WorldWideScience

Sample records for cis-regulatory element zrs

  1. Preaxial polydactyly/triphalangeal thumb is associated with changed transcription factor-binding affinity in a family with a novel point mutation in the long-range cis-regulatory element ZRS

    DEFF Research Database (Denmark)

    Farooq, Muhammad; Troelsen, Jesper T; Boyd, Mette

    2010-01-01

    A cis-regulatory sequence also known as zone of polarizing activity (ZPA) regulatory sequence (ZRS) located in intron 5 of LMBR1 is essential for expression of sonic hedgehog (SHH) in the developing posterior limb bud mesenchyme. Even though many point mutations causing preaxial duplication defects...

  2. Changes in Cis-regulatory Elements during Morphological Evolution

    Directory of Open Access Journals (Sweden)

    Yu-Lee Paul

    2012-10-01

    Full Text Available How have animals evolved new body designs (morphological evolution? This requires explanations both for simple morphological changes, such as differences in pigmentation and hair patterns between different Drosophila populations and species, and also for more complex changes, such as differences in the forelimbs of mice and bats, and the necks of amphibians and reptiles. The genetic changes and pathways involved in these evolutionary steps require identification. Many, though not all, of these events occur by changes in cis-regulatory (enhancer elements within developmental genes. Enhancers are modular, each affecting expression in only one or a few tissues. Therefore it is possible to add, remove or alter an enhancer without producing changes in multiple tissues, and thereby avoid widespread (pleiotropic deleterious effects. Ideally, for a given step in morphological evolution it is necessary to identify (i the change in phenotype, (ii the changes in gene expression, (iii the DNA region, enhancer or otherwise, affected, (iv the mutation involved, (v the nature of the transcription or other factors that bind to this site. In practice these data are incomplete for most of the published studies upon morphological evolution. Here, the investigations are categorized according to how far these analyses have proceeded.

  3. Dynamic SPR monitoring of yeast nuclear protein binding to a cis-regulatory element.

    Science.gov (United States)

    Mao, Grace; Brody, James P

    2007-11-09

    Gene expression is controlled by protein complexes binding to short specific sequences of DNA, called cis-regulatory elements. Expression of most eukaryotic genes is controlled by dozens of these elements. Comprehensive identification and monitoring of these elements is a major goal of genomics. In pursuit of this goal, we are developing a surface plasmon resonance (SPR) based assay to identify and monitor cis-regulatory elements. To test whether we could reliably monitor protein binding to a regulatory element, we immobilized a 16bp region of Saccharomyces cerevisiae chromosome 5 onto a gold surface. This 16bp region of DNA is known to bind several proteins and thought to control expression of the gene RNR1, which varies through the cell cycle. We synchronized yeast cell cultures, and then sampled these cultures at a regular interval. These samples were processed to purify nuclear lysate, which was then exposed to the sensor. We found that nuclear protein binds this particular element of DNA at a significantly higher rate (as compared to unsynchronized cells) during G1 phase. Other time points show levels of DNA-nuclear protein binding similar to the unsynchronized control. We also measured the apparent association complex of the binding to be 0.014s(-1). We conclude that (1) SPR-based assays can monitor DNA-nuclear protein binding and that (2) for this particular cis-regulatory element, maximum DNA-nuclear protein binding occurs during G1 phase.

  4. Computational identification of new structured cis-regulatory elements in the 3'-untranslated region of human protein coding genes.

    Science.gov (United States)

    Chen, Xiaowei Sylvia; Brown, Chris M

    2012-10-01

    Messenger ribonucleic acids (RNAs) contain a large number of cis-regulatory RNA elements that function in many types of post-transcriptional regulation. These cis-regulatory elements are often characterized by conserved structures and/or sequences. Although some classes are well known, given the wide range of RNA-interacting proteins in eukaryotes, it is likely that many new classes of cis-regulatory elements are yet to be discovered. An approach to this is to use computational methods that have the advantage of analysing genomic data, particularly comparative data on a large scale. In this study, a set of structural discovery algorithms was applied followed by support vector machine (SVM) classification. We trained a new classification model (CisRNA-SVM) on a set of known structured cis-regulatory elements from 3'-untranslated regions (UTRs) and successfully distinguished these and groups of cis-regulatory elements not been strained on from control genomic and shuffled sequences. The new method outperformed previous methods in classification of cis-regulatory RNA elements. This model was then used to predict new elements from cross-species conserved regions of human 3'-UTRs. Clustering of these elements identified new classes of potential cis-regulatory elements. The model, training and testing sets and novel human predictions are available at: http://mRNA.otago.ac.nz/CisRNA-SVM.

  5. The identification of cis-regulatory elements: A review from a machine learning perspective.

    Science.gov (United States)

    Li, Yifeng; Chen, Chih-Yu; Kaye, Alice M; Wasserman, Wyeth W

    2015-12-01

    The majority of the human genome consists of non-coding regions that have been called junk DNA. However, recent studies have unveiled that these regions contain cis-regulatory elements, such as promoters, enhancers, silencers, insulators, etc. These regulatory elements can play crucial roles in controlling gene expressions in specific cell types, conditions, and developmental stages. Disruption to these regions could contribute to phenotype changes. Precisely identifying regulatory elements is key to deciphering the mechanisms underlying transcriptional regulation. Cis-regulatory events are complex processes that involve chromatin accessibility, transcription factor binding, DNA methylation, histone modifications, and the interactions between them. The development of next-generation sequencing techniques has allowed us to capture these genomic features in depth. Applied analysis of genome sequences for clinical genetics has increased the urgency for detecting these regions. However, the complexity of cis-regulatory events and the deluge of sequencing data require accurate and efficient computational approaches, in particular, machine learning techniques. In this review, we describe machine learning approaches for predicting transcription factor binding sites, enhancers, and promoters, primarily driven by next-generation sequencing data. Data sources are provided in order to facilitate testing of novel methods. The purpose of this review is to attract computational experts and data scientists to advance this field.

  6. Bounded search for de novo identification of degenerate cis-regulatory elements

    Directory of Open Access Journals (Sweden)

    Khetani Radhika S

    2006-05-01

    Full Text Available Abstract Background The identification of statistically overrepresented sequences in the upstream regions of coregulated genes should theoretically permit the identification of potential cis-regulatory elements. However, in practice many cis-regulatory elements are highly degenerate, precluding the use of an exhaustive word-counting strategy for their identification. While numerous methods exist for inferring base distributions using a position weight matrix, recent studies suggest that the independence assumptions inherent in the model, as well as the inability to reach a global optimum, limit this approach. Results In this paper, we report PRISM, a degenerate motif finder that leverages the relationship between the statistical significance of a set of binding sites and that of the individual binding sites. PRISM first identifies overrepresented, non-degenerate consensus motifs, then iteratively relaxes each one into a high-scoring degenerate motif. This approach requires no tunable parameters, thereby lending itself to unbiased performance comparisons. We therefore compare PRISM's performance against nine popular motif finders on 28 well-characterized S. cerevisiae regulons. PRISM consistently outperforms all other programs. Finally, we use PRISM to predict the binding sites of uncharacterized regulons. Our results support a proposed mechanism of action for the yeast cell-cycle transcription factor Stb1, whose binding site has not been determined experimentally. Conclusion The relationship between statistical measures of the binding sites and the set as a whole leads to a simple means of identifying the diverse range of cis-regulatory elements to which a protein binds. This approach leverages the advantages of word-counting, in that position dependencies are implicitly accounted for and local optima are more easily avoided. While we sacrifice guaranteed optimality to prevent the exponential blowup of exhaustive search, we prove that the error

  7. Dissection of cis-regulatory elements in the C. elegans Hox gene egl-5 promoter.

    Science.gov (United States)

    Teng, Yingqi; Girard, Lisa; Ferreira, Henrique B; Sternberg, Paul W; Emmons, Scott W

    2004-12-15

    Hox genes are highly conserved segmental identity genes well known for their complex expression patterns and divergent targets. Here we present an analysis of cis-regulatory elements in the Caenorhabditis elegans Hox gene egl-5, which is expressed in multiple tissues in the posterior region of the nematode. We have utilized phylogenetic footprinting to efficiently identify cis-regulatory elements and have characterized these with gfp reporters and tissue-specific rescue experiments. We have found that the complex expression pattern of egl-5 is the cumulative result of the activities of multiple tissue or local region-specific activator sequences that are conserved both in sequence and near-perfect order in the related nematode Caenorhabditis briggsae. Two conserved regulatory blocks analyzed in detail contain multiple sites for both positively and negatively acting factors. One of these regions may promote activation of egl-5 in certain cells via the Wnt pathway. Positively acting regions are repressed in inappropriate tissues by additional negative pathways acting at other sites within the promoter. Our analysis has allowed us to implicate several new regulatory factors significant to the control of egl-5 expression.

  8. Engineering Synthetic cis-Regulatory Elements for Simultaneous Recognition of Three Transcriptional Factors in Bacteria.

    Science.gov (United States)

    Amores, Gerardo Ruiz; Guazzaroni, María-Eugenia; Silva-Rocha, Rafael

    2015-12-18

    Recognition of cis-regulatory elements by transcription factors (TF) at target promoters is crucial to gene regulation in bacteria. In this process, binding of TFs to their cognate sequences depends on a set of physical interactions between these proteins and specific nucleotides in the operator region. Previously, we showed that in silico optimization algorithms are able to generate short sequences that are recognized by two different TFs of Escherichia coli, namely, CRP and IHF, thus generating an AND logic gate. Here, we expanded this approach in order to engineer DNA sequences that can be simultaneously recognized by three unrelated TFs (CRP, IHF, and Fis). Using in silico optimization and experimental validation strategies, we were able to obtain a candidate promoter (Plac-CFI1) regulated by only two TFs with an AND logic, thus demonstrating a limitation in the design. Subsequently, we modified the algorithm to allow the optimization of extended sequences, and were able to design two synthetic promoters (PCFI20-1 and PCFI22-5) that were functional in vivo. Expression assays in E. coli mutant strains for each TF revealed that while CRP positively regulates the promoter activities, IHF and Fis are strong repressors of both the promoter variants. Taken together, our results demonstrate the potential of in silico strategies in bacterial synthetic promoter engineering. Furthermore, the study also shows how small modifications in cis-regulatory elements can drastically affect the final logic of the resulting promoter.

  9. Identification of putative cis-regulatory elements in Cryptosporidium parvum by de novo pattern finding

    Directory of Open Access Journals (Sweden)

    Kissinger Jessica C

    2007-01-01

    Full Text Available Abstract Background Cryptosporidium parvum is a unicellular eukaryote in the phylum Apicomplexa. It is an obligate intracellular parasite that causes diarrhea and is a significant AIDS-related pathogen. Cryptosporidium parvum is not amenable to long-term laboratory cultivation or classical molecular genetic analysis. The parasite exhibits a complex life cycle, a broad host range, and fundamental mechanisms of gene regulation remain unknown. We have used data from the recently sequenced genome of this organism to uncover clues about gene regulation in C. parvum. We have applied two pattern finding algorithms MEME and AlignACE to identify conserved, over-represented motifs in the 5' upstream regions of genes in C. parvum. To support our findings, we have established comparative real-time -PCR expression profiles for the groups of genes examined computationally. Results We find that groups of genes that share a function or belong to a common pathway share upstream motifs. Different motifs are conserved upstream of different groups of genes. Comparative real-time PCR studies show co-expression of genes within each group (in sub-sets during the life cycle of the parasite, suggesting co-regulation of these genes may be driven by the use of conserved upstream motifs. Conclusion This is one of the first attempts to characterize cis-regulatory elements in the absence of any previously characterized elements and with very limited expression data (seven genes only. Using de novo pattern finding algorithms, we have identified specific DNA motifs that are conserved upstream of genes belonging to the same metabolic pathway or gene family. We have demonstrated the co-expression of these genes (often in subsets using comparative real-time-PCR experiments thus establishing evidence for these conserved motifs as putative cis-regulatory elements. Given the lack of prior information concerning expression patterns and organization of promoters in C. parvum we

  10. Lessons from Domestication: Targeting Cis-Regulatory Elements for Crop Improvement.

    Science.gov (United States)

    Swinnen, Gwen; Goossens, Alain; Pauwels, Laurens

    2016-06-01

    Domestication of wild plant species has provided us with crops that serve our human nutritional needs. Advanced DNA sequencing has propelled the unveiling of underlying genetic changes associated with domestication. Interestingly, many changes reside in cis-regulatory elements (CREs) that control the expression of an unmodified coding sequence. Sequence variation in CREs can impact gene expression levels, but also developmental timing and tissue specificity of expression. When genes are involved in multiple pathways or active in several organs and developmental stages CRE modifications are favored in contrast to mutations in coding regions, due to the lack of detrimental pleiotropic effects. Therefore, learning from domestication, we propose that CREs are interesting targets for genome editing to create new alleles for plant breeding.

  11. Computational discovery of soybean promoter cis-regulatory elements for the construction of soybean cyst nematode inducible synthetic promoters

    Science.gov (United States)

    Computational methods offer great hope but limited accuracy in the prediction of functional cis-regulatory elements; improvements are needed to enable synthetic promoter design. We applied an ensemble strategy for de novo soybean cyst nematode (SCN)-inducible motif discovery among promoters of 18 co...

  12. cis-regulatory elements involved in ultraviolet light regulation and plant defense.

    Science.gov (United States)

    Wingender, R; Röhrig, H; Höricke, C; Schell, J

    1990-10-01

    An elicitor-regulated transient expression system was established in soybean protoplasts that allowed the identification of cis-regulatory elements involved in plant defense. The 5' region of an ultraviolet (UV) light-inducible and elicitor-inducible chs gene (chs1) of soybean was subjected to deletion analysis with the help of chimeric chs-nptII/gus gene constructs. This analysis delimited the sequences necessary for elicitor inducibility to -175 and -134 of the chs1 promoter. The same soybean sequences were able to direct elicitor inducibility in parsley protoplasts, suggesting a conserved function of cis-acting elements involved in plant defense. In addition, this region of the soybean promoter also promotes UV light inducibility in parsley protoplasts. However, in contrast to the elicitor induction, correct regulation was not observed after UV light induction when sequences downstream of -75 were replaced by a heterologous minimal promoter. This result indicates that at least two cis-acting elements are involved in UV light induction.

  13. Identification of distal cis-regulatory elements at mouse mitoferrin loci using zebrafish transgenesis.

    Science.gov (United States)

    Amigo, Julio D; Yu, Ming; Troadec, Marie-Berengere; Gwynn, Babette; Cooney, Jeffrey D; Lambert, Amy J; Chi, Neil C; Weiss, Mitchell J; Peters, Luanne L; Kaplan, Jerry; Cantor, Alan B; Paw, Barry H

    2011-04-01

    Mitoferrin 1 (Mfrn1; Slc25a37) and mitoferrin 2 (Mfrn2; Slc25a28) function as essential mitochondrial iron importers for heme and Fe/S cluster biogenesis. A genetic deficiency of Mfrn1 results in a profound hypochromic anemia in vertebrate species. To map the cis-regulatory modules (CRMs) that control expression of the Mfrn genes, we utilized genome-wide chromatin immunoprecipitation (ChIP) datasets for the major erythroid transcription factor GATA-1. We identified the CRMs that faithfully drive the expression of Mfrn1 during blood and heart development and Mfrn2 ubiquitously. Through in vivo analyses of the Mfrn-CRMs in zebrafish and mouse, we demonstrate their functional and evolutionary conservation. Using knockdowns with morpholinos and cell sorting analysis in transgenic zebrafish embryos, we show that GATA-1 directly regulates the expression of Mfrn1. Mutagenesis of individual GATA-1 binding cis elements (GBE) demonstrated that at least two of the three GBE within this CRM are functionally required for GATA-mediated transcription of Mfrn1. Furthermore, ChIP assays demonstrate switching from GATA-2 to GATA-1 at these elements during erythroid maturation. Our results provide new insights into the genetic regulation of mitochondrial function and iron homeostasis and, more generally, illustrate the utility of genome-wide ChIP analysis combined with zebrafish transgenesis for identifying long-range transcriptional enhancers that regulate tissue development.

  14. Characterization of Putative cis-Regulatory Elements in Genes Preferentially Expressed in Arabidopsis Male Meiocytes

    Directory of Open Access Journals (Sweden)

    Junhua Li

    2014-01-01

    Full Text Available Meiosis is essential for plant reproduction because it is the process during which homologous chromosome pairing, synapsis, and meiotic recombination occur. The meiotic transcriptome is difficult to investigate because of the size of meiocytes and the confines of anther lobes. The recent development of isolation techniques has enabled the characterization of transcriptional profiles in male meiocytes of Arabidopsis. Gene expression in male meiocytes shows unique features. The direct interaction of transcription factors (TFs with DNA regulatory sequences forms the basis for the specificity of transcriptional regulation. Here, we identified putative cis-regulatory elements (CREs associated with male meiocyte-expressed genes using in silico tools. The upstream regions (1 kb of the top 50 genes preferentially expressed in Arabidopsis meiocytes possessed conserved motifs. These motifs are putative binding sites of TFs, some of which share common functions, such as roles in cell division. In combination with cell-type-specific analysis, our findings could be a substantial aid for the identification and experimental verification of the protein-DNA interactions for the specific TFs that drive gene expression in meiocytes.

  15. Recurrent modification of a conserved cis-regulatory element underlies fruit fly pigmentation diversity.

    Directory of Open Access Journals (Sweden)

    William A Rogers

    2013-08-01

    Full Text Available The development of morphological traits occurs through the collective action of networks of genes connected at the level of gene expression. As any node in a network may be a target of evolutionary change, the recurrent targeting of the same node would indicate that the path of evolution is biased for the relevant trait and network. Although examples of parallel evolution have implicated recurrent modification of the same gene and cis-regulatory element (CRE, little is known about the mutational and molecular paths of parallel CRE evolution. In Drosophila melanogaster fruit flies, the Bric-à-brac (Bab transcription factors control the development of a suite of sexually dimorphic traits on the posterior abdomen. Female-specific Bab expression is regulated by the dimorphic element, a CRE that possesses direct inputs from body plan (ABD-B and sex-determination (DSX transcription factors. Here, we find that the recurrent evolutionary modification of this CRE underlies both intraspecific and interspecific variation in female pigmentation in the melanogaster species group. By reconstructing the sequence and regulatory activity of the ancestral Drosophila melanogaster dimorphic element, we demonstrate that a handful of mutations were sufficient to create independent CRE alleles with differing activities. Moreover, intraspecific and interspecific dimorphic element evolution proceeded with little to no alterations to the known body plan and sex-determination regulatory linkages. Collectively, our findings represent an example where the paths of evolution appear biased to a specific CRE, and drastic changes in function were accompanied by deep conservation of key regulatory linkages.

  16. Putative cis-regulatory elements associated with heat shock genes activated during excystation of Cryptosporidium parvum.

    Directory of Open Access Journals (Sweden)

    Benjamin Cohn

    Full Text Available BACKGROUND: Cryptosporidiosis is a ubiquitous infectious disease, caused by the protozoan parasites Cryptosporidium hominis and C. parvum, leading to acute, persistent and chronic diarrhea worldwide. Although the complications of this disease can be serious, even fatal, in immunocompromised patients of any age, they have also been found to lead to long term effects, including growth inhibition and impaired cognitive development, in infected immunocompetent children. The Cryptosporidium life cycle alternates between a dormant stage, the oocyst, and a highly replicative phase that includes both asexual vegetative stages as well as sexual stages, implying fine genetic regulatory mechanisms. The parasite is extremely difficult to study because it cannot be cultured in vitro and animal models are equally challenging. The recent publication of the genome sequence of C. hominis and C. parvum has, however, significantly advanced our understanding of the biology and pathogenesis of this parasite. METHODOLOGY/PRINCIPAL FINDINGS: Herein, our goal was to identify cis-regulatory elements associated with heat shock response in Cryptosporidium using a combination of in silico and real time RT-PCR strategies. Analysis with Gibbs-Sampling algorithms of upstream non-translated regions of twelve genes annotated as heat shock proteins in the Cryptosporidium genome identified a highly conserved over-represented sequence motif in eleven of them. RT-PCR analyses, described herein and also by others, show that these eleven genes bearing the putative element are induced concurrent with excystation of parasite oocysts via heat shock. CONCLUSIONS/SIGNIFICANCE: Our analyses suggest that occurrences of a motif identified in the upstream regions of the Cryptosporidium heat shock genes represent parts of the transcriptional apparatus and function as stress response elements that activate expression of these genes during excystation, and possibly at other stages in the life

  17. Deciphering Cis-Regulatory Element Mediated Combinatorial Regulation in Rice under Blast Infected Condition.

    Science.gov (United States)

    Deb, Arindam; Kundu, Sudip

    2015-01-01

    Combinations of cis-regulatory elements (CREs) present at the promoters facilitate the binding of several transcription factors (TFs), thereby altering the consequent gene expressions. Due to the eminent complexity of the regulatory mechanism, the combinatorics of CRE-mediated transcriptional regulation has been elusive. In this work, we have developed a new methodology that quantifies the co-occurrence tendencies of CREs present in a set of promoter sequences; these co-occurrence scores are filtered in three consecutive steps to test their statistical significance; and the significantly co-occurring CRE pairs are presented as networks. These networks of co-occurring CREs are further transformed to derive higher order of regulatory combinatorics. We have further applied this methodology on the differentially up-regulated gene-sets of rice tissues under fungal (Magnaporthe) infected conditions to demonstrate how it helps to understand the CRE-mediated combinatorial gene regulation. Our analysis includes a wide spectrum of biologically important results. The CRE pairs having a strong tendency to co-occur often exhibit very similar joint distribution patterns at the promoters of rice. We couple the network approach with experimental results of plant gene regulation and defense mechanisms and find evidences of auto and cross regulation among TF families, cross-talk among multiple hormone signaling pathways, similarities and dissimilarities in regulatory combinatorics between different tissues, etc. Our analyses have pointed a highly distributed nature of the combinatorial gene regulation facilitating an efficient alteration in response to fungal attack. All together, our proposed methodology could be an important approach in understanding the combinatorial gene regulation. It can be further applied to unravel the tissue and/or condition specific combinatorial gene regulation in other eukaryotic systems with the availability of annotated genomic sequences and suitable

  18. Changes in cis-regulatory elements of a key floral regulator are associated with divergence of inflorescence architectures.

    Science.gov (United States)

    Kusters, Elske; Della Pina, Serena; Castel, Rob; Souer, Erik; Koes, Ronald

    2015-08-15

    Higher plant species diverged extensively with regard to the moment (flowering time) and position (inflorescence architecture) at which flowers are formed. This seems largely caused by variation in the expression patterns of conserved genes that specify floral meristem identity (FMI), rather than changes in the encoded proteins. Here, we report a functional comparison of the promoters of homologous FMI genes from Arabidopsis, petunia, tomato and Antirrhinum. Analysis of promoter-reporter constructs in petunia and Arabidopsis, as well as complementation experiments, showed that the divergent expression of leafy (LFY) and the petunia homolog aberrant leaf and flower (ALF) results from alterations in the upstream regulatory network rather than cis-regulatory changes. The divergent expression of unusual floral organs (UFO) from Arabidopsis, and the petunia homolog double top (DOT), however, is caused by the loss or gain of cis-regulatory promoter elements, which respond to trans-acting factors that are expressed in similar patterns in both species. Introduction of pUFO:UFO causes no obvious defects in Arabidopsis, but in petunia it causes the precocious and ectopic formation of flowers. This provides an example of how a change in a cis-regulatory region can account for a change in the plant body plan.

  19. Identification of a cis-regulatory element by transient analysis of co-ordinately regulated genes

    Directory of Open Access Journals (Sweden)

    Allan Andrew C

    2008-07-01

    Full Text Available Abstract Background Transcription factors (TFs co-ordinately regulate target genes that are dispersed throughout the genome. This co-ordinate regulation is achieved, in part, through the interaction of transcription factors with conserved cis-regulatory motifs that are in close proximity to the target genes. While much is known about the families of transcription factors that regulate gene expression in plants, there are few well characterised cis-regulatory motifs. In Arabidopsis, over-expression of the MYB transcription factor PAP1 (PRODUCTION OF ANTHOCYANIN PIGMENT 1 leads to transgenic plants with elevated anthocyanin levels due to the co-ordinated up-regulation of genes in the anthocyanin biosynthetic pathway. In addition to the anthocyanin biosynthetic genes, there are a number of un-associated genes that also change in expression level. This may be a direct or indirect consequence of the over-expression of PAP1. Results Oligo array analysis of PAP1 over-expression Arabidopsis plants identified genes co-ordinately up-regulated in response to the elevated expression of this transcription factor. Transient assays on the promoter regions of 33 of these up-regulated genes identified eight promoter fragments that were transactivated by PAP1. Bioinformatic analysis on these promoters revealed a common cis-regulatory motif that we showed is required for PAP1 dependent transactivation. Conclusion Co-ordinated gene regulation by individual transcription factors is a complex collection of both direct and indirect effects. Transient transactivation assays provide a rapid method to identify direct target genes from indirect target genes. Bioinformatic analysis of the promoters of these direct target genes is able to locate motifs that are common to this sub-set of promoters, which is impossible to identify with the larger set of direct and indirect target genes. While this type of analysis does not prove a direct interaction between protein and DNA

  20. Identification of Distal cis-Regulatory Elements at Mouse Mitoferrin Loci Using Zebrafish Transgenesis▿

    OpenAIRE

    Amigo, J. D.; Yu, M.; Troadec, M.-B.; Gwynn, B; Cooney, J. D.; Lambert, A.J.; Chi, N. C.; Weiss, M J; Peters, L. L.; Kaplan, J; Cantor, Alan B.; Paw, Barry Htin

    2011-01-01

    Mitoferrin 1 (Mfrn1; Slc25a37) and mitoferrin 2 (Mfrn2; Slc25a28) function as essential mitochondrial iron importers for heme and Fe/S cluster biogenesis. A genetic deficiency of Mfrn1 results in a profound hypochromic anemia in vertebrate species. To map the cis-regulatory modules (CRMs) that control expression of the Mfrn genes, we utilized genome-wide chromatin immunoprecipitation (ChIP) datasets for the major erythroid transcription factor GATA-1. We identified the CRMs that faithfully dr...

  1. Prioritizing predicted cis-regulatory elements for co-expressed gene sets based on Lasso regression models.

    Science.gov (United States)

    Hu, Hong; Roqueiro, Damian; Dai, Yang

    2011-01-01

    Computational prediction of cis-regulatory elements for a set of co-expressed genes based on sequence analysis provides an overwhelming volume of potential transcription factor binding sites. It presents a challenge to prioritize transcription factors for regulatory functional studies. A novel approach based on the use of Lasso regression models is proposed to address this problem. We examine the ability of the Lasso model using time-course microarray data obtained from a comprehensive study of gene expression profiles in skin and mucosal wounds in mouse over all stages of wound healing.

  2. Characterization of a putative cis-regulatory element that controls transcriptional activity of the pig uroplakin II gene promoter.

    Science.gov (United States)

    Kwon, Deug-Nam; Park, Mi-Ryung; Park, Jong-Yi; Cho, Ssang-Goo; Park, Chankyu; Oh, Jae-Wook; Song, Hyuk; Kim, Jae-Hwan; Kim, Jin-Hoi

    2011-07-01

    Uroplakin II (UPII) is a one of the integral membrane proteins synthesized as a major differentiation product of mammalian urothelium. UPII gene expression is bladder specific and differentiation dependent, but little is known about its transcription response elements and molecular mechanism. To identify the cis-regulatory elements in the pig UPII (pUPII) gene promoter region, we constructed pUPII 5' upstream region deletion mutants and demonstrated that each of the deletion mutants participates in controlling the expression of the pUPII gene in human bladder carcinoma RT4 cells. We also identified a new core promoter region and putative negative cis-regulatory element within a minimal promoter region. In addition, we showed that hepatocyte nuclear factor 4 (HNF4) can directly bind in the pUPII core promoter (5F-1) region, which plays a critical role in controlling promoter activity. Transient cotransfection experiments showed that HNF4 positively regulates pUPII gene promoter activity. Thus, the binding element and its binding protein, HNF4 transcription factor, may be involved in the mechanism that specifically regulates pUPII gene transcription.

  3. Creation of cis-regulatory elements during sea urchin evolution by co-option and optimization of a repetitive sequence adjacent to the spec2a gene.

    Science.gov (United States)

    Dayal, Sandeep; Kiyama, Takae; Villinski, Jeffrey T; Zhang, Ning; Liang, Shuguang; Klein, William H

    2004-09-15

    The creation, preservation, and degeneration of cis-regulatory elements controlling developmental gene expression are fundamental genome-level evolutionary processes about which little is known. Here, we identify critical differences in cis-regulatory elements controlling the expression of the sea urchin aboral ectoderm-specific spec genes. We found multiple copies of a repetitive sequence element termed RSR in genomes of species within the Strongylocentrotidae family, but RSRs were not detected in genomes of species outside Strongylocentrotidae. spec genes in Strongylocentrotus purpuratus are invariably associated with RSRs, and the spec2a RSR functioned as a transcriptional enhancer and displayed greater activity than did spec1 or spec2c RSRs. Single-base pair differences at two cis-regulatory elements within the spec2a RSR increased the binding affinities of four transcription factors, SpCCAAT-binding factor at one element and SpOtx, SpGoosecoid, and SpGATA-E at another. The cis-regulatory elements to which these four factors bound were recent evolutionary acquisitions that acted to either activate or repress transcription, depending on the cell type. These elements were found in the spec2a RSR ortholog in Strongylocentrotus pallidus but not in RSR orthologs of Strongylocentrotus droebachiensis or Hemicentrotus pulcherrimus. Our results indicated that a dynamic pattern of cis-regulatory element evolution exists for spec genes despite their conserved aboral ectoderm expression.

  4. Distinct functional constraints partition sequence conservation in a cis-regulatory element.

    Directory of Open Access Journals (Sweden)

    Antoine Barrière

    2011-06-01

    Full Text Available Different functional constraints contribute to different evolutionary rates across genomes. To understand why some sequences evolve faster than others in a single cis-regulatory locus, we investigated function and evolutionary dynamics of the promoter of the Caenorhabditis elegans unc-47 gene. We found that this promoter consists of two distinct domains. The proximal promoter is conserved and is largely sufficient to direct appropriate spatial expression. The distal promoter displays little if any conservation between several closely related nematodes. Despite this divergence, sequences from all species confer robustness of expression, arguing that this function does not require substantial sequence conservation. We showed that even unrelated sequences have the ability to promote robust expression. A prominent feature shared by all of these robustness-promoting sequences is an AT-enriched nucleotide composition consistent with nucleosome depletion. Because general sequence composition can be maintained despite sequence turnover, our results explain how different functional constraints can lead to vastly disparate rates of sequence divergence within a promoter.

  5. Shared Enhancer Activity in the Limbs and Phallus and Functional Divergence of a Limb-Genital cis-Regulatory Element in Snakes.

    Science.gov (United States)

    Infante, Carlos R; Mihala, Alexandra G; Park, Sungdae; Wang, Jialiang S; Johnson, Kenji K; Lauderdale, James D; Menke, Douglas B

    2015-10-12

    The amniote phallus and limbs differ dramatically in their morphologies but share patterns of signaling and gene expression in early development. Thus far, the extent to which genital and limb transcriptional networks also share cis-regulatory elements has remained unexplored. We show that many limb enhancers are retained in snake genomes, suggesting that these elements may function in non-limb tissues. Consistent with this, our analysis of cis-regulatory activity in mice and Anolis lizards reveals that patterns of enhancer activity in embryonic limbs and genitalia overlap heavily. In mice, deletion of HLEB, an enhancer of Tbx4, produces defects in hindlimbs and genitalia, establishing the importance of this limb-genital enhancer for development of these different appendages. Further analyses demonstrate that the HLEB of snakes has lost hindlimb enhancer function while retaining genital activity. Our findings identify roles for Tbx4 in genital development and highlight deep similarities in cis-regulatory activity between limbs and genitalia.

  6. A comparative analysis of the evolution, expression, and cis-regulatory element of polygalacturonase genes in grasses and dicots.

    Science.gov (United States)

    Liang, Ying; Yu, Youjian; Cui, Jinlong; Lyu, Meiling; Xu, Liai; Cao, Jiashu

    2016-11-01

    Cell walls are a distinguishing characteristic of plants essential to their survival. The pectin content of primary cell walls in grasses and dicots is distinctly different. Polygalacturonases (PGs) can degrade pectins and participate in multiple developmental processes of plants. This study comprehensively compared the evolution, expression, and cis-regulatory element of PGs in grasses and dicots. A total of 577 PGs identified from five grasses and five dicots fell into seven clades. Evolutionary analysis demonstrated the distinct differences between grasses and dicots in patterns of gene duplication and loss, and evolutionary rates. Grasses generally contained much fewer clade C and F members than dicots. We found that this disparity was the result of less duplication and more gene losses in grasses. More duplications occurred in clades D and E, and expression analysis showed that most of clade E members were expressed ubiquitously at a high overall level and clade D members were closely related to male reproduction in both grasses and dicots, suggesting their biological functions were highly conserved across species. In addition to the general role in reproductive development, PGs of clades C and F specifically played roles in root development in dicots, shedding light on organ differentiation between the two groups of plants. A regulatory element analysis of clade C and F members implied that possible functions of PGs in specific biological responses contributed to their expansion and preservation. This work can improve the knowledge of PGs in plants generally and in grasses specifically and is beneficial to functional studies.

  7. Characterization of "cis"-regulatory elements ("c"RE) associated with mammary gland function

    Science.gov (United States)

    The Bos taurus genome assembly has propelled dairy science into a new era; still, most of the information encoded in the genome has not yet been decoded. The human Encyclopedia of DNA Elements (ENCODE) project has spearheaded the identification and annotation of functional genomic elements in the hu...

  8. Evaluation of combinatorial cis-regulatory elements for stable gene expression in chicken cells

    Directory of Open Access Journals (Sweden)

    Seo Hee W

    2010-09-01

    Full Text Available Abstract Background Recent successes in biotechnological application of birds are based on their unique physiological traits such as unlimited manipulability onto developing embryos and simple protein constituents of the eggs. However it is not likely that target protein is produced as kinetically expected because various factors affect target gene expression. Although there have been various attempts to minimize the silencing of transgenes, a generalized study that uses multiple cis-acting elements in chicken has not been made. The aim of the present study was to analyze whether various cis-acting elements can help to sustain transgene expression in chicken fibroblasts. Results We investigated the optimal transcriptional regulatory elements for enhancing stable transgene expression in chicken cells. We generated eight constructs that encode enhanced green fluorescent protein (eGFP driven by either CMV or CAG promoters (including the control, containing three types of key regulatory elements: a chicken lysozyme matrix attachment region (cMAR, 5'-DNase I-hypersensitive sites 4 (cHS4, and the woodchuck hepatitis virus posttranscriptional regulatory element (WPRE. Then we transformed immortalized chicken embryonic fibroblasts with these constructs by electroporation, and after cells were expanded under G418 selection, analyzed mRNA levels and mean fluorescence intensity (MFI by quantitative real-time PCR and flow cytometry, respectively. We found that the copy number of each construct significantly decreased as the size of the construct increased (R2 = 0.701. A significant model effect was found in the expression level among various constructs in both mRNA and protein (P cis-acting elements decreased the level of gene silencing as well as the coefficient of variance of eGFP-expressing cells (P Conclusions Our current data show that an optimal combination of cis-acting elements and promoters/enhancers for sustaining gene expression in chicken cells

  9. An arthropod cis-regulatory element functioning in sensory organ precursor development dates back to the Cambrian

    Directory of Open Access Journals (Sweden)

    Simpson Pat

    2010-09-01

    Full Text Available Abstract Background An increasing number of publications demonstrate conservation of function of cis-regulatory elements without sequence similarity. In invertebrates such functional conservation has only been shown for closely related species. Here we demonstrate the existence of an ancient arthropod regulatory element that functions during the selection of neural precursors. The activity of genes of the achaete-scute (ac-sc family endows cells with neural potential. An essential, conserved characteristic of proneural genes is their ability to restrict their own activity to single or a small number of progenitor cells from their initially broad domains of expression. This is achieved through a process called lateral inhibition. A regulatory element, the sensory organ precursor enhancer (SOPE, is required for this process. First identified in Drosophila, the SOPE contains discrete binding sites for four regulatory factors. The SOPE of the Drosophila asense gene is situated in the 5' UTR. Results Through a manual comparison of consensus binding site sequences we have been able to identify a SOPE in UTR sequences of asense-like genes in species belonging to all four arthropod groups (Crustacea, Myriapoda, Chelicerata and Insecta. The SOPEs of the spider Cupiennius salei and the insect Tribolium castaneum are shown to be functional in transgenic Drosophila. This would place the origin of this regulatory sequence as far back as the last common ancestor of the Arthropoda, that is, in the Cambrian, 550 million years ago. Conclusions The SOPE is not detectable by inter-specific sequence comparison, raising the possibility that other ancient regulatory modules in invertebrates might have escaped detection.

  10. Evaluation of phylogenetic footprint discovery for predicting bacterial cis-regulatory elements and revealing their evolution

    Directory of Open Access Journals (Sweden)

    van Helden Jacques

    2008-01-01

    Full Text Available Abstract Background The detection of conserved motifs in promoters of orthologous genes (phylogenetic footprints has become a common strategy to predict cis-acting regulatory elements. Several software tools are routinely used to raise hypotheses about regulation. However, these tools are generally used as black boxes, with default parameters. A systematic evaluation of optimal parameters for a footprint discovery strategy can bring a sizeable improvement to the predictions. Results We evaluate the performances of a footprint discovery approach based on the detection of over-represented spaced motifs. This method is particularly suitable for (but not restricted to Bacteria, since such motifs are typically bound by factors containing a Helix-Turn-Helix domain. We evaluated footprint discovery in 368 Escherichia coli K12 genes with annotated sites, under 40 different combinations of parameters (taxonomical level, background model, organism-specific filtering, operon inference. Motifs are assessed both at the levels of correctness and significance. We further report a detailed analysis of 181 bacterial orthologs of the LexA repressor. Distinct motifs are detected at various taxonomical levels, including the 7 previously characterized taxon-specific motifs. In addition, we highlight a significantly stronger conservation of half-motifs in Actinobacteria, relative to Firmicutes, suggesting an intermediate state in specificity switching between the two Gram-positive phyla, and thereby revealing the on-going evolution of LexA auto-regulation. Conclusion The footprint discovery method proposed here shows excellent results with E. coli and can readily be extended to predict cis-acting regulatory signals and propose testable hypotheses in bacterial genomes for which nothing is known about regulation.

  11. Nutritional control of gene expression in Drosophila larvae via TOR, Myc and a novel cis-regulatory element

    Directory of Open Access Journals (Sweden)

    Grewal Savraj S

    2010-01-01

    Full Text Available Abstract Background Nutrient availability is a key determinant of eukaryotic cell growth. In unicellular organisms many signaling and transcriptional networks link nutrient availability to the expression of metabolic genes required for growth. However, less is known about the corresponding mechanisms that operate in metazoans. We used gene expression profiling to explore this issue in developing Drosophila larvae. Results We found that starvation for dietary amino acids (AA's leads to dynamic changes in transcript levels of many metabolic genes. The conserved insulin/PI3K and TOR signaling pathways mediate nutrition-dependent growth in Drosophila and other animals. We found that many AA starvation-responsive transcripts were also altered in TOR mutants. In contrast, although PI3K overexpression induced robust changes in the expression of many metabolic genes, these changes showed limited overlap with the AA starvation expression profile. We did however identify a strong overlap between genes regulated by the transcription factor, Myc, and AA starvation-responsive genes, particularly those involved in ribosome biogenesis, protein synthesis and mitochondrial function. The consensus Myc DNA binding site is enriched in promoters of these AA starvation genes, and we found that Myc overexpression could bypass dietary AA to induce expression of these genes. We also identified another sequence motif (Motif 1 enriched in the promoters of AA starvation-responsive genes. We showed that Motif 1 was both necessary and sufficient to mediate transcriptional responses to dietary AA in larvae. Conclusions Our data suggest that many of the transcriptional effects of amino acids are mediated via signaling through the TOR pathway in Drosophila larvae. We also find that these transcriptional effects are mediated through at least two mechanisms: via the transcription factor Myc, and via the Motif 1 cis-regulatory element. These studies begin to elucidate a nutrient

  12. The contribution of cis-regulatory elements to head-to-head gene pairs’ co-expression pattern

    Institute of Scientific and Technical Information of China (English)

    2009-01-01

    Transcription regulation is one of the most critical pipelines in biological process,in which cis-elements play the role as gene expression regulators.We attempt to deduce the principles underlying the co-expression of "head-to-head" gene pairs by analyzing activities or behaviors of the shared cis-elements.A network component analysis was performed to estimate the impact of cis-elements on gene promoters and their activities under different conditions.Our discoveries reveal how biological system uses those regulatory elements to control the expression pattern of "head-to-head" gene pairs and the whole transcription regulation system.

  13. Cis-regulatory element-based genome-wide identification of DREB1/CBF targets in Arabidopsis

    Institute of Scientific and Technical Information of China (English)

    Huan Zhao; Weizhong Liu; Yong Hu; Xianglin Liu; Yikun He

    2008-01-01

    Microarray analysis is used to identify transcriptional targets.However,the direct targets of transcription factors cannot be distin guished from indirect ones;further,genes with low-expression levels cannot be identified by this method.In the present study,we exploi the cis-element dehydration-responsive element(DRE)that is known to be responsible for the transcription of DRE binding factor](DREB1)targets in the promoter region of all Arabidopsis genes.Putative targets whose promoters contain the elements were verified by both microarray and reverse transcription-polymerase chain reaction(RT-PCR)analysis.Five new DREB 1/CBF direct targets were identified.Compared with traditional microarray analysis,our method is convenient and cost-effective for identifying the downstream targets of transcription factors.

  14. Distinct cis regulatory elements govern the expression of TAG1 in embryonic sensory ganglia and spinal cord.

    Science.gov (United States)

    Hadas, Yoav; Nitzan, Noa; Furley, Andrew J W; Kozlov, Serguei V; Klar, Avihu

    2013-01-01

    Cell fate commitment of spinal progenitor neurons is initiated by long-range, midline-derived, morphogens that regulate an array of transcription factors that, in turn, act sequentially or in parallel to control neuronal differentiation. Included among these are transcription factors that regulate the expression of receptors for guidance cues, thereby determining axonal trajectories. The Ig/FNIII superfamily molecules TAG1/Axonin1/CNTN2 (TAG1) and Neurofascin (Nfasc) are co-expressed in numerous neuronal cell types in the CNS and PNS - for example motor, DRG and interneurons - both promote neurite outgrowth and both are required for the architecture and function of nodes of Ranvier. The genes encoding TAG1 and Nfasc are adjacent in the genome, an arrangement which is evolutionarily conserved. To study the transcriptional network that governs TAG1 and Nfasc expression in spinal motor and commissural neurons, we set out to identify cis elements that regulate their expression. Two evolutionarily conserved DNA modules, one located between the Nfasc and TAG1 genes and the second directly 5' to the first exon and encompassing the first intron of TAG1, were identified that direct complementary expression to the CNS and PNS, respectively, of the embryonic hindbrain and spinal cord. Sequential deletions and point mutations of the CNS enhancer element revealed a 130bp element containing three conserved E-boxes required for motor neuron expression. In combination, these two elements appear to recapitulate a major part of the pattern of TAG1 expression in the embryonic nervous system.

  15. Distinct cis regulatory elements govern the expression of TAG1 in embryonic sensory ganglia and spinal cord.

    Directory of Open Access Journals (Sweden)

    Yoav Hadas

    Full Text Available Cell fate commitment of spinal progenitor neurons is initiated by long-range, midline-derived, morphogens that regulate an array of transcription factors that, in turn, act sequentially or in parallel to control neuronal differentiation. Included among these are transcription factors that regulate the expression of receptors for guidance cues, thereby determining axonal trajectories. The Ig/FNIII superfamily molecules TAG1/Axonin1/CNTN2 (TAG1 and Neurofascin (Nfasc are co-expressed in numerous neuronal cell types in the CNS and PNS - for example motor, DRG and interneurons - both promote neurite outgrowth and both are required for the architecture and function of nodes of Ranvier. The genes encoding TAG1 and Nfasc are adjacent in the genome, an arrangement which is evolutionarily conserved. To study the transcriptional network that governs TAG1 and Nfasc expression in spinal motor and commissural neurons, we set out to identify cis elements that regulate their expression. Two evolutionarily conserved DNA modules, one located between the Nfasc and TAG1 genes and the second directly 5' to the first exon and encompassing the first intron of TAG1, were identified that direct complementary expression to the CNS and PNS, respectively, of the embryonic hindbrain and spinal cord. Sequential deletions and point mutations of the CNS enhancer element revealed a 130bp element containing three conserved E-boxes required for motor neuron expression. In combination, these two elements appear to recapitulate a major part of the pattern of TAG1 expression in the embryonic nervous system.

  16. Properties of non-coding DNA and identification of putative cis-regulatory elements in Theileria parva

    Directory of Open Access Journals (Sweden)

    Guo Xiang

    2008-12-01

    Full Text Available Abstract Background Parasites in the genus Theileria cause lymphoproliferative diseases in cattle, resulting in enormous socio-economic losses. The availability of the genome sequences and annotation for T. parva and T. annulata has facilitated the study of parasite biology and their relationship with host cell transformation and tropism. However, the mechanism of transcriptional regulation in this genus, which may be key to understanding fundamental aspects of its parasitology, remains poorly understood. In this study, we analyze the evolution of non-coding sequences in the Theileria genome and identify conserved sequence elements that may be involved in gene regulation of these parasitic species. Results Intergenic regions and introns in Theileria are short, and their length distributions are considerably right-skewed. Intergenic regions flanked by genes in 5'-5' orientation tend to be longer and slightly more AT-rich than those flanked by two stop codons; intergenic regions flanked by genes in 3'-5' orientation have intermediate values of length and AT composition. Intron position is negatively correlated with intron length, and positively correlated with GC content. Using stringent criteria, we identified a set of high-quality orthologous non-coding sequences between T. parva and T. annulata, and determined the distribution of selective constraints across regions, which are shown to be higher close to translation start sites. A positive correlation between constraint and length in both intergenic regions and introns suggests a tight control over length expansion of non-coding regions. Genome-wide searches for functional elements revealed several conserved motifs in intergenic regions of Theileria genomes. Two such motifs are preferentially located within the first 60 base pairs upstream of transcription start sites in T. parva, are preferentially associated with specific protein functional categories, and have significant similarity to know

  17. Identification of Predictive Cis-Regulatory Elements Using a Discriminative Objective Function and a Dynamic Search Space.

    Directory of Open Access Journals (Sweden)

    Rahul Karnik

    Full Text Available The generation of genomic binding or accessibility data from massively parallel sequencing technologies such as ChIP-seq and DNase-seq continues to accelerate. Yet state-of-the-art computational approaches for the identification of DNA binding motifs often yield motifs of weak predictive power. Here we present a novel computational algorithm called MotifSpec, designed to find predictive motifs, in contrast to over-represented sequence elements. The key distinguishing feature of this algorithm is that it uses a dynamic search space and a learned threshold to find discriminative motifs in combination with the modeling of motifs using a full PWM (position weight matrix rather than k-mer words or regular expressions. We demonstrate that our approach finds motifs corresponding to known binding specificities in several mammalian ChIP-seq datasets, and that our PWMs classify the ChIP-seq signals with accuracy comparable to, or marginally better than motifs from the best existing algorithms. In other datasets, our algorithm identifies novel motifs where other methods fail. Finally, we apply this algorithm to detect motifs from expression datasets in C. elegans using a dynamic expression similarity metric rather than fixed expression clusters, and find novel predictive motifs.

  18. Identification of Predictive Cis-Regulatory Elements Using a Discriminative Objective Function and a Dynamic Search Space.

    Science.gov (United States)

    Karnik, Rahul; Beer, Michael A

    2015-01-01

    The generation of genomic binding or accessibility data from massively parallel sequencing technologies such as ChIP-seq and DNase-seq continues to accelerate. Yet state-of-the-art computational approaches for the identification of DNA binding motifs often yield motifs of weak predictive power. Here we present a novel computational algorithm called MotifSpec, designed to find predictive motifs, in contrast to over-represented sequence elements. The key distinguishing feature of this algorithm is that it uses a dynamic search space and a learned threshold to find discriminative motifs in combination with the modeling of motifs using a full PWM (position weight matrix) rather than k-mer words or regular expressions. We demonstrate that our approach finds motifs corresponding to known binding specificities in several mammalian ChIP-seq datasets, and that our PWMs classify the ChIP-seq signals with accuracy comparable to, or marginally better than motifs from the best existing algorithms. In other datasets, our algorithm identifies novel motifs where other methods fail. Finally, we apply this algorithm to detect motifs from expression datasets in C. elegans using a dynamic expression similarity metric rather than fixed expression clusters, and find novel predictive motifs.

  19. Deletion hotspots in AMACR promoter CpG island are cis-regulatory elements controlling the gene expression in the colon.

    Directory of Open Access Journals (Sweden)

    Xiang Zhang

    2009-01-01

    Full Text Available Alpha-methylacyl-coenzyme A racemase (AMACR regulates peroxisomal beta-oxidation of phytol-derived, branched-chain fatty acids from red meat and dairy products -- suspected risk factors for colon carcinoma (CCa. AMACR was first found overexpressed in prostate cancer but not in benign glands and is now an established diagnostic marker for prostate cancer. Aberrant expression of AMACR was recently reported in Cca; however, little is known about how this gene is abnormally activated in cancer. By using a panel of immunostained-laser-capture-microdissected clinical samples comprising the entire colon adenoma-carcinoma sequence, we show that deregulation of AMACR during colon carcinogenesis involves two nonrandom events, resulting in the mutually exclusive existence of double-deletion at CG3 and CG10 and deletion of CG12-16 in a newly identified CpG island within the core promoter of AMACR. The double-deletion at CG3 and CG10 was found to be a somatic lesion. It existed in histologically normal colonic glands and tubular adenomas with low AMACR expression and was absent in villous adenomas and all CCas expressing variable levels of AMACR. In contrast, deletion of CG12-16 was shown to be a constitutional allele with a frequency of 43% in a general population. Its prevalence reached 89% in moderately differentiated CCas strongly expressing AMACR but only existed at 14% in poorly differentiated CCas expressing little or no AMACR. The DNA sequences housing these deletions were found to be putative cis-regulatory elements for Sp1 at CG3 and CG10, and ZNF202 at CG12-16. Chromatin immunoprecipitation, siRNA knockdown, gel shift assay, ectopic expression, and promoter analyses supported the regulation by Sp1 and ZNF202 of AMACR gene expression in an opposite manner. Our findings identified key in vivo events and novel transcription factors responsible for AMACR regulation in CCas and suggested these AMACR deletions may have diagnostic/prognostic value for

  20. Cis-regulatory mutations in human disease.

    Science.gov (United States)

    Epstein, Douglas J

    2009-07-01

    Cis-acting regulatory sequences are required for the proper temporal and spatial control of gene expression. Variation in gene expression is highly heritable and a significant determinant of human disease susceptibility. The diversity of human genetic diseases attributed, in whole or in part, to mutations in non-coding regulatory sequences is on the rise. Improvements in genome-wide methods of associating genetic variation with human disease and predicting DNA with cis-regulatory potential are two of the major reasons for these recent advances. This review will highlight select examples from the literature that have successfully integrated genetic and genomic approaches to uncover the molecular basis by which cis-regulatory mutations alter gene expression and contribute to human disease. The fine mapping of disease-causing variants has led to the discovery of novel cis-acting regulatory elements that, in some instances, are located as far away as 1.5 Mb from the target gene. In other cases, the prior knowledge of the regulatory landscape surrounding the gene of interest aided in the selection of enhancers for mutation screening. The success of these studies should provide a framework for following up on the large number of genome-wide association studies that have identified common variants in non-coding regions of the genome that associate with increased risk of human diseases including, diabetes, autism, Crohn's, colorectal cancer, and asthma, to name a few.

  1. Genomic analysis reveals major determinants of cis-regulatory variation in Capsella grandiflora.

    Science.gov (United States)

    Steige, Kim A; Laenen, Benjamin; Reimegård, Johan; Scofield, Douglas G; Slotte, Tanja

    2017-01-31

    Understanding the causes of cis-regulatory variation is a long-standing aim in evolutionary biology. Although cis-regulatory variation has long been considered important for adaptation, we still have a limited understanding of the selective importance and genomic determinants of standing cis-regulatory variation. To address these questions, we studied the prevalence, genomic determinants, and selective forces shaping cis-regulatory variation in the outcrossing plant Capsella grandiflora We first identified a set of 1,010 genes with common cis-regulatory variation using analyses of allele-specific expression (ASE). Population genomic analyses of whole-genome sequences from 32 individuals showed that genes with common cis-regulatory variation (i) are under weaker purifying selection and (ii) undergo less frequent positive selection than other genes. We further identified genomic determinants of cis-regulatory variation. Gene body methylation (gbM) was a major factor constraining cis-regulatory variation, whereas presence of nearby transposable elements (TEs) and tissue specificity of expression increased the odds of ASE. Our results suggest that most common cis-regulatory variation in C. grandiflora is under weak purifying selection, and that gene-specific functional constraints are more important for the maintenance of cis-regulatory variation than genome-scale variation in the intensity of selection. Our results agree with previous findings that suggest TE silencing affects nearby gene expression, and provide evidence for a link between gbM and cis-regulatory constraint, possibly reflecting greater dosage sensitivity of body-methylated genes. Given the extensive conservation of gbM in flowering plants, this suggests that gbM could be an important predictor of cis-regulatory variation in a wide range of plant species.

  2. The Role of cis Regulatory Evolution in Maize Domestication

    Science.gov (United States)

    Lemmon, Zachary H.; Bukowski, Robert; Sun, Qi; Doebley, John F.

    2014-01-01

    Gene expression differences between divergent lineages caused by modification of cis regulatory elements are thought to be important in evolution. We assayed genome-wide cis and trans regulatory differences between maize and its wild progenitor, teosinte, using deep RNA sequencing in F1 hybrid and parent inbred lines for three tissue types (ear, leaf and stem). Pervasive regulatory variation was observed with approximately 70% of ∼17,000 genes showing evidence of regulatory divergence between maize and teosinte. However, many fewer genes (1,079 genes) show consistent cis differences with all sampled maize and teosinte lines. For ∼70% of these 1,079 genes, the cis differences are specific to a single tissue. The number of genes with cis regulatory differences is greatest for ear tissue, which underwent a drastic transformation in form during domestication. As expected from the domestication bottleneck, maize possesses less cis regulatory variation than teosinte with this deficit greatest for genes showing maize-teosinte cis regulatory divergence, suggesting selection on cis regulatory differences during domestication. Consistent with selection on cis regulatory elements, genes with cis effects correlated strongly with genes under positive selection during maize domestication and improvement, while genes with trans regulatory effects did not. We observed a directional bias such that genes with cis differences showed higher expression of the maize allele more often than the teosinte allele, suggesting domestication favored up-regulation of gene expression. Finally, this work documents the cis and trans regulatory changes between maize and teosinte in over 17,000 genes for three tissues. PMID:25375861

  3. The role of cis regulatory evolution in maize domestication.

    Directory of Open Access Journals (Sweden)

    Zachary H Lemmon

    2014-11-01

    Full Text Available Gene expression differences between divergent lineages caused by modification of cis regulatory elements are thought to be important in evolution. We assayed genome-wide cis and trans regulatory differences between maize and its wild progenitor, teosinte, using deep RNA sequencing in F1 hybrid and parent inbred lines for three tissue types (ear, leaf and stem. Pervasive regulatory variation was observed with approximately 70% of ∼17,000 genes showing evidence of regulatory divergence between maize and teosinte. However, many fewer genes (1,079 genes show consistent cis differences with all sampled maize and teosinte lines. For ∼70% of these 1,079 genes, the cis differences are specific to a single tissue. The number of genes with cis regulatory differences is greatest for ear tissue, which underwent a drastic transformation in form during domestication. As expected from the domestication bottleneck, maize possesses less cis regulatory variation than teosinte with this deficit greatest for genes showing maize-teosinte cis regulatory divergence, suggesting selection on cis regulatory differences during domestication. Consistent with selection on cis regulatory elements, genes with cis effects correlated strongly with genes under positive selection during maize domestication and improvement, while genes with trans regulatory effects did not. We observed a directional bias such that genes with cis differences showed higher expression of the maize allele more often than the teosinte allele, suggesting domestication favored up-regulation of gene expression. Finally, this work documents the cis and trans regulatory changes between maize and teosinte in over 17,000 genes for three tissues.

  4. The role of cis regulatory evolution in maize domestication.

    Science.gov (United States)

    Lemmon, Zachary H; Bukowski, Robert; Sun, Qi; Doebley, John F

    2014-11-01

    Gene expression differences between divergent lineages caused by modification of cis regulatory elements are thought to be important in evolution. We assayed genome-wide cis and trans regulatory differences between maize and its wild progenitor, teosinte, using deep RNA sequencing in F1 hybrid and parent inbred lines for three tissue types (ear, leaf and stem). Pervasive regulatory variation was observed with approximately 70% of ∼17,000 genes showing evidence of regulatory divergence between maize and teosinte. However, many fewer genes (1,079 genes) show consistent cis differences with all sampled maize and teosinte lines. For ∼70% of these 1,079 genes, the cis differences are specific to a single tissue. The number of genes with cis regulatory differences is greatest for ear tissue, which underwent a drastic transformation in form during domestication. As expected from the domestication bottleneck, maize possesses less cis regulatory variation than teosinte with this deficit greatest for genes showing maize-teosinte cis regulatory divergence, suggesting selection on cis regulatory differences during domestication. Consistent with selection on cis regulatory elements, genes with cis effects correlated strongly with genes under positive selection during maize domestication and improvement, while genes with trans regulatory effects did not. We observed a directional bias such that genes with cis differences showed higher expression of the maize allele more often than the teosinte allele, suggesting domestication favored up-regulation of gene expression. Finally, this work documents the cis and trans regulatory changes between maize and teosinte in over 17,000 genes for three tissues.

  5. Combining computational prediction of cis-regulatory elements with a new enhancer assay to efficiently label neuronal structures in the medaka fish.

    Directory of Open Access Journals (Sweden)

    Emmanuel Mongin

    Full Text Available The developing vertebrate nervous system contains a remarkable array of neural cells organized into complex, evolutionarily conserved structures. The labeling of living cells in these structures is key for the understanding of brain development and function, yet the generation of stable lines expressing reporter genes in specific spatio-temporal patterns remains a limiting step. In this study we present a fast and reliable pipeline to efficiently generate a set of stable lines expressing a reporter gene in multiple neuronal structures in the developing nervous system in medaka. The pipeline combines both the accurate computational genome-wide prediction of neuronal specific cis-regulatory modules (CRMs and a newly developed experimental setup to rapidly obtain transgenic lines in a cost-effective and highly reproducible manner. 95% of the CRMs tested in our experimental setup show enhancer activity in various and numerous neuronal structures belonging to all major brain subdivisions. This pipeline represents a significant step towards the dissection of embryonic neuronal development in vertebrates.

  6. A universal algorithm for genome-wide in silicio identification of biologically significant gene promoter putative cis-regulatory-elements; identification of new elements for reactive oxygen species and sucrose signaling in Arabidopsis.

    Science.gov (United States)

    Geisler, Matt; Kleczkowski, Leszek A; Karpinski, Stanislaw

    2006-02-01

    Short motifs of many cis-regulatory elements (CREs) can be found in the promoters of most Arabidopsis genes, and this raises the question of how their presence can confer specific regulation. We developed a universal algorithm to test the biological significance of CREs by first identifying every Arabidopsis gene with a CRE and then statistically correlating the presence or absence of the element with the gene expression profile on multiple DNA microarrays. This algorithm was successfully verified for previously characterized abscisic acid, ethylene, sucrose and drought responsive CREs in Arabidopsis, showing that the presence of these elements indeed correlates with treatment-specific gene induction. Later, we used standard motif sampling methods to identify 128 putative motifs induced by excess light, reactive oxygen species and sucrose. Our algorithm was able to filter 20 out of 128 novel CREs which significantly correlated with gene induction by either heat, reactive oxygen species and/or sucrose. The position, orientation and sequence specificity of CREs was tested in silicio by analyzing the expression of genes with naturally occurring sequence variations. In three novel CREs the forward orientation correlated with sucrose induction and the reverse orientation with sucrose suppression. The functionality of the predicted novel CREs was experimentally confirmed using Arabidopsis cell-suspension cultures transformed with short promoter fragments or artificial promoters fused with the GUS reporter gene. Our genome-wide analysis opens up new possibilities for in silicio verification of the biological significance of newly discovered CREs, and allows for subsequent selection of such CREs for experimental studies.

  7. Favorable genomic environments for cis-regulatory evolution: A novel theoretical framework.

    Science.gov (United States)

    Maeso, Ignacio; Tena, Juan J

    2016-09-01

    Cis-regulatory changes are arguably the primary evolutionary source of animal morphological diversity. With the recent explosion of genome-wide comparisons of the cis-regulatory content in different animal species is now possible to infer general principles underlying enhancer evolution. However, these studies have also revealed numerous discrepancies and paradoxes, suggesting that the mechanistic causes and modes of cis-regulatory evolution are still not well understood and are probably much more complex than generally appreciated. Here, we argue that the mutational mechanisms and genomic regions generating new regulatory activities must comply with the constraints imposed by the molecular properties of cis-regulatory elements (CREs) and the organizational features of long-range chromatin interactions. Accordingly, we propose a new integrative evolutionary framework for cis-regulatory evolution based on two major premises for the origin of novel enhancer activity: (i) an accessible chromatin environment and (ii) compatibility with the 3D structure and interactions of pre-existing CREs. Mechanisms and DNA sequences not fulfilling these premises, will be less likely to have a measurable impact on gene expression and as such, will have a minor contribution to the evolution of gene regulation. Finally, we discuss current comparative cis-regulatory data under the light of this new evolutionary model, and propose that the two most prominent mechanisms for the evolution of cis-regulatory changes are the overprinting of ancestral CREs and the exaptation of transposable elements.

  8. CREME: Cis-Regulatory Module Explorer for the Human Genome

    Energy Technology Data Exchange (ETDEWEB)

    Loots, G G; Sharan, R; Ovcharenko, I; Ben-Hur, A

    2004-02-11

    The binding of transcription factors to specific regulatory sequence elements is a primary mechanism for controlling gene transcription. Eukaryotic genes are often regulated by several transcription factors, whose binding sites are tightly clustered and form cis-regulatory modules. In this paper we present a web-server, CREME, for identifying and visualizing cis-regulatory modules in the promoter regions of a given set of potentially co-regulated genes. CREME relies on a database of putative transcription factor binding sites that have been annotated across the human genome using a library of position weight matrices and evolutionary conservation with the mouse and rat genomes. A search algorithm is applied to this dataset to identify combinations of transcription factors whose binding sites tend to co-occur in close proximity in the promoter regions of the input gene set. The identified cis-regulatory modules are statistically scored and significant combinations are reported and graphically visualized. Our web-server is available at http://creme.dcode.org/.

  9. Parallel evolution of chordate cis-regulatory code for development.

    Directory of Open Access Journals (Sweden)

    Laura Doglio

    2013-11-01

    Full Text Available Urochordates are the closest relatives of vertebrates and at the larval stage, possess a characteristic bilateral chordate body plan. In vertebrates, the genes that orchestrate embryonic patterning are in part regulated by highly conserved non-coding elements (CNEs, yet these elements have not been identified in urochordate genomes. Consequently the evolution of the cis-regulatory code for urochordate development remains largely uncharacterised. Here, we use genome-wide comparisons between C. intestinalis and C. savignyi to identify putative urochordate cis-regulatory sequences. Ciona conserved non-coding elements (ciCNEs are associated with largely the same key regulatory genes as vertebrate CNEs. Furthermore, some of the tested ciCNEs are able to activate reporter gene expression in both zebrafish and Ciona embryos, in a pattern that at least partially overlaps that of the gene they associate with, despite the absence of sequence identity. We also show that the ability of a ciCNE to up-regulate gene expression in vertebrate embryos can in some cases be localised to short sub-sequences, suggesting that functional cross-talk may be defined by small regions of ancestral regulatory logic, although functional sub-sequences may also be dispersed across the whole element. We conclude that the structure and organisation of cis-regulatory modules is very different between vertebrates and urochordates, reflecting their separate evolutionary histories. However, functional cross-talk still exists because the same repertoire of transcription factors has likely guided their parallel evolution, exploiting similar sets of binding sites but in different combinations.

  10. Abundant raw material for cis-regulatory evolution in humans

    Science.gov (United States)

    Rockman, Matthew V.; Wray, Gregory A.

    2002-01-01

    Changes in gene expression and regulation--due in particular to the evolution of cis-regulatory DNA sequences--may underlie many evolutionary changes in phenotypes, yet little is known about the distribution of such variation in populations. We present in this study the first survey of experimentally validated functional cis-regulatory polymorphism. These data are derived from more than 140 polymorphisms involved in the regulation of 107 genes in Homo sapiens, the eukaryote species with the most available data. We find that functional cis-regulatory variation is widespread in the human genome and that the consequent variation in gene expression is twofold or greater for 63% of the genes surveyed. Transcription factor-DNA interactions are highly polymorphic, and regulatory interactions have been gained and lost within human populations. On average, humans are heterozygous at more functional cis-regulatory sites (>16,000) than at amino acid positions (human phenotypic variation.

  11. Using hexamers to predict cis-regulatory motifs in Drosophila

    Directory of Open Access Journals (Sweden)

    Kibler Dennis

    2005-10-01

    Full Text Available Abstract Background Cis-regulatory modules (CRMs are short stretches of DNA that help regulate gene expression in higher eukaryotes. They have been found up to 1 megabase away from the genes they regulate and can be located upstream, downstream, and even within their target genes. Due to the difficulty of finding CRMs using biological and computational techniques, even well-studied regulatory systems may contain CRMs that have not yet been discovered. Results We present a simple, efficient method (HexDiff based only on hexamer frequencies of known CRMs and non-CRM sequence to predict novel CRMs in regulatory systems. On a data set of 16 gap and pair-rule genes containing 52 known CRMs, predictions made by HexDiff had a higher correlation with the known CRMs than several existing CRM prediction algorithms: Ahab, Cluster Buster, MSCAN, MCAST, and LWF. After combining the results of the different algorithms, 10 putative CRMs were identified and are strong candidates for future study. The hexamers used by HexDiff to distinguish between CRMs and non-CRM sequence were also analyzed and were shown to be enriched in regulatory elements. Conclusion HexDiff provides an efficient and effective means for finding new CRMs based on known CRMs, rather than known binding sites.

  12. ChIP-Seq-Annotated Heliconius erato Genome Highlights Patterns of cis-Regulatory Evolution in Lepidoptera.

    Science.gov (United States)

    Lewis, James J; van der Burg, Karin R L; Mazo-Vargas, Anyi; Reed, Robert D

    2016-09-13

    Uncovering phylogenetic patterns of cis-regulatory evolution remains a fundamental goal for evolutionary and developmental biology. Here, we characterize the evolution of regulatory loci in butterflies and moths using chromatin immunoprecipitation sequencing (ChIP-seq) annotation of regulatory elements across three stages of head development. In the process we provide a high-quality, functionally annotated genome assembly for the butterfly, Heliconius erato. Comparing cis-regulatory element conservation across six lepidopteran genomes, we find that regulatory sequences evolve at a pace similar to that of protein-coding regions. We also observe that elements active at multiple developmental stages are markedly more conserved than elements with stage-specific activity. Surprisingly, we also find that stage-specific proximal and distal regulatory elements evolve at nearly identical rates. Our study provides a benchmark for genome-wide patterns of regulatory element evolution in insects, and it shows that developmental timing of activity strongly predicts patterns of regulatory sequence evolution.

  13. Divergence in cis-regulatory sequences surrounding the opsin gene arrays of African cichlid fishes

    Directory of Open Access Journals (Sweden)

    Streelman J Todd

    2011-05-01

    Full Text Available Abstract Background Divergence within cis-regulatory sequences may contribute to the adaptive evolution of gene expression, but functional alleles in these regions are difficult to identify without abundant genomic resources. Among African cichlid fishes, the differential expression of seven opsin genes has produced adaptive differences in visual sensitivity. Quantitative genetic analysis suggests that cis-regulatory alleles near the SWS2-LWS opsins may contribute to this variation. Here, we sequence BACs containing the opsin genes of two cichlids, Oreochromis niloticus and Metriaclima zebra. We use phylogenetic footprinting and shadowing to examine divergence in conserved non-coding elements, promoter sequences, and 3'-UTRs surrounding each opsin in search of candidate cis-regulatory sequences that influence cichlid opsin expression. Results We identified 20 conserved non-coding elements surrounding the opsins of cichlids and other teleosts, including one known enhancer and a retinal microRNA. Most conserved elements contained computationally-predicted binding sites that correspond to transcription factors that function in vertebrate opsin expression; O. niloticus and M. zebra were significantly divergent in two of these. Similarly, we found a large number of relevant transcription factor binding sites within each opsin's proximal promoter, and identified five opsins that were considerably divergent in both expression and the number of transcription factor binding sites shared between O. niloticus and M. zebra. We also found several microRNA target sites within the 3'-UTR of each opsin, including two 3'-UTRs that differ significantly between O. niloticus and M. zebra. Finally, we examined interspecific divergence among 18 phenotypically diverse cichlids from Lake Malawi for one conserved non-coding element, two 3'-UTRs, and five opsin proximal promoters. We found that all regions were highly conserved with some evidence of CRX transcription

  14. cis-Regulatory control of the initial neurogenic pattern of onecut gene expression in the sea urchin embryo.

    Science.gov (United States)

    Barsi, Julius C; Davidson, Eric H

    2016-01-01

    Specification of the ciliated band (CB) of echinoid embryos executes three spatial functions essential for postgastrular organization. These are establishment of a band about 5 cells wide which delimits and bounds other embryonic territories; definition of a neurogenic domain within this band; and generation within it of arrays of ciliary cells that bear the special long cilia from which the structure derives its name. In Strongylocentrotus purpuratus the spatial coordinates of the future ciliated band are initially and exactly determined by the disposition of a ring of cells that transcriptionally activate the onecut homeodomain regulatory gene, beginning in blastula stage, long before the appearance of the CB per se. Thus the cis-regulatory apparatus that governs onecut expression in the blastula directly reveals the genomic sequence code by which these aspects of the spatial organization of the embryo are initially determined. We screened the entire onecut locus and its flanking region for transcriptionally active cis-regulatory elements, and by means of BAC recombineered deletions identified three separated and required cis-regulatory modules that execute different functions. The operating logic of the crucial spatial control module accounting for the spectacularly precise and beautiful early onecut expression domain depends on spatial repression. Previously predicted oral ectoderm and aboral ectoderm repressors were identified by cis-regulatory mutation as the products of goosecoid and irxa genes respectively, while the pan-ectodermal activator SoxB1 supplies a transcriptional driver function.

  15. On the Concept of Cis-regulatory Information: From Sequence Motifs to Logic Functions

    Science.gov (United States)

    Tarpine, Ryan; Istrail, Sorin

    The regulatory genome is about the “system level organization of the core genomic regulatory apparatus, and how this is the locus of causality underlying the twin phenomena of animal development and animal evolution” (E.H. Davidson. The Regulatory Genome: Gene Regulatory Networks in Development and Evolution, Academic Press, 2006). Information processing in the regulatory genome is done through regulatory states, defined as sets of transcription factors (sequence-specific DNA binding proteins which determine gene expression) that are expressed and active at the same time. The core information processing machinery consists of modular DNA sequence elements, called cis-modules, that interact with transcription factors. The cis-modules “read” the information contained in the regulatory state of the cell through transcription factor binding, “process” it, and directly or indirectly communicate with the basal transcription apparatus to determine gene expression. This endowment of each gene with the information-receiving capacity through their cis-regulatory modules is essential for the response to every possible regulatory state to which it might be exposed during all phases of the life cycle and in all cell types. We present here a set of challenges addressed by our CYRENE research project aimed at studying the cis-regulatory code of the regulatory genome. The CYRENE Project is devoted to (1) the construction of a database, the cis-Lexicon, containing comprehensive information across species about experimentally validated cis-regulatory modules; and (2) the software development of a next-generation genome browser, the cis-Browser, specialized for the regulatory genome. The presentation is anchored on three main computational challenges: the Gene Naming Problem, the Consensus Sequence Bottleneck Problem, and the Logic Function Inference Problem.

  16. Nucleotide sequence conservation of novel and established cis-regulatory sites within the tyrosine hydroxylase gene promoter.

    Science.gov (United States)

    Wang, Meng; Banerjee, Kasturi; Baker, Harriet; Cave, John W

    2015-02-01

    Tyrosine hydroxylase (TH) is the rate-limiting enzyme in catecholamine biosynthesis and its gene proximal promoter ( electromobility shift assays showed that brain-region specific complexes assemble on these motifs. These studies also identified a non-canonical CRE binding (CREB) protein recognition element in the proximal promoter. Together, these studies provide a detailed analysis of evolutionary conservation within the TH promoter and identify potential cis-regulatory motifs that underlie a core set of regulatory mechanisms in mammals.

  17. cis-Regulatory Circuits Regulating NEK6 Kinase Overexpression in Transformed B Cells Are Super-Enhancer Independent.

    Science.gov (United States)

    Huang, Yue; Koues, Olivia I; Zhao, Jiang-Yang; Liu, Regina; Pyfrom, Sarah C; Payton, Jacqueline E; Oltz, Eugene M

    2017-03-21

    Alterations in distal regulatory elements that control gene expression underlie many diseases, including cancer. Epigenomic analyses of normal and diseased cells have produced correlative predictions for connections between dysregulated enhancers and target genes involved in pathogenesis. However, with few exceptions, these predicted cis-regulatory circuits remain untested. Here, we dissect cis-regulatory circuits that lead to overexpression of NEK6, a mitosis-associated kinase, in human B cell lymphoma. We find that only a minor subset of predicted enhancers is required for NEK6 expression. Indeed, an annotated super-enhancer is dispensable for NEK6 overexpression and for maintaining the architecture of a B cell-specific regulatory hub. A CTCF cluster serves as a chromatin and architectural boundary to block communication of the NEK6 regulatory hub with neighboring genes. Our findings emphasize that validation of predicted cis-regulatory circuits and super-enhancers is needed to prioritize transcriptional control elements as therapeutic targets.

  18. A primer on regression methods for decoding cis-regulatory logic

    Energy Technology Data Exchange (ETDEWEB)

    Das, Debopriya; Pellegrini, Matteo; Gray, Joe W.

    2009-03-03

    The rapidly emerging field of systems biology is helping us to understand the molecular determinants of phenotype on a genomic scale [1]. Cis-regulatory elements are major sequence-based determinants of biological processes in cells and tissues [2]. For instance, during transcriptional regulation, transcription factors (TFs) bind to very specific regions on the promoter DNA [2,3] and recruit the basal transcriptional machinery, which ultimately initiates mRNA transcription (Figure 1A). Learning cis-Regulatory Elements from Omics Data A vast amount of work over the past decade has shown that omics data can be used to learn cis-regulatory logic on a genome-wide scale [4-6]--in particular, by integrating sequence data with mRNA expression profiles. The most popular approach has been to identify over-represented motifs in promoters of genes that are coexpressed [4,7,8]. Though widely used, such an approach can be limiting for a variety of reasons. First, the combinatorial nature of gene regulation is difficult to explicitly model in this framework. Moreover, in many applications of this approach, expression data from multiple conditions are necessary to obtain reliable predictions. This can potentially limit the use of this method to only large data sets [9]. Although these methods can be adapted to analyze mRNA expression data from a pair of biological conditions, such comparisons are often confounded by the fact that primary and secondary response genes are clustered together--whereas only the primary response genes are expected to contain the functional motifs [10]. A set of approaches based on regression has been developed to overcome the above limitations [11-32]. These approaches have their foundations in certain biophysical aspects of gene regulation [26,33-35]. That is, the models are motivated by the expected transcriptional response of genes due to the binding of TFs to their promoters. While such methods have gathered popularity in the computational domain

  19. SMCis: An Effective Algorithm for Discovery of Cis-Regulatory Modules

    Science.gov (United States)

    Guo, Haitao; Huo, Hongwei; Yu, Qiang

    2016-01-01

    The discovery of cis-regulatory modules (CRMs) is a challenging problem in computational biology. Limited by the difficulty of using an HMM to model dependent features in transcriptional regulatory sequences (TRSs), the probabilistic modeling methods based on HMMs cannot accurately represent the distance between regulatory elements in TRSs and are cumbersome to model the prevailing dependencies between motifs within CRMs. We propose a probabilistic modeling algorithm called SMCis, which builds a more powerful CRM discovery model based on a hidden semi-Markov model. Our model characterizes the regulatory structure of CRMs and effectively models dependencies between motifs at a higher level of abstraction based on segments rather than nucleotides. Experimental results on three benchmark datasets indicate that our method performs better than the compared algorithms. PMID:27637070

  20. Massively parallel cis-regulatory analysis in the mammalian central nervous system.

    Science.gov (United States)

    Shen, Susan Q; Myers, Connie A; Hughes, Andrew E O; Byrne, Leah C; Flannery, John G; Corbo, Joseph C

    2016-02-01

    Cis-regulatory elements (CREs, e.g., promoters and enhancers) regulate gene expression, and variants within CREs can modulate disease risk. Next-generation sequencing has enabled the rapid generation of genomic data that predict the locations of CREs, but a bottleneck lies in functionally interpreting these data. To address this issue, massively parallel reporter assays (MPRAs) have emerged, in which barcoded reporter libraries are introduced into cells, and the resulting barcoded transcripts are quantified by next-generation sequencing. Thus far, MPRAs have been largely restricted to assaying short CREs in a limited repertoire of cultured cell types. Here, we present two advances that extend the biological relevance and applicability of MPRAs. First, we adapt exome capture technology to instead capture candidate CREs, thereby tiling across the targeted regions and markedly increasing the length of CREs that can be readily assayed. Second, we package the library into adeno-associated virus (AAV), thereby allowing delivery to target organs in vivo. As a proof of concept, we introduce a capture library of about 46,000 constructs, corresponding to roughly 3500 DNase I hypersensitive (DHS) sites, into the mouse retina by ex vivo plasmid electroporation and into the mouse cerebral cortex by in vivo AAV injection. We demonstrate tissue-specific cis-regulatory activity of DHSs and provide examples of high-resolution truncation mutation analysis for multiplex parsing of CREs. Our approach should enable massively parallel functional analysis of a wide range of CREs in any organ or species that can be infected by AAV, such as nonhuman primates and human stem cell-derived organoids.

  1. Brachyury, Foxa2 and the cis-Regulatory Origins of the Notochord.

    Directory of Open Access Journals (Sweden)

    Diana S José-Edwards

    2015-12-01

    Full Text Available A main challenge of modern biology is to understand how specific constellations of genes are activated to differentiate cells and give rise to distinct tissues. This study focuses on elucidating how gene expression is initiated in the notochord, an axial structure that provides support and patterning signals to embryos of humans and all other chordates. Although numerous notochord genes have been identified, the regulatory DNAs that orchestrate development and propel evolution of this structure by eliciting notochord gene expression remain mostly uncharted, and the information on their configuration and recurrence is still quite fragmentary. Here we used the simple chordate Ciona for a systematic analysis of notochord cis-regulatory modules (CRMs, and investigated their composition, architectural constraints, predictive ability and evolutionary conservation. We found that most Ciona notochord CRMs relied upon variable combinations of binding sites for the transcription factors Brachyury and/or Foxa2, which can act either synergistically or independently from one another. Notably, one of these CRMs contains a Brachyury binding site juxtaposed to an (AC microsatellite, an unusual arrangement also found in Brachyury-bound regulatory regions in mouse. In contrast, different subsets of CRMs relied upon binding sites for transcription factors of widely diverse families. Surprisingly, we found that neither intra-genomic nor interspecific conservation of binding sites were reliably predictive hallmarks of notochord CRMs. We propose that rather than obeying a rigid sequence-based cis-regulatory code, most notochord CRMs are rather unique. Yet, this study uncovered essential elements recurrently used by divergent chordates as basic building blocks for notochord CRMs.

  2. The cis-regulatory logic of the mammalian photoreceptor transcriptional network.

    Directory of Open Access Journals (Sweden)

    Timothy H-C Hsiau

    Full Text Available The photoreceptor cells of the retina are subject to a greater number of genetic diseases than any other cell type in the human body. The majority of more than 120 cloned human blindness genes are highly expressed in photoreceptors. In order to establish an integrative framework in which to understand these diseases, we have undertaken an experimental and computational analysis of the network controlled by the mammalian photoreceptor transcription factors, Crx, Nrl, and Nr2e3. Using microarray and in situ hybridization datasets we have produced a model of this network which contains over 600 genes, including numerous retinal disease loci as well as previously uncharacterized photoreceptor transcription factors. To elucidate the connectivity of this network, we devised a computational algorithm to identify the photoreceptor-specific cis-regulatory elements (CREs mediating the interactions between these transcription factors and their target genes. In vivo validation of our computational predictions resulted in the discovery of 19 novel photoreceptor-specific CREs near retinal disease genes. Examination of these CREs permitted the definition of a simple cis-regulatory grammar rule associated with high-level expression. To test the generality of this rule, we used an expanded form of it as a selection filter to evolve photoreceptor CREs from random DNA sequences in silico. When fused to fluorescent reporters, these evolved CREs drove strong, photoreceptor-specific expression in vivo. This study represents the first systematic identification and in vivo validation of CREs in a mammalian neuronal cell type and lays the groundwork for a systems biology of photoreceptor transcriptional regulation.

  3. Identifying cis-regulatory sequences by word profile similarity.

    Directory of Open Access Journals (Sweden)

    Garmay Leung

    Full Text Available BACKGROUND: Recognizing regulatory sequences in genomes is a continuing challenge, despite a wealth of available genomic data and a growing number of experimentally validated examples. METHODOLOGY/PRINCIPAL FINDINGS: We discuss here a simple approach to search for regulatory sequences based on the compositional similarity of genomic regions and known cis-regulatory sequences. This method, which is not limited to searching for predefined motifs, recovers sequences known to be under similar regulatory control. The words shared by the recovered sequences often correspond to known binding sites. Furthermore, we show that although local word profile clustering is predictive for the regulatory sequences involved in blastoderm segmentation, local dissimilarity is a more universal feature of known regulatory sequences in Drosophila. CONCLUSIONS/SIGNIFICANCE: Our method leverages sequence motifs within a known regulatory sequence to identify co-regulated sequences without explicitly defining binding sites. We also show that regulatory sequences can be distinguished from surrounding sequences by local sequence dissimilarity, a novel feature in identifying regulatory sequences across a genome. Source code for WPH-finder is available for download at http://rana.lbl.gov/downloads/wph.tar.gz.

  4. ChIP-Seq-Annotated Heliconius erato Genome Highlights Patterns of cis-Regulatory Evolution in Lepidoptera

    Directory of Open Access Journals (Sweden)

    James J. Lewis

    2016-09-01

    Full Text Available Uncovering phylogenetic patterns of cis-regulatory evolution remains a fundamental goal for evolutionary and developmental biology. Here, we characterize the evolution of regulatory loci in butterflies and moths using chromatin immunoprecipitation sequencing (ChIP-seq annotation of regulatory elements across three stages of head development. In the process we provide a high-quality, functionally annotated genome assembly for the butterfly, Heliconius erato. Comparing cis-regulatory element conservation across six lepidopteran genomes, we find that regulatory sequences evolve at a pace similar to that of protein-coding regions. We also observe that elements active at multiple developmental stages are markedly more conserved than elements with stage-specific activity. Surprisingly, we also find that stage-specific proximal and distal regulatory elements evolve at nearly identical rates. Our study provides a benchmark for genome-wide patterns of regulatory element evolution in insects, and it shows that developmental timing of activity strongly predicts patterns of regulatory sequence evolution.

  5. Understanding the Dynamics of Gene Regulatory Systems; Characterisation and Clinical Relevance of cis-Regulatory Polymorphisms

    Directory of Open Access Journals (Sweden)

    Philip Cowie

    2013-01-01

    Full Text Available Modern genetic analysis has shown that most polymorphisms associated with human disease are non-coding. Much of the functional information contained in the non-coding genome consists of cis-regulatory sequences (CRSs that are required to respond to signal transduction cues that direct cell specific gene expression. It has been hypothesised that many diseases may be due to polymorphisms within CRSs that alter their responses to signal transduction cues. However, identification of CRSs, and the effects of allelic variation on their ability to respond to signal transduction cues, is still at an early stage. In the current review we describe the use of comparative genomics and experimental techniques that allow for the identification of CRSs building on recent advances by the ENCODE consortium. In addition we describe techniques that allow for the analysis of the effects of allelic variation and epigenetic modification on CRS responses to signal transduction cues. Using specific examples we show that the interactions driving these elements are highly complex and the effects of disease associated polymorphisms often subtle. It is clear that gaining an understanding of the functions of CRSs, and how they are affected by SNPs and epigenetic modification, is essential to understanding the genetic basis of human disease and stratification whilst providing novel directions for the development of personalised medicine.

  6. A transposon-based chromosomal engineering method to survey a large cis-regulatory landscape in mice.

    Science.gov (United States)

    Kokubu, Chikara; Horie, Kyoji; Abe, Koichiro; Ikeda, Ryuji; Mizuno, Sumi; Uno, Yoshihiro; Ogiwara, Sanae; Ohtsuka, Masato; Isotani, Ayako; Okabe, Masaru; Imai, Kenji; Takeda, Junji

    2009-08-01

    A large cis-regulatory landscape is a common feature of vertebrate genomes, particularly at key developmental gene loci with finely tuned expression patterns. Existing genetic tools for surveying large genomic regions of interest spanning over hundreds of kilobases are limited. Here we propose a chromosomal engineering strategy exploiting the local hopping trait of the Sleeping Beauty transposon in the mouse genome. We generated embryonic stem cells with a targeted integration of the transposon vector, carrying an enhancer-detecting lacZ reporter and loxP cassette, into the developmentally critical Pax1 gene locus, followed by efficient local transpositions, nested deletion formation and derivation of embryos by tetraploid complementation. Comparative reporter expression analysis among different insertion/deletion embryos substantially facilitated long-range cis-regulatory element mapping in the genomic neighborhood and demonstrated the potential of the transposon-based approach as a versatile tool for exploration of defined genomic intervals of functional or clinical relevance, such as disease-associated microdeletions.

  7. Global profiling of rice and poplar transcriptomes highlights key conserved circadian-controlled pathways and cis-regulatory modules.

    Directory of Open Access Journals (Sweden)

    Sergei A Filichkin

    Full Text Available BACKGROUND: Circadian clocks provide an adaptive advantage through anticipation of daily and seasonal environmental changes. In plants, the central clock oscillator is regulated by several interlocking feedback loops. It was shown that a substantial proportion of the Arabidopsis genome cycles with phases of peak expression covering the entire day. Synchronized transcriptome cycling is driven through an extensive network of diurnal and clock-regulated transcription factors and their target cis-regulatory elements. Study of the cycling transcriptome in other plant species could thus help elucidate the similarities and differences and identify hubs of regulation common to monocot and dicot plants. METHODOLOGY/PRINCIPAL FINDINGS: Using a combination of oligonucleotide microarrays and data mining pipelines, we examined daily rhythms in gene expression in one monocotyledonous and one dicotyledonous plant, rice and poplar, respectively. Cycling transcriptomes were interrogated under different diurnal (driven and circadian (free running light and temperature conditions. Collectively, photocycles and thermocycles regulated about 60% of the expressed nuclear genes in rice and poplar. Depending on the condition tested, up to one third of oscillating Arabidopsis-poplar-rice orthologs were phased within three hours of each other suggesting a high degree of conservation in terms of rhythmic gene expression. We identified clusters of rhythmically co-expressed genes and searched their promoter sequences to identify phase-specific cis-elements, including elements that were conserved in the promoters of Arabidopsis, poplar, and rice. CONCLUSIONS/SIGNIFICANCE: Our results show that the cycling patterns of many circadian clock genes are highly conserved across poplar, rice, and Arabidopsis. The expression of many orthologous genes in key metabolic and regulatory pathways is diurnal and/or circadian regulated and phased to similar times of day. Our results confirm

  8. Conserved cis-regulatory modules in promoters of genes encoding wheat high-molecular-weight glutenin subunits.

    Science.gov (United States)

    Ravel, Catherine; Fiquet, Samuel; Boudet, Julie; Dardevet, Mireille; Vincent, Jonathan; Merlino, Marielle; Michard, Robin; Martre, Pierre

    2014-01-01

    The concentration and composition of the gliadin and glutenin seed storage proteins (SSPs) in wheat flour are the most important determinants of its end-use value. In cereals, the synthesis of SSPs is predominantly regulated at the transcriptional level by a complex network involving at least five cis-elements in gene promoters. The high-molecular-weight glutenin subunits (HMW-GS) are encoded by two tightly linked genes located on the long arms of group 1 chromosomes. Here, we sequenced and annotated the HMW-GS gene promoters of 22 electrophoretic wheat alleles to identify putative cis-regulatory motifs. We focused on 24 motifs known to be involved in SSP gene regulation. Most of them were identified in at least one HMW-GS gene promoter sequence. A common regulatory framework was observed in all the HMW-GS gene promoters, as they shared conserved cis-regulatory modules (CCRMs) including all the five motifs known to regulate the transcription of SSP genes. This common regulatory framework comprises a composite box made of the GATA motifs and GCN4-like Motifs (GLMs) and was shown to be functional as the GLMs are able to bind a bZIP transcriptional factor SPA (Storage Protein Activator). In addition to this regulatory framework, each HMW-GS gene promoter had additional motifs organized differently. The promoters of most highly expressed x-type HMW-GS genes contain an additional box predicted to bind R2R3-MYB transcriptional factors. However, the differences in annotation between promoter alleles could not be related to their level of expression. In summary, we identified a common modular organization of HMW-GS gene promoters but the lack of correlation between the cis-motifs of each HMW-GS gene promoter and their level of expression suggests that other cis-elements or other mechanisms regulate HMW-GS gene expression.

  9. Prediction of tissue-specific cis-regulatory modules using Bayesian networks and regression trees

    Directory of Open Access Journals (Sweden)

    Chen Xiaoyu

    2007-12-01

    Full Text Available Abstract Background In vertebrates, a large part of gene transcriptional regulation is operated by cis-regulatory modules. These modules are believed to be regulating much of the tissue-specificity of gene expression. Results We develop a Bayesian network approach for identifying cis-regulatory modules likely to regulate tissue-specific expression. The network integrates predicted transcription factor binding site information, transcription factor expression data, and target gene expression data. At its core is a regression tree modeling the effect of combinations of transcription factors bound to a module. A new unsupervised EM-like algorithm is developed to learn the parameters of the network, including the regression tree structure. Conclusion Our approach is shown to accurately identify known human liver and erythroid-specific modules. When applied to the prediction of tissue-specific modules in 10 different tissues, the network predicts a number of important transcription factor combinations whose concerted binding is associated to specific expression.

  10. Direct functional consequences of ZRS enhancer mutation combine with secondary long range SHH signalling effects to cause preaxial polydactyly.

    Science.gov (United States)

    Johnson, Edward J; Neely, David M; Dunn, Ian C; Davey, Megan G

    2014-08-15

    Sonic hedgehog (SHH) plays a central role in patterning numerous embryonic tissues including, classically, the developing limb bud where it controls digit number and identity. This study utilises the polydactylous Silkie (Slk) chicken breed, which carries a mutation in the long range limb-specific regulatory element of SHH, the ZRS. Using allele specific SHH expression analysis combined with quantitative protein analysis, we measure allele specific changes in SHH mRNA and concentration of SHH protein over time. This confirms that the Slk ZRS enhancer mutation causes increased SHH expression in the posterior leg mesenchyme. Secondary consequences of this increased SHH signalling include increased FGF pathway signalling and growth as predicted by the SHH/GREM1/FGF feedback loop and the Growth/Morphogen models. Manipulation of Hedgehog, FGF signalling and growth demonstrate that anterior-ectopic expression of SHH and induction of preaxial polydactyly is induced secondary to increased SHH signalling and Hedgehog-dependent growth directed from the posterior limb. We predict that increased long range SHH signalling acts in combination with changes in activation of SHH transcription from the Slk ZRS allele. Through analysis of the temporal dynamics of anterior SHH induction we predict a gene regulatory network which may contribute to activation of anterior SHH expression from the Slk ZRS.

  11. Conservation of shh cis-regulatory architecture of the coelacanth is consistent with its ancestral phylogenetic position

    Directory of Open Access Journals (Sweden)

    Lang Michael

    2010-11-01

    Full Text Available Abstract Background The modern coelacanth (Latimeria is the extant taxon of a basal sarcopterygian lineage and sister group to tetrapods. Apart from certain apomorphic traits, its morphology is characterized by a high degree of retention of ancestral vertebrate structures and little morphological change. An insight into the molecular evolution that may explain the unchanged character of Latimeria morphology requires the analysis of the expression patterns of developmental regulator genes and their cis-regulatory modules (CRMs. Results We describe the comparative and functional analysis of the sonic hedgehog (shh genomic region of Latimeria menadoensis. Several putative enhancers in the Latimeria shh locus have been identified by comparisons to sarcopterygian and actinopterygian extant species. Specific sequence conservation with all known actinopterygian enhancer elements has been detected. However, these elements are selectively missing in more recently diverged actinopterygian and sarcopterygian species. The functionality of the putative Latimeria enhancers was confirmed by reporter gene expression analysis in transient transgenic zebrafish and chick embryos. Conclusions Latimeria shh CRMs represent the ancestral set of enhancers that have emerged before the split of lobe-finned and ray-finned fishes. In contrast to lineage-specific losses and differentiations in more derived lineages, Latimeria shh enhancers reveal low levels of sequence diversification. High overall sequence conservation of shh conserved noncoding elements (CNE is consistent with the general trend of high levels of conservation of noncoding DNA in the slowly evolving Latimeria genome.

  12. Expression-guided in silico evaluation of candidate cis regulatory codes for Drosophila muscle founder cells.

    Directory of Open Access Journals (Sweden)

    Anthony A Philippakis

    2006-05-01

    Full Text Available While combinatorial models of transcriptional regulation can be inferred for metazoan systems from a priori biological knowledge, validation requires extensive and time-consuming experimental work. Thus, there is a need for computational methods that can evaluate hypothesized cis regulatory codes before the difficult task of experimental verification is undertaken. We have developed a novel computational framework (termed "CodeFinder" that integrates transcription factor binding site and gene expression information to evaluate whether a hypothesized transcriptional regulatory model (TRM; i.e., a set of co-regulating transcription factors is likely to target a given set of co-expressed genes. Our basic approach is to simultaneously predict cis regulatory modules (CRMs associated with a given gene set and quantify the enrichment for combinatorial subsets of transcription factor binding site motifs comprising the hypothesized TRM within these predicted CRMs. As a model system, we have examined a TRM experimentally demonstrated to drive the expression of two genes in a sub-population of cells in the developing Drosophila mesoderm, the somatic muscle founder cells. This TRM was previously hypothesized to be a general mode of regulation for genes expressed in this cell population. In contrast, the present analyses suggest that a modified form of this cis regulatory code applies to only a subset of founder cell genes, those whose gene expression responds to specific genetic perturbations in a similar manner to the gene on which the original model was based. We have confirmed this hypothesis by experimentally discovering six (out of 12 tested new CRMs driving expression in the embryonic mesoderm, four of which drive expression in founder cells.

  13. Conserved cis-regulatory regions in a large genomic landscape control SHH and BMP-regulated Gremlin1 expression in mouse limb buds

    Directory of Open Access Journals (Sweden)

    Zuniga Aimée

    2012-08-01

    Full Text Available Abstract Background Mouse limb bud is a prime model to study the regulatory interactions that control vertebrate organogenesis. Major aspects of limb bud development are controlled by feedback loops that define a self-regulatory signalling system. The SHH/GREM1/AER-FGF feedback loop forms the core of this signalling system that operates between the posterior mesenchymal organiser and the ectodermal signalling centre. The BMP antagonist Gremlin1 (GREM1 is a critical node in this system, whose dynamic expression is controlled by BMP, SHH, and FGF signalling and key to normal progression of limb bud development. Previous analysis identified a distant cis-regulatory landscape within the neighbouring Formin1 (Fmn1 locus that is required for Grem1 expression, reminiscent of the genomic landscapes controlling HoxD and Shh expression in limb buds. Results Three highly conserved regions (HMCO1-3 were identified within the previously defined critical genomic region and tested for their ability to regulate Grem1 expression in mouse limb buds. Using a combination of BAC and conventional transgenic approaches, a 9 kb region located ~70 kb downstream of the Grem1 transcription unit was identified. This region, termed Grem1 Regulatory Sequence 1 (GRS1, is able to recapitulate major aspects of Grem1 expression, as it drives expression of a LacZ reporter into the posterior and, to a lesser extent, in the distal-anterior mesenchyme. Crossing the GRS1 transgene into embryos with alterations in the SHH and BMP pathways established that GRS1 depends on SHH and is modulated by BMP signalling, i.e. integrates inputs from these pathways. Chromatin immunoprecipitation revealed interaction of endogenous GLI3 proteins with the core cis-regulatory elements in the GRS1 region. As GLI3 is a mediator of SHH signal transduction, these results indicated that SHH directly controls Grem1 expression through the GRS1 region. Finally, all cis-regulatory regions within the Grem1

  14. Rapid evolution of cis-regulatory sequences via local point mutations

    Science.gov (United States)

    Stone, J. R.; Wray, G. A.

    2001-01-01

    Although the evolution of protein-coding sequences within genomes is well understood, the same cannot be said of the cis-regulatory regions that control transcription. Yet, changes in gene expression are likely to constitute an important component of phenotypic evolution. We simulated the evolution of new transcription factor binding sites via local point mutations. The results indicate that new binding sites appear and become fixed within populations on microevolutionary timescales under an assumption of neutral evolution. Even combinations of two new binding sites evolve very quickly. We predict that local point mutations continually generate considerable genetic variation that is capable of altering gene expression.

  15. Plasticity of the cis-regulatory input function of a gene.

    Directory of Open Access Journals (Sweden)

    Avraham E Mayo

    2006-04-01

    Full Text Available The transcription rate of a gene is often controlled by several regulators that bind specific sites in the gene's cis-regulatory region. The combined effect of these regulators is described by a cis-regulatory input function. What determines the form of an input function, and how variable is it with respect to mutations? To address this, we employ the well-characterized lac operon of Escherichia coli, which has an elaborate input function, intermediate between Boolean AND-gate and OR-gate logic. We mapped in detail the input function of 12 variants of the lac promoter, each with different point mutations in the regulator binding sites, by means of accurate expression measurements from living cells. We find that even a few mutations can significantly change the input function, resulting in functions that resemble Pure AND gates, OR gates, or single-input switches. Other types of gates were not found. The variant input functions can be described in a unified manner by a mathematical model. The model also lets us predict which functions cannot be reached by point mutations. The input function that we studied thus appears to be plastic, in the sense that many of the mutations do not ruin the regulation completely but rather result in new ways to integrate the inputs.

  16. Establishment of the methods for searching eukaryotic gene cis-regulatory modules.

    Science.gov (United States)

    Zhong, Dong; Zhang, Zhen-shu; Liu, Yu-hu; Zheng, Guo-qing; Liu, Xiao-yi; Lu, Yang; Zhao, Gui-jun; Xu, An-long

    2004-02-01

    On the basis of the knowledge of eukaryotic gene regulation, we modified the method in three aspects: (1) Searching the cis-regulatory modules (CRM) according Fasta or Blast sequence with multiple sequence and low E value, followed by mutual scoring of these sequence with Smith-Waterman algorithms and finally by clustering analysis; (2) Searching the transcription factor-binding site using International Union of Pure and Applied Chemistry, Position-Weight Matrix(PWM) and Dyed method; (3) Designing and implementation of data analysis based on the software in Windows 2000 and UNIX using object-oriented technology. The results of analysis of the major histocompatibility complex gene family show that this procedure may accurately locate the regions that contain some of the CRMs.

  17. Alignment and prediction of cis-regulatory modules based on a probabilistic model of evolution.

    Science.gov (United States)

    He, Xin; Ling, Xu; Sinha, Saurabh

    2009-03-01

    Cross-species comparison has emerged as a powerful paradigm for predicting cis-regulatory modules (CRMs) and understanding their evolution. The comparison requires reliable sequence alignment, which remains a challenging task for less conserved noncoding sequences. Furthermore, the existing models of DNA sequence evolution generally do not explicitly treat the special properties of CRM sequences. To address these limitations, we propose a model of CRM evolution that captures different modes of evolution of functional transcription factor binding sites (TFBSs) and the background sequences. A particularly novel aspect of our work is a probabilistic model of gains and losses of TFBSs, a process being recognized as an important part of regulatory sequence evolution. We present a computational framework that uses this model to solve the problems of CRM alignment and prediction. Our alignment method is similar to existing methods of statistical alignment but uses the conserved binding sites to improve alignment. Our CRM prediction method deals with the inherent uncertainties of binding site annotations and sequence alignment in a probabilistic framework. In simulated as well as real data, we demonstrate that our program is able to improve both alignment and prediction of CRM sequences over several state-of-the-art methods. Finally, we used alignments produced by our program to study binding site conservation in genome-wide binding data of key transcription factors in the Drosophila blastoderm, with two intriguing results: (i) the factor-bound sequences are under strong evolutionary constraints even if their neighboring genes are not expressed in the blastoderm and (ii) binding sites in distal bound sequences (relative to transcription start sites) tend to be more conserved than those in proximal regions. Our approach is implemented as software, EMMA (Evolutionary Model-based cis-regulatory Module Analysis), ready to be applied in a broad biological context.

  18. Alignment and prediction of cis-regulatory modules based on a probabilistic model of evolution.

    Directory of Open Access Journals (Sweden)

    Xin He

    2009-03-01

    Full Text Available Cross-species comparison has emerged as a powerful paradigm for predicting cis-regulatory modules (CRMs and understanding their evolution. The comparison requires reliable sequence alignment, which remains a challenging task for less conserved noncoding sequences. Furthermore, the existing models of DNA sequence evolution generally do not explicitly treat the special properties of CRM sequences. To address these limitations, we propose a model of CRM evolution that captures different modes of evolution of functional transcription factor binding sites (TFBSs and the background sequences. A particularly novel aspect of our work is a probabilistic model of gains and losses of TFBSs, a process being recognized as an important part of regulatory sequence evolution. We present a computational framework that uses this model to solve the problems of CRM alignment and prediction. Our alignment method is similar to existing methods of statistical alignment but uses the conserved binding sites to improve alignment. Our CRM prediction method deals with the inherent uncertainties of binding site annotations and sequence alignment in a probabilistic framework. In simulated as well as real data, we demonstrate that our program is able to improve both alignment and prediction of CRM sequences over several state-of-the-art methods. Finally, we used alignments produced by our program to study binding site conservation in genome-wide binding data of key transcription factors in the Drosophila blastoderm, with two intriguing results: (i the factor-bound sequences are under strong evolutionary constraints even if their neighboring genes are not expressed in the blastoderm and (ii binding sites in distal bound sequences (relative to transcription start sites tend to be more conserved than those in proximal regions. Our approach is implemented as software, EMMA (Evolutionary Model-based cis-regulatory Module Analysis, ready to be applied in a broad biological context.

  19. In silico evolution of the hunchback gene indicates redundancy in cis-regulatory organization and spatial gene expression

    Science.gov (United States)

    Zagrijchuk, Elizaveta A.; Sabirov, Marat A.; Holloway, David M.; Spirov, Alexander V.

    2014-01-01

    Biological development depends on the coordinated expression of genes in time and space. Developmental genes have extensive cis-regulatory regions which control their expression. These regions are organized in a modular manner, with different modules controlling expression at different times and locations. Both how modularity evolved and what function it serves are open questions. We present a computational model for the cis-regulation of the hunchback (hb) gene in the fruit fly (Drosophila). We simulate evolution (using an evolutionary computation approach from computer science) to find the optimal cis-regulatory arrangements for fitting experimental hb expression patterns. We find that the cis-regulatory region tends to readily evolve modularity. These cis-regulatory modules (CRMs) do not tend to control single spatial domains, but show a multi-CRM/multi-domain correspondence. We find that the CRM-domain correspondence seen in Drosophila evolves with a high probability in our model, supporting the biological relevance of the approach. The partial redundancy resulting from multi-CRM control may confer some biological robustness against corruption of regulatory sequences. The technique developed on hb could readily be applied to other multi-CRM developmental genes. PMID:24712536

  20. In silico evolution of the hunchback gene indicates redundancy in cis-regulatory organization and spatial gene expression.

    Science.gov (United States)

    Zagrijchuk, Elizaveta A; Sabirov, Marat A; Holloway, David M; Spirov, Alexander V

    2014-04-01

    Biological development depends on the coordinated expression of genes in time and space. Developmental genes have extensive cis-regulatory regions which control their expression. These regions are organized in a modular manner, with different modules controlling expression at different times and locations. Both how modularity evolved and what function it serves are open questions. We present a computational model for the cis-regulation of the hunchback (hb) gene in the fruit fly (Drosophila). We simulate evolution (using an evolutionary computation approach from computer science) to find the optimal cis-regulatory arrangements for fitting experimental hb expression patterns. We find that the cis-regulatory region tends to readily evolve modularity. These cis-regulatory modules (CRMs) do not tend to control single spatial domains, but show a multi-CRM/multi-domain correspondence. We find that the CRM-domain correspondence seen in Drosophila evolves with a high probability in our model, supporting the biological relevance of the approach. The partial redundancy resulting from multi-CRM control may confer some biological robustness against corruption of regulatory sequences. The technique developed on hb could readily be applied to other multi-CRM developmental genes.

  1. New cis-regulatory elements in the Rht-D1b locus region of wheat

    Science.gov (United States)

    Fifteen gene-containing BACs with accumulated length of 1.82-Mb from the Rht-D1b locus region weresequenced and compared in detail with the orthologous regions of rice, sorghum, and maize. Our results show that Rht-D1b represents a conserved genomic region as implied by high gene sequence identity...

  2. cis-Regulatory control of three cell fate-specific genes in vulval organogenesis of Caenorhabditis elegans and C. briggsae.

    Science.gov (United States)

    Kirouac, Martha; Sternberg, Paul W

    2003-05-01

    The great-grandprogeny of the Caenorhabditis elegans vulval precursor cells (VPCs) adopt one of the final vulA, B1, B2, C, D, E, and F cell fates in a precise spatial pattern. This pattern of vulval cell types is likely to depend on the cis-regulatory regions of the transcriptional targets of intercellular signals in vulval development. egl-17, zmp-1, and cdh-3 are expressed differentially in the developing vulva cells, providing a potential readout for different signaling pathways. To understand how such pathways interact to specify unique vulval cell types in a precise pattern, we have identified cis-regulatory regions sufficient to confer vulval cell type-specific regulation when fused in cis to the basal pes-10 promoter. We have identified the C. briggsae homologs of these three genes, with their corresponding control regions, and tested these regions in both C. elegans and C. briggsae. These regions of similarity in C. elegans and C. briggsae upstream of egl-17, zmp-1, and cdh-3 promote expression in vulval cells and the anchor cell (AC). By using the cis-regulatory analysis and phylogenetic footprinting, we have identified overrepresented sequences involved in conferring vulval and AC expression.

  3. Shh and ZRS enhancer colocalisation is specific to the zone of polarising activity.

    Science.gov (United States)

    Williamson, Iain; Lettice, Laura A; Hill, Robert E; Bickmore, Wendy A

    2016-08-15

    Limb-specific Shh expression is regulated by the (∼1 Mb distant) ZRS enhancer. In the mouse, limb bud-restricted spatiotemporal Shh expression occurs from ∼E10 to E11.5 at the distal posterior margin and is essential for correct autopod formation. Here, we have analysed the higher-order chromatin conformation of Shh in expressing and non-expressing tissues, both by fluorescence in situ hybridisation (FISH) and by chromosome conformation capture (5C). Conventional and super-resolution light microscopy identified significantly elevated frequencies of Shh/ZRS colocalisation only in the Shh-expressing regions of the limb bud, in a conformation consistent with enhancer-promoter loop formation. However, in all tissues and at all developmental stages analysed, Shh-ZRS spatial distances were still consistently shorter than those to a neural enhancer located between Shh and ZRS in the genome. 5C identified a topologically associating domain (TAD) over the Shh/ZRS genomic region and enriched interactions between Shh and ZRS throughout E11.5 embryos. Shh/ZRS colocalisation, therefore, correlates with the spatiotemporal domain of limb bud-specific Shh expression, but close Shh and ZRS proximity in the nucleus occurs regardless of whether the gene or enhancer is active. We suggest that this constrained chromatin configuration optimises the opportunity for the active enhancer to locate and instigate the expression of Shh.

  4. Identification of High-Impact cis-Regulatory Mutations Using Transcription Factor Specific Random Forest Models.

    Directory of Open Access Journals (Sweden)

    Dmitry Svetlichnyy

    2015-11-01

    Full Text Available Cancer genomes contain vast amounts of somatic mutations, many of which are passenger mutations not involved in oncogenesis. Whereas driver mutations in protein-coding genes can be distinguished from passenger mutations based on their recurrence, non-coding mutations are usually not recurrent at the same position. Therefore, it is still unclear how to identify cis-regulatory driver mutations, particularly when chromatin data from the same patient is not available, thus relying only on sequence and expression information. Here we use machine-learning methods to predict functional regulatory regions using sequence information alone, and compare the predicted activity of the mutated region with the reference sequence. This way we define the Predicted Regulatory Impact of a Mutation in an Enhancer (PRIME. We find that the recently identified driver mutation in the TAL1 enhancer has a high PRIME score, representing a "gain-of-target" for MYB, whereas the highly recurrent TERT promoter mutation has a surprisingly low PRIME score. We trained Random Forest models for 45 cancer-related transcription factors, and used these to score variations in the HeLa genome and somatic mutations across more than five hundred cancer genomes. Each model predicts only a small fraction of non-coding mutations with a potential impact on the function of the encompassing regulatory region. Nevertheless, as these few candidate driver mutations are often linked to gains in chromatin activity and gene expression, they may contribute to the oncogenic program by altering the expression levels of specific oncogenes and tumor suppressor genes.

  5. Predicting tissue specific cis-regulatory modules in the human genome using pairs of co-occurring motifs

    Directory of Open Access Journals (Sweden)

    Girgis Hani Z

    2012-02-01

    Full Text Available Abstract Background Researchers seeking to unlock the genetic basis of human physiology and diseases have been studying gene transcription regulation. The temporal and spatial patterns of gene expression are controlled by mainly non-coding elements known as cis-regulatory modules (CRMs and epigenetic factors. CRMs modulating related genes share the regulatory signature which consists of transcription factor (TF binding sites (TFBSs. Identifying such CRMs is a challenging problem due to the prohibitive number of sequence sets that need to be analyzed. Results We formulated the challenge as a supervised classification problem even though experimentally validated CRMs were not required. Our efforts resulted in a software system named CrmMiner. The system mines for CRMs in the vicinity of related genes. CrmMiner requires two sets of sequences: a mixed set and a control set. Sequences in the vicinity of the related genes comprise the mixed set, whereas the control set includes random genomic sequences. CrmMiner assumes that a large percentage of the mixed set is made of background sequences that do not include CRMs. The system identifies pairs of closely located motifs representing vertebrate TFBSs that are enriched in the training mixed set consisting of 50% of the gene loci. In addition, CrmMiner selects a group of the enriched pairs to represent the tissue-specific regulatory signature. The mixed and the control sets are searched for candidate sequences that include any of the selected pairs. Next, an optimal Bayesian classifier is used to distinguish candidates found in the mixed set from their control counterparts. Our study proposes 62 tissue-specific regulatory signatures and putative CRMs for different human tissues and cell types. These signatures consist of assortments of ubiquitously expressed TFs and tissue-specific TFs. Under controlled settings, CrmMiner identified known CRMs in noisy sets up to 1:25 signal-to-noise ratio. CrmMiner was

  6. Comparative genome sequencing of Drosophila pseudoobscura: Chromosomal, gene, and cis-element evolution

    DEFF Research Database (Denmark)

    Richards, Stephen; Liu, Yue; Bettencourt, Brian R.;

    2005-01-01

    between the species-but the difference is slight, suggesting that the evolution of cis-regulatory elements is flexible. Overall, a pattern of repeat-mediated chromosomal rearrangement, and high coadaptation of both male genes and cis-regulatory sequences emerges as important themes of genome divergence...

  7. A specific mutation in the distant sonic hedgehog (SHH) cis-regulator (ZRS) causes Werner mesomelic syndrome (WMS) while complete ZRS duplications underlie Haas type polysyndactyly and preaxial polydactyly (PPD) with or without triphalangeal thumb.

    Science.gov (United States)

    Wieczorek, Dagmar; Pawlik, Barbara; Li, Yun; Akarsu, Nurten A; Caliebe, Almuth; May, Klaus J W; Schweiger, Bernd; Vargas, Fernando R; Balci, Sevim; Gillessen-Kaesbach, Gabriele; Wollnik, Bernd

    2010-01-01

    Werner mesomelic syndrome (WMS) is an autosomal dominant disorder with unknown molecular etiology characterized by hypo- or aplasia of the tibiae in addition to the preaxial polydactyly (PPD) of the hands and feet and/or five-fingered hand with absence of thumbs. We show that point mutations of a specific nucleotide within the sonic hedgehog (SHH) regulatory region (ZRS) cause WMS. In a previously unpublished WMS family, we identified the causative G>A transition at position 404 of the ZRS, and in six affected family members of a second WMS family we found a 404G>C mutation of the ZRS. The 404G>A ZRS mutation is known as the "Cuban mutation" of PPD type II (PPD2). Interestingly, the index patient of that family had tibial hypoplasia as well. These data provide the first evidence that WMS is caused by a specific ZRS mutation, which leads to strong ectopic SHH expression. In contrast, we show that complete duplications of the ZRS region lead to type Haas polysyndactyly or triphalangeal thumb-polysyndactyly syndrome, but do not affect lower limb development. We suggest the term "ZRS-associated syndromes" and a clinical subclassification for the continuum of limb malformations caused by different molecular alterations of the ZRS.

  8. Mapping cis-Regulatory Domains in the Human Genome UsingMulti-Species Conservation of Synteny

    Energy Technology Data Exchange (ETDEWEB)

    Ahituv, Nadav; Prabhakar, Shyam; Poulin, Francis; Rubin, EdwardM.; Couronne, Olivier

    2005-06-13

    Our inability to associate distant regulatory elements with the genes that they regulate has largely precluded their examination for sequence alterations contributing to human disease. One major obstacle is the large genomic space surrounding targeted genes in which such elements could potentially reside. In order to delineate gene regulatory boundaries we used whole-genome human-mouse-chicken (HMC) and human-mouse-frog (HMF) multiple alignments to compile conserved blocks of synteny (CBS), under the hypothesis that these blocks have been kept intact throughout evolution at least in part by the requirement of regulatory elements to stay linked to the genes that they regulate. A total of 2,116 and 1,942 CBS>200 kb were assembled for HMC and HMF respectively, encompassing 1.53 and 0.86 Gb of human sequence. To support the existence of complex long-range regulatory domains within these CBS we analyzed the prevalence and distribution of chromosomal aberrations leading to position effects (disruption of a genes regulatory environment), observing a clear bias not only for mapping onto CBS but also for longer CBS size. Our results provide a genome wide data set characterizing the regulatory domains of genes and the conserved regulatory elements within them.

  9. Ancient polymorphism and functional variation in the primate MHC-DQA1 5' cis-regulatory region.

    Science.gov (United States)

    Loisel, Dagan A; Rockman, Matthew V; Wray, Gregory A; Altmann, Jeanne; Alberts, Susan C

    2006-10-31

    Precise regulation of MHC gene expression is critical to vertebrate immune surveillance and response. Polymorphisms in the 5' proximal promoter region of the human class II gene HLA-DQA1 have been shown to influence its transcriptional regulation and may contribute to the pathogenesis of autoimmune diseases. We investigated the evolutionary history of this cis-regulatory region by sequencing the DQA1 5' proximal promoter region in eight nonhuman primate species. We observed unexpectedly high levels of sequence variation and multiple strong signatures of balancing selection in this region. Specifically, the considerable DQA1 promoter region diversity was characterized by abundant shared (or trans-species) polymorphism and a pronounced lack of fixed differences between species. The majority of transcription factor binding sites in the DQA1 promoter region were polymorphic within species, and these binding site polymorphisms were commonly shared among multiple species despite evidence for negative selection eliminating a significant fraction of binding site mutations. We assessed the functional consequences of intraspecific promoter region diversity using a cell line-based reporter assay and detected significant differences among baboon DQA1 promoter haplotypes in their ability to drive transcription in vitro. The functional differentiation of baboon promoter haplotypes, together with the significant deviations from neutral sequence evolution, suggests a role for balancing selection in the evolution of DQA1 transcriptional regulation in primates.

  10. Does positive selection drive transcription factor binding site turnover? A test with Drosophila cis-regulatory modules.

    Directory of Open Access Journals (Sweden)

    Bin Z He

    2011-04-01

    Full Text Available Transcription factor binding site(s (TFBS gain and loss (i.e., turnover is a well-documented feature of cis-regulatory module (CRM evolution, yet little attention has been paid to the evolutionary force(s driving this turnover process. The predominant view, motivated by its widespread occurrence, emphasizes the importance of compensatory mutation and genetic drift. Positive selection, in contrast, although it has been invoked in specific instances of adaptive gene expression evolution, has not been considered as a general alternative to neutral compensatory evolution. In this study we evaluate the two hypotheses by analyzing patterns of single nucleotide polymorphism in the TFBS of well-characterized CRM in two closely related Drosophila species, Drosophila melanogaster and Drosophila simulans. An important feature of the analysis is classification of TFBS mutations according to the direction of their predicted effect on binding affinity, which allows gains and losses to be evaluated independently along the two phylogenetic lineages. The observed patterns of polymorphism and divergence are not compatible with neutral evolution for either class of mutations. Instead, multiple lines of evidence are consistent with contributions of positive selection to TFBS gain and loss as well as purifying selection in its maintenance. In discussion, we propose a model to reconcile the finding of selection driving TFBS turnover with constrained CRM function over long evolutionary time.

  11. Comparative epigenomics in distantly related teleost species identifies conserved cis-regulatory nodes active during the vertebrate phylotypic period

    Science.gov (United States)

    Tena, Juan J.; González-Aguilera, Cristina; Fernández-Miñán, Ana; Vázquez-Marín, Javier; Parra-Acero, Helena; Cross, Joe W.; Rigby, Peter W.J.; Carvajal, Jaime J.; Wittbrodt, Joachim; Gómez-Skarmeta, José L.; Martínez-Morales, Juan R.

    2014-01-01

    The complex relationship between ontogeny and phylogeny has been the subject of attention and controversy since von Baer’s formulations in the 19th century. The classic concept that embryogenesis progresses from clade general features to species-specific characters has often been revisited. It has become accepted that embryos from a clade show maximum morphological similarity at the so-called phylotypic period (i.e., during mid-embryogenesis). According to the hourglass model, body plan conservation would depend on constrained molecular mechanisms operating at this period. More recently, comparative transcriptomic analyses have provided conclusive evidence that such molecular constraints exist. Examining cis-regulatory architecture during the phylotypic period is essential to understand the evolutionary source of body plan stability. Here we compare transcriptomes and key epigenetic marks (H3K4me3 and H3K27ac) from medaka (Oryzias latipes) and zebrafish (Danio rerio), two distantly related teleosts separated by an evolutionary distance of 115–200 Myr. We show that comparison of transcriptome profiles correlates with anatomical similarities and heterochronies observed at the phylotypic stage. Through comparative epigenomics, we uncover a pool of conserved regulatory regions (≈700), which are active during the vertebrate phylotypic period in both species. Moreover, we show that their neighboring genes encode mainly transcription factors with fundamental roles in tissue specification. We postulate that these regulatory regions, active in both teleost genomes, represent key constrained nodes of the gene networks that sustain the vertebrate body plan. PMID:24709821

  12. Cis-regulatory underpinnings of human GLI3 expression in embryonic craniofacial structures and internal organs.

    Science.gov (United States)

    Abbasi, Amir A; Minhas, Rashid; Schmidt, Ansgar; Koch, Sabine; Grzeschik, Karl-Heinz

    2013-10-01

    The zinc finger transcription factor Gli3 is an important mediator of Sonic hedgehog (Shh) signaling. During early embryonic development Gli3 participates in patterning and growth of the central nervous system, face, skeleton, limb, tooth and gut. Precise regulation of the temporal and spatial expression of Gli3 is crucial for the proper specification of these structures in mammals and other vertebrates. Previously we reported a set of human intronic cis-regulators controlling almost the entire known repertoire of endogenous Gli3 expression in mouse neural tube and limbs. However, the genetic underpinning of GLI3 expression in other embryonic domains such as craniofacial structures and internal organs remain elusive. Here we demonstrate in a transgenic mice assay the potential of a subset of human/fish conserved non-coding sequences (CNEs) residing within GLI3 intronic intervals to induce reporter gene expression at known regions of endogenous Gli3 transcription in embryonic domains other than central nervous system (CNS) and limbs. Highly specific reporter expression was observed in craniofacial structures, eye, gut, and genitourinary system. Moreover, the comparison of expression patterns directed by these intronic cis-acting regulatory elements in mouse and zebrafish embryos suggests that in accordance with sequence conservation, the target site specificity of a subset of these elements remains preserved among these two lineages. Taken together with our recent investigations, it is proposed here that during vertebrate evolution the Gli3 expression control acquired multiple, independently acting, intronic enhancers for spatiotemporal patterning of CNS, limbs, craniofacial structures and internal organs.

  13. Network discovery pipeline elucidates conserved time-of-day-specific cis-regulatory modules.

    Directory of Open Access Journals (Sweden)

    Todd P Michael

    2008-02-01

    Full Text Available Correct daily phasing of transcription confers an adaptive advantage to almost all organisms, including higher plants. In this study, we describe a hypothesis-driven network discovery pipeline that identifies biologically relevant patterns in genome-scale data. To demonstrate its utility, we analyzed a comprehensive matrix of time courses interrogating the nuclear transcriptome of Arabidopsis thaliana plants grown under different thermocycles, photocycles, and circadian conditions. We show that 89% of Arabidopsis transcripts cycle in at least one condition and that most genes have peak expression at a particular time of day, which shifts depending on the environment. Thermocycles alone can drive at least half of all transcripts critical for synchronizing internal processes such as cell cycle and protein synthesis. We identified at least three distinct transcription modules controlling phase-specific expression, including a new midnight specific module, PBX/TBX/SBX. We validated the network discovery pipeline, as well as the midnight specific module, by demonstrating that the PBX element was sufficient to drive diurnal and circadian condition-dependent expression. Moreover, we show that the three transcription modules are conserved across Arabidopsis, poplar, and rice. These results confirm the complex interplay between thermocycles, photocycles, and the circadian clock on the daily transcription program, and provide a comprehensive view of the conserved genomic targets for a transcriptional network key to successful adaptation.

  14. Changes in cis-regulatory elements of a key floral regulator are associated with divergence of inflorescence architectures

    NARCIS (Netherlands)

    Kusters, E.; Della Pina, S.; Castel, R.; Souer, E.; Koes, R.

    2015-01-01

    Higher plant species diverged extensively with regard to the moment (flowering time) and position (inflorescence architecture) at which flowers are formed. This seems largely caused by variation in the expression patterns of conserved genes that specify floral meristem identity (FMI), rather than ch

  15. Expression, subcellular localization, and cis-regulatory structure of duplicated phytoene synthase genes in melon (Cucumis melo L.).

    Science.gov (United States)

    Qin, Xiaoqiong; Coku, Ardian; Inoue, Kentaro; Tian, Li

    2011-10-01

    Carotenoids perform many critical functions in plants, animals, and humans. It is therefore important to understand carotenoid biosynthesis and its regulation in plants. Phytoene synthase (PSY) catalyzes the first committed and rate-limiting step in carotenoid biosynthesis. While PSY is present as a single copy gene in Arabidopsis, duplicated PSY genes have been identified in many economically important monocot and dicot crops. CmPSY1 was previously identified from melon (Cucumis melo L.), but was not functionally characterized. We isolated a second PSY gene, CmPSY2, from melon in this work. CmPSY2 possesses a unique intron/exon structure that has not been observed in other plant PSYs. Both CmPSY1 and CmPSY2 are functional in vitro, but exhibit distinct expression patterns in different melon tissues and during fruit development, suggesting differential regulation of the duplicated melon PSY genes. In vitro chloroplast import assays verified the plastidic localization of CmPSY1 and CmPSY2 despite the lack of an obvious plastid target peptide in CmPSY2. Promoter motif analysis of the duplicated melon and tomato PSY genes and the Arabidopsis PSY revealed distinctive cis-regulatory structures of melon PSYs and identified gibberellin-responsive motifs in all PSYs except for SlPSY1, which has not been reported previously. Overall, these data provide new insights into the evolutionary history of plant PSY genes and the regulation of PSY expression by developmental and environmental signals that may involve different regulatory networks.

  16. Cis-regulatory variants affect CHRNA5 mRNA expression in populations of African and European ancestry.

    Directory of Open Access Journals (Sweden)

    Jen-Chyong Wang

    Full Text Available Variants within the gene cluster encoding α3, α5, and β4 nicotinic receptor subunits are major risk factors for substance dependence. The strongest impact on risk is associated with variation in the CHRNA5 gene, where at least two mechanisms are at work: amino acid variation and altered mRNA expression levels. The risk allele of the non-synonymous variant (rs16969968; D398N primarily occurs on the haplotype containing the low mRNA expression allele. In populations of European ancestry, there are approximately 50 highly correlated variants in the CHRNA5-CHRNA3-CHRNB4 gene cluster and the adjacent PSMA4 gene region that are associated with CHRNA5 mRNA levels. It is not clear which of these variants contribute to the changes in CHRNA5 transcript level. Because populations of African ancestry have reduced linkage disequilibrium among variants spanning this gene cluster, eQTL mapping in subjects of African ancestry could potentially aid in defining the functional variants that affect CHRNA5 mRNA levels. We performed quantitative allele specific gene expression using frontal cortices derived from 49 subjects of African ancestry and 111 subjects of European ancestry. This method measures allele-specific transcript levels in the same individual, which eliminates other biological variation that occurs when comparing expression levels between different samples. This analysis confirmed that substance dependence associated variants have a direct cis-regulatory effect on CHRNA5 transcript levels in human frontal cortices of African and European ancestry and identified 10 highly correlated variants, located in a 9 kb region, that are potential functional variants modifying CHRNA5 mRNA expression levels.

  17. Shh and ZRS enhancer colocalisation is specific to the zone of polarising activity

    OpenAIRE

    Williamson, Iain; Lettice, Laura A.; Hill, Robert E.; Bickmore, Wendy A

    2016-01-01

    Limb-specific Shh expression is regulated by the (∼1 Mb distant) ZRS enhancer. In the mouse, limb bud-restricted spatiotemporal Shh expression occurs from ∼E10 to E11.5 at the distal posterior margin and is essential for correct autopod formation. Here, we have analysed the higher-order chromatin conformation of Shh in expressing and non-expressing tissues, both by fluorescence in situ hybridisation (FISH) and by chromosome conformation capture (5C). Conventional and super-resolution light mi...

  18. Genome-wide identification of enhancer elements.

    Science.gov (United States)

    Tulin, Sarah; Barsi, Julius C; Bocconcelli, Carlo; Smith, Joel

    2016-01-01

    We present a prospective genome-wide regulatory element database for the sea urchin embryo and the modified chromosome capture-related methodology used to create it. The method we developed is termed GRIP-seq for genome-wide regulatory element immunoprecipitation and combines features of chromosome conformation capture, chromatin immunoprecipitation, and paired-end next-generation sequencing with molecular steps that enrich for active cis-regulatory elements associated with basal transcriptional machinery. The first GRIP-seq database, available to the community, comes from S. purpuratus 24 hpf embryos and takes advantage of the extremely well-characterized cis-regulatory elements in this system for validation. In addition, using the GRIP-seq database, we identify and experimentally validate a novel, intronic cis-regulatory element at the onecut locus. We find GRIP-seq signal sensitively identifies active cis-regulatory elements with a high signal-to-noise ratio for both distal and intronic elements. This promising GRIP-seq protocol has the potential to address a rate-limiting step in resolving comprehensive, predictive network models in all systems.

  19. Microduplications encompassing the Sonic Hedgehog Limb Enhancer ZRS are Associated with Haas Type Polysyndactyly and Laurin-Sandrow Syndrome

    DEFF Research Database (Denmark)

    Lohan, Silke; Spielmann, Malte; Doelken, Sandra C

    2014-01-01

    with Haas type polysyndactyly (HTS) regarding the digital phenotype. Here we report on five unrelated families with overlapping microduplications encompassing the Sonic hedgehog (SHH) limb enhancer ZRS on chromosome 7q36. Clinically, the patients show polysyndactyly phenotypes and various types of lower...

  20. A cis-regulatory mutation in troponin-I of Drosophila reveals the importance of proper stoichiometry of structural proteins during muscle assembly.

    Science.gov (United States)

    Firdaus, Hena; Mohan, Jayaram; Naz, Sarwat; Arathi, Prabhashankar; Ramesh, Saraf R; Nongthomba, Upendra

    2015-05-01

    Rapid and high wing-beat frequencies achieved during insect flight are powered by the indirect flight muscles, the largest group of muscles present in the thorax. Any anomaly during the assembly and/or structural impairment of the indirect flight muscles gives rise to a flightless phenotype. Multiple mutagenesis screens in Drosophila melanogaster for defective flight behavior have led to the isolation and characterization of mutations that have been instrumental in the identification of many proteins and residues that are important for muscle assembly, function, and disease. In this article, we present a molecular-genetic characterization of a flightless mutation, flightless-H (fliH), originally designated as heldup-a (hdp-a). We show that fliH is a cis-regulatory mutation of the wings up A (wupA) gene, which codes for the troponin-I protein, one of the troponin complex proteins, involved in regulation of muscle contraction. The mutation leads to reduced levels of troponin-I transcript and protein. In addition to this, there is also coordinated reduction in transcript and protein levels of other structural protein isoforms that are part of the troponin complex. The altered transcript and protein stoichiometry ultimately culminates in unregulated acto-myosin interactions and a hypercontraction muscle phenotype. Our results shed new insights into the importance of maintaining the stoichiometry of structural proteins during muscle assembly for proper function with implications for the identification of mutations and disease phenotypes in other species, including humans.

  1. Cis-regulatory control of the nuclear receptor Coup-TF gene in the sea urchin Paracentrotus lividus embryo.

    Directory of Open Access Journals (Sweden)

    Lamprini G Kalampoki

    Full Text Available Coup-TF, an orphan member of the nuclear receptor super family, has a fundamental role in the development of metazoan embryos. The study of the gene's regulatory circuit in the sea urchin embryo will facilitate the placement of this transcription factor in the well-studied embryonic Gene Regulatory Network (GRN. The Paracentrotus lividus Coup-TF gene (PlCoup-TF is expressed throughout embryonic development preferentially in the oral ectoderm of the gastrula and the ciliary band of the pluteus stage. Two overlapping λ genomic clones, containing three exons and upstream sequences of PlCoup-TF, were isolated from a genomic library. The transcription initiation site was determined and 5' deletions and individual segments of a 1930 bp upstream region were placed ahead of a GFP reporter cassette and injected into fertilized P.lividus eggs. Module a (-532 to -232, was necessary and sufficient to confer ciliary band expression to the reporter. Comparison of P.lividus and Strongylocentrotus purpuratus upstream Coup-TF sequences, revealed considerable conservation, but none within module a. 5' and internal deletions into module a, defined a smaller region that confers ciliary band specific expression. Putative regulatory cis-acting elements (RE1, RE2 and RE3 within module a, were specifically bound by proteins in sea urchin embryonic nuclear extracts. Site-specific mutagenesis of these elements resulted in loss of reporter activity (RE1 or ectopic expression (RE2, RE3. It is proposed that sea urchin transcription factors, which bind these three regulatory sites, are necessary for spatial and quantitative regulation of the PlCoup-TF gene at pluteus stage sea urchin embryos. These findings lead to the future identification of these factors and to the hierarchical positioning of PlCoup-TF within the embryonic GRN.

  2. A novel mutation in the SHH long-range regulator (ZRS) is associated with preaxial polydactyly, triphalangeal thumb, and severe radial ray deficiency.

    Science.gov (United States)

    Al-Qattan, Mohammad M; Al Abdulkareem, Ibrahim; Al Haidan, Yazied; Al Balwi, Mohammed

    2012-10-01

    Sonic Hedgehog (SHH) within the posteriorly located zone of polarizing activity is the main controller of the antero-posterior axis of limb development. The ZRS (zone of polarizing activity regulatory sequence) is a long-range limb-specific SHH enhancer. Several point mutations in the ZRS have been described in humans. These mutations cause enhanced SHH activity and ectopic anterior expression of SHH and a variable phenotype of preaxial polydactyly and triphalangeal thumb. Absent thumb or radius has not been reported with ZRS mutations. Here, we report on a family with a variable phenotype of preaxial polydactyly as well as absent thumb and radius, with kidney and cardiac defects. The family was screened for SALL1, SALL4, and TBX5 mutations, but all were normal. Finally, they were screened for ZRS mutations, which showed a novel point mutation within the ZRS, NG_009240.1: g.106954C>T (traditional nomenclature: ZRS619C>T) in the five affected members. This mutation was not previously reported in any public domain database, and was not found in our healthy and ethnically matched control individuals or unaffected family members. We hypothesize that interactions of SHH and SALL1 explain the overlapping features of the family described here and patients with Townes-Brocks syndrome.

  3. Identification of spontaneous mutations within the long-range limb-specific Sonic Hedgehog enhancer (ZRS) that alter Sonic Hedgehog expression in the chicken limb mutants oligozeugodactly and Silkie Breed

    OpenAIRE

    2011-01-01

    The evolutionarily conserved, non-coding ~800 base-pair zone of polarizing activity (ZPA) regulatory sequence (ZRS) controls Shh expression in the posterior limb. We report that the chicken mutant oligozeugodactly (ozd), which lacks limb Shh expression, has a large deletion within the ZRS. Furthermore, the preaxial polydactylous, Silkie Breed chicken, which develops ectopic anterior limb Shh expression, has a single base-pair change within the ZRS. Using an in vivo reporter assay to examine e...

  4. Sex Chromosome-wide Transcriptional Suppression and Compensatory Cis-Regulatory Evolution Mediate Gene Expression in the Drosophila Male Germline.

    Directory of Open Access Journals (Sweden)

    Emily L Landeen

    2016-07-01

    Full Text Available The evolution of heteromorphic sex chromosomes has repeatedly resulted in the evolution of sex chromosome-specific forms of regulation, including sex chromosome dosage compensation in the soma and meiotic sex chromosome inactivation in the germline. In the male germline of Drosophila melanogaster, a novel but poorly understood form of sex chromosome-specific transcriptional regulation occurs that is distinct from canonical sex chromosome dosage compensation or meiotic inactivation. Previous work shows that expression of reporter genes driven by testis-specific promoters is considerably lower-approximately 3-fold or more-for transgenes inserted into X chromosome versus autosome locations. Here we characterize this transcriptional suppression of X-linked genes in the male germline and its evolutionary consequences. Using transgenes and transpositions, we show that most endogenous X-linked genes, not just testis-specific ones, are transcriptionally suppressed several-fold specifically in the Drosophila male germline. In wild-type testes, this sex chromosome-wide transcriptional suppression is generally undetectable, being effectively compensated by the gene-by-gene evolutionary recruitment of strong promoters on the X chromosome. We identify and experimentally validate a promoter element sequence motif that is enriched upstream of the transcription start sites of hundreds of testis-expressed genes; evolutionarily conserved across species; associated with strong gene expression levels in testes; and overrepresented on the X chromosome. These findings show that the expression of X-linked genes in the Drosophila testes reflects a balance between chromosome-wide epigenetic transcriptional suppression and long-term compensatory adaptation by sex-linked genes. Our results have broad implications for the evolution of gene expression in the Drosophila male germline and for genome evolution.

  5. Sex Chromosome-wide Transcriptional Suppression and Compensatory Cis-Regulatory Evolution Mediate Gene Expression in the Drosophila Male Germline.

    Science.gov (United States)

    Landeen, Emily L; Muirhead, Christina A; Wright, Lori; Meiklejohn, Colin D; Presgraves, Daven C

    2016-07-01

    The evolution of heteromorphic sex chromosomes has repeatedly resulted in the evolution of sex chromosome-specific forms of regulation, including sex chromosome dosage compensation in the soma and meiotic sex chromosome inactivation in the germline. In the male germline of Drosophila melanogaster, a novel but poorly understood form of sex chromosome-specific transcriptional regulation occurs that is distinct from canonical sex chromosome dosage compensation or meiotic inactivation. Previous work shows that expression of reporter genes driven by testis-specific promoters is considerably lower-approximately 3-fold or more-for transgenes inserted into X chromosome versus autosome locations. Here we characterize this transcriptional suppression of X-linked genes in the male germline and its evolutionary consequences. Using transgenes and transpositions, we show that most endogenous X-linked genes, not just testis-specific ones, are transcriptionally suppressed several-fold specifically in the Drosophila male germline. In wild-type testes, this sex chromosome-wide transcriptional suppression is generally undetectable, being effectively compensated by the gene-by-gene evolutionary recruitment of strong promoters on the X chromosome. We identify and experimentally validate a promoter element sequence motif that is enriched upstream of the transcription start sites of hundreds of testis-expressed genes; evolutionarily conserved across species; associated with strong gene expression levels in testes; and overrepresented on the X chromosome. These findings show that the expression of X-linked genes in the Drosophila testes reflects a balance between chromosome-wide epigenetic transcriptional suppression and long-term compensatory adaptation by sex-linked genes. Our results have broad implications for the evolution of gene expression in the Drosophila male germline and for genome evolution.

  6. Exact p-value calculation for heterotypic clusters of regulatory motifs and its application in computational annotation of cis-regulatory modules

    Directory of Open Access Journals (Sweden)

    Roytberg Mikhail A

    2007-10-01

    Full Text Available Abstract Background cis-Regulatory modules (CRMs of eukaryotic genes often contain multiple binding sites for transcription factors. The phenomenon that binding sites form clusters in CRMs is exploited in many algorithms to locate CRMs in a genome. This gives rise to the problem of calculating the statistical significance of the event that multiple sites, recognized by different factors, would be found simultaneously in a text of a fixed length. The main difficulty comes from overlapping occurrences of motifs. So far, no tools have been developed allowing the computation of p-values for simultaneous occurrences of different motifs which can overlap. Results We developed and implemented an algorithm computing the p-value that s different motifs occur respectively k1, ..., ks or more times, possibly overlapping, in a random text. Motifs can be represented with a majority of popular motif models, but in all cases, without indels. Zero or first order Markov chains can be adopted as a model for the random text. The computational tool was tested on the set of cis-regulatory modules involved in D. melanogaster early development, for which there exists an annotation of binding sites for transcription factors. Our test allowed us to correctly identify transcription factors cooperatively/competitively binding to DNA. Method The algorithm that precisely computes the probability of simultaneous motif occurrences is inspired by the Aho-Corasick automaton and employs a prefix tree together with a transition function. The algorithm runs with the O(n|Σ|(m|ℋ MathType@MTEF@5@5@+=feaafiart1ev1aaatCvAUfKttLearuWrP9MDH5MBPbIqV92AaeXatLxBI9gBaebbnrfifHhDYfgasaacH8akY=wiFfYdH8Gipec8Eeeu0xXdbba9frFj0=OqFfea0dXdd9vqai=hGuQ8kuc9pgc9s8qqaq=dirpe0xb9q8qiLsFr0=vr0=vr0dc8meaabaqaciaacaGaaeqabaqabeGadaaakeaat0uy0HwzTfgDPnwy1egaryqtHrhAL1wy0L2yHvdaiqaacqWFlecsaaa@3762@| + K|σ|K ∏i ki time complexity, where n is the length of the text, |Σ| is the alphabet size, m is the

  7. Arabidopsis Flower and Embryo Developmental Genes are Repressed in Seedlings by Different Combinations of Polycomb Group Proteins in Association with Distinct Sets of Cis-regulatory Elements.

    Science.gov (United States)

    Wang, Hua; Liu, Chunmei; Cheng, Jingfei; Liu, Jian; Zhang, Lei; He, Chongsheng; Shen, Wen-Hui; Jin, Hong; Xu, Lin; Zhang, Yijing

    2016-01-01

    Polycomb repressive complexes (PRCs) play crucial roles in transcriptional repression and developmental regulation in both plants and animals. In plants, depletion of different members of PRCs causes both overlapping and unique phenotypic defects. However, the underlying molecular mechanism determining the target specificity and functional diversity is not sufficiently characterized. Here, we quantitatively compared changes of tri-methylation at H3K27 in Arabidopsis mutants deprived of various key PRC components. We show that CURLY LEAF (CLF), a major catalytic subunit of PRC2, coordinates with different members of PRC1 in suppression of distinct plant developmental programs. We found that expression of flower development genes is repressed in seedlings preferentially via non-redundant role of CLF, which specifically associated with LIKE HETEROCHROMATIN PROTEIN1 (LHP1). In contrast, expression of embryo development genes is repressed by PRC1-catalytic core subunits AtBMI1 and AtRING1 in common with PRC2-catalytic enzymes CLF or SWINGER (SWN). This context-dependent role of CLF corresponds well with the change in H3K27me3 profiles, and is remarkably associated with differential co-occupancy of binding motifs of transcription factors (TFs), including MADS box and ABA-related factors. We propose that different combinations of PRC members distinctively regulate different developmental programs, and their target specificity is modulated by specific TFs.

  8. Arabidopsis Flower and Embryo Developmental Genes are Repressed in Seedlings by Different Combinations of Polycomb Group Proteins in Association with Distinct Sets of Cis-regulatory Elements.

    Directory of Open Access Journals (Sweden)

    Hua Wang

    2016-01-01

    Full Text Available Polycomb repressive complexes (PRCs play crucial roles in transcriptional repression and developmental regulation in both plants and animals. In plants, depletion of different members of PRCs causes both overlapping and unique phenotypic defects. However, the underlying molecular mechanism determining the target specificity and functional diversity is not sufficiently characterized. Here, we quantitatively compared changes of tri-methylation at H3K27 in Arabidopsis mutants deprived of various key PRC components. We show that CURLY LEAF (CLF, a major catalytic subunit of PRC2, coordinates with different members of PRC1 in suppression of distinct plant developmental programs. We found that expression of flower development genes is repressed in seedlings preferentially via non-redundant role of CLF, which specifically associated with LIKE HETEROCHROMATIN PROTEIN1 (LHP1. In contrast, expression of embryo development genes is repressed by PRC1-catalytic core subunits AtBMI1 and AtRING1 in common with PRC2-catalytic enzymes CLF or SWINGER (SWN. This context-dependent role of CLF corresponds well with the change in H3K27me3 profiles, and is remarkably associated with differential co-occupancy of binding motifs of transcription factors (TFs, including MADS box and ABA-related factors. We propose that different combinations of PRC members distinctively regulate different developmental programs, and their target specificity is modulated by specific TFs.

  9. A variant in a Cis-regulatory element enhances claudin-14 expression and is associated with pediatric-onset hypercalciuria and kidney stones

    DEFF Research Database (Denmark)

    Ure, Megan E; Heydari, Emma; Pan, Wanling

    2017-01-01

    The greatest risk factor for kidney stones is hypercalciuria, the etiology of which is largely unknown. A recent genome-wide association study (GWAS) linked hypercalciuria and kidney stones to a claudin-14 (CLDN14) risk haplotype. However, the underlying molecular mechanism was not delineated...... sequenced the CLDN14 risk haplotype in a cohort of children with idiopathic hypercalciuria and kidney stones. An intronic single nucleotide polymorphism (SNP) was more frequent in affected children. Dual luciferase and cell based assays demonstrated increased reporter or CLDN14 expression when...... with the INSM1 binding site within the CLDN14 risk haplotype have a higher likelihood of hypercalciruia and kidney stones. Enhanced CLDN14 expression may play a role in the pathophysiology of their hypercalciuria. This article is protected by copyright. All rights reserved....

  10. The disruption of a novel limb cis-regulatory element of SHH is associated with autosomal dominant preaxial polydactyly-hypertrichosis.

    Science.gov (United States)

    Petit, Florence; Jourdain, Anne-Sophie; Holder-Espinasse, Muriel; Keren, Boris; Andrieux, Joris; Duterque-Coquillaud, Martine; Porchet, Nicole; Manouvrier-Hanu, Sylvie; Escande, Fabienne

    2016-01-01

    The expression gradient of the morphogen Sonic Hedgehog (SHH) is crucial in establishing the number and the identity of the digits during anteroposterior patterning of the limb. Its anterior ectopic expression is responsible for preaxial polydactyly (PPD). Most of these malformations are due to the gain-of-function of the Zone of Polarizing Activity Regulatory Sequence, the only limb-specific enhancer of SHH known to date. We report a family affected with a novel condition associating PPD and hypertrichosis of the upper back, following an autosomal dominant mode of inheritance. This phenotype is consistent with deregulation of SHH expression during limb and follicle development. In affected members, we identified a 2 kb deletion located ~240 kb upstream from the SHH promoter. The deleted sequence is capable of repressing the transcriptional activity of the SHH promoter in vitro, consistent with a silencer activity. We hypothesize that the deletion of this silencer could be responsible for SHH deregulation during development, leading to a PPD-hypertrichosis phenotype.

  11. Identification of spontaneous mutations within the long-range limb-specific Sonic Hedgehog enhancer (ZRS) that alter Sonic Hedgehog expression in the chicken limb mutants oligozeugodactly and Silkie Breed

    Science.gov (United States)

    Maas, Sarah A.; Suzuki, Takayuki; Fallon, John F.

    2011-01-01

    The evolutionarily conserved, non-coding ~800 base-pair zone of polarizing activity (ZPA) regulatory sequence (ZRS) controls Shh expression in the posterior limb. We report that the chicken mutant oligozeugodactly (ozd), which lacks limb Shh expression, has a large deletion within the ZRS. Furthermore, the preaxial polydactylous, Silkie Breed chicken, which develops ectopic anterior limb Shh expression, has a single base-pair change within the ZRS. Using an in vivo reporter assay to examine enhancer function in the chick limb, we demonstrate that the wild-type ZRS drives β-galactosidase reporter expression in the ZPA of both wild-type and ozd limbs. The Silkie ZRS drives β-galactosidase in both posterior and anterior Shh domains in wild-type limb buds. These results support the hypothesis that the ZRS integrates positive and negative prepatterned regulatory inputs in the chicken model system and demonstrate the utility of the chicken limb as an efficient genetic system for gene regulatory studies. PMID:21509895

  12. A New Approach to Sequence Analysis Exemplified by Identification of cis-Elements in Abscisic Acid Inducible Promoters

    DEFF Research Database (Denmark)

    Busk, Peter Kamp; Hallin, Peter Fischer; Salomon, Jesper

    Identification of cis-regulatory elements in DNA promoters by computational approaches are a great help in genome-wide elucidation of signal transduction, transcriptional regulation and gene expression. However, to accomplish this has proven a difficult problem in computational genomics in part d...

  13. TiS2 and ZrS2 single- and double-wall nanotubes: first-principles study.

    Science.gov (United States)

    Bandura, Andrei V; Evarestov, Robert A

    2014-02-15

    Hybrid density functional theory has been applied for investigations of the electronic and atomic structure of bulk phases, nanolayers, and nanotubes based on titanium and zirconium disulfides. Calculations have been performed on the basis of the localized atomic functions by means of the CRYSTAL-2009 computer code. The full optimization of all atomic positions in the regarded systems has been made to study the atomic relaxation and to determine the most favorable structures. The different layered and isotropic bulk phases have been considered as the possible precursors of the nanotubes. Calculations on single-walled TiS2 and ZrS2 nanotubes confirmed that the nanotubes obtained by rolling up the hexagonal crystalline layers with octahedral 1T morphology are the most stable. The strain energy of TiS2 and ZrS2 nanotubes is small, does not depend on the tube chirality, and approximately obeys to D(-2) law (D is nanotube diameter) of the classical elasticity theory. It is greater than the strain energy of the similar TiO2 and ZrO2 nanotubes; however, the formation energy of the disulfide nanotubes is considerably less than the formation energy of the dioxide nanotubes. The distance and interaction energy between the single-wall components of the double-wall nanotubes is proved to be close to the distance and interaction energy between layers in the layered crystals. Analysis of the relaxed nanotube shape using radial coordinate of the metal atoms demonstrates a small but noticeable deviation from completely cylindrical cross-section of the external walls in the armchair-like double-wall nanotubes.

  14. Analyses of fugu hoxa2 genes provide evidence for subfunctionalization of neural crest cell and rhombomere cis-regulatory modules during vertebrate evolution.

    Science.gov (United States)

    McEllin, Jennifer A; Alexander, Tara B; Tümpel, Stefan; Wiedemann, Leanne M; Krumlauf, Robb

    2016-01-15

    Hoxa2 gene is a primary player in regulation of craniofacial programs of head development in vertebrates. Here we investigate the evolution of a Hoxa2 neural crest enhancer identified originally in mouse by comparing and contrasting the fugu hoxa2a and hoxa2b genes with their orthologous teleost and mammalian sequences. Using sequence analyses in combination with transgenic regulatory assays in zebrafish and mouse embryos we demonstrate subfunctionalization of regulatory activity for expression in hindbrain segments and neural crest cells between these two fugu co-orthologs. hoxa2a regulatory sequences have retained the ability to mediate expression in neural crest cells while those of hoxa2b include cis-elements that direct expression in rhombomeres. Functional dissection of the neural crest regulatory potential of the fugu hoxa2a and hoxa2b genes identify the previously unknown cis-element NC5, which is implicated in generating the differential activity of the enhancers from these genes. The NC5 region plays a similar role in the ability of this enhancer to mediate reporter expression in mice, suggesting it is a conserved component involved in control of neural crest expression of Hoxa2 in vertebrate craniofacial development.

  15. Integration of bioinformatics and synthetic promoters leads to the discovery of novel elicitor-responsive cis-regulatory sequences in Arabidopsis.

    Science.gov (United States)

    Koschmann, Jeannette; Machens, Fabian; Becker, Marlies; Niemeyer, Julia; Schulze, Jutta; Bülow, Lorenz; Stahl, Dietmar J; Hehl, Reinhard

    2012-09-01

    A combination of bioinformatic tools, high-throughput gene expression profiles, and the use of synthetic promoters is a powerful approach to discover and evaluate novel cis-sequences in response to specific stimuli. With Arabidopsis (Arabidopsis thaliana) microarray data annotated to the PathoPlant database, 732 different queries with a focus on fungal and oomycete pathogens were performed, leading to 510 up-regulated gene groups. Using the binding site estimation suite of tools, BEST, 407 conserved sequence motifs were identified in promoter regions of these coregulated gene sets. Motif similarities were determined with STAMP, classifying the 407 sequence motifs into 37 families. A comparative analysis of these 37 families with the AthaMap, PLACE, and AGRIS databases revealed similarities to known cis-elements but also led to the discovery of cis-sequences not yet implicated in pathogen response. Using a parsley (Petroselinum crispum) protoplast system and a modified reporter gene vector with an internal transformation control, 25 elicitor-responsive cis-sequences from 10 different motif families were identified. Many of the elicitor-responsive cis-sequences also drive reporter gene expression in an Agrobacterium tumefaciens infection assay in Nicotiana benthamiana. This work significantly increases the number of known elicitor-responsive cis-sequences and demonstrates the successful integration of a diverse set of bioinformatic resources combined with synthetic promoter analysis for data mining and functional screening in plant-pathogen interaction.

  16. Gene expression profiling of cultured human NF1 heterozygous (NF1+/-) melanocytes reveals downregulation of a transcriptional cis-regulatory network mediating activation of the melanocyte-specific dopachrome tautomerase (DCT) gene.

    Science.gov (United States)

    Boucneau, Joachim; De Schepper, Sofie; Vuylsteke, Marnik; Van Hummelen, Paul; Naeyaert, Jean-Marie; Lambert, Jo

    2005-08-01

    One of the major primary features of the neurocutaneous genetic disorder Neurofibromatosis type 1 are the hyperpigmentary café-au-lait macules where disregulation of melanocyte biology is supposed to play a key etiopathogenic role. To gain better insight into the possible role of the tumor suppressor gene NF1, a transcriptomic microarray analysis was performed on human NF1 heterozygous (NF1+/-) melanocytes of a Neurofibromatosis type 1 patient and NF1 wild type (NF1+/+) melanocytes of a healthy control patient, both cultured from normally pigmented skin and hyperpigmented lesional café-au-lait skin. From the magnitude of gene effects, we found that gene expression was affected most strongly by genotype and less so by lesional type. A total of 137 genes had a significant twofold or more up- (72) or downregulated (65) expression in NF1+/- melanocytes compared with NF1+/+ melanocytes. Melanocytes cultured from hyperpigmented café-au-lait skin showed 37 upregulated genes whereas only 14 were downregulated compared with normal skin melanocytes. In addition, significant genotype xlesional type interactions were observed for 465 genes. Differentially expressed genes were mainly involved in regulating cell proliferation and cell adhesion. A high number of transcription factor genes, among which a specific subset important in melanocyte lineage development, were downregulated in the cis-regulatory network governing the activation of the melanocyte-specific dopachrome tautomerase (DCT) gene. Although the results presented have been obtained with a restricted number of patients (one NF1 patient and one control) and using cDNA microarrays that may limit their interpretation, the data nevertheless addresses for the first time the effect of a heterozygous NF1 gene on the expression of the human melanocyte transcriptome and has generated several interesting candidate genes helpful in elucidating the etiopathology of café-au-lait macules in NF1 patients.

  17. Prediction of transcriptional regulatory elements for plant hormone responses based on microarray data

    Directory of Open Access Journals (Sweden)

    Yamaguchi-Shinozaki Kazuko

    2011-02-01

    Full Text Available Abstract Background Phytohormones organize plant development and environmental adaptation through cell-to-cell signal transduction, and their action involves transcriptional activation. Recent international efforts to establish and maintain public databases of Arabidopsis microarray data have enabled the utilization of this data in the analysis of various phytohormone responses, providing genome-wide identification of promoters targeted by phytohormones. Results We utilized such microarray data for prediction of cis-regulatory elements with an octamer-based approach. Our test prediction of a drought-responsive RD29A promoter with the aid of microarray data for response to drought, ABA and overexpression of DREB1A, a key regulator of cold and drought response, provided reasonable results that fit with the experimentally identified regulatory elements. With this succession, we expanded the prediction to various phytohormone responses, including those for abscisic acid, auxin, cytokinin, ethylene, brassinosteroid, jasmonic acid, and salicylic acid, as well as for hydrogen peroxide, drought and DREB1A overexpression. Totally 622 promoters that are activated by phytohormones were subjected to the prediction. In addition, we have assigned putative functions to 53 octamers of the Regulatory Element Group (REG that have been extracted as position-dependent cis-regulatory elements with the aid of their feature of preferential appearance in the promoter region. Conclusions Our prediction of Arabidopsis cis-regulatory elements for phytohormone responses provides guidance for experimental analysis of promoters to reveal the basis of the transcriptional network of phytohormone responses.

  18. Repetitive Elements in Mycoplasma hyopneumoniae Transcriptional Regulation

    Science.gov (United States)

    Cattani, Amanda Malvessi; Siqueira, Franciele Maboni; Guedes, Rafael Lucas Muniz; Schrank, Irene Silveira

    2016-01-01

    Transcriptional regulation, a multiple-step process, is still poorly understood in the important pig pathogen Mycoplasma hyopneumoniae. Basic motifs like promoters and terminators have already been described, but no other cis-regulatory elements have been found. DNA repeat sequences have been shown to be an interesting potential source of cis-regulatory elements. In this work, a genome-wide search for tandem and palindromic repetitive elements was performed in the intergenic regions of all coding sequences from M. hyopneumoniae strain 7448. Computational analysis demonstrated the presence of 144 tandem repeats and 1,171 palindromic elements. The DNA repeat sequences were distributed within the 5’ upstream regions of 86% of transcriptional units of M. hyopneumoniae strain 7448. Comparative analysis between distinct repetitive sequences found in related mycoplasma genomes demonstrated different percentages of conservation among pathogenic and nonpathogenic strains. qPCR assays revealed differential expression among genes showing variable numbers of repetitive elements. In addition, repeats found in 206 genes already described to be differentially regulated under different culture conditions of M. hyopneumoniae strain 232 showed almost 80% conservation in relation to M. hyopneumoniae strain 7448 repeats. Altogether, these findings suggest a potential regulatory role of tandem and palindromic DNA repeats in the M. hyopneumoniae transcriptional profile. PMID:28005945

  19. Comparative genome sequencing of drosophila pseudoobscura: Chromosomal, gene and cis-element evolution

    Energy Technology Data Exchange (ETDEWEB)

    Richards, Stephen; Liu, Yue; Bettencourt, Brian R.; Hradecky, Pavel; Letovsky, Stan; Nielsen, Rasmus; Thornton, Kevin; Todd, Melissa J.; Chen, Rui; Meisel, Richard P.; Couronne, Olivier; Hua, Sujun; Smith, Mark A.; Bussemaker, Harmen J.; van Batenburg, Marinus F.; Howells, Sally L.; Scherer, Steven E.; Sodergren, Erica; Matthews, Beverly B.; Crosby, Madeline A.; Schroeder, Andrew J.; Ortiz-Barrientos, Daniel; Rives, Catherine M.; Metzker, Michael L.; Muzny, Donna M.; Scott, Graham; Steffen, David; Wheeler, David A.; Worley, Kim C.; Havlak, Paul; Durbin, K. James; Egan, Amy; Gill, Rachel; Hume, Jennifer; Morgan, Margaret B.; Miner, George; Hamilton, Cerissa; Huang, Yanmei; Waldron, Lenee; Verduzco, Daniel; Blankenburg, Kerstin P.; Dubchak, Inna; Noor, Mohamed A.F.; Anderson, Wyatt; White, Kevin P.; Clark, Andrew G.; Schaeffer, Stephen W.; Gelbart, William; Weinstock, George M.; Gibbs, Richard A.

    2004-04-01

    The genome sequence of a second fruit fly, D. pseudoobscura, presents an opportunity for comparative analysis of a primary model organism D. melanogaster. The vast majority of Drosophila genes have remained on the same arm, but within each arm gene order has been extensively reshuffled leading to the identification of approximately 1300 syntenic blocks. A repetitive sequence is found in the D. pseudoobscura genome at many junctions between adjacent syntenic blocks. Analysis of this novel repetitive element family suggests that recombination between offset elements may have given rise to many paracentric inversions, thereby contributing to the shuffling of gene order in the D. pseudoobscura lineage. Based on sequence similarity and synteny, 10,516 putative orthologs have been identified as a core gene set conserved over 35 My since divergence. Genes expressed in the testes had higher amino acid sequence divergence than the genome wide average consistent with the rapid evolution of sex-specific proteins. Cis-regulatory sequences are more conserved than control sequences between the species but the difference is slight, suggesting that the evolution of cis-regulatory elements is flexible. Overall, a picture of repeat mediated chromosomal rearrangement, and high co-adaptation of both male genes and cis-regulatory sequences emerges as important themes of genome divergence between these species of Drosophila.

  20. Regulatory elements of the floral homeotic gene AGAMOUS identified by phylogenetic footprinting and shadowing.

    Energy Technology Data Exchange (ETDEWEB)

    Hong, R. L., Hamaguchi, L., Busch, M. A., and Weigel, D.

    2003-06-01

    OAK-B135 In Arabidopsis thaliana, cis-regulatory sequences of the floral homeotic gene AGAMOUS (AG) are located in the second intron. This 3 kb intron contains binding sites for two direct activators of AG, LEAFY (LFY) and WUSCHEL (WUS), along with other putative regulatory elements. We have used phylogenetic footprinting and the related technique of phylogenetic shadowing to identify putative cis-regulatory elements in this intron. Among 29 Brassicaceae, several other motifs, but not the LFY and WUS binding sites previously identified, are largely invariant. Using reporter gene analyses, we tested six of these motifs and found that they are all functionally important for activity of AG regulatory sequences in A. thaliana. Although there is little obvious sequence similarity outside the Brassicaceae, the intron from cucumber AG has at least partial activity in A. thaliana. Our studies underscore the value of the comparative approach as a tool that complements gene-by-gene promoter dissection, but also highlight that sequence-based studies alone are insufficient for a complete identification of cis-regulatory sites.

  1. Conserved stem-loop structures in the HIV-1 RNA region containing the A3 3' splice site and its cis-regulatory element: possible involvement in RNA splicing.

    Science.gov (United States)

    Jacquenet, S; Ropers, D; Bilodeau, P S; Damier, L; Mougin, A; Stoltzfus, C M; Branlant, C

    2001-01-15

    The HIV-1 transcript is alternatively spliced to over 30 different mRNAs. Whether RNA secondary structure can influence HIV-1 RNA alternative splicing has not previously been examined. Here we have determined the secondary structure of the HIV-1/BRU RNA segment, containing the alternative A3, A4a, A4b, A4c and A5 3' splice sites. Site A3, required for tat mRNA production, is contained in the terminal loop of a stem-loop structure (SLS2), which is highly conserved in HIV-1 and related SIVcpz strains. The exon splicing silencer (ESS2) acting on site A3 is located in a long irregular stem-loop structure (SLS3). Two SLS3 domains were protected by nuclear components under splicing condition assays. One contains the A4c branch points and a putative SR protein binding site. The other one is adjacent to ESS2. Unexpectedly, only the 3' A residue of ESS2 was protected. The suboptimal A3 polypyrimidine tract (PPT) is base paired. Using site-directed mutagenesis and transfection of a mini-HIV-1 cDNA into HeLa cells, we found that, in a wild-type PPT context, a mutation of the A3 downstream sequence that reinforced SLS2 stability decreased site A3 utilization. This was not the case with an optimized PPT. Hence, sequence and secondary structure of the PPT may cooperate in limiting site A3 utilization.

  2. Isolation and characterization of a native strain of Aspergillus niger ZRS14 with capability of high resistance to zinc and its supernatant application towards extracellular synthesis of zinc oxide nanoparticles

    Directory of Open Access Journals (Sweden)

    Morahem Ashengroph

    2013-01-01

    Full Text Available Introduction: Zinc oxide nanoparticles have quite a few applications in the fields of biology, optics, mechanics, magnetism, energy, hygiene and medicine. Due to serious problems associated with physiochemical synthesis of ZnO nanoparticles, including environmental pollution, complicated and costly processes, there is a growing need to develop a simple biological procedure for synthesis of nanoparticles to achieve the monodisperse-sized particles with a higher purity, low energy consumption and a cleaner environment. We conducted this investigation to screen and isolate native fungi strains capable of high zinc metal tolerance ability and a potential for extracellular synthesis of ZnO nanoparticles using fungal secretions as biological catalysts.Materials and methods: 15 different strains of fungi were isolated from soil samples collected from lead and zinc mines of Angoran-Zanjan using conventional enrichment process and characterized initially based on macroscopic and microscopic characteristics and colony morphology. The intrinsic tolerance of the isolated strains to zinc toxic metal was measured in the synthetic and complex media using the agar dilution method. The supernatants of isolated fungi were incubated with zinc acetate solution in a shaker incubator for 72h; then, the strain that was able to synthesis ZnO nanoparticle was identified. The ZnO nanoparticles formation was investigated by using spectroscopic techniques and microscopic observations.Results: Among the 15 isolated strains, the strain ZRS14 had highest zinc metal tolerance ability and was selected and identified as Aspergillus niger strain ZRS14 (GenBank accession number KF414527 based on morphological and molecular phylogenetic analysis. For synthesis of ZnO nanoparticles by isolated A. niger ZRS14, fungal cell-free filtrate of the strain was collected and incubated in the presence of zinc acetate solution at a final concentration of 250 mg/l zinc metal ion at 28º C for

  3. An adaptive transposable element insertion in the regulatory region of the EO gene in the domesticated silkworm, Bombyx mori.

    Science.gov (United States)

    Sun, Wei; Shen, Yi-Hong; Han, Min-Jin; Cao, Yun-Feng; Zhang, Ze

    2014-12-01

    Although there are many studies to show a key role of transposable elements (TEs) in adaptive evolution of higher organisms, little is known about the molecular mechanisms. In this study, we found that a partial TE (Taguchi) inserted in the cis-regulatory region of the silkworm ecdysone oxidase (EO) gene, which encodes a crucial enzyme to reduce the titer of molting hormone (20-hydroxyecdysone, 20E). The TE insertion occurred during domestication of silkworm and the frequency of the TE insertion in the domesticated silkworm (Bombyx mori) is high, 54.24%. The linkage disequilibrium in the TE inserted strains of the domesticated silkworm was elevated. Molecular population genetics analyses suggest that this TE insertion is adaptive for the domesticated silkworm. Luminescent reporter assay shows that the TE inserted in the cis-regulatory region of the EO gene functions as a 20E-induced enhancer of the gene expression. Further, phenotypic bioassay indicates that the silkworm with the TE insertion exhibited more stable developmental phenotype than the silkworm without the TE insertion when suffering from food shortage. Thus, the inserted TE in the cis-regulatory region of the EO gene increased developmental uniformity of silkworm individuals through regulating 20E metabolism, partially explaining transformation of a domestication developmental trait in the domesticated silkworm. Our results emphasize the exceptional role of gene expression regulation in developmental transition of domesticated animals.

  4. Close Sequence Comparisons are Sufficient to Identify Humancis-Regulatory Elements

    Energy Technology Data Exchange (ETDEWEB)

    Prabhakar, Shyam; Poulin, Francis; Shoukry, Malak; Afzal, Veena; Rubin, Edward M.; Couronne, Olivier; Pennacchio, Len A.

    2005-12-01

    Cross-species DNA sequence comparison is the primary method used to identify functional noncoding elements in human and other large genomes. However, little is known about the relative merits of evolutionarily close and distant sequence comparisons, due to the lack of a universal metric for sequence conservation, and also the paucity of empirically defined benchmark sets of cis-regulatory elements. To address this problem, we developed a general-purpose algorithm (Gumby) that detects slowly-evolving regions in primate, mammalian and more distant comparisons without requiring adjustment of parameters, and ranks conserved elements by P-value using Karlin-Altschul statistics. We benchmarked Gumby predictions against previously identified cis-regulatory elements at diverse genomic loci, and also tested numerous extremely conserved human-rodent sequences for transcriptional enhancer activity using reporter-gene assays in transgenic mice. Human regulatory elements were identified with acceptable sensitivity and specificity by comparison with 1-5 other eutherian mammals or 6 other simian primates. More distant comparisons (marsupial, avian, amphibian and fish) failed to identify many of the empirically defined functional noncoding elements. We derived an intuitive relationship between ancient and recent noncoding sequence conservation from whole genome comparative analysis, which explains some of these findings. Lastly, we determined that, in addition to strength of conservation, genomic location and/or density of surrounding conserved elements must also be considered in selecting candidate enhancers for testing at embryonic time points.

  5. Conserved Noncoding Elements in the Most Distant Genera of Cephalochordates: The Goldilocks Principle

    Science.gov (United States)

    Yue, Jia-Xing; Kozmikova, Iryna; Ono, Hiroki; Nossa, Carlos W.; Kozmik, Zbynek; Putnam, Nicholas H.; Yu, Jr-Kai; Holland, Linda Z.

    2016-01-01

    Cephalochordates, the sister group of vertebrates + tunicates, are evolving particularly slowly. Therefore, genome comparisons between two congeners of Branchiostoma revealed so many conserved noncoding elements (CNEs), that it was not clear how many are functional regulatory elements. To more effectively identify CNEs with potential regulatory functions, we compared noncoding sequences of genomes of the most phylogenetically distant cephalochordate genera, Asymmetron and Branchiostoma, which diverged approximately 120–160 million years ago. We found 113,070 noncoding elements conserved between the two species, amounting to 3.3% of the genome. The genomic distribution, target gene ontology, and enriched motifs of these CNEs all suggest that many of them are probably cis-regulatory elements. More than 90% of previously verified amphioxus regulatory elements were re-captured in this study. A search of the cephalochordate CNEs around 50 developmental genes in several vertebrate genomes revealed eight CNEs conserved between cephalochordates and vertebrates, indicating sequence conservation over >500 million years of divergence. The function of five CNEs was tested in reporter assays in zebrafish, and one was also tested in amphioxus. All five CNEs proved to be tissue-specific enhancers. Taken together, these findings indicate that even though Branchiostoma and Asymmetron are distantly related, as they are evolving slowly, comparisons between them are likely optimal for identifying most of their tissue-specific cis-regulatory elements laying the foundation for functional characterizations and a better understanding of the evolution of developmental regulation in cephalochordates. PMID:27412606

  6. Structure of Proximal and Distant Regulatory Elements in the Human Genome

    Science.gov (United States)

    Ovcharenko, Ivan

    Clustering of multiple transcription factor binding sites (TFBSs) for the same transcription factor (TF) is a common feature of cis-regulatory modules in invertebrate animals, but the occurrence of such homotypic clusters of TFBSs (HCTs) in the human genome has remained largely unknown. To explore whether HCTs are also common in human and other vertebrates, we used known binding motifs for vertebrate TFs and a hidden Markov model-based approach to detect HCTs in the human, mouse, chicken, and fugu genomes, and examined their association with cis-regulatory modules. We found that evolutionarily conserved HCTs occupy nearly 2% of the human genome, with experimental evidence for individual TFs supporting their binding to predicted HCTs. More than half of promoters of human genes contain HCTs, with a distribution around the transcription start site in agreement with the experimental data from the ENCODE project. In addition, almost half of 487 experimentally validated developmental enhancers contain them as well - a number more than 25-fold larger than expected by chance. We also found evidence of negative selection acting on TFBSs within HCTs, as the conservation of TFBSs is stronger than the conservation of sequences separating them. The important role of HCTs as components of developmental enhancers is additionally supported by a strong correlation between HCTs and the binding of the enhancer-associated co-activator protein p300. Experimental validation of HCT-containing elements in both zebrafish and mouse suggest that HCTs could be used to predict both the presence of enhancers and their tissue specificity, and are thus a feature that can be effectively used in deciphering the gene regulatory code. In conclusion, our results indicate that HCTs are a pervasive feature of human cis-regulatory modules and suggest that they play an important role in gene regulation in the human and other vertebrate genomes.

  7. Investigation of the SHH gradient during limb development through quantitation of transcriptional regulation, expression, and protein distribution.

    OpenAIRE

    Johnson, Edward James

    2015-01-01

    Correct number and pattern of digits is determined in a time and concentration-dependent manner by a gradient of Sonic Hedgehog (SHH) across the anterior-posterior axis of the embryonic limb bud. Owing to the potent morphogenic/mitogenic capabilities of SHH, transcription of the SHH gene in the limb is tightly regulated by feedback loops with other signalling pathways and by the Zone of Polarising Activity regulatory sequence (ZRS). The ZRS is a long-range, cis-regulatory li...

  8. Patterns of cis regulatory variation in diverse human populations.

    Directory of Open Access Journals (Sweden)

    Barbara E Stranger

    Full Text Available The genetic basis of gene expression variation has long been studied with the aim to understand the landscape of regulatory variants, but also more recently to assist in the interpretation and elucidation of disease signals. To date, many studies have looked in specific tissues and population-based samples, but there has been limited assessment of the degree of inter-population variability in regulatory variation. We analyzed genome-wide gene expression in lymphoblastoid cell lines from a total of 726 individuals from 8 global populations from the HapMap3 project and correlated gene expression levels with HapMap3 SNPs located in cis to the genes. We describe the influence of ancestry on gene expression levels within and between these diverse human populations and uncover a non-negligible impact on global patterns of gene expression. We further dissect the specific functional pathways differentiated between populations. We also identify 5,691 expression quantitative trait loci (eQTLs after controlling for both non-genetic factors and population admixture and observe that half of the cis-eQTLs are replicated in one or more of the populations. We highlight patterns of eQTL-sharing between populations, which are partially determined by population genetic relatedness, and discover significant sharing of eQTL effects between Asians, European-admixed, and African subpopulations. Specifically, we observe that both the effect size and the direction of effect for eQTLs are highly conserved across populations. We observe an increasing proximity of eQTLs toward the transcription start site as sharing of eQTLs among populations increases, highlighting that variants close to TSS have stronger effects and therefore are more likely to be detected across a wider panel of populations. Together these results offer a unique picture and resource of the degree of differentiation among human populations in functional regulatory variation and provide an estimate for the transferability of complex trait variants across populations.

  9. Computational methods to dissect cis-regulatory transcriptional networks

    Indian Academy of Sciences (India)

    Vibha Rani

    2007-12-01

    The formation of diverse cell types from an invariant set of genes is governed by biochemical and molecular processes that regulate gene activity. A complete understanding of the regulatory mechanisms of gene expression is the major function of genomics. Computational genomics is a rapidly emerging area for deciphering the regulation of metazoan genes as well as interpreting the results of high-throughput screening. The integration of computer science with biology has expedited molecular modelling and processing of large-scale data inputs such as microarrays, analysis of genomes, transcriptomes and proteomes. Many bioinformaticians have developed various algorithms for predicting transcriptional regulatory mechanisms from the sequence, gene expression and interaction data. This review contains compiled information of various computational methods adopted to dissect gene expression pathways.

  10. Phylogeny based discovery of regulatory elements

    Directory of Open Access Journals (Sweden)

    Cohen Barak A

    2006-05-01

    Full Text Available Abstract Background Algorithms that locate evolutionarily conserved sequences have become powerful tools for finding functional DNA elements, including transcription factor binding sites; however, most methods do not take advantage of an explicit model for the constrained evolution of functional DNA sequences. Results We developed a probabilistic framework that combines an HKY85 model, which assigns probabilities to different base substitutions between species, and weight matrix models of transcription factor binding sites, which describe the probabilities of observing particular nucleotides at specific positions in the binding site. The method incorporates the phylogenies of the species under consideration and takes into account the position specific variation of transcription factor binding sites. Using our framework we assessed the suitability of alignments of genomic sequences from commonly used species as substrates for comparative genomic approaches to regulatory motif finding. We then applied this technique to Saccharomyces cerevisiae and related species by examining all possible six base pair DNA sequences (hexamers and identifying sequences that are conserved in a significant number of promoters. By combining similar conserved hexamers we reconstructed known cis-regulatory motifs and made predictions of previously unidentified motifs. We tested one prediction experimentally, finding it to be a regulatory element involved in the transcriptional response to glucose. Conclusion The experimental validation of a regulatory element prediction missed by other large-scale motif finding studies demonstrates that our approach is a useful addition to the current suite of tools for finding regulatory motifs.

  11. Crystal Structure, Electronic Structure, and Photocatalytic Activity of Oxysulfides: La2Ta2ZrS2O8, La2Ta2TiS2O8, and La2Nb2TiS2O8.

    Science.gov (United States)

    Goto, Yosuke; Seo, Jeongsuk; Kumamoto, Kazunori; Hisatomi, Takashi; Mizuguchi, Yoshikazu; Kamihara, Yoichi; Katayama, Masao; Minegishi, Tsutomu; Domen, Kazunari

    2016-04-01

    The novel oxysulfides La2Ta2ZrS2O8 (LTZSO), La2Ta2TiS2O8 (LTTSO), and La2Nb2TiS2O8 (LNTSO) were synthesized, and their crystal structures, electronic structures, and photocatalytic activities for water splitting under visible light were investigated. Density functional theory calculations showed that these compounds are direct-band-gap semiconductors. Close to the conduction band minimum, the main contribution to the band structure comes from the d orbitals of Zr or Ti ions, while the region near the valence band maximum is associated with the 3p orbitals of S ions. The absorption-edge wavelength was determined to be 540 nm for LTZSO and 700 nm for LTTSO and LNTSO. An analysis of the crystal structure using synchrotron X-ray diffraction revealed that these compounds contained antisite defects at transition metal ion sites, and these were considered to be the origin of the broad absorption at wavelengths longer than that corresponding to band-gap excitation. LTZSO was revealed to be active in the oxygen evolution reaction from aqueous solution containing a sacrificial electron acceptor under visible-light illumination. This result was supported by the band alignment and flat-band potential determined by photoelectron spectroscopy and Mott-Schottky plots.

  12. Multiple Regulatory Elements in the Arabidopsis NIA1 Promoter Act Synergistically to Form a Nitrate Enhancer1[W][OA

    Science.gov (United States)

    Wang, Rongchen; Guan, Peizhu; Chen, Mingsheng; Xing, Xiujuan; Zhang, Yali; Crawford, Nigel M.

    2010-01-01

    To accommodate fluctuating nutrient levels in the soil, plants modulate their metabolism and root development via signaling mechanisms that rapidly reprogram the plant transcriptome. In the case of nitrate, over 1,000 genes are induced or repressed within minutes of nitrate exposure. To identify cis-regulatory elements that mediate these responses, an enhancer screen was performed in transgenic Arabidopsis (Arabidopsis thaliana) plants. A 1.8-kb promoter fragment from the nitrate reductase gene NIA1 was identified that acts as a nitrate enhancer when fused to a 35S minimal promoter. Enhancer activity was localized to a 180-bp fragment, and this activity could be enhanced by the addition of a 131-bp fragment from the nitrite reductase promoter. A promoter construct containing the 180- and 131-bp fragments was also induced by nitrite and repressed by ammonium, indicating that it was responsive to multiple nitrogen signals. To identify specific regulatory elements within the 180-bp NIA1 fragment, a transient expression system using agroinfiltration of Nicotiana benthamiana was developed. Deletion analysis identified three elements corresponding to predicted binding motifs for homeodomain/E-box, Myb, and Alfin1 transcription factors. A fully active promoter showing nitrate and nitrite enhancer activity equivalent to that of the wild-type 180-bp fragment could be built from these three elements if the spacing between the homeodomain/E-box and Myb-Alfin1 sites was equivalent to that of the native promoter. These findings were validated in transgenic Arabidopsis plants and identify a cis-regulatory module containing three elements that comprise a nitrate enhancer in the NIA1 promoter. PMID:20668061

  13. Transposable element recruitments in the mammalian placenta: impacts and mechanisms.

    Science.gov (United States)

    Emera, Deena; Wagner, Günter P

    2012-07-01

    Transposable elements (TEs) are mobile DNA elements found at high frequency in mammalian genomes. Although these elements are generally perceived as genomic parasites, they have the potential to influence host genome function in many beneficial ways. This article discusses the role TEs have played in the evolution of the placenta and pregnancy in viviparous mammals. Using examples from our own research and the literature, we argue that frequent recruitment of TEs, in particular of retroelements, has facilitated the extreme diversification of tissues at the maternal-fetal interface. We also discuss the mechanisms by which TEs have been recruited for functions during pregnancy. We argue that retroelements are pre-adapted to becoming cis-regulatory elements for host genomes because they need to utilize host regulatory signals for their own life cycle. However, although TEs contain some of the signals necessary for host functions upon insertion, they often require modification before acquiring a biological role in a host tissue. We discuss the process by which one TE was transformed into a promoter for prolactin expression in the endometrium, describing a model for TE domestication called 'epistatic capture'.

  14. Adaptive evolution of conserved noncoding elements in mammals.

    Directory of Open Access Journals (Sweden)

    Su Yeon Kim

    2007-09-01

    Full Text Available Conserved noncoding elements (CNCs are an abundant feature of vertebrate genomes. Some CNCs have been shown to act as cis-regulatory modules, but the function of most CNCs remains unclear. To study the evolution of CNCs, we have developed a statistical method called the "shared rates test" to identify CNCs that show significant variation in substitution rates across branches of a phylogenetic tree. We report an application of this method to alignments of 98,910 CNCs from the human, chimpanzee, dog, mouse, and rat genomes. We find that approximately 68% of CNCs evolve according to a null model where, for each CNC, a single parameter models the level of constraint acting throughout the phylogeny linking these five species. The remaining approximately 32% of CNCs show departures from the basic model including speed-ups and slow-downs on particular branches and occasionally multiple rate changes on different branches. We find that a subset of the significant CNCs have evolved significantly faster than the local neutral rate on a particular branch, providing strong evidence for adaptive evolution in these CNCs. The distribution of these signals on the phylogeny suggests that adaptive evolution of CNCs occurs in occasional short bursts of evolution. Our analyses suggest a large set of promising targets for future functional studies of adaptation.

  15. Sequences upstream of the homologous cis-elements of the Adh adult enhancer of Drosophila are required for maximal levels of Adh gene transcription in adults of Scaptodrosophila lebanonensis.

    Science.gov (United States)

    Papaceit, Montserrat; Orengo, Dorcas; Juan, Elvira

    2004-01-01

    The evolution of cis-regulatory elements is of particular interest for our understanding of the evolution of gene regulation. The Adh gene of Drosophilidae shows interspecific differences in tissue-specific expression and transcript levels during development. In Scaptodrosophila lebanonensis adults, the level of distal transcripts is maximal between the fourth and eighth day after eclosion and is around five times higher than that in D. melanogaster Adh(S). To examine whether these quantitative differences are regulated by sequences lying upstream of the distal promoter, we performed in vitro deletion mutagenesis of the Adh gene of S. lebanonensis, followed by P-element-mediated germ-line transformation. All constructs included, as a cotransgene, a modified Adh gene of D. melanogaster (dAdh) in a fixed position and orientation that acted as a chromosomal position control. Using this approach, we have identified a fragment of 1.5 kb in the 5' region, 830 bp upstream of the distal start site, which is required to achieve maximal levels of distal transcript in S. lebanonensis. The presence of this fragment produces a 3.5-fold higher level of distal mRNA (as determined by real time quantitative PCR) compared with the D. melanogaster dAdh cotransgene. This region contains the degenerated end of a minisatellite sequence expanding farther upstream and does not correspond to the Adh adult enhancer (AAE) of D. melanogaster. Indeed, the cis-regulatory elements of the AAE have been identified by phylogenetic footprinting within the region 830 bp upstream of the distal start site of S. lebanonensis. Furthermore, the deletions Delta-830 and Delta-2358 yield the same pattern of tissue-specific expression, indicating that all tissue-specific elements are contained within the region 830 bp upstream of the distal start site. PMID:15166155

  16. Histone H3 K27 acetylation marks a potent enhancer element on the adipogenic master regulator gene Pparg2

    Science.gov (United States)

    Ramlee, Muhammad Khairul; Zhang, Qiongyi; Idris, Muhammad; Peng, Xu; Sim, Choon Kiat; Han, Weiping; Xu, Feng

    2014-01-01

    PPARγ2 is expressed almost exclusively in adipose tissue and plays a central role in adipogenesis. Despite intensive studies over the last 2 decades, the mechanism regulating the expression of the Pparg2 gene, especially the role of cis-regulatory elements, is still not completely understood. Here, we report a comprehensive investigation of the enhancer elements within the murine Pparg2 gene. Utilizing the combined techniques of sequence conservation analysis and chromatin marker examination, we identified a potent enhancer element that augmented the expression of a reporter gene under the control of the Pparg2 promoter by 20-fold. This enhancer element was first identified as highly conserved non-coding sequence 10 (CNS10) and was later shown to be enriched with the enhancer marker H3 K27 acetylation. Further studies identified a binding site for p300 as the essential enhancer element in CNS10. Moreover, p300 physically binds to CNS10 and is required for the enhancer activity of CNS10. The depletion of p300 by siRNA resulted in significantly impaired activation of Pparg2 at the early stages of 3T3-L1 adipogenesis. In summary, our study identified a novel enhancer element on the murine Pparg2 gene and suggested a novel mechanism for the regulation of Pparg2 expression by p300 in 3T3-L1 adipogenesis. PMID:25485585

  17. Detection and characterization of regulatory elements using probabilistic conditional random field and hidden Markov models

    Institute of Scientific and Technical Information of China (English)

    Hongyan Wang; Xiaobo Zhou

    2013-01-01

    By altering the electrostatic charge of histones or providing binding sites to protein recognition molecules,Chromatin marks have been proposed to regulate gene expression,a property that has motivated researchers to link these marks to cis-regulatory elements.With the help of next generation sequencing technologies,we can now correlate one specific chromatin mark with regulatory elements (e.g.enhancers or promoters) and also build tools,such as hidden Markov models,to gain insight into mark combinations.However,hidden Markov models have limitation for their character of generative models and assume that a current observation depends only on a current hidden state in the chain.Here,we employed two graphical probabilistic models,namely the linear conditional random field model and multivariate hidden Markov model,to mark gene regions with different states based on recurrent and spatially coherent character of these eight marks.Both models revealed chromatin states that may correspond to enhancers and promoters,transcribed regions,transcriptional elongation,and low-signal regions.We also found that the linear conditional random field model was more effective than the hidden Markov model in recognizing regulatory elements,such as promoter-,enhancer-,and transcriptional elongation-associated regions,which gives us a better choice.

  18. Ancient Transposable Elements Transformed the Uterine Regulatory Landscape and Transcriptome during the Evolution of Mammalian Pregnancy

    Directory of Open Access Journals (Sweden)

    Vincent J. Lynch

    2015-02-01

    Full Text Available A major challenge in biology is determining how evolutionarily novel characters originate; however, mechanistic explanations for the origin of new characters are almost completely unknown. The evolution of pregnancy is an excellent system in which to study the origin of novelties because mammals preserve stages in the transition from egg laying to live birth. To determine the molecular bases of this transition, we characterized the pregnant/gravid uterine transcriptome from tetrapods to trace the evolutionary history of uterine gene expression. We show that thousands of genes evolved endometrial expression during the origins of mammalian pregnancy, including genes that mediate maternal-fetal communication and immunotolerance. Furthermore, thousands of cis-regulatory elements that mediate decidualization and cell-type identity in decidualized stromal cells are derived from ancient mammalian transposable elements (TEs. Our results indicate that one of the defining mammalian novelties evolved from DNA sequences derived from ancient mammalian TEs co-opted into hormone-responsive regulatory elements distributed throughout the genome.

  19. Discovery and analysis of evolutionarily conserved intronic splicing regulatory elements.

    Directory of Open Access Journals (Sweden)

    Gene W Yeo

    2007-05-01

    Full Text Available Knowledge of the functional cis-regulatory elements that regulate constitutive and alternative pre-mRNA splicing is fundamental for biology and medicine. Here we undertook a genome-wide comparative genomics approach using available mammalian genomes to identify conserved intronic splicing regulatory elements (ISREs. Our approach yielded 314 ISREs, and insertions of ~70 ISREs between competing splice sites demonstrated that 84% of ISREs altered 5' and 94% altered 3' splice site choice in human cells. Consistent with our experiments, comparisons of ISREs to known splicing regulatory elements revealed that 40%-45% of ISREs might have dual roles as exonic splicing silencers. Supporting a role for ISREs in alternative splicing, we found that 30%-50% of ISREs were enriched near alternatively spliced (AS exons, and included almost all known binding sites of tissue-specific alternative splicing factors. Further, we observed that genes harboring ISRE-proximal exons have biases for tissue expression and molecular functions that are ISRE-specific. Finally, we discovered that for Nova1, neuronal PTB, hnRNP C, and FOX1, the most frequently occurring ISRE proximal to an alternative conserved exon in the splicing factor strongly resembled its own known RNA binding site, suggesting a novel application of ISRE density and the propensity for splicing factors to auto-regulate to associate RNA binding sites to splicing factors. Our results demonstrate that ISREs are crucial building blocks in understanding general and tissue-specific AS regulation and the biological pathways and functions regulated by these AS events.

  20. Whorl-specific expression of the SUPERMAN gene of Arabidopsis is mediated by cis elements in the transcribed region.

    Science.gov (United States)

    Ito, Toshiro; Sakai, Hajime; Meyerowitz, Elliot M

    2003-09-02

    The SUPERMAN (SUP) gene of Arabidopsis is involved in controlling cell proliferation in stamen and carpel primordia and in ovules during flower development. The SUP gene encodes a transcription factor with a C2H2-type zinc finger motif, a serine/proline-rich domain, a basic domain, and a leucine-zipper-like domain and is expressed in a very limited region in stamen primordia and in the developing ovary during flower development. The SUP gene is susceptible to methylation, resulting in epigenetic gene silencing. To understand how the SUP gene is expressed spatially and temporally in its restricted domain, and why methylation of the transcribed region affects early-stage SUP expression, we have identified the SUP cis regulatory elements by characterizing SUP gene fusions. These studies show that the SUP gene has discrete upstream promoter elements required for expression in stamen primordia in early stages and in the ovary in later stages. The promoter activity for stamen primordia is modulated by several positive and negative elements located in the transcribed and translated regions. Several regulatory elements in the transcribed region correlate with the areas of the gene that are heavily methylated in epigenetic alleles; these data provide a possible explanation of how methylation of the transcribed region represses transcription.

  1. Evolutionary origin of Rosaceae-specific active non-autonomous hAT elements and their contribution to gene regulation and genomic structural variation.

    Science.gov (United States)

    Wang, Lu; Peng, Qian; Zhao, Jianbo; Ren, Fei; Zhou, Hui; Wang, Wei; Liao, Liao; Owiti, Albert; Jiang, Quan; Han, Yuepeng

    2016-05-01

    Transposable elements account for approximately 30 % of the Prunus genome; however, their evolutionary origin and functionality remain largely unclear. In this study, we identified a hAT transposon family, termed Moshan, in Prunus. The Moshan elements consist of three types, aMoshan, tMoshan, and mMoshan. The aMoshan and tMoshan types contain intact or truncated transposase genes, respectively, while the mMoshan type is miniature inverted-repeat transposable element (MITE). The Moshan transposons are unique to Rosaceae, and the copy numbers of different Moshan types are significantly correlated. Sequence homology analysis reveals that the mMoshan MITEs are direct deletion derivatives of the tMoshan progenitors, and one kind of mMoshan containing a MuDR-derived fragment were amplified predominately in the peach genome. The mMoshan sequences contain cis-regulatory elements that can enhance gene expression up to 100-fold. The mMoshan MITEs can serve as potential sources of micro and long noncoding RNAs. Whole-genome re-sequencing analysis indicates that mMoshan elements are highly active, and an insertion into S-haplotype-specific F-box gene was reported to cause the breakdown of self-incompatibility in sour cherry. Taken together, all these results suggest that the mMoshan elements play important roles in regulating gene expression and driving genomic structural variation in Prunus.

  2. Finding cis-regulatory modules in Drosophila using phylogenetic hidden Markov models

    DEFF Research Database (Denmark)

    Wong, Wendy S W; Nielsen, Rasmus

    2007-01-01

    of the increasing availability of comparative genomic data. RESULTS: We develop a method for finding regulatory modules in Eukaryotic species using phylogenetic data. Using computer simulations and analysis of real data, we show that the use of phylogenetic hidden Markov model can lead to an increase in accuracy...

  3. Systematic identification of cis-regulatory sequences active in mouse and human embryonic stem cells.

    Directory of Open Access Journals (Sweden)

    Marica Grskovic

    2007-08-01

    Full Text Available Understanding the transcriptional regulation of pluripotent cells is of fundamental interest and will greatly inform efforts aimed at directing differentiation of embryonic stem (ES cells or reprogramming somatic cells. We first analyzed the transcriptional profiles of mouse ES cells and primordial germ cells and identified genes upregulated in pluripotent cells both in vitro and in vivo. These genes are enriched for roles in transcription, chromatin remodeling, cell cycle, and DNA repair. We developed a novel computational algorithm, CompMoby, which combines analyses of sequences both aligned and non-aligned between different genomes with a probabilistic segmentation model to systematically predict short DNA motifs that regulate gene expression. CompMoby was used to identify conserved overrepresented motifs in genes upregulated in pluripotent cells. We show that the motifs are preferentially active in undifferentiated mouse ES and embryonic germ cells in a sequence-specific manner, and that they can act as enhancers in the context of an endogenous promoter. Importantly, the activity of the motifs is conserved in human ES cells. We further show that the transcription factor NF-Y specifically binds to one of the motifs, is differentially expressed during ES cell differentiation, and is required for ES cell proliferation. This study provides novel insights into the transcriptional regulatory networks of pluripotent cells. Our results suggest that this systematic approach can be broadly applied to understanding transcriptional networks in mammalian species.

  4. Interactions between glucocorticoid treatment and cis-regulatory polymorphisms contribute to cellular response phenotypes.

    Directory of Open Access Journals (Sweden)

    Joseph C Maranville

    2011-07-01

    Full Text Available Glucocorticoids (GCs mediate physiological responses to environmental stress and are commonly used as pharmaceuticals. GCs act primarily through the GC receptor (GR, a transcription factor. Despite their clear biomedical importance, little is known about the genetic architecture of variation in GC response. Here we provide an initial assessment of variability in the cellular response to GC treatment by profiling gene expression and protein secretion in 114 EBV-transformed B lymphocytes of African and European ancestry. We found that genetic variation affects the response of nearby genes and exhibits distinctive patterns of genotype-treatment interactions, with genotypic effects evident in either only GC-treated or only control-treated conditions. Using a novel statistical framework, we identified interactions that influence the expression of 26 genes known to play central roles in GC-related pathways (e.g. NQO1, AIRE, and SGK1 and that influence the secretion of IL6.

  5. Extensive cis-regulatory variation robust to environmental perturbation in Arabidopsis.

    Science.gov (United States)

    Cubillos, Francisco A; Stegle, Oliver; Grondin, Cécile; Canut, Matthieu; Tisné, Sébastien; Gy, Isabelle; Loudet, Olivier

    2014-11-01

    cis- and trans-acting factors affect gene expression and responses to environmental conditions. However, for most plant systems, we lack a comprehensive map of these factors and their interaction with environmental variation. Here, we examined allele-specific expression (ASE) in an F1 hybrid to study how alleles from two Arabidopsis thaliana accessions affect gene expression. To investigate the effect of the environment, we used drought stress and developed a variance component model to estimate the combined genetic contributions of cis- and trans-regulatory polymorphisms, environmental factors, and their interactions. We quantified ASE for 11,003 genes, identifying 3318 genes with consistent ASE in control and stress conditions, demonstrating that cis-acting genetic effects are essentially robust to changes in the environment. Moreover, we found 1618 genes with genotype x environment (GxE) interactions, mostly cis x E interactions with magnitude changes in ASE. We found fewer trans x E interactions, but these effects were relatively less robust across conditions, showing more changes in the direction of the effect between environments; this confirms that trans-regulation plays an important role in the response to environmental conditions. Our data provide a detailed map of cis- and trans-regulation and GxE interactions in A. thaliana, laying the ground for mechanistic investigations and studies in other plants and environments.

  6. Extensive cis-Regulatory Variation Robust to Environmental Perturbation in Arabidopsis[W

    Science.gov (United States)

    Cubillos, Francisco A.; Stegle, Oliver; Grondin, Cécile; Canut, Matthieu; Tisné, Sébastien; Gy, Isabelle

    2014-01-01

    cis- and trans-acting factors affect gene expression and responses to environmental conditions. However, for most plant systems, we lack a comprehensive map of these factors and their interaction with environmental variation. Here, we examined allele-specific expression (ASE) in an F1 hybrid to study how alleles from two Arabidopsis thaliana accessions affect gene expression. To investigate the effect of the environment, we used drought stress and developed a variance component model to estimate the combined genetic contributions of cis- and trans-regulatory polymorphisms, environmental factors, and their interactions. We quantified ASE for 11,003 genes, identifying 3318 genes with consistent ASE in control and stress conditions, demonstrating that cis-acting genetic effects are essentially robust to changes in the environment. Moreover, we found 1618 genes with genotype x environment (GxE) interactions, mostly cis x E interactions with magnitude changes in ASE. We found fewer trans x E interactions, but these effects were relatively less robust across conditions, showing more changes in the direction of the effect between environments; this confirms that trans-regulation plays an important role in the response to environmental conditions. Our data provide a detailed map of cis- and trans-regulation and GxE interactions in A. thaliana, laying the ground for mechanistic investigations and studies in other plants and environments. PMID:25428981

  7. Structure-aided prediction of mammalian transcription factor complexes in conserved non-coding elements

    KAUST Repository

    Guturu, H.

    2013-11-11

    Mapping the DNA-binding preferences of transcription factor (TF) complexes is critical for deciphering the functions of cis-regulatory elements. Here, we developed a computational method that compares co-occurring motif spacings in conserved versus unconserved regions of the human genome to detect evolutionarily constrained binding sites of rigid TF complexes. Structural data were used to estimate TF complex physical plausibility, explore overlapping motif arrangements seldom tackled by non-structure-aware methods, and generate and analyse three-dimensional models of the predicted complexes bound to DNA. Using this approach, we predicted 422 physically realistic TF complex motifs at 18% false discovery rate, the majority of which (326, 77%) contain some sequence overlap between binding sites. The set of mostly novel complexes is enriched in known composite motifs, predictive of binding site configurations in TF-TF-DNA crystal structures, and supported by ChIP-seq datasets. Structural modelling revealed three cooperativity mechanisms: direct protein-protein interactions, potentially indirect interactions and \\'through-DNA\\' interactions. Indeed, 38% of the predicted complexes were found to contain four or more bases in which TF pairs appear to synergize through overlapping binding to the same DNA base pairs in opposite grooves or strands. Our TF complex and associated binding site predictions are available as a web resource at http://bejerano.stanford.edu/complex.

  8. Genome-wide profiling of p63 DNA-binding sites identifies an element that regulates gene expression during limb development in the 7q21 SHFM1 locus.

    Directory of Open Access Journals (Sweden)

    Evelyn N Kouwenhoven

    2010-08-01

    Full Text Available Heterozygous mutations in p63 are associated with split hand/foot malformations (SHFM, orofacial clefting, and ectodermal abnormalities. Elucidation of the p63 gene network that includes target genes and regulatory elements may reveal new genes for other malformation disorders. We performed genome-wide DNA-binding profiling by chromatin immunoprecipitation (ChIP, followed by deep sequencing (ChIP-seq in primary human keratinocytes, and identified potential target genes and regulatory elements controlled by p63. We show that p63 binds to an enhancer element in the SHFM1 locus on chromosome 7q and that this element controls expression of DLX6 and possibly DLX5, both of which are important for limb development. A unique micro-deletion including this enhancer element, but not the DLX5/DLX6 genes, was identified in a patient with SHFM. Our study strongly indicates disruption of a non-coding cis-regulatory element located more than 250 kb from the DLX5/DLX6 genes as a novel disease mechanism in SHFM1. These data provide a proof-of-concept that the catalogue of p63 binding sites identified in this study may be of relevance to the studies of SHFM and other congenital malformations that resemble the p63-associated phenotypes.

  9. CONDOR: a database resource of developmentally associated conserved non-coding elements

    Directory of Open Access Journals (Sweden)

    Smith Sarah

    2007-08-01

    Full Text Available Abstract Background Comparative genomics is currently one of the most popular approaches to study the regulatory architecture of vertebrate genomes. Fish-mammal genomic comparisons have proved powerful in identifying conserved non-coding elements likely to be distal cis-regulatory modules such as enhancers, silencers or insulators that control the expression of genes involved in the regulation of early development. The scientific community is showing increasing interest in characterizing the function, evolution and language of these sequences. Despite this, there remains little in the way of user-friendly access to a large dataset of such elements in conjunction with the analysis and the visualization tools needed to study them. Description Here we present CONDOR (COnserved Non-coDing Orthologous Regions available at: http://condor.fugu.biology.qmul.ac.uk. In an interactive and intuitive way the website displays data on > 6800 non-coding elements associated with over 120 early developmental genes and conserved across vertebrates. The database regularly incorporates results of ongoing in vivo zebrafish enhancer assays of the CNEs carried out in-house, which currently number ~100. Included and highlighted within this set are elements derived from duplication events both at the origin of vertebrates and more recently in the teleost lineage, thus providing valuable data for studying the divergence of regulatory roles between paralogs. CONDOR therefore provides a number of tools and facilities to allow scientists to progress in their own studies on the function and evolution of developmental cis-regulation. Conclusion By providing access to data with an approachable graphics interface, the CONDOR database presents a rich resource for further studies into the regulation and evolution of genes involved in early development.

  10. A method of predicting changes in human gene splicing induced by genetic variants in context of cis-acting elements

    Directory of Open Access Journals (Sweden)

    Hicks Chindo

    2010-01-01

    Full Text Available Abstract Background Polymorphic variants and mutations disrupting canonical splicing isoforms are among the leading causes of human hereditary disorders. While there is a substantial evidence of aberrant splicing causing Mendelian diseases, the implication of such events in multi-genic disorders is yet to be well understood. We have developed a new tool (SpliceScan II for predicting the effects of genetic variants on splicing and cis-regulatory elements. The novel Bayesian non-canonical 5'GC splice site (SS sensor used in our tool allows inference on non-canonical exons. Results Our tool performed favorably when compared with the existing methods in the context of genes linked to the Autism Spectrum Disorder (ASD. SpliceScan II was able to predict more aberrant splicing isoforms triggered by the mutations, as documented in DBASS5 and DBASS3 aberrant splicing databases, than other existing methods. Detrimental effects behind some of the polymorphic variations previously associated with Alzheimer's and breast cancer could be explained by changes in predicted splicing patterns. Conclusions We have developed SpliceScan II, an effective and sensitive tool for predicting the detrimental effects of genomic variants on splicing leading to Mendelian and complex hereditary disorders. The method could potentially be used to screen resequenced patient DNA to identify de novo mutations and polymorphic variants that could contribute to a genetic disorder.

  11. A distal intergenic region controls pancreatic endocrine differentiation by acting as a transcriptional enhancer and as a polycomb response element

    Science.gov (United States)

    Pardanaud-Glavieux, Corinne; García-Hurtado, Javier; Sauty, Claire; Guerci, Aline; Ferrer, Jorge

    2017-01-01

    Lineage-selective expression of developmental genes is dependent on the interplay between activating and repressive mechanisms. Gene activation is dependent on cell-specific transcription factors that recognize transcriptional enhancer sequences. Gene repression often depends on the recruitment of Polycomb group (PcG) proteins, although the sequences that underlie the recruitment of PcG proteins, also known as Polycomb response elements (PREs), remain poorly understood in vertebrates. While distal PREs have been identified in mammals, a role for positive-acting enhancers in PcG-mediated repression has not been described. Here we have used a highly efficient procedure based on lentiviral-mediated transgenesis to carry out in vivo fine-mapping of, cis-regulatory sequences that control lineage-specific activation of Neurog3, a master regulator of pancreatic endocrine differentiation. Our findings reveal an enhancer region that is sufficient to drive correct spacio-temporal expression of Neurog3 and demonstrate that this same region serves as a PRE in alternative lineages where Neurog3 is inactive. PMID:28225770

  12. Quantitative analysis of polycomb response elements (PREs at identical genomic locations distinguishes contributions of PRE sequence and genomic environment

    Directory of Open Access Journals (Sweden)

    Okulski Helena

    2011-03-01

    Full Text Available Abstract Background Polycomb/Trithorax response elements (PREs are cis-regulatory elements essential for the regulation of several hundred developmentally important genes. However, the precise sequence requirements for PRE function are not fully understood, and it is also unclear whether these elements all function in a similar manner. Drosophila PRE reporter assays typically rely on random integration by P-element insertion, but PREs are extremely sensitive to genomic position. Results We adapted the ΦC31 site-specific integration tool to enable systematic quantitative comparison of PREs and sequence variants at identical genomic locations. In this adaptation, a miniwhite (mw reporter in combination with eye-pigment analysis gives a quantitative readout of PRE function. We compared the Hox PRE Frontabdominal-7 (Fab-7 with a PRE from the vestigial (vg gene at four landing sites. The analysis revealed that the Fab-7 and vg PREs have fundamentally different properties, both in terms of their interaction with the genomic environment at each site and their inherent silencing abilities. Furthermore, we used the ΦC31 tool to examine the effect of deletions and mutations in the vg PRE, identifying a 106 bp region containing a previously predicted motif (GTGT that is essential for silencing. Conclusions This analysis showed that different PREs have quantifiably different properties, and that changes in as few as four base pairs have profound effects on PRE function, thus illustrating the power and sensitivity of ΦC31 site-specific integration as a tool for the rapid and quantitative dissection of elements of PRE design.

  13. Human Papillomavirus Type 18 cis-Elements Crucial for Segregation and Latency.

    Directory of Open Access Journals (Sweden)

    Mart Ustav

    Full Text Available Stable maintenance replication is characteristic of the latency phase of HPV infection, during which the viral genomes are actively maintained as extrachromosomal genetic elements in infected proliferating basal keratinocytes. Active replication in the S-phase and segregation of the genome into daughter cells in mitosis are required for stable maintenance replication. Most of our knowledge about papillomavirus genome segregation has come from studies of bovine papillomavirus type 1 (BPV-1, which have demonstrated that the E2 protein cooperates with cellular trans-factors and that E2 binding sites act as cis-regulatory elements in the viral genome that are essential for the segregation process. However, the genomic organization of the regulatory region in HPVs, and the properties of the viral proteins are different from those of their BPV-1 counterparts. We have designed a segregation assay for HPV-18 and used it to demonstrate that the E2 protein performs segregation in combination with at least two E2 binding sites. The cooperative binding of the E2 protein to two E2 binding sites is a major determinant of HPV-18 genome segregation, as demonstrated by the change in spacing between adjacent binding sites #1 and #2 in the HPV-18 Upstream Regulatory Region (URR. Duplication or triplication of the natural 4 bp 5'-CGGG-3' spacer between the E2 binding sites increased the cooperative binding of the E2 molecules as well as E2-dependent segregation. Removal of any spacing between these sites eliminated cooperative binding of the E2 protein and disabled segregation of the URR and HPV-18 genome. Transfer of these configurations of the E2 binding sites into viral genomes confirmed the role of the E2 protein and binding sites #1 and #2 in the segregation process. Additional analysis demonstrated that these sites also play an important role in the transcriptional regulation of viral gene expression from different HPV-18 promoters.

  14. A Novel Peroxisome Proliferator Response Element Modulates Hepatic Low Density Lipoprotein Receptor Gene Transcription in Response to PPARδ Activation

    Science.gov (United States)

    Shende, Vikram R.; Singh, Amar Bahadur; Liu, Jingwen

    2016-01-01

    The hepatic expression of LDLR gene is regulated primarily at the transcriptional level by a sterol-regulatory element (SRE) in its proximal promoter region which is the site of action of SRE-binding protein 2 (SREBP2). However whether additional cis-regulatory elements contribute to LDLR transcription has not been fully explored. We investigated the function of a putative PPAR-response element (PPRE) sequence motif located at −768 to −752 bases upstream of the transcription start site of human LDLR gene in response to PPARδ activation. Promoter luciferase reporter analyses showed that treating HepG2 cells with PPARδ agonist L165041 markedly increased the activity of a full-length LDLR promoter construct (pLDLR-1192) without any effects on the shorter promoter reporter pLDLR-234 that contains only the core regulatory elements SRE-1 and SP1 sites. Importantly, mutation of the PPRE sequence greatly attenuated the induction of the full-length LDLR promoter activity by L165041 without affecting rosuvastatin mediated transactivation. Electrophoretic mobility shift and chromatin immunoprecipitation assays further confirmed the binding of PPARδ to the LDLR-PPRE site. Treating HepG2 cells with L165041 elevated the mRNA and protein expressions of LDLR without affecting the LDLR mRNA decay rate. The induction of LDLR expression by PPARδ agonist was further observed in liver tissue of mice and hamsters treated with L165041. Altogether, our studies identify a novel PPRE-mediated regulatory mechanism for LDLR transcription and suggest that combined treatment of statin with PPARδ agonists may have advantageous effects on LDLR expression. PMID:26443862

  15. A novel peroxisome proliferator response element modulates hepatic low-density lipoprotein receptor gene transcription in response to PPARδ activation.

    Science.gov (United States)

    Shende, Vikram R; Singh, Amar Bahadur; Liu, Jingwen

    2015-12-15

    The hepatic expression of low-density lipoprotein (LDL) receptor (LDLR) gene is regulated primarily at the transcriptional level by a sterol-regulatory element (SRE) in its proximal promoter region which is the site of action of SRE-binding protein 2 (SREBP2). However whether additional cis-regulatory elements contribute to LDLR transcription has not been fully explored. We investigated the function of a putative peroxisome proliferator-activated receptor (PPAR)-response element (PPRE) sequence motif located at -768 to -752 bases upstream of the transcription start site of human LDLR gene in response to PPARδ activation. Promoter luciferase reporter analyses showed that treating HepG2 cells with PPARδ agonist L165041 markedly increased the activity of a full-length LDLR promoter construct (pLDLR-1192) without any effects on the shorter promoter reporter pLDLR-234 that contains only the core regulatory elements SRE-1 and SP1 sites. Importantly, mutation of the PPRE sequence greatly attenuated the induction of the full-length LDLR promoter activity by L165041 without affecting rosuvastatin (RSV)-mediated transactivation. EMSA and ChIP assay further confirmed the binding of PPARδ to the LDLR-PPRE site. Treating HepG2 cells with L165041 elevated the mRNA and protein expressions of LDLR without affecting the LDLR mRNA decay rate. The induction of LDLR expression by PPARδ agonist was further observed in liver tissue of mice and hamsters treated with L165041. Altogether, our studies identify a novel PPRE-mediated regulatory mechanism for LDLR transcription and suggest that combined treatment of statin with PPARδ agonists may have advantageous effects on LDLR expression.

  16. Genome-wide prediction of transcriptional regulatory elements of human promoters using gene expression and promoter analysis data

    Directory of Open Access Journals (Sweden)

    Kim Seon-Young

    2006-07-01

    Full Text Available Abstract Background A complete understanding of the regulatory mechanisms of gene expression is the next important issue of genomics. Many bioinformaticians have developed methods and algorithms for predicting transcriptional regulatory mechanisms from sequence, gene expression, and binding data. However, most of these studies involved the use of yeast which has much simpler regulatory networks than human and has many genome wide binding data and gene expression data under diverse conditions. Studies of genome wide transcriptional networks of human genomes currently lag behind those of yeast. Results We report herein a new method that combines gene expression data analysis with promoter analysis to infer transcriptional regulatory elements of human genes. The Z scores from the application of gene set analysis with gene sets of transcription factor binding sites (TFBSs were successfully used to represent the activity of TFBSs in a given microarray data set. A significant correlation between the Z scores of gene sets of TFBSs and individual genes across multiple conditions permitted successful identification of many known human transcriptional regulatory elements of genes as well as the prediction of numerous putative TFBSs of many genes which will constitute a good starting point for further experiments. Using Z scores of gene sets of TFBSs produced better predictions than the use of mRNA levels of a transcription factor itself, suggesting that the Z scores of gene sets of TFBSs better represent diverse mechanisms for changing the activity of transcription factors in the cell. In addition, cis-regulatory modules, combinations of co-acting TFBSs, were readily identified by our analysis. Conclusion By a strategic combination of gene set level analysis of gene expression data sets and promoter analysis, we were able to identify and predict many transcriptional regulatory elements of human genes. We conclude that this approach will aid in decoding

  17. An element

    Energy Technology Data Exchange (ETDEWEB)

    Nakamura, K.; Iidzima, K.

    1983-03-30

    An anode of a light metal is used in the element, along with an electrolyte which consists of an ether solvent and an ionogenic additive in the form of a salt of dithiocarbamic acid. The element has good discharge characteristics.

  18. Two estrogen response element sequences near the PCNA gene are not responsible for its estrogen-enhanced expression in MCF7 cells.

    Directory of Open Access Journals (Sweden)

    Cheng Wang

    Full Text Available BACKGROUND: The proliferating cell nuclear antigen (PCNA is an essential component of DNA replication, cell cycle regulation, and epigenetic inheritance. High expression of PCNA is associated with poor prognosis in patients with breast cancer. The 5'-region of the PCNA gene contains two computationally-detected estrogen response element (ERE sequences, one of which is evolutionarily conserved. Both of these sequences are of undocumented cis-regulatory function. We recently demonstrated that estradiol (E2 enhances PCNA mRNA expression in MCF7 breast cancer cells. MCF7 cells proliferate in response to E2. METHODOLOGY/PRINCIPAL FINDINGS: Here, we demonstrate that E2 rapidly enhanced PCNA mRNA and protein expression in a process that requires ERalpha as well as de novo protein synthesis. One of the two upstream ERE sequences was specifically bound by ERalpha-containing protein complexes, in vitro, in gel shift analysis. Yet, each ERE sequence, when cloned as a single copy, or when engineered as two tandem copies of the ERE-containing sequence, was not capable of activating a luciferase reporter construct in response to E2. In MCF7 cells, neither ERE-containing genomic region demonstrated E2-dependent recruitment of ERalpha by sensitive ChIP-PCR assays. CONCLUSION/SIGNIFICANCE: We conclude that E2 enhances PCNA gene expression by an indirect process and that computational detection of EREs, even when evolutionarily conserved and when near E2-responsive genes, requires biochemical validation.

  19. The alr-groEL1 operon in Mycobacterium tuberculosis: an interplay of multiple regulatory elements

    Science.gov (United States)

    Bhat, Aadil H.; Pathak, Deepika; Rao, Alka

    2017-01-01

    Threonylcarbamoyladenosine is a universally conserved essential modification of tRNA that ensures translational fidelity in cellular milieu. TsaD, TsaB and TsaE are identified as tRNA-A37-threonylcarbamoyl (t6A)-transferase enzymes that have been reconstituted in vitro, in few bacteria recently. However, transcriptional organization and regulation of these genes are not known in any of these organisms. This study describes the intricate architecture of a complex multicistronic alr-groEL1 operon, harboring essential genes, namely tsaD, tsaB, tsaE, groES, groEL1, and alr (required for cell wall synthesis), and rimI encoding an N-α- acetyltransferase in Mycobacterium tuberculosis. Using northern blotting, RT-PCR and in vivo fluorescence assays, genes alr to groEL1 were found to constitute an ~6.3 kb heptacistronic operon with multiple internal promoters and an I-shaped intrinsic hairpin-like cis-regulatory element. A strong promoter PtsaD within the coding sequence of rimI gene is identified in M. tuberculosis, in addition. The study further proposes an amendment in the known bicistronic groESL1 operon annotation by providing evidence that groESL1 is co-transcribed as sub-operon of alr-groEL1 operon. The architecture of alr-groEL1 operon, conservation of the genetic context and a mosaic transcriptional profile displayed under various stress conditions convincingly suggest the involvement of this operon in stress adaptation in M. tuberculosis. PMID:28256563

  20. Disease: H00855 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available defects such as triphalangeal thumb-polydactyly syndrome (TPT-PS). TPT is caused... by defects in a cis-regulatory sequence ZRS, located in intron 5 of LMBR1, which is crucial for expression ...syndactyly syndrome in a Chinese family. Biochem Biophys Res Commun 355:312-7 (2007) PMID:20068592 (descript...ion, gene) Farooq M, Troelsen JT, Boyd M, Eiberg H, Hansen L, Hussain MS, Rehman S, Azhar A, Ali A, Bakhtiar...R, Urban M, Koszewicz M, Moron K Rare triphalangeal thumb polydactyly: a case report. J Plast Reconstr Aesth

  1. Toxic Elements

    DEFF Research Database (Denmark)

    Hajeb, Parvaneh; Shakibazadeh, Shahram; Sloth, Jens Jørgen

    2016-01-01

    Food is considered the main source of toxic element (arsenic, cadmium, lead, and mercury) exposure to humans, and they can cause major public health effects. In this chapter, we discuss the most important sources for toxic element in food and the foodstuffs which are significant contributors to h...

  2. The meta-epigenomic structure of purified human stem cell populations is defined at cis-regulatory sequences

    Science.gov (United States)

    Zhao, Yong Mei; Golden, Aaron; Mar, Jessica C.; Einstein, Francine H.; Greally, John M.

    2014-01-01

    The mechanism and significance of epigenetic variability in the same cell type between healthy individuals are not clear. Here, we purify human CD34+ hematopoietic stem and progenitor cells (HSPCs) from different individuals and find that there is increased variability of DNA methylation at loci with properties of promoters and enhancers. The variability is especially enriched at candidate enhancers near genes transitioning between silent and expressed states, and encoding proteins with leukocyte differentiation properties. Our findings of increased variability at loci with intermediate DNA methylation values, at candidate “poised” enhancers, and at genes involved in HSPC lineage commitment suggest that CD34+ cell subtype heterogeneity between individuals is a major mechanism for the variability observed. Epigenomic studies performed on cell populations, even when purified, are testing collections of epigenomes, or meta-epigenomes. Our findings show that meta-epigenomic approaches to data analysis can provide insights into cell subpopulation structure. PMID:25327398

  3. A cis-regulatory antisense RNA represses translation in Vibrio cholerae through extensive complementarity and proximity to the target locus.

    Science.gov (United States)

    Chang, Howard; Replogle, John Michael; Vather, Naomi; Tsao-Wu, Maya; Mistry, Ronak; Liu, Jane M

    2015-01-01

    As with all facultative pathogens, Vibrio cholerae must optimize its cellular processes to adapt to different environments with varying carbon sources and to environmental stresses. More specifically, in order to metabolize mannitol, V. cholerae must regulate the synthesis of MtlA, a mannitol transporter protein produced exclusively in the presence of mannitol. We previously showed that a cis-acting small RNA (sRNA) expressed by V. cholerae, MtlS, appears to post-transcriptionally downregulate the expression of mtlA and is produced in the absence of mannitol. We hypothesized that since it is complementary to the 5' untranslated region (UTR) of mtlA mRNA, MtlS may affect synthesis of MtlA by forming an mtlA-MtlS complex that blocks translation of the mRNA through occlusion of its ribosome binding site. To test this hypothesis, we used in vitro translation assays in order to examine the role MtlS plays in mtlA regulation and found that MtlS is sufficient to suppress translation of transcripts harboring the 5' UTR of mtlA. However, in a cellular context, the 5' UTR of mtlA is not sufficient for targeted repression by endogenous MtlS; additional segments from the coding region of mtlA play a role in the ability of the sRNA to regulate translation of mtlA mRNA. Additionally, proximity of transcription sites between the sRNA and mRNA significantly affects the efficacy of MtlS.

  4. Powerful identification of cis-regulatory SNPs in human primary monocytes using allele-specific gene expression.

    Directory of Open Access Journals (Sweden)

    Jonas Carlsson Almlöf

    Full Text Available A large number of genome-wide association studies have been performed during the past five years to identify associations between SNPs and human complex diseases and traits. The assignment of a functional role for the identified disease-associated SNP is not straight-forward. Genome-wide expression quantitative trait locus (eQTL analysis is frequently used as the initial step to define a function while allele-specific gene expression (ASE analysis has not yet gained a wide-spread use in disease mapping studies. We compared the power to identify cis-acting regulatory SNPs (cis-rSNPs by genome-wide allele-specific gene expression (ASE analysis with that of traditional expression quantitative trait locus (eQTL mapping. Our study included 395 healthy blood donors for whom global gene expression profiles in circulating monocytes were determined by Illumina BeadArrays. ASE was assessed in a subset of these monocytes from 188 donors by quantitative genotyping of mRNA using a genome-wide panel of SNP markers. The performance of the two methods for detecting cis-rSNPs was evaluated by comparing associations between SNP genotypes and gene expression levels in sample sets of varying size. We found that up to 8-fold more samples are required for eQTL mapping to reach the same statistical power as that obtained by ASE analysis for the same rSNPs. The performance of ASE is insensitive to SNPs with low minor allele frequencies and detects a larger number of significantly associated rSNPs using the same sample size as eQTL mapping. An unequivocal conclusion from our comparison is that ASE analysis is more sensitive for detecting cis-rSNPs than standard eQTL mapping. Our study shows the potential of ASE mapping in tissue samples and primary cells which are difficult to obtain in large numbers.

  5. The Schizosaccharomyces pombe inv1+ regulatory region is unusually large and contains redundant cis-acting elements that function in a SAGA- and Swi/Snf-dependent fashion.

    Science.gov (United States)

    Ahn, Sejin; Spatt, Dan; Winston, Fred

    2012-08-01

    The Schizosaccharomyces pombe inv1(+) gene encodes invertase, the enzyme required for hydrolysis of sucrose and raffinose. Transcription of inv1(+) is regulated by glucose levels, with transcription tightly repressed in high glucose and strongly induced in low glucose. To understand this regulation, we have analyzed the inv1(+) cis-regulatory region and the requirement for the trans-acting coactivators SAGA and Swi/Snf. Surprisingly, deletion of the entire 1-kilobase intergenic region between the inv1(+) TATA element and the upstream open reading frame SPCC191.10 does not significantly alter regulation of inv1(+) transcription. However, a longer deletion that extends through SPCC191.10 abolishes inv1(+) induction in low glucose. Additional analysis demonstrates that there are multiple, redundant regulatory regions spread over 1.5 kb 5' of inv1(+), including within SPCC191.10, that can confer glucose-mediated transcriptional regulation to inv1(+). Furthermore, SPCC191.10 can regulate inv1(+) transcription in an orientation-independent fashion and from a distance as great as 3 kb. With respect to trans-acting factors, both SAGA and Swi/Snf are recruited to SPCC191.10 and to other locations in the large inv1(+) regulatory region in a glucose-dependent fashion, and both are required for inv1(+) derepression. Taken together, these results demonstrate that inv1(+) regulation in S. pombe occurs via the use of multiple regulatory elements and that activation can occur over a great distance, even from elements within other open reading frames.

  6. Improved recombinant antibody production by CHO cells using a production enhancer DNA element with repeated transgene integration at a predetermined chromosomal site.

    Science.gov (United States)

    Kawabe, Yoshinori; Inao, Takanori; Komatsu, Shodai; Huang, Guan; Ito, Akira; Omasa, Takeshi; Kamihira, Masamichi

    2017-03-01

    Chinese hamster ovary (CHO) cells are one of the most useful host cell lines for the production of biopharmaceutical proteins. Although a series of production processes have been refined to improve protein productivity and cost performance, establishing producer cells is still time-consuming and labor-intensive. Recombinase-mediated site-specific gene integration into a predetermined chromosomal locus may enable predictable protein expression, reducing the laborious process of cell screening. We previously developed an accumulative site-specific gene integration system (AGIS) using Cre recombinase and mutated loxP sites for transgene integration and amplification in the CHO cell genome. Epigenetic modifier elements such as insulators are effective DNA cis-regulatory elements for stabilizing transgene expression. Here, we attempted to enhance transgene expression in recombinant CHO cells generated by AGIS using a production enhancer DNA element (PE) derived from the CHO genome. The PE was introduced into an expression unit for a recombinant scFv-Fc antibody. The effect on scFv-Fc productivity of PE position and orientation within the transgene was evaluated, while keeping the background chromosomal structure constant. For the optimal PE arrangement, scFv-Fc productivity was enhanced 2.6-fold compared with an expression unit without a PE. The enhancing effect of the PE on transgene expression was also observed when two or three PE-flanked expression units were inserted as tandem repeats. These results indicate that AGIS using the PE-flanked expression unit is a promising approach for establishing producer cell lines for biopharmaceutical protein production.

  7. PELTIER ELEMENTS

    CERN Document Server

    Tani, Laurits

    2015-01-01

    To control Peltier elements, temperature controller was used. I used TEC-1091 that was manufactured my Meerstetter Engineering. To gain control with the temperature controller, software had to be intalled on a controlling PC. There were different modes to control the Peltier: Tempererature controller to control temperature, Static current/voltage to control voltage and current and LIVE ON/OFF to auto-tune the controller respectively to the system. Also, since near the collision pipe there is much radiation, radiation-proof Peltier elements have to be used. To gain the best results, I had to find the most efficient Peltier elements and try to get their cold side to -40 degrees Celsius.

  8. DNA element downstream of the κB site in the Lcn2 promoter is required for transcriptional activation by IκBζ and NF-κB p50.

    Science.gov (United States)

    Kohda, Akira; Yamazaki, Soh; Sumimoto, Hideki

    2014-08-01

    The nuclear protein IκBζ activates transcription of a subset of NF-κB-dependent innate immune genes such as Lcn2 encoding the antibacterial protein lipocalin-2. IκBζ functions as a coactivator via its interaction with NF-κB p50, which contains a DNA-binding Rel-homology domain but lacks a transcriptional activation domain. However cis-regulatory elements involved in IκBζ function have remained unknown. Here, we show that, although IκBζ by itself is unable to associate with the Lcn2 promoter, IκBζ interacts with the promoter via p50 binding to the NF-κB-binding site (κB site) and the interaction also requires the pyrimidine-rich site (CCCCTC) that localizes seven bases downstream of the κB site. The pyrimidine-rich site is also essential for IκBζ-mediated activation of the Lcn2 gene. Introduction of both sites into an IκBζ-independent gene culminates in IκBζ-p50-DNA complex formation and transcriptional activation. Furthermore, spacing between the two sites is crucial for both IκBζ-DNA interaction and IκBζ-mediated gene activation. Thus, the pyrimidine-rich IκBζ-responsive site plays an essential role in productive interaction of IκBζ with the p50-DNA complex.

  9. Element Research.

    Science.gov (United States)

    Herald, Christine

    2001-01-01

    Describes a research assignment for 8th grade students on the elements of the periodic table. Students use web-based resources and a chemistry handbook to gather information, construct concept maps, and present the findings to the full class using the mode of their choice: a humorous story, a slideshow or gameboard, a brochure, a song, or skit.…

  10. Reference: SRENTTTO1 [PLACE

    Lifescience Database Archive (English)

    Full Text Available SRENTTTO1 Takeda S, Sugimoto K, Otsuki H, Hirochika H A 13-bp cis-regulatory elemen...t in the LTR promoter of the tobacco retrotransposon Tto1 is involved in responsiveness to tissue culture, w

  11. Reference: OCTAMERMOTIFTAH3H4 [PLACE

    Lifescience Database Archive (English)

    Full Text Available OCTAMERMOTIFTAH3H4 Nakayama T, Sakamoto A, Yang P, Minami M, Fujimoto Y, Ito T, Iwa...buchi M Highly conserved hexamer, octamer and nonamer motifs are positive cis-regulatory elements of the whe

  12. Dynamic regulation of the transcription initiation landscape at single nucleotide resolution during vertebrate embryogenesis

    NARCIS (Netherlands)

    C. Nepal (Chirag); Y. Hadzhiev (Yavor); C. Previti (Christopher); V. Haberle (Vanja); N. Li (Nan); H. Takahashi (Hiroyuki); A.M. Suzuki (Ana Maria); Y. Sheng (Ying); R.F. Abdelhamid (Rehab); S. Anand (Santosh); P.A. Gehrig (Paola A.); A. Akalin (Altuna); C. Kockx (Christel); A. Van Der Sloot (Antoine); W.F.J. van IJcken (Wilfred); O. Armant (Olivier); S. Rastegar (Sepand); C. Watson (Craig); U. Strähle (Uwe); E. Stupka (Elia); P. Carninci (Piero); B. Lenhard (Boris); F. Müller (Ferenc)

    2013-01-01

    textabstractSpatiotemporal control of gene expression is central to animal development. Core promoters represent a previously unanticipated regulatory level by interacting with cis-regulatory elements and transcription initiation in different physiological and developmental contexts. Here, we provid

  13. Discrete Element Modeling

    Energy Technology Data Exchange (ETDEWEB)

    Morris, J; Johnson, S

    2007-12-03

    The Distinct Element Method (also frequently referred to as the Discrete Element Method) (DEM) is a Lagrangian numerical technique where the computational domain consists of discrete solid elements which interact via compliant contacts. This can be contrasted with Finite Element Methods where the computational domain is assumed to represent a continuum (although many modern implementations of the FEM can accommodate some Distinct Element capabilities). Often the terms Discrete Element Method and Distinct Element Method are used interchangeably in the literature, although Cundall and Hart (1992) suggested that Discrete Element Methods should be a more inclusive term covering Distinct Element Methods, Displacement Discontinuity Analysis and Modal Methods. In this work, DEM specifically refers to the Distinct Element Method, where the discrete elements interact via compliant contacts, in contrast with Displacement Discontinuity Analysis where the contacts are rigid and all compliance is taken up by the adjacent intact material.

  14. Data Element Registry Services

    Data.gov (United States)

    U.S. Environmental Protection Agency — Data Element Registry Services (DERS) is a resource for information about value lists (aka code sets / pick lists), data dictionaries, data elements, and EPA data...

  15. On Element SDD Approximability

    CERN Document Server

    Avron, Haim; Toledo, Sivan

    2009-01-01

    This short communication shows that in some cases scalar elliptic finite element matrices cannot be approximated well by an SDD matrix. We also give a theoretical analysis of a simple heuristic method for approximating an element by an SDD matrix.

  16. Element-ary Development.

    Science.gov (United States)

    Schamp, Homer W., Jr.

    1989-01-01

    Describes the historic development of the periodic table from the four-element theory to the Lavoisier's table. Presents a table listing the old and new names of chemicals and the Lavoisier's table of elements. Lists two references. (YP)

  17. Rare (Earth Elements [score

    Directory of Open Access Journals (Sweden)

    Camilo Méndez

    2014-12-01

    Full Text Available Rare (Earth Elements is a cycle of works for solo piano. The cycle was inspired by James Dillon’s Book of Elements (Vol. I-V. The complete cycle will consist of 14 pieces; one for each selected rare (earth element. The chosen elements are Neodymium, Erbium, Tellurium, Hafnium, Tantalum, Technetium, Indium, Dysprosium, Lanthanium, Cerium, Europium, Terbium, Yttrium and Darmstadtium. These elements were selected due to their special atomic properties that in many cases make them extremely valuable for the development of new technologies, and also because of their scarcity. To date, only 4 works have been completed Yttrium, Technetium, Indium and Tellurium.

  18. Musikalske elementer i musikaler

    OpenAIRE

    Jensen, Linnea Reitan

    2014-01-01

    Denne masteroppgaven undersøker hvordan musikalske elementer kan bli brukt i musikaler for å påvirke den dramaturgiske helheten. Gjennom både musikalsk og dramaturgisk analyse viser jeg hvordan elementer i musikk kan ha innvirkning på forestillingens dramaturgi. In this master thesis I am aiming to examine the musical elements used in the songs in musicals. Music is an important element in the musical, and therefore I want to look at how some musical elements can contribute to the musical'...

  19. Finite element procedures

    CERN Document Server

    Bathe, Klaus-Jürgen

    2015-01-01

    Finite element procedures are now an important and frequently indispensable part of engineering analyses and scientific investigations. This book focuses on finite element procedures that are very useful and are widely employed. Formulations for the linear and nonlinear analyses of solids and structures, fluids, and multiphysics problems are presented, appropriate finite elements are discussed, and solution techniques for the governing finite element equations are given. The book presents general, reliable, and effective procedures that are fundamental and can be expected to be in use for a long time. The given procedures form also the foundations of recent developments in the field.

  20. Exon B of human surfactant protein A2 mRNA, alone or within its surrounding sequences, interacts with 14-3-3; role of cis-elements and secondary structure.

    Science.gov (United States)

    Noutsios, Georgios T; Silveyra, Patricia; Bhatti, Faizah; Floros, Joanna

    2013-06-01

    Human surfactant protein A, an innate immunity molecule, is encoded by two genes: SFTPA1 (SP-A1) and SFTPA2 (SP-A2). The 5' untranslated (5'UTR) splice variant of SP-A2 (ABD), but not of SP-A1 (AD), contains exon B (eB), which is an enhancer for transcription and translation. We investigated whether eB contains cis-regulatory elements that bind trans-acting factors in a sequence-specific manner as well as the role of the eB mRNA secondary structure. Binding of cytoplasmic NCI-H441 proteins to wild-type eB, eB mutant, AD, and ABD 5'UTR mRNAs were studied by RNA electromobility shift assays (REMSAs). The bound proteins were identified by mass spectroscopy and specific antibodies (Abs). We found that 1) proteins bind eB mRNA in a sequence-specific manner, with two cis-elements identified within eB to be important; 2) eB secondary structure is necessary for binding; 3) mass spectroscopy and specific Abs in REMSAs identified 14-3-3 proteins to bind (directly or indirectly) eB and the natural SP-A2 (ABD) splice variant but not the SP-A1 (AD) splice variant; 4) other ribosomal and cytoskeletal proteins, and translation factors, are also present in the eB mRNA-protein complex; 5) knockdown of 14-3-3 β/α isoform resulted in a downregulation of SP-A2 expression. In conclusion, proteins including the 14-3-3 family bind two cis-elements within eB of hSP-A2 mRNA in a sequence- and secondary structure-specific manner. Differential regulation of SP-A1 and SP-A2 is mediated by the 14-3-3 protein family as well as by a number of other proteins that bind UTRs with or without eB mRNA.

  1. Main: -300ELEMENT [PLACE

    Lifescience Database Archive (English)

    Full Text Available -300ELEMENT S000122 11-May-2006 (last modified) kehi Present upstream of the promot...er from the B-hordein gene of barley and the alpha-gliadin, gamma-gliadin, and low molecular weight glutenin... genes of wheat; See S000001 -300CORE; See S000002 -300MOTIF; -300 element; hordein; gliadin; glutenin; seed; wheat (Triticum aestivum) TGHAAARK ...

  2. A dry element

    Energy Technology Data Exchange (ETDEWEB)

    Kimura, T.; Ota, A.

    1983-08-11

    The agglomerate for the element is made from activated charcoal powder, an electrically conducting additive and a neutral electrolyte. The activated charcoal makes up 30 to 50 percent of the weight of the agglomerate. It is a mixture of hydrophobized and unhydrophobized powder in a ratio of 85 to 70 to 15 to 30. The element has high discharge characteristics.

  3. A battery element

    Energy Technology Data Exchange (ETDEWEB)

    Nakai, M.; Koboyasi, S.; Oisi, K.; Okadzaki, R.; Ota, A.

    1983-07-29

    An anode made of an alkaline or an alkaline earth metal and an electrolyte based on an organic solvent are used in the element. A mixture of Mn203 and Mn304 in a 9 to 1 to 3 to 7 ratio serves as the cathode. The element has a stable discharge curve at a nominal voltage of 1.5 volts.

  4. The solar element

    DEFF Research Database (Denmark)

    Kragh, Helge

    2009-01-01

    Apart from hydrogen, helium is the most abundant chemical element in the universe, and yet it was only discovered on the Earth in 1895. Its early history is unique because it encompasses astronomy as well as chemistry, two sciences which the spectroscope brought into contact during the second half...... of the nineteenth century. In the modest form of a yellow spectral line known as D3, 'helium' was sometimes supposed to exist in the Sun's atmosphere, an idea which is traditionally ascribed to J. Norman Lockyer. Did Lockyer discover helium as a solar element? How was the suggestion received by chemists, physicists...... elements might be different. The complex story of how helium became established as both a solar and terrestrial element involves precise observations as well as airy speculations. It is a story that is unique among the discovery histories of the chemical elements....

  5. Flow Element Models

    DEFF Research Database (Denmark)

    Heiselberg, Per; Nielsen, Peter V.

    Air distribution in ventilated rooms is a flow process that can be divided into different elements such as supply air jets, exhaust flows, thermal plumes, boundary layer flows, infiltration and gravity currents. These flow elements are isolated volumes where the air movement is controlled...... by a restricted number of parameters, and the air movement is fairly independent of the general flow in the enclosure. In many practical situations, the most convenient· method is to design the air distribution system using flow element theory....

  6. Finite element mesh generation

    CERN Document Server

    Lo, Daniel SH

    2014-01-01

    Highlights the Progression of Meshing Technologies and Their ApplicationsFinite Element Mesh Generation provides a concise and comprehensive guide to the application of finite element mesh generation over 2D domains, curved surfaces, and 3D space. Organised according to the geometry and dimension of the problem domains, it develops from the basic meshing algorithms to the most advanced schemes to deal with problems with specific requirements such as boundary conformity, adaptive and anisotropic elements, shape qualities, and mesh optimization. It sets out the fundamentals of popular techniques

  7. Discovery of element 112

    Energy Technology Data Exchange (ETDEWEB)

    Hofmann, S. [GSI, Darmstadt (Germany)

    1996-12-31

    The new elements 110, 111, and 112 were synthesized and unambiguously identified in experiments at SHIP. Due to strong shell effects the dominant decay mode is not fission, but emission of alpha particles. Theoretical investigations predict that maximum shell effects should exist in nuclei near proton number 114 and neutron number 184. Measurements give hope that isotopes of element 114 close to the island of spherical Superheavy Elements could be produced by fusion reactions using {sup 118}Pb as target. systematic studies of the reaction cross-sections indicate that transfer of nucleons is the important process to initiate the fusion.

  8. New functionalities in abundant element oxides: ubiquitous element strategy.

    Science.gov (United States)

    Hosono, Hideo; Hayashi, Katsuro; Kamiya, Toshio; Atou, Toshiyuki; Susaki, Tomofumi

    2011-06-01

    While most ceramics are composed of ubiquitous elements (the ten most abundant elements within the Earth's crust), many advanced materials are based on rare elements. A 'rare-element crisis' is approaching owing to the imbalance between the limited supply of rare elements and the increasing demand. Therefore, we propose a 'ubiquitous element strategy' for materials research, which aims to apply abundant elements in a variety of innovative applications. Creation of innovative oxide materials and devices based on conventional ceramics is one specific challenge. This review describes the concept of ubiquitous element strategy and gives some highlights of our recent research on the synthesis of electronic, thermionic and structural materials using ubiquitous elements.

  9. New roof element system

    DEFF Research Database (Denmark)

    Ditlev, Jesper; Rudbeck, Claus Christian

    1997-01-01

    The aim of the project has been to develop an element system for warm deck roofs which, from a thermal and economical point of view, can deal with the future demands for heat loss coefficients for low slope roofs.......The aim of the project has been to develop an element system for warm deck roofs which, from a thermal and economical point of view, can deal with the future demands for heat loss coefficients for low slope roofs....

  10. Structural elements design manual

    CERN Document Server

    Draycott, Trevor

    2012-01-01

    Gives clear explanations of the logical design sequence for structural elements. The Structural Engineer says: `The book explains, in simple terms, and with many examples, Code of Practice methods for sizing structural sections in timber, concrete,masonry and steel. It is the combination into one book of section sizing methods in each of these materials that makes this text so useful....Students will find this an essential support text to the Codes of Practice in their study of element sizing'.

  11. Novel porcine repetitive elements

    Directory of Open Access Journals (Sweden)

    Nonneman Dan J

    2006-12-01

    Full Text Available Abstract Background Repetitive elements comprise ~45% of mammalian genomes and are increasingly known to impact genomic function by contributing to the genomic architecture, by direct regulation of gene expression and by affecting genomic size, diversity and evolution. The ubiquity and increasingly understood importance of repetitive elements contribute to the need to identify and annotate them. We set out to identify previously uncharacterized repetitive DNA in the porcine genome. Once found, we characterized the prevalence of these repeats in other mammals. Results We discovered 27 repetitive elements in 220 BACs covering 1% of the porcine genome (Comparative Vertebrate Sequencing Initiative; CVSI. These repeats varied in length from 55 to 1059 nucleotides. To estimate copy numbers, we went to an independent source of data, the BAC-end sequences (Wellcome Trust Sanger Institute, covering approximately 15% of the porcine genome. Copy numbers in BAC-ends were less than one hundred for 6 repeat elements, between 100 and 1000 for 16 and between 1,000 and 10,000 for 5. Several of the repeat elements were found in the bovine genome and we have identified two with orthologous sites, indicating that these elements were present in their common ancestor. None of the repeat elements were found in primate, rodent or dog genomes. We were unable to identify any of the replication machinery common to active transposable elements in these newly identified repeats. Conclusion The presence of both orthologous and non-orthologous sites indicates that some sites existed prior to speciation and some were generated later. The identification of low to moderate copy number repetitive DNA that is specific to artiodactyls will be critical in the assembly of livestock genomes and studies of comparative genomics.

  12. A battery element

    Energy Technology Data Exchange (ETDEWEB)

    Vatanabe, U.; Aoki, K.; Ito, K.; Ogava, K.; Okadzaki, R.

    1983-07-29

    An anode made of a light metal is used in the element, along with an anhydrous liquid electrolyte and a cathode made of CuC12(CFn)x or another material. The current tap of the anode is made from aluminum, gold, silver or another metal of the platinum group and the current tap may be coated with this metal. The thickness of the coating is 0.1 to 1 micrometer. The element has a long storage life.

  13. Atoms, molecules & elements

    CERN Document Server

    Graybill, George

    2007-01-01

    Young scientists will be thrilled to explore the invisible world of atoms, molecules and elements. Our resource provides ready-to-use information and activities for remedial students using simplified language and vocabulary. Students will label each part of the atom, learn what compounds are, and explore the patterns in the periodic table of elements to find calcium (Ca), chlorine (Cl), and helium (He) through hands-on activities.

  14. Trace elements in dialysis.

    Science.gov (United States)

    Filler, Guido; Felder, Sarah

    2014-08-01

    In end-stage chronic kidney disease (CKD), pediatric nephrologists must consider the homeostasis of the multiple water-soluble ions that are influenced by renal replacement therapy (RRT). While certain ions such as potassium and calcium are closely monitored, little is known about the handling of trace elements in pediatric dialysis. RRT may lead to accumulation of toxic trace elements, either due to insufficient elimination or due to contamination, or to excessive removal of essential trace elements. However, trace elements are not routinely monitored in dialysis patients and no mechanism for these deficits or toxicities has been established. This review summarizes the handling of trace elements, with particular attention to pediatric data. The best data describe lead and indicate that there is a higher prevalence of elevated lead (Pb, atomic number 82) levels in children on RRT when compared to adults. Lead is particularly toxic in neurodevelopment and lead levels should therefore be monitored. Monitoring of zinc (Zn, atomic number 30) and selenium (Se, atomic number 34) may be indicated in the monitoring of all pediatric dialysis patients to reduce morbidity from deficiency. Prospective studies evaluating the impact of abnormal trace elements and the possible therapeutic value of intervention are required.

  15. Elemental analysis in biotechnology.

    Science.gov (United States)

    Hann, Stephan; Dernovics, Mihaly; Koellensperger, Gunda

    2015-02-01

    This article focuses on analytical strategies integrating atomic spectroscopy in biotechnology. The rationale behind developing such methods is inherently linked to unique features of the key technique in elemental analysis, which is inductively coupled plasma mass spectrometry: (1) the high sensitivity and selectivity of state of the art instrumentation, (2) the possibility of accurate absolute quantification even in complex matrices, (3) the capability of combining elemental detectors with chromatographic separation methods and the versatility of the latter approach, (4) the complementarity of inorganic and organic mass spectrometry, (5) the multi-element capability and finally (6) the capability of isotopic analysis. The article highlights the most recent bio-analytical developments exploiting these methodological advantages and shows the potential in biotechnological applications.

  16. Advanced finite element technologies

    CERN Document Server

    Wriggers, Peter

    2016-01-01

    The book presents an overview of the state of research of advanced finite element technologies. Besides the mathematical analysis, the finite element development and their engineering applications are shown to the reader. The authors give a survey of the methods and technologies concerning efficiency, robustness and performance aspects. The book covers the topics of mathematical foundations for variational approaches and the mathematical understanding of the analytical requirements of modern finite element methods. Special attention is paid to finite deformations, adaptive strategies, incompressible, isotropic or anisotropic material behavior and the mathematical and numerical treatment of the well-known locking phenomenon. Beyond that new results for the introduced approaches are presented especially for challenging nonlinear problems.

  17. Fuel Element Technical Manual

    Energy Technology Data Exchange (ETDEWEB)

    Burley, H.H. [ed.

    1956-08-01

    It is the purpose of the Fuel Element Technical Manual to Provide a single document describing the fabrication processes used in the manufacture of the fuel element as well as the technical bases for these processes. The manual will be instrumental in the indoctrination of personnel new to the field and will provide a single data reference for all personnel involved in the design or manufacture of the fuel element. The material contained in this manual was assembled by members of the Engineering Department and the Manufacturing Department at the Hanford Atomic Products Operation between the dates October, 1955 and June, 1956. Arrangement of the manual. The manual is divided into six parts: Part I--introduction; Part II--technical bases; Part III--process; Part IV--plant and equipment; Part V--process control and improvement; and VI--safety.

  18. Creativity Management Key Elements

    Directory of Open Access Journals (Sweden)

    Rosa María Fuchs Ángeles

    2015-09-01

    Full Text Available Organizations are constantly looking towards innovation. In order to reach it they must foment creativity. This paper analyzes a series of elements considered in the organizational creativity management and proposes a model with the indispensable factors that organizations should consider to reach it. These elements are: culture and organizational environment, strategy, structure, communication, relation with customers, human resources (recruiting, training, job design, compensation, promotion, and performance evaluation, long term orientation and the organizational life cycle. Having the analysis of those elements as a basis, the indispensable pillars on management creativity are identified. The proposed model is based on 5 pillars: the alignment between strategic, culture and organizational structure, called by the authors 'Holy Trinity'; intern publicity; customer’s voice; recognition and a look towards future. Finally, the case of an innovative Peruvian enterprise is presented from the model’s perspective and the study conclusions.

  19. An alkaline element

    Energy Technology Data Exchange (ETDEWEB)

    Arita, T.; Murakami, K.; Okha, K.

    1983-04-28

    A cathode with a dual layer active mass is installed in the disk shaped alkaline silver and zinc element. The first layer, which is turned towards the anode, contains 85 parts Ag2O, 5 parts electrolytic MnO2 and 10 parts graphite. The second layer, which contacts the bottom of the element, contains 35 parts Ag2O, 60 parts electrolytic MnO2 and 5 parts graphite. The electrical capacity of the first and second layers is 60 and 40, respectively. The first layer may be discharged with a high current density and the second layer with less current density. The element has high characteristics with comparatively low cost.

  20. Intelligent Elements for ISHM

    Science.gov (United States)

    Schmalzel, John L.; Morris, Jon; Turowski, Mark; Figueroa, Fernando; Oostdyk, Rebecca

    2008-01-01

    There are a number of architecture models for implementing Integrated Systems Health Management (ISHM) capabilities. For example, approaches based on the OSA-CBM and OSA-EAI models, or specific architectures developed in response to local needs. NASA s John C. Stennis Space Center (SSC) has developed one such version of an extensible architecture in support of rocket engine testing that integrates a palette of functions in order to achieve an ISHM capability. Among the functional capabilities that are supported by the framework are: prognostic models, anomaly detection, a data base of supporting health information, root cause analysis, intelligent elements, and integrated awareness. This paper focuses on the role that intelligent elements can play in ISHM architectures. We define an intelligent element as a smart element with sufficient computing capacity to support anomaly detection or other algorithms in support of ISHM functions. A smart element has the capabilities of supporting networked implementations of IEEE 1451.x smart sensor and actuator protocols. The ISHM group at SSC has been actively developing intelligent elements in conjunction with several partners at other Centers, universities, and companies as part of our ISHM approach for better supporting rocket engine testing. We have developed several implementations. Among the key features for these intelligent sensors is support for IEEE 1451.1 and incorporation of a suite of algorithms for determination of sensor health. Regardless of the potential advantages that can be achieved using intelligent sensors, existing large-scale systems are still based on conventional sensors and data acquisition systems. In order to bring the benefits of intelligent sensors to these environments, we have also developed virtual implementations of intelligent sensors.

  1. A saturation screen for cis-acting regulatory DNA in the Hox genes of Ciona intestinalis

    Energy Technology Data Exchange (ETDEWEB)

    Keys, David N.; Lee, Byung-in; Di Gregorio, Anna; Harafuji, Naoe; Detter, Chris; Wang, Mei; Kahsai, Orsalem; Ahn, Sylvia; Arellano, Andre; Zhang, Quin; Trong, Stephan; Doyle, Sharon A.; Satoh, Noriyuki; Satou, Yutaka; Saiga, Hidetoshi; Christian, Allen; Rokhsar, Dan; Hawkins, Trevor L.; Levine, Mike; Richardson, Paul

    2005-01-05

    A screen for the systematic identification of cis-regulatory elements within large (>100 kb) genomic domains containing Hox genes was performed by using the basal chordate Ciona intestinalis. Randomly generated DNA fragments from bacterial artificial chromosomes containing two clusters of Hox genes were inserted into a vector upstream of a minimal promoter and lacZ reporter gene. A total of 222 resultant fusion genes were separately electroporated into fertilized eggs, and their regulatory activities were monitored in larvae. In sum, 21 separable cis-regulatory elements were found. These include eight Hox linked domains that drive expression in nested anterior-posterior domains of ectodermally derived tissues. In addition to vertebrate-like CNS regulation, the discovery of cis-regulatory domains that drive epidermal transcription suggests that C. intestinalis has arthropod-like Hox patterning in the epidermis.

  2. Finite elements and approximation

    CERN Document Server

    Zienkiewicz, O C

    2006-01-01

    A powerful tool for the approximate solution of differential equations, the finite element is extensively used in industry and research. This book offers students of engineering and physics a comprehensive view of the principles involved, with numerous illustrative examples and exercises.Starting with continuum boundary value problems and the need for numerical discretization, the text examines finite difference methods, weighted residual methods in the context of continuous trial functions, and piecewise defined trial functions and the finite element method. Additional topics include higher o

  3. Elements of linear space

    CERN Document Server

    Amir-Moez, A R; Sneddon, I N

    1962-01-01

    Elements of Linear Space is a detailed treatment of the elements of linear spaces, including real spaces with no more than three dimensions and complex n-dimensional spaces. The geometry of conic sections and quadric surfaces is considered, along with algebraic structures, especially vector spaces and transformations. Problems drawn from various branches of geometry are given.Comprised of 12 chapters, this volume begins with an introduction to real Euclidean space, followed by a discussion on linear transformations and matrices. The addition and multiplication of transformations and matrices a

  4. Annihilators of nilpotent elements

    Directory of Open Access Journals (Sweden)

    Abraham A. Klein

    2005-01-01

    Full Text Available Let x be a nilpotent element of an infinite ring R (not necessarily with 1. We prove that A(x—the two-sided annihilator of x—has a large intersection with any infinite ideal I of R in the sense that card(A(x∩I=cardI. In particular, cardA(x=cardR; and this is applied to prove that if N is the set of nilpotent elements of R and R≠N, then card(R\\N≥cardN.

  5. Finite element analysis

    CERN Document Server

    2010-01-01

    Finite element analysis is an engineering method for the numerical analysis of complex structures. This book provides a bird's eye view on this very broad matter through 27 original and innovative research studies exhibiting various investigation directions. Through its chapters the reader will have access to works related to Biomedical Engineering, Materials Engineering, Process Analysis and Civil Engineering. The text is addressed not only to researchers, but also to professional engineers, engineering lecturers and students seeking to gain a better understanding of where Finite Element Analysis stands today.

  6. Elements of social security

    DEFF Research Database (Denmark)

    Hansen, Hans

    (Alte Länder). This is the 9th and last edition of the publication,covering income levels and rules for social security and personal taxation for 1999. Basis for the projections to 1999 income levels is the 1998 data (in some cases 1999 data)for OECD's Taxing Wages as reported by national experts.......Elements of Social Security is a comparative study of important elements of the social security systems in Denmark (DK), Sweden (S), Finland (FIN), Austria (A), Germany (D), the Netherlands (NL), Great Britain (GB) and Canada (CAN). It should be emphasized that Germany is the former West Germany...

  7. Rocket propulsion elements

    CERN Document Server

    Sutton, George P

    2011-01-01

    The definitive text on rocket propulsion-now revised to reflect advancements in the field For sixty years, Sutton's Rocket Propulsion Elements has been regarded as the single most authoritative sourcebook on rocket propulsion technology. As with the previous edition, coauthored with Oscar Biblarz, the Eighth Edition of Rocket Propulsion Elements offers a thorough introduction to basic principles of rocket propulsion for guided missiles, space flight, or satellite flight. It describes the physical mechanisms and designs for various types of rockets' and provides an unders

  8. Archaeal extrachromosomal genetic elements

    DEFF Research Database (Denmark)

    Wang, Haina; Peng, Nan; Shah, Shiraz Ali

    2015-01-01

    SUMMARY: Research on archaeal extrachromosomal genetic elements (ECEs) has progressed rapidly in the past decade. To date, over 60 archaeal viruses and 60 plasmids have been isolated. These archaeal viruses exhibit an exceptional diversity in morphology, with a wide array of shapes, such as spind......SUMMARY: Research on archaeal extrachromosomal genetic elements (ECEs) has progressed rapidly in the past decade. To date, over 60 archaeal viruses and 60 plasmids have been isolated. These archaeal viruses exhibit an exceptional diversity in morphology, with a wide array of shapes...

  9. An alkaline element

    Energy Technology Data Exchange (ETDEWEB)

    Obi, F.

    1983-09-29

    A current tap pressed into the anode is installed in the central part of the top of the element. There is an internal top made of plastic under the top. There is a projection in the center of the top with an opening, through which the current tap is passed. The edge of the plastic top serves as an insulation lining between the metallic top and the body, which serves as the current tap for the cathode. A separator is placed between the anode and the cathode. Electrolyte leaks are prevented in the slotted disk elements.

  10. It is elemental

    DEFF Research Database (Denmark)

    Delgado-Baquerizo, Manuel; Reich, Peter B.; Khachane, Amit N.

    2017-01-01

    It is well established that resource quantity and elemental stoichiometry play major roles in shaping below and aboveground plant biodiversity, but their importance for shaping microbial diversity in soil remains unclear. Here, we used statistical modeling on a regional database covering 179 loca...

  11. Elemental Chem Lab

    Science.gov (United States)

    Franco Mariscal, Antonio Joaquin

    2008-01-01

    This educative material uses the symbols of 45 elements to spell the names of 32 types of laboratory equipment usually found in chemical labs. This teaching material has been divided into three puzzles according to the type of the laboratory equipment: (i) glassware as reaction vessels or containers; (ii) glassware for measuring, addition or…

  12. Reference: -300ELEMENT [PLACE

    Lifescience Database Archive (English)

    Full Text Available -300ELEMENT Kreis M, Williamson MS, Forde J, Schmitz D, Clark J, Buxton B, Pywell J..., Marris C, Henderson J, Harris N, Shewry PR, Forde BG, Miflin BJ Differential gene expression in the developing barley endosperm. Philos Trans R Soc Lond B314:355-365 (1986) ...

  13. Beam transport elements

    CERN Multimedia

    1965-01-01

    Two of the beam transport elements for the slow ejection system. On the left, a quadrupole 1.2 m long with a 5 cm aperture, capable of producing a gradient of 5000 gauss. On the right, a 1 m bending magnet with a 4 cm gap; its field is 20 000 gauss.

  14. Light element ceramics

    OpenAIRE

    Rao, KJ; Varma, KBR; Raju, AR

    1988-01-01

    An overview of a few structually important light element ceramics is presented. Included in the overview are silicon nitide, sialon, aluminium nitride, boron carbide and silicon carbide. Methods of preparation, characterization and industrial applications of these ceramics are summarized. Mechanical properties, industrial production techniques and principal uses of these ceramics are emphasized.

  15. Water, the intangible element

    NARCIS (Netherlands)

    Schotting, R.J.

    2009-01-01

    Water is the key to life. No living creature can survive without water. Too much water or polluted water are serious threats to mankind. Managing this intangible element is complex, not only in wet deltaic regions but also in the (semi-)arid regions of the world. Combined efforts of the hydro(geo)lo

  16. CEDS Addresses: Rubric Elements

    Science.gov (United States)

    US Department of Education, 2015

    2015-01-01

    Common Education Data Standards (CEDS) Version 4 introduced a common data vocabulary for defining rubrics in a data system. The CEDS elements support digital representations of both holistic and analytic rubrics. This document shares examples of holistic and analytic project rubrics, available CEDS Connections, and a logical model showing the…

  17. Movies and Literary Elements.

    Science.gov (United States)

    Keller, Rodney D.

    1987-01-01

    Recommends using movie clips to stimulate students' interest in reading a novel as well as to teach elements of fiction such as plot, character, setting, symbol, irony, and theme. Describes each clip and provides study questions. Includes a listing of movies made from books. (NH)

  18. Inside finite elements

    CERN Document Server

    Weiser, Martin

    2016-01-01

    All relevant implementation aspects of finite element methods are discussed in this book. The focus is on algorithms and data structures as well as on their concrete implementation. Theory is covered as far as it gives insight into the construction of algorithms. Throughout the exercises a complete FE-solver for scalar 2D problems will be implemented in Matlab/Octave.

  19. Element-topology-independent preconditioners for parallel finite element computations

    Science.gov (United States)

    Park, K. C.; Alexander, Scott

    1992-01-01

    A family of preconditioners for the solution of finite element equations are presented, which are element-topology independent and thus can be applicable to element order-free parallel computations. A key feature of the present preconditioners is the repeated use of element connectivity matrices and their left and right inverses. The properties and performance of the present preconditioners are demonstrated via beam and two-dimensional finite element matrices for implicit time integration computations.

  20. Elements of quantum optics

    CERN Document Server

    Meystre, Pierre

    2007-01-01

    Elements of Quantum Optics gives a self-contained and broad coverage of the basic elements necessary to understand and carry out research in laser physics and quantum optics, including a review of basic quantum mechanics and pedagogical introductions to system-reservoir interactions and to second quantization. The text reveals the close connection between many seemingly unrelated topics, such as probe absorption, four-wave mixing, optical instabilities, resonance fluorescence and squeezing. It also comprises discussions of cavity quantum electrodynamics and atom optics. The 4th edition includes a new chapter on quantum entanglement and quantum information, as well as added discussions of the quantum beam splitter, electromagnetically induced transparency, slow light, and the input-output formalism needed to understand many problems in quantum optics. It also provides an expanded treatment of the minimum-coupling Hamiltonian and a simple derivation of the Gross-Pitaevskii equation, an important gateway to rese...

  1. Nuclear fuel element

    Science.gov (United States)

    Meadowcroft, Ronald Ross; Bain, Alastair Stewart

    1977-01-01

    A nuclear fuel element wherein a tubular cladding of zirconium or a zirconium alloy has a fission gas plenum chamber which is held against collapse by the loops of a spacer in the form of a tube which has been deformed inwardly at three equally spaced, circumferential positions to provide three loops. A heat resistant disc of, say, graphite separates nuclear fuel pellets within the cladding from the plenum chamber. The spacer is of zirconium or a zirconium alloy.

  2. Quantum theory elements

    CERN Document Server

    Bates, David Robert

    1962-01-01

    Quantum Theory: A Treatise in Three Volumes, I: Elements focuses on the principles, methodologies, and approaches involved in quantum theory, including quantum mechanics, linear combinations, collisions, and transitions. The selection first elaborates on the fundamental principles of quantum mechanics, exactly soluble bound state problems, and continuum. Discussions focus on delta function normalization, spherically symmetric potentials, rectangular potential wells, harmonic oscillators, spherically symmetrical potentials, Coulomb potential, axiomatic basis, consequences of first three postula

  3. A sealing element

    Energy Technology Data Exchange (ETDEWEB)

    Obi, F.; Takada, K.

    1983-09-22

    A sealing lining made of a mixture of polyethylene or polypropylene with an additive which prevents destruction of the lining is used in the element. The content of the additive in the mixture is 10 to 30 percent by mass. The additive basically consists of polyethylene. Carboxyl groups are introduced into the polymer as an anion and sodium, potassium and molybdenum are introduced as the cation.

  4. Helium the disappearing element

    CERN Document Server

    Sears, Wheeler M

    2015-01-01

    The subject of the book is helium, the element, and its use in myriad applications including MRI machines, particle accelerators, space telescopes, and of course balloons and blimps. It was at the birth of our Universe, or the Big Bang, where the majority of cosmic helium was created; and stellar helium production continues. Although helium is the second most abundant element in the Universe, it is actually quite rare here on Earth and only exists because of radioactive elements deep within the Earth. This book includes a detailed history of the discovery of helium, of the commercial industry built around it, how the helium we actually encounter is produced within the Earth, and the state of the helium industry today. The gas that most people associate with birthday party balloons is running out. “Who cares?” you might ask. Well, without helium, MRI machines could not function, rockets could not go into space, particle accelerators such as those used by CERN could not operate, fiber optic cables would not...

  5. New Aperture Partitioning Element

    Science.gov (United States)

    Griffin, S.; Calef, B.; Williams, S.

    Postprocessing in an optical system can be aided by adding an optical element to partition the pupil into a number of segments. When imaging through the atmosphere, the recorded data are blurred by temperature-induced variations in the index of refraction along the line of sight. Using speckle imaging techniques developed in the astronomy community, this blurring can be corrected to some degree. The effectiveness of these techniques is diminished by redundant baselines in the pupil. Partitioning the pupil reduces the degree of baseline redundancy, and therefore improves the quality of images that can be obtained from the system. It is possible to implement the described approach on an optical system with a segmented primary mirror, but not very practical. This is because most optical systems do not have segmented primary mirrors, and those that do have relatively low bandwidth positioning of segments due to their large mass and inertia. It is much more practical to position an active aperture partitioning element at an aft optics pupil of the optical system. This paper describes the design, implementation and testing of a new aperture partitioning element that is completely reflective and reconfigurable. The device uses four independent, annular segments that can be positioned with a high degree of accuracy without impacting optical wavefront of each segment. This mirror has been produced and is currently deployed and working on the 3.6 m telescope.

  6. Method of securing filter elements

    Energy Technology Data Exchange (ETDEWEB)

    Brown, Erik P.; Haslam, Jeffery L.; Mitchell, Mark A.

    2016-10-04

    A filter securing system including a filter unit body housing; at least one tubular filter element positioned in the filter unit body housing, the tubular filter element having a closed top and an open bottom; a dimple in either the filter unit body housing or the top of the tubular filter element; and a socket in either the filter unit body housing or the top of the tubular filter element that receives the dimple in either the filter unit body housing or the top of the tubular filter element to secure the tubular filter element to the filter unit body housing.

  7. Elements of energy conversion

    CERN Document Server

    Russell, Charles R

    2013-01-01

    Elements of Energy Conversion brings together scattered information on the subject of energy conversion and presents it in terms of the fundamental thermodynamics that apply to energy conversion by any process. Emphasis is given to the development of the theory of heat engines because these are and will remain most important power sources. Descriptive material is then presented to provide elementary information on all important energy conversion devices. The book contains 10 chapters and opens with a discussion of forms of energy, energy sources and storage, and energy conversion. This is foll

  8. [Healthcare marketing elements].

    Science.gov (United States)

    Ameri, Cinzia; Fiorini, Fulvio

    2014-01-01

    Marketing puts its foundation on a few key concepts: need-demand, product-service, satisfaction, exchange, market, or business structure manufacturing / supply. The combination of these elements allows you to build an effective marketing strategy. Crucial in this respect is to remember the Porter matrix, which shows that for a correct analysis of the relevant market is necessary to refer to the "five forces at play", ie: customers, competitors, new entrants and substitutes threat. Another key lever for proper marketing oriented approach is the continuous and constant monitoring of the application, anticipating their dissatisfactions.

  9. Elements of analytical dynamics

    CERN Document Server

    Kurth, Rudolph; Stark, M

    1976-01-01

    Elements of Analytical Dynamics deals with dynamics, which studies the relationship between motion of material bodies and the forces acting on them. This book is a compilation of lectures given by the author at the Georgia and Institute of Technology and formed a part of a course in Topological Dynamics. The book begins by discussing the notions of space and time and their basic properties. It then discusses the Hamilton-Jacobi theory and Hamilton's principle and first integrals. The text concludes with a discussion on Jacobi's geometric interpretation of conservative systems. This book will

  10. Analytical elements of mechanics

    CERN Document Server

    Kane, Thomas R

    2013-01-01

    Analytical Elements of Mechanics, Volume 1, is the first of two volumes intended for use in courses in classical mechanics. The books aim to provide students and teachers with a text consistent in content and format with the author's ideas regarding the subject matter and teaching of mechanics, and to disseminate these ideas. The book opens with a detailed exposition of vector algebra, and no prior knowledge of this subject is required. This is followed by a chapter on the topic of mass centers, which is presented as a logical extension of concepts introduced in connection with centroids. A

  11. Elements of probability theory

    CERN Document Server

    Rumshiskii, L Z

    1965-01-01

    Elements of Probability Theory presents the methods of the theory of probability. This book is divided into seven chapters that discuss the general rule for the multiplication of probabilities, the fundamental properties of the subject matter, and the classical definition of probability. The introductory chapters deal with the functions of random variables; continuous random variables; numerical characteristics of probability distributions; center of the probability distribution of a random variable; definition of the law of large numbers; stability of the sample mean and the method of moments

  12. Elements of real analysis

    CERN Document Server

    Sprecher, David A

    2010-01-01

    This classic text in introductory analysis delineates and explores the intermediate steps between the basics of calculus and the ultimate stage of mathematics: abstraction and generalization.Since many abstractions and generalizations originate with the real line, the author has made it the unifying theme of the text, constructing the real number system from the point of view of a Cauchy sequence (a step which Dr. Sprecher feels is essential to learn what the real number system is).The material covered in Elements of Real Analysis should be accessible to those who have completed a course in

  13. Osteoporosis and trace elements

    DEFF Research Database (Denmark)

    Aaseth, J.; Boivin, G.; Andersen, Ole

    2012-01-01

    More than 200 million people are affected by osteoporosis worldwide, as estimated by 2 million annual hip fractures and other debilitating bone fractures (vertebrae compression and Colles' fractures). Osteoporosis is a multi-factorial disease with potential contributions from genetic, endocrine...... in new bone and results in a net gain in bone mass, but may be associated with a tissue of poor quality. Aluminum induces impairment of bone formation. Gallium and cadmium suppresses bone turnover. However, exact involvements of the trace elements in osteoporosis have not yet been fully clarified...

  14. Elements of Architecture

    DEFF Research Database (Denmark)

    Elements of Architecture explores new ways of engaging architecture in archaeology. It conceives of architecture both as the physical evidence of past societies and as existing beyond the physical environment, considering how people in the past have not just dwelled in buildings but have existed...... and affective impacts, of these material remains. The contributions in this volume investigate the way time, performance and movement, both physically and emotionally, are central aspects of understanding architectural assemblages. It is a book about the constellations of people, places and things that emerge...

  15. Ring-laser gyroscope system using dispersive element(s)

    Science.gov (United States)

    Smith, David D. (Inventor)

    2010-01-01

    A ring-laser gyroscope system includes a ring-laser gyroscope (RLG) and at least one dispersive element optically coupled to the RLG's ring-shaped optical path. Each dispersive element has a resonant frequency that is approximately equal to the RLG's lasing frequency. A group index of refraction defined collectively by the dispersive element(s) has (i) a real portion that is greater than zero and less than one, and (ii) an imaginary portion that is less than zero.

  16. An efficient rectangular plate element

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    A new 12-parameter rectangular plate element is presented by useof the double set parameter method. The error in the energy norm is of order O(h2), one order higher than the commonly used Adini nonconforming element.

  17. NIH Common Data Elements Repository

    Data.gov (United States)

    U.S. Department of Health & Human Services — The NIH Common Data Elements (CDE) Repository has been designed to provide access to structured human and machine-readable definitions of data elements that have...

  18. Trace element emissions from coal

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2012-09-15

    Trace elements are emitted during coal combustion. The quantity, in general, depends on the physical and chemical properties of the element itself, the concentration of the element in the coal, the combustion conditions and the type of particulate control device used, and its collection efficiency as a function of particle size. Some trace elements become concentrated in certain particle streams following combustion such as bottom ash, fly ash, and flue gas particulate matter, while others do not. Various classification schemes have been developed to describe this partitioning behaviour. These classification schemes generally distinguish between: Class 1: elements that are approximately equally concentrated in the fly ash and bottom ash, or show little or no fine particle enrichment, examples include Mn, Be, Co and Cr; Class 2: elements that are enriched in the fly ash relative to bottom ash, or show increasing enrichment with decreasing particle size, examples include As, Cd, Pb and Sb; Class 3: elements which are emitted in the gas phase (primarily Hg (not discussed in this review), and in some cases, Se). Control of class 1 trace elements is directly related to control of total particulate matter emissions, while control of the class 2 elements depends on collection of fine particulates. Due to the variability in particulate control device efficiencies, emission rates of these elements can vary substantially. The volatility of class 3 elements means that particulate controls have only a limited impact on the emissions of these elements.

  19. COLOR- SENSITIZED SOLAR ELEMENTS

    Directory of Open Access Journals (Sweden)

    Gish R. A.

    2016-05-01

    Full Text Available Photovoltaic devices are a promising solution to the energy crisis, because they generate electricity directly from sunlight, without producing CO2. While color-sensitized batteries are the most studied element, mainly due to its low cost and high efficiency solar energy conversion into electricity. Until recently, the color-sensitized solar cells performance was less than 1%, however, the use of titanium dioxide as the anode material have greatly raised their efficiency. The advantages of titanium dioxide is primarily in the low cost, but its use provides high light capture efficiency, with external quantum efficiency (efficiency incident photon - charge, usually in the range of 60-90% using nanocrystal forms in comparison with

  20. Ucla, escuela elemental

    Directory of Open Access Journals (Sweden)

    Neutra, Richard J.

    1962-03-01

    Full Text Available La Escuela Elemental de Preparación de la Universidad de California, en Los Angeles, está dedicada a la educación e investigación y preparación del profesorado de la infancia. Se ha construido en un paraje maravilloso, de frondosa vegetación, frente a un terreno bastante quebrado, circunstancia que presta mayor encanto al conjunto, construido con gran pericia y adaptación al paisaje a base de una dominante horizontalidad, con materiales sencillos (ladrillos, hierro y madera y gran comunicación con la naturaleza mediante grandes cristaleras correderas que ensanchan las clases y las suplementan hacia el jardín de acuerdo con las nuevas normas y prácticas docentes.

  1. The fantastic four.. elements

    Science.gov (United States)

    Marsili, Antonella; D'Addezio, Giuliana; Rubbia, Giuliana; Ramieri, Caterina; Todaro, Riccardo; Scipilliti, Francesca; Tosto, Eleonora

    2015-04-01

    With a "Sunday between territory and music to 'National Institute of Geophysics and Volcanology," October 12, 2014 the headquarters of INGV Roma kicked off the activities of the second edition of the Week of Planet Earth. The laboratory of scientific outreach and museum activities together with volunteers of the National Civil Service have organized the whole day dedicated to the dissemination of earth sciences, involving adults and children. Especially for primary school children a laboratory was made involving three amusing activities all aimed at inspiring respect for the Earth: a theatrical representation called "The Fantastic 4... elements", a behavioral game and a nursery rhyme reading. The theater as a means of communication of science is an innovative and creative way to introduce children to important scientific concepts. The use of this methodology and simple language favoring the emotional involvement of the child facilitating learning. The main character is a child, chosen to facilitate the identification of the spectators with the protagonist, that through a fantastic journey discovers the importance of the four elements of our planet: earth, fire, air and water. As a second step, volunteers involved children in reading a nursery rhyme "the ABC to become a Friend of the Earth" inviting them to protect and respect the environment and its resources. Finally, the behavioral game gave indications about behaviors to adopt to safeguard the planet. Volunteers introduced a billboard divided into two colors, green to indicate the right behaviors and red for the wrong ones. Each child, after reading a card with indication on the behavior to adopt, had to decide if they were correct or not with respect to the environment safeguard. After listening to the children's answer, the volunteer gave the correct explanation about the appropriate behavior to adopt. At the end of the activities, each child received a certificate as "a friend of Planet Earth".

  2. Novel high-performance element in the electromagnetic finite-element method--node-edge element

    Institute of Scientific and Technical Information of China (English)

    Sheng Xinqing; Peng Zhen

    2008-01-01

    It is known in the computational electromagnetics (CEM) that the node element has a relative well-conditioned matrix,but suffers from the spurious solution problem; whereas the edge element has no spurious solutions,but usually produces an ill-conditioned matrix.Particularly,when the mesh is over dense,the iterative solution of the matrix equation from edge element converges very slowly.Based on the node element and edge element,a node-edge element is presented,which has no spurious solutions and better-conditioned matrix.Numerical experiments demonstrate that the proposed node-edge element is more efficient than now-widely used edge element.

  3. An element by element spectral element method for elastic wave modeling

    Institute of Scientific and Technical Information of China (English)

    LIN Weijun; WANG Xiuming; ZHANG Hailan

    2006-01-01

    The spectral element method which combines the advantages of spectral method with those of finite element method,provides an efficient tool in simulating elastic wave equation in complex medium. Based on weak form of elastodynamic equations, mathematical formulations for Legendre spectral element method are presented. The wave field on an element is discretized using high-order Lagrange interpolation, and integration over the element is accomplished based upon the Gauss-Lobatto-Legendre integration rule. This results in a diagonal mass matrix which leads to a greatly simplified algorithm. In addition, the element by element technique is introduced in our method to reduce the memory sizes and improve the computation efficiency. Finally, some numerical examples are presented to demonstrate the spectral accuracy and the efficiency. Because of combinations of the finite element scheme and spectral algorithms, this method can be used for complex models, including free surface boundaries and strong heterogeneity.

  4. The Chemistry of Superheavy Elements

    CERN Document Server

    Schädel, M

    2003-01-01

    The chemistry of transactinide or superheavy elements has reached element 108. Preparations are under way to leap to element 112 and beyond. The current status of this atom-at-a-time chemical research and its future perspectives are reviewed from an experimental point of view together with some of the interesting results from n -rich nuclides near and at the N=162 neutron shell. Experimental techniques and important results enlightening typical chemical properties of elements 104 through 108 are presented in an exemplary way. From the results of these experiments it is justified to place these elements in the Periodic Table of the Elements in to groups 4 through 8, respectively. However, mainly due to the influence of relativistic effects, it is no longer possible to deduce detailed chemical properties of these superheavy elements simply from this position.

  5. Understanding Selective Downregulation of c-Myc Expression through Inhibition of General Transcription Regulators in Multiple Myeloma

    Science.gov (United States)

    2014-06-01

    hypersensitive cis-regulatory elements from small biological samples (Figure 3). Combined these efforts will allow further elucidation of the mechanisms by...Oshimura, Tottori University, Japan) were cultured in DMEM. All media were supplemented with 10% FBS, 100 IU/ml penicillin and 100 g/ml streptomycin

  6. Cis- and trans-regulatory mechanisms of gene expression in the ASJ sensory neuron of Caenorhabditis elegans

    NARCIS (Netherlands)

    M. González-Barrios (María); J.C. Fierro-González (Juan Carlos); E. Krpelanova (Eva); J.A. Mora-Lorca (José Antonio); J. Rafael Pedrajas (José); X. Peñate (Xenia); S. Chavez (Sebastián); P. Swoboda (Peter); G. Jansen (Gert); A. Miranda-Vizuet (Antonio)

    2015-01-01

    textabstractThe identity of a given cell type is determined by the expression of a set of genes sharing common cis-regulatory motifs and being regulated by shared transcription factors. Here, we identify cis and trans regulatory elements that drive gene expression in the bilateral sensory neuron ASJ

  7. Genesis of chromatin and transcription dynamics in the origin of species

    NARCIS (Netherlands)

    Koster, Maria J E; Snel, Berend; Timmers, H. Th Marc

    2015-01-01

    Histone proteins compact and stabilize the genomes of Eukarya and Archaea. By forming nucleosome(-like) structures they restrict access of DNA-binding transcription regulators to cis-regulatory DNA elements. Dynamic competition between histones and transcription factors is facilitated by different c

  8. Genesis of Chromatin and Transcription Dynamics in the Origin of Species

    NARCIS (Netherlands)

    Koster, Maria J. E.; Snel, Berend; Timmers, H. Th. Marc

    2015-01-01

    Histone proteins compact and stabilize the genomes of Eukarya and Archaea. By forming nucleosome(-like) structures they restrict access of DNA-binding transcription regulators to cis-regulatory DNA elements. Dynamic competition between histones and transcription factors is facilitated by different c

  9. CRITERIA FOR AN UPDATED CLASSIFICATION OF HUMAN TRANSCRIPTION FACTOR DNA-BINDING DOMAINS

    NARCIS (Netherlands)

    Wingender, Edgar

    2013-01-01

    By binding to cis-regulatory elements in a sequence-specific manner, transcription factors regulate the activity of nearby genes. Here, we discuss the criteria for a comprehensive classification of human TFs based on their DNA-binding domains. In particular, classification of basic leucine zipper (b

  10. The untranslated leader sequence of the barley lipoxygenase 1 (Lox1) gene confers embryo-specific expression

    NARCIS (Netherlands)

    Rouster, J.; Mechelen J. van; Cameron-Mills, V.

    1998-01-01

    The barley lipoxygenase 1 (Lox1) gene encodes a protein expressed in embryos during grain development and germination and in leaves after methyl-jasmonate (MeJA) treatment. Transient gene expression assays in germinating barley embryos were used to identify cis-regulatory elements involved in the em

  11. Effects of a GA3/4PU-30 compound (90-09) on leaf senescence of hybrid rice

    Institute of Scientific and Technical Information of China (English)

    TANGRisheng

    1997-01-01

    90-09 is a cmpound made with GA3, 4PU-30 and some trace elements (B etc. ) To study the effects of 90-09 on the leaf senescence of hybrid rice leaf, the changes of activities of some degradation enzyme and the contents of endogenous hormones (ABA, ZRs, GAs, and IAA), protein, and nucleic acids were measured during leaf senescence.

  12. Chemistry of the superheavy elements.

    Science.gov (United States)

    Schädel, Matthias

    2015-03-13

    The quest for superheavy elements (SHEs) is driven by the desire to find and explore one of the extreme limits of existence of matter. These elements exist solely due to their nuclear shell stabilization. All 15 presently 'known' SHEs (11 are officially 'discovered' and named) up to element 118 are short-lived and are man-made atom-at-a-time in heavy ion induced nuclear reactions. They are identical to the transactinide elements located in the seventh period of the periodic table beginning with rutherfordium (element 104), dubnium (element 105) and seaborgium (element 106) in groups 4, 5 and 6, respectively. Their chemical properties are often surprising and unexpected from simple extrapolations. After hassium (element 108), chemistry has now reached copernicium (element 112) and flerovium (element 114). For the later ones, the focus is on questions of their metallic or possibly noble gas-like character originating from interplay of most pronounced relativistic effects and electron-shell effects. SHEs provide unique opportunities to get insights into the influence of strong relativistic effects on the atomic electrons and to probe 'relativistically' influenced chemical properties and the architecture of the periodic table at its farthest reach. In addition, they establish a test bench to challenge the validity and predictive power of modern fully relativistic quantum chemical models.

  13. Vesta's Elemental Composition

    Science.gov (United States)

    Prettyman, T. H.; Beck, A. W.; Feldman, W. C.; Lawrence, D. J.; McCoy, T. J.; McSween, H. Y.; Mittlefehldt, D. W.; Peplowski, P. N.; Raymond, C. A.; Reedy, R. C.; Russell, C. T.; Titus, T. N.; Toplis, M. J.; Yamashita, N.

    2014-01-01

    Many lines of evidence (e.g. common geochemistry, chronology, O-isotope trends, and the presence of different HED rock types in polymict breccias) indicate that the howardite, eucrite, and diogenite (HED) meteorites originated from a single parent body. Meteorite studies show that this protoplanet underwent igneous differentiation to form a metallic core, an ultramafic mantle, and a basaltic crust. A spectroscopic match between the HEDs and 4 Vesta along with a plausible mechanism for their transfer to Earth, perhaps as chips off V-type asteroids ejected from Vesta's southern impact basin, supports the consensus view that many of these achondritic meteorites are samples of Vesta's crust and upper mantle. The HED-Vesta connection was put to the test by the NASA Dawn mission, which spent a year in close proximity to Vesta. Measurements by Dawn's three instruments, redundant Framing Cameras (FC), a Visible-InfraRed (VIR) spectrometer, and a Gamma Ray and Neutron Detector (GRaND), along with radio science have strengthened the link. Gravity measurements by Dawn are consistent with a differentiated, silicate body, with a dense Fe-rich core. The range of pyroxene compositions determined by VIR overlaps that of the howardites. Elemental abundances determined by nuclear spectroscopy are also consistent with HED-compositions. Observations by GRaND provided a new view of Vesta inaccessible by telescopic observations. Here, we summarize the results of Dawn's geochemical investigation of Vesta and their implications.

  14. EAF optimal managing elements

    Science.gov (United States)

    Ioana, A.; Constantin, N.; Dragna, E. C.

    2017-01-01

    Electric Arc Furnaces (EAF) is an important and complex aggregate. We present elements of EAF operating efficiency. The reliability of the EAF is mainly determined by electric circuit reliability and especially of the transformator of the furnace. This due to the fact that, in an electric steel plant, the objective „24 tapping/day” involves. Due to the complexity of the process, the EAF operation needs a computer usage and, in his componence, it must have two independent calculation units (UC1) and (UC2). Based on these two input sets (Σi1) and ((Σi2), the calculation unit (UC1) builds the general operation procedure based on mathematical methods. For that purpose, there are used the results of the 5 mathematical methods: the mathematical model to write-off the function objective (M.F.O.); the mathematical model of calculating the charge (M.C.C.); the mathematical model of conducting the effective melt (M.C.M.); the mathematical model of reheating the charge (M.R.C.); the mathematical model of blasting the reactive dusts (M.B.R.D.).

  15. Matrix elements of unstable states

    CERN Document Server

    Bernard, V; Meißner, U -G; Rusetsky, A

    2012-01-01

    Using the language of non-relativistic effective Lagrangians, we formulate a systematic framework for the calculation of resonance matrix elements in lattice QCD. The generalization of the L\\"uscher-Lellouch formula for these matrix elements is derived. We further discuss in detail the procedure of the analytic continuation of the resonance matrix elements into the complex energy plane and investigate the infinite-volume limit.

  16. EDGE-ORIENTED HEXAGONAL ELEMENTS

    Institute of Scientific and Technical Information of China (English)

    Chao Yang; Jiachang Sun

    2007-01-01

    In this paper, two new nonconforming hexagonal elements are presented, which are based on the trilinear function space Q(3)1 and are edge-oriented, analogical to the case of the rotated Q1 quadrilateral element. A priori error estimates are given to show that the new elements achieve first-order accuracy in the energy norm and second-order accuracy in the L2 norm. This theoretical result is confirmed by the numerical tests.

  17. Gamification Elements for Learning Applications

    Directory of Open Access Journals (Sweden)

    Firas Layth Khaleel

    2016-12-01

    Full Text Available Gamification technique is getting popular to be implemented in learning or training application. It is referred to the use of game elements or game thinking in a non-game context in order to increase engagement between students and learning application. Since there are many elements of games that are identified from previous works, this study focuses on game elements from Gamification technique that positively affect learning when applied to a learning application. Therefore, the objectives of this research are to identify game elements that can be gamified in a learning application; and to verify those elements by multiple users (gamers, students, and experts. Suitable game elements are identified through literature reviews. Two approaches are used to verify these elements; interview experts and administer a survey to gamers and students. The finding of this study suggests the use of a group of game elements with three aims, (1 increase the level of fun and entertainment; (2 motivate students to challenge each other; and (3 improve gaming and learning skills. In a further study, these elements will be implemented in a learning application and its effectiveness shall be tested.

  18. Photoshop Elements 10 For Dummies

    CERN Document Server

    Obermeier, Barbara

    2011-01-01

    Perfect your photos and images with this "focused" guide to the latest version of Photoshop Elements For most of us, the professional-level Photoshop is overkill for our needs. Amateur photographers and photo enthusiasts turn to Photoshop Elements for a powerful but simpler way to edit and retouch their snapshots. Photoshop Elements 10 For Dummies, fully updated and revised for the latest release of this software product, helps you navigate Elements to create, edit, fix, share, and organize the high-quality images you desire. Full color pages bring the techniques to life and make taking great

  19. SNTP program fuel element design

    Science.gov (United States)

    Walton, Lewis A.; Ales, Matthew W.

    1993-06-01

    The SNTP program is evaluating the feasibility of utilizing a particle bed reactor to develop a high-performance nuclear thermal rocket engine. The optimum fuel element arrangement depends on the power level desired and the intended application. The key components of the fuel element have been developed and are being tested.

  20. RESEARCH METHODS OF LOCATIVE ELEMENT

    Directory of Open Access Journals (Sweden)

    SULAYMANOVA N.J.

    2012-01-01

    Full Text Available The article is devoted to the methods of investigation of locative elements. Sentence analysis with locative elements is taken according to the results of component analysis in the system of contradicting – opposition. More over the article is full of examples related to the description of various syntactic units.

  1. Repetitive elements in parasitic protozoa

    Directory of Open Access Journals (Sweden)

    Clayton Christine

    2010-05-01

    Full Text Available Abstract A recent paper published in BMC Genomics suggests that retrotransposition may be active in the human gut parasite Entamoeba histolytica. This adds to our knowledge of the various types of repetitive elements in parasitic protists and the potential influence of such elements on pathogenicity. See research article http://www.biomedcentral.com/1471-2164/11/321

  2. Clean Elements in Abelian Rings

    Indian Academy of Sciences (India)

    Angelina Y M Chin

    2009-04-01

    Let be a ring with identity. An element in is said to be clean if it is the sum of a unit and an idempotent. is said to be clean if all of its elements are clean. If every idempotent in is central, then is said to be abelian. In this paper we obtain some conditions equivalent to being clean in an abelian ring.

  3. Solution of Finite Element Equations

    DEFF Research Database (Denmark)

    Krenk, Steen

    An important step in solving any problem by the finite element method is the solution of the global equations. Numerical solution of linear equations is a subject covered in most courses in numerical analysis. However, the equations encountered in most finite element applications have some special...

  4. Chemical experiments with superheavy elements.

    Science.gov (United States)

    Türler, Andreas

    2010-01-01

    Unnoticed by many chemists, the Periodic Table of the Elements has been extended significantly in the last couple of years and the 7th period has very recently been completed with eka-Rn (element 118) currently being the heaviest element whose synthesis has been reported. These 'superheavy' elements (also called transactinides with atomic number > or = 104 (Rf)) have been artificially synthesized in fusion reactions at accelerators in minute quantities of a few single atoms. In addition, all isotopes of the transactinide elements are radioactive and decay with rather short half-lives. Nevertheless, it has been possible in some cases to investigate experimentally chemical properties of transactinide elements and even synthesize simple compounds. The experimental investigation of superheavy elements is especially intriguing, since theoretical calculations predict significant deviations from periodic trends due to the influence of strong relativistic effects. In this contribution first experiments with hassium (Hs, atomic number 108), copernicium (Cn, atomic number 112) and element 114 (eka-Pb) are reviewed.

  5. Massively Parallel Finite Element Programming

    KAUST Repository

    Heister, Timo

    2010-01-01

    Today\\'s large finite element simulations require parallel algorithms to scale on clusters with thousands or tens of thousands of processor cores. We present data structures and algorithms to take advantage of the power of high performance computers in generic finite element codes. Existing generic finite element libraries often restrict the parallelization to parallel linear algebra routines. This is a limiting factor when solving on more than a few hundreds of cores. We describe routines for distributed storage of all major components coupled with efficient, scalable algorithms. We give an overview of our effort to enable the modern and generic finite element library deal.II to take advantage of the power of large clusters. In particular, we describe the construction of a distributed mesh and develop algorithms to fully parallelize the finite element calculation. Numerical results demonstrate good scalability. © 2010 Springer-Verlag.

  6. Chemical elements distribution in cells

    Science.gov (United States)

    Ortega, R.

    2005-04-01

    Analysing, imaging and understanding the cellular chemistry, from macromolecules to monoatomic elements, is probably a major challenge for the scientific community after the conclusion of the genome project. In order to probe the distribution of elements in cells, especially the so-called inorganic elements, it is necessary to apply microanalytical techniques with sub-micrometer resolution and high chemical sensitivity. This paper presents the current status of chemical element imaging inside cells, and a comparison of the different analytical techniques available: nuclear microprobe, electron microprobe and electron energy loss spectroscopy, synchrotron radiation microprobe, secondary ion mass spectrometry and fluorescence microscopy methods. Examples of intracellular chemical elements distributions relevant to cancer pharmacology, medical imaging, metal carcinogenesis and neuropathology studies obtained by nuclear microprobe and other microanalytical techniques are presented.

  7. Second order tensor finite element

    Science.gov (United States)

    Oden, J. Tinsley; Fly, J.; Berry, C.; Tworzydlo, W.; Vadaketh, S.; Bass, J.

    1990-01-01

    The results of a research and software development effort are presented for the finite element modeling of the static and dynamic behavior of anisotropic materials, with emphasis on single crystal alloys. Various versions of two dimensional and three dimensional hybrid finite elements were implemented and compared with displacement-based elements. Both static and dynamic cases are considered. The hybrid elements developed in the project were incorporated into the SPAR finite element code. In an extension of the first phase of the project, optimization of experimental tests for anisotropic materials was addressed. In particular, the problem of calculating material properties from tensile tests and of calculating stresses from strain measurements were considered. For both cases, numerical procedures and software for the optimization of strain gauge and material axes orientation were developed.

  8. Kriging-Based Finite Element Method: Element-By-Element Kriging Interpolation

    Directory of Open Access Journals (Sweden)

    W. Kanok-Nukulchai

    2009-01-01

    Full Text Available An enhancement of the finite element method with Kriging shape functions (K-FEM was recently proposed. In this method, the field variables of a boundary value problem are approximated using ‘element-by-element’ piecewise Kriging interpolation (el-KI. For each element, the interpolation function is constructed from a set of nodes within a prescribed domain of influence comprising the element and its several layers of neighbouring elements. This paper presents a numerical study on the accuracy and convergence of the el-KI in function fitting problems. Several examples of functions in two-dimensional space are employed in this study. The results show that very accurate function fittings and excellent convergence can be attained by the el-KI.

  9. Imaging techniques for elements and element species in plant science.

    Science.gov (United States)

    Wu, Bei; Becker, J Sabine

    2012-05-01

    Revealing the uptake, transport, localization and speciation of both essential and toxic elements in plants is important for understanding plant homeostasis and metabolism, subsequently, providing information for food and nutrient studies, agriculture activities, as well as environmental research. In the last decade, emerging techniques for elemental imaging and speciation analysis allowed us to obtain increasing knowledge of elemental distribution and availabilities in plants. Chemical imaging techniques include mass spectrometric methods such as secondary ionization mass spectrometry (SIMS), laser ablation inductively coupled plasma mass spectrometry (LA-ICP-MS) and synchrotron-based techniques such as X-ray fluorescence spectroscopy (SRXRF), and so forth. On the other hand, X-ray absorption spectroscopy (XAS) based on synchrotron radiation is capable of in situ investigation of local atomic structure around the central element of interest. This technique can also be operated in tandem with SRXRF to image each element species of interest within plant tissue. In this review, the principles and state-of-the-art of these techniques regarding sample preparation, advantages and limitations, and improvement of sensitivity and spatial resolution are discussed. New results with respect to elemental distribution and speciation in plants revealed by these techniques are presented.

  10. Transposable elements: The enemies within.

    Science.gov (United States)

    Scarfò, Irene; Pellegrino, Elisa; Mereu, Elisabetta; Inghirami, Giorgio; Piva, Roberto

    2016-10-01

    Understanding transformation mechanisms other than genetic aberrations has recently captured the attention of cancer researchers. To date, the role of transposable elements (TEs) in tumor development remains largely undefined. However, an increasing number of studies have reported that loss of epigenetic control causes TE reactivation and consequent oncogenic transcription. Here, we discuss principal examples of TEs-driven oncogenesis. Available data suggest that long terminal repeats and long interspersed nuclear elements play a pivotal role as alternative promoters. These findings provide definitive experimental evidence that repetitive elements are a powerful underestimated force toward oncogenesis and open the possibility to new therapeutic treatments.

  11. Finite element computational fluid mechanics

    Science.gov (United States)

    Baker, A. J.

    1983-01-01

    Finite element analysis as applied to the broad spectrum of computational fluid mechanics is analyzed. The finite element solution methodology is derived, developed, and applied directly to the differential equation systems governing classes of problems in fluid mechanics. The heat conduction equation is used to reveal the essence and elegance of finite element theory, including higher order accuracy and convergence. The algorithm is extended to the pervasive nonlinearity of the Navier-Stokes equations. A specific fluid mechanics problem class is analyzed with an even mix of theory and applications, including turbulence closure and the solution of turbulent flows.

  12. Finite element methods for engineers

    CERN Document Server

    Fenner, Roger T

    2013-01-01

    This book is intended as a textbook providing a deliberately simple introduction to finite element methods in a way that should be readily understandable to engineers, both students and practising professionals. Only the very simplest elements are considered, mainly two dimensional three-noded “constant strain triangles”, with simple linear variation of the relevant variables. Chapters of the book deal with structural problems (beams), classification of a broad range of engineering into harmonic and biharmonic types, finite element analysis of harmonic problems, and finite element analysis of biharmonic problems (plane stress and plane strain). Full Fortran programs are listed and explained in detail, and a range of practical problems solved in the text. Despite being somewhat unfashionable for general programming purposes, the Fortran language remains very widely used in engineering. The programs listed, which were originally developed for use on mainframe computers, have been thoroughly updated for use ...

  13. An efficient rectangular plate element

    Institute of Scientific and Technical Information of China (English)

    SHI; Zhongci

    2001-01-01

    [1]Shi Zhong-ci, On the accuracy of the quasi-conforming and generalize conforming finite elements, Chin. Ann. Math., 1990, 11B: 148.[2]Shi Zhong-ci, Chen Shao-chun, Huang Hong-ci, Plate elements with high accuracy, Collec. Geom. Anal. Math. Phys. (ed. Li Ta-Tsien), Singapore: World Scientific, 1997, 155—164.[3]Chen Shao-chun, Shi Zhong-ci, Double set parameter method for the construction of the element stiffness matrix, Mathematica Numerica Sinica (in Chinese), 1991, 13: 286.[4]Ciarlet, P., The Finite Element Method for Elliptic Problems, Amsterdam: North-Holland, 1978.

  14. PROPOSAL OF NEW OPTICAL ELEMENTS

    Directory of Open Access Journals (Sweden)

    Goce Chadzitaskos

    2013-10-01

    Full Text Available A overview of our patented proposals of new optical elements is presented. The elements are suitable for laser pulse analysis, telescopy, X-ray microscopy and X-ray telescopy. They are based on the interference properties of light: a special grating for a double slit pattern, parabolic strip imaging for a telescope, and Bragg’s condition for X-ray scattering on a slice of a single crystal for X-raymicroscopy and X-ray telescopy.

  15. Naturalistic Elements in The Egg

    Institute of Scientific and Technical Information of China (English)

    惠菲菲

    2013-01-01

    The purpose of the study is to analyze the naturalistic elements in The Egg, which is taken from the collection of short stories, The Triumph of the Egg. The study states the ideology and technique of naturalism and then exams how naturalistic ele-ments are revealed in the fiction. Then it comes to the conclusion that the family is defeated by the egg and the life of human be-ings is under control of complicated forces from both inside and outside.

  16. Elements of EAF automation processes

    Science.gov (United States)

    Ioana, A.; Constantin, N.; Dragna, E. C.

    2017-01-01

    Our article presents elements of Electric Arc Furnace (EAF) automation. So, we present and analyze detailed two automation schemes: the scheme of electrical EAF automation system; the scheme of thermic EAF automation system. The application results of these scheme of automation consists in: the sensitive reduction of specific consummation of electrical energy of Electric Arc Furnace, increasing the productivity of Electric Arc Furnace, increase the quality of the developed steel, increasing the durability of the building elements of Electric Arc Furnace.

  17. [Unusual elements in renal calculi].

    Science.gov (United States)

    Rodríguez-Miñón Cifuentes, J L; Salvador, E; Traba Villameytide, M L

    2006-01-01

    A group of 54 renal calculi were spontaneously passed renal stone after a nephritic colic. Two groups of calculi were found: papillary and non-papillary calculi. All calculi were analyzed by infrared spectroscopy and electronic microscopy scan (EMS) and EDAX. When the stones were analyzed with EDAX, elements such as C, N, O, Na, S, Mg, Al, Si, Cl, K, Ca, Mn, Fe, Ni, Zn were detected. The possible origin of these elements is discussed in this work.

  18. Nuclear chemistry of transactinide elements

    Energy Technology Data Exchange (ETDEWEB)

    Nagame, Yuichiro [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment

    1997-07-01

    The current status on the nuclear chemistry studies of transactinide elements is reviewed. The production of transactinides in heavy ion reactions is briefly discussed, and nuclear properties on the stability of transactinides are presented. Chemical properties of the trans-actinide elements 104, 105 and 106, and a typical experimental technique used to study these properties on an atom-at-a-time base are introduced. (author)

  19. Physical model of Nernst element

    Energy Technology Data Exchange (ETDEWEB)

    Nakamura, Hiroaki [Venture Business Lab., Nagoya Univ., Nagoya (Japan); Ikeda, Kazuaki; Yamaguchi, Satarou

    1998-08-01

    Generation of electric power by the Nernst effect is a new application of a semiconductor. A key point of this proposal is to find materials with a high thermomagnetic figure-of-merit, which are called Nernst elements. In order to find candidates of the Nernst element, a physical model to describe its transport phenomena is needed. As the first model, we began with a parabolic two-band model in classical statistics. According to this model, we selected InSb as candidates of the Nernst element and measured their transport coefficients in magnetic fields up to 4 Tesla within a temperature region from 270 K to 330 K. In this region, we calculated transport coefficients numerically by our physical model. For InSb, experimental data are coincident with theoretical values in strong magnetic field. (author)

  20. Spectral element simulation of ultrafiltration

    DEFF Research Database (Denmark)

    Hansen, M.; Barker, Vincent A.; Hassager, Ole

    1998-01-01

    A spectral element method for simulating stationary 2-D ultrafiltration is presented. The mathematical model is comprised of the Navier-Stokes equations for the velocity field of the fluid and a transport equation for the concentration of the solute. In addition to the presence of the velocity...... vector in the transport equation, the system is coupled by the dependency of the fluid viscosity on the solute concentration and by a concentration-dependent boundary condition for the Navier-Stokes equations at the membrane surface. The spectral element discretization yields a nonlinear algebraic system....... The performance of the spectral element code when applied to several ultrafiltration problems is reported. (C) 1998 Elsevier Science Ltd. All rights reserved....

  1. Element-Based Computational Model

    Directory of Open Access Journals (Sweden)

    Conrad Mueller

    2012-02-01

    Full Text Available A variation on the data-flow model is proposed to use for developing parallel architectures. While the model is a data driven model it has significant differences to the data-flow model. The proposed model has an evaluation cycleof processing elements (encapsulated data that is similar to the instruction cycle of the von Neumann model. The elements contain the information required to process them. The model is inherently parallel. An emulation of the model has been implemented. The objective of this paper is to motivate support for taking the research further. Using matrix multiplication as a case study, the element/data-flow based model is compared with the instruction-based model. This is done using complexity analysis followed by empirical testing to verify this analysis. The positive results are given as motivation for the research to be taken to the next stage - that is, implementing the model using FPGAs.

  2. Mechanical Analogies of Fractional Elements

    Institute of Scientific and Technical Information of China (English)

    HU Kai-Xin; ZHU Ke-Qin

    2009-01-01

    A Fractional element model describes a special kind of viscoelastic material.Its stress is proportional to the fractional-order derivative of strain. Physically the mechanical analogies of fractional elements can be represented by spring-dashpot fractal networks. We introduce a constitutive operator in the constitutive equations of viscoelastic materials.To derive constitutive operators for spring-dashpot fractal networks, we use Heaviside operational calculus, which provides explicit answers not otherwise obtainable simply.Then the series-parallel formulas for the constitutive operator are derived. Using these formulas, a constitutive equation of fractional element with 1/2-order derivative is obtained.Finally we find the way to derive the constitutive equations with other fractional-order derivatives and their mechanical analogies.

  3. SUPERCONVERGENCE ANALYSIS FOR CUBIC TRIANGULAR ELEMENT OF THE FINITE ELEMENT

    Institute of Scientific and Technical Information of China (English)

    Qi-ding Zhu

    2000-01-01

    In this paper, we construct a projection interpolation for cubic triangular ele- ment by using othogonal expansion triangular method. We show two fundamental formulas of estimation on a special partion and obtain a superconvergence result of 1 -e order higher for the placement function and its tangential derivative on the third order Lobatto points and Gauss points on each edge of triangular element.

  4. Transposable elements and circular DNAs

    KAUST Repository

    Mourier, Tobias

    2016-09-26

    Circular DNAs are extra-chromosomal fragments that become circularized by genomic recombination events. We have recently shown that yeast LTR elements generate circular DNAs through recombination events between their flanking long terminal repeats (LTRs). Similarly, circular DNAs can be generated by recombination between LTRs residing at different genomic loci, in which case the circular DNA will contain the intervening sequence. In yeast, this can result in gene copy number variations when circles contain genes and origins of replication. Here, I speculate on the potential and implications of circular DNAs generated through recombination between human transposable elements.

  5. Finite elements of nonlinear continua

    CERN Document Server

    Oden, J T

    2000-01-01

    Geared toward undergraduate and graduate students, this text extends applications of the finite element method from linear problems in elastic structures to a broad class of practical, nonlinear problems in continuum mechanics. It treats both theory and applications from a general and unifying point of view.The text reviews the thermomechanical principles of continuous media and the properties of the finite element method, and then brings them together to produce discrete physical models of nonlinear continua. The mathematical properties of these models are analyzed, along with the numerical s

  6. Organic chemistry of elemental phosphorus

    Energy Technology Data Exchange (ETDEWEB)

    Milyukov, V A; Budnikova, Yulia H; Sinyashin, Oleg G [A.E. Arbuzov Institute of Organic and Physical Chemistry, Kazan Scientific Centre of the Russian Academy of Sciences, Kazan (Russian Federation)

    2005-09-30

    The principal achievements and the modern trends in the development of the chemistry of elemental phosphorus are analysed, described systematically and generalised. The possibilities and advantages of the preparation of organophosphorus compounds directly from white phosphorus are demonstrated. Attention is focused on the activation and transformation of elemental phosphorus in the coordination sphere of transition metal complexes. The mechanisms of the reactions of white phosphorus with nucleophilic and electrophilic reagents are discussed. Electrochemical approaches to the synthesis of organic phosphorus derivatives based on white phosphorus are considered.

  7. FINITE ELEMENT ANALYSIS OF STRUCTURES

    Directory of Open Access Journals (Sweden)

    PECINGINA OLIMPIA-MIOARA

    2015-05-01

    Full Text Available The application of finite element method is analytical when solutions can not be applied for deeper study analyzes static, dynamic or other types of requirements in different points of the structures .In practice it is necessary to know the behavior of the structure or certain parts components of the machine under the influence of certain factors static and dynamic . The application of finite element in the optimization of components leads to economic growth , to increase reliability and durability organs studied, thus the machine itself.

  8. Elements of spatial data quality

    CERN Document Server

    Guptill, SC

    1995-01-01

    Elements of Spatial Data Quality outlines the need and suggests potential categories for the content of a comprehensive statement of data quality that must be imbedded in the metadata that accompanies the transfer of a digital spatial data file or is available in a separate metadata catalog. Members of the International Cartographic Association's Commission on Spatial Data Quality have identified seven elements of data quality: positional accuracy, attribute accuracy, completeness, logical consistency, lineage, semantic accuracy and temporal information. In the book the authors describe: compo

  9. Fractal elements and their applications

    CERN Document Server

    Gil’mutdinov, Anis Kharisovich; El-Khazali, Reyad

    2017-01-01

    This book describes a new type of passive electronic components, called fractal elements, from a theoretical and practical point of view. The authors discuss in detail the physical implementation and design of fractal devices for application in fractional-order signal processing and systems. The concepts of fractals and fractal signals are explained, as well as the fundamentals of fractional calculus. Several implementations of fractional impedances are discussed, along with comparison of their performance characteristics. Details of design, schematics, fundamental techniques and implementation of RC-based fractal elements are provided. .

  10. A high temperature fuel element

    Energy Technology Data Exchange (ETDEWEB)

    Sekido, A.; Nakai, M.; Ninomiya, Y.

    1982-12-21

    A solid electrolyte which conducts electricity with heating by oxygen ions and operates at a temperature of 1,000C is used in the element. The cathode, besides the ionic conductivity in oxygen, has an electron conductivity. The anode has electron conductivity. Substances such as Bi203, into which oxides of alkaline earth metals are added, are used for making the cathode. The electrolyte consists of ZrO2 and Y2O3, to which CaO is added. WC, to which an H2 type fuel is fed, serves as the anode. The element has a long service life.

  11. A 3D pyramid spline element

    Institute of Scientific and Technical Information of China (English)

    Juan Chen; Chong-Jun Li; Wan-Ji Chen

    2011-01-01

    In this paper,a 13-node pyramid spline element is derived by using the tetrahedron volume coordinates and the B-net method,which achieves the second order completeness in Cartesian coordinates.Some appropriate examples were employed to evaluate the performance of the proposed element.The numerical results show that the spline element has much better performance compared with the isoparametric serendipity element Q20 and its degenerate pyramid element P13 especially when mesh is distorted,and it is comparable to the Lagrange element Q27.It has been demonstrated that the spline finite element method is an efficient tool for developing high accuracy elements.

  12. Nuclear fuel elements design, fabrication and performance

    CERN Document Server

    Frost, Brian R T

    1982-01-01

    Nuclear Fuel Elements: Design, Fabrication and Performance is concerned with the design, fabrication, and performance of nuclear fuel elements, with emphasis on fast reactor fuel elements. Topics range from fuel types and the irradiation behavior of fuels to cladding and duct materials, fuel element design and modeling, fuel element performance testing and qualification, and the performance of water reactor fuels. Fast reactor fuel elements, research and test reactor fuel elements, and unconventional fuel elements are also covered. This volume consists of 12 chapters and begins with an overvie

  13. On Gothic Elements in Beloved

    Institute of Scientific and Technical Information of China (English)

    任欢

    2016-01-01

    Toni Morrison,a well-known female writer,won Nobel Prize for literature in 1993.Beloved,her fifth novel,wins great popu-larity among readers and it is famous for adopting gothic genre to represent black people’s trauma and deal with it.This paper aims at analy-zing the gothic elements demonstrated in this novel.

  14. Gothic Elements in Folding Beijing

    Institute of Scientific and Technical Information of China (English)

    Hua Yan

    2016-01-01

    The study claims that Folding Beijing can not only be read as science fiction but also as Gothic literature,in which perspective,Gothic Elements such as Gothic Setting, Gothic Wanderer and Transgressions,and Gothic Terror are discussed respectively.

  15. Environmental research on actinide elements

    Energy Technology Data Exchange (ETDEWEB)

    Pinder, J.E. III; Alberts, J.J.; McLeod, K.W.; Schreckhise, R.G. (eds.)

    1987-08-01

    The papers synthesize the results of research sponsored by DOE's Office of Health and Environmental Research on the behavior of transuranic and actinide elements in the environment. Separate abstracts have been prepared for the 21 individual papers. (ACR)

  16. Trace elements: implications for nursing.

    Science.gov (United States)

    Hayter, J

    1980-01-01

    Although most were unknown a few years ago, present evidence indicates that at least 25 trace elements have some pertinence to health. Unlike vitamins, they cannot be synthesized. Some trace elements are now considered important only because of their harmful effects but traces of them may be essential. Zinc is especially important during puberty, pregnancy and menopause and is related to protein metabolism. Both fluoride and cadmium accumulate in the body year after year. Cadmium is positively correlated with several chronic diseases, especially hypertension. It is obtained from smoking and drinking soft water. Silicon, generally associated with silicosis, may be necessary for healthy bone and connective tissue. Chromium, believed to be the glucose tolerance factor, is obtained from brewer's yeast, spices, and whole wheat products. Copper deficiency may be implicated in a wide range of cardiovascular and blood related disorders. Either marginal deficiencies or slight excesses of most trace elements are harmful. Nurses should instruct patients to avoid highly refined foods, fad diets, or synthetic and fabricated foods. A well balanced and varied diet is the best safeguard against trace element excesses or deficiencies.

  17. Dynamic and Transient Infinite Elements

    CERN Document Server

    Zhao, Chongbin

    2009-01-01

    Intends to provide the theory and the application of dynamic and transient infinite elements for simulating the far fields of infinite domains involved in many of scientific and engineering problems, based on the author's own work over the years. This title is suitable for computational geoscientists, geotechnical engineers, and civil engineers.

  18. Evidence for primordial superheavy elements

    Energy Technology Data Exchange (ETDEWEB)

    Gentry, R.V.; Cahill, T.A.; Fletcher, N.R.; Kaufmann, H.C.; Medsker, L.R.; Nelson, J.W.; Flocchini, R.G.

    1976-07-05

    Microscopic crystalline monazite inclusions showing giant halo formation in biotite mica have been analyzed by the method of proton-induced x-ray emission. The observed x-ray energy spectra are best explained by the presence of a number of superheavy elements. (AIP)

  19. Presidential elements in government: introduction

    NARCIS (Netherlands)

    Reestman, J.H.

    2006-01-01

    The editorial board of the European Constitutional Law Review has solicited a number of contributions on presidential elements in government systems in Europe. At the origin of the project are some recent sweeping interventions of heads of state in the political arena. These are notably the (suspens

  20. Naturalistic Elements in Sister Carrie

    Institute of Scientific and Technical Information of China (English)

    刘艳晖

    2007-01-01

    @@ Theodore Dreiser is considered to be a controversial writer.His first novel.Sister Carrie makes a new way of presenting re-ality.This paper discusses the naturalistic elements from the de-tailed description of the environment in that society.

  1. Compact Fuel Element Environment Test

    Science.gov (United States)

    Bradley, D. E.; Mireles, O. R.; Hickman, R. R.; Broadway, J. W.

    2012-01-01

    Deep space missions with large payloads require high specific impulse (I(sub sp)) and relatively high thrust to achieve mission goals in reasonable time frames. Conventional, storable propellants produce average I(sub sp). Nuclear thermal rockets (NTRs) capable of high I(sub sp) thrust have been proposed. NTR employs heat produced by fission reaction to heat and therefore accelerate hydrogen, which is then forced through a rocket nozzle providing thrust. Fuel element temperatures are very high (up to 3,000 K) and hydrogen is highly reactive with most materials at high temperatures. Data covering the effects of high-temperature hydrogen exposure on fuel elements are limited. The primary concern is the mechanical failure of fuel elements that employ high melting point metals, ceramics, or a combination (cermet) as a structural matrix into which the nuclear fuel is distributed. It is not necessary to include fissile material in test samples intended to explore high-temperature hydrogen exposure of the structural support matrices. A small-scale test bed designed to heat fuel element samples via noncontact radio frequency heating and expose samples to hydrogen for typical mission durations has been developed to assist in optimal material and manufacturing process selection without employing fissile material. This Technical Memorandum details the test bed design and results of testing conducted to date.

  2. Actinomycete integrative and conjugative elements

    NARCIS (Netherlands)

    Poele, Evelien M. te; Bolhuis, Henk; Dijkhuizen, Lubbert

    2008-01-01

    This paper reviews current knowledge on actinomycete integrative and conjugative elements (AICEs). The best characterised AICEs, pSAM2 of Streptomyces ambofaciens (10.9 kb), SLP1 (17.3 kb) of Streptomyces coelicolor and pMEA300 of Amycolatopsis methanolica (13.3 kb), are present as integrative eleme

  3. Superheavy-element spectroscopy: Correlations along element 115 decay chains

    Directory of Open Access Journals (Sweden)

    Rudolph D.

    2016-01-01

    Full Text Available Following a brief summary of the region of the heaviest atomic nuclei yet created in the laboratory, data on more than hundred α-decay chains associated with the production of element 115 are combined to investigate time and energy correlations along the observed decay chains. Several of these are analysed using a new method for statistical assessments of lifetimes in sets of decay chains.

  4. An improved optimal elemental method for updating finite element models

    Institute of Scientific and Technical Information of China (English)

    Duan Zhongdong(段忠东); Spencer B.F.; Yan Guirong(闫桂荣); Ou Jinping(欧进萍)

    2004-01-01

    The optimal matrix method and optimal elemental method used to update finite element models may not provide accurate results. This situation occurs when the test modal model is incomplete, as is often the case in practice. An improved optimal elemental method is presented that defines a new objective function, and as a byproduct, circumvents the need for mass normalized modal shapes, which are also not readily available in practice. To solve the group of nonlinear equations created by the improved optimal method, the Lagrange multiplier method and Matlab function fmincon are employed. To deal with actual complex structures,the float-encoding genetic algorithm (FGA) is introduced to enhance the capability of the improved method. Two examples, a 7-degree of freedom (DOF) mass-spring system and a 53-DOF planar frame, respectively, are updated using the improved method.Thc example results demonstrate the advantages of the improved method over existing optimal methods, and show that the genetic algorithm is an effective way to update the models used for actual complex structures.

  5. Low cost, lightweight fuel cell elements

    Science.gov (United States)

    Kindler, Andrew (Inventor)

    2001-01-01

    New fuel cell elements for use in liquid feed fuel cells are provided. The elements including biplates and endplates are low in cost, light in weight, and allow high efficiency operation. Electrically conductive elements are also a part of the fuel cell elements.

  6. The Transuranium Elements - Present Status: Nobel Lecture

    Science.gov (United States)

    Seaborg, G. T.

    1951-12-12

    The discovery of the transuranium elements and the work done on them up to the present time are reviewed. The properties of these elements, their relationship to other elements, their place in the periodic table, and the possibility of production and identification of other transuranium elements are discussed briefly.

  7. Composite oxygen ion transport element

    Science.gov (United States)

    Chen, Jack C.; Besecker, Charles J.; Chen, Hancun; Robinson, Earil T.

    2007-06-12

    A composite oxygen ion transport element that has a layered structure formed by a dense layer to transport oxygen ions and electrons and a porous support layer to provide mechanical support. The dense layer can be formed of a mixture of a mixed conductor, an ionic conductor, and a metal. The porous support layer can be fabricated from an oxide dispersion strengthened metal, a metal-reinforced intermetallic alloy, a boron-doped Mo.sub.5Si.sub.3-based intermetallic alloy or combinations thereof. The support layer can be provided with a network of non-interconnected pores and each of said pores communicates between opposite surfaces of said support layer. Such a support layer can be advantageously employed to reduce diffusion resistance in any type of element, including those using a different material makeup than that outlined above.

  8. Selective Smoothed Finite Element Method

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    The paper examines three selective schemes for the smoothed finite element method (SFEM) which was formulated by incorporating a cell-wise strain smoothing operation into the standard compatible finite element method (FEM). These selective SFEM schemes were formulated based on three selective integration FEM schemes with similar properties found between the number of smoothing cells in the SFEM and the number of Gaussian integration points in the FEM. Both scheme 1 and scheme 2 are free of nearly incompressible locking, but scheme 2 is more general and gives better results than scheme 1. In addition, scheme 2 can be applied to anisotropic and nonlinear situations, while scheme 1 can only be applied to isotropic and linear situations. Scheme 3 is free of shear locking. This scheme can be applied to plate and shell problems. Results of the numerical study show that the selective SFEM schemes give more accurate results than the FEM schemes.

  9. Surface energies of elemental crystals

    Science.gov (United States)

    Tran, Richard; Xu, Zihan; Radhakrishnan, Balachandran; Winston, Donald; Sun, Wenhao; Persson, Kristin A.; Ong, Shyue Ping

    2016-09-01

    The surface energy is a fundamental property of the different facets of a crystal that is crucial to the understanding of various phenomena like surface segregation, roughening, catalytic activity, and the crystal’s equilibrium shape. Such surface phenomena are especially important at the nanoscale, where the large surface area to volume ratios lead to properties that are significantly different from the bulk. In this work, we present the largest database of calculated surface energies for elemental crystals to date. This database contains the surface energies of more than 100 polymorphs of about 70 elements, up to a maximum Miller index of two and three for non-cubic and cubic crystals, respectively. Well-known reconstruction schemes are also accounted for. The database is systematically improvable and has been rigorously validated against previous experimental and computational data where available. We will describe the methodology used in constructing the database, and how it can be accessed for further studies and design of materials.

  10. Automation of finite element methods

    CERN Document Server

    Korelc, Jože

    2016-01-01

    New finite elements are needed as well in research as in industry environments for the development of virtual prediction techniques. The design and implementation of novel finite elements for specific purposes is a tedious and time consuming task, especially for nonlinear formulations. The automation of this process can help to speed up this process considerably since the generation of the final computer code can be accelerated by order of several magnitudes. This book provides the reader with the required knowledge needed to employ modern automatic tools like AceGen within solid mechanics in a successful way. It covers the range from the theoretical background, algorithmic treatments to many different applications. The book is written for advanced students in the engineering field and for researchers in educational and industrial environments.

  11. ADAPTIVE ELLIPSOIDAL ACOUSTIC INFINITE ELEMENT

    Institute of Scientific and Technical Information of China (English)

    Yang Ruiliang; Wang Hongzhen

    2004-01-01

    It is shown that the basis of the ellipsoidal acoustic infinite element Burnett method,the multipole expansion,cannot represent real ellipsoidal acoustic field exactly.To solve the problem,a weight of angular direction is added to the multipole expansion.The comparison of the modified method and the prime method shows that the modified method can describe and solve the ellipsoidal acoustic field more accurately than ever.A dilating sphere is used to test the new method further.Unlike other infinite element methods,varied ratio of the ellipsoidal artificial boundary instead of sphere is used.The pressure value of the artificial boundary is utilized as the initial value of the new method.Then the radiating phenomena of the ellipsoidal acoustic field can be researched using the new method.These examples show the feasibility of the adaptive method.

  12. DOLFIN: Automated Finite Element Computing

    CERN Document Server

    Logg, Anders; 10.1145/1731022.1731030

    2011-01-01

    We describe here a library aimed at automating the solution of partial differential equations using the finite element method. By employing novel techniques for automated code generation, the library combines a high level of expressiveness with efficient computation. Finite element variational forms may be expressed in near mathematical notation, from which low-level code is automatically generated, compiled and seamlessly integrated with efficient implementations of computational meshes and high-performance linear algebra. Easy-to-use object-oriented interfaces to the library are provided in the form of a C++ library and a Python module. This paper discusses the mathematical abstractions and methods used in the design of the library and its implementation. A number of examples are presented to demonstrate the use of the library in application code.

  13. CONSTRAINED QUADRILATERAL NONCONFORMING ROTATED Q1 ELEMENT

    Institute of Scientific and Technical Information of China (English)

    Jun Hu; Zhong-ci Shi

    2005-01-01

    In this paper, we define a new nonconforming quadrilateral finite element based on the nonconforming rotated Q1 element by enforcing a constraint on each element, which has only three degrees of freedom. We investigate the consistency, approximation, superclose property, discrete Green's function and superconvergence of this element. Moreover, we propose a new postprocessing technique and apply it to this element. It is proved that the postprocessed discrete solution is superconvergent under a mild assumption on the mesh.

  14. LOG PERIODIC DIPOLE ARRAY WITH PARASITIC ELEMENTS

    Science.gov (United States)

    The design and measured characteristics of dipole and monopole versions of a log periodic array with parasitic elements are discussed. In a dipole...array with parasitic elements, these elements are used in place of every alternate dipole, thereby eliminating the need of a twisted feed arrangement...for the elements to obtain log periodic performance of the anntenna. This design with parasitic elements lends itself to a monopole version of the

  15. Backfire antennas with dipole elements

    DEFF Research Database (Denmark)

    Nielsen, Erik Dragø; Pontoppidan, Knud

    1970-01-01

    A method is set up for a theoretical investigation of arbitrary backfire antennas based upon dipole structures. The mutual impedance between the dipole elements of the antenna is taken into account, and the field radiated due to a surface wave reflector of finite extent is determined by calculating...... the surface current distribution on the reflector plate. Numerical results obtained for Yagi backfire antennas and short-backfire antennas using this theory are compared with experimental results....

  16. Origin of the Chemical Elements

    CERN Document Server

    Rauscher, T

    2010-01-01

    This review provides the necessary background from astrophysics, nuclear, and particle physics to understand the cosmic origin of the chemical elements. It reflects the year 2009 state of the art in this extremely quickly developing interdisciplinary research direction. The discussion summarizes the nucleosynthetic processes in the course of the evolution of the Universe and the galaxies contained within, including primordial nucleosynthesis, stellar evolution, and explosive nucleosynthesis in single and binary systems.

  17. Conrad's Skeptical Elements in Nostromo

    Institute of Scientific and Technical Information of China (English)

    何旭

    2016-01-01

    The Paper analyze the skeptical elements in Nostromo through mostly the analysis of the values held by different char-acter and their respective destiny. Conrad expresses his skepticism towards material interest through the character of Charles Gould, who firmly believes that material interests alone can bring order and peace to the country. But his success is temporary. Eventually success of his silver mine not only intensifies political conflicts but also brings him disillusionment and loneliness.

  18. Elements of Bayesian experimental design

    Energy Technology Data Exchange (ETDEWEB)

    Sivia, D.S. [Rutherford Appleton Lab., Oxon (United Kingdom)

    1997-09-01

    We consider some elements of the Bayesian approach that are important for optimal experimental design. While the underlying principles used are very general, and are explained in detail in a recent tutorial text, they are applied here to the specific case of characterising the inferential value of different resolution peakshapes. This particular issue was considered earlier by Silver, Sivia and Pynn (1989, 1990a, 1990b), and the following presentation confirms and extends the conclusions of their analysis.

  19. Auto and cross regulatory elements control Onecut expression in the ascidian nervous system.

    Science.gov (United States)

    Pezzotti, Maria Rosa; Locascio, Annamaria; Racioppi, Claudia; Fucci, Laura; Branno, Margherita

    2014-06-15

    The expression pattern of Onecut genes in the central and peripheral nervous systems is highly conserved in invertebrates and vertebrates but the regulatory networks in which they are involved are still largely unknown. The presence of three gene copies in vertebrates has revealed the functional roles of the Onecut genes in liver, pancreas and some populations of motor neurons. Urochordates have only one Onecut gene and are the closest living relatives of vertebrates and thus represent a good model system to understand its regulatory network and involvement in nervous system formation. In order to define the Onecut genetic cascade, we extensively characterized the Onecut upstream cis-regulatory DNA in the ascidian Ciona intestinalis. Electroporation experiments using a 2.5kb genomic fragment and of a series of deletion constructs identified a small region of 262bp able to reproduce most of the Onecut expression profile during embryonic development. Further analyses, both bioinformatic and in vivo using transient transgenes, permitted the identification of transcription factors responsible for Onecut endogenous expression. We provide evidence that Neurogenin is a direct activator of Onecut and that an autoregulatory loop is responsible for the maintenance of its expression. Furthermore, for the first time we propose the existence of a direct connection among Neurogenin, Onecut and Rx transcription factors in photoreceptor cell formation.

  20. Inferring regulatory element landscapes and transcription factor networks from cancer methylomes.

    Science.gov (United States)

    Yao, Lijing; Shen, Hui; Laird, Peter W; Farnham, Peggy J; Berman, Benjamin P

    2015-05-21

    Recent studies indicate that DNA methylation can be used to identify transcriptional enhancers, but no systematic approach has been developed for genome-wide identification and analysis of enhancers based on DNA methylation. We describe ELMER (Enhancer Linking by Methylation/Expression Relationships), an R-based tool that uses DNA methylation to identify enhancers and correlates enhancer state with expression of nearby genes to identify transcriptional targets. Transcription factor motif analysis of enhancers is coupled with expression analysis of transcription factors to infer upstream regulators. Using ELMER, we investigated more than 2,000 tumor samples from The Cancer Genome Atlas. We identified networks regulated by known cancer drivers such as GATA3 and FOXA1 (breast cancer), SOX17 and FOXA2 (endometrial cancer), and NFE2L2, SOX2, and TP63 (squamous cell lung cancer). We also identified novel networks with prognostic associations, including RUNX1 in kidney cancer. We propose ELMER as a powerful new paradigm for understanding the cis-regulatory interface between cancer-associated transcription factors and their functional target genes.

  1. Peridynamic Multiscale Finite Element Methods

    Energy Technology Data Exchange (ETDEWEB)

    Costa, Timothy [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Bond, Stephen D. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Littlewood, David John [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Moore, Stan Gerald [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

    2015-12-01

    The problem of computing quantum-accurate design-scale solutions to mechanics problems is rich with applications and serves as the background to modern multiscale science research. The prob- lem can be broken into component problems comprised of communicating across adjacent scales, which when strung together create a pipeline for information to travel from quantum scales to design scales. Traditionally, this involves connections between a) quantum electronic structure calculations and molecular dynamics and between b) molecular dynamics and local partial differ- ential equation models at the design scale. The second step, b), is particularly challenging since the appropriate scales of molecular dynamic and local partial differential equation models do not overlap. The peridynamic model for continuum mechanics provides an advantage in this endeavor, as the basic equations of peridynamics are valid at a wide range of scales limiting from the classical partial differential equation models valid at the design scale to the scale of molecular dynamics. In this work we focus on the development of multiscale finite element methods for the peridynamic model, in an effort to create a mathematically consistent channel for microscale information to travel from the upper limits of the molecular dynamics scale to the design scale. In particular, we first develop a Nonlocal Multiscale Finite Element Method which solves the peridynamic model at multiple scales to include microscale information at the coarse-scale. We then consider a method that solves a fine-scale peridynamic model to build element-support basis functions for a coarse- scale local partial differential equation model, called the Mixed Locality Multiscale Finite Element Method. Given decades of research and development into finite element codes for the local partial differential equation models of continuum mechanics there is a strong desire to couple local and nonlocal models to leverage the speed and state of the

  2. Adobe Photoshop Elements 10 unleash the hidden performance of Elements

    CERN Document Server

    Galer, Mark

    2011-01-01

    Master the most powerful photo editing tools and techniques that Elements has to offer! Using step-by-step projects, Mark Galer will have you creating stunning images in no time at all. Whether you want to create impressive, seamless montages, optimize your photos for perfect print quality, or simply enhance your images for maximum impact, Maximum Performance will give you the skills and know-how you need to create professional quality results. Featured projects teach you how to work with multilayered 16 bit/channel files, as well as convert to black and white using Adobe Camera Raw, create

  3. Finite element analysis of elasto-plastic plate bending problems using transition rectangular plate elements

    Institute of Scientific and Technical Information of China (English)

    Bahattin Kanber; O.Yavuz Bozkurt

    2006-01-01

    In this work,the finite element analysis of the elasto-plastic plate bending problems is carried out using transition rectangular plate elements.The shape functions of the transition plate elements are derived based on a practical rule.The transition plate elements are all quadrilateral and can be used to obtain efficient finite element models using minimum number of elements.The mesh convergence rates of the models including the transition elements are compared with the regular element models.To verify the developed elements,simple tests are demonstrated and various elasto-plastic problems are solved.Their results are compared with ANSYS results.

  4. Implementing wavelet transform with SAW elements

    Institute of Scientific and Technical Information of China (English)

    卢文科; 朱长纯; 刘君华; 刘清洪

    2003-01-01

    In the design of the finger-overlap envelope according to the envelope of wavelet function, it is concluded that the pulse-response function of the interdigital transducer (IDT) for surface acoustic wave (SAW) is identical to the wavelet function. SAW type of the wavelet-transform element is manufactured. A new method of using two wavelet-transform elements to manufacture the reconstruction element of the wavelet transform is proposed. The sources of the element error are analyzed, and the methods for reducing the error are put forward. SAW type of the wavelet transformation element and its reconstruction element have the following three characteristics: (i) the implementing methods of the wavelet transform element and its reconstruction element are simple, and free of complicated mathematical algorithms of the wavelet transform; (ii) because one of SAW element is fast, the response velocities of SAW type of the wavelet transform element and its reconstruction element are also fast; (iii) the costs of the wavelet transform element and its reconstruction element are low, so the elements may be manufactured in a large quantity.

  5. Duration judgements over multiple elements

    Directory of Open Access Journals (Sweden)

    Inci eAyhan

    2012-11-01

    Full Text Available We investigated the limits of the number of events observers can simultaneously time. For single targets occurring in one of eight positions sensitivity to duration was improved for spatially pre-cued items as compared to post-cued items indicating that exogenous driven attention can improve duration discrimination. Sensitivity to duration for pre-cued items was also marginally better for single items as compared to eight items indicating that even after the allocation of focal attention, distracter items can interfere with the encoding of duration. For an eight item array discrimination was worse for post-cued locations as compared to pre-cued locations indicating both that attention can improve duration discrimination performance and that it was not possible to access a perfect memory trace of the duration of eight elements. The interference from the distracters in the pre-cued eight item array may reflect some mandatory averaging of target and distracter events. To further explore duration averaging we asked subjects to explicitly compare average durations of multiple item arrays against a single item standard duration. Duration discrimination thresholds were significantly lower for single elements as compared to multiple elements, showing that averaging, either automatically or intentionally, impairs duration discrimination. There was no set size effect. Performance was the same for averages of two and eight items, but performance with even an average of two items was worse than for one item. This was also true for sequential presentation indicating poor performance was not due to limits on the division of attention across items. Rather performance appears to be limited by an inability to remember or aggregate duration information from two or more items. Although it is possible to manipulate perceived duration locally, there appears to be no perceptual mechanisms for aggregating local durations across space.

  6. Elemental composition of Malawian rice.

    Science.gov (United States)

    Joy, Edward J M; Louise Ander, E; Broadley, Martin R; Young, Scott D; Chilimba, Allan D C; Hamilton, Elliott M; Watts, Michael J

    2016-07-20

    Widespread potential dietary deficiencies of calcium (Ca), iron (Fe), iodine (I), selenium (Se) and zinc (Zn) have been identified in Malawi. Several deficiencies are likely to be compounded by high phytic acid (PA) consumption. Rice (Oryza sativa) is commonly consumed in some Malawian populations, and its mineral micronutrient content is important for food security. The considerable irrigation requirements and flooded conditions of paddy soils can also introduce or mobilise potentially toxic elements including arsenic (As), cadmium (Cd) and lead (Pb). The aim of this study was to determine the mineral composition of rice sampled from farmers' fields and markets in Malawi. Rice was sampled from 18 extension planning areas across Malawi with 21 white (i.e. polished) and 33 brown samples collected. Elemental composition was determined by inductively coupled plasma-mass spectrometry (ICP-MS). Arsenic speciation was performed using high-performance liquid chromatography (HPLC)-ICP-MS. Concentration of PA was determined using a PA-total phosphorus assay. Median total concentrations (mg kg(-1), dry weight) of elements important for human nutrition in brown and white rice, respectively, were: Ca = 66.5 and 37.8; Cu = 3.65 and 2.49; Fe = 22.1 and 7.2; I = 0.006 and Biofortification strategies could significantly increase Se and Zn concentrations and require further investigation. Concentrations of Fe in rice grain varied greatly, and this was likely due to contamination of rice samples with soil. Risk of As, Cd or Pb toxicity due to rice consumption in Malawi appears to be minimal.

  7. Fluidic Elements based on Coanda Effect

    Directory of Open Access Journals (Sweden)

    Constantin OLIVOTTO

    2010-12-01

    Full Text Available This paper contains first some definitions and classifications regarding the fluidic elements. Thegeneral current status is presented, nominating the main specific elements based on the Coanda effect developedspecially in Romania. In particularly the development of an original bistable element using industrial compressedair at industrial pressure supply is presented. The function of this element is based on the controlled attachmentof the main jet at a curved wall through the Coanda effect. The methods used for particular calculation andexperiments are nominated. The main application of these elements was to develop a specific execution element:a fluidic step–by-step motor based on the Coanda effect.

  8. ACCURACY ANALYSIS FOR QUASI-CAREY ELEMENT

    Institute of Scientific and Technical Information of China (English)

    Dongyang SHI; Xiaobin HAO

    2008-01-01

    In this paper, a new triangular element (Quasi-Carey element) is constructed by the idea of Specht element. It is shown that this Quasi-Carey element possesses a very special property, i.e.,the consistency error is of order O(h2), one order higher than its interpolation error when the exact solution belongs to Ha(Ω). However, the interpolation error and consistency error of Carey element are of order O(h). It seems that the above special property has never been seen for other triangular elements for the second order problems.

  9. Formulations of a hydromechanical interface element

    Institute of Scientific and Technical Information of China (English)

    Zhong-Zhi Fu; Si-Hong Liu

    2011-01-01

    A hydromechanical interface element is proposed for the consideration of the hydraulic-mechanical coupling effect along the interface.The fully coupled governing equations and the relevant finite element formulations are derived in detail for the interface element.All the involved matrices are of the same form as those of a solid element,which makes the incorporation of the model into a finite element program straightforward.Three examples are then numerically simulated using the interface element.Reasonable results confirm the correctness of the proposed model and motivate its application in hydromechanical contact problems in the future.

  10. Elements of partial differential equations

    CERN Document Server

    Sneddon, Ian N

    2006-01-01

    Geared toward students of applied rather than pure mathematics, this volume introduces elements of partial differential equations. Its focus is primarily upon finding solutions to particular equations rather than general theory.Topics include ordinary differential equations in more than two variables, partial differential equations of the first and second orders, Laplace's equation, the wave equation, and the diffusion equation. A helpful Appendix offers information on systems of surfaces, and solutions to the odd-numbered problems appear at the end of the book. Readers pursuing independent st

  11. Nuclear reactor fuel element. Kernreaktorbrennelement

    Energy Technology Data Exchange (ETDEWEB)

    Lippert, H.J.

    1985-03-28

    The fuel element box for a BWR is situated with a corner bolt on the inside in one corner of its top on the top side of the top plate. This corner bolt is screwed down with a bolt with a corner part which is provided with leaf springs outside on two sides, where the bolt has a smaller diameter and an expansion shank. The bolt is held captive to the bolt head on the top and the holder on the bottom of the corner part. The holder is a locknut. If the expansion forces are too great, the bolt can only break at the expansion shank.

  12. Elements of abstract harmonic analysis

    CERN Document Server

    Bachman, George

    2013-01-01

    Elements of Abstract Harmonic Analysis provides an introduction to the fundamental concepts and basic theorems of abstract harmonic analysis. In order to give a reasonably complete and self-contained introduction to the subject, most of the proofs have been presented in great detail thereby making the development understandable to a very wide audience. Exercises have been supplied at the end of each chapter. Some of these are meant to extend the theory slightly while others should serve to test the reader's understanding of the material presented. The first chapter and part of the second give

  13. Elements of a Spatial Web

    DEFF Research Database (Denmark)

    Jensen, Christian S.

    2010-01-01

    community is hard at work inventing means of efficiently supporting new spatial query functionality. Points of interest with a web presence, called spatial web objects, have a location as well as a textual description. Spatio-textual queries return such objects that are near a location argument...... and are relevant to a text argument. An important element in enabling such queries is to be able to rank spatial web objects. Another is to be able to determine the relevance of an object to a query. Yet another is to enable the efficient processing of such queries. The talk covers recent results on spatial web...

  14. Main Elements for Upscaling Recreation

    DEFF Research Database (Denmark)

    Zandersen, Marianne; Termansen, Mette

    2012-01-01

    This report provides information on the main elements used to scale up modelled local visitor flow data to regional level based on recreational de-mand models. These models are described in Report #1. This report also provides information on data sources such as spatial data (e.g. land cov......-er/land use information), demographic information. The report is accom-pagnied with a spatial database for the regional case of forest recreation in Northern Zealand, Denmark. The spatial database contains forest polygons; forest attribute; estimation of total annual number of visits per site; and es...

  15. Basic Elements of Knowledge Management

    Directory of Open Access Journals (Sweden)

    Marcin W. Staniewski

    2007-10-01

    Full Text Available The article is a review of basic knowledge management terminology. It presents such a description as: knowledge resources levels (data, information, knowledge, and wisdom, knowledge sources (internal, external, and knowledge typology (implicit, tacit or individual, social. Moreover the article characterizes knowledge management process, knowledge management system and main knowledge management strategies (codification, personalization. At the end of the article there is mentioned the knowledge creating process (the concept of knowledge creation spiral and the role of Intelligence Technology (IT and organizational culture as main elements supporting knowledge management implementation in organizations.

  16. Differential trypanosome surface coat regulation by a CCCH protein that co-associates with procyclin mRNA cis-elements.

    Directory of Open Access Journals (Sweden)

    Pegine Walrad

    2009-02-01

    Full Text Available The genome of Trypanosoma brucei is unusual in being regulated almost entirely at the post-transcriptional level. In terms of regulation, the best-studied genes are procyclins, which encode a family of major surface GPI-anchored glycoproteins (EP1, EP2, EP3, GPEET that show differential expression in the parasite's tsetse-fly vector. Although procyclin mRNA cis-regulatory sequences have provided the paradigm for post-transcriptional control in kinetoplastid parasites, trans-acting regulators of procyclin mRNAs are unidentified, despite intensive effort over 15 years. Here we identify the developmental regulator, TbZFP3, a CCCH-class predicted RNA binding protein, as an isoform-specific regulator of Procyclin surface coat expression in trypanosomes. We demonstrate (i that endogenous TbZFP3 shows sequence-specific co-precipitation of EP1 and GPEET, but not EP2 and EP3, procyclin mRNA isoforms, (ii that ectopic overexpression of TbZFP3 does not perturb the mRNA abundance of procyclin transcripts, but rather that (iii their protein expression is regulated in an isoform-specific manner, as evidenced by mass spectrometric analysis of the Procyclin expression signature in the transgenic cell lines. The TbZFP3 mRNA-protein complex (TbZFP3mRNP is identified as a trans-regulator of differential surface protein expression in trypanosomes. Moreover, its sequence-specific interactions with procyclin mRNAs are compatible with long-established predictions for Procyclin regulation. Combined with the known association of TbZFP3 with the translational apparatus, this study provides a long-sought missing link between surface protein cis-regulatory signals and the gene expression machinery in trypanosomes.

  17. New alternating direction procedures in finite element analysis based upon EBE approximate factorizations. [element-by-element

    Science.gov (United States)

    Hughes, T. J. R.; Winget, J.; Levit, I.; Tezduyar, T. E.

    1983-01-01

    Element-by-element approximate factorization procedures are proposed for solving the large finite element equation systems which arise in computational mechanics. A variety of techniques are compared on problems of structural mechanics, heat conduction and fluid mechanics. The results obtained suggest considerable potential for the methods described.

  18. Analysis of composite structural elements

    Directory of Open Access Journals (Sweden)

    A. Baier

    2010-12-01

    Full Text Available Purpose: The themes of the study are composite structural components. For this purpose have been designed and built several research positions.Design/methodology/approach: Using different structural materials to build new device components requires multiple tests of the components. Research posts were designed in the advanced graphical program CAx Siemens NX 7.5. Analysed samples were made from the glass fibre, aramid and carbon of various weights. Due to the specific use of composite materials it focuses on the elements in the form of plates and flat bars. For the examination of experimental strain gauge technique was used bead, the force sensor and displacement sensor. The experimental methods were compared with computer simulation using the FEM.Findings: The aim of this study was to determine the basic material constants and a comparison of the experimental method and the method of computer simulation.Research limitations/implications: Change the number of layers and how to connect the laminate with the steel plate changes mechanical properties of the structural component.Practical implications: The ultimate result will be knowledge on the different forms of laminates, such as material properties, the stresses in all layers, strain and comparing the results obtained by two methods.Originality/value: The expected outcome of the study will be the composition and method of joining composite laminate with a steel plate to the possible application in the repair and construction of structural elements of freight wagons.

  19. Light element opacities from ATOMIC

    Science.gov (United States)

    Colgan, J.; Kilcrease, D. P.; Magee, N. H.; Armstrong, G. S. J.; Abdallah, J.; Sherrill, M. E.; Fontes, C. J.; Zhang, H. L.; Hakel, P.

    2013-06-01

    We present new calculations of local-thermodynamic-equilibrium (LTE) light element opacities from the Los Alamos ATOMIC code. ATOMIC is a multi-purpose code that can generate LTE or non-LTE quantities of interest at various levels of approximation. A program of work is currently underway to compute new LTE opacity data for all elements H through Zn. New opacity tables for H through Ne are complete, and a new Fe opacity table will be available soon. Our calculations, which include fine-structure detail, represent a systematic improvement over previous Los Alamos opacity calculations using the LEDCOP legacy code. Our opacity calculations incorporate atomic structure data computed from the CATS code, which is based on Cowan's atomic structure codes, and photoionization cross section data computed from the Los Alamos ionization code GIPPER. We make use of a new equation-of-state (EOS) model based on the chemical picture. ATOMIC incorporates some physics packages from LEDCOP and also includes additional physical processes, such as improved free-free cross sections and additional scattering mechanisms. In this report, we briefly discuss the physics improvements included in our new opacity calculations and present comparisons of our new opacities with other work for C, O, and Fe at selected conditions.

  20. METHODOLOGICAL ELEMENTS OF SITUATIONAL ANALYSIS

    Directory of Open Access Journals (Sweden)

    Tetyana KOVALCHUK

    2016-07-01

    Full Text Available The article deals with the investigation of theoretical and methodological principles of situational analysis. The necessity of situational analysis is proved in modern conditions. The notion “situational analysis” is determined. We have concluded that situational analysis is a continuous system study which purpose is to identify dangerous situation signs, to evaluate comprehensively such signs influenced by a system of objective and subjective factors, to search for motivated targeted actions used to eliminate adverse effects of the exposure of the system to the situation now and in the future and to develop the managerial actions needed to bring the system back to norm. It is developed a methodological approach to the situational analysis, its goal is substantiated, proved the expediency of diagnostic, evaluative and searching functions in the process of situational analysis. The basic methodological elements of the situational analysis are grounded. The substantiation of the principal methodological elements of system analysis will enable the analyst to develop adaptive methods able to take into account the peculiar features of a unique object which is a situation that has emerged in a complex system, to diagnose such situation and subject it to system and in-depth analysis, to identify risks opportunities, to make timely management decisions as required by a particular period.

  1. Fuel elements of thermionic converters

    Energy Technology Data Exchange (ETDEWEB)

    Hunter, R.L. [ed.] [Sandia National Labs., Albuquerque, NM (United States). Environmental Systems Assessment Dept.; Gontar, A.S.; Nelidov, M.V.; Nikolaev, Yu.V.; Schulepov, L.N. [RI SIA Lutch, Podolsk (Russian Federation)

    1997-01-01

    Work on thermionic nuclear power systems has been performed in Russia within the framework of the TOPAZ reactor program since the early 1960s. In the TOPAZ in-core thermionic convertor reactor design, the fuel element`s cladding is also the thermionic convertor`s emitter. Deformation of the emitter can lead to short-circuiting and is the primary cause of premature TRC failure. Such deformation can be the result of fuel swelling, thermocycling, or increased unilateral pressure on the emitter due to the release of gaseous fission products. Much of the work on TRCs has concentrated on preventing or mitigating emitter deformation by improving the following materials and structures: nuclear fuel; emitter materials; electrical insulators; moderator and reflector materials; and gas-exhaust device. In addition, considerable effort has been directed toward the development of experimental techniques that accurately mimic operational conditions and toward the creation of analytical and numerical models that allow operational conditions and behavior to be predicted without the expense and time demands of in-pile tests. New and modified materials and structures for the cores of thermionic NPSs and new fabrication processes for the materials have ensured the possibility of creating thermionic NPSs for a wide range of powers, from tens to several hundreds of kilowatts, with life spans of 5 to 10 years.

  2. Recovery of trans-plutonium elements; Recuperation des elements transplutoniens

    Energy Technology Data Exchange (ETDEWEB)

    Espie, J.Y.; Poncet, B.; Simon, A. [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires

    1970-07-01

    The object of this work is to study the recovery of americium and curium from the fission-product solution obtained from the processing of irradiated fuel elements made of natural metallic uranium alloyed with aluminium, iron and silicon; these elements have been subjected to an average irradiation of 4000 MW days/ton in a gas-graphite type reactor having a thermal power of 3.7 MW/ton of uranium. The process used consists of 3 extraction cycles and one americium-curium separation: - 1) extraction cycle in 40 per cent TBP: extraction of actinides and lanthanides; elimination of fission products; - 2) extraction cycle in 8 per cent D2EHPA: decontamination from the fission products, decontamination of actinides from lanthanides; - 3) extraction cycle in 40 per cent TBP: separation of the complexing agent and concentration of the actinides; - 4) americium-curium separation by precipitation. (authors) [French] Cette etude a pour objet, la recuperation de l'americium et du curium de la solution de produits de fission provenant du traitement de combustibles irradies a base d'uranium naturel metallique allie a l'aluminium, le fer, et le silicium, et ayant subi une irradiation moyenne de 4000 MWj/t dans une pile du type graphite-gaz, dont la puissance thermique est de 3.7 MW/t d'uranium. Le procede utilise comprend 3 cycles d'extraction et une separation americium-curium: - 1. cycle d'extraction dans le TBP a 40 pour cent: extraction des actinides et des lanthanides, elimination des produits de fission; - 2. cycle d'extraction dans le D2EHPA a 8 pour cent: decontamination en produits de fission, decontamination des actinides en lanthanides; - 3. cycle d'extraction dans le TBP a 40 pour cent: separation du complexant et concentration des actinides; - 4. separation americium-curium par precipitation. (auteurs)

  3. Infinite Possibilities for the Finite Element.

    Science.gov (United States)

    Finlayson, Bruce A.

    1981-01-01

    Describes the uses of finite element methods in solving problems of heat transfer, fluid flow, etc. Suggests that engineers should know the general concepts and be able to apply the principles of finite element methods. (Author/WB)

  4. Natural wetland emissions of methylated trace elements

    NARCIS (Netherlands)

    Vriens, B.; Lenz, M.; Charlet, L.; Berg, M.; Winkel, L.H.E.

    2014-01-01

    Natural wetlands are well known for their significant methane emissions. However, trace element emissions via biomethylation and subsequent volatilization from pristine wetlands are virtually unstudied, even though wetlands constitute large reservoirs for trace elements. Here we show that the averag

  5. Finite element differential forms on cubical meshes

    CERN Document Server

    Arnold, Douglas N

    2012-01-01

    We develop a family of finite element spaces of differential forms defined on cubical meshes in any number of dimensions. The family contains elements of all polynomial degrees and all form degrees. In two dimensions, these include the serendipity finite elements and the rectangular BDM elements. In three dimensions they include a recent generalization of the serendipity spaces, and new H(curl) and H(div) finite element spaces. Spaces in the family can be combined to give finite element subcomplexes of the de Rham complex which satisfy the basic hypotheses of the finite element exterior calculus, and hence can be used for stable discretization of a variety of problems. The construction and properties of the spaces are established in a uniform manner using finite element exterior calculus.

  6. Superconvergence for rectangular serendipity finite elements

    Institute of Scientific and Technical Information of China (English)

    CHEN; Chuanmiao(陈传淼)

    2003-01-01

    Based on an orthogonal expansion and orthogonality correction in an element, superconvergenceat symmetric points for any degree rectangular serendipity finite element approximation to second order ellipticproblem is proved, and its behaviour up to the boundary is also discussed.

  7. Integrating Environmentally Responsive Elements in Buildings

    DEFF Research Database (Denmark)

    Heiselberg, Per; Andresen, Inger; Perino, Marco;

    2006-01-01

    Significant improvement have been achieved on efficiency improvements of specific building elements like the building envelope and building equipment and services and whilst most building elements still offer opportunities for efficiency improvements, the greatest future potential lie with techno...

  8. Continuous finite element methods for Hamiltonian systems

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    By applying the continuous finite element methods of ordinary differential equations, the linear element methods are proved having second-order pseudo-symplectic scheme and the quadratic element methods are proved having third-order pseudosymplectic scheme respectively for general Hamiltonian systems, and they both keep energy conservative. The finite element methods are proved to be symplectic as well as energy conservative for linear Hamiltonian systems. The numerical results are in agreement with theory.

  9. Superheavy Element Research at Tasca at GSI

    Science.gov (United States)

    Düllmann, Christoph E.

    2014-09-01

    Experiments on the synthesis of the heaviest elements are in the center of the current research program on superheavy elements at GSI Darmstadt. At the gas-filled recoil separator TASCA, search experiments for the new elements 119 and 120 have been performed in the reactions 50Ti + 249Bk and 50Ti + 249Cf, respectively, and the production of element 117 in the reaction 48Ca + 249Bk was studied. The experiments were performed successfully and the data are currently under analysis.

  10. Element Cycles: An Environmental Chemistry Board Game

    Science.gov (United States)

    Pippins, Tracy; Anderson, Cody M.; Poindexter, Eric F.; Sultemeier, S. Whitney; Schultz, Linda D.

    2011-01-01

    "Element Cycles" is an activity designed to reinforce correlation of essential elements and their different forms in the ecosystem. Students are assigned essential elements to research as homework, then share results, and construct game boards with four ecosphere sections: geosphere (earth), hydrosphere (water), atmosphere (air), and biosphere…

  11. Main: ELEMENT1GMLBC3 [PLACE

    Lifescience Database Archive (English)

    Full Text Available ELEMENT1GMLBC3 S000319 7-Sep-2000 (last modified) seki Element 1 found in the promo...ter of soybean (G.m.) leghaemoglobin lbc3 gene; Binding site of nuclear extract from soybean nodules; Locate...Element 2 share a common motif; See S000320; nodule; leghaemoglobin; lbc3; root; Soybean (Glycine max) GATATATTAATATTTTATTTTATA ...

  12. Elements from chlorine to calcium nuclear reactions

    CERN Document Server

    Kunz, Wunibald

    1968-01-01

    Nuclear Tables: Part II Nuclear Reactions, Volume 3: The Elements from Chlorine to Calcium contains tabulations of the nuclear reaction values of elements chlorine, argon, potassium, and calcium. These tabulations provide the calculated Q-values of the elements and their isotopes. This book will be of value to general chemistry researchers.

  13. Data Element Dictionary: Facilities. Preliminary Draft.

    Science.gov (United States)

    Thomas, Charles R.

    The draft includes--(1) comments on file structure, (2) descriptions of dictionary organization and format, (3) alphabetical lists of elements, and (4) facilities related elements in dictionary form. The data element definitions in this draft are compatible with the Higher Education Facilities Classification and Inventory Procedures Manual, which…

  14. 40 CFR 721.10068 - Elemental mercury.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Elemental mercury. 721.10068 Section... Substances § 721.10068 Elemental mercury. (a) Definitions. The definitions in § 721.3 apply to this section... elemental mercury (CAS. No. 7439-97-6) is subject to reporting under this section for the significant...

  15. Superheavy elements: existence, classification and experiment

    OpenAIRE

    Kostyghin, V. A.; Vaschenko, V. M.; Loza, Ye. A.

    2012-01-01

    This paper proposes spatial periodic table developed based on classic electron shell structure model. The periodic table determines location and chemical properties of superheavy elements. 14 new long-living superheavy elements found by Proton-21 laboratory and one long-living superheavy element found by A.Marinov were identified.

  16. Downhole elemental analysis with LIBS

    Science.gov (United States)

    Moreschini, P.; Zacny, K.; Rickman, D.

    2011-12-01

    In this paper we discuss a novel instrument, currently under development at Honeybee Robotics with SBIR funding from NASA. The device is designed to characterize elemental composition as a function of depth in non-terrestrial geological formations. The instrument consists of a miniaturized LIBS analyzer integrated in a 2" diameter drill string. While the drill provides subsurface access, the LIBS analyzer provides information on the elemental composition of the borehole wall. This instrument has a variety of space applications ranging from exploration of the Moon for which it was originally designed, to Mars, as well as a variety of terrestrial applications. Subsurface analysis is usually performed by sample acquisition through a drill or excavator, followed by sample preparation and subsequent sample presentation to an instrument or suite of instruments. An alternative approach consisting in bringing a miniaturized version of the instrument to the sample has many advantages over the traditional methodology, as it allows faster response, reduced probability of cross-contamination and a simplification in the sampling mechanisms. LIBS functions by focusing a high energy laser on a material inducing a plasma consisting of a small fraction of the material under analysis. Optical emission from the plasma, analyzed by a spectrometer, can be used to determine elemental composition. A triangulation sensor located in the sensor head determines the distance of the sensor from the borehole wall. An actuator modifies the position of the sensor accordingly, in order to compensate for changes due to the profile of the borehole walls. This is necessary because LIBS measurements are negatively affected by changes in the relative position of the focus of the laser with respect to the position of the sample (commonly referred to as the "lens to sample distance"). Profiling the borehole is done by adjusting the position of the sensor with a vertical stage; a second actuator at the

  17. Elements of algebraic coding systems

    CERN Document Server

    Cardoso da Rocha, Jr, Valdemar

    2014-01-01

    Elements of Algebraic Coding Systems is an introductory textto algebraic coding theory. In the first chapter, you'll gain insideknowledge of coding fundamentals, which is essential for a deeperunderstanding of state-of-the-art coding systems.This book is a quick reference for those who are unfamiliar withthis topic, as well as for use with specific applications such as cryptographyand communication. Linear error-correcting block codesthrough elementary principles span eleven chapters of the text.Cyclic codes, some finite field algebra, Goppa codes, algebraic decodingalgorithms, and applications in public-key cryptography andsecret-key cryptography are discussed, including problems and solutionsat the end of each chapter. Three appendices cover the Gilbertbound and some related derivations, a derivation of the Mac-Williams' identities based on the probability of undetected error,and two important tools for algebraic decoding-namely, the finitefield Fourier transform and the Euclidean algorithm for polynomials.

  18. Spectroscopy of the Heaviest Elements

    Science.gov (United States)

    Clark, Roderick

    2009-10-01

    The specific ``magic'' proton and neutron numbers, representing major spherical shell gaps, beyond 208Pb are a matter of considerable debate. It is well established that nuclei near Z=100, N=152 (252Fm) have well-deformed prolate shapes. By performing prompt and delayed gamma-ray spectroscopy on deformed transfermium nuclei we can learn about the single-particle structure, shell gaps, pairing correlations, and excitation modes in the heaviest nuclei. After a brief overview of state-of-the-art measurements, I will describe recent results from experiments at the 88-Inch Cyclotron of the Lawrence Berkeley National Laboratory which use the Berkeley Gas-filled Separator (BGS). I will then discuss the prospects of a new generation of spectroscopy measurements on the heaviest elements when the BGS is used in conjunction with the GRETINA gamma--ray tracking array.

  19. Thermionic fuel element technology status

    Science.gov (United States)

    Holland, J. W.; Horner, M. W.; Yang, L.

    1985-01-01

    The results of research, conducted between the mid-1960s and 1973, on the multiconverter thermionic fuel elements (TFEs) that comprise the reactor core of an SP-100 thermionic reactor system are presented. Fueled-emitter technology, insulator technology and cell and TFE assembly technology of the prototypical TFEs which were tested in-pile and out-of-pile during these years are described. The proto-TFEs have demonstrated reproducible performance within 5 percent and no premature failures within the 1.5 yr of operation (with projected 3-yr lifetimes). The two primary life-limiting factors had been identified as thermionic emitter dimensional increase due to interactions with the fuel and electrical insulator structural damage from fast neutrons. Multiple options for extending TFE lifetimes to 7 yr or longer are available and will be investigated in the 1984-1985 SP-100 program for resolution of critical technology issues. Design diagrams and test graphs are included.

  20. Remediation using trace element humate surfactant

    Energy Technology Data Exchange (ETDEWEB)

    Riddle, Catherine Lynn; Taylor, Steven Cheney; Bruhn, Debra Fox

    2016-08-30

    A method of remediation at a remediation site having one or more undesirable conditions in which one or more soil characteristics, preferably soil pH and/or elemental concentrations, are measured at a remediation site. A trace element humate surfactant composition is prepared comprising a humate solution, element solution and at least one surfactant. The prepared trace element humate surfactant composition is then dispensed onto the remediation site whereby the trace element humate surfactant composition will reduce the amount of undesirable compounds by promoting growth of native species activity. By promoting native species activity, remediation occurs quickly and environmental impact is minimal.

  1. A New Geochemical Classification of Elements

    Institute of Scientific and Technical Information of China (English)

    Qi Changmou; L. Lynn Chyi

    2001-01-01

    The geochemical classification proposed by Goldschmidt was based on meteoritic analysis and elemental partition in blast furnace. There are many surprises when applied to the discussion of natural occurrences. A modified classification of elements based on basic chemical properties and their occurrences. A modified classification of elements based on basic chemical properties and their occurrences in nature is, therefore, proposed for students learning geochemistry and geologists working in the field. Elements are classified into six groups including lithophile, oxyphile, siderophile, chalcophile, biophile, and atmophile elements. Five terms are taken from Goldshcmidt's original classification. Oxyphile is a new term.

  2. Transition elements based on transfinite interpolation

    Science.gov (United States)

    Odabas, Onur R.; Sarigul-Klijn, Nesrin

    1993-01-01

    In this study the transfinite interpolation methodology, a 'blending-function' method in particular, is utilized for the formulation of transition elements. The method offers a formal way of meeting continuity requirements in a transition element. Element shape functions are derived by blending the continuity requirements of individual boundary segments. The blending directions are naturally orthogonal in rectangular domains therefore interpolation of the boundaries over rectangular 2D and 3D elements can be performed with minimal effort. In triangular domains, however, the choice of blending directions and interpolants is not straightforward. For that reason, two interpolation techniques are proposed for blending of the boundaries of triangular domains. A series of transition elements of various classes compatible with elements of different orders and dimensions is developed and the full potential of the transfinite interpolation, as it applies to element formulation, is explored.

  3. Rare earth elements: end use and recyclability

    Science.gov (United States)

    Goonan, Thomas G.

    2011-01-01

    Rare earth elements are used in mature markets (such as catalysts, glassmaking, lighting, and metallurgy), which account for 59 percent of the total worldwide consumption of rare earth elements, and in newer, high-growth markets (such as battery alloys, ceramics, and permanent magnets), which account for 41 percent of the total worldwide consumption of rare earth elements. In mature market segments, lanthanum and cerium constitute about 80 percent of rare earth elements used, and in new market segments, dysprosium, neodymium, and praseodymium account for about 85 percent of rare earth elements used. Regardless of the end use, rare earth elements are not recycled in large quantities, but could be if recycling became mandated or very high prices of rare earth elements made recycling feasible.

  4. Regulation of human clotting factor IX cDNA expression in transgenic mice

    Institute of Scientific and Technical Information of China (English)

    胡以平; 邱信芳; 薛京伦; 刘祖洞

    1995-01-01

    To study the expression of human dotting factor IX cDNA in transgenic mice,Which is an es-sential work on gene therapy for hemophilia B,3 recombinant constructions containing different lengths ofhuman dotting factor IX cDNA have been introduced into the cultured cells.All of the recombinant constructionswere found to he expressed well in vitro.They were then microinjected into the male pronudei of the fertilizedmouse eggs respectively for generating trahsgenic mice.Unfortunately,none of them was expressed in any transgenicmice.These results show that the expression of the human clotting factor IX cDNA in the transgenic mice canbe determined by cis regulatory element(s).As compared With the results from other related works,it is sug-gested that the cis regulatory element(s)is resided in the 5’-end non-coding region.

  5. A NOVEL ELLIPSOIDAL ACOUSTIC INFINITE ELEMENT

    Institute of Scientific and Technical Information of China (English)

    YANG Rui-liang; WANG Hong-zhen

    2005-01-01

    A novel ellipsoidal acoustic infinite element is proposed. It is based a new pressure representation, which can describe and solve the ellipsoidal acoustic field more exactly. The shape functions of this novel acoustic infinite element are similar .to the Burnett's method, while the weight functions are defined as the product of the complex conjugates of the shaped functions and an additional weighting factor. The code of this method is cheap to generate as for 1-D element because only 1-D integral needs to be numerical. Coupling with the standard finite element, this method provides a capability for very efficiently modeling acoustic fields surrounding structures of virtually any practical shape. This novel method was deduced in brief and the conclusion was kept in detail. To test the feasibility of this novel method efficiently, in the examples the infinite elements were considered, excluding the finite elements relative. This novel ellipsoidal acoustic infinite element can deduce the analytic solution of an oscillating sphere. The example of a prolate spheroid shows that the novel infinite element is superior to the boundary element and other acoustic infinite elements. Analytical and numerical results of these examples show that this novel method is feasible.

  6. Interstitial Functionalization in elemental Si

    Science.gov (United States)

    Kiefer, Boris; Fohtung, Edwin

    Societies in the 21st century will face many challenges. Materials science and materials design will be essential to address and master some if not all of these challenges. Semiconductors are among the most important technological material classes. Properties such as electrical transport are strongly affected by defects and a central goal continues to be the reduction of defect densities as much as possible in these compounds. Here we present results of interstitial Fe doping in elemental Si using first-principles DFT calculations. The preliminary results show that Fe will only occupy octahedral interstitial sites. The analysis of the electronic structure shows that the compounds are ferromagnetic and that a bandgap opens as interstitial Fe concentrations decrease, with a possible intermittent semi-metallic phase. The formation energy for interstitial Fe is unfavorable, as expected, by ~1.5 eV but becomes favorable as the chemical potential of Fe increases. Therefore, we expect that biasing the system with an external electrical field will lead to the formation of these materials. Thus, our results show that interstitial defects can be beneficial for the design of functionalities that differ significantly from those of the host material.

  7. Functional Metamirrors Using Bianisotropic Elements

    Science.gov (United States)

    Asadchy, V. S.; Ra'di, Y.; Vehmas, J.; Tretyakov, S. A.

    2015-03-01

    Conventional mirrors obey the simple reflection law that a plane wave is reflected as a plane wave, at the same angle. To engineer spatial distributions of fields reflected from a mirror, one can either shape the reflector or position some phase-correcting elements on top of a mirror surface. Here we show, both theoretically and experimentally, that full-power reflection with general control over the reflected wave phase is possible with a single-layer array of deeply subwavelength inclusions. These proposed artificial surfaces, metamirrors, provide various functions of shaped or nonuniform reflectors without utilizing any mirror. This can be achieved only if the forward and backward scattering of the inclusions in the array can be engineered independently, and we prove that it is possible using electrically and magnetically polarizable inclusions. The proposed subwavelength inclusions possess desired reflecting properties at the operational frequency band, while at other frequencies the array is practically transparent. The metamirror concept leads to a variety of applications over the entire electromagnetic spectrum, such as optically transparent focusing antennas for satellites, multifrequency reflector antennas for radio astronomy, low-profile conformal antennas for telecommunications, and nanoreflectarray antennas for integrated optics.

  8. Recycling of Rare Earth Elements

    Science.gov (United States)

    Lorenz, Tom; Bertau, Martin

    2017-01-01

    Any development of an effective process for rare earth (RE) recycling has become more and more challenging, especially in recent years. Since 2011, when commodity prices of REs had met their all-time maximum, prices have dropped rapidly by more than 90 %. An economic process able to offset these fluctuations has to take unconventional methods into account beside well-known strategies like acid/basic leaching or solvent extraction. The solid-state chlorination provides such an unconventional method for mobilizing RE elements from waste streams. Instead of hydrochloric acid this kind of chlorination decomposes NH4Cl thermally to release up to 400 °C hot HCl gas. After cooling the resulting solid metal chlorides may be easily dissolved in pH-adjusted water. Without producing strongly acidic wastes and with NH4Cl as cheap source for hydrogen chloride, solid-state chlorination provides various advantages in terms of costs and disposal. In the course of the SepSELSA project this method was examined, adjusted and optimized for RE recycling from fluorescent lamp scraps as well as Fe14Nd2B magnets. Thereby many surprising influences and trends required various analytic methods to examine the reasons and special mechanisms behind them.

  9. Trace Element Management in Rice

    Directory of Open Access Journals (Sweden)

    Abin Sebastian

    2015-08-01

    Full Text Available Trace elements (TEs are vital for the operation of metabolic pathways that promote growth and structural integrity. Paddy soils are often prone to TE limitation due to intensive cultivation and irrigation practices. Apart from this, rice paddies are potentially contaminated with transition metals such as Cd, which are often referred to as toxic TEs. Deficiency of TEs in the soil not only delays plant growth but also causes exposure of plant roots to toxic TEs. Fine-tuning of nutrient cycling in the rice field is a practical solution to cope with TEs deficiency. Adjustment of soil physicochemical properties, biological process such as microbial activities, and fertilization helps to control TEs mobilization in soil. Modifications in root architecture, metal transporters activity, and physiological processes are also promising approaches to enhance TEs accumulation in grains. Through genetic manipulation, these modifications help to increase TE mining capacity of rice plants as well as transport and trafficking of TEs into the grains. The present review summarizes that regulation of TE mobilization in soil, and the genetic improvement of TE acquisition traits help to boost essential TE content in rice grain.

  10. High resolution mapping of Twist to DNA in Drosophila embryos: Efficient functional analysis and evolutionary conservation

    OpenAIRE

    Ozdemir, Anil; Fisher-Aylor, Katherine I.; Pepke, Shirley; Samanta, Manoj; Dunipace, Leslie; McCue, Kenneth; Zeng, Lucy; Ogawa, Nobuo; Wold, Barbara J; Stathopoulos, Angelike

    2011-01-01

    Cis-regulatory modules (CRMs) function by binding sequence specific transcription factors, but the relationship between in vivo physical binding and the regulatory capacity of factor-bound DNA elements remains uncertain. We investigate this relationship for the well-studied Twist factor in Drosophila melanogaster embryos by analyzing genome-wide factor occupancy and testing the functional significance of Twist occupied regions and motifs within regions. Twist ChIP-seq data efficiently identif...

  11. Integration of ATAC-seq and RNA-seq identifies human alpha cell and beta cell signature genes

    Directory of Open Access Journals (Sweden)

    Amanda M. Ackermann

    2016-03-01

    Conclusions: We have determined the genetic landscape of human α- and β-cells based on chromatin accessibility and transcript levels, which allowed for detection of novel α- and β-cell signature genes not previously known to be expressed in islets. Using fine-mapping of open chromatin, we have identified thousands of potential cis-regulatory elements that operate in an endocrine cell type-specific fashion.

  12. Composite structure of auxin response elements.

    Science.gov (United States)

    Ulmasov, T; Liu, Z B; Hagen, G; Guilfoyle, T J

    1995-10-01

    The auxin-responsive soybean GH3 gene promoter is composed of multiple auxin response elements (AuxREs), and each AuxRE contributes incrementally to the strong auxin inducibility to the promoter. Two independent AuxREs of 25 bp (D1) and 32 bp (D4) contain the sequence TGTCTC. Results presented here show that the TGTCTC element in D1 and D4 is required but not sufficient for auxin inducibility in carrot protoplast transient expression assays. Additional nucleotides upstream of TGTCTC are also required for auxin inducibility. These upstream sequences showed constitutive activity and no auxin inducibility when part or all of the TGTCTC element was mutated or deleted. In D1, the constitutive element overlaps the 5' portion of TGTCTC; in D4, the constitutive element is separated from TGTCTC. An 11-bp element in D1, CCTCGTGTCTC, conferred auxin inducibility to a minimal cauliflower mosaic virus 35S promoter in transgenic tobacco seedlings as well as in carrot protoplasts (i.e., transient expression assays). Both constitutive elements bound specifically to plant nuclear proteins, and the constitutive element in D1 bound to a recombinant soybean basic leucine zipper transcription factor with G-box specificity. To demonstrate further the composite nature of AuxREs and the ability of the TGTCTC element to confer auxin inducibility, we created a novel AuxRE by placing a yeast GAL4 DNA binding site adjacent to the TGTCTC element. Expression of a GAL4-c-Rel transactivator in the presence of this novel AuxRE resulted in auxin-inducible expression. Our results indicate that at least some AuxREs have a composite structure consisting of a constitutive element adjacent to a conserved TGTCTC element that confers auxin inducibility.

  13. Noncoding Elements: Evolution and Epigenetic Regulation

    KAUST Repository

    Seridi, Loqmane

    2016-03-09

    When the human genome project was completed, it revealed a surprising result. 98% of the genome did not code for protein of which more than 50% are repeats— later known as ”Junk DNA”. However, comparative genomics unveiled that many noncoding elements are evolutionarily constrained; thus luckily to have a role in genome stability and regulation. Though, their exact functions remained largely unknown. Several large international consortia such as the Functional Annotation of Mammalian Genomes (FANTOM) and the Encyclopedia of DNA Elements (ENCODE) were set to understand the structure and the regulation of the genome. Specifically, these endeavors aim to measure and reveal the transcribed components and functional elements of the genome. One of the most the striking findings of these efforts is that most of the genome is transcribed, including non-conserved noncoding elements and repeat elements. Specifically, we investigated the evolution and epigenetic properties of noncoding elements. 1. We compared genomes of evolutionarily distant species and showed the ubiquity of constrained noncoding elements in metazoa. 2. By integrating multi-omic data (such as transcriptome, nucleosome profiling, histone modifications), I conducted a comprehensive analysis of epigenetic properties (chromatin states) of conserved noncoding elements in insects. We showed that those elements have distinct and protective sequence features, undergo dynamic epigenetic regulation, and appear to be associated with the structural components of the chromatin, replication origins, and nuclear matrix. 3. I focused on the relationship between enhancers and repetitive elements. Using Cap Analysis of Gene Expression (CAGE) and RNASeq, I compiled a full catalog of active enhancers (a class of noncoding elements) during myogenesis of human primary cells of healthy donors and donors affected by Duchenne muscular dystrophy (DMD). Comparing the two time-courses, a significant change in the epigenetic

  14. Benchmarking the QUAD4/TRIA3 element

    Science.gov (United States)

    Pitrof, Stephen M.; Venkayya, Vipperla B.

    1993-01-01

    The QUAD4 and TRIA3 elements are the primary plate/shell elements in NASTRAN. These elements enable the user to analyze thin plate/shell structures for membrane, bending and shear phenomena. They are also very new elements in the NASTRAN library. These elements are extremely versatile and constitute a substantially enhanced analysis capability in NASTRAN. However, with the versatility comes the burden of understanding a myriad of modeling implications and their effect on accuracy and analysis quality. The validity of many aspects of these elements were established through a series of benchmark problem results and comparison with those available in the literature and obtained from other programs like MSC/NASTRAN and CSAR/NASTRAN. Never-the-less such a comparison is never complete because of the new and creative use of these elements in complex modeling situations. One of the important features of QUAD4 and TRIA3 elements is the offset capability which allows the midsurface of the plate to be noncoincident with the surface of the grid points. None of the previous elements, with the exception of bar (beam), has this capability. The offset capability played a crucial role in the design of QUAD4 and TRIA3 elements. It allowed modeling layered composites, laminated plates and sandwich plates with the metal and composite face sheets. Even though the basic implementation of the offset capability is found to be sound in the previous applications, there is some uncertainty in relatively simple applications. The main purpose of this paper is to test the integrity of the offset capability and provide guidelines for its effective use. For the purpose of simplicity, references in this paper to the QUAD4 element will also include the TRIA3 element.

  15. Quantum mechanics and elements of reality

    OpenAIRE

    Mohrhoff, Ulrich

    1999-01-01

    It is widely accepted that a Born probability of 1 is sufficient for the existence of a corresponding element of reality. Recently Vaidman has extended this idea to the ABL probabilities of the time-symmetrized version of quantum mechanics originated by Aharonov, Bergmann, and Lebowitz. Several authors have objected to Vaidman's time-symmetrized elements of reality without casting doubt on the widely accepted sufficiency condition for `ordinary' elements of reality. In this paper I show that ...

  16. DETERMINATION OF IMPURITY ELEMENTS IN ALUMINIUM

    Institute of Scientific and Technical Information of China (English)

    侯小琳; 张永保

    1994-01-01

    Twenty five impurity elements in aluminium applied as reactor material are determined.Titanium and nickel are determined with epithermal neutron activation analysis(NAA),magnesium and silicon by inductance coupling plasma emission spectra(ICP),other elements by thermal NAA.The fission coefficient of uranium is given by an experiment,the interferences of uranium to Ce,Nd,Mo,Zr,La,Sm are subtracted.The detection limits of these methods to all of impurity elements in aluminium are calculated.

  17. Domain decomposition methods for mortar finite elements

    Energy Technology Data Exchange (ETDEWEB)

    Widlund, O.

    1996-12-31

    In the last few years, domain decomposition methods, previously developed and tested for standard finite element methods and elliptic problems, have been extended and modified to work for mortar and other nonconforming finite element methods. A survey will be given of work carried out jointly with Yves Achdou, Mario Casarin, Maksymilian Dryja and Yvon Maday. Results on the p- and h-p-version finite elements will also be discussed.

  18. Superheavy Elements Challenge Experimental and Theoretical Chemistry

    CERN Document Server

    Zvára, I

    2003-01-01

    When reflecting on the story of superheavy elements, the an experimenter, acknowledges the role, which the predictions of nuclear and chemical theories have played in ongoing studies. Today, the problems of major interest for experimental chemistry are the studies of elements 112 and 114 including their chemical identification. Advanced quantum chemistry calculations of atoms and molecules would be of much help. First experiments with element 112 evidence that the metal is much more volatile and inert than mercury.

  19. The elements of life and medicines.

    Science.gov (United States)

    Chellan, Prinessa; Sadler, Peter J

    2015-03-13

    Which elements are essential for human life? Here we make an element-by-element journey through the periodic table and attempt to assess whether elements are essential or not, and if they are, whether there is a relevant code for them in the human genome. There are many difficulties such as the human biochemistry of several so-called essential elements is not well understood, and it is not clear how we should classify elements that are involved in the destruction of invading microorganisms, or elements which are essential for microorganisms with which we live in symbiosis. In general, genes do not code for the elements themselves, but for specific chemical species, i.e. for the element, its oxidation state, type and number of coordinated ligands, and the coordination geometry. Today, the biological periodic table is in a position somewhat similar to Mendeleev's chemical periodic table of 1869: there are gaps and we need to do more research to fill them. The periodic table also offers potential for novel therapeutic and diagnostic agents, based on not only essential elements, but also non-essential elements, and on radionuclides. Although the potential for inorganic chemistry in medicine was realized more than 2000 years ago, this area of research is still in its infancy. Future advances in the design of inorganic drugs require more knowledge of their mechanism of action, including target sites and metabolism. Temporal speciation of elements in their biological environments at the atomic level is a major challenge, for which new methods are urgently needed.

  20. Jucys-Murphy elements for partition algebras

    CERN Document Server

    Enyang, John

    2010-01-01

    An inductive formula is given for a family of elements which are shown to play a role in the partition algebras which is analogous to the part played by classical Jucys-Murphy elements in the symmetric group. Using Schur-Weyl duality it is shown that the aforementioned inductive definition is equivalent to the combinatorial definition given by Halverson and Ram for Jucys-Murphy elements of partition algebras. As a consequence of the inductive formula for Jucys-Murphy elements, a new presentation for partition algebras in terms of certain involutions is also derived.

  1. Unified Framework for Finite Element Assembly

    CERN Document Server

    Alnæs, Martin Sandve; Mardal, Kent-Andre; Skavhaug, Ola; Langtangen, Hans Petter; 10.1504/IJCSE.2009.029160

    2012-01-01

    At the heart of any finite element simulation is the assembly of matrices and vectors from discrete variational forms. We propose a general interface between problem-specific and general-purpose components of finite element programs. This interface is called Unified Form-assembly Code (UFC). A wide range of finite element problems is covered, including mixed finite elements and discontinuous Galerkin methods. We discuss how the UFC interface enables implementations of variational form evaluation to be independent of mesh and linear algebra components. UFC does not depend on any external libraries, and is released into the public domain.

  2. Photoshop Elements 8 After the Shoot

    CERN Document Server

    Fitzgerald, Mark

    2010-01-01

    A handy, full-color reference for using Photoshop Elements 8 while on the go. Photoshop Elements combines an easy-to-use set of features and enhancements with image editing power in an affordable program. The newest version—Photoshop Elements 8—features more online integration with products like the new Flash-based Web galleries. Featuring a convenient trim size that goes where you go, this portable guide is essential reading for Elements users and especially suited if you are a mobile user who wants to edit and post your digital photographs while on the go.: Serves as a portable reference for

  3. Trace Elements in Ovaries: Measurement and Physiology.

    Science.gov (United States)

    Ceko, Melanie J; O'Leary, Sean; Harris, Hugh H; Hummitzsch, Katja; Rodgers, Raymond J

    2016-04-01

    Traditionally, research in the field of trace element biology and human and animal health has largely depended on epidemiological methods to demonstrate involvement in biological processes. These studies were typically followed by trace element supplementation trials or attempts at identification of the biochemical pathways involved. With the discovery of biological molecules that contain the trace elements, such as matrix metalloproteinases containing zinc (Zn), cytochrome P450 enzymes containing iron (Fe), and selenoproteins containing selenium (Se), much of the current research focuses on these molecules, and, hence, only indirectly on trace elements themselves. This review focuses largely on two synchrotron-based x-ray techniques: X-ray absorption spectroscopy and x-ray fluorescence imaging that can be used to identify the in situ speciation and distribution of trace elements in tissues, using our recent studies of bovine ovaries, where the distribution of Fe, Se, Zn, and bromine were determined. It also discusses the value of other techniques, such as inductively coupled plasma mass spectrometry, used to garner information about the concentrations and elemental state of the trace elements. These applications to measure trace elemental distributions in bovine ovaries at high resolutions provide new insights into possible roles for trace elements in the ovary.

  4. EDITORIAL: King of the elements? King of the elements?

    Science.gov (United States)

    Demming, Anna

    2010-07-01

    Throughout the history of science, carbon-based research has played a defining role in the development of a range of fundamental and technological fields. It was used in Avagadro's definition of the mole in the early 18th century, it provides the 'backbone' of molecules in organic compounds, and in the environmental debate currently raging in the press and international government discussions, the 'carbon footprint' has become the metric of our species' impact on our planet. Also in nanotechnology, with the discovery of various wonder materials, carbon is once again asserting its claim as king of the elements. Until the 1980s the only known forms of carbon were diamond, graphite and amorphous carbon, as in soot or charcoal. In 1985 Robert Curl, Harold Kroto and Richard Smalley reported the existence of fullerenes, spherical structures comprising hexagonal carbon rings [1], work for which they won the Nobel Prize for Chemistry in 1996 [2]. The discovery of fullerenes was followed in 1991 by Sumio Ijima with the discovery of rolled graphite sheets, the carbon nanotube [3]. The discovery of these novel carbon nanostructures inspired researchers in a range of fields, largely as a result of the extraordinary capacity for investigations of these structures to reveal ever more intriguing properties. One of the fascinating properties attributed to carbon nanotubes is their phenomenal strength, with a Young's modulus of single walled carbon nanotubes approaching a terapascal [4]. Ingenious methods of harnessing this strength have since been developed, including bucky paper, a term used to refer to a mat of randomly self-entangled carbon nanotubes. Steven Crannford and Markus Buehler have recently reported a novel computational technique for probing the mechanical properties of these structures and show that the Young's modulus of bucky paper can be tuned by manipulation of the carbon nanotube type and density [5]. The electrical properties of carbon nanotubes, which depend

  5. Transvection and silencing of the Scr homeotic gene of Drosophila melanogaster.

    Science.gov (United States)

    Southworth, Jeffrey W; Kennison, James A

    2002-06-01

    The Sex combs reduced (Scr) gene specifies the identities of the labial and first thoracic segments in Drosophila melanogaster. In imaginal cells, some Scr mutations allow cis-regulatory elements on one chromosome to stimulate expression of the promoter on the homolog, a phenomenon that was named transvection by Ed Lewis in 1954. Transvection at the Scr gene is blocked by rearrangements that disrupt pairing, but is zeste independent. Silencing of the Scr gene in the second and third thoracic segments, which requires the Polycomb group proteins, is disrupted by most chromosomal aberrations within the Scr gene. Some chromosomal aberrations completely derepress Scr even in the presence of normal levels of all Polycomb group proteins. On the basis of the pattern of chromosomal aberrations that disrupt Scr gene silencing, we propose a model in which two cis-regulatory elements interact to stabilize silencing of any promoter or cis-regulatory element physically between them. This model also explains the anomalous behavior of the Scx allele of the flanking homeotic gene, Antennapedia. This allele, which is associated with an insertion near the Antennapedia P1 promoter, inactivates the Antennapedia P1 and P2 promoters in cis and derepresses the Scr promoters both in cis and on the homologous chromosome.

  6. Just-in-time elements and benefits

    CERN Document Server

    García-Alcaraz, Jorge Luis

    2016-01-01

    This book reports the elements required for implementing Just in Time (JIT) technique in companies. The main reasons for low implementation processes and the main benefits from the successful implementation of them are highlighted in this book. Structural equation models are presented to help identify the essential elements in JIT.

  7. Protein export elements from Lactococcus lactis

    NARCIS (Netherlands)

    Perez-Martinez, Gaspar; Kok, Jan; Venema, Gerhardus; Dijl, Jan Maarten van; Smith, Hilda; Bron, Sierd

    1992-01-01

    Broad-host-range plasmids carrying α-amylase or β-lactamase reporter genes lacking a signal sequence were used to select export elements from Lactococcus lactis chromosomal DNA that could function as signal sequences. Fragments containing such elements were identified by their ability to direct the

  8. Trace elements in animal production systems

    NARCIS (Netherlands)

    Schlegel, P.; Durosoy, S.; Jongbloed, A.W.

    2008-01-01

    This book deals with trace elements, such as cobalt, copper, iron, manganese, selenium and zinc which are essential to modern animal nutrition, but are increasingly detrimental to soil and water quality in today's globalized production. The goal in finding a sustainable balance between trace element

  9. Micromagnetic simulations of semielliptical permalloy elements

    Energy Technology Data Exchange (ETDEWEB)

    Waifalkar, P.P.; Patil, P.S. [Thin Film Materials Laboratory, Department of Physics, Shivaji University, Kolhapur 416004, Maharashtra (India); Patil, P.B., E-mail: prashantphy@gmail.com [Department of Physics, The New College, Kolhapur 416012, Maharashtra (India)

    2014-09-01

    Magnetic spin configuration of patterned semielliptical permalloy elements useful for transportation of biofunctionlized magnetic particles was investigated by micromagnetic simulations. A demagnetized state at zero field shows a stable vortex state around the center. Application of 100 Oe field along a short axis of semiellipse was found to be sufficient to completely saturate the element along the field direction.

  10. Reference: ELEMENT1GMLBC3 [PLACE

    Lifescience Database Archive (English)

    Full Text Available ELEMENT1GMLBC3 Jensen EO, Marcker KA, Schell J, de Bruijn J Interaction of a nodule... specific, trans-acting factor with distinct DNA elements in the soybean leghaemoglobin lbc3 5' upstream region EMBO J 7:1265-1271 (1988) ...

  11. Reference: ELEMENT2GMLBC3 [PLACE

    Lifescience Database Archive (English)

    Full Text Available ELEMENT2GMLBC3 Jensen EO, Marcker KA, Schell J, de Bruijn J Interaction of a nodule... specific, trans-acting factor with distinct DNA elements in the soybean leghaemoglobin lbc3 5' upstream region EMBO J 7:1265-1271 (1988) ...

  12. Enhanced patch test of finite element methods

    Institute of Scientific and Technical Information of China (English)

    CHEN; Wanji

    2006-01-01

    Theoretically, the constant stress patch test is not rigorous. Also, either the patch test of non-zero constant shear for Mindlin plate problem or non-zero strain gradient curvature of the microstructures cannot be performed. To improve the theory of the patch test, in this paper, based on the variational principle with relaxed continuity requirement of nonconforming element for homogeneous differential equations, the author proposed the individual element condition for passing the patch test and the convergence condition of the element: besides passing the patch test, the element function should include the rigid body modes and constant strain modes and satisfy the weak continuity condition, and no extra zero energy modes occur. Moreover, the author further established a variational principle with relaxed continuity requirement of nonconforming element for inhomogeneous differential equations, the enhanced patch test condition and the individual element condition. To assure the convergence of the element that should pass the enhanced patch test, the element function should include the rigid body modes and non-zero strain modes which satisfied the equilibrium equations, and no spurious zero energy modes occur and should satisfy new weak continuity condition. The theory of the enhanced patch test proposed in this paper can be applied to both homogeneous and inhomogeneous differential equations. Based on this theory, the patch test of the non-zero constant shear stress for Mindlin plate and the C0-1 patch test of the non-zero constant curvature for the couple stress/strain gradient theory were established.

  13. Non-linear finite element modeling

    DEFF Research Database (Denmark)

    Mikkelsen, Lars Pilgaard

    The note is written for courses in "Non-linear finite element method". The note has been used by the author teaching non-linear finite element modeling at Civil Engineering at Aalborg University, Computational Mechanics at Aalborg University Esbjerg, Structural Engineering at the University...... on the governing equations and methods of implementing....

  14. MODERATOR ELEMENTS FOR UNIFORM POWER NUCLEAR REACTOR

    Science.gov (United States)

    Balent, R.

    1963-03-12

    This patent describes a method of obtaining a flatter flux and more uniform power generation across the core of a nuclear reactor. The method comprises using moderator elements having differing moderating strength. The elements have an increasing amount of the better moderating material as a function of radial and/or axial distance from the reactor core center. (AEC)

  15. 42 CFR 56.203 - Project elements.

    Science.gov (United States)

    2010-10-01

    ... SERVICES Grants for Planning and Developing Migrant Health Centers § 56.203 Project elements. A project for... population, based on the assessment prepared pursuant to paragraph (b) of this section which indicates in... 42 Public Health 1 2010-10-01 2010-10-01 false Project elements. 56.203 Section 56.203...

  16. 42 CFR 51c.203 - Project elements.

    Science.gov (United States)

    2010-10-01

    ... SERVICES Grants for Planning and Developing Community Health Centers § 51c.203 Project elements. A project... fulfill the needs identified in the assessment prepared pursuant to paragraph (a) of this section and how... 42 Public Health 1 2010-10-01 2010-10-01 false Project elements. 51c.203 Section 51c.203...

  17. Quadrature representation of finite element variational forms

    DEFF Research Database (Denmark)

    Ølgaard, Kristian Breum; Wells, Garth N.

    2012-01-01

    This chapter addresses the conventional run-time quadrature approach for the numerical integration of local element tensors associated with finite element variational forms, and in particular automated optimizations that can be performed to reduce the number of floating point operations...

  18. Kazhdan-Lusztig polynomials of boolean elements

    CERN Document Server

    Mongelli, Pietro

    2011-01-01

    We give closed combinatorial product formulas for Kazhdan-Lusztig poynomials and their parabolic analogue of type q in the case of boolean elements, introduced in [M. Marietti, Boolean elements in Kazhdan-Lusztig theory, J. Algebra 295 (2006)], in Coxeter groups whose Coxeter graph is a tree.

  19. The forgotten Elements of Action Learning

    DEFF Research Database (Denmark)

    Nunez, Heilyn Camacho; Aguirre, María

    The aim of this article is to provide a discussion and description of some topics of action learning that are not so commonly discussed in the literature and that I have called ‘the forgotten elements of action learning’. Those elements are dealing with Revans’ moral, spiritual and ethical reflec...

  20. Why do probabilistic finite element analysis ?

    CERN Document Server

    Thacker, B H

    2008-01-01

    The intention of this book is to provide an introduction to performing probabilistic finite element analysis. As a short guideline, the objective is to inform the reader of the use, benefits and issues associated with performing probabilistic finite element analysis without excessive theory or mathematical detail.

  1. A method for making an alkaline element

    Energy Technology Data Exchange (ETDEWEB)

    Obi, F.; Takada, K.

    1983-05-11

    A mixture of asphalt with polybutene is applied to the contacting surfaces of the body top and the hermetically sealing stuffing. After assembly the element is heated to a temperature which exceeds the softening point of the mixture. The edge of the body is rolled in. The element has high reliability.

  2. Escherichia coli genome-wide promoter analysis: Identification of additional AtoC binding target elements

    Directory of Open Access Journals (Sweden)

    Kolisis Fragiskos N

    2011-05-01

    Full Text Available Abstract Background Studies on bacterial signal transduction systems have revealed complex networks of functional interactions, where the response regulators play a pivotal role. The AtoSC system of E. coli activates the expression of atoDAEB operon genes, and the subsequent catabolism of short-chain fatty acids, upon acetoacetate induction. Transcriptome and phenotypic analyses suggested that atoSC is also involved in several other cellular activities, although we have recently reported a palindromic repeat within the atoDAEB promoter as the single, cis-regulatory binding site of the AtoC response regulator. In this work, we used a computational approach to explore the presence of yet unidentified AtoC binding sites within other parts of the E. coli genome. Results Through the implementation of a computational de novo motif detection workflow, a set of candidate motifs was generated, representing putative AtoC binding targets within the E. coli genome. In order to assess the biological relevance of the motifs and to select for experimental validation of those sequences related robustly with distinct cellular functions, we implemented a novel approach that applies Gene Ontology Term Analysis to the motif hits and selected those that were qualified through this procedure. The computational results were validated using Chromatin Immunoprecipitation assays to assess the in vivo binding of AtoC to the predicted sites. This process verified twenty-two additional AtoC binding sites, located not only within intergenic regions, but also within gene-encoding sequences. Conclusions This study, by tracing a number of putative AtoC binding sites, has indicated an AtoC-related cross-regulatory function. This highlights the significance of computational genome-wide approaches in elucidating complex patterns of bacterial cell regulation.

  3. Multiple Herbicide Resistance in Lolium multiflorum and Identification of Conserved Regulatory Elements of Herbicide Resistance Genes.

    Science.gov (United States)

    Mahmood, Khalid; Mathiassen, Solvejg K; Kristensen, Michael; Kudsk, Per

    2016-01-01

    Herbicide resistance is a ubiquitous challenge to herbicide sustainability and a looming threat to control weeds in crops. Recently four genes were found constituently over-expressed in herbicide resistant individuals of Lolium rigidum, a close relative of Lolium multiflorum. These include two cytochrome P450s, one nitronate monooxygenase and one glycosyl-transferase. Higher expressions of these four herbicide metabolism related (HMR) genes were also observed after herbicides exposure in the gene expression databases, indicating them as reliable markers. In order to get an overview of herbicidal resistance status of L. multiflorum L, 19 field populations were collected. Among these populations, four populations were found to be resistant to acetolactate synthase (ALS) inhibitors while three exhibited resistance to acetyl-CoA carboxylase (ACCase) inhibitors in our initial screening and dose response study. The genotyping showed the presence of mutations Trp-574-Leu and Ile-2041-Asn in ALS and ACCase, respectively, and qPCR experiments revealed the enhanced expression of HMR genes in individuals of certain resistant populations. Moreover, co-expression networks and promoter analyses of HMR genes in O. sativa and A. thaliana resulted in the identification of a cis-regulatory motif and zinc finger transcription factors. The identified transcription factors were highly expressed similar to HMR genes in response to xenobiotics whereas the identified motif is known to play a vital role in coping with environmental stresses and maintaining genome stability. Overall, our findings provide an important step forward toward a better understanding of metabolism-based herbicide resistance that can be utilized to devise novel strategies of weed management.

  4. Multiple Herbicide Resistance in Lolium multiflorum and Identification of Conserved Regulatory Elements of Herbicide Resistance Genes

    Science.gov (United States)

    Mahmood, Khalid; Mathiassen, Solvejg K.; Kristensen, Michael; Kudsk, Per

    2016-01-01

    Herbicide resistance is a ubiquitous challenge to herbicide sustainability and a looming threat to control weeds in crops. Recently four genes were found constituently over-expressed in herbicide resistant individuals of Lolium rigidum, a close relative of Lolium multiflorum. These include two cytochrome P450s, one nitronate monooxygenase and one glycosyl-transferase. Higher expressions of these four herbicide metabolism related (HMR) genes were also observed after herbicides exposure in the gene expression databases, indicating them as reliable markers. In order to get an overview of herbicidal resistance status of L. multiflorum L, 19 field populations were collected. Among these populations, four populations were found to be resistant to acetolactate synthase (ALS) inhibitors while three exhibited resistance to acetyl-CoA carboxylase (ACCase) inhibitors in our initial screening and dose response study. The genotyping showed the presence of mutations Trp-574-Leu and Ile-2041-Asn in ALS and ACCase, respectively, and qPCR experiments revealed the enhanced expression of HMR genes in individuals of certain resistant populations. Moreover, co-expression networks and promoter analyses of HMR genes in O. sativa and A. thaliana resulted in the identification of a cis-regulatory motif and zinc finger transcription factors. The identified transcription factors were highly expressed similar to HMR genes in response to xenobiotics whereas the identified motif is known to play a vital role in coping with environmental stresses and maintaining genome stability. Overall, our findings provide an important step forward toward a better understanding of metabolism-based herbicide resistance that can be utilized to devise novel strategies of weed management. PMID:27547209

  5. Multiple herbicide resistance in Lolium multiflorum and identification of conserved regulatory elements of herbicide resistance genes

    Directory of Open Access Journals (Sweden)

    Khalid Mahmood

    2016-08-01

    Full Text Available Herbicide resistance is a ubiquitous challenge to herbicide sustainability and a looming threat to control weeds in crops. Recently four genes were found constituently over-expressed in herbicide resistant individuals of Lolium rigidum, a close relative of L. multiflorum. These include two cytochrome P450s, one nitronate monooxygenase and one glycosyl-transferase. Higher expressions of these four herbicide metabolism related (HMR genes were also observed after herbicides exposure in the gene expression databases, indicating them a reliable marker. In order to get an overview of herbicidal resistance status of Lolium multiflorum L, 19 field populations were collected. Among these populations, four populations were found to be resistant to acetolactate synthase (ALS inhibitors while three exhibited resistance to acetyl-CoA carboxylase (ACCase inhibitors in our initial screening and dose response study. The genotyping showed the presence of mutations Trp-574-Leu and Ile-2041-Asn in ALS and ACCase, respectively and qPCR experiments revealed the enhanced expression of HMR genes in individuals of certain resistant populations. Moreover, co-expression networks and promoter analyses of HMR genes in O.sativa and A.thaliana resulted in the identification of a cis-regulatory motif and zinc finger transcription factors. The identified transcription factors were highly expressed similar to HMR genes in response to xenobiotics whereas the identified motif known to play a vital role in coping with environmental stresses and maintaining genome stability. Overall, our findings provide an important step forward towards a better understanding of metabolism-based herbicide resistance that can be utilized to devise novel strategies of weed management.

  6. Writing analytic element programs in Python.

    Science.gov (United States)

    Bakker, Mark; Kelson, Victor A

    2009-01-01

    The analytic element method is a mesh-free approach for modeling ground water flow at both the local and the regional scale. With the advent of the Python object-oriented programming language, it has become relatively easy to write analytic element programs. In this article, an introduction is given of the basic principles of the analytic element method and of the Python programming language. A simple, yet flexible, object-oriented design is presented for analytic element codes using multiple inheritance. New types of analytic elements may be added without the need for any changes in the existing part of the code. The presented code may be used to model flow to wells (with either a specified discharge or drawdown) and streams (with a specified head). The code may be extended by any hydrogeologist with a healthy appetite for writing computer code to solve more complicated ground water flow problems.

  7. An Improved Linear Tetrahedral Element for Plasticity

    Energy Technology Data Exchange (ETDEWEB)

    Puso, M

    2005-04-25

    A stabilized, nodally integrated linear tetrahedral is formulated and analyzed. It is well known that linear tetrahedral elements perform poorly in problems with plasticity, nearly incompressible materials, and acute bending. For a variety of reasons, linear tetrahedral elements are preferable to quadratic tetrahedral elements in most nonlinear problems. Whereas, mixed methods work well for linear hexahedral elements, they don't for linear tetrahedrals. On the other hand, automatic mesh generation is typically not feasible for building many 3D hexahedral meshes. A stabilized, nodally integrated linear tetrahedral is developed and shown to perform very well in problems with plasticity, nearly incompressible materials and acute bending. Furthermore, the formulation is analytically and numerically shown to be stable and optimally convergent. The element is demonstrated to perform well in several standard linear and nonlinear benchmarks.

  8. LOCKING-FREE DEGENERATED ISOPARAMETRIC SHELL ELEMENT

    Institute of Scientific and Technical Information of China (English)

    章向明; 王安稳; 何汉林

    2001-01-01

    An 8-noded locking-free degenerated isoparametric shell element is presented.A revised interpolation for shear strain terms was constructed in natural co-ordinate system such that all necessary modes ( translation, rotation and constant curvature ) are preserved,which can be used to eliminate shear locking. A revised interpolation for membrane strains was produced in the local Cartesian co-ordinate system to overcome membrane locking behavior. The new 8-noded element has the proper rank, with the requisite number of zero eigenvalues each associated with a rigid mode. The element does not exhibit membrane or shear locking for large span-thickness ratio. The element does not form element mechanisms or extra spurious zero energy modes. Therefore, it can be used for both thin and thick shells.

  9. Element 74, the Wolfram Versus Tungsten Controversy

    Energy Technology Data Exchange (ETDEWEB)

    Holden,N.E.

    2008-08-11

    Two and a quarter centuries ago, a heavy mineral ore was found which was thought to contain a new chemical element called heavy stone (or tungsten in Swedish). A few years later, the metal was separated from its oxide and the new element (Z=74) was called wolfram. Over the years since that time, both the names wolfram and tungsten were attached to this element in various countries. Sixty years ago, IUPAC chose wolfram as the official name for the element. A few years later, under pressure from the press in the USA, the alternative name tungsten was also allowed by IUPAC. Now the original, official name 'wolfram' has been deleted by IUPAC as one of the two alternate names for the element. The history of this controversy is described here.

  10. Rolling Element Bearing Stiffness Matrix Determination (Presentation)

    Energy Technology Data Exchange (ETDEWEB)

    Guo, Y.; Parker, R.

    2014-01-01

    Current theoretical bearing models differ in their stiffness estimates because of different model assumptions. In this study, a finite element/contact mechanics model is developed for rolling element bearings with the focus of obtaining accurate bearing stiffness for a wide range of bearing types and parameters. A combined surface integral and finite element method is used to solve for the contact mechanics between the rolling elements and races. This model captures the time-dependent characteristics of the bearing contact due to the orbital motion of the rolling elements. A numerical method is developed to determine the full bearing stiffness matrix corresponding to two radial, one axial, and two angular coordinates; the rotation about the shaft axis is free by design. This proposed stiffness determination method is validated against experiments in the literature and compared to existing analytical models and widely used advanced computational methods. The fully-populated stiffness matrix demonstrates the coupling between bearing radial, axial, and tilting bearing deflections.

  11. Pump element for a tube pump

    DEFF Research Database (Denmark)

    2011-01-01

    relative to the rod element so as to allow for a fluid flow in the tube through the first valve member, along the rod element, and through the second valve member. The tube comprises an at least partly flexible tube portion between the valve members such that a repeated deformation of the flexible tube...... portion acts to alternately close and open the valve members thereby generating a fluid flow through the tube. The invention further relates to a pump element comprising at least two non-return valve members connected by a rod element, and for insertion in an at least partly flexible tube in such tube...... pump as mentioned above, thereby acting to generate a fluid flow through the tube upon repeated deformation of the tube between the two valve members. The pump element may comprise a connecting part for coupling to another tube and may comprise a sealing part establishing a fluid tight connection...

  12. A new multiresolution finite element method based on a multiresolution quadrilateral plate element

    CERN Document Server

    Xia, YiMing

    2014-01-01

    A new multiresolution quadrilateral plate element is proposed and a multiresolution finite element method is hence presented. The multiresolution analysis (MRA) framework is formulated out of a mutually nesting displacement subspace sequence, whose basis functions are constructed of scaling and shifting on the element domain of basic node shape function. The basic node shape function is constructed by extending shape function around a specific node. The MRA endows the proposed element with the resolution level (RL) to adjust the element node number, thus modulating structural analysis accuracy accordingly. As a result, the traditional 4-node quadrilateral plate element and method is a monoresolution one and also a special case of the proposed element and method. The meshing for the monoresolution plate element model is based on the empiricism while the RL adjusting for the multiresolution is laid on the rigorous mathematical basis. The accuracy of a structural analysis is fully determined by the RL, not by th...

  13. A multiresolution finite element method based on a new locking-free rectangular Mindlin plate element

    CERN Document Server

    Xia, Yi-Ming

    2015-01-01

    A locking-free rectangular Mindlin plate element with a new multi-resolution analysis (MRA) is proposed and a multireolution finite element method is hence presented. The MRA framework is formulated out of a mutually nesting displacement subspace sequence. The MRA endows the proposed element with the resolution level (RL) to adjust the element node number, thus modulating structural analysis accuracy accordingly. As a result, the traditional 4-node rectangular Mindlin plate element and method is a mono-resolution one and also a special case of the proposed element and method. The meshing for the monoresolution plate element model is based on the empiricism while the RL adjusting for the multiresolution is laid on the rigorous mathematical basis. The accuracy of a structural analysis is actually determined by the RL, not by the mesh. The rational MRA enables the implementation of the multiresolution Mindlin plate element method to be more rational and efficient than that of the conventional monoresolution or o...

  14. Multi-Element Lean Direct Injection Combustor Single Element Demonstration Project

    Data.gov (United States)

    National Aeronautics and Space Administration — We propose to demonstrate the feasibility in a single element of a Multi-Element Lean Direct Injection, ME-LDI, Combustion concept. The concept will have the...

  15. Mobile genetic elements in protozoan parasites

    Indian Academy of Sciences (India)

    Sudha Bhattacharya; Abhijeet Bakre; Alok Bhattacharya

    2002-08-01

    Mobile genetic elements, by virtue of their ability to move to new chromosomal locations, are considered important in shaping the evolutionary course of the genome. They are widespread in the biological kingdom. Among the protozoan parasites several types of transposable elements are encountered. The largest variety is seen in the trypanosomatids—Trypanosoma brucei, Trypanosoma cruzi and Crithidia fasciculata. They contain elements that insert site-specifically in the spliced-leader RNA genes, and others that are dispersed in a variety of genomic locations. Giardia lamblia contains three families of transposable elements. Two of these are subtelomeric in location while one is chromosome-internal. Entamoeba histolytica has an abundant retrotransposon dispersed in the genome. Nucleotide sequence analysis of all the elements shows that they are all retrotransposons, and, with the exception of one class of elements in T. cruzi, all of them are non-long-terminal-repeat retrotransposons. Although most copies have accumulated mutations, they can potentially encode reverse transcriptase, endonuclease and nucleic-acid-binding activities. Functionally and phylogenetically they do not belong to a single lineage, showing that retrotransposons were acquired early in the evolution of protozoan parasites. Many of the potentially autonomous elements that encode their own transposition functions have nonautonomous counterparts that probably utilize the functions in trans. In this respect these elements are similar to the mammalian LINEs and SINEs (long and short interspersed DNA elements), showing a common theme in the evolution of retrotransposons. So far there is no report of a DNA transposon in any protozoan parasite. The genome projects that are under way for most of these organisms will help understand the evolution and possible function of these genetic elements.

  16. PRECONDITIONING HIGHER ORDER FINITE ELEMENT SYSTEMS BY ALGEBRAIC MULTIGRID METHOD OF LINEAR ELEMENTS

    Institute of Scientific and Technical Information of China (English)

    Yun-qing Huang; Shi Shu; Xi-jun Yu

    2006-01-01

    We present and analyze a robust preconditioned conjugate gradient method for the higher order Lagrangian finite element systems of a class of elliptic problems. An auxiliary linear element stiffness matrix is chosen to be the preconditioner for higher order finite elements. Then an algebraic multigrid method of linear finite element is applied for solving the preconditioner. The optimal condition number which is independent of the mesh size is obtained. Numerical experiments confirm the efficiency of the algorithm.

  17. A novel mammal-specific three partite enhancer element regulates node and notochord-specific Noto expression.

    Directory of Open Access Journals (Sweden)

    Leonie Alten

    Full Text Available The vertebrate organizer and notochord have conserved, essential functions for embryonic development and patterning. The restricted expression of developmental regulators in these tissues is directed by specific cis-regulatory modules (CRMs whose sequence conservation varies considerably. Some CRMs have been conserved throughout vertebrates and likely represent ancestral regulatory networks, while others have diverged beyond recognition but still function over a wide evolutionary range. Here we identify and characterize a mammalian-specific CRM required for node and notochord specific (NNC expression of NOTO, a transcription factor essential for node morphogenesis, nodal cilia movement and establishment of laterality in mouse. A 523 bp enhancer region (NOCE upstream the Noto promoter was necessary and sufficient for NNC expression from the endogenous Noto locus. Three subregions in NOCE together mediated full activity in vivo. Binding sites for known transcription factors in NOCE were functional in vitro but dispensable for NOCE activity in vivo. A FOXA2 site in combination with a novel motif was necessary for NOCE activity in vivo. Strikingly, syntenic regions in non-mammalian vertebrates showed no recognizable sequence similarities. In contrast to its activity in mouse NOCE did not drive NNC expression in transgenic fish. NOCE represents a novel, mammal-specific CRM required for the highly restricted Noto expression in the node and nascent notochord and thus regulates normal node development and function.

  18. The Connection between the Properties of Elements and Compounds; Mineralogical-Crystallochemical Classification of Elements

    OpenAIRE

    Godovikov, Alexander A.; Hariya, Yu

    1987-01-01

    The described mineralogical-crystallochemical classification bears some similar features with geochemical classification of elements. This similarity emphasizes a greater importance in conforming the vast practical data on petrology. The present classification also bears some resemblance to the technical classification of elements by Berg (1929). The similarity seems logical since the mineralogical. crystallochemical classification of elements unites them on the basis of crystallochemical sim...

  19. Analysis of bender element test interpretation using the discrete element method

    NARCIS (Netherlands)

    O’Donovan, J.; O’Sullivan, C.; Marketos, G.; Muir Wood, D.

    2015-01-01

    While bender element testing is now well-established as a laboratory technique to determine soil stiffness, a robust technique to interpret the data remains elusive. A discrete element method (DEM) model of a face-centred cubic packing of uniform spheres was created to simulate bender element tests

  20. Mortar Upwind Finite Volume Element Method with Crouzeix-Raviart Element for Parabolic Convection Diffusion Problems

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    In this paper, we study the semi-discrete mortar upwind finite volume element method with the Crouzeix-Raviart element for the parabolic convection diffusion problems.It is proved that the semi-discrete mortar upwind finite volume element approximations derived are convergent in the H1- and L2-norms.

  1. In Silico Expression Analysis.

    Science.gov (United States)

    Bolívar, Julio; Hehl, Reinhard; Bülow, Lorenz

    2016-01-01

    Information on the specificity of cis-sequences enables the design of functional synthetic plant promoters that are responsive to specific stresses. Potential cis-sequences may be experimentally tested, however, correlation of genomic sequence with gene expression data enables an in silico expression analysis approach to bioinformatically assess the stress specificity of candidate cis-sequences prior to experimental verification. The present chapter demonstrates an example for the in silico validation of a potential cis-regulatory sequence responsive to cold stress. The described online tool can be applied for the bioinformatic assessment of cis-sequences responsive to most abiotic and biotic stresses of plants. Furthermore, a method is presented based on a reverted in silico expression analysis approach that predicts highly specific potentially functional cis-regulatory elements for a given stress.

  2. Combining classifiers for robust PICO element detection

    Directory of Open Access Journals (Sweden)

    Grad Roland

    2010-05-01

    Full Text Available Abstract Background Formulating a clinical information need in terms of the four atomic parts which are Population/Problem, Intervention, Comparison and Outcome (known as PICO elements facilitates searching for a precise answer within a large medical citation database. However, using PICO defined items in the information retrieval process requires a search engine to be able to detect and index PICO elements in the collection in order for the system to retrieve relevant documents. Methods In this study, we tested multiple supervised classification algorithms and their combinations for detecting PICO elements within medical abstracts. Using the structural descriptors that are embedded in some medical abstracts, we have automatically gathered large training/testing data sets for each PICO element. Results Combining multiple classifiers using a weighted linear combination of their prediction scores achieves promising results with an f-measure score of 86.3% for P, 67% for I and 56.6% for O. Conclusions Our experiments on the identification of PICO elements showed that the task is very challenging. Nevertheless, the performance achieved by our identification method is competitive with previously published results and shows that this task can be achieved with a high accuracy for the P element but lower ones for I and O elements.

  3. Moving KML geometry elements within Google Earth

    Science.gov (United States)

    Zhu, Liang-feng; Wang, Xi-feng; Pan, Xin

    2014-11-01

    During the process of modeling and visualizing geospatial information on the Google Earth virtual globe, there is an increasing demand to carry out such operations as moving geospatial objects defined by KML geometry elements horizontally or vertically. Due to the absence of the functionality and user interface for performing the moving transformation, it is either hard or impossible to interactively move multiple geospatial objects only using the existing Google Earth desktop application, especially when the data sets are in large volume. In this paper, we present a general framework and associated implementation methods for moving multiple KML geometry elements within Google Earth. In our proposed framework, we first load KML objects into the Google Earth plug-in, and then extract KML geometry elements from the imported KML objects. Subsequently, we interactively control the movement distance along a specified orientation by employing a custom user interface, calculate the transformed geographic location for each KML geometry element, and adjust geographic coordinates of the points in each KML objects. And finally, transformed KML geometry elements can be displayed in Google Earth for 3D visualization and spatial analysis. A key advantage of the proposed framework is that it provides a simple, uniform and efficient user interface for moving multiple KML geometry elements within Google Earth. More importantly, the proposed framework and associated implementations can be conveniently integrated into other customizable Google Earth applications to support interactively visualizing and analyzing geospatial objects defined by KML geometry elements.

  4. The dynamic stiffness matrix of two-dimensional elements: application to Kirchhoff's plate continuous elements

    Science.gov (United States)

    Casimir, J. B.; Kevorkian, S.; Vinh, T.

    2005-10-01

    This paper describes a procedure for building the dynamic stiffness matrix of two-dimensional elements with free edge boundary conditions. The dynamic stiffness matrix is the basis of the continuous element method. Then, the formulation is used to build a Kirchhoff rectangular plate element. Gorman's method of boundary condition decomposition and Levy's series are used to obtain the strong solution of the elementary problem. A symbolic computation software partially performs the construction of the dynamic stiffness matrix from this solution. The performances of the element are evaluated from comparisons with harmonic responses of plates obtained by the finite element method.

  5. APPLICATION OF SUB-ELEMENT AND MICRO-ELEMENT IN BEM WITH ROLLER BEARING LOAD

    Institute of Scientific and Technical Information of China (English)

    Shu Xuedao; Xing Xidong

    2004-01-01

    Aiming at the discontinuous traction on contact elements of roller bearing, new concepts of sub- and micro-element are put forward. In the sub-element and micro-element, traction influence coefficient has been modified, which is calculated by the former boundary element method (BEM) with roller bearing load. Hence, three-dimensional distribution of load on roller bearing is calculated accurately. In practice, it has been proved that this method has higher calculation accuracy. An effective numerical method is offered for analyzing load characteristics of roller bearing to improve service longevity of roller bearing and operation efficiency of rolling mill.

  6. Environmental monitoring for some transuranium elements

    Energy Technology Data Exchange (ETDEWEB)

    Sedlet, J.; Golchert, N.W.

    1977-01-01

    Knowledge of contemporary environmental levels of transuranium elements is necessary as baseline information if the future impact of nuclear fuel plants and power reactors is to be evaluated. The chemical behavior of these elements at low concentrations in the environment is also important in hazard prediction. This paper describes methods for the analysis of environmental materials for several transuranium elements and summarizes the results for the past several years. In some cases comparison with natural uranium and thorium was useful, and their concentrations were also determined.

  7. Mineral elements in milk and dairy products

    Directory of Open Access Journals (Sweden)

    Šimun Zamberlin

    2012-06-01

    Full Text Available Mineral elements occur in milk and dairy products as inorganic ions and salts, as well as part of organic molecules, such as proteins, fats, carbohydrates and nucleic acids. The chemical form of mineral elements is important because it determines their absorption in the intestine and their biological utilization. The mineral composition of milk is not constant because it depends on lactation phase, nutritional status of the animal, and environmental and genetic factors. The objective of this research is to point out the research results of chemical form, content and nutritional importance of individual mineral elements that are present in various milks and dairy products.

  8. On Hybrid and mixed finite element methods

    Science.gov (United States)

    Pian, T. H. H.

    1981-01-01

    Three versions of the assumed stress hybrid model in finite element methods and the corresponding variational principles for the formulation are presented. Examples of rank deficiency for stiffness matrices by the hybrid stress model are given and their corresponding kinematic deformation modes are identified. A discussion of the derivation of general semi-Loof elements for plates and shells by the hybrid stress method is given. It is shown that the equilibrium model by Fraeijs de Veubeke can be derived by the approach of the hybrid stress model as a special case of semi-Loof elements.

  9. Error computation for adaptive finite element analysis

    CERN Document Server

    Khan, A A; Memon, I R; Ming, X Y

    2002-01-01

    The paper gives a simple numerical procedure for computations of errors generated by the discretisation process of finite element method. The procedure given is based on the ZZ error estimator which is believed to be reasonable accurate and thus can be readily implemented in any existing finite element codes. The devised procedure not only estimates the global energy norm error but also evaluates the local errors in individual elements. In the example, the given procedure is combined with an adaptive refinement procedure, which provides guidance for optimal mesh designing and allows the user to obtain a desired accuracy with a limited number of interaction. (author)

  10. Photoshop Elements 5 The Missing Manual

    CERN Document Server

    Brundage, Barbara

    2006-01-01

    Anyone still think that Adobe Photoshop Elements is a toy version of the real thing? As the most popular photo-editing program on the market, Photoshop Elements not only has Photoshop's marvelous powers, but also has capabilities the mothership lacks. Each new version includes more tools designed specifically for today's consumer digital photo enthusiasts. The latest edition, Photoshop Elements 5, solidifies the reputation of this superb and inexpensive product with new scrapbook features, a link to online photo services, and many other improvements. In fact, there's so much to Photoshop Ele

  11. The extraction behaviors of transuranic elements

    Energy Technology Data Exchange (ETDEWEB)

    Byeon, Kee Hoh; Lee, Eil Hee; Kwon, Seon Gil; Kim, Kwang Wook; Yang, Han Beom; Chung, Dong Yong; Lim, Jae Kwan; Shin, Hyun Kyoo; Kim, Soo Ho

    1999-10-01

    We have studied the distribution data between organic and aqueous phases and the related reaction data in the state of extraction equilibrium for neptunium, americium and curium of transuranic elements, and also studied the chemical properties for these chemical elements. In the results of study, distribution coefficients of transuranic elements such as Np(IV), Np(V), Np(VI) Am(III), CM(III) and the redox reactions of neptunium were rearranged numerically with the data in the published literatures. (author)

  12. The ENCODE (ENCyclopedia Of DNA Elements) Project.

    Science.gov (United States)

    2004-10-22

    The ENCyclopedia Of DNA Elements (ENCODE) Project aims to identify all functional elements in the human genome sequence. The pilot phase of the Project is focused on a specified 30 megabases (approximately 1%) of the human genome sequence and is organized as an international consortium of computational and laboratory-based scientists working to develop and apply high-throughput approaches for detecting all sequence elements that confer biological function. The results of this pilot phase will guide future efforts to analyze the entire human genome.

  13. Finite Element Computational Dynamics of Rotating Systems

    Directory of Open Access Journals (Sweden)

    Jaroslav Mackerle

    1999-01-01

    Full Text Available This bibliography lists references to papers, conference proceedings and theses/dissertations dealing with finite element analysis of rotor dynamics problems that were published in 1994–1998. It contains 319 citations. Also included, as separate subsections, are finite element analyses of rotor elements – discs, shafts, spindles, and blades. Topics dealing with fracture mechanics, contact and stability problems of rotating machinery are also considered in specific sections. The last part of the bibliography presents papers dealing with specific industrial applications.

  14. Will Finite Elements Replace Structural Mechanics?

    Science.gov (United States)

    Ojalvo, I. U.

    1984-01-01

    This paper presents a personal view regarding the need for a continued interest and activity in structural methods in general, while viewing finite elements and the computer as simply two specific tools for assisting in this endeavor. An attempt is made to provide some insight as to why finite element methods seem to have "won the war," and to give examples of their more (and less) intelligent use. Items addressed include a highlight of unnecessary limitations of many existing standard finite element codes and where it is felt that further development work is needed.

  15. Finite Dynamic Elements and Modal Analysis

    Directory of Open Access Journals (Sweden)

    N.J. Fergusson

    1993-01-01

    Full Text Available A general modal analysis scheme is derived for forced response that makes use of high accuracy modes computed by the dynamic element method. The new procedure differs from the usual modal analysis in that the modes are obtained from a power series expansion for the dynamic stiffness matrix that includes an extra dynamic correction term in addition to the static stiffness matrix and the consistent mass matrix based on static displacement. A cantilevered beam example is used to demonstrate the relative accuracies of the dynamic element and the traditional finite element methods.

  16. Photoshop Elements 10 The Missing Manual

    CERN Document Server

    Brundage, Barbara

    2011-01-01

    Elements 10 offers much of Photoshop's power without the huge price tag. It's a great tool for most image-editing buffs-whether you're a photographer, scrapbooker, or aspiring graphic artist. But Elements still doesn't come with a useful manual. This bestselling book helps you get the most out of the program, from the basics to advanced tips for both Windows and Mac users. The important stuff you need to know: Quickly learn your way around. Customize Elements to suit your working style.Get to work right away. Import, organize, and make quick image fixes with ease.Retouch any image. Learn how

  17. Finite element analysis of optical waveguides

    Science.gov (United States)

    Mabaya, N.; Lagasse, P. E.; Vandenbulcke, P.

    1981-06-01

    Several finite element programs for the computation of the guided modes of optical waveguides are presented. The advantages and limitations of a very general program for the analysis of anisotropic guides are presented. A possible solution to the problem of the spurious numerical modes, encountered when calculating higher order modes, is proposed. For isotropic waveguides, it is shown that both EH- and HE-type modes can be very accurately approximated by two different scalar finite element programs. Finally, a boundary perturbation method is outlined that makes it possible to calculate the attenuation coefficient of leaky modes in single material guides, starting from a finite element calculation.

  18. Unconscious emotional effects of packaging design elements

    DEFF Research Database (Denmark)

    Liao, Lewis; Corsi, Armando; Lockshin, Larry;

    This research investigates consumers’ unconscious emotional responses to packaging elements such as image, colour and font. The intensity and valence of the emotional response, in reaction to these packaging elements, is established by the use of skin conductance tests and facial electromyography...... on a convenience sample of 120 participants. The results suggest that image is the only element able to generate a significant effect on consumers’ unconscious emotional response. In addition, the results also suggest the interaction between image and colour has a significant effect on consumers’ unconscious...

  19. 模糊Prime元%Fuzzy Prime Elements

    Institute of Scientific and Technical Information of China (English)

    饶三平

    2012-01-01

    基于完备剩余格,本文在模糊完备格中,引入模糊Prime元概念.给出了模糊Prime元的等价刻画,证明了所有的模糊Prime元构成的模糊集是模糊完全分配格.%Based on complete residuated lattices, the concept of fuzzy Prime elements in fuzzy complete lattices is given, then the equivalent characterization of fuzzy Prime elements is obtained. We also prove that the fuzzy subsets of fuzzy Prime elements is a fuzzy completely distributice lattice.

  20. Studying Extrachromosomal Genetic Elements in Sulfolobus

    DEFF Research Database (Denmark)

    Guannan, Liu

    facilitated the characterization of viruses, plasmids and membrane vesicles. Studying the interactions between Sulfolobus and extrachromosomal genetic elements has provided many new insights into basic molecular processes. Secreted membrane vesicle seems to be a common characteristic for Sulfolobus. In order...... of random chromosomal fragments, including IS elements. The results suggest that membrane vesicles could serve as vehicles for the inter-cellular transport of genetic material. A variant of ATV, ATV2, was isolated that infected a newly isolated Sulfolobus solfataricus P3 strain. Comparative genomics......, whereas the deactivation of pKEF9 in S. solfataricus was caused by mobile elements after it had integrated into the host genome....

  1. Electrical machine analysis using finite elements

    CERN Document Server

    Bianchi, Nicola

    2005-01-01

    OUTLINE OF ELECTROMAGNETIC FIELDSVector AnalysisElectromagnetic FieldsFundamental Equations SummaryReferencesBASIC PRINCIPLES OF FINITE ELEMENT METHODSIntroductionField Problems with Boundary ConditionsClassical Method for the Field Problem SolutionThe Classical Residual Method (Galerkin's Method)The Classical Variational Method (Rayleigh-Ritz's Method)The Finite Element MethodReferencesAPPLICATIONS OF THE FINITE ELEMENT METHOD TO TWO-DIMENSIONAL FIELDSIntroductionLinear Interpolation of the Function fApplication of the Variational MethodSimple Descriptions of Electromagnetic FieldsAppendix: I

  2. The Superheavy Elements and Anti-Gravity

    Science.gov (United States)

    Anastasovski, Petar K.

    2004-02-01

    The essence of any propulsion concept is to overcome gravity. Anti-gravity is a natural means to achieve this. Thus, the technology to pursue anti-gravity, by using superheavy elements, may provide a new propulsion paradigm. The theory of superluminal relativity provides a hypothesis for existence of elements with atomic number up to Z = 145, some of which may possess anti-gravity properties. Analysis results show that curved space-time exists demonstrating both gravitic and anti-gravitic properties not only around nuclei but inside the nuclei as well. Two groups of elements (Z Hawking, in honour of Stephen W. Hawking.

  3. Photoshop Elements 9 the missing manual

    CERN Document Server

    Brundage, Barbara

    2010-01-01

    Elements 9 offers much of Photoshop's power without the huge price tag. It's an ideal tool for most image-editing buffs -- including scrapbookers, photographers, and aspiring graphic artists. But Elements still doesn't come with a decent manual. This bestselling book will help you get the most out of the program, from the basics to advanced tips for both Windows and Mac. Quickly learn your way around. Customize Elements to suit your working style.Get to work right away. Import, organize, and make quick image fixes with ease.Retouch any image. Learn how to repair and restore your old and damag

  4. MRT fuel element inspection at Dounreay

    Energy Technology Data Exchange (ETDEWEB)

    Gibson, J.

    1997-08-01

    To ensure that their production and inspection processes are performed in an acceptable manner, ie. auditable and traceable, the MTR Fuel Element Fabrication Plant at Dounreay operates to a documented quality system. This quality system, together with the fuel element manufacturing and inspection operations, has been independently certified to ISO9002-1987, EN29002-1987 and BS5750:Pt2:1987 by Lloyd`s Register Quality Assurance Limited (LRQA). This certification also provides dual accreditation to the relevant German, Dutch and Australian certification bodies. This paper briefly describes the quality system, together with the various inspection stages involved in the manufacture of MTR fuel elements at Dounreay.

  5. Superconvergence of tricubic block finite elements

    Institute of Scientific and Technical Information of China (English)

    2009-01-01

    In this paper, we first introduce interpolation operator of projection type in three dimen- sions, from which we derive weak estimates for tricubic block finite elements. Then using the estimate for the W 2, 1-seminorm of the discrete derivative Green’s function and the weak estimates, we show that the tricubic block finite element solution uh and the tricubic interpolant of projection type Πh3u have superclose gradient in the pointwise sense of the L∞-norm. Finally, this supercloseness is applied to superconvergence analysis, and the global superconvergence of the finite element approximation is derived.

  6. Human Exploration Telerobotics (HET2): Astrobee Element

    Data.gov (United States)

    National Aeronautics and Space Administration — The HET2 Astrobee Element will focus on developing a new free-flying robot suitable for performing IVA work on the International Space Station (ISS). The new robot...

  7. Diffractive Optical Elements for Dynamic Optical Coupling

    Institute of Scientific and Technical Information of China (English)

    Changhe Zhou; Xin Zhao; Liren Liu

    2003-01-01

    Diffractive optical elements such as the complementary Dammann gratings are incorporated for dynamic optical fiber splitting and combining. Experimental results of 1′8 dynamic optical couplings are presented.

  8. Diffractive Optical Elements for Dynamic Optical Coupling

    Institute of Scientific and Technical Information of China (English)

    2003-01-01

    Diffractive optical elements such as the complementary Dammann gratings are incorporated for dynamic optical fiber splitting and combining. Experimental results of 1×8 dynamic optical couplings are presented.

  9. A survey of mixed finite element methods

    Science.gov (United States)

    Brezzi, F.

    1987-01-01

    This paper is an introduction to and an overview of mixed finite element methods. It discusses the mixed formulation of certain basic problems in elasticity and hydrodynamics. It also discusses special techniques for solving the discrete problem.

  10. Experimental Finite Element Approach for Stress Analysis

    Directory of Open Access Journals (Sweden)

    Ahmet Erklig

    2014-01-01

    Full Text Available This study aims to determining the strain gauge location points in the problems of stress concentration, and it includes both experimental and numerical results. Strain gauges were proposed to be positioned to corresponding locations on beam and blocks to related node of elements of finite element models. Linear and nonlinear cases were studied. Cantilever beam problem was selected as the linear case to approve the approach and conforming contact problem was selected as the nonlinear case. An identical mesh structure was prepared for the finite element and the experimental models. The finite element analysis was carried out with ANSYS. It was shown that the results of the experimental and the numerical studies were in good agreement.

  11. Nuclear Thermal Rocket Element Environmental Simulator (NTREES)

    Science.gov (United States)

    Schoenfeld, Michael

    2009-01-01

    A detailed description of the Nuclear Thermal Rocket Element Environmental Simulator (NTREES) is presented. The contents include: 1) Design Requirements; 2) NTREES Layout; 3) Data Acquisition and Control System Schematics; 4) NTREES System Schematic; and 5) NTREES Setup.

  12. Finite-Element Software for Conceptual Design

    DEFF Research Database (Denmark)

    Lindemann, J.; Sandberg, G.; Damkilde, Lars

    2010-01-01

    Using finite-element analysis in conceptual design and teaching has quite different software requirements to that in engineering and research. In teaching and conceptual design the focus is on speed, interactivity and ease of use, whereas accuracy and precision are needed in engineering...... and research. Forcepad is an effort to provide a conceptual design and teaching tool in a finite-element software package. Forcepad is a two-dimensional finite-element application based on the same conceptual model as image editing applications such as Adobe Photoshop or Microsoft Paint. Instead of using...... geometric modelling with polygons, curves and lines, modelling is accomplished by ‘painting' with pixels with varying stiffness properties. This makes the learning curve for finite-element analysis much shallower and also makes it available for a much wider audience. The software has been used with great...

  13. Elemental tracers for Chinese source dust

    Institute of Scientific and Technical Information of China (English)

    张小曳; 张光宇; 朱光华; 张德二; 安芷生; 陈拓; 黄湘萍

    1996-01-01

    The mass-particle size distributions of 10 dust-carrying elements in aerosol particles were determined tor 12 sites in desert regions of northern China. The desert dust is proved to he of origin of eolian loess deposited on the Loess Plateau. Their transport to the loess was mainly attributable to the non-dust storm processes under the interglacial climate condition. The impact ot" dust storm on the accumulation of the loess increased in the glacial stage. On the basis of the signatures of 4 dust elements (Al. Fe, Mg and Sc). Chinese dust is believed to have 3 major desert sources (northwestern deserts, northern high dust deserts and northern low dust deserts). With a chemical element balance model, an elemental tracer system is established to proportion the export of China-source dust.

  14. Trace element geochemistry of CR chondrite metal

    CERN Document Server

    Jacquet, Emmanuel; Alard, Olivier; Kearsley, Anton T; Gounelle, Matthieu

    2015-01-01

    We report trace element analyses by laser ablation inductively coupled plasma mass spectrometry of metal grains from 9 different CR chondrites, distinguishing grains from chondrule interior ("interior grains"), chondrule surficial shells ("margin grains") and the matrix ("isolated grains"). Save for a few anomalous grains, Ni-normalized trace element patterns are similar for all three petrographical settings, with largely unfractionated refractory siderophile elements and depleted volatile Au, Cu, Ag, S. All types of grains are interpreted to derive from a common precursor approximated by the least melted, fine-grained objects in CR chondrites. This also excludes recondensation of metal vapor as the origin of the bulk of margin grains. The metal precursors presumably formed by incomplete condensation, with evidence for high-temperature isolation of refractory platinum-group-element (PGE)-rich condensates before mixing with lower temperature PGE-depleted condensates. The rounded shape of the Ni-rich, interior ...

  15. Interaction Between Flow Elements in Large Enclosures

    DEFF Research Database (Denmark)

    Heiselberg, Per

    In this paper experiments in a scale model are used as a first attempt to investigate how different flow elements such as supply air jets, thermal plumes and free convection flows interact with each other in a large enclosure, if the path of each individual flow element changes and if this influe......In this paper experiments in a scale model are used as a first attempt to investigate how different flow elements such as supply air jets, thermal plumes and free convection flows interact with each other in a large enclosure, if the path of each individual flow element changes...... and if this influences the overall air flow pattern in the enclosure. The main emphasis has been put on the pathways of chilled free air jets and whether the convective flows from both distributed and concentrated heat sources affect the pathway of the jet and the air flow pattern in the enclosure as a function...

  16. Finite element methods a practical guide

    CERN Document Server

    Whiteley, Jonathan

    2017-01-01

    This book presents practical applications of the finite element method to general differential equations. The underlying strategy of deriving the finite element solution is introduced using linear ordinary differential equations, thus allowing the basic concepts of the finite element solution to be introduced without being obscured by the additional mathematical detail required when applying this technique to partial differential equations. The author generalizes the presented approach to partial differential equations which include nonlinearities. The book also includes variations of the finite element method such as different classes of meshes and basic functions. Practical application of the theory is emphasised, with development of all concepts leading ultimately to a description of their computational implementation illustrated using Matlab functions. The target audience primarily comprises applied researchers and practitioners in engineering, but the book may also be beneficial for graduate students.

  17. Elements with Square Roots in Finite Groups

    Institute of Scientific and Technical Information of China (English)

    M.S. Lucido; M.R. Pournaki

    2005-01-01

    In this paper, we study the probability that a randomly chosen element in a finite group has a square root, in particular the simple groups of Lie type of rank 1, the sporadic finite simple groups and the alternating groups.

  18. Integrating Responsive Building Elements in Buildings

    DEFF Research Database (Denmark)

    Haase, Matthias; Amato, Alex; Heiselberg, Per

    2006-01-01

    There is a global need for a more sustainable building development. About 50% of energy is used in buildings indicating that buildings provide a considerable potential for operational energy savings. Studies were conducted with the following objectives: to perform a state-of-the-art review...... energy strategies to develop guidelines and procedures for estimation of environmental performance of responsive building elements and integrated building concepts This paper introduces the ideas of this collaborative work and discusses its usefulness for Hong Kong and China. Special focus was put...... of responsive building elements, of integrated building concepts and of environmental performance assessment methods to improve and optimize responsive building elements to develop and optimize new building concepts with integration of responsive building elements, HVAC-systems as well as natural and renewable...

  19. New Variational Formulations of Hybrid Stress Elements

    Science.gov (United States)

    Pian, T. H. H.; Sumihara, K.; Kang, D.

    1984-01-01

    In the variational formulations of finite elements by the Hu-Washizu and Hellinger-Reissner principles the stress equilibrium condition is maintained by the inclusion of internal displacements which function as the Lagrange multipliers for the constraints. These versions permit the use of natural coordinates and the relaxation of the equilibrium conditions and render considerable improvements in the assumed stress hybrid elements. These include the derivation of invariant hybrid elements which possess the ideal qualities such as minimum sensitivity to geometric distortions, minimum number of independent stress parameters, rank sufficient, and ability to represent constant strain states and bending moments. Another application is the formulation of semiLoof thin shell elements which can yield excellent results for many severe test cases because the rigid body nodes, the momentless membrane strains, and the inextensional bending modes are all represented.

  20. Conforming finite elements with embedded strong discontinuities

    NARCIS (Netherlands)

    Dias-da-Costa, D.; Alfaiate, J.; Sluys, L.J.; Areias, P.; Fernandes, C.; Julio, E.

    2012-01-01

    The possibility of embedding strong discontinuities into finite elements allowed the simulation of different problems, namely, brickwork masonry fracture, dynamic fracture, failure in finite strain problems and simulation of reinforcement concrete members. However, despite the significant contributi

  1. Influence of chemical elements on mammalian spermatozoa.

    Science.gov (United States)

    Marzec-Wróblewska, U; Kamiński, P; Lakota, P

    2012-01-01

    Exposure to heavy metals is the most important risk factor in the assessment of spermatogenesis. About 30-40 % cases of infertility are caused by the male factor, and most of them are due to the small quantity of spermatozoa or to inferior spermatozoa quality. The negative impact on sperm motility, morphology and concentration of such chemical elements as Al, Cr, Cd, Pb or Fe was observed, while positive influence was noticed for Zn, Mg, and Ca. The influence of Mn, Cu, Ni or Se on spermatozoa is ambiguous. Chemical elements known as necessary for capacitation and acrosome reaction are Zn, Mg and Ca, while Cd and Pb disturb initiation and progress of the acrosome reaction. The positive effect of chemical elements Al, Cd, Cr, Cu, Ni, Pb, Se, and Zn, lies in their protection against oxidative stress. On the other hand, Al, Cu and Ni induce structural changes in the testes and epididymis or influence interactions with other chemical elements.

  2. PLANE INFINITE ANALYTICAL ELEMENT AND HAMILTONIAN SYSTEM

    Institute of Scientific and Technical Information of China (English)

    孙雁; 周钢; 刘正兴

    2003-01-01

    It is not convenient to solve those engineering problems defined in an infinitefield by using FEM. An infinite area can be divided into a regular infinite external area anda finite internal area. The finite internal area was dealt with by the FEM and the regularinfinite external area was settled in a polar coordinate. All governing equations weretransformed into the Hamiltonian system. The methods of variable separation andeigenfunction expansion were used to derive the stiffness matrix of a new infinite analyticalelement. This new element, like a super finite element, can be combined with commonlyused finite elements. The proposed method was verified by numerical case studies. Theresults show that the preparation work is very simple, the infinite analytical element has ahigh precision, and it can be used conveniently. The method can also be easily extended to a three-dimensional problem.

  3. Comix, a New Matrix Element Generator

    Energy Technology Data Exchange (ETDEWEB)

    Gleisberg, Tanju; /SLAC; Hoche, Stefan; /Durham U., IPPP

    2008-09-03

    We present a new tree-level matrix element generator, based on the color dressed Berends-Giele recursive relations. We discuss two new algorithms for phase space integration, dedicated to be used with large multiplicities and color sampling.

  4. Comparative study of different Schlieren diffracting elements

    Indian Academy of Sciences (India)

    Raj Kumar; Sushil K Kaura; D P Chhachhia; D Mohan; A K Aggarwal

    2008-01-01

    This paper presents an analysis of diffraction effects taking place at different Schlieren diffracting elements. Two types of diffraction effects are prominent in the Schlieren schemes. One is diffraction of direct light (source image) at the Schlieren element, which limits the sensitivity and resolution of Schlieren systems. The second type is the diffraction of light deflected from the test object at the Schlieren-diffracting element. This second type of diffraction degrades the quality of Schlieren results. Experimental results showing the effect of diffraction of light deflected from the test object at a phase knife-edge, corner of a square phase aperture and an optical fiber tip as Schlieren diffracting elements have been presented and discussed.

  5. NEW RSW & Wall Fine Mixed Element Grid

    Data.gov (United States)

    National Aeronautics and Space Administration — RSW Fine Mixed Element Grid with viscous root wind tunnel wall. This grid is for a node-based unstructured solver. Quad Surface Faces= 38016 Tria Surface Faces=...

  6. NEW RSW & Wall Coarse Mixed Element Grid

    Data.gov (United States)

    National Aeronautics and Space Administration — This is the Coarse Mixed Element Grid for the RSW with a viscous wall at the root. This grid is for a node-based unstructured solver. Quad Surface Faces= 9728 Tria...

  7. NEW RSW & Wall Medium Mixed Element Grid

    Data.gov (United States)

    National Aeronautics and Space Administration — RSW Medium Mixed Element Grid with Viscous Wind Tunnel Wall at the root. This grid is for a node-based unstructured solver. Quad Surface Faces= 18432 Tria Surface...

  8. Surgery simulation using fast finite elements

    DEFF Research Database (Denmark)

    Bro-Nielsen, Morten

    1996-01-01

    This paper describes our recent work on real-time surgery simulation using fast finite element models of linear elasticity. In addition, we discuss various improvements in terms of speed and realism...

  9. Advanced finite element method in structural engineering

    CERN Document Server

    Long, Yu-Qiu; Long, Zhi-Fei

    2009-01-01

    This book systematically introduces the research work on the Finite Element Method completed over the past 25 years. Original theoretical achievements and their applications in the fields of structural engineering and computational mechanics are discussed.

  10. ANALYTICAL ELEMENT MODELING OF COASTAL AQUIFERS

    Science.gov (United States)

    Four topics were studied concerning the modeling of groundwater flow in coastal aquifers with analytic elements: (1) practical experience was obtained by constructing a groundwater model of the shallow aquifers below the Delmarva Peninsula USA using the commercial program MVAEM; ...

  11. Finite element analysis of tibial fractures

    DEFF Research Database (Denmark)

    Wong, Christian Nai En; Mikkelsen, Mikkel Peter W; Hansen, Leif Berner;

    2010-01-01

    of bony healing. The biomechanical results are the basis for fracture healing, biomechanical fall analysis and stability analysis of osteosynthesis. MATERIAL AND METHODS: A finite element model of the bony part of the lower leg was generated on the basis of computed tomography data from the Visible Human...... Project. The data consisted of 21,219 3D elements with a cortical shell and a trabecular core. Three types of load of torsion, a direct lateral load and axial compression were applied. RESULTS: The finite element linear static analysis resulted in relevant fracture localizations and indicated relevant......INTRODUCTION: Fractures of the tibial shaft are relatively common injuries. There are indications that tibial shaft fractures share characteristics in terms of site, type and local fracture mechanisms. In this study, we aimed to set up a mathematical, computer-based model using finite element...

  12. A method for making a dry element

    Energy Technology Data Exchange (ETDEWEB)

    Abe, T.; Isikhara, K.; Kimura, T.; Momose, K.; Sakata, Y.

    1983-08-11

    The agglomerate is coated along the lateral surface by a separator and is enclosed in a zinc cylinder which serves as the anode. A separating plate is installed in the upper part of the agglomerate between the agglomerate and the anode. A current outlead is attached to the anode. The element is inserted into a body, pressing the plate into the agglomerate with a punch which has a recess. A guide cylinder is used for precise installation of the element. The space between the plate and the body in the upper part of the element is filled with wax or another substance. Short circuiting (KZ) between the current outlead and the agglomerate is prevented in the element.

  13. Discovery announced of four new elements

    Science.gov (United States)

    Banks, Michael

    2016-02-01

    The International Union of Pure and Applied Chemistry (IUPAC) and the International Union of Pure and Applied Physics (IUPAP) have announced the discovery of four new elements: 113, 115, 117 and 118 - completing the periodic table's seventh row.

  14. The finite element method in electromagnetics

    CERN Document Server

    Jin, Jianming

    2014-01-01

    A new edition of the leading textbook on the finite element method, incorporating major advancements and further applications in the field of electromagnetics The finite element method (FEM) is a powerful simulation technique used to solve boundary-value problems in a variety of engineering circumstances. It has been widely used for analysis of electromagnetic fields in antennas, radar scattering, RF and microwave engineering, high-speed/high-frequency circuits, wireless communication, electromagnetic compatibility, photonics, remote sensing, biomedical engineering, and space exploration. The

  15. A NOTE ON FINITE ELEMENT WAVELETS

    Institute of Scientific and Technical Information of China (English)

    谌秋辉; 陈翰麟

    2001-01-01

    The refinability and approximation order of finite element multi-scale vector are discussed in [1]. But the coefficients in the conditions of approximation order of finite element multi-scale vector are incorrect there. The main purpose of this note is to make a correction of the error in the main result of [1]. These coefficients are very important for the properties of wavelets, such as vanishing moments and regularity.

  16. Trace elements in coals of eastern Donbas

    Energy Technology Data Exchange (ETDEWEB)

    Taranushich, F.F. [All Russian Research & Geological Prospecting Institute for Coal Deposits, Rostov Na Donu (Russian Federation)

    2003-02-01

    Peculiarities of trace element (TE) distribution in coals of the eastern Donets Basin (Donbas) are discussed. The correlation of TE distribution with specific features of the geological setting of the region can testify to the hydrothermal introduction of trace elements or their redistribution in fluid-active zones. The geochemical regionalization of eastern Donbas is based on TE distribution. Strontium-gold-base metal, tungsten, and selenium geochemical belts and a rare metal geochemical block are outlined.

  17. Predictions of synthesizing element 119 and 120

    Institute of Scientific and Technical Information of China (English)

    2011-01-01

    The evaporation residue cross sections of synthesizing superheavy nuclei Z=119, 120 are calculated by different sets of master equations with different dynamical variables. Two methods basically predicted similar results that the Ca induced hot fusion can 48 produce element 119 easier than produce 120, and the evaporation residue cross sections for 119 are detectable by current advanced techniques, while the evaporation residue cross sections are below 0.1 pb for producing element 120.

  18. Børnehaven De fire Elementer

    DEFF Research Database (Denmark)

    Sørensen, Hanne Værum

    I projektet undersøges og beskrives arbejdet i børnehaven De fire Elementer, med særligt fokus på kønsopdelingen fire formiddage om ugen.......I projektet undersøges og beskrives arbejdet i børnehaven De fire Elementer, med særligt fokus på kønsopdelingen fire formiddage om ugen....

  19. Molecular clusters of the main group elements

    CERN Document Server

    Driess, Matthias

    2008-01-01

    ""To summarize, Molecular Clusters of the Main Group Elements is certainly not a popular science book, nor is it a textbook; it is a very good, up-to-date collection of articles for the specialist. Als Fazit bleibt: Molecular Clusters of the Main Group Elements ist sicher kein populissenschaftliches Werk, auch kein Lehrbuch, aber eine gelungene, hoch aktuelle Zusammenstellung fen interessierten Fachmann."" -Michael Ruck, TU Dresden, Angewandte Chemie, 2004 - 116/36 + International Edition 2004 - 43/36

  20. Main: ELEMENT2GMLBC3 [PLACE

    Lifescience Database Archive (English)

    Full Text Available ELEMENT2GMLBC3 S000320 7-Sep-2000 (last modified) seki Element 2 found in the promo...ter of soybean (G.m.) leghaemoglobin lbc3 gene; Binding site of nuclear extract from soybean nodules; Locate...nt 2 is highly conserved in other soybean lb gene promoter regions; See S000319; nodule; leghaemoglobin; lbc3; root; Soybean (Glycine max) CTTAAATTATTTATTT ...

  1. Visual examinations of K west fuel elements

    Energy Technology Data Exchange (ETDEWEB)

    Pitner, A.L., Fluor Daniel Hanford

    1997-02-03

    Over 250 fuel assemblies stored in sealed canisters in the K West Basin were extracted and visually examined for damage. Substantial damage was expected based on high cesium levels previously measured in water samples taken from these canisters. About 11% of the inner elements and 45% of the outer elements were found to be failed in these examinations. Canisters that had cesium levels of I curie or more generally had multiple instances of major fuel damage.

  2. Elements and formulae of special relativity

    CERN Document Server

    Guggenheim, E A

    2013-01-01

    Elements and Formulae of Special Relativity presents elements and formulas of the theory of special relativity and covers topics ranging from kinematics and propagation of light to mechanics of single bodies, hydrodynamics, and thermodynamics. Vector operators, electromagnetic fields, electrodynamics, and statistical mechanics are also explored. This book is comprised of 13 chapters and begins by introducing the reader to the kinematics of special relativity, paying particular attention to formulas required for transformations between two frames of reference. Attention then turns to the propag

  3. Stretchable semiconductor elements and stretchable electrical circuits

    Science.gov (United States)

    Rogers, John A.; Khang, Dahl-Young; Menard, Etienne

    2009-07-07

    The invention provides methods and devices for fabricating printable semiconductor elements and assembling printable semiconductor elements onto substrate surfaces. Methods, devices and device components of the present invention are capable of generating a wide range of flexible electronic and optoelectronic devices and arrays of devices on substrates comprising polymeric materials. The present invention also provides stretchable semiconductor structures and stretchable electronic devices capable of good performance in stretched configurations.

  4. Finite element modeling of the human pelvis

    Energy Technology Data Exchange (ETDEWEB)

    Carlson, B.

    1995-11-01

    A finite element model of the human pelvis was created using a commercial wire frame image as a template. To test the final mesh, the model`s mechanical behavior was analyzed through finite element analysis and the results were displayed graphically as stress concentrations. In the future, this grid of the pelvis will be integrated with a full leg model and used in side-impact car collision simulations.

  5. How Cultural Elements Affect Business English Translation

    Institute of Scientific and Technical Information of China (English)

    路萱

    2008-01-01

    Transnational,cross -racial,cross -cultural exchanges are becoming increasingly extensive and frequent,and mutual contacts and commercial intercourse of different peoples show that cultural interchange and cultural integration,accompanied by economic integration,to some extent, have come to every aspect of life and to every participant. This article concentrates on the impact of cultural elements in business English translation while analyzing the relationship between cultural elements and translation in the Chinese perspective.

  6. Poole-frenkel piezoconductive element and sensor

    Science.gov (United States)

    Habermehl, Scott D.

    2004-08-03

    A new class of highly sensitive piezoconductive strain sensor elements and sensors has been invented. The new elements function under conditions such that electrical conductivity is dominated by Poole-Frenkel transport. A substantial piezoconductive effect appears in this regime, allowing the new sensors to exhibit sensitivity to applied strain as much as two orders of magnitude in excess of prior art sensors based on doped silicon.

  7. Transcriptional activity of transposable elements in coelacanth.

    Science.gov (United States)

    Forconi, Mariko; Chalopin, Domitille; Barucca, Marco; Biscotti, Maria Assunta; De Moro, Gianluca; Galiana, Delphine; Gerdol, Marco; Pallavicini, Alberto; Canapa, Adriana; Olmo, Ettore; Volff, Jean-Nicolas

    2014-09-01

    The morphological stasis of coelacanths has long suggested a slow evolutionary rate. General genomic stasis might also imply a decrease of transposable elements activity. To evaluate the potential activity of transposable elements (TEs) in "living fossil" species, transcriptomic data of Latimeria chalumnae and its Indonesian congener Latimeria menadoensis were compared through the RNA-sequencing mapping procedures in three different organs (liver, testis, and muscle). The analysis of coelacanth transcriptomes highlights a significant percentage of transcribed TEs in both species. Major contributors are LINE retrotransposons, especially from the CR1 family. Furthermore, some particular elements such as a LF-SINE and a LINE2 sequences seem to be more expressed than other elements. The amount of TEs expressed in testis suggests possible transposition burst in incoming generations. Moreover, significant amount of TEs in liver and muscle transcriptomes were also observed. Analyses of elements displaying marked organ-specific expression gave us the opportunity to highlight exaptation cases, that is, the recruitment of TEs as new cellular genes, but also to identify a new Latimeria-specific family of Short Interspersed Nuclear Elements called CoeG-SINEs. Overall, transcriptome results do not seem to be in line with a slow-evolving genome with poor TE activity.

  8. The Last Element of Mendeleev's Periodic Table

    Science.gov (United States)

    Khazan, Albert

    2010-02-01

    Despite much achievements of the synthesis for super-heavy elements (10 new elements were obtained during the last 25 years), the experts in Mendeleev's Periodic Table have not answered the most fundamental question: where the Table ends? The calculations produced on the basis of Quantum Mechanics (the physical conditions in micro-scales) do not not answer this question till now. In my study of chemical compounds, I focused onto the physical conditions observed in macro-scales (the subjects of the regular physics and chemistry). Thus, the Law of Hyperboles was discovered in the Periodic Table: given any chemical compound, the contents of any element in it (per 1 gram-atom), including the contents of unknown elements, whose atomic masses can be set up arbitrarily, is described by the equation of a equilateral hyperbola Y=K/X. The tops of all the arcs are distributed along a real axis crossing the line Y=1 in the point of abscissa 411.66, which manifests the actual atomic mass of the last (heaviest) element of the Periodic Table: its location is Period 8, Group 1; its atomic mass is 411.66, its number is 155 (Khazan A. Upper Limit in Mendeleev's Periodic Table --- Element No.155. Svenska fysikarkivet, 2009). )

  9. Macro-Elements and Trace Elements in Cereal Grains Cultivated in Latvia

    Directory of Open Access Journals (Sweden)

    Jākobsone Ida

    2015-09-01

    Full Text Available Cereal-based foods have great importance in the compensation of micro- and trace element deficiency, because 50% of the foods produced worldwide are made up of cereal grains. The aim of the research was to determine the concentration of macro-elements and trace elements in different cereals cultivated in Latvia. Various cereals were used in the research: rye (n = 45, barley (n = 54, spring wheat (n = 27, winter wheat (n = 53, triticale (n = 45 and oats (n = 42. Thirteen macro- and trace elements (Cd, Pb, Ni, Cr, Al, Cu, K, Na, Mn, Fe, Zn, Mg, Ca were determined in cereal grain samples (n = 266. Macro-elements and trace elements varied significantly (p < 0.01 or p < 0.001. The highest concentrations of macro- and trace elements were found in oats and the lowest in rye. The obtained data will expand the opportunity for food and nutrition scientists to evaluate content of the examined elements in grain products, and dietary consumption (bioavailability of the examined macro-elements and trace elements.

  10. Comparison of hexahedral and tetrahedral elements in finite element analysis of the foot and footwear.

    Science.gov (United States)

    Tadepalli, Srinivas C; Erdemir, Ahmet; Cavanagh, Peter R

    2011-08-11

    Finite element analysis has been widely used in the field of foot and footwear biomechanics to determine plantar pressures as well as stresses and strains within soft tissue and footwear materials. When dealing with anatomical structures such as the foot, hexahedral mesh generation accounts for most of the model development time due to geometric complexities imposed by branching and embedded structures. Tetrahedral meshing, which can be more easily automated, has been the approach of choice to date in foot and footwear biomechanics. Here we use the nonlinear finite element program Abaqus (Simulia, Providence, RI) to examine the advantages and disadvantages of tetrahedral and hexahedral elements under compression and shear loading, material incompressibility, and frictional contact conditions, which are commonly seen in foot and footwear biomechanics. This study demonstrated that for a range of simulation conditions, hybrid hexahedral elements (Abaqus C3D8H) consistently performed well while hybrid linear tetrahedral elements (Abaqus C3D4H) performed poorly. On the other hand, enhanced quadratic tetrahedral elements with improved stress visualization (Abaqus C3D10I) performed as well as the hybrid hexahedral elements in terms of contact pressure and contact shear stress predictions. Although the enhanced quadratic tetrahedral element simulations were computationally expensive compared to hexahedral element simulations in both barefoot and footwear conditions, the enhanced quadratic tetrahedral element formulation seems to be very promising for foot and footwear applications as a result of decreased labor and expedited model development, all related to facilitated mesh generation.

  11. A flat triangular shell element with Loof nodes

    DEFF Research Database (Denmark)

    Poulsen, Peter Noe; Damkilde, Lars

    1996-01-01

    In the formulation of flat shell elements it is difficult to achieve inter-element compatibility between membrane and transverse displacements for non-coplanar elements. Many elements lack proper nodal degrees of freedom to model intersections making the assembly of elements troublesome. A flat...... triangular shell element is established by a combination of a new plate bending element DKTL and the well-known linear membrane strain element LST, and for this element the above-mentioned deficiences are avoided. The plate bending element DKTL is based on Discrete Kirchhoff Theory and Loof nodes. The nodal...... configuration of the element is similar to the SemiLoof element, and the formulation is an improvement of a previous formulation. The element is used for both linear statics, linear buckling and geometrical non-linear analysis, and numerical examples are presented to show the robustness, accuracy and quick...

  12. A review of flexibility-based finite element method for beam-column elements

    Institute of Scientific and Technical Information of China (English)

    LI Shuang; ZHAI Changhai; XIE Lili

    2009-01-01

    For material nonlinear problem, elements derived with the flexibility-based method are more accurate than classical elements derived with the stiffness-based method. A review of the current state of the art of the flexibility-based finite element method is provided to enhance the robustness of structure analysis. The research on beam-column elements is the mainstream in the research on flexibility-based finite element method at present. The original development of flexibility-based finite element method is reviewed, and the further development of this method is then presented in several specific aspects, such as geometrically nonlinear analysis and dynamic analysis. The further research needed to be carried out in the future is finally discussed.

  13. COUPLING OF ASSUMED STRESS FINITE ELEMENT AND BOUNDARY ELEMENT METHODS WITH STRESS-TRACTION EQUILIBRIUM

    Institute of Scientific and Technical Information of China (English)

    GUZELBEY Ibrahim H.; KANBER Bahattin; AKPOLAT Abdullah

    2004-01-01

    In this study, the stress based finite element method is coupled with the boundary element method in two different ways. In the first one, the ordinary distribution matrix is used for coupling. In the second one, the stress traction equilibrium is used at the interface line of both regions as a new coupling process. This new coupling procedure is presented without a distribution matrix. Several case studies are solved for the validation of the developed coupling procedure. The results of case studies are compared with the distribution matrix coupling, displacement based finite element method, assumed stress finite element method, boundary element method, ANSYS and analytical results whenever possible. It is shown that the coupling of the stress traction equilibrium with assumed stress finite elements gives as accurate results as those by the distribution matrix coupling.

  14. A Family of Uniform Strain Tetrahedral Elements and a Method for Connecting Dissimilar Finite Element Meshes

    Energy Technology Data Exchange (ETDEWEB)

    Dohrmann, C.R.; Heinstein, M.W.; Jung, J.; Key, S.W.

    1999-01-01

    This report documents a collection of papers on a family of uniform strain tetrahedral finite elements and their connection to different element types. Also included in the report are two papers which address the general problem of connecting dissimilar meshes in two and three dimensions. Much of the work presented here was motivated by the development of the tetrahedral element described in the report "A Suitable Low-Order, Eight-Node Tetrahedral Finite Element For Solids," by S. W. Key {ital et al.}, SAND98-0756, March 1998. Two basic issues addressed by the papers are: (1) the performance of alternative tetrahedral elements with uniform strain and enhanced uniform strain formulations, and (2) the proper connection of tetrahedral and other element types when two meshes are "tied" together to represent a single continuous domain.

  15. Comparison of boundary element and finite element methods in spur gear root stress analysis

    Science.gov (United States)

    Sun, H.; Mavriplis, D.; Huston, R. L.; Oswald, F. B.

    1989-01-01

    The boundary element method (BEM) is used to compute fillet stress concentration in spur gear teeth. The results are shown to compare favorably with analogous results obtained using the finite element method (FEM). A partially supported thin rim gear is studied. The loading is applied at the pitch point. A three-dimensional analysis is conducted using both the BEM and FEM (NASTRAN). The results are also compared with those of a two-dimensional finite element model. An advantage of the BEM over the FEM is that fewer elements are needed with the BEM. Indeed, in the current study the BEM used 92 elements and 270 nodes whereas the FEM used 320 elements and 2037 nodes. Moreover, since the BEM is especially useful in problems with high stress gradients it is potentially a very useful tool for fillet stress analyses.

  16. Swedish Chemists and Discovery of the Elements

    Science.gov (United States)

    Thomsen, Volker

    1996-10-01

    All of the elements not already known from antiquity were discovered in Europe and North America. So which country ranks number one on the discovery list? The question occurred to me while leafing through reference 1 in search of thermodynamic data on silicon. Never having seen such a tabulation, I wondered if it might prove useful in teaching. The question has a sports-related flavor that will appeal to many students. Personally, I picked England or Germany for #1. The actual result is surprising. The ranking considering only up to atomic number 103 is as follows: Note: Where two or more independent discoveries have been made, each country is credited. In the "others" category Austria and Denmark each has two discoveries. The remaining countries, with one each, are Finland, Italy, Mexico, Poland, Romania, Russia, and Spain. The high place for the USA is primarily due to the work done at Berkeley and Los Alamos on the transuranics. Without these discoveries, the US would have tied with Switzerland at three elements. Perhaps the most interesting aspect of this tabulation is that Swedish chemists have discovered the most elements. Four chemists alone account for twelve of the 20 discoveries: Baron Jöns Jakob Berzelius (1779-1848) is credited with four elements. His pupil, friend, and assistant, Carl Gustav Mosander (1797-1858) discovered three. P. T. Cleve also found three elements and Karl Wilhelm Scheele (1742-1786) discovered two. Biographical research on the Swedish chemists is a suitable assignment at the introductory level. Reasons for the predominance of Swedish chemists presents a challenging student research topic in the history of chemistry. Another interesting question at the introductory level is, transuranics aside, who discovered the most elements? At the more advanced level the question becomes, why? Literature Cited: 1. Emsley, J. The Elements; Clarendon: Oxford, 1989.

  17. Superheavy Element Studies with TASCA at GSI: Spectroscopy of Element 115 Decay Chains

    Science.gov (United States)

    Rudolph, Dirk

    Experimental campaigns on investigations of the superheavy elements 115, 117, 119, and 120 were conducted 2011 and 2012 at the gas-filled "TransActinide Separator and Chemistry Apparatus" (TASCA) at the GSI Helmholtzzentrum für Schwerionenforschung, Darmstadt, Germany. Nuclear structure implications of first-ever α-photon coincidence spectroscopy on element 115 and its daughters obtained with the TASISpec set-up are discussed, likewise possible connections between decay chains associated with elements 115 and 117.

  18. NEW ALGORITHM OF COUPLING ELEMENT-FREE GALERKIN WITH FINITE ELEMENT METHOD

    Institute of Scientific and Technical Information of China (English)

    ZHAO Guang-ming; SONG Shun-cheng

    2005-01-01

    Through the construction of a new ramp function, the element-free Galerkin method and finite element coupling method were applied to the whole field, and was made fit for the structure of element nodes within the interface regions, both satisfying the essential boundary conditions and deploying meshless nodes and finite elements in a convenient and flexible way, which can meet the requirements of computation for complicated field. The comparison between the results of the present study and the corresponding analytical solutions shows this method is feasible and effective.

  19. Adaptive finite element-element-free Galerkin coupling method for bulk metal forming processes

    Institute of Scientific and Technical Information of China (English)

    Lei-chao LIU; Xiang-huai DONG; Cong-xin LI

    2009-01-01

    An adaptive finite element-element-free Galerkin (FE-EFG) coupling method is proposed and developed for the numerical simulation of bulk metal forming processes. This approach is able to adaptively convert distorted FE elements to EFG domain in analysis. A new scheme to implement adaptive conversion and coupling is presented. The coupling method takes both advantages of finite element method (FEM) and meshless methods. It is capable of handling large deformations with no need of remeshing procedures, while it is computationally more efficient than those full meshless methods. The effectiveness of the proposed method is demonstrated with the numerical simulations of the bulk metal forming processes including forging and extrusion.

  20. Biological toxicity of lanthanide elements on algae.

    Science.gov (United States)

    Tai, Peidong; Zhao, Qing; Su, Dan; Li, Peijun; Stagnitti, Frank

    2010-08-01

    The biological toxicity of lanthanides on marine monocellular algae was investigated. The specific objective of this research was to establish the relationship between the abundance in the seawater of lanthanides and their biological toxicities on marine monocellular algae. The results showed that all single lanthanides had similar toxic effects on Skeletonema costatum. High concentrations of lanthanides (29.04+/-0.61 micromol L(-1)) resulted in 50% reduction in growth of algae compared to the controls (0 micromol L(-1)) after 96 h (96 h-EC50). The biological toxicity of 13 lanthanides on marine monocellular algae was unrelated with the abundance of different lanthanide elements in nature, and the "Harkins rule" was not appropriate for the lanthanides. A mixed solution that contained equivalent concentrations of each lanthanide element had the same inhibition effect on algae cells as each individual lanthanide element at the same total concentration. This phenomenon is unique compared to the groups of other elements in the periodic table. Hence, we speculate that the monocellular organisms might not be able to sufficiently differentiate between the almost chemically identical lanthanide elements.