WorldWideScience

Sample records for cis-regulatory element zrs

  1. Preaxial polydactyly/triphalangeal thumb is associated with changed transcription factor-binding affinity in a family with a novel point mutation in the long-range cis-regulatory element ZRS

    DEFF Research Database (Denmark)

    Farooq, Muhammad; Troelsen, Jesper T; Boyd, Mette;

    2010-01-01

    A cis-regulatory sequence also known as zone of polarizing activity (ZPA) regulatory sequence (ZRS) located in intron 5 of LMBR1 is essential for expression of sonic hedgehog (SHH) in the developing posterior limb bud mesenchyme. Even though many point mutations causing preaxial duplication defects...

  2. Changes in Cis-regulatory Elements during Morphological Evolution

    Directory of Open Access Journals (Sweden)

    Yu-Lee Paul

    2012-10-01

    Full Text Available How have animals evolved new body designs (morphological evolution? This requires explanations both for simple morphological changes, such as differences in pigmentation and hair patterns between different Drosophila populations and species, and also for more complex changes, such as differences in the forelimbs of mice and bats, and the necks of amphibians and reptiles. The genetic changes and pathways involved in these evolutionary steps require identification. Many, though not all, of these events occur by changes in cis-regulatory (enhancer elements within developmental genes. Enhancers are modular, each affecting expression in only one or a few tissues. Therefore it is possible to add, remove or alter an enhancer without producing changes in multiple tissues, and thereby avoid widespread (pleiotropic deleterious effects. Ideally, for a given step in morphological evolution it is necessary to identify (i the change in phenotype, (ii the changes in gene expression, (iii the DNA region, enhancer or otherwise, affected, (iv the mutation involved, (v the nature of the transcription or other factors that bind to this site. In practice these data are incomplete for most of the published studies upon morphological evolution. Here, the investigations are categorized according to how far these analyses have proceeded.

  3. Hunting for Cis-Regulatory Elements in Proteins.

    Science.gov (United States)

    Gibson, Toby J; Kumar, Manjeet

    2016-02-24

    A new bioinformatics tool predicts natively disordered protein control elements that function in cis, opening the door to more systematic studies of this biomedically important class of protein modules. PMID:27135160

  4. Bounded search for de novo identification of degenerate cis-regulatory elements

    Directory of Open Access Journals (Sweden)

    Khetani Radhika S

    2006-05-01

    Full Text Available Abstract Background The identification of statistically overrepresented sequences in the upstream regions of coregulated genes should theoretically permit the identification of potential cis-regulatory elements. However, in practice many cis-regulatory elements are highly degenerate, precluding the use of an exhaustive word-counting strategy for their identification. While numerous methods exist for inferring base distributions using a position weight matrix, recent studies suggest that the independence assumptions inherent in the model, as well as the inability to reach a global optimum, limit this approach. Results In this paper, we report PRISM, a degenerate motif finder that leverages the relationship between the statistical significance of a set of binding sites and that of the individual binding sites. PRISM first identifies overrepresented, non-degenerate consensus motifs, then iteratively relaxes each one into a high-scoring degenerate motif. This approach requires no tunable parameters, thereby lending itself to unbiased performance comparisons. We therefore compare PRISM's performance against nine popular motif finders on 28 well-characterized S. cerevisiae regulons. PRISM consistently outperforms all other programs. Finally, we use PRISM to predict the binding sites of uncharacterized regulons. Our results support a proposed mechanism of action for the yeast cell-cycle transcription factor Stb1, whose binding site has not been determined experimentally. Conclusion The relationship between statistical measures of the binding sites and the set as a whole leads to a simple means of identifying the diverse range of cis-regulatory elements to which a protein binds. This approach leverages the advantages of word-counting, in that position dependencies are implicitly accounted for and local optima are more easily avoided. While we sacrifice guaranteed optimality to prevent the exponential blowup of exhaustive search, we prove that the error

  5. [Identification and mapping of cis-regulatory elements within long genomic sequences].

    Science.gov (United States)

    Akopov, S B; Chernov, I P; Vetchinova, A S; Bulanenkova, S S; Nikolaev, L G

    2007-01-01

    The publication of the human and other metazoan genome sequences opened up the possibility for mapping and analysis of genomic regulatory elements. Unfortunately, experimental data on genomic positions of such sequences as enhancers, silencers, insulators, transcription terminators, and replication origins are very limited, especially at the whole genome level. As most genomic regulatory elements (e.g., enhancers) are generally gene-, tissue-, or cell-specific, the prediction of these elements in silico is often ambiguous. Therefore, the development of high-throughput experimental approaches for identification and mapping of genomic functional elements is highly desirable. In this review we discuss novel approaches to high-throughput experimental identification of mammalian genomes cis-regulatory elements which is a necessary step toward the complete genome annotation. PMID:18240562

  6. Transcription of Mammalian cis-Regulatory Elements Is Restrained by Actively Enforced Early Termination.

    Science.gov (United States)

    Austenaa, Liv M I; Barozzi, Iros; Simonatto, Marta; Masella, Silvia; Della Chiara, Giulia; Ghisletti, Serena; Curina, Alessia; de Wit, Elzo; Bouwman, Britta A M; de Pretis, Stefano; Piccolo, Viviana; Termanini, Alberto; Prosperini, Elena; Pelizzola, Mattia; de Laat, Wouter; Natoli, Gioacchino

    2015-11-01

    Upon recruitment to active enhancers and promoters, RNA polymerase II (Pol II) generates short non-coding transcripts of unclear function. The mechanisms that control the length and the amount of ncRNAs generated by cis-regulatory elements are largely unknown. Here, we show that the adaptor protein WDR82 and its associated complexes actively limit such non-coding transcription. WDR82 targets the SET1 H3K4 methyltransferases and the nuclear protein phosphatase 1 (PP1) complexes to the initiating Pol II. WDR82 and PP1 also interact with components of the transcriptional termination and RNA processing machineries. Depletion of WDR82, SET1, or the PP1 subunit required for its nuclear import caused distinct but overlapping transcription termination defects at highly expressed genes and active enhancers and promoters, thus enabling the increased synthesis of unusually long ncRNAs. These data indicate that transcription initiated from cis-regulatory elements is tightly coordinated with termination mechanisms that impose the synthesis of short RNAs. PMID:26593720

  7. Lessons from Domestication: Targeting Cis-Regulatory Elements for Crop Improvement.

    Science.gov (United States)

    Swinnen, Gwen; Goossens, Alain; Pauwels, Laurens

    2016-06-01

    Domestication of wild plant species has provided us with crops that serve our human nutritional needs. Advanced DNA sequencing has propelled the unveiling of underlying genetic changes associated with domestication. Interestingly, many changes reside in cis-regulatory elements (CREs) that control the expression of an unmodified coding sequence. Sequence variation in CREs can impact gene expression levels, but also developmental timing and tissue specificity of expression. When genes are involved in multiple pathways or active in several organs and developmental stages CRE modifications are favored in contrast to mutations in coding regions, due to the lack of detrimental pleiotropic effects. Therefore, learning from domestication, we propose that CREs are interesting targets for genome editing to create new alleles for plant breeding. PMID:26876195

  8. Characterization of Putative cis-Regulatory Elements in Genes Preferentially Expressed in Arabidopsis Male Meiocytes

    Directory of Open Access Journals (Sweden)

    Junhua Li

    2014-01-01

    Full Text Available Meiosis is essential for plant reproduction because it is the process during which homologous chromosome pairing, synapsis, and meiotic recombination occur. The meiotic transcriptome is difficult to investigate because of the size of meiocytes and the confines of anther lobes. The recent development of isolation techniques has enabled the characterization of transcriptional profiles in male meiocytes of Arabidopsis. Gene expression in male meiocytes shows unique features. The direct interaction of transcription factors (TFs with DNA regulatory sequences forms the basis for the specificity of transcriptional regulation. Here, we identified putative cis-regulatory elements (CREs associated with male meiocyte-expressed genes using in silico tools. The upstream regions (1 kb of the top 50 genes preferentially expressed in Arabidopsis meiocytes possessed conserved motifs. These motifs are putative binding sites of TFs, some of which share common functions, such as roles in cell division. In combination with cell-type-specific analysis, our findings could be a substantial aid for the identification and experimental verification of the protein-DNA interactions for the specific TFs that drive gene expression in meiocytes.

  9. Recurrent modification of a conserved cis-regulatory element underlies fruit fly pigmentation diversity.

    Directory of Open Access Journals (Sweden)

    William A Rogers

    2013-08-01

    Full Text Available The development of morphological traits occurs through the collective action of networks of genes connected at the level of gene expression. As any node in a network may be a target of evolutionary change, the recurrent targeting of the same node would indicate that the path of evolution is biased for the relevant trait and network. Although examples of parallel evolution have implicated recurrent modification of the same gene and cis-regulatory element (CRE, little is known about the mutational and molecular paths of parallel CRE evolution. In Drosophila melanogaster fruit flies, the Bric-à-brac (Bab transcription factors control the development of a suite of sexually dimorphic traits on the posterior abdomen. Female-specific Bab expression is regulated by the dimorphic element, a CRE that possesses direct inputs from body plan (ABD-B and sex-determination (DSX transcription factors. Here, we find that the recurrent evolutionary modification of this CRE underlies both intraspecific and interspecific variation in female pigmentation in the melanogaster species group. By reconstructing the sequence and regulatory activity of the ancestral Drosophila melanogaster dimorphic element, we demonstrate that a handful of mutations were sufficient to create independent CRE alleles with differing activities. Moreover, intraspecific and interspecific dimorphic element evolution proceeded with little to no alterations to the known body plan and sex-determination regulatory linkages. Collectively, our findings represent an example where the paths of evolution appear biased to a specific CRE, and drastic changes in function were accompanied by deep conservation of key regulatory linkages.

  10. Recurrent Modification of a Conserved Cis-Regulatory Element Underlies Fruit Fly Pigmentation Diversity

    Science.gov (United States)

    Rogers, William A.; Salomone, Joseph R.; Tacy, David J.; Camino, Eric M.; Davis, Kristen A.; Rebeiz, Mark; Williams, Thomas M.

    2013-01-01

    The development of morphological traits occurs through the collective action of networks of genes connected at the level of gene expression. As any node in a network may be a target of evolutionary change, the recurrent targeting of the same node would indicate that the path of evolution is biased for the relevant trait and network. Although examples of parallel evolution have implicated recurrent modification of the same gene and cis-regulatory element (CRE), little is known about the mutational and molecular paths of parallel CRE evolution. In Drosophila melanogaster fruit flies, the Bric-à-brac (Bab) transcription factors control the development of a suite of sexually dimorphic traits on the posterior abdomen. Female-specific Bab expression is regulated by the dimorphic element, a CRE that possesses direct inputs from body plan (ABD-B) and sex-determination (DSX) transcription factors. Here, we find that the recurrent evolutionary modification of this CRE underlies both intraspecific and interspecific variation in female pigmentation in the melanogaster species group. By reconstructing the sequence and regulatory activity of the ancestral Drosophila melanogaster dimorphic element, we demonstrate that a handful of mutations were sufficient to create independent CRE alleles with differing activities. Moreover, intraspecific and interspecific dimorphic element evolution proceeded with little to no alterations to the known body plan and sex-determination regulatory linkages. Collectively, our findings represent an example where the paths of evolution appear biased to a specific CRE, and drastic changes in function were accompanied by deep conservation of key regulatory linkages. PMID:24009528

  11. Deciphering Cis-Regulatory Element Mediated Combinatorial Regulation in Rice under Blast Infected Condition.

    Science.gov (United States)

    Deb, Arindam; Kundu, Sudip

    2015-01-01

    Combinations of cis-regulatory elements (CREs) present at the promoters facilitate the binding of several transcription factors (TFs), thereby altering the consequent gene expressions. Due to the eminent complexity of the regulatory mechanism, the combinatorics of CRE-mediated transcriptional regulation has been elusive. In this work, we have developed a new methodology that quantifies the co-occurrence tendencies of CREs present in a set of promoter sequences; these co-occurrence scores are filtered in three consecutive steps to test their statistical significance; and the significantly co-occurring CRE pairs are presented as networks. These networks of co-occurring CREs are further transformed to derive higher order of regulatory combinatorics. We have further applied this methodology on the differentially up-regulated gene-sets of rice tissues under fungal (Magnaporthe) infected conditions to demonstrate how it helps to understand the CRE-mediated combinatorial gene regulation. Our analysis includes a wide spectrum of biologically important results. The CRE pairs having a strong tendency to co-occur often exhibit very similar joint distribution patterns at the promoters of rice. We couple the network approach with experimental results of plant gene regulation and defense mechanisms and find evidences of auto and cross regulation among TF families, cross-talk among multiple hormone signaling pathways, similarities and dissimilarities in regulatory combinatorics between different tissues, etc. Our analyses have pointed a highly distributed nature of the combinatorial gene regulation facilitating an efficient alteration in response to fungal attack. All together, our proposed methodology could be an important approach in understanding the combinatorial gene regulation. It can be further applied to unravel the tissue and/or condition specific combinatorial gene regulation in other eukaryotic systems with the availability of annotated genomic sequences and suitable

  12. Changes in cis-regulatory elements of a key floral regulator are associated with divergence of inflorescence architectures.

    Science.gov (United States)

    Kusters, Elske; Della Pina, Serena; Castel, Rob; Souer, Erik; Koes, Ronald

    2015-08-15

    Higher plant species diverged extensively with regard to the moment (flowering time) and position (inflorescence architecture) at which flowers are formed. This seems largely caused by variation in the expression patterns of conserved genes that specify floral meristem identity (FMI), rather than changes in the encoded proteins. Here, we report a functional comparison of the promoters of homologous FMI genes from Arabidopsis, petunia, tomato and Antirrhinum. Analysis of promoter-reporter constructs in petunia and Arabidopsis, as well as complementation experiments, showed that the divergent expression of leafy (LFY) and the petunia homolog aberrant leaf and flower (ALF) results from alterations in the upstream regulatory network rather than cis-regulatory changes. The divergent expression of unusual floral organs (UFO) from Arabidopsis, and the petunia homolog double top (DOT), however, is caused by the loss or gain of cis-regulatory promoter elements, which respond to trans-acting factors that are expressed in similar patterns in both species. Introduction of pUFO:UFO causes no obvious defects in Arabidopsis, but in petunia it causes the precocious and ectopic formation of flowers. This provides an example of how a change in a cis-regulatory region can account for a change in the plant body plan. PMID:26220938

  13. Identification of a cis-regulatory element by transient analysis of co-ordinately regulated genes

    Directory of Open Access Journals (Sweden)

    Allan Andrew C

    2008-07-01

    Full Text Available Abstract Background Transcription factors (TFs co-ordinately regulate target genes that are dispersed throughout the genome. This co-ordinate regulation is achieved, in part, through the interaction of transcription factors with conserved cis-regulatory motifs that are in close proximity to the target genes. While much is known about the families of transcription factors that regulate gene expression in plants, there are few well characterised cis-regulatory motifs. In Arabidopsis, over-expression of the MYB transcription factor PAP1 (PRODUCTION OF ANTHOCYANIN PIGMENT 1 leads to transgenic plants with elevated anthocyanin levels due to the co-ordinated up-regulation of genes in the anthocyanin biosynthetic pathway. In addition to the anthocyanin biosynthetic genes, there are a number of un-associated genes that also change in expression level. This may be a direct or indirect consequence of the over-expression of PAP1. Results Oligo array analysis of PAP1 over-expression Arabidopsis plants identified genes co-ordinately up-regulated in response to the elevated expression of this transcription factor. Transient assays on the promoter regions of 33 of these up-regulated genes identified eight promoter fragments that were transactivated by PAP1. Bioinformatic analysis on these promoters revealed a common cis-regulatory motif that we showed is required for PAP1 dependent transactivation. Conclusion Co-ordinated gene regulation by individual transcription factors is a complex collection of both direct and indirect effects. Transient transactivation assays provide a rapid method to identify direct target genes from indirect target genes. Bioinformatic analysis of the promoters of these direct target genes is able to locate motifs that are common to this sub-set of promoters, which is impossible to identify with the larger set of direct and indirect target genes. While this type of analysis does not prove a direct interaction between protein and DNA

  14. Mutagenesis of GATA motifs controlling the endoderm regulator elt-2 reveals distinct dominant and secondary cis-regulatory elements.

    Science.gov (United States)

    Du, Lawrence; Tracy, Sharon; Rifkin, Scott A

    2016-04-01

    Cis-regulatory elements (CREs) are crucial links in developmental gene regulatory networks, but in many cases, it can be difficult to discern whether similar CREs are functionally equivalent. We found that despite similar conservation and binding capability to upstream activators, different GATA cis-regulatory motifs within the promoter of the C. elegans endoderm regulator elt-2 play distinctive roles in activating and modulating gene expression throughout development. We fused wild-type and mutant versions of the elt-2 promoter to a gfp reporter and inserted these constructs as single copies into the C. elegans genome. We then counted early embryonic gfp transcripts using single-molecule RNA FISH (smFISH) and quantified gut GFP fluorescence. We determined that a single primary dominant GATA motif located 527bp upstream of the elt-2 start codon was necessary for both embryonic activation and later maintenance of transcription, while nearby secondary GATA motifs played largely subtle roles in modulating postembryonic levels of elt-2. Mutation of the primary activating site increased low-level spatiotemporally ectopic stochastic transcription, indicating that this site acts repressively in non-endoderm cells. Our results reveal that CREs with similar GATA factor binding affinities in close proximity can play very divergent context-dependent roles in regulating the expression of a developmentally critical gene in vivo. PMID:26896592

  15. Characterization and identification of cis-regulatory elements in Arabidopsis based on single-nucleotide polymorphism information.

    Science.gov (United States)

    Korkuc, Paula; Schippers, Jos H M; Walther, Dirk

    2014-01-01

    Identifying regulatory elements and revealing their role in gene expression regulation remains a central goal of plant genome research. We exploited the detailed genomic sequencing information of a large number of Arabidopsis (Arabidopsis thaliana) accessions to characterize known and to identify novel cis-regulatory elements in gene promoter regions of Arabidopsis by relying on conservation as the hallmark signal of functional relevance. Based on the genomic layout and the obtained density profiles of single-nucleotide polymorphisms (SNPs) in sequence regions upstream of transcription start sites, the average length of promoter regions in Arabidopsis could be established at 500 bp. Genes associated with high degrees of variability of their respective upstream regions are preferentially involved in environmental response and signaling processes, while low levels of promoter SNP density are common among housekeeping genes. Known cis-elements were found to exhibit a decreased SNP density than sequence regions not associated with known motifs. For 15 known cis-element motifs, strong positional preferences relative to the transcription start site were detected based on their promoter SNP density profiles. Five novel candidate cis-element motifs were identified as consensus motifs of 17 sequence hexamers exhibiting increased sequence conservation combined with evidence of positional preferences, annotation information, and functional relevance for inducing correlated gene expression. Our study demonstrates that the currently available resolution of SNP data offers novel ways for the identification of functional genomic elements and the characterization of gene promoter sequences. PMID:24204023

  16. Identification and Characterization of a cis-Regulatory Element for Zygotic Gene Expression in Chlamydomonas reinhardtii.

    Science.gov (United States)

    Hamaji, Takashi; Lopez, David; Pellegrini, Matteo; Umen, James

    2016-01-01

    Upon fertilization Chlamydomonas reinhardtii zygotes undergo a program of differentiation into a diploid zygospore that is accompanied by transcription of hundreds of zygote-specific genes. We identified a distinct sequence motif we term a zygotic response element (ZYRE) that is highly enriched in promoter regions of C reinhardtii early zygotic genes. A luciferase reporter assay was used to show that native ZYRE motifs within the promoter of zygotic gene ZYS3 or intron of zygotic gene DMT4 are necessary for zygotic induction. A synthetic luciferase reporter with a minimal promoter was used to show that ZYRE motifs introduced upstream are sufficient to confer zygotic upregulation, and that ZYRE-controlled zygotic transcription is dependent on the homeodomain transcription factor GSP1. We predict that ZYRE motifs will correspond to binding sites for the homeodomain proteins GSP1-GSM1 that heterodimerize and activate zygotic gene expression in early zygotes. PMID:27172209

  17. RAR/RXR binding dynamics distinguish pluripotency from differentiation associated cis-regulatory elements.

    Science.gov (United States)

    Chatagnon, Amandine; Veber, Philippe; Morin, Valérie; Bedo, Justin; Triqueneaux, Gérard; Sémon, Marie; Laudet, Vincent; d'Alché-Buc, Florence; Benoit, Gérard

    2015-05-26

    In mouse embryonic cells, ligand-activated retinoic acid receptors (RARs) play a key role in inhibiting pluripotency-maintaining genes and activating some major actors of cell differentiation. To investigate the mechanism underlying this dual regulation, we performed joint RAR/RXR ChIP-seq and mRNA-seq time series during the first 48 h of the RA-induced Primitive Endoderm (PrE) differentiation process in F9 embryonal carcinoma (EC) cells. We show here that this dual regulation is associated with RAR/RXR genomic redistribution during the differentiation process. In-depth analysis of RAR/RXR binding sites occupancy dynamics and composition show that in undifferentiated cells, RAR/RXR interact with genomic regions characterized by binding of pluripotency-associated factors and high prevalence of the non-canonical DR0-containing RA response element. By contrast, in differentiated cells, RAR/RXR bound regions are enriched in functional Sox17 binding sites and are characterized with a higher frequency of the canonical DR5 motif. Our data offer an unprecedentedly detailed view on the action of RA in triggering pluripotent cell differentiation and demonstrate that RAR/RXR action is mediated via two different sets of regulatory regions tightly associated with cell differentiation status. PMID:25897113

  18. Nutritional control of gene expression in Drosophila larvae via TOR, Myc and a novel cis-regulatory element

    Directory of Open Access Journals (Sweden)

    Grewal Savraj S

    2010-01-01

    Full Text Available Abstract Background Nutrient availability is a key determinant of eukaryotic cell growth. In unicellular organisms many signaling and transcriptional networks link nutrient availability to the expression of metabolic genes required for growth. However, less is known about the corresponding mechanisms that operate in metazoans. We used gene expression profiling to explore this issue in developing Drosophila larvae. Results We found that starvation for dietary amino acids (AA's leads to dynamic changes in transcript levels of many metabolic genes. The conserved insulin/PI3K and TOR signaling pathways mediate nutrition-dependent growth in Drosophila and other animals. We found that many AA starvation-responsive transcripts were also altered in TOR mutants. In contrast, although PI3K overexpression induced robust changes in the expression of many metabolic genes, these changes showed limited overlap with the AA starvation expression profile. We did however identify a strong overlap between genes regulated by the transcription factor, Myc, and AA starvation-responsive genes, particularly those involved in ribosome biogenesis, protein synthesis and mitochondrial function. The consensus Myc DNA binding site is enriched in promoters of these AA starvation genes, and we found that Myc overexpression could bypass dietary AA to induce expression of these genes. We also identified another sequence motif (Motif 1 enriched in the promoters of AA starvation-responsive genes. We showed that Motif 1 was both necessary and sufficient to mediate transcriptional responses to dietary AA in larvae. Conclusions Our data suggest that many of the transcriptional effects of amino acids are mediated via signaling through the TOR pathway in Drosophila larvae. We also find that these transcriptional effects are mediated through at least two mechanisms: via the transcription factor Myc, and via the Motif 1 cis-regulatory element. These studies begin to elucidate a nutrient

  19. Shared Enhancer Activity in the Limbs and Phallus and Functional Divergence of a Limb-Genital cis-Regulatory Element in Snakes.

    Science.gov (United States)

    Infante, Carlos R; Mihala, Alexandra G; Park, Sungdae; Wang, Jialiang S; Johnson, Kenji K; Lauderdale, James D; Menke, Douglas B

    2015-10-12

    The amniote phallus and limbs differ dramatically in their morphologies but share patterns of signaling and gene expression in early development. Thus far, the extent to which genital and limb transcriptional networks also share cis-regulatory elements has remained unexplored. We show that many limb enhancers are retained in snake genomes, suggesting that these elements may function in non-limb tissues. Consistent with this, our analysis of cis-regulatory activity in mice and Anolis lizards reveals that patterns of enhancer activity in embryonic limbs and genitalia overlap heavily. In mice, deletion of HLEB, an enhancer of Tbx4, produces defects in hindlimbs and genitalia, establishing the importance of this limb-genital enhancer for development of these different appendages. Further analyses demonstrate that the HLEB of snakes has lost hindlimb enhancer function while retaining genital activity. Our findings identify roles for Tbx4 in genital development and highlight deep similarities in cis-regulatory activity between limbs and genitalia. PMID:26439399

  20. Decoding a signature-based model of transcription cofactor recruitment dictated by cardinal cis-regulatory elements in proximal promoter regions.

    Directory of Open Access Journals (Sweden)

    Christopher Benner

    2013-11-01

    Full Text Available Genome-wide maps of DNase I hypersensitive sites (DHSs reveal that most human promoters contain perpetually active cis-regulatory elements between -150 bp and +50 bp (-150/+50 bp relative to the transcription start site (TSS. Transcription factors (TFs recruit cofactors (chromatin remodelers, histone/protein-modifying enzymes, and scaffold proteins to these elements in order to organize the local chromatin structure and coordinate the balance of post-translational modifications nearby, contributing to the overall regulation of transcription. However, the rules of TF-mediated cofactor recruitment to the -150/+50 bp promoter regions remain poorly understood. Here, we provide evidence for a general model in which a series of cis-regulatory elements (here termed 'cardinal' motifs prefer acting individually, rather than in fixed combinations, within the -150/+50 bp regions to recruit TFs that dictate cofactor signatures distinctive of specific promoter subsets. Subsequently, human promoters can be subclassified based on the presence of cardinal elements and their associated cofactor signatures. In this study, furthermore, we have focused on promoters containing the nuclear respiratory factor 1 (NRF1 motif as the cardinal cis-regulatory element and have identified the pervasive association of NRF1 with the cofactor lysine-specific demethylase 1 (LSD1/KDM1A. This signature might be distinctive of promoters regulating nuclear-encoded mitochondrial and other particular genes in at least some cells. Together, we propose that decoding a signature-based, expanded model of control at proximal promoter regions should lead to a better understanding of coordinated regulation of gene transcription.

  1. The contribution of cis-regulatory elements to head-to-head gene pairs’ co-expression pattern

    Institute of Scientific and Technical Information of China (English)

    2009-01-01

    Transcription regulation is one of the most critical pipelines in biological process,in which cis-elements play the role as gene expression regulators.We attempt to deduce the principles underlying the co-expression of "head-to-head" gene pairs by analyzing activities or behaviors of the shared cis-elements.A network component analysis was performed to estimate the impact of cis-elements on gene promoters and their activities under different conditions.Our discoveries reveal how biological system uses those regulatory elements to control the expression pattern of "head-to-head" gene pairs and the whole transcription regulation system.

  2. Distinct cis regulatory elements govern the expression of TAG1 in embryonic sensory ganglia and spinal cord.

    Directory of Open Access Journals (Sweden)

    Yoav Hadas

    Full Text Available Cell fate commitment of spinal progenitor neurons is initiated by long-range, midline-derived, morphogens that regulate an array of transcription factors that, in turn, act sequentially or in parallel to control neuronal differentiation. Included among these are transcription factors that regulate the expression of receptors for guidance cues, thereby determining axonal trajectories. The Ig/FNIII superfamily molecules TAG1/Axonin1/CNTN2 (TAG1 and Neurofascin (Nfasc are co-expressed in numerous neuronal cell types in the CNS and PNS - for example motor, DRG and interneurons - both promote neurite outgrowth and both are required for the architecture and function of nodes of Ranvier. The genes encoding TAG1 and Nfasc are adjacent in the genome, an arrangement which is evolutionarily conserved. To study the transcriptional network that governs TAG1 and Nfasc expression in spinal motor and commissural neurons, we set out to identify cis elements that regulate their expression. Two evolutionarily conserved DNA modules, one located between the Nfasc and TAG1 genes and the second directly 5' to the first exon and encompassing the first intron of TAG1, were identified that direct complementary expression to the CNS and PNS, respectively, of the embryonic hindbrain and spinal cord. Sequential deletions and point mutations of the CNS enhancer element revealed a 130bp element containing three conserved E-boxes required for motor neuron expression. In combination, these two elements appear to recapitulate a major part of the pattern of TAG1 expression in the embryonic nervous system.

  3. PlantPAN: Plant promoter analysis navigator, for identifying combinatorial cis-regulatory elements with distance constraint in plant gene groups

    Directory of Open Access Journals (Sweden)

    Huang Hsien-Da

    2008-11-01

    Full Text Available Abstract Background The elucidation of transcriptional regulation in plant genes is important area of research for plant scientists, following the mapping of various plant genomes, such as A. thaliana, O. sativa and Z. mays. A variety of bioinformatic servers or databases of plant promoters have been established, although most have been focused only on annotating transcription factor binding sites in a single gene and have neglected some important regulatory elements (tandem repeats and CpG/CpNpG islands in promoter regions. Additionally, the combinatorial interaction of transcription factors (TFs is important in regulating the gene group that is associated with the same expression pattern. Therefore, a tool for detecting the co-regulation of transcription factors in a group of gene promoters is required. Results This study develops a database-assisted system, PlantPAN (Plant Promoter Analysis Navigator, for recognizing combinatorial cis-regulatory elements with a distance constraint in sets of plant genes. The system collects the plant transcription factor binding profiles from PLACE, TRANSFAC (public release 7.0, AGRIS, and JASPER databases and allows users to input a group of gene IDs or promoter sequences, enabling the co-occurrence of combinatorial transcription factor binding sites (TFBSs within a defined distance (20 bp to 200 bp to be identified. Furthermore, the new resource enables other regulatory features in a plant promoter, such as CpG/CpNpG islands and tandem repeats, to be displayed. The regulatory elements in the conserved regions of the promoters across homologous genes are detected and presented. Conclusion In addition to providing a user-friendly input/output interface, PlantPAN has numerous advantages in the analysis of a plant promoter. Several case studies have established the effectiveness of PlantPAN. This novel analytical resource is now freely available at http://PlantPAN.mbc.nctu.edu.tw.

  4. Tissue-specific expression of the human alpha 1-antitrypsin gene is controlled by multiple cis-regulatory elements.

    Science.gov (United States)

    Shen, R F; Li, Y; Sifers, R N; Wang, H; Hardick, C; Tsai, S Y; Woo, S L

    1987-10-26

    Human alpha 1-antitrypsin (AAT) is expressed in the liver, and a 318 bp fragment immediately flanking the CAP site of the gene was found to be sufficient to drive the expression of a reporter gene (CAT) specifically in hepatoma cells. The enhancing activity however, was orientation-dependent. The DNA fragment was separated into a distal region and a proximal region. A "core enhancer" sequence GTGGTTTC is present within the distal region and is capable of activity enhancement in both orientations when complemented by the proximal region in the sense orientation. The results strongly suggest that there are multiple cis-acting elements in the human AAT gene that confer cell specificity for its expression. Nuclear proteins prepared from the hepatoma cells bound specifically to the proximal region in a band-shifting assay that was resistant to competition by the globin promoter DNA. Foot-printing analysis showed a protected domain within the proximal region that contains a nearly perfect palindromic sequence TGGTTAATATTCACCA, which may be important in the regulation of AAT expression in the liver. PMID:2823229

  5. Identification of Predictive Cis-Regulatory Elements Using a Discriminative Objective Function and a Dynamic Search Space.

    Directory of Open Access Journals (Sweden)

    Rahul Karnik

    Full Text Available The generation of genomic binding or accessibility data from massively parallel sequencing technologies such as ChIP-seq and DNase-seq continues to accelerate. Yet state-of-the-art computational approaches for the identification of DNA binding motifs often yield motifs of weak predictive power. Here we present a novel computational algorithm called MotifSpec, designed to find predictive motifs, in contrast to over-represented sequence elements. The key distinguishing feature of this algorithm is that it uses a dynamic search space and a learned threshold to find discriminative motifs in combination with the modeling of motifs using a full PWM (position weight matrix rather than k-mer words or regular expressions. We demonstrate that our approach finds motifs corresponding to known binding specificities in several mammalian ChIP-seq datasets, and that our PWMs classify the ChIP-seq signals with accuracy comparable to, or marginally better than motifs from the best existing algorithms. In other datasets, our algorithm identifies novel motifs where other methods fail. Finally, we apply this algorithm to detect motifs from expression datasets in C. elegans using a dynamic expression similarity metric rather than fixed expression clusters, and find novel predictive motifs.

  6. Cis-Regulatory Elements Determine Germline Specificity and Expression Level of an Isopentenyltransferase Gene in Sperm Cells of Arabidopsis.

    Science.gov (United States)

    Zhang, Jinghua; Yuan, Tong; Duan, Xiaomeng; Wei, Xiaoping; Shi, Tao; Li, Jia; Russell, Scott D; Gou, Xiaoping

    2016-03-01

    Flowering plant sperm cells transcribe a divergent and complex complement of genes. To examine promoter function, we chose an isopentenyltransferase gene known as PzIPT1. This gene is highly selectively transcribed in one sperm cell morphotype of Plumbago zeylanica, which preferentially fuses with the central cell during fertilization and is thus a founding cell of the primary endosperm. In transgenic Arabidopsis (Arabidopsis thaliana), PzIPT1 promoter displays activity in both sperm cells and upon progressive promoter truncation from the 5'-end results in a progressive decrease in reporter production, consistent with occurrence of multiple enhancer sites. Cytokinin-dependent protein binding motifs are identified in the promoter sequence, which respond with stimulation by cytokinin. Expression of PzIPT1 promoter in sperm cells confers specificity independently of previously reported Germline Restrictive Silencer Factor binding sequence. Instead, a cis-acting regulatory region consisting of two duplicated 6-bp Male Gamete Selective Activation (MGSA) motifs occurs near the site of transcription initiation. Disruption of this sequence-specific site inactivates expression of a GFP reporter gene in sperm cells. Multiple copies of the MGSA motif fused with the minimal CaMV35S promoter elements confer reporter gene expression in sperm cells. Similar duplicated MGSA motifs are also identified from promoter sequences of sperm cell-expressed genes in Arabidopsis, suggesting selective activation is possibly a common mechanism for regulation of gene expression in sperm cells of flowering plants. PMID:26739233

  7. Combining computational prediction of cis-regulatory elements with a new enhancer assay to efficiently label neuronal structures in the medaka fish.

    Directory of Open Access Journals (Sweden)

    Emmanuel Mongin

    Full Text Available The developing vertebrate nervous system contains a remarkable array of neural cells organized into complex, evolutionarily conserved structures. The labeling of living cells in these structures is key for the understanding of brain development and function, yet the generation of stable lines expressing reporter genes in specific spatio-temporal patterns remains a limiting step. In this study we present a fast and reliable pipeline to efficiently generate a set of stable lines expressing a reporter gene in multiple neuronal structures in the developing nervous system in medaka. The pipeline combines both the accurate computational genome-wide prediction of neuronal specific cis-regulatory modules (CRMs and a newly developed experimental setup to rapidly obtain transgenic lines in a cost-effective and highly reproducible manner. 95% of the CRMs tested in our experimental setup show enhancer activity in various and numerous neuronal structures belonging to all major brain subdivisions. This pipeline represents a significant step towards the dissection of embryonic neuronal development in vertebrates.

  8. Parallel Evolution of Chordate Cis-Regulatory Code for Development

    OpenAIRE

    Doglio, Laura; Goode, Debbie K.; Maria C. Pelleri; Pauls, Stefan; Frabetti, Flavia; Shimeld, Sebastian M; Vavouri, Tanya; Elgar, Greg

    2013-01-01

    Urochordates are the closest relatives of vertebrates and at the larval stage, possess a characteristic bilateral chordate body plan. In vertebrates, the genes that orchestrate embryonic patterning are in part regulated by highly conserved non-coding elements (CNEs), yet these elements have not been identified in urochordate genomes. Consequently the evolution of the cis-regulatory code for urochordate development remains largely uncharacterised. Here, we use genome-wide comparisons between C...

  9. The search for cis-regulatory driver mutations in cancer genomes

    OpenAIRE

    Poulos, Rebecca C.; Sloane, Mathew A; Hesson, Luke B; Wong, Jason W. H.

    2015-01-01

    With the advent of high-throughput and relatively inexpensive whole-genome sequencing technology, the focus of cancer research has begun to shift toward analyses of somatic mutations in non-coding cis-regulatory elements of the cancer genome. Cis-regulatory elements play an important role in gene regulation, with mutations in these elements potentially resulting in changes to the expression of linked genes. The recent discoveries of recurrent TERT promoter mutations in melanoma, and recurrent...

  10. Twine: display and analysis of cis-regulatory modules

    OpenAIRE

    Pearson, Joseph C.; Crews, Stephen T.

    2013-01-01

    Summary: Many algorithms analyze enhancers for overrepresentation of known and novel motifs, with the goal of identifying binding sites for direct regulators of gene expression. Twine is a Java GUI with multiple graphical representations (‘Views’) of enhancer alignments that displays motifs, as IUPAC consensus sequences or position frequency matrices, in the context of phylogenetic conservation to facilitate cis-regulatory element discovery. Thresholds of phylogenetic conservation and motif s...

  11. CREME: Cis-Regulatory Module Explorer for the Human Genome

    Energy Technology Data Exchange (ETDEWEB)

    Loots, G G; Sharan, R; Ovcharenko, I; Ben-Hur, A

    2004-02-11

    The binding of transcription factors to specific regulatory sequence elements is a primary mechanism for controlling gene transcription. Eukaryotic genes are often regulated by several transcription factors, whose binding sites are tightly clustered and form cis-regulatory modules. In this paper we present a web-server, CREME, for identifying and visualizing cis-regulatory modules in the promoter regions of a given set of potentially co-regulated genes. CREME relies on a database of putative transcription factor binding sites that have been annotated across the human genome using a library of position weight matrices and evolutionary conservation with the mouse and rat genomes. A search algorithm is applied to this dataset to identify combinations of transcription factors whose binding sites tend to co-occur in close proximity in the promoter regions of the input gene set. The identified cis-regulatory modules are statistically scored and significant combinations are reported and graphically visualized. Our web-server is available at http://creme.dcode.org/.

  12. Theria-specific homeodomain and cis-regulatory element evolution of the Dlx3-4 bigene cluster in 12 different mammalian species.

    Science.gov (United States)

    Sumiyama, Kenta; Miyake, Tsutomu; Grimwood, Jane; Stuart, Andrew; Dickson, Mark; Schmutz, Jeremy; Ruddle, Frank H; Myers, Richard M; Amemiya, Chris T

    2012-12-01

    The mammalian Dlx3 and Dlx4 genes are configured as a bigene cluster, and their respective expression patterns are controlled temporally and spatially by cis-elements that largely reside within the intergenic region of the cluster. Previous work revealed that there are conspicuously conserved elements within the intergenic region of the Dlx3-4 bigene clusters of mouse and human. In this paper we have extended these analyses to include 12 additional mammalian taxa (including a marsupial and a monotreme) in order to better define the nature and molecular evolutionary trends of the coding and non-coding functional elements among morphologically divergent mammals. Dlx3-4 regions were fully sequenced from 12 divergent taxa of interest. We identified three theria-specific amino acid replacements in homeodomain of Dlx4 gene that functions in placenta. Sequence analyses of constrained nucleotide sites in the intergenic non-coding region showed that many of the intergenic conserved elements are highly conserved and have evolved slowly within the mammals. In contrast, a branchial arch/craniofacial enhancer I37-2 exhibited accelerated evolution at the branch between the monotreme and therian common ancestor despite being highly conserved among therian species. Functional analysis of I37-2 in transgenic mice has shown that the equivalent region of the platypus fails to drive transcriptional activity in branchial arches. These observations, taken together with our molecular evolutionary data, suggest that theria-specific episodic changes in the I37-2 element may have contributed to craniofacial innovation at the base of the mammalian lineage. PMID:22951979

  13. The search for cis-regulatory driver mutations in cancer genomes.

    Science.gov (United States)

    Poulos, Rebecca C; Sloane, Mathew A; Hesson, Luke B; Wong, Jason W H

    2015-10-20

    With the advent of high-throughput and relatively inexpensive whole-genome sequencing technology, the focus of cancer research has begun to shift toward analyses of somatic mutations in non-coding cis-regulatory elements of the cancer genome. Cis-regulatory elements play an important role in gene regulation, with mutations in these elements potentially resulting in changes to the expression of linked genes. The recent discoveries of recurrent TERT promoter mutations in melanoma, and recurrent mutations that create a super-enhancer regulating TAL1 expression in T-cell acute lymphoblastic leukaemia (T-ALL), have sparked significant interest in the search for other somatic cis-regulatory mutations driving cancer development. In this review, we look more closely at the TERT promoter and TAL1 enhancer alterations and use these examples to ask whether other cis-regulatory mutations may play a role in cancer susceptibility. In doing so, we make observations from the data emerging from recent research in this field, and describe the experimental and analytical approaches which could be adopted in the hope of better uncovering the true functional significance of somatic cis-regulatory mutations in cancer. PMID:26356674

  14. Abundant raw material for cis-regulatory evolution in humans

    Science.gov (United States)

    Rockman, Matthew V.; Wray, Gregory A.

    2002-01-01

    Changes in gene expression and regulation--due in particular to the evolution of cis-regulatory DNA sequences--may underlie many evolutionary changes in phenotypes, yet little is known about the distribution of such variation in populations. We present in this study the first survey of experimentally validated functional cis-regulatory polymorphism. These data are derived from more than 140 polymorphisms involved in the regulation of 107 genes in Homo sapiens, the eukaryote species with the most available data. We find that functional cis-regulatory variation is widespread in the human genome and that the consequent variation in gene expression is twofold or greater for 63% of the genes surveyed. Transcription factor-DNA interactions are highly polymorphic, and regulatory interactions have been gained and lost within human populations. On average, humans are heterozygous at more functional cis-regulatory sites (>16,000) than at amino acid positions (human phenotypic variation.

  15. Using hexamers to predict cis-regulatory motifs in Drosophila

    Directory of Open Access Journals (Sweden)

    Kibler Dennis

    2005-10-01

    Full Text Available Abstract Background Cis-regulatory modules (CRMs are short stretches of DNA that help regulate gene expression in higher eukaryotes. They have been found up to 1 megabase away from the genes they regulate and can be located upstream, downstream, and even within their target genes. Due to the difficulty of finding CRMs using biological and computational techniques, even well-studied regulatory systems may contain CRMs that have not yet been discovered. Results We present a simple, efficient method (HexDiff based only on hexamer frequencies of known CRMs and non-CRM sequence to predict novel CRMs in regulatory systems. On a data set of 16 gap and pair-rule genes containing 52 known CRMs, predictions made by HexDiff had a higher correlation with the known CRMs than several existing CRM prediction algorithms: Ahab, Cluster Buster, MSCAN, MCAST, and LWF. After combining the results of the different algorithms, 10 putative CRMs were identified and are strong candidates for future study. The hexamers used by HexDiff to distinguish between CRMs and non-CRM sequence were also analyzed and were shown to be enriched in regulatory elements. Conclusion HexDiff provides an efficient and effective means for finding new CRMs based on known CRMs, rather than known binding sites.

  16. Deciphering cis-regulatory control in inflammatory cells.

    Science.gov (United States)

    Ghisletti, Serena; Natoli, Gioacchino

    2013-01-01

    In innate immune system cells, such as macrophages and dendritic cells, deployment of inducible gene expression programmes in response to microbes and danger signals requires highly precise regulatory mechanisms. The inflammatory response has to be tailored based on both the triggering stimulus and its dose, and it has to be unfolded in a kinetically complex manner that suits the different phases of the inflammatory process. Genomic characterization of regulatory elements in this context indicated that transcriptional regulators involved in macrophage specification act as pioneer transcription factors (TFs) that generate regions of open chromatin that enable the recruitment of TFs activated in response to external inputs. Therefore, competence for responses to a specific stimulus is programmed at an early stage of differentiation by factors involved in lineage commitment and maintenance of cell identity, which are responsible for the organization of a cell-type-specific cis-regulatory repertoire. The basic functional and organizational principles that regulate inflammatory gene expression in professional cells of the innate immune system provide general paradigms on the interplay between differentiation and environmental responses. PMID:23650641

  17. cis-Regulatory control of the initial neurogenic pattern of onecut gene expression in the sea urchin embryo.

    Science.gov (United States)

    Barsi, Julius C; Davidson, Eric H

    2016-01-01

    Specification of the ciliated band (CB) of echinoid embryos executes three spatial functions essential for postgastrular organization. These are establishment of a band about 5 cells wide which delimits and bounds other embryonic territories; definition of a neurogenic domain within this band; and generation within it of arrays of ciliary cells that bear the special long cilia from which the structure derives its name. In Strongylocentrotus purpuratus the spatial coordinates of the future ciliated band are initially and exactly determined by the disposition of a ring of cells that transcriptionally activate the onecut homeodomain regulatory gene, beginning in blastula stage, long before the appearance of the CB per se. Thus the cis-regulatory apparatus that governs onecut expression in the blastula directly reveals the genomic sequence code by which these aspects of the spatial organization of the embryo are initially determined. We screened the entire onecut locus and its flanking region for transcriptionally active cis-regulatory elements, and by means of BAC recombineered deletions identified three separated and required cis-regulatory modules that execute different functions. The operating logic of the crucial spatial control module accounting for the spectacularly precise and beautiful early onecut expression domain depends on spatial repression. Previously predicted oral ectoderm and aboral ectoderm repressors were identified by cis-regulatory mutation as the products of goosecoid and irxa genes respectively, while the pan-ectodermal activator SoxB1 supplies a transcriptional driver function. PMID:26522848

  18. Evolutionarily Assembled cis-Regulatory Module at a Human Ciliopathy Locus

    Science.gov (United States)

    Lee, Jeong Ho; Silhavy, Jennifer L.; Lee, Ji Eun; Al-Gazali, Lihadh; Thomas, Sophie; Davis, Erica E.; Bielas, Stephanie L.; Hill, Kiley J.; Iannicelli, Miriam; Brancati, Francesco; Gabriel, Stacey B.; Russ, Carsten; Logan, Clare V.; Sharif, Saghira Malik; Bennett, Christopher P.; Abe, Masumi; Hildebrandt, Friedhelm; Diplas, Bill H.; Attié-Bitach, Tania; Katsanis, Nicholas; Rajab, Anna; Koul, Roshan; Sztriha, Laszlo; Waters, Elizabeth R.; Ferro-Novick, Susan; Woods, C. Geoffrey; Johnson, Colin A.; Valente, Enza Maria; Zaki, Maha S.; Gleeson, Joseph G.

    2013-01-01

    Neighboring genes are often coordinately expressed within cis-regulatory modules, but evidence that nonparalogous genes share functions in mammals is lacking. Here, we report that mutation of either TMEM138 or TMEM216 causes a phenotypically indistinguishable human ciliopathy, Joubert syndrome. Despite a lack of sequence homology, the genes are aligned in a head-to-tail configuration and joined by chromosomal rearrangement at the amphibian-to-reptile evolutionary transition. Expression of the two genes is mediated by a conserved regulatory element in the noncoding intergenic region. Coordinated expression is important for their interdependent cellular role in vesicular transport to primary cilia. Hence, during vertebrate evolution of genes involved in ciliogenesis, nonparalogous genes were arranged to a functional gene cluster with shared regulatory elements. PMID:22282472

  19. A primer on regression methods for decoding cis-regulatory logic

    Energy Technology Data Exchange (ETDEWEB)

    Das, Debopriya; Pellegrini, Matteo; Gray, Joe W.

    2009-03-03

    The rapidly emerging field of systems biology is helping us to understand the molecular determinants of phenotype on a genomic scale [1]. Cis-regulatory elements are major sequence-based determinants of biological processes in cells and tissues [2]. For instance, during transcriptional regulation, transcription factors (TFs) bind to very specific regions on the promoter DNA [2,3] and recruit the basal transcriptional machinery, which ultimately initiates mRNA transcription (Figure 1A). Learning cis-Regulatory Elements from Omics Data A vast amount of work over the past decade has shown that omics data can be used to learn cis-regulatory logic on a genome-wide scale [4-6]--in particular, by integrating sequence data with mRNA expression profiles. The most popular approach has been to identify over-represented motifs in promoters of genes that are coexpressed [4,7,8]. Though widely used, such an approach can be limiting for a variety of reasons. First, the combinatorial nature of gene regulation is difficult to explicitly model in this framework. Moreover, in many applications of this approach, expression data from multiple conditions are necessary to obtain reliable predictions. This can potentially limit the use of this method to only large data sets [9]. Although these methods can be adapted to analyze mRNA expression data from a pair of biological conditions, such comparisons are often confounded by the fact that primary and secondary response genes are clustered together--whereas only the primary response genes are expected to contain the functional motifs [10]. A set of approaches based on regression has been developed to overcome the above limitations [11-32]. These approaches have their foundations in certain biophysical aspects of gene regulation [26,33-35]. That is, the models are motivated by the expected transcriptional response of genes due to the binding of TFs to their promoters. While such methods have gathered popularity in the computational domain

  20. Cis-regulatory architecture of a brain signaling center predates the origin of chordates.

    Science.gov (United States)

    Yao, Yao; Minor, Paul J; Zhao, Ying-Tao; Jeong, Yongsu; Pani, Ariel M; King, Anna N; Symmons, Orsolya; Gan, Lin; Cardoso, Wellington V; Spitz, François; Lowe, Christopher J; Epstein, Douglas J

    2016-05-01

    Genomic approaches have predicted hundreds of thousands of tissue-specific cis-regulatory sequences, but the determinants critical to their function and evolutionary history are mostly unknown. Here we systematically decode a set of brain enhancers active in the zona limitans intrathalamica (zli), a signaling center essential for vertebrate forebrain development via the secreted morphogen Sonic hedgehog (Shh). We apply a de novo motif analysis tool to identify six position-independent sequence motifs together with their cognate transcription factors that are essential for zli enhancer activity and Shh expression in the mouse embryo. Using knowledge of this regulatory lexicon, we discover new Shh zli enhancers in mice and a functionally equivalent element in hemichordates, indicating an ancient origin of the Shh zli regulatory network that predates the chordate phylum. These findings support a strategy for delineating functionally conserved enhancers in the absence of overt sequence homologies and over extensive evolutionary distances. PMID:27064252

  1. Discovering cis-regulatory RNAs in Shewanella genomes by Support Vector Machines.

    Science.gov (United States)

    Xu, Xing; Ji, Yongmei; Stormo, Gary D

    2009-04-01

    An increasing number of cis-regulatory RNA elements have been found to regulate gene expression post-transcriptionally in various biological processes in bacterial systems. Effective computational tools for large-scale identification of novel regulatory RNAs are strongly desired to facilitate our exploration of gene regulation mechanisms and regulatory networks. We present a new computational program named RSSVM (RNA Sampler+Support Vector Machine), which employs Support Vector Machines (SVMs) for efficient identification of functional RNA motifs from random RNA secondary structures. RSSVM uses a set of distinctive features to represent the common RNA secondary structure and structural alignment predicted by RNA Sampler, a tool for accurate common RNA secondary structure prediction, and is trained with functional RNAs from a variety of bacterial RNA motif/gene families covering a wide range of sequence identities. When tested on a large number of known and random RNA motifs, RSSVM shows a significantly higher sensitivity than other leading RNA identification programs while maintaining the same false positive rate. RSSVM performs particularly well on sets with low sequence identities. The combination of RNA Sampler and RSSVM provides a new, fast, and efficient pipeline for large-scale discovery of regulatory RNA motifs. We applied RSSVM to multiple Shewanella genomes and identified putative regulatory RNA motifs in the 5' untranslated regions (UTRs) in S. oneidensis, an important bacterial organism with extraordinary respiratory and metal reducing abilities and great potential for bioremediation and alternative energy generation. From 1002 sets of 5'-UTRs of orthologous operons, we identified 166 putative regulatory RNA motifs, including 17 of the 19 known RNA motifs from Rfam, an additional 21 RNA motifs that are supported by literature evidence, 72 RNA motifs overlapping predicted transcription terminators or attenuators, and other candidate regulatory RNA motifs

  2. Detailed map of a cis-regulatory input function

    Science.gov (United States)

    Setty, Y.; Mayo, A. E.; Surette, M. G.; Alon, U.

    2003-06-01

    Most genes are regulated by multiple transcription factors that bind specific sites in DNA regulatory regions. These cis-regulatory regions perform a computation: the rate of transcription is a function of the active concentrations of each of the input transcription factors. Here, we used accurate gene expression measurements from living cell cultures, bearing GFP reporters, to map in detail the input function of the classic lacZYA operon of Escherichia coli, as a function of about a hundred combinations of its two inducers, cAMP and isopropyl -D-thiogalactoside (IPTG). We found an unexpectedly intricate function with four plateau levels and four thresholds. This result compares well with a mathematical model of the binding of the regulatory proteins cAMP receptor protein (CRP) and LacI to the lac regulatory region. The model is also used to demonstrate that with few mutations, the same region could encode much purer AND-like or even OR-like functions. This possibility means that the wild-type region is selected to perform an elaborate computation in setting the transcription rate. The present approach can be generally used to map the input functions of other genes.

  3. Computational methods for the detection of cis-regulatory modules.

    Science.gov (United States)

    Van Loo, Peter; Marynen, Peter

    2009-09-01

    Metazoan transcription regulation occurs through the concerted action of multiple transcription factors that bind co-operatively to cis-regulatory modules (CRMs). The annotation of these key regulators of transcription is lagging far behind the annotation of the transcriptome itself. Here, we give an overview of existing computational methods to detect these CRMs in metazoan genomes. We subdivide these methods into three classes: CRM scanners screen sequences for CRMs based on predefined models that often consist of multiple position weight matrices (PWMs). CRM builders construct models of similar CRMs controlling a set of co-regulated or co-expressed genes. CRM genome screeners screen sequences or complete genomes for CRMs as homotypic or heterotypic clusters of binding sites for any combination of transcription factors. We believe that CRM scanners are currently the most advanced methods, although their applicability is limited. Finally, we argue that CRM builders that make use of PWM libraries will benefit greatly from future advances and will prove to be most instrumental for the annotation of regulatory regions in metazoan genomes. PMID:19498042

  4. Brachyury, Foxa2 and the cis-Regulatory Origins of the Notochord.

    Directory of Open Access Journals (Sweden)

    Diana S José-Edwards

    2015-12-01

    Full Text Available A main challenge of modern biology is to understand how specific constellations of genes are activated to differentiate cells and give rise to distinct tissues. This study focuses on elucidating how gene expression is initiated in the notochord, an axial structure that provides support and patterning signals to embryos of humans and all other chordates. Although numerous notochord genes have been identified, the regulatory DNAs that orchestrate development and propel evolution of this structure by eliciting notochord gene expression remain mostly uncharted, and the information on their configuration and recurrence is still quite fragmentary. Here we used the simple chordate Ciona for a systematic analysis of notochord cis-regulatory modules (CRMs, and investigated their composition, architectural constraints, predictive ability and evolutionary conservation. We found that most Ciona notochord CRMs relied upon variable combinations of binding sites for the transcription factors Brachyury and/or Foxa2, which can act either synergistically or independently from one another. Notably, one of these CRMs contains a Brachyury binding site juxtaposed to an (AC microsatellite, an unusual arrangement also found in Brachyury-bound regulatory regions in mouse. In contrast, different subsets of CRMs relied upon binding sites for transcription factors of widely diverse families. Surprisingly, we found that neither intra-genomic nor interspecific conservation of binding sites were reliably predictive hallmarks of notochord CRMs. We propose that rather than obeying a rigid sequence-based cis-regulatory code, most notochord CRMs are rather unique. Yet, this study uncovered essential elements recurrently used by divergent chordates as basic building blocks for notochord CRMs.

  5. Brachyury, Foxa2 and the cis-Regulatory Origins of the Notochord.

    Science.gov (United States)

    José-Edwards, Diana S; Oda-Ishii, Izumi; Kugler, Jamie E; Passamaneck, Yale J; Katikala, Lavanya; Nibu, Yutaka; Di Gregorio, Anna

    2015-12-01

    A main challenge of modern biology is to understand how specific constellations of genes are activated to differentiate cells and give rise to distinct tissues. This study focuses on elucidating how gene expression is initiated in the notochord, an axial structure that provides support and patterning signals to embryos of humans and all other chordates. Although numerous notochord genes have been identified, the regulatory DNAs that orchestrate development and propel evolution of this structure by eliciting notochord gene expression remain mostly uncharted, and the information on their configuration and recurrence is still quite fragmentary. Here we used the simple chordate Ciona for a systematic analysis of notochord cis-regulatory modules (CRMs), and investigated their composition, architectural constraints, predictive ability and evolutionary conservation. We found that most Ciona notochord CRMs relied upon variable combinations of binding sites for the transcription factors Brachyury and/or Foxa2, which can act either synergistically or independently from one another. Notably, one of these CRMs contains a Brachyury binding site juxtaposed to an (AC) microsatellite, an unusual arrangement also found in Brachyury-bound regulatory regions in mouse. In contrast, different subsets of CRMs relied upon binding sites for transcription factors of widely diverse families. Surprisingly, we found that neither intra-genomic nor interspecific conservation of binding sites were reliably predictive hallmarks of notochord CRMs. We propose that rather than obeying a rigid sequence-based cis-regulatory code, most notochord CRMs are rather unique. Yet, this study uncovered essential elements recurrently used by divergent chordates as basic building blocks for notochord CRMs. PMID:26684323

  6. ChIP-Seq-Annotated Heliconius erato Genome Highlights Patterns of cis-Regulatory Evolution in Lepidoptera.

    Science.gov (United States)

    Lewis, James J; van der Burg, Karin R L; Mazo-Vargas, Anyi; Reed, Robert D

    2016-09-13

    Uncovering phylogenetic patterns of cis-regulatory evolution remains a fundamental goal for evolutionary and developmental biology. Here, we characterize the evolution of regulatory loci in butterflies and moths using chromatin immunoprecipitation sequencing (ChIP-seq) annotation of regulatory elements across three stages of head development. In the process we provide a high-quality, functionally annotated genome assembly for the butterfly, Heliconius erato. Comparing cis-regulatory element conservation across six lepidopteran genomes, we find that regulatory sequences evolve at a pace similar to that of protein-coding regions. We also observe that elements active at multiple developmental stages are markedly more conserved than elements with stage-specific activity. Surprisingly, we also find that stage-specific proximal and distal regulatory elements evolve at nearly identical rates. Our study provides a benchmark for genome-wide patterns of regulatory element evolution in insects, and it shows that developmental timing of activity strongly predicts patterns of regulatory sequence evolution. PMID:27626657

  7. The Hematopoietic Stem and Progenitor Cell Cistrome: GATA Factor-Dependent cis-Regulatory Mechanisms.

    Science.gov (United States)

    Hewitt, K J; Johnson, K D; Gao, X; Keles, S; Bresnick, E H

    2016-01-01

    Transcriptional regulators mediate the genesis and function of the hematopoietic system by binding complex ensembles of cis-regulatory elements to establish genetic networks. While thousands to millions of any given cis-element resides in a genome, how transcriptional regulators select these sites and how site attributes dictate functional output is not well understood. An instructive system to address this problem involves the GATA family of transcription factors that control vital developmental and physiological processes and are linked to multiple human pathologies. Although GATA factors bind DNA motifs harboring the sequence GATA, only a very small subset of these abundant motifs are occupied in genomes. Mechanistic studies revealed a unique configuration of a GATA factor-regulated cis-element consisting of an E-box and a downstream GATA motif separated by a short DNA spacer. GATA-1- or GATA-2-containing multiprotein complexes at these composite elements control transcription of genes critical for hematopoietic stem cell emergence in the mammalian embryo, hematopoietic progenitor cell regulation, and erythroid cell maturation. Other constituents of the complex include the basic helix-loop-loop transcription factor Scl/TAL1, its heterodimeric partner E2A, and the Lim domain proteins LMO2 and LDB1. This chapter reviews the structure/function of E-box-GATA composite cis-elements, which collectively constitute an important sector of the hematopoietic stem and progenitor cell cistrome. PMID:27137654

  8. Cis-regulatory Evolution of Chalcone-Synthase Expression in the Genus Arabidopsis

    OpenAIRE

    de Meaux, J. (Juliette); Pop, A.(National Institute for Physics and Nuclear Engineering, Bucharest, Romania); Mitchell-Olds, T.

    2006-01-01

    The contribution of cis-regulation to adaptive evolutionary change is believed to be essential, yet little is known about the evolutionary rules that govern regulatory sequences. Here, we characterize the short-term evolutionary dynamics of a cis-regulatory region within and among two closely related species, A. lyrata and A. halleri, and compare our findings to A. thaliana. We focused on the cis-regulatory region of chalcone synthase (CHS), a key enzyme involved in the synthesis of plant sec...

  9. Conserved cis-regulatory modules in promoters of genes encoding wheat high-molecular-weight glutenin subunits

    Directory of Open Access Journals (Sweden)

    Catherine eRAVEL

    2014-11-01

    Full Text Available The concentration and composition of the gliadin and glutenin seed storage proteins (SSPs in wheat flour are the most important determinants of its end-use value. In cereals, the synthesis of SSPs is predominantly regulated at the transcriptional level by a complex network involving at least five cis-elements in gene promoters. The high-molecular-weight glutenin subunits (HMW-GS are encoded by two tightly linked genes located on the long arms of group 1 chromosomes. Here, we sequenced and annotated the HMW-GS gene promoters of 22 electrophoretic wheat alleles to identify putative cis-regulatory motifs. We focused on 24 motifs known to be involved in SSP gene regulation. Most of them were identified in at least one HMW-GS gene promoter sequence. A common regulatory framework was observed in all the HMW-GS gene promoters, as they shared conserved cis-regulatory modules including all the five motifs known to regulate the transcription of SSP genes. This common regulatory framework comprises a composite box made of the GATA motifs and GCN4-like Motifs (GLMs and was shown to be functional as the GLMs are able to bind a bZIP transcriptional factor SPA (Storage Protein Activator. In addition to this regulatory framework, each HMW-GS gene promoter had additional motifs organized differently. The promoters of most highly expressed x-type HMW-GS genes contain an additional box predicted to bind R2R3-MYB transcriptional factors. However, the differences in annotation between promoter alleles could not be related to their level of expression. In summary, we identified a common modular organization of HMW-GS gene promoters but the lack of correlation between the cis-motifs of each HMW-GS gene promoter and their level of expression suggests that other cis-elements or other mechanisms regulate HMW-GS gene expression.

  10. Deciphering cis-regulatory control in inflammatory cells

    OpenAIRE

    Ghisletti, Serena; Natoli, Gioacchino

    2013-01-01

    In innate immune system cells, such as macrophages and dendritic cells, deployment of inducible gene expression programmes in response to microbes and danger signals requires highly precise regulatory mechanisms. The inflammatory response has to be tailored based on both the triggering stimulus and its dose, and it has to be unfolded in a kinetically complex manner that suits the different phases of the inflammatory process. Genomic characterization of regulatory elements in this context indi...

  11. MotifCombinator: a web-based tool to search for combinations of cis-regulatory motifs

    Directory of Open Access Journals (Sweden)

    Tsunoda Tatsuhiko

    2007-03-01

    Full Text Available Abstract Background A combination of multiple types of transcription factors and cis-regulatory elements is often required for gene expression in eukaryotes, and the combinatorial regulation confers specific gene expression to tissues or environments. To reveal the combinatorial regulation, computational methods are developed that efficiently infer combinations of cis-regulatory motifs that are important for gene expression as measured by DNA microarrays. One promising type of computational method is to utilize regression analysis between expression levels and scores of motifs in input sequences. This type takes full advantage of information on expression levels because it does not require that the expression level of each gene be dichotomized according to whether or not it reaches a certain threshold level. However, there is no web-based tool that employs regression methods to systematically search for motif combinations and that practically handles combinations of more than two or three motifs. Results We here introduced MotifCombinator, an online tool with a user-friendly interface, to systematically search for combinations composed of any number of motifs based on regression methods. The tool utilizes well-known regression methods (the multivariate linear regression, the multivariate adaptive regression spline or MARS, and the multivariate logistic regression method for this purpose, and uses the genetic algorithm to search for combinations composed of any desired number of motifs. The visualization systems in this tool help users to intuitively grasp the process of the combination search, and the backup system allows users to easily stop and restart calculations that are expected to require large computational time. This tool also provides preparatory steps needed for systematic combination search – i.e., selecting single motifs to constitute combinations and cutting out redundant similar motifs based on clustering analysis. Conclusion

  12. cis-Regulatory and Protein Evolution in Orthologous and Duplicate Genes

    OpenAIRE

    Castillo-Davis, Cristian I.; Hartl, Daniel L.; Achaz, Guillaume

    2004-01-01

    The relationship between protein and regulatory sequence evolution is a central question in molecular evolution. It is currently not known to what extent changes in gene expression are coupled with the evolution of protein coding sequences, or whether these changes differ among orthologs (species homologs) and paralogs (duplicate genes). Here, we develop a method to measure the extent of functionally relevant cis-regulatory sequence change in homologous genes, and validate it using microarray...

  13. Genome-wide de novo prediction of cis-regulatory binding sites in prokaryotes

    OpenAIRE

    Zhang, Shaoqiang; Xu, Minli; Li, Shan; Su, Zhengchang

    2009-01-01

    Although cis-regulatory binding sites (CRBSs) are at least as important as the coding sequences in a genome, our general understanding of them in most sequenced genomes is very limited due to the lack of efficient and accurate experimental and computational methods for their characterization, which has largely hindered our understanding of many important biological processes. In this article, we describe a novel algorithm for genome-wide de novo prediction of CRBSs with high accuracy. We desi...

  14. Computational and molecular dissection of an X-box cis-Regulatory module

    OpenAIRE

    Warrington, Timothy Burton

    2015-01-01

    Ciliopathies are a class of human diseases marked by dysfunction of the cellular organelle, cilia. While many of the molecular components that make up cilia have been identified and studied, comparatively little is understood about the transcriptional regulation of genes encoding these components. The conserved transcription factor Regulatory Factor X (RFX)/DAF-19, which acts through binding to the cis-regulatory motif known as X-box, has been shown to regulate ciliary genes in many animals f...

  15. Studying the functional conservation of cis-regulatory modules and their transcriptional output

    OpenAIRE

    Bailey Timothy L; Bauer Denis C

    2008-01-01

    Abstract Background Cis-regulatory modules (CRMs) are distinct, genomic regions surrounding the target gene that can independently activate the promoter to drive transcription. The activation of a CRM is controlled by the binding of a certain combination of transcription factors (TFs). It would be of great benefit if the transcriptional output mediated by a specific CRM could be predicted. Of equal benefit would be identifying in silico a specific CRM as the driver of the expression in a spec...

  16. Conservation of shh cis-regulatory architecture of the coelacanth is consistent with its ancestral phylogenetic position

    Directory of Open Access Journals (Sweden)

    Lang Michael

    2010-11-01

    Full Text Available Abstract Background The modern coelacanth (Latimeria is the extant taxon of a basal sarcopterygian lineage and sister group to tetrapods. Apart from certain apomorphic traits, its morphology is characterized by a high degree of retention of ancestral vertebrate structures and little morphological change. An insight into the molecular evolution that may explain the unchanged character of Latimeria morphology requires the analysis of the expression patterns of developmental regulator genes and their cis-regulatory modules (CRMs. Results We describe the comparative and functional analysis of the sonic hedgehog (shh genomic region of Latimeria menadoensis. Several putative enhancers in the Latimeria shh locus have been identified by comparisons to sarcopterygian and actinopterygian extant species. Specific sequence conservation with all known actinopterygian enhancer elements has been detected. However, these elements are selectively missing in more recently diverged actinopterygian and sarcopterygian species. The functionality of the putative Latimeria enhancers was confirmed by reporter gene expression analysis in transient transgenic zebrafish and chick embryos. Conclusions Latimeria shh CRMs represent the ancestral set of enhancers that have emerged before the split of lobe-finned and ray-finned fishes. In contrast to lineage-specific losses and differentiations in more derived lineages, Latimeria shh enhancers reveal low levels of sequence diversification. High overall sequence conservation of shh conserved noncoding elements (CNE is consistent with the general trend of high levels of conservation of noncoding DNA in the slowly evolving Latimeria genome.

  17. Plasticity of the cis-regulatory input function of a gene.

    Directory of Open Access Journals (Sweden)

    Avraham E Mayo

    2006-04-01

    Full Text Available The transcription rate of a gene is often controlled by several regulators that bind specific sites in the gene's cis-regulatory region. The combined effect of these regulators is described by a cis-regulatory input function. What determines the form of an input function, and how variable is it with respect to mutations? To address this, we employ the well-characterized lac operon of Escherichia coli, which has an elaborate input function, intermediate between Boolean AND-gate and OR-gate logic. We mapped in detail the input function of 12 variants of the lac promoter, each with different point mutations in the regulator binding sites, by means of accurate expression measurements from living cells. We find that even a few mutations can significantly change the input function, resulting in functions that resemble Pure AND gates, OR gates, or single-input switches. Other types of gates were not found. The variant input functions can be described in a unified manner by a mathematical model. The model also lets us predict which functions cannot be reached by point mutations. The input function that we studied thus appears to be plastic, in the sense that many of the mutations do not ruin the regulation completely but rather result in new ways to integrate the inputs.

  18. Genome-wide de novo prediction of cis-regulatory binding sites in prokaryotes

    Science.gov (United States)

    Zhang, Shaoqiang; Xu, Minli; Su, Zhengchang

    2009-01-01

    Although cis-regulatory binding sites (CRBSs) are at least as important as the coding sequences in a genome, our general understanding of them in most sequenced genomes is very limited due to the lack of efficient and accurate experimental and computational methods for their characterization, which has largely hindered our understanding of many important biological processes. In this article, we describe a novel algorithm for genome-wide de novo prediction of CRBSs with high accuracy. We designed our algorithm to circumvent three identified difficulties for CRBS prediction using comparative genomics principles based on a new method for the selection of reference genomes, a new metric for measuring the similarity of CRBSs, and a new graph clustering procedure. When operon structures are correctly predicted, our algorithm can predict 81% of known individual binding sites belonging to 94% of known cis-regulatory motifs in the Escherichia coli K12 genome, while achieving high prediction specificity. Our algorithm has also achieved similar prediction accuracy in the Bacillus subtilis genome, suggesting that it is very robust, and thus can be applied to any other sequenced prokaryotic genome. When compared with the prior state-of-the-art algorithms, our algorithm outperforms them in both prediction sensitivity and specificity. PMID:19383880

  19. RAR/RXR binding dynamics distinguish pluripotency from differentiation associated cis-regulatory elements

    OpenAIRE

    Chatagnon, Amandine; Veber, Philippe; Morin, Valérie; Bedo, Justin; Triqueneaux, Gérard; Sémon, Marie; Laudet, Vincent; D'Alché-Buc, Florence; Benoit, Gérard

    2015-01-01

    In mouse embryonic cells, ligand-activated retinoic acid receptors (RARs) play a key role in inhibiting pluripotency-maintaining genes and activating some major actors of cell differentiation. To investigate the mechanism underlying this dual regulation, we performed joint RAR/RXR ChIP-seq and mRNA-seq time series during the first 48 h of the RA-induced Primitive Endoderm (PrE) differentiation process in F9 embryonal carcinoma (EC) cells. We show here that this dual regulation is associated w...

  20. Bacterial regulon modeling and prediction based on systematic cis regulatory motif analyses

    Science.gov (United States)

    Liu, Bingqiang; Zhou, Chuan; Li, Guojun; Zhang, Hanyuan; Zeng, Erliang; Liu, Qi; Ma, Qin

    2016-03-01

    Regulons are the basic units of the response system in a bacterial cell, and each consists of a set of transcriptionally co-regulated operons. Regulon elucidation is the basis for studying the bacterial global transcriptional regulation network. In this study, we designed a novel co-regulation score between a pair of operons based on accurate operon identification and cis regulatory motif analyses, which can capture their co-regulation relationship much better than other scores. Taking full advantage of this discovery, we developed a new computational framework and built a novel graph model for regulon prediction. This model integrates the motif comparison and clustering and makes the regulon prediction problem substantially more solvable and accurate. To evaluate our prediction, a regulon coverage score was designed based on the documented regulons and their overlap with our prediction; and a modified Fisher Exact test was implemented to measure how well our predictions match the co-expressed modules derived from E. coli microarray gene-expression datasets collected under 466 conditions. The results indicate that our program consistently performed better than others in terms of the prediction accuracy. This suggests that our algorithms substantially improve the state-of-the-art, leading to a computational capability to reliably predict regulons for any bacteria.

  1. Validation of skeletal muscle cis-regulatory module predictions reveals nucleotide composition bias in functional enhancers.

    Directory of Open Access Journals (Sweden)

    Andrew T Kwon

    2011-12-01

    Full Text Available We performed a genome-wide scan for muscle-specific cis-regulatory modules (CRMs using three computational prediction programs. Based on the predictions, 339 candidate CRMs were tested in cell culture with NIH3T3 fibroblasts and C2C12 myoblasts for capacity to direct selective reporter gene expression to differentiated C2C12 myotubes. A subset of 19 CRMs validated as functional in the assay. The rate of predictive success reveals striking limitations of computational regulatory sequence analysis methods for CRM discovery. Motif-based methods performed no better than predictions based only on sequence conservation. Analysis of the properties of the functional sequences relative to inactive sequences identifies nucleotide sequence composition can be an important characteristic to incorporate in future methods for improved predictive specificity. Muscle-related TFBSs predicted within the functional sequences display greater sequence conservation than non-TFBS flanking regions. Comparison with recent MyoD and histone modification ChIP-Seq data supports the validity of the functional regions.

  2. Maps of cis-Regulatory Nodes in Megabase Long Genome Segments are an Inevitable Intermediate Step Toward Whole Genome Functional Mapping.

    Science.gov (United States)

    Nikolaev, Lev G; Akopov, Sergey B; Chernov, Igor P; Sverdlov, Eugene D

    2007-04-01

    The availability of complete human and other metazoan genome sequences has greatly facilitated positioning and analysis of various genomic functional elements, with initial emphasis on coding sequences. However, complete functional maps of sequenced eukaryotic genomes should include also positions of all non-coding regulatory elements. Unfortunately, experimental data on genomic positions of a multitude of regulatory sequences, such as enhancers, silencers, insulators, transcription terminators, and replication origins are very limited, especially at the whole genome level. Since most genomic regulatory elements (e.g. enhancers) are generally gene-, tissue-, or cell-specific, the prediction of these elements by computational methods is difficult and often ambiguous. Therefore, the development of high-throughput experimental approaches for identifying and mapping genomic functional elements is highly desirable. At the same time, the creation of whole-genome map of hundreds of thousands of regulatory elements in several hundreds of tissue/cell types is presently far beyond our capabilities. A possible alternative for the whole genome approach is to concentrate efforts on individual genomic segments and then to integrate the data obtained into a whole genome functional map. Moreover, the maps of polygenic fragments with functional cis-regulatory elements would provide valuable data on complex regulatory systems, including their variability and evolution. Here, we reviewed experimental approaches to the realization of these ideas, including our own developments of experimental techniques for selection of cis-acting functionally active DNA fragments from large (megabase-sized) segments of mammalian genomes. PMID:18660850

  3. Maps of cis-Regulatory Nodes in Megabase Long Genome Segments are an Inevitable Intermediate Step Toward Whole Genome Functional Mapping

    Science.gov (United States)

    Nikolaev, Lev G; Akopov, Sergey B; Chernov, Igor P; Sverdlov, Eugene D

    2007-01-01

    The availability of complete human and other metazoan genome sequences has greatly facilitated positioning and analysis of various genomic functional elements, with initial emphasis on coding sequences. However, complete functional maps of sequenced eukaryotic genomes should include also positions of all non-coding regulatory elements. Unfortunately, experimental data on genomic positions of a multitude of regulatory sequences, such as enhancers, silencers, insulators, transcription terminators, and replication origins are very limited, especially at the whole genome level. Since most genomic regulatory elements (e.g. enhancers) are generally gene-, tissue-, or cell-specific, the prediction of these elements by computational methods is difficult and often ambiguous. Therefore, the development of high-throughput experimental approaches for identifying and mapping genomic functional elements is highly desirable. At the same time, the creation of whole-genome map of hundreds of thousands of regulatory elements in several hundreds of tissue/cell types is presently far beyond our capabilities. A possible alternative for the whole genome approach is to concentrate efforts on individual genomic segments and then to integrate the data obtained into a whole genome functional map. Moreover, the maps of polygenic fragments with functional cis-regulatory elements would provide valuable data on complex regulatory systems, including their variability and evolution. Here, we reviewed experimental approaches to the realization of these ideas, including our own developments of experimental techniques for selection of cis-acting functionally active DNA fragments from large (megabase-sized) segments of mammalian genomes. PMID:18660850

  4. Mapping Association between Long-Range Cis-Regulatory Regions and Their Target Genes Using Comparative Genomics

    Science.gov (United States)

    Mongin, Emmanuel; Dewar, Ken; Blanchette, Mathieu

    In chordates, long-range cis-regulatory regions are involved in the control of transcription initiation (either as repressors or enhancers). They can be located as far as 1 Mb from the transcription start site of the target gene and can regulate more than one gene. Therefore, proper characterization of functional interactions between long-range cis-regulatory regions and their target genes remains problematic. We present a novel method to predict such interactions based on the analysis of rearrangements between the human and 16 other vertebrate genomes. Our method is based on the assumption that genome rearrangements that would disrupt the functional interaction between a cis-regulatory region and its target gene are likely to be deleterious. Therefore, conservation of synteny through evolution would be an indication of a functional interaction. We use our algorithm to classify a set of 1,406,084 putative associations from the human genome. This genome-wide map of interactions has many potential applications, including the selection of candidate regions prior to in vivo experimental characterization, a better characterization of regulatory regions involved in position effect diseases, and an improved understanding of the mechanisms and importance of long-range regulation.

  5. Identification of High-Impact cis-Regulatory Mutations Using Transcription Factor Specific Random Forest Models.

    Science.gov (United States)

    Svetlichnyy, Dmitry; Imrichova, Hana; Fiers, Mark; Kalender Atak, Zeynep; Aerts, Stein

    2015-11-01

    Cancer genomes contain vast amounts of somatic mutations, many of which are passenger mutations not involved in oncogenesis. Whereas driver mutations in protein-coding genes can be distinguished from passenger mutations based on their recurrence, non-coding mutations are usually not recurrent at the same position. Therefore, it is still unclear how to identify cis-regulatory driver mutations, particularly when chromatin data from the same patient is not available, thus relying only on sequence and expression information. Here we use machine-learning methods to predict functional regulatory regions using sequence information alone, and compare the predicted activity of the mutated region with the reference sequence. This way we define the Predicted Regulatory Impact of a Mutation in an Enhancer (PRIME). We find that the recently identified driver mutation in the TAL1 enhancer has a high PRIME score, representing a "gain-of-target" for MYB, whereas the highly recurrent TERT promoter mutation has a surprisingly low PRIME score. We trained Random Forest models for 45 cancer-related transcription factors, and used these to score variations in the HeLa genome and somatic mutations across more than five hundred cancer genomes. Each model predicts only a small fraction of non-coding mutations with a potential impact on the function of the encompassing regulatory region. Nevertheless, as these few candidate driver mutations are often linked to gains in chromatin activity and gene expression, they may contribute to the oncogenic program by altering the expression levels of specific oncogenes and tumor suppressor genes. PMID:26562774

  6. Bioinformatic analysis of cis-regulatory interactions between progesterone and estrogen receptors in breast cancer

    Directory of Open Access Journals (Sweden)

    Matloob Khushi

    2014-11-01

    Full Text Available Chromatin factors interact with each other in a cell and sequence-specific manner in order to regulate transcription and a wealth of publically available datasets exists describing the genomic locations of these interactions. Our recently published BiSA (Binding Sites Analyser database contains transcription factor binding locations and epigenetic modifications collected from published studies and provides tools to analyse stored and imported data. Using BiSA we investigated the overlapping cis-regulatory role of estrogen receptor alpha (ERα and progesterone receptor (PR in the T-47D breast cancer cell line. We found that ERα binding sites overlap with a subset of PR binding sites. To investigate further, we re-analysed raw data to remove any biases introduced by the use of distinct tools in the original publications. We identified 22,152 PR and 18,560 ERα binding sites (<5% false discovery rate with 4,358 overlapping regions among the two datasets. BiSA statistical analysis revealed a non-significant overall overlap correlation between the two factors, suggesting that ERα and PR are not partner factors and do not require each other for binding to occur. However, Monte Carlo simulation by Binary Interval Search (BITS, Relevant Distance, Absolute Distance, Jaccard and Projection tests by Genometricorr revealed a statistically significant spatial correlation of binding regions on chromosome between the two factors. Motif analysis revealed that the shared binding regions were enriched with binding motifs for ERα, PR and a number of other transcription and pioneer factors. Some of these factors are known to co-locate with ERα and PR binding. Therefore spatially close proximity of ERα binding sites with PR binding sites suggests that ERα and PR, in general function independently at the molecular level, but that their activities converge on a specific subset of transcriptional targets.

  7. Studying the functional conservation of cis-regulatory modules and their transcriptional output

    Directory of Open Access Journals (Sweden)

    Bailey Timothy L

    2008-04-01

    Full Text Available Abstract Background Cis-regulatory modules (CRMs are distinct, genomic regions surrounding the target gene that can independently activate the promoter to drive transcription. The activation of a CRM is controlled by the binding of a certain combination of transcription factors (TFs. It would be of great benefit if the transcriptional output mediated by a specific CRM could be predicted. Of equal benefit would be identifying in silico a specific CRM as the driver of the expression in a specific tissue or situation. We extend a recently developed biochemical modeling approach to manage both prediction tasks. Given a set of TFs, their protein concentrations, and the positions and binding strengths of each of the TFs in a putative CRM, the model predicts the transcriptional output of the gene. Our approach predicts the location of the regulating CRM by using predicted TF binding sites in regions near the gene as input to the model and searching for the region that yields a predicted transcription rate most closely matching the known rate. Results Here we show the ability of the model on the example of one of the CRMs regulating the eve gene, MSE2. A model trained on the MSE2 in D. melanogaster was applied to the surrounding sequence of the eve gene in seven other Drosophila species. The model successfully predicts the correct MSE2 location and output in six out of eight Drosophila species we examine. Conclusion The model is able to generalize from D. melanogaster to other Drosophila species and accurately predicts the location and transcriptional output of MSE2 in those species. However, we also show that the current model is not specific enough to function as a genome-wide CRM scanner, because it incorrectly predicts other genomic regions to be MSE2s.

  8. Controlled Synthesis of ZrS2 Monolayer and Few Layers on Hexagonal Boron Nitride.

    Science.gov (United States)

    Zhang, Mei; Zhu, Yiming; Wang, Xinsheng; Feng, Qingliang; Qiao, Shanlin; Wen, Wen; Chen, Yanfeng; Cui, Menghua; Zhang, Jin; Cai, Congzhong; Xie, Liming

    2015-06-10

    Group IVB transition metal (Zr and Hf) dichalcogenide (TMD) monolayers can have higher carrier mobility and higher tunneling current density than group VIB (Mo and W) TMD monolayers. Here we report the synthesis of hexagonal ZrS2 monolayer and few layers on hexagonal boron nitride (BN) using ZrCl4 and S as precursors. The domain size of ZrS2 hexagons is around 1-3 μm. The number of layers of ZrS2 was controlled by tuning the evaporation temperature of ZrCl4. The stacking angle between ZrS2 and BN characterized by transmission electron microscopy shows a preferred stacking angle of near 0°. Field-effect transistors (FETs) fabricated on ZrS2 flakes showed n-type transport behavior with an estimated mobility of 0.1-1.1 cm(2) V(-1) s(-1). PMID:25996159

  9. Promoter analysis reveals cis-regulatory motifs associated with the expression of the WRKY transcription factor CrWRKY1 in Catharanthus roseus.

    Science.gov (United States)

    Yang, Zhirong; Patra, Barunava; Li, Runzhi; Pattanaik, Sitakanta; Yuan, Ling

    2013-12-01

    WRKY transcription factors (TFs) are emerging as an important group of regulators of plant secondary metabolism. However, the cis-regulatory elements associated with their regulation have not been well characterized. We have previously demonstrated that CrWRKY1, a member of subgroup III of the WRKY TF family, regulates biosynthesis of terpenoid indole alkaloids in the ornamental and medicinal plant, Catharanthus roseus. Here, we report the isolation and functional characterization of the CrWRKY1 promoter. In silico analysis of the promoter sequence reveals the presence of several potential TF binding motifs, indicating the involvement of additional TFs in the regulation of the TIA pathway. The CrWRKY1 promoter can drive the expression of a β-glucuronidase (GUS) reporter gene in native (C. roseus protoplasts and transgenic hairy roots) and heterologous (transgenic tobacco seedlings) systems. Analysis of 5'- or 3'-end deletions indicates that the sequence located between positions -140 to -93 bp and -3 to +113 bp, relative to the transcription start site, is critical for promoter activity. Mutation analysis shows that two overlapping as-1 elements and a CT-rich motif contribute significantly to promoter activity. The CrWRKY1 promoter is induced in response to methyl jasmonate (MJ) treatment and the promoter region between -230 and -93 bp contains a putative MJ-responsive element. The CrWRKY1 promoter can potentially be used as a tool to isolate novel TFs involved in the regulation of the TIA pathway. PMID:23979312

  10. Reverse saturable absorption and nonlinear refraction of ultrathin ZrS3 nanobelts

    Science.gov (United States)

    Wu, Jia-Jing; Tao, You-Rong; Wang, Jia-Nan; Wu, Zhong-Yu; Fan, Lei; Wu, Xing-Cai

    2016-05-01

    The nonlinear optical (NLO) properties of a ZrS3 nanobelt were measured with a 6.5 ns pulse laser at 532 nm. Its optical response to the incident light exhibits good optical absorptive and refractive effects, with the nonlinear absorption coefficient β = 4.42 × 10-10 m W-1 and the nonlinear refraction coefficient γ = 5.86 × 10-17 m2 W-1 for the ZrS3 nanobelt in ethanol dispersions at an input energy of 34.25 μJ. In addition, the β values and γ values have dependence on input energy. Results show that the ZrS3 nanobelts have an excellent reverse saturable absorption (RSA) performance in nanosecond pulses, demonstrating that ZrS3 nanobelts are an extraordinarily promising novel optical power limiting material. Meanwhile, compared to the pure ZrS3, graphene oxide (GO) and reduced graphene oxide (RGO), composites (ZrS3/GRO) exhibit an enhanced nonlinear absorption response at the same input energy.The nonlinear optical (NLO) properties of a ZrS3 nanobelt were measured with a 6.5 ns pulse laser at 532 nm. Its optical response to the incident light exhibits good optical absorptive and refractive effects, with the nonlinear absorption coefficient β = 4.42 × 10-10 m W-1 and the nonlinear refraction coefficient γ = 5.86 × 10-17 m2 W-1 for the ZrS3 nanobelt in ethanol dispersions at an input energy of 34.25 μJ. In addition, the β values and γ values have dependence on input energy. Results show that the ZrS3 nanobelts have an excellent reverse saturable absorption (RSA) performance in nanosecond pulses, demonstrating that ZrS3 nanobelts are an extraordinarily promising novel optical power limiting material. Meanwhile, compared to the pure ZrS3, graphene oxide (GO) and reduced graphene oxide (RGO), composites (ZrS3/GRO) exhibit an enhanced nonlinear absorption response at the same input energy. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr09268j

  11. Combinatorial regulation modules on GmSBP2 promoter: a distal cis-regulatory domain confines the SBP2 promoter activity to the vascular tissue in vegetative organs.

    Science.gov (United States)

    Waclawovsky, Alessandro J; Freitas, Rejane L; Rocha, Carolina S; Contim, Luis Antônio S; Fontes, Elizabeth P B

    2006-01-01

    The Glycine max sucrose binding protein (GmSBP2) promoter directs phloem-specific expression of reporter genes in transgenic tobacco. Here, we identified cis-regulatory domains (CRD) that contribute with positive and negative regulation for the tissue-specific pattern of the GmSPB2 promoter. Negative regulatory elements in the distal CRD-A (-2000 to -700) sequences suppressed expression from the GmSBP2 promoter in tissues other than seed tissues and vascular tissues of vegetative organs. Deletion of this region relieved repression resulting in a constitutive promoter highly active in all tissues analyzed. Further deletions from the strong constitutive -700GmSBP2 promoter delimited several intercalating enhancer-like and repressing domains that function in a context-dependent manner. Histochemical examination revealed that the CRD-C (-445 to -367) harbors both negative and positive elements. This region abolished promoter expression in roots and in all tissues of stems except for the inner phloem. In contrast, it restores root meristem expression when fused to the -132pSBP2-GUS construct, which contains root meristem expression-repressing determinants mapped to the 44-bp CRD-G (-136 to -92). Thus, the GmSBP2 promoter is functionally organized into a proximal region with the combinatorial modular configuration of plant promoters and a distal domain, which restricts gene expression to the vascular tissues in vegetative organs. PMID:16574256

  12. A Hox Transcription Factor Collective Binds a Highly Conserved Distal-less cis-Regulatory Module to Generate Robust Transcriptional Outcomes.

    Science.gov (United States)

    Uhl, Juli D; Zandvakili, Arya; Gebelein, Brian

    2016-04-01

    cis-regulatory modules (CRMs) generate precise expression patterns by integrating numerous transcription factors (TFs). Surprisingly, CRMs that control essential gene patterns can differ greatly in conservation, suggesting distinct constraints on TF binding sites. Here, we show that a highly conserved Distal-less regulatory element (DCRE) that controls gene expression in leg precursor cells recruits multiple Hox, Extradenticle (Exd) and Homothorax (Hth) complexes to mediate dual outputs: thoracic activation and abdominal repression. Using reporter assays, we found that abdominal repression is particularly robust, as neither individual binding site mutations nor a DNA binding deficient Hth protein abolished cooperative DNA binding and in vivo repression. Moreover, a re-engineered DCRE containing a distinct configuration of Hox, Exd, and Hth sites also mediated abdominal Hox repression. However, the re-engineered DCRE failed to perform additional segment-specific functions such as thoracic activation. These findings are consistent with two emerging concepts in gene regulation: First, the abdominal Hox/Exd/Hth factors utilize protein-protein and protein-DNA interactions to form repression complexes on flexible combinations of sites, consistent with the TF collective model of CRM organization. Second, the conserved DCRE mediates multiple cell-type specific outputs, consistent with recent findings that pleiotropic CRMs are associated with conserved TF binding and added evolutionary constraints. PMID:27058369

  13. CisMiner: genome-wide in-silico cis-regulatory module prediction by fuzzy itemset mining.

    Directory of Open Access Journals (Sweden)

    Carmen Navarro

    Full Text Available Eukaryotic gene control regions are known to be spread throughout non-coding DNA sequences which may appear distant from the gene promoter. Transcription factors are proteins that coordinately bind to these regions at transcription factor binding sites to regulate gene expression. Several tools allow to detect significant co-occurrences of closely located binding sites (cis-regulatory modules, CRMs. However, these tools present at least one of the following limitations: 1 scope limited to promoter or conserved regions of the genome; 2 do not allow to identify combinations involving more than two motifs; 3 require prior information about target motifs. In this work we present CisMiner, a novel methodology to detect putative CRMs by means of a fuzzy itemset mining approach able to operate at genome-wide scale. CisMiner allows to perform a blind search of CRMs without any prior information about target CRMs nor limitation in the number of motifs. CisMiner tackles the combinatorial complexity of genome-wide cis-regulatory module extraction using a natural representation of motif combinations as itemsets and applying the Top-Down Fuzzy Frequent- Pattern Tree algorithm to identify significant itemsets. Fuzzy technology allows CisMiner to better handle the imprecision and noise inherent to regulatory processes. Results obtained for a set of well-known binding sites in the S. cerevisiae genome show that our method yields highly reliable predictions. Furthermore, CisMiner was also applied to putative in-silico predicted transcription factor binding sites to identify significant combinations in S. cerevisiae and D. melanogaster, proving that our approach can be further applied genome-wide to more complex genomes. CisMiner is freely accesible at: http://genome2.ugr.es/cisminer. CisMiner can be queried for the results presented in this work and can also perform a customized cis-regulatory module prediction on a query set of transcription factor binding

  14. Mapping cis-Regulatory Domains in the Human Genome UsingMulti-Species Conservation of Synteny

    Energy Technology Data Exchange (ETDEWEB)

    Ahituv, Nadav; Prabhakar, Shyam; Poulin, Francis; Rubin, EdwardM.; Couronne, Olivier

    2005-06-13

    Our inability to associate distant regulatory elements with the genes that they regulate has largely precluded their examination for sequence alterations contributing to human disease. One major obstacle is the large genomic space surrounding targeted genes in which such elements could potentially reside. In order to delineate gene regulatory boundaries we used whole-genome human-mouse-chicken (HMC) and human-mouse-frog (HMF) multiple alignments to compile conserved blocks of synteny (CBS), under the hypothesis that these blocks have been kept intact throughout evolution at least in part by the requirement of regulatory elements to stay linked to the genes that they regulate. A total of 2,116 and 1,942 CBS>200 kb were assembled for HMC and HMF respectively, encompassing 1.53 and 0.86 Gb of human sequence. To support the existence of complex long-range regulatory domains within these CBS we analyzed the prevalence and distribution of chromosomal aberrations leading to position effects (disruption of a genes regulatory environment), observing a clear bias not only for mapping onto CBS but also for longer CBS size. Our results provide a genome wide data set characterizing the regulatory domains of genes and the conserved regulatory elements within them.

  15. Cis-regulatory programs in the development and evolution of vertebrate paired appendages.

    Science.gov (United States)

    Gehrke, Andrew R; Shubin, Neil H

    2016-09-01

    Differential gene expression is the core of development, mediating the genetic changes necessary for determining cell identity. The regulation of gene activity by cis-acting elements (e.g., enhancers) is a crucial mechanism for determining differential gene activity by precise control of gene expression in embryonic space and time. Modifications to regulatory regions can have profound impacts on phenotype, and therefore developmental and evolutionary biologists have increasingly focused on elucidating the transcriptional control of genes that build and pattern body plans. Here, we trace the evolutionary history of transcriptional control of three loci key to vertebrate appendage development (Fgf8, Shh, and HoxD/A). Within and across these regulatory modules, we find both complex and flexible regulation in contrast with more fixed enhancers that appear unchanged over vast timescales of vertebrate evolution. The transcriptional control of vertebrate appendage development was likely already incredibly complex in the common ancestor of fish, implying that subtle changes to regulatory networks were more likely responsible for alterations in phenotype rather than the de novo addition of whole regulatory domains. Finally, we discuss the dangers of relying on inter-species transgenesis when testing enhancer function, and call for more controlled regulatory swap experiments when inferring the evolutionary history of enhancer elements. PMID:26783722

  16. Does positive selection drive transcription factor binding site turnover? A test with Drosophila cis-regulatory modules.

    Directory of Open Access Journals (Sweden)

    Bin Z He

    2011-04-01

    Full Text Available Transcription factor binding site(s (TFBS gain and loss (i.e., turnover is a well-documented feature of cis-regulatory module (CRM evolution, yet little attention has been paid to the evolutionary force(s driving this turnover process. The predominant view, motivated by its widespread occurrence, emphasizes the importance of compensatory mutation and genetic drift. Positive selection, in contrast, although it has been invoked in specific instances of adaptive gene expression evolution, has not been considered as a general alternative to neutral compensatory evolution. In this study we evaluate the two hypotheses by analyzing patterns of single nucleotide polymorphism in the TFBS of well-characterized CRM in two closely related Drosophila species, Drosophila melanogaster and Drosophila simulans. An important feature of the analysis is classification of TFBS mutations according to the direction of their predicted effect on binding affinity, which allows gains and losses to be evaluated independently along the two phylogenetic lineages. The observed patterns of polymorphism and divergence are not compatible with neutral evolution for either class of mutations. Instead, multiple lines of evidence are consistent with contributions of positive selection to TFBS gain and loss as well as purifying selection in its maintenance. In discussion, we propose a model to reconcile the finding of selection driving TFBS turnover with constrained CRM function over long evolutionary time.

  17. Evolving New Skeletal Traits by cis-Regulatory Changes in Bone Morphogenetic Proteins.

    Science.gov (United States)

    Indjeian, Vahan B; Kingman, Garrett A; Jones, Felicity C; Guenther, Catherine A; Grimwood, Jane; Schmutz, Jeremy; Myers, Richard M; Kingsley, David M

    2016-01-14

    Changes in bone size and shape are defining features of many vertebrates. Here we use genetic crosses and comparative genomics to identify specific regulatory DNA alterations controlling skeletal evolution. Armor bone-size differences in sticklebacks map to a major effect locus overlapping BMP family member GDF6. Freshwater fish express more GDF6 due in part to a transposon insertion, and transgenic overexpression of GDF6 phenocopies evolutionary changes in armor-plate size. The human GDF6 locus also has undergone distinctive regulatory evolution, including complete loss of an enhancer that is otherwise highly conserved between chimps and other mammals. Functional tests show that the ancestral enhancer drives expression in hindlimbs but not forelimbs, in locations that have been specifically modified during the human transition to bipedalism. Both gain and loss of regulatory elements can localize BMP changes to specific anatomical locations, providing a flexible regulatory basis for evolving species-specific changes in skeletal form. PMID:26774823

  18. Network discovery pipeline elucidates conserved time-of-day-specific cis-regulatory modules.

    Directory of Open Access Journals (Sweden)

    Todd P Michael

    2008-02-01

    Full Text Available Correct daily phasing of transcription confers an adaptive advantage to almost all organisms, including higher plants. In this study, we describe a hypothesis-driven network discovery pipeline that identifies biologically relevant patterns in genome-scale data. To demonstrate its utility, we analyzed a comprehensive matrix of time courses interrogating the nuclear transcriptome of Arabidopsis thaliana plants grown under different thermocycles, photocycles, and circadian conditions. We show that 89% of Arabidopsis transcripts cycle in at least one condition and that most genes have peak expression at a particular time of day, which shifts depending on the environment. Thermocycles alone can drive at least half of all transcripts critical for synchronizing internal processes such as cell cycle and protein synthesis. We identified at least three distinct transcription modules controlling phase-specific expression, including a new midnight specific module, PBX/TBX/SBX. We validated the network discovery pipeline, as well as the midnight specific module, by demonstrating that the PBX element was sufficient to drive diurnal and circadian condition-dependent expression. Moreover, we show that the three transcription modules are conserved across Arabidopsis, poplar, and rice. These results confirm the complex interplay between thermocycles, photocycles, and the circadian clock on the daily transcription program, and provide a comprehensive view of the conserved genomic targets for a transcriptional network key to successful adaptation.

  19. Tissue-specific expression of the human alpha 1-antitrypsin gene is controlled by multiple cis-regulatory elements.

    OpenAIRE

    Shen, R F; Li, Y.; Sifers, R N; Wang, H.; Hardick, C; Tsai, S. Y.; Woo, S L

    1987-01-01

    Human alpha 1-antitrypsin (AAT) is expressed in the liver, and a 318 bp fragment immediately flanking the CAP site of the gene was found to be sufficient to drive the expression of a reporter gene (CAT) specifically in hepatoma cells. The enhancing activity however, was orientation-dependent. The DNA fragment was separated into a distal region and a proximal region. A "core enhancer" sequence GTGGTTTC is present within the distal region and is capable of activity enhancement in both orientati...

  20. Changes in cis-regulatory elements of a key floral regulator are associated with divergence of inflorescence architectures

    OpenAIRE

    Kusters, E.; Pina, Della, S.; Castel, R; Souer, E.; Koes, R

    2015-01-01

    Higher plant species diverged extensively with regard to the moment (flowering time) and position (inflorescence architecture) at which flowers are formed. This seems largely caused by variation in the expression patterns of conserved genes that specify floral meristem identity (FMI), rather than changes in the encoded proteins. Here, we report a functional comparison of the promoters of homologous FMI genes from Arabidopsis, petunia, tomato and Antirrhinum. Analysis of promoter-reporter cons...

  1. Changes in cis-regulatory elements of a key floral regulator are associated with divergence of inflorescence architectures

    NARCIS (Netherlands)

    E. Kusters; S. Della Pina; R. Castel; E. Souer; R. Koes

    2015-01-01

    Higher plant species diverged extensively with regard to the moment (flowering time) and position (inflorescence architecture) at which flowers are formed. This seems largely caused by variation in the expression patterns of conserved genes that specify floral meristem identity (FMI), rather than ch

  2. ModuleMiner - improved computational detection of cis-regulatory modules: are there different modes of gene regulation in embryonic development and adult tissues?

    OpenAIRE

    Van Loo, Peter; Aerts, Stein; Thienpont, Bernard; De Moor, Bart; Moreau, Yves; Marynen, Peter

    2008-01-01

    We present ModuleMiner, a novel algorithm for computationally detecting cis-regulatory modules (CRMs) in a set of co-expressed genes. ModuleMiner outperforms other methods for CRM detection on benchmark data, and successfully detects CRMs in tissue-specific microarray clusters and in embryonic development gene sets. Interestingly, CRM predictions for differentiated tissues exhibit strong enrichment close to the transcription start site, whereas CRM predictions for embryonic development gene s...

  3. ‘In silico expression analysis’, a novel PathoPlant web tool to identify abiotic and biotic stress conditions associated with specific cis-regulatory sequences

    Science.gov (United States)

    Machens, Fabian; Brill, Yuri; Romanov, Artyom; Bülow, Lorenz; Hehl, Reinhard

    2014-01-01

    Using bioinformatics, putative cis-regulatory sequences can be easily identified using pattern recognition programs on promoters of specific gene sets. The abundance of predicted cis-sequences is a major challenge to associate these sequences with a possible function in gene expression regulation. To identify a possible function of the predicted cis-sequences, a novel web tool designated ‘in silico expression analysis’ was developed that correlates submitted cis-sequences with gene expression data from Arabidopsis thaliana. The web tool identifies the A. thaliana genes harbouring the sequence in a defined promoter region and compares the expression of these genes with microarray data. The result is a hierarchy of abiotic and biotic stress conditions to which these genes are most likely responsive. When testing the performance of the web tool, known cis-regulatory sequences were submitted to the ‘in silico expression analysis’ resulting in the correct identification of the associated stress conditions. When using a recently identified novel elicitor-responsive sequence, a WT-box (CGACTTTT), the ‘in silico expression analysis’ predicts that genes harbouring this sequence in their promoter are most likely Botrytis cinerea induced. Consistent with this prediction, the strongest induction of a reporter gene harbouring this sequence in the promoter is observed with B. cinerea in transgenic A. thaliana. Database URL: http://www.pathoplant.de/expression_analysis.php. PMID:24727366

  4. A cis-regulatory sequence from a short intergenic region gives rise to a strong microbe-associated molecular pattern-responsive synthetic promoter.

    Science.gov (United States)

    Lehmeyer, Mona; Hanko, Erik K R; Roling, Lena; Gonzalez, Lilian; Wehrs, Maren; Hehl, Reinhard

    2016-06-01

    The high gene density in Arabidopsis thaliana leaves only relatively short intergenic regions for potential cis-regulatory sequences. To learn more about the regulation of genes harbouring only very short upstream intergenic regions, this study investigates a recently identified novel microbe-associated molecular pattern (MAMP)-responsive cis-sequence located within the 101 bp long intergenic region upstream of the At1g13990 gene. It is shown that the cis-regulatory sequence is sufficient for MAMP-responsive reporter gene activity in the context of its native promoter. The 3' UTR of the upstream gene has a quantitative effect on gene expression. In context of a synthetic promoter, the cis-sequence is shown to achieve a strong increase in reporter gene activity as a monomer, dimer and tetramer. Mutation analysis of the cis-sequence determined the specific nucleotides required for gene expression activation. In transgenic A. thaliana the synthetic promoter harbouring a tetramer of the cis-sequence not only drives strong pathogen-responsive reporter gene expression but also shows a high background activity. The results of this study contribute to our understanding how genes with very short upstream intergenic regions are regulated and how these regions can serve as a source for MAMP-responsive cis-sequences for synthetic promoter design. PMID:26833485

  5. 'In silico expression analysis', a novel PathoPlant web tool to identify abiotic and biotic stress conditions associated with specific cis-regulatory sequences.

    Science.gov (United States)

    Bolívar, Julio C; Machens, Fabian; Brill, Yuri; Romanov, Artyom; Bülow, Lorenz; Hehl, Reinhard

    2014-01-01

    Using bioinformatics, putative cis-regulatory sequences can be easily identified using pattern recognition programs on promoters of specific gene sets. The abundance of predicted cis-sequences is a major challenge to associate these sequences with a possible function in gene expression regulation. To identify a possible function of the predicted cis-sequences, a novel web tool designated 'in silico expression analysis' was developed that correlates submitted cis-sequences with gene expression data from Arabidopsis thaliana. The web tool identifies the A. thaliana genes harbouring the sequence in a defined promoter region and compares the expression of these genes with microarray data. The result is a hierarchy of abiotic and biotic stress conditions to which these genes are most likely responsive. When testing the performance of the web tool, known cis-regulatory sequences were submitted to the 'in silico expression analysis' resulting in the correct identification of the associated stress conditions. When using a recently identified novel elicitor-responsive sequence, a WT-box (CGACTTTT), the 'in silico expression analysis' predicts that genes harbouring this sequence in their promoter are most likely Botrytis cinerea induced. Consistent with this prediction, the strongest induction of a reporter gene harbouring this sequence in the promoter is observed with B. cinerea in transgenic A. thaliana. DATABASE URL: http://www.pathoplant.de/expression_analysis.php. PMID:24727366

  6. An in vivo cis-regulatory screen at the type 2 diabetes associated TCF7L2 locus identifies multiple tissue-specific enhancers.

    Directory of Open Access Journals (Sweden)

    Daniel Savic

    Full Text Available Genome-wide association studies (GWAS have repeatedly shown an association between non-coding variants in the TCF7L2 locus and risk for type 2 diabetes (T2D, implicating a role for cis-regulatory variation within this locus in disease etiology. Supporting this hypothesis, we previously localized complex regulatory activity to the TCF7L2 T2D-associated interval using an in vivo bacterial artificial chromosome (BAC enhancer-trapping reporter strategy. To follow-up on this broad initial survey of the TCF7L2 regulatory landscape, we performed a fine-mapping enhancer scan using in vivo mouse transgenic reporter assays. We functionally interrogated approximately 50% of the sequences within the T2D-associated interval, utilizing sequence conservation within this 92-kb interval to determine the regulatory potential of all evolutionary conserved sequences that exhibited conservation to the non-eutherian mammal opossum. Included in this study was a detailed functional interrogation of sequences spanning both protective and risk alleles of single nucleotide polymorphism (SNP rs7903146, which has exhibited allele-specific enhancer function in pancreatic beta cells. Using these assays, we identified nine segments regulating various aspects of the TCF7L2 expression profile and that constitute nearly 70% of the sequences tested. These results highlight the regulatory complexity of this interval and support the notion that a TCF7L2 cis-regulatory disruption leads to T2D predisposition.

  7. The fabrication and characterization of diodes and solar cells of the transition metal chalcogenides WSe2, MoSe2, ZrSe3 and ZrS3

    International Nuclear Information System (INIS)

    In the present thesis the fabrication and characterization of the transition element semiconductors WSe2, MoSe2, ZrSe3 and ZrS3 and of diodes and solar cells of these materials are investigated. Monocrystals were grown, polycrystalline substrates of WSe2 were produced, moreover P-N junctions, photodiodes and CdS/p-WSe2 and ITO/p-WSe2 solar cells. The materials are investigated electrically, and the efficiency of the solar cells is tested. (BHO)

  8. Characterization and application of a novel bioemulsifier in crude oil degradation by Acinetobacter beijerinckii ZRS.

    Science.gov (United States)

    Zhao, Yi-He; Chen, Li-Yuan; Tian, Zi-Jing; Sun, Yue; Liu, Jin-Biao; Huang, Lei

    2016-02-01

    Bioemulsifiers can be applicated in a variety of areas such as bioremediation and microbial-enhanced oil recovery. The present study was aimed at bioemulsifier production, optimization, stability studies, and applications of the bioemulsifier produced by one of these strains, Acinetobacter beijerinckii ZRS. When Acinetobacter beijerinckii ZRS is cultured with hexadecane as a carbon source, it produces a novel extracellular emulsifying agent that does not cause remarkable reductions in surface tension. In order to enhance bioemulsifier production, response surface methodology was applied to optimize the culture medium. The bioemulsifier was subjected to thin-layer chromatography, Fourier transform infrared spectroscopy (FTIR), gel filtration chromatography, matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF), and nuclear magnetic resonance (NMR), which allowed for the identification of a novel polymeric bioemulsifier. The bioemulsifier retained its properties at a wide range of pH values, high temperatures and high salinities (up to 5% [w⁄v] Na(+) and 24% Ca(2+)). To deduce the role of this bioemulsifier in a coastal zone oil spill, the propagation of oil-degrading bacteria on oil-coated grains of gravel immersed in seawater was investigated in beach-simulating tanks. The bioemulsifier played a positive role in the degradation of these hydrocarbons and increasing the light crude oil degradation rate of the bacterial strain from 37.5 to 58.3% within 56 days. Therefore, this bioemulsifier shows strong potential to be used for bioremediation of oil pollution in marine environments. PMID:26576943

  9. Compton scattering study of ZrS1.5Se1.5

    International Nuclear Information System (INIS)

    In this paper, we present the first ever experimental Compton profile (CP) of ZrS1.5Se1.5 compound using 100 mCi 241Am source. To analyze the experimental CP, theoretical profiles were derived using linear combination of atomic orbitals (LCAO) method within the Hartree-Fock (HF) scheme, density functional theory with generalized gradient approximation (DFT-GGA) and hybrid functional of HF and DFT (B3PW). It is seen that LCAO-DFT-GGA calculation gives a better agreement with the experimental data. Mulliken's population analysis shows the total transfer of 2.27 e- from Zr to S and Se atoms. (author)

  10. Cis-regulatory control of the nuclear receptor Coup-TF gene in the sea urchin Paracentrotus lividus embryo.

    Directory of Open Access Journals (Sweden)

    Lamprini G Kalampoki

    Full Text Available Coup-TF, an orphan member of the nuclear receptor super family, has a fundamental role in the development of metazoan embryos. The study of the gene's regulatory circuit in the sea urchin embryo will facilitate the placement of this transcription factor in the well-studied embryonic Gene Regulatory Network (GRN. The Paracentrotus lividus Coup-TF gene (PlCoup-TF is expressed throughout embryonic development preferentially in the oral ectoderm of the gastrula and the ciliary band of the pluteus stage. Two overlapping λ genomic clones, containing three exons and upstream sequences of PlCoup-TF, were isolated from a genomic library. The transcription initiation site was determined and 5' deletions and individual segments of a 1930 bp upstream region were placed ahead of a GFP reporter cassette and injected into fertilized P.lividus eggs. Module a (-532 to -232, was necessary and sufficient to confer ciliary band expression to the reporter. Comparison of P.lividus and Strongylocentrotus purpuratus upstream Coup-TF sequences, revealed considerable conservation, but none within module a. 5' and internal deletions into module a, defined a smaller region that confers ciliary band specific expression. Putative regulatory cis-acting elements (RE1, RE2 and RE3 within module a, were specifically bound by proteins in sea urchin embryonic nuclear extracts. Site-specific mutagenesis of these elements resulted in loss of reporter activity (RE1 or ectopic expression (RE2, RE3. It is proposed that sea urchin transcription factors, which bind these three regulatory sites, are necessary for spatial and quantitative regulation of the PlCoup-TF gene at pluteus stage sea urchin embryos. These findings lead to the future identification of these factors and to the hierarchical positioning of PlCoup-TF within the embryonic GRN.

  11. Different cis-Regulatory DNA Elements Mediate Developmental Stage- and Tissue-specific Expression of the Human COL2A1 Gene in Transgenic Mice

    OpenAIRE

    Leung, Keith K.H.; Ng, Ling Jim; Ho, Ken K.Y.; Tam, Patrick P L; Cheah, Kathryn S. E.

    1998-01-01

    Expression of the type II collagen gene (human COL2A1, mouse Col2a1) heralds the differentiation of chondrocytes. It is also expressed in progenitor cells of some nonchondrogenic tissues during embryogenesis. DNA sequences in the 5' flanking region and intron 1 are known to control tissue- specific expression in vitro, but the regulation of COL2A1 expression in vivo is not clearly understood. We have tested the regulatory activity of DNA sequences from COL2A1 on the expression of a lacZ repor...

  12. Comparative genome sequencing of Drosophila pseudoobscura: Chromosomal, gene, and cis-element evolution

    DEFF Research Database (Denmark)

    Richards, Stephen; Liu, Yue; Bettencourt, Brian R.;

    2005-01-01

    years (Myr) since the pseudoobscura/melanogaster divergence. Genes expressed in the testes had higher amino acid sequence divergence than the genome-wide average, consistent with the rapid evolution of sex-specific proteins. Cis-regulatory sequences are more conserved than random and nearby sequences......We have sequenced the genome of a second Drosophila species, Drosophila pseudoobscura, and compared this to the genome sequence of Drosophila melanogaster, a primary model organism. Throughout evolution the vast majority of Drosophila genes have remained on the same chromosome arm, but within each...... between the species-but the difference is slight, suggesting that the evolution of cis-regulatory elements is flexible. Overall, a pattern of repeat-mediated chromosomal rearrangement, and high coadaptation of both male genes and cis-regulatory sequences emerges as important themes of genome divergence...

  13. Integration of Bioinformatics and Synthetic Promoters Leads to the Discovery of Novel Elicitor-Responsive cis-Regulatory Sequences in Arabidopsis1[C][W][OA

    Science.gov (United States)

    Koschmann, Jeannette; Machens, Fabian; Becker, Marlies; Niemeyer, Julia; Schulze, Jutta; Bülow, Lorenz; Stahl, Dietmar J.; Hehl, Reinhard

    2012-01-01

    A combination of bioinformatic tools, high-throughput gene expression profiles, and the use of synthetic promoters is a powerful approach to discover and evaluate novel cis-sequences in response to specific stimuli. With Arabidopsis (Arabidopsis thaliana) microarray data annotated to the PathoPlant database, 732 different queries with a focus on fungal and oomycete pathogens were performed, leading to 510 up-regulated gene groups. Using the binding site estimation suite of tools, BEST, 407 conserved sequence motifs were identified in promoter regions of these coregulated gene sets. Motif similarities were determined with STAMP, classifying the 407 sequence motifs into 37 families. A comparative analysis of these 37 families with the AthaMap, PLACE, and AGRIS databases revealed similarities to known cis-elements but also led to the discovery of cis-sequences not yet implicated in pathogen response. Using a parsley (Petroselinum crispum) protoplast system and a modified reporter gene vector with an internal transformation control, 25 elicitor-responsive cis-sequences from 10 different motif families were identified. Many of the elicitor-responsive cis-sequences also drive reporter gene expression in an Agrobacterium tumefaciens infection assay in Nicotiana benthamiana. This work significantly increases the number of known elicitor-responsive cis-sequences and demonstrates the successful integration of a diverse set of bioinformatic resources combined with synthetic promoter analysis for data mining and functional screening in plant-pathogen interaction. PMID:22744985

  14. Integration of bioinformatics and synthetic promoters leads to the discovery of novel elicitor-responsive cis-regulatory sequences in Arabidopsis.

    Science.gov (United States)

    Koschmann, Jeannette; Machens, Fabian; Becker, Marlies; Niemeyer, Julia; Schulze, Jutta; Bülow, Lorenz; Stahl, Dietmar J; Hehl, Reinhard

    2012-09-01

    A combination of bioinformatic tools, high-throughput gene expression profiles, and the use of synthetic promoters is a powerful approach to discover and evaluate novel cis-sequences in response to specific stimuli. With Arabidopsis (Arabidopsis thaliana) microarray data annotated to the PathoPlant database, 732 different queries with a focus on fungal and oomycete pathogens were performed, leading to 510 up-regulated gene groups. Using the binding site estimation suite of tools, BEST, 407 conserved sequence motifs were identified in promoter regions of these coregulated gene sets. Motif similarities were determined with STAMP, classifying the 407 sequence motifs into 37 families. A comparative analysis of these 37 families with the AthaMap, PLACE, and AGRIS databases revealed similarities to known cis-elements but also led to the discovery of cis-sequences not yet implicated in pathogen response. Using a parsley (Petroselinum crispum) protoplast system and a modified reporter gene vector with an internal transformation control, 25 elicitor-responsive cis-sequences from 10 different motif families were identified. Many of the elicitor-responsive cis-sequences also drive reporter gene expression in an Agrobacterium tumefaciens infection assay in Nicotiana benthamiana. This work significantly increases the number of known elicitor-responsive cis-sequences and demonstrates the successful integration of a diverse set of bioinformatic resources combined with synthetic promoter analysis for data mining and functional screening in plant-pathogen interaction. PMID:22744985

  15. Prediction of transcriptional regulatory elements for plant hormone responses based on microarray data

    Directory of Open Access Journals (Sweden)

    Yamaguchi-Shinozaki Kazuko

    2011-02-01

    Full Text Available Abstract Background Phytohormones organize plant development and environmental adaptation through cell-to-cell signal transduction, and their action involves transcriptional activation. Recent international efforts to establish and maintain public databases of Arabidopsis microarray data have enabled the utilization of this data in the analysis of various phytohormone responses, providing genome-wide identification of promoters targeted by phytohormones. Results We utilized such microarray data for prediction of cis-regulatory elements with an octamer-based approach. Our test prediction of a drought-responsive RD29A promoter with the aid of microarray data for response to drought, ABA and overexpression of DREB1A, a key regulator of cold and drought response, provided reasonable results that fit with the experimentally identified regulatory elements. With this succession, we expanded the prediction to various phytohormone responses, including those for abscisic acid, auxin, cytokinin, ethylene, brassinosteroid, jasmonic acid, and salicylic acid, as well as for hydrogen peroxide, drought and DREB1A overexpression. Totally 622 promoters that are activated by phytohormones were subjected to the prediction. In addition, we have assigned putative functions to 53 octamers of the Regulatory Element Group (REG that have been extracted as position-dependent cis-regulatory elements with the aid of their feature of preferential appearance in the promoter region. Conclusions Our prediction of Arabidopsis cis-regulatory elements for phytohormone responses provides guidance for experimental analysis of promoters to reveal the basis of the transcriptional network of phytohormone responses.

  16. Unique Alterations of an Ultraconserved Non-Coding Element in the 3′UTR of ZIC2 in Holoprosencephaly

    OpenAIRE

    Roessler, Erich; Hu, Ping; Hong, Sung-Kook; Srivastava, Kshitij; Carrington, Blake; Sood, Raman; Petrykowska, Hanna; Elnitski, Laura; Ribeiro, Lucilene A.; Richieri-Costa, Antonio; Feldman, Benjamin; Odenwald, Ward F; Muenke, Maximilian

    2012-01-01

    Coding region alterations of ZIC2 are the second most common type of mutation in holoprosencephaly (HPE). Here we use several complementary bioinformatic approaches to identify ultraconserved cis-regulatory sequences potentially driving the expression of human ZIC2. We demonstrate that an 804 bp element in the 3′ untranslated region (3′UTR) is highly conserved across the evolutionary history of vertebrates from fish to humans. Furthermore, we show that while genetic variation of this element ...

  17. A Functional Screen for Regulatory Elements that Improve Retroviral Vector Gene Expression

    OpenAIRE

    Groth, Amy C; Emery, David W.

    2010-01-01

    Recombinant retroviruses constitute the most common class of gene delivery vectors used in hematopoietic cell-based gene therapy. However, the use of these vectors can be limited by inadequate levels of transgene expression, often mediated by expression variegation and vector silencing due to chromosomal position effects. Toward the goal of addressing this problem, we sought to identify cis-regulatory elements from the human genome that can improve the level and stability of retroviral vector...

  18. Comparative genome sequencing of drosophila pseudoobscura: Chromosomal, gene and cis-element evolution

    Energy Technology Data Exchange (ETDEWEB)

    Richards, Stephen; Liu, Yue; Bettencourt, Brian R.; Hradecky, Pavel; Letovsky, Stan; Nielsen, Rasmus; Thornton, Kevin; Todd, Melissa J.; Chen, Rui; Meisel, Richard P.; Couronne, Olivier; Hua, Sujun; Smith, Mark A.; Bussemaker, Harmen J.; van Batenburg, Marinus F.; Howells, Sally L.; Scherer, Steven E.; Sodergren, Erica; Matthews, Beverly B.; Crosby, Madeline A.; Schroeder, Andrew J.; Ortiz-Barrientos, Daniel; Rives, Catherine M.; Metzker, Michael L.; Muzny, Donna M.; Scott, Graham; Steffen, David; Wheeler, David A.; Worley, Kim C.; Havlak, Paul; Durbin, K. James; Egan, Amy; Gill, Rachel; Hume, Jennifer; Morgan, Margaret B.; Miner, George; Hamilton, Cerissa; Huang, Yanmei; Waldron, Lenee; Verduzco, Daniel; Blankenburg, Kerstin P.; Dubchak, Inna; Noor, Mohamed A.F.; Anderson, Wyatt; White, Kevin P.; Clark, Andrew G.; Schaeffer, Stephen W.; Gelbart, William; Weinstock, George M.; Gibbs, Richard A.

    2004-04-01

    The genome sequence of a second fruit fly, D. pseudoobscura, presents an opportunity for comparative analysis of a primary model organism D. melanogaster. The vast majority of Drosophila genes have remained on the same arm, but within each arm gene order has been extensively reshuffled leading to the identification of approximately 1300 syntenic blocks. A repetitive sequence is found in the D. pseudoobscura genome at many junctions between adjacent syntenic blocks. Analysis of this novel repetitive element family suggests that recombination between offset elements may have given rise to many paracentric inversions, thereby contributing to the shuffling of gene order in the D. pseudoobscura lineage. Based on sequence similarity and synteny, 10,516 putative orthologs have been identified as a core gene set conserved over 35 My since divergence. Genes expressed in the testes had higher amino acid sequence divergence than the genome wide average consistent with the rapid evolution of sex-specific proteins. Cis-regulatory sequences are more conserved than control sequences between the species but the difference is slight, suggesting that the evolution of cis-regulatory elements is flexible. Overall, a picture of repeat mediated chromosomal rearrangement, and high co-adaptation of both male genes and cis-regulatory sequences emerges as important themes of genome divergence between these species of Drosophila.

  19. Application of zone-folding approach to the first-principles estimation of thermodynamic properties of carbon and ZrS2 -based nanotubes.

    Science.gov (United States)

    Bandura, Andrei V; Porsev, Vitaly V; Evarestov, Robert A

    2016-03-15

    A zone-folding (ZF) approach is applied for the estimation of the phonon contributions to thermodynamic properties of carbon-and ZrS2 -based nanotubes (NTs) of hexagonal morphology with different chiralities. The results obtained are compared with those from the direct calculation of the thermodynamic properties of NTs using PBE0 hybrid exchange-correlation functional. The phonon contribution to the stability of NTs proved to be negligible for the internal energy and small for the Helmholtz free energy. It is found that the ZF approach allows us an accurate estimation of phonon contributions to internal energy, but slightly overestimates the phonon contributions to entropy. © 2015 Wiley Periodicals, Inc. PMID:26519863

  20. Regulatory elements of the floral homeotic gene AGAMOUS identified by phylogenetic footprinting and shadowing.

    Energy Technology Data Exchange (ETDEWEB)

    Hong, R. L., Hamaguchi, L., Busch, M. A., and Weigel, D.

    2003-06-01

    OAK-B135 In Arabidopsis thaliana, cis-regulatory sequences of the floral homeotic gene AGAMOUS (AG) are located in the second intron. This 3 kb intron contains binding sites for two direct activators of AG, LEAFY (LFY) and WUSCHEL (WUS), along with other putative regulatory elements. We have used phylogenetic footprinting and the related technique of phylogenetic shadowing to identify putative cis-regulatory elements in this intron. Among 29 Brassicaceae, several other motifs, but not the LFY and WUS binding sites previously identified, are largely invariant. Using reporter gene analyses, we tested six of these motifs and found that they are all functionally important for activity of AG regulatory sequences in A. thaliana. Although there is little obvious sequence similarity outside the Brassicaceae, the intron from cucumber AG has at least partial activity in A. thaliana. Our studies underscore the value of the comparative approach as a tool that complements gene-by-gene promoter dissection, but also highlight that sequence-based studies alone are insufficient for a complete identification of cis-regulatory sites.

  1. Isolation and characterization of a native strain of Aspergillus niger ZRS14 with capability of high resistance to zinc and its supernatant application towards extracellular synthesis of zinc oxide nanoparticles

    Directory of Open Access Journals (Sweden)

    Morahem Ashengroph

    2013-01-01

    Full Text Available Introduction: Zinc oxide nanoparticles have quite a few applications in the fields of biology, optics, mechanics, magnetism, energy, hygiene and medicine. Due to serious problems associated with physiochemical synthesis of ZnO nanoparticles, including environmental pollution, complicated and costly processes, there is a growing need to develop a simple biological procedure for synthesis of nanoparticles to achieve the monodisperse-sized particles with a higher purity, low energy consumption and a cleaner environment. We conducted this investigation to screen and isolate native fungi strains capable of high zinc metal tolerance ability and a potential for extracellular synthesis of ZnO nanoparticles using fungal secretions as biological catalysts.Materials and methods: 15 different strains of fungi were isolated from soil samples collected from lead and zinc mines of Angoran-Zanjan using conventional enrichment process and characterized initially based on macroscopic and microscopic characteristics and colony morphology. The intrinsic tolerance of the isolated strains to zinc toxic metal was measured in the synthetic and complex media using the agar dilution method. The supernatants of isolated fungi were incubated with zinc acetate solution in a shaker incubator for 72h; then, the strain that was able to synthesis ZnO nanoparticle was identified. The ZnO nanoparticles formation was investigated by using spectroscopic techniques and microscopic observations.Results: Among the 15 isolated strains, the strain ZRS14 had highest zinc metal tolerance ability and was selected and identified as Aspergillus niger strain ZRS14 (GenBank accession number KF414527 based on morphological and molecular phylogenetic analysis. For synthesis of ZnO nanoparticles by isolated A. niger ZRS14, fungal cell-free filtrate of the strain was collected and incubated in the presence of zinc acetate solution at a final concentration of 250 mg/l zinc metal ion at 28º C for

  2. "Reverse Genomics" Predicts Function of Human Conserved Noncoding Elements.

    Science.gov (United States)

    Marcovitz, Amir; Jia, Robin; Bejerano, Gill

    2016-05-01

    Evolutionary changes in cis-regulatory elements are thought to play a key role in morphological and physiological diversity across animals. Many conserved noncoding elements (CNEs) function as cis-regulatory elements, controlling gene expression levels in different biological contexts. However, determining specific associations between CNEs and related phenotypes is a challenging task. Here, we present a computational "reverse genomics" approach that predicts the phenotypic functions of human CNEs. We identify thousands of human CNEs that were lost in at least two independent mammalian lineages (IL-CNEs), and match their evolutionary profiles against a diverse set of phenotypes recently annotated across multiple mammalian species. We identify 2,759 compelling associations between human CNEs and a diverse set of mammalian phenotypes. We discuss multiple CNEs, including a predicted ear element near BMP7, a pelvic CNE in FBN1, a brain morphology element in UBE4B, and an aquatic adaptation forelimb CNE near EGR2, and provide a full list of our predictions. As more genomes are sequenced and more traits are annotated across species, we expect our method to facilitate the interpretation of noncoding mutations in human disease and expedite the discovery of individual CNEs that play key roles in human evolution and development. PMID:26744417

  3. Close Sequence Comparisons are Sufficient to Identify Humancis-Regulatory Elements

    Energy Technology Data Exchange (ETDEWEB)

    Prabhakar, Shyam; Poulin, Francis; Shoukry, Malak; Afzal, Veena; Rubin, Edward M.; Couronne, Olivier; Pennacchio, Len A.

    2005-12-01

    Cross-species DNA sequence comparison is the primary method used to identify functional noncoding elements in human and other large genomes. However, little is known about the relative merits of evolutionarily close and distant sequence comparisons, due to the lack of a universal metric for sequence conservation, and also the paucity of empirically defined benchmark sets of cis-regulatory elements. To address this problem, we developed a general-purpose algorithm (Gumby) that detects slowly-evolving regions in primate, mammalian and more distant comparisons without requiring adjustment of parameters, and ranks conserved elements by P-value using Karlin-Altschul statistics. We benchmarked Gumby predictions against previously identified cis-regulatory elements at diverse genomic loci, and also tested numerous extremely conserved human-rodent sequences for transcriptional enhancer activity using reporter-gene assays in transgenic mice. Human regulatory elements were identified with acceptable sensitivity and specificity by comparison with 1-5 other eutherian mammals or 6 other simian primates. More distant comparisons (marsupial, avian, amphibian and fish) failed to identify many of the empirically defined functional noncoding elements. We derived an intuitive relationship between ancient and recent noncoding sequence conservation from whole genome comparative analysis, which explains some of these findings. Lastly, we determined that, in addition to strength of conservation, genomic location and/or density of surrounding conserved elements must also be considered in selecting candidate enhancers for testing at embryonic time points.

  4. PRE-1, a cis element sufficient to enhance cone- and rod- specific expression in differentiating zebrafish photoreceptors

    Directory of Open Access Journals (Sweden)

    Hurley James B

    2011-01-01

    Full Text Available Abstract Background Appropriate transcriptional regulation is required for cone photoreceptor development and integrity. To date, only a few cis-regulatory elements that control cone photoreceptor-specific expression have been characterised. The alpha-subunit of cone transducin (TαC is specifically expressed in cone photoreceptors and is required for colour vision. In order to better understand the molecular genetics controlling the initiation of cone photoreceptor-specific expression in vivo, we have utilised zebrafish to identify cis-regulatory elements in the upstream promoter region of the TαC gene. Results A 0.5 kb TαC promoter fragment is sufficient to direct cone-specific expression in transgenic larvae. Within this minimal promoter, we identify photoreceptor regulatory element-1 (PRE-1, a unique 41 bp sequence. PRE-1 specifically binds nuclear factors expressed in ocular tissue. PRE-1 is not required for cone-specific expression directed from a 2.5 kb TαC promoter. However, PRE-1-like sequences, with potential functional redundancy, are located in this 2.5 kb promoter. PRE-1-rho which has the highest sequence and structural homology to PRE-1 is located in the rhodopsin promoter. Surprisingly, PRE-1 and PRE-1-rho are functionally distinct. We demonstrate that PRE-1, but not PRE-1-rho, is sufficient to enhance expression from a heterologous UV cone promoter. PRE-1 is also sufficient to enhance expression from a heterologous rhodopsin promoter without altering its rod photoreceptor specificity. Finally, mutations in consensus E-box and Otx sites prevent PRE-1 from forming complexes with eye nuclear protein and enhancing photoreceptor expression. Conclusions PRE-1 is a novel cis-regulatory module that is sufficient to enhance the initiation of photoreceptor-specific gene expression in differentiating rod and cone photoreceptors.

  5. Patterns of cis regulatory variation in diverse human populations.

    Directory of Open Access Journals (Sweden)

    Barbara E Stranger

    Full Text Available The genetic basis of gene expression variation has long been studied with the aim to understand the landscape of regulatory variants, but also more recently to assist in the interpretation and elucidation of disease signals. To date, many studies have looked in specific tissues and population-based samples, but there has been limited assessment of the degree of inter-population variability in regulatory variation. We analyzed genome-wide gene expression in lymphoblastoid cell lines from a total of 726 individuals from 8 global populations from the HapMap3 project and correlated gene expression levels with HapMap3 SNPs located in cis to the genes. We describe the influence of ancestry on gene expression levels within and between these diverse human populations and uncover a non-negligible impact on global patterns of gene expression. We further dissect the specific functional pathways differentiated between populations. We also identify 5,691 expression quantitative trait loci (eQTLs after controlling for both non-genetic factors and population admixture and observe that half of the cis-eQTLs are replicated in one or more of the populations. We highlight patterns of eQTL-sharing between populations, which are partially determined by population genetic relatedness, and discover significant sharing of eQTL effects between Asians, European-admixed, and African subpopulations. Specifically, we observe that both the effect size and the direction of effect for eQTLs are highly conserved across populations. We observe an increasing proximity of eQTLs toward the transcription start site as sharing of eQTLs among populations increases, highlighting that variants close to TSS have stronger effects and therefore are more likely to be detected across a wider panel of populations. Together these results offer a unique picture and resource of the degree of differentiation among human populations in functional regulatory variation and provide an estimate for the transferability of complex trait variants across populations.

  6. Computational methods to dissect cis-regulatory transcriptional networks

    Indian Academy of Sciences (India)

    Vibha Rani

    2007-12-01

    The formation of diverse cell types from an invariant set of genes is governed by biochemical and molecular processes that regulate gene activity. A complete understanding of the regulatory mechanisms of gene expression is the major function of genomics. Computational genomics is a rapidly emerging area for deciphering the regulation of metazoan genes as well as interpreting the results of high-throughput screening. The integration of computer science with biology has expedited molecular modelling and processing of large-scale data inputs such as microarrays, analysis of genomes, transcriptomes and proteomes. Many bioinformaticians have developed various algorithms for predicting transcriptional regulatory mechanisms from the sequence, gene expression and interaction data. This review contains compiled information of various computational methods adopted to dissect gene expression pathways.

  7. Crystal Structure, Electronic Structure, and Photocatalytic Activity of Oxysulfides: La2Ta2ZrS2O8, La2Ta2TiS2O8, and La2Nb2TiS2O8.

    Science.gov (United States)

    Goto, Yosuke; Seo, Jeongsuk; Kumamoto, Kazunori; Hisatomi, Takashi; Mizuguchi, Yoshikazu; Kamihara, Yoichi; Katayama, Masao; Minegishi, Tsutomu; Domen, Kazunari

    2016-04-01

    The novel oxysulfides La2Ta2ZrS2O8 (LTZSO), La2Ta2TiS2O8 (LTTSO), and La2Nb2TiS2O8 (LNTSO) were synthesized, and their crystal structures, electronic structures, and photocatalytic activities for water splitting under visible light were investigated. Density functional theory calculations showed that these compounds are direct-band-gap semiconductors. Close to the conduction band minimum, the main contribution to the band structure comes from the d orbitals of Zr or Ti ions, while the region near the valence band maximum is associated with the 3p orbitals of S ions. The absorption-edge wavelength was determined to be 540 nm for LTZSO and 700 nm for LTTSO and LNTSO. An analysis of the crystal structure using synchrotron X-ray diffraction revealed that these compounds contained antisite defects at transition metal ion sites, and these were considered to be the origin of the broad absorption at wavelengths longer than that corresponding to band-gap excitation. LTZSO was revealed to be active in the oxygen evolution reaction from aqueous solution containing a sacrificial electron acceptor under visible-light illumination. This result was supported by the band alignment and flat-band potential determined by photoelectron spectroscopy and Mott-Schottky plots. PMID:27008368

  8. Phylogeny based discovery of regulatory elements

    Directory of Open Access Journals (Sweden)

    Cohen Barak A

    2006-05-01

    Full Text Available Abstract Background Algorithms that locate evolutionarily conserved sequences have become powerful tools for finding functional DNA elements, including transcription factor binding sites; however, most methods do not take advantage of an explicit model for the constrained evolution of functional DNA sequences. Results We developed a probabilistic framework that combines an HKY85 model, which assigns probabilities to different base substitutions between species, and weight matrix models of transcription factor binding sites, which describe the probabilities of observing particular nucleotides at specific positions in the binding site. The method incorporates the phylogenies of the species under consideration and takes into account the position specific variation of transcription factor binding sites. Using our framework we assessed the suitability of alignments of genomic sequences from commonly used species as substrates for comparative genomic approaches to regulatory motif finding. We then applied this technique to Saccharomyces cerevisiae and related species by examining all possible six base pair DNA sequences (hexamers and identifying sequences that are conserved in a significant number of promoters. By combining similar conserved hexamers we reconstructed known cis-regulatory motifs and made predictions of previously unidentified motifs. We tested one prediction experimentally, finding it to be a regulatory element involved in the transcriptional response to glucose. Conclusion The experimental validation of a regulatory element prediction missed by other large-scale motif finding studies demonstrates that our approach is a useful addition to the current suite of tools for finding regulatory motifs.

  9. Unique Alterations of an Ultraconserved Non-Coding Element in the 3′UTR of ZIC2 in Holoprosencephaly

    Science.gov (United States)

    Roessler, Erich; Hu, Ping; Hong, Sung-Kook; Srivastava, Kshitij; Carrington, Blake; Sood, Raman; Petrykowska, Hanna; Elnitski, Laura; Ribeiro, Lucilene A.; Richieri-Costa, Antonio; Feldman, Benjamin; Odenwald, Ward F.; Muenke, Maximilian

    2012-01-01

    Coding region alterations of ZIC2 are the second most common type of mutation in holoprosencephaly (HPE). Here we use several complementary bioinformatic approaches to identify ultraconserved cis-regulatory sequences potentially driving the expression of human ZIC2. We demonstrate that an 804 bp element in the 3′ untranslated region (3′UTR) is highly conserved across the evolutionary history of vertebrates from fish to humans. Furthermore, we show that while genetic variation of this element is unexpectedly common among holoprosencephaly subjects (6/528 or >1%), it is not present in control individuals. Two of six proband-unique variants are de novo, supporting their pathogenic involvement in HPE outcomes. These findings support a general recommendation that the identification and analysis of key ultraconserved elements should be incorporated into the genetic risk assessment of holoprosencephaly cases. PMID:22859937

  10. Unique alterations of an ultraconserved non-coding element in the 3'UTR of ZIC2 in holoprosencephaly.

    Science.gov (United States)

    Roessler, Erich; Hu, Ping; Hong, Sung-Kook; Srivastava, Kshitij; Carrington, Blake; Sood, Raman; Petrykowska, Hanna; Elnitski, Laura; Ribeiro, Lucilene A; Richieri-Costa, Antonio; Feldman, Benjamin; Odenwald, Ward F; Muenke, Maximilian

    2012-01-01

    Coding region alterations of ZIC2 are the second most common type of mutation in holoprosencephaly (HPE). Here we use several complementary bioinformatic approaches to identify ultraconserved cis-regulatory sequences potentially driving the expression of human ZIC2. We demonstrate that an 804 bp element in the 3' untranslated region (3'UTR) is highly conserved across the evolutionary history of vertebrates from fish to humans. Furthermore, we show that while genetic variation of this element is unexpectedly common among holoprosencephaly subjects (6/528 or >1%), it is not present in control individuals. Two of six proband-unique variants are de novo, supporting their pathogenic involvement in HPE outcomes. These findings support a general recommendation that the identification and analysis of key ultraconserved elements should be incorporated into the genetic risk assessment of holoprosencephaly cases. PMID:22859937

  11. PP2C-like Promoter and Its Deletion Variants Are Induced by ABA but Not by MeJA and SA in Arabidopsis thaliana

    OpenAIRE

    Bhalothia, Purva; Sangwan, Chetna; Alok, Anshu; Mehrotra, Sandhya; Mehrotra, Rajesh

    2016-01-01

    Gene expression is mediated through interaction between cis regulatory elements and its cognate transcription factors. Cis regulatory elements are defined as non-coding DNA sequences that provide the binding sites for transcription factors and are clustered in the upstream region of genes. ACGT cis regulatory element is one of the important cis regulatory elements found to be involved in diverse biological processes like auxin response, salicylic acid (SA) response, UV light response, ABA res...

  12. Structural relationships between highly conserved elements and genes in vertebrate genomes.

    Directory of Open Access Journals (Sweden)

    Hong Sun

    Full Text Available Large numbers of sequence elements have been identified to be highly conserved among vertebrate genomes. These highly conserved elements (HCEs are often located in or around genes that are involved in transcription regulation and early development. They have been shown to be involved in cis-regulatory activities through both in vivo and additional computational studies. We have investigated the structural relationships between such elements and genes in six vertebrate genomes human, mouse, rat, chicken, zebrafish and tetraodon and detected several thousand cases of conserved HCE-gene associations, and also cases of HCEs with no common target genes. A few examples underscore the potential significance of our findings about several individual genes. We found that the conserved association between HCE/HCEs and gene/genes are not restricted to elements by their absolute distance on the genome. Notably, long-range associations were identified and the molecular functions of the associated genes do not show any particular overrepresentation of the functional categories previously reported. HCEs in close proximity are found to be linked with different set of gene/genes. The results reflect the highly complex correlation between HCEs and their putative target genes.

  13. Evolution of anterior Hox regulatory elements among chordates

    Directory of Open Access Journals (Sweden)

    Natale Alfonso

    2011-11-01

    Full Text Available Abstract Background The Hox family of transcription factors has a fundamental role in segmentation pathways and axial patterning of embryonic development and their clustered organization is linked with the regulatory mechanisms governing their coordinated expression along embryonic axes. Among chordates, of particular interest are the Hox paralogous genes in groups 1-4 since their expression is coupled to the control of regional identity in the anterior nervous system, where the highest structural diversity is observed. Results To investigate the degree of conservation in cis-regulatory components that form the basis of Hox expression in the anterior nervous system, we have used assays for transcriptional activity in ascidians and vertebrates to compare and contrast regulatory potential. We identified four regulatory sequences located near the CiHox1, CiHox2 and CiHox4 genes of the ascidian Ciona intestinalis which direct neural specific domains of expression. Using functional assays in Ciona and vertebrate embryos in combination with sequence analyses of enhancer fragments located in similar positions adjacent to Hox paralogy group genes, we compared the activity of these four Ciona cis-elements with a series of neural specific enhancers from the amphioxus Hox1-3 genes and from mouse Hox paralogous groups 1-4. Conclusions This analysis revealed that Kreisler and Krox20 dependent enhancers critical in segmental regulation of the hindbrain appear to be specific for the vertebrate lineage. In contrast, neural enhancers that function as Hox response elements through the action of Hox/Pbx binding motifs have been conserved during chordate evolution. The functional assays reveal that these Hox response cis-elements are recognized by the regulatory components of different and extant species. Together, our results indicate that during chordate evolution, cis-elements dependent upon Hox/Pbx regulatory complexes, are responsible for key aspects of

  14. Detection and characterization of regulatory elements using probabilistic conditional random field and hidden Markov models.

    Science.gov (United States)

    Wang, Hongyan; Zhou, Xiaobo

    2013-04-01

    By altering the electrostatic charge of histones or providing binding sites to protein recognition molecules, Chromatin marks have been proposed to regulate gene expression, a property that has motivated researchers to link these marks to cis-regulatory elements. With the help of next generation sequencing technologies, we can now correlate one specific chromatin mark with regulatory elements (e.g. enhancers or promoters) and also build tools, such as hidden Markov models, to gain insight into mark combinations. However, hidden Markov models have limitation for their character of generative models and assume that a current observation depends only on a current hidden state in the chain. Here, we employed two graphical probabilistic models, namely the linear conditional random field model and multivariate hidden Markov model, to mark gene regions with different states based on recurrent and spatially coherent character of these eight marks. Both models revealed chromatin states that may correspond to enhancers and promoters, transcribed regions, transcriptional elongation, and low-signal regions. We also found that the linear conditional random field model was more effective than the hidden Markov model in recognizing regulatory elements, such as promoter-, enhancer-, and transcriptional elongation-associated regions, which gives us a better choice. PMID:23237214

  15. Ancient Transposable Elements Transformed the Uterine Regulatory Landscape and Transcriptome during the Evolution of Mammalian Pregnancy

    Directory of Open Access Journals (Sweden)

    Vincent J. Lynch

    2015-02-01

    Full Text Available A major challenge in biology is determining how evolutionarily novel characters originate; however, mechanistic explanations for the origin of new characters are almost completely unknown. The evolution of pregnancy is an excellent system in which to study the origin of novelties because mammals preserve stages in the transition from egg laying to live birth. To determine the molecular bases of this transition, we characterized the pregnant/gravid uterine transcriptome from tetrapods to trace the evolutionary history of uterine gene expression. We show that thousands of genes evolved endometrial expression during the origins of mammalian pregnancy, including genes that mediate maternal-fetal communication and immunotolerance. Furthermore, thousands of cis-regulatory elements that mediate decidualization and cell-type identity in decidualized stromal cells are derived from ancient mammalian transposable elements (TEs. Our results indicate that one of the defining mammalian novelties evolved from DNA sequences derived from ancient mammalian TEs co-opted into hormone-responsive regulatory elements distributed throughout the genome.

  16. A novel E2 box-GATA element modulates Cdc6 transcription during human cells polyploidization.

    Science.gov (United States)

    Vilaboa, Nuria; Bermejo, Rodrigo; Martinez, Pilar; Bornstein, Rafael; Calés, Carmela

    2004-01-01

    Cdc6 is a key regulator of the strict alternation of S and M phases during the mitotic cell cycle. In mammalian and plant cells that physiologically become polyploid, cdc6 is transcriptionally and post-translationally regulated. We have recently reported that Cdc6 levels are maintained in megakaryoblastic HEL cells, but severely downregulated by ectopic expression of transcriptional repressor Drosophila melanogaster escargot. Here, we show that cdc6 promoter activity is upregulated during megakaryocytic differentiation of HEL endoreplicating cells, and that Escargot interferes with such activation. Transactivation experiments showed that a 1.7 kb region located at 2800 upstream cdc6 transcription initiation site behaved as a potent enhancer in endoreplicating cells only. This activity was mainly dependent on a novel cis-regulatory element composed by an E2 box overlapping a GATA motif. Ectopic Escargot could bind this regulatory element in vitro and endogenous GATA-1 and E2A formed specific complexes in megakaryoblastic cells as well as in primary megakaryocytes. Chromatin Immunoprecipitation analysis revealed that both transcription factors were occupying the E2 box/GATA site in vivo. Altogether, these data suggest that cdc6 expression could be actively maintained during megakaryocytic differentiation through transcriptional mechanisms involving specific cis- and trans-regulatory elements. PMID:15590906

  17. Cis-acting elements in its 3' UTR mediate post-transcriptional regulation of KRAS.

    Science.gov (United States)

    Kim, Minlee; Kogan, Nicole; Slack, Frank J

    2016-03-15

    Multiple RNA-binding proteins and non-coding RNAs, such as microRNAs (miRNAs), are involved in post-transcriptional gene regulation through recognition motifs in the 3' untranslated region (UTR) of their target genes. The KRAS gene encodes a key signaling protein, and its messenger RNA (mRNA) contains an exceptionally long 3' UTR; this suggests that it may be subject to a highly complex set of regulatory processes. However, 3' UTR-dependent regulation of KRAS expression has not been explored in detail. Using extensive deletion and mutational analyses combined with luciferase reporter assays, we have identified inhibitory and stabilizing cis-acting regions within the KRAS 3' UTR that may interact with miRNAs and RNA-binding proteins, such as HuR. Particularly, we have identified an AU-rich 49-nt fragment in the KRAS 3' UTR that is required for KRAS 3' UTR reporter repression. This element contains a miR-185 complementary element, and we show that overexpression of miR-185 represses endogenous KRAS mRNA and protein in vitro. In addition, we have identified another 49-nt fragment that is required to promote KRAS 3' UTR reporter expression. These findings indicate that multiple cis-regulatory motifs in the 3' UTR of KRAS finely modulate its expression, and sequence alterations within a binding motif may disrupt the precise functions of trans-regulatory factors, potentially leading to aberrant KRAS expression. PMID:26930719

  18. Finding cis-regulatory modules in Drosophila using phylogenetic hidden Markov models

    DEFF Research Database (Denmark)

    Wong, Wendy S W; Nielsen, Rasmus

    2007-01-01

    MOTIVATION: Finding the regulatory modules for transcription factors binding is an important step in elucidating the complex molecular mechanisms underlying regulation of gene expression. There are numerous methods available for solving this problem, however, very few of them take advantage of th...

  19. Dissection of transcriptional and cis-regulatory control of differentiation in human pancreatic cancer.

    Science.gov (United States)

    Diaferia, Giuseppe R; Balestrieri, Chiara; Prosperini, Elena; Nicoli, Paola; Spaggiari, Paola; Zerbi, Alessandro; Natoli, Gioacchino

    2016-03-15

    The histological grade of carcinomas describes the ability of tumor cells to organize in differentiated epithelial structures and has prognostic and therapeutic impact. Here, we show that differential usage of the genomic repertoire of transcriptional enhancers leads to grade-specific gene expression programs in human pancreatic ductal adenocarcinoma (PDAC). By integrating gene expression profiling, epigenomic footprinting, and loss-of-function experiments in PDAC cell lines of different grade, we identified the repertoires of enhancers specific to high- and low-grade PDACs and the cognate set of transcription factors acting to maintain their activity. Among the candidate regulators of PDAC differentiation, KLF5 was selectively expressed in pre-neoplastic lesions and low-grade primary PDACs and cell lines, where it maintained the acetylation of grade-specific enhancers, the expression of epithelial genes such as keratins and mucins, and the ability to organize glandular epithelia in xenografts. The identification of the transcription factors controlling differentiation in PDACs will help clarify the molecular bases of its heterogeneity and progression. PMID:26769127

  20. Extensive conservation of ancient microsynteny across metazoans due to cis-regulatory constraints

    OpenAIRE

    Irimia, Manuel; Tena, Juan J.; Alexis, Maria S.; Fernandez-Miñan, Ana; Maeso, Ignacio; Bogdanović, Ozren; de la Calle-Mustienes, Elisa; Roy, Scott W; Gómez-Skarmeta, José L.; Fraser, Hunter B.

    2012-01-01

    The order of genes in eukaryotic genomes has generally been assumed to be neutral, since gene order is largely scrambled over evolutionary time. Only a handful of exceptional examples are known, typically involving deeply conserved clusters of tandemly duplicated genes (e.g., Hox genes and histones). Here we report the first systematic survey of microsynteny conservation across metazoans, utilizing 17 genome sequences. We identified nearly 600 pairs of unrelated genes that have remained tight...

  1. A cis-Regulatory Mutation of PDSS2 Causes Silky-Feather in Chickens

    OpenAIRE

    Feng, Chungang; Gao, Yu; Dorshorst, Ben; Song, Chi; Gu, Xiaorong; Li, Qingyuan; Li, Jinxiu; Liu, Tongxin; Rubin, Carl-Johan; Zhao, Yiqiang; Wang, Yanqiang; Fei, Jing; Li, Huifang; Chen, Kuanwei; Qu, Hao

    2014-01-01

    Author Summary The feather is an excellent model for evolution and development due to its complex structure and vast diversity. Some chickens have silky-feather because of a loss of hooklets in pennaceous feathers, while most chickens have the wild-type normal feather. Hooklets are formed in the last differentiation stage of the life cycle of a pennaceous feather. Chickens with silky-feather are homozygous for a recessive allele (hookless, h). Silkie chicken from China is one of the breeds sh...

  2. Cis-regulatory mechanisms of left/right asymmetric neuron-subtype specification in C. elegans

    OpenAIRE

    Etchberger, John F.; Eileen B Flowers; Poole, Richard J.; Bashllari, Enkelejda; Hobert, Oliver

    2008-01-01

    Anatomically and functionally defined neuron types are sometimes further classified into individual subtypes based on unique functional or molecular properties. To better understand how developmental programs controlling neuron type specification are mechanistically linked to programs controlling neuronal subtype specification, we have analyzed a neuronal subtype specification program that occurs across the left/right axis in the nervous system of the nematode C. elegans. A terminal selector ...

  3. Bisphenol A activates the Nrf1/2-antioxidant response element pathway in HEK 293 cells.

    Science.gov (United States)

    Chepelev, Nikolai L; Enikanolaiye, Mutiat I; Chepelev, Leonid L; Almohaisen, Abdulrahman; Chen, Qixuan; Scoggan, Kylie A; Coughlan, Melanie C; Cao, Xu-Liang; Jin, Xiaolei; Willmore, William G

    2013-03-18

    Bisphenol A (BPA) is used in the production of polycarbonate plastics and epoxy resins for baby bottles, liners of canned food, and many other consumer products. Previously, BPA has been shown to reduce the activity of several antioxidant enzymes, which may contribute to oxidative stress. However, the underlying mechanism of the BPA-mediated effect upon antioxidant enzyme activity is unknown. Antioxidant and phase II metabolizing enzymes protect cells from oxidative stress and are transcriptionally activated by Nrf1 and Nrf2 factors through their cis-regulatory antioxidant response elements (AREs). In this work, we have assessed the effect of BPA on the Nrf1/2-ARE pathway in cultured human embryonic kidney (HEK) 293 cells. Surprisingly, glutathione and reactive oxygen species (ROS) assays revealed that BPA application created a more reduced intracellular environment in cultured HEK 293 cells. Furthermore, BPA increased the transactivation activity of ectopic Nrf1 and Nrf2 and increased the expression of ARE-target genes ho-1 and nqo1 at high (100-200 μM) BPA concentrations only. Our study suggests that BPA activates the Nrf1/2-ARE pathway at high (>10 μM) micromolar concentrations. PMID:23360430

  4. Structure-aided prediction of mammalian transcription factor complexes in conserved non-coding elements

    KAUST Repository

    Guturu, H.

    2013-11-11

    Mapping the DNA-binding preferences of transcription factor (TF) complexes is critical for deciphering the functions of cis-regulatory elements. Here, we developed a computational method that compares co-occurring motif spacings in conserved versus unconserved regions of the human genome to detect evolutionarily constrained binding sites of rigid TF complexes. Structural data were used to estimate TF complex physical plausibility, explore overlapping motif arrangements seldom tackled by non-structure-aware methods, and generate and analyse three-dimensional models of the predicted complexes bound to DNA. Using this approach, we predicted 422 physically realistic TF complex motifs at 18% false discovery rate, the majority of which (326, 77%) contain some sequence overlap between binding sites. The set of mostly novel complexes is enriched in known composite motifs, predictive of binding site configurations in TF-TF-DNA crystal structures, and supported by ChIP-seq datasets. Structural modelling revealed three cooperativity mechanisms: direct protein-protein interactions, potentially indirect interactions and \\'through-DNA\\' interactions. Indeed, 38% of the predicted complexes were found to contain four or more bases in which TF pairs appear to synergize through overlapping binding to the same DNA base pairs in opposite grooves or strands. Our TF complex and associated binding site predictions are available as a web resource at http://bejerano.stanford.edu/complex.

  5. Genome-wide profiling of p63 DNA-binding sites identifies an element that regulates gene expression during limb development in the 7q21 SHFM1 locus.

    Directory of Open Access Journals (Sweden)

    Evelyn N Kouwenhoven

    2010-08-01

    Full Text Available Heterozygous mutations in p63 are associated with split hand/foot malformations (SHFM, orofacial clefting, and ectodermal abnormalities. Elucidation of the p63 gene network that includes target genes and regulatory elements may reveal new genes for other malformation disorders. We performed genome-wide DNA-binding profiling by chromatin immunoprecipitation (ChIP, followed by deep sequencing (ChIP-seq in primary human keratinocytes, and identified potential target genes and regulatory elements controlled by p63. We show that p63 binds to an enhancer element in the SHFM1 locus on chromosome 7q and that this element controls expression of DLX6 and possibly DLX5, both of which are important for limb development. A unique micro-deletion including this enhancer element, but not the DLX5/DLX6 genes, was identified in a patient with SHFM. Our study strongly indicates disruption of a non-coding cis-regulatory element located more than 250 kb from the DLX5/DLX6 genes as a novel disease mechanism in SHFM1. These data provide a proof-of-concept that the catalogue of p63 binding sites identified in this study may be of relevance to the studies of SHFM and other congenital malformations that resemble the p63-associated phenotypes.

  6. CONDOR: a database resource of developmentally associated conserved non-coding elements

    Directory of Open Access Journals (Sweden)

    Smith Sarah

    2007-08-01

    Full Text Available Abstract Background Comparative genomics is currently one of the most popular approaches to study the regulatory architecture of vertebrate genomes. Fish-mammal genomic comparisons have proved powerful in identifying conserved non-coding elements likely to be distal cis-regulatory modules such as enhancers, silencers or insulators that control the expression of genes involved in the regulation of early development. The scientific community is showing increasing interest in characterizing the function, evolution and language of these sequences. Despite this, there remains little in the way of user-friendly access to a large dataset of such elements in conjunction with the analysis and the visualization tools needed to study them. Description Here we present CONDOR (COnserved Non-coDing Orthologous Regions available at: http://condor.fugu.biology.qmul.ac.uk. In an interactive and intuitive way the website displays data on > 6800 non-coding elements associated with over 120 early developmental genes and conserved across vertebrates. The database regularly incorporates results of ongoing in vivo zebrafish enhancer assays of the CNEs carried out in-house, which currently number ~100. Included and highlighted within this set are elements derived from duplication events both at the origin of vertebrates and more recently in the teleost lineage, thus providing valuable data for studying the divergence of regulatory roles between paralogs. CONDOR therefore provides a number of tools and facilities to allow scientists to progress in their own studies on the function and evolution of developmental cis-regulation. Conclusion By providing access to data with an approachable graphics interface, the CONDOR database presents a rich resource for further studies into the regulation and evolution of genes involved in early development.

  7. Quantitative analysis of polycomb response elements (PREs at identical genomic locations distinguishes contributions of PRE sequence and genomic environment

    Directory of Open Access Journals (Sweden)

    Okulski Helena

    2011-03-01

    Full Text Available Abstract Background Polycomb/Trithorax response elements (PREs are cis-regulatory elements essential for the regulation of several hundred developmentally important genes. However, the precise sequence requirements for PRE function are not fully understood, and it is also unclear whether these elements all function in a similar manner. Drosophila PRE reporter assays typically rely on random integration by P-element insertion, but PREs are extremely sensitive to genomic position. Results We adapted the ΦC31 site-specific integration tool to enable systematic quantitative comparison of PREs and sequence variants at identical genomic locations. In this adaptation, a miniwhite (mw reporter in combination with eye-pigment analysis gives a quantitative readout of PRE function. We compared the Hox PRE Frontabdominal-7 (Fab-7 with a PRE from the vestigial (vg gene at four landing sites. The analysis revealed that the Fab-7 and vg PREs have fundamentally different properties, both in terms of their interaction with the genomic environment at each site and their inherent silencing abilities. Furthermore, we used the ΦC31 tool to examine the effect of deletions and mutations in the vg PRE, identifying a 106 bp region containing a previously predicted motif (GTGT that is essential for silencing. Conclusions This analysis showed that different PREs have quantifiably different properties, and that changes in as few as four base pairs have profound effects on PRE function, thus illustrating the power and sensitivity of ΦC31 site-specific integration as a tool for the rapid and quantitative dissection of elements of PRE design.

  8. Transuranium elements

    International Nuclear Information System (INIS)

    In this paper, the authors introduce this volume of historical and research papers on the transuranium elements by reviewing the period of discovery of elements 93 and beyond. Then the authors highlight the research achievements that focus on the unique properties of the 5f elements. Finally, the authors outline the technology and applications of transuranium elements and their radiobiology

  9. Human Papillomavirus Type 18 cis-Elements Crucial for Segregation and Latency.

    Directory of Open Access Journals (Sweden)

    Mart Ustav

    Full Text Available Stable maintenance replication is characteristic of the latency phase of HPV infection, during which the viral genomes are actively maintained as extrachromosomal genetic elements in infected proliferating basal keratinocytes. Active replication in the S-phase and segregation of the genome into daughter cells in mitosis are required for stable maintenance replication. Most of our knowledge about papillomavirus genome segregation has come from studies of bovine papillomavirus type 1 (BPV-1, which have demonstrated that the E2 protein cooperates with cellular trans-factors and that E2 binding sites act as cis-regulatory elements in the viral genome that are essential for the segregation process. However, the genomic organization of the regulatory region in HPVs, and the properties of the viral proteins are different from those of their BPV-1 counterparts. We have designed a segregation assay for HPV-18 and used it to demonstrate that the E2 protein performs segregation in combination with at least two E2 binding sites. The cooperative binding of the E2 protein to two E2 binding sites is a major determinant of HPV-18 genome segregation, as demonstrated by the change in spacing between adjacent binding sites #1 and #2 in the HPV-18 Upstream Regulatory Region (URR. Duplication or triplication of the natural 4 bp 5'-CGGG-3' spacer between the E2 binding sites increased the cooperative binding of the E2 molecules as well as E2-dependent segregation. Removal of any spacing between these sites eliminated cooperative binding of the E2 protein and disabled segregation of the URR and HPV-18 genome. Transfer of these configurations of the E2 binding sites into viral genomes confirmed the role of the E2 protein and binding sites #1 and #2 in the segregation process. Additional analysis demonstrated that these sites also play an important role in the transcriptional regulation of viral gene expression from different HPV-18 promoters.

  10. Human Papillomavirus Type 18 cis-Elements Crucial for Segregation and Latency.

    Science.gov (United States)

    Ustav, Mart; Castaneda, Fernando Rodriguez; Reinson, Tormi; Männik, Andres; Ustav, Mart

    2015-01-01

    Stable maintenance replication is characteristic of the latency phase of HPV infection, during which the viral genomes are actively maintained as extrachromosomal genetic elements in infected proliferating basal keratinocytes. Active replication in the S-phase and segregation of the genome into daughter cells in mitosis are required for stable maintenance replication. Most of our knowledge about papillomavirus genome segregation has come from studies of bovine papillomavirus type 1 (BPV-1), which have demonstrated that the E2 protein cooperates with cellular trans-factors and that E2 binding sites act as cis-regulatory elements in the viral genome that are essential for the segregation process. However, the genomic organization of the regulatory region in HPVs, and the properties of the viral proteins are different from those of their BPV-1 counterparts. We have designed a segregation assay for HPV-18 and used it to demonstrate that the E2 protein performs segregation in combination with at least two E2 binding sites. The cooperative binding of the E2 protein to two E2 binding sites is a major determinant of HPV-18 genome segregation, as demonstrated by the change in spacing between adjacent binding sites #1 and #2 in the HPV-18 Upstream Regulatory Region (URR). Duplication or triplication of the natural 4 bp 5'-CGGG-3' spacer between the E2 binding sites increased the cooperative binding of the E2 molecules as well as E2-dependent segregation. Removal of any spacing between these sites eliminated cooperative binding of the E2 protein and disabled segregation of the URR and HPV-18 genome. Transfer of these configurations of the E2 binding sites into viral genomes confirmed the role of the E2 protein and binding sites #1 and #2 in the segregation process. Additional analysis demonstrated that these sites also play an important role in the transcriptional regulation of viral gene expression from different HPV-18 promoters. PMID:26288015

  11. A biophysical model for identifying splicing regulatory elements and their interactions.

    Directory of Open Access Journals (Sweden)

    Ji Wen

    Full Text Available Alternative splicing (AS of precursor mRNA (pre-mRNA is a crucial step in the expression of most eukaryotic genes. Splicing factors (SFs play an important role in AS regulation by binding to the cis-regulatory elements on the pre-mRNA. Although many splicing factors (SFs and their binding sites have been identified, their combinatorial regulatory effects remain to be elucidated. In this paper, we derive a biophysical model for AS regulation that integrates combinatorial signals of cis-acting splicing regulatory elements (SREs and their interactions. We also develop a systematic framework for model inference. Applying the biophysical model to a human RNA-Seq data set, we demonstrate that our model can explain 49.1%-66.5% variance of the data, which is comparable to the best result achieved by biophysical models for transcription. In total, we identified 119 SRE pairs between different regions of cassette exons that may regulate exon or intron definition in splicing, and 77 SRE pairs from the same region that may arise from a long motif or two different SREs bound by different SFs. Particularly, putative binding sites of polypyrimidine tract-binding protein (PTB, heterogeneous nuclear ribonucleoprotein (hnRNP F/H and E/K are identified as interacting SRE pairs, and have been shown to be consistent with the interaction models proposed in previous experimental results. These results show that our biophysical model and inference method provide a means of quantitative modeling of splicing regulation and is a useful tool for identifying SREs and their interactions. The software package for model inference is available under an open source license.

  12. Cis-acting elements in its 3′ UTR mediate post-transcriptional regulation of KRAS

    Science.gov (United States)

    Kim, Minlee; Kogan, Nicole; Slack, Frank J.

    2016-01-01

    Multiple RNA-binding proteins and non-coding RNAs, such as microRNAs (miRNAs), are involved in post-transcriptional gene regulation through recognition motifs in the 3′ untranslated region (UTR) of their target genes. The KRAS gene encodes a key signaling protein, and its messenger RNA (mRNA) contains an exceptionally long 3′ UTR; this suggests that it may be subject to a highly complex set of regulatory processes. However, 3′ UTR-dependent regulation of KRAS expression has not been explored in detail. Using extensive deletion and mutational analyses combined with luciferase reporter assays, we have identified inhibitory and stabilizing cis-acting regions within the KRAS 3′ UTR that may interact with miRNAs and RNA-binding proteins, such as HuR. Particularly, we have identified an AU-rich 49-nt fragment in the KRAS 3′ UTR that is required for KRAS 3′ UTR reporter repression. This element contains a miR-185 complementary element, and we show that overexpression of miR-185 represses endogenous KRAS mRNA and protein in vitro. In addition, we have identified another 49-nt fragment that is required to promote KRAS 3′ UTR reporter expression. These findings indicate that multiple cis-regulatory motifs in the 3′ UTR of KRAS finely modulate its expression, and sequence alterations within a binding motif may disrupt the precise functions of trans-regulatory factors, potentially leading to aberrant KRAS expression. PMID:26930719

  13. Transuranium elements

    International Nuclear Information System (INIS)

    This paper reports that neutron irradiation of uranium, beginning in 1934, led to the reported discovery of such transuranium elements as eka-rhenium. After a few years of investigation these were correctly identified, in December 1938, as fission products. The first real transuranium elements, with atomic numbers 93 and 94 (neptumiun and plutionium), were discovered in 1940-1941. Plutomiun-239 was shown to be fission-able with slow neutrons, and chemical methods for its separation in quantity were developed. Not until it was recognized that transuranium elements should be part of a 14-member actinide series could elements 95 and 96 (americium and curium) be chemically identified after their nuclear synthesis. This new view was the key to the synthesis and identified after their nuclear synthesis. This new view was the key to the synthesis and identification of the next seven transuranium elements, resulting in the completion of the actinide series at element 103 in 1961. The transactinide elements could, according to the actinide concept, also be correctly placed in the periodic table, and the chemical properties of the first transactinide elements, elements 104 and 105 (rutherfordium and hafnium), confirm this point of view. Transuranium elements through number 109 are now known

  14. Cis-regulatory control of the nodal gene, initiator of the sea urchin oral ectoderm gene network

    OpenAIRE

    Nam, Jongmin; Su, Yi-Hsien; Lee, Pei Yun; Robertson, Anthony J; Coffman, James A.; Davidson, Eric H.

    2007-01-01

    Expression of the nodal gene initiates the gene regulatory network which establishes the transcriptional specification of the oral ectoderm in the sea urchin embryo. This gene encodes a TGFβ ligand, and in Strongylocentrotus purpuratus its transcription is activated in the presumptive oral ectoderm at about the 30-cell stage. Thereafter Nodal signaling occurs among all cells of the oral ectoderm territory, and nodal expression is required for expression of oral ectoderm regulatory genes. The ...

  15. In planta analysis of a cis-regulatory cytokinin response motif in Arabidopsis and identification of a novel enhancer sequence.

    Science.gov (United States)

    Ramireddy, Eswarayya; Brenner, Wolfram G; Pfeifer, Andreas; Heyl, Alexander; Schmülling, Thomas

    2013-07-01

    The phytohormone cytokinin plays a key role in regulating plant growth and development, and is involved in numerous physiological responses to environmental changes. The type-B response regulators, which regulate the transcription of cytokinin response genes, are a part of the cytokinin signaling system. Arabidopsis thaliana encodes 11 type-B response regulators (type-B ARRs), and some of them were shown to bind in vitro to the core cytokinin response motif (CRM) 5'-(A/G)GAT(T/C)-3' or, in the case of ARR1, to an extended motif (ECRM), 5'-AAGAT(T/C)TT-3'. Here we obtained in planta proof for the functionality of the latter motif. Promoter deletion analysis of the primary cytokinin response gene ARR6 showed that a combination of two extended motifs within the promoter is required to mediate the full transcriptional activation by ARR1 and other type-B ARRs. CRMs were found to be over-represented in the vicinity of ECRMs in the promoters of cytokinin-regulated genes, suggesting their functional relevance. Moreover, an evolutionarily conserved 27 bp long T-rich region between -220 and -193 bp was identified and shown to be required for the full activation by type-B ARRs and the response to cytokinin. This novel enhancer is not bound by the DNA-binding domain of ARR1, indicating that additional proteins might be involved in mediating the transcriptional cytokinin response. Furthermore, genome-wide expression profiling identified genes, among them ARR16, whose induction by cytokinin depends on both ARR1 and other specific type-B ARRs. This together with the ECRM/CRM sequence clustering indicates cooperative action of different type-B ARRs for the activation of particular target genes. PMID:23620480

  16. A Survey of 6,300 Genomic Fragments for cis-Regulatory Activity in the Imaginal Discs of Drosophila melanogaster

    Directory of Open Access Journals (Sweden)

    Aurélie Jory

    2012-10-01

    Full Text Available Over 6,000 fragments from the genome of Drosophila melanogaster were analyzed for their ability to drive expression of GAL4 reporter genes in the third-instar larval imaginal discs. About 1,200 reporter genes drove expression in the eye, antenna, leg, wing, haltere, or genital imaginal discs. The patterns ranged from large regions to individual cells. About 75% of the active fragments drove expression in multiple discs; 20% were expressed in ventral, but not dorsal, discs (legs, genital, and antenna, whereas ∼23% were expressed in dorsal but not ventral discs (wing, haltere, and eye. Several patterns, for example, within the leg chordotonal organ, appeared a surprisingly large number of times. Unbiased searches for DNA sequence motifs suggest candidate transcription factors that may regulate enhancers with shared activities. Together, these expression patterns provide a valuable resource to the community and offer a broad overview of how transcriptional regulatory information is distributed in the Drosophila genome.

  17. PELTIER ELEMENTS

    CERN Document Server

    Tani, Laurits

    2015-01-01

    To control Peltier elements, temperature controller was used. I used TEC-1091 that was manufactured my Meerstetter Engineering. To gain control with the temperature controller, software had to be intalled on a controlling PC. There were different modes to control the Peltier: Tempererature controller to control temperature, Static current/voltage to control voltage and current and LIVE ON/OFF to auto-tune the controller respectively to the system. Also, since near the collision pipe there is much radiation, radiation-proof Peltier elements have to be used. To gain the best results, I had to find the most efficient Peltier elements and try to get their cold side to -40 degrees Celsius.

  18. Radiographic element

    International Nuclear Information System (INIS)

    Radiographic elements are disclosed having first and second silver halide emulsion layers comprised of a dispersing medium and radiation-sensitive silver halide grains, and a support interposed between said silver halide emulsion layers capable of transmitting radiation to which said second silver halide emulsion layer is responsive. These elements are characterized in that at least said first silver halide emulsion layer contains tabular silver halide grains and spectral sensitizing dye adsorbed to the surface of the grains. Crossover can be improved in relation to the imaging characteristics. (author)

  19. Dynamic regulation of the transcription initiation landscape at single nucleotide resolution during vertebrate embryogenesis

    NARCIS (Netherlands)

    C. Nepal (Chirag); Y. Hadzhiev (Yavor); C. Previti (Christopher); V. Haberle (Vanja); N. Li (Nan); H. Takahashi (Hiroyuki); A.M. Suzuki (Ana Maria); Y. Sheng (Ying); R.F. Abdelhamid (Rehab); S. Anand (Santosh); P.A. Gehrig (Paola A.); A. Akalin (Altuna); C. Kockx (Christel); A. Van Der Sloot (Antoine); W.F.J. van IJcken (Wilfred); O. Armant (Olivier); S. Rastegar (Sepand); C. Watson (Craig); U. Strähle (Uwe); E. Stupka (Elia); P. Carninci (Piero); B. Lenhard (Boris); F. Müller (Ferenc)

    2013-01-01

    textabstractSpatiotemporal control of gene expression is central to animal development. Core promoters represent a previously unanticipated regulatory level by interacting with cis-regulatory elements and transcription initiation in different physiological and developmental contexts. Here, we provid

  20. fRNAdb Summary: FR339005 [

    Lifescience Database Archive (English)

    Full Text Available FR339005 AY205193 Bamboo mosaic virus satellite ... RNA cis-regulatory element mature_transcript Bam ... boo mosaic virus satellite ... RNA RF00389 Rfam v8.1 FR339005.jpg FR339005.png FR ...

  1. fRNAdb Summary: FR332175 [

    Lifescience Database Archive (English)

    Full Text Available FR332175 AY205219 Bamboo mosaic virus satellite ... RNA cis-regulatory element mature_transcript Bam ... boo mosaic virus satellite ... RNA RF00389 Rfam v8.1 FR332175.jpg FR332175.png FR ...

  2. fRNAdb Summary: FR219993 [

    Lifescience Database Archive (English)

    Full Text Available FR219993 AY205172 Bamboo mosaic virus satellite ... RNA cis-regulatory element mature_transcript Bam ... boo mosaic virus satellite ... RNA RF00389 Rfam v8.1 FR219993.jpg FR219993.png FR ...

  3. fRNAdb Summary: FR039440 [

    Lifescience Database Archive (English)

    Full Text Available FR039440 AY205214 Bamboo mosaic virus satellite ... RNA cis-regulatory element mature_transcript Bam ... boo mosaic virus satellite ... RNA RF00389 Rfam v8.1 FR039440.jpg FR039440.png FR ...

  4. fRNAdb Summary: FR188013 [

    Lifescience Database Archive (English)

    Full Text Available FR188013 AY205231 Bamboo mosaic virus satellite ... RNA cis-regulatory element mature_transcript Bam ... boo mosaic virus satellite ... RNA RF00389 Rfam v8.1 FR188013.jpg FR188013.png FR ...

  5. fRNAdb Summary: FR216193 [

    Lifescience Database Archive (English)

    Full Text Available FR216193 AY205201 Bamboo mosaic virus satellite ... RNA cis-regulatory element mature_transcript Bam ... boo mosaic virus satellite ... RNA RF00389 Rfam v8.1 FR216193.jpg FR216193.png FR ...

  6. fRNAdb Summary: FR221490 [

    Lifescience Database Archive (English)

    Full Text Available FR221490 AY205202 Bamboo mosaic virus satellite ... RNA cis-regulatory element mature_transcript Bam ... boo mosaic virus satellite ... RNA RF00389 Rfam v8.1 FR221490.jpg FR221490.png FR ...

  7. fRNAdb Summary: FR350837 [

    Lifescience Database Archive (English)

    Full Text Available FR350837 AY205217 Bamboo mosaic virus satellite ... RNA cis-regulatory element mature_transcript Bam ... boo mosaic virus satellite ... RNA RF00389 Rfam v8.1 FR350837.jpg FR350837.png FR ...

  8. fRNAdb Summary: FR097495 [

    Lifescience Database Archive (English)

    Full Text Available FR097495 AY205170 Bamboo mosaic virus satellite ... RNA cis-regulatory element mature_transcript Bam ... boo mosaic virus satellite ... RNA RF00389 Rfam v8.1 FR097495.jpg FR097495.png FR ...

  9. fRNAdb Summary: FR294235 [

    Lifescience Database Archive (English)

    Full Text Available FR294235 AY205209 Bamboo mosaic virus satellite ... RNA cis-regulatory element mature_transcript Bam ... boo mosaic virus satellite ... RNA RF00389 Rfam v8.1 FR294235.jpg FR294235.png FR ...

  10. fRNAdb Summary: FR178054 [

    Lifescience Database Archive (English)

    Full Text Available FR178054 AY205197 Bamboo mosaic virus satellite ... RNA cis-regulatory element mature_transcript Bam ... boo mosaic virus satellite ... RNA RF00389 Rfam v8.1 FR178054.jpg FR178054.png FR ...

  11. fRNAdb Summary: FR284890 [

    Lifescience Database Archive (English)

    Full Text Available FR284890 AY205184 Bamboo mosaic virus satellite ... RNA cis-regulatory element mature_transcript Bam ... boo mosaic virus satellite ... RNA RF00389 Rfam v8.1 FR284890.jpg FR284890.png FR ...

  12. fRNAdb Summary: FR319601 [

    Lifescience Database Archive (English)

    Full Text Available FR319601 AY205216 Bamboo mosaic virus satellite ... RNA cis-regulatory element mature_transcript Bam ... boo mosaic virus satellite ... RNA RF00389 Rfam v8.1 FR319601.jpg FR319601.png FR ...

  13. fRNAdb Summary: FR378206 [

    Lifescience Database Archive (English)

    Full Text Available FR378206 AY205220 Bamboo mosaic virus satellite ... RNA cis-regulatory element mature_transcript Bam ... boo mosaic virus satellite ... RNA RF00389 Rfam v8.1 FR378206.jpg FR378206.png FR ...

  14. fRNAdb Summary: FR074834 [

    Lifescience Database Archive (English)

    Full Text Available FR074834 AY205212 Bamboo mosaic virus satellite ... RNA cis-regulatory element mature_transcript Bam ... boo mosaic virus satellite ... RNA RF00389 Rfam v8.1 FR074834.jpg FR074834.png FR ...

  15. fRNAdb Summary: FR073577 [

    Lifescience Database Archive (English)

    Full Text Available FR073577 AY205213 Bamboo mosaic virus satellite ... RNA cis-regulatory element mature_transcript Bam ... boo mosaic virus satellite ... RNA RF00389 Rfam v8.1 FR073577.jpg FR073577.png FR ...

  16. fRNAdb Summary: FR202046 [

    Lifescience Database Archive (English)

    Full Text Available FR202046 AY205229 Bamboo mosaic virus satellite ... RNA cis-regulatory element mature_transcript Bam ... boo mosaic virus satellite ... RNA RF00389 Rfam v8.1 FR202046.jpg FR202046.png FR ...

  17. fRNAdb Summary: FR293211 [

    Lifescience Database Archive (English)

    Full Text Available FR293211 AY205174 Bamboo mosaic virus satellite ... RNA cis-regulatory element mature_transcript Bam ... boo mosaic virus satellite ... RNA RF00389 Rfam v8.1 FR293211.jpg FR293211.png FR ...

  18. fRNAdb Summary: FR093485 [

    Lifescience Database Archive (English)

    Full Text Available FR093485 AY205228 Bamboo mosaic virus satellite ... RNA cis-regulatory element mature_transcript Bam ... boo mosaic virus satellite ... RNA RF00389 Rfam v8.1 FR093485.jpg FR093485.png FR ...

  19. fRNAdb Summary: FR327816 [

    Lifescience Database Archive (English)

    Full Text Available FR327816 AY205176 Bamboo mosaic virus satellite ... RNA cis-regulatory element mature_transcript Bam ... boo mosaic virus satellite ... RNA RF00389 Rfam v8.1 FR327816.jpg FR327816.png FR ...

  20. fRNAdb Summary: FR249942 [

    Lifescience Database Archive (English)

    Full Text Available FR249942 AY205218 Bamboo mosaic virus satellite ... RNA cis-regulatory element mature_transcript Bam ... boo mosaic virus satellite ... RNA RF00389 Rfam v8.1 FR249942.jpg FR249942.png FR ...

  1. fRNAdb Summary: FR054881 [

    Lifescience Database Archive (English)

    Full Text Available FR054881 AY205222 Bamboo mosaic virus satellite ... RNA cis-regulatory element mature_transcript Bam ... boo mosaic virus satellite ... RNA RF00389 Rfam v8.1 FR054881.jpg FR054881.png FR ...

  2. fRNAdb Summary: FR142536 [

    Lifescience Database Archive (English)

    Full Text Available FR142536 AY205199 Bamboo mosaic virus satellite ... RNA cis-regulatory element mature_transcript Bam ... boo mosaic virus satellite ... RNA RF00389 Rfam v8.1 FR142536.jpg FR142536.png FR ...

  3. fRNAdb Summary: FR023014 [

    Lifescience Database Archive (English)

    Full Text Available FR023014 AY205210 Bamboo mosaic virus satellite ... RNA cis-regulatory element mature_transcript Bam ... boo mosaic virus satellite ... RNA RF00389 Rfam v8.1 FR023014.jpg FR023014.png FR ...

  4. fRNAdb Summary: FR079719 [

    Lifescience Database Archive (English)

    Full Text Available FR079719 AY205224 Bamboo mosaic virus satellite ... RNA cis-regulatory element mature_transcript Bam ... boo mosaic virus satellite ... RNA RF00389 Rfam v8.1 FR079719.jpg FR079719.png FR ...

  5. fRNAdb Summary: FR333794 [

    Lifescience Database Archive (English)

    Full Text Available FR333794 AY205225 Bamboo mosaic virus satellite ... RNA cis-regulatory element mature_transcript Bam ... boo mosaic virus satellite ... RNA RF00389 Rfam v8.1 FR333794.jpg FR333794.png FR ...

  6. fRNAdb Summary: FR260751 [

    Lifescience Database Archive (English)

    Full Text Available FR260751 AY205211 Bamboo mosaic virus satellite ... RNA cis-regulatory element mature_transcript Bam ... boo mosaic virus satellite ... RNA RF00389 Rfam v8.1 FR260751.jpg FR260751.png FR ...

  7. fRNAdb Summary: FR029846 [

    Lifescience Database Archive (English)

    Full Text Available FR029846 AY205226 Bamboo mosaic virus satellite ... RNA cis-regulatory element mature_transcript Bam ... boo mosaic virus satellite ... RNA RF00389 Rfam v8.1 FR029846.jpg FR029846.png FR ...

  8. fRNAdb Summary: FR003009 [

    Lifescience Database Archive (English)

    Full Text Available FR003009 AY205164 Bamboo mosaic virus satellite ... RNA cis-regulatory element mature_transcript Bam ... boo mosaic virus satellite ... RNA RF00389 Rfam v8.1 FR003009.jpg FR003009.png FR ...

  9. fRNAdb Summary: FR208256 [

    Lifescience Database Archive (English)

    Full Text Available FR208256 AY205182 Bamboo mosaic virus satellite ... RNA cis-regulatory element mature_transcript Bam ... boo mosaic virus satellite ... RNA RF00389 Rfam v8.1 FR208256.jpg FR208256.png FR ...

  10. fRNAdb Summary: FR260595 [

    Lifescience Database Archive (English)

    Full Text Available FR260595 AY205221 Bamboo mosaic virus satellite ... RNA cis-regulatory element mature_transcript Bam ... boo mosaic virus satellite ... RNA RF00389 Rfam v8.1 FR260595.jpg FR260595.png FR ...

  11. fRNAdb Summary: FR305973 [

    Lifescience Database Archive (English)

    Full Text Available FR305973 AY205215 Bamboo mosaic virus satellite ... RNA cis-regulatory element mature_transcript Bam ... boo mosaic virus satellite ... RNA RF00389 Rfam v8.1 FR305973.jpg FR305973.png FR ...

  12. fRNAdb Summary: FR119661 [

    Lifescience Database Archive (English)

    Full Text Available FR119661 AY205223 Bamboo mosaic virus satellite ... RNA cis-regulatory element mature_transcript Bam ... boo mosaic virus satellite ... RNA RF00389 Rfam v8.1 FR119661.jpg FR119661.png FR ...

  13. fRNAdb Summary: FR294358 [

    Lifescience Database Archive (English)

    Full Text Available FR294358 AY205169 Bamboo mosaic virus satellite ... RNA cis-regulatory element mature_transcript Bam ... boo mosaic virus satellite ... RNA RF00389 Rfam v8.1 FR294358.jpg FR294358.png FR ...

  14. fRNAdb Summary: FR200226 [

    Lifescience Database Archive (English)

    Full Text Available FR200226 AY205230 Bamboo mosaic virus satellite ... RNA cis-regulatory element mature_transcript Bam ... boo mosaic virus satellite ... RNA RF00389 Rfam v8.1 FR200226.jpg FR200226.png FR ...

  15. Reference: SRENTTTO1 [PLACE

    Lifescience Database Archive (English)

    Full Text Available SRENTTTO1 Takeda S, Sugimoto K, Otsuki H, Hirochika H A 13-bp cis-regulatory element in the LTR ... poson Tto1 is involved in responsiveness to tissue culture , wounding, methyl jasmonate and fungal elicitors P ...

  16. Radiographic element

    International Nuclear Information System (INIS)

    Radiographic elements are disclosed comprised of first and second silver halide emulsion layers separated by an interposed support capable of transmitting radiation to which the second image portion is responsive. At least the first imaging portion contains a silver halide emulsion in which thin tubular silver halide grains of intermediate aspect ratios (from 5:1 to 8:1) are present. Spectral sensitizing dye is adsorbed to the surface of the tubular grains. Increased photographic speeds can be realized at comparable levels of crossover. (author)

  17. Superheavy elements

    CERN Document Server

    Hofmann, S

    1999-01-01

    The outstanding aim of experimental investigations of heavy nuclei is the exploration of spherical 'SuperHeavy Elements' (SHEs). On the basis of the nuclear shell model, the next double magic shell-closure beyond sup 2 sup 0 sup 8 Pb is predicted at proton numbers between Z=114 and 126 and at neutron number N=184. All experimental efforts aiming at identifying SHEs (Z>=114) were negative so far. A highly sensitive search experiment was performed in November-December 1995 at SHIP. The isotope sup 2 sup 9 sup 0 116 produced by 'radiative capture' was searched for in the course of a 33 days irradiation of a sup 2 sup 0 sup 8 Pb target with sup 8 sup 2 Se projectiles, however, only cross-section limits were measured. Positive results were obtained in experiments searching for elements from 110 to 112 using cold fusion and the 1n evaporation channel. The produced isotopes were unambiguously identified by means of alpha-alpha correlations. Not fission, but alpha emission is the dominant decay mode. The measurement ...

  18. Genome-wide discovery of human heart enhancers

    OpenAIRE

    Narlikar, Leelavati; Sakabe, Noboru J.; Blanski, Alexander A.; Arimura, Fabio E.; Westlund, John M.; Nobrega, Marcelo A.; Ovcharenko, Ivan

    2010-01-01

    The various organogenic programs deployed during embryonic development rely on the precise expression of a multitude of genes in time and space. Identifying the cis-regulatory elements responsible for this tightly orchestrated regulation of gene expression is an essential step in understanding the genetic pathways involved in development. We describe a strategy to systematically identify tissue-specific cis-regulatory elements that share combinations of sequence motifs. Using heart developmen...

  19. Heavy elements (I). From transuranium elements to superheavy elements

    International Nuclear Information System (INIS)

    History of the synthesis and discovery of heavy elements starting from 93 is reviewed. This article describes the story of thrilling competition for the discovery of new elements with increasing difficulties as the atomic number increases, beginning the 93 element, neptunium. Particularly, competition between USA and USSR has lasted from 102 to 106 element and was unsettled until a new aspect was developed in relation with the superheavy elements theoretically predicted. Here, the search of naturally occurring superheavy elements is briefly explained as an introduction to the present and future perspectives of the research on the superheavy elements which is appearing in the succeeding article. (author)

  20. Dissecting the fission yeast regulatory network reveals phase-specific control elements of its cell cycle

    Directory of Open Access Journals (Sweden)

    Liu Liwen

    2009-09-01

    Full Text Available Abstract Background Fission yeast Schizosaccharomyces pombe and budding yeast Saccharomyces cerevisiae are among the original model organisms in the study of the cell-division cycle. Unlike budding yeast, no large-scale regulatory network has been constructed for fission yeast. It has only been partially characterized. As a result, important regulatory cascades in budding yeast have no known or complete counterpart in fission yeast. Results By integrating genome-wide data from multiple time course cell cycle microarray experiments we reconstructed a gene regulatory network. Based on the network, we discovered in addition to previously known regulatory hubs in M phase, a new putative regulatory hub in the form of the HMG box transcription factor SPBC19G7.04. Further, we inferred periodic activities of several less known transcription factors over the course of the cell cycle, identified over 500 putative regulatory targets and detected many new phase-specific and conserved cis-regulatory motifs. In particular, we show that SPBC19G7.04 has highly significant periodic activity that peaks in early M phase, which is coordinated with the late G2 activity of the forkhead transcription factor fkh2. Finally, using an enhanced Bayesian algorithm to co-cluster the expression data, we obtained 31 clusters of co-regulated genes 1 which constitute regulatory modules from different phases of the cell cycle, 2 whose phase order is coherent across the 10 time course experiments, and 3 which lead to identification of phase-specific control elements at both the transcriptional and post-transcriptional levels in S. pombe. In particular, the ribosome biogenesis clusters expressed in G2 phase reveal new, highly conserved RNA motifs. Conclusion Using a systems-level analysis of the phase-specific nature of the S. pombe cell cycle gene regulation, we have provided new testable evidence for post-transcriptional regulation in the G2 phase of the fission yeast cell cycle

  1. Adaptive evolution of HoxA-11 and HoxA-13 at the origin of the uterus in mammals.

    OpenAIRE

    Lynch, Vincent J.; Roth, Jutta J; Takahashi, Kazuhiko; Dunn, Casey W.; Nonaka, Daisuke F.; Stopper, Geffrey F.; Wagner, Günter P.

    2004-01-01

    The evolution of morphological characters is mediated by the evolution of developmental genes. Evolutionary changes can either affect cis-regulatory elements, leading to differences in their temporal and spatial regulation, or affect the coding region. Although there is ample evidence for the importance of cis-regulatory evolution, it has only recently been shown that transcription factors do not remain functionally equivalent during evolution. These results suggest that the evolution of tran...

  2. Conservation and Evolution of Cis-Regulatory Systems in Ascomycete Fungi

    OpenAIRE

    Gasch Audrey P; Moses Alan M; Chiang Derek Y; Fraser Hunter B; Berardini Mark; Eisen Michael B

    2004-01-01

    Relatively little is known about the mechanisms through which gene expression regulation evolves. To investigate this, we systematically explored the conservation of regulatory networks in fungi by examining the cis-regulatory elements that govern the expression of coregulated genes. We first identified groups of coregulated Saccharomyces cerevisiae genes enriched for genes with known upstream or downstream cis-regulatory sequences. Reasoning that many of these gene groups are coregulated in ...

  3. Transient expression of the cloned mouse c-Ha-ras 5' upstream region in transfected primary SENCAR mouse keratinocytes demonstrates its power as a promoter element.

    Science.gov (United States)

    Neades, R; Betz, N A; Sheng, X Y; Pelling, J C

    1991-01-01

    The mouse Ha-ras oncogene is activated by point mutation and overexpressed in developing papillomas during two-stage skin carcinogenesis in SENCAR mice. One of our research aims is to characterize the factors regulating Ha-ras gene expression at the transcriptional level in SENCAR mouse epidermis. Towards this goal, we sequenced 1400 bp of the 5' upstream region of the mouse Ha-ras gene so as to characterize various cis-regulatory elements present in the gene. We identified seven sites with the proper consensus sequence for binding the SP1 transcription factor and three potential binding sites for the CTF-1 factor. In addition, we located a 13-base sequence with 92% homology to the consensus sequence for an estrogen response element and two hexamers with consensus sequences identical to the core sequence of the glucocorticoid response element. A series of transient gene expression vectors was constructed in which various regions of the mouse Ha-ras 5' upstream region were fused to the chloramphenicol acetyltransferase (CAT) gene. These expression plasmids were transfected into newborn and adult primary SENCAR epidermal cells, the epidermal cell population that presumably contains the stem cells involved in two-stage skin tumorigenesis. Transient gene expression assays carried out after 48-72 h indicated that a 2.3-kb Ha-ras 5' fragment produced CAT activity comparable to that produced by pSV2CAT and pdolCMVCAT, both of which are plasmids with strong viral promoters and enhancers driving CAT gene expression. Maintenance of transfected keratinocytes under both nondifferentiating (0.05 mM calcium) and differentiating (1.2 mM calcium) culture conditions demonstrated that the mouse Ha-ras upstream region was relatively unresponsive to changes in calcium concentration in transient expression assays carried out in either newborn or adult keratinocytes. Our results demonstrated the power of the cloned mouse Ha-ras promoter and upstream region in driving transient gene

  4. Discrete Element Modeling

    Energy Technology Data Exchange (ETDEWEB)

    Morris, J; Johnson, S

    2007-12-03

    The Distinct Element Method (also frequently referred to as the Discrete Element Method) (DEM) is a Lagrangian numerical technique where the computational domain consists of discrete solid elements which interact via compliant contacts. This can be contrasted with Finite Element Methods where the computational domain is assumed to represent a continuum (although many modern implementations of the FEM can accommodate some Distinct Element capabilities). Often the terms Discrete Element Method and Distinct Element Method are used interchangeably in the literature, although Cundall and Hart (1992) suggested that Discrete Element Methods should be a more inclusive term covering Distinct Element Methods, Displacement Discontinuity Analysis and Modal Methods. In this work, DEM specifically refers to the Distinct Element Method, where the discrete elements interact via compliant contacts, in contrast with Displacement Discontinuity Analysis where the contacts are rigid and all compliance is taken up by the adjacent intact material.

  5. The Ekamanganese elements

    International Nuclear Information System (INIS)

    A recent study tends to revalidate the search for element 43 done in 1925. In ores with properties similar to the hypothetical chemical properties of the missing elements 43 and 75, the unknown elements were concentrated by chemical means. Roentgen-ray spectroscopy was applied in order to observe the characteristic Roentgen L lines for element 75 and K lines for element 43. Element 43 was observed in sperrylith, gadolinit, fergusonit and columbit. The name masurium was proposed. Similarly, element 75 was observed in tantalit, wolframit and platinit. The name rhenium was chosen. (MCB)

  6. Fuel element design handbook

    Energy Technology Data Exchange (ETDEWEB)

    Merckx, K.R.

    1958-09-01

    The economic development of nuclear reactors depends upon the integrated progress in the fields of reactor design, fuel element design, reactor operation, and fuel production and separation. Broad criteria, which restrict the fuel element design, are determined by the mutual consideration of the problems encountered in all the above fields. Hence, no stage of reactor design or operation is independent of the fuel element problem, nor can the fuel element designer disregard the interest of any one field. As an introduction to the fuel element design problem, this chapter describes how the general criteria for a fuel element are determined.

  7. Isolation and analysis of MPF2-like MADS-box genes from Physaleae and characterization of their cis-regulatory regions

    OpenAIRE

    Riß, Simone

    2009-01-01

    Species with large inflated lantern-like calyces occur in several genera of the family Solanaceae. In Physalis, this morphological novelty has been termed �Chinese lantern� or �Inflated-Calyx-Syndrome� (ICS). It has been shown that in Physalis floridana the MADS-box transcription factor MPF2 is expressed in floral organs, while expression of its ortholog STMADS16 from Solanum tuberosum is solely restricted to vegetative tissues. Expression of MPF2 in floral organs is not only important for fo...

  8. Data Element Registry Services

    Data.gov (United States)

    U.S. Environmental Protection Agency — Data Element Registry Services (DERS) is a resource for information about value lists (aka code sets / pick lists), data dictionaries, data elements, and EPA data...

  9. Rare (Earth Elements [score

    Directory of Open Access Journals (Sweden)

    Camilo Méndez

    2014-12-01

    Full Text Available Rare (Earth Elements is a cycle of works for solo piano. The cycle was inspired by James Dillon’s Book of Elements (Vol. I-V. The complete cycle will consist of 14 pieces; one for each selected rare (earth element. The chosen elements are Neodymium, Erbium, Tellurium, Hafnium, Tantalum, Technetium, Indium, Dysprosium, Lanthanium, Cerium, Europium, Terbium, Yttrium and Darmstadtium. These elements were selected due to their special atomic properties that in many cases make them extremely valuable for the development of new technologies, and also because of their scarcity. To date, only 4 works have been completed Yttrium, Technetium, Indium and Tellurium.

  10. Properties of elements

    International Nuclear Information System (INIS)

    An element, in its chemical definition, is a common entity to the different variants of a simple substance and to the combinations of this substance with others. The place of an element in the periodic system is indicated by its atomic number (number of protons of the nucleus). The isotopes of a same element differ by the number of neutrons. Ninety-three elements exist naturally and 20 others have been produced artificially. This article presents the main properties of the elements summarized in tables: general properties (atomic number, name, symbol, atomic mass, electronic structure, first ionization energy, electronic affinity, oxidation number, density, fusion and boiling temperatures), the atomic and metallic radii, the electronegativity, the atomic mass and period of the main radionuclides, the historical discovery of the elements and their relative abundance on the Earth. (J.S.)

  11. The synthetic elements

    International Nuclear Information System (INIS)

    Prior to 1940, the heaviest element known was uranium, discovered in 1789. Since that time the elements 93 through 109 have been synthesized and identified and the elements 43, 61, 85, and 87 which were missing form the periodic tables of the 1930's have been discovered. The techniques and problems involved in these discoveries and the placement of the transuranium elements in the periodic table will be discussed. The production and positive identification of elements heavier than Md (Z=101), which have very short half-lives and can only be produced an atom-at-a-time, are very difficult and there have been controversies concerning their discovery. Some of the new methods which have been developed and used in these studies will be described. The prospects for production of still heavier elements will be considered

  12. The solar element

    DEFF Research Database (Denmark)

    Kragh, Helge

    2009-01-01

    of the nineteenth century. In the modest form of a yellow spectral line known as D3, 'helium' was sometimes supposed to exist in the Sun's atmosphere, an idea which is traditionally ascribed to J. Norman Lockyer. Did Lockyer discover helium as a solar element? How was the suggestion received by chemists, physicists...... and astronomers in the period until the spring of 1895, when William Ramsay serendipitously found the gas in uranium minerals? The hypothetical element helium was fairly well known, yet Ramsay's discovery owed little or nothing to Lockyer's solar element. Indeed, for a brief while it was thought that the two...... elements might be different. The complex story of how helium became established as both a solar and terrestrial element involves precise observations as well as airy speculations. It is a story that is unique among the discovery histories of the chemical elements....

  13. The synthetic elements

    Energy Technology Data Exchange (ETDEWEB)

    Hoffman, D.C.

    1990-05-01

    Prior to 1940, the heaviest element known was uranium, discovered in 1789. Since that time the elements 93 through 109 have been synthesized and identified and the elements 43, 61, 85, and 87 which were missing form the periodic tables of the 1930's have been discovered. The techniques and problems involved in these discoveries and the placement of the transuranium elements in the periodic table will be discussed. The production and positive identification of elements heavier than Md (Z=101), which have very short half-lives and can only be produced an atom-at-a-time, are very difficult and there have been controversies concerning their discovery. Some of the new methods which have been developed and used in these studies will be described. The prospects for production of still heavier elements will be considered.

  14. Element Level Semantic Matching

    OpenAIRE

    Giunchiglia, Fausto; Yatskevich, Mikalai

    2004-01-01

    We think of Match as an operator which takes two graph-like structures and produces a mapping between semantically related nodes. The matching process is essentially divided into two steps: element level and structure level. Element level matchers consider only labels of nodes, while structure level matchers start from this information to consider the full graph. In this paper we present various element level semantic matchers, and discuss their implementation within the S-Match system. The m...

  15. Elements in biological AMS

    International Nuclear Information System (INIS)

    AMS (Accelerator Mass Spectrometry) provides high detection sensitivity for isotopes whose half-lives are between 10 years and 100 million years. 14C is the most developed of such isotopes and is used in tracing natural and anthropogenic organic compounds in the Earth's biosphere. Thirty-three elements in the main periodic table and 17 lanthanides or actinides have long lived isotopes, providing potential tracers for research in elemental biochemistry. Overlap of biologically interesting heavy elements and possible AMS tracers is discussed

  16. Chemistry of superheavy elements

    Energy Technology Data Exchange (ETDEWEB)

    Schaedel, M. [Japan Atomic Energy Agency, Tokai, Ibaraki (Japan). Advanced Science Research Center; GSI Helmholtz Center for Heavy Ion Research, Darmstadt (Germany)

    2012-07-01

    The chemistry of superheavy elements - or transactinides from their position in the Periodic Table - is summarized. After giving an overview over historical developments, nuclear aspects about synthesis of neutron-rich isotopes of these elements, produced in hot-fusion reactions, and their nuclear decay properties are briefly mentioned. Specific requirements to cope with the one-atom-at-a-time situation in automated chemical separations and recent developments in aqueous-phase and gas-phase chemistry are presented. Exciting, current developments, first applications, and future prospects of chemical separations behind physical recoil separators ('pre-separator') are discussed in detail. The status of our current knowledge about the chemistry of rutherfordium (Rf, element 104), dubnium (Db, element 105), seaborgium (Sg, element 106), bohrium (Bh, element 107), hassium (Hs, element 108), copernicium (Cn, element 112), and element 114 is discussed from an experimental point of view. Recent results are emphasized and compared with empirical extrapolations and with fully-relativistic theoretical calculations, especially also under the aspect of the architecture of the Periodic Table. (orig.)

  17. Chemistry of superheavy elements

    International Nuclear Information System (INIS)

    The chemistry of superheavy elements - or transactinides from their position in the Periodic Table - is summarized. After giving an overview over historical developments, nuclear aspects about synthesis of neutron-rich isotopes of these elements, produced in hot-fusion reactions, and their nuclear decay properties are briefly mentioned. Specific requirements to cope with the one-atom-at-a-time situation in automated chemical separations and recent developments in aqueous-phase and gas-phase chemistry are presented. Exciting, current developments, first applications, and future prospects of chemical separations behind physical recoil separators ('pre-separator') are discussed in detail. The status of our current knowledge about the chemistry of rutherfordium (Rf, element 104), dubnium (Db, element 105), seaborgium (Sg, element 106), bohrium (Bh, element 107), hassium (Hs, element 108), copernicium (Cn, element 112), and element 114 is discussed from an experimental point of view. Recent results are emphasized and compared with empirical extrapolations and with fully-relativistic theoretical calculations, especially also under the aspect of the architecture of the Periodic Table. (orig.)

  18. Stochastic finite element method with simple random elements

    OpenAIRE

    Starkloff, Hans-Jörg

    2008-01-01

    We propose a variant of the stochastic finite element method, where the random elements occuring in the problem formulation are approximated by simple random elements, i.e. random elements with only a finite number of possible values.

  19. BSCW Unstructured Mixed Element Grids

    Data.gov (United States)

    National Aeronautics and Space Administration — Corase Grid: Quad Surface Faces= 9360 Tria Surface Faces= 128928 Nodes = 2869187 Total Elements = 9099201 Hex Elements = 0 Pent_5 Elements = 0 Pent_6 Elements =...

  20. Main: -300ELEMENT [PLACE

    Lifescience Database Archive (English)

    Full Text Available -300ELEMENT S000122 11-May-2006 (last modified) kehi Present upstream of the promoter from the B ... liadin, and low molecular weight glutenin genes of wheat ; See S000001 -300CORE; See S000002 -300MOTIF; -300 ... element; hordein; gliadin; glutenin; seed; wheat ... (Triticum aestivum) TGHAAARK ...

  1. Proceedings of transuranium elements

    International Nuclear Information System (INIS)

    The identification of the first synthetic elements was established by chemical evidence. Conclusive proof of the synthesis of the first artificial element, technetium, was published in 1937 by Perrier and Segre. An essential aspect of their achievement was the prediction of the chemical properties of element 43, which had been missing from the periodic table and which was expected to have properties similar to those of manganese and rhenium. The discovery of other artificial elements, astatine and francium, was facilitated in 1939-1940 by the prediction of their chemical properties. A little more than 50 years ago, in the spring of 1940, Edwin McMillan and Philip Abelson synthesized element 93, neptunium, and confirmed its uniqueness by chemical means. On August 30, 1940, Glenn Seaborg, Arthur Wahl, and the late Joseph Kennedy began their neutron irradiations of uranium nitrate hexahydrate. A few months later they synthesized element 94, later named plutonium, by observing the alpha particles emitted from uranium oxide targets that had been bombarded with deuterons. Shortly thereafter they proved that is was the second transuranium element by establishing its unique oxidation-reduction behavior. The symposium honored the scientists and engineers whose vision and dedication led to the discovery of the transuranium elements and to the understanding of the influence of 5f electrons on their electronic structure and bonding. This volume represents a record of papers presented at the symposium

  2. Elements of life

    OpenAIRE

    Samuel, J.

    2004-01-01

    A Biography of J.M.W. Turner's life told through the use of the elements. A five screen video installation. This is the Main Screen which was complimented by four video screens to represent each element.Shown at the Community Pharmacy Gallery May 2004.

  3. The Elements of Empathy.

    Science.gov (United States)

    Iannotti, Ronald J.

    When assessing the influence of empathy on prosocial motivation, analyzing empathy alone would lead to a misunderstanding. We must also assess other elements of the situation, such as the altruist's coping skills and situational constraints. In a similar manner empathy itself should be conceptualized as a process with many elements. One way to…

  4. Flow Element Models

    DEFF Research Database (Denmark)

    Heiselberg, Per; Nielsen, Peter V.

    Air distribution in ventilated rooms is a flow process that can be divided into different elements such as supply air jets, exhaust flows, thermal plumes, boundary layer flows, infiltration and gravity currents. These flow elements are isolated volumes where the air movement is controlled by a re...... restricted number of parameters, and the air movement is fairly independent of the general flow in the enclosure. In many practical situations, the most convenient· method is to design the air distribution system using flow element theory.......Air distribution in ventilated rooms is a flow process that can be divided into different elements such as supply air jets, exhaust flows, thermal plumes, boundary layer flows, infiltration and gravity currents. These flow elements are isolated volumes where the air movement is controlled by a...

  5. NUCLEAR REACTOR FUEL ELEMENT

    Science.gov (United States)

    Wheelock, C.W.; Baumeister, E.B.

    1961-09-01

    A reactor fuel element utilizing fissionable fuel materials in plate form is described. This fuel element consists of bundles of fuel-bearing plates. The bundles are stacked inside of a tube which forms the shell of the fuel element. The plates each have longitudinal fins running parallel to the direction of coolant flow, and interspersed among and parallel to the fins are ribs which position the plates relative to each other and to the fuel element shell. The plate bundles are held together by thin bands or wires. The ex tended surface increases the heat transfer capabilities of a fuel element by a factor of 3 or more over those of a simple flat plate.

  6. Monolithic freeform element

    Science.gov (United States)

    Kiontke, Sven R.

    2015-09-01

    For 10 years there has been the asphere as one of the new products to be accepted by the market. All parts of the chain design, production and measurement needed to learn how to treat the asphere and what it is helpful for. The aspheric optical element now is established and accepted as an equal optical element between other as a fast growing part of all the optical elements. Now we are focusing onto the next new element with a lot of potential, the optical freeform surface. Manufacturing results will be shown for fully tolerance optic including manufacturing, setup and optics configurations including measurement setup. The element itself is a monolith consisting of several optical surfaces that have to be aligned properly to each other. The freeform surface is measured for surface form tolerance (irregularity, slope, Zernike, PV).

  7. Phase constitution and steam corrosion resistance of binary Zr-S alloys

    International Nuclear Information System (INIS)

    The solubility limit of sulfur in alpha zirconium is about 20 ppm. This value is similar to the sulfur content leading to the maximum improvement in creep strength. In amounts up to 850 ppm, sulfur also has an extremely beneficial effect on the steam corrosion resistance at 400 deg. C. Thus, while sulfur in solid solution markedly enhances creep strength, the presence of sulfide precipitates has an additional favorable influence on the corrosion behavior

  8. The heaviest elements

    International Nuclear Information System (INIS)

    How long does an atom need to ''exist before it's possible to do any meaningful chemistry on it? Is it possible to learn anything at all about the reactions of an element for which no more than a few dozen atoms have ever existed simultaneously? These are some of the questions colleagues in a few laboratories worldwide attempt to answer as they investigate the chemistry of the heaviest elements--elements produced one atom at a time in accelerators by bombarding radioactive targets with high-intensity beams of heavy ions. All of these elements spontaneously decay; the most stable of them have half-lives of only a few minutes, some that are less stable exist for only milliseconds. So far, no chemical studies have been performed on elements whose longest lived isotopes last only milliseconds because the difficulties of doing chemistry on this time scale under highly radioactive conditions are enormous. Over the past 10 years, however, nuclear chemists have developed new techniques or adapted existing ones to begin to probe the chemical properties of those very heavy elements that have half-lives in the range of seconds to minutes. Although the classic experiments are now nearly 40 years old, they are worth describing, as they were the first of their kind and illustrate many of the techniques that are still used and essential in studying these very short-lived, radioactive elements

  9. System Elements Heterogeneity

    Directory of Open Access Journals (Sweden)

    Stanislav A. Kuja

    2013-01-01

    Full Text Available The paper deals with the features of the systematic approach development, shows that the systematic approach lacks the definition of system elements divisibility. This fact simplifies the system description. The article shows that, depending on the selection of the criterion of divisibility, different types of elements with different properties are got. Depending on the selection of the criterion of divisibility, the system structure becomes multidimensional. The paper recommends to indicate the criterion of the system divisibility during the systems research. It increases the certainty of the description of a complex system and characterizes the system elements.

  10. Multi-Element Airfoil System

    Science.gov (United States)

    Turner, Travis L. (Inventor); Khorrami, Mehdi R. (Inventor); Lockard, David P. (Inventor); McKenney, Martin J. (Inventor); Atherley, Raymond D. (Inventor); Kidd, Reggie T. (Inventor)

    2014-01-01

    A multi-element airfoil system includes an airfoil element having a leading edge region and a skin element coupled to the airfoil element. A slat deployment system is coupled to the slat and the skin element, and is capable of deploying and retracting the slat and the skin element. The skin element substantially fills the lateral gap formed between the slat and the airfoil element when the slat is deployed. The system further includes an uncoupling device and a sensor to remove the skin element from the gap based on a critical angle-of-attack of the airfoil element. The system can alternatively comprise a trailing edge flap, where a skin element substantially fills the lateral gap between the flap and the trailing edge region of the airfoil element. In each case, the skin element fills a gap between the airfoil element and the deployed flap or slat to reduce airframe noise.

  11. Nuclear reactor fuel elements

    International Nuclear Information System (INIS)

    An improved nuclear power reactor fuel element is described which consists of fuel rods, rod guide tubes and an end plate. The system allows direct access to an end of each fuel rod for inspection purposes. (U.K.)

  12. Solar cell element

    Energy Technology Data Exchange (ETDEWEB)

    Nakano, Akihiko; Matsumoto, Hitoshi; Uda, Hiroshi; Komatsu, Yasumitsu; Ikegami, Kiyoharu.

    1989-05-18

    In the existing CdS/CdTe-based solar cell element, nothing is formed except the component effective for generating electromotive force and the components necessary for leading, collecting and extracting the generated electricity, hence even when the element shows deterioration of its performance during its usage, it has been difficult to analyze the above situation. In addition, it has also a defect that its characteristic such as the transfer efficiency in the neighborhood of its glass substrate in connection also with its manufacturing process. In order to solve the above problematical points, this invention proposes, with regard to a CdS-based solar cell element composed by forming a thin film on its substrate, to make a blank space on the above substrate and form thereon a thin film which composes the solar cell element concerned alone or in a piling up manner. 4 figs.

  13. Nuclear reactor fuel element

    International Nuclear Information System (INIS)

    The fuel element for a BWR known from the patent application DE 2824265 is developed so that the screw only breaks on the expansion shank with reduced diameter if the expansion forces are too great. (HP)

  14. Structural elements design manual

    CERN Document Server

    Draycott, Trevor

    2012-01-01

    Gives clear explanations of the logical design sequence for structural elements. The Structural Engineer says: `The book explains, in simple terms, and with many examples, Code of Practice methods for sizing structural sections in timber, concrete,masonry and steel. It is the combination into one book of section sizing methods in each of these materials that makes this text so useful....Students will find this an essential support text to the Codes of Practice in their study of element sizing'.

  15. Distant elements of surprise

    International Nuclear Information System (INIS)

    The fortuitous alignment of a quasar and a distant galaxy has enabled astronomers to unravel the origin and evolution of chemical elements. Cosmologists and fossil hunters have more in common than it might first appear. Palaeontologists analyse fossil records of the last 3.5 billion years to track the evolution of life on Earth. Motivated by a similar curiosity, astronomers are searching for chemical elements in stars and cosmic gas to understand the origin of the chemistry of the universe, and how it has developed since the Big Bang. The basic theoretical framework of the universe's chemistry has been in place for half a century. The lightest elements - hydrogen and helium, along with trace amounts of deuterium and lithium - were created within a few minutes of the Big Bang. All of the other elements were assembled at much later times by the fusion of hydrogen and helium nuclei in the interior of stars. Some of these elements were dispersed through space in the violent supernova explosions with which some stars end their lives. They were then condensed into subsequent generations of stars, and into the planets that formed around them. Some of these elements were eventually incorporated into organic structures and became essential for life on Earth. This cosmic cycle continues to the present day. The closest region of active star formation is the Orion nebula, which is visible to anyone who looks up at the sky on a clear winter's night. But the details of the cycle are still far from clear. For example, we do not know when most of the elements were produced in the universe as a whole, or which stars were responsible for producing which elements. In order to unravel the path of chemical evolution we have to shift our attention to much further away than the Orion nebula. (U.K.)

  16. Creativity Management Key Elements

    OpenAIRE

    Fuchs Ángeles, Rosa María; Franceso Tonetti, Federico Carlo

    2015-01-01

    Organizations are constantly looking towards innovation. In order to reach it they must foment creativity. This paper analyzes a series of elements considered in the organizational creativity management and proposes a model with the indispensable factors that organizations should consider to reach it. These elements are: culture and organizational environment, strategy, structure, communication, relation with customers, human resources (recruiting, training, job design, compensation, promotio...

  17. New roof element system

    DEFF Research Database (Denmark)

    Ditlev, Jesper; Rudbeck, Claus Christian

    1997-01-01

    The aim of the project has been to develop an element system for warm deck roofs which, from a thermal and economical point of view, can deal with the future demands for heat loss coefficients for low slope roofs.......The aim of the project has been to develop an element system for warm deck roofs which, from a thermal and economical point of view, can deal with the future demands for heat loss coefficients for low slope roofs....

  18. Atoms, molecules & elements

    CERN Document Server

    Graybill, George

    2007-01-01

    Young scientists will be thrilled to explore the invisible world of atoms, molecules and elements. Our resource provides ready-to-use information and activities for remedial students using simplified language and vocabulary. Students will label each part of the atom, learn what compounds are, and explore the patterns in the periodic table of elements to find calcium (Ca), chlorine (Cl), and helium (He) through hands-on activities.

  19. Creating superheavy elements

    International Nuclear Information System (INIS)

    During the past 20 years physicists around the world have been engaged in the task of producing superheavy elements. At the Institute for Heavy-Ion Research in Darmstadt the authors have met with some success, synthesizing the nuclei of elements 107, 108 and 109. These nuclei lie beyond the 106-proton threshold that marked the limits of previous techniques for creating and identifying heavy elements. Experimental mass measurements, followed up by theory, show that the new elements owe their stability to the microscopic arrangement of their protons and neutrons rather than the macroscopic properties that stabilize lighter nuclei. On the other hand the authors have met with problems that have thus far prevented them from reaching the goals set in the late 1960's, when elements up to 114 seemed within reach. Working to overcome obstacles to further progress, however, has deepened our understanding of nuclear structure and of the dynamics of fusion reactions between nuclei. Nucleosynthesis has come a long way from the earliest years when elements not found in nature were created in nuclear reactors. Physicists have employed ever-heavier projectiles to bombard target atoms; the latest development is cold fusion, which masses and bombardment energies are carefully chosen to minimize the excitation of newly formed nuclei. In the course of their work early ideas about how to synthesize superheavy elements have almost all turned out to be wrong: the nuclei of the elements that can be synthesized are deformed and not, as postulated in 1966, spherical. In the fusion process they use stable, naturally plentiful spherical nuclei and medium-weight projectiles, not, as expected earlier, the heaviest radioactive man-made nuclei and correspondingly light projectiles. Fusion must take place at the lowest possible bombardment energy, and not, as believed earlier, with excess impact energy to assist the process by brute force

  20. Novel porcine repetitive elements

    Directory of Open Access Journals (Sweden)

    Nonneman Dan J

    2006-12-01

    Full Text Available Abstract Background Repetitive elements comprise ~45% of mammalian genomes and are increasingly known to impact genomic function by contributing to the genomic architecture, by direct regulation of gene expression and by affecting genomic size, diversity and evolution. The ubiquity and increasingly understood importance of repetitive elements contribute to the need to identify and annotate them. We set out to identify previously uncharacterized repetitive DNA in the porcine genome. Once found, we characterized the prevalence of these repeats in other mammals. Results We discovered 27 repetitive elements in 220 BACs covering 1% of the porcine genome (Comparative Vertebrate Sequencing Initiative; CVSI. These repeats varied in length from 55 to 1059 nucleotides. To estimate copy numbers, we went to an independent source of data, the BAC-end sequences (Wellcome Trust Sanger Institute, covering approximately 15% of the porcine genome. Copy numbers in BAC-ends were less than one hundred for 6 repeat elements, between 100 and 1000 for 16 and between 1,000 and 10,000 for 5. Several of the repeat elements were found in the bovine genome and we have identified two with orthologous sites, indicating that these elements were present in their common ancestor. None of the repeat elements were found in primate, rodent or dog genomes. We were unable to identify any of the replication machinery common to active transposable elements in these newly identified repeats. Conclusion The presence of both orthologous and non-orthologous sites indicates that some sites existed prior to speciation and some were generated later. The identification of low to moderate copy number repetitive DNA that is specific to artiodactyls will be critical in the assembly of livestock genomes and studies of comparative genomics.

  1. The Middle Pivot Element Algorithm

    OpenAIRE

    Anchala Kumari; Soubhik Chakraborty

    2012-01-01

    This paper is an improvement over the previous work on New Sorting Algorithm first proposed by Sundararajan and Chakraborty (2007). Here we have taken the pivot element as the middle element of the array. We call this improved version Middle Pivot Element Algorithm (MPA) and it is found that MPA is much faster than the two algorithms RPA (Random Pivot element Algorithm) and FPA (First Pivot element Algorithm) in which the pivot element was selected either randomly or as the first element, res...

  2. Solar energy - design element

    International Nuclear Information System (INIS)

    The main focus of this study is the theoretical examination of the possibilities of applying technological, functional, aesthetic and energy resources in elements of urban design. Designed solutions are treated as part of the overall optimization of architectural elements and urban space, in which technological development enables the use of certain energy potentials of elements of urban design. The paper presents student hypothetical design models of urban architectural elements with integrated photovoltaic modules. The analytical procedure was applied in the analysis of student work in a seminar of the first year of master studies at the Faculty of Architecture. The aim is to improve students' awareness of the need for proper handling of energy and the possibility of integration with other architectural elements. The research and the results have enabled further work on the sustainable development of architectural elements with a focus on the use of solar energy by promoting the modern design approach. Key words: PV module, teaching, solar energy, urban design

  3. A saturation screen for cis-acting regulatory DNA in the Hox genes of Ciona intestinalis

    Energy Technology Data Exchange (ETDEWEB)

    Keys, David N.; Lee, Byung-in; Di Gregorio, Anna; Harafuji, Naoe; Detter, Chris; Wang, Mei; Kahsai, Orsalem; Ahn, Sylvia; Arellano, Andre; Zhang, Quin; Trong, Stephan; Doyle, Sharon A.; Satoh, Noriyuki; Satou, Yutaka; Saiga, Hidetoshi; Christian, Allen; Rokhsar, Dan; Hawkins, Trevor L.; Levine, Mike; Richardson, Paul

    2005-01-05

    A screen for the systematic identification of cis-regulatory elements within large (>100 kb) genomic domains containing Hox genes was performed by using the basal chordate Ciona intestinalis. Randomly generated DNA fragments from bacterial artificial chromosomes containing two clusters of Hox genes were inserted into a vector upstream of a minimal promoter and lacZ reporter gene. A total of 222 resultant fusion genes were separately electroporated into fertilized eggs, and their regulatory activities were monitored in larvae. In sum, 21 separable cis-regulatory elements were found. These include eight Hox linked domains that drive expression in nested anterior-posterior domains of ectodermally derived tissues. In addition to vertebrate-like CNS regulation, the discovery of cis-regulatory domains that drive epidermal transcription suggests that C. intestinalis has arthropod-like Hox patterning in the epidermis.

  4. New elements - approaching ?

    Science.gov (United States)

    Hofmann, S.

    1998-06-01

    The search for new elements is part of the broader field of investigations of nuclei at the limits of stability. In two series of experiments at SHIP, six new elements 0034-4885/61/6/002/img2 were synthesized via fusion reactions using 1n-deexcitation channels and lead or bismuth targets. The isotopes were unambiguously identified by means of 0034-4885/61/6/002/img3 correlations. Alpha decay, not fission, is the dominant decay mode. The collected decay data establish a means of comparison with theoretical data. This aids in the selection of appropriate models that describe the properties of known nuclei. Predictions based on these models are useful in the preparation of the next generation of experiments. Cross sections decrease by two orders of magnitude from bohrium (Z = 107) to element 112, for which a cross section of 1 pb was measured. The development of intense beam currents and sensitive detection methods is essential for the production and identification of still heavier elements and new isotopes of already known elements, as well as the measurement of small 0034-4885/61/6/002/img4-, 0034-4885/61/6/002/img5- and fission-branching ratios. An equally sensitive set-up is needed for the measurement of excitation functions at low cross sections. Based on our results, it is likely that the production of isotopes of element 114 close to the island of spherical superheavy elements (SHEs) could be achieved by fusion reactions using 0034-4885/61/6/002/img6 targets. Systematic studies of the reaction cross sections indicate that the transfer of nucleons is an important process for the initiation of fusion. The data allow for the fixing of a narrow energy window for the production of SHEs using 1n-emission channels. The likelihood of broadening the energy window by investigation of radiative capture reactions, use of neutron deficient projectile isotopes and use of actinide targets is discussed.

  5. Probabilistic boundary element method

    Science.gov (United States)

    Cruse, T. A.; Raveendra, S. T.

    1989-01-01

    The purpose of the Probabilistic Structural Analysis Method (PSAM) project is to develop structural analysis capabilities for the design analysis of advanced space propulsion system hardware. The boundary element method (BEM) is used as the basis of the Probabilistic Advanced Analysis Methods (PADAM) which is discussed. The probabilistic BEM code (PBEM) is used to obtain the structural response and sensitivity results to a set of random variables. As such, PBEM performs analogous to other structural analysis codes such as finite elements in the PSAM system. For linear problems, unlike the finite element method (FEM), the BEM governing equations are written at the boundary of the body only, thus, the method eliminates the need to model the volume of the body. However, for general body force problems, a direct condensation of the governing equations to the boundary of the body is not possible and therefore volume modeling is generally required.

  6. Computing Heavy Elements

    CERN Document Server

    Schunck, N; Kortelainen, M; McDonnell, J; Moré, J; Nazarewicz, W; Pei, J; Sarich, J; Sheikh, J; Staszczak, A; Stoitsov, M; Wild, S M

    2011-01-01

    Reliable calculations of the structure of heavy elements are crucial to address fundamental science questions such as the origin of the elements in the universe. Applications relevant for energy production, medicine, or national security also rely on theoretical predictions of basic properties of atomic nuclei. Heavy elements are best described within the nuclear density functional theory (DFT) and its various extensions. While relatively mature, DFT has never been implemented in its full power, as it relies on a very large number (~ 10^9-10^12) of expensive calculations (~ day). The advent of leadership-class computers, as well as dedicated large-scale collaborative efforts such as the SciDAC 2 UNEDF project, have dramatically changed the field. This article gives an overview of the various computational challenges related to the nuclear DFT, as well as some of the recent achievements.

  7. Fuel Element Technical Manual

    Energy Technology Data Exchange (ETDEWEB)

    Burley, H.H. [ed.

    1956-08-01

    It is the purpose of the Fuel Element Technical Manual to Provide a single document describing the fabrication processes used in the manufacture of the fuel element as well as the technical bases for these processes. The manual will be instrumental in the indoctrination of personnel new to the field and will provide a single data reference for all personnel involved in the design or manufacture of the fuel element. The material contained in this manual was assembled by members of the Engineering Department and the Manufacturing Department at the Hanford Atomic Products Operation between the dates October, 1955 and June, 1956. Arrangement of the manual. The manual is divided into six parts: Part I--introduction; Part II--technical bases; Part III--process; Part IV--plant and equipment; Part V--process control and improvement; and VI--safety.

  8. Advanced finite element technologies

    CERN Document Server

    Wriggers, Peter

    2016-01-01

    The book presents an overview of the state of research of advanced finite element technologies. Besides the mathematical analysis, the finite element development and their engineering applications are shown to the reader. The authors give a survey of the methods and technologies concerning efficiency, robustness and performance aspects. The book covers the topics of mathematical foundations for variational approaches and the mathematical understanding of the analytical requirements of modern finite element methods. Special attention is paid to finite deformations, adaptive strategies, incompressible, isotropic or anisotropic material behavior and the mathematical and numerical treatment of the well-known locking phenomenon. Beyond that new results for the introduced approaches are presented especially for challenging nonlinear problems.

  9. Finite element analysis

    CERN Document Server

    2010-01-01

    Finite element analysis is an engineering method for the numerical analysis of complex structures. This book provides a bird's eye view on this very broad matter through 27 original and innovative research studies exhibiting various investigation directions. Through its chapters the reader will have access to works related to Biomedical Engineering, Materials Engineering, Process Analysis and Civil Engineering. The text is addressed not only to researchers, but also to professional engineers, engineering lecturers and students seeking to gain a better understanding of where Finite Element Analysis stands today.

  10. Osteoporosis and trace elements

    DEFF Research Database (Denmark)

    Aaseth, J.; Boivin, G.; Andersen, Ole

    2012-01-01

    functional, exercise related and nutritional factors. Of particular considerations are calcium (Ca) status, vitamin D, fluoride, magnesium and other trace elements. Several trace elements such as zinc and copper are essential for normal development of the skeleton in humans and animals. Fluoride accumulates....... Numerous investigators have evaluated the role of medications and supplementations with minerals and trace substances to reverse the progression of this disease. Although bisphosphonates are still the drugs of choice, low-dosed fluoride and strontium salts have shown promise for the future....

  11. Bibliography on transuranium elements

    International Nuclear Information System (INIS)

    A selective bibliography of prominent publications on transuranium elements is compiled. Heading papers, symposia proceedings and the textbooks are included in the bibliography. The bibliography is arranged under the headings: (1)Books, Symposia Proceedings, Reviews etc., (2)Discovery, (3)Weighable Isolation, (4)Metal Preparation, (5)Nuclear Properties, (6)Plutonium as Reactor Fuel, (7)Fuel Reprocessing, (8)Solid State Chemistry, Thermochemistry and Spectroscopy, (9)Radiation Safety, (10)Applications, and (11)Some Typical Indian Papers. Total number of references cited are 298. The bibliography, though selective, will serve as a starting point for comprehensive literature search on transuranium elements. (author)

  12. Rocket propulsion elements

    CERN Document Server

    Sutton, George P

    2011-01-01

    The definitive text on rocket propulsion-now revised to reflect advancements in the field For sixty years, Sutton's Rocket Propulsion Elements has been regarded as the single most authoritative sourcebook on rocket propulsion technology. As with the previous edition, coauthored with Oscar Biblarz, the Eighth Edition of Rocket Propulsion Elements offers a thorough introduction to basic principles of rocket propulsion for guided missiles, space flight, or satellite flight. It describes the physical mechanisms and designs for various types of rockets' and provides an unders

  13. Finite elements and approximation

    CERN Document Server

    Zienkiewicz, O C

    2006-01-01

    A powerful tool for the approximate solution of differential equations, the finite element is extensively used in industry and research. This book offers students of engineering and physics a comprehensive view of the principles involved, with numerous illustrative examples and exercises.Starting with continuum boundary value problems and the need for numerical discretization, the text examines finite difference methods, weighted residual methods in the context of continuous trial functions, and piecewise defined trial functions and the finite element method. Additional topics include higher o

  14. Elements of linear space

    CERN Document Server

    Amir-Moez, A R; Sneddon, I N

    1962-01-01

    Elements of Linear Space is a detailed treatment of the elements of linear spaces, including real spaces with no more than three dimensions and complex n-dimensional spaces. The geometry of conic sections and quadric surfaces is considered, along with algebraic structures, especially vector spaces and transformations. Problems drawn from various branches of geometry are given.Comprised of 12 chapters, this volume begins with an introduction to real Euclidean space, followed by a discussion on linear transformations and matrices. The addition and multiplication of transformations and matrices a

  15. TABLE OF RADIOACTIVE ELEMENTS.

    Energy Technology Data Exchange (ETDEWEB)

    HOLDEN,N.E.

    2001-06-29

    For those chemical elements which have no stable nuclides with a terrestrial isotopic composition, the data on radioactive half-lives and relative atomic masses for the nuclides of interest and importance have been evaluated and the recommended values and uncertainties are listed.

  16. TABLE OF RADIOACTIVE ELEMENTS

    International Nuclear Information System (INIS)

    For those chemical elements which have no stable nuclides with a terrestrial isotopic composition, the data on radioactive half-lives and relative atomic masses for the nuclides of interest and importance have been evaluated and the recommended values and uncertainties are listed

  17. Inside finite elements

    CERN Document Server

    Weiser, Martin

    2016-01-01

    All relevant implementation aspects of finite element methods are discussed in this book. The focus is on algorithms and data structures as well as on their concrete implementation. Theory is covered as far as it gives insight into the construction of algorithms. Throughout the exercises a complete FE-solver for scalar 2D problems will be implemented in Matlab/Octave.

  18. Periodic table of elements

    International Nuclear Information System (INIS)

    Following a recommendation by the International Union for Pure and Applied Chemistry (IUPAC), the groups of the periodic table shall be numbered from 1 to 18, instead of I to VIII as before. The recommendations has been approved of by the Committee on Nomenclature of the American Chemical Society. The new system abandons the distinction between main groups (a) and auxiliary groups (b), which in the past frequently has been the reason for misunderstandings between European and American chemists, due to different handling. The publishing house VCH Verlagsgesellschaft recently produced a new periodic table that shows the old and the new numbering system together at a glance, so that chemists will have time to get familiar with the new system. In addition the new periodic table represents an extensive data compilation arranged by elements. The front page lists the chemical properties of elements, the back page their physical properties. (orig./EF)

  19. Production of transuranium elements

    International Nuclear Information System (INIS)

    The Radiochemical Engineering Development Center (REDC) has the programmatic responsibility for the Department of Energy's Transuranium Element Program. Principle elements from the program are einsteinium, berkelium, and fermium. Targets containing curium oxide mixed with aluminum powder are fabricated by the REDC and irradiated in the Oak Ridge National Laboratory (ORNL) High Flux Isotope Reactor. Following an irradiation period of 6-12 months, targets are returned to the REDC for chemical processing. Processing operations consists of aluminum dejacketing in a caustic-nitrate solution, filtration, acid dissolution, solvent extraction, anion exchange, and finally a cation exchange to recover the actinides. The processing operations take place in heavily shielded hot cell facilities and all operations are carried out remotely. The chemistry for the separations has been well established over the 26-yr. operating life of the facility

  20. Origin of light elements

    International Nuclear Information System (INIS)

    A brief review on the state of the problem of occurrence of light elements, physics of shearing reactions and nucleosynthesis, caused by the observed fluxes of galactic cosmic rays is presented. Special attention is paid to 7Li nucleosynthesis, revealing interesting aspects of star physics, the problem of the effect of low-energy cosmic ray flux, strongly modulated by solar wind and solar magnetic activity, nucleosynthesis in red giants, explosions of novae and early stages of the Universe evolution which are of particular interest among them. The conclusion is made, that light elements Li, Be and B present a unique instrument for the analysis of cosmologic problems, as well as for the comprehension of the physics of cosmic rays and chemical evolution of galaxies

  1. ELEMENTS OF MARKETING

    OpenAIRE

    Ramakrishna Mohan Rao Munaga

    2014-01-01

    The marketing thinking starts with customer’s needs. Today the customer is on the driver’s seat. It is also because of the change in the demand supply equation. Now the demand is less than supply just reverse to the past times situation. Today each marketer wants to retain and satisfy the customer because of the intense competition. The marketing elements are Needs, Wants, Demands, Products, Value, Exchange, Transaction and Relationship, Market, Marketers.

  2. Nuclear reactor fuel elements

    International Nuclear Information System (INIS)

    A nuclear reactor fuel element comprising a column of vibration compacted fuel which is retained in consolidated condition by a thimble shaped plug. The plug is wedged into gripping engagement with the wall of the sheath by a wedge. The wedge material has a lower coefficient of expansion than the sheath material so that at reactor operating temperature the retainer can relax sufficient to accommodate thermal expansion of the column of fuel. (author)

  3. Finite elements in fluids

    International Nuclear Information System (INIS)

    This book discusses the topics in the general field of finite element analysis of flow problems and describes the major advances over the last two years and introduces new powerful methods for high-speed and free-surface flows, and discusses applications. The contents include: General Topics, Computational and Mathematical Aspects. High-speed and Transonic flows. Hydraulics, Viscous Flow, Boundary-Layers, MHD. Free Surface Flow. Index

  4. Elements of quantum information

    International Nuclear Information System (INIS)

    Elements of Quantum Information introduces the reader to the fascinating field of quantum information processing, which lives on the interface between computer science, physics, mathematics, and engineering. This interdisciplinary branch of science thrives on the use of quantum mechanics as a resource for high potential modern applications. With its wide coverage of experiments, applications, and specialized topics - all written by renowned experts - Elements of Quantum Information provides and indispensable, up-to-date account of the state of the art of this rapidly advancing field and takes the reader straight up to the frontiers of current research. The articles have first appeared as a special issue of the journal 'Fortschritte der Physik / Progress of Physics'. Since then, they have been carefully updated. The book will be an inspiring source of information and insight for anyone researching and specializing in experiments and theory of quantum information. Topics addressed in Elements of Quantum Information include - Cavity Quantum Electrodynamics - Segmented Paul Traps - Cold Atoms and Bose-Einstein Condensates in Microtraps, Optical Lattices, and on Atom Chips - Rydberg Gases - Factorization of Numbers with Physical Systems - Entanglement of Continuous Variables - NMR and Solid State Quantum Computation - Quantum Algorithms and Quantum Machines - Complexity Theory - Quantum Crytography. (orig.)

  5. Helium the disappearing element

    CERN Document Server

    Sears, Wheeler M

    2015-01-01

    The subject of the book is helium, the element, and its use in myriad applications including MRI machines, particle accelerators, space telescopes, and of course balloons and blimps. It was at the birth of our Universe, or the Big Bang, where the majority of cosmic helium was created; and stellar helium production continues. Although helium is the second most abundant element in the Universe, it is actually quite rare here on Earth and only exists because of radioactive elements deep within the Earth. This book includes a detailed history of the discovery of helium, of the commercial industry built around it, how the helium we actually encounter is produced within the Earth, and the state of the helium industry today. The gas that most people associate with birthday party balloons is running out. “Who cares?” you might ask. Well, without helium, MRI machines could not function, rockets could not go into space, particle accelerators such as those used by CERN could not operate, fiber optic cables would not...

  6. The transuranium elements

    International Nuclear Information System (INIS)

    In this paper Seaborg's actinide hypothesis is traced from its beginnings to the present. The wealth of spectroscopic and magnetic data accumulated over the years leads to conclusions about the electronic structure of the actinides. These investigations include spectroscopic studies of gaseous atoms and ions, as well as of solutions and compounds, and magnetic susceptibility and electron spin resonance studies of metals, alloys, and compounds. Both experimental and theoretical studies have resulted in accurate values for spin-orbit coupling and crystal-field parameters for 5f electrons, for example, which can be compared with values characteristic of 4f electrons. For instance, the somewhat greater spatial extent of 5f versus 4f wave functions gives rise to 5f orbital participation in the bonding of actinide element organometallic compounds and leads to an extensive and intricate organometallic chemistry for this group of elements. The rich chemistry of Np and Pu provides new insights into electronic structure and the unique nature of 5f electrons yields exciting findings in the exploration of the chemistry of the actinide elements

  7. The transuranium elements: From neptunium and plutonium to element 112

    International Nuclear Information System (INIS)

    Beginning in the 1930's, both chemists and physicists became interested in synthesizing new artificial elements. The first transuranium element, Np, was synthesized in 1940. Over the past six decades, 20 transuranium elements have been produced. A review of the synthesis is given. The procedure of naming the heavy elements is also discussed. It appears feasible to produce elements 113 and 114. With the Berkeley Gas-filled Separator, it should be possible to reach the superheavy elements in the region of the spherical Z=114 shell, but with fewer neutrons than the N=184 spherical shell. 57 refs, 6 figs

  8. The transuranium elements: From neptunium and plutonium to element 112

    Energy Technology Data Exchange (ETDEWEB)

    Hoffman, D.C. [California Univ., Berkeley, CA (United States)]|[Lawrence Livermore National Lab., CA (United States)

    1996-07-26

    Beginning in the 1930`s, both chemists and physicists became interested in synthesizing new artificial elements. The first transuranium element, Np, was synthesized in 1940. Over the past six decades, 20 transuranium elements have been produced. A review of the synthesis is given. The procedure of naming the heavy elements is also discussed. It appears feasible to produce elements 113 and 114. With the Berkeley Gas-filled Separator, it should be possible to reach the superheavy elements in the region of the spherical Z=114 shell, but with fewer neutrons than the N=184 spherical shell. 57 refs, 6 figs.

  9. [Healthcare marketing elements].

    Science.gov (United States)

    Ameri, Cinzia; Fiorini, Fulvio

    2014-01-01

    Marketing puts its foundation on a few key concepts: need-demand, product-service, satisfaction, exchange, market, or business structure manufacturing / supply. The combination of these elements allows you to build an effective marketing strategy. Crucial in this respect is to remember the Porter matrix, which shows that for a correct analysis of the relevant market is necessary to refer to the "five forces at play", ie: customers, competitors, new entrants and substitutes threat. Another key lever for proper marketing oriented approach is the continuous and constant monitoring of the application, anticipating their dissatisfactions. PMID:24777920

  10. Elements of probability theory

    CERN Document Server

    Rumshiskii, L Z

    1965-01-01

    Elements of Probability Theory presents the methods of the theory of probability. This book is divided into seven chapters that discuss the general rule for the multiplication of probabilities, the fundamental properties of the subject matter, and the classical definition of probability. The introductory chapters deal with the functions of random variables; continuous random variables; numerical characteristics of probability distributions; center of the probability distribution of a random variable; definition of the law of large numbers; stability of the sample mean and the method of moments

  11. Primordial heavy element production

    CERN Document Server

    Rauscher, T

    2015-01-01

    A number of possible mechanisms have been suggested to generate density inhomogeneities in the early Universe which could survive until the onset of primordial nucleosynthesis and generate neutron-rich regions. In this work we are not concerned with how the inhomogeneities were generated but we want to focus on the effect of such inhomogeneities on primordial nucleosynthesis. One of the proposed signatures of inhomogeneity, the synthesis of very heavy elements by neutron capture in a primordial r-process, was analyzed for varying baryon to photon ratios $\\eta$ and fluctuation length scales $L$.

  12. Elements of analytical dynamics

    CERN Document Server

    Kurth, Rudolph; Stark, M

    1976-01-01

    Elements of Analytical Dynamics deals with dynamics, which studies the relationship between motion of material bodies and the forces acting on them. This book is a compilation of lectures given by the author at the Georgia and Institute of Technology and formed a part of a course in Topological Dynamics. The book begins by discussing the notions of space and time and their basic properties. It then discusses the Hamilton-Jacobi theory and Hamilton's principle and first integrals. The text concludes with a discussion on Jacobi's geometric interpretation of conservative systems. This book will

  13. Elements of energy conversion

    CERN Document Server

    Russell, Charles R

    2013-01-01

    Elements of Energy Conversion brings together scattered information on the subject of energy conversion and presents it in terms of the fundamental thermodynamics that apply to energy conversion by any process. Emphasis is given to the development of the theory of heat engines because these are and will remain most important power sources. Descriptive material is then presented to provide elementary information on all important energy conversion devices. The book contains 10 chapters and opens with a discussion of forms of energy, energy sources and storage, and energy conversion. This is foll

  14. Nuclear fuel element cladding

    International Nuclear Information System (INIS)

    Composite cladding for a nuclear fuel element containing fuel pellets is formed with a zirconium metal barrier layer bonded to the inside surface of a zirconium alloy tube. The composite tube is sized by a cold working tube reduction process and is heat treated after final reduction to provide complete recrystallization of the zirconium metal barrier layer and a fine-grained microstructure. The zirconium alloy tube is stress-relieved but is not fully recrystallized. The crystallographic structure of the zirconium metal barrier layer may be improved by compressive deformation such as shot-peening. (author)

  15. Nuclear fuel element

    International Nuclear Information System (INIS)

    Purpose: To reduce the probability of stress corrosion cracks in a zirconium alloy fuel can even when tensile stresses are resulted to the fuel can. Constitution: Sintered nuclear fuel pellets composed of uranium dioxide or a solid solution of gadolinium as a burnable poison in uranium dioxide are charged in a tightly sealed zirconium alloy fuel can. The nuclear fuel pellets for the nuclear fuel element are heat-treated in a gas mixture of carbon dioxide and carbon monoxide. Further, a charging gas containing a mixture of carbon dioxide and carbon monoxide is charged within a zirconium alloy fuel can packed with the nuclear fuel pellets and tightly sealed. (Aizawa, K.)

  16. Radiolabelled Cellular Blood Elements

    International Nuclear Information System (INIS)

    This volume contains the abstracts of the 5th International Symposion on Radiolabelling of Cellular Blood Elements to be held in Vienna, Austria, September 10-14, 1989. The Meeting is the fifth in a series of meetings designed to discuss the basics and clinical application of radiolabelling techniques. In these days, beside the search for new labelling agents and extending the knowledge in clinical use, the use of monoclonal antibodies is a big new challenge. All reviewed contributions that have been accepted for presentation are contained in this volume. (authors) 58 of them are of INIS scope

  17. Analytical elements of mechanics

    CERN Document Server

    Kane, Thomas R

    2013-01-01

    Analytical Elements of Mechanics, Volume 1, is the first of two volumes intended for use in courses in classical mechanics. The books aim to provide students and teachers with a text consistent in content and format with the author's ideas regarding the subject matter and teaching of mechanics, and to disseminate these ideas. The book opens with a detailed exposition of vector algebra, and no prior knowledge of this subject is required. This is followed by a chapter on the topic of mass centers, which is presented as a logical extension of concepts introduced in connection with centroids. A

  18. Nuclear reactor fuel element

    International Nuclear Information System (INIS)

    The fuel element box for a BWR is situated with a corner bolt on the inside in one corner of its top on the top side of the top plate. This corner bolt is screwed down with a bolt with a corner part which is provided with leaf springs outside on two sides, where the bolt has a smaller diameter and an expansion shank. The bolt is held captive to the bolt head on the top and the holder on the bottom of the corner part. The holder is a locknut. If the expansion forces are too great, the bolt can only break at the expansion shank. (HP)

  19. Extractability of risk elements and nutrition elements from ash

    OpenAIRE

    Hrma, Jiří

    2012-01-01

    The thesis „Extractability of risk elements and nutrition elements from ash“ studies the determination of physicochemical properties of ash and compares the mobility of heavy metals and nutrition elements in various samples. The aim of the study was to determine the extractability of heavy metals and nutrition elements from biomass ash and their chemical speciation using sequential extraction procedure based upon Tessier which was modified for given matrix. The results permit to classify m...

  20. PP2C-like Promoter and Its Deletion Variants Are Induced by ABA but Not by MeJA and SA in Arabidopsis thaliana

    Science.gov (United States)

    Bhalothia, Purva; Sangwan, Chetna; Alok, Anshu; Mehrotra, Sandhya; Mehrotra, Rajesh

    2016-01-01

    Gene expression is mediated through interaction between cis regulatory elements and its cognate transcription factors. Cis regulatory elements are defined as non-coding DNA sequences that provide the binding sites for transcription factors and are clustered in the upstream region of genes. ACGT cis regulatory element is one of the important cis regulatory elements found to be involved in diverse biological processes like auxin response, salicylic acid (SA) response, UV light response, ABA response and jasmonic acid (JA) response. We identified through in silico analysis that the upstream region of protein phosphatase 2C (PP2C) gene has a distinct genetic architecture of ACGT elements. In the present study, the activation of the full length promoter and its deletion constructs like 900 base pair, 500 base pair, 400 base pair and NRM (Nathji Rajesh Mehrotra) were examined by stable transformation in Arabidopsis thaliana using β-glucuronidase as the reporter gene. Evaluation of deletion constructs of PP2C-like promoter was carried out in the presence of phytohormones like abscisic acid (ABA), SA and JA. Our result indicated that the full length and 900 base pair promoter-reporter constructs of PP2C-like promoter was induced in response to ABA but not to methyl jasmonate and SA. PMID:27200023

  1. Fundamental Atomtronic Circuit Elements

    Science.gov (United States)

    Lee, Jeffrey; McIlvain, Brian; Lobb, Christopher; Hill, Wendell T., III

    2012-06-01

    Recent experiments with neutral superfluid gases have shown that it is possible to create atomtronic circuits analogous to existing superconducting circuits. The goals of these experiments are to create complex systems such as Josephson junctions. In addition, there are theoretical models for active atomtronic components analogous to diodes, transistors and oscillators. In order for any of these devices to function, an understanding of the more fundamental atomtronic elements is needed. Here we describe the first experimental realization of these more fundamental elements. We have created an atomtronic capacitor that is discharged through a resistance and inductance. We will discuss a theoretical description of the system that allows us to determine values for the capacitance, resistance and inductance. The resistance is shown to be analogous to the Sharvin resistance, and the inductance analogous to kinetic inductance in electronics. This atomtronic circuit is implemented with a thermal sample of laser cooled rubidium atoms. The atoms are confined using what we call free-space atom chips, a novel optical dipole trap produced using a generalized phase-contrast imaging technique. We will also discuss progress toward implementing this atomtronic system in a degenerate Bose gas.

  2. NIH Common Data Elements Repository

    Data.gov (United States)

    U.S. Department of Health & Human Services — The NIH Common Data Elements (CDE) Repository has been designed to provide access to structured human and machine-readable definitions of data elements that have...

  3. News from the 'superheavy elements'

    International Nuclear Information System (INIS)

    The search of some groups of scientists after superheavy elements in nature (minerals, meteorites) is shortly outlined, and the main facts suggesting the existence of at least some of these elements are stated. However, it is also pointed out that the problem of superheavy elements still leaves much room for speculations. (RB)

  4. Analog elements for transuranic chemistries

    International Nuclear Information System (INIS)

    A chemical extraction technique for estimating the biologically available fraction of nonessential trace elements in soils has been developed. This procedure has been used in evaluating the uptake of naturally occurring transuranic analog elements from soils into several foodstuffs. The availability of the natural elements has been compared with the availability of their analog transuranics which have been derived from global fallout

  5. Chemistry of the transactinide elements

    International Nuclear Information System (INIS)

    The synthesis and decay of the elements 104, 105 and 106 are described as well as the chemistry of the elements in the gaseous and liquid phase. The electron configurations of the ground state of the elements 105 and higher are described, as well as further chemical properties. (SR)

  6. Trace element emissions from coal

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2012-09-15

    Trace elements are emitted during coal combustion. The quantity, in general, depends on the physical and chemical properties of the element itself, the concentration of the element in the coal, the combustion conditions and the type of particulate control device used, and its collection efficiency as a function of particle size. Some trace elements become concentrated in certain particle streams following combustion such as bottom ash, fly ash, and flue gas particulate matter, while others do not. Various classification schemes have been developed to describe this partitioning behaviour. These classification schemes generally distinguish between: Class 1: elements that are approximately equally concentrated in the fly ash and bottom ash, or show little or no fine particle enrichment, examples include Mn, Be, Co and Cr; Class 2: elements that are enriched in the fly ash relative to bottom ash, or show increasing enrichment with decreasing particle size, examples include As, Cd, Pb and Sb; Class 3: elements which are emitted in the gas phase (primarily Hg (not discussed in this review), and in some cases, Se). Control of class 1 trace elements is directly related to control of total particulate matter emissions, while control of the class 2 elements depends on collection of fine particulates. Due to the variability in particulate control device efficiencies, emission rates of these elements can vary substantially. The volatility of class 3 elements means that particulate controls have only a limited impact on the emissions of these elements.

  7. Accelerator vacuum system elements

    International Nuclear Information System (INIS)

    Some elements of vacuum systems are investigated. Considerable attention has been given to the investigation into peculiarities in pumping out of a ionoguide for transportation of an accelerated charged particles beam the spread of which often attains a considerable length. The number of pumps over the ionoguide length is experimentally determined. It is shown that as a result of ionoguide warm-up the pumping out time is considerably reduced maximum permissible pressure is decreased by two orders and lesser rate of pump pumping out is required. The investigations have shown that when operating the ionoguide there is no necessity in setting up seals between the ionoguide and magnetodischarged pump. The causes of the phenomenon in which the pressure near the pump is greater than in the end of the ionoguide, are impurities carried in by the pump into the ionoguide volume and the pumping out capacity of the pressure converter

  8. Finite element modelling

    International Nuclear Information System (INIS)

    The Finite Element Method (FEM) is a numerical technique for finding approximate solutions to boundary value problems. While FEM is commonly used to solve solid mechanics equations, it can be applied to a large range of BVPs from many different fields. FEM has been used for reactor fuels modelling for many years. It is most often used for fuel performance modelling at the pellet and pin scale, however, it has also been used to investigate properties of the fuel material, such as thermal conductivity and fission gas release. Recently, the United Stated Department Nuclear Energy Advanced Modelling and Simulation Program has begun using FEM as the basis of the MOOSE-BISON-MARMOT Project that is developing a multi-dimensional, multi-physics fuel performance capability that is massively parallel and will use multi-scale material models to provide a truly predictive modelling capability. (authors)

  9. Heavy-element research

    International Nuclear Information System (INIS)

    The status is reported of studies on the solid-state chemistry of the actinides and lanthanides, spectroscopy of actinide compounds, and dynamic chemical description of actinide elements in solution. Phase studies were done on Rb2UO4, K2UO4, Li2UO4, and Es2U2O7. The lithium neptunate (VI) system was investigated and the existence of Li2NpO4 was established. In oxidation-reduction studies it was shown that Am(III) can be electrolytically oxidized to Am(IV) in strong H3PO4, but Cf(III) and Pr(III) do not oxidize. The low-temperature absorption spectrum of thin films of NpBr3 was investigated. (U.S.)

  10. Nuclear reactor fuel element

    International Nuclear Information System (INIS)

    The grid-shaped spacer for PWR fuel elements consists of flat, upright metal bars at right angles to the fuel rods. In one corner of a grid mesh it has a spring with two end parts for the fuel rod. The cut-outs for the end parts start from an end edge of the metal bar parallel to the fuel rods. The transverse metal bar is one of four outer metal bars. Both end parts of the spring have an extension parallel to this outer metal arm, which grips a grid mesh adjacent to this grid mesh at the side in one corner of the spacer and forms an end part of a spring for the fuel rod there on the inside of the outer metal bar. (HP)

  11. Burnable neutron absorber element

    International Nuclear Information System (INIS)

    A burnable thermal neutron absorber element is described comprising: a zirconium alloy elongated tubular container having an inside diameter surface; hydrogen diffusion barrier means for limiting hydrogen diffusion from within the container into the zirconium alloy; a boron-containing burnable thermal neutron absorber material sealed within the zirconium alloy elongated container, the boron-containing burnable absorber material being in a particle form, the particles of absorber material being coated with a diffusion barrier material; zirconium hydride sealed within the zirconium alloy elongated container, the zirconium hydride being in a partially hydrided condition and having a H to Zr ratio on an atomic basis in the range of about 1.0 to about 1.8; the burnable thermal neutron absorber material and the zirconium hydride distributed along the length of the zirconium alloy elongated container; and the zirconium hydride acts as a neutron moderator thereby enhancing the neutron capture efficiency of the burnable thermal neutron absorber

  12. Burnable neutron absorber element

    Energy Technology Data Exchange (ETDEWEB)

    Ferrari, H.M.

    1988-06-14

    A burnable thermal neutron absorber element is described comprising: a zirconium alloy elongated tubular container having an inside diameter surface; hydrogen diffusion barrier means for limiting hydrogen diffusion from within the container into the zirconium alloy; a boron-containing burnable thermal neutron absorber material sealed within the zirconium alloy elongated container, the boron-containing burnable absorber material being in a particle form, the particles of absorber material being coated with a diffusion barrier material; zirconium hydride sealed within the zirconium alloy elongated container, the zirconium hydride being in a partially hydrided condition and having a H to Zr ratio on an atomic basis in the range of about 1.0 to about 1.8; the burnable thermal neutron absorber material and the zirconium hydride distributed along the length of the zirconium alloy elongated container; and the zirconium hydride acts as a neutron moderator thereby enhancing the neutron capture efficiency of the burnable thermal neutron absorber.

  13. The fantastic four.. elements

    Science.gov (United States)

    Marsili, Antonella; D'Addezio, Giuliana; Rubbia, Giuliana; Ramieri, Caterina; Todaro, Riccardo; Scipilliti, Francesca; Tosto, Eleonora

    2015-04-01

    With a "Sunday between territory and music to 'National Institute of Geophysics and Volcanology," October 12, 2014 the headquarters of INGV Roma kicked off the activities of the second edition of the Week of Planet Earth. The laboratory of scientific outreach and museum activities together with volunteers of the National Civil Service have organized the whole day dedicated to the dissemination of earth sciences, involving adults and children. Especially for primary school children a laboratory was made involving three amusing activities all aimed at inspiring respect for the Earth: a theatrical representation called "The Fantastic 4... elements", a behavioral game and a nursery rhyme reading. The theater as a means of communication of science is an innovative and creative way to introduce children to important scientific concepts. The use of this methodology and simple language favoring the emotional involvement of the child facilitating learning. The main character is a child, chosen to facilitate the identification of the spectators with the protagonist, that through a fantastic journey discovers the importance of the four elements of our planet: earth, fire, air and water. As a second step, volunteers involved children in reading a nursery rhyme "the ABC to become a Friend of the Earth" inviting them to protect and respect the environment and its resources. Finally, the behavioral game gave indications about behaviors to adopt to safeguard the planet. Volunteers introduced a billboard divided into two colors, green to indicate the right behaviors and red for the wrong ones. Each child, after reading a card with indication on the behavior to adopt, had to decide if they were correct or not with respect to the environment safeguard. After listening to the children's answer, the volunteer gave the correct explanation about the appropriate behavior to adopt. At the end of the activities, each child received a certificate as "a friend of Planet Earth".

  14. Novel high-performance element in the electromagnetic finite-element method--node-edge element

    Institute of Scientific and Technical Information of China (English)

    Sheng Xinqing; Peng Zhen

    2008-01-01

    It is known in the computational electromagnetics (CEM) that the node element has a relative well-conditioned matrix,but suffers from the spurious solution problem; whereas the edge element has no spurious solutions,but usually produces an ill-conditioned matrix.Particularly,when the mesh is over dense,the iterative solution of the matrix equation from edge element converges very slowly.Based on the node element and edge element,a node-edge element is presented,which has no spurious solutions and better-conditioned matrix.Numerical experiments demonstrate that the proposed node-edge element is more efficient than now-widely used edge element.

  15. An element by element spectral element method for elastic wave modeling

    Institute of Scientific and Technical Information of China (English)

    LIN Weijun; WANG Xiuming; ZHANG Hailan

    2006-01-01

    The spectral element method which combines the advantages of spectral method with those of finite element method,provides an efficient tool in simulating elastic wave equation in complex medium. Based on weak form of elastodynamic equations, mathematical formulations for Legendre spectral element method are presented. The wave field on an element is discretized using high-order Lagrange interpolation, and integration over the element is accomplished based upon the Gauss-Lobatto-Legendre integration rule. This results in a diagonal mass matrix which leads to a greatly simplified algorithm. In addition, the element by element technique is introduced in our method to reduce the memory sizes and improve the computation efficiency. Finally, some numerical examples are presented to demonstrate the spectral accuracy and the efficiency. Because of combinations of the finite element scheme and spectral algorithms, this method can be used for complex models, including free surface boundaries and strong heterogeneity.

  16. RNAsnp: efficient detection of local RNA secondary structure changes induced by SNPs

    DEFF Research Database (Denmark)

    Radhakrishnan, Sabarinathan; Tafer, Hakim; Seemann, Ernst Stefan; Hofacker, Ivo L.; Stadler, Peter F.; Gorodkin, Jan

    2013-01-01

    Structural characteristics are essential for the functioning of many noncoding RNAs and cis-regulatory elements of mRNAs. SNPs may disrupt these structures, interfere with their molecular function, and hence cause a phenotypic effect. RNA folding algorithms can provide detailed insights into stru...

  17. fRNAdb Summary: FR213337 [

    Lifescience Database Archive (English)

    Full Text Available FR213337 AY205227,L22762 Bamboo mosaic virus satellite ... RNA cis-regulatory element mature_transcr ... ipt Bamboo mosaic virus satellite ... RNA RF00389 Rfam v8.1 FR213337.jpg FR213337.png FR ...

  18. Reference: L1BOXATPDF1 [PLACE

    Lifescience Database Archive (English)

    Full Text Available L1BOXATPDF1 Abe M, Takahashi T, Komeda Y Identification of a cis-regulatory element for L1 la...yer-specific gene expression, which is targeted by an L1-specific homeodomain protein Plant J 26: 487-494 (2001) PubMed: 11439135; ...

  19. Chemical characterization of element 112.

    Science.gov (United States)

    Eichler, R; Aksenov, N V; Belozerov, A V; Bozhikov, G A; Chepigin, V I; Dmitriev, S N; Dressler, R; Gäggeler, H W; Gorshkov, V A; Haenssler, F; Itkis, M G; Laube, A; Lebedev, V Ya; Malyshev, O N; Oganessian, Yu Ts; Petrushkin, O V; Piguet, D; Rasmussen, P; Shishkin, S V; Shutov, A V; Svirikhin, A I; Tereshatov, E E; Vostokin, G K; Wegrzecki, M; Yeremin, A V

    2007-05-01

    The heaviest elements to have been chemically characterized are seaborgium (element 106), bohrium (element 107) and hassium (element 108). All three behave according to their respective positions in groups 6, 7 and 8 of the periodic table, which arranges elements according to their outermost electrons and hence their chemical properties. However, the chemical characterization results are not trivial: relativistic effects on the electronic structure of the heaviest elements can strongly influence chemical properties. The next heavy element targeted for chemical characterization is element 112; its closed-shell electronic structure with a filled outer s orbital suggests that it may be particularly susceptible to strong deviations from the chemical property trends expected within group 12. Indeed, first experiments concluded that element 112 does not behave like its lighter homologue mercury. However, the production and identification methods used cast doubt on the validity of this result. Here we report a more reliable chemical characterization of element 112, involving the production of two atoms of (283)112 through the alpha decay of the short-lived (287)114 (which itself forms in the nuclear fusion reaction of 48Ca with 242Pu) and the adsorption of the two atoms on a gold surface. By directly comparing the adsorption characteristics of (283)112 to that of mercury and the noble gas radon, we find that element 112 is very volatile and, unlike radon, reveals a metallic interaction with the gold surface. These adsorption characteristics establish element 112 as a typical element of group 12, and its successful production unambiguously establishes the approach to the island of stability of superheavy elements through 48Ca-induced nuclear fusion reactions with actinides. PMID:17476264

  20. Chemical characterization of element 112

    Science.gov (United States)

    Eichler, R.; Aksenov, N. V.; Belozerov, A. V.; Bozhikov, G. A.; Chepigin, V. I.; Dmitriev, S. N.; Dressler, R.; Gäggeler, H. W.; Gorshkov, V. A.; Haenssler, F.; Itkis, M. G.; Laube, A.; Lebedev, V. Ya.; Malyshev, O. N.; Oganessian, Yu. Ts.; Petrushkin, O. V.; Piguet, D.; Rasmussen, P.; Shishkin, S. V.; Shutov, A. V.; Svirikhin, A. I.; Tereshatov, E. E.; Vostokin, G. K.; Wegrzecki, M.; Yeremin, A. V.

    2007-05-01

    The heaviest elements to have been chemically characterized are seaborgium (element 106), bohrium (element 107) and hassium (element 108). All three behave according to their respective positions in groups 6, 7 and 8 of the periodic table, which arranges elements according to their outermost electrons and hence their chemical properties. However, the chemical characterization results are not trivial: relativistic effects on the electronic structure of the heaviest elements can strongly influence chemical properties. The next heavy element targeted for chemical characterization is element 112; its closed-shell electronic structure with a filled outer s orbital suggests that it may be particularly susceptible to strong deviations from the chemical property trends expected within group 12. Indeed, first experiments concluded that element 112 does not behave like its lighter homologue mercury. However, the production and identification methods used cast doubt on the validity of this result. Here we report a more reliable chemical characterization of element 112, involving the production of two atoms of 283112 through the alpha decay of the short-lived 287114 (which itself forms in the nuclear fusion reaction of 48Ca with 242Pu) and the adsorption of the two atoms on a gold surface. By directly comparing the adsorption characteristics of 283112 to that of mercury and the noble gas radon, we find that element 112 is very volatile and, unlike radon, reveals a metallic interaction with the gold surface. These adsorption characteristics establish element 112 as a typical element of group 12, and its successful production unambiguously establishes the approach to the island of stability of superheavy elements through 48Ca-induced nuclear fusion reactions with actinides.

  1. Portable element analysis unit

    International Nuclear Information System (INIS)

    A field portable X-ray fluorescent spectrometer is described, including a multichannel analyzer and a plurality of interchangeable sensor heads. Each sensor head includes a shutter which, when open, permits one of several radiation sources to irradiate the material to be analyzed. The returned radiation is detected by a corresponding detector which provides corresponding data in response. When the shutter is open, the multichannel analyzer utilizes the detector data to accumulate an energy spectrum of the material being analyzed, and displays the spectrum on a display screen. A cursor control allows the operator to move a cursor along the displayed spectrum. The symbol of the element having its major spectral peak at the position identified by the cursor, is automatically displayed on another display screen. Memory is provided for storing a number of reference spectra which may be displayed on the first screen along with the acquired spectrum for comparison purposes. The memory also stores previously acquired spectra for later analyses. To permit quantitative chemical analysis of materials in the field, the analyzer also includes other operational features such as normalization, window control and ratio and concentration determination

  2. Chemistry of the superheavy elements.

    Science.gov (United States)

    Schädel, Matthias

    2015-03-13

    The quest for superheavy elements (SHEs) is driven by the desire to find and explore one of the extreme limits of existence of matter. These elements exist solely due to their nuclear shell stabilization. All 15 presently 'known' SHEs (11 are officially 'discovered' and named) up to element 118 are short-lived and are man-made atom-at-a-time in heavy ion induced nuclear reactions. They are identical to the transactinide elements located in the seventh period of the periodic table beginning with rutherfordium (element 104), dubnium (element 105) and seaborgium (element 106) in groups 4, 5 and 6, respectively. Their chemical properties are often surprising and unexpected from simple extrapolations. After hassium (element 108), chemistry has now reached copernicium (element 112) and flerovium (element 114). For the later ones, the focus is on questions of their metallic or possibly noble gas-like character originating from interplay of most pronounced relativistic effects and electron-shell effects. SHEs provide unique opportunities to get insights into the influence of strong relativistic effects on the atomic electrons and to probe 'relativistically' influenced chemical properties and the architecture of the periodic table at its farthest reach. In addition, they establish a test bench to challenge the validity and predictive power of modern fully relativistic quantum chemical models. PMID:25666065

  3. Transuranium organometallic elements

    International Nuclear Information System (INIS)

    This paper reports that neptunium and plutonium metal react cleanly with 1.5 equiv of I2 in aprotic ligating solvents, L, to give the triiodide complexes as tetrasolvates, AnI3L4 [An is Np, L is tetrahydrofuran (THF) (1); An is Pu, L is THF (2a), pyridine (Py) (2b), and dimethyl sulfoxide (DMSO) (2c)]. These complexes are convenient precursors to both new and existing transuranium compounds. Reaction of the triiodide complexes 1 and 2a in hexane with 3 equiv of sodium bis(trimethylsilyl)amide provides the volatile, solvate-free tris (silylamide) complexes, An[N(SiMe3)2]3 (An is Np, 3; An is Pu, 4). Hexan solutions of 3 and 4 react rapidly with 3 equiv of HO-2,6-(t-C4H9)2C6H3 to give the aryloxide complexes An[O-26-(t-C4H9)2C6H3]3 (An is Np 5; An is Pu, 6). Preliminary investigations indicate that complexes 5 and 6 react with lithium bis(trimethylsilyl)methanide, Li[CH(SiMe3)2], in hexane to give the alkyl complexes An[CH(SiME3)2]3 (An is Np, 7; An is PU, 8). Plutonium triiodide complex 2a readily reacts with LiC5H5 to give the known (n5-C5H5)3Pu(THF). The homoleptic silylamide, aryloxide, and alkyl complexes are the first reported examples for transuranium elements

  4. EDGE-ORIENTED HEXAGONAL ELEMENTS

    Institute of Scientific and Technical Information of China (English)

    Chao Yang; Jiachang Sun

    2007-01-01

    In this paper, two new nonconforming hexagonal elements are presented, which are based on the trilinear function space Q(3)1 and are edge-oriented, analogical to the case of the rotated Q1 quadrilateral element. A priori error estimates are given to show that the new elements achieve first-order accuracy in the energy norm and second-order accuracy in the L2 norm. This theoretical result is confirmed by the numerical tests.

  5. Electronic structure of superheavy elements

    International Nuclear Information System (INIS)

    The electronic structure of superheavy elements, from element 121 to 131, studied using the relativistic density-functional theory with quantum electrodynamical corrections (Berit interaction) by MacDonald and Vosko, is reported. These corrections give rise to a modification to previous results, and the g electron is found to appear from element 126. Since a recent study on molecular systems has clarified the surprising accuracy of the density-functional approach in evaluating the relative energy difference of ground and excited states, a further study of the electronic configuration of heavy elements using the relativistic density-functional theory and the further improvement of the theory are both awaited. (author)

  6. Finite Element Method: An Overview

    Directory of Open Access Journals (Sweden)

    Vishal JAGOTA

    2013-02-01

    Full Text Available The finite element method (FEM is a numerical analysis technique for obtaining approximate solutions to a wide variety of engineering problems. A finite element model of a problem gives a piecewise approximation to the governing equations. The basic premise of the FEM is that a solution region can be analytically modeled or approximated by replacing it with an assemblage of discrete elements (discretization. Since these elements can be put together in a variety of ways, they can be used to represent exceedingly complex shapes.

  7. Photoshop Elements 10 For Dummies

    CERN Document Server

    Obermeier, Barbara

    2011-01-01

    Perfect your photos and images with this "focused" guide to the latest version of Photoshop Elements For most of us, the professional-level Photoshop is overkill for our needs. Amateur photographers and photo enthusiasts turn to Photoshop Elements for a powerful but simpler way to edit and retouch their snapshots. Photoshop Elements 10 For Dummies, fully updated and revised for the latest release of this software product, helps you navigate Elements to create, edit, fix, share, and organize the high-quality images you desire. Full color pages bring the techniques to life and make taking great

  8. Trace element emissions. Literature review

    International Nuclear Information System (INIS)

    Application of fossil fuels by various utilities results in the emission of trace elements to air, water and solid waste streams. Elements present in coal are released as particles or as vapours during coal combustion or gasification. Owing to the increased consumption of coal, especially for power generation, huge quantities of potentially hazardous trace elements are released into the atmosphere every year. It is necessary to evaluate the emissions of each trace element from coal-fired combustion or gasification systems, and their effects on the environment. Present research interests should be aimed at determining the sources, concentrations, and environmental impact of trace elements related with energy generation and relevant control technologies. Two of the emerging advanced coal gasification technologies, such as integrated gasification combined cycle (IGCC) and integrated gasification fuel cell (IGFC) are presently experiencing potential difficulties due to trace element emissions. In order to control the levels of these contaminants within regulatory limits and to ensure the efficient operation of fuel cells, it is necessary to determine the type and quantity of trace elements emitted from coal gasification-based systems as a function of system, operating conditions, and type of coal. The partitioning of the trace elements is influenced by the gasification conditions. In general, the following gasification conditions are expected to influence the distribution of trace elements between various product streams. (a) reducing and oxidizing environments (b) gas phase composition, pressure and temperature. The present report was aimed at finding and identifying gaps existing in the literature on the trace element transformations during gasification. Also included in the report is the modelling of relevant transformation mechanisms of the trace elements during gasification as a function of coal type and process conditions. 7 figs., 6 tabs., 69 refs

  9. Repetitive elements in parasitic protozoa

    OpenAIRE

    Clayton Christine

    2010-01-01

    Abstract A recent paper published in BMC Genomics suggests that retrotransposition may be active in the human gut parasite Entamoeba histolytica. This adds to our knowledge of the various types of repetitive elements in parasitic protists and the potential influence of such elements on pathogenicity. See research article http://www.biomedcentral.com/1471-2164/11/321

  10. Fuel element for nuclear reactor

    International Nuclear Information System (INIS)

    In order to avoid a can box or an adjacent fuel element sitting on the spacer of a fuel element in the corner during assembly, the top and bottom edges of the outer bars of the spacers are provided with deflector bars, which have projections projecting beyond the outside of the outer bars. (orig.)

  11. Clean Elements in Abelian Rings

    Indian Academy of Sciences (India)

    Angelina Y M Chin

    2009-04-01

    Let be a ring with identity. An element in is said to be clean if it is the sum of a unit and an idempotent. is said to be clean if all of its elements are clean. If every idempotent in is central, then is said to be abelian. In this paper we obtain some conditions equivalent to being clean in an abelian ring.

  12. Stabilized Finite Elements with Matlab

    OpenAIRE

    Asensio, M. I.; A. Russo

    2002-01-01

    The purpose of this note is to explain the MATLAB code developed to solve an advection diffusion-reaction problem, with different Finite Element Methods: Standard Galerkin [7], Streamline Upwind/ Petrov-Galerkin (SUPG) [6], Unsual Stabilized [8, 9] and Residual-Free Bubbles [3, 4, 5], for both linear (P1) (see [1]) and quadratic (P2) (see [2]) triangular finite elements.

  13. Rack for nuclear fuel elements

    International Nuclear Information System (INIS)

    Disclosed is a rack for storing spent nuclear fuel elements in which a plurality of aligned rows of upright enclosures of generally square cross-sectional areas contain vertically disposed spent fuel elements. Each fuel element is supported at the lower end thereof by a respective support that rests on the floor of the spent fuel pool for a nuclear power plant. An open rack frame is employed as an upright support for the enclosures containing the spent fuel elements. Legs at the lower corners of the frame rest on the floor of the pool to support the frame. In one exemplary embodiment, the support for the fuel element is in the form of a base on which a fuel element rests and the base is supported by legs. In another exemplary embodiment, each fuel element is supported on the pool floor by a self-adjusting support in the form of a base on which a fuel element rests and the base rests on a ball or swivel joint for self-alignment. The lower four corners of the frame are supported by legs adjustable in height for leveling the frame. Each adjustable frame leg is in the form of a base resting on the pool floor and the base supports a threaded post. The threaded post adjustably engages a threaded column on which rests the lower end of the frame. 16 claims, 14 figures

  14. Solution of Finite Element Equations

    DEFF Research Database (Denmark)

    Krenk, Steen

    An important step in solving any problem by the finite element method is the solution of the global equations. Numerical solution of linear equations is a subject covered in most courses in numerical analysis. However, the equations encountered in most finite element applications have some special...

  15. Repetitive elements in parasitic protozoa

    Directory of Open Access Journals (Sweden)

    Clayton Christine

    2010-05-01

    Full Text Available Abstract A recent paper published in BMC Genomics suggests that retrotransposition may be active in the human gut parasite Entamoeba histolytica. This adds to our knowledge of the various types of repetitive elements in parasitic protists and the potential influence of such elements on pathogenicity. See research article http://www.biomedcentral.com/1471-2164/11/321

  16. Trace element speciation in man

    International Nuclear Information System (INIS)

    The toxicological properties associated with an element depend upon its chemical form since this will dictate the metabolic pathway that the compound follows in the body. The speciation of the element is determinant for its physiological behaviour in a living system. The complicated interactions of the different forms of trace elements in human metabolism were reviewed and the species present were categorised into seven groups. The complexity of the tasks involved in a study of trace element speciation in man was illustrated and many of the pitfalls were identified together with an example of the detective approach that must be followed to elucidate the intricacies of the associations between trace elements and biomolecular moieties

  17. Massively Parallel Finite Element Programming

    KAUST Repository

    Heister, Timo

    2010-01-01

    Today\\'s large finite element simulations require parallel algorithms to scale on clusters with thousands or tens of thousands of processor cores. We present data structures and algorithms to take advantage of the power of high performance computers in generic finite element codes. Existing generic finite element libraries often restrict the parallelization to parallel linear algebra routines. This is a limiting factor when solving on more than a few hundreds of cores. We describe routines for distributed storage of all major components coupled with efficient, scalable algorithms. We give an overview of our effort to enable the modern and generic finite element library deal.II to take advantage of the power of large clusters. In particular, we describe the construction of a distributed mesh and develop algorithms to fully parallelize the finite element calculation. Numerical results demonstrate good scalability. © 2010 Springer-Verlag.

  18. Chemistry of the heaviest elements

    International Nuclear Information System (INIS)

    Studies of the chemical properties of the elements at the uppermost end of the periodic table are discussed. Some historical perspective is given, but major emphasis is on recent studies. Isotopes of these elements are short-lived and, therefore, must be studied near the site of production. They must be produced with charged-particle beams at accelerators rather than via neutron capture. The use of radioactive heavy actinide targets is often required and the number of atoms produced is so small that any chemistry to be performed must be done on an ''atom-at-a-time'' basis. Furthermore, a knowledge of their nuclear properties is required in order to identify and detect them. To date, both gas and aqueous phase properties of elements as heavy as element 104 (rutherfordium) and element 105 (hahnium) have been investigated, even though their longest-lived known isotopes have half-lives of only 65 and 35 seconds, respectively. The experimental results show that their chemical properties cannot be simply extrapolated from the known properties of their lighter homologs in the periodic table, emphasizing the importance of obtaining additional experimental information for the heaviest elements to compare with predictions and help assess the influence of relativistic effects. The feasibility of the extension of chemical studies to still heavier elements is also discussed. (orig.)

  19. Higher-Order Finite Element Modeling with Curvilinear Elements

    Czech Academy of Sciences Publication Activity Database

    Karban, P.; Mach, F.; Doležel, Ivo

    Gliwice : Silesian University of Technology, 2011, s. 5-6. ISBN 978-83-85940-33-3. [INTERNATIONAL CONFERENCE ON FUNDAMENTALS OF ELECTROTECHNICS AND CIRCUIT THEORY /34./. Ustroň (PL), 18.05.2011-21.05.2011] R&D Projects: GA ČR(CZ) GAP102/11/0498 Institutional research plan: CEZ:AV0Z20570509 Keywords : automatic adaptivity * higher-order finite element method * curvilinear elements Subject RIV: JA - Electronics ; Optoelectronics, Electrical Engineering

  20. Increased burnup of fuel elements

    International Nuclear Information System (INIS)

    The specialists' group for fuel elements of the Kerntechnische Gesellschaft e.V. held a meeting on ''Increased Burnup of Fuel Elements'' on 9th and 10th of November 1982 at the GKSS Research Center Geesthacht. Most papers dealt with the problems of burnup increase of fuel elements for light water reactors with respect to fuel manufacturing, power plant operation and reprocessing. Review papers were given on the burnup limits for high temperature gas cooled reactors and sodium fast breeder reactors. The meeting ended with a presentation of the technical equipment of the hot laboratory of the GKSS and the programs which are in progress there. (orig.)

  1. Packing element of a packer

    Energy Technology Data Exchange (ETDEWEB)

    Safin, V.A.

    1982-01-01

    The packing element of a packer is proposed which consists of an elastic core and outer layer made of plastic sealing material. It is distinguished by the fact that in order to facilitate removal of the packing element from the site of installation, the outer layer has a sublayer made of polymer material which is chemically inactive in relationship to the material of the core, for example polytetrafluoroethylene. The element is also distinguished by the fact that the outer layer together with the sublayer is attached to the core through a nonhardening and nondrying glue composition, for example, based on rubber, rosin, lanolin, vaseline oil and zinc oxide.

  2. Spacer for a fuel element

    International Nuclear Information System (INIS)

    Spacers for fuel pins arranged to form congish fuel elements can be shaped as plates with openings in accordance with the fuel pin grid. Such a plate that covers the cross section of a fuel element consists according to the invention of at least two parts that are offset in the fuel element's longitudinal direction and joint hinge-like in at least one grid position. Thus, one has smaller parts that are easier to work on with due accuracy. The invention is designed in particular for breeder reactors and high-conversion reactors. (orig.)

  3. Finite element computational fluid mechanics

    Science.gov (United States)

    Baker, A. J.

    1983-01-01

    Finite element analysis as applied to the broad spectrum of computational fluid mechanics is analyzed. The finite element solution methodology is derived, developed, and applied directly to the differential equation systems governing classes of problems in fluid mechanics. The heat conduction equation is used to reveal the essence and elegance of finite element theory, including higher order accuracy and convergence. The algorithm is extended to the pervasive nonlinearity of the Navier-Stokes equations. A specific fluid mechanics problem class is analyzed with an even mix of theory and applications, including turbulence closure and the solution of turbulent flows.

  4. Photoshop Elements 9 Digital Classroom

    CERN Document Server

    Team, AGI Creative

    2011-01-01

    Learn Photoshop Elements at your own pace with this unique book-and-DVD training packagePhotoshop Elements is the leading image-editing software, and this personal training course uses a full-color book plus video tutorials on the DVD to teach you how to use all its features. Each of the 13 lessons is presented with step-by-step instructions and includes lesson files and a video explanation of the concepts. You can learn from leading instructors, and do it at your own pace.Photoshop Elements provides professional quality image-editing tools at an affordable price; this book-and-DVD package off

  5. Essential Elements of Geologic Reports.

    Science.gov (United States)

    Webb, Elmer James

    1988-01-01

    Described is a report outline for geologic reports. Essential elements include title; abstract; introduction; stratigraphy; petrography; geochemistry; petrology; geophysics; structural geology; geologic history; modeling; economics; conclusions; and recommendations. (Author/CW)

  6. Finite element methods for engineers

    CERN Document Server

    Fenner, Roger T

    2013-01-01

    This book is intended as a textbook providing a deliberately simple introduction to finite element methods in a way that should be readily understandable to engineers, both students and practising professionals. Only the very simplest elements are considered, mainly two dimensional three-noded “constant strain triangles”, with simple linear variation of the relevant variables. Chapters of the book deal with structural problems (beams), classification of a broad range of engineering into harmonic and biharmonic types, finite element analysis of harmonic problems, and finite element analysis of biharmonic problems (plane stress and plane strain). Full Fortran programs are listed and explained in detail, and a range of practical problems solved in the text. Despite being somewhat unfashionable for general programming purposes, the Fortran language remains very widely used in engineering. The programs listed, which were originally developed for use on mainframe computers, have been thoroughly updated for use ...

  7. Environmental research on actinide elements

    International Nuclear Information System (INIS)

    The papers synthesize the results of research sponsored by DOE's Office of Health and Environmental Research on the behavior of transuranic and actinide elements in the environment. Separate abstracts have been prepared for the 21 individual papers

  8. In situ trace element microanalysis

    Science.gov (United States)

    Burnett, D. S.; Woolum, D. S.

    1983-01-01

    The use of particle-track-radiography and X-ray- fluorescence techniques in the in situ measurement of trace (less than 1000 ppm) elements in single mineral phases of polished sections is surveyed, and examples of their application to ordinary, carbonaceous and enstatite chondrites are provided. Radiographic methods surveyed include fission-track radiography (for U, Th, and Pu-244), alpha radiography using nuclear reactions (for Li and B), alpha autoradiography (for Bi and Pb), and beta autoradiography (for several elements in synthetic or biological samples). Two X-ray-fluorescence methods are compared: (1) photon-induced X-ray emission (PIXE), and (2) the potential use of synchrotron radiation. The latter is shown to allow much greater sensitivity than current PIXE technology and a much broader range of elements than particle-track radiography: the ppm analysis of 10-micron grains for all elements heavier than Na. These advantages are seen as balancing the high cost of accelerator use.

  9. Elemental ABAREX -- a user's manual

    International Nuclear Information System (INIS)

    ELEMENTAL ABAREX is an extended version of the spherical optical-statistical model code ABAREX, designed for the interpretation of neutron interactions with elemental targets consisting of up to ten isotopes. The contributions from each of the isotopes of the element are explicitly dealt with, and combined for comparison with the elemental observables. Calculations and statistical fitting of experimental data are considered. The code is written in FORTRAN-77 and arranged for use on the IBM-compatible personal computer (PC), but it should operate effectively on a number of other systems, particularly VAX/VMS and IBM work stations. Effort is taken to make the code user friendly. With this document a reasonably skilled individual should become fluent with the use of the code in a brief period of time

  10. Web engineering security: essential elements

    OpenAIRE

    Glisson, W.B.; Welland, R.

    2007-01-01

    Security is an elusive target in today’s high-speed and extremely complex, Web enabled, information rich business environment. This paper presents the idea that there are essential, basic organizational elements that need to be identified, defined and addressed before examining security aspects of a Web Engineering Development process. These elements are derived from empirical evidence based on a Web survey and supporting literature. This paper makes two contributions. The first contribution ...

  11. Elemental mercury exposure: peripheral neurotoxicity.

    OpenAIRE

    Levine, S P; Cavender, G D; Langolf, G D; Albers, J W

    1982-01-01

    Nerve conduction tests were performed on the right ulnar nerve of factory workers exposed to elemental mercury vapour. Time integrated urine mercury indices were used to measure the degree of exposure. Workers with prolonged distal latencies had significantly higher urine mercury concentrations when compared with those with normal latencies. Significant correlations between increasing urine mercury concentrations and prolonged motor and sensory distal latencies were established. Elemental mer...

  12. Nuclear reactor fuel element splitter

    International Nuclear Information System (INIS)

    A method and apparatus are disclosed for removing nuclear fuel from a clad fuel element. The fuel element is power driven past laser beams which simultaneously cut the cladding lengthwise into at least two longitudinal pieces. The axially cut lengths of cladding are then separated, causing the nuclear fuel contained therein to drop into a receptacle for later disposition. The cut lengths of cladding comprise nuclear waste which is disposed of in a suitable manner. 6 claims, 10 drawing figures

  13. Organisms and Elements. Survey Paper

    International Nuclear Information System (INIS)

    An attempt is made in this paper to fit the subject matter of the Symposium within a general biological framework. With this in view the following points are considered. Living organisms are autonomously functioning complex units, whose basic structures are macromolecules (proteins, lipids, carbohydrates, nucleic acids) composed of only a few elements (C, H, O, N, S, P). However, the study of the life processes has increasingly shown that a considerable number of additional elements are of importance for many vital functions. Depending on differences in their ability to synthesize complex molecules, the organisms must continuously assimilate a greater or smaller variety of molecular and elemental constituents from their environments. Thus a complex network comprising many energy, food, and element chains exists in the biosphere. Living organisms are distributed among a variety of biotopes which differ greatly from each other (sea, brackish water, freshwater, land, air). Their basic food and energy requirements in these environments are reflected in their primary structures and ways of life (e. g. sessility, mobility). Furthermore, in many organisms, special external and internal pumps and other homeostatic mechanisms (hormones) exist which serve a special purpose in relation to particular elements in their environments. In those organisms which have, in the past, migrated from one main biotope to another, such a factor in their origin and development may be betrayed by their elemental compositions. Living organisms, therefore, form a unity with their non-living milieu. They are the living part of the elemental pool at the surface of this planet. A careful study of the elements present in the organisms - not just a descriptive study but rather a physiological one - is of fundamental importance for biology. (author)

  14. PROPOSAL OF NEW OPTICAL ELEMENTS

    Directory of Open Access Journals (Sweden)

    Goce Chadzitaskos

    2013-10-01

    Full Text Available A overview of our patented proposals of new optical elements is presented. The elements are suitable for laser pulse analysis, telescopy, X-ray microscopy and X-ray telescopy. They are based on the interference properties of light: a special grating for a double slit pattern, parabolic strip imaging for a telescope, and Bragg’s condition for X-ray scattering on a slice of a single crystal for X-raymicroscopy and X-ray telescopy.

  15. Sortable elements and Cambrian lattices

    OpenAIRE

    Reading, Nathan

    2005-01-01

    We show that the Coxeter-sortable elements in a finite Coxeter group W are the minimal congruence-class representatives of a lattice congruence of the weak order on W. We identify this congruence as the Cambrian congruence on W, so that the Cambrian lattice is the weak order on Coxeter-sortable elements. These results exhibit W-Catalan combinatorics arising in the context of the lattice theory of the weak order on W.

  16. Chemistry of the transactinide elements

    International Nuclear Information System (INIS)

    The experimentally known chemical properties of the transactinide elements 104 and 105, and the experimental techniques used to study these properties on an atom-at-a-time base, are reviewed. The production of transactinides in heavy ion reactions and the specific aspects of chemical separations with single atoms is briefly discussed. The chemical properties of the first two transactinide elements are compared with the lighter element homologs in group 4 and 5 of the Periodic Table and with the expected behaviour obtained from most recent atomic and molecular calculations which take the increasingly strong relativistic effect into account. Elements 104 and 105 behave as transactinide elements and, in general, exhibit properties characteristic of their position in group 4 and 5 of the Periodic Table. However, surprising deviations of the chemical properties from expectations based on simple extrapolations have been observed. It is shown that the chemical properties of the heaviest elements cannot reliably be predicted by simple extrapolations. Prospects to extend our chemical knowledge at the top end of the Periodic Table are discussed. (orig.)

  17. Microduplications encompassing the Sonic Hedgehog Limb Enhancer ZRS are Associated with Haas Type Polysyndactyly and Laurin-Sandrow Syndrome

    DEFF Research Database (Denmark)

    Lohan, Silke; Spielmann, Malte; Doelken, Sandra C;

    2014-01-01

    Laurin-Sandrow syndrome (LSS) is a rare autosomal dominant disorder characterized by polysyndactyly of hands and/or feet, mirror image duplication of the feet, nasal defects, and loss of identity between fibula and tibia. The genetic basis of LSS is currently unknown. LSS shows phenotypic overlap...

  18. Separation of mutational and transcriptional enhancers in immunoglobulin genes

    OpenAIRE

    Kothapalli, Naga Rama; Collura, Kaitlin M.; Norton, Darrell D.; Fugmann, Sebastian D.

    2011-01-01

    Secondary immunoglobulin (Ig) gene diversification relies on activation-induced cytidine deaminase (AID) to create U:G mismatches that are subsequently fixed by mutagenic repair pathways. AID activity is focused to Ig loci by cis-regulatory DNA sequences named targeting elements. Here we show that in contrast to prevailing thought in the field, the targeting elements in the chicken IGL locus are distinct from classical transcriptional enhancers. These mutational enhancer elements (MEEs) are r...

  19. Alterations in growth and cell death by genetic deletion of the antioxidan response factor Nrf2 ist target, the quinone reductase NQ01

    OpenAIRE

    Ariza Gómez, Julia

    2015-01-01

    To neutralize oxidative stress insults, cells have acquire complex defense mechanisms which are induced in a highly coordinated way. This coordinated response is regulated through a cis-regulatory element, called the antioxidant responsive element (ARE) or electrophile-responsive element (EpRE), located within the regulatory region of target genes (Friling, Bensimon et al. 1990, Rushmore, Morton et al. 1991). Nrf2 (Nuclear factor erythroid 2 related factor, NF-E2-related factor...

  20. ANSYS duplicate finite-element checker routine

    Science.gov (United States)

    Ortega, R.

    1995-01-01

    An ANSYS finite-element code routine to check for duplicated elements within the volume of a three-dimensional (3D) finite-element mesh was developed. The routine developed is used for checking floating elements within a mesh, identically duplicated elements, and intersecting elements with a common face. A space shuttle main engine alternate turbopump development high pressure oxidizer turbopump finite-element model check using the developed subroutine is discussed. Finally, recommendations are provided for duplicate element checking of 3D finite-element models.

  1. New elements - approaching Z=114

    International Nuclear Information System (INIS)

    The search for new elements is part of the broader field of investigations of nuclei at the limits of stability. In two series of experiments at SHIP, six new elements (Z=107-112) were synthesized via fusion reactions using 1n-deexcitation channels and lead or bismuth targets. The isotopes were unambiguously identified by means of α-α correlations. Not fission, but alpha decay is the dominant decay mode. The collected decay data establish a means of comparison with theoretical data. This aids in the selection of appropriate models that describe the properties of known nuclei. Predictions based on these models are useful in the preparation of the next generation of experiments. Cross-sections decrease by two orders of magnitude from bohrium (Z=107) to element 112, for which a cross-section of 1 pb was measured. The development of intense beam currents and sensitive detection methods is essential for the production and identification of still heavier elements and new isotopes of already known elements, as well as the measurement of small α-, β- and fission-branching ratios. An equally sensitive set-up is needed for the measurement of excitation functions at low cross-sections. Based on our results, it is likely that the production of isotopes of element 114 close to the island of spherical super heavy elements (SHE) could be achieved by fusion reactions using 208Pb targets. Systematic studies of the reaction cross-sections indicate that the transfer of nucleons is an important process for the initiation of fusion. The data allow for the fixing of a narrow energy window for the production of SHE using 1n-emission channels. (orig.)

  2. New elements - approaching Z=114

    Energy Technology Data Exchange (ETDEWEB)

    Hofmann, S.

    1998-03-01

    The search for new elements is part of the broader field of investigations of nuclei at the limits of stability. In two series of experiments at SHIP, six new elements (Z=107-112) were synthesized via fusion reactions using 1n-deexcitation channels and lead or bismuth targets. The isotopes were unambiguously identified by means of {alpha}-{alpha} correlations. Not fission, but alpha decay is the dominant decay mode. The collected decay data establish a means of comparison with theoretical data. This aids in the selection of appropriate models that describe the properties of known nuclei. Predictions based on these models are useful in the preparation of the next generation of experiments. Cross-sections decrease by two orders of magnitude from bohrium (Z=107) to element 112, for which a cross-section of 1 pb was measured. The development of intense beam currents and sensitive detection methods is essential for the production and identification of still heavier elements and new isotopes of already known elements, as well as the measurement of small {alpha}-, {beta}- and fission-branching ratios. An equally sensitive set-up is needed for the measurement of excitation functions at low cross-sections. Based on our results, it is likely that the production of isotopes of element 114 close to the island of spherical super heavy elements (SHE) could be achieved by fusion reactions using {sup 208}Pb targets. Systematic studies of the reaction cross-sections indicate that the transfer of nucleons is an important process for the initiation of fusion. The data allow for the fixing of a narrow energy window for the production of SHE using 1n-emission channels. (orig.)

  3. New elements - approaching Z = 114

    International Nuclear Information System (INIS)

    The search for new elements is part of the broader field of investigations of nuclei at the limits of stability. In two series of experiments at SHIP, six new elements (Z = 107-112) were synthesized via fusion reactions using 1n-deexcitation channels and lead or bismuth targets. The isotopes were unambiguously identified by means of α-α correlations. Alpha decay, not fission, is the dominant decay mode. The collected decay data establish a means of comparison with theoretical data. This aids in the selection of appropriate models that describe the properties of known nuclei. Predictions based on these models are useful in the preparation of the next generation of experiments. Cross sections decrease by two orders of magnitude from bohrium (Z = 107) to element 112, for which a cross section of 1 pb was measured. The development of intense beam currents and sensitive detection methods is essential for the production and identification of still heavier elements and new isotopes of already known elements, as well as the measurement of small α-, β- and fission-branching ratios. An equally sensitive set-up is needed for the measurement of excitation functions at low cross sections. Based on our results, it is likely that the production of isotopes of element 114 close to the island of spherical superheavy elements (SHEs) could be achieved by fusion reactions using 208Pb targets. Systematic studies of the reaction cross sections indicate that the transfer of nucleons is an important process for the initiation of fusion. The data allow for the fixing of a narrow energy window for the production of SHEs using 1n-emission channels. The likelihood of broadening the energy window by investigation of radiative capture reactions, use of neutron deficient projectile isotopes and use of actinide targets is discussed. (author)

  4. Brain trace elements and aging

    International Nuclear Information System (INIS)

    Degenerative mechanisms involved in the aging process of the brain are to a certain extent counteracted by repair mechanisms. In both degenerative and recovery processes, trace elements are involved. The present study focused on the role of two minor (i.e., K and Ca) and six trace elements (i.e., Mn, Fe, Cu, Zn, Se and Rb) in the aging process. The elements were determined by PIXE in cerebral cortex and white matter, basal ganglia, brainstem and cerebellar cortex of 18 postmortem human brains, from persons without a history of neurologic or psychiatric disease who deceased between the age of 7 and 79. This age range allowed us to study the relationship between elemental concentrations and age. The most prominent findings were a concentration decrease for K and Rb and a concentration increase for the elements Ca, Fe, Zn and Se. The study supports recent findings that Ca and Fe are involved in brain degenerative processes initiated by oxygen free radicals, whereas Zn and Se are involved in immunological reactions counteracting the aging process

  5. Novel RSFQ elements and devices

    International Nuclear Information System (INIS)

    A new generation of the Josephson digital circuits - Rapid Single Flux Quantum (RSFQ) devices - have been introduced and experimentally investigated. The information in RSFQ-logic is carried by Single magnetic Flux Quanta (SFQ). The basic principle of operation of RSFQ elements lies in controlling SFQ in complex structures of Josephson junction arrays. DC powered RSFQ elements differ radically from latching family by much higher clock frequency up to 100 GHz. New RSFQ elements, which are necessary for practical application have been designed, fabricated and experimentally investigated. All refractory Nb-AlOx-Nb overdamped junctions (βc≤1, jc∼103A/cm2) have been successfully employed for fabrication of RSFQ microcircuits. Four-bit Flash type Analog to Digital converter (ADC) has been suggested, designed and tested. The DC/SFQ converter of information from potential into SFQ form as well as comparators and SFQ/DC converters for asynchronous readout were implemented. The RSFQ version of Flash type ADC surpasses traditional latching one for the next reasons: 1) DC powering; 2) asynchronous readout; 3) readout elements are allocated outside of comparator; 4) internal frequency of elements is higher than 50GHz. Latching logic to RSFQ converter has been fabricated, tested and used for DC/SFQ input current level stabilization. (orig.)

  6. Spectral element simulation of ultrafiltration

    DEFF Research Database (Denmark)

    Hansen, M.; Barker, Vincent A.; Hassager, Ole

    1998-01-01

    vector in the transport equation, the system is coupled by the dependency of the fluid viscosity on the solute concentration and by a concentration-dependent boundary condition for the Navier-Stokes equations at the membrane surface. The spectral element discretization yields a nonlinear algebraic system......A spectral element method for simulating stationary 2-D ultrafiltration is presented. The mathematical model is comprised of the Navier-Stokes equations for the velocity field of the fluid and a transport equation for the concentration of the solute. In addition to the presence of the velocity....... The performance of the spectral element code when applied to several ultrafiltration problems is reported. (C) 1998 Elsevier Science Ltd. All rights reserved....

  7. Element profiles of mouse hair

    International Nuclear Information System (INIS)

    Element profile patterns of growth and nongrowth phase hair were obtained for the C57L/J male mouse using a proton microprobe. Growth phase hair profiles of Cl, S, K and P show that these elements are concentrating in regions of higher pigmentation. Calcium is restricted to the medulla region in the hair shaft. For nongrowth phase hair, the profiles of Cl and S are essentially unchanged, whereas K and P are depleted in the hair shaft and are concentrating in the cornified root sheath. The element patterns found for the nongrowth phase profiles of mouse hair show striking similarities to previously reported patterns for growth profiles of human hair. (author) 10 refs.; 4 figs

  8. Mechanical Analogies of Fractional Elements

    Institute of Scientific and Technical Information of China (English)

    HU Kai-Xin; ZHU Ke-Qin

    2009-01-01

    A Fractional element model describes a special kind of viscoelastic material.Its stress is proportional to the fractional-order derivative of strain. Physically the mechanical analogies of fractional elements can be represented by spring-dashpot fractal networks. We introduce a constitutive operator in the constitutive equations of viscoelastic materials.To derive constitutive operators for spring-dashpot fractal networks, we use Heaviside operational calculus, which provides explicit answers not otherwise obtainable simply.Then the series-parallel formulas for the constitutive operator are derived. Using these formulas, a constitutive equation of fractional element with 1/2-order derivative is obtained.Finally we find the way to derive the constitutive equations with other fractional-order derivatives and their mechanical analogies.

  9. An external drag measuring element

    Science.gov (United States)

    Ringel, Mordechai; Levin, Daniel; Seginer, Arnan

    The accurate measurement of the axial-force component acting on small wind-tunnel models has traditionally made use of integral string balances, which eliminated many accuracy problems, such as friction and hysteresis, but also introduced interactions between the various force and moment sensing elements due to nonlinear elastic phenomena. The reduction of these interactions usually calls for complicated designs, expensive manufacturing, hard-to-handle calibration processes, and cumbersome data reduction programs. An approach is presented that is based on an external axial-force-measuring element and avoids the ill-conditioned design problems of integral balances. Other difficulties that are encountered, such as friction, misalignment, and relative motion between metric elements are considered, and their solution is examined. Calibration and test results show that the new approach duplicates and surpasses the results of much more complicated and expensive integral balances.

  10. The age of the elements

    International Nuclear Information System (INIS)

    The paper is devoted to nuclear cosmochronology. The age of the Universe is estimated with the aid of radioactive nuclear-nuclear chronometers (NC). For calculations it is required that the proportion in which the appropriate pair of NC is at present ('relative abundance') and the proportion for the moment of their formation ('relative production') should be known. A short description is given of production of elements in the process of star evolution. The 'relative production' is calculated theoretically. The relative abundance is determined from experiments, mainly from meteorites. Recentl Lunar rocks have been also coming into use. The following elements are chosen as pairs of chronometers: Th-232/U-238; U-235/U-238; Pu-244/Th-232; J-129/J-127. Using this method the authors have determined the age of elements from 7 to 15 billion years, the best estimate being approximately 10 billion years. This age is quite in an agreement with calculations made by other methods

  11. Regeneration method for filter element

    International Nuclear Information System (INIS)

    The outer surface of a filter element used for treating exhaust gases from an incinerator is divided into a plurality of zones. A back-washing for the filter is conducted in a container by using pressurized air in a state of leaving a certain zone unsealed. Then, the unsealed zone is displaced and back-washing is applied in the same manner. With such procedures, clogged materials which could not be removed by the existent method of simultaneously back-washing the entire filter element can certainly be removed. Further, according to the present invention, the clogged materials removed from the filter element are not discharged to the outside, but prevented from flowing out of the system. (T.M.)

  12. Trace element analysis in flour

    International Nuclear Information System (INIS)

    Trace elements in five kinds of flour which were made in Japan, America and Canada, have been measured by means of in-air PIXE. Twelve kinds of trace elements were detected, such as Cl, K, Ca, Sc, Cr, Mn, Fe, Co, Ni, Cu, Zn and Br. The concentration of these elements varied depending on the place where they were made. In order to check the target preparation procedure, two types of sample preparation have been used, such as wet ashing by nitric acid in a microwave oven and making a paste by an internal standard solution. Comparisons of the results of both samples ensures that bromine was not lost during micro-wave oven heating. Analytic fitting of PIXE spectra by a personal computer and a commercial application software was successfully used. (author)

  13. Marine oligotrophy and element biogeochemistry

    International Nuclear Information System (INIS)

    A biogeochemical model has been developed that explains the inverse and non-linear relationship between Po-210 concentration in zooplankton and their biomass, under oligotrophic conditions in French Polynesia. This study identified other elements with comparable accumulatory behaviours to Po-210 in phytoplankton, seston and zooplankton, that are proposed to be critical to its enhanced environmental levels under oligotrophy. Field investigation in the Gulf of Papua showed that four of these a priori identified elements viz Cd, Co, Pb and Mn, as well as Cr and Ni, showed elevated water concentrations with reduced biological productivity, results that are consistent with those previously obtained for Po-210 and the proposed explanatory model. These findings point to the enhanced susceptibility of oligotrophic systems to contamination from particle-reactive elements. (author)

  14. New elements - approaching Z = 114

    Energy Technology Data Exchange (ETDEWEB)

    Hofmann, S. [Gesellschaft fuer Schwerionenforschung (GSI), Darmstadt (Germany)

    1998-06-01

    The search for new elements is part of the broader field of investigations of nuclei at the limits of stability. In two series of experiments at SHIP, six new elements (Z = 107-112) were synthesized via fusion reactions using 1n-deexcitation channels and lead or bismuth targets. The isotopes were unambiguously identified by means of {alpha}-{alpha} correlations. Alpha decay, not fission, is the dominant decay mode. The collected decay data establish a means of comparison with theoretical data. This aids in the selection of appropriate models that describe the properties of known nuclei. Predictions based on these models are useful in the preparation of the next generation of experiments. Cross sections decrease by two orders of magnitude from bohrium (Z = 107) to element 112, for which a cross section of 1 pb was measured. The development of intense beam currents and sensitive detection methods is essential for the production and identification of still heavierelements and new isotopes of already known elements, as well as the measurement of small {alpha}-, {beta}- and fission-branching ratios. An equally sensitive set-up is needed for the measurement of excitation functions at low cross sections. Based on our results, it is likely that the production of isotopes of element 114 close to the island of spherical superheavy elements (SHEs) could be achieved by fusion reactions using {sup 208}Pb targets. Systematic studies of the reaction cross sections indicate that the transfer of nucleons is an important process for the initiation of fusion. The data allow for the fixing of a narrow energy window for the production of SHEs using 1n-emission channels. The likelihood of broadening the energy window by investigation of radiative capture reactions, use of neutron deficient projectile isotopes and use of actinide targets is discussed. (author)

  15. Elements to diminish radioactive accidents

    International Nuclear Information System (INIS)

    In this work it is presented an application of the cause-effect diagram method or Ichikawa method identifying the elements that allow to diminish accidents when the radioactive materials are transported. It is considered the transport of hazardous materials which include radioactive materials in the period: December 1996 until March 1997. Among the identified elements by this method it is possible to mention: the road type, the radioactive source protection, the grade driver responsibility and the preparation that the OEP has in the radioactive material management. It is showed the differences found between the country inner roads and the Mexico City area. (Author)

  16. Multiphoton spectroscopy in heavy elements

    Energy Technology Data Exchange (ETDEWEB)

    Solarz, R.W.; Paisner, J.A.; Worden, E.F.

    1977-05-03

    Some recently discovered regularities in the spectra of heavy elements which are also applicable to the analysis of the spectra of lighter atoms are described. It is pointed out that stepwise resonant multiphoton methods are irreplaceable tools in the study of high lying states in a complex atomic system. Systematic applications of these methods has permitted regularities to be observed which also hold for the lighter elements. It is noted that greatly increased understanding of the excited state structure of heavy atoms is not possible. 8 references. (JFP)

  17. Elements of spatial data quality

    CERN Document Server

    Guptill, SC

    1995-01-01

    Elements of Spatial Data Quality outlines the need and suggests potential categories for the content of a comprehensive statement of data quality that must be imbedded in the metadata that accompanies the transfer of a digital spatial data file or is available in a separate metadata catalog. Members of the International Cartographic Association's Commission on Spatial Data Quality have identified seven elements of data quality: positional accuracy, attribute accuracy, completeness, logical consistency, lineage, semantic accuracy and temporal information. In the book the authors describe: compo

  18. Elemental mercury exposure: peripheral neurotoxicity

    Energy Technology Data Exchange (ETDEWEB)

    Levine, S.P.; Cavender, G.D.; Langolf, G.D.; Albers, J.W.

    1982-05-01

    Nerve conduction tests were performed on the right ulnar nerve of factory workers exposed to elemental mercury vapour. Time integrated urine mercury indices were used to measure the degree of exposure. Workers with prolonged distal latencies had significantly higher urine mercury concentrations when compared with those with normal latencies. Significant correlations between increasing urine mercury concentrations and prolonged motor and sensory distal latencies were established. Elemental mercury can affect both motor and sensory peripheral nerve conduction and the degree of involvement may be related to time-integrated urine mercury concentrations.

  19. Staggered weak matrix element miscellany

    International Nuclear Information System (INIS)

    I report on work, done with Rajan Gupta and Greg Kilcup, using staggered fermions to study weak matrix elements in quenched QCD. I give an update on the ΔI = 1/2 rule on matrix elements relevant for ε'. I show results of a study of the dependence of BK on non-leading terms in the chiral expansion. I present our results for BK from quenched calculation at β = 6.4 on 323 x 48 lattices, based on ensemble of 12 configurations. 15 refs., 5 figs

  20. Finite elements of nonlinear continua

    CERN Document Server

    Oden, J T

    2000-01-01

    Geared toward undergraduate and graduate students, this text extends applications of the finite element method from linear problems in elastic structures to a broad class of practical, nonlinear problems in continuum mechanics. It treats both theory and applications from a general and unifying point of view.The text reviews the thermomechanical principles of continuous media and the properties of the finite element method, and then brings them together to produce discrete physical models of nonlinear continua. The mathematical properties of these models are analyzed, along with the numerical s

  1. Nuclear fuel elements design, fabrication and performance

    CERN Document Server

    Frost, Brian R T

    1982-01-01

    Nuclear Fuel Elements: Design, Fabrication and Performance is concerned with the design, fabrication, and performance of nuclear fuel elements, with emphasis on fast reactor fuel elements. Topics range from fuel types and the irradiation behavior of fuels to cladding and duct materials, fuel element design and modeling, fuel element performance testing and qualification, and the performance of water reactor fuels. Fast reactor fuel elements, research and test reactor fuel elements, and unconventional fuel elements are also covered. This volume consists of 12 chapters and begins with an overvie

  2. Fuel element database: developer handbook

    International Nuclear Information System (INIS)

    The fuel elements database which was developed for Atomic Institute of the Austrian Universities is described. The software uses standards like HTML, PHP and SQL. For the standard installation freely available software packages such as MySQL database or the PHP interpreter from Apache Software Foundation and Java Script were used. (nevyjel)

  3. New elements produced at GSI

    Science.gov (United States)

    Hofmann, Sigurd

    1998-12-01

    In two series of experiments at SHIP, six new elements (Z=107-112) were synthesized via fusion reactions using lead or bismuth targets and 1n-deexcitation channels. The isotopes were unambiguously identified by means of α-α correlations. Not fission, but alpha decay is the dominant decay mode. Cross-sections decrease by two orders of magnitude from bohrium (Z=107) to element 112, for which a cross-section of 1 pb was measured. Based on our results, it is likely that the production of isotopes of element 114 close to the island of spherical SuperHeavy Elements (SHE) could be achieved by fusion reactions using 208Pb targets. Systematic studies of the reaction cross-sections indicate that the transfer of nucleons is an important process for the initiation of fusion. The data allow for the fixing of a narrow energy window for the production of SHE using 1n-emission channels. The likelihood of broadening the energy window by investigation of radiative capture reactions, use of neutron deficient projectile isotopes and use of actinide targets is discussed.

  4. New elements produced at GSI

    International Nuclear Information System (INIS)

    In two series of experiments at SHIP, six new elements (Z=107-112) were synthesized via fusion reactions using lead or bismuth targets and 1n-deexcitation channels. The isotopes were unambiguously identified by means of α-α correlations. Not fission, but alpha decay is the dominant decay mode. Cross-sections decrease by two orders of magnitude from bohrium (Z=107) to element 112, for which a cross-section of 1 pb was measured. Based on our results, it is likely that the production of isotopes of element 114 close to the island of spherical SuperHeavy Elements (SHE) could be achieved by fusion reactions using 208Pb targets. Systematic studies of the reaction cross-sections indicate that the transfer of nucleons is an important process for the initiation of fusion. The data allow for the fixing of a narrow energy window for the production of SHE using 1n-emission channels. The likelihood of broadening the energy window by investigation of radiative capture reactions, use of neutron deficient projectile isotopes and use of actinide targets is discussed

  5. Compact Fuel Element Environment Test

    Science.gov (United States)

    Bradley, D. E.; Mireles, O. R.; Hickman, R. R.; Broadway, J. W.

    2012-01-01

    Deep space missions with large payloads require high specific impulse (I(sub sp)) and relatively high thrust to achieve mission goals in reasonable time frames. Conventional, storable propellants produce average I(sub sp). Nuclear thermal rockets (NTRs) capable of high I(sub sp) thrust have been proposed. NTR employs heat produced by fission reaction to heat and therefore accelerate hydrogen, which is then forced through a rocket nozzle providing thrust. Fuel element temperatures are very high (up to 3,000 K) and hydrogen is highly reactive with most materials at high temperatures. Data covering the effects of high-temperature hydrogen exposure on fuel elements are limited. The primary concern is the mechanical failure of fuel elements that employ high melting point metals, ceramics, or a combination (cermet) as a structural matrix into which the nuclear fuel is distributed. It is not necessary to include fissile material in test samples intended to explore high-temperature hydrogen exposure of the structural support matrices. A small-scale test bed designed to heat fuel element samples via noncontact radio frequency heating and expose samples to hydrogen for typical mission durations has been developed to assist in optimal material and manufacturing process selection without employing fissile material. This Technical Memorandum details the test bed design and results of testing conducted to date.

  6. Environmental research on actinide elements

    Energy Technology Data Exchange (ETDEWEB)

    Pinder, J.E. III; Alberts, J.J.; McLeod, K.W.; Schreckhise, R.G. (eds.)

    1987-08-01

    The papers synthesize the results of research sponsored by DOE's Office of Health and Environmental Research on the behavior of transuranic and actinide elements in the environment. Separate abstracts have been prepared for the 21 individual papers. (ACR)

  7. Treatment of incorporated transuranium elements

    International Nuclear Information System (INIS)

    The text of this report and its tables and figures provide basic information on the decorporation of transuranium elements as well as an insight into the more general principles, trends and interactions. The detailed tables and the exhaustive list of important references should enable the reader to make his own conclusions in a minimum of time

  8. Key Elements of Social Innovation

    OpenAIRE

    Allyson Hewitt

    2008-01-01

    This article describes four key elements of social innovation: i) social technology; ii) innovation intermediaries; iii) people who drive innovation; and iv) openness. By taking experiences from social technology and examining the impact of "open everything", this article posits the value of innovation intermediaries as critical enablers of success in the emergent field of social innovation.

  9. Dynamic and Transient Infinite Elements

    CERN Document Server

    Zhao, Chongbin

    2009-01-01

    Intends to provide the theory and the application of dynamic and transient infinite elements for simulating the far fields of infinite domains involved in many of scientific and engineering problems, based on the author's own work over the years. This title is suitable for computational geoscientists, geotechnical engineers, and civil engineers.

  10. Elements Of Epistemic Crypto Logic

    OpenAIRE

    2014-01-01

    The talk presents an extension of DEL (dynamic epistemic logic) intended for model checking of cryptographic protocols. Key elements are a feasible epistemic representation of knowledge of large integers, using register models, and exchange of such knowledge over a network. I will demonstrate how the approach can be used for model checking Diffie-Helman key exchange and similar protocols.

  11. Experimental search for superheavy elements

    International Nuclear Information System (INIS)

    This work reports on the experimental search for superheavy elements (SHE). Two types of approaches for SHE production are studied i.e. '' cold '' fusion mechanism and massive transfer mechanism. First mechanism was studied in normal and inverse kinematics, by using Wien filter at the GANIL facility. The production of SHE elements with Z 106 and 108 is reported while negative results on the synthesis of SHE elements with Z 114 and 118 was received. The other approach i.e. reactions induced by heavy ion projectiles (e.g. 172Yb, 197Au) on fissile target nuclei (e.g. 238U, 232Th) at near Coulomb barrier incident energies was studied by using superconducting solenoid installed Texas A(and)M University. Preliminary results for the reaction 197Au(7.5 MeV/u) - 232Th are presented where three cases of the possible candidates for SHE elements were found. A dedicated detection setup for such studies is discussed and the detailed data analysis is presented. Detection of alpha and spontaneous fission radioactive decays is used to unambiguously identify the atomic number of SHE. Special statistical analysis for a very low detected number of α decays is applied to check consistency of the αradioactive chains. (author)

  12. Superheavy element flerovium (element 114) is a volatile metal.

    Science.gov (United States)

    Yakushev, Alexander; Gates, Jacklyn M; Türler, Andreas; Schädel, Matthias; Düllmann, Christoph E; Ackermann, Dieter; Andersson, Lise-Lotte; Block, Michael; Brüchle, Willy; Dvorak, Jan; Eberhardt, Klaus; Essel, Hans G; Even, Julia; Forsberg, Ulrika; Gorshkov, Alexander; Graeger, Reimar; Gregorich, Kenneth E; Hartmann, Willi; Herzberg, Rolf-Dietmar; Hessberger, Fritz P; Hild, Daniel; Hübner, Annett; Jäger, Egon; Khuyagbaatar, Jadambaa; Kindler, Birgit; Kratz, Jens V; Krier, Jörg; Kurz, Nikolaus; Lommel, Bettina; Niewisch, Lorenz J; Nitsche, Heino; Omtvedt, Jon Petter; Parr, Edward; Qin, Zhi; Rudolph, Dirk; Runke, Jörg; Schausten, Brigitta; Schimpf, Erwin; Semchenkov, Andrey; Steiner, Jutta; Thörle-Pospiech, Petra; Uusitalo, Juha; Wegrzecki, Maciej; Wiehl, Norbert

    2014-02-01

    The electron shell structure of superheavy elements, i.e., elements with atomic number Z ≥ 104, is influenced by strong relativistic effects caused by the high Z. Early atomic calculations on element 112 (copernicium, Cn) and element 114 (flerovium, Fl) having closed and quasi-closed electron shell configurations of 6d(10)7s(2) and 6d(10)7s(2)7p1/2(2), respectively, predicted them to be noble-gas-like due to very strong relativistic effects on the 7s and 7p1/2 valence orbitals. Recent fully relativistic calculations studying Cn and Fl in different environments suggest them to be less reactive compared to their lighter homologues in the groups, but still exhibiting a metallic character. Experimental gas-solid chromatography studies on Cn have, indeed, revealed a metal-metal bond formation with Au. In contrast to this, for Fl, the formation of a weak bond upon physisorption on a Au surface was inferred from first experiments. Here, we report on a gas-solid chromatography study of the adsorption of Fl on a Au surface. Fl was produced in the nuclear fusion reaction (244)Pu((48)Ca, 3-4n)(288,289)Fl and was isolated in-flight from the primary (48)Ca beam in a physical recoil separator. The adsorption behavior of Fl, its nuclear α-decay product Cn, their lighter homologues in groups 14 and 12, i.e., Pb and Hg, and the noble gas Rn were studied simultaneously by isothermal gas chromatography and thermochromatography. Two Fl atoms were detected. They adsorbed on a Au surface at room temperature in the first, isothermal part, but not as readily as Pb and Hg. The observed adsorption behavior of Fl points to a higher inertness compared to its nearest homologue in the group, Pb. However, the measured lower limit for the adsorption enthalpy of Fl on a Au surface points to the formation of a metal-metal bond of Fl with Au. Fl is the least reactive element in the group, but still a metal. PMID:24456007

  13. An Improved Triangular Element With Drilling Rotations

    DEFF Research Database (Denmark)

    Damkilde, Lars; Grønne, Mikael

    2002-01-01

    A new plane element with rotational degrees in the corner nodes is presented. The element has 12 degrees of freedom and the only difference from the well-known Linear Strain Triangular (LST) element is that the displacements perpendicular to the element sides in the mid-side nodes are replaced by...... rotations in the corner nodes. Compared to Allman's plane element which was the first succesfull implementation of drilling rotations the proposed element has extra displacements in the mid-side nodes parallel to the element sides. The performance should therefore be better and closer to the LST...

  14. The scl +18/19 Stem Cell Enhancer Is Not Required for Hematopoiesis: Identification of a 5′ Bifunctional Hematopoietic-Endothelial Enhancer Bound by Fli-1 and Elf-1

    OpenAIRE

    Göttgens, Berthold; Broccardo, Cyril; Sanchez, Maria-Jose; Deveaux, Sophie; Murphy, George; Göthert, Joachim R.; Kotsopoulou, Ekaterini; Kinston, Sarah; Delaney, Liz; Piltz, Sandie; Barton, Linda M.; Knezevic, Kathy; Erber, Wendy N.; Begley, C. Glenn; Frampton, Jonathan

    2004-01-01

    Analysis of cis-regulatory elements is central to understanding the genomic program for development. The scl/tal-1 transcription factor is essential for lineage commitment to blood cell formation and previous studies identified an scl enhancer (the +18/19 element) which was sufficient to target the vast majority of hematopoietic stem cells, together with hematopoietic progenitors and endothelium. Moreover, expression of scl under control of the +18/19 enhancer rescued blood progenitor formati...

  15. Transthyretin Mouse Transgenes Direct RFP Expression or Cre-Mediated Recombination Throughout the Visceral Endoderm

    OpenAIRE

    Kwon, Gloria S.; Hadjantonakis, Anna-Katerina

    2009-01-01

    Transthyretin (Ttr) is a thyroid hormone transport protein secreted by cells of the visceral yolk sac and fetal liver in developing embryos, and by hepatocytes and the choroid plexus epithelium of the brain in adult mice. Spatiotemporal localization of Ttr mRNA during embryogenesis suggested that Ttr regulatory elements might drive transgene expression throughout the visceral endoderm of early mouse embryos. We use Ttr cis-regulatory elements to generate Ttr::RFP and Ttr::Cre strains of mice,...

  16. Cis and Trans, p53 and NF-kB rules of transactivation

    OpenAIRE

    Sharma, Vasundhara

    2016-01-01

    p53 and NF-kB families of Transcription Factors (TFs) are among the most studied proteins in tumour biology, typically known to function as antagonists, although recent studies identified example of positive, even cooperative interactions. p53 and NF-kB act as dimer or dimer of dimers, bind cis regulatory elements (referred herein as Response Elements REs) of which multiple versions exist in the genome, and coordinate very large networks of target genes, through highly regulated transactivati...

  17. Inferring regulatory element landscapes and transcription factor networks from cancer methylomes.

    Science.gov (United States)

    Yao, Lijing; Shen, Hui; Laird, Peter W; Farnham, Peggy J; Berman, Benjamin P

    2015-01-01

    Recent studies indicate that DNA methylation can be used to identify transcriptional enhancers, but no systematic approach has been developed for genome-wide identification and analysis of enhancers based on DNA methylation. We describe ELMER (Enhancer Linking by Methylation/Expression Relationships), an R-based tool that uses DNA methylation to identify enhancers and correlates enhancer state with expression of nearby genes to identify transcriptional targets. Transcription factor motif analysis of enhancers is coupled with expression analysis of transcription factors to infer upstream regulators. Using ELMER, we investigated more than 2,000 tumor samples from The Cancer Genome Atlas. We identified networks regulated by known cancer drivers such as GATA3 and FOXA1 (breast cancer), SOX17 and FOXA2 (endometrial cancer), and NFE2L2, SOX2, and TP63 (squamous cell lung cancer). We also identified novel networks with prognostic associations, including RUNX1 in kidney cancer. We propose ELMER as a powerful new paradigm for understanding the cis-regulatory interface between cancer-associated transcription factors and their functional target genes. PMID:25994056

  18. Fermilab Booster Correction Elements upgrade

    International Nuclear Information System (INIS)

    The Fermilab Booster Correction Element Power Supply System is being upgraded to provide significant improvements in performance and versatility. At the same time these improvements will compliment raising the Booster injection energy from 200 MeV to 400 MeV and will allow increased range of adjustment to tune, chromaticity, closed orbit and harmonic corrections. All correction elements will be capable of ramping to give dynamic orbit, tune and chromaticity control throughout the acceleration cycle. The power supplies are commercial switch mode current sources capable of operating in all four current-voltage quadrants. External secondary feedback loops on the amplifiers have extended the small signal bandwidth to 3 kHz and allow current ramps in excess of 1000 A/sec. Implementation and present status of the upgrade project is described in this paper. (author) 4 refs., 2 figs., 1 tab

  19. Elemental composition of charcoal sorbants

    International Nuclear Information System (INIS)

    Despite the widespread use of charcoal sorbants in the collection of vapor phase chemicals and trace atmospheric gases, the charcoal's initial elemental composition is frequently not well characterized. This information is important in predicting possible reactions of collected chemicals within the charcoal matrix, the production of artifacts, and the possible sample loss during sampling. Also, it is critical in choosing the proper analytical technique for chemical measurement. For example, the authors have recently found that instrumental neutron activation analysis cannot be applied to measure mercury concentrations in oil bottom ashes, which are similar to some charcoals, due to the analytical interference of high levels of rare earth elements in these matrices. It is therefore vital to have at least a general knowledge of the major constituents of the sampling media for proper sampling and the selection of suitable analytical techniques

  20. Composite oxygen ion transport element

    Science.gov (United States)

    Chen, Jack C.; Besecker, Charles J.; Chen, Hancun; Robinson, Earil T.

    2007-06-12

    A composite oxygen ion transport element that has a layered structure formed by a dense layer to transport oxygen ions and electrons and a porous support layer to provide mechanical support. The dense layer can be formed of a mixture of a mixed conductor, an ionic conductor, and a metal. The porous support layer can be fabricated from an oxide dispersion strengthened metal, a metal-reinforced intermetallic alloy, a boron-doped Mo.sub.5Si.sub.3-based intermetallic alloy or combinations thereof. The support layer can be provided with a network of non-interconnected pores and each of said pores communicates between opposite surfaces of said support layer. Such a support layer can be advantageously employed to reduce diffusion resistance in any type of element, including those using a different material makeup than that outlined above.

  1. Chemistry of the transactinide elements

    International Nuclear Information System (INIS)

    Synthesis and decay of elements in the upper end of periodic table (z=104 to 111) are described. In view of very short half-life of about 1 s, the production of the transactinide isotopes and their transport to the separation and detection chamber are to be necessarily carried out employing fast and reliable techniques. Advances in microchemical separation techniques such as OLGA-II, HEVI, ARCA-II and SISAK, coupled to sensitive detection methods enable the detection of these heavier transactinide elements at atomic level. Their position in the periodic table and similarities, if any, with the corresponding lighter homologs are discussed based on their predicted and observed chemical behaviour. (author). 70 refs., 15 figs

  2. Trace-elements and tectonics

    International Nuclear Information System (INIS)

    Trends of the past twenty years in geochemical investigation of trace elements are reflected in studies of the partial melting of mantle and also the differentiation of magma. Substantial improvements have been made in accuracy, sensitivity and convenience of trace elements analysis, mainly through improved techniques and equipment for neutron activation analysis. Models for genesis of the zonal arrangement in island arc volcanic rocks as products of partial melting and fractional crystallization have been developed. We also applied these results to discuss the tectonic development of island arcs. Dating of geological materials is on universal concern to earth scientists working on various problems. In many research situations the use of a combination of dating method and paleomagnetism or geochemistry provides the greatest tectonic results for crustal materials, such as rotation of microcontinent and cooling history of rock body. (author)

  3. Automation of finite element methods

    CERN Document Server

    Korelc, Jože

    2016-01-01

    New finite elements are needed as well in research as in industry environments for the development of virtual prediction techniques. The design and implementation of novel finite elements for specific purposes is a tedious and time consuming task, especially for nonlinear formulations. The automation of this process can help to speed up this process considerably since the generation of the final computer code can be accelerated by order of several magnitudes. This book provides the reader with the required knowledge needed to employ modern automatic tools like AceGen within solid mechanics in a successful way. It covers the range from the theoretical background, algorithmic treatments to many different applications. The book is written for advanced students in the engineering field and for researchers in educational and industrial environments.

  4. Gelivity Effects on Construction Elements

    Directory of Open Access Journals (Sweden)

    Bogdan Rujanu

    2009-01-01

    Full Text Available Complex nature of environment effects on concrete structures has imposed an improvement of material characteristics, an adequate design, accurate execution and inspection, maintenance and prevention of deterioration risks. Large complexity of concrete elements deterioration processes, it is determined by the relation between adopted structural conceptions, exposing climatic conditions, concrete composition, quality of execution processes, but also due to synergetic action of destructive agents. When water freezes in a porous material, like cement stone, raise its volume about 9%, and can lead to concrete cleavage, when pores are saturated with water. Using deicers on concrete surface for melting of ice or snow, cause a thermal shock. Temperature difference between the surface and the core of concrete leads to interior stress and deformation state, capable to influence cracking of concrete layer from the surface of element. Prevention of damages and their amplification needs inspection, maintenance and overhauling of structures.

  5. Backfire antennas with dipole elements

    DEFF Research Database (Denmark)

    Nielsen, Erik Dragø; Pontoppidan, Knud

    1970-01-01

    A method is set up for a theoretical investigation of arbitrary backfire antennas based upon dipole structures. The mutual impedance between the dipole elements of the antenna is taken into account, and the field radiated due to a surface wave reflector of finite extent is determined by calculating...... the surface current distribution on the reflector plate. Numerical results obtained for Yagi backfire antennas and short-backfire antennas using this theory are compared with experimental results....

  6. Elements of Bayesian experimental design

    Energy Technology Data Exchange (ETDEWEB)

    Sivia, D.S. [Rutherford Appleton Lab., Oxon (United Kingdom)

    1997-09-01

    We consider some elements of the Bayesian approach that are important for optimal experimental design. While the underlying principles used are very general, and are explained in detail in a recent tutorial text, they are applied here to the specific case of characterising the inferential value of different resolution peakshapes. This particular issue was considered earlier by Silver, Sivia and Pynn (1989, 1990a, 1990b), and the following presentation confirms and extends the conclusions of their analysis.

  7. Trace Element Management in Rice

    OpenAIRE

    Abin Sebastian; Majeti Narasimha Vara Prasad

    2015-01-01

    Trace elements (TEs) are vital for the operation of metabolic pathways that promote growth and structural integrity. Paddy soils are often prone to TE limitation due to intensive cultivation and irrigation practices. Apart from this, rice paddies are potentially contaminated with transition metals such as Cd, which are often referred to as toxic TEs. Deficiency of TEs in the soil not only delays plant growth but also causes exposure of plant roots to toxic TEs. Fine-tuning of nutrient cycling...

  8. CONSTRAINED QUADRILATERAL NONCONFORMING ROTATED Q1 ELEMENT

    Institute of Scientific and Technical Information of China (English)

    Jun Hu; Zhong-ci Shi

    2005-01-01

    In this paper, we define a new nonconforming quadrilateral finite element based on the nonconforming rotated Q1 element by enforcing a constraint on each element, which has only three degrees of freedom. We investigate the consistency, approximation, superclose property, discrete Green's function and superconvergence of this element. Moreover, we propose a new postprocessing technique and apply it to this element. It is proved that the postprocessed discrete solution is superconvergent under a mild assumption on the mesh.

  9. Synthesis of super heavy elements

    International Nuclear Information System (INIS)

    An era of study and synthesis of superheavy elements began with the prediction of the existence of an island of stability of long lived superheavy elements in the vicinity Z = 126, N = 184 by Myers and Swiatecki in 1966. Within coulomb and proximity potential model, we have studied cluster emission from all even-even nuclei from 270118 to 318118. Fission decay half lives for these isotopes are calculated by the model proposed by Ren et al. The range of isotopes in which α-decay shall occur for the element Z=118 is found out using the difference in α-decay half life and fission decay half life as a criterion. This range is also the one in which isotopes can exist without getting spontaneously fissioned. Making use of the concepts of quantum mechanical fragmentation theory and the information that is gathered from our work, about the range of isotopes where synthesis of Z = 118 is probable, sets of reactions, according to order of possibility, for the production of all isotopes in the range have been elucidated. Along with that the involved fusion barrier and ground state Q-value also are shown

  10. Inorganic elements in sugar samples

    International Nuclear Information System (INIS)

    Sugar is considered a safe food ingredient; however, it can be contaminated by organic elements since its planting until its production process. Thus, this study aims at checking the presence of inorganic elements in samples of crystal, refined and brown sugar available for consumption in Brazil. The applied technique was neutron activation analysis, the k0 method, using the TRIGA MARK - IPR-R1 reactor located at CDTN/CNEN, in Belo Horizonte. It was identified the presence of elements such as, Au, Br, Co, Cr, Hf, K, Na, Sb, Sc and Zn in the samples of crystal/refined sugar and the presence of As, Au, Br, Ca, Co, Cr, Cs, Fe, Hf, K, Na, Sb, Sc, Sm, Sr, Th and Zn in the brown sugar samples. The applied technique was appropriate to this study because it was not necessary to put the samples in solution, essential condition in order to apply other techniques, avoiding contaminations and sample losses, besides allowing a multi elementary detection in different sugar samples. (author)

  11. Elemental composition of cosmic ray

    International Nuclear Information System (INIS)

    The report first summarizes some data that have been obtained so far from observation of isotopes and elements in cosmic rays in the low energy region. Then, objectives of studies planned to be carried out with Astromag are outlined and the number of incident particles expected to be measured by baloon observation is estimated. Heavy elements with atomic numbers of greater than 30 are considered to be formed through neutron absorption reactions by the s- or r-process. Observations show that products of the r-process is abundant in cosmic ray sources. The escape length depends on energy. In relation to this, it has been reported that the ratios Ar-Fe and Ca-Fe increase above 200 GeV-n while such a tendency is not observed for K, Sc, Ti or V. Thus, no satisfactory models are available at present which can fully explain the changes in the escape length. The ratio 3He-4He in the range of 5 - 10 GeV-n is inconsistent with the general theory that interprets the escape length of heavy elements. Some models, including the supermetallicity model and Wolf Rayet theory, have been proposed to explain unusual ratios of isotopes in cosmic rays, but more measurements are required to verify them. It is expected that Astromag can serve to make observations that can clarify these points. (Nogami, K.)

  12. The UNCLE finite element scheme

    International Nuclear Information System (INIS)

    A completely general finite element scheme, implemented in the UKAEA Reactor Group is outlined. UNCLE is not a complete, self-contained program. It is a framework of routines that provide the common services required by all general purpose finite element programs, whether for heat transfer, stress analysis or any other linear (or piece-wise linear) problem. These services are: input of mesh, geometry, loads (etc) and material data: matrix and load vector calculation and assembly (including handling of standard boundary conditions); solution of global matrix (elimination and conjugate gradient methods); output (printed and graphical) of initial geometry, displacements, stresses, final geometry etc; facilities for iteration for non-linear problems and time integration; mass matrix reduction, dynamic analysis of reduced problem and expansion of displacements to full problem. The framework is written to handle 1, 2, 3 or more dimensions equally efficiently. To produce a general purpose program for a particular range of applications it is only necessary to provide a set of element subroutines specialised to the application (heat transfer, framework analysis, continuum stress analysis etc)

  13. Inorganic elements in sugar samples

    Energy Technology Data Exchange (ETDEWEB)

    Salles, Paulo M.B. de; Campos, Tarcisio P.R. de, E-mail: pauladesalles@yahoo.com.br, E-mail: tprcampos@pq.cnpq.br [Universidade Federal de Minas Gerais (DEN/UFMG), Belo Horizonte, MG (Brazil). Departamento de Engenharia Nuclear; Menezes, Maria Angela de B.C., E-mail: menezes@cdtn.br [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil)

    2013-07-01

    Sugar is considered a safe food ingredient; however, it can be contaminated by organic elements since its planting until its production process. Thus, this study aims at checking the presence of inorganic elements in samples of crystal, refined and brown sugar available for consumption in Brazil. The applied technique was neutron activation analysis, the k{sub 0} method, using the TRIGA MARK - IPR-R1 reactor located at CDTN/CNEN, in Belo Horizonte. It was identified the presence of elements such as, Au, Br, Co, Cr, Hf, K, Na, Sb, Sc and Zn in the samples of crystal/refined sugar and the presence of As, Au, Br, Ca, Co, Cr, Cs, Fe, Hf, K, Na, Sb, Sc, Sm, Sr, Th and Zn in the brown sugar samples. The applied technique was appropriate to this study because it was not necessary to put the samples in solution, essential condition in order to apply other techniques, avoiding contaminations and sample losses, besides allowing a multi elementary detection in different sugar samples. (author)

  14. The Synthesis of Superheavy Elements

    International Nuclear Information System (INIS)

    The elements with the atomic numbers 107-112 have been synthesized and unambiguously identified at the velocity filter SHIP at GSI. The technique allowing for this successful experimental program is the combination of the detection of correlations between evaporation residues and subsequent a-decays with a powerful separator. Systematic investigations, the construction of decay chain networks and mass measurements are some of the possible approaches to study the decay chains tentatively attributed to the isotopes of the elements 114 and 116 at Dubna, which are, in contrast to those observed at GSI, not connected to α-decays of known isotopes. The sensitivity limit of the set-up at GSI has reached the 1pb level. For systematic investigation in this region of extremely low cross section and to synthesize nuclei of higher Z this limit has to be pushed to even lower values. An extensive development program is pursued at SHIP in order to reach at least an order of magnitude lower cross sections. Apart from target cooling and separator development a super conducting CW linear accelerator is studied to reach this goal. To design a successful experimental program for the possible discovery of new elements the nuclear structure of the heaviest nuclei has to be understood as well as the reaction mechanism which leads to their production in heavy ion reactions. We have initiated series of systematic studies for both subjects

  15. Adobe Photoshop Elements 10 unleash the hidden performance of Elements

    CERN Document Server

    Galer, Mark

    2011-01-01

    Master the most powerful photo editing tools and techniques that Elements has to offer! Using step-by-step projects, Mark Galer will have you creating stunning images in no time at all. Whether you want to create impressive, seamless montages, optimize your photos for perfect print quality, or simply enhance your images for maximum impact, Maximum Performance will give you the skills and know-how you need to create professional quality results. Featured projects teach you how to work with multilayered 16 bit/channel files, as well as convert to black and white using Adobe Camera Raw, create

  16. Peridynamic Multiscale Finite Element Methods

    Energy Technology Data Exchange (ETDEWEB)

    Costa, Timothy [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Bond, Stephen D. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Littlewood, David John [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Moore, Stan Gerald [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

    2015-12-01

    The problem of computing quantum-accurate design-scale solutions to mechanics problems is rich with applications and serves as the background to modern multiscale science research. The prob- lem can be broken into component problems comprised of communicating across adjacent scales, which when strung together create a pipeline for information to travel from quantum scales to design scales. Traditionally, this involves connections between a) quantum electronic structure calculations and molecular dynamics and between b) molecular dynamics and local partial differ- ential equation models at the design scale. The second step, b), is particularly challenging since the appropriate scales of molecular dynamic and local partial differential equation models do not overlap. The peridynamic model for continuum mechanics provides an advantage in this endeavor, as the basic equations of peridynamics are valid at a wide range of scales limiting from the classical partial differential equation models valid at the design scale to the scale of molecular dynamics. In this work we focus on the development of multiscale finite element methods for the peridynamic model, in an effort to create a mathematically consistent channel for microscale information to travel from the upper limits of the molecular dynamics scale to the design scale. In particular, we first develop a Nonlocal Multiscale Finite Element Method which solves the peridynamic model at multiple scales to include microscale information at the coarse-scale. We then consider a method that solves a fine-scale peridynamic model to build element-support basis functions for a coarse- scale local partial differential equation model, called the Mixed Locality Multiscale Finite Element Method. Given decades of research and development into finite element codes for the local partial differential equation models of continuum mechanics there is a strong desire to couple local and nonlocal models to leverage the speed and state of the

  17. Element-by-element and implicit-explicit finite element formulations for computational fluid dynamics

    Science.gov (United States)

    Tezduyar, T. E.; Liou, J.

    1988-01-01

    Preconditioner algorithms to reduce the computational effort in FEM analyses of large-scale fluid-dynamics problems are presented. A general model problem is constructed on the basis of the convection-diffusion equation and the two-dimensional vorticity/stream-function formulation of the Navier-Stokes equations; this problem is then analyzed using element-by-element, implicit-explicit, and adaptive implicit-explicit approximation schemes. Numerical results for the two-dimensional advection and rigid-body rotation of a cosine hill, flow past a circular cylinder, and driven cavity flow are presented in extensive graphs and shown to be in good agreement with those obtained using implicit methods.

  18. Major and trace elements in human tears

    International Nuclear Information System (INIS)

    Major elements in tears were determined by ion chromatography. The concentrations of major elements in tears (Cl, Na, K) are in the range from 600 to 4000 ppm. Minor elements in tears (Ca and Mg) were analyzed using ICP-MS and their concentration range is 10 to 80 ppm. All trace elements in tears have concentrations below the ppm range. Two techniques were applied for the determination of trace elements in tears (GFAAS and ICP-MS). The time-dependence of the concentrations of major and minor elements in tears was studied. The concentrations of major elements in tears hardly change with passage of time. However, the concentrations of minor elements (Ca, Mg, Rb) vary with time but in inconsistent manner. Some correlations are found between the concentrations of major elements (Cl and Na, Cl and Na+K) No correlations were observed between K and either Cl or Na. (author)

  19. Calculation of binary phase diagrams between the actinide elements, rare earth elements, and transition metal elements

    International Nuclear Information System (INIS)

    Attempts were made to apply the Kaufman method of calculating binary phase diagrams to the calculation of binary phase diagrams between the rare earths, actinides, and the refractory transition metals. Difficulties were encountered in applying the method to the rare earths and actinides, and modifications were necessary to provide accurate representation of known diagrams. To calculate the interaction parameters for rare earth-rare earth diagrams, it was necessary to use the atomic volumes for each of the phases: liquid, body-centered cubic, hexagonal close-packed, and face-centered cubic. Determination of the atomic volumes of each of these phases for each element is discussed in detail. In some cases, empirical means were necessary. Results are presented on the calculation of rare earth-rare earth, rare earth-actinide, and actinide-actinide diagrams. For rare earth-refractory transition metal diagrams and actinide-refractory transition metal diagrams, empirical means were required to develop values for the enthalpy of vaporization for rare earth elements and values for the constant (C) required when intermediate phases are present. Results of using the values determined for each element are presented

  20. Implementing wavelet transform with SAW elements

    Institute of Scientific and Technical Information of China (English)

    LU; Wenke(卢文科); ZHU; Changchun(朱长纯); LIU; Junhua(刘君华); LIU; Qinghong(刘清洪)

    2003-01-01

    In the design of the finger-overlap envelope according to the envelope of wavelet function, it is concluded that the pulse-response function of the interdigital transducer (IDT) for surface acoustic wave (SAW) is identical to the wavelet function. SAW type of the wavelet-transform element is manufactured. A new method of using two wavelet-transform elements to manufacture the reconstruction element of the wavelet transform is proposed. The sources of the element error are analyzed, and the methods for reducing the error are put forward. SAW type of the wavelet transformation element and its reconstruction element have the following three characteristics: (i) the implementing methods of the wavelet transform element and its reconstruction element are simple, and free of complicated mathematical algorithms of the wavelet transform; (ii) because one of SAW element is fast, the response velocities of SAW type of the wavelet transform element and its reconstruction element are also fast; (iii) the costs of the wavelet transform element and its reconstruction element are low, so the elements may be manufactured in a large quantity.

  1. Differential trypanosome surface coat regulation by a CCCH protein that co-associates with procyclin mRNA cis-elements.

    Directory of Open Access Journals (Sweden)

    Pegine Walrad

    2009-02-01

    Full Text Available The genome of Trypanosoma brucei is unusual in being regulated almost entirely at the post-transcriptional level. In terms of regulation, the best-studied genes are procyclins, which encode a family of major surface GPI-anchored glycoproteins (EP1, EP2, EP3, GPEET that show differential expression in the parasite's tsetse-fly vector. Although procyclin mRNA cis-regulatory sequences have provided the paradigm for post-transcriptional control in kinetoplastid parasites, trans-acting regulators of procyclin mRNAs are unidentified, despite intensive effort over 15 years. Here we identify the developmental regulator, TbZFP3, a CCCH-class predicted RNA binding protein, as an isoform-specific regulator of Procyclin surface coat expression in trypanosomes. We demonstrate (i that endogenous TbZFP3 shows sequence-specific co-precipitation of EP1 and GPEET, but not EP2 and EP3, procyclin mRNA isoforms, (ii that ectopic overexpression of TbZFP3 does not perturb the mRNA abundance of procyclin transcripts, but rather that (iii their protein expression is regulated in an isoform-specific manner, as evidenced by mass spectrometric analysis of the Procyclin expression signature in the transgenic cell lines. The TbZFP3 mRNA-protein complex (TbZFP3mRNP is identified as a trans-regulator of differential surface protein expression in trypanosomes. Moreover, its sequence-specific interactions with procyclin mRNAs are compatible with long-established predictions for Procyclin regulation. Combined with the known association of TbZFP3 with the translational apparatus, this study provides a long-sought missing link between surface protein cis-regulatory signals and the gene expression machinery in trypanosomes.

  2. Super-Light Prefabricated Deck Element Integrated in Traditional Concrete Prefabricated Element Construction

    DEFF Research Database (Denmark)

    Christensen, Jacob Ellehauge; Hertz, Kristian Dahl

    the super-light slab element are element size, which have greatly reduced the total number of elements the pedestrian bridges consist of. The application also demonstrated the ability to control the path that the forces will take in the element. The deck elements are for example fully prepared at the...

  3. Duration judgements over multiple elements

    Directory of Open Access Journals (Sweden)

    InciAyhan

    2012-11-01

    Full Text Available We investigated the limits of the number of events observers can simultaneously time. For single targets occurring in one of eight positions sensitivity to duration was improved for spatially pre-cued items as compared to post-cued items indicating that exogenous driven attention can improve duration discrimination. Sensitivity to duration for pre-cued items was also marginally better for single items as compared to eight items indicating that even after the allocation of focal attention, distracter items can interfere with the encoding of duration. For an eight item array discrimination was worse for post-cued locations as compared to pre-cued locations indicating both that attention can improve duration discrimination performance and that it was not possible to access a perfect memory trace of the duration of eight elements. The interference from the distracters in the pre-cued eight item array may reflect some mandatory averaging of target and distracter events. To further explore duration averaging we asked subjects to explicitly compare average durations of multiple item arrays against a single item standard duration. Duration discrimination thresholds were significantly lower for single elements as compared to multiple elements, showing that averaging, either automatically or intentionally, impairs duration discrimination. There was no set size effect. Performance was the same for averages of two and eight items, but performance with even an average of two items was worse than for one item. This was also true for sequential presentation indicating poor performance was not due to limits on the division of attention across items. Rather performance appears to be limited by an inability to remember or aggregate duration information from two or more items. Although it is possible to manipulate perceived duration locally, there appears to be no perceptual mechanisms for aggregating local durations across space.

  4. Fluidic Elements based on Coanda Effect

    Directory of Open Access Journals (Sweden)

    Constantin OLIVOTTO

    2010-12-01

    Full Text Available This paper contains first some definitions and classifications regarding the fluidic elements. Thegeneral current status is presented, nominating the main specific elements based on the Coanda effect developedspecially in Romania. In particularly the development of an original bistable element using industrial compressedair at industrial pressure supply is presented. The function of this element is based on the controlled attachmentof the main jet at a curved wall through the Coanda effect. The methods used for particular calculation andexperiments are nominated. The main application of these elements was to develop a specific execution element:a fluidic step–by-step motor based on the Coanda effect.

  5. The elements of life and medicines

    OpenAIRE

    Chellan, Prinessa; Sadler, Peter J.

    2015-01-01

    Which elements are essential for human life? Here we make an element-by-element journey through the periodic table and attempt to assess whether elements are essential or not, and if they are, whether there is a relevant code for them in the human genome. There are many difficulties such as the human biochemistry of several so-called essential elements is not well understood, and it is not clear how we should classify elements that are involved in the destruction of invading microorganisms, o...

  6. Gas phase chemistry studies of superheavy elements

    International Nuclear Information System (INIS)

    The present status of the chemical properties investigation for superheavy elements was described in this paper. The synthesis of superheavy elements and the experimental techniques used in studies on the gas phase chemistry of superheavy elements were briefly introduced. The current experimental studies about the gas-chromatography of Rf, Db, Sg, Bh, Hs and element 112 were discussed in detail. Finally, the development of synthesis of superheavy elements and the study on gas phase chemical properties of superheavy elements in China were prospected. (authors)

  7. Formulations of a hydromechanical interface element

    Institute of Scientific and Technical Information of China (English)

    Zhong-Zhi Fu; Si-Hong Liu

    2011-01-01

    A hydromechanical interface element is proposed for the consideration of the hydraulic-mechanical coupling effect along the interface.The fully coupled governing equations and the relevant finite element formulations are derived in detail for the interface element.All the involved matrices are of the same form as those of a solid element,which makes the incorporation of the model into a finite element program straightforward.Three examples are then numerically simulated using the interface element.Reasonable results confirm the correctness of the proposed model and motivate its application in hydromechanical contact problems in the future.

  8. Main Elements for Upscaling Recreation

    DEFF Research Database (Denmark)

    Zandersen, Marianne; Termansen, Mette

    2012-01-01

    This report provides information on the main elements used to scale up modelled local visitor flow data to regional level based on recreational de-mand models. These models are described in Report #1. This report also provides information on data sources such as spatial data (e.g. land cov......-er/land use information), demographic information. The report is accom-pagnied with a spatial database for the regional case of forest recreation in Northern Zealand, Denmark. The spatial database contains forest polygons; forest attribute; estimation of total annual number of visits per site; and es...

  9. Elements of partial differential equations

    CERN Document Server

    Sneddon, Ian N

    2006-01-01

    Geared toward students of applied rather than pure mathematics, this volume introduces elements of partial differential equations. Its focus is primarily upon finding solutions to particular equations rather than general theory.Topics include ordinary differential equations in more than two variables, partial differential equations of the first and second orders, Laplace's equation, the wave equation, and the diffusion equation. A helpful Appendix offers information on systems of surfaces, and solutions to the odd-numbered problems appear at the end of the book. Readers pursuing independent st

  10. Transportation of irradiated fuel elements

    International Nuclear Information System (INIS)

    The report falls under the headings: introduction (explaining the special interest of the London Borough of Brent, as forming part of the route for transportation of irradiated fuel elements); nuclear power (with special reference to transport of spent fuel and radioactive wastes); the flask aspect (design, safety regulations, criticisms, tests, etc.); the accident aspect (working manual for rail staff, train formation, responsibility, postulated accident situations); the emergency arrangements aspect; the monitoring aspect (health and safety reports); legislation; contingency plans; radiation - relevant background information. (U.K.)

  11. Elements of abstract harmonic analysis

    CERN Document Server

    Bachman, George

    2013-01-01

    Elements of Abstract Harmonic Analysis provides an introduction to the fundamental concepts and basic theorems of abstract harmonic analysis. In order to give a reasonably complete and self-contained introduction to the subject, most of the proofs have been presented in great detail thereby making the development understandable to a very wide audience. Exercises have been supplied at the end of each chapter. Some of these are meant to extend the theory slightly while others should serve to test the reader's understanding of the material presented. The first chapter and part of the second give

  12. Basic Elements of Knowledge Management

    Directory of Open Access Journals (Sweden)

    Marcin W. Staniewski

    2007-10-01

    Full Text Available The article is a review of basic knowledge management terminology. It presents such a description as: knowledge resources levels (data, information, knowledge, and wisdom, knowledge sources (internal, external, and knowledge typology (implicit, tacit or individual, social. Moreover the article characterizes knowledge management process, knowledge management system and main knowledge management strategies (codification, personalization. At the end of the article there is mentioned the knowledge creating process (the concept of knowledge creation spiral and the role of Intelligence Technology (IT and organizational culture as main elements supporting knowledge management implementation in organizations.

  13. Mars Surface Tunnel Element Concept

    Science.gov (United States)

    Rucker, Michelle A.; Mary, Natalie; Howe, A. Scott; Jeffries, Sharon

    2016-01-01

    How Mars surface crews get into their ascent vehicle has profound implications for Mars surface architecture. To meet planetary protection protocols, the architecture has get Intravehicular Activity (IVA)-suited crew into a Mars Ascent Vehicle (MAV) without having to step outside into the Mars environment. Pushing EVA suit don/doff and EVA operations to an element that remains on the surface also helps to minimize MAV cabin volume, which in turn can reduce MAV cabin mass. Because the MAV will require at least seven kilograms of propellant to ascend each kilogram of cabin mass, minimal MAV mass is desired. For architectures involving more than one surface element-such as an ascent vehicle and a pressurized rover or surface habitat-a retractable tunnel is an attractive solution. Beyond addressing the immediate MAV access issue, a reusable tunnel may be useful for other surface applications once its primary mission is complete. A National Aeronautics and Space Administration (NASA) team is studying the optimal balance between surface tunnel functionality, mass, and stowed volume as part of the Evolvable Mars Campaign (EMC). The "Minimum Functional Tunnel" is a conceptual design that performs a single function. Having established this baseline configuration, the next step is to trade design options, evaluate other applications, and explore alternative solutions.

  14. Fuel elements of thermionic converters

    Energy Technology Data Exchange (ETDEWEB)

    Hunter, R.L. [ed.] [Sandia National Labs., Albuquerque, NM (United States). Environmental Systems Assessment Dept.; Gontar, A.S.; Nelidov, M.V.; Nikolaev, Yu.V.; Schulepov, L.N. [RI SIA Lutch, Podolsk (Russian Federation)

    1997-01-01

    Work on thermionic nuclear power systems has been performed in Russia within the framework of the TOPAZ reactor program since the early 1960s. In the TOPAZ in-core thermionic convertor reactor design, the fuel element`s cladding is also the thermionic convertor`s emitter. Deformation of the emitter can lead to short-circuiting and is the primary cause of premature TRC failure. Such deformation can be the result of fuel swelling, thermocycling, or increased unilateral pressure on the emitter due to the release of gaseous fission products. Much of the work on TRCs has concentrated on preventing or mitigating emitter deformation by improving the following materials and structures: nuclear fuel; emitter materials; electrical insulators; moderator and reflector materials; and gas-exhaust device. In addition, considerable effort has been directed toward the development of experimental techniques that accurately mimic operational conditions and toward the creation of analytical and numerical models that allow operational conditions and behavior to be predicted without the expense and time demands of in-pile tests. New and modified materials and structures for the cores of thermionic NPSs and new fabrication processes for the materials have ensured the possibility of creating thermionic NPSs for a wide range of powers, from tens to several hundreds of kilowatts, with life spans of 5 to 10 years.

  15. AthaMap web tools for the analysis and identification of co-regulated genes.

    Science.gov (United States)

    Galuschka, Claudia; Schindler, Martin; Bülow, Lorenz; Hehl, Reinhard

    2007-01-01

    The AthaMap database generates a map of cis-regulatory elements for the whole Arabidopsis thaliana genome. This database has been extended by new tools to identify common cis-regulatory elements in specific regions of user-provided gene sets. A resulting table displays all cis-regulatory elements annotated in AthaMap including positional information relative to the respective gene. Further tables show overviews with the number of individual transcription factor binding sites (TFBS) present and TFBS common to the whole set of genes. Over represented cis-elements are easily identified. These features were used to detect specific enrichment of drought-responsive elements in cold-induced genes. For identification of co-regulated genes, the output table of the colocalization function was extended to show the closest genes and their relative distances to the colocalizing TFBS. Gene sets determined by this function can be used for a co-regulation analysis in microarray gene expression databases such as Genevestigator or PathoPlant. Additional improvements of AthaMap include display of the gene structure in the sequence window and a significant data increase. AthaMap is freely available at http://www.athamap.de/. PMID:17148485

  16. A coupling procedure for modeling acoustic problems using finite elements and boundary elements

    OpenAIRE

    Coyette, J.; Vanderborck, G.; Steichen, W.

    1994-01-01

    Finite element (FEM) and boundary element (BEM) methods have been used for a long time for the numerical simulation of acoustic problems. The development presented in this paper deals with a general procedure for coupling acoustic finite elements with acoustic boundary elements in order to solve efficiently acoustic problems involving non homogeneous fluids. Emphasis is made on problems where finite elements are used for a confined (bounded) fluid while boundary elements are selected for an e...

  17. Apparatus for locating defective nuclear fuel elements

    International Nuclear Information System (INIS)

    An ultrasonic search unit for locating defective fuel elements within a fuel assembly used in a water cooled nuclear reactor is presented. The unit is capable of freely traversing the restricted spaces between the fuel elements

  18. Natural wetland emissions of methylated trace elements

    NARCIS (Netherlands)

    Vriens, B.; Lenz, M.; Charlet, L.; Berg, M.; Winkel, L.H.E.

    2014-01-01

    Natural wetlands are well known for their significant methane emissions. However, trace element emissions via biomethylation and subsequent volatilization from pristine wetlands are virtually unstudied, even though wetlands constitute large reservoirs for trace elements. Here we show that the averag

  19. Admixture elements as indicators of fluorite genesis

    International Nuclear Information System (INIS)

    Present book is devoted to comparative analysis of abundance and distribution of admixture elements in fluorite-mineral. The data on composition and content of admixture elements in fluorite was generalized. The hydrothermal deposits were characterized on mineral types.

  20. Dow Introduces "Human Element" to China

    Institute of Scientific and Technical Information of China (English)

    Jenny Du

    2007-01-01

    @@ Recently, the DOW Chemical Company of the United States introduced the "Human Element" to China. The "Human Element" series campaignwas launched in North America and Europe respectively from 2006 and the Q2 of 2007.

  1. Indication for a volatile element 114

    International Nuclear Information System (INIS)

    Recently, the chemical investigation of element 112 revealed a highly volatile, noble metallic behaviour, as expected for the last group 12 member of the periodic table. The observed volatility and chemical inertness were ascribed to the growing influence of relativistic effects on the chemical properties of the heaviest elements with increasing nuclear charge. Here, we report for the first time on gas phase chemical experiments aiming at a determination of element 114 properties. This element was investigated using its isotopes 287114 and 288114 produced in the nuclear fusion reactions of 48Ca with 242Pu and 244Pu, respectively. Identification of three atoms of element 114 in thermochromatography experiments and their deposition pattern on a gold surface indicates that this element is at least as volatile as simultaneously investigated elements Hg, At, and element 112. This behaviour is rather unexpected for a typical metal of group 14. (orig.)

  2. Continuous finite element methods for Hamiltonian systems

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    By applying the continuous finite element methods of ordinary differential equations, the linear element methods are proved having second-order pseudo-symplectic scheme and the quadratic element methods are proved having third-order pseudosymplectic scheme respectively for general Hamiltonian systems, and they both keep energy conservative. The finite element methods are proved to be symplectic as well as energy conservative for linear Hamiltonian systems. The numerical results are in agreement with theory.

  3. Light elements in oceanic and ophiolitic serpentinities

    OpenAIRE

    Vils, Flurin Andri; Katz, Angelika

    2009-01-01

    Despite the key importance of altered oceanic mantle as a repository and carrier of light elements (B, Li, and Be) to depth, its inventory of these elements has hardly been explored and quantified. In order to constrain the systematics and budgets of these elements in the oceanic lithosphere, this thesis has studied samples of highly serpentinized peridotites from the mid-Atlantic ridge (ODP Leg 209) and progressively metamorphosed alpine ophiolites (Totalp, Platta and Malenco). Light element...

  4. ELEMENT FUNCTIONS OF DISCRETE OPERATOR DIFFERENCE METHOD

    Institute of Scientific and Technical Information of China (English)

    田中旭; 唐立民; 刘正兴

    2002-01-01

    The discrete scheme called discrete operator difference for differential equations was given. Several difference elements for plate bending problems and plane problems were given. By investigating these elements, the ability of the discrete forms expressing to the element functions was talked about. In discrete operator difference method, the displacements of the elements can be reproduced exactly in the discrete forms whether the displacements are conforming or not. According to this point, discrete operator difference method is a method with good performance.

  5. Solid finite elements through three decades

    OpenAIRE

    Venkatesh, DN; Shrinivasa, U

    1994-01-01

    conventionally, solid finite elements have been looked upon as just generalizations of two-dimensional finite elements. In this article we trace their development starting from the days of their inception. Keeping in tune with our perceptions on developing finite elements, without taking recourse to any extra variational techniques, we discuss a few of the techniques which have been applied to solid finite elements. Finally we critically examine our own work on formulating solid finite elemen...

  6. Fluidic Elements based on Coanda Effect

    OpenAIRE

    Constantin OLIVOTTO

    2010-01-01

    This paper contains first some definitions and classifications regarding the fluidic elements. Thegeneral current status is presented, nominating the main specific elements based on the Coanda effect developedspecially in Romania. In particularly the development of an original bistable element using industrial compressedair at industrial pressure supply is presented. The function of this element is based on the controlled attachmentof the main jet at a curved wall through the Coanda effect. T...

  7. Flux-conserving finite element methods

    OpenAIRE

    Zhang, Shangyou; Zhang, Zhimin; Zou, Qingsong

    2012-01-01

    We analyze the flux conservation property of the finite element method. It is shown that the finite element solution does approximate the flux locally in the optimal order, i.e., the same order as that of the nodal interpolation operator. We propose two methods, post-processing the finite element solutions locally. The new solutions, remaining as optimal-order solutions, are flux-conserving elementwise. In one of our methods, the processed solution also satisfies the original finite element e...

  8. Modelling optimization involving different types of elements in finite element analysis

    International Nuclear Information System (INIS)

    Finite elements are used to express the mechanical behaviour of a structure in finite element analysis. Therefore, the selection of the elements determines the quality of the analysis. The aim of this paper is to compare and contrast 1D element, 2D element, and 3D element used in finite element analysis. A simple case study was carried out on a standard W460x74 I-beam. The I-beam was modelled and analyzed statically with 1D elements, 2D elements and 3D elements. The results for the three separate finite element models were compared in terms of stresses, deformation and displacement of the I-beam. All three finite element models yield satisfactory results with acceptable errors. The advantages and limitations of these elements are discussed. 1D elements offer simplicity although lacking in their ability to model complicated geometry. 2D elements and 3D elements provide more detail yet sophisticated results which require more time and computer memory in the modelling process. It is also found that the choice of element in finite element analysis is influence by a few factors such as the geometry of the structure, desired analysis results, and the capability of the computer

  9. Downhole Elemental Analysis with LIBS

    Science.gov (United States)

    Moreschini, Paolo; Zacny, Kris; Rickman, Doug

    2011-01-01

    In this paper we discuss a novel instrument, currently under development at Honeybee Robotics with SBIR funding from NASA. The device is designed to characterize elemental composition as a function of depth in non-terrestrial geological formations. The instrument consists of a miniaturized laser-induced breakdown spectrometer (LIBS) analyzer integrated in a 2" diameter drill string. While the drill provides subsurface access, the LIBS analyzer provides information on the elemental composition of the borehole wall. This instrument has a variety of space applications ranging from exploration of the Moon for which it was originally designed, to Mars, as well as a variety of terrestrial applications. Subsurface analysis is usually performed by sample acquisition through a drill or excavator, followed by sample preparation and subsequent sample presentation to an instrument or suite of instruments. An alternative approach consisting in bringing a miniaturized version of the instrument to the sample has many advantages over the traditional methodology, as it allows faster response, reduced probability of cross-contamination and a simplification in the sampling mechanisms. LIBS functions by focusing a high energy laser on a material inducing a plasma consisting of a small fraction of the material under analysis. Optical emission from the plasma, analyzed by a spectrometer, can be used to determine elemental composition. A triangulation sensor located in the sensor head determines the distance of the sensor from the borehole wall. An actuator modifies the position of the sensor accordingly, in order to compensate for changes due to the profile of the borehole walls. This is necessary because LIBS measurements are negatively affected by changes in the relative position of the focus of the laser with respect to the position of the sample (commonly referred to as the "lens to sample distance"). Profiling the borehole is done by adjusting the position of the sensor with a

  10. Downhole elemental analysis with LIBS

    Science.gov (United States)

    Moreschini, P.; Zacny, K.; Rickman, D.

    2011-12-01

    In this paper we discuss a novel instrument, currently under development at Honeybee Robotics with SBIR funding from NASA. The device is designed to characterize elemental composition as a function of depth in non-terrestrial geological formations. The instrument consists of a miniaturized LIBS analyzer integrated in a 2" diameter drill string. While the drill provides subsurface access, the LIBS analyzer provides information on the elemental composition of the borehole wall. This instrument has a variety of space applications ranging from exploration of the Moon for which it was originally designed, to Mars, as well as a variety of terrestrial applications. Subsurface analysis is usually performed by sample acquisition through a drill or excavator, followed by sample preparation and subsequent sample presentation to an instrument or suite of instruments. An alternative approach consisting in bringing a miniaturized version of the instrument to the sample has many advantages over the traditional methodology, as it allows faster response, reduced probability of cross-contamination and a simplification in the sampling mechanisms. LIBS functions by focusing a high energy laser on a material inducing a plasma consisting of a small fraction of the material under analysis. Optical emission from the plasma, analyzed by a spectrometer, can be used to determine elemental composition. A triangulation sensor located in the sensor head determines the distance of the sensor from the borehole wall. An actuator modifies the position of the sensor accordingly, in order to compensate for changes due to the profile of the borehole walls. This is necessary because LIBS measurements are negatively affected by changes in the relative position of the focus of the laser with respect to the position of the sample (commonly referred to as the "lens to sample distance"). Profiling the borehole is done by adjusting the position of the sensor with a vertical stage; a second actuator at the

  11. Deformation Expression for Elements of Algebra

    OpenAIRE

    Omori, H.; Y. Maeda; Miyazaki, N.; Yoshioka, A.

    2011-01-01

    The purpose of this paper is to give a notion of deformation of expressions for elements of algebra. Deformation quantization (cf.[BF]) deforms the commutative world to a non-commutative world. However, this involves deformation of expression of elements of algebras even from a commutative world to another commutative world. This is indeed a deformation of expressions for elements of algebra.

  12. Tool Releases Optical Elements From Spring Brackets

    Science.gov (United States)

    Gum, J. S.

    1984-01-01

    Threaded hooks retract bracket arms holding element. Tool uses three hooks with threaded shanks mounted in ring-shaped holder to pull on tabs to release optical element. One person can easily insert or remove optical element (such as prism or lens) from spring holder or bracket with minimal risk of damage.

  13. Superheavy elements: existence, classification and experiment

    OpenAIRE

    Kostyghin, V. A.; Vaschenko, V. M.; Loza, Ye. A.

    2012-01-01

    This paper proposes spatial periodic table developed based on classic electron shell structure model. The periodic table determines location and chemical properties of superheavy elements. 14 new long-living superheavy elements found by Proton-21 laboratory and one long-living superheavy element found by A.Marinov were identified.

  14. Main: ELEMENT1GMLBC3 [PLACE

    Lifescience Database Archive (English)

    Full Text Available ELEMENT1GMLBC3 S000319 7-Sep-2000 (last modified) seki Element 1 found in the promo...ter of soybean (G.m.) leghaemoglobin lbc3 gene; Binding site of nuclear extract from soybean nodules; Locate...Element 2 share a common motif; See S000320; nodule; leghaemoglobin; lbc3; root; Soybean (Glycine max) GATATATTAATATTTTATTTTATA ...

  15. Climbing elements in finite coxeter groups

    OpenAIRE

    Brady, Thomas; Kenny, Aisling; Watt, And Colum

    2010-01-01

    We define the notion of a climbing element in a finite real reflection group relative to a total order on the reflection set and we characterise these elements in the case where the total order arises from a bipartite Coxeter element.

  16. Element Cycles: An Environmental Chemistry Board Game

    Science.gov (United States)

    Pippins, Tracy; Anderson, Cody M.; Poindexter, Eric F.; Sultemeier, S. Whitney; Schultz, Linda D.

    2011-01-01

    "Element Cycles" is an activity designed to reinforce correlation of essential elements and their different forms in the ecosystem. Students are assigned essential elements to research as homework, then share results, and construct game boards with four ecosphere sections: geosphere (earth), hydrosphere (water), atmosphere (air), and biosphere…

  17. Heavy element production and limits to fusion

    International Nuclear Information System (INIS)

    The recent experiments on the synthesis of the heaviest elements led to the discovery of a region of nuclei of an unexpected high ground-state stability. The experimental results on our synthesis of new elements will be discussed as well as our new insights as their ground-state properties. The prospects to proceed to new elements will be outlined. (orig.)

  18. Determination of toxic elements in Malaysian foodstuffs

    International Nuclear Information System (INIS)

    This project is concentrating on the analysis of toxic elements content in seafoods including fishes, mussel, squid and prawn. Samples were collected from various places throughout Malay Peninsular. Samples were prepared according to RCA research protocol - nuclear techniques for toxic element in foodstuffs. Techniques used for elemental analysis were neutron activation analysis (instrumental and radiochemical) and anodic stripping voltametry. (author). 9 refs, 9 tabs

  19. Elements from chlorine to calcium nuclear reactions

    CERN Document Server

    Kunz, Wunibald

    1968-01-01

    Nuclear Tables: Part II Nuclear Reactions, Volume 3: The Elements from Chlorine to Calcium contains tabulations of the nuclear reaction values of elements chlorine, argon, potassium, and calcium. These tabulations provide the calculated Q-values of the elements and their isotopes. This book will be of value to general chemistry researchers.

  20. Elements of a Spatial Web

    DEFF Research Database (Denmark)

    Jensen, Christian S.

    2010-01-01

    Driven by factors such as the increasingly mobile use of the web and the proliferation of geo-positioning technologies, the web is rapidly acquiring a spatial aspect. Specifically, content and users are being geo-tagged, and services are being developed that exploit these tags. The research...... community is hard at work inventing means of efficiently supporting new spatial query functionality. Points of interest with a web presence, called spatial web objects, have a location as well as a textual description. Spatio-textual queries return such objects that are near a location argument and are...... relevant to a text argument. An important element in enabling such queries is to be able to rank spatial web objects. Another is to be able to determine the relevance of an object to a query. Yet another is to enable the efficient processing of such queries. The talk covers recent results on spatial web...

  1. Logical elements in living cells.

    Science.gov (United States)

    Kremen, A

    1984-11-01

    Recognition processes with enhanced accuracy (as performed by structures like enzymes or ribosomes) are investigated using elementary ideas of statistical mechanics and related concepts of thermodynamics. The analysis starts from a formal definition of recognition and provides a correspondence with appropriate physical properties of the macromolecular logical elements. Transitions of the recognizing system between different modifications are a necessary feature of a more exacting recognition process. Rearrangement steps provide the process with higher accuracy by performing two physical operations: (1) rearranging the phase space of the system so that the "correct" states be better separated from the "wrong" states and the probability of occupation of the "correct" states be enhanced, (2) directing the process toward the more favourable modifications thus formed. Both operations are related to changes in the physical properties of the recognizing system. These changes can be expressed as differences of macromolecular Gibbs energy levels; if ligand binding or release participate in a step, directivity of the step depends also on the actual chemical potentials of the ligands in solution. The two operations just mentioned resemble two basic operations known to be necessary in electronic digital networks: directivity of control and signal standardization. An analysis of the entire reaction catalysed by a macromolecular logical element takes into account the requirements imposed by the logical functions as well as the need that the chemical potential of the product be not restricted to very low values. To satisfy these conditions, the reaction must be supported by a so-called non-specific reaction, usually implemented by the cleavage reaction of a nucleoside triphosphate. PMID:6513567

  2. Trace Element Analysis of Selenium

    International Nuclear Information System (INIS)

    The present thesis divided into four chapters as follows:Chapter (1):This chapter contains an introduction on different oxidation states of organic and inorganic species for selenium in environmental and biological samples, the process for separation of selenium from these samples and the importance of selenium as a component for these samples. Also gives notes about the techniques which are used in the elemental analysis for selenium species and the detection limits for selenium in these techniques, selenium species in human body and the importance of these species in protecting the body from the different types of cancer and the sources of selenium in environmental samples (soil and water) and distribution levels of selenium in these samples.Chapter (2):This chapter is divided into two parts :The first part deals with the sample collection process for environmental samples (underground water, soil) and the wet digestion ( microwave digestion ) process of soil samples. It also contains the theory of work of the closed microwave digestion system.The second part contains detailed information concerning the theoretical considerations of the used analytical techniques. These techniques include Hydride generation - Atomic Absorption Spectrometer (HG-AAS), Inductively Coupled Plasma Mass Spectrometer (ICP-MS) and Neutron Activation Analysis (NAA).Chapter (3): This chapter includes the methods of sampling, sample preparation, and sample digesition. The measures of quality assurance are disscused in this chapter. It describes in details the closed microwave digestion technique and the analytical methods used in this study which are present in Central Laboratory for Elemental and Isotopic Analysis (CLEIA) and the Egypt Second Research Reactor (ETRR-2). The described techniques are Atomic Absorption Spectrometer (AAS 6 vario, Analytical Jena GmbH, Germany), JMS-PLASMAX2 Mass Spectrometer (ICP-MS) and the Egypt Second Research Reactor (NAA).

  3. Trace elements and cutaneous cancer

    International Nuclear Information System (INIS)

    The mineral macro- and micro-elements are playing essential biological roles. Some are co-factors of enzymes or act as organizers of the molecular structures of the cell or have an important role in ionic transport while some could be even beneficial as anti-tumor agents. Their concentration in the organism is closely linked to the long-term dietary intake, the environmental exposure, (e.g. cumulative exposure to chemicals from industrial sources could increase the incidence of skin cancer) and the health profile of the concerned subject. The research objective consisted in the examination of the content levels of some micro- and macro-elements found in the tumor tissue of patients having skin cancer disease, namely basal cell carcinoma (BCC), squamous cell carcinoma (SCC), malignant melanoma (MM), as well as benign tumor nevi. The analytical method of proton induced X-ray emission (PIXE) was used. The skin samples were collected from 22 cancer patients, aged 32-88 years, 11 males and 11 females. Controls were health skin samples (histopathological diagnosis) from patients having skin cancer. The samples were freeze-dried and then mineralized for PIXE analysis, using nitric acid at 1200 deg C temperature. The internal standard (Yttrium) technique was used for quantitative determination. Thin targets were measured in vacuum using a 3 MeV proton beam delivered by the Van de Graaff Tandem accelerator of the Institute for Physics and Nuclear Engineering in Bucharest - Magurele. A collimated beam (of 3 mm diameter) bombarded the target oriented at an angle of 45 angle with respect to the beam direction. The beam current entering the scattering chamber was maintained at several nAs. The samples were typically irradiated for a collected charge of 10 μC. The emitted X-rays have been detected by a Canberra Ge(HP) detector with energy resolution of 180 eV / 5.9 keV placed perpendicularly to the beam direction. Data manipulation and storage were performed with a Canberra S

  4. Multigroup finite element-boundary element method for neutron diffusion

    International Nuclear Information System (INIS)

    Full text: The finite element method (FEM) is an efficient method used for the solution of partial differential equations (PDE's) of engineering physics due to its symmetric, sparse and positive-definite coefficient matrix. FEM has been successfully applied for the solution of multigroup neutron transport and diffusion equations since 1970's. The boundary element method (BEM), on the other hand, is a newer method and is unique among the numerical methods used for the solution of PDE's with its property of confining the unknowns only to the boundaries of homogeneous regions, thus, greatly reducing matrix dimensions. The first application of BEM to the neutron diffusion equation (NDE) dates back to 1985 and many researchers are currently working in this area. Although BEM is known to have the desirable property of being an internal-mesh free method, this advantage is lost in some of its application to the NDE due to the existence of fission source volume integrals in fissionable regions unless domain-decomposition methods are used. To exploit the favorable properties of both FEM and BEM, a hybrid FE/BE method has been recently proposed for reflected systems treated by one or two-group diffusion theories in a recent paper co-authored by the first author. In this work, the hybrid FE/BE method for reflected systems is generalized to multigroup diffusion theory. The core is treated by FEM to preserve the high accuracy of FEM in such neutron-producing regions. Using a boundary integral equation formerly proposed by the second author, BEM, is utilized for the discretization of the reflector, thus, eliminating the internal mesh completely for this nonfissionable region. The multigroup FE/BE method has been implemented in our recently developed FORTRAN program. The program is validated by comparison of the calculated effective multiplication factor and the group fluxes with their analytical counterparts for a two-group reflected system. Comparison of these results and

  5. Gas chromatographic studies of the heaviest elements

    International Nuclear Information System (INIS)

    Recent experiments are reviewed which used on-line isothermal gas chromatography techniques for studying chemical properties of transactinide elements. Elements 106 (Sg) and 107(Bh) could assigned to groups 6 and 7 of the Periodic Table. The chemical characterization of elements 108 (Hs) and 112 has been prepared. A first attempt to chemically identify element 112 has been unsuccessful. Nevertheless, the chemical isolation of transactinide elements with Z>107 appears feasible. It could also serve to confirm the discovery of SHE decaying to nuclides which have previously been unknown

  6. A New Geochemical Classification of Elements

    Institute of Scientific and Technical Information of China (English)

    Qi Changmou; L. Lynn Chyi

    2001-01-01

    The geochemical classification proposed by Goldschmidt was based on meteoritic analysis and elemental partition in blast furnace. There are many surprises when applied to the discussion of natural occurrences. A modified classification of elements based on basic chemical properties and their occurrences. A modified classification of elements based on basic chemical properties and their occurrences in nature is, therefore, proposed for students learning geochemistry and geologists working in the field. Elements are classified into six groups including lithophile, oxyphile, siderophile, chalcophile, biophile, and atmophile elements. Five terms are taken from Goldshcmidt's original classification. Oxyphile is a new term.

  7. Chemical characterization of bohrium (element 107)

    Science.gov (United States)

    Eichler; Bruchle; Dressler; Dullmann; Eichler; Gaggeler; Gregorich; Hoffman; Hubener; Jost; Kirbach; Laue; Lavanchy; Nitsche; Patin; Piguet; Schadel; Shaughnessy; Strellis; Taut; Tobler; Tsyganov; Turler; Vahle; Wilk; Yakushev

    2000-09-01

    The arrangement of the chemical elements in the periodic table highlights resemblances in chemical properties, which reflect the elements' electronic structure. For the heaviest elements, however, deviations in the periodicity of chemical properties are expected: electrons in orbitals with a high probability density near the nucleus are accelerated by the large nuclear charges to relativistic velocities, which increase their binding energies and cause orbital contraction. This leads to more efficient screening of the nuclear charge and corresponding destabilization of the outer d and f orbitals: it is these changes that can give rise to unexpected chemical properties. The synthesis of increasingly heavy elements, now including that of elements 114, 116 and 118, allows the investigation of this effect, provided sufficiently long-lived isotopes for chemical characterization are available. In the case of elements 104 and 105, for example, relativistic effects interrupt characteristic trends in the chemical properties of the elements constituting the corresponding columns of the periodic table, whereas element 106 behaves in accordance with the expected periodicity. Here we report the chemical separation and characterization of six atoms of element 107 (bohrium, Bh), in the form of its oxychloride. We find that this compound is less volatile than the oxychlorides of the lighter elements of group VII, thus confirming relativistic calculations that predict the behaviour of bohrium, like that of element 106, to coincide with that expected on the basis of its position in the periodic table. PMID:10993071

  8. Chemical characterization of bohrium (element 107)

    Science.gov (United States)

    Eichler, R.; Brüchle, W.; Dressler, R.; Düllmann, Ch. E.; Eichler, B.; Gäggeler, H. W.; Gregorich, K. E.; Hoffman, D. C.; Hübener, S.; Jost, D. T.; Kirbach, U. W.; Laue, C. A.; Lavanchy, V. M.; Nitsche, H.; Patin, J. B.; Piguet, D.; Schädel, M.; Shaughnessy, D. A.; Strellis, D. A.; Taut, S.; Tobler, L.; Tsyganov, Y. S.; Türler, A.; Vahle, A.; WiIk, P. A.; Yakushev, A. B.

    2000-09-01

    The arrangement of the chemical elements in the periodic table highlights resemblances in chemical properties, which reflect the elements' electronic structure. For the heaviest elements, however, deviations in the periodicity of chemical properties are expected: electrons in orbitals with a high probability density near the nucleus are accelerated by the large nuclear charges to relativistic velocities, which increase their binding energies and cause orbital contraction. This leads to more efficient screening of the nuclear charge and corresponding destabilization of the outer d and f orbitals: it is these changes that can give rise to unexpected chemical properties. The synthesis of increasingly heavy elements, now including that of elements 114, 116 and 118, allows the investigation of this effect, provided sufficiently long-lived isotopes for chemical characterization are available. In the case of elements 104 and 105, for example, relativistic effects interrupt characteristic trends in the chemical properties of the elements constituting the corresponding columns of the periodic table, whereas element 106 behaves in accordance with the expected periodicity. Here we report the chemical separation and characterization of six atoms of element 107 (bohrium, Bh), in the form of its oxychloride. We find that this compound is less volatile than the oxychlorides of the lighter elements of group VII, thus confirming relativistic calculations that predict the behaviour of bohrium, like that of element 106, to coincide with that expected on the basis of its position in the periodic table.

  9. Superheavy element chemistry. Achievements and perspectives

    International Nuclear Information System (INIS)

    Superheavy elements have been synthesized and chemically characterized one-atom-at-a-time up to element 108. Presently, the quest for element 112 is one of the hottest topics in this field. The transactinide elements 104 to 108 are members of group 4 to 8 of the Periodic Table and element 112 belongs into group 12. Chemical properties of some of these elements, like elements 104 and 105, show stunning deviations from simple extrapolations within their respective group while others exhibit great similarities with their lighter homologues elements. First experiments to investigate seaborgium (Sg, element 106) in aqueous solution were performed. Again, in large international collaborations at the GSI, several gas-phase chemistry experiments were performed with hassium (Hs, element 108). Recently, the highly efficient and very clean separation of Hs was applied for nuclear studies of various Hs nuclides investigating their cross section and their nuclear decay properties in the region of the doubly-magic 270Hs (Z=108, N=162). To overcome certain limitations of the presently used on-line chemical separations the new TransActinide Separation and Chemistry Apparatus (TASCA) - with a gas-filled recoil separator as a front-end tool - was designed and built at the GSI in a collaborative effort. Presently in its commissioning phase, TASCA shall be a key instrument for a big leap into quantitatively and qualitatively new experiments in the region of superheavy elements. (author)

  10. Synthesis of superheavy elements by cold fusion

    Energy Technology Data Exchange (ETDEWEB)

    Hofmann, S. [GSI Helmholtzzentrum fuer Schwerionenforschung GmbH, Darmstadt (Germany); Frankfurt Univ. (Germany). Inst. fuer Kernphysik

    2011-07-01

    The new elements from Z = 107 to 112 were synthesized in cold fusion reactions based on targets of lead and bismuth. The principle physical concepts are presented which led to the application of this reaction type in search experiments for new elements. Described are the technical developments from early mechanical devices to experiments with recoil separators. An overview is given of present experiments which use cold fusion for systematic studies and synthesis of new isotopes. Perspectives are also presented for the application of cold fusion reactions in synthesis of elements beyond element 113, the so far heaviest element produced in a cold fusion reaction. Further, the transition of hot fusion to cold fusion is pointed out, which occurs in reactions for synthesis of elements near Z = 126 using actinide targets and beams of neutron rich isotopes of elements from iron to germanium. (orig.)

  11. Synthesis of superheavy elements by cold fusion

    International Nuclear Information System (INIS)

    The new elements from Z = 107 to 112 were synthesized in cold fusion reactions based on targets of lead and bismuth. The principle physical concepts are presented which led to the application of this reaction type in search experiments for new elements. Described are the technical developments from early mechanical devices to experiments with recoil separators. An overview is given of present experiments which use cold fusion for systematic studies and synthesis of new isotopes. Perspectives are also presented for the application of cold fusion reactions in synthesis of elements beyond element 113, the so far heaviest element produced in a cold fusion reaction. Further, the transition of hot fusion to cold fusion is pointed out, which occurs in reactions for synthesis of elements near Z = 126 using actinide targets and beams of neutron rich isotopes of elements from iron to germanium. (orig.)

  12. Pump element for a tube pump

    DEFF Research Database (Denmark)

    2011-01-01

    The invention relates to a tube pump comprising a tube and a pump element inserted in the tube, where the pump element comprises a rod element and a first and a second non-return valve member positioned a distance apart on the rod element. The valve members are oriented in the same direction...... portion acts to alternately close and open the valve members thereby generating a fluid flow through the tube. The invention further relates to a pump element comprising at least two non-return valve members connected by a rod element, and for insertion in an at least partly flexible tube in such tube...... pump as mentioned above, thereby acting to generate a fluid flow through the tube upon repeated deformation of the tube between the two valve members. The pump element may comprise a connecting part for coupling to another tube and may comprise a sealing part establishing a fluid tight connection to a...

  13. Transpositionally active episomal hAT elements

    Directory of Open Access Journals (Sweden)

    Hice Robert H

    2009-12-01

    Full Text Available Abstract Background hAT elements and V(DJ recombination may have evolved from a common ancestral transposable element system. Extrachromosomal, circular forms of transposable elements (referred to here as episomal forms have been reported yet their biological significance remains unknown. V(DJ signal joints, which resemble episomal transposable elements, have been considered non-recombinogenic products of V(DJ recombination and a safe way to dispose of excised chromosomal sequences. V(DJ signal joints can, however, participate in recombination reactions and the purpose of this study was to determine if hobo and Hermes episomal elements are also recombinogenic. Results Up to 50% of hobo/Hermes episomes contained two intact, inverted-terminal repeats and 86% of these contained from 1-1000 bp of intercalary DNA. Episomal hobo/Hermes elements were recovered from Musca domestica (a natural host of Hermes, Drosophila melanogaster (a natural host of hobo and transgenic Drosophila melanogaster and Aedes aegypti (with autonomous Hermes elements. Episomal Hermes elements were recovered from unfertilized eggs of M. domestica and D. melanogaster demonstrating their potential for extrachromosomal, maternal transmission. Reintegration of episomal Hermes elements was observed in vitro and in vivo and the presence of Hermes episomes resulted in lower rates of canonical Hermes transposition in vivo. Conclusion Episomal hobo/Hermes elements are common products of element excision and can be maternally transmitted. Episomal forms of Hermes are capable of integration and also of influencing the transposition of canonical elements suggesting biological roles for these extrachromosomal elements in element transmission and regulation.

  14. Osmolality of Elemental and Semi-Elemental Formulas Supplemented with Nonprotein Energy Supplements

    OpenAIRE

    Pereira-da-Silva, L; Pitta-Grós Dias, M; Virella, D; Serelha, M.

    2008-01-01

    Elemental and semi-elemental formulas are used to feed infants with short bowel syndrome, who may not be able to tolerate feeds of more than 310 mOsm kg(-1). The present study aimed to measure the osmolality of elemental and semi-elemental formulas at different concentrations, with and without the addition of nonprotein energy supplements.

  15. Development of polygon elements based on the scaled boundary finite element method

    International Nuclear Information System (INIS)

    We aim to extend the scaled boundary finite element method to construct conforming polygon elements. The development of the polygonal finite element is highly anticipated in computational mechanics as greater flexibility and accuracy can be achieved using these elements. The scaled boundary polygonal finite element will enable new developments in mesh generation, better accuracy from a higher order approximation and better transition elements in finite element meshes. Polygon elements of arbitrary number of edges and order have been developed successfully. The edges of an element are discretised with line elements. The displacement solution of the scaled boundary finite element method is used in the development of shape functions. They are shown to be smooth and continuous within the element, and satisfy compatibility and completeness requirements. Furthermore, eigenvalue decomposition has been used to depict element modes and outcomes indicate the ability of the scaled boundary polygonal element to express rigid body and constant strain modes. Numerical tests are presented; the patch test is passed and constant strain modes verified. Accuracy and convergence of the method are also presented and the performance of the scaled boundary polygonal finite element is verified on Cook's swept panel problem. Results show that the scaled boundary polygonal finite element method outperforms a traditional mesh and accuracy and convergence are achieved from fewer nodes. The proposed method is also shown to be truly flexible, and applies to arbitrary n-gons formed of irregular and non-convex polygons.

  16. Human COL2A1-directed SV40 T antigen expression in transgenic and chimeric mice results in abnormal skeletal development

    OpenAIRE

    1995-01-01

    The ability of SV40 T antigen to cause abnormalities in cartilage development in transgenic mice and chimeras has been tested. The cis- regulatory elements of the COL2A1 gene were used to target expression of SV40 T antigen to differentiating chondrocytes in transgenic mice and chimeras derived from embryonal stem (ES) cells bearing the same transgene. The major phenotypic consequences of transgenic (pAL21) expression are malformed skeleton, disproportionate dwarfism, and perinatal/neonatal d...

  17. Identification and dissection of a key enhancer mediating cranial neural crest specific expression of transcription factor, Ets-1

    OpenAIRE

    Barembaum, Meyer; Bronner, Marianne E.

    2013-01-01

    Neural crest cells form diverse derivatives that vary according to their level of origin along the body axis, with only cranial neural crest cells contributing to facial skeleton. Interestingly, the transcription factor Ets-1 is uniquely expressed in cranial but not trunk neural crest, where it functions as a direct input into neural crest specifier genes, Sox10 and FoxD3. We have isolated and interrogated a cis-regulatory element, conserved between birds and mammals, that drives reporter exp...

  18. Molecular mechanisms of decreased smooth muscle differentiation marker expression after vascular injury

    OpenAIRE

    Regan, Christopher P.; Adam, Paul J.; Madsen, Cort S.; Owens, Gary K.

    2000-01-01

    While it is well established that phenotypic modulation of vascular smooth muscle cells (VSMCs) contributes to the development and progression of vascular lesions, little is known regarding the molecular mechanisms of phenotypic modulation in vivo. Here we show that vascular injury reduces transcription of VSMC differentiation marker genes, and we identify cis regulatory elements that may mediate this decrease. Using a carotid wire-injury model in mice carrying transgenes for smooth muscle α-...

  19. Genetic distance as an alternative to physical distance for definition of gene units in association studies

    OpenAIRE

    Rodriguez-Fontenla, Cristina; Calaza, Manuel; Gonzalez, Antonio

    2014-01-01

    Background Some association studies, as the implemented in VEGAS, ALIGATOR, i-GSEA4GWAS, GSA-SNP and other software tools, use genes as the unit of analysis. These genes include the coding sequence plus flanking sequences. Polymorphisms in the flanking sequences are of interest because they involve cis-regulatory elements or they inform on untyped genetic variants trough linkage disequilibrium. Gene extensions have customarily been defined as ± 50 Kb. This approach is not fully satisfactory b...

  20. Emerging principles of regulatory evolution

    OpenAIRE

    Prud'homme, Benjamin; Gompel, Nicolas; Carroll, Sean B.

    2007-01-01

    Understanding the genetic and molecular mechanisms governing the evolution of morphology is a major challenge in biology. Because most animals share a conserved repertoire of body-building and -patterning genes, morphological diversity appears to evolve primarily through changes in the deployment of these genes during development. The complex expression patterns of developmentally regulated genes are typically controlled by numerous independent cis-regulatory elements (CREs). It has been prop...

  1. Novel characterisation of the gene encoding conglutinin reveals that previously characterised promoter corresponds to the CL-43 promoter

    DEFF Research Database (Denmark)

    Hansen, Soren; Moeller, Vivi; Holm, Dorte; Vitved, Lars; Bendixen, Christian; Skjødt, Karsten; Holmskov, Uffe

    Conglutinin, a collectin found in bovine serum, is an opsonin that binds to glycoconjugates on the surface of microorganisms or on deposited iC3b, and acts in concert with phagocytes to establish a first-line of immune defense. We have isolated a genomic conglutinin phage clone and found that the 5...... CL-43. Comparison of potential cis-regulatory elements in relation to the functional studies indicates that the two genes are regulated by different mechanisms....

  2. Neofunctionalization in vertebrates: the example of retinoic acid receptors.

    OpenAIRE

    Hector Escriva; Stéphanie Bertrand; Pierre Germain; Marc Robinson-Rechavi; Muriel Umbhauer; Jérôme Cartry; Marilyne Duffraisse; Linda Holland; Hinrich Gronemeyer; Vincent Laudet

    2006-01-01

    Understanding the role of gene duplications in establishing vertebrate innovations is one of the main challenges of Evo-Devo (evolution of development) studies. Data on evolutionary changes in gene expression (i.e., evolution of transcription factor-cis-regulatory elements relationships) tell only part of the story; protein function, best studied by biochemical and functional assays, can also change. In this study, we have investigated how gene duplication has affected both the expression and...

  3. Analysis of Sequence Conservation at Nucleotide Resolution

    OpenAIRE

    Asthana, Saurabh; Roytberg, Mikhail; Stamatoyannopoulos, John; Sunyaev, Shamil R.

    2007-01-01

    One of the major goals of comparative genomics is to understand the evolutionary history of each nucleotide in the human genome sequence, and the degree to which it is under selective pressure. Ascertainment of selective constraint at nucleotide resolution is particularly important for predicting the functional significance of human genetic variation and for analyzing the sequence substructure of cis-regulatory sequences and other functional elements. Current methods for analysis of sequence ...

  4. Evolutionary Novelty in a Butterfly Wing Pattern through Enhancer Shuffling.

    OpenAIRE

    Wallbank, Richard W. R.; Baxter, Simon W.; Pardo-D?az, Carolina; Hanly, Joseph J.; Martin, Simon H.; Mallet, James; Dasmahapatra, Kanchon K.; Salazar, Camilo; Joron, Mathieu; Nadeau, Nicola; McMillan, W. Owen; Jiggins, Chris D.

    2016-01-01

    An important goal in evolutionary biology is to understand the genetic changes underlying novel morphological structures. We investigated the origins of a complex wing pattern found among Amazonian Heliconius butterflies. Genome sequence data from 142 individuals across 17 species identified narrow regions associated with two distinct red colour pattern elements, dennis and ray. We hypothesise that these modules in non-coding sequence represent distinct cis-regulatory loci that control expres...

  5. Micro fuel elements and fuel elements studies with the use of pre-irradiation

    International Nuclear Information System (INIS)

    The ampoule and loop canal designs for irradiation of HTGR fuel elements and methods of investigation of their radiation stability are described. The results are presented on the measurement of fission product yield from fuel elements during irradiation. Irradiation main parameters are in agreement with HTGR operating conditions. The results of metallographic investigations of the micro fuel elements irradiated are given. The processes taking place in fuel elements and microfuel elements during irradiation are discussed

  6. Chromosome rearrangements and transposable elements.

    Science.gov (United States)

    Lonnig, Wolf-Ekkehard; Saedler, Heinz

    2002-01-01

    There has been limited corroboration to date for McClintock's vision of gene regulation by transposable elements (TEs), although her proposition on the origin of species by TE-induced complex chromosome reorganizations in combination with gene mutations, i.e., the involvement of both factors in relatively sudden formations of species in many plant and animal genera, has been more promising. Moreover, resolution is in sight for several seemingly contradictory phenomena such as the endless reshuffling of chromosome structures and gene sequences versus synteny and the constancy of living fossils (or stasis in general). Recent wide-ranging investigations have confirmed and enlarged the number of earlier cases of TE target site selection (hot spots for TE integration), implying preestablished rather than accidental chromosome rearrangements for nonhomologous recombination of host DNA. The possibility of a partly predetermined generation of biodiversity and new species is discussed. The views of several leading transposon experts on the rather abrupt origin of new species have not been synthesized into the macroevolutionary theory of the punctuated equilibrium school of paleontology inferred from thoroughly consistent features of the fossil record. PMID:12429698

  7. Efficiency analysis of betavoltaic elements

    Science.gov (United States)

    Sachenko, A. V.; Shkrebtii, A. I.; Korkishko, R. M.; Kostylyov, V. P.; Kulish, M. R.; Sokolovskyi, I. O.

    2015-09-01

    The conversion of energy of electrons produced by a radioactive β-source into electricity in a Si and SiC p-n junctions is modeled. The features of the generation function that describes the electron-hole pair production by an electron flux and the emergence of a "dead layer" are discussed. The collection efficiency Q that describes the rate of electron-hole pair production by incident beta particles, is calculated taking into account the presence of the dead layer. It is shown that in the case of high-grade Si p-n junctions, the collection efficiency of electron-hole pairs created by a high-energy electrons flux (such as, e.g., Pm-147 beta flux) is close or equal to unity in a wide range of electron energies. For SiC p-n junctions, Q is near unity only for electrons with relatively low energies of about 5 keV (produced, e.g., by a tritium source) and decreases rapidly with further increase of electron energy. The conditions, under which the influence of the dead layer on the collection efficiency is negligible, are determined. The open-circuit voltage is calculated for realistic values of the minority carriers' diffusion coefficients and lifetimes in Si and SiC p-n junctions, irradiated by a high-energy electrons flux. Our calculations allow to estimate the attainable efficiency of betavoltaic elements.

  8. Fuel elements of thermionic converters

    International Nuclear Information System (INIS)

    Work on thermionic nuclear power systems has been performed in Russia within the framework of the TOPAZ reactor program since the early 1960s. In the TOPAZ in-core thermionic convertor reactor design, the fuel element's cladding is also the thermionic convertor's emitter. Deformation of the emitter can lead to short-circuiting and is the primary cause of premature TRC failure. Such deformation can be the result of fuel swelling, thermocycling, or increased unilateral pressure on the emitter due to the release of gaseous fission products. Much of the work on TRCs has concentrated on preventing or mitigating emitter deformation by improving the following materials and structures: nuclear fuel; emitter materials; electrical insulators; moderator and reflector materials; and gas-exhaust device. In addition, considerable effort has been directed toward the development of experimental techniques that accurately mimic operational conditions and toward the creation of analytical and numerical models that allow operational conditions and behavior to be predicted without the expense and time demands of in-pile tests. New and modified materials and structures for the cores of thermionic NPSs and new fabrication processes for the materials have ensured the possibility of creating thermionic NPSs for a wide range of powers, from tens to several hundreds of kilowatts, with life spans of 5 to 10 years

  9. Dynamic heater for display elements

    Science.gov (United States)

    Dehmlow, Brian P.; Bishop, Gary D.; Steffensmeier, Martin J.; Sampica, James D.; Skarohlid, Mark C.

    1997-07-01

    Liquid crystal display (LCD) deliver optimal performance when the entire display surface is isothermal and at a controllable temperature. This condition creates uniform electro-optical properties within the liquid crystal layer. This paper describes a dynamic, multicontact heater system that actively compensates for uneven heat loads, thereby creating the desired isothermal condition. The heater system includes a uniform resistive sheet, with multiple electrical contacts around the perimeter. A switch network connects each heater contact to a power supply, ground potential, or a high impedance. A microprocessor monitors the display temperature, and detects non-uniformity, and selectively applies heat to cold areas of the display. The dynamic heater system employs a variety of heating patterns to create the desired isothermal condition.Heating patterns vary in duration, power applied, and location on the display face. The microprocessor control loop can also detect and isolate faulty drive elements, and compensate for non- uniformity in the heater itself. The heater prevents stress- induced delaminations, mechanical distortions, and stress- induced birefringence in optical components. Test results indicate that a dynamic heater can be beneficial in the thermal design of LCD products.

  10. Functional Metamirrors Using Bianisotropic Elements

    Science.gov (United States)

    Asadchy, V. S.; Ra'di, Y.; Vehmas, J.; Tretyakov, S. A.

    2015-03-01

    Conventional mirrors obey the simple reflection law that a plane wave is reflected as a plane wave, at the same angle. To engineer spatial distributions of fields reflected from a mirror, one can either shape the reflector or position some phase-correcting elements on top of a mirror surface. Here we show, both theoretically and experimentally, that full-power reflection with general control over the reflected wave phase is possible with a single-layer array of deeply subwavelength inclusions. These proposed artificial surfaces, metamirrors, provide various functions of shaped or nonuniform reflectors without utilizing any mirror. This can be achieved only if the forward and backward scattering of the inclusions in the array can be engineered independently, and we prove that it is possible using electrically and magnetically polarizable inclusions. The proposed subwavelength inclusions possess desired reflecting properties at the operational frequency band, while at other frequencies the array is practically transparent. The metamirror concept leads to a variety of applications over the entire electromagnetic spectrum, such as optically transparent focusing antennas for satellites, multifrequency reflector antennas for radio astronomy, low-profile conformal antennas for telecommunications, and nanoreflectarray antennas for integrated optics.

  11. Designing Rolling-Element Bearings

    Science.gov (United States)

    Moore, James D., Jr.

    2007-01-01

    Bearing Analysis Tool (BAT) is a computer program for designing rolling-element bearings for cryogenic turbomachines. BAT provides a graphical user interface (GUI) that guides the entry of data to develop mathematical models of bearings. The GUI breaks model data into logical subsets that are entered through logic-driven input screens. The software generates a threedimensional graphical model of a bearing as the data are entered. Most dataentry errors become immediately obvious in the graphical model. BAT provides for storage of all the data on a shaft/bearing system, enabling the creation of a library of proven designs. Data from the library can be transferred to subsequent projects by use of simple cut-and-paste routines. BAT includes a library of temperature- dependent cryogenic bearing-material properties for use in the mathematical models. BAT implements algorithms that (1) enable the user to select combinations of design and/or operating-condition parameters, and then (2) automatically optimize the design by performing trade studies over all of the parameter combinations. This feature enables optimization over a large trade space in a fraction of the time taken when using prior bearingmodel software.

  12. Mars Surface Tunnel Element Concept

    Science.gov (United States)

    Rucker, Michelle A.; Jefferies, Sharon; Howe, A. Scott; Howard, Robert; Mary, Natalie; Watson, Judith; Lewis, Ruthan

    2016-01-01

    When the first human visitors on Mars prepare to return to Earth, they will have to comply with stringent planetary protection requirements. Apollo Program experience warns that opening an EVA hatch directly to the surface will bring dust into the ascent vehicle. To prevent inadvertent return of potential Martian contaminants to Earth, careful consideration must be given to the way in which crew ingress their Mars Ascent Vehicle (MAV). For architectures involving more than one surface element-such as an ascent vehicle and a pressurized rover or surface habitat-a retractable tunnel that eliminates extravehicular activity (EVA) ingress is an attractive solution. Beyond addressing the immediate MAV access issue, a reusable tunnel may be useful for other surface applications, such as rover to habitat transfer, once its primary mission is complete. A National Aeronautics and Space Administration (NASA) team is studying the optimal balance between surface tunnel functionality, mass, and stowed volume as part of the Evolvable Mars Campaign (EMC). The study team began by identifying the minimum set of functional requirements needed for the tunnel to perform its primary mission, as this would presumably be the simplest design, with the lowest mass and volume. This Minimum Functional Tunnel then becomes a baseline against which various tunnel design concepts and potential alternatives can be traded, and aids in assessing the mass penalty of increased functionality. Preliminary analysis indicates that the mass of a single-mission tunnel is about 237 kg, not including mass growth allowance.

  13. Functions over RDF Language Elements

    Science.gov (United States)

    Schandl, Bernhard

    RDF data are usually accessed using one of two methods: either, graphs are rendered in forms perceivable by human users (e.g., in tabular or in graphical form), which are difficult to handle for large data sets. Alternatively, query languages like SPARQL provide means to express information needs in structured form; hence they are targeted towards developers and experts. Inspired by the concept of spreadsheet tools, where users can perform relatively complex calculations by splitting formulas and values across multiple cells, we have investigated mechanisms that allow us to access RDF graphs in a more intuitive and manageable, yet formally grounded manner. In this paper, we make three contributions towards this direction. First, we present RDFunctions, an algebra that consists of mappings between sets of RDF language elements (URIs, blank nodes, and literals) under consideration of the triples contained in a background graph. Second, we define a syntax for expressing RDFunctions, which can be edited, parsed and evaluated. Third, we discuss Tripcel, an implementation of RDFunctions using a spreadsheet metaphor. Using this tool, users can easily edit and execute function expressions and perform analysis tasks on the data stored in an RDF graph.

  14. Nuclear fuel element and container

    International Nuclear Information System (INIS)

    The invention is based on the discovery that a substantial reduction in metal embrittlement or stress corrosion cracking from fuel pellet-cladding interaction can be achieved by the use of a copper layer or liner in proximity to the nuclear fuel, and an intermediate zirconium oxide barrier layer between the copper layer and the zirconium cladding substrate. The intermediate zirconia layer is a good copper diffusion barrier; also, if the zirconium cladding surface is modified prior to oxidation, copper can be deposited by electroless plating. A nuclear fuel element is described which comprises a central core of fuel material and an elongated container using the system outlined above. The method for making the container is again described. It comprises roughening or etching the surface of the zirconium or zirconium alloy container, oxidizing the resulting container, activating the oxidized surface to allow for the metallic coating of such surfaces by electroless deposition and further coating the activated-oxidized surface of the zirconium or zirconium alloy container with copper, iron or nickel or an alloy thereof. (U.K.)

  15. Finite element coiled cochlea model

    Science.gov (United States)

    Isailovic, Velibor; Nikolic, Milica; Milosevic, Zarko; Saveljic, Igor; Nikolic, Dalibor; Radovic, Milos; Filipović, Nenad

    2015-12-01

    Cochlea is important part of the hearing system, and thanks to special structure converts external sound waves into neural impulses which go to the brain. Shape of the cochlea is like snail, so geometry of the cochlea model is complex. The simplified cochlea coiled model was developed using finite element method inside SIFEM FP7 project. Software application is created on the way that user can prescribe set of the parameters for spiral cochlea, as well as material properties and boundary conditions to the model. Several mathematical models were tested. The acoustic wave equation for describing fluid in the cochlea chambers - scala vestibuli and scala timpani, and Newtonian dynamics for describing vibrations of the basilar membrane are used. The mechanical behavior of the coiled cochlea was analyzed and the third chamber, scala media, was not modeled because it does not have a significant impact on the mechanical vibrations of the basilar membrane. The obtained results are in good agreement with experimental measurements. Future work is needed for more realistic geometry model. Coiled model of the cochlea was created and results are compared with initial simplified coiled model of the cochlea.

  16. Trace Element Management in Rice

    Directory of Open Access Journals (Sweden)

    Abin Sebastian

    2015-08-01

    Full Text Available Trace elements (TEs are vital for the operation of metabolic pathways that promote growth and structural integrity. Paddy soils are often prone to TE limitation due to intensive cultivation and irrigation practices. Apart from this, rice paddies are potentially contaminated with transition metals such as Cd, which are often referred to as toxic TEs. Deficiency of TEs in the soil not only delays plant growth but also causes exposure of plant roots to toxic TEs. Fine-tuning of nutrient cycling in the rice field is a practical solution to cope with TEs deficiency. Adjustment of soil physicochemical properties, biological process such as microbial activities, and fertilization helps to control TEs mobilization in soil. Modifications in root architecture, metal transporters activity, and physiological processes are also promising approaches to enhance TEs accumulation in grains. Through genetic manipulation, these modifications help to increase TE mining capacity of rice plants as well as transport and trafficking of TEs into the grains. The present review summarizes that regulation of TE mobilization in soil, and the genetic improvement of TE acquisition traits help to boost essential TE content in rice grain.

  17. Beryllium reflector elements for PARR-1

    International Nuclear Information System (INIS)

    The LEU fuel of PARR-1 was designed for a discharge burnup of 35% of initial /sup 235/U loading. Recently some of the fuel elements have been discharged from the PARR-1 core after attaining the burnup closed to the design value. These fuel elements were discharged due to diminished excess reactivity although they were physically intact. After satisfactory performance of these fuel elements there has been a desire to explore the possibility of enhancing the discharge burnup by boosting up the core reactivity. Use of better reflector elements is one of the methods to obtain this goal. In this report properties of various reflector elements have been compared and it is found that use of Beryllium metal reflector elements may be a promising choice for this purpose. (author)

  18. Spacer for supporting fuel element boxes

    International Nuclear Information System (INIS)

    A spacer plate unit arranged externally on each side and at a predetermined level of a polygonal fuel element box for mutually supporting, with respect to one another, a plurality of the fuel element boxes forming a fuel element bundle, is formed of a first and a second spacer plate part each having the same length and the same width and being constituted of unlike first and second materials, respectively. The first and second spacer plate parts of the several spacer plate units situated at the predetermined level are arranged in an alternating continuous series when viewed in the peripheral direction of the fuel element box, so that any two spacer plate units belonging to face-to-face oriented sides of two adjoining fuel element boxes in the fuel element bundle define interfaces of unlike materials

  19. Stable isotopes for heavy element production

    CERN Document Server

    Lommel, B; Hofmann, S; Kindler, B; Klemm, J; Steiner, J; Tinschert, K

    2003-01-01

    The synthesis of heavy elements and the search for new superheavy elements is one of the exciting fields in modern nuclear physics and chemistry. Heavy elements are produced by heavy-ion fusion reactions. Necessary prerequisites are intense heavy-ion beams from pure isotopic material and thin isotopically enriched targets. At GSI the elements from 107 to 112 were produced using targets of Pb and Bi and beams of the most neutron rich isotopes of Cr, Fe, Ni, and Zn. Experimental set-up consisting of target wheel, velocity filter SHIP (Separator for Heavy Ion Reaction Products), and detector system is presented. Status of the ion source techniques for delivering intense and stable beams for this kind of experiment is shortly described. The manufacturing and properties of various source - target combinations used for the synthesis of the elements by now are discussed in detail as well as the possibilities for extending the experiments into the region of superheavy elements.

  20. Automated Fuel Element Closure Welding System

    International Nuclear Information System (INIS)

    The Automated Fuel Element Closure Welding System is a robotic device that will load and weld top end plugs onto nuclear fuel elements in a highly radioactive and inert gas environment. The system was developed at Argonne National Laboratory-West as part of the Fuel Cycle Demonstration. The welding system performs four main functions, it (1) injects a small amount of a xenon/krypton gas mixture into specific fuel elements, and (2) loads tiny end plugs into the tops of fuel element jackets, and (3) welds the end plugs to the element jackets, and (4) performs a dimensional inspection of the pre- and post-welded fuel elements. The system components are modular to facilitate remote replacement of failed parts. The entire system can be operated remotely in manual, semi-automatic, or fully automatic modes using a computer control system. The welding system is currently undergoing software testing and functional checkout

  1. The landscape of accessible chromatin in mammalian preimplantation embryos.

    Science.gov (United States)

    Wu, Jingyi; Huang, Bo; Chen, He; Yin, Qiangzong; Liu, Yang; Xiang, Yunlong; Zhang, Bingjie; Liu, Bofeng; Wang, Qiujun; Xia, Weikun; Li, Wenzhi; Li, Yuanyuan; Ma, Jing; Peng, Xu; Zheng, Hui; Ming, Jia; Zhang, Wenhao; Zhang, Jing; Tian, Geng; Xu, Feng; Chang, Zai; Na, Jie; Yang, Xuerui; Xie, Wei

    2016-06-30

    In mammals, extensive chromatin reorganization is essential for reprogramming terminally committed gametes to a totipotent state during preimplantation development. However, the global chromatin landscape and its dynamics in this period remain unexplored. Here we report a genome-wide map of accessible chromatin in mouse preimplantation embryos using an improved assay for transposase-accessible chromatin with high throughput sequencing (ATAC-seq) approach with CRISPR/Cas9-assisted mitochondrial DNA depletion. We show that despite extensive parental asymmetry in DNA methylomes, the chromatin accessibility between the parental genomes is globally comparable after major zygotic genome activation (ZGA). Accessible chromatin in early embryos is widely shaped by transposable elements and overlaps extensively with putative cis-regulatory sequences. Unexpectedly, accessible chromatin is also found near the transcription end sites of active genes. By integrating the maps of cis-regulatory elements and single-cell transcriptomes, we construct the regulatory network of early development, which helps to identify the key modulators for lineage specification. Finally, we find that the activities of cis-regulatory elements and their associated open chromatin diminished before major ZGA. Surprisingly, we observed many loci showing non-canonical, large open chromatin domains over the entire transcribed units in minor ZGA, supporting the presence of an unusually permissive chromatin state. Together, these data reveal a unique spatiotemporal chromatin configuration that accompanies early mammalian development. PMID:27309802

  2. Benchmarking the QUAD4/TRIA3 element

    Science.gov (United States)

    Pitrof, Stephen M.; Venkayya, Vipperla B.

    1993-01-01

    The QUAD4 and TRIA3 elements are the primary plate/shell elements in NASTRAN. These elements enable the user to analyze thin plate/shell structures for membrane, bending and shear phenomena. They are also very new elements in the NASTRAN library. These elements are extremely versatile and constitute a substantially enhanced analysis capability in NASTRAN. However, with the versatility comes the burden of understanding a myriad of modeling implications and their effect on accuracy and analysis quality. The validity of many aspects of these elements were established through a series of benchmark problem results and comparison with those available in the literature and obtained from other programs like MSC/NASTRAN and CSAR/NASTRAN. Never-the-less such a comparison is never complete because of the new and creative use of these elements in complex modeling situations. One of the important features of QUAD4 and TRIA3 elements is the offset capability which allows the midsurface of the plate to be noncoincident with the surface of the grid points. None of the previous elements, with the exception of bar (beam), has this capability. The offset capability played a crucial role in the design of QUAD4 and TRIA3 elements. It allowed modeling layered composites, laminated plates and sandwich plates with the metal and composite face sheets. Even though the basic implementation of the offset capability is found to be sound in the previous applications, there is some uncertainty in relatively simple applications. The main purpose of this paper is to test the integrity of the offset capability and provide guidelines for its effective use. For the purpose of simplicity, references in this paper to the QUAD4 element will also include the TRIA3 element.

  3. Integrating Environmentally Responsive Elements in Buildings

    OpenAIRE

    Heiselberg, Per; Andresen, Inger; Perino, Marco; van der Aa, Ad

    2006-01-01

    Significant improvement have been achieved on efficiency improvements of specific building elements like the building envelope and building equipment and services and whilst most building elements still offer opportunities for efficiency improvements, the greatest future potential lie with technologies that promote the integration of responsive building elements and building services in integrated building concepts. In order to address some of these issues an international research effort, IE...

  4. Domain decomposition methods for mortar finite elements

    Energy Technology Data Exchange (ETDEWEB)

    Widlund, O.

    1996-12-31

    In the last few years, domain decomposition methods, previously developed and tested for standard finite element methods and elliptic problems, have been extended and modified to work for mortar and other nonconforming finite element methods. A survey will be given of work carried out jointly with Yves Achdou, Mario Casarin, Maksymilian Dryja and Yvon Maday. Results on the p- and h-p-version finite elements will also be discussed.

  5. Rotationally invariant distortion resistant finite-elements.

    OpenAIRE

    Cowan, T.; Coombs, W.M.

    2014-01-01

    The predictive capability of conventional iso-parametric finite-elements deteriorates with mesh distortion. In the case of geometrically non-linear analysis, changes in geometry causing severe distortion can result in negative Jacobian mapping between the local and global systems resulting in numerical breakdown. This paper presents a finite-element formulation that is resistant to irregular mesh geometries and large element distortions whilst remaining invariant to rigid body motion. The pre...

  6. All Spin Nano-magnetic State Elements

    OpenAIRE

    Manipatruni, Sasikanth; Nikonov, Dmitri E.; Young, Ian A.

    2012-01-01

    We propose an all spin state element to enable all spin state machines using spin currents and nanomagnets. We demonstrate via numerical simulations the operation of a state element a critical building block for synchronous, sequential logic computation. The numerical models encompass Landau-Lifshitz-Gilbert (LLG) nanomagnet dynamics with stochastic models and vector spin-transport in metallic magnetic and non-magnetic channels. Combined with all spin combinatorial logic, the state elements c...

  7. Benchmarking the QUAD4/TRIA3 element

    Science.gov (United States)

    Pitrof, Stephen M.; Venkayya, Vipperla B.

    1993-09-01

    The QUAD4 and TRIA3 elements are the primary plate/shell elements in NASTRAN. These elements enable the user to analyze thin plate/shell structures for membrane, bending and shear phenomena. They are also very new elements in the NASTRAN library. These elements are extremely versatile and constitute a substantially enhanced analysis capability in NASTRAN. However, with the versatility comes the burden of understanding a myriad of modeling implications and their effect on accuracy and analysis quality. The validity of many aspects of these elements were established through a series of benchmark problem results and comparison with those available in the literature and obtained from other programs like MSC/NASTRAN and CSAR/NASTRAN. Never-the-less such a comparison is never complete because of the new and creative use of these elements in complex modeling situations. One of the important features of QUAD4 and TRIA3 elements is the offset capability which allows the midsurface of the plate to be noncoincident with the surface of the grid points. None of the previous elements, with the exception of bar (beam), has this capability. The offset capability played a crucial role in the design of QUAD4 and TRIA3 elements. It allowed modeling layered composites, laminated plates and sandwich plates with the metal and composite face sheets. Even though the basic implementation of the offset capability is found to be sound in the previous applications, there is some uncertainty in relatively simple applications. The main purpose of this paper is to test the integrity of the offset capability and provide guidelines for its effective use. For the purpose of simplicity, references in this paper to the QUAD4 element will also include the TRIA3 element.

  8. Completely normal elements in finite abelian extensions

    CERN Document Server

    Koo, Ja Kung

    2011-01-01

    We give a completely normal element in the maximal real subfield of a cyclotomic field over the field of rational numbers, which is different from that of Okada. This result is a consequence of the criterion for a normal element developed in [Normal bases of ray class fields over imaginary quadratic fields, Math. Zeit.]. Furthermore, we find a completely normal element in certain extension of modular function fields in terms of a quotient of the modular discriminant function.

  9. Superheavy Elements Challenge Experimental and Theoretical Chemistry

    International Nuclear Information System (INIS)

    When reflecting on the story of superheavy elements, the author, an experimenter, acknowledges the role, which the predictions of nuclear and chemical theories have played in ongoing studies. Today, the problems of major interest for experimental chemistry are the studies of elements 112 and 114 including their chemical identification. Advanced quantum chemistry calculations of atoms and molecules would be of much help. First experiments with element 112 evidence that the metal is much more volatile and inert than mercury. (author)

  10. The elements of life and medicines.

    Science.gov (United States)

    Chellan, Prinessa; Sadler, Peter J

    2015-03-13

    Which elements are essential for human life? Here we make an element-by-element journey through the periodic table and attempt to assess whether elements are essential or not, and if they are, whether there is a relevant code for them in the human genome. There are many difficulties such as the human biochemistry of several so-called essential elements is not well understood, and it is not clear how we should classify elements that are involved in the destruction of invading microorganisms, or elements which are essential for microorganisms with which we live in symbiosis. In general, genes do not code for the elements themselves, but for specific chemical species, i.e. for the element, its oxidation state, type and number of coordinated ligands, and the coordination geometry. Today, the biological periodic table is in a position somewhat similar to Mendeleev's chemical periodic table of 1869: there are gaps and we need to do more research to fill them. The periodic table also offers potential for novel therapeutic and diagnostic agents, based on not only essential elements, but also non-essential elements, and on radionuclides. Although the potential for inorganic chemistry in medicine was realized more than 2000 years ago, this area of research is still in its infancy. Future advances in the design of inorganic drugs require more knowledge of their mechanism of action, including target sites and metabolism. Temporal speciation of elements in their biological environments at the atomic level is a major challenge, for which new methods are urgently needed. PMID:25666066

  11. Superheavy Elements Challenge Experimental and Theoretical Chemistry

    CERN Document Server

    Zvára, I

    2003-01-01

    When reflecting on the story of superheavy elements, the an experimenter, acknowledges the role, which the predictions of nuclear and chemical theories have played in ongoing studies. Today, the problems of major interest for experimental chemistry are the studies of elements 112 and 114 including their chemical identification. Advanced quantum chemistry calculations of atoms and molecules would be of much help. First experiments with element 112 evidence that the metal is much more volatile and inert than mercury.

  12. Noncoding Elements: Evolution and Epigenetic Regulation

    KAUST Repository

    Seridi, Loqmane

    2016-03-09

    When the human genome project was completed, it revealed a surprising result. 98% of the genome did not code for protein of which more than 50% are repeats— later known as ”Junk DNA”. However, comparative genomics unveiled that many noncoding elements are evolutionarily constrained; thus luckily to have a role in genome stability and regulation. Though, their exact functions remained largely unknown. Several large international consortia such as the Functional Annotation of Mammalian Genomes (FANTOM) and the Encyclopedia of DNA Elements (ENCODE) were set to understand the structure and the regulation of the genome. Specifically, these endeavors aim to measure and reveal the transcribed components and functional elements of the genome. One of the most the striking findings of these efforts is that most of the genome is transcribed, including non-conserved noncoding elements and repeat elements. Specifically, we investigated the evolution and epigenetic properties of noncoding elements. 1. We compared genomes of evolutionarily distant species and showed the ubiquity of constrained noncoding elements in metazoa. 2. By integrating multi-omic data (such as transcriptome, nucleosome profiling, histone modifications), I conducted a comprehensive analysis of epigenetic properties (chromatin states) of conserved noncoding elements in insects. We showed that those elements have distinct and protective sequence features, undergo dynamic epigenetic regulation, and appear to be associated with the structural components of the chromatin, replication origins, and nuclear matrix. 3. I focused on the relationship between enhancers and repetitive elements. Using Cap Analysis of Gene Expression (CAGE) and RNASeq, I compiled a full catalog of active enhancers (a class of noncoding elements) during myogenesis of human primary cells of healthy donors and donors affected by Duchenne muscular dystrophy (DMD). Comparing the two time-courses, a significant change in the epigenetic

  13. Generalizations of the primitive element theorem

    Directory of Open Access Journals (Sweden)

    Panagiotis Nikolopoulos

    1991-09-01

    Full Text Available In this paper we generalize the primitive element theorem to the generation of separable algebras over fields and rings. We prove that any finitely generated separable algebra over an infinite field is generated by two elements and if the algebra is commutative it can be generated by one element. We then derive similar results for finitely generated separable algebras over semilocal rings.

  14. All-spin nanomagnetic state elements

    Science.gov (United States)

    Manipatruni, Sasikanth; Nikonov, Dmitri E.; Young, Ian A.

    2013-08-01

    We propose an all-spin state element using spin currents and nanomagnets to enable all-spin state machines for digital computing. We demonstrate via numerical simulations the operation of the state element, a critical building block for synchronous, sequential logic computation. The numerical models encompass Landau-Lifshitz-Gilbert nanomagnet dynamics with stochastic models and vector spin-transport in metallic magnetic and non-magnetic channels. Combined with all-spin combinatorial logic, the state elements can enable synchronous and asynchronous computing elements.

  15. Spectral analysis method for detecting an element

    Science.gov (United States)

    Blackwood, Larry G [Idaho Falls, ID; Edwards, Andrew J [Idaho Falls, ID; Jewell, James K [Idaho Falls, ID; Reber, Edward L [Idaho Falls, ID; Seabury, Edward H [Idaho Falls, ID

    2008-02-12

    A method for detecting an element is described and which includes the steps of providing a gamma-ray spectrum which has a region of interest which corresponds with a small amount of an element to be detected; providing nonparametric assumptions about a shape of the gamma-ray spectrum in the region of interest, and which would indicate the presence of the element to be detected; and applying a statistical test to the shape of the gamma-ray spectrum based upon the nonparametric assumptions to detect the small amount of the element to be detected.

  16. Anisotropic damping of Timoshenko beam elements

    DEFF Research Database (Denmark)

    Hansen, M.H.

    2001-01-01

    This report contains a description of a structural damping model for Timoshenko beam elements used in the aeroelastic code HawC developed at Risø for modeling wind turbines. The model has been developed to enable modeling of turbine blades which oftenhave different damping characteristics for...... ¤flapwise¤, ¤edgewise¤ and ¤torsional¤ vibrations. The structural damping forces acting on the beam element are modeled by viscous damping described by an element damping matrix. The composition of this matrix is basedon the element mass and stiffness matrices. It is shown how the coefficients for the mass...

  17. Unified Framework for Finite Element Assembly

    CERN Document Server

    Alnæs, Martin Sandve; Mardal, Kent-Andre; Skavhaug, Ola; Langtangen, Hans Petter; 10.1504/IJCSE.2009.029160

    2012-01-01

    At the heart of any finite element simulation is the assembly of matrices and vectors from discrete variational forms. We propose a general interface between problem-specific and general-purpose components of finite element programs. This interface is called Unified Form-assembly Code (UFC). A wide range of finite element problems is covered, including mixed finite elements and discontinuous Galerkin methods. We discuss how the UFC interface enables implementations of variational form evaluation to be independent of mesh and linear algebra components. UFC does not depend on any external libraries, and is released into the public domain.

  18. Chemical properties of element 106 (seaborgium)

    International Nuclear Information System (INIS)

    The synthesis, via nuclear fusion reactions, of elements heavier than the actinides, allows one to prove the limits of the periodic table as a means of classifying the elements. In particular, deviations in the periodicity of chemical properties for the heaviest elements are predicted as a consequence of increasingly strong relativistic effects on the electronic shell structure. The transactinide elements have now been extended up to element 112, but the chemical properties have been investigated only for the first two of the transactinide elements, 104 and 105. Those studies showed that relativistic effect render these two elements chemically different from their lighter homologues in the same columns of the periodic table. Here we report the chemical separation of element 106 (seaborgium, Sg) and investigations of its chemical behaviour in the gas phase and in aqueous solution. The methods that we use are able to probe the reactivity of individual atoms, and are based on the detection of just seven atoms of seaborgium we find that it exhibits properties characteristic of the group 6 homologues molybdenum and tungsten. Thus seaborgium appears to restore the trends of the periodic table disrupted by relativistic effects in elements 104 and 105. (Author)

  19. The search for the missing elements

    International Nuclear Information System (INIS)

    The theory behind the Periodic Table of elements predicts that some ''super heavy'' elements should exist with atomic number 114. These would have stable spherical nuclear shells completely filled with protons and neutrons. This article describes the search, at various laboratories, to discover and isolate these superheavy elements which occur at the so-called Magic Island of stability. The search has proved harder than predicted. Even though the elements' half-lives are too short for them to exist in nature, more sensitive detectors may be able to reveal their existence in the future. Future work will focus on detecting spontaneous fission fragments more efficiently and accurately measuring their atomic numbers. (UK)

  20. Diagonalizability of elements of a group algebra

    OpenAIRE

    Randriamaro, Hery

    2012-01-01

    Sei G eine Gruppe und K ein Körper der Charakteristik 0 sein. Sei f ein Element der Gruppe Algebra K[G]. Sei X(f) die Matrix der Linksmultiplikationsaktion von f auf K[G]. Wir bestimmen die Eigenwerte und ihre Vielfachheiten von X(f), wenn f ein zentrales Element von G ist, wenn f ein Element der Descent Algebra von K[G] für eine Coxeter Gruppe G ist, und wenn f ist ein besonderes Element von K [G] für symmetrische Gruppe ...

  1. Laser emission spectrography of rare earth elements

    International Nuclear Information System (INIS)

    Emission spectrography of rare earth elements in several matrixes is studied by using a Q-switched ruby laser as an exciting source for macro analysis. The emission intensities of rare earth elements are considerably affected by the matrixes. The emission intensities of rare earth elements are most intense in sodium chloride matrix, but fairly suppressed in sodium sulfate matrix. Scandium, yttrium, europium, and ytterbium, in sodium chloride matrix are detected down to concentrations of ppm order with one laser shot. The emission intensities of rare earth elements in refractory oxides, such as aluminum oxide or rate earth oxides, are about two orders of magnitude less than those in sodium chloride matrix. (auth.)

  2. Multi-element analysis of wines

    OpenAIRE

    Ivanova, Violeta

    2014-01-01

    The knowledge of the element composition in wine is very important from toxicological point of view, since it could contains harmful elements, such as Pb, As and Cd, and from nutritional point of view, since wine contains essential elements for the human organism, such as Ca, Cr, Co, K, Se and Zn [1]. The presence of metals (i.e. Al, Zn, Cu, Fe, Pb) in wine is important for efficient alcoholic fermentation and for its sensorial characteristics (flavor, aroma, freshness). The element compositi...

  3. A first course in finite elements

    CERN Document Server

    Fish, Jacob

    2007-01-01

    Developed from the authors, combined total of 50 years undergraduate and graduate teaching experience, this book presents the finite element method formulated as a general-purpose numerical procedure for solving engineering problems governed by partial differential equations.  Focusing on the formulation and application of the finite element method through the integration of finite element theory, code development, and software application, the book is both introductory and self-contained, as well as being a hands-on experience for any student. This authoritative text on Finite Elements:Adopts

  4. Soreq Nuclear Reactor Fuel Element Flow Distribution

    International Nuclear Information System (INIS)

    Flow of cold water through the Soreq Nuclear Reactor fuel element was simulated numerically. The main objective of the present study was to obtain the flow distribution among the rectangular channels of the element. The results of the simulations were compared to the overall pressure drop on the element measured in Soreq Nuclear Reactor. The numerical model chosen has succeeded in predicting the pressure drop on the fuel element of up to 5% from the measured values. Flow through the IPEN IEA-R1 MTR fuel element was also simulated as a part of a model validation procedure. The numerical results were compared to the measurements available in the literature [1]. It was found that the water pool above the fuel element has a significant influence on the flow distribution among the channels of the element. The flow distribution reported in [1] was closely predicted numerically when the water pool was included into the simulated geometry. It can be concluded that flow distribution in the Soreq Nuclear Reactor fuel element is flatter than that in the IPEN IEA-R1 MTR fuel element

  5. Gamma spectrometry of TRIGA fuel elements

    International Nuclear Information System (INIS)

    The burnupt of 19 TRIGA fuel elements was determined by gamma spectrometry using a special fuel element holder developed and constructed at the Atom Institute, Vienna. The investigated fuel element is kept in a horizontal position about 4 m below the reactor pool water surface. A collimator tube extends to the reactor platform where an intrinsic Ge-detector is located. With this system each fuel element was investigated at eight equidistant points along its active zone and the Cs 137 activity was evaluated. (orig.)

  6. In Silico Expression Analysis.

    Science.gov (United States)

    Bolívar, Julio; Hehl, Reinhard; Bülow, Lorenz

    2016-01-01

    Information on the specificity of cis-sequences enables the design of functional synthetic plant promoters that are responsive to specific stresses. Potential cis-sequences may be experimentally tested, however, correlation of genomic sequence with gene expression data enables an in silico expression analysis approach to bioinformatically assess the stress specificity of candidate cis-sequences prior to experimental verification. The present chapter demonstrates an example for the in silico validation of a potential cis-regulatory sequence responsive to cold stress. The described online tool can be applied for the bioinformatic assessment of cis-sequences responsive to most abiotic and biotic stresses of plants. Furthermore, a method is presented based on a reverted in silico expression analysis approach that predicts highly specific potentially functional cis-regulatory elements for a given stress. PMID:27557772

  7. Molecular dissection of the AGAMOUS control region shows that cis elements for spatial regulation are located intragenically.

    Science.gov (United States)

    Sieburth, L E; Meyerowitz, E M

    1997-03-01

    AGAMOUS (AG) is an Arabidopsis MADS box gene required for the normal development of the internal two whorls of the flower. AG RNA accumulates in distinct patterns early and late in flower development, and several genes have been identified as regulators of AG gene expression based on altered AG RNA accumulation in mutants. To understand AG regulatory circuits, we are now identifying cis regulatory domains by characterizing AG::beta-glucuronidase (GUS) gene fusions. These studies show that a normal AG::GUS staining pattern is conferred by a 9.8-kb region encompassing 6 kb of upstream sequences and 3.8 kb of intragenic sequences. Constructs lacking the 3.8-kb intragenic sequences confer a GUS staining pattern that deviates both spatially and temporally from normal AG expression. The GUS staining patterns in the mutants for the three negative regulators of AG, apetala2, leunig, and curly leaf, showed the predicted change of expression for the construct containing the intragenic sequences, but no significant change was observed for the constructs lacking this intragenic region. These results suggest that intragenic sequences are essential for AG regulation and that these intragenic sequences contain the ultimate target sites for at least some of the known regulatory molecules. PMID:9090880

  8. A novel mammal-specific three partite enhancer element regulates node and notochord-specific Noto expression.

    Directory of Open Access Journals (Sweden)

    Leonie Alten

    Full Text Available The vertebrate organizer and notochord have conserved, essential functions for embryonic development and patterning. The restricted expression of developmental regulators in these tissues is directed by specific cis-regulatory modules (CRMs whose sequence conservation varies considerably. Some CRMs have been conserved throughout vertebrates and likely represent ancestral regulatory networks, while others have diverged beyond recognition but still function over a wide evolutionary range. Here we identify and characterize a mammalian-specific CRM required for node and notochord specific (NNC expression of NOTO, a transcription factor essential for node morphogenesis, nodal cilia movement and establishment of laterality in mouse. A 523 bp enhancer region (NOCE upstream the Noto promoter was necessary and sufficient for NNC expression from the endogenous Noto locus. Three subregions in NOCE together mediated full activity in vivo. Binding sites for known transcription factors in NOCE were functional in vitro but dispensable for NOCE activity in vivo. A FOXA2 site in combination with a novel motif was necessary for NOCE activity in vivo. Strikingly, syntenic regions in non-mammalian vertebrates showed no recognizable sequence similarities. In contrast to its activity in mouse NOCE did not drive NNC expression in transgenic fish. NOCE represents a novel, mammal-specific CRM required for the highly restricted Noto expression in the node and nascent notochord and thus regulates normal node development and function.

  9. 40 CFR 721.10068 - Elemental mercury.

    Science.gov (United States)

    2010-07-01

    ... Substances § 721.10068 Elemental mercury. (a) Definitions. The definitions in § 721.3 apply to this section. In addition, the following definition applies: Motor vehicle has the meaning found at 40 CFR 85.1703... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Elemental mercury. 721.10068...

  10. Elements of Inclusion: Findings from the Field

    Science.gov (United States)

    McMaster, Christopher

    2014-01-01

    The Ministry of Education has set the target of 100% of New Zealand schools to be "mostly" inclusive by 2014. But what are the essential elements of inclusion? This paper explores essential core elements that allow inclusion to flourish. Based on an extensive time in the field as part of a year-long doctoral research project, these…

  11. Search for superheavy-elements in nature

    International Nuclear Information System (INIS)

    The possibility of the existence of superheavy-elements in nature was predicted 35 years ago, but it is not confirmed up to the present. The history of the search for superheavy-elements on nature was described, in addition author's own trial also was commented in short. (author)

  12. Handling and inspection of nuclear fuel elements

    International Nuclear Information System (INIS)

    The invention provides improvements in the handling and inspection of nuclear fuel elements. A mobile bridge is mounted astraddle over a water tank, and from said bridge is suspended and immersed insulating plate capable of vertically receiving a fuel element and of taking a horizontal position for inspecting the latter. This can be applied to nuclear power stations

  13. Heavy element nuclear chemistry research in JAERI

    International Nuclear Information System (INIS)

    Heavy element nuclear chemistry research in JAERI is reviewed. Recent experimental results on decay studies of neutron deficient actinide nuclei using the gas-jet coupled JAERI-ISOL are presented. Successful production of the transactinide nuclei, 261Rf and 262Db, and the present status of studies of chemical properties on the transactinide elements are introduced. (author)

  14. The Superheavy Elements and Anti-Gravity

    International Nuclear Information System (INIS)

    The essence of any propulsion concept is to overcome gravity. Anti-gravity is a natural means to achieve this. Thus, the technology to pursue anti-gravity, by using superheavy elements, may provide a new propulsion paradigm. The theory of superluminal relativity provides a hypothesis for existence of elements with atomic number up to Z = 145, some of which may possess anti-gravity properties. Analysis results show that curved space-time exists demonstrating both gravitic and anti-gravitic properties not only around nuclei but inside the nuclei as well. Two groups of elements (Z < 64 and 63 < Z <145) exist that demonstrate these capabilities. The nuclei of the first group of elements have the masses with only the property of gravity. The nuclei of the elements of the second group have the masses with both properties: gravity and anti-gravity in two different ranges of curved space-time around the nuclei.. The hypothetical element with Z = 145 is the unique among all elements whose nucleus has only anti-gravity property. It is proposed that this element be named Hawking, in honour of Stephen W. Hawking

  15. System for assembling nuclear fuel elements

    International Nuclear Information System (INIS)

    An automatic system is described for assembling nuclear fuel elements, in particular those employing mixed oxide fuels. The system includes a sealing mechanism which allows movement during the assembling of the fuel element along the assembly stations without excessive release of contaminants. (U.K.)

  16. Enhanced patch test of finite element methods

    Institute of Scientific and Technical Information of China (English)

    CHEN; Wanji

    2006-01-01

    Theoretically, the constant stress patch test is not rigorous. Also, either the patch test of non-zero constant shear for Mindlin plate problem or non-zero strain gradient curvature of the microstructures cannot be performed. To improve the theory of the patch test, in this paper, based on the variational principle with relaxed continuity requirement of nonconforming element for homogeneous differential equations, the author proposed the individual element condition for passing the patch test and the convergence condition of the element: besides passing the patch test, the element function should include the rigid body modes and constant strain modes and satisfy the weak continuity condition, and no extra zero energy modes occur. Moreover, the author further established a variational principle with relaxed continuity requirement of nonconforming element for inhomogeneous differential equations, the enhanced patch test condition and the individual element condition. To assure the convergence of the element that should pass the enhanced patch test, the element function should include the rigid body modes and non-zero strain modes which satisfied the equilibrium equations, and no spurious zero energy modes occur and should satisfy new weak continuity condition. The theory of the enhanced patch test proposed in this paper can be applied to both homogeneous and inhomogeneous differential equations. Based on this theory, the patch test of the non-zero constant shear stress for Mindlin plate and the C0-1 patch test of the non-zero constant curvature for the couple stress/strain gradient theory were established.

  17. Finite-Element Composite-Analysis Program

    Science.gov (United States)

    Bowles, David E.

    1990-01-01

    Finite Element Composite Analysis Program, FECAP, special-purpose finite-element program for analyzing behavior of composite material with microcomputer. Procedure leads to set of linear simultaneous equations relating unknown nodal displacement to applied loads. Written in HP BASIC 3.0.

  18. Trace element metabolism in man and animals

    International Nuclear Information System (INIS)

    Uptake, distribution, storage, excretion of different trace elements and resulting disturbances are investigated in blood and organs in animal experiments and in human diagnostics with the aid of radioisotopes. Apart from this, untritional disturbances are mentioned. Finally, future aspects of physiological trace element examinations are listed. (AJ) 891 AJ

  19. 47 CFR 97.505 - Element credit.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 5 2010-10-01 2010-10-01 false Element credit. 97.505 Section 97.505... SERVICE Qualifying Examination Systems § 97.505 Element credit. (a) The administering VEs must give credit.... (b) No examination credit, except as herein provided, shall be allowed on the basis of holding...

  20. Elemental composition of human and animal milk

    International Nuclear Information System (INIS)

    A review is presented of the elemental composition of human and animal milk with special reference to trace elements determined through nuclear techniques, particularly neutron activation analysis (NAA). In the joint IAEA/WHO research project, 16 of the 24 elements under investigation have been analysed by NAA with the aid of advanced research nuclear reactors. Literature data are discussed and tabulated in 50 separate tables (one for each element) mainly for the period after 1950. Each table uses a standard format comprising 10 columns indicating (1) source of milk (e.g. human or animal), (2) status of the milk (colostrum, transitional or mature), (3) country of origin, (4) year of data publication, (5) mean concentration, (6) range of single values or standard deviation of the mean, (7) number of samples analysed, (8) analytical technique employed, (9) literature source of the data, and (10) relevant remarks, if any. The most abundant data refer to the minor elements Ca, Cl, K, Mg, N, Na, P and S and to the trace elements Cu, Fe and Zn. Fewer data are available for Cd, Hg, I, Mn, Pb and Se. For the remaining elements, including such biologically important trace elements as As, Co, Cr, F, Mo, Ni, Si and Sn, very few reliable data so far appear to exist