrition elements in various samples. The aim of the study was to determine the extractability of heavy metals and nutrition elements from biomass ash and their chemical speciation using sequential extraction procedure based upon Tessier which was modified for given matrix. The results permit to classify m...

  7. Ring-laser gyroscope system using dispersive element(s)

    Science.gov (United States)

    Smith, David D. (Inventor)

    2010-01-01

    A ring-laser gyroscope system includes a ring-laser gyroscope (RLG) and at least one dispersive element optically coupled to the RLG's ring-shaped optical path. Each dispersive element has a resonant frequency that is approximately equal to the RLG's lasing frequency. A group index of refraction defined collectively by the dispersive element(s) has (i) a real portion that is greater than zero and less than one, and (ii) an imaginary portion that is less than zero.

  8. Fundamental Atomtronic Circuit Elements

    Science.gov (United States)

    Lee, Jeffrey; McIlvain, Brian; Lobb, Christopher; Hill, Wendell T., III

    2012-06-01

    Recent experiments with neutral superfluid gases have shown that it is possible to create atomtronic circuits analogous to existing superconducting circuits. The goals of these experiments are to create complex systems such as Josephson junctions. In addition, there are theoretical models for active atomtronic components analogous to diodes, transistors and oscillators. In order for any of these devices to function, an understanding of the more fundamental atomtronic elements is needed. Here we describe the first experimental realization of these more fundamental elements. We have created an atomtronic capacitor that is discharged through a resistance and inductance. We will discuss a theoretical description of the system that allows us to determine values for the capacitance, resistance and inductance. The resistance is shown to be analogous to the Sharvin resistance, and the inductance analogous to kinetic inductance in electronics. This atomtronic circuit is implemented with a thermal sample of laser cooled rubidium atoms. The atoms are confined using what we call free-space atom chips, a novel optical dipole trap produced using a generalized phase-contrast imaging technique. We will also discuss progress toward implementing this atomtronic system in a degenerate Bose gas.

  9. NIH Common Data Elements Repository

    Data.gov (United States)

    U.S. Department of Health & Human Services — The NIH Common Data Elements (CDE) Repository has been designed to provide access to structured human and machine-readable definitions of data elements that have...

  10. Trace element emissions from coal

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2012-09-15

    Trace elements are emitted during coal combustion. The quantity, in general, depends on the physical and chemical properties of the element itself, the concentration of the element in the coal, the combustion conditions and the type of particulate control device used, and its collection efficiency as a function of particle size. Some trace elements become concentrated in certain particle streams following combustion such as bottom ash, fly ash, and flue gas particulate matter, while others do not. Various classification schemes have been developed to describe this partitioning behaviour. These classification schemes generally distinguish between: Class 1: elements that are approximately equally concentrated in the fly ash and bottom ash, or show little or no fine particle enrichment, examples include Mn, Be, Co and Cr; Class 2: elements that are enriched in the fly ash relative to bottom ash, or show increasing enrichment with decreasing particle size, examples include As, Cd, Pb and Sb; Class 3: elements which are emitted in the gas phase (primarily Hg (not discussed in this review), and in some cases, Se). Control of class 1 trace elements is directly related to control of total particulate matter emissions, while control of the class 2 elements depends on collection of fine particulates. Due to the variability in particulate control device efficiencies, emission rates of these elements can vary substantially. The volatility of class 3 elements means that particulate controls have only a limited impact on the emissions of these elements.

  11. Accelerator vacuum system elements

    International Nuclear Information System (INIS)

    Some elements of vacuum systems are investigated. Considerable attention has been given to the investigation into peculiarities in pumping out of a ionoguide for transportation of an accelerated charged particles beam the spread of which often attains a considerable length. The number of pumps over the ionoguide length is experimentally determined. It is shown that as a result of ionoguide warm-up the pumping out time is considerably reduced maximum permissible pressure is decreased by two orders and lesser rate of pump pumping out is required. The investigations have shown that when operating the ionoguide there is no necessity in setting up seals between the ionoguide and magnetodischarged pump. The causes of the phenomenon in which the pressure near the pump is greater than in the end of the ionoguide, are impurities carried in by the pump into the ionoguide volume and the pumping out capacity of the pressure converter

  12. Finite element modelling

    International Nuclear Information System (INIS)

    The Finite Element Method (FEM) is a numerical technique for finding approximate solutions to boundary value problems. While FEM is commonly used to solve solid mechanics equations, it can be applied to a large range of BVPs from many different fields. FEM has been used for reactor fuels modelling for many years. It is most often used for fuel performance modelling at the pellet and pin scale, however, it has also been used to investigate properties of the fuel material, such as thermal conductivity and fission gas release. Recently, the United Stated Department Nuclear Energy Advanced Modelling and Simulation Program has begun using FEM as the basis of the MOOSE-BISON-MARMOT Project that is developing a multi-dimensional, multi-physics fuel performance capability that is massively parallel and will use multi-scale material models to provide a truly predictive modelling capability. (authors)

  13. Heavy-element research

    International Nuclear Information System (INIS)

    The status is reported of studies on the solid-state chemistry of the actinides and lanthanides, spectroscopy of actinide compounds, and dynamic chemical description of actinide elements in solution. Phase studies were done on Rb2UO4, K2UO4, Li2UO4, and Es2U2O7. The lithium neptunate (VI) system was investigated and the existence of Li2NpO4 was established. In oxidation-reduction studies it was shown that Am(III) can be electrolytically oxidized to Am(IV) in strong H3PO4, but Cf(III) and Pr(III) do not oxidize. The low-temperature absorption spectrum of thin films of NpBr3 was investigated. (U.S.)

  14. Nuclear reactor fuel element

    International Nuclear Information System (INIS)

    The grid-shaped spacer for PWR fuel elements consists of flat, upright metal bars at right angles to the fuel rods. In one corner of a grid mesh it has a spring with two end parts for the fuel rod. The cut-outs for the end parts start from an end edge of the metal bar parallel to the fuel rods. The transverse metal bar is one of four outer metal bars. Both end parts of the spring have an extension parallel to this outer metal arm, which grips a grid mesh adjacent to this grid mesh at the side in one corner of the spacer and forms an end part of a spring for the fuel rod there on the inside of the outer metal bar. (HP)

  15. The fantastic four.. elements

    Science.gov (United States)

    Marsili, Antonella; D'Addezio, Giuliana; Rubbia, Giuliana; Ramieri, Caterina; Todaro, Riccardo; Scipilliti, Francesca; Tosto, Eleonora

    2015-04-01

    With a "Sunday between territory and music to 'National Institute of Geophysics and Volcanology," October 12, 2014 the headquarters of INGV Roma kicked off the activities of the second edition of the Week of Planet Earth. The laboratory of scientific outreach and museum activities together with volunteers of the National Civil Service have organized the whole day dedicated to the dissemination of earth sciences, involving adults and children. Especially for primary school children a laboratory was made involving three amusing activities all aimed at inspiring respect for the Earth: a theatrical representation called "The Fantastic 4... elements", a behavioral game and a nursery rhyme reading. The theater as a means of communication of science is an innovative and creative way to introduce children to important scientific concepts. The use of this methodology and simple language favoring the emotional involvement of the child facilitating learning. The main character is a child, chosen to facilitate the identification of the spectators with the protagonist, that through a fantastic journey discovers the importance of the four elements of our planet: earth, fire, air and water. As a second step, volunteers involved children in reading a nursery rhyme "the ABC to become a Friend of the Earth" inviting them to protect and respect the environment and its resources. Finally, the behavioral game gave indications about behaviors to adopt to safeguard the planet. Volunteers introduced a billboard divided into two colors, green to indicate the right behaviors and red for the wrong ones. Each child, after reading a card with indication on the behavior to adopt, had to decide if they were correct or not with respect to the environment safeguard. After listening to the children's answer, the volunteer gave the correct explanation about the appropriate behavior to adopt. At the end of the activities, each child received a certificate as "a friend of Planet Earth".

  16. Novel high-performance element in the electromagnetic finite-element method--node-edge element

    Institute of Scientific and Technical Information of China (English)

    Sheng Xinqing; Peng Zhen

    2008-01-01

    It is known in the computational electromagnetics (CEM) that the node element has a relative well-conditioned matrix,but suffers from the spurious solution problem; whereas the edge element has no spurious solutions,but usually produces an ill-conditioned matrix.Particularly,when the mesh is over dense,the iterative solution of the matrix equation from edge element converges very slowly.Based on the node element and edge element,a node-edge element is presented,which has no spurious solutions and better-conditioned matrix.Numerical experiments demonstrate that the proposed node-edge element is more efficient than now-widely used edge element.

  17. An element by element spectral element method for elastic wave modeling

    Institute of Scientific and Technical Information of China (English)

    LIN Weijun; WANG Xiuming; ZHANG Hailan

    2006-01-01

    The spectral element method which combines the advantages of spectral method with those of finite element method,provides an efficient tool in simulating elastic wave equation in complex medium. Based on weak form of elastodynamic equations, mathematical formulations for Legendre spectral element method are presented. The wave field on an element is discretized using high-order Lagrange interpolation, and integration over the element is accomplished based upon the Gauss-Lobatto-Legendre integration rule. This results in a diagonal mass matrix which leads to a greatly simplified algorithm. In addition, the element by element technique is introduced in our method to reduce the memory sizes and improve the computation efficiency. Finally, some numerical examples are presented to demonstrate the spectral accuracy and the efficiency. Because of combinations of the finite element scheme and spectral algorithms, this method can be used for complex models, including free surface boundaries and strong heterogeneity.

  18. PP2C-like Promoter and Its Deletion Variants Are Induced by ABA but Not by MeJA and SA in Arabidopsis thaliana

    Science.gov (United States)

    Bhalothia, Purva; Sangwan, Chetna; Alok, Anshu; Mehrotra, Sandhya; Mehrotra, Rajesh

    2016-01-01

    Gene expression is mediated through interaction between cis regulatory elements and its cognate transcription factors. Cis regulatory elements are defined as non-coding DNA sequences that provide the binding sites for transcription factors and are clustered in the upstream region of genes. ACGT cis regulatory element is one of the important cis regulatory elements found to be involved in diverse biological processes like auxin response, salicylic acid (SA) response, UV light response, ABA response and jasmonic acid (JA) response. We identified through in silico analysis that the upstream region of protein phosphatase 2C (PP2C) gene has a distinct genetic architecture of ACGT elements. In the present study, the activation of the full length promoter and its deletion constructs like 900 base pair, 500 base pair, 400 base pair and NRM (Nathji Rajesh Mehrotra) were examined by stable transformation in Arabidopsis thaliana using β-glucuronidase as the reporter gene. Evaluation of deletion constructs of PP2C-like promoter was carried out in the presence of phytohormones like abscisic acid (ABA), SA and JA. Our result indicated that the full length and 900 base pair promoter-reporter constructs of PP2C-like promoter was induced in response to ABA but not to methyl jasmonate and SA. PMID:27200023

  19. The Chemistry of Superheavy Elements

    CERN Document Server

    Schädel, M

    2003-01-01

    The chemistry of transactinide or superheavy elements has reached element 108. Preparations are under way to leap to element 112 and beyond. The current status of this atom-at-a-time chemical research and its future perspectives are reviewed from an experimental point of view together with some of the interesting results from n -rich nuclides near and at the N=162 neutron shell. Experimental techniques and important results enlightening typical chemical properties of elements 104 through 108 are presented in an exemplary way. From the results of these experiments it is justified to place these elements in the Periodic Table of the Elements in to groups 4 through 8, respectively. However, mainly due to the influence of relativistic effects, it is no longer possible to deduce detailed chemical properties of these superheavy elements simply from this position.

  20. Chemistry of the superheavy elements.

    Science.gov (United States)

    Schädel, Matthias

    2015-03-13

    The quest for superheavy elements (SHEs) is driven by the desire to find and explore one of the extreme limits of existence of matter. These elements exist solely due to their nuclear shell stabilization. All 15 presently 'known' SHEs (11 are officially 'discovered' and named) up to element 118 are short-lived and are man-made atom-at-a-time in heavy ion induced nuclear reactions. They are identical to the transactinide elements located in the seventh period of the periodic table beginning with rutherfordium (element 104), dubnium (element 105) and seaborgium (element 106) in groups 4, 5 and 6, respectively. Their chemical properties are often surprising and unexpected from simple extrapolations. After hassium (element 108), chemistry has now reached copernicium (element 112) and flerovium (element 114). For the later ones, the focus is on questions of their metallic or possibly noble gas-like character originating from interplay of most pronounced relativistic effects and electron-shell effects. SHEs provide unique opportunities to get insights into the influence of strong relativistic effects on the atomic electrons and to probe 'relativistically' influenced chemical properties and the architecture of the periodic table at its farthest reach. In addition, they establish a test bench to challenge the validity and predictive power of modern fully relativistic quantum chemical models. PMID:25666065

  1. Genesis of chromatin and transcription dynamics in the origin of species

    NARCIS (Netherlands)

    Koster, Maria J E; Snel, Berend; Timmers, H. Th Marc

    2015-01-01

    Histone proteins compact and stabilize the genomes of Eukarya and Archaea. By forming nucleosome(-like) structures they restrict access of DNA-binding transcription regulators to cis-regulatory DNA elements. Dynamic competition between histones and transcription factors is facilitated by different c

  2. Genesis of Chromatin and Transcription Dynamics in the Origin of Species

    NARCIS (Netherlands)

    Koster, Maria J. E.; Snel, Berend; Timmers, H. Th. Marc

    2015-01-01

    Histone proteins compact and stabilize the genomes of Eukarya and Archaea. By forming nucleosome(-like) structures they restrict access of DNA-binding transcription regulators to cis-regulatory DNA elements. Dynamic competition between histones and transcription factors is facilitated by different c

  3. CRITERIA FOR AN UPDATED CLASSIFICATION OF HUMAN TRANSCRIPTION FACTOR DNA-BINDING DOMAINS

    NARCIS (Netherlands)

    Wingender, Edgar

    2013-01-01

    By binding to cis-regulatory elements in a sequence-specific manner, transcription factors regulate the activity of nearby genes. Here, we discuss the criteria for a comprehensive classification of human TFs based on their DNA-binding domains. In particular, classification of basic leucine zipper (b

  4. Cis- and trans-regulatory mechanisms of gene expression in the ASJ sensory neuron of Caenorhabditis elegans

    NARCIS (Netherlands)

    M. González-Barrios (María); J.C. Fierro-González (Juan Carlos); E. Krpelanova (Eva); J.A. Mora-Lorca (José Antonio); J. Rafael Pedrajas (José); X. Peñate (Xenia); S. Chavez (Sebastián); P. Swoboda (Peter); G. Jansen (Gert); A. Miranda-Vizuet (Antonio)

    2015-01-01

    textabstractThe identity of a given cell type is determined by the expression of a set of genes sharing common cis-regulatory motifs and being regulated by shared transcription factors. Here, we identify cis and trans regulatory elements that drive gene expression in the bilateral sensory neuron ASJ

  5. Multiple steps in the regulation of transcription-factor level and activity

    NARCIS (Netherlands)

    Calkhoven, CF; Ab, G

    1996-01-01

    This review focuses on the regulation of transcription factors, many of which are DNA-binding proteins that recognize cis-regulatory elements of target genes and are the most direct regulators of gene transcription. Transcription factors serve as integration centres of the different signal-transduct

  6. The untranslated leader sequence of the barley lipoxygenase 1 (Lox1) gene confers embryo-specific expression

    NARCIS (Netherlands)

    Rouster, J.; Mechelen J. van; Cameron-Mills, V.

    1998-01-01

    The barley lipoxygenase 1 (Lox1) gene encodes a protein expressed in embryos during grain development and germination and in leaves after methyl-jasmonate (MeJA) treatment. Transient gene expression assays in germinating barley embryos were used to identify cis-regulatory elements involved in the em

  7. Effects of a GA3/4PU-30 compound (90-09) on leaf senescence of hybrid rice

    Institute of Scientific and Technical Information of China (English)

    TANGRisheng

    1997-01-01

    90-09 is a cmpound made with GA3, 4PU-30 and some trace elements (B etc. ) To study the effects of 90-09 on the leaf senescence of hybrid rice leaf, the changes of activities of some degradation enzyme and the contents of endogenous hormones (ABA, ZRs, GAs, and IAA), protein, and nucleic acids were measured during leaf senescence.

  8. Transuranium organometallic elements

    International Nuclear Information System (INIS)

    This paper reports that neptunium and plutonium metal react cleanly with 1.5 equiv of I2 in aprotic ligating solvents, L, to give the triiodide complexes as tetrasolvates, AnI3L4 [An is Np, L is tetrahydrofuran (THF) (1); An is Pu, L is THF (2a), pyridine (Py) (2b), and dimethyl sulfoxide (DMSO) (2c)]. These complexes are convenient precursors to both new and existing transuranium compounds. Reaction of the triiodide complexes 1 and 2a in hexane with 3 equiv of sodium bis(trimethylsilyl)amide provides the volatile, solvate-free tris (silylamide) complexes, An[N(SiMe3)2]3 (An is Np, 3; An is Pu, 4). Hexan solutions of 3 and 4 react rapidly with 3 equiv of HO-2,6-(t-C4H9)2C6H3 to give the aryloxide complexes An[O-26-(t-C4H9)2C6H3]3 (An is Np 5; An is Pu, 6). Preliminary investigations indicate that complexes 5 and 6 react with lithium bis(trimethylsilyl)methanide, Li[CH(SiMe3)2], in hexane to give the alkyl complexes An[CH(SiME3)2]3 (An is Np, 7; An is PU, 8). Plutonium triiodide complex 2a readily reacts with LiC5H5 to give the known (n5-C5H5)3Pu(THF). The homoleptic silylamide, aryloxide, and alkyl complexes are the first reported examples for transuranium elements

  9. Matrix elements of unstable states

    CERN Document Server

    Bernard, V; Meißner, U -G; Rusetsky, A

    2012-01-01

    Using the language of non-relativistic effective Lagrangians, we formulate a systematic framework for the calculation of resonance matrix elements in lattice QCD. The generalization of the L\\"uscher-Lellouch formula for these matrix elements is derived. We further discuss in detail the procedure of the analytic continuation of the resonance matrix elements into the complex energy plane and investigate the infinite-volume limit.

  10. EDGE-ORIENTED HEXAGONAL ELEMENTS

    Institute of Scientific and Technical Information of China (English)

    Chao Yang; Jiachang Sun

    2007-01-01

    In this paper, two new nonconforming hexagonal elements are presented, which are based on the trilinear function space Q(3)1 and are edge-oriented, analogical to the case of the rotated Q1 quadrilateral element. A priori error estimates are given to show that the new elements achieve first-order accuracy in the energy norm and second-order accuracy in the L2 norm. This theoretical result is confirmed by the numerical tests.

  11. Photoshop Elements 10 For Dummies

    CERN Document Server

    Obermeier, Barbara

    2011-01-01

    Perfect your photos and images with this "focused" guide to the latest version of Photoshop Elements For most of us, the professional-level Photoshop is overkill for our needs. Amateur photographers and photo enthusiasts turn to Photoshop Elements for a powerful but simpler way to edit and retouch their snapshots. Photoshop Elements 10 For Dummies, fully updated and revised for the latest release of this software product, helps you navigate Elements to create, edit, fix, share, and organize the high-quality images you desire. Full color pages bring the techniques to life and make taking great

  12. Trace element emissions. Literature review

    International Nuclear Information System (INIS)

    Application of fossil fuels by various utilities results in the emission of trace elements to air, water and solid waste streams. Elements present in coal are released as particles or as vapours during coal combustion or gasification. Owing to the increased consumption of coal, especially for power generation, huge quantities of potentially hazardous trace elements are released into the atmosphere every year. It is necessary to evaluate the emissions of each trace element from coal-fired combustion or gasification systems, and their effects on the environment. Present research interests should be aimed at determining the sources, concentrations, and environmental impact of trace elements related with energy generation and relevant control technologies. Two of the emerging advanced coal gasification technologies, such as integrated gasification combined cycle (IGCC) and integrated gasification fuel cell (IGFC) are presently experiencing potential difficulties due to trace element emissions. In order to control the levels of these contaminants within regulatory limits and to ensure the efficient operation of fuel cells, it is necessary to determine the type and quantity of trace elements emitted from coal gasification-based systems as a function of system, operating conditions, and type of coal. The partitioning of the trace elements is influenced by the gasification conditions. In general, the following gasification conditions are expected to influence the distribution of trace elements between various product streams. (a) reducing and oxidizing environments (b) gas phase composition, pressure and temperature. The present report was aimed at finding and identifying gaps existing in the literature on the trace element transformations during gasification. Also included in the report is the modelling of relevant transformation mechanisms of the trace elements during gasification as a function of coal type and process conditions. 7 figs., 6 tabs., 69 refs

  13. Repetitive elements in parasitic protozoa

    OpenAIRE

    Clayton Christine

    2010-01-01

    Abstract A recent paper published in BMC Genomics suggests that retrotransposition may be active in the human gut parasite Entamoeba histolytica. This adds to our knowledge of the various types of repetitive elements in parasitic protists and the potential influence of such elements on pathogenicity. See research article http://www.biomedcentral.com/1471-2164/11/321

  14. Clean Elements in Abelian Rings

    Indian Academy of Sciences (India)

    Angelina Y M Chin

    2009-04-01

    Let be a ring with identity. An element in is said to be clean if it is the sum of a unit and an idempotent. is said to be clean if all of its elements are clean. If every idempotent in is central, then is said to be abelian. In this paper we obtain some conditions equivalent to being clean in an abelian ring.

  15. Solution of Finite Element Equations

    DEFF Research Database (Denmark)

    Krenk, Steen

    An important step in solving any problem by the finite element method is the solution of the global equations. Numerical solution of linear equations is a subject covered in most courses in numerical analysis. However, the equations encountered in most finite element applications have some special...

  16. Fuel element for nuclear reactor

    International Nuclear Information System (INIS)

    In order to avoid a can box or an adjacent fuel element sitting on the spacer of a fuel element in the corner during assembly, the top and bottom edges of the outer bars of the spacers are provided with deflector bars, which have projections projecting beyond the outside of the outer bars. (orig.)

  17. Repetitive elements in parasitic protozoa

    Directory of Open Access Journals (Sweden)

    Clayton Christine

    2010-05-01

    Full Text Available Abstract A recent paper published in BMC Genomics suggests that retrotransposition may be active in the human gut parasite Entamoeba histolytica. This adds to our knowledge of the various types of repetitive elements in parasitic protists and the potential influence of such elements on pathogenicity. See research article http://www.biomedcentral.com/1471-2164/11/321

  18. Subsidence modelling with analytic elements.

    NARCIS (Netherlands)

    Fokker, P.A.; Orlic, B.

    2000-01-01

    The method of Analytic Elements has been extended to enable elasticity calculations, to evaluate subsidence at the surface as resulting from extraction of oil or gas. Validation has been achieved by comparison with more limited analytical methods and with a comprehensive finite-element simulator. Th

  19. Stabilized Finite Elements with Matlab

    OpenAIRE

    Asensio, M. I.; A. Russo

    2002-01-01

    The purpose of this note is to explain the MATLAB code developed to solve an advection diffusion-reaction problem, with different Finite Element Methods: Standard Galerkin [7], Streamline Upwind/ Petrov-Galerkin (SUPG) [6], Unsual Stabilized [8, 9] and Residual-Free Bubbles [3, 4, 5], for both linear (P1) (see [1]) and quadratic (P2) (see [2]) triangular finite elements.

  20. Massively Parallel Finite Element Programming

    KAUST Repository

    Heister, Timo

    2010-01-01

    Today\\'s large finite element simulations require parallel algorithms to scale on clusters with thousands or tens of thousands of processor cores. We present data structures and algorithms to take advantage of the power of high performance computers in generic finite element codes. Existing generic finite element libraries often restrict the parallelization to parallel linear algebra routines. This is a limiting factor when solving on more than a few hundreds of cores. We describe routines for distributed storage of all major components coupled with efficient, scalable algorithms. We give an overview of our effort to enable the modern and generic finite element library deal.II to take advantage of the power of large clusters. In particular, we describe the construction of a distributed mesh and develop algorithms to fully parallelize the finite element calculation. Numerical results demonstrate good scalability. © 2010 Springer-Verlag.

  1. Chemical elements distribution in cells

    Science.gov (United States)

    Ortega, R.

    2005-04-01

    Analysing, imaging and understanding the cellular chemistry, from macromolecules to monoatomic elements, is probably a major challenge for the scientific community after the conclusion of the genome project. In order to probe the distribution of elements in cells, especially the so-called inorganic elements, it is necessary to apply microanalytical techniques with sub-micrometer resolution and high chemical sensitivity. This paper presents the current status of chemical element imaging inside cells, and a comparison of the different analytical techniques available: nuclear microprobe, electron microprobe and electron energy loss spectroscopy, synchrotron radiation microprobe, secondary ion mass spectrometry and fluorescence microscopy methods. Examples of intracellular chemical elements distributions relevant to cancer pharmacology, medical imaging, metal carcinogenesis and neuropathology studies obtained by nuclear microprobe and other microanalytical techniques are presented.

  2. Second order tensor finite element

    Science.gov (United States)

    Oden, J. Tinsley; Fly, J.; Berry, C.; Tworzydlo, W.; Vadaketh, S.; Bass, J.

    1990-01-01

    The results of a research and software development effort are presented for the finite element modeling of the static and dynamic behavior of anisotropic materials, with emphasis on single crystal alloys. Various versions of two dimensional and three dimensional hybrid finite elements were implemented and compared with displacement-based elements. Both static and dynamic cases are considered. The hybrid elements developed in the project were incorporated into the SPAR finite element code. In an extension of the first phase of the project, optimization of experimental tests for anisotropic materials was addressed. In particular, the problem of calculating material properties from tensile tests and of calculating stresses from strain measurements were considered. For both cases, numerical procedures and software for the optimization of strain gauge and material axes orientation were developed.

  3. quadratic spline finite element method

    Directory of Open Access Journals (Sweden)

    A. R. Bahadir

    2002-01-01

    Full Text Available The problem of heat transfer in a Positive Temperature Coefficient (PTC thermistor, which may form one element of an electric circuit, is solved numerically by a finite element method. The approach used is based on Galerkin finite element using quadratic splines as shape functions. The resulting system of ordinary differential equations is solved by the finite difference method. Comparison is made with numerical and analytical solutions and the accuracy of the computed solutions indicates that the method is well suited for the solution of the PTC thermistor problem.

  4. Increased burnup of fuel elements

    International Nuclear Information System (INIS)

    The specialists' group for fuel elements of the Kerntechnische Gesellschaft e.V. held a meeting on ''Increased Burnup of Fuel Elements'' on 9th and 10th of November 1982 at the GKSS Research Center Geesthacht. Most papers dealt with the problems of burnup increase of fuel elements for light water reactors with respect to fuel manufacturing, power plant operation and reprocessing. Review papers were given on the burnup limits for high temperature gas cooled reactors and sodium fast breeder reactors. The meeting ended with a presentation of the technical equipment of the hot laboratory of the GKSS and the programs which are in progress there. (orig.)

  5. Transposable elements: The enemies within.

    Science.gov (United States)

    Scarfò, Irene; Pellegrino, Elisa; Mereu, Elisabetta; Inghirami, Giorgio; Piva, Roberto

    2016-10-01

    Understanding transformation mechanisms other than genetic aberrations has recently captured the attention of cancer researchers. To date, the role of transposable elements (TEs) in tumor development remains largely undefined. However, an increasing number of studies have reported that loss of epigenetic control causes TE reactivation and consequent oncogenic transcription. Here, we discuss principal examples of TEs-driven oncogenesis. Available data suggest that long terminal repeats and long interspersed nuclear elements play a pivotal role as alternative promoters. These findings provide definitive experimental evidence that repetitive elements are a powerful underestimated force toward oncogenesis and open the possibility to new therapeutic treatments.

  6. Photoshop Elements 9 Digital Classroom

    CERN Document Server

    Team, AGI Creative

    2011-01-01

    Learn Photoshop Elements at your own pace with this unique book-and-DVD training packagePhotoshop Elements is the leading image-editing software, and this personal training course uses a full-color book plus video tutorials on the DVD to teach you how to use all its features. Each of the 13 lessons is presented with step-by-step instructions and includes lesson files and a video explanation of the concepts. You can learn from leading instructors, and do it at your own pace.Photoshop Elements provides professional quality image-editing tools at an affordable price; this book-and-DVD package off

  7. Spacer for a fuel element

    International Nuclear Information System (INIS)

    Spacers for fuel pins arranged to form congish fuel elements can be shaped as plates with openings in accordance with the fuel pin grid. Such a plate that covers the cross section of a fuel element consists according to the invention of at least two parts that are offset in the fuel element's longitudinal direction and joint hinge-like in at least one grid position. Thus, one has smaller parts that are easier to work on with due accuracy. The invention is designed in particular for breeder reactors and high-conversion reactors. (orig.)

  8. Essential Elements of Geologic Reports.

    Science.gov (United States)

    Webb, Elmer James

    1988-01-01

    Described is a report outline for geologic reports. Essential elements include title; abstract; introduction; stratigraphy; petrography; geochemistry; petrology; geophysics; structural geology; geologic history; modeling; economics; conclusions; and recommendations. (Author/CW)

  9. Finite element methods for engineers

    CERN Document Server

    Fenner, Roger T

    2013-01-01

    This book is intended as a textbook providing a deliberately simple introduction to finite element methods in a way that should be readily understandable to engineers, both students and practising professionals. Only the very simplest elements are considered, mainly two dimensional three-noded “constant strain triangles”, with simple linear variation of the relevant variables. Chapters of the book deal with structural problems (beams), classification of a broad range of engineering into harmonic and biharmonic types, finite element analysis of harmonic problems, and finite element analysis of biharmonic problems (plane stress and plane strain). Full Fortran programs are listed and explained in detail, and a range of practical problems solved in the text. Despite being somewhat unfashionable for general programming purposes, the Fortran language remains very widely used in engineering. The programs listed, which were originally developed for use on mainframe computers, have been thoroughly updated for use ...

  10. Environmental research on actinide elements

    International Nuclear Information System (INIS)

    The papers synthesize the results of research sponsored by DOE's Office of Health and Environmental Research on the behavior of transuranic and actinide elements in the environment. Separate abstracts have been prepared for the 21 individual papers

  11. In situ trace element microanalysis

    Science.gov (United States)

    Burnett, D. S.; Woolum, D. S.

    1983-01-01

    The use of particle-track-radiography and X-ray- fluorescence techniques in the in situ measurement of trace (less than 1000 ppm) elements in single mineral phases of polished sections is surveyed, and examples of their application to ordinary, carbonaceous and enstatite chondrites are provided. Radiographic methods surveyed include fission-track radiography (for U, Th, and Pu-244), alpha radiography using nuclear reactions (for Li and B), alpha autoradiography (for Bi and Pb), and beta autoradiography (for several elements in synthetic or biological samples). Two X-ray-fluorescence methods are compared: (1) photon-induced X-ray emission (PIXE), and (2) the potential use of synchrotron radiation. The latter is shown to allow much greater sensitivity than current PIXE technology and a much broader range of elements than particle-track radiography: the ppm analysis of 10-micron grains for all elements heavier than Na. These advantages are seen as balancing the high cost of accelerator use.

  12. Naturalistic Elements in The Egg

    Institute of Scientific and Technical Information of China (English)

    惠菲菲

    2013-01-01

    The purpose of the study is to analyze the naturalistic elements in The Egg, which is taken from the collection of short stories, The Triumph of the Egg. The study states the ideology and technique of naturalism and then exams how naturalistic ele-ments are revealed in the fiction. Then it comes to the conclusion that the family is defeated by the egg and the life of human be-ings is under control of complicated forces from both inside and outside.

  13. Nuclear reactor fuel element splitter

    International Nuclear Information System (INIS)

    A method and apparatus are disclosed for removing nuclear fuel from a clad fuel element. The fuel element is power driven past laser beams which simultaneously cut the cladding lengthwise into at least two longitudinal pieces. The axially cut lengths of cladding are then separated, causing the nuclear fuel contained therein to drop into a receptacle for later disposition. The cut lengths of cladding comprise nuclear waste which is disposed of in a suitable manner. 6 claims, 10 drawing figures

  14. Elemental mercury exposure: peripheral neurotoxicity.

    OpenAIRE

    Levine, S P; Cavender, G D; Langolf, G D; Albers, J W

    1982-01-01

    Nerve conduction tests were performed on the right ulnar nerve of factory workers exposed to elemental mercury vapour. Time integrated urine mercury indices were used to measure the degree of exposure. Workers with prolonged distal latencies had significantly higher urine mercury concentrations when compared with those with normal latencies. Significant correlations between increasing urine mercury concentrations and prolonged motor and sensory distal latencies were established. Elemental mer...

  15. PROPOSAL OF NEW OPTICAL ELEMENTS

    Directory of Open Access Journals (Sweden)

    Goce Chadzitaskos

    2013-10-01

    Full Text Available A overview of our patented proposals of new optical elements is presented. The elements are suitable for laser pulse analysis, telescopy, X-ray microscopy and X-ray telescopy. They are based on the interference properties of light: a special grating for a double slit pattern, parabolic strip imaging for a telescope, and Bragg’s condition for X-ray scattering on a slice of a single crystal for X-raymicroscopy and X-ray telescopy.

  16. Marine oligotrophy and element biogeochemistry

    International Nuclear Information System (INIS)

    A biogeochemical model has been developed that explains the inverse and non-linear relationship between Po-210 concentration in zooplankton and their biomass, under oligotrophic conditions in French Polynesia. This study identified other elements with comparable accumulatory behaviours to Po-210 in phytoplankton, seston and zooplankton, that are proposed to be critical to its enhanced environmental levels under oligotrophy. Field investigation in the Gulf of Papua showed that four of these a priori identified elements viz Cd, Co, Pb and Mn, as well as Cr and Ni, showed elevated water concentrations with reduced biological productivity, results that are consistent with those previously obtained for Po-210 and the proposed explanatory model. These findings point to the enhanced susceptibility of oligotrophic systems to contamination from particle-reactive elements. (author)

  17. Mechanical Analogies of Fractional Elements

    Institute of Scientific and Technical Information of China (English)

    HU Kai-Xin; ZHU Ke-Qin

    2009-01-01

    A Fractional element model describes a special kind of viscoelastic material.Its stress is proportional to the fractional-order derivative of strain. Physically the mechanical analogies of fractional elements can be represented by spring-dashpot fractal networks. We introduce a constitutive operator in the constitutive equations of viscoelastic materials.To derive constitutive operators for spring-dashpot fractal networks, we use Heaviside operational calculus, which provides explicit answers not otherwise obtainable simply.Then the series-parallel formulas for the constitutive operator are derived. Using these formulas, a constitutive equation of fractional element with 1/2-order derivative is obtained.Finally we find the way to derive the constitutive equations with other fractional-order derivatives and their mechanical analogies.

  18. An external drag measuring element

    Science.gov (United States)

    Ringel, Mordechai; Levin, Daniel; Seginer, Arnan

    The accurate measurement of the axial-force component acting on small wind-tunnel models has traditionally made use of integral string balances, which eliminated many accuracy problems, such as friction and hysteresis, but also introduced interactions between the various force and moment sensing elements due to nonlinear elastic phenomena. The reduction of these interactions usually calls for complicated designs, expensive manufacturing, hard-to-handle calibration processes, and cumbersome data reduction programs. An approach is presented that is based on an external axial-force-measuring element and avoids the ill-conditioned design problems of integral balances. Other difficulties that are encountered, such as friction, misalignment, and relative motion between metric elements are considered, and their solution is examined. Calibration and test results show that the new approach duplicates and surpasses the results of much more complicated and expensive integral balances.

  19. The age of the elements

    International Nuclear Information System (INIS)

    The paper is devoted to nuclear cosmochronology. The age of the Universe is estimated with the aid of radioactive nuclear-nuclear chronometers (NC). For calculations it is required that the proportion in which the appropriate pair of NC is at present ('relative abundance') and the proportion for the moment of their formation ('relative production') should be known. A short description is given of production of elements in the process of star evolution. The 'relative production' is calculated theoretically. The relative abundance is determined from experiments, mainly from meteorites. Recentl Lunar rocks have been also coming into use. The following elements are chosen as pairs of chronometers: Th-232/U-238; U-235/U-238; Pu-244/Th-232; J-129/J-127. Using this method the authors have determined the age of elements from 7 to 15 billion years, the best estimate being approximately 10 billion years. This age is quite in an agreement with calculations made by other methods

  20. Elements to diminish radioactive accidents

    International Nuclear Information System (INIS)

    In this work it is presented an application of the cause-effect diagram method or Ichikawa method identifying the elements that allow to diminish accidents when the radioactive materials are transported. It is considered the transport of hazardous materials which include radioactive materials in the period: December 1996 until March 1997. Among the identified elements by this method it is possible to mention: the road type, the radioactive source protection, the grade driver responsibility and the preparation that the OEP has in the radioactive material management. It is showed the differences found between the country inner roads and the Mexico City area. (Author)

  1. Multiphoton spectroscopy in heavy elements

    Energy Technology Data Exchange (ETDEWEB)

    Solarz, R.W.; Paisner, J.A.; Worden, E.F.

    1977-05-03

    Some recently discovered regularities in the spectra of heavy elements which are also applicable to the analysis of the spectra of lighter atoms are described. It is pointed out that stepwise resonant multiphoton methods are irreplaceable tools in the study of high lying states in a complex atomic system. Systematic applications of these methods has permitted regularities to be observed which also hold for the lighter elements. It is noted that greatly increased understanding of the excited state structure of heavy atoms is not possible. 8 references. (JFP)

  2. FINITE ELEMENT ANALYSIS OF STRUCTURES

    Directory of Open Access Journals (Sweden)

    PECINGINA OLIMPIA-MIOARA

    2015-05-01

    Full Text Available The application of finite element method is analytical when solutions can not be applied for deeper study analyzes static, dynamic or other types of requirements in different points of the structures .In practice it is necessary to know the behavior of the structure or certain parts components of the machine under the influence of certain factors static and dynamic . The application of finite element in the optimization of components leads to economic growth , to increase reliability and durability organs studied, thus the machine itself.

  3. Organic chemistry of elemental phosphorus

    Energy Technology Data Exchange (ETDEWEB)

    Milyukov, V A; Budnikova, Yulia H; Sinyashin, Oleg G [A.E. Arbuzov Institute of Organic and Physical Chemistry, Kazan Scientific Centre of the Russian Academy of Sciences, Kazan (Russian Federation)

    2005-09-30

    The principal achievements and the modern trends in the development of the chemistry of elemental phosphorus are analysed, described systematically and generalised. The possibilities and advantages of the preparation of organophosphorus compounds directly from white phosphorus are demonstrated. Attention is focused on the activation and transformation of elemental phosphorus in the coordination sphere of transition metal complexes. The mechanisms of the reactions of white phosphorus with nucleophilic and electrophilic reagents are discussed. Electrochemical approaches to the synthesis of organic phosphorus derivatives based on white phosphorus are considered.

  4. Finite elements of nonlinear continua

    CERN Document Server

    Oden, J T

    2000-01-01

    Geared toward undergraduate and graduate students, this text extends applications of the finite element method from linear problems in elastic structures to a broad class of practical, nonlinear problems in continuum mechanics. It treats both theory and applications from a general and unifying point of view.The text reviews the thermomechanical principles of continuous media and the properties of the finite element method, and then brings them together to produce discrete physical models of nonlinear continua. The mathematical properties of these models are analyzed, along with the numerical s

  5. Staggered weak matrix element miscellany

    International Nuclear Information System (INIS)

    I report on work, done with Rajan Gupta and Greg Kilcup, using staggered fermions to study weak matrix elements in quenched QCD. I give an update on the ΔI = 1/2 rule on matrix elements relevant for ε'. I show results of a study of the dependence of BK on non-leading terms in the chiral expansion. I present our results for BK from quenched calculation at β = 6.4 on 323 x 48 lattices, based on ensemble of 12 configurations. 15 refs., 5 figs

  6. Elements of spatial data quality

    CERN Document Server

    Guptill, SC

    1995-01-01

    Elements of Spatial Data Quality outlines the need and suggests potential categories for the content of a comprehensive statement of data quality that must be imbedded in the metadata that accompanies the transfer of a digital spatial data file or is available in a separate metadata catalog. Members of the International Cartographic Association's Commission on Spatial Data Quality have identified seven elements of data quality: positional accuracy, attribute accuracy, completeness, logical consistency, lineage, semantic accuracy and temporal information. In the book the authors describe: compo

  7. A high temperature fuel element

    Energy Technology Data Exchange (ETDEWEB)

    Sekido, A.; Nakai, M.; Ninomiya, Y.

    1982-12-21

    A solid electrolyte which conducts electricity with heating by oxygen ions and operates at a temperature of 1,000C is used in the element. The cathode, besides the ionic conductivity in oxygen, has an electron conductivity. The anode has electron conductivity. Substances such as Bi203, into which oxides of alkaline earth metals are added, are used for making the cathode. The electrolyte consists of ZrO2 and Y2O3, to which CaO is added. WC, to which an H2 type fuel is fed, serves as the anode. The element has a long service life.

  8. A 3D pyramid spline element

    Institute of Scientific and Technical Information of China (English)

    Juan Chen; Chong-Jun Li; Wan-Ji Chen

    2011-01-01

    In this paper,a 13-node pyramid spline element is derived by using the tetrahedron volume coordinates and the B-net method,which achieves the second order completeness in Cartesian coordinates.Some appropriate examples were employed to evaluate the performance of the proposed element.The numerical results show that the spline element has much better performance compared with the isoparametric serendipity element Q20 and its degenerate pyramid element P13 especially when mesh is distorted,and it is comparable to the Lagrange element Q27.It has been demonstrated that the spline finite element method is an efficient tool for developing high accuracy elements.

  9. Nuclear fuel elements design, fabrication and performance

    CERN Document Server

    Frost, Brian R T

    1982-01-01

    Nuclear Fuel Elements: Design, Fabrication and Performance is concerned with the design, fabrication, and performance of nuclear fuel elements, with emphasis on fast reactor fuel elements. Topics range from fuel types and the irradiation behavior of fuels to cladding and duct materials, fuel element design and modeling, fuel element performance testing and qualification, and the performance of water reactor fuels. Fast reactor fuel elements, research and test reactor fuel elements, and unconventional fuel elements are also covered. This volume consists of 12 chapters and begins with an overvie

  10. Dynamic and Transient Infinite Elements

    CERN Document Server

    Zhao, Chongbin

    2009-01-01

    Intends to provide the theory and the application of dynamic and transient infinite elements for simulating the far fields of infinite domains involved in many of scientific and engineering problems, based on the author's own work over the years. This title is suitable for computational geoscientists, geotechnical engineers, and civil engineers.

  11. Compact Fuel Element Environment Test

    Science.gov (United States)

    Bradley, D. E.; Mireles, O. R.; Hickman, R. R.; Broadway, J. W.

    2012-01-01

    Deep space missions with large payloads require high specific impulse (I(sub sp)) and relatively high thrust to achieve mission goals in reasonable time frames. Conventional, storable propellants produce average I(sub sp). Nuclear thermal rockets (NTRs) capable of high I(sub sp) thrust have been proposed. NTR employs heat produced by fission reaction to heat and therefore accelerate hydrogen, which is then forced through a rocket nozzle providing thrust. Fuel element temperatures are very high (up to 3,000 K) and hydrogen is highly reactive with most materials at high temperatures. Data covering the effects of high-temperature hydrogen exposure on fuel elements are limited. The primary concern is the mechanical failure of fuel elements that employ high melting point metals, ceramics, or a combination (cermet) as a structural matrix into which the nuclear fuel is distributed. It is not necessary to include fissile material in test samples intended to explore high-temperature hydrogen exposure of the structural support matrices. A small-scale test bed designed to heat fuel element samples via noncontact radio frequency heating and expose samples to hydrogen for typical mission durations has been developed to assist in optimal material and manufacturing process selection without employing fissile material. This Technical Memorandum details the test bed design and results of testing conducted to date.

  12. Treatment of incorporated transuranium elements

    International Nuclear Information System (INIS)

    The text of this report and its tables and figures provide basic information on the decorporation of transuranium elements as well as an insight into the more general principles, trends and interactions. The detailed tables and the exhaustive list of important references should enable the reader to make his own conclusions in a minimum of time

  13. Experimental search for superheavy elements

    International Nuclear Information System (INIS)

    This work reports on the experimental search for superheavy elements (SHE). Two types of approaches for SHE production are studied i.e. '' cold '' fusion mechanism and massive transfer mechanism. First mechanism was studied in normal and inverse kinematics, by using Wien filter at the GANIL facility. The production of SHE elements with Z 106 and 108 is reported while negative results on the synthesis of SHE elements with Z 114 and 118 was received. The other approach i.e. reactions induced by heavy ion projectiles (e.g. 172Yb, 197Au) on fissile target nuclei (e.g. 238U, 232Th) at near Coulomb barrier incident energies was studied by using superconducting solenoid installed Texas A(and)M University. Preliminary results for the reaction 197Au(7.5 MeV/u) - 232Th are presented where three cases of the possible candidates for SHE elements were found. A dedicated detection setup for such studies is discussed and the detailed data analysis is presented. Detection of alpha and spontaneous fission radioactive decays is used to unambiguously identify the atomic number of SHE. Special statistical analysis for a very low detected number of α decays is applied to check consistency of the αradioactive chains. (author)

  14. Environmental research on actinide elements

    Energy Technology Data Exchange (ETDEWEB)

    Pinder, J.E. III; Alberts, J.J.; McLeod, K.W.; Schreckhise, R.G. (eds.)

    1987-08-01

    The papers synthesize the results of research sponsored by DOE's Office of Health and Environmental Research on the behavior of transuranic and actinide elements in the environment. Separate abstracts have been prepared for the 21 individual papers. (ACR)

  15. Spectral element simulation of ultrafiltration

    DEFF Research Database (Denmark)

    Hansen, M.; Barker, Vincent A.; Hassager, Ole

    1998-01-01

    A spectral element method for simulating stationary 2-D ultrafiltration is presented. The mathematical model is comprised of the Navier-Stokes equations for the velocity field of the fluid and a transport equation for the concentration of the solute. In addition to the presence of the velocity...

  16. Main Elements for Upscaling Recreation

    DEFF Research Database (Denmark)

    Zandersen, Marianne; Termansen, Mette

    2012-01-01

    This report provides information on the main elements used to scale up modelled local visitor flow data to regional level based on recreational de-mand models. These models are described in Report #1. This report also provides information on data sources such as spatial data (e.g. land cov......-timated value per site for car-borne visits....

  17. An improved optimal elemental method for updating finite element models

    Institute of Scientific and Technical Information of China (English)

    Duan Zhongdong(段忠东); Spencer B.F.; Yan Guirong(闫桂荣); Ou Jinping(欧进萍)

    2004-01-01

    The optimal matrix method and optimal elemental method used to update finite element models may not provide accurate results. This situation occurs when the test modal model is incomplete, as is often the case in practice. An improved optimal elemental method is presented that defines a new objective function, and as a byproduct, circumvents the need for mass normalized modal shapes, which are also not readily available in practice. To solve the group of nonlinear equations created by the improved optimal method, the Lagrange multiplier method and Matlab function fmincon are employed. To deal with actual complex structures,the float-encoding genetic algorithm (FGA) is introduced to enhance the capability of the improved method. Two examples, a 7-degree of freedom (DOF) mass-spring system and a 53-DOF planar frame, respectively, are updated using the improved method.Thc example results demonstrate the advantages of the improved method over existing optimal methods, and show that the genetic algorithm is an effective way to update the models used for actual complex structures.

  18. The Transuranium Elements - Present Status: Nobel Lecture

    Science.gov (United States)

    Seaborg, G. T.

    1951-12-12

    The discovery of the transuranium elements and the work done on them up to the present time are reviewed. The properties of these elements, their relationship to other elements, their place in the periodic table, and the possibility of production and identification of other transuranium elements are discussed briefly.

  19. An Improved Triangular Element With Drilling Rotations

    DEFF Research Database (Denmark)

    Damkilde, Lars; Grønne, Mikael

    2002-01-01

    A new plane element with rotational degrees in the corner nodes is presented. The element has 12 degrees of freedom and the only difference from the well-known Linear Strain Triangular (LST) element is that the displacements perpendicular to the element sides in the mid-side nodes are replaced by...... rotations in the corner nodes. Compared to Allman's plane element which was the first succesfull implementation of drilling rotations the proposed element has extra displacements in the mid-side nodes parallel to the element sides. The performance should therefore be better and closer to the LST...

  20. Automation of finite element methods

    CERN Document Server

    Korelc, Jože

    2016-01-01

    New finite elements are needed as well in research as in industry environments for the development of virtual prediction techniques. The design and implementation of novel finite elements for specific purposes is a tedious and time consuming task, especially for nonlinear formulations. The automation of this process can help to speed up this process considerably since the generation of the final computer code can be accelerated by order of several magnitudes. This book provides the reader with the required knowledge needed to employ modern automatic tools like AceGen within solid mechanics in a successful way. It covers the range from the theoretical background, algorithmic treatments to many different applications. The book is written for advanced students in the engineering field and for researchers in educational and industrial environments.

  1. Selective Smoothed Finite Element Method

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    The paper examines three selective schemes for the smoothed finite element method (SFEM) which was formulated by incorporating a cell-wise strain smoothing operation into the standard compatible finite element method (FEM). These selective SFEM schemes were formulated based on three selective integration FEM schemes with similar properties found between the number of smoothing cells in the SFEM and the number of Gaussian integration points in the FEM. Both scheme 1 and scheme 2 are free of nearly incompressible locking, but scheme 2 is more general and gives better results than scheme 1. In addition, scheme 2 can be applied to anisotropic and nonlinear situations, while scheme 1 can only be applied to isotropic and linear situations. Scheme 3 is free of shear locking. This scheme can be applied to plate and shell problems. Results of the numerical study show that the selective SFEM schemes give more accurate results than the FEM schemes.

  2. Gelivity Effects on Construction Elements

    Directory of Open Access Journals (Sweden)

    Bogdan Rujanu

    2009-01-01

    Full Text Available Complex nature of environment effects on concrete structures has imposed an improvement of material characteristics, an adequate design, accurate execution and inspection, maintenance and prevention of deterioration risks. Large complexity of concrete elements deterioration processes, it is determined by the relation between adopted structural conceptions, exposing climatic conditions, concrete composition, quality of execution processes, but also due to synergetic action of destructive agents. When water freezes in a porous material, like cement stone, raise its volume about 9%, and can lead to concrete cleavage, when pores are saturated with water. Using deicers on concrete surface for melting of ice or snow, cause a thermal shock. Temperature difference between the surface and the core of concrete leads to interior stress and deformation state, capable to influence cracking of concrete layer from the surface of element. Prevention of damages and their amplification needs inspection, maintenance and overhauling of structures.

  3. Composite oxygen ion transport element

    Science.gov (United States)

    Chen, Jack C.; Besecker, Charles J.; Chen, Hancun; Robinson, Earil T.

    2007-06-12

    A composite oxygen ion transport element that has a layered structure formed by a dense layer to transport oxygen ions and electrons and a porous support layer to provide mechanical support. The dense layer can be formed of a mixture of a mixed conductor, an ionic conductor, and a metal. The porous support layer can be fabricated from an oxide dispersion strengthened metal, a metal-reinforced intermetallic alloy, a boron-doped Mo.sub.5Si.sub.3-based intermetallic alloy or combinations thereof. The support layer can be provided with a network of non-interconnected pores and each of said pores communicates between opposite surfaces of said support layer. Such a support layer can be advantageously employed to reduce diffusion resistance in any type of element, including those using a different material makeup than that outlined above.

  4. Trace-elements and tectonics

    International Nuclear Information System (INIS)

    Trends of the past twenty years in geochemical investigation of trace elements are reflected in studies of the partial melting of mantle and also the differentiation of magma. Substantial improvements have been made in accuracy, sensitivity and convenience of trace elements analysis, mainly through improved techniques and equipment for neutron activation analysis. Models for genesis of the zonal arrangement in island arc volcanic rocks as products of partial melting and fractional crystallization have been developed. We also applied these results to discuss the tectonic development of island arcs. Dating of geological materials is on universal concern to earth scientists working on various problems. In many research situations the use of a combination of dating method and paleomagnetism or geochemistry provides the greatest tectonic results for crustal materials, such as rotation of microcontinent and cooling history of rock body. (author)

  5. DOLFIN: Automated Finite Element Computing

    CERN Document Server

    Logg, Anders; 10.1145/1731022.1731030

    2011-01-01

    We describe here a library aimed at automating the solution of partial differential equations using the finite element method. By employing novel techniques for automated code generation, the library combines a high level of expressiveness with efficient computation. Finite element variational forms may be expressed in near mathematical notation, from which low-level code is automatically generated, compiled and seamlessly integrated with efficient implementations of computational meshes and high-performance linear algebra. Easy-to-use object-oriented interfaces to the library are provided in the form of a C++ library and a Python module. This paper discusses the mathematical abstractions and methods used in the design of the library and its implementation. A number of examples are presented to demonstrate the use of the library in application code.

  6. CONSTRAINED QUADRILATERAL NONCONFORMING ROTATED Q1 ELEMENT

    Institute of Scientific and Technical Information of China (English)

    Jun Hu; Zhong-ci Shi

    2005-01-01

    In this paper, we define a new nonconforming quadrilateral finite element based on the nonconforming rotated Q1 element by enforcing a constraint on each element, which has only three degrees of freedom. We investigate the consistency, approximation, superclose property, discrete Green's function and superconvergence of this element. Moreover, we propose a new postprocessing technique and apply it to this element. It is proved that the postprocessed discrete solution is superconvergent under a mild assumption on the mesh.

  7. Backfire antennas with dipole elements

    DEFF Research Database (Denmark)

    Nielsen, Erik Dragø; Pontoppidan, Knud

    1970-01-01

    A method is set up for a theoretical investigation of arbitrary backfire antennas based upon dipole structures. The mutual impedance between the dipole elements of the antenna is taken into account, and the field radiated due to a surface wave reflector of finite extent is determined by calculating...... the surface current distribution on the reflector plate. Numerical results obtained for Yagi backfire antennas and short-backfire antennas using this theory are compared with experimental results....

  8. Elements of Bayesian experimental design

    Energy Technology Data Exchange (ETDEWEB)

    Sivia, D.S. [Rutherford Appleton Lab., Oxon (United Kingdom)

    1997-09-01

    We consider some elements of the Bayesian approach that are important for optimal experimental design. While the underlying principles used are very general, and are explained in detail in a recent tutorial text, they are applied here to the specific case of characterising the inferential value of different resolution peakshapes. This particular issue was considered earlier by Silver, Sivia and Pynn (1989, 1990a, 1990b), and the following presentation confirms and extends the conclusions of their analysis.

  9. Synthesis of super heavy elements

    International Nuclear Information System (INIS)

    An era of study and synthesis of superheavy elements began with the prediction of the existence of an island of stability of long lived superheavy elements in the vicinity Z = 126, N = 184 by Myers and Swiatecki in 1966. Within coulomb and proximity potential model, we have studied cluster emission from all even-even nuclei from 270118 to 318118. Fission decay half lives for these isotopes are calculated by the model proposed by Ren et al. The range of isotopes in which α-decay shall occur for the element Z=118 is found out using the difference in α-decay half life and fission decay half life as a criterion. This range is also the one in which isotopes can exist without getting spontaneously fissioned. Making use of the concepts of quantum mechanical fragmentation theory and the information that is gathered from our work, about the range of isotopes where synthesis of Z = 118 is probable, sets of reactions, according to order of possibility, for the production of all isotopes in the range have been elucidated. Along with that the involved fusion barrier and ground state Q-value also are shown

  10. Inorganic elements in sugar samples

    Energy Technology Data Exchange (ETDEWEB)

    Salles, Paulo M.B. de; Campos, Tarcisio P.R. de, E-mail: pauladesalles@yahoo.com.br, E-mail: tprcampos@pq.cnpq.br [Universidade Federal de Minas Gerais (DEN/UFMG), Belo Horizonte, MG (Brazil). Departamento de Engenharia Nuclear; Menezes, Maria Angela de B.C., E-mail: menezes@cdtn.br [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil)

    2013-07-01

    Sugar is considered a safe food ingredient; however, it can be contaminated by organic elements since its planting until its production process. Thus, this study aims at checking the presence of inorganic elements in samples of crystal, refined and brown sugar available for consumption in Brazil. The applied technique was neutron activation analysis, the k{sub 0} method, using the TRIGA MARK - IPR-R1 reactor located at CDTN/CNEN, in Belo Horizonte. It was identified the presence of elements such as, Au, Br, Co, Cr, Hf, K, Na, Sb, Sc and Zn in the samples of crystal/refined sugar and the presence of As, Au, Br, Ca, Co, Cr, Cs, Fe, Hf, K, Na, Sb, Sc, Sm, Sr, Th and Zn in the brown sugar samples. The applied technique was appropriate to this study because it was not necessary to put the samples in solution, essential condition in order to apply other techniques, avoiding contaminations and sample losses, besides allowing a multi elementary detection in different sugar samples. (author)

  11. Elemental composition of cosmic ray

    International Nuclear Information System (INIS)

    The report first summarizes some data that have been obtained so far from observation of isotopes and elements in cosmic rays in the low energy region. Then, objectives of studies planned to be carried out with Astromag are outlined and the number of incident particles expected to be measured by baloon observation is estimated. Heavy elements with atomic numbers of greater than 30 are considered to be formed through neutron absorption reactions by the s- or r-process. Observations show that products of the r-process is abundant in cosmic ray sources. The escape length depends on energy. In relation to this, it has been reported that the ratios Ar-Fe and Ca-Fe increase above 200 GeV-n while such a tendency is not observed for K, Sc, Ti or V. Thus, no satisfactory models are available at present which can fully explain the changes in the escape length. The ratio 3He-4He in the range of 5 - 10 GeV-n is inconsistent with the general theory that interprets the escape length of heavy elements. Some models, including the supermetallicity model and Wolf Rayet theory, have been proposed to explain unusual ratios of isotopes in cosmic rays, but more measurements are required to verify them. It is expected that Astromag can serve to make observations that can clarify these points. (Nogami, K.)

  12. The UNCLE finite element scheme

    International Nuclear Information System (INIS)

    A completely general finite element scheme, implemented in the UKAEA Reactor Group is outlined. UNCLE is not a complete, self-contained program. It is a framework of routines that provide the common services required by all general purpose finite element programs, whether for heat transfer, stress analysis or any other linear (or piece-wise linear) problem. These services are: input of mesh, geometry, loads (etc) and material data: matrix and load vector calculation and assembly (including handling of standard boundary conditions); solution of global matrix (elimination and conjugate gradient methods); output (printed and graphical) of initial geometry, displacements, stresses, final geometry etc; facilities for iteration for non-linear problems and time integration; mass matrix reduction, dynamic analysis of reduced problem and expansion of displacements to full problem. The framework is written to handle 1, 2, 3 or more dimensions equally efficiently. To produce a general purpose program for a particular range of applications it is only necessary to provide a set of element subroutines specialised to the application (heat transfer, framework analysis, continuum stress analysis etc)

  13. Adobe Photoshop Elements 10 unleash the hidden performance of Elements

    CERN Document Server

    Galer, Mark

    2011-01-01

    Master the most powerful photo editing tools and techniques that Elements has to offer! Using step-by-step projects, Mark Galer will have you creating stunning images in no time at all. Whether you want to create impressive, seamless montages, optimize your photos for perfect print quality, or simply enhance your images for maximum impact, Maximum Performance will give you the skills and know-how you need to create professional quality results. Featured projects teach you how to work with multilayered 16 bit/channel files, as well as convert to black and white using Adobe Camera Raw, create

  14. Peridynamic Multiscale Finite Element Methods

    Energy Technology Data Exchange (ETDEWEB)

    Costa, Timothy [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Bond, Stephen D. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Littlewood, David John [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Moore, Stan Gerald [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

    2015-12-01

    The problem of computing quantum-accurate design-scale solutions to mechanics problems is rich with applications and serves as the background to modern multiscale science research. The prob- lem can be broken into component problems comprised of communicating across adjacent scales, which when strung together create a pipeline for information to travel from quantum scales to design scales. Traditionally, this involves connections between a) quantum electronic structure calculations and molecular dynamics and between b) molecular dynamics and local partial differ- ential equation models at the design scale. The second step, b), is particularly challenging since the appropriate scales of molecular dynamic and local partial differential equation models do not overlap. The peridynamic model for continuum mechanics provides an advantage in this endeavor, as the basic equations of peridynamics are valid at a wide range of scales limiting from the classical partial differential equation models valid at the design scale to the scale of molecular dynamics. In this work we focus on the development of multiscale finite element methods for the peridynamic model, in an effort to create a mathematically consistent channel for microscale information to travel from the upper limits of the molecular dynamics scale to the design scale. In particular, we first develop a Nonlocal Multiscale Finite Element Method which solves the peridynamic model at multiple scales to include microscale information at the coarse-scale. We then consider a method that solves a fine-scale peridynamic model to build element-support basis functions for a coarse- scale local partial differential equation model, called the Mixed Locality Multiscale Finite Element Method. Given decades of research and development into finite element codes for the local partial differential equation models of continuum mechanics there is a strong desire to couple local and nonlocal models to leverage the speed and state of the

  15. Inferring regulatory element landscapes and transcription factor networks from cancer methylomes.

    Science.gov (United States)

    Yao, Lijing; Shen, Hui; Laird, Peter W; Farnham, Peggy J; Berman, Benjamin P

    2015-05-21

    Recent studies indicate that DNA methylation can be used to identify transcriptional enhancers, but no systematic approach has been developed for genome-wide identification and analysis of enhancers based on DNA methylation. We describe ELMER (Enhancer Linking by Methylation/Expression Relationships), an R-based tool that uses DNA methylation to identify enhancers and correlates enhancer state with expression of nearby genes to identify transcriptional targets. Transcription factor motif analysis of enhancers is coupled with expression analysis of transcription factors to infer upstream regulators. Using ELMER, we investigated more than 2,000 tumor samples from The Cancer Genome Atlas. We identified networks regulated by known cancer drivers such as GATA3 and FOXA1 (breast cancer), SOX17 and FOXA2 (endometrial cancer), and NFE2L2, SOX2, and TP63 (squamous cell lung cancer). We also identified novel networks with prognostic associations, including RUNX1 in kidney cancer. We propose ELMER as a powerful new paradigm for understanding the cis-regulatory interface between cancer-associated transcription factors and their functional target genes.

  16. Finite element analysis of elasto-plastic plate bending problems using transition rectangular plate elements

    Institute of Scientific and Technical Information of China (English)

    Bahattin Kanber; O.Yavuz Bozkurt

    2006-01-01

    In this work,the finite element analysis of the elasto-plastic plate bending problems is carried out using transition rectangular plate elements.The shape functions of the transition plate elements are derived based on a practical rule.The transition plate elements are all quadrilateral and can be used to obtain efficient finite element models using minimum number of elements.The mesh convergence rates of the models including the transition elements are compared with the regular element models.To verify the developed elements,simple tests are demonstrated and various elasto-plastic problems are solved.Their results are compared with ANSYS results.

  17. Implementing wavelet transform with SAW elements

    Institute of Scientific and Technical Information of China (English)

    LU; Wenke(卢文科); ZHU; Changchun(朱长纯); LIU; Junhua(刘君华); LIU; Qinghong(刘清洪)

    2003-01-01

    In the design of the finger-overlap envelope according to the envelope of wavelet function, it is concluded that the pulse-response function of the interdigital transducer (IDT) for surface acoustic wave (SAW) is identical to the wavelet function. SAW type of the wavelet-transform element is manufactured. A new method of using two wavelet-transform elements to manufacture the reconstruction element of the wavelet transform is proposed. The sources of the element error are analyzed, and the methods for reducing the error are put forward. SAW type of the wavelet transformation element and its reconstruction element have the following three characteristics: (i) the implementing methods of the wavelet transform element and its reconstruction element are simple, and free of complicated mathematical algorithms of the wavelet transform; (ii) because one of SAW element is fast, the response velocities of SAW type of the wavelet transform element and its reconstruction element are also fast; (iii) the costs of the wavelet transform element and its reconstruction element are low, so the elements may be manufactured in a large quantity.

  18. Cis and Trans, p53 and NF-kB rules of transactivation

    OpenAIRE

    Sharma, Vasundhara

    2016-01-01

    p53 and NF-kB families of Transcription Factors (TFs) are among the most studied proteins in tumour biology, typically known to function as antagonists, although recent studies identified example of positive, even cooperative interactions. p53 and NF-kB act as dimer or dimer of dimers, bind cis regulatory elements (referred herein as Response Elements REs) of which multiple versions exist in the genome, and coordinate very large networks of target genes, through highly regulated transactivati...

  19. Calculation of binary phase diagrams between the actinide elements, rare earth elements, and transition metal elements

    International Nuclear Information System (INIS)

    Attempts were made to apply the Kaufman method of calculating binary phase diagrams to the calculation of binary phase diagrams between the rare earths, actinides, and the refractory transition metals. Difficulties were encountered in applying the method to the rare earths and actinides, and modifications were necessary to provide accurate representation of known diagrams. To calculate the interaction parameters for rare earth-rare earth diagrams, it was necessary to use the atomic volumes for each of the phases: liquid, body-centered cubic, hexagonal close-packed, and face-centered cubic. Determination of the atomic volumes of each of these phases for each element is discussed in detail. In some cases, empirical means were necessary. Results are presented on the calculation of rare earth-rare earth, rare earth-actinide, and actinide-actinide diagrams. For rare earth-refractory transition metal diagrams and actinide-refractory transition metal diagrams, empirical means were required to develop values for the enthalpy of vaporization for rare earth elements and values for the constant (C) required when intermediate phases are present. Results of using the values determined for each element are presented

  20. Super-Light Prefabricated Deck Element Integrated in Traditional Concrete Prefabricated Element Construction

    DEFF Research Database (Denmark)

    Christensen, Jacob Ellehauge; Hertz, Kristian Dahl

    the super-light slab element are element size, which have greatly reduced the total number of elements the pedestrian bridges consist of. The application also demonstrated the ability to control the path that the forces will take in the element. The deck elements are for example fully prepared at the...

  1. Fluidic Elements based on Coanda Effect

    Directory of Open Access Journals (Sweden)

    Constantin OLIVOTTO

    2010-12-01

    Full Text Available This paper contains first some definitions and classifications regarding the fluidic elements. Thegeneral current status is presented, nominating the main specific elements based on the Coanda effect developedspecially in Romania. In particularly the development of an original bistable element using industrial compressedair at industrial pressure supply is presented. The function of this element is based on the controlled attachmentof the main jet at a curved wall through the Coanda effect. The methods used for particular calculation andexperiments are nominated. The main application of these elements was to develop a specific execution element:a fluidic step–by-step motor based on the Coanda effect.

  2. Formulations of a hydromechanical interface element

    Institute of Scientific and Technical Information of China (English)

    Zhong-Zhi Fu; Si-Hong Liu

    2011-01-01

    A hydromechanical interface element is proposed for the consideration of the hydraulic-mechanical coupling effect along the interface.The fully coupled governing equations and the relevant finite element formulations are derived in detail for the interface element.All the involved matrices are of the same form as those of a solid element,which makes the incorporation of the model into a finite element program straightforward.Three examples are then numerically simulated using the interface element.Reasonable results confirm the correctness of the proposed model and motivate its application in hydromechanical contact problems in the future.

  3. Nuclear reactor fuel element. Kernreaktorbrennelement

    Energy Technology Data Exchange (ETDEWEB)

    Lippert, H.J.

    1985-03-28

    The fuel element box for a BWR is situated with a corner bolt on the inside in one corner of its top on the top side of the top plate. This corner bolt is screwed down with a bolt with a corner part which is provided with leaf springs outside on two sides, where the bolt has a smaller diameter and an expansion shank. The bolt is held captive to the bolt head on the top and the holder on the bottom of the corner part. The holder is a locknut. If the expansion forces are too great, the bolt can only break at the expansion shank.

  4. Transportation of irradiated fuel elements

    International Nuclear Information System (INIS)

    The report falls under the headings: introduction (explaining the special interest of the London Borough of Brent, as forming part of the route for transportation of irradiated fuel elements); nuclear power (with special reference to transport of spent fuel and radioactive wastes); the flask aspect (design, safety regulations, criticisms, tests, etc.); the accident aspect (working manual for rail staff, train formation, responsibility, postulated accident situations); the emergency arrangements aspect; the monitoring aspect (health and safety reports); legislation; contingency plans; radiation - relevant background information. (U.K.)

  5. Elements of partial differential equations

    CERN Document Server

    Sneddon, Ian N

    2006-01-01

    Geared toward students of applied rather than pure mathematics, this volume introduces elements of partial differential equations. Its focus is primarily upon finding solutions to particular equations rather than general theory.Topics include ordinary differential equations in more than two variables, partial differential equations of the first and second orders, Laplace's equation, the wave equation, and the diffusion equation. A helpful Appendix offers information on systems of surfaces, and solutions to the odd-numbered problems appear at the end of the book. Readers pursuing independent st

  6. Elements of abstract harmonic analysis

    CERN Document Server

    Bachman, George

    2013-01-01

    Elements of Abstract Harmonic Analysis provides an introduction to the fundamental concepts and basic theorems of abstract harmonic analysis. In order to give a reasonably complete and self-contained introduction to the subject, most of the proofs have been presented in great detail thereby making the development understandable to a very wide audience. Exercises have been supplied at the end of each chapter. Some of these are meant to extend the theory slightly while others should serve to test the reader's understanding of the material presented. The first chapter and part of the second give

  7. Basic Elements of Knowledge Management

    Directory of Open Access Journals (Sweden)

    Marcin W. Staniewski

    2007-10-01

    Full Text Available The article is a review of basic knowledge management terminology. It presents such a description as: knowledge resources levels (data, information, knowledge, and wisdom, knowledge sources (internal, external, and knowledge typology (implicit, tacit or individual, social. Moreover the article characterizes knowledge management process, knowledge management system and main knowledge management strategies (codification, personalization. At the end of the article there is mentioned the knowledge creating process (the concept of knowledge creation spiral and the role of Intelligence Technology (IT and organizational culture as main elements supporting knowledge management implementation in organizations.

  8. Differential trypanosome surface coat regulation by a CCCH protein that co-associates with procyclin mRNA cis-elements.

    Directory of Open Access Journals (Sweden)

    Pegine Walrad

    2009-02-01

    Full Text Available The genome of Trypanosoma brucei is unusual in being regulated almost entirely at the post-transcriptional level. In terms of regulation, the best-studied genes are procyclins, which encode a family of major surface GPI-anchored glycoproteins (EP1, EP2, EP3, GPEET that show differential expression in the parasite's tsetse-fly vector. Although procyclin mRNA cis-regulatory sequences have provided the paradigm for post-transcriptional control in kinetoplastid parasites, trans-acting regulators of procyclin mRNAs are unidentified, despite intensive effort over 15 years. Here we identify the developmental regulator, TbZFP3, a CCCH-class predicted RNA binding protein, as an isoform-specific regulator of Procyclin surface coat expression in trypanosomes. We demonstrate (i that endogenous TbZFP3 shows sequence-specific co-precipitation of EP1 and GPEET, but not EP2 and EP3, procyclin mRNA isoforms, (ii that ectopic overexpression of TbZFP3 does not perturb the mRNA abundance of procyclin transcripts, but rather that (iii their protein expression is regulated in an isoform-specific manner, as evidenced by mass spectrometric analysis of the Procyclin expression signature in the transgenic cell lines. The TbZFP3 mRNA-protein complex (TbZFP3mRNP is identified as a trans-regulator of differential surface protein expression in trypanosomes. Moreover, its sequence-specific interactions with procyclin mRNAs are compatible with long-established predictions for Procyclin regulation. Combined with the known association of TbZFP3 with the translational apparatus, this study provides a long-sought missing link between surface protein cis-regulatory signals and the gene expression machinery in trypanosomes.

  9. METHODOLOGICAL ELEMENTS OF SITUATIONAL ANALYSIS

    Directory of Open Access Journals (Sweden)

    Tetyana KOVALCHUK

    2016-07-01

    Full Text Available The article deals with the investigation of theoretical and methodological principles of situational analysis. The necessity of situational analysis is proved in modern conditions. The notion “situational analysis” is determined. We have concluded that situational analysis is a continuous system study which purpose is to identify dangerous situation signs, to evaluate comprehensively such signs influenced by a system of objective and subjective factors, to search for motivated targeted actions used to eliminate adverse effects of the exposure of the system to the situation now and in the future and to develop the managerial actions needed to bring the system back to norm. It is developed a methodological approach to the situational analysis, its goal is substantiated, proved the expediency of diagnostic, evaluative and searching functions in the process of situational analysis. The basic methodological elements of the situational analysis are grounded. The substantiation of the principal methodological elements of system analysis will enable the analyst to develop adaptive methods able to take into account the peculiar features of a unique object which is a situation that has emerged in a complex system, to diagnose such situation and subject it to system and in-depth analysis, to identify risks opportunities, to make timely management decisions as required by a particular period.

  10. Mars Surface Tunnel Element Concept

    Science.gov (United States)

    Rucker, Michelle A.; Mary, Natalie; Howe, A. Scott; Jeffries, Sharon

    2016-01-01

    How Mars surface crews get into their ascent vehicle has profound implications for Mars surface architecture. To meet planetary protection protocols, the architecture has get Intravehicular Activity (IVA)-suited crew into a Mars Ascent Vehicle (MAV) without having to step outside into the Mars environment. Pushing EVA suit don/doff and EVA operations to an element that remains on the surface also helps to minimize MAV cabin volume, which in turn can reduce MAV cabin mass. Because the MAV will require at least seven kilograms of propellant to ascend each kilogram of cabin mass, minimal MAV mass is desired. For architectures involving more than one surface element-such as an ascent vehicle and a pressurized rover or surface habitat-a retractable tunnel is an attractive solution. Beyond addressing the immediate MAV access issue, a reusable tunnel may be useful for other surface applications once its primary mission is complete. A National Aeronautics and Space Administration (NASA) team is studying the optimal balance between surface tunnel functionality, mass, and stowed volume as part of the Evolvable Mars Campaign (EMC). The "Minimum Functional Tunnel" is a conceptual design that performs a single function. Having established this baseline configuration, the next step is to trade design options, evaluate other applications, and explore alternative solutions.

  11. Analysis of composite structural elements

    Directory of Open Access Journals (Sweden)

    A. Baier

    2010-12-01

    Full Text Available Purpose: The themes of the study are composite structural components. For this purpose have been designed and built several research positions.Design/methodology/approach: Using different structural materials to build new device components requires multiple tests of the components. Research posts were designed in the advanced graphical program CAx Siemens NX 7.5. Analysed samples were made from the glass fibre, aramid and carbon of various weights. Due to the specific use of composite materials it focuses on the elements in the form of plates and flat bars. For the examination of experimental strain gauge technique was used bead, the force sensor and displacement sensor. The experimental methods were compared with computer simulation using the FEM.Findings: The aim of this study was to determine the basic material constants and a comparison of the experimental method and the method of computer simulation.Research limitations/implications: Change the number of layers and how to connect the laminate with the steel plate changes mechanical properties of the structural component.Practical implications: The ultimate result will be knowledge on the different forms of laminates, such as material properties, the stresses in all layers, strain and comparing the results obtained by two methods.Originality/value: The expected outcome of the study will be the composition and method of joining composite laminate with a steel plate to the possible application in the repair and construction of structural elements of freight wagons.

  12. Light element opacities from ATOMIC

    Science.gov (United States)

    Colgan, J.; Kilcrease, D. P.; Magee, N. H.; Armstrong, G. S. J.; Abdallah, J.; Sherrill, M. E.; Fontes, C. J.; Zhang, H. L.; Hakel, P.

    2013-06-01

    We present new calculations of local-thermodynamic-equilibrium (LTE) light element opacities from the Los Alamos ATOMIC code. ATOMIC is a multi-purpose code that can generate LTE or non-LTE quantities of interest at various levels of approximation. A program of work is currently underway to compute new LTE opacity data for all elements H through Zn. New opacity tables for H through Ne are complete, and a new Fe opacity table will be available soon. Our calculations, which include fine-structure detail, represent a systematic improvement over previous Los Alamos opacity calculations using the LEDCOP legacy code. Our opacity calculations incorporate atomic structure data computed from the CATS code, which is based on Cowan's atomic structure codes, and photoionization cross section data computed from the Los Alamos ionization code GIPPER. We make use of a new equation-of-state (EOS) model based on the chemical picture. ATOMIC incorporates some physics packages from LEDCOP and also includes additional physical processes, such as improved free-free cross sections and additional scattering mechanisms. In this report, we briefly discuss the physics improvements included in our new opacity calculations and present comparisons of our new opacities with other work for C, O, and Fe at selected conditions.

  13. Fuel elements of thermionic converters

    Energy Technology Data Exchange (ETDEWEB)

    Hunter, R.L. [ed.] [Sandia National Labs., Albuquerque, NM (United States). Environmental Systems Assessment Dept.; Gontar, A.S.; Nelidov, M.V.; Nikolaev, Yu.V.; Schulepov, L.N. [RI SIA Lutch, Podolsk (Russian Federation)

    1997-01-01

    Work on thermionic nuclear power systems has been performed in Russia within the framework of the TOPAZ reactor program since the early 1960s. In the TOPAZ in-core thermionic convertor reactor design, the fuel element`s cladding is also the thermionic convertor`s emitter. Deformation of the emitter can lead to short-circuiting and is the primary cause of premature TRC failure. Such deformation can be the result of fuel swelling, thermocycling, or increased unilateral pressure on the emitter due to the release of gaseous fission products. Much of the work on TRCs has concentrated on preventing or mitigating emitter deformation by improving the following materials and structures: nuclear fuel; emitter materials; electrical insulators; moderator and reflector materials; and gas-exhaust device. In addition, considerable effort has been directed toward the development of experimental techniques that accurately mimic operational conditions and toward the creation of analytical and numerical models that allow operational conditions and behavior to be predicted without the expense and time demands of in-pile tests. New and modified materials and structures for the cores of thermionic NPSs and new fabrication processes for the materials have ensured the possibility of creating thermionic NPSs for a wide range of powers, from tens to several hundreds of kilowatts, with life spans of 5 to 10 years.

  14. Apparatus for locating defective nuclear fuel elements

    International Nuclear Information System (INIS)

    An ultrasonic search unit for locating defective fuel elements within a fuel assembly used in a water cooled nuclear reactor is presented. The unit is capable of freely traversing the restricted spaces between the fuel elements

  15. Natural wetland emissions of methylated trace elements

    NARCIS (Netherlands)

    Vriens, B.; Lenz, M.; Charlet, L.; Berg, M.; Winkel, L.H.E.

    2014-01-01

    Natural wetlands are well known for their significant methane emissions. However, trace element emissions via biomethylation and subsequent volatilization from pristine wetlands are virtually unstudied, even though wetlands constitute large reservoirs for trace elements. Here we show that the averag

  16. Dow Introduces "Human Element" to China

    Institute of Scientific and Technical Information of China (English)

    Jenny Du

    2007-01-01

    @@ Recently, the DOW Chemical Company of the United States introduced the "Human Element" to China. The "Human Element" series campaignwas launched in North America and Europe respectively from 2006 and the Q2 of 2007.

  17. Natural wetland emissions of methylated trace elements

    Science.gov (United States)

    Vriens, Bas; Lenz, Markus; Charlet, Laurent; Berg, Michael; Winkel, Lenny H. E.

    2014-01-01

    Natural wetlands are well known for their significant methane emissions. However, trace element emissions via biomethylation and subsequent volatilization from pristine wetlands are virtually unstudied, even though wetlands constitute large reservoirs for trace elements. Here we show that the average volatile fluxes of selenium (health-relevant trace elements will increase with global warming. We suggest that biomethylation and volatilization in wetlands play a crucial role in the mobilization and global biogeochemical cycling of trace elements.

  18. Flux-conserving finite element methods

    OpenAIRE

    Zhang, Shangyou; Zhang, Zhimin; Zou, Qingsong

    2012-01-01

    We analyze the flux conservation property of the finite element method. It is shown that the finite element solution does approximate the flux locally in the optimal order, i.e., the same order as that of the nodal interpolation operator. We propose two methods, post-processing the finite element solutions locally. The new solutions, remaining as optimal-order solutions, are flux-conserving elementwise. In one of our methods, the processed solution also satisfies the original finite element e...

  19. Continuous finite element methods for Hamiltonian systems

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    By applying the continuous finite element methods of ordinary differential equations, the linear element methods are proved having second-order pseudo-symplectic scheme and the quadratic element methods are proved having third-order pseudosymplectic scheme respectively for general Hamiltonian systems, and they both keep energy conservative. The finite element methods are proved to be symplectic as well as energy conservative for linear Hamiltonian systems. The numerical results are in agreement with theory.

  20. Light elements in oceanic and ophiolitic serpentinities

    OpenAIRE

    Vils, Flurin Andri; Katz, Angelika

    2009-01-01

    Despite the key importance of altered oceanic mantle as a repository and carrier of light elements (B, Li, and Be) to depth, its inventory of these elements has hardly been explored and quantified. In order to constrain the systematics and budgets of these elements in the oceanic lithosphere, this thesis has studied samples of highly serpentinized peridotites from the mid-Atlantic ridge (ODP Leg 209) and progressively metamorphosed alpine ophiolites (Totalp, Platta and Malenco). Light element...

  1. ELEMENT FUNCTIONS OF DISCRETE OPERATOR DIFFERENCE METHOD

    Institute of Scientific and Technical Information of China (English)

    田中旭; 唐立民; 刘正兴

    2002-01-01

    The discrete scheme called discrete operator difference for differential equations was given. Several difference elements for plate bending problems and plane problems were given. By investigating these elements, the ability of the discrete forms expressing to the element functions was talked about. In discrete operator difference method, the displacements of the elements can be reproduced exactly in the discrete forms whether the displacements are conforming or not. According to this point, discrete operator difference method is a method with good performance.

  2. Data Element Dictionary: Facilities. Preliminary Draft.

    Science.gov (United States)

    Thomas, Charles R.

    The draft includes--(1) comments on file structure, (2) descriptions of dictionary organization and format, (3) alphabetical lists of elements, and (4) facilities related elements in dictionary form. The data element definitions in this draft are compatible with the Higher Education Facilities Classification and Inventory Procedures Manual, which…

  3. Main: ELEMENT1GMLBC3 [PLACE

    Lifescience Database Archive (English)

    Full Text Available ELEMENT1GMLBC3 S000319 7-Sep-2000 (last modified) seki Element 1 found in the promo...ter of soybean (G.m.) leghaemoglobin lbc3 gene; Binding site of nuclear extract from soybean nodules; Locate...Element 2 share a common motif; See S000320; nodule; leghaemoglobin; lbc3; root; Soybean (Glycine max) GATATATTAATATTTTATTTTATA ...

  4. Elements from chlorine to calcium nuclear reactions

    CERN Document Server

    Kunz, Wunibald

    1968-01-01

    Nuclear Tables: Part II Nuclear Reactions, Volume 3: The Elements from Chlorine to Calcium contains tabulations of the nuclear reaction values of elements chlorine, argon, potassium, and calcium. These tabulations provide the calculated Q-values of the elements and their isotopes. This book will be of value to general chemistry researchers.

  5. Downhole elemental analysis with LIBS

    Science.gov (United States)

    Moreschini, P.; Zacny, K.; Rickman, D.

    2011-12-01

    In this paper we discuss a novel instrument, currently under development at Honeybee Robotics with SBIR funding from NASA. The device is designed to characterize elemental composition as a function of depth in non-terrestrial geological formations. The instrument consists of a miniaturized LIBS analyzer integrated in a 2" diameter drill string. While the drill provides subsurface access, the LIBS analyzer provides information on the elemental composition of the borehole wall. This instrument has a variety of space applications ranging from exploration of the Moon for which it was originally designed, to Mars, as well as a variety of terrestrial applications. Subsurface analysis is usually performed by sample acquisition through a drill or excavator, followed by sample preparation and subsequent sample presentation to an instrument or suite of instruments. An alternative approach consisting in bringing a miniaturized version of the instrument to the sample has many advantages over the traditional methodology, as it allows faster response, reduced probability of cross-contamination and a simplification in the sampling mechanisms. LIBS functions by focusing a high energy laser on a material inducing a plasma consisting of a small fraction of the material under analysis. Optical emission from the plasma, analyzed by a spectrometer, can be used to determine elemental composition. A triangulation sensor located in the sensor head determines the distance of the sensor from the borehole wall. An actuator modifies the position of the sensor accordingly, in order to compensate for changes due to the profile of the borehole walls. This is necessary because LIBS measurements are negatively affected by changes in the relative position of the focus of the laser with respect to the position of the sample (commonly referred to as the "lens to sample distance"). Profiling the borehole is done by adjusting the position of the sensor with a vertical stage; a second actuator at the

  6. Elements of algebraic coding systems

    CERN Document Server

    Cardoso da Rocha, Jr, Valdemar

    2014-01-01

    Elements of Algebraic Coding Systems is an introductory textto algebraic coding theory. In the first chapter, you'll gain insideknowledge of coding fundamentals, which is essential for a deeperunderstanding of state-of-the-art coding systems.This book is a quick reference for those who are unfamiliar withthis topic, as well as for use with specific applications such as cryptographyand communication. Linear error-correcting block codesthrough elementary principles span eleven chapters of the text.Cyclic codes, some finite field algebra, Goppa codes, algebraic decodingalgorithms, and applications in public-key cryptography andsecret-key cryptography are discussed, including problems and solutionsat the end of each chapter. Three appendices cover the Gilbertbound and some related derivations, a derivation of the Mac-Williams' identities based on the probability of undetected error,and two important tools for algebraic decoding-namely, the finitefield Fourier transform and the Euclidean algorithm for polynomials.

  7. Logical elements in living cells.

    Science.gov (United States)

    Kremen, A

    1984-11-01

    Recognition processes with enhanced accuracy (as performed by structures like enzymes or ribosomes) are investigated using elementary ideas of statistical mechanics and related concepts of thermodynamics. The analysis starts from a formal definition of recognition and provides a correspondence with appropriate physical properties of the macromolecular logical elements. Transitions of the recognizing system between different modifications are a necessary feature of a more exacting recognition process. Rearrangement steps provide the process with higher accuracy by performing two physical operations: (1) rearranging the phase space of the system so that the "correct" states be better separated from the "wrong" states and the probability of occupation of the "correct" states be enhanced, (2) directing the process toward the more favourable modifications thus formed. Both operations are related to changes in the physical properties of the recognizing system. These changes can be expressed as differences of macromolecular Gibbs energy levels; if ligand binding or release participate in a step, directivity of the step depends also on the actual chemical potentials of the ligands in solution. The two operations just mentioned resemble two basic operations known to be necessary in electronic digital networks: directivity of control and signal standardization. An analysis of the entire reaction catalysed by a macromolecular logical element takes into account the requirements imposed by the logical functions as well as the need that the chemical potential of the product be not restricted to very low values. To satisfy these conditions, the reaction must be supported by a so-called non-specific reaction, usually implemented by the cleavage reaction of a nucleoside triphosphate. PMID:6513567

  8. AthaMap web tools for the analysis and identification of co-regulated genes.

    Science.gov (United States)

    Galuschka, Claudia; Schindler, Martin; Bülow, Lorenz; Hehl, Reinhard

    2007-01-01

    The AthaMap database generates a map of cis-regulatory elements for the whole Arabidopsis thaliana genome. This database has been extended by new tools to identify common cis-regulatory elements in specific regions of user-provided gene sets. A resulting table displays all cis-regulatory elements annotated in AthaMap including positional information relative to the respective gene. Further tables show overviews with the number of individual transcription factor binding sites (TFBS) present and TFBS common to the whole set of genes. Over represented cis-elements are easily identified. These features were used to detect specific enrichment of drought-responsive elements in cold-induced genes. For identification of co-regulated genes, the output table of the colocalization function was extended to show the closest genes and their relative distances to the colocalizing TFBS. Gene sets determined by this function can be used for a co-regulation analysis in microarray gene expression databases such as Genevestigator or PathoPlant. Additional improvements of AthaMap include display of the gene structure in the sequence window and a significant data increase. AthaMap is freely available at http://www.athamap.de/. PMID:17148485

  9. A New Geochemical Classification of Elements

    Institute of Scientific and Technical Information of China (English)

    Qi Changmou; L. Lynn Chyi

    2001-01-01

    The geochemical classification proposed by Goldschmidt was based on meteoritic analysis and elemental partition in blast furnace. There are many surprises when applied to the discussion of natural occurrences. A modified classification of elements based on basic chemical properties and their occurrences. A modified classification of elements based on basic chemical properties and their occurrences in nature is, therefore, proposed for students learning geochemistry and geologists working in the field. Elements are classified into six groups including lithophile, oxyphile, siderophile, chalcophile, biophile, and atmophile elements. Five terms are taken from Goldshcmidt's original classification. Oxyphile is a new term.

  10. Spectral-element agglomerate coarsening in AMGe

    Energy Technology Data Exchange (ETDEWEB)

    Vassilevski, P S

    2000-12-06

    In this talk the authors present a highly accurate coarsening algorithm for constructing coarse finite element spaces to be used in algebraic multigrid methods designed for finite element problems on generally unstructured meshes. The new algorithm relies on removing certain percentage of the high oscillating components from the spectrum of local stiffness matrices corresponding to element agglomerations. By doing so, one is guaranteed that the hierarchical complement finite element subspace gives rise to a well conditioned matrix. The coarsening consists of an agglomeration step and of computing a few minimal eigenvectors of the corresponding assembled agglomerate stiffness matrix. The method requires access to the individual element matrices. Based on the topological agglomeration algorithms they employed one is able to define coarse elements and coarse element matrices thus allowing for recursive use of the same algorithm. Some numerical illustration for elliptic problems is also given.

  11. Osmolality of Elemental and Semi-Elemental Formulas Supplemented with Nonprotein Energy Supplements

    OpenAIRE

    Pereira-da-Silva, L; Pitta-Grós Dias, M; Virella, D; Serelha, M.

    2008-01-01

    Elemental and semi-elemental formulas are used to feed infants with short bowel syndrome, who may not be able to tolerate feeds of more than 310 mOsm kg(-1). The present study aimed to measure the osmolality of elemental and semi-elemental formulas at different concentrations, with and without the addition of nonprotein energy supplements.

  12. Regulation of human clotting factor IX cDNA expression in transgenic mice

    Institute of Scientific and Technical Information of China (English)

    胡以平; 邱信芳; 薛京伦; 刘祖洞

    1995-01-01

    To study the expression of human dotting factor IX cDNA in transgenic mice,Which is an es-sential work on gene therapy for hemophilia B,3 recombinant constructions containing different lengths ofhuman dotting factor IX cDNA have been introduced into the cultured cells.All of the recombinant constructionswere found to he expressed well in vitro.They were then microinjected into the male pronudei of the fertilizedmouse eggs respectively for generating trahsgenic mice.Unfortunately,none of them was expressed in any transgenicmice.These results show that the expression of the human clotting factor IX cDNA in the transgenic mice canbe determined by cis regulatory element(s).As compared With the results from other related works,it is sug-gested that the cis regulatory element(s)is resided in the 5’-end non-coding region.

  13. Functional Metamirrors Using Bianisotropic Elements

    Science.gov (United States)

    Asadchy, V. S.; Ra'di, Y.; Vehmas, J.; Tretyakov, S. A.

    2015-03-01

    Conventional mirrors obey the simple reflection law that a plane wave is reflected as a plane wave, at the same angle. To engineer spatial distributions of fields reflected from a mirror, one can either shape the reflector or position some phase-correcting elements on top of a mirror surface. Here we show, both theoretically and experimentally, that full-power reflection with general control over the reflected wave phase is possible with a single-layer array of deeply subwavelength inclusions. These proposed artificial surfaces, metamirrors, provide various functions of shaped or nonuniform reflectors without utilizing any mirror. This can be achieved only if the forward and backward scattering of the inclusions in the array can be engineered independently, and we prove that it is possible using electrically and magnetically polarizable inclusions. The proposed subwavelength inclusions possess desired reflecting properties at the operational frequency band, while at other frequencies the array is practically transparent. The metamirror concept leads to a variety of applications over the entire electromagnetic spectrum, such as optically transparent focusing antennas for satellites, multifrequency reflector antennas for radio astronomy, low-profile conformal antennas for telecommunications, and nanoreflectarray antennas for integrated optics.

  14. Chromosome rearrangements and transposable elements.

    Science.gov (United States)

    Lonnig, Wolf-Ekkehard; Saedler, Heinz

    2002-01-01

    There has been limited corroboration to date for McClintock's vision of gene regulation by transposable elements (TEs), although her proposition on the origin of species by TE-induced complex chromosome reorganizations in combination with gene mutations, i.e., the involvement of both factors in relatively sudden formations of species in many plant and animal genera, has been more promising. Moreover, resolution is in sight for several seemingly contradictory phenomena such as the endless reshuffling of chromosome structures and gene sequences versus synteny and the constancy of living fossils (or stasis in general). Recent wide-ranging investigations have confirmed and enlarged the number of earlier cases of TE target site selection (hot spots for TE integration), implying preestablished rather than accidental chromosome rearrangements for nonhomologous recombination of host DNA. The possibility of a partly predetermined generation of biodiversity and new species is discussed. The views of several leading transposon experts on the rather abrupt origin of new species have not been synthesized into the macroevolutionary theory of the punctuated equilibrium school of paleontology inferred from thoroughly consistent features of the fossil record. PMID:12429698

  15. Trace Element Management in Rice

    Directory of Open Access Journals (Sweden)

    Abin Sebastian

    2015-08-01

    Full Text Available Trace elements (TEs are vital for the operation of metabolic pathways that promote growth and structural integrity. Paddy soils are often prone to TE limitation due to intensive cultivation and irrigation practices. Apart from this, rice paddies are potentially contaminated with transition metals such as Cd, which are often referred to as toxic TEs. Deficiency of TEs in the soil not only delays plant growth but also causes exposure of plant roots to toxic TEs. Fine-tuning of nutrient cycling in the rice field is a practical solution to cope with TEs deficiency. Adjustment of soil physicochemical properties, biological process such as microbial activities, and fertilization helps to control TEs mobilization in soil. Modifications in root architecture, metal transporters activity, and physiological processes are also promising approaches to enhance TEs accumulation in grains. Through genetic manipulation, these modifications help to increase TE mining capacity of rice plants as well as transport and trafficking of TEs into the grains. The present review summarizes that regulation of TE mobilization in soil, and the genetic improvement of TE acquisition traits help to boost essential TE content in rice grain.

  16. Finite element coiled cochlea model

    Science.gov (United States)

    Isailovic, Velibor; Nikolic, Milica; Milosevic, Zarko; Saveljic, Igor; Nikolic, Dalibor; Radovic, Milos; Filipović, Nenad

    2015-12-01

    Cochlea is important part of the hearing system, and thanks to special structure converts external sound waves into neural impulses which go to the brain. Shape of the cochlea is like snail, so geometry of the cochlea model is complex. The simplified cochlea coiled model was developed using finite element method inside SIFEM FP7 project. Software application is created on the way that user can prescribe set of the parameters for spiral cochlea, as well as material properties and boundary conditions to the model. Several mathematical models were tested. The acoustic wave equation for describing fluid in the cochlea chambers - scala vestibuli and scala timpani, and Newtonian dynamics for describing vibrations of the basilar membrane are used. The mechanical behavior of the coiled cochlea was analyzed and the third chamber, scala media, was not modeled because it does not have a significant impact on the mechanical vibrations of the basilar membrane. The obtained results are in good agreement with experimental measurements. Future work is needed for more realistic geometry model. Coiled model of the cochlea was created and results are compared with initial simplified coiled model of the cochlea.

  17. Interstitial Functionalization in elemental Si

    Science.gov (United States)

    Kiefer, Boris; Fohtung, Edwin

    Societies in the 21st century will face many challenges. Materials science and materials design will be essential to address and master some if not all of these challenges. Semiconductors are among the most important technological material classes. Properties such as electrical transport are strongly affected by defects and a central goal continues to be the reduction of defect densities as much as possible in these compounds. Here we present results of interstitial Fe doping in elemental Si using first-principles DFT calculations. The preliminary results show that Fe will only occupy octahedral interstitial sites. The analysis of the electronic structure shows that the compounds are ferromagnetic and that a bandgap opens as interstitial Fe concentrations decrease, with a possible intermittent semi-metallic phase. The formation energy for interstitial Fe is unfavorable, as expected, by ~1.5 eV but becomes favorable as the chemical potential of Fe increases. Therefore, we expect that biasing the system with an external electrical field will lead to the formation of these materials. Thus, our results show that interstitial defects can be beneficial for the design of functionalities that differ significantly from those of the host material.

  18. A NOVEL ELLIPSOIDAL ACOUSTIC INFINITE ELEMENT

    Institute of Scientific and Technical Information of China (English)

    YANG Rui-liang; WANG Hong-zhen

    2005-01-01

    A novel ellipsoidal acoustic infinite element is proposed. It is based a new pressure representation, which can describe and solve the ellipsoidal acoustic field more exactly. The shape functions of this novel acoustic infinite element are similar .to the Burnett's method, while the weight functions are defined as the product of the complex conjugates of the shaped functions and an additional weighting factor. The code of this method is cheap to generate as for 1-D element because only 1-D integral needs to be numerical. Coupling with the standard finite element, this method provides a capability for very efficiently modeling acoustic fields surrounding structures of virtually any practical shape. This novel method was deduced in brief and the conclusion was kept in detail. To test the feasibility of this novel method efficiently, in the examples the infinite elements were considered, excluding the finite elements relative. This novel ellipsoidal acoustic infinite element can deduce the analytic solution of an oscillating sphere. The example of a prolate spheroid shows that the novel infinite element is superior to the boundary element and other acoustic infinite elements. Analytical and numerical results of these examples show that this novel method is feasible.

  19. Stable isotopes for heavy element production

    CERN Document Server

    Lommel, B; Hofmann, S; Kindler, B; Klemm, J; Steiner, J; Tinschert, K

    2003-01-01

    The synthesis of heavy elements and the search for new superheavy elements is one of the exciting fields in modern nuclear physics and chemistry. Heavy elements are produced by heavy-ion fusion reactions. Necessary prerequisites are intense heavy-ion beams from pure isotopic material and thin isotopically enriched targets. At GSI the elements from 107 to 112 were produced using targets of Pb and Bi and beams of the most neutron rich isotopes of Cr, Fe, Ni, and Zn. Experimental set-up consisting of target wheel, velocity filter SHIP (Separator for Heavy Ion Reaction Products), and detector system is presented. Status of the ion source techniques for delivering intense and stable beams for this kind of experiment is shortly described. The manufacturing and properties of various source - target combinations used for the synthesis of the elements by now are discussed in detail as well as the possibilities for extending the experiments into the region of superheavy elements.

  20. Automated Fuel Element Closure Welding System

    International Nuclear Information System (INIS)

    The Automated Fuel Element Closure Welding System is a robotic device that will load and weld top end plugs onto nuclear fuel elements in a highly radioactive and inert gas environment. The system was developed at Argonne National Laboratory-West as part of the Fuel Cycle Demonstration. The welding system performs four main functions, it (1) injects a small amount of a xenon/krypton gas mixture into specific fuel elements, and (2) loads tiny end plugs into the tops of fuel element jackets, and (3) welds the end plugs to the element jackets, and (4) performs a dimensional inspection of the pre- and post-welded fuel elements. The system components are modular to facilitate remote replacement of failed parts. The entire system can be operated remotely in manual, semi-automatic, or fully automatic modes using a computer control system. The welding system is currently undergoing software testing and functional checkout

  1. Spacer for supporting fuel element boxes

    International Nuclear Information System (INIS)

    A spacer plate unit arranged externally on each side and at a predetermined level of a polygonal fuel element box for mutually supporting, with respect to one another, a plurality of the fuel element boxes forming a fuel element bundle, is formed of a first and a second spacer plate part each having the same length and the same width and being constituted of unlike first and second materials, respectively. The first and second spacer plate parts of the several spacer plate units situated at the predetermined level are arranged in an alternating continuous series when viewed in the peripheral direction of the fuel element box, so that any two spacer plate units belonging to face-to-face oriented sides of two adjoining fuel element boxes in the fuel element bundle define interfaces of unlike materials

  2. Completely normal elements in finite abelian extensions

    CERN Document Server

    Koo, Ja Kung

    2011-01-01

    We give a completely normal element in the maximal real subfield of a cyclotomic field over the field of rational numbers, which is different from that of Okada. This result is a consequence of the criterion for a normal element developed in [Normal bases of ray class fields over imaginary quadratic fields, Math. Zeit.]. Furthermore, we find a completely normal element in certain extension of modular function fields in terms of a quotient of the modular discriminant function.

  3. DETERMINATION OF IMPURITY ELEMENTS IN ALUMINIUM

    Institute of Scientific and Technical Information of China (English)

    侯小琳; 张永保

    1994-01-01

    Twenty five impurity elements in aluminium applied as reactor material are determined.Titanium and nickel are determined with epithermal neutron activation analysis(NAA),magnesium and silicon by inductance coupling plasma emission spectra(ICP),other elements by thermal NAA.The fission coefficient of uranium is given by an experiment,the interferences of uranium to Ce,Nd,Mo,Zr,La,Sm are subtracted.The detection limits of these methods to all of impurity elements in aluminium are calculated.

  4. Integrating Environmentally Responsive Elements in Buildings

    OpenAIRE

    Heiselberg, Per; Andresen, Inger; Perino, Marco; van der Aa, Ad

    2006-01-01

    Significant improvement have been achieved on efficiency improvements of specific building elements like the building envelope and building equipment and services and whilst most building elements still offer opportunities for efficiency improvements, the greatest future potential lie with technologies that promote the integration of responsive building elements and building services in integrated building concepts. In order to address some of these issues an international research effort, IE...

  5. The elements of life and medicines.

    Science.gov (United States)

    Chellan, Prinessa; Sadler, Peter J

    2015-03-13

    Which elements are essential for human life? Here we make an element-by-element journey through the periodic table and attempt to assess whether elements are essential or not, and if they are, whether there is a relevant code for them in the human genome. There are many difficulties such as the human biochemistry of several so-called essential elements is not well understood, and it is not clear how we should classify elements that are involved in the destruction of invading microorganisms, or elements which are essential for microorganisms with which we live in symbiosis. In general, genes do not code for the elements themselves, but for specific chemical species, i.e. for the element, its oxidation state, type and number of coordinated ligands, and the coordination geometry. Today, the biological periodic table is in a position somewhat similar to Mendeleev's chemical periodic table of 1869: there are gaps and we need to do more research to fill them. The periodic table also offers potential for novel therapeutic and diagnostic agents, based on not only essential elements, but also non-essential elements, and on radionuclides. Although the potential for inorganic chemistry in medicine was realized more than 2000 years ago, this area of research is still in its infancy. Future advances in the design of inorganic drugs require more knowledge of their mechanism of action, including target sites and metabolism. Temporal speciation of elements in their biological environments at the atomic level is a major challenge, for which new methods are urgently needed. PMID:25666066

  6. Anisotropic damping of Timoshenko beam elements

    DEFF Research Database (Denmark)

    Hansen, M.H.

    2001-01-01

    for ¤flapwise¤, ¤edgewise¤ and ¤torsional¤ vibrations. The structural damping forces acting on the beam element are modeled by viscous damping described by an element damping matrix. The composition of this matrix is basedon the element mass and stiffness matrices. It is shown how the coefficients for the mass...... and stiffness contributions can be calibrated to give the desired modal damping in the complete model of a blade....

  7. Benchmarking the QUAD4/TRIA3 element

    Science.gov (United States)

    Pitrof, Stephen M.; Venkayya, Vipperla B.

    1993-09-01

    The QUAD4 and TRIA3 elements are the primary plate/shell elements in NASTRAN. These elements enable the user to analyze thin plate/shell structures for membrane, bending and shear phenomena. They are also very new elements in the NASTRAN library. These elements are extremely versatile and constitute a substantially enhanced analysis capability in NASTRAN. However, with the versatility comes the burden of understanding a myriad of modeling implications and their effect on accuracy and analysis quality. The validity of many aspects of these elements were established through a series of benchmark problem results and comparison with those available in the literature and obtained from other programs like MSC/NASTRAN and CSAR/NASTRAN. Never-the-less such a comparison is never complete because of the new and creative use of these elements in complex modeling situations. One of the important features of QUAD4 and TRIA3 elements is the offset capability which allows the midsurface of the plate to be noncoincident with the surface of the grid points. None of the previous elements, with the exception of bar (beam), has this capability. The offset capability played a crucial role in the design of QUAD4 and TRIA3 elements. It allowed modeling layered composites, laminated plates and sandwich plates with the metal and composite face sheets. Even though the basic implementation of the offset capability is found to be sound in the previous applications, there is some uncertainty in relatively simple applications. The main purpose of this paper is to test the integrity of the offset capability and provide guidelines for its effective use. For the purpose of simplicity, references in this paper to the QUAD4 element will also include the TRIA3 element.

  8. Noncoding Elements: Evolution and Epigenetic Regulation

    KAUST Repository

    Seridi, Loqmane

    2016-03-09

    When the human genome project was completed, it revealed a surprising result. 98% of the genome did not code for protein of which more than 50% are repeats— later known as ”Junk DNA”. However, comparative genomics unveiled that many noncoding elements are evolutionarily constrained; thus luckily to have a role in genome stability and regulation. Though, their exact functions remained largely unknown. Several large international consortia such as the Functional Annotation of Mammalian Genomes (FANTOM) and the Encyclopedia of DNA Elements (ENCODE) were set to understand the structure and the regulation of the genome. Specifically, these endeavors aim to measure and reveal the transcribed components and functional elements of the genome. One of the most the striking findings of these efforts is that most of the genome is transcribed, including non-conserved noncoding elements and repeat elements. Specifically, we investigated the evolution and epigenetic properties of noncoding elements. 1. We compared genomes of evolutionarily distant species and showed the ubiquity of constrained noncoding elements in metazoa. 2. By integrating multi-omic data (such as transcriptome, nucleosome profiling, histone modifications), I conducted a comprehensive analysis of epigenetic properties (chromatin states) of conserved noncoding elements in insects. We showed that those elements have distinct and protective sequence features, undergo dynamic epigenetic regulation, and appear to be associated with the structural components of the chromatin, replication origins, and nuclear matrix. 3. I focused on the relationship between enhancers and repetitive elements. Using Cap Analysis of Gene Expression (CAGE) and RNASeq, I compiled a full catalog of active enhancers (a class of noncoding elements) during myogenesis of human primary cells of healthy donors and donors affected by Duchenne muscular dystrophy (DMD). Comparing the two time-courses, a significant change in the epigenetic

  9. Superheavy Elements Challenge Experimental and Theoretical Chemistry

    CERN Document Server

    Zvára, I

    2003-01-01

    When reflecting on the story of superheavy elements, the an experimenter, acknowledges the role, which the predictions of nuclear and chemical theories have played in ongoing studies. Today, the problems of major interest for experimental chemistry are the studies of elements 112 and 114 including their chemical identification. Advanced quantum chemistry calculations of atoms and molecules would be of much help. First experiments with element 112 evidence that the metal is much more volatile and inert than mercury.

  10. Domain decomposition methods for mortar finite elements

    Energy Technology Data Exchange (ETDEWEB)

    Widlund, O.

    1996-12-31

    In the last few years, domain decomposition methods, previously developed and tested for standard finite element methods and elliptic problems, have been extended and modified to work for mortar and other nonconforming finite element methods. A survey will be given of work carried out jointly with Yves Achdou, Mario Casarin, Maksymilian Dryja and Yvon Maday. Results on the p- and h-p-version finite elements will also be discussed.

  11. Novel characterisation of the gene encoding conglutinin reveals that previously characterised promoter corresponds to the CL-43 promoter

    DEFF Research Database (Denmark)

    Hansen, Soren; Moeller, Vivi; Holm, Dorte;

    2002-01-01

    '-flanking region shows 95.8% identity with the sequence previously published, which on the other hand shows 99.7% identity with the CL-43 promoter. We conclude that the previously published promoter corresponds to the CL-43 promoter and that the functional studies performed on it apply to transcription...... of CL-43. Comparison of potential cis-regulatory elements in relation to the functional studies indicates that the two genes are regulated by different mechanisms....

  12. Human COL2A1-directed SV40 T antigen expression in transgenic and chimeric mice results in abnormal skeletal development

    OpenAIRE

    1995-01-01

    The ability of SV40 T antigen to cause abnormalities in cartilage development in transgenic mice and chimeras has been tested. The cis- regulatory elements of the COL2A1 gene were used to target expression of SV40 T antigen to differentiating chondrocytes in transgenic mice and chimeras derived from embryonal stem (ES) cells bearing the same transgene. The major phenotypic consequences of transgenic (pAL21) expression are malformed skeleton, disproportionate dwarfism, and perinatal/neonatal d...

  13. Identification and dissection of a key enhancer mediating cranial neural crest specific expression of transcription factor, Ets-1

    OpenAIRE

    Barembaum, Meyer; Bronner, Marianne E.

    2013-01-01

    Neural crest cells form diverse derivatives that vary according to their level of origin along the body axis, with only cranial neural crest cells contributing to facial skeleton. Interestingly, the transcription factor Ets-1 is uniquely expressed in cranial but not trunk neural crest, where it functions as a direct input into neural crest specifier genes, Sox10 and FoxD3. We have isolated and interrogated a cis-regulatory element, conserved between birds and mammals, that drives reporter exp...

  14. Emerging principles of regulatory evolution

    OpenAIRE

    Prud'homme, Benjamin; Gompel, Nicolas; Carroll, Sean B.

    2007-01-01

    Understanding the genetic and molecular mechanisms governing the evolution of morphology is a major challenge in biology. Because most animals share a conserved repertoire of body-building and -patterning genes, morphological diversity appears to evolve primarily through changes in the deployment of these genes during development. The complex expression patterns of developmentally regulated genes are typically controlled by numerous independent cis-regulatory elements (CREs). It has been prop...

  15. Neofunctionalization in vertebrates: the example of retinoic acid receptors.

    OpenAIRE

    Hector Escriva; Stéphanie Bertrand; Pierre Germain; Marc Robinson-Rechavi; Muriel Umbhauer; Jérôme Cartry; Marilyne Duffraisse; Linda Holland; Hinrich Gronemeyer; Vincent Laudet

    2006-01-01

    Understanding the role of gene duplications in establishing vertebrate innovations is one of the main challenges of Evo-Devo (evolution of development) studies. Data on evolutionary changes in gene expression (i.e., evolution of transcription factor-cis-regulatory elements relationships) tell only part of the story; protein function, best studied by biochemical and functional assays, can also change. In this study, we have investigated how gene duplication has affected both the expression and...

  16. Molecular mechanisms of decreased smooth muscle differentiation marker expression after vascular injury

    OpenAIRE

    Regan, Christopher P.; Adam, Paul J.; Madsen, Cort S.; Owens, Gary K.

    2000-01-01

    While it is well established that phenotypic modulation of vascular smooth muscle cells (VSMCs) contributes to the development and progression of vascular lesions, little is known regarding the molecular mechanisms of phenotypic modulation in vivo. Here we show that vascular injury reduces transcription of VSMC differentiation marker genes, and we identify cis regulatory elements that may mediate this decrease. Using a carotid wire-injury model in mice carrying transgenes for smooth muscle α-...

  17. Multi-element analysis of wines

    OpenAIRE

    Ivanova, Violeta

    2014-01-01

    The knowledge of the element composition in wine is very important from toxicological point of view, since it could contains harmful elements, such as Pb, As and Cd, and from nutritional point of view, since wine contains essential elements for the human organism, such as Ca, Cr, Co, K, Se and Zn [1]. The presence of metals (i.e. Al, Zn, Cu, Fe, Pb) in wine is important for efficient alcoholic fermentation and for its sensorial characteristics (flavor, aroma, freshness). The element compositi...

  18. Photoshop Elements 8 After the Shoot

    CERN Document Server

    Fitzgerald, Mark

    2010-01-01

    A handy, full-color reference for using Photoshop Elements 8 while on the go. Photoshop Elements combines an easy-to-use set of features and enhancements with image editing power in an affordable program. The newest version—Photoshop Elements 8—features more online integration with products like the new Flash-based Web galleries. Featuring a convenient trim size that goes where you go, this portable guide is essential reading for Elements users and especially suited if you are a mobile user who wants to edit and post your digital photographs while on the go.: Serves as a portable reference for

  19. Quadrature representation of finite element variational forms

    DEFF Research Database (Denmark)

    Ølgaard, Kristian Breum; Wells, Garth N.

    2012-01-01

    This chapter addresses the conventional run-time quadrature approach for the numerical integration of local element tensors associated with finite element variational forms, and in particular automated optimizations that can be performed to reduce the number of floating point operations. An alter......This chapter addresses the conventional run-time quadrature approach for the numerical integration of local element tensors associated with finite element variational forms, and in particular automated optimizations that can be performed to reduce the number of floating point operations...

  20. Laser emission spectrography of rare earth elements

    International Nuclear Information System (INIS)

    Emission spectrography of rare earth elements in several matrixes is studied by using a Q-switched ruby laser as an exciting source for macro analysis. The emission intensities of rare earth elements are considerably affected by the matrixes. The emission intensities of rare earth elements are most intense in sodium chloride matrix, but fairly suppressed in sodium sulfate matrix. Scandium, yttrium, europium, and ytterbium, in sodium chloride matrix are detected down to concentrations of ppm order with one laser shot. The emission intensities of rare earth elements in refractory oxides, such as aluminum oxide or rate earth oxides, are about two orders of magnitude less than those in sodium chloride matrix. (auth.)

  1. A first course in finite elements

    CERN Document Server

    Fish, Jacob

    2007-01-01

    Developed from the authors, combined total of 50 years undergraduate and graduate teaching experience, this book presents the finite element method formulated as a general-purpose numerical procedure for solving engineering problems governed by partial differential equations.  Focusing on the formulation and application of the finite element method through the integration of finite element theory, code development, and software application, the book is both introductory and self-contained, as well as being a hands-on experience for any student. This authoritative text on Finite Elements:Adopts

  2. Gamma spectrometry of TRIGA fuel elements

    International Nuclear Information System (INIS)

    The burnupt of 19 TRIGA fuel elements was determined by gamma spectrometry using a special fuel element holder developed and constructed at the Atom Institute, Vienna. The investigated fuel element is kept in a horizontal position about 4 m below the reactor pool water surface. A collimator tube extends to the reactor platform where an intrinsic Ge-detector is located. With this system each fuel element was investigated at eight equidistant points along its active zone and the Cs 137 activity was evaluated. (orig.)

  3. EDITORIAL: King of the elements? King of the elements?

    Science.gov (United States)

    Demming, Anna

    2010-07-01

    Throughout the history of science, carbon-based research has played a defining role in the development of a range of fundamental and technological fields. It was used in Avagadro's definition of the mole in the early 18th century, it provides the 'backbone' of molecules in organic compounds, and in the environmental debate currently raging in the press and international government discussions, the 'carbon footprint' has become the metric of our species' impact on our planet. Also in nanotechnology, with the discovery of various wonder materials, carbon is once again asserting its claim as king of the elements. Until the 1980s the only known forms of carbon were diamond, graphite and amorphous carbon, as in soot or charcoal. In 1985 Robert Curl, Harold Kroto and Richard Smalley reported the existence of fullerenes, spherical structures comprising hexagonal carbon rings [1], work for which they won the Nobel Prize for Chemistry in 1996 [2]. The discovery of fullerenes was followed in 1991 by Sumio Ijima with the discovery of rolled graphite sheets, the carbon nanotube [3]. The discovery of these novel carbon nanostructures inspired researchers in a range of fields, largely as a result of the extraordinary capacity for investigations of these structures to reveal ever more intriguing properties. One of the fascinating properties attributed to carbon nanotubes is their phenomenal strength, with a Young's modulus of single walled carbon nanotubes approaching a terapascal [4]. Ingenious methods of harnessing this strength have since been developed, including bucky paper, a term used to refer to a mat of randomly self-entangled carbon nanotubes. Steven Crannford and Markus Buehler have recently reported a novel computational technique for probing the mechanical properties of these structures and show that the Young's modulus of bucky paper can be tuned by manipulation of the carbon nanotube type and density [5]. The electrical properties of carbon nanotubes, which depend

  4. The landscape of accessible chromatin in mammalian preimplantation embryos.

    Science.gov (United States)

    Wu, Jingyi; Huang, Bo; Chen, He; Yin, Qiangzong; Liu, Yang; Xiang, Yunlong; Zhang, Bingjie; Liu, Bofeng; Wang, Qiujun; Xia, Weikun; Li, Wenzhi; Li, Yuanyuan; Ma, Jing; Peng, Xu; Zheng, Hui; Ming, Jia; Zhang, Wenhao; Zhang, Jing; Tian, Geng; Xu, Feng; Chang, Zai; Na, Jie; Yang, Xuerui; Xie, Wei

    2016-06-30

    In mammals, extensive chromatin reorganization is essential for reprogramming terminally committed gametes to a totipotent state during preimplantation development. However, the global chromatin landscape and its dynamics in this period remain unexplored. Here we report a genome-wide map of accessible chromatin in mouse preimplantation embryos using an improved assay for transposase-accessible chromatin with high throughput sequencing (ATAC-seq) approach with CRISPR/Cas9-assisted mitochondrial DNA depletion. We show that despite extensive parental asymmetry in DNA methylomes, the chromatin accessibility between the parental genomes is globally comparable after major zygotic genome activation (ZGA). Accessible chromatin in early embryos is widely shaped by transposable elements and overlaps extensively with putative cis-regulatory sequences. Unexpectedly, accessible chromatin is also found near the transcription end sites of active genes. By integrating the maps of cis-regulatory elements and single-cell transcriptomes, we construct the regulatory network of early development, which helps to identify the key modulators for lineage specification. Finally, we find that the activities of cis-regulatory elements and their associated open chromatin diminished before major ZGA. Surprisingly, we observed many loci showing non-canonical, large open chromatin domains over the entire transcribed units in minor ZGA, supporting the presence of an unusually permissive chromatin state. Together, these data reveal a unique spatiotemporal chromatin configuration that accompanies early mammalian development. PMID:27309802

  5. Transvection and silencing of the Scr homeotic gene of Drosophila melanogaster.

    Science.gov (United States)

    Southworth, Jeffrey W; Kennison, James A

    2002-06-01

    The Sex combs reduced (Scr) gene specifies the identities of the labial and first thoracic segments in Drosophila melanogaster. In imaginal cells, some Scr mutations allow cis-regulatory elements on one chromosome to stimulate expression of the promoter on the homolog, a phenomenon that was named transvection by Ed Lewis in 1954. Transvection at the Scr gene is blocked by rearrangements that disrupt pairing, but is zeste independent. Silencing of the Scr gene in the second and third thoracic segments, which requires the Polycomb group proteins, is disrupted by most chromosomal aberrations within the Scr gene. Some chromosomal aberrations completely derepress Scr even in the presence of normal levels of all Polycomb group proteins. On the basis of the pattern of chromosomal aberrations that disrupt Scr gene silencing, we propose a model in which two cis-regulatory elements interact to stabilize silencing of any promoter or cis-regulatory element physically between them. This model also explains the anomalous behavior of the Scx allele of the flanking homeotic gene, Antennapedia. This allele, which is associated with an insertion near the Antennapedia P1 promoter, inactivates the Antennapedia P1 and P2 promoters in cis and derepresses the Scr promoters both in cis and on the homologous chromosome.

  6. Photosynthetic system as a biological functional element

    International Nuclear Information System (INIS)

    Photosynthetic apparatus of high plants and photosynthetic bacteria is essentially autonomic system in terms of genetics and structural -functional properties located in specific medium, a bio-membrane. Processes of light absorption and exciton migration in light harvesting antenna, separation and further transfer of charges in reaction centers have specific features, which may be used for application of these objects as key elements in construction of future biological functional elements. Progress in study and genetic modification of photosynthetic membranes achieved during the last decade opens great prospects in development biological functional elements and systems. The main characteristics of photosynthetic system for these purposes are: (i) energy conversion processes in the first light phase of the photosynthesis have very short periods, up to picoseconds, which indicates possibility of creation of ultrafast functional elements on their basis; (ii) characteristics sizes of photosynthetic units, 10-100 nm, and possibility to arrange regularly disposed elements in relevant membranes could be prospective point for creation of nano structures and on their basis relevant biologic functional elements; (iii) elements based on modified photosynthetic apparatus and bio-membranes might be efficiently created by methods of gene engineering and manipulation, that open huge opportunities for development of read biological functional systems. In the paper structural-functional properties and characteristics of high plants and purple photosynthetic bacteria, which may be useful for creation of future biological functional elements are considered. (author)

  7. Elemental composition of human and animal milk

    International Nuclear Information System (INIS)

    A review is presented of the elemental composition of human and animal milk with special reference to trace elements determined through nuclear techniques, particularly neutron activation analysis (NAA). In the joint IAEA/WHO research project, 16 of the 24 elements under investigation have been analysed by NAA with the aid of advanced research nuclear reactors. Literature data are discussed and tabulated in 50 separate tables (one for each element) mainly for the period after 1950. Each table uses a standard format comprising 10 columns indicating (1) source of milk (e.g. human or animal), (2) status of the milk (colostrum, transitional or mature), (3) country of origin, (4) year of data publication, (5) mean concentration, (6) range of single values or standard deviation of the mean, (7) number of samples analysed, (8) analytical technique employed, (9) literature source of the data, and (10) relevant remarks, if any. The most abundant data refer to the minor elements Ca, Cl, K, Mg, N, Na, P and S and to the trace elements Cu, Fe and Zn. Fewer data are available for Cd, Hg, I, Mn, Pb and Se. For the remaining elements, including such biologically important trace elements as As, Co, Cr, F, Mo, Ni, Si and Sn, very few reliable data so far appear to exist

  8. Unconscious emotional effects of packaging design elements

    DEFF Research Database (Denmark)

    Liao, Lewis; Corsi, Armando; Lockshin, Larry;

    This research investigates consumers’ unconscious emotional responses to packaging elements such as image, colour and font. The intensity and valence of the emotional response, in reaction to these packaging elements, is established by the use of skin conductance tests and facial electromyography...... response to packaging....

  9. Protein export elements from Lactococcus lactis

    NARCIS (Netherlands)

    Perez-Martinez, Gaspar; Kok, Jan; Venema, Gerhardus; Dijl, Jan Maarten van; Smith, Hilda; Bron, Sierd

    1992-01-01

    Broad-host-range plasmids carrying α-amylase or β-lactamase reporter genes lacking a signal sequence were used to select export elements from Lactococcus lactis chromosomal DNA that could function as signal sequences. Fragments containing such elements were identified by their ability to direct the

  10. 40 CFR 721.10068 - Elemental mercury.

    Science.gov (United States)

    2010-07-01

    ... Substances § 721.10068 Elemental mercury. (a) Definitions. The definitions in § 721.3 apply to this section. In addition, the following definition applies: Motor vehicle has the meaning found at 40 CFR 85.1703... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Elemental mercury. 721.10068...

  11. An elemental microanalysis of mouse ileum tissue

    International Nuclear Information System (INIS)

    A scanning proton microprobe has been used for a preliminary investigation of the cellular distribution of heavy metals and other elements in mouse ileum tissue. In order to study the cellular and elemental morphology of a villus the spatial distributions of the yields of characteristic X-rays are compared to a photomicrograph of the irradiated tissue and to a stained adjacent tissue section

  12. Trace Elements in Human Tooth Enamel

    International Nuclear Information System (INIS)

    The trace elements are considered to play a role in the resistance of teeth to dental caries. The exact mechanism by which they act has not yet been fully established. Estimations of trace elements have been undertaken in sound human teeth. By means of activation analysis it has been possible to determine trace element concentrations in different layers of enamel in the same tooth. The concentrations of the following elements have been determined: arsenic, antimony, copper, zinc, manganese, mercury, molybdenum and vanadium. The distribution of trace elements in enamel varies from those with a narrow range, such as manganese, to those with a broad range, such as antimony. The elements present in the broad range are considered to be non-essential and their presence is thought to result from a chance incorporation into the enamel. Those in the narrow range appear to be essential trace elements and are present in amounts which do not vary unduly from other body tissues. Only manganese and zinc were found in higher concentrations in the surface layer of enamel compared with the inner layers. The importance of the concentration of trace elements on this surface layer of enamel is emphasized as this layer is the site of the first attack by the carious process. (author)

  13. Enhanced patch test of finite element methods

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    Theoretically, the constant stress patch test is not rigorous. Also, either the patch test of non-zero constant shear for Mindlin plate problem or non-zero strain gradient curvature of the microstructures cannot be performed. To improve the theory of the patch test, in this paper, based on the variational principle with relaxed continuity requirement of nonconforming element for homogeneous differential equations, the author proposed the individual element condition for passing the patch test and the convergence condition of the element: besides passing the patch test, the element function should include the rigid body modes and constant strain modes and satisfy the weak continuity condition, and no extra zero energy modes occur. Moreover, the author further established a variational principle with relaxed continuity requirement of nonconforming element for inhomogeneous differential equations, the enhanced patch test condition and the individual element condition. To assure the convergence of the element that should pass the enhanced patch test, the element function should include the rigid body modes and non-zero strain modes which satisfied the equilibrium equations, and no spurious zero energy modes occur and should satisfy new weak continuity condition. The theory of the enhanced patch test proposed in this paper can be applied to both homogeneous and inhomogeneous differential equations. Based on this theory, the patch test of the non-zero constant shear stress for Mindlin plate and the C0-1 patch test of the non-zero constant curvature for the couple stress/strain gradient theory were established.

  14. Finite-Element Composite-Analysis Program

    Science.gov (United States)

    Bowles, David E.

    1990-01-01

    Finite Element Composite Analysis Program, FECAP, special-purpose finite-element program for analyzing behavior of composite material with microcomputer. Procedure leads to set of linear simultaneous equations relating unknown nodal displacement to applied loads. Written in HP BASIC 3.0.

  15. Finite-Element Software for Conceptual Design

    DEFF Research Database (Denmark)

    Lindemann, J.; Sandberg, G.; Damkilde, Lars

    2010-01-01

    and research. Forcepad is an effort to provide a conceptual design and teaching tool in a finite-element software package. Forcepad is a two-dimensional finite-element application based on the same conceptual model as image editing applications such as Adobe Photoshop or Microsoft Paint. Instead of using...

  16. Elements of Inclusion: Findings from the Field

    Science.gov (United States)

    McMaster, Christopher

    2014-01-01

    The Ministry of Education has set the target of 100% of New Zealand schools to be "mostly" inclusive by 2014. But what are the essential elements of inclusion? This paper explores essential core elements that allow inclusion to flourish. Based on an extensive time in the field as part of a year-long doctoral research project, these…

  17. MODERATOR ELEMENTS FOR UNIFORM POWER NUCLEAR REACTOR

    Science.gov (United States)

    Balent, R.

    1963-03-12

    This patent describes a method of obtaining a flatter flux and more uniform power generation across the core of a nuclear reactor. The method comprises using moderator elements having differing moderating strength. The elements have an increasing amount of the better moderating material as a function of radial and/or axial distance from the reactor core center. (AEC)

  18. Non-linear finite element modeling

    DEFF Research Database (Denmark)

    Mikkelsen, Lars Pilgaard

    The note is written for courses in "Non-linear finite element method". The note has been used by the author teaching non-linear finite element modeling at Civil Engineering at Aalborg University, Computational Mechanics at Aalborg University Esbjerg, Structural Engineering at the University...

  19. Reference: ELEMENT1GMLBC3 [PLACE

    Lifescience Database Archive (English)

    Full Text Available ELEMENT1GMLBC3 Jensen EO, Marcker KA, Schell J, de Bruijn J Interaction of a nodule... specific, trans-acting factor with distinct DNA elements in the soybean leghaemoglobin lbc3 5' upstream region EMBO J 7:1265-1271 (1988) ...

  20. Reference: ELEMENT2GMLBC3 [PLACE

    Lifescience Database Archive (English)

    Full Text Available ELEMENT2GMLBC3 Jensen EO, Marcker KA, Schell J, de Bruijn J Interaction of a nodule... specific, trans-acting factor with distinct DNA elements in the soybean leghaemoglobin lbc3 5' upstream region EMBO J 7:1265-1271 (1988) ...

  1. Solar cycle variation of network magnetic elements

    Science.gov (United States)

    Wang, J. X.; Jin, C. L.

    With the unique database from Michelson Doppler Imager aboard the Solar and Heliospheric Observatory in an interval embodying solar cycle 23, the cyclic behavior of solar small-scale magnetic elements is studied. More than 13 million solar network magnetic elements are selected, and the following results are discussed. (1) With increasing flux per element, the number variation of the network elements shows a three-fold scenario: no-correlation, anti-correlation, and correlation with sunspots, respectively. The anti-correlated elements cover flux range of (2.9 - 32.0)× 10^{18} Mx, and occupy 77.2% of total network elements. (2) The latitude distribution of the correlated elements follows the sunspot butterfly diagram in the solar cycle but has wider latitude distribution than sunspots. Furthermore, the anti-correlated elements also show much broad latitude distribution, but a moderate migration toward equator during the solar maximum which was clearly out of phase with sunspots. These results shed new light in understanding anti-correlated variations of small-scale solar activity, e.g., X-ray coronal bright points, and the origin of the Sun's small-scale magnetism.

  2. Just-in-time elements and benefits

    CERN Document Server

    García-Alcaraz, Jorge Luis

    2016-01-01

    This book reports the elements required for implementing Just in Time (JIT) technique in companies. The main reasons for low implementation processes and the main benefits from the successful implementation of them are highlighted in this book. Structural equation models are presented to help identify the essential elements in JIT.

  3. Trace element metabolism in man and animals

    International Nuclear Information System (INIS)

    Uptake, distribution, storage, excretion of different trace elements and resulting disturbances are investigated in blood and organs in animal experiments and in human diagnostics with the aid of radioisotopes. Apart from this, untritional disturbances are mentioned. Finally, future aspects of physiological trace element examinations are listed. (AJ) 891 AJ

  4. 47 CFR 97.505 - Element credit.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 5 2010-10-01 2010-10-01 false Element credit. 97.505 Section 97.505... SERVICE Qualifying Examination Systems § 97.505 Element credit. (a) The administering VEs must give credit.... (b) No examination credit, except as herein provided, shall be allowed on the basis of holding...

  5. Elemental Etymology: What's in a Name?

    Science.gov (United States)

    Ball, David W.

    1985-01-01

    Examines the origin of the names (or etymologies) of the chemical elements. Includes tables listing elements: (1) with names of obscure origin; (2) named for colors; (3) named after real or mythical people; (4) named after places; (5) named after heavenly bodies; and (6) having names of miscellaneous origin. (JN)

  6. Rare Earth Elements Distribution in Beryl

    International Nuclear Information System (INIS)

    Laser ablation method is applied to a double focusing inductively coupled plasma mass spectrometer to determine the rare earth element distribution in some selected beryl samples. White, green and blue beryl samples are selected from the Egyptian eastern desert. Distributions of chondrite- normalized plot for the rare earth element in the selected beryl samples are investigated

  7. A method for making an alkaline element

    Energy Technology Data Exchange (ETDEWEB)

    Obi, F.; Takada, K.

    1983-05-11

    A mixture of asphalt with polybutene is applied to the contacting surfaces of the body top and the hermetically sealing stuffing. After assembly the element is heated to a temperature which exceeds the softening point of the mixture. The edge of the body is rolled in. The element has high reliability.

  8. Multiple Herbicide Resistance in Lolium multiflorum and Identification of Conserved Regulatory Elements of Herbicide Resistance Genes

    Science.gov (United States)

    Mahmood, Khalid; Mathiassen, Solvejg K.; Kristensen, Michael; Kudsk, Per

    2016-01-01

    Herbicide resistance is a ubiquitous challenge to herbicide sustainability and a looming threat to control weeds in crops. Recently four genes were found constituently over-expressed in herbicide resistant individuals of Lolium rigidum, a close relative of Lolium multiflorum. These include two cytochrome P450s, one nitronate monooxygenase and one glycosyl-transferase. Higher expressions of these four herbicide metabolism related (HMR) genes were also observed after herbicides exposure in the gene expression databases, indicating them as reliable markers. In order to get an overview of herbicidal resistance status of L. multiflorum L, 19 field populations were collected. Among these populations, four populations were found to be resistant to acetolactate synthase (ALS) inhibitors while three exhibited resistance to acetyl-CoA carboxylase (ACCase) inhibitors in our initial screening and dose response study. The genotyping showed the presence of mutations Trp-574-Leu and Ile-2041-Asn in ALS and ACCase, respectively, and qPCR experiments revealed the enhanced expression of HMR genes in individuals of certain resistant populations. Moreover, co-expression networks and promoter analyses of HMR genes in O. sativa and A. thaliana resulted in the identification of a cis-regulatory motif and zinc finger transcription factors. The identified transcription factors were highly expressed similar to HMR genes in response to xenobiotics whereas the identified motif is known to play a vital role in coping with environmental stresses and maintaining genome stability. Overall, our findings provide an important step forward toward a better understanding of metabolism-based herbicide resistance that can be utilized to devise novel strategies of weed management. PMID:27547209

  9. Multiple herbicide resistance in Lolium multiflorum and identification of conserved regulatory elements of herbicide resistance genes

    Directory of Open Access Journals (Sweden)

    Khalid Mahmood

    2016-08-01

    Full Text Available Herbicide resistance is a ubiquitous challenge to herbicide sustainability and a looming threat to control weeds in crops. Recently four genes were found constituently over-expressed in herbicide resistant individuals of Lolium rigidum, a close relative of L. multiflorum. These include two cytochrome P450s, one nitronate monooxygenase and one glycosyl-transferase. Higher expressions of these four herbicide metabolism related (HMR genes were also observed after herbicides exposure in the gene expression databases, indicating them a reliable marker. In order to get an overview of herbicidal resistance status of Lolium multiflorum L, 19 field populations were collected. Among these populations, four populations were found to be resistant to acetolactate synthase (ALS inhibitors while three exhibited resistance to acetyl-CoA carboxylase (ACCase inhibitors in our initial screening and dose response study. The genotyping showed the presence of mutations Trp-574-Leu and Ile-2041-Asn in ALS and ACCase, respectively and qPCR experiments revealed the enhanced expression of HMR genes in individuals of certain resistant populations. Moreover, co-expression networks and promoter analyses of HMR genes in O.sativa and A.thaliana resulted in the identification of a cis-regulatory motif and zinc finger transcription factors. The identified transcription factors were highly expressed similar to HMR genes in response to xenobiotics whereas the identified motif known to play a vital role in coping with environmental stresses and maintaining genome stability. Overall, our findings provide an important step forward towards a better understanding of metabolism-based herbicide resistance that can be utilized to devise novel strategies of weed management.

  10. An Improved Linear Tetrahedral Element for Plasticity

    Energy Technology Data Exchange (ETDEWEB)

    Puso, M

    2005-04-25

    A stabilized, nodally integrated linear tetrahedral is formulated and analyzed. It is well known that linear tetrahedral elements perform poorly in problems with plasticity, nearly incompressible materials, and acute bending. For a variety of reasons, linear tetrahedral elements are preferable to quadratic tetrahedral elements in most nonlinear problems. Whereas, mixed methods work well for linear hexahedral elements, they don't for linear tetrahedrals. On the other hand, automatic mesh generation is typically not feasible for building many 3D hexahedral meshes. A stabilized, nodally integrated linear tetrahedral is developed and shown to perform very well in problems with plasticity, nearly incompressible materials and acute bending. Furthermore, the formulation is analytically and numerically shown to be stable and optimally convergent. The element is demonstrated to perform well in several standard linear and nonlinear benchmarks.

  11. International experience in conditioning spent fuel elements

    International Nuclear Information System (INIS)

    The purpose of this report is to compile and present in a clear form international experience (USA, Canada, Sweden, FRG, UK, Japan, Switzerland) gained to date in conditioning spent fuel elements. The term conditioning is here taken to mean the handling and packaging of spent fuel elements for short- or long-term storage or final disposal. Plants of a varying nature fall within this scope, both in terms of the type of fuel element treated and the plant purpose eg. experimental or production plant. Emphasis is given to plants which bear some similarity to the concept developed in Germany for direct disposal of spent fuel elements. Worldwide, however, relatively few conditioning plants are in existence or have been conceived. Hence additional plants have been included where aspects of the experience gained are also of relevance eg. plants developed for the consolidation of spent fuel elements. (orig./HP)

  12. Transuranic element behavior in soils and plants

    International Nuclear Information System (INIS)

    The principal objective of this study is to define soil, plant, and foliar interaction processes that influence the availability of transuranic elements to agricultural plants and animals as a basis for improved modeling and dose-assessment. Major areas of emphasis are: (1) soil and soil-microbial processes that influence the concentration and form of transuranic elements in soil solutions and availability to the plant root with time; (2) deposition and plant interception of airborne submicronic particles containing transuranic elements and their susceptibility to leaching; (3) plant processes that influence transport across plant root membrane and foliar surfaces, as well as the form and sites of deposition of transuranic elements in mature plants; and (4) the integrated effect of soil and plant processes on transuranic element availability to, and form in, animals that consume plants

  13. Finite element modelling of perturbed stellar systems

    CERN Document Server

    Jalali, Mir Abbas

    2010-01-01

    I formulate a general finite element method (FEM) for self-gravitating stellar systems. I split the configuration space to finite elements, and express the potential and density functions over each element in terms of their nodal values and suitable interpolating functions. General expressions are then introduced for the Hamiltonian and phase space distribution functions of the stars that visit a given element. Using the weighted residual form of Poisson's equation, I derive the Galerkin projection of the perturbed collisionless Boltzmann equation, and assemble the global evolutionary equations of nodal distribution functions. The FEM is highly adaptable to all kinds of potential and density profiles, and it can deal with density clumps and initially non-axisymmetric systems. I use ring elements of non-uniform widths, choose linear and quadratic interpolation functions in the radial direction, and apply the FEM to the stability analysis of the cutout Mestel disc. I also integrate the forced evolutionary equat...

  14. Rolling Element Bearing Stiffness Matrix Determination (Presentation)

    Energy Technology Data Exchange (ETDEWEB)

    Guo, Y.; Parker, R.

    2014-01-01

    Current theoretical bearing models differ in their stiffness estimates because of different model assumptions. In this study, a finite element/contact mechanics model is developed for rolling element bearings with the focus of obtaining accurate bearing stiffness for a wide range of bearing types and parameters. A combined surface integral and finite element method is used to solve for the contact mechanics between the rolling elements and races. This model captures the time-dependent characteristics of the bearing contact due to the orbital motion of the rolling elements. A numerical method is developed to determine the full bearing stiffness matrix corresponding to two radial, one axial, and two angular coordinates; the rotation about the shaft axis is free by design. This proposed stiffness determination method is validated against experiments in the literature and compared to existing analytical models and widely used advanced computational methods. The fully-populated stiffness matrix demonstrates the coupling between bearing radial, axial, and tilting bearing deflections.

  15. Spectral element methods: Algorithms and architectures

    Science.gov (United States)

    Fischer, Paul; Ronquist, Einar M.; Dewey, Daniel; Patera, Anthony T.

    1988-01-01

    Spectral element methods are high-order weighted residual techniques for partial differential equations that combine the geometric flexibility of finite element methods with the rapid convergence of spectral techniques. Spectral element methods are described for the simulation of incompressible fluid flows, with special emphasis on implementation of spectral element techniques on medium-grained parallel processors. Two parallel architectures are considered: the first, a commercially available message-passing hypercube system; the second, a developmental reconfigurable architecture based on Geometry-Defining Processors. High parallel efficiency is obtained in hypercube spectral element computations, indicating that load balancing and communication issues can be successfully addressed by a high-order technique/medium-grained processor algorithm-architecture coupling.

  16. Spectral element methods - Algorithms and architectures

    Science.gov (United States)

    Fischer, Paul; Ronquist, Einar M.; Dewey, Daniel; Patera, Anthony T.

    1988-01-01

    Spectral element methods are high-order weighted residual techniques for partial differential equations that combine the geometric flexibility of finite element methods with the rapid convergence of spectral techniques. Spectral element methods are described for the simulation of incompressible fluid flows, with special emphasis on implementation of spectral element techniques on medium-grained parallel processors. Two parallel architectures are considered; the first, a commercially available message-passing hypercube system; the second, a developmental reconfigurable architecture based on Geometry-Defining Processors. High parallel efficiency is obtained in hypercube spectral element computations, indicating that load balancing and communication issues can be successfully addressed by a high-order technique/medium-grained processor algorithm-architecture coupling.

  17. Writing analytic element programs in Python.

    Science.gov (United States)

    Bakker, Mark; Kelson, Victor A

    2009-01-01

    The analytic element method is a mesh-free approach for modeling ground water flow at both the local and the regional scale. With the advent of the Python object-oriented programming language, it has become relatively easy to write analytic element programs. In this article, an introduction is given of the basic principles of the analytic element method and of the Python programming language. A simple, yet flexible, object-oriented design is presented for analytic element codes using multiple inheritance. New types of analytic elements may be added without the need for any changes in the existing part of the code. The presented code may be used to model flow to wells (with either a specified discharge or drawdown) and streams (with a specified head). The code may be extended by any hydrogeologist with a healthy appetite for writing computer code to solve more complicated ground water flow problems.

  18. Writing analytic element programs in Python.

    Science.gov (United States)

    Bakker, Mark; Kelson, Victor A

    2009-01-01

    The analytic element method is a mesh-free approach for modeling ground water flow at both the local and the regional scale. With the advent of the Python object-oriented programming language, it has become relatively easy to write analytic element programs. In this article, an introduction is given of the basic principles of the analytic element method and of the Python programming language. A simple, yet flexible, object-oriented design is presented for analytic element codes using multiple inheritance. New types of analytic elements may be added without the need for any changes in the existing part of the code. The presented code may be used to model flow to wells (with either a specified discharge or drawdown) and streams (with a specified head). The code may be extended by any hydrogeologist with a healthy appetite for writing computer code to solve more complicated ground water flow problems. PMID:19473273

  19. Effects of thirty elements on bone metabolism.

    Science.gov (United States)

    Dermience, Michael; Lognay, Georges; Mathieu, Françoise; Goyens, Philippe

    2015-10-01

    The human skeleton, made of 206 bones, plays vital roles including supporting the body, protecting organs, enabling movement, and storing minerals. Bones are made of organic structures, intimately connected with an inorganic matrix produced by bone cells. Many elements are ubiquitous in our environment, and many impact bone metabolism. Most elements have antagonistic actions depending on concentration. Indeed, some elements are essential, others are deleterious, and many can be both. Several pathways mediate effects of element deficiencies or excesses on bone metabolism. This paper aims to identify all elements that impact bone health and explore the mechanisms by which they act. To date, this is the first time that the effects of thirty minerals on bone metabolism have been summarized. PMID:26302917

  20. Element spots in HgMn stars

    CERN Document Server

    Korhonen, Heidi

    2013-01-01

    A fraction of late B-type stars, the so-called HgMn stars, exhibit enhanced absorption lines of certain chemical elements, notably Hg and Mn, combined with an underabundance of He. For about a decade now the elements with anomalously high abundances in HgMn stars are known to be distributed inhomogeneously over the stellar surface. Temporal evolution of these elemental spots have been reported in a few HgMn stars, first secular evolution of the mercury spots in alpha And, and recently also a fast evolution of yttrium and strontium spots in HD 11753. The fast evolution of spots in HD 11753 is combined with a slower change in the overall abundance of the affected elements. In this paper I review what is known of elemental spots in HgMn stars and their secular and fast temporal evolution.

  1. Multi-Element Lean Direct Injection Combustor Single Element Demonstration Project

    Data.gov (United States)

    National Aeronautics and Space Administration — We propose to demonstrate the feasibility in a single element of a Multi-Element Lean Direct Injection, ME-LDI, Combustion concept. The concept will have the...

  2. Burnup measurements of leader fuel elements

    International Nuclear Information System (INIS)

    Some time ago the CCHEN authorities decided to produce a set of 50 low enrichment fuel elements. These elements were produced in the PEC (Fuel Elements Plant), located at CCHEN offices in Lo Aguirre. These new fuel elements have basically the same geometrical characteristics of previous ones, which were British and made with raw material from the U.S. The principal differences between our fuel elements and the British ones is the density of fissile material, U-235, which was increased to compensate the reduction in enrichment. Last year, the Fuel Elements Plant (PEC) delivered the shipment's first four (4) fuel elements, called leaders, to the RECH1. A test element was delivered too, and the complete set was introduced into the reactor's nucleus, following the normal routine, but performing a special follow-up on their behavior inside the nucleus. This experimental element has only one outside fuel plate, and the remaining (15) structural plates are aluminum. In order to study the burnup, the test element was taken out of the nucleus, in mid- November 1999, and left to decay until June 2000, when it was moved to the laboratory (High Activity Cell), to start the burnup measurements, with a gamma spectroscopy system. This work aims to show the results of these measurements and in addition to meet the following objectives: (a) Visual test of the plate's general condition; (b) Sipping test of fission products; (c) Study of burn-up distribution in the plate; (d) Check and improve the calculus algorithm; (e) Comparison of the results obtained from the spectroscopy with the ones from neutron calculus

  3. Mobile genetic elements in protozoan parasites

    Indian Academy of Sciences (India)

    Sudha Bhattacharya; Abhijeet Bakre; Alok Bhattacharya

    2002-08-01

    Mobile genetic elements, by virtue of their ability to move to new chromosomal locations, are considered important in shaping the evolutionary course of the genome. They are widespread in the biological kingdom. Among the protozoan parasites several types of transposable elements are encountered. The largest variety is seen in the trypanosomatids—Trypanosoma brucei, Trypanosoma cruzi and Crithidia fasciculata. They contain elements that insert site-specifically in the spliced-leader RNA genes, and others that are dispersed in a variety of genomic locations. Giardia lamblia contains three families of transposable elements. Two of these are subtelomeric in location while one is chromosome-internal. Entamoeba histolytica has an abundant retrotransposon dispersed in the genome. Nucleotide sequence analysis of all the elements shows that they are all retrotransposons, and, with the exception of one class of elements in T. cruzi, all of them are non-long-terminal-repeat retrotransposons. Although most copies have accumulated mutations, they can potentially encode reverse transcriptase, endonuclease and nucleic-acid-binding activities. Functionally and phylogenetically they do not belong to a single lineage, showing that retrotransposons were acquired early in the evolution of protozoan parasites. Many of the potentially autonomous elements that encode their own transposition functions have nonautonomous counterparts that probably utilize the functions in trans. In this respect these elements are similar to the mammalian LINEs and SINEs (long and short interspersed DNA elements), showing a common theme in the evolution of retrotransposons. So far there is no report of a DNA transposon in any protozoan parasite. The genome projects that are under way for most of these organisms will help understand the evolution and possible function of these genetic elements.

  4. PRECONDITIONING HIGHER ORDER FINITE ELEMENT SYSTEMS BY ALGEBRAIC MULTIGRID METHOD OF LINEAR ELEMENTS

    Institute of Scientific and Technical Information of China (English)

    Yun-qing Huang; Shi Shu; Xi-jun Yu

    2006-01-01

    We present and analyze a robust preconditioned conjugate gradient method for the higher order Lagrangian finite element systems of a class of elliptic problems. An auxiliary linear element stiffness matrix is chosen to be the preconditioner for higher order finite elements. Then an algebraic multigrid method of linear finite element is applied for solving the preconditioner. The optimal condition number which is independent of the mesh size is obtained. Numerical experiments confirm the efficiency of the algorithm.

  5. A novel mammal-specific three partite enhancer element regulates node and notochord-specific Noto expression.

    Directory of Open Access Journals (Sweden)

    Leonie Alten

    Full Text Available The vertebrate organizer and notochord have conserved, essential functions for embryonic development and patterning. The restricted expression of developmental regulators in these tissues is directed by specific cis-regulatory modules (CRMs whose sequence conservation varies considerably. Some CRMs have been conserved throughout vertebrates and likely represent ancestral regulatory networks, while others have diverged beyond recognition but still function over a wide evolutionary range. Here we identify and characterize a mammalian-specific CRM required for node and notochord specific (NNC expression of NOTO, a transcription factor essential for node morphogenesis, nodal cilia movement and establishment of laterality in mouse. A 523 bp enhancer region (NOCE upstream the Noto promoter was necessary and sufficient for NNC expression from the endogenous Noto locus. Three subregions in NOCE together mediated full activity in vivo. Binding sites for known transcription factors in NOCE were functional in vitro but dispensable for NOCE activity in vivo. A FOXA2 site in combination with a novel motif was necessary for NOCE activity in vivo. Strikingly, syntenic regions in non-mammalian vertebrates showed no recognizable sequence similarities. In contrast to its activity in mouse NOCE did not drive NNC expression in transgenic fish. NOCE represents a novel, mammal-specific CRM required for the highly restricted Noto expression in the node and nascent notochord and thus regulates normal node development and function.

  6. Analysis of bender element test interpretation using the discrete element method

    NARCIS (Netherlands)

    O’Donovan, J.; O’Sullivan, C.; Marketos, G.; Muir Wood, D.

    2015-01-01

    While bender element testing is now well-established as a laboratory technique to determine soil stiffness, a robust technique to interpret the data remains elusive. A discrete element method (DEM) model of a face-centred cubic packing of uniform spheres was created to simulate bender element tests

  7. Mortar Upwind Finite Volume Element Method with Crouzeix-Raviart Element for Parabolic Convection Diffusion Problems

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    In this paper, we study the semi-discrete mortar upwind finite volume element method with the Crouzeix-Raviart element for the parabolic convection diffusion problems.It is proved that the semi-discrete mortar upwind finite volume element approximations derived are convergent in the H1- and L2-norms.

  8. Stabilized tetrahedral elements for crystal plasticity finite element analysis overcoming volumetric locking

    Science.gov (United States)

    Cheng, Jiahao; Shahba, Ahmad; Ghosh, Somnath

    2016-05-01

    Image-based CPFE modeling involves computer generation of virtual polycrystalline microstructures from experimental data, followed by discretization into finite element meshes. Discretization is commonly accomplished using three-dimensional four-node tetrahedral or TET4 elements, which conform to the complex geometries. It has been commonly observed that TET4 elements suffer from severe volumetric locking when simulating deformation of incompressible or nearly incompressible materials. This paper develops and examines three locking-free stabilized finite element formulations in the context of crystal plasticity finite element analysis. They include a node-based uniform strain (NUS) element, a locally integrated B-bar (LIB) based element and a F-bar patch (FP) based element. All three formulations are based on the partitioning of TET4 element meshes and integrating over patches to obtain favorable incompressibility constraint ratios without adding large degrees of freedom. The results show that NUS formulation introduces unstable spurious energy modes, while the LIB and FP elements stabilize the solutions and are preferred for reliable CPFE analysis. The FP element is found to be computationally efficient over the LIB element.

  9. In Silico Expression Analysis.

    Science.gov (United States)

    Bolívar, Julio; Hehl, Reinhard; Bülow, Lorenz

    2016-01-01

    Information on the specificity of cis-sequences enables the design of functional synthetic plant promoters that are responsive to specific stresses. Potential cis-sequences may be experimentally tested, however, correlation of genomic sequence with gene expression data enables an in silico expression analysis approach to bioinformatically assess the stress specificity of candidate cis-sequences prior to experimental verification. The present chapter demonstrates an example for the in silico validation of a potential cis-regulatory sequence responsive to cold stress. The described online tool can be applied for the bioinformatic assessment of cis-sequences responsive to most abiotic and biotic stresses of plants. Furthermore, a method is presented based on a reverted in silico expression analysis approach that predicts highly specific potentially functional cis-regulatory elements for a given stress.

  10. In Silico Expression Analysis.

    Science.gov (United States)

    Bolívar, Julio; Hehl, Reinhard; Bülow, Lorenz

    2016-01-01

    Information on the specificity of cis-sequences enables the design of functional synthetic plant promoters that are responsive to specific stresses. Potential cis-sequences may be experimentally tested, however, correlation of genomic sequence with gene expression data enables an in silico expression analysis approach to bioinformatically assess the stress specificity of candidate cis-sequences prior to experimental verification. The present chapter demonstrates an example for the in silico validation of a potential cis-regulatory sequence responsive to cold stress. The described online tool can be applied for the bioinformatic assessment of cis-sequences responsive to most abiotic and biotic stresses of plants. Furthermore, a method is presented based on a reverted in silico expression analysis approach that predicts highly specific potentially functional cis-regulatory elements for a given stress. PMID:27557772

  11. The dynamic stiffness matrix of two-dimensional elements: application to Kirchhoff's plate continuous elements

    Science.gov (United States)

    Casimir, J. B.; Kevorkian, S.; Vinh, T.

    2005-10-01

    This paper describes a procedure for building the dynamic stiffness matrix of two-dimensional elements with free edge boundary conditions. The dynamic stiffness matrix is the basis of the continuous element method. Then, the formulation is used to build a Kirchhoff rectangular plate element. Gorman's method of boundary condition decomposition and Levy's series are used to obtain the strong solution of the elementary problem. A symbolic computation software partially performs the construction of the dynamic stiffness matrix from this solution. The performances of the element are evaluated from comparisons with harmonic responses of plates obtained by the finite element method.

  12. APPLICATION OF SUB-ELEMENT AND MICRO-ELEMENT IN BEM WITH ROLLER BEARING LOAD

    Institute of Scientific and Technical Information of China (English)

    Shu Xuedao; Xing Xidong

    2004-01-01

    Aiming at the discontinuous traction on contact elements of roller bearing, new concepts of sub- and micro-element are put forward. In the sub-element and micro-element, traction influence coefficient has been modified, which is calculated by the former boundary element method (BEM) with roller bearing load. Hence, three-dimensional distribution of load on roller bearing is calculated accurately. In practice, it has been proved that this method has higher calculation accuracy. An effective numerical method is offered for analyzing load characteristics of roller bearing to improve service longevity of roller bearing and operation efficiency of rolling mill.

  13. Finite Dynamic Elements and Modal Analysis

    Directory of Open Access Journals (Sweden)

    N.J. Fergusson

    1993-01-01

    Full Text Available A general modal analysis scheme is derived for forced response that makes use of high accuracy modes computed by the dynamic element method. The new procedure differs from the usual modal analysis in that the modes are obtained from a power series expansion for the dynamic stiffness matrix that includes an extra dynamic correction term in addition to the static stiffness matrix and the consistent mass matrix based on static displacement. A cantilevered beam example is used to demonstrate the relative accuracies of the dynamic element and the traditional finite element methods.

  14. Use of SCC in Prefabricated Concrete Elements

    DEFF Research Database (Denmark)

    Thrane, Lars Nyholm; Lauritsen, Ib

    2004-01-01

    This paper presents observations made on the use of self-compacting concrete for pre-cast elements at Byggebjerg Beton A/S during the last 3 years. The elements include L- and sandwich elements and are mainly produced for agriculture purposes. In general, the flow properties and air content are...... concrete to achieve a good surface quality with a limited number of blowholes. For horizontal castings it is important to keep the concrete flowing to avoid casting joints. Blocking is avoided by using the right type of spacers and a maximum size aggregate of 8mm. However, if the concrete has to flow over...

  15. MRT fuel element inspection at Dounreay

    Energy Technology Data Exchange (ETDEWEB)

    Gibson, J.

    1997-08-01

    To ensure that their production and inspection processes are performed in an acceptable manner, ie. auditable and traceable, the MTR Fuel Element Fabrication Plant at Dounreay operates to a documented quality system. This quality system, together with the fuel element manufacturing and inspection operations, has been independently certified to ISO9002-1987, EN29002-1987 and BS5750:Pt2:1987 by Lloyd`s Register Quality Assurance Limited (LRQA). This certification also provides dual accreditation to the relevant German, Dutch and Australian certification bodies. This paper briefly describes the quality system, together with the various inspection stages involved in the manufacture of MTR fuel elements at Dounreay.

  16. Electrical machine analysis using finite elements

    CERN Document Server

    Bianchi, Nicola

    2005-01-01

    OUTLINE OF ELECTROMAGNETIC FIELDSVector AnalysisElectromagnetic FieldsFundamental Equations SummaryReferencesBASIC PRINCIPLES OF FINITE ELEMENT METHODSIntroductionField Problems with Boundary ConditionsClassical Method for the Field Problem SolutionThe Classical Residual Method (Galerkin's Method)The Classical Variational Method (Rayleigh-Ritz's Method)The Finite Element MethodReferencesAPPLICATIONS OF THE FINITE ELEMENT METHOD TO TWO-DIMENSIONAL FIELDSIntroductionLinear Interpolation of the Function fApplication of the Variational MethodSimple Descriptions of Electromagnetic FieldsAppendix: I

  17. On Hybrid and mixed finite element methods

    Science.gov (United States)

    Pian, T. H. H.

    1981-01-01

    Three versions of the assumed stress hybrid model in finite element methods and the corresponding variational principles for the formulation are presented. Examples of rank deficiency for stiffness matrices by the hybrid stress model are given and their corresponding kinematic deformation modes are identified. A discussion of the derivation of general semi-Loof elements for plates and shells by the hybrid stress method is given. It is shown that the equilibrium model by Fraeijs de Veubeke can be derived by the approach of the hybrid stress model as a special case of semi-Loof elements.

  18. Will Finite Elements Replace Structural Mechanics?

    Science.gov (United States)

    Ojalvo, I. U.

    1984-01-01

    This paper presents a personal view regarding the need for a continued interest and activity in structural methods in general, while viewing finite elements and the computer as simply two specific tools for assisting in this endeavor. An attempt is made to provide some insight as to why finite element methods seem to have "won the war," and to give examples of their more (and less) intelligent use. Items addressed include a highlight of unnecessary limitations of many existing standard finite element codes and where it is felt that further development work is needed.

  19. Photoshop Elements 9 the missing manual

    CERN Document Server

    Brundage, Barbara

    2010-01-01

    Elements 9 offers much of Photoshop's power without the huge price tag. It's an ideal tool for most image-editing buffs -- including scrapbookers, photographers, and aspiring graphic artists. But Elements still doesn't come with a decent manual. This bestselling book will help you get the most out of the program, from the basics to advanced tips for both Windows and Mac. Quickly learn your way around. Customize Elements to suit your working style.Get to work right away. Import, organize, and make quick image fixes with ease.Retouch any image. Learn how to repair and restore your old and damag

  20. Determination of light elements in amalgam restorations

    International Nuclear Information System (INIS)

    Rutherford backscattering has been used to measure the major elemental compositions in the near-surface regions of freshly prepared and used samples of dental amalgam. A depletion from bulk stoichiometry of the major elements, which indicates an accumulation of lighter elements on the surface of the materials, has been observed. Increases in the F, Na, Cl, P, O, C, and N concentrations between freshly prepared samples and used samples were measured by observation of gamma rays produced by proton and deuteron induced reactions

  1. A carbon nanotube-based sensing element

    Institute of Scientific and Technical Information of China (English)

    YANG Xing; ZHOU Zhao-ying; WU Ying; ZHANG Jin; ZHANG Ying-ying

    2007-01-01

    A carbon nanotube-based(CNT) sensing element is presented, which consists of substrate, insulating layer, electrodes,carbon nanotube and measuring circuit. The sensing components are a single or array of CNTs, which are located on the two electrodes. The CNT-based sensing element is fabricated by CVD (chemical vapor deposition)-direct-growth on microelectrodes. The sensing model and measurement method of electromechanical property are also presented. Finally, the voltage-current characteristics are measured, which show that the CNT-based sensing element has good electrical properties.

  2. Finite Element Computational Dynamics of Rotating Systems

    Directory of Open Access Journals (Sweden)

    Jaroslav Mackerle

    1999-01-01

    Full Text Available This bibliography lists references to papers, conference proceedings and theses/dissertations dealing with finite element analysis of rotor dynamics problems that were published in 1994–1998. It contains 319 citations. Also included, as separate subsections, are finite element analyses of rotor elements – discs, shafts, spindles, and blades. Topics dealing with fracture mechanics, contact and stability problems of rotating machinery are also considered in specific sections. The last part of the bibliography presents papers dealing with specific industrial applications.

  3. Mineral elements in milk and dairy products

    Directory of Open Access Journals (Sweden)

    Šimun Zamberlin

    2012-06-01

    Full Text Available Mineral elements occur in milk and dairy products as inorganic ions and salts, as well as part of organic molecules, such as proteins, fats, carbohydrates and nucleic acids. The chemical form of mineral elements is important because it determines their absorption in the intestine and their biological utilization. The mineral composition of milk is not constant because it depends on lactation phase, nutritional status of the animal, and environmental and genetic factors. The objective of this research is to point out the research results of chemical form, content and nutritional importance of individual mineral elements that are present in various milks and dairy products.

  4. The origin of the chemical elements

    International Nuclear Information System (INIS)

    The subject is discussed in relation to the composition of initially created matter and changes which have occurred during the life history of the universe, with particular reference to our galaxy and nearby galaxies. Headings are: observations of element abundances (stars, gas clouds in our own and nearby galaxies, hot gas in galaxy clusters, the solar system); the originally created matter (Big Bang theory and early nuclear reactions); processes changing observed composition (galactic evolution; nuclear fusion reactions in stellar interiors; chemical composition of a highly evolved massive star); supernovae (production of heavy elements); chemical evolution of the galaxy; production of very heavy elements (s process, r process). (U.K.)

  5. Photoshop Elements 5 The Missing Manual

    CERN Document Server

    Brundage, Barbara

    2006-01-01

    Anyone still think that Adobe Photoshop Elements is a toy version of the real thing? As the most popular photo-editing program on the market, Photoshop Elements not only has Photoshop's marvelous powers, but also has capabilities the mothership lacks. Each new version includes more tools designed specifically for today's consumer digital photo enthusiasts. The latest edition, Photoshop Elements 5, solidifies the reputation of this superb and inexpensive product with new scrapbook features, a link to online photo services, and many other improvements. In fact, there's so much to Photoshop Ele

  6. The Superheavy Elements and Anti-Gravity

    Science.gov (United States)

    Anastasovski, Petar K.

    2004-02-01

    The essence of any propulsion concept is to overcome gravity. Anti-gravity is a natural means to achieve this. Thus, the technology to pursue anti-gravity, by using superheavy elements, may provide a new propulsion paradigm. The theory of superluminal relativity provides a hypothesis for existence of elements with atomic number up to Z = 145, some of which may possess anti-gravity properties. Analysis results show that curved space-time exists demonstrating both gravitic and anti-gravitic properties not only around nuclei but inside the nuclei as well. Two groups of elements (Z Hawking, in honour of Stephen W. Hawking.

  7. 模糊Prime元%Fuzzy Prime Elements

    Institute of Scientific and Technical Information of China (English)

    饶三平

    2012-01-01

    基于完备剩余格,本文在模糊完备格中,引入模糊Prime元概念.给出了模糊Prime元的等价刻画,证明了所有的模糊Prime元构成的模糊集是模糊完全分配格.%Based on complete residuated lattices, the concept of fuzzy Prime elements in fuzzy complete lattices is given, then the equivalent characterization of fuzzy Prime elements is obtained. We also prove that the fuzzy subsets of fuzzy Prime elements is a fuzzy completely distributice lattice.

  8. Conversion of elemental iodine during atmospheric transport

    International Nuclear Information System (INIS)

    At the Juelich Nuclear Research Centre the conversion of elemental iodine during the transport in the atmosphere from the source point to the place of deposition is studied. For this reason the short living I-123 is released in form of elemental iodine in 50 m release height. In a distance of 200 to 1000 m downwind air samples are taken with a tripartite filter system. Each part of the filter system is measured with a Ge(Li) detector seperately at the end of sampling. After the evaluation of the experiments until now in the average about 50% of the elemental iodine is transformed into other iodine species. (orig./HP)

  9. Finite-element models of continental extension

    Science.gov (United States)

    Lynch, H. David; Morgan, Paul

    1990-01-01

    Numerical models of the initial deformation of extending continental lithosphere, computed to investigate the control of preexisting thermal and mechanical heterogeneities on the style of deformation, are presented. The finite element method is used to calculate deformation with a viscoelastic-plastic model for the lithosphere. Comparisons of the results of analytic models and finite-element models using this method show that good results may be obtained by the numerical technique, even with elements containing both brittle and viscoelastic sampling points. It is shown that the gross style of initial extensional deformation is controlled by the depth and width of the initial heterogeneity which localizes deformation.

  10. The ENCODE (ENCyclopedia Of DNA Elements) Project.

    Science.gov (United States)

    2004-10-22

    The ENCyclopedia Of DNA Elements (ENCODE) Project aims to identify all functional elements in the human genome sequence. The pilot phase of the Project is focused on a specified 30 megabases (approximately 1%) of the human genome sequence and is organized as an international consortium of computational and laboratory-based scientists working to develop and apply high-throughput approaches for detecting all sequence elements that confer biological function. The results of this pilot phase will guide future efforts to analyze the entire human genome.

  11. Pump element for a tube pump

    DEFF Research Database (Denmark)

    2011-01-01

    relative to the rod element so as to allow for a fluid flow in the tube through the first valve member, along the rod element, and through the second valve member. The tube comprises an at least partly flexible tube portion between the valve members such that a repeated deformation of the flexible tube...... pump as mentioned above, thereby acting to generate a fluid flow through the tube upon repeated deformation of the tube between the two valve members. The pump element may comprise a connecting part for coupling to another tube and may comprise a sealing part establishing a fluid tight connection...

  12. Superconvergence of tricubic block finite elements

    Institute of Scientific and Technical Information of China (English)

    2009-01-01

    In this paper, we first introduce interpolation operator of projection type in three dimen- sions, from which we derive weak estimates for tricubic block finite elements. Then using the estimate for the W 2, 1-seminorm of the discrete derivative Green’s function and the weak estimates, we show that the tricubic block finite element solution uh and the tricubic interpolant of projection type Πh3u have superclose gradient in the pointwise sense of the L∞-norm. Finally, this supercloseness is applied to superconvergence analysis, and the global superconvergence of the finite element approximation is derived.

  13. Element spots in HgMn stars

    OpenAIRE

    Korhonen, Heidi

    2013-01-01

    A fraction of late B-type stars, the so-called HgMn stars, exhibit enhanced absorption lines of certain chemical elements, notably Hg and Mn, combined with an underabundance of He. For about a decade now the elements with anomalously high abundances in HgMn stars are known to be distributed inhomogeneously over the stellar surface. Temporal evolution of these elemental spots have been reported in a few HgMn stars, first secular evolution of the mercury spots in alpha And, and recently also a ...

  14. A flat triangular shell element with Loof nodes

    DEFF Research Database (Denmark)

    Poulsen, Peter Noe; Damkilde, Lars

    1996-01-01

    In the formulation of flat shell elements it is difficult to achieve inter-element compatibility between membrane and transverse displacements for non-coplanar elements. Many elements lack proper nodal degrees of freedom to model intersections making the assembly of elements troublesome. A flat...... triangular shell element is established by a combination of a new plate bending element DKTL and the well-known linear membrane strain element LST, and for this element the above-mentioned deficiences are avoided. The plate bending element DKTL is based on Discrete Kirchhoff Theory and Loof nodes. The nodal...

  15. NEW RSW & Wall Fine Mixed Element Grid

    Data.gov (United States)

    National Aeronautics and Space Administration — RSW Fine Mixed Element Grid with viscous root wind tunnel wall. This grid is for a node-based unstructured solver. Quad Surface Faces= 38016 Tria Surface Faces=...

  16. NEW RSW & Wall Coarse Mixed Element Grid

    Data.gov (United States)

    National Aeronautics and Space Administration — This is the Coarse Mixed Element Grid for the RSW with a viscous wall at the root. This grid is for a node-based unstructured solver. Quad Surface Faces= 9728 Tria...

  17. NEW RSW & Wall Medium Mixed Element Grid

    Data.gov (United States)

    National Aeronautics and Space Administration — RSW Medium Mixed Element Grid with Viscous Wind Tunnel Wall at the root. This grid is for a node-based unstructured solver. Quad Surface Faces= 18432 Tria Surface...

  18. Data sheets on selected toxic elements

    International Nuclear Information System (INIS)

    The chemical elements considered in this volume have been identified as toxic to animal and vegetable life forms; however, these elements have not been studied as intensely as lead, mercury, cadmium, etc. Since, in most cases, existing data are insufficient to permit discussion and comparisons of relative quality, it was decided to present what quantitative data there are in as concise a manner as possible. The resulting data sheets present what is considered to be the best available information on the environmental levels, emissions and toxicology of these elements and some of their compounds. Reference is made to the article or review in which the datum appears and which may contain any discussion of the datum and the methods whereby it was obtained. Elements considered in this volume are antimony, barium, beryllium, bismuth, boron, cesium, gallium, germanium, indium, molybdenum, silver, tellurium, thallium, tin, uranium and zirconium

  19. Solar System Abundances of the Elements

    CERN Document Server

    Lodders, Katharina

    2010-01-01

    Representative abundances of the chemical elements for use as a solar abundance standard in astronomical and planetary studies are summarized. Updated abundance tables for solar system abundances based on meteorites and photospheric measurements are presented.

  20. Experimental Finite Element Approach for Stress Analysis

    Directory of Open Access Journals (Sweden)

    Ahmet Erklig

    2014-01-01

    Full Text Available This study aims to determining the strain gauge location points in the problems of stress concentration, and it includes both experimental and numerical results. Strain gauges were proposed to be positioned to corresponding locations on beam and blocks to related node of elements of finite element models. Linear and nonlinear cases were studied. Cantilever beam problem was selected as the linear case to approve the approach and conforming contact problem was selected as the nonlinear case. An identical mesh structure was prepared for the finite element and the experimental models. The finite element analysis was carried out with ANSYS. It was shown that the results of the experimental and the numerical studies were in good agreement.

  1. Trace element geochemistry of CR chondrite metal

    CERN Document Server

    Jacquet, Emmanuel; Alard, Olivier; Kearsley, Anton T; Gounelle, Matthieu

    2015-01-01

    We report trace element analyses by laser ablation inductively coupled plasma mass spectrometry of metal grains from 9 different CR chondrites, distinguishing grains from chondrule interior ("interior grains"), chondrule surficial shells ("margin grains") and the matrix ("isolated grains"). Save for a few anomalous grains, Ni-normalized trace element patterns are similar for all three petrographical settings, with largely unfractionated refractory siderophile elements and depleted volatile Au, Cu, Ag, S. All types of grains are interpreted to derive from a common precursor approximated by the least melted, fine-grained objects in CR chondrites. This also excludes recondensation of metal vapor as the origin of the bulk of margin grains. The metal precursors presumably formed by incomplete condensation, with evidence for high-temperature isolation of refractory platinum-group-element (PGE)-rich condensates before mixing with lower temperature PGE-depleted condensates. The rounded shape of the Ni-rich, interior ...

  2. Elemental tracers for Chinese source dust

    Institute of Scientific and Technical Information of China (English)

    张小曳; 张光宇; 朱光华; 张德二; 安芷生; 陈拓; 黄湘萍

    1996-01-01

    The mass-particle size distributions of 10 dust-carrying elements in aerosol particles were determined tor 12 sites in desert regions of northern China. The desert dust is proved to he of origin of eolian loess deposited on the Loess Plateau. Their transport to the loess was mainly attributable to the non-dust storm processes under the interglacial climate condition. The impact ot" dust storm on the accumulation of the loess increased in the glacial stage. On the basis of the signatures of 4 dust elements (Al. Fe, Mg and Sc). Chinese dust is believed to have 3 major desert sources (northwestern deserts, northern high dust deserts and northern low dust deserts). With a chemical element balance model, an elemental tracer system is established to proportion the export of China-source dust.

  3. Elements with Square Roots in Finite Groups

    Institute of Scientific and Technical Information of China (English)

    M.S. Lucido; M.R. Pournaki

    2005-01-01

    In this paper, we study the probability that a randomly chosen element in a finite group has a square root, in particular the simple groups of Lie type of rank 1, the sporadic finite simple groups and the alternating groups.

  4. Advanced finite element method in structural engineering

    CERN Document Server

    Long, Yu-Qiu; Long, Zhi-Fei

    2009-01-01

    This book systematically introduces the research work on the Finite Element Method completed over the past 25 years. Original theoretical achievements and their applications in the fields of structural engineering and computational mechanics are discussed.

  5. Elemental Compositions of Over 80 Cell Phones

    Science.gov (United States)

    Christian, Beverley; Romanov, Alexandre; Romanova, Irina; Turbini, Laura J.

    2014-11-01

    Over the last few years, 85 cell phones have been disassembled, ground up, dissolved, and analyzed for elemental content, mainly for information about the metals present in the phones, but also for some metalloids and nonmetals. The following list of 38 elements were detected in some or all of the phones: Be, B, Mg, Al, Ti, V, Mn, Fe, Co, Ni, Cu, Zn, As, Se, Y, Nb, Pd, Ag, In, Sn, Sb, Te, Ba, Ta, W, Pt, Au, Tl, Pb, Bi, Pr, Nd, Sm, Eu, Gd, Tb, Dy, and Er. Cadmium was never detected. This paper discusses the methods used for carrying out the analysis, proposes possible sources in the telephones for the elements of interest, the reasons for the interest in most of the elements, and method repeatability.

  6. Diffractive Optical Elements for Dynamic Optical Coupling

    Institute of Scientific and Technical Information of China (English)

    Changhe Zhou; Xin Zhao; Liren Liu

    2003-01-01

    Diffractive optical elements such as the complementary Dammann gratings are incorporated for dynamic optical fiber splitting and combining. Experimental results of 1′8 dynamic optical couplings are presented.

  7. Diffractive Optical Elements for Dynamic Optical Coupling

    Institute of Scientific and Technical Information of China (English)

    2003-01-01

    Diffractive optical elements such as the complementary Dammann gratings are incorporated for dynamic optical fiber splitting and combining. Experimental results of 1×8 dynamic optical couplings are presented.

  8. Discovery announced of four new elements

    Science.gov (United States)

    Banks, Michael

    2016-02-01

    The International Union of Pure and Applied Chemistry (IUPAC) and the International Union of Pure and Applied Physics (IUPAP) have announced the discovery of four new elements: 113, 115, 117 and 118 - completing the periodic table's seventh row.

  9. Conforming finite elements with embedded strong discontinuities

    NARCIS (Netherlands)

    Dias-da-Costa, D.; Alfaiate, J.; Sluys, L.J.; Areias, P.; Fernandes, C.; Julio, E.

    2012-01-01

    The possibility of embedding strong discontinuities into finite elements allowed the simulation of different problems, namely, brickwork masonry fracture, dynamic fracture, failure in finite strain problems and simulation of reinforcement concrete members. However, despite the significant contributi

  10. APPLICATION OF PARAGRAPHEMICS ELEMENTS WHILE MAKING PACKAGING

    Directory of Open Access Journals (Sweden)

    V. V. Кuzmich

    2014-01-01

    Full Text Available The paper investigates mechanisms for creation of paragraphemics elements in printed advertisement on the packaging that attract attention to semantic characteristics of words and ensure a deeper understanding of the advertising text in comparison with superficial perception

  11. Discrete mechanics Based on Finite Element Methods

    OpenAIRE

    Chen, Jing-Bo; Guo, Han-Ying; Wu, Ke

    2002-01-01

    Discrete Mechanics based on finite element methods is presented in this paper. We also explore the relationship between this discrete mechanics and Veselov discrete mechanics. High order discretizations are constructed in terms of high order interpolations.

  12. Discrete Element Modeling of Drop Tests

    Science.gov (United States)

    Wang, Yuannian; Tonon, Fulvio

    2012-09-01

    A discrete element code with impact model has been developed and calibrated to simulate the dynamic behavior of rock materials, with special regard to rock fragmentation upon impact during rock-fall analysis. The paper summarizes the discrete element code, the calibration algorithms developed to identify the model microparameters, and the impact model. Experimental work on drop tests is then used to validate the code on modeling impact fragmentation. It has been found that the developed discrete element code and impact model can reasonably simulate rock fragmentation in drop tests. The use of the discrete element code and impact model can provide good reference results in evaluating impact fragmentation in rock-fall analysis.

  13. Taste as didactic element in food education

    DEFF Research Database (Denmark)

    Wistoft, Karen

    to their own expected learning, viewed in the light of three didactic elements: motivation, student participation and innovation in school. The method is a survey based on questionnaire among students (N= 769) who have participated a cooking competition that forms part of the subject Food Knowledge...... in the national Danish school. The connection between taste and learning is a relatively unexplored field, and the analysis indicates that student’s experience of working with taste have an impact on students’ learning that is equally positive – or even more so – as that of known didactic elements like student...... participation and innovation. The paper conclude that food education building on ‘hegemonic nutrition’ and traditional didactic elements do not necessarily condition the best learning outcome; food education that balance between traditional didactic elements and incorporate taste as a didactic approach enable...

  14. Finite element analysis of tibial fractures

    DEFF Research Database (Denmark)

    Wong, Christian Nai En; Mikkelsen, Mikkel Peter W; Hansen, Leif Berner;

    2010-01-01

    of bony healing. The biomechanical results are the basis for fracture healing, biomechanical fall analysis and stability analysis of osteosynthesis. MATERIAL AND METHODS: A finite element model of the bony part of the lower leg was generated on the basis of computed tomography data from the Visible Human......INTRODUCTION: Fractures of the tibial shaft are relatively common injuries. There are indications that tibial shaft fractures share characteristics in terms of site, type and local fracture mechanisms. In this study, we aimed to set up a mathematical, computer-based model using finite element...... Project. The data consisted of 21,219 3D elements with a cortical shell and a trabecular core. Three types of load of torsion, a direct lateral load and axial compression were applied. RESULTS: The finite element linear static analysis resulted in relevant fracture localizations and indicated relevant...

  15. Human Exploration Telerobotics (HET2): Astrobee Element

    Data.gov (United States)

    National Aeronautics and Space Administration — The HET2 Astrobee Element will focus on developing a new free-flying robot suitable for performing IVA work on the International Space Station (ISS). The new robot...

  16. Element spots in HgMn stars

    Science.gov (United States)

    Korhonen, H.

    2014-11-01

    A fraction of late B-type stars, the so-called HgMn stars, exhibit enhanced absorption lines of certain chemical elements, notably Hg and Mn, combined with an underabundance of He. For about a decade it has been known that the elements with anomalously high abundances in HgMn stars are distributed inhomogeneously over the stellar surface. Observation of the temporal evolution of those spots has been reported in a few HgMn stars, first of a secular evolution of the mercury spots in α And, and more recently of a fast evolution of yttrium and strontium spots in HD 11753. The fast evolution of spots in HD 11753 is combined with a slower change in the overall abundance of the elements affected. In this paper I review what is known about these ``elemental spots'' in HgMn stars and their secular and fast temporal evolution.

  17. Comparative study of different Schlieren diffracting elements

    Indian Academy of Sciences (India)

    Raj Kumar; Sushil K Kaura; D P Chhachhia; D Mohan; A K Aggarwal

    2008-01-01

    This paper presents an analysis of diffraction effects taking place at different Schlieren diffracting elements. Two types of diffraction effects are prominent in the Schlieren schemes. One is diffraction of direct light (source image) at the Schlieren element, which limits the sensitivity and resolution of Schlieren systems. The second type is the diffraction of light deflected from the test object at the Schlieren-diffracting element. This second type of diffraction degrades the quality of Schlieren results. Experimental results showing the effect of diffraction of light deflected from the test object at a phase knife-edge, corner of a square phase aperture and an optical fiber tip as Schlieren diffracting elements have been presented and discussed.

  18. Comix, a New Matrix Element Generator

    Energy Technology Data Exchange (ETDEWEB)

    Gleisberg, Tanju; /SLAC; Hoche, Stefan; /Durham U., IPPP

    2008-09-03

    We present a new tree-level matrix element generator, based on the color dressed Berends-Giele recursive relations. We discuss two new algorithms for phase space integration, dedicated to be used with large multiplicities and color sampling.

  19. PLANE INFINITE ANALYTICAL ELEMENT AND HAMILTONIAN SYSTEM

    Institute of Scientific and Technical Information of China (English)

    孙雁; 周钢; 刘正兴

    2003-01-01

    It is not convenient to solve those engineering problems defined in an infinitefield by using FEM. An infinite area can be divided into a regular infinite external area anda finite internal area. The finite internal area was dealt with by the FEM and the regularinfinite external area was settled in a polar coordinate. All governing equations weretransformed into the Hamiltonian system. The methods of variable separation andeigenfunction expansion were used to derive the stiffness matrix of a new infinite analyticalelement. This new element, like a super finite element, can be combined with commonlyused finite elements. The proposed method was verified by numerical case studies. Theresults show that the preparation work is very simple, the infinite analytical element has ahigh precision, and it can be used conveniently. The method can also be easily extended to a three-dimensional problem.

  20. Elements of an effective environmental auditing program

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1996-08-01

    Significant advances have been made the last few years in the approach to and role of environmental compliance auditing in industry. Expectations of stakeholders, the public and governmental agencies continue to grow regarding assurance of compliance and environmental protection. These growing expectations have been drivers for improved auditing programs. This paper will provide a discussion of an effective environmental auditing program from industry`s point of view. It will identify and discuss the key elements needed for auditing environmental compliance, discuss how these elements are incorporated into industry programs and how these elements have been used to evaluate compliance in Conoco. In addition, a discussion of a method to tie compliance auditing to management system elements in order to facilitate systematic improvement in environmental performance will be presented.

  1. Elements of an effective environmental auditing program

    Energy Technology Data Exchange (ETDEWEB)

    McLemore, J.A.

    1996-11-01

    Significant advances have been made the last few years in the approach to and role of environmental compliance auditing in the petroleum industry. Expectations of stakeholders, the public and governmental agencies continue to grow regarding assurance of compliance and environmental protection. These growing expectations have been drivers for improved auditing programs. This paper will provide a discussion of an effective environmental auditing program from industry`s point of view. It will identify and discuss the key elements needed for auditing environmental compliance, discuss how these elements are incorporated into industry programs and how these elements have been used to evaluate compliance in Conoco. In addition, a discussion of a method to tie compliance auditing to management system elements in order to facilitate systematic improvement in environmental performance will be presented.

  2. Die drei Elemente des Electronic Government

    OpenAIRE

    Schedler, Kuno; Scharf, Maria Christina

    2000-01-01

    Electronic Government ist das Schlagwort der Stunde. Unterschiedlichste Definitionen dieses Begriffs verwirren die Praktiker/innen zunehmend. Eine prozessorientierte Sicht lässt drei Elemente als Basis des neuen Konzeptes erkennen.

  3. A method for making a dry element

    Energy Technology Data Exchange (ETDEWEB)

    Abe, T.; Isikhara, K.; Kimura, T.; Momose, K.; Sakata, Y.

    1983-08-11

    The agglomerate is coated along the lateral surface by a separator and is enclosed in a zinc cylinder which serves as the anode. A separating plate is installed in the upper part of the agglomerate between the agglomerate and the anode. A current outlead is attached to the anode. The element is inserted into a body, pressing the plate into the agglomerate with a punch which has a recess. A guide cylinder is used for precise installation of the element. The space between the plate and the body in the upper part of the element is filled with wax or another substance. Short circuiting (KZ) between the current outlead and the agglomerate is prevented in the element.

  4. PRAGMALINGUISTIC ELEMENTS IN TOURIST DESTIONATION IMAGE FORMATION

    OpenAIRE

    Blažević, Nevenka; Stojić, Aneta

    2006-01-01

    Image has been an important topic in tourism research. It is one of the key factors in the travel selection process. The image of a tourist destination is the sum of all perceptions tourists and potential visitors hold of that destination. In tourist advertising materials it is represented through verbal and pictorial elements. The focus of this research is to find out pragmalinguistic elements in tourist destination image formation. This paper especially concentrates on some typical pragmali...

  5. Predictions of synthesizing element 119 and 120

    Institute of Scientific and Technical Information of China (English)

    2011-01-01

    The evaporation residue cross sections of synthesizing superheavy nuclei Z=119, 120 are calculated by different sets of master equations with different dynamical variables. Two methods basically predicted similar results that the Ca induced hot fusion can 48 produce element 119 easier than produce 120, and the evaporation residue cross sections for 119 are detectable by current advanced techniques, while the evaporation residue cross sections are below 0.1 pb for producing element 120.

  6. A human hepatitis B viral enhancer element.

    OpenAIRE

    Shaul, Y; Rutter, W J; Laub, O

    1985-01-01

    Fragments of the cloned hepatitis B virus (HBV) genome were assayed in vivo for the presence of a transcriptional enhancer element. We demonstrate that sequences positioned approximately 450 bp upstream from the HBcAg gene promoter are required for its efficient activity. These HBV stimulatory sequences activate transcription when inserted upstream to a heterologous SV40 early promoter. Like other known enhancer elements, this HBV sequence acts in an orientation-independent manner. Furthermor...

  7. Børnehaven De fire Elementer

    DEFF Research Database (Denmark)

    Sørensen, Hanne Værum

    I projektet undersøges og beskrives arbejdet i børnehaven De fire Elementer, med særligt fokus på kønsopdelingen fire formiddage om ugen.......I projektet undersøges og beskrives arbejdet i børnehaven De fire Elementer, med særligt fokus på kønsopdelingen fire formiddage om ugen....

  8. Finite element modeling of the human pelvis

    Energy Technology Data Exchange (ETDEWEB)

    Carlson, B.

    1995-11-01

    A finite element model of the human pelvis was created using a commercial wire frame image as a template. To test the final mesh, the model`s mechanical behavior was analyzed through finite element analysis and the results were displayed graphically as stress concentrations. In the future, this grid of the pelvis will be integrated with a full leg model and used in side-impact car collision simulations.

  9. Explicit Instruction Elements in Core Reading Programs

    OpenAIRE

    Child, Angela R.

    2012-01-01

    Classroom teachers are provided instructional recommendations for teaching reading from their adopted core reading programs (CRPs). Explicit instruction elements or what is also called instructional moves, including direct explanation, modeling, guided practice, independent practice, discussion, feedback, and monitoring, were examined within CRP reading lessons. This study sought to answer the question: What elements of explicit instruction or instructional moves are included in the five most...

  10. Main: ELEMENT2GMLBC3 [PLACE

    Lifescience Database Archive (English)

    Full Text Available ELEMENT2GMLBC3 S000320 7-Sep-2000 (last modified) seki Element 2 found in the promo...ter of soybean (G.m.) leghaemoglobin lbc3 gene; Binding site of nuclear extract from soybean nodules; Locate...nt 2 is highly conserved in other soybean lb gene promoter regions; See S000319; nodule; leghaemoglobin; lbc3; root; Soybean (Glycine max) CTTAAATTATTTATTT ...

  11. Major and trace elements in lithogenesis

    OpenAIRE

    Słojewski, Marcin

    2011-01-01

    The process of crystallization in the urinary tract occurs when the equilibrium between promoting and inhibiting factors is broken. Many theories have been published to explain the mechanism of urinary stones formation; however, none of these theories has paid attention to trace elements. Their role in lithogenesis is still unclear and under debate. The findings of some studies may support the thesis that some major and trace elements may take part in the initiation of stone crystallization f...

  12. A NOTE ON FINITE ELEMENT WAVELETS

    Institute of Scientific and Technical Information of China (English)

    谌秋辉; 陈翰麟

    2001-01-01

    The refinability and approximation order of finite element multi-scale vector are discussed in [1]. But the coefficients in the conditions of approximation order of finite element multi-scale vector are incorrect there. The main purpose of this note is to make a correction of the error in the main result of [1]. These coefficients are very important for the properties of wavelets, such as vanishing moments and regularity.

  13. How Cultural Elements Affect Business English Translation

    Institute of Scientific and Technical Information of China (English)

    路萱

    2008-01-01

    Transnational,cross -racial,cross -cultural exchanges are becoming increasingly extensive and frequent,and mutual contacts and commercial intercourse of different peoples show that cultural interchange and cultural integration,accompanied by economic integration,to some extent, have come to every aspect of life and to every participant. This article concentrates on the impact of cultural elements in business English translation while analyzing the relationship between cultural elements and translation in the Chinese perspective.

  14. The finite element method in electromagnetics

    CERN Document Server

    Jin, Jianming

    2014-01-01

    A new edition of the leading textbook on the finite element method, incorporating major advancements and further applications in the field of electromagnetics The finite element method (FEM) is a powerful simulation technique used to solve boundary-value problems in a variety of engineering circumstances. It has been widely used for analysis of electromagnetic fields in antennas, radar scattering, RF and microwave engineering, high-speed/high-frequency circuits, wireless communication, electromagnetic compatibility, photonics, remote sensing, biomedical engineering, and space exploration. The

  15. Molecular clusters of the main group elements

    CERN Document Server

    Driess, Matthias

    2008-01-01

    ""To summarize, Molecular Clusters of the Main Group Elements is certainly not a popular science book, nor is it a textbook; it is a very good, up-to-date collection of articles for the specialist. Als Fazit bleibt: Molecular Clusters of the Main Group Elements ist sicher kein populissenschaftliches Werk, auch kein Lehrbuch, aber eine gelungene, hoch aktuelle Zusammenstellung fen interessierten Fachmann."" -Michael Ruck, TU Dresden, Angewandte Chemie, 2004 - 116/36 + International Edition 2004 - 43/36

  16. Surgery simulation using fast finite elements

    DEFF Research Database (Denmark)

    Bro-Nielsen, Morten

    1996-01-01

    This paper describes our recent work on real-time surgery simulation using fast finite element models of linear elasticity. In addition, we discuss various improvements in terms of speed and realism......This paper describes our recent work on real-time surgery simulation using fast finite element models of linear elasticity. In addition, we discuss various improvements in terms of speed and realism...

  17. Finite Element Analysis of Deep Excavations

    OpenAIRE

    Bentler, David J.

    1998-01-01

    This dissertation describes enhancements made to the finite element program, SAGE, and research on the performance of deep excavations This dissertation describes enhancements made to the finite element program, SAGE, and research on the performance of deep excavations. SAGE was developed at Virginia Tech for analysis of soil-structure interaction problems (Morrison, 1995). The purpose of the work described in this text with SAGE was to increase the capabilities o...

  18. Stretchable semiconductor elements and stretchable electrical circuits

    Science.gov (United States)

    Rogers, John A.; Khang, Dahl-Young; Menard, Etienne

    2009-07-07

    The invention provides methods and devices for fabricating printable semiconductor elements and assembling printable semiconductor elements onto substrate surfaces. Methods, devices and device components of the present invention are capable of generating a wide range of flexible electronic and optoelectronic devices and arrays of devices on substrates comprising polymeric materials. The present invention also provides stretchable semiconductor structures and stretchable electronic devices capable of good performance in stretched configurations.

  19. Transcriptional activity of transposable elements in coelacanth.

    Science.gov (United States)

    Forconi, Mariko; Chalopin, Domitille; Barucca, Marco; Biscotti, Maria Assunta; De Moro, Gianluca; Galiana, Delphine; Gerdol, Marco; Pallavicini, Alberto; Canapa, Adriana; Olmo, Ettore; Volff, Jean-Nicolas

    2014-09-01

    The morphological stasis of coelacanths has long suggested a slow evolutionary rate. General genomic stasis might also imply a decrease of transposable elements activity. To evaluate the potential activity of transposable elements (TEs) in "living fossil" species, transcriptomic data of Latimeria chalumnae and its Indonesian congener Latimeria menadoensis were compared through the RNA-sequencing mapping procedures in three different organs (liver, testis, and muscle). The analysis of coelacanth transcriptomes highlights a significant percentage of transcribed TEs in both species. Major contributors are LINE retrotransposons, especially from the CR1 family. Furthermore, some particular elements such as a LF-SINE and a LINE2 sequences seem to be more expressed than other elements. The amount of TEs expressed in testis suggests possible transposition burst in incoming generations. Moreover, significant amount of TEs in liver and muscle transcriptomes were also observed. Analyses of elements displaying marked organ-specific expression gave us the opportunity to highlight exaptation cases, that is, the recruitment of TEs as new cellular genes, but also to identify a new Latimeria-specific family of Short Interspersed Nuclear Elements called CoeG-SINEs. Overall, transcriptome results do not seem to be in line with a slow-evolving genome with poor TE activity.

  20. The Last Element of Mendeleev's Periodic Table

    Science.gov (United States)

    Khazan, Albert

    2010-02-01

    Despite much achievements of the synthesis for super-heavy elements (10 new elements were obtained during the last 25 years), the experts in Mendeleev's Periodic Table have not answered the most fundamental question: where the Table ends? The calculations produced on the basis of Quantum Mechanics (the physical conditions in micro-scales) do not not answer this question till now. In my study of chemical compounds, I focused onto the physical conditions observed in macro-scales (the subjects of the regular physics and chemistry). Thus, the Law of Hyperboles was discovered in the Periodic Table: given any chemical compound, the contents of any element in it (per 1 gram-atom), including the contents of unknown elements, whose atomic masses can be set up arbitrarily, is described by the equation of a equilateral hyperbola Y=K/X. The tops of all the arcs are distributed along a real axis crossing the line Y=1 in the point of abscissa 411.66, which manifests the actual atomic mass of the last (heaviest) element of the Periodic Table: its location is Period 8, Group 1; its atomic mass is 411.66, its number is 155 (Khazan A. Upper Limit in Mendeleev's Periodic Table --- Element No.155. Svenska fysikarkivet, 2009). )