WorldWideScience

Sample records for cis-antisense gene pairs

  1. NCYM, a Cis-antisense gene of MYCN, encodes a de novo evolved protein that inhibits GSK3β resulting in the stabilization of MYCN in human neuroblastomas.

    Directory of Open Access Journals (Sweden)

    Yusuke Suenaga

    2014-01-01

    Full Text Available The rearrangement of pre-existing genes has long been thought of as the major mode of new gene generation. Recently, de novo gene birth from non-genic DNA was found to be an alternative mechanism to generate novel protein-coding genes. However, its functional role in human disease remains largely unknown. Here we show that NCYM, a cis-antisense gene of the MYCN oncogene, initially thought to be a large non-coding RNA, encodes a de novo evolved protein regulating the pathogenesis of human cancers, particularly neuroblastoma. The NCYM gene is evolutionally conserved only in the taxonomic group containing humans and chimpanzees. In primary human neuroblastomas, NCYM is 100% co-amplified and co-expressed with MYCN, and NCYM mRNA expression is associated with poor clinical outcome. MYCN directly transactivates both NCYM and MYCN mRNA, whereas NCYM stabilizes MYCN protein by inhibiting the activity of GSK3β, a kinase that promotes MYCN degradation. In contrast to MYCN transgenic mice, neuroblastomas in MYCN/NCYM double transgenic mice were frequently accompanied by distant metastases, behavior reminiscent of human neuroblastomas with MYCN amplification. The NCYM protein also interacts with GSK3β, thereby stabilizing the MYCN protein in the tumors of the MYCN/NCYM double transgenic mice. Thus, these results suggest that GSK3β inhibition by NCYM stabilizes the MYCN protein both in vitro and in vivo. Furthermore, the survival of MYCN transgenic mice bearing neuroblastoma was improved by treatment with NVP-BEZ235, a dual PI3K/mTOR inhibitor shown to destabilize MYCN via GSK3β activation. In contrast, tumors caused in MYCN/NCYM double transgenic mice showed chemo-resistance to the drug. Collectively, our results show that NCYM is the first de novo evolved protein known to act as an oncopromoting factor in human cancer, and suggest that de novo evolved proteins may functionally characterize human disease.

  2. Cis-Antisense Transcription Gives Rise to Tunable Genetic Switch Behavior: A Mathematical Modeling Approach.

    Science.gov (United States)

    Bordoy, Antoni E; Chatterjee, Anushree

    2015-01-01

    Antisense transcription has been extensively recognized as a regulatory mechanism for gene expression across all kingdoms of life. Despite the broad importance and extensive experimental determination of cis-antisense transcription, relatively little is known about its role in controlling cellular switching responses. Growing evidence suggests the presence of non-coding cis-antisense RNAs that regulate gene expression via antisense interaction. Recent studies also indicate the role of transcriptional interference in regulating expression of neighboring genes due to traffic of RNA polymerases from adjacent promoter regions. Previous models investigate these mechanisms independently, however, little is understood about how cells utilize coupling of these mechanisms in advantageous ways that could also be used to design novel synthetic genetic devices. Here, we present a mathematical modeling framework for antisense transcription that combines the effects of both transcriptional interference and cis-antisense regulation. We demonstrate the tunability of transcriptional interference through various parameters, and that coupling of transcriptional interference with cis-antisense RNA interaction gives rise to hypersensitive switches in expression of both antisense genes. When implementing additional positive and negative feed-back loops from proteins encoded by these genes, the system response acquires a bistable behavior. Our model shows that combining these multiple-levels of regulation allows fine-tuning of system parameters to give rise to a highly tunable output, ranging from a simple-first order response to biologically complex higher-order response such as tunable bistable switch. We identify important parameters affecting the cellular switch response in order to provide the design principles for tunable gene expression using antisense transcription. This presents an important insight into functional role of antisense transcription and its importance towards

  3. Evolution of closely linked gene pairs in vertebrate genomes

    NARCIS (Netherlands)

    Franck, E.; Hulsen, T.; Huynen, M.A.; Jong, de W.W.; Lunsen, N.H.; Madsen, O.

    2008-01-01

    The orientation of closely linked genes in mammalian genomes is not random: there are more head-to-head (h2h) gene pairs than expected. To understand the origin of this enrichment in h2h gene pairs, we have analyzed the phylogenetic distribution of gene pairs separated by less than 600 bp of interge

  4. Gene pair signatures in cell type transcriptomes reveal lineage control

    Science.gov (United States)

    Heinäniemi, Merja; Nykter, Matti; Kramer, Roger; Wienecke-Baldacchino, Anke; Sinkkonen, Lasse; Zhou, Joseph Xu; Kreisberg, Richard; Kauffman, Stuart A.; Huang, Sui; Shmulevich, Ilya

    2013-01-01

    The distinct cell types of multicellular organisms arise due to constraints imposed by gene regulatory networks on the collective change of gene expression across the genome, creating self-stabilizing expression states, or attractors. We compiled a resource of curated human expression data comprising 166 cell types and 2,602 transcription regulating genes and developed a data driven method built around the concept of expression reversal defined at the level of gene pairs, such as those participating in toggle switch circuits. This approach allows us to organize the cell types into their ontogenetic lineage-relationships and to reflect regulatory relationships among genes that explain their ability to function as determinants of cell fate. We show that this method identifies genes belonging to regulatory circuits that control neuronal fate, pluripotency and blood cell differentiation, thus offering a novel large-scale perspective on lineage specification. PMID:23603899

  5. Link-based quantitative methods to identify differentially coexpressed genes and gene Pairs

    Directory of Open Access Journals (Sweden)

    Ye Zhi-Qiang

    2011-08-01

    Full Text Available Abstract Background Differential coexpression analysis (DCEA is increasingly used for investigating the global transcriptional mechanisms underlying phenotypic changes. Current DCEA methods mostly adopt a gene connectivity-based strategy to estimate differential coexpression, which is characterized by comparing the numbers of gene neighbors in different coexpression networks. Although it simplifies the calculation, this strategy mixes up the identities of different coexpression neighbors of a gene, and fails to differentiate significant differential coexpression changes from those trivial ones. Especially, the correlation-reversal is easily missed although it probably indicates remarkable biological significance. Results We developed two link-based quantitative methods, DCp and DCe, to identify differentially coexpressed genes and gene pairs (links. Bearing the uniqueness of exploiting the quantitative coexpression change of each gene pair in the coexpression networks, both methods proved to be superior to currently popular methods in simulation studies. Re-mining of a publicly available type 2 diabetes (T2D expression dataset from the perspective of differential coexpression analysis led to additional discoveries than those from differential expression analysis. Conclusions This work pointed out the critical weakness of current popular DCEA methods, and proposed two link-based DCEA algorithms that will make contribution to the development of DCEA and help extend it to a broader spectrum.

  6. Aldehyde Dehydrogenase Gene Superfamily in Populus: Organization and Expression Divergence between Paralogous Gene Pairs.

    Directory of Open Access Journals (Sweden)

    Feng-Xia Tian

    Full Text Available Aldehyde dehydrogenases (ALDHs constitute a superfamily of NAD(P+-dependent enzymes that catalyze the irreversible oxidation of a wide range of reactive aldehydes to their corresponding nontoxic carboxylic acids. ALDHs have been studied in many organisms from bacteria to mammals; however, no systematic analyses incorporating genome organization, gene structure, expression profiles, and cis-acting elements have been conducted in the model tree species Populus trichocarpa thus far. In this study, a comprehensive analysis of the Populus ALDH gene superfamily was performed. A total of 26 Populus ALDH genes were found to be distributed across 12 chromosomes. Genomic organization analysis indicated that purifying selection may have played a pivotal role in the retention and maintenance of PtALDH gene families. The exon-intron organizations of PtALDHs were highly conserved within the same family, suggesting that the members of the same family also may have conserved functionalities. Microarray data and qRT-PCR analysis indicated that most PtALDHs had distinct tissue-specific expression patterns. The specificity of cis-acting elements in the promoter regions of the PtALDHs and the divergence of expression patterns between nine paralogous PtALDH gene pairs suggested that gene duplications may have freed the duplicate genes from the functional constraints. The expression levels of some ALDHs were up- or down-regulated by various abiotic stresses, implying that the products of these genes may be involved in the adaptation of Populus to abiotic stresses. Overall, the data obtained from our investigation contribute to a better understanding of the complexity of the Populus ALDH gene superfamily and provide insights into the function and evolution of ALDH gene families in vascular plants.

  7. A stochastic model for identifying differential gene pair co-expression patterns in prostate cancer progression

    Directory of Open Access Journals (Sweden)

    Mao Yu

    2009-07-01

    Full Text Available Abstract Background The identification of gene differential co-expression patterns between cancer stages is a newly developing method to reveal the underlying molecular mechanisms of carcinogenesis. Most researches of this subject lack an algorithm useful for performing a statistical significance assessment involving cancer progression. Lacking this specific algorithm is apparently absent in identifying precise gene pairs correlating to cancer progression. Results In this investigation we studied gene pair co-expression change by using a stochastic process model for approximating the underlying dynamic procedure of the co-expression change during cancer progression. Also, we presented a novel analytical method named 'Stochastic process model for Identifying differentially co-expressed Gene pair' (SIG method. This method has been applied to two well known prostate cancer data sets: hormone sensitive versus hormone resistant, and healthy versus cancerous. From these data sets, 428,582 gene pairs and 303,992 gene pairs were identified respectively. Afterwards, we used two different current statistical methods to the same data sets, which were developed to identify gene pair differential co-expression and did not consider cancer progression in algorithm. We then compared these results from three different perspectives: progression analysis, gene pair identification effectiveness analysis, and pathway enrichment analysis. Statistical methods were used to quantify the quality and performance of these different perspectives. They included: Re-identification Scale (RS and Progression Score (PS in progression analysis, True Positive Rate (TPR in gene pair analysis, and Pathway Enrichment Score (PES in pathway analysis. Our results show small values of RS and large values of PS, TPR, and PES; thus, suggesting that gene pairs identified by the SIG method are highly correlated with cancer progression, and highly enriched in disease-specific pathways. From

  8. Homologue Pairing in Flies and Mammals: Gene Regulation When Two Are Involved

    Directory of Open Access Journals (Sweden)

    Manasi S. Apte

    2012-01-01

    Full Text Available Chromosome pairing is usually discussed in the context of meiosis. Association of homologues in germ cells enables chromosome segregation and is necessary for fertility. A few organisms, such as flies, also pair their entire genomes in somatic cells. Most others, including mammals, display little homologue pairing outside of the germline. Experimental evidence from both flies and mammals suggests that communication between homologues contributes to normal genome regulation. This paper will contrast the role of pairing in transmitting information between homologues in flies and mammals. In mammals, somatic homologue pairing is tightly regulated, occurring at specific loci and in a developmentally regulated fashion. Inappropriate pairing, or loss of normal pairing, is associated with gene misregulation in some disease states. While homologue pairing in flies is capable of influencing gene expression, the significance of this for normal expression remains unknown. The sex chromosomes pose a particularly interesting situation, as females are able to pair X chromosomes, but males cannot. The contribution of homologue pairing to the biology of the X chromosome will also be discussed.

  9. Classification between normal and tumor tissues based on the pair-wise gene expression ratio

    Directory of Open Access Journals (Sweden)

    Wong YC

    2004-10-01

    Full Text Available Abstract Background Precise classification of cancer types is critically important for early cancer diagnosis and treatment. Numerous efforts have been made to use gene expression profiles to improve precision of tumor classification. However, reliable cancer-related signals are generally lacking. Method Using recent datasets on colon and prostate cancer, a data transformation procedure from single gene expression to pair-wise gene expression ratio is proposed. Making use of the internal consistency of each expression profiling dataset this transformation improves the signal to noise ratio of the dataset and uncovers new relevant cancer-related signals (features. The efficiency in using the transformed dataset to perform normal/tumor classification was investigated using feature partitioning with informative features (gene annotation as discriminating axes (single gene expression or pair-wise gene expression ratio. Classification results were compared to the original datasets for up to 10-feature model classifiers. Results 82 and 262 genes that have high correlation to tissue phenotype were selected from the colon and prostate datasets respectively. Remarkably, data transformation of the highly noisy expression data successfully led to lower the coefficient of variation (CV for the within-class samples as well as improved the correlation with tissue phenotypes. The transformed dataset exhibited lower CV when compared to that of single gene expression. In the colon cancer set, the minimum CV decreased from 45.3% to 16.5%. In prostate cancer, comparable CV was achieved with and without transformation. This improvement in CV, coupled with the improved correlation between the pair-wise gene expression ratio and tissue phenotypes, yielded higher classification efficiency, especially with the colon dataset – from 87.1% to 93.5%. Over 90% of the top ten discriminating axes in both datasets showed significant improvement after data transformation. The

  10. Contrasted patterns of selective pressure in three recent paralogous gene pairs in the Medicago genus (L.

    Directory of Open Access Journals (Sweden)

    Ho-Huu Joan

    2012-10-01

    Full Text Available Abstract Background Gene duplications are a molecular mechanism potentially mediating generation of functional novelty. However, the probabilities of maintenance and functional divergence of duplicated genes are shaped by selective pressures acting on gene copies immediately after the duplication event. The ratio of non-synonymous to synonymous substitution rates in protein-coding sequences provides a means to investigate selective pressures based on genic sequences. Three molecular signatures can reveal early stages of functional divergence between gene copies: change in the level of purifying selection between paralogous genes, occurrence of positive selection, and transient relaxed purifying selection following gene duplication. We studied three pairs of genes that are known to be involved in an interaction with symbiotic bacteria and were recently duplicated in the history of the Medicago genus (Fabaceae. We sequenced two pairs of polygalacturonase genes (Pg11-Pg3 and Pg11a-Pg11c and one pair of auxine transporter-like genes (Lax2-Lax4 in 17 species belonging to the Medicago genus, and sought for molecular signatures of differentiation between copies. Results Selective histories revealed by these three signatures of molecular differentiation were found to be markedly different between each pair of paralogs. We found sites under positive selection in the Pg11 paralogs while Pg3 has mainly evolved under purifying selection. The most recent paralogs examined Pg11a and Pg11c, are both undergoing positive selection and might be acquiring new functions. Lax2 and Lax4 paralogs are both under strong purifying selection, but still underwent a temporary relaxation of purifying selection immediately after duplication. Conclusions This study illustrates the variety of selective pressures undergone by duplicated genes and the effect of age of the duplication. We found that relaxation of selective constraints immediately after duplication might promote

  11. Pax8, a murine paired box gene expressed in the developing excretory system and thyroid gland.

    Science.gov (United States)

    Plachov, D; Chowdhury, K; Walther, C; Simon, D; Guenet, J L; Gruss, P

    1990-10-01

    Several mouse genes designated 'Pax genes' contain a highly conserved DNA sequence homologous to the paired box of Drosophila. Here we describe the isolation of Pax8, a novel paired box containing clone from an 8.5 day p.c. mouse embryo cDNA library. An open reading frame of 457 amino acids (aa) contains the 128 aa paired domain near the amino terminus. Another conserved region present in some other paired box genes, the octapeptide Tyr-Ser-Ile-Asn-Gly-Leu-Leu-Gly, is located 43 aa C-terminal to the paired domain. Using an interspecies backcross system, we have mapped the Pax8 gene within the proximal portion of mouse chromosome 2 in a close linkage to the surf locus. Several developmental mutations are located in this region. In situ hybridization was used to determine the pattern of Pax8 expression during mouse embryogenesis. Pax8 is expressed transiently between 11.5 and 12.5 days of gestation along the rostrocaudal axis extending from the myelencephalon throughout the length of the neural tube, predominantly in two parallel regions on either side of the basal plate. We also detected Pax8 expression in the developing thyroid gland beginning at 10.5 days of gestation, during the thyroid evagination. In the mesonephros and metanephros the expression of Pax8 was localized to the mesenchymal condensations, which are induced by the nephric duct and ureter, respectively. These condensations develop to functional units, the nephrons, of the kidney. These data are consistent with a role for Pax8 in the induction of kidney epithelium. The embryonic expression pattern of Pax8 is compared with that of Pax2, another recently described paired box gene expressed in the developing excretory system.

  12. Identification of genes that promote or antagonize somatic homolog pairing using a high-throughput FISH-based screen.

    Directory of Open Access Journals (Sweden)

    Eric F Joyce

    Full Text Available The pairing of homologous chromosomes is a fundamental feature of the meiotic cell. In addition, a number of species exhibit homolog pairing in nonmeiotic, somatic cells as well, with evidence for its impact on both gene regulation and double-strand break (DSB repair. An extreme example of somatic pairing can be observed in Drosophila melanogaster, where homologous chromosomes remain aligned throughout most of development. However, our understanding of the mechanism of somatic homolog pairing remains unclear, as only a few genes have been implicated in this process. In this study, we introduce a novel high-throughput fluorescent in situ hybridization (FISH technology that enabled us to conduct a genome-wide RNAi screen for factors involved in the robust somatic pairing observed in Drosophila. We identified both candidate "pairing promoting genes" and candidate "anti-pairing genes," providing evidence that pairing is a dynamic process that can be both enhanced and antagonized. Many of the genes found to be important for promoting pairing are highly enriched for functions associated with mitotic cell division, suggesting a genetic framework for a long-standing link between chromosome dynamics during mitosis and nuclear organization during interphase. In contrast, several of the candidate anti-pairing genes have known interphase functions associated with S-phase progression, DNA replication, and chromatin compaction, including several components of the condensin II complex. In combination with a variety of secondary assays, these results provide insights into the mechanism and dynamics of somatic pairing.

  13. Comprehensive profiling of EBV gene expression in nasopharyngeal carcinoma through paired-end transcriptome sequencing.

    Science.gov (United States)

    Hu, Lijuan; Lin, Zhirui; Wu, Yanheng; Dong, Juqin; Zhao, Bo; Cheng, Yanbing; Huang, Peiyu; Xu, Lihua; Xia, Tianliang; Xiong, Dan; Wang, Hongbo; Li, Manzhi; Guo, Ling; Kieff, Elliott; Zeng, Yixin; Zhong, Qian; Zeng, Musheng

    2016-03-01

    The latent expression pattern of Epstein-Barr Virus (EBV) genes in nasopharyngeal carcinoma (NPC) has been extensively investigated, and the expression of several lytic genes in NPC has been reported. However, comprehensive information through EBV transcriptome analysis in NPC is limited. We performed paired-end RNA-seq to systematically and comprehensively characterize the expression of EBV genes in NPC tissue and C666-1 NPC cell line, which consistently carries EBV. In addition to the transcripts restricted to type II latency infection, the type III latency EBNA3s genes and a substantial number of lytic genes, such as BZLF1, BRLF1, and BMRF1, were detected through RNA-seq and were further verified in C666-1 cells and NPC tissue through realtime PCR.We also performed clustering analysis to classify NPC patient groups in terms of EBV gene expression, which presented two subtypes of NPC samples. Results revealed interesting patterns of EBV gene expression in NPC patients. This clustering was correlated with many signaling pathways, such as those related to heterotrimeric G-protein signaling, inflammation mediated by chemokine and cytokine signaling, ribosomes, protein metabolism, influenza infection, and ECM-receptor interaction. Our combined findings suggested that the expression of EBV genes in NPC is restricted not only to type II latency genes but also to type III latency and lytic genes. This study provided further insights into the potential role of EBV in the development of NPC.

  14. The association between paired basic amino acid cleaving enzyme 4 gene haplotype and diastolic blood pressure

    Institute of Scientific and Technical Information of China (English)

    李建平; 王晓滨; 陈常忠; 徐新; 洪雪梅; 徐希平; 高炜; 霍勇

    2004-01-01

    Background In a previously identified locus linked to hypertension on chromosome 15q, we identified three blood pressure candidate genes: insulin-like growth factor 1 receptor gene (IGF1R), myocyte specific enhancer factor 2A gene (MEF2A), and paired basic amino acid cleaving enzyme 4 gene (PACE4). In this study, we tested their associations with hypertension using haplotype analysis.Methods A total of 288 unrelated individuals, including 163 high diastolic blood pressure (DBP) subjects and 125 normal DBP subjects were enrolled in this case-control study. Twenty single nucleotide polymorphisms (SNPs) in the three genes were genotyped using polymerase chain reaction followed by restriction enzyme digestion. Haplotype analysis was accomplished in the following stages: (1) pair-wise linkage disequilibrium test among SNPs on the same gene was performed to explore blocks in which recombination is very unlikely to happen; (2) Estimation-Maximization algorithm was applied to estimate haplotype frequencies in each block; (3) the chi-square test was used to examine the specific haplotype difference, and a permutation test was used to examine the overall haplotype profile difference between cases and controls in each block.Results An estimated haplotype "CCCCG" frequency in the haplotype block on the PACE4 gene was significantly higher in high DBP cases than in controls (P<0.01). The overall estimated haplotype profile in this block was also significantly different between the cases and the controls (P<0.001). This association indicates. Conclusions This study for the first time demonstrated that PACE4 gene may play an important role in the regulation of DBP. This association indicates that variations influencing DBP resides in or near this genomic region.

  15. [Using the operonic gene pairs for establishing the treshold for correlation coefficient of differently expressed genes].

    Science.gov (United States)

    Hedge, Sh; Klimova, E Iu; Mande, Sh; Medvedeva, Iu A; Makeev, V Iu; Permina, E A

    2011-01-01

    We developed an approach for effective estimating the correlations in the noise component of gene expression data. An efficent noise reduction technique has been suggested. The resulting technique has been applied to E. coli microarray data and tested on SOS response modulated genes.

  16. Combinatory microarray and SuperSAGE analyses identify pairing-dependently transcribed genes in Schistosoma mansoni males, including follistatin.

    Directory of Open Access Journals (Sweden)

    Silke Leutner

    2013-11-01

    Full Text Available BACKGROUND: Schistosomiasis is a disease of world-wide importance and is caused by parasitic flatworms of the genus Schistosoma. These parasites exhibit a unique reproduction biology as the female's sexual maturation depends on a constant pairing-contact to the male. Pairing leads to gonad differentiation in the female, and even gene expression of some gonad-associated genes is controlled by pairing. In contrast, no morphological changes have been observed in males, although first data indicated an effect of pairing also on gene transcription in males. METHODOLOGY/PRINCIPAL FINDINGS: To investigate the influence of pairing on males, we performed a combinatory approach applying SuperSAGE and microarray hybridization, generating the most comprehensive data-set on differential transcription available to date. Of 6,326 sense transcripts detected by both analyses, 29 were significantly differentially transcribed. Besides mutual confirmation, the two methods complemented each other as shown by data comparison and real-time PCR, which revealed a number of genes with consistent regulation across all methods. One of the candidate genes, follistatin of S. mansoni (SmFst was characterized in more detail by in situ hybridization and yeast two-hybrid (Y2H interaction analyses with potential binding partners. CONCLUSIONS/SIGNIFICANCE: Beyond confirming previously hypothesized differences in metabolic processes between pairing-experienced (EM and pairing-unexperienced males (UM, our data indicate that neuronal processes are involved in male-female interaction but also TGFβ-signaling. One candidate revealing significant down-regulation in EM was the TGFβ-pathway controlling molecule follistatin (SmFst. First functional analyses demonstrated SmFst interaction with the S. mansoni TGFβ-receptor agonists inhibin/activin (SmInAct and bone morphogenic protein (SmBMP, and all molecules colocalized in the testes. This indicates a yet unknown role of the TGF

  17. Integrated miRNA-risk gene-pathway pair network analysis provides prognostic biomarkers for gastric cancer

    Directory of Open Access Journals (Sweden)

    Cai H

    2016-05-01

    Full Text Available Hui Cai,1 Jiping Xu,2 Yifang Han,3 Zhengmao Lu,1 Ting Han,1 Yibo Ding,4 Liye Ma1 1Department of General Surgery, Changhai Hospital, Second Military Medical University, Shanghai, 2Department of Medical Administration, Changhai Hospital, Second Military Medical University, Shanghai, 3Department of Epidemiology, Research Institute for Medicine of Nanjing Command, Nanjing, 4Department of Epidemiology, Changhai Hospital, Second Military Medical University, Shanghai, People’s Republic of China Purpose: This study aimed to identify molecular prognostic biomarkers for gastric cancer. Methods: mRNA and miRNA expression profiles of eligible gastric cancer and control samples were downloaded from Gene Expression Omnibus to screen the differentially expressed genes (DEGs and differentially expressed miRNAs (DEmiRs, using MetaDE and limma packages, respectively. Target genes of the DEmiRs were also collected from both predictive and experimentally validated target databases of miRNAs. The overlapping genes between selected targets and DEGs were identified as risk genes, followed by functional enrichment analysis. Human pathways and their corresponding genes were downloaded from the Kyoto Encyclopedia of Genes and Genomes (KEGG database for the expression analysis of each pathway in gastric cancer samples. Next, co-pathway pairs were selected according to the Pearson correlation coefficients. Finally, the co-pathway pairs, miRNA–target pairs, and risk gene–pathway pairs were merged into a complex interaction network, the most important nodes (miRNAs/target genes/co-pathway pairs of which were selected by calculating their degrees.Results: Totally, 1,260 DEGs and 144 DEmiRs were identified. There were 336 risk genes found in the 9,572 miRNA–target pairs. Judging from the pathway expression files, 45 co-pathway pairs were screened out. There were 1,389 interactive pairs and 480 nodes in the integrated network. Among all nodes in the network, focal

  18. Transcriptional regulation of bidirectional gene pairs by 17-β-estradiol in MCF-7 breast cancer cells

    Directory of Open Access Journals (Sweden)

    S.A.B. Garcia

    2011-02-01

    Full Text Available Using cDNA microarray analysis, we previously identified a set of differentially expressed genes in primary breast tumors based on the status of estrogen and progesterone receptors. In the present study, we performed an integrated computer-assisted and manual search of potential estrogen response element (ERE binding sites in the promoter region of these genes to characterize their potential to be regulated by estrogen receptors (ER. Publicly available databases were used to annotate the position of these genes in the genome and to extract a 5’flanking region 2 kb upstream to 2 kb downstream of the transcription start site for transcription binding site analysis. The search for EREs and other binding sites was performed using several publicly available programs. Overall, approximately 40% of the genes analyzed were potentially able to be regulated by estrogen via ER. In addition, 17% of these genes are located very close to other genes organized in a head-to-head orientation with less than 1.0 kb between their transcript units, sharing a bidirectional promoter, and could be classified as bidirectional gene pairs. Using quantitative real-time PCR, we further investigated the effects of 17β-estradiol and antiestrogens on the expression of the bidirectional gene pairs in MCF-7 breast cancer cells. Our results showed that some of these gene pairs, such as TXNDC9/EIF5B, GALNS/TRAPPC2L, and SERINC1/PKIB, are modulated by 17β-estradiol via ER in MCF-7 breast cancer cells. Here, we also characterize the promoter region of potential ER-regulated genes and provide new information on the transcriptional regulation of bidirectional gene pairs.

  19. Expression of miR-98 in myocarditis and its influence on transcription of the FAS/FASL gene pair.

    Science.gov (United States)

    Zhang, B Y; Zhao, Z; Jin, Z

    2016-06-03

    Myocarditis is a common cardiovascular disease and frequently occurs in children and teenagers. It is believed to be caused by both endogenous and exogenous factors, among which FAS/FASL gene pair-induced cell apoptosis is a major mechanism of myocardial cell injury. A previous study has detected low expression of microRNA (miR)-98 in myocarditis patients. Therefore, in this study we investigated the functional implications of miR-98 with respect to the disease. We carried out a case-control study including 50 myocarditis patients and 50 healthy individuals. Total RNA was extracted from peripheral blood plasma. Expression levels of miR-98 and the FAS/FASL gene pair were determined by real-time fluorescent quantitative polymerase chain reaction. The interaction between miR-98 and the FAS/FASL pair was visualized by dual-luciferase reporter assay. The expression of the FAS/FASL gene pair was further detected by transfecting with an miR-98 mimic or an miR-98 inhibitor. The content of miR-98 in the peripheral blood of the myocarditis patients was significantly lower than in the healthy individuals. However, the FAS/FASL genes were upregulated by 1.68-fold in the myocarditis patients. miR-98 was shown to interact with the 3'-untranslated region of the FAS/FASL gene pair. The inhibition/facilitation of miR-98 expression in myocardial cells can modulate apoptosis. miR-98 was downregulated in the peripheral blood of myocarditis patients. It may interact with the FAS/FASL gene pair to further modulate cell apoptosis.

  20. An H3-H4 histone gene pair in the marine copepod Tigriopus californicus, contains an intergenic dyad symmetry element.

    Science.gov (United States)

    Porter, D; Brown, D; Wells, D

    1991-01-01

    Histone genes are one of the most widely studied multigene families in eucaryotes. Over 200 histone genes have been sequenced, primarily in vertebrates, echinoderms, fungi and plants. We present here the structure and genomic orientation of an H3-H4 histone gene pair from the marine copepod, Tigriopus californicus. These histone gene sequences are the first to be determined for the class Crustacea and among the first to be determined for protostomes. The H4 and H3 genes in Tigriopus are shown to be adjacent, to have opposite polarity, and to contain a 26 bp region of dyad symmetry centrally located within the spacer region between the two genes. A similarly located dyad element has been found in yeast which contributes to the coordinated cell cycle control of the adjacent histone genes. The Tigriopus H3-H4 histone gene pair is clustered with one H2A and two H2B histone genes on a 15 kb genomic Bam H1 fragment. The H4 gene sequence predicts an H4 protein with an unusual serine to threonine substitution at the amino terminal residue. The H3 gene sequence predicts an H3 protein which is identical to the vertebrate H3.2 histone.

  1. Targeted mutagenesis of multiple and paralogous genes in Xenopus laevis using two pairs of transcription activator-like effector nucleases.

    Science.gov (United States)

    Sakane, Yuto; Sakuma, Tetsushi; Kashiwagi, Keiko; Kashiwagi, Akihiko; Yamamoto, Takashi; Suzuki, Ken-Ichi T

    2014-01-01

    Transcription activator-like effector nucleases (TALENs) have been extensively used in genome editing in various organisms. In some cases, however, it is difficult to efficiently disrupt both paralogous genes using a single pair of TALENs in Xenopus laevis because of its polyploidy. Here, we report targeted mutagenesis of multiple and paralogous genes using two pairs of TALENs in X. laevis. First, we show simultaneous targeted mutagenesis of three genes, tyrosinase paralogues (tyra and tyrb) and enhanced green fluorescent protein (egfp) by injection of two TALENs pairs in transgenic embryos carrying egfp. Consistent with the high frequency of both severe phenotypic traits, albinism and loss of GFP fluorescence, frameshift mutation rates of tyr paralogues and egfp reached 40-80%. Next, we show early introduction of TALEN-mediated mutagenesis of these target loci during embryogenesis. Finally, we also demonstrate that two different pairs of TALENs can simultaneously introduce mutations to both paralogues encoding histone chaperone with high efficiency. Our results suggest that targeted mutagenesis of multiple genes using TALENs can be applied to analyze the functions of paralogous genes with redundancy in X. laevis.

  2. DNA methylation analysis of chromosome 21 gene promoters at single base pair and single allele resolution.

    Directory of Open Access Journals (Sweden)

    Yingying Zhang

    2009-03-01

    Full Text Available Differential DNA methylation is an essential epigenetic signal for gene regulation, development, and disease processes. We mapped DNA methylation patterns of 190 gene promoter regions on chromosome 21 using bisulfite conversion and subclone sequencing in five human cell types. A total of 28,626 subclones were sequenced at high accuracy using (long-read Sanger sequencing resulting in the measurement of the DNA methylation state of 580427 CpG sites. Our results show that average DNA methylation levels are distributed bimodally with enrichment of highly methylated and unmethylated sequences, both for amplicons and individual subclones, which represent single alleles from individual cells. Within CpG-rich sequences, DNA methylation was found to be anti-correlated with CpG dinucleotide density and GC content, and methylated CpGs are more likely to be flanked by AT-rich sequences. We observed over-representation of CpG sites in distances of 9, 18, and 27 bps in highly methylated amplicons. However, DNA sequence alone is not sufficient to predict an amplicon's DNA methylation status, since 43% of all amplicons are differentially methylated between the cell types studied here. DNA methylation in promoter regions is strongly correlated with the absence of gene expression and low levels of activating epigenetic marks like H3K4 methylation and H3K9 and K14 acetylation. Utilizing the single base pair and single allele resolution of our data, we found that i amplicons from different parts of a CpG island frequently differ in their DNA methylation level, ii methylation levels of individual cells in one tissue are very similar, and iii methylation patterns follow a relaxed site-specific distribution. Furthermore, iv we identified three cases of allele-specific DNA methylation on chromosome 21. Our data shed new light on the nature of methylation patterns in human cells, the sequence dependence of DNA methylation, and its function as epigenetic signal in gene

  3. Lethal osteogenesis imperfecta congenita and a 300 base pair gene deletion for an α1(I)-like collagen.

    NARCIS (Netherlands)

    F.M. Pope; K.S.E. Cheah (Kathryn); A.C. Nicholls; A.B. Price; F.G. Grosveld (Frank)

    1984-01-01

    textabstractBroad boned lethal osteogenesis imperfecta is a severely crippling disease of unknown cause. By means of recombinant DNA technology a 300 base pair deletion in an alpha 1(I)-like collagen gene was detected in six patients and four complete parent-child groups including patients with this

  4. Gene expression profiling of lymphoblasts from autistic and nonaffected sib pairs: altered pathways in neuronal development and steroid biosynthesis.

    Science.gov (United States)

    Hu, Valerie W; Nguyen, AnhThu; Kim, Kyung Soon; Steinberg, Mara E; Sarachana, Tewarit; Scully, Michele A; Soldin, Steven J; Luu, Truong; Lee, Norman H

    2009-06-03

    Despite the identification of numerous autism susceptibility genes, the pathobiology of autism remains unknown. The present "case-control" study takes a global approach to understanding the molecular basis of autism spectrum disorders based upon large-scale gene expression profiling. DNA microarray analyses were conducted on lymphoblastoid cell lines from over 20 sib pairs in which one sibling had a diagnosis of autism and the other was not affected in order to identify biochemical and signaling pathways which are differentially regulated in cells from autistic and nonautistic siblings. Bioinformatics and gene ontological analyses of the data implicate genes which are involved in nervous system development, inflammation, and cytoskeletal organization, in addition to genes which may be relevant to gastrointestinal or other physiological symptoms often associated with autism. Moreover, the data further suggests that these processes may be modulated by cholesterol/steroid metabolism, especially at the level of androgenic hormones. Elevation of male hormones, in turn, has been suggested as a possible factor influencing susceptibility to autism, which affects approximately 4 times as many males as females. Preliminary metabolic profiling of steroid hormones in lymphoblastoid cell lines from several pairs of siblings reveals higher levels of testosterone in the autistic sibling, which is consistent with the increased expression of two genes involved in the steroidogenesis pathway. Global gene expression profiling of cultured cells from ASD probands thus serves as a window to underlying metabolic and signaling deficits that may be relevant to the pathobiology of autism.

  5. Gene expression profiling of lymphoblasts from autistic and nonaffected sib pairs: altered pathways in neuronal development and steroid biosynthesis.

    Directory of Open Access Journals (Sweden)

    Valerie W Hu

    Full Text Available Despite the identification of numerous autism susceptibility genes, the pathobiology of autism remains unknown. The present "case-control" study takes a global approach to understanding the molecular basis of autism spectrum disorders based upon large-scale gene expression profiling. DNA microarray analyses were conducted on lymphoblastoid cell lines from over 20 sib pairs in which one sibling had a diagnosis of autism and the other was not affected in order to identify biochemical and signaling pathways which are differentially regulated in cells from autistic and nonautistic siblings. Bioinformatics and gene ontological analyses of the data implicate genes which are involved in nervous system development, inflammation, and cytoskeletal organization, in addition to genes which may be relevant to gastrointestinal or other physiological symptoms often associated with autism. Moreover, the data further suggests that these processes may be modulated by cholesterol/steroid metabolism, especially at the level of androgenic hormones. Elevation of male hormones, in turn, has been suggested as a possible factor influencing susceptibility to autism, which affects approximately 4 times as many males as females. Preliminary metabolic profiling of steroid hormones in lymphoblastoid cell lines from several pairs of siblings reveals higher levels of testosterone in the autistic sibling, which is consistent with the increased expression of two genes involved in the steroidogenesis pathway. Global gene expression profiling of cultured cells from ASD probands thus serves as a window to underlying metabolic and signaling deficits that may be relevant to the pathobiology of autism.

  6. Systems biology-guided identification of synthetic lethal gene pairs and its potential use to discover antibiotic combinations

    DEFF Research Database (Denmark)

    Aziz, Ramy K.; Monk, Jonathan M.; Lewis, R. M.

    2015-01-01

    Mathematical models of metabolism from bacterial systems biology have proven their utility across multiple fields, for example metabolic engineering, growth phenotype simulation, and biological discovery. The usefulness of the models stems from their ability to compute a link between genotype...... and phenotype, but their ability to accurately simulate gene-gene interactions has not been investigated extensively. Here we assess how accurately a metabolic model for Escherichia coli computes one particular type of gene-gene interaction, synthetic lethality, and find that the accuracy rate is between 25......% and 43%. The most common failure modes were incorrect computation of single gene essentiality and biological information that was missing from the model. Moreover, we performed virtual and biological screening against several synthetic lethal pairs to explore whether two-compound formulations could...

  7. Short communication: phylodynamics analysis of the human immunodeficiency virus type 1 envelope gene in mother and child pairs.

    Science.gov (United States)

    Santos, Luciane Amorim; Gray, Rebecca R; Monteiro-Cunha, Joana Paixão; Strazza, Evandra; Kashima, Simone; Santos, Edson de Souza; Araújo, Thessika Hialla Almeida; Gonçalves, Marilda de Souza; Salemi, Marco; Alcantara, Luiz Carlos Junior

    2015-09-01

    Characterizing the impact of HIV transmission routes on viral genetic diversity can improve the understanding of the mechanisms of virus evolution and adaptation. HIV vertical transmission can occur in utero, during delivery, or while breastfeeding. The present study investigated the phylodynamics of the HIV-1 env gene in mother-to-child transmission by analyzing one chronically infected pair from Brazil and three acutely infected pairs from Zambia, with three to five time points. Sequences from 25 clones from each sample were obtained and aligned using Clustal X. ML trees were constructed in PhyML using the best evolutionary model. Bayesian analyses testing the relaxed and strict molecular clock were performed using BEAST and a Bayesian Skyline Plot (BSP) was construed. The genetic variability of previously described epitopes was investigated and compared between each individual time point and between mother and child sequences. The relaxed molecular clock was the best-fitted model for all datasets. The tree topologies did not show differentiation in the evolutionary dynamics of the virus circulating in the mother from the viral population in the child. In the BSP, the effective population size was more constant in time in the chronically infected patients while in the acute patients it was possible to detect bottlenecks. The genetic variability within viral epitopes recognized by the human immune system was considerably higher among the chronically infected pair in comparison with acutely infected pairs. These results contribute to a better understanding of HIV-1 evolutionary dynamics in mother-to-child transmission.

  8. Biphasic Hoxd gene expression in shark paired fins reveals an ancient origin of the distal limb domain.

    Directory of Open Access Journals (Sweden)

    Renata Freitas

    Full Text Available The evolutionary transition of fins to limbs involved development of a new suite of distal skeletal structures, the digits. During tetrapod limb development, genes at the 5' end of the HoxD cluster are expressed in two spatiotemporally distinct phases. In the first phase, Hoxd9-13 are activated sequentially and form nested domains along the anteroposterior axis of the limb. This initial phase patterns the limb from its proximal limit to the middle of the forearm. Later in development, a second wave of transcription results in 5' HoxD gene expression along the distal end of the limb bud, which regulates formation of digits. Studies of zebrafish fins showed that the second phase of Hox expression does not occur, leading to the idea that the origin of digits was driven by addition of the distal Hox expression domain in the earliest tetrapods. Here we test this hypothesis by investigating Hoxd gene expression during paired fin development in the shark Scyliorhinus canicula, a member of the most basal lineage of jawed vertebrates. We report that at early stages, 5'Hoxd genes are expressed in anteroposteriorly nested patterns, consistent with the initial wave of Hoxd transcription in teleost and tetrapod paired appendages. Unexpectedly, a second phase of expression occurs at later stages of shark fin development, in which Hoxd12 and Hoxd13 are re-expressed along the distal margin of the fin buds. This second phase is similar to that observed in tetrapod limbs. The results indicate that a second, distal phase of Hoxd gene expression is not uniquely associated with tetrapod digit development, but is more likely a plesiomorphic condition present the common ancestor of chondrichthyans and osteichthyans. We propose that a temporal extension, rather than de novo activation, of Hoxd expression in the distal part of the fin may have led to the evolution of digits.

  9. Perception of the usefulness of drug/gene pairs and barriers for pharmacogenomics in Latin America.

    Science.gov (United States)

    Quinones, Luis Abel; Lavanderos, Maria Alejandra; Cayun, Juan Pablo; Garcia-Martin, Elena; Agundez, Jose Augusto; Caceres, Dante Daniel; Roco, Angela Margarita; Morales, Jorge E; Herrera, Luisa; Encina, Gonzalo; Isaza, Carlos Alberto; Redal, Maria Ana; Larovere, Laura; Soria, Nestor Walter; Eslava-Schmalbach, Javier; Castaneda-Hernandez, Gilberto; Lopez-Cortes, Andres; Magno, Luiz Alexandre; Lopez, Marisol; Chiurillo, Miguel Angel; Rodeiro, Idania; Castro de Guerra, Dinorah; Teran, Enrique; Estevez-Carrizo, Francisco; Lares-Assef, Ismael

    2014-02-01

    Pharmacogenetics and Pharmacogenomics areas are currently emerging fields focused to manage pharmacotherapy that may prevent undertreatment while avoiding associated drug toxicity in patients. Large international differences in the awareness and in the use of pharmacogenomic testing are presumed, but not well assessed to date. In the present study we review the awareness of Latin American scientific community about pharmacogenomic testing and the perceived barriers for their clinical application. In order to that, we have compiled information from 9 countries of the region using a structured survey which is compared with surveys previously performed in USA and Spain. The most relevant group of barriers was related to the need for clear guidelines for the use of pharmacogenomics in clinical practice, followed by insufficient awareness about pharmacogenomics among clinicians and the absence of regulatory institutions that facilitate the use of pharmacogenetic tests. The higher ranked pairs were TPMT/thioguanine, TPMT/azathioprine, CYP2C9/warfarin, UGT1A1/irinotecan, CYP2D6/amitriptiline, CYP2C19/citalopram and CYP2D6/clozapine. The lower ranked pairs were SLCO1B1/simvastatin, CYP2D6/metoprolol and GP6D/chloroquine. Compared with USA and Spanish surveys, 25 pairs were of lower importance for Latin American respondents. Only CYP2C19/esomeprazole, CYP2C19/omeprazole, CYP2C19/celecoxib and G6PD/dapsone were ranked higher or similarly to the USA and Spanish surveys. Integration of pharmacogenomics in clinical practice needs training of healthcare professionals and citizens, but in addition legal and regulatory guidelines and safeguards will be needed. We propose that the approach offered by pharmacogenomics should be incorporated into the decision-making plans in Latin America.

  10. Systems biology-guided identification of synthetic lethal gene pairs and its potential use to discover antibiotic combinations

    Science.gov (United States)

    Aziz, Ramy K.; Monk, Jonathan M.; Lewis, Robert M.; In Loh, Suh; Mishra, Arti; Abhay Nagle, Amrita; Satyanarayana, Chitkala; Dhakshinamoorthy, Saravanakumar; Luche, Michele; Kitchen, Douglas B.; Andrews, Kathleen A.; Fong, Nicole L.; Li, Howard J.; Palsson, Bernhard O.; Charusanti, Pep

    2015-01-01

    Mathematical models of metabolism from bacterial systems biology have proven their utility across multiple fields, for example metabolic engineering, growth phenotype simulation, and biological discovery. The usefulness of the models stems from their ability to compute a link between genotype and phenotype, but their ability to accurately simulate gene-gene interactions has not been investigated extensively. Here we assess how accurately a metabolic model for Escherichia coli computes one particular type of gene-gene interaction, synthetic lethality, and find that the accuracy rate is between 25% and 43%. The most common failure modes were incorrect computation of single gene essentiality and biological information that was missing from the model. Moreover, we performed virtual and biological screening against several synthetic lethal pairs to explore whether two-compound formulations could be found that inhibit the growth of Gram-negative bacteria. One set of molecules was identified that, depending on the concentrations, inhibits E. coli and S. enterica serovar Typhimurium in an additive or antagonistic manner. These findings pinpoint specific ways in which to improve the predictive ability of metabolic models, and highlight one potential application of systems biology to drug discovery and translational medicine. PMID:26531810

  11. De novo assembly, gene annotation and marker development using Illumina paired-end transcriptome sequences in celery (Apium graveolens L..

    Directory of Open Access Journals (Sweden)

    Nan Fu

    Full Text Available BACKGROUND: Celery is an increasing popular vegetable species, but limited transcriptome and genomic data hinder the research to it. In addition, a lack of celery molecular markers limits the process of molecular genetic breeding. High-throughput transcriptome sequencing is an efficient method to generate a large transcriptome sequence dataset for gene discovery, molecular marker development and marker-assisted selection breeding. PRINCIPAL FINDINGS: Celery transcriptomes from four tissues were sequenced using Illumina paired-end sequencing technology. De novo assembling was performed to generate a collection of 42,280 unigenes (average length of 502.6 bp that represent the first transcriptome of the species. 78.43% and 48.93% of the unigenes had significant similarity with proteins in the National Center for Biotechnology Information (NCBI non-redundant protein database (Nr and Swiss-Prot database respectively, and 10,473 (24.77% unigenes were assigned to Clusters of Orthologous Groups (COG. 21,126 (49.97% unigenes harboring Interpro domains were annotated, in which 15,409 (36.45% were assigned to Gene Ontology(GO categories. Additionally, 7,478 unigenes were mapped onto 228 pathways using the Kyoto Encyclopedia of Genes and Genomes Pathway database (KEGG. Large numbers of simple sequence repeats (SSRs were indentified, and then the rate of successful amplication and polymorphism were investigated among 31 celery accessions. CONCLUSIONS: This study demonstrates the feasibility of generating a large scale of sequence information by Illumina paired-end sequencing and efficient assembling. Our results provide a valuable resource for celery research. The developed molecular markers are the foundation of further genetic linkage analysis and gene localization, and they will be essential to accelerate the process of breeding.

  12. MicroRNA-34 directly targets pair-rule genes and cytoskeleton component in the honey bee

    Science.gov (United States)

    Freitas, Flávia C. P.; Pires, Camilla V.; Claudianos, Charles; Cristino, Alexandre S.; Simões, Zilá L. P.

    2017-01-01

    MicroRNAs (miRNAs) are key regulators of developmental processes, such as cell fate determination and differentiation. Previous studies showed Dicer knockdown in honeybee embryos disrupt the processing of functional mature miRNAs and impairs embryo patterning. Here we investigated the expression profiles of miRNAs in honeybee embryogenesis and the role of the highly conserved miR-34-5p in the regulation of genes involved in insect segmentation. A total of 221 miRNAs were expressed in honey bee embryogenesis among which 97 mature miRNA sequences have not been observed before. Interestingly, we observed a switch in dominance between the 5-prime and 3-prime arm of some miRNAs in different embryonic stages; however, most miRNAs present one dominant arm across all stages of embryogenesis. Our genome-wide analysis of putative miRNA-target networks and functional pathways indicates miR-34-5p is one of the most conserved and connected miRNAs associated with the regulation of genes involved in embryonic patterning and development. In addition, we experimentally validated that miR-34-5p directly interacts to regulatory elements in the 3′-untranslated regions of pair-rule (even-skipped, hairy, fushi-tarazu transcription factor 1) and cytoskeleton (actin5C) genes. Our study suggests that miR-34-5p may regulate the expression of pair-rule and cytoskeleton genes during early development and control insect segmentation. PMID:28098233

  13. Over half of breakpoints in gene pairs involved in cancer-specific recurrent translocations are mapped to human chromosomal fragile sites

    Directory of Open Access Journals (Sweden)

    Pierce Levi CT

    2009-01-01

    Full Text Available Abstract Background Gene rearrangements such as chromosomal translocations have been shown to contribute to cancer development. Human chromosomal fragile sites are regions of the genome especially prone to breakage, and have been implicated in various chromosome abnormalities found in cancer. However, there has been no comprehensive and quantitative examination of the location of fragile sites in relation to all chromosomal aberrations. Results Using up-to-date databases containing all cancer-specific recurrent translocations, we have examined 444 unique pairs of genes involved in these translocations to determine the correlation of translocation breakpoints and fragile sites in the gene pairs. We found that over half (52% of translocation breakpoints in at least one gene of these gene pairs are mapped to fragile sites. Among these, we examined the DNA sequences within and flanking three randomly selected pairs of translocation-prone genes, and found that they exhibit characteristic features of fragile DNA, with frequent AT-rich flexibility islands and the potential of forming highly stable secondary structures. Conclusion Our study is the first to examine gene pairs involved in all recurrent chromosomal translocations observed in tumor cells, and to correlate the location of more than half of breakpoints to positions of known fragile sites. These results provide strong evidence to support a causative role for fragile sites in the generation of cancer-specific chromosomal rearrangements.

  14. Evaluation of 16S rRNA Gene Primer Pairs for Monitoring Microbial Community Structures Showed High Reproducibility within and Low Comparability between Datasets Generated with Multiple Archaeal and Bacterial Primer Pairs.

    Science.gov (United States)

    Fischer, Martin A; Güllert, Simon; Neulinger, Sven C; Streit, Wolfgang R; Schmitz, Ruth A

    2016-01-01

    The application of next-generation sequencing technology in microbial community analysis increased our knowledge and understanding of the complexity and diversity of a variety of ecosystems. In contrast to Bacteria, the archaeal domain was often not particularly addressed in the analysis of microbial communities. Consequently, established primers specifically amplifying the archaeal 16S ribosomal gene region are scarce compared to the variety of primers targeting bacterial sequences. In this study, we aimed to validate archaeal primers suitable for high throughput next generation sequencing. Three archaeal 16S primer pairs as well as two bacterial and one general microbial 16S primer pairs were comprehensively tested by in-silico evaluation and performing an experimental analysis of a complex microbial community of a biogas reactor. The results obtained clearly demonstrate that comparability of community profiles established using different primer pairs is difficult. 16S rRNA gene data derived from a shotgun metagenome of the same reactor sample added an additional perspective on the community structure. Furthermore, in-silico evaluation of primers, especially those for amplification of archaeal 16S rRNA gene regions, does not necessarily reflect the results obtained in experimental approaches. In the latter, archaeal primer pair ArchV34 showed the highest similarity to the archaeal community structure compared to observed by the metagenomic approach and thus appears to be the appropriate for analyzing archaeal communities in biogas reactors. However, a disadvantage of this primer pair was its low specificity for the archaeal domain in the experimental application leading to high amounts of bacterial sequences within the dataset. Overall our results indicate a rather limited comparability between community structures investigated and determined using different primer pairs as well as between metagenome and 16S rRNA gene amplicon based community structure analysis

  15. Correlation of global and gene-specific DNA methylation in maternal-infant pairs.

    Directory of Open Access Journals (Sweden)

    Molly L Kile

    Full Text Available The inheritance of DNA methylation patterns is a popular theory to explain the influence of parental genetic and environmental factors on the phenotype of their offspring but few studies have examined this relationship in humans. Using 120 paired maternal-umbilical cord blood samples randomly selected from a prospective birth cohort in Bangladesh, we quantified DNA methylation by pyrosequencing seven CpG positions in the promoter region of p16, four CpG positions in the promoter region of p53, LINE-1 and Alu. Positive correlations were observed between maternal and umbilical cord blood at p16, LINE-1, and Alu but not p53. Multiple linear regression models observed a significant association between maternal and umbilical cord blood at LINE-1 and Alu (LINE-1: β = 0.63, p<0.0001; Alu: β = 0.28, p = 0.009. After adjusting for multiple comparisons, maternal methylation of p16 at position 4 significantly predicted methylation at the same position in umbilical cord blood (β = 0.43, p = <0.0001. These models explained 48%, 5% and 16% of the observed variability in umbilical cord %5mC for LINE-1, Alu and p16 at position 4, respectively. These results suggest that DNA methylation in maternal blood was correlated with her offspring at LINE-1, Alu, and p16 but not p53. Additional studies are needed to confirm whether these observed associations were due to the inheritance of epigenetic events or the shared environment between mother and fetus. Future studies should also use a multi-generational family-based design that would quantify both maternal and paternal contributions to DNA methylation in offspring across more than one generation.

  16. TMPRSS2-ERG Gene Fusion Causing ERG Overexpression Precedes Chromosome Copy Number Changes in Prostate Carcinomas, Paired HGPIN Lesions

    Directory of Open Access Journals (Sweden)

    Nuno Cerveira

    2006-10-01

    Full Text Available TMPRSS2-ETS gene fusions have been found recurrently in prostate carcinomas, but not in the presumed precursor lesion, high-grade prostatic intraepithelial neoplasia (HGPIN. However, HGPIN lesions may share chromosomal changes with prostate cancer. To determine the relative order of genetic events in prostate carcinogenesis, we have analyzed 34 prostate carcinomas, 19 paired HGPIN lesions, 14 benign prostate hyperplasias, 11 morphologically normal prostatic tissues for TMPRSS2-ERG, TMPRSS2-ETV1 rearrangements, genomic imbalances. TMPRSS2 exon 1 was fused in-frame with ERG exon 4 in 17 of 34 (50% prostate carcinomas, in 4 of 19 (21% HGPIN lesions, but in none of controls. The findings were further validated by sequencing analysis, by the real-time polymerase chain reaction quantification of TMPRSS2-ERG fusion transcript, the ERG exons 5/6:exons 1/2 expression ratio. Chromosome copy number changes were detected by comparative genomic hybridization in 42% of clinically confined carcinomas, in none of the 16 HGPIN lesions analyzed. We demonstrate for the first time that the TMPRSS2-ERG fusion gene can be detected in a proportion of HGPIN lesions, that this molecular rearrangement is an early event that may precede chromosome-level alterations in prostate carcinogenesis.

  17. Protocadherin 11X/Y a human-specific gene pair: an immunohistochemical survey of fetal and adult brains.

    Science.gov (United States)

    Priddle, Thomas H; Crow, Tim J

    2013-08-01

    Protocadherins 11X and 11Y are cell adhesion molecules of the δ1-protocadherin family. Pcdh11X is present throughout the mammalian radiation; however, 6 million years ago (MYA), a reduplicative translocation of the Xq21.3 block onto what is now human Yp11 created the Homo sapiens-specific PCDH11Y. Therefore, modern human females express PCDH11X whereas males express both PCDH11X and PCDH11Y. PCDH11X/Y has been subject to accelerated evolution resulting in human-specific changes to both proteins, most notably 2 cysteine substitutions in the PCDH11X ectodomain that may alter binding characteristics. The PCDH11X/Y gene pair is postulated to be critical to aspects of human brain evolution related to the neural correlates of language. Therefore, we raised antibodies to investigate the temporal and spatial expression of PCDH11X/Y in cortical and sub-cortical areas of the human fetal brain between 12 and 34 postconceptional weeks. We then used the antibodies to determine if this expression was consistent in a series of adult brains. PCDH11X/Y immunoreactivity was detectable at all developmental stages. Strong expression was detected in the fetal neocortex, ganglionic eminences, cerebellum, and inferior olive. In the adult brain, the cerebral cortex, hippocampal formation, and cerebellum were strongly immunoreactive, with expression also detectable in the brainstem.

  18. Towards a clinical practice guide in pharmacogenomics testing for functional polymorphisms of drug-metabolising enzymes. Gene/drug pairs and barriers perceived in Spain.

    Directory of Open Access Journals (Sweden)

    José A G Agúndez

    2012-11-01

    Full Text Available The development of clinical practice recommendations or guidelines for the clinical use of biomarkers is an issue of great importance with regard to adverse drug reactions. The potential of pharmacogenomic biomarkers has been extensively investigated in recent years. However, several barriers to implementing the use of pharmacogenomics testing exist. We conducted a survey among members of the Spanish Societies of Pharmacology and Clinical Pharmacology to obtain information about the perception of such barriers and to compare the perceptions of participants about the relative importance of major gene/drug pairs.Of 11 potential barriers, the highest importance was attributed to lack of institutional support for pharmacogenomics testing, and to the issues related to the lack of guidelines. Of the proposed gene/drug pairs the highest importance was assigned to HLA-B/abacavir, UGT1A1/irinotecan and CYP2D6/tamoxifen. In this perspective article we compare the relative importance of 29 gene/drug pairs in the Spanish study with that of the same pairs in the American Society for Clinical Pharmacology & Therapeutics study, and we provide suggestions and areas of focus to develop a guide for clinical practice in pharmacogenomics testing.

  19. A COMPARATIVE ANALYSIS OF METHYLATION STATUS OF TUMOR SUPPRESSOR GENES IN PAIRED BIOPSY AND SERUM SAMPLES FROM CERVICAL CANCER PATIENTS AMONG NORTH INDIAN POPULATION.

    Science.gov (United States)

    Jha, A K; Sharma, V; Nikbakht, M; Jain, V; Sehgal, A; Capalash, N; Kaur, J

    2016-02-01

    Tumor-specific genetic or epigenetic alterations have been detected in serum DNA in case of various types of cancers. In breast cancer, the detection of tumor suppressor gene hypermethylation has been reported in several body fluids. Promoter hypermethylation of some genes like MYOD1, CALCA, hTERT etc. has also been detected in serum samples from cervical cancer. The present study is the first report on the comparison of promoter hypermethylation of tumor suppressor genes likep14, p15, p16, p21, p27, p57, p53, p73, RARβ2, FHIT, DAPK, STAT1 and-RB1 genes in paired biopsy and serum samples from cervical cancer patients among north Indian population. This is also the first report on the hypermethylation of these genes in serum samples from cervical cancer patients among north Indian population. According to the results of the present study, promoter hypermethylation of these genes can also be detected in serum samples of cervical cancer patients. The sensitivity of detection of promoter hypermethylation in serum samples of cervical cancer patients as compared to paired biopsy samples was found to be around 83.3%. It was observed that promoter hypermethylation was mainly observed in the serum samples in the higher stages and very rarely in the lower stages. The present study clearly showed that serum of patients with cervical cancer can also be used to study methylated genes as biomarkers.

  20. Power of non-parametric linkage analysis in mapping genes contributing to human longevity in long-lived sib-pairs

    DEFF Research Database (Denmark)

    Tan, Qihua; Zhao, J H; Iachine, I

    2004-01-01

    This report investigates the power issue in applying the non-parametric linkage analysis of affected sib-pairs (ASP) [Kruglyak and Lander, 1995: Am J Hum Genet 57:439-454] to localize genes that contribute to human longevity using long-lived sib-pairs. Data were simulated by introducing a recently...... developed statistical model for measuring marker-longevity associations [Yashin et al., 1999: Am J Hum Genet 65:1178-1193], enabling direct power comparison between linkage and association approaches. The non-parametric linkage (NPL) scores estimated in the region harboring the causal allele are evaluated...... in case of a dominant effect. Although the power issue may depend heavily on the true genetic nature in maintaining survival, our study suggests that results from small-scale sib-pair investigations should be referred with caution, given the complexity of human longevity....

  1. Expression of human AID in yeast induces mutations in context similar to the context of somatic hypermutation at G-C pairs in immunoglobulin genes

    Directory of Open Access Journals (Sweden)

    Kunkel Thomas A

    2005-06-01

    Full Text Available Abstract Background Antibody genes are diversified by somatic hypermutation (SHM, gene conversion and class-switch recombination. All three processes are initiated by the activation-induced deaminase (AID. According to a DNA deamination model of SHM, AID converts cytosine to uracil in DNA sequences. The initial deamination of cytosine leads to mutation and recombination in pathways involving replication, DNA mismatch repair and possibly base excision repair. The DNA sequence context of mutation hotspots at G-C pairs during SHM is DGYW/WRCH (G-C is a hotspot position, R = A/G, Y = T/C, W = A/T, D = A/G/T. Results To investigate the mechanisms of AID-induced mutagenesis in a model system, we studied the genetic consequences of AID expression in yeast. We constructed a yeast vector with an artificially synthesized human AID gene insert using codons common to highly expressed yeast genes. We found that expression of the artificial hAIDSc gene was moderately mutagenic in a wild-type strain and highly mutagenic in an ung1 uracil-DNA glycosylase-deficient strain. A majority of mutations were at G-C pairs. In the ung1 strain, C-G to T-A transitions were found almost exclusively, while a mixture of transitions with 12% transversions was characteristic in the wild-type strain. In the ung1 strain mutations that could have originated from deamination of the transcribed stand were found more frequently. In the wild-type strain, the strand bias was reversed. DGYW/WRCH motifs were preferential sites of mutations. Conclusion The results are consistent with the hypothesis that AID-mediated deamination of DNA is a major cause of mutations at G-C base pairs in immunoglobulin genes during SHM. The sequence contexts of mutations in yeast induced by AID and those of somatic mutations at G-C pairs in immunoglobulin genes are significantly similar. This indicates that the intrinsic substrate specificity of AID itself is a primary determinant of mutational hotspots at G

  2. Association of ADH and ALDH Genes With Alcohol Dependence in the Irish Affected Sib Pair Study of Alcohol Dependence (IASPSAD) Sample

    Science.gov (United States)

    Kuo, Po-Hsiu; Kalsi, Gursharan; Prescott, Carol A.; Hodgkinson, Colin A.; Goldman, David; van den Oord, Edwin J.; Alexander, Jeffry; Jiang, Cizhong; Sullivan, Patrick F.; Patterson, Diana G.; Walsh, Dermot; Kendler, Kenneth S.; Riley, Brien P.

    2008-01-01

    Background: The genes coding for ethanol metabolism enzymes [alcohol dehydrogenase (ADH) and aldehyde dehydrogenase (ALDH)] have been widely studied for their influence on the risk to develop alcohol dependence (AD). However, the relation between polymorphisms of these metabolism genes and AD in Caucasian subjects has not been clearly established. The present study examined evidence for the association of alcohol metabolism genes with AD in the Irish Affected Sib Pair Study of alcohol dependence. Methods: We conducted a case–control association study with 575 independent subjects who met Diagnostic and Statistical Manual of Mental Disorders, 4th Edition, AD diagnosis and 530 controls. A total of 77 single nucleotide polymorphisms (SNPs) in the seven ADH (ADH1-7) and two ALDH genes (ALDH1A1 and ALDH2) were genotyped using the Illumina GoldenGate protocols. Several statistical procedures were implemented to control for false discoveries. Results: All markers with minor allele frequency greater than 0.01 were in Hardy–Weinberg equilibrium. Numerous SNPs in ADH genes showed association with AD, including one marker in the coding region of ADH1C (rs1693482 in exon6, Ile271Gln). Haplotypic association was observed in the ADH5 and ADH1C genes, and in a long haplotype block formed by the ADH1A and ADH1B loci. We detected two significant interactions between pairs of markers in intron 6 of ADH6 and intron 12 of ALDH2 (p = 5 × 10−5), and 5′ of both ADH4 and ADH1A (p = 2 × 10−4). Conclusion: We found evidence for the association of several ADH genes with AD in a sample of Western European origin. The significant interaction effects between markers in ADH and ALDH genes suggest possible epistatic roles between alcohol metabolic enzymes in the risk for AD. PMID:18331377

  3. Bridging cancer biology with the clinic: relative expression of a GRHL2-mediated gene-set pair predicts breast cancer metastasis.

    Directory of Open Access Journals (Sweden)

    Xinan Yang

    Full Text Available Identification and characterization of crucial gene target(s that will allow focused therapeutics development remains a challenge. We have interrogated the putative therapeutic targets associated with the transcription factor Grainy head-like 2 (GRHL2, a critical epithelial regulatory factor. We demonstrate the possibility to define the molecular functions of critical genes in terms of their personalized expression profiles, allowing appropriate functional conclusions to be derived. A novel methodology, relative expression analysis with gene-set pairs (RXA-GSP, is designed to explore the potential clinical utility of cancer-biology discovery. Observing that Grhl2-overexpression leads to increased metastatic potential in vitro, we established a model assuming Grhl2-induced or -inhibited genes confer poor or favorable prognosis respectively for cancer metastasis. Training on public gene expression profiles of 995 breast cancer patients, this method prioritized one gene-set pair (GRHL2, CDH2, FN1, CITED2, MKI67 versus CTNNB1 and CTNNA3 from all 2717 possible gene-set pairs (GSPs. The identified GSP significantly dichotomized 295 independent patients for metastasis-free survival (log-rank tested p = 0.002; severe empirical p = 0.035. It also showed evidence of clinical prognostication in another independent 388 patients collected from three studies (log-rank tested p = 3.3e-6. This GSP is independent of most traditional prognostic indicators, and is only significantly associated with the histological grade of breast cancer (p = 0.0017, a GRHL2-associated clinical character (p = 6.8e-6, Spearman correlation, suggesting that this GSP is reflective of GRHL2-mediated events. Furthermore, a literature review indicates the therapeutic potential of the identified genes. This research demonstrates a novel strategy to integrate both biological experiments and clinical gene expression profiles for extracting and elucidating the genomic

  4. Obesity induced by a pair-fed high fat sucrose diet: methylation and expression pattern of genes related to energy homeostasis

    Science.gov (United States)

    2010-01-01

    Background The expression of some genes controlling energy homeostasis could be regulated by epigenetic mechanisms that may play a role in body weight regulation. Thus, it is known that various nutritional factors affect DNA methylation. In order to assess whether the macronutrient composition of the diet could be related to the epigenetic regulation of gene expression and with obesity development, we investigated the effects on methylation and expression patterns of two pair-fed isocaloric diets in rats: control (rich in starch) and HFS (rich in fat and sucrose). Results The pair-fed HFS diet induced higher weight gain and adiposity as compared to the controls as well as liver triglyceride accumulation and oxidative stress. Feeding the HFS diet impaired glucose tolerance and serum triglycerides and cholesterol. Liver glucokinase expression, a key glycolytic gene, remained unaltered, as well as the mRNA values of fatty acid synthase and NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 6 (NDUFB6) in liver and visceral adipocytes, which regulate lipogenesis and mitochondrial oxidative metabolism, respectively. Liver expression of hydroxyacyl-coenzyme A dehydrogenase (HADHB), a key gene of β-oxidation pathway, was higher in the HFS-fed animals. However, the methylation status of CpG islands in HADHB and glucokinase genes remained unchanged after feeding the HFS diet. Conclusions These results confirm that the distribution and type of macronutrients (starch vs. sucrose, and percent of fat) influence obesity onset and the associated metabolic complications. HFS diets produce obesity independently of total energy intake, although apparently no epigenetic (DNA methylation) changes accompanied the modifications observed in gene expression. PMID:20534152

  5. Obesity induced by a pair-fed high fat sucrose diet: methylation and expression pattern of genes related to energy homeostasis

    Directory of Open Access Journals (Sweden)

    Campión Javier

    2010-06-01

    Full Text Available Abstract Background The expression of some genes controlling energy homeostasis could be regulated by epigenetic mechanisms that may play a role in body weight regulation. Thus, it is known that various nutritional factors affect DNA methylation. In order to assess whether the macronutrient composition of the diet could be related to the epigenetic regulation of gene expression and with obesity development, we investigated the effects on methylation and expression patterns of two pair-fed isocaloric diets in rats: control (rich in starch and HFS (rich in fat and sucrose. Results The pair-fed HFS diet induced higher weight gain and adiposity as compared to the controls as well as liver triglyceride accumulation and oxidative stress. Feeding the HFS diet impaired glucose tolerance and serum triglycerides and cholesterol. Liver glucokinase expression, a key glycolytic gene, remained unaltered, as well as the mRNA values of fatty acid synthase and NADH dehydrogenase (ubiquinone 1 beta subcomplex, 6 (NDUFB6 in liver and visceral adipocytes, which regulate lipogenesis and mitochondrial oxidative metabolism, respectively. Liver expression of hydroxyacyl-coenzyme A dehydrogenase (HADHB, a key gene of β-oxidation pathway, was higher in the HFS-fed animals. However, the methylation status of CpG islands in HADHB and glucokinase genes remained unchanged after feeding the HFS diet. Conclusions These results confirm that the distribution and type of macronutrients (starch vs. sucrose, and percent of fat influence obesity onset and the associated metabolic complications. HFS diets produce obesity independently of total energy intake, although apparently no epigenetic (DNA methylation changes accompanied the modifications observed in gene expression.

  6. Weight gain induced by an isocaloric pair-fed high fat diet: a nutriepigenetic study on FASN and NDUFB6 gene promoters.

    Science.gov (United States)

    Lomba, Almudena; Martínez, J Alfredo; García-Díaz, Diego F; Paternain, Laura; Marti, Amelia; Campión, Javier; Milagro, Fermín I

    2010-01-01

    Experimental studies have demonstrated that dietary macronutrient distribution plays an important role in insulin regulation, a risk factor associated to obesity, diabetes and other metabolic disorders. To assess whether the macronutrient composition of the diet could be related to obesity onset by affecting the epigenetic regulation of gene expression, we investigated in rats the metabolic effects of two pair-fed isocaloric diets: control (rich in carbohydrates) and high fat diet (rich in fat; HFD). Compared to controls, HFD induced higher weight gain and adiposity and impaired glucose tolerance, which was accompanied by a slight increase in adiponectin levels and liver steatosis. Epididymal adipose tissue expression of the fatty acid synthase (FASN) gene and NADH dehydrogenase (ubiquinone) 1β-subcomplex 6 (NDUFB6) were significantly reduced in HFD group. These variations in mRNA levels were accompanied by changes in the methylation patterns of several CpG islands located in the promoter region of these genes. However, no correlations were found between gene expression and the methylation status. These results suggest that high fat intake produces overweighted rats independently of total energy intake. These diets could also induce some epigenetic changes in the promoters of key genes that could influence gene expression and may be behind metabolic alterations.

  7. The protocadherin 11X/Y (PCDH11X/Y) gene pair as determinant of cerebral asymmetry in modern Homo sapiens.

    Science.gov (United States)

    Priddle, Thomas H; Crow, Timothy J

    2013-06-01

    Annett's right-shift theory proposes that human cerebral dominance (the functional and anatomical asymmetry or torque along the antero-posterior axis) and handedness are determined by a single "right-shift" gene. Familial transmission of handedness and specific deviations of cerebral dominance in sex chromosome aneuploidies implicate a locus within an X-Y homologous region of the sex chromosomes. The Xq21.3/Yp11.2 human-specific region of homology includes the protocadherin 11X/Y (PCDH11X/Y) gene pair, which encode cell adhesion molecules subject to accelerated evolution following the separation of the human and chimpanzee lineages six million years ago. PCDH11X and PCDH11Y, differentially regulated by retinoic acid, are highly expressed in the ventricular zone, subplate, and cortical plate of the developing cerebral cortex. Both proteins interact with β-catenin, a protein that plays a role in determining axis formation and regulating cortical size. In this way, the PCDH11X/Y gene pair determines cerebral asymmetry by initiating the right shift in Homo sapiens.

  8. A pair of two-component regulatory genes ecrA1/A2 in S. coelicolor

    Institute of Scientific and Technical Information of China (English)

    李永泉; 岑沛霖; 陈时飞; 吴凡; 郑静

    2004-01-01

    Two-component genes are kinds of genetic elements involved in regulation of antibiotic production in Streptomyces coelicolor. DNA microarray analysis revealed that ecrA1/A2, which mapped at distant sites from red locus and encode respectively the kinase and regulator, expressed coordinately with genes of Red specific biosynthetic pathway, ecrA1 and ecrA2 gene-disruptive mutants were constructed using homogenotisation by reciprocal double crossover. Fermentation data showed that the undecylprodigiosin (Red) level of production was lower than that of wild-type strain. However, the change of the actinorhodin (Act) production level was not significant compared with wild type. Thus, these experiment results confirmed that the two-component system ecrA 1/A2 was positive regulatory element for red gene cluster.

  9. A pair of two-component regulatory genes ecrA1/A2 in S.coelicolor

    Institute of Scientific and Technical Information of China (English)

    李永泉; 岑沛霖; 陈时飞; 吴丹; 郑静

    2004-01-01

    Two-component genes are kinds of genetic elements involved in regulation of antibiotic production in Streptomyces coelicolor. DNA microarray analysis revealed that ecrA1/A2, which mapped at distant sites from red locus and encode respectively the kinase and regulator, expressed coordinately with genes of Red specific biosynthetic pathway, ecrA1 and ecrA2 gene-disruptive mutants were constructed using homogenotisation by reciprocal double crossover. Fermentation data showed that the undecylprodigiosin (Red) level of production was lower than that of wild-type strain. However, the change of the actinorhodin (Act) production level was not significant compared with wild type. Thus, these experiment results confirmed that the two-component system ecrA 1/A2 was positive regulatory element for red gene cluster.

  10. Computer-aided codon-pairs deoptimization of the major envelope GP5 gene attenuates porcine reproductive and respiratory syndrome virus.

    Science.gov (United States)

    Ni, Yan-Yan; Zhao, Zhao; Opriessnig, Tanja; Subramaniam, Sakthivel; Zhou, Lei; Cao, Dianjun; Cao, Qian; Yang, Hanchun; Meng, Xiang-Jin

    2014-02-01

    Synthetic attenuated virus engineering (SAVE) is an emerging technology that enables rapid attenuation of viruses. In this study, by using SAVE we demonstrated rapid attenuation of an arterivirus, porcine reproductive and respiratory syndrome virus (PRRSV). The major envelope GP5 gene of PRRSV was codon-pair deoptimized aided by a computer algorithm. The codon-pair deoptimized virus, designated as SAVE5 with a deoptimized GP5 gene, was successfully rescued in vitro. The SAVE5 virus replicated at a lower level in vitro with a significant decrease of GP5 protein expression compared to the wild-type PRRSV VR2385 virus. Pigs experimentally infected with the SAVE5 virus had significantly lower viremia level up to 14 days post-infection as well as significantly reduced gross and histological lung lesions when compared to wild-type PRRSV VR2385 virus-infected pigs, indicating the attenuation of the SAVE5 virus. This study proved the feasibility of rapidly attenuating PRRSV by SAVE.

  11. Meiotic pairing and gene expression disturbance in germ cells from an infertile boar with a balanced reciprocal autosome-autosome translocation.

    Science.gov (United States)

    Barasc, Harmonie; Congras, Annabelle; Mary, Nicolas; Trouilh, Lidwine; Marquet, Valentine; Ferchaud, Stéphane; Raymond-Letron, Isabelle; Calgaro, Anne; Loustau-Dudez, Anne-Marie; Mouney-Bonnet, Nathalie; Acloque, Hervé; Ducos, Alain; Pinton, Alain

    2016-12-01

    Individuals carrying balanced constitutional reciprocal translocations generally have a normal phenotype, but often present reproductive disorders. The aim of our research was to analyze the meiotic process in an oligoasthenoteratospermic boar carrying an asymmetric reciprocal translocation involving chromosomes 1 and 14. Different multivalent structures (quadrivalent and trivalent plus univalent) were identified during chromosome pairing analysis. Some of these multivalents were characterized by the presence of unpaired autosomal segments with histone γH2AX accumulation sometimes associated with the XY body. Gene expression in spermatocytes was studied by RNA-DNA-FISH and microarray-based testis transcriptome analysis. Our results revealed a decrease in gene expression for chromosomes 1 and 14 and an up-regulated expression of X-chromosome genes for the translocated boar compared with normal individuals. We hypothesized that the observed meiotic arrest and reproductive failure in this boar might be due to silencing of crucial autosomal genes (MSUC) and disturbance of meiotic sex chromosome inactivation (MSCI). Further analysis revealed abnormal meiotic recombination (frequency and distribution) and the production of a high rate of unbalanced spermatozoa.

  12. Germline cell death is inhibited by P-element insertions disrupting the dcp-1/pita nested gene pair in Drosophila.

    Science.gov (United States)

    Laundrie, Bonni; Peterson, Jeanne S; Baum, Jason S; Chang, Jeffrey C; Fileppo, Dana; Thompson, Sharona R; McCall, Kimberly

    2003-12-01

    Germline cell death in Drosophila oogenesis is controlled by distinct signals. The death of nurse cells in late oogenesis is developmentally regulated, whereas the death of egg chambers during mid-oogenesis is induced by environmental stress or developmental abnormalities. P-element insertions in the caspase gene dcp-1 disrupt both dcp-1 and the outlying gene, pita, leading to lethality and defective nurse cell death in late oogenesis. By isolating single mutations in the two genes, we have found that the loss of both genes contributes to this ovary phenotype. Mutants of pita, which encodes a C2H2 zinc-finger protein, are homozygous lethal and show dumpless egg chambers and premature nurse cell death in germline clones. Early nurse cell death is not observed in the dcp-1/pita double mutants, suggesting that dcp-1+ activity is required for the mid-oogenesis cell death seen in pita mutants. dcp-1 mutants are viable and nurse cell death in late oogenesis occurs normally. However, starvation-induced germline cell death during mid-oogenesis is blocked, leading to a reduction and inappropriate nuclear localization of the active caspase Drice. These findings suggest that the combinatorial loss of pita and dcp-1 leads to the increased survival of abnormal egg chambers in mutants bearing the P-element alleles and that dcp-1 is essential for cell death during mid-oogenesis.

  13. A sib-pair analysis study of 15 candidate genes in French families with morbid obesity: indication for linkage with islet 1 locus on chromosome 5q.

    Science.gov (United States)

    Clément, K; Dina, C; Basdevant, A; Chastang, N; Pelloux, V; Lahlou, N; Berlan, M; Langin, D; Guy-Grand, B; Froguel, P

    1999-02-01

    As part of an ongoing search for susceptibility genes in obese families, we performed linkage analyses in 101 French families between qualitative and quantitative traits related to morbid obesity and polymorphisms located in or near 15 candidate genes whose products are involved in body weight regulation. These included cholecystokinin A and B receptors (CCK-AR and CCK-BR), glucagon-like peptide 1 receptor (GLP-1R), the LIM/homeodomain islet-1 gene (Isl-1), the caudal-type homeodomain 3 (CDX-3), the uncoupling protein 1 (UCP-1), the beta3-adrenoceptor (beta3-AR), the fatty acid-binding protein 2 (FABP-2), the hormone-sensitive lipase (HSL), the lipoprotein lipase (LPL), the apoprotein-C2 (apo-C2), the insulin receptor substrate-1 (IRS-1), the peroxisome proliferator-activated receptor-gamma (PPAR-gamma), tumor necrosis factor-alpha (TNF-alpha), and the liver carnitine palmitoyltransferase-1 (CPT-1). Phenotypes related to obesity such as BMI, adult life body weight gain, fasting leptin, insulin, fasting glycerol, and free fatty acids were used for nonparametric sib-pair analyses. A weak indication for linkage was obtained between the Isl-1 locus and obesity status defined by a z score over one SD of BMI (n = 226 sib pairs, pi = 0.54 +/- 0.02, P = 0.03). Moreover, a suggestive indication for linkage was found between the Isl-1 locus and BMI and leptin values (P = 0.001 and 0.0003, respectively) and leptin adjusted for BMI (P = 0.0001). Multipoint analyses for leptin trait with Isl-1 and two flanking markers (D5S418 and D5S407) showed that the logarithm of odds (LOD) score is 1.73, coinciding with the Isl-1 locus. Although marginally positive indications for linkage in subgroups of families were found with IRS-1, CPT-1, and HSL loci, our data suggested that these genes are not major contributors to obesity. Whether an obesity susceptibility gene (Isl-1 itself or another nearby gene) lies on chromosome 5q should be determined by further analyses.

  14. Microphthalmia in Texel sheep is associated with a missense mutation in the paired-like homeodomain 3 (PITX3) gene.

    Science.gov (United States)

    Becker, Doreen; Tetens, Jens; Brunner, Adrian; Bürstel, Daniela; Ganter, Martin; Kijas, James; Drögemüller, Cord

    2010-01-13

    Microphthalmia in sheep is an autosomal recessive inherited congenital anomaly found within the Texel breed. It is characterized by extremely small or absent eyes and affected lambs are absolutely blind. For the first time, we use a genome-wide ovine SNP array for positional cloning of a Mendelian trait in sheep. Genotyping 23 cases and 23 controls using Illumina's OvineSNP50 BeadChip allowed us to localize the causative mutation for microphthalmia to a 2.4 Mb interval on sheep chromosome 22 by association and homozygosity mapping. The PITX3 gene is located within this interval and encodes a homeodomain-containing transcription factor involved in vertebrate lens formation. An abnormal development of the lens vesicle was shown to be the primary event in ovine microphthalmia. Therefore, we considered PITX3 a positional and functional candidate gene. An ovine BAC clone was sequenced, and after full-length cDNA cloning the PITX3 gene was annotated. Here we show that the ovine microphthalmia phenotype is perfectly associated with a missense mutation (c.338G>C, p.R113P) in the evolutionary conserved homeodomain of PITX3. Selection against this candidate causative mutation can now be used to eliminate microphthalmia from Texel sheep in production systems. Furthermore, the identification of a naturally occurring PITX3 mutation offers the opportunity to use the Texel as a genetically characterized large animal model for human microphthalmia.

  15. Microphthalmia in Texel sheep is associated with a missense mutation in the paired-like homeodomain 3 (PITX3 gene.

    Directory of Open Access Journals (Sweden)

    Doreen Becker

    Full Text Available Microphthalmia in sheep is an autosomal recessive inherited congenital anomaly found within the Texel breed. It is characterized by extremely small or absent eyes and affected lambs are absolutely blind. For the first time, we use a genome-wide ovine SNP array for positional cloning of a Mendelian trait in sheep. Genotyping 23 cases and 23 controls using Illumina's OvineSNP50 BeadChip allowed us to localize the causative mutation for microphthalmia to a 2.4 Mb interval on sheep chromosome 22 by association and homozygosity mapping. The PITX3 gene is located within this interval and encodes a homeodomain-containing transcription factor involved in vertebrate lens formation. An abnormal development of the lens vesicle was shown to be the primary event in ovine microphthalmia. Therefore, we considered PITX3 a positional and functional candidate gene. An ovine BAC clone was sequenced, and after full-length cDNA cloning the PITX3 gene was annotated. Here we show that the ovine microphthalmia phenotype is perfectly associated with a missense mutation (c.338G>C, p.R113P in the evolutionary conserved homeodomain of PITX3. Selection against this candidate causative mutation can now be used to eliminate microphthalmia from Texel sheep in production systems. Furthermore, the identification of a naturally occurring PITX3 mutation offers the opportunity to use the Texel as a genetically characterized large animal model for human microphthalmia.

  16. Atrophic dermatofibrosarcoma protuberans with the fusion gene COL1A1-PDGFB detected by RT-PCR using only a single primer pair.

    Science.gov (United States)

    Xu, Wen-Jun; Wang, Ju-Sheng

    2015-01-01

    Dermatofibrosarcoma protuberans (DFSPs) is an uncommon dermal tumor of intermediate to low-grade malignancy. A few patients have clinically persistent plaques that might be atrophic, and they are difficult to be diagnosed clinically. With the development of cytogenetic and molecular biology techniques, the detection of fusion transcripts of the collagen type 1a1 (COL1A1) and platelet-derived growth factor-BB (PDGFB) genes has been recognized as a reliable and valuable molecular tool for the diagnosis of DFSPs. We reported a 24-year-old woman who had a 2 years history of atrophic DFSPs, and detected the gene fusion between COL1A1 to PDGFB by one-step method of RT-PCR using only a single primer pair. The gene fusion detected by this rapid and efficient one-step method in our patient appears to be the first report of atrophic DFSPs, and we detected a novel COL1A1 breakpoint between exon 2 and exon 3.

  17. Light and auxin responsive cytochrome P450s from Withania somnifera Dunal: cloning, expression and molecular modelling of two pairs of homologue genes with differential regulation.

    Science.gov (United States)

    Srivastava, Sudhakar; Sangwan, Rajender Singh; Tripathi, Sandhya; Mishra, Bhawana; Narnoliya, L K; Misra, L N; Sangwan, Neelam S

    2015-11-01

    Cytochrome P450s (CYPs) catalyse a wide variety of oxygenation/hydroxylation reactions that facilitate diverse metabolic functions in plants. Specific CYP families are essential for the biosynthesis of species-specialized metabolites. Therefore, we investigated the role of different CYPs related to secondary metabolism in Withania somnifera, a medicinally important plant of the Indian subcontinent. In this study, complete complementary DNAs (cDNAs) of four different CYP genes were isolated and christened as WSCYP93Id, WSCYP93Sm, WSCYP734B and WSCYP734R. These cDNAs encoded polypeptides comprising of 498, 496, 522 and 550 amino acid residues with their deduced molecular mass of 56.7, 56.9, 59.4 and 62.2 kDa, respectively. Phylogenetic study and molecular modelling analysis of the four cloned WSCYPs revealed their categorization into two CYP families (CYP83B1 and CYP734A1) belonging to CYP71 and CYP72 clans, respectively. BLASTp searches showed similarity of 75 and 56 %, respectively, between the two CYP members of CYP83B1 and CYP734A1 with major variances exhibited in their N-terminal regions. The two pairs of homologues exhibited differential expression profiles in the leaf tissues of selected chemotypes of W. somnifera as well as in response to treatments such as methyl jasmonate, wounding, light and auxin. Light and auxin regulated two pairs of WSCYP homologues in a developing seedling in an interesting differential manner. Their lesser resemblance and homology with other CYP sequences suggested these genes to be more specialized and distinct ones. The results on chemotype-specific expression patterns of the four genes strongly suggested their key/specialized involvement of the CYPs in the biosynthesis of chemotype-specific metabolites, though their further biochemical characterization would reveal the specificity in more detail. It is revealed that WSCYP93Id and WSCYP93Sm may be broadly involved in the oxygenation reactions in the plant and, thereby, control

  18. Association Between Interleukin 4 Gene Seventy-Base-Pair Variable Number of Tandem Repeats Polymorphism and Uterine Leiomyoma

    Directory of Open Access Journals (Sweden)

    Salimi

    2014-06-01

    Full Text Available Background Uterine Leiomyoma (UL is the most common gynecological tumor and a public health problem. Higher serum interleukin 4 (IL-4 level, as an anti-inflammatory cytokine that regulates TH1/TH2 cells balance, has been observed in the uterine cavity. Objectives The aim of this study was to investigate the association between IL4 gene variable number of tandem repeats (VNTR polymorphism and the risk of UL in southeast of Iran. Patients and Methods We compared of 99 patients with UL with that of 102 healthy controls. The IL4 VNTR polymorphism was genotyped by gel electrophoresis after PCR amplification. Results There was no significant association between RP*1/RP*2 and RP*2/RP*2 genotypes and UL; however, a significant association between RP*2/RP*2 genotype and UL was found after adjustment for age (OR, 4; 95% CI, 1.3-12.4; and P = 0.015. The frequency of RP*2 allele was significantly higher in women with UL (OR, 1.9; 95% CI, 1.1-3.5; and P = 0.03. Conclusions The IL4 VNTR RP*2/RP*2 genotype could be an age-related risk factor for UL. Moreover, the frequency of RP*2 allele was significantly higher in women with UL.

  19. The Wnt and Delta-Notch signalling pathways interact to direct pair-rule gene expression via caudal during segment addition in the spider Parasteatoda tepidariorum.

    Science.gov (United States)

    Schönauer, Anna; Paese, Christian L B; Hilbrant, Maarten; Leite, Daniel J; Schwager, Evelyn E; Feitosa, Natália Martins; Eibner, Cornelius; Damen, Wim G M; McGregor, Alistair P

    2016-07-01

    In short-germ arthropods, posterior segments are added sequentially from a segment addition zone (SAZ) during embryogenesis. Studies in spiders such as Parasteatoda tepidariorum have provided insights into the gene regulatory network (GRN) underlying segment addition, and revealed that Wnt8 is required for dynamic Delta (Dl) expression associated with the formation of new segments. However, it remains unclear how these pathways interact during SAZ formation and segment addition. Here, we show that Delta-Notch signalling is required for Wnt8 expression in posterior SAZ cells, but represses the expression of this Wnt gene in anterior SAZ cells. We also found that these two signalling pathways are required for the expression of the spider orthologues of even-skipped (eve) and runt-1 (run-1), at least in part via caudal (cad). Moreover, it appears that dynamic expression of eve in this spider does not require a feedback loop with run-1, as is found in the pair-rule circuit of the beetle Tribolium Taken together, our results suggest that the development of posterior segments in Parasteatoda is directed by dynamic interactions between Wnt8 and Delta-Notch signalling that are read out by cad, which is necessary but probably not sufficient to regulate the expression of eve and run-1 Our study therefore provides new insights towards better understanding the evolution and developmental regulation of segmentation in other arthropods, including insects.

  20. A study of 45,X/46,XX mosaicism in Turner syndrome females: a novel primer pair for the (CAG)n repeat within the androgen receptor gene.

    Science.gov (United States)

    Leonova, J; Hanson, C

    1999-01-01

    This paper describes the procedures developed for the determining of diparental/uniparental origin of X chromosomes in mosaic Turner females (karyotype 45,X/46,XX), and accounts for results of the analysis of chromosomal material from 20 girls with Turner syndrome. An (CAG)n repeat within the androgen receptor (AR) gene was selected as a genetic marker. A novel primer pair for amplification of the (CAG)12-30 repeat was designed. These primers gave an amplification product of 338 bp in length and were following (5'-->3'): agttagggctgggaagggtc and cggctgtgaaggttgctgt. Nineteen of the subjects were heterozygous for the selected marker. In 4 cases there were distinct signals from three alleles. The only Turner female in the study who had been previously ascribed a non-mosaic 45,X karyotype by using cytogenetic techniques, proved to be a cryptic mosaic, displaying two alleles of the genetic marker in the more sensitive molecular assay. These results suggest that in most cases 45,X/46,XX mosaicism in Turner females arises through loss of one of the X chromosomes in some cell lines in originally 46,XX conceptuses, rather than through mitotic non-disjunction during early embryogenesis in originally 45,X conceptuses. A high sensitivity of the modified assay based on PCR-amplification of the (CAG)n repeat within AR gene proves its usefulness as a tool for studying mosaicism in Turner syndrome.

  1. Comparative Genomics Integrated with Association Analysis Identifies Candidate Effector Genes Corresponding to Lr20 in Phenotype-Paired Puccinia triticina Isolates from Australia

    Science.gov (United States)

    Wu, Jing Qin; Sakthikumar, Sharadha; Dong, Chongmei; Zhang, Peng; Cuomo, Christina A.; Park, Robert F.

    2017-01-01

    Leaf rust is one of the most common and damaging diseases of wheat, and is caused by an obligate biotrophic basidiomycete, Puccinia triticina (Pt). In the present study, 20 Pt isolates from Australia, comprising 10 phenotype-matched pairs with contrasting pathogenicity for Lr20, were analyzed using whole genome sequencing. Compared to the reference genome of the American Pt isolate 1-1 BBBD Race 1, an average of 404,690 single nucleotide polymorphisms (SNPs) per isolate was found and the proportion of heterozygous SNPs was above 87% in the majority of the isolates, demonstrating a high level of polymorphism and a high rate of heterozygosity. From the genome-wide SNPs, a phylogenetic tree was inferred, which consisted of a large clade of 15 isolates representing diverse presumed clonal lineages including 14 closely related isolates and the more diverged isolate 670028, and a small clade of five isolates characterized by lower heterozygosity level. Principle component analysis detected three distinct clusters, corresponding exactly to the two major subsets of the small clade and the large clade comprising all 15 isolates without further separation of isolate 670028. While genome-wide association analysis identified 302 genes harboring at least one SNP associated with Lr20 virulence (p epigenetics and small RNA in Pt pathogenicity. Future studies are thus warranted to investigate the biological functions of the candidate effectors as well as the gene regulation mechanisms at epigenetic and post-transcription levels. Our study is the first to integrate phenotype-genotype association with effector prediction in Pt genomes, an approach that may circumvent some of the technical difficulties in working with obligate rust fungi and accelerate avirulence gene identification. PMID:28232843

  2. prx-1 functions cooperatively with another paired-related homeobox gene, prx-2, to maintain cell fates within the craniofacial mesenchyme.

    Science.gov (United States)

    Lu, M F; Cheng, H T; Kern, M J; Potter, S S; Tran, B; Diekwisch, T G; Martin, J F

    1999-02-01

    The paired-related homeobox gene, prx-1, is expressed in the postmigratory cranial mesenchyme of all facial prominences and is required for the formation of proximal first arch derivatives. We introduced lacZ into the prx-1 locus to study the developmental fate of cells destined to express prx-1 in the prx-1 mutant background. lacZ was normally expressed in prx-1(neo); prx-1(lacZ )mutant craniofacial mesenchyme up until 11.5 d.p.c. At later time points, lacZ expression was lost from structures that are defective in the prx-1(neo) mutant mice. A related gene, prx-2, demonstrated overlapping expression with prx-1. To test the idea that prx-1 and prx-2 perform redundant functions, we generated prx-1(neo;)prx-2 compound mutant mice. Double mutant mice had novel phenotypes in which the rostral aspect of the mandible was defective, the mandibular incisor arrested as a single, bud-stage tooth germ and Meckel's cartilage was absent. Expression of two markers for tooth development, pax9 and patched, were downregulated. Using a transgene that marks a subset of prx-1-expressing cells in the craniofacial mesenchyme, we showed that cells within the hyoid arch take on the properties of the first branchial arch. These data suggest that prx-1 and prx-2 coordinately regulate gene expression in cells that contribute to the distal aspects of the mandibular arch mesenchyme and that prx-1 and prx-2 play a role in the maintenance of cell fate within the craniofacial mesenchyme.

  3. Conserved regulation of p53 network dosage by microRNA-125b occurs through evolving miRNA-target gene pairs.

    Directory of Open Access Journals (Sweden)

    Minh T N Le

    2011-09-01

    Full Text Available MicroRNAs regulate networks of genes to orchestrate cellular functions. MiR-125b, the vertebrate homologue of the Caenorhabditis elegans microRNA lin-4, has been implicated in the regulation of neural and hematopoietic stem cell homeostasis, analogous to how lin-4 regulates stem cells in C. elegans. Depending on the cell context, miR-125b has been proposed to regulate both apoptosis and proliferation. Because the p53 network is a central regulator of both apoptosis and proliferation, the dual roles of miR-125b raise the question of what genes in the p53 network might be regulated by miR-125b. By using a gain- and loss-of-function screen for miR-125b targets in humans, mice, and zebrafish and by validating these targets with the luciferase assay and a novel miRNA pull-down assay, we demonstrate that miR-125b directly represses 20 novel targets in the p53 network. These targets include both apoptosis regulators like Bak1, Igfbp3, Itch, Puma, Prkra, Tp53inp1, Tp53, Zac1, and also cell-cycle regulators like cyclin C, Cdc25c, Cdkn2c, Edn1, Ppp1ca, Sel1l, in the p53 network. We found that, although each miRNA-target pair was seldom conserved, miR-125b regulation of the p53 pathway is conserved at the network level. Our results lead us to propose that miR-125b buffers and fine-tunes p53 network activity by regulating the dose of both proliferative and apoptotic regulators, with implications for tissue stem cell homeostasis and oncogenesis.

  4. KIR gene variability in cutaneous malignant melanoma: influence of KIR2D/HLA-C pairings on disease susceptibility and prognosis.

    Science.gov (United States)

    Campillo, José A; Legaz, Isabel; López-Álvarez, M Rocío; Bolarín, José Miguel; Las Heras, Beatriz; Muro, Manuel; Minguela, Alfredo; Moya-Quiles, María R; Blanco-García, Rosa; Martínez-Banaclocha, Helios; García-Alonso, Ana M; Alvarez-López, M Rocío; Martínez-Escribano, Jorge A

    2013-05-01

    Natural killer and CD8(+) T cells are believed to be involved in the immune protection against melanoma. Their function may be regulated by a group of receptors defined as killer immunoglobulin-like receptors (KIRs) and their cognate HLA class I ligands. In this study, we analyzed the influence of KIR genes and KIR/HLA-I combinations on melanoma susceptibility and/or prognosis in a Spanish Caucasian population. For this purpose, KIR genotyping by PCR-SSP and HLA-C genotyping by reverse PCR-SSO were performed in 187 melanoma patients and 200 matched controls. We found a significantly low frequency of KIR2DL3 in nodular melanoma (NM) patients (P = 0.001) and in ulcerated melanoma patients (P < 0.0001). Similarly, the KIR2DL3/C1 combination was significantly decreased in melanoma patients (Pc = 0.008) and in patients with sentinel lymph node (SLN) melanoma metastasis (Pc = 0.002). Multivariate logistic regression models showed that KIR2DL3 behaves as a protective marker for NM and ulcerated melanoma (P = 0.02, odds ratio (OR) = 0.14 and P = 0.04, OR = 0.28, respectively), whereas the KIR2DL3/C1 pair acts as a protective marker for melanoma (P = 0.017, OR = 0.54), particularly superficial spreading melanoma (P = 0.02, OR = 0.52), and SLN metastasis (P = 0.0004, OR = 0.14). In contrast, the KIR2DL3(-)/C1C2 genotype seems to be correlated with NM and ulceration. We also report that the KIR2DL1(+)/S1(-)/C2C2 genotype is associated with susceptibility to melanoma and SLN metastasis. Altogether, the study of KIR2D genes and HLA-C ligands may help in assessing cutaneous melanoma risk and prognosis.

  5. Pairing Learners in Pair Work Activity

    Science.gov (United States)

    Storch, Neomy; Aldosari, Ali

    2013-01-01

    Although pair work is advocated by major theories of second language (L2) learning and research findings suggest that pair work facilitates L2 learning, what is unclear is how to best pair students in L2 classes of mixed L2 proficiency. This study investigated the nature of pair work in an English as a Foreign Language (EFL) class in a college in…

  6. Cluster of genes that encode positive and negative elements influencing filament length in a heterocyst-forming cyanobacterium.

    Science.gov (United States)

    Merino-Puerto, Victoria; Herrero, Antonia; Flores, Enrique

    2013-09-01

    The filamentous, heterocyst-forming cyanobacteria perform oxygenic photosynthesis in vegetative cells and nitrogen fixation in heterocysts, and their filaments can be hundreds of cells long. In the model heterocyst-forming cyanobacterium Anabaena sp. strain PCC 7120, the genes in the fraC-fraD-fraE operon are required for filament integrity mainly under conditions of nitrogen deprivation. The fraC operon transcript partially overlaps gene all2395, which lies in the opposite DNA strand and ends 1 bp beyond fraE. Gene all2395 produces transcripts of 1.35 kb (major transcript) and 2.2 kb (minor transcript) that overlap fraE and whose expression is dependent on the N-control transcription factor NtcA. Insertion of a gene cassette containing transcriptional terminators between fraE and all2395 prevented production of the antisense RNAs and resulted in an increased length of the cyanobacterial filaments. Deletion of all2395 resulted in a larger increase of filament length and in impaired growth, mainly under N2-fixing conditions and specifically on solid medium. We denote all2395 the fraF gene, which encodes a protein restricting filament length. A FraF-green fluorescent protein (GFP) fusion protein accumulated significantly in heterocysts. Similar to some heterocyst differentiation-related proteins such as HglK, HetL, and PatL, FraF is a pentapeptide repeat protein. We conclude that the fraC-fraD-fraE←fraF gene cluster (where the arrow indicates a change in orientation), in which cis antisense RNAs are produced, regulates morphology by encoding proteins that influence positively (FraC, FraD, FraE) or negatively (FraF) the length of the filament mainly under conditions of nitrogen deprivation. This gene cluster is often conserved in heterocyst-forming cyanobacteria.

  7. Mutations in the paired domain of the human PAX3 gene cause Klein-Waardenburg syndrome (WS-III) as well as Waardenburg syndrome type I (WS-I)

    Energy Technology Data Exchange (ETDEWEB)

    Hoth, C.F.; Milunsky, A.; Lipsky, N.; Baldwin, C.T. (Boston Univ. School of Medicine, MA (United States)); Sheffer, R. (Hadassah-Hebrew Univ. Medical Center, Jerusalem (Israel)); Clarren, S.K. (Univ. of Washington School of Medicine, Seattle (United States))

    1993-03-01

    Waardenburg syndrome type I (WS-I) is an autosomal dominant disorder characterized by sensorineural hearing loss, dystopia canthorum, pigmentary disturbances, and other developmental defects. Klein-Waardenburg syndrome (WS-III) is a disorder with many of the same characteristics as WS-I and includes musculoskeletal abnormalities. The authors have recently reported the identification and characterization of one of the first gene defects, in the human PAX3 gene, which causes WS-I. PAX3 is a DNA-binding protein that contains a structural motif known as the paired domain and is believed to regulate the expression of other genes. In this report they describe two new mutations, in the human PAX3 gene, that are associated with WS. One mutation was found in a family with WS-I, while the other mutation was found in a family with WS-III. Both mutations were in the highly conserved paired domain of the human PAX3 gene and are similar to other mutations that cause WS. The results indicate that mutations in the PAX3 gene can cause both WS-I and WS-III. 36 refs., 4 figs.

  8. Expression of the pair-rule gene homologs runt, Pax3/7, even-skipped-1 and even-skipped-2 during larval and juvenile development of the polychaete annelid Capitella teleta does not support a role in segmentation

    Directory of Open Access Journals (Sweden)

    Seaver Elaine C

    2012-04-01

    Full Text Available Abstract Background Annelids and arthropods each possess a segmented body. Whether this similarity represents an evolutionary convergence or inheritance from a common segmented ancestor is the subject of ongoing investigation. Methods To investigate whether annelids and arthropods share molecular components that control segmentation, we isolated orthologs of the Drosophila melanogaster pair-rule genes, runt, paired (Pax3/7 and eve, from the polychaete annelid Capitella teleta and used whole mount in situ hybridization to characterize their expression patterns. Results When segments first appear, expression of the single C. teleta runt ortholog is only detected in the brain. Later, Ct-runt is expressed in the ventral nerve cord, foregut and hindgut. Analysis of Pax genes in the C. teleta genome reveals the presence of a single Pax3/7 ortholog. Ct-Pax3/7 is initially detected in the mid-body prior to segmentation, but is restricted to two longitudinal bands in the ventral ectoderm. Each of the two C. teleta eve orthologs has a unique and complex expression pattern, although there is partial overlap in several tissues. Prior to and during segment formation, Ct-eve1 and Ct-eve2 are both expressed in the bilaterial pair of mesoteloblasts, while Ct-eve1 is expressed in the descendant mesodermal band cells. At later stages, Ct-eve2 is expressed in the central and peripheral nervous system, and in mesoderm along the dorsal midline. In late stage larvae and adults, Ct-eve1 and Ct-eve2 are expressed in the posterior growth zone. Conclusions C. teleta eve, Pax3/7 and runt homologs all have distinct expression patterns and share expression domains with homologs from other bilaterians. None of the pair-rule orthologs examined in C. teleta exhibit segmental or pair-rule stripes of expression in the ectoderm or mesoderm, consistent with an independent origin of segmentation between annelids and arthropods.

  9. Powered Tate Pairing Computation

    Science.gov (United States)

    Kang, Bo Gyeong; Park, Je Hong

    In this letter, we provide a simple proof of bilinearity for the eta pairing. Based on it, we show an efficient method to compute the powered Tate pairing as well. Although efficiency of our method is equivalent to that of the Tate pairing on the eta pairing approach, but ours is more general in principle.

  10. Pairings on hyperelliptic curves

    CERN Document Server

    Balakrishnan, Jennifer; Chisholm, Sarah; Eisentraeger, Kirsten; Stange, Katherine; Teske, Edlyn

    2009-01-01

    We assemble and reorganize the recent work in the area of hyperelliptic pairings: We survey the research on constructing hyperelliptic curves suitable for pairing-based cryptography. We also showcase the hyperelliptic pairings proposed to date, and develop a unifying framework. We discuss the techniques used to optimize the pairing computation on hyperelliptic curves, and present many directions for further research.

  11. Nearly complete rRNA genes assembled from across the metazoan animals: effects of more taxa, a structure-based alignment, and paired-sites evolutionary models on phylogeny reconstruction.

    Science.gov (United States)

    Mallatt, Jon; Craig, Catherine Waggoner; Yoder, Matthew J

    2010-04-01

    This study (1) uses nearly complete rRNA-gene sequences from across Metazoa (197 taxa) to reconstruct animal phylogeny; (2) presents a highly annotated, manual alignment of these sequences with special reference to rRNA features including paired sites (http://purl.oclc.org/NET/rRNA/Metazoan_alignment) and (3) tests, after eliminating as few disruptive, rogue sequences as possible, if a likelihood framework can recover the main metazoan clades. We found that systematic elimination of approximately 6% of the sequences, including the divergent or unstably placed sequences of cephalopods, arrowworm, symphylan and pauropod myriapods, and of myzostomid and nemertodermatid worms, led to a tree that supported Ecdysozoa, Lophotrochozoa, Protostomia, and Bilateria. Deuterostomia, however, was never recovered, because the rRNA of urochordates goes (nonsignificantly) near the base of the Bilateria. Counterintuitively, when we modeled the evolution of the paired sites, phylogenetic resolution was not increased over traditional tree-building models that assume all sites in rRNA evolve independently. The rRNA genes of non-bilaterians contain a higher % AT than do those of most bilaterians. The rRNA genes of Acoela and Myzostomida were found to be secondarily shortened, AT-enriched, and highly modified, throwing some doubt on the location of these worms at the base of Bilateria in the rRNA tree--especially myzostomids, which other evidence suggests are annelids instead. Other findings are marsupial-with-placental mammals, arrowworms in Ecdysozoa (well supported here but contradicted by morphology), and Placozoa as sister to Cnidaria. Finally, despite the difficulties, the rRNA-gene trees are in strong concordance with trees derived from multiple protein-coding genes in supporting the new animal phylogeny.

  12. Microevolution between paired antral and paired antrum and corpus Helicobacter pylori isolates recovered from individual patients.

    Science.gov (United States)

    Carroll, Ian M; Ahmed, Niyaz; Beesley, Sarah M; Khan, Aleem A; Ghousunnissa, Sheikh; Moráin, Colm A O; Habibullah, C M; Smyth, Cyril J

    2004-07-01

    Sequence variations located at the signal sequence and mid-region within the vacA gene, the 3'-end of the cagA gene, the indel motifs at the 3'-end of the cag pathogenicity island and the regions upstream of the vacA and ribA genes were determined by PCR in 19 paired antral or antrum and corpus Helicobacter pylori isolates obtained at the same endoscopic session, and three antral pairs taken sequentially. Random amplification of polymorphic DNA (RAPD)-PCR and fluorescent amplified fragment length polymorphism (FAFLP)-PCR fingerprinting were applied to these paired clinical isolates. The FAFLP-PCR profiles generated were phylogenetically analysed. For the 22 paired isolates there were no differences within pairs at five of the genetic loci studied. However, six pairs of isolates (27%), of which four were antrum and corpus pairs, showed differences in the numbers of repeats located at the 3'-end of the cagA gene. RAPD-PCR fingerprinting showed that 16 (73%) pairs, nine of which were antrum and corpus pairs, possessed identical profiles, while six (27%) displayed distinctly different profiles, indicating mixed infections. Three of the six pairs showing differences at the 3'-end of the cagA gene yielded identical RAPD-PCR fingerprints. FAFLP-PCR fingerprinting and phylogenetic analysis revealed that all 16 pairs that displayed identical RAPD-PCR profiles had highly similar, but not identical, fingerprints, demonstrating that these pairs were ancestrally related but had undergone minor genomic alterations. Two antrum and corpus pairs of isolates, within the latter group, were isolates obtained from two siblings from the same family. This analysis demonstrated that each sibling was colonized by ancestrally related strains that exhibited differences in vacA genotype characteristics.

  13. Identification of a common reference gene pair for qPCR in human mesenchymal stromal cells from different tissue sources treated with VEGF

    DEFF Research Database (Denmark)

    Tratwal, Josefine; Follin, Bjarke; Ekblond, Annette

    2014-01-01

    on reference genes (RGs) for the normalization of qPCR data. RESULTS: BMSCs and ASCs were stimulated with vascular endothelial growth factor A-165 (VEGF) for one week, and compared with un-stimulated cells from the same donor. The stability of nine RGs through VEGF treatment as well as the donor variation...... gene, TBP, was found to be the most stable standalone gene, while TBP and YWHAZ were found to be the best two-RG combination for qPCR analyses for both BMSCs and ASCs through the VEGF stimulation. The presented stepwise elimination procedure was validated, while we found the final normalization...

  14. Casimir light: photon pairs.

    OpenAIRE

    1993-01-01

    Expressions are developed for weak single pair emission probability and strong emission average number of pairs. The water transparency cutoff is closely realized, showing that the fundamental time scale is even shorter.

  15. Ancestral Y-linked genes were maintained by translocation to the X and Y chromosomes fused to an autosomal pair in the Okinawa spiny rat Tokudaia muenninki.

    Science.gov (United States)

    Murata, Chie; Kuroki, Yoko; Imoto, Issei; Kuroiwa, Asato

    2016-09-01

    Two species of the genus Tokudaia lack the Y chromosome and SRY, but several Y-linked genes have been rescued by translocation or transposition to other chromosomes. Tokudaia muenninki is the only species in the genus that maintains the Y owing to sex chromosome-autosome fusions. According to previous studies, many SRY pseudocopies and other Y-linked genes have evolved by excess duplication in this species. Using RNA-seq and RT-PCR, we found that ZFY, EIF2S3Y, TSPY, UTY, DDX3Y, USP9Y, and RBMY, but not UBA1Y, had high deduced amino acid sequence similarity and similar expression patterns with other rodents, suggesting that these genes were functional. Based on FISH and quantitative real-time PCR, all of the genes except for UTY and DDX3Y were amplified on the X and Y chromosomes with approximately 10-66 copies in the male genome. In a comparative analysis of the 372.4-kb BAC sequence and Y-linked gene transcripts from T. muenninki with the mouse Y genomic sequence, we observed that multiple-copy genes in the ancestral Y genome were nonfunctional, indicating that the gene functions were assumed by amplified copies. We also found a LTR sequence at the distal end of a SRY duplication unit, suggesting that unequal sister chromatid exchange mediated by retrotransposable elements could have been involved in SRY amplification. Our results revealed that the Y-linked genes were rescued from degeneration via translocations to other sex chromosomal regions and amplification events in T. muenninki.

  16. A stabilized pairing functional

    CERN Document Server

    Erler, J; Reinhard, P --G

    2008-01-01

    We propose a modified pairing functional for nuclear structure calculations which avoids the abrupt phase transition between pairing and non-pairing states. The intended application is the description of nuclear collective motion where the smoothing of the transition is compulsory to remove singularities. The stabilized pairing functional allows a thoroughly variational formulation, unlike the Lipkin-Nogami (LN) scheme which is often used for the purpose of smoothing. First applications to nuclear ground states and collective excitations prove the reliability and efficiency of the proposed stabilized pairing.

  17. Investigation of mRNA expression of collagen genes in oral squamous cell carcinoma and paired normal tissue%胶原类基因mRNA在口腔鳞癌组织中的表达

    Institute of Scientific and Technical Information of China (English)

    吕晓智; 陈万涛; 张陈平

    2011-01-01

    Objective To investigate the mRNA expression of collagen genes in oral squamous cell carcinoma (OSCC) and paired normal oral mucosal tissue. Methods The differential mRNA expressions of collagen genes between 30 OSCC tissues and the paired normal oral mucosal tissues were detected by RT-PCR. Result The relative expression level of COL1 Al mRNA in the 30 cancerous tissues was up-regulated by 2.78 folds as compared with its expression in the paired normal samples, suggesting its significant overexpression in OSCC (P0.001). The expression levels of COL1A2, COL4A1, COL4A2, and COL5A2 mRNA in the cancerous tissues were up-regulated by 1.07, 1.15, 1.27, and 1.16 folds compared to those in paired normal samples (P>0.05). Conclusion COL1A1 mRNA overexpression may play an important role in the carcinogenesis of OSCC and can be a potential molecular marker of OSCC.%目的 研究胶原类基因COL1A1、COL1A2、COL4A1、COL4A2、COL5A2 mRNA在口腔鳞状细胞癌(OSCC)及配对正常口腔黏膜组织中的表达及意义.方法 采用RT-PCR方法检测30例OSCC患者肿瘤组织及其配对的正常口腔黏膜中胶原基因COL1A1、COL1A2、COL4A1、COL4A2、COL5A2 mRNA的表达;所得数据采用SAS6.12软件包进行t检验.结果 RT-PCR检测结果表明,COL1A1 mRNA在OSCC中的表达较其对照粘膜表达上调2.78倍(P0.05).结论 在OSCC癌变过程中,COL1A1 mRNA过表达,可能是OSCC的-个靶基因;COL1A1在OSCC分类诊断中有应用价值.

  18. Evidence for multiple promoters of the human IL-5 receptor alpha subunit gene: a novel 6-base pair element determines cell-specific promoter function.

    Science.gov (United States)

    Zhang, J; Kuvelkar, R; Cheewatrakoolpong, B; Williams, S; Egan, R W; Billah, M M

    1997-12-01

    In addition to a previously characterized promoter (P1), we now show the existence of a second promoter for the human IL-5Ralpha gene. Initially, a genomic region (P2) 5' upstream of human IL-5Ralpha exon 2 was cloned by an inverted PCR. The transcriptional start site was then mapped to a deoxycytidine (C) residue within P2 by analyzing cellular mRNA with both the 5' rapid amplification of cDNA end-PCR and S1 nuclease protection assays. Transfection of eosinophilic HL-60 cells with reporter gene constructs in which either P1 or P2 was linked to the bacterial chloramphenicol acetyltransferase (CAT) gene resulted in CAT expression; little or no CAT expression occurred in other myeloid and nonmyeloid cell lines. Deletion studies showed that a 66-bp region, ranging from -31 to +35, was sufficient to promote CAT expression in eosinophilic HL-60 cells. Analysis of linker-scanning mutants identified a novel 6-bp element (5' CTAATT 3') spanning -19 to -14 that was essential for P2 promoter activity. In electrophoretic mobility shift assays, a P2 region from -31 to +1 containing the unique 6-bp element, when used as a probe, formed a complex with a protein(s) that was found only in the eosinophilic cell line. This binding activity was lost upon replacement of the 6-bp element with a 6-bp linker, suggesting that this element likely serves as the binding site for an eosinophilic HL-60 cell-specific transcription factor(s). Together, these data suggest an important role for P2 promoter in the regulation of eosinophil-specific expression of the human IL-5 receptor alpha gene.

  19. A novel 3-base pair deletion of the CRYAA gene identified in a large Chinese pedigree featuring autosomal dominant congenital perinuclear cataract.

    Science.gov (United States)

    Kong, X D; Liu, N; Shi, H R; Dong, J M; Zhao, Z H; Liu, J; Li-Ling, J; Yang, Y X

    2015-01-23

    Congenital cataract is caused by reduced transparency of the lens resulting from metabolic disorders during the fetal period. The disease shows great heterogeneity both clinically and genetically. We identified a 4-generation ethnic Han Chinese family affected by autosomal dominant congenital perinuclear cataract. The patients underwent full clinical and ophthalmologic examinations to rule out any concomitant disorders. Blood samples were collected and genomic DNA was extracted. Potential mutations in the candidate gene alpha A crystallin (CRYAA) were screened. Prenatal diagnosis was then provided for a fetus of the affected proband by chorionic villus sampling. In all patients, DNA sequencing of the CRYAA gene revealed a novel 3-bp deletion mutation in exon 3 (c.246_248delCGC), which led to deletion of codon 117 encoding arginine (p.117delR) in the peptide chain. The same mutation was not found among unaffected and healthy individuals. Bioinformatic analysis revealed that although the c.246_248delCGC is an 'in-frame' mutation, removal of arginine resulted in a significant change in the protein structure. The fetus did not possess this mutation and was confirmed to be healthy at 1-year follow-up. A novel disease-causing mutation, c.246_248delCGC (p.117delR), of the CRYAA gene has been identified in a Chinese family with autosomal-type perinuclear congenital cataracts. This is also the first report of prenatal diagnosis of this type of congenital cataract.

  20. Matched-pair classification

    Energy Technology Data Exchange (ETDEWEB)

    Theiler, James P [Los Alamos National Laboratory

    2009-01-01

    Following an analogous distinction in statistical hypothesis testing, we investigate variants of machine learning where the training set comes in matched pairs. We demonstrate that even conventional classifiers can exhibit improved performance when the input data has a matched-pair structure. Online algorithms, in particular, converge quicker when the data is presented in pairs. In some scenarios (such as the weak signal detection problem), matched pairs can be generated from independent samples, with the effect not only doubling the nominal size of the training set, but of providing the structure that leads to better learning. A family of 'dipole' algorithms is introduced that explicitly takes advantage of matched-pair structure in the input data and leads to further performance gains. Finally, we illustrate the application of matched-pair learning to chemical plume detection in hyperspectral imagery.

  1. The Paired-box Homeodomain Transcription Factor Pax6 Binds to the Upstream Region of the TRAP Gene Promoter and Suppresses Receptor Activator of NF-κB Ligand (RANKL)-induced Osteoclast Differentiation*

    Science.gov (United States)

    Kogawa, Masakazu; Hisatake, Koji; Atkins, Gerald J.; Findlay, David M.; Enoki, Yuichiro; Sato, Tsuyoshi; Gray, Peter C.; Kanesaki-Yatsuka, Yukiko; Anderson, Paul H.; Wada, Seiki; Kato, Naoki; Fukuda, Aya; Katayama, Shigehiro; Tsujimoto, Masafumi; Yoda, Tetsuya; Suda, Tatsuo; Okazaki, Yasushi; Matsumoto, Masahito

    2013-01-01

    Osteoclast formation is regulated by balancing between the receptor activator of nuclear factor-κB ligand (RANKL) expressed in osteoblasts and extracellular negative regulatory cytokines such as interferon-γ (IFN-γ) and interferon-β (IFN-β), which can suppress excessive bone destruction. However, relatively little is known about intrinsic negative regulatory factors in RANKL-mediated osteoclast differentiation. Here, we show the paired-box homeodomain transcription factor Pax6 acts as a negative regulator of RANKL-mediated osteoclast differentiation. Electrophoretic mobility shift and reporter assays found that Pax6 binds endogenously to the proximal region of the tartrate acid phosphatase (TRAP) gene promoter and suppresses nuclear factor of activated T cells c1 (NFATc1)-induced TRAP gene expression. Introduction of Pax6 retrovirally into bone marrow macrophages attenuates RANKL-induced osteoclast formation. Moreover, we found that the Groucho family member co-repressor Grg6 contributes to Pax6-mediated suppression of the TRAP gene expression induced by NFATc1. These results suggest that Pax6 interferes with RANKL-mediated osteoclast differentiation together with Grg6. Our results demonstrate that the Pax6 pathway constitutes a new aspect of the negative regulatory circuit of RANKL-RANK signaling in osteoclastogenesis and that the augmentation of Pax6 might therefore represent a novel target to block pathological bone resorption. PMID:23990468

  2. Frequencies of 32 base pair deletion of the (Delta 32) allele of the CCR5 HIV-1 co-receptor gene in Caucasians: a comparative analysis.

    Science.gov (United States)

    Lucotte, Gérard

    2002-05-01

    The CCR5 gene encodes for the co-receptor for the major macrophage-tropics strains of human immunodeficiency virus (HIV-1), and a mutant allele of this gene (Delta 32) provide to homozygotes a strong resistance against infection by HIV. The frequency of the Delta 32 allele was investigated in 40 populations of 8842 non-infected subjects coming from Europe, the Middle-East and North Africa. A clear north-south decreasing gradient was evident for Delta 32 frequencies, with a significant correlation coefficient (r=0.83). The main frequency value of Delta 32 for Sweden, Norway, Denmark, Finland and Iceland (0.134) is significantly (chi(2)=63.818, PVikings might have been instrumental in disseminating the Delta 32 allele during the eighth to the tenth centuries during historical times. Possibly variola virus has discriminated the Delta 32 carriers in Europe since the eighth century AD, explaining the high frequency of the Delta 32 allele in Europe today.

  3. Cooper pairs and bipolarons

    OpenAIRE

    Lakhno, Victor D.

    2016-01-01

    It is shown that Cooper pairs are a solution of the bipolaron problem for model Fr\\"{o}hlich Hamiltonian. The total energy of a pair for the initial Fr\\"{o}hlich Hamiltonian is found. Differences between the solutions for the model and initial two-particle problems are discussed.

  4. Cooper pairs and bipolarons

    Science.gov (United States)

    Lakhno, Victor

    2016-11-01

    It is shown that Cooper pairs are a solution of the bipolaron problem for model Fröhlich Hamiltonian. The total energy of a pair for the initial Fröhlich Hamiltonian is found. Differences between the solutions for the model and initial two-particle problems are discussed.

  5. Stereo pairs in Astrophysics

    CERN Document Server

    Vogt, Frédéric

    2011-01-01

    Stereoscopic visualization is seldom used in Astrophysical publications and presentations compared to other scientific fields, e.g., Biochemistry, where it has been recognized as a valuable tool for decades. We put forth the view that stereo pairs can be a useful tool for the Astrophysics community in communicating a truer representation of astrophysical data. Here, we review the main theoretical aspects of stereoscopy, and present a tutorial to easily create stereo pairs using Python. We then describe how stereo pairs provide a way to incorporate 3D data in 2D publications of standard journals. We illustrate the use of stereo pairs with one conceptual and two Astrophysical science examples: an integral field spectroscopy study of a supernova remnant, and numerical simulations of a relativistic AGN jet. We also use these examples to make the case that stereo pairs are not merely an ostentatious way to present data, but an enhancement in the communication of scientific results in publications because they prov...

  6. Au pair trajectories

    DEFF Research Database (Denmark)

    Dalgas, Karina Märcher

    2015-01-01

    and dreams for the future become intertwined with their financial possibilities, limitations and responsibilities. The following three articles employ the notion of relatedness to explore the transnational and local social networks, including family relations, of which the au pairs are part. Arguing...... that Filipina au pairs see their stay abroad as an avenue of personal development and social recognition, I examine how the au pairs re-position themselves within their families at home through migration, and how they navigate between the often conflicting expectations of participation in the sociality...... important remittances back home. Their time in Denmark is also often part of long-term migration trajectories involving future stays in Scandinavia and southern Europe. Based on ten months of fieldwork among current and former au pairs in Denmark and ten weeks of fieldwork among prospective au pairs and au...

  7. Critical Schwinger Pair Production.

    Science.gov (United States)

    Gies, Holger; Torgrimsson, Greger

    2016-03-04

    We investigate Schwinger pair production in spatially inhomogeneous electric backgrounds. A critical point for the onset of pair production can be approached by fields that marginally provide sufficient electrostatic energy for an off-shell long-range electron-positron fluctuation to become a real pair. Close to this critical point, we observe features of universality which are analogous to continuous phase transitions in critical phenomena with the pair-production rate serving as an order parameter: electric backgrounds can be subdivided into universality classes and the onset of pair production exhibits characteristic scaling laws. An appropriate design of the electric background field can interpolate between power-law scaling, essential Berezinskii-Kosterlitz-Thouless-type scaling, and a power-law scaling with log corrections. The corresponding critical exponents only depend on the large-scale features of the electric background, whereas the microscopic details of the background play the role of irrelevant perturbations not affecting criticality.

  8. Critical Schwinger pair production

    CERN Document Server

    Gies, Holger

    2015-01-01

    We investigate Schwinger pair production in spatially inhomogeneous electric backgrounds. A critical point for the onset of pair production can be approached by fields that marginally provide sufficient electrostatic energy for an off-shell long-range electron-positron fluctuation to become a real pair. Close to this critical point, we observe features of universality which are analogous to continuous phase transitions in critical phenomena with the pair-production rate serving as an order parameter: electric backgrounds can be subdivided into universality classes and the onset of pair production exhibits characteristic scaling laws. An appropriate design of the electric background field can interpolate between power-law scaling, essential BKT-type scaling and a power-law scaling with log corrections. The corresponding critical exponents only depend on the large-scale features of the electric background, whereas the microscopic details of the background play the role of irrelevant perturbations not affecting ...

  9. Adaptive Pairing Reversible Watermarking.

    Science.gov (United States)

    Dragoi, Ioan-Catalin; Coltuc, Dinu

    2016-05-01

    This letter revisits the pairwise reversible watermarking scheme of Ou et al., 2013. An adaptive pixel pairing that considers only pixels with similar prediction errors is introduced. This adaptive approach provides an increased number of pixel pairs where both pixels are embedded and decreases the number of shifted pixels. The adaptive pairwise reversible watermarking outperforms the state-of-the-art low embedding bit-rate schemes proposed so far.

  10. Stereo pairs in Astrophysics

    Science.gov (United States)

    Vogt, Frédéric; Wagner, Alexander Y.

    2012-01-01

    Stereoscopic visualization is seldom used in Astrophysical publications and presentations compared to other scientific fields, e.g., Biochemistry, where it has been recognized as a valuable tool for decades. We put forth the view that stereo pairs can be a useful tool for the Astrophysics community in communicating a truer representation of astrophysical data. Here, we review the main theoretical aspects of stereoscopy, and present a tutorial to easily create stereo pairs using Python. We then describe how stereo pairs provide a way to incorporate 3D data in 2D publications of standard journals. We illustrate the use of stereo pairs with one conceptual and two Astrophysical science examples: an integral field spectroscopy study of a supernova remnant, and numerical simulations of a relativistic AGN jet. We also use these examples to make the case that stereo pairs are not merely an ostentatious way to present data, but an enhancement in the communication of scientific results in publications because they provide the reader with a realistic view of multi-dimensional data, be it of observational or theoretical nature. In recognition of the ongoing 3D expansion in the commercial sector, we advocate an increased use of stereo pairs in Astrophysics publications and presentations as a first step towards new interactive and multi-dimensional publication methods.

  11. A three base pair gene variation within the distal 5'-flanking region of the interleukin-10 (IL-10) gene is related to the in vitro IL-10 production capacity of lipopolysaccharide-stimulated peripheral blood mononuclear cells.

    NARCIS (Netherlands)

    Rieth, H.; Mormann, M.; Luty, J.F.; Assohou-Luty, C.A.; Roupelieva, M.; Kremsner, P.G.; Kube, D.

    2004-01-01

    Interleukin-10 (IL-10) is an important multifunctional immunmodulator. There is evidence that IL-10 secretion is associated with certain genetic elements of the proximal IL-10 gene 5'-flanking region. The allelic and genotypic comparison of IL-10 expression by lipopolysaccharide (LPS)- stimulated le

  12. Paired fuzzy sets

    DEFF Research Database (Denmark)

    Rodríguez, J. Tinguaro; Franco de los Ríos, Camilo; Gómez, Daniel

    2015-01-01

    In this paper we want to stress the relevance of paired fuzzy sets, as already proposed in previous works of the authors, as a family of fuzzy sets that offers a unifying view for different models based upon the opposition of two fuzzy sets, simply allowing the existence of different types...

  13. Minimal Pairs: Minimal Importance?

    Science.gov (United States)

    Brown, Adam

    1995-01-01

    This article argues that minimal pairs do not merit as much attention as they receive in pronunciation instruction. There are other aspects of pronunciation that are of greater importance, and there are other ways of teaching vowel and consonant pronunciation. (13 references) (VWL)

  14. Excited cooper pairs

    Energy Technology Data Exchange (ETDEWEB)

    Lopez-Arrietea, M. G.; Solis, M. A.; De Llano, M. [Universidad Nacional Autonoma de Mexico, Mexico, D.F (Mexico)

    2001-02-01

    Excited cooper pairs formed in a many-fermion system are those with nonzero total center-of mass momentum (CMM). They are normally neglected in the standard Bardeen-Cooper-Schrieffer (BCS) theory of superconductivity for being too few compared with zero CMM pairs. However, a Bose-Einstein condensation picture requires both zero and nonzero CMM pairs. Assuming a BCS model interaction between fermions we determine the populations for all CMM values of Cooper pairs by actually calculating the number of nonzero-CMM pairs relative to that of zero-CMM ones in both 2D and 3D. Although this ratio decreases rapidly with CMM, the number of Cooper pairs for any specific CMM less than the maximum (or breakup of the pair) momentum turns out to be typically larger than about 95% of those with zero-CMM at zero temperature T. Even at T {approx}100 K this fraction en 2D is still as large as about 70% for typical quasi-2D cuprate superconductor parameters. [Spanish] Los pares de cooper excitados formados en un sistema de muchos electrones, son aquellos con momentos de centro de masa (CMM) diferente de cero. Normalmente estos no son tomados en cuenta en la teoria estandar de la superconductividad de Bardeen-Cooper-Schrieffer (BCS) al suponer que su numero es muy pequeno comparados con los pares de centro de masa igual a cero. Sin embargo, un esquema de condensacion Bose-Einstein requiere de ambos pares, con CMM cero y diferente de cero. Asumiendo una interaccion modelo BCS entre los fermiones, determinamos la poblacion de pares cooper con cada uno de todos los posibles valores del CMM calculando el numero de pares con momentos de centro de masa diferente de cero relativo a los pares de CMM igual a cero, en 2D y 3D. Aunque esta razon decrece rapidamente con el CMM, el numero de pares de cooper para cualquier CMM especifico menor que el momento maximo (o rompimiento de par) es tipicamente mas grande que el 95% de aquellos con CMM cero. Aun a T {approx}100 K esta fraccion en 2D es

  15. Multi-pair states in electron-positron pair creation

    Science.gov (United States)

    Wöllert, Anton; Bauke, Heiko; Keitel, Christoph H.

    2016-09-01

    Ultra strong electromagnetic fields can lead to spontaneous creation of single or multiple electron-positron pairs. A quantum field theoretical treatment of the pair creation process combined with numerical methods provides a description of the fermionic quantum field state, from which all observables of the multiple electron-positron pairs can be inferred. This allows to study the complex multi-particle dynamics of electron-positron pair creation in-depth, including multi-pair statistics as well as momentum distributions and spin. To illustrate the potential benefit of this approach, it is applied to the intermediate regime of pair creation between nonperturbative Schwinger pair creation and perturbative multiphoton pair creation where the creation of multi-pair states becomes nonnegligible but cascades do not yet set in. Furthermore, it is demonstrated how spin and helicity of the created electrons and positrons are affected by the polarization of the counterpropagating laser fields, which induce the creation of electron-positron pairs.

  16. Junctionless Cooper pair transistor

    Science.gov (United States)

    Arutyunov, K. Yu.; Lehtinen, J. S.

    2017-02-01

    Quantum phase slip (QPS) is the topological singularity of the complex order parameter of a quasi-one-dimensional superconductor: momentary zeroing of the modulus and simultaneous 'slip' of the phase by ±2π. The QPS event(s) are the dynamic equivalent of tunneling through a conventional Josephson junction containing static in space and time weak link(s). Here we demonstrate the operation of a superconducting single electron transistor (Cooper pair transistor) without any tunnel junctions. Instead a pair of thin superconducting titanium wires in QPS regime was used. The current-voltage characteristics demonstrate the clear Coulomb blockade with magnitude of the Coulomb gap modulated by the gate potential. The Coulomb blockade disappears above the critical temperature, and at low temperatures can be suppressed by strong magnetic field.

  17. Protected Flux Pairing Qubit

    Science.gov (United States)

    Bell, Matthew; Zhang, Wenyuan; Ioffe, Lev; Gershenson, Michael

    2014-03-01

    We have studied the coherent flux tunneling in a qubit containing two submicron Josephson junctions shunted by a superinductor (a dissipationless inductor with an impedance much greater than the resistance quantum). The two low energy quantum states of this device, " open="|"> 0 and " open="|"> 1, are represented by even and odd number of fluxes in the loop, respectively. This device is dual to the charge pairing Josephson rhombi qubit. The spectrum of the device, studied by microwave spectroscopy, reflects the interference between coherent quantum phase slips in the two junctions (the Aharonov-Casher effect). The time domain measurements demonstrate the suppression of the qubit's energy relaxation in the protected regime, which illustrates the potential of this flux pairing device as a protected quantum circuit. Templeton Foundation, NSF, and ARO.

  18. The novel regulatory ncRNA, NfiS, optimizes nitrogen fixation via base pairing with the nitrogenase gene nifK mRNA in Pseudomonas stutzeri A1501

    Science.gov (United States)

    Zhan, Yuhua; Yan, Yongliang; Deng, Zhiping; Chen, Ming; Lu, Wei; Lu, Chao; Shang, Liguo; Yang, Zhimin; Zhang, Wei; Wang, Wei; Li, Yun; Ke, Qi; Lu, Jiasi; Xu, Yuquan; Zhang, Liwen; Xie, Zhihong; Cheng, Qi; Elmerich, Claudine; Lin, Min

    2016-01-01

    Unlike most Pseudomonas, the root-associated bacterium Pseudomonas stutzeri A1501 fixes nitrogen after the horizontal acquisition of a nitrogen-fixing (nif) island. A genome-wide search for small noncoding RNAs (ncRNAs) in P. stutzeri A1501 identified the novel P. stutzeri-specific ncRNA NfiS in the core genome, whose synthesis was significantly induced under nitrogen fixation or sorbitol stress conditions. The expression of NfiS was RNA chaperone Hfq-dependent and activated by the sigma factor RpoN/global nitrogen activator NtrC/nif-specific activator NifA regulatory cascade. The nfiS-deficient mutant displayed reduced nitrogenase activity, as well as increased sensitivity to multiple stresses, such as osmotic and oxidative stresses. Secondary structure prediction and complementation studies confirmed that a stem-loop structure was essential for NfiS to regulate the nitrogenase gene nifK mRNA synthesis and thus nitrogenase activity. Microscale thermophoresis and physiological analysis showed that NfiS directly pairs with nifK mRNA and ultimately enhances nitrogenase activity by increasing the translation efficiency and the half-life of nifK mRNA. Our data also suggest structural and functional divergence of NfiS evolution in diazotrophic and nondiazotrophic backgrounds. It is proposed that NfiS was recruited by nifK mRNA as a novel regulator to integrate the horizontally acquired nif island into host global networks. PMID:27407147

  19. Multispecies pair annihilation reactions.

    Science.gov (United States)

    Deloubrière, Olivier; Hilhorst, Henk J; Täuber, Uwe C

    2002-12-16

    We consider diffusion-limited reactions A(i)+A(j)--> (12 and d> or =2, we argue that the asymptotic density decay for such mutual annihilation processes with equal rates and initial densities is the same as for single-species pair annihilation A+A-->. In d=1, however, particle segregation occurs for all q< infinity. The total density decays according to a q dependent power law, rho(t) approximately t(-alpha(q)). Within a simplified version of the model alpha(q)=(q-1)/2q can be determined exactly. Our findings are supported through Monte Carlo simulations.

  20. Au pairs on Facebook

    DEFF Research Database (Denmark)

    Dalgas, Karina Märcher

    2016-01-01

    Ethnographers are increasingly making use of Facebook to acquire access and general acquaintance with their field of study. However, little has been written on how Facebook is used methodologically in research that does not have social media sites as the main focus of interest. This article argues...... that engagement with Facebook as a methodological tool can be useful in research among migrants in highly politicised fields. Pointing to a discursive construction of Filipina au pairs as victims of labour exploitation, the article shows how fieldwork on Facebook enables the exploration of the ways in which...... and on Facebook....

  1. Searching for Pair Halos

    Science.gov (United States)

    Fallon, Lisa; Abramowski, A.; Acero, F.; Aharonian, F.; Akhperjanian, A. G.; Anton, G.; Barres de Almeida, U.; Bazer-Bachi, A. R.; Becherini, Y.; Behera, B.; Bernlühr, K.; Bochow, A.; Boisson, C.; Bolmont, J.; Borrel, V.; Brucker, J.; Brun, F.; Brun, P.; Bühler, R.; Bulik, T.; Büsching, I.; Boutelier, T.; Chadwick, P. M.; Charbonnier, A.; Chaves, R. C. G.; Cheesebrough, A.; Conrad, J.; Chounet, L.-M.; Clapson, A. C.; Coignet, G.; Dalton, M.; Daniel, M. K.; Davids, I. D.; Degrange, B.; Deil, C.; Dickinson, H. J.; Domainko, A. Djannati-Ataü W.; Drury, L. O'c.; Dubois, F.; Dubus, G.; Dyks, J.; Dyrda, M.; Egberts, K.; Eger, P.; Espigat, P.; Fallon, L.; Farnier, C.; Fegan, S.; Feinstein, F.; Fernandes, M. V.; Fiasson, A.; Fürster, A.; Fontaine, G.; Füssling, M.; Gabici, S.; Gallant, Y. A.; Gérard, L.; Gerbig, D.; Giebels, B.; Glicenstein, J. F.; Glück, B.; Goret, P.; Güring, D.; Hampf, D.; Hauser, M.; Heinz, S.; Heinzelmann, G.; Henri, G.; Hermann, G.; Hinton, J. A.; Hoffmann, A.; Hofmann, W.; Hofverberg, P.; Holleran, M.; Hoppe, S.; Horns, D.; Jacholkowska, A.; de Jager, O. C.; Jahn, C.; Jung, I.; Katarzynski, K.; Katz, U.; Kaufmann, S.; Kerschhaggl, M.; Khangulyan, D.; Khálifi, B.; Keogh, D.; Klochkov, D.; Kluzniak, W.; Kneiske, T.; Komin, Nu.; Kosack, K.; Kossakowski, R.; Lamanna, G.; Lenain, J.-P.; Lohse, T.; Lu, C.-C.; Marandon, V.; Marcowith, A.; Masbou, J.; Mau-Rin, D.; McComb, T. J. L.; Medina, M. C.; Méhault, J.; Moderski, R.; Moulin, E.; Naumann-Godo, M.; de Naurois, M.; Nedbal, D.; Nekrassov, D.; Nguyen, N.; Nicholas, B.; Niemiec, J.; Nolan, S. J.; Ohm, S.; Olive, J.-F.; de Ona Wilhelmi, E.; Opitz, B.; Orford, K. J.; Ostrowski, M.; Panter, M.; Paz Arribas, M.; Pedaletti, G.; Pelletier, G.; Petrucci, P.-O.; Pita, S.; Pühlhofer, G.; Punch, M.; Quirrenbach, A.; Raubenheimer, B. C.; Raue, M.; Rayner, S. M.; Reimer, O.; Renaud, M.; de Los Reyes, R.; Rieger, F.; Ripken, J.; Rob, L.; Rosier-Lees, S.; Rowell, G.; Rudak, B.; Rulten, C. B.; Ruppel, J.; Ryde, F.; Sahakian, V.; Santangelo, A.; Schlickeiser, R.; Schück, F. M.; Schünwald, A.; Schwanke, U.; Schwarzburg, S.; Schwemmer, S.; Shalchi, A.; Sushch, I.; Sikora, M.; Skilton, J. L.; Sol, H.; Stawarz, L.; Steenkamp, R.; Stegmann, C.; Stinzing, F.; Szostek, A.; Tam, P. H.; Tavernet, J.-P.; Terrier, R.; Tibolla, O.; Tluczykont, M.; Valerius, K.; van Eldik, C.; Vasileiadis, G.; Venter, C.; Venter, L.; Vialle, J. P.; Viana, A.; Vincent, P.; Vivier, M.; Vülk, H. J.; Volpe, F.; Vorobiov, S.; Wagner, S. J.; Ward, M.; Zdziarski, A. A.; Zech, A.; Zechlin, H.-S.

    We have conducted a search for the giant Pair Halo structures which are inevitably formed around TeV sources due to interactions of very high energy gamma-rays with the Extragalactic Background Light (EBL). The resulting electron/positron pairs are Compton upscattered on photons of the 2.7 K Cosmic Microwave Background Radiation to produce a second generation of gamma-rays which again interact with the EBL; thus an electromagnetic cascade develops. If the magnetic fields on Mpc scales surrounding the central source are sufficiently strong (10-11 G or more), electrons are effectively isotropised before interacting with radiation fields. In this case an extended halo is produced around the source. Using H.E.S.S. observations of Active Galactic Nuclei, including data from PKS 2155-304, 1ES 1101-232 and 1ES 0229+200, we have completed a detailed analysis of these sources. I will present and discuss the astrophysical implications of these results.

  2. Application of Acupoints in Pairs

    Institute of Scientific and Technical Information of China (English)

    季扬

    2004-01-01

    @@ Application of acupoints in pairs is a kind of point association in which only a pair of compatible points is used. Based on the principle of compatibility, the author of this article often uses the "pair-point needling" to treat some common diseases, and have obtained very good therapeutic results. Some examples are introduced below.

  3. Diffractive charged meson pair production

    CERN Document Server

    Lehmann-Dronke, B; Schäfer, S; Stein, E; Schäfer, A

    1999-01-01

    We investigate the possibility to measure the nonforward gluon distribution function by means of diffractively produced charged pion and kaon pairs in polarized lepton nucleon scattering. The resulting cross sections are sizable and are dominated by the gluonic contribution. We find large spin asymmetries, both for pion pairs and for kaon pairs.

  4. Cotorsion Pair Extensions

    Institute of Scientific and Technical Information of China (English)

    De Xu ZHOU

    2009-01-01

    Assume that S is an almost excellent extension of R. Using functors Hom R(S,-) and -(×)R S, we establish some connections between classes of modules (L)R and (L)S, cotorsion pairs ((A)R, (A)R)and ((A)S, (B)S). If (L)S is a T-extension or (and) H-extension of (L)R, we show that (L)S is a (resp., monomorphic, epimorphic, special) preenveloping class if and only if so is (L)R. If (S, S) is a TH-extension of ((A)R,(B)R), we obtain that ((A)S,(B)S) is complete (resp., of finite type, of cofinite type, hereditary, perfect, n-tilting) if and only if so is ((A)R,(B)R).

  5. Multi-pair states in electron–positron pair creation

    Directory of Open Access Journals (Sweden)

    Anton Wöllert

    2016-09-01

    Full Text Available Ultra strong electromagnetic fields can lead to spontaneous creation of single or multiple electron–positron pairs. A quantum field theoretical treatment of the pair creation process combined with numerical methods provides a description of the fermionic quantum field state, from which all observables of the multiple electron–positron pairs can be inferred. This allows to study the complex multi-particle dynamics of electron–positron pair creation in-depth, including multi-pair statistics as well as momentum distributions and spin. To illustrate the potential benefit of this approach, it is applied to the intermediate regime of pair creation between nonperturbative Schwinger pair creation and perturbative multiphoton pair creation where the creation of multi-pair states becomes nonnegligible but cascades do not yet set in. Furthermore, it is demonstrated how spin and helicity of the created electrons and positrons are affected by the polarization of the counterpropagating laser fields, which induce the creation of electron–positron pairs.

  6. Gene

    Data.gov (United States)

    U.S. Department of Health & Human Services — Gene integrates information from a wide range of species. A record may include nomenclature, Reference Sequences (RefSeqs), maps, pathways, variations, phenotypes,...

  7. Pairing the Volcano

    CERN Document Server

    Ionica, Sorina

    2011-01-01

    Isogeny volcanoes are graphs whose vertices are elliptic curves and whose edges are $\\ell$-isogenies. Algorithms allowing to travel on these graphs were developed by Kohel in his thesis (1996) and later on, by Fouquet and Morain (2001). However, up to now, no method was known, to predict, before taking a step on the volcano, the direction of this step. Hence, in Kohel's and Fouquet-Morain algorithms, many steps are taken before choosing the right direction. In particular, ascending or horizontal isogenies are usually found using a trial-and-error approach. In this paper, we propose an alternative method that efficiently finds all points $P$ of order $\\ell$ such that the subgroup generated by $P$ is the kernel of an horizontal or an ascending isogeny. In many cases, our method is faster than previous methods. This is an extended version of a paper published in the proceedings of ANTS 2010. In addition, we treat the case of 2-isogeny volcanoes and we derive from the group structure of the curve and the pairing ...

  8. Multiple origins of asteroid pairs

    CERN Document Server

    Jacobson, Seth A

    2015-01-01

    Rotationally fissioned asteroids produce unbound daughter asteroids that have very similar heliocentric orbits. Backward integration of their current heliocentric orbits provides an age of closest proximity that can be used to date the rotational fission event. Most asteroid pairs follow a predicted theoretical relationship between the primary spin period and the mass ratio of the two pair members that is a direct consequence of the YORP-induced rotational fission hypothesis. If the progenitor asteroid has strength, asteroid pairs may have high mass ratios with possibly fast rotating primaries. However, secondary fission leaves the originally predicted trend unaltered. We also describe the characteristics of pair members produced by four alternative routes from a rotational fission event to an asteroid pair. Unlike direct formation from the event itself, the age of closest proximity of these pairs cannot generally be used to date the rotational fission event since considerable time may have passed.

  9. Kramers Pairs in configuration interaction

    DEFF Research Database (Denmark)

    Avery, John Scales; Avery, James Emil

    2003-01-01

    The theory of symmetry-preserving Kramers pair creation operators is reviewed and formulas for applying these operators to configuration interaction calculations are derived. A new and more general type of symmetry-preserving pair creation operator is proposed and shown to commute with the total...

  10. Assessment Strategies for Pair Programming

    Science.gov (United States)

    Hahn, Jan Hendrik; Mentz, Elsa; Meyer, Lukas

    2009-01-01

    Although pair programming has proved its usefulness in teaching and learning programming skills, it is difficult to assess the individual roles and abilities of students whilst programming in pairs. (Note that within this manuscript, the term assessment refers to evaluating individual student performance.) Assessing only the outcomes of a pair…

  11. PERIODIC COMPLEMENTARY BINARY SEQUENCE PAIRS

    Institute of Scientific and Technical Information of China (English)

    XuChengqian; ZhaoXiaoqun

    2002-01-01

    A new set of binary sequences-Periodic Complementary Binary Sequence Pair (PCSP)is proposed .A new class of block design-Difference Family Pair (DFP)is also proposed .The relationship between PCSP and DFP,the properties and exising conditions of PCSP and the recursive constructions for PCSP are given.

  12. PERIODIC COMPLEMENTARY BINARY SEQUENCE PAIRS

    Institute of Scientific and Technical Information of China (English)

    Xu Chengqian; Zhao Xiaoqun

    2002-01-01

    A new set of binary sequences-Periodic Complementary Binary Sequence Pair (PCSP) is proposed. A new class of block design-Difference Family Pair (DFP) is also proposed.The relationship between PCSP and DFP, the properties and existing conditions of PCSP and the recursive constructions for PCSP are given.

  13. Instability of vortex pair leapfrogging

    DEFF Research Database (Denmark)

    Tophøj, Laust; Aref, Hassan

    2013-01-01

    pairs fly off to infinity, and a "walkabout" mode, where the vortices depart from leapfrogging but still remain within a finite distance of one another. We show numerically that this transition is more gradual, a result that we relate to earlier investigations of chaotic scattering of vortex pairs [L...

  14. Stereo Pair: Patagonia, Argentina

    Science.gov (United States)

    2000-01-01

    This view of northern Patagonia, near El Cain, Argentina shows complexly eroded volcanic terrain, with basalt mesas, sinkholes, landslide debris, playas, and relatively few integrated drainage channels. Surrounding this site (but also extending far to the east) is a broad plateau capped by basalt, the Meseta de Somuncura. Here, near the western edge of the plateau, erosion has broken through the basalt cap in a variety of ways. On the mesas, water-filled sinkholes (lower left) are most likely the result of the collapse of old lava tubes. Along the edges of the mesas (several locations) the basalt seems to be sliding away from the plateau in a series of slices. Water erosion by overland flow is also evident, particularly in canyons where vegetation blankets the drainage channels (green patterns, bottom of image). However, overland water flow does not extend very far at any location. This entire site drains to local playas, some of which are seen here (blue). While the water can reach the playas and then evaporate, what becomes of the eroded rock debris? Wind might excavate some of the finer eroded debris, but the fate of much of the missing bedrock remains mysterious.This cross-eyed stereoscopic image pair was generated using topographic data from the Shuttle Radar Topography Mission, combined with an enhanced Landsat 7 satellite color image. The topography data are used to create two differing perspectives of a single image, one perspective for each eye. In doing so, each point in the image is shifted slightly, depending on its elevation. When stereoscopically merged, the result is a vertically exaggerated view of the Earth's surface in its full three dimensions.Landsat satellites have provided visible light and infrared images of the Earth continuously since 1972. SRTM topographic data match the 30-meter (99-foot) spatial resolution of most Landsat images and provide a valuable complement for studying the historic and growing Landsat data archive. The Landsat 7

  15. Pairing correlations in exotic nuclei

    CERN Document Server

    Sagawa, H

    2012-01-01

    The BCS and HFB theories which can accommodate the pairing correlations in the ground states of atomic nuclei are presented. As an application of the pairing theories, we investigate the spatial extension of weakly bound Ne and C isotopes by taking into account the pairing correlation with the Hartree-Fock-Bogoliubov (HFB) method and a 3-body model, respectively. We show that the odd-even staggering in the reaction cross sections of $^{30,31,32}$Ne and $^{14,15,16}$C are successfully reproduced, and thus the staggering can be attributed to the unique role of pairing correlations in nuclei far from the stability line. A correlation between a one-neutron separation energy and the anti-halo effect is demonstrated for $s$- and p-waves using the HFB wave functions. We also propose effective density-dependent pairing interactions which reproduce both the neutron-neutron ($nn$) scattering length at zero density and the neutron pairing gap in uniform matter. Then, we apply these interactions to study pairing gaps in ...

  16. Pairing Correlations at High Spins

    Science.gov (United States)

    Ma, Hai-Liang; Dong, Bao-Guo; Zhang, Yan; Fan, Ping; Yuan, Da-Qing; Zhu, Shen-Yun; Zhang, Huan-Qiao; Petrache, C. M.; Ragnarsson, I.; Carlsson, B. G.

    The pairing correcting energies at high spins in 161Lu and 138Nd are studied by comparing the results of the cranked-Nilsson-Strutinsky (CNS) and cranked-Nilsson-Strutinsky-Bogoliubov (CNSB) models. It is concluded that the Coriolis effect rather than the rotational alignment effect plays a major role in the reduction of the pairing correlations in the high spin region. Then we proposed an average pairing correction method which not only better reproduces the experimental data comparing with the CNS model but also enables a clean-cut tracing of the configurations thus the full-spin-range discussion on the various rotating bands.

  17. Exact solution for generalized pairing

    OpenAIRE

    Pan, Feng; J.P. Draayer

    1997-01-01

    An infinite dimensional algebra, which is useful for deriving exact solutions of the generalized pairing problem, is introduced. A formalism for diagonalizing the corresponding Hamiltonian is also proposed. The theory is illustrated with some numerical examples.

  18. Pairing versus quarteting coherence length

    CERN Document Server

    Delion, Doru S

    2015-01-01

    We systematically analyse the coherence length in even-even nuclei. The pairing coherence length in the spin-singlet channel for the effective density dependent delta (DDD) and Gaussian interaction is estimated. We consider in our calculations bound states as well as narrow resonances. It turns out that the pairing gaps given by the DDD interaction are similar to those of the Gaussian potential if one renormalizes the radial width to the nuclear radius. The correlations induced by the pairing interaction have in all considered cases a long range character inside the nucleus and decrease towards the surface. The mean coherence length is larger than the geometrical radius for light nuclei and approaches this value for heavy nuclei. The effect of the temperature and states in continuum is investigated. Strong shell effects are evidenced, especially for protons. We generalize this concept to quartets by considering similar relations, but between proton and neutron pairs. The quartet coherence length has a similar...

  19. Dual pairs in fluid dynamics

    CERN Document Server

    Gay-Balmaz, François

    2010-01-01

    This paper is a rigorous study of the dual pair structure of the ideal fluid and the dual pair structure for the $n$-dimensional Camassa-Holm (EPDiff) equation, including the proofs of the necessary transitivity results. In the case of the ideal fluid, we show that a careful definition of the momentum maps leads naturally to central extensions of diffeomorphism groups such as the group of quantomorphisms and the Ismagilov central extension.

  20. Pair programming: more than just working together in pairs.

    Directory of Open Access Journals (Sweden)

    Elsa Mentz

    2012-03-01

    Full Text Available Pair programming originated in the industry where focus is placed on the development of a programme at the most costand time-effective manner, and within the parameters of quality. In this context, a specific programming code is not developed individually; rather, two people work together in order to ensure a higher quality programming code and to motivate each other to work at a faster pace. The problem with this approach was that novice programmers lacked the social skills to work in pairs as they had not been exposed to this sufficiently at tertiary level. The demand of the industry, especially in terms of programmers needing to be able to programme together, led to the incorporation of pair programming at tertiary level in the late nineties. The pedagogical principles on which any teaching-learning strategy should be built were, however, largely overlooked during this process. This article firstly looks into the semantic and ontological differences between co-operative and collaborative learning and secondly argues that pair programming, within the context of a social constructivist approach to teaching and learning, can be seen as a co-operative teaching-learning strategy. Pair programming is more than just allowing two students to work together on a programming task. The more structured way, in which pair programming needs to be implemented, concur with the principles of co-operative learning. The article concludes that the correct pedagogical application of pair programming as a co-operative teaching-learning strategy in tertiary education will result in improved learning capital.

  1. Three carbon pairs in Si

    Energy Technology Data Exchange (ETDEWEB)

    Docaj, A. [Physics Department, Texas Tech University, Lubbock, TX 79409-1051 (United States); Estreicher, S.K., E-mail: Stefan.Estreicher@ttu.edu [Physics Department, Texas Tech University, Lubbock, TX 79409-1051 (United States)

    2012-08-01

    Carbon impurities in Si are common in floating-zone and cast-Si materials. The simplest and most discussed carbon complex is the interstitial-substitutional C{sub i}C{sub s} pair, which readily forms when self-interstitials are present in the material. This pair has three possible configurations, each of which is electrically active. The less common C{sub s}C{sub s} pair has been studied in irradiated material but has also recently been seen in as-grown C-rich cast-Si, which is commonly used to fabricate solar cells. The third pair consists of two interstitial C atoms: C{sub i}C{sub i}. Although its formation probability is low for several reasons, the C{sub i}C{sub i} pair is very stable and electrically inactive. In this contribution, we report preliminary results of first-principles calculations of these three C pairs in Si. The structures, binding energies, vibrational spectra, and electrical activity are predicted.

  2. Counting pairs of faint galaxies

    CERN Document Server

    Woods, D; Richer, H B; Woods, David; Fahlman, Gregory G; Richer, Harvey B

    1995-01-01

    The number of close pairs of galaxies observed to faint magnitude limits, when compared to nearby samples, determines the interaction or merger rate as a function of redshift. The prevalence of mergers at intermediate redshifts is fundamental to understanding how galaxies evolve and the relative population of galaxy types. Mergers have been used to explain the excess of galaxies in faint blue counts above the numbers expected from no-evolution models. Using deep CFHT (I\\leq24) imaging of a ``blank'' field we find a pair fraction which is consistent with the galaxies in our sample being randomly distributed with no significant excess of ``physical'' close pairs. This is contrary to the pair fraction of 34\\%\\pm9\\% found by Burkey {\\it et al.} for similar magnitude limits and using an identical approach to the pair analysis. Various reasons for this discrepancy are discussed. Colors and morphologies of our close pairs are consistent with the bulk of them being random superpositions although, as indicators of int...

  3. Superconductivity: The persistence of pairs

    Energy Technology Data Exchange (ETDEWEB)

    Edelman, Alex; Littlewood, Peter

    2015-05-20

    Superconductivity stems from a weak attraction between electrons that causes them to form bound pairs and behave much like bosons. These so-called Cooper pairs are phase coherent, which leads to the astonishing properties of zero electrical resistance and magnetic flux expulsion typical of superconducting materials. This coherent state may be qualitatively understood within the Bose–Einstein condensate (BEC) model, which predicts that a gas of interacting bosons will become unstable below a critical temperature and condense into a phase of matter with a macroscopic, coherent population in the lowest energy state, as happens in 4He or cold atomic gases. The successful theory proposed by Bardeen, Cooper and Schrieffer (BCS) predicts that at the superconducting transition temperature Tc, electrons simultaneously form pairs and condense, with no sign of pairing above Tc. Theorists have long surmised that the BCS and BEC models are opposite limits of a single theory and that strong interactions or low density can, in principle, drive the system to a paired state at a temperature Tpair higher than Tc, making the transition to the superconducting state BEC-like (Fig. 1). Yet most superconductors to date are reasonably well described by BCS theory or its extensions, and there has been scant evidence in electronic materials for the existence of pairing independent of the full superconducting state (though an active debate rages over the cuprate superconductors). Writing in Nature, Jeremy Levy and colleagues have now used ingenious nanostructured devices to provide evidence for electron pairing1. Perhaps surprisingly, the material they have studied is a venerable, yet enigmatic, low-temperature superconductor, SrTiO3.

  4. Organometallic frustrated Lewis pair chemistry.

    Science.gov (United States)

    Erker, Gerhard

    2011-08-07

    Frustrated Lewis pairs are playing an increasingly important role in organometallic chemistry. Examples are presented and discussed where organometallic systems themselves serve as the Lewis base or Lewis acid components in frustrated Lewis pair chemistry, mostly through their attached functional groups. Activation of dihydrogen takes place easily in many of these systems. This may lead to the generation of novel catalyst systems but also in many cases to the occurrence of specific reactions at the periphery of the organometallic frameworks. Increasingly, FLP reactions are used to carry out functional group conversions in organometallic systems under mild reaction conditions. The limits of typical FLP reactivity are explored with selected organometallic examples, a discussion that points toward new developments, such as the discovery of facile new 1,1-carboboration reactions. Learning more and more about the broad spectrum of frustrated Lewis pair chemistry helps us to find novel reactions and applications.

  5. Paired structures in knowledge representation

    DEFF Research Database (Denmark)

    Montero, J.; Bustince, H.; Franco de los Ríos, Camilo;

    2016-01-01

    In this position paper we propose a consistent and unifying view to all those basic knowledge representation models that are based on the existence of two somehow opposite fuzzy concepts. A number of these basic models can be found in fuzzy logic and multi-valued logic literature. Here it is clai......In this position paper we propose a consistent and unifying view to all those basic knowledge representation models that are based on the existence of two somehow opposite fuzzy concepts. A number of these basic models can be found in fuzzy logic and multi-valued logic literature. Here...... of paired structures, generated from two paired concepts together with their associated neutrality, all of them to be modeled as fuzzy sets. In this way, paired structures can be viewed as a standard basic model from which different models arise. This unifying view should therefore allow a deeper analysis...

  6. Exlusive charmed meson pair production

    CERN Document Server

    Berezhnoy, A V

    2004-01-01

    The experimental data of BELLE Collaboration on the exclusive charmed meson pair production in the process of monophotonic $e^+e^-$-annihilation ($e^+e^-\\to \\gamma^* \\to D\\bar D$) has been studied. It has been shown that these data is described satisfactorily in the frame work of constituent quark model. Our studies have demonstrated that the central production process $e^+e^-\\to e^+e^-\\gamma\\gamma \\to e^+e^-D\\bar D +X$ and the process of monophotonic $e^+e^-$-annihilation yield comparable numbers of the charmed meson pairs.

  7. Instantons in lepton pair production

    Energy Technology Data Exchange (ETDEWEB)

    Brandenburg, A.; Ringwald, A. [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany); Utermann, A. [Vrije Univ., Amsterdam (Netherlands). Dept. of Physics and Astronomy

    2006-05-15

    We consider QCD instanton-induced contributions to lepton pair production in hadron-hadron collisions. We relate these contributions to those known from deep inelastic scattering and demonstrate that they can be calculated reliably for sufficiently large momentum transfer. We observe that the instanton contribution to the angular distribution of the lepton pairs at finite momentum transfer strongly violates the Lam-Tung relation - a relation between coefficient functions of the angular distribution which is valid within the framework of ordinary perturbation theory. The drastic violation of this relation, as seen in experimental data, might be related to such instanton-induced effects. (Orig.)

  8. Evolutionary Transitions of MicroRNA-Target Pairs

    KAUST Repository

    Nozawa, Masafumi

    2016-04-27

    How newly generated microRNA (miRNA) genes are integrated into gene regulatory networks during evolution is fundamental in understanding the molecular and evolutionary bases of robustness and plasticity in gene regulation. A recent model proposed that after the birth of a miRNA, the miRNA is generally integrated into the network by decreasing the number of target genes during evolution. However, this decreasing model remains to be carefully examined by considering in vivo conditions. In this study, we therefore compared the number of target genes among miRNAs with different ages, combining experiments with bioinformatics predictions. First, we focused on three Drosophila miRNAs with different ages. As a result, we found that an older miRNA has a greater number of target genes than a younger miRNA, suggesting the increasing number of targets for each miRNA during evolution (increasing model). To further confirm our results, we also predicted all target genes for all miRNAs in D. melanogaster, considering co-expression of miRNAs and mRNAs in vivo. The results obtained also do not support the decreasing model but are reasonably consistent with the increasing model of miRNA-target pairs. Furthermore, our large-scale analyses of currently available experimental data of miRNA-target pairs also showed a weak but the same trend in humans. These results indicate that the current decreasing model of miRNA-target pairs should be reconsidered and the increasing model may be more appropriate to explain the evolutionary transitions of miRNA-target pairs in many organisms.

  9. Electron pair creation by photons

    NARCIS (Netherlands)

    Holtwijk, Theodoor

    1960-01-01

    In our experiment on the creation of electron pairs a 5 MeV betatron was used as radiation source and a cloud chamber (with magnetic field) was used as detection instrument. The experimental arrangement is described in section 2.1. The cloud chamber was of the overcompression type so that the recove

  10. Pairs of dual periodic frames

    DEFF Research Database (Denmark)

    Christensen, Ole; Goh, Say Song

    2012-01-01

    is needed. The purpose of the present paper is to provide constructions of dual pairs of frames in the setting of the Hilbert space of periodic functions L2(0,2π). The frames constructed are given explicitly as trigonometric polynomials, which allows for an efficient calculation of the coefficients...

  11. Skew Pairs of Idempotents in Transformation Semigroups

    Institute of Scientific and Technical Information of China (English)

    T. S. BLYTH; M. H. ALMEIDA SANTOS

    2006-01-01

    An ordered pair (e, f) of idempotents of a regular semigroup is called a skew pair if ef is not idempotent whereas fe is idempotent. We have shown previously that there are four distinct types of skew pairs of idempotents. Here we investigate the ubiquity of such skew pairs in full transformation semigroups.

  12. Collisions of Vortex Filament Pairs

    Science.gov (United States)

    Banica, Valeria; Faou, Erwan; Miot, Evelyne

    2014-12-01

    We consider the problem of collisions of vortex filaments for a model introduced by Klein et al. (J Fluid Mech 288:201-248, 1995) and Zakharov (Sov Phys Usp 31(7):672-674, 1988, Lect. Notes Phys 536:369-385, 1999) to describe the interaction of almost parallel vortex filaments in three-dimensional fluids. Since the results of Crow (AIAA J 8:2172-2179, 1970) examples of collisions are searched as perturbations of antiparallel translating pairs of filaments, with initial perturbations related to the unstable mode of the linearized problem; most results are numerical calculations. In this article, we first consider a related model for the evolution of pairs of filaments, and we display another type of initial perturbation leading to collision in finite time. Moreover, we give numerical evidence that it also leads to collision through the initial model. We finally study the self-similar solutions of the model.

  13. Pair interaction of bilayer-coated nanoscopic particles

    Institute of Scientific and Technical Information of China (English)

    Zhang Qi-Yi

    2009-01-01

    The pair interaction between bilayer membrane-coated nanosized particles has been explored by using the self-consistent field (SCF) theory. The bilayer membranes are composed of amphiphilic polymers. For different system parameters, the pair-interaction free energies are obtained. Particular emphasis is placcd on the analysis of a sequence of structural transformations of bilayers on spherical particles, which occur during their approaching processes. For different head fractions of amphiphilcs, the asymmetrical morphologies between bilayers on two particles and the inverted micellar intermediates have been found in the membrane fusion pathway. These results can benefit the fabrication of vesicles as encapsulation vectors for drug and gene delivery.

  14. [The pairing, synapsis and recombination of meiosis in plant].

    Science.gov (United States)

    Liu, Chun-Xia; He, Qun-Yan; Jin, Wei-Wei

    2010-12-01

    Meiosis is the crucial step for sexual reproduction, while the pairing, synapsis and recombination are the key events in this process and have become the hotspots in meiosis studies. In recent years, with the development of the molecular biology and cell biology, associated with the mutant screened from mutant libraries, much advances were achieved in pairing, synapsis and recombination of meiosis in plant. In this review, we have gave an overview of the genes identification in this field and further studies of its molecular mechanism in plant.

  15. Septin pairs, a complex choreography.

    Science.gov (United States)

    Ewers, Helge

    2011-06-13

    Septins form a filamentous collar at the mother-bud neck in budding yeast. In cytokinesis, this collar splits into two rings and the septin complexes undergo a dramatic reorientation. Using fluorescence polarization microscopy, DeMay et al. (2011. J. Cell Biol. doi:10.1083/jcb.201012143) now demonstrate that septin complexes assemble as paired filaments in vivo and reveal new insights into septin organization during cytokinesis.

  16. Triplet Pairing in Neutron Matter

    CERN Document Server

    Khodel, V V; Clark, J W

    2001-01-01

    The separation method developed earlier by us [Nucl. Phys. {\\bf A598} 390 (1996)] to calculate and analyze solutions of the BCS gap equation for $^1$S$_0$ pairing is extended and applied to $^3$P$_2$--$^3$F$_2$ pairing in pure neutron matter. The pairing matrix elements are written as a separable part plus a remainder that vanishes when either momentum variable is on the Fermi surface. This decomposition effects a separation of the problem of determining the dependence of the gap components in a spin-angle representation on the magnitude of the momentum (described by a set of functions independent of magnetic quantum number) from the problem of determining the dependence of the gap on angle or magnetic projection. The former problem is solved through a set of nonsingular, quasilinear integral equations, providing inputs for solution of the latter problem through a coupled system of algebraic equations for a set of numerical coefficients. An incisive criterion is given for finding the upper critical density fo...

  17. Morse theory and stable pairs

    CERN Document Server

    Wentworth, Richard A

    2010-01-01

    We study the Morse theory of the Yang-Mills-Higgs functional on the space of pairs $(A,\\Phi)$, where $A$ is a unitary connection on a rank 2 hermitian vector bundle over a compact Riemann surface, and $\\Phi$ is a holomorphic section of $(E, d_A")$. We prove that a certain explicitly defined substratification of the Morse stratification is perfect in the sense of $\\G$-equivariant cohomology, where $\\G$ denotes the unitary gauge group. As a consequence, Kirwan surjectivity holds for pairs. It also follows that the twist embedding into higher degree induces a surjection on equivariant cohomology. This may be interpreted as a rank 2 version of the analogous statement for symmetric products of Riemann surfaces. Finally, we compute the $\\G$-equivariant Poincar\\'e polynomial of the space of $\\tau$-semistable pairs. In particular, we recover an earlier result of Thaddeus. The analysis provides an interpretation of the Thaddeus flips in terms of a variation of Morse functions.

  18. Germline progenitors escape the widespread phenomenon of homolog pairing during Drosophila development.

    Directory of Open Access Journals (Sweden)

    Eric F Joyce

    Full Text Available Homolog pairing, which plays a critical role in meiosis, poses a potential risk if it occurs in inappropriate tissues or between nonallelic sites, as it can lead to changes in gene expression, chromosome entanglements, and loss-of-heterozygosity due to mitotic recombination. This is particularly true in Drosophila, which supports organismal-wide pairing throughout development. Discovered over a century ago, such extensive pairing has led to the perception that germline pairing in the adult gonad is an extension of the pairing established during embryogenesis and, therefore, differs from the mechanism utilized in most species to initiate pairing specifically in the germline. Here, we show that, contrary to long-standing assumptions, Drosophila meiotic pairing in the gonad is not an extension of pairing established during embryogenesis. Instead, we find that homologous chromosomes are unpaired in primordial germ cells from the moment the germline can be distinguished from the soma in the embryo and remain unpaired even in the germline stem cells of the adult gonad. We further establish that pairing originates immediately after the stem cell stage. This pairing occurs well before the initiation of meiosis and, strikingly, continues through the several mitotic divisions preceding meiosis. These discoveries indicate that the spatial organization of the Drosophila genome differs between the germline and the soma from the earliest moments of development and thus argue that homolog pairing in the germline is an active process as versus a passive continuation of pairing established during embryogenesis.

  19. Charge Aspects of Composite Pair Superconductivity

    Science.gov (United States)

    Flint, Rebecca

    2014-03-01

    Conventional Cooper pairs form from well-defined electronic quasiparticles, making the internal structure of the pair irrelevant. However, in the 115 family of superconductors, the heavy electrons are forming as they pair and the internal pair structure becomes as important as the pairing mechanism. Conventional spin fluctuation mediated pairing cannot capture the direct transition from incoherent local moments to heavy fermion superconductivity, but the formation of composite pairs favored by the two channel Kondo effect can. These composite pairs are local d-wave pairs formed by two conduction electrons in orthogonal Kondo channels screening the same local moment. Composite pairing shares the same symmetries as magnetically mediated pairing, however, only composite pairing necessarily involves a redistribution of charge within the unit cell originating from the internal pair structure, both as a monopole (valence change) and a quadrupole effect. This redistribution will onset sharply at the superconducting transition temperature. A smoking gun test for composite pairing is therefore a sharp signature at Tc - for example, a cusp in the Mossbauer isomer shift in NpPd5Al2 or in the NQR shift in (Ce,Pu)CoIn5.

  20. Pair Tunneling through Single Molecules

    Science.gov (United States)

    Raikh, Mikhail

    2007-03-01

    Coupling to molecular vibrations induces a polaronic shift, and can lead to a negative charging energy, U. For negative U, the occupation of the ground state of the molecule is even. In this situation, virtual pair transitions between the molecule and the leads can dominate electron transport. At low temperature, T, these transitions give rise to the charge-Kondo effect [1]. We developed the electron transport theory through the negative-U molecule [2] at relatively high T, when the Kondo correlations are suppressed. Two physical ingredients distinguish our theory from the transport through a superconducting grain coupled to the normal leads [3]: (i) in parallel with sequential pair-tunneling processes, single-particle cotunneling processes take place; (ii) the electron pair on the molecule can be created (or annihilated) by two electrons tunneling in from (or out to) opposite leads. We found that, even within the rate-equation description, the behavior of differential conductance through the negative-U molecule as function of the gate voltage is quite peculiar: the height of the peak near the degeneracy point is independent of temperature, while its width is proportional to T. This is in contrast to the ordinary Coulomb-blockade conductance peak, whose integral strength is T-independent. At finite source-drain bias, V>>T, the width of the conductance peak is ˜V, whereas the conventional Coulomb-blockade peak at finite V splits into two sharp peaks at detunings V/2, and -V/2. Possible applications to the gate-controlled current rectification and switching will be discussed. [1] A. Taraphder and P. Coleman, Phys. Rev. Lett. 66, 2814 (1991). [2] J. Koch, M. E. Raikh, and F. von Oppen, Phys. Rev. Lett. 96, 056803 (2006). [3] F. W. J. Hekking, L. I. Glazman, K. A. Matveev, and R. I. Shekhter, Phys. Rev. Lett. 70, 4138 (1993).

  1. Endocrine factors of pair bonding.

    Science.gov (United States)

    Stárka, L

    2007-01-01

    Throughout literature--fiction and poetry, fine arts and music--falling in love and enjoying romantic love plays a central role. While several psychosocial conceptions of pair attachment consider the participation of hormones, human endocrinology has dealt with this theme only marginally. According to some authors in addictology, falling in love shows some signs of hormonal response to stressors with changes in dopamine and serotonin signalling and neurotrophin (transforming growth factor b) concentration. Endorphins, oxytocin and vasopressin may play a role during the later phases of love. However, proof of hormonal events associated with love in humans has, until recently, been lacking.

  2. Top pair production at ATLAS

    Directory of Open Access Journals (Sweden)

    Loginov Andrey

    2013-05-01

    Full Text Available An overview of latest ATLAS measurements of top pair (tt̅ production in proton-proton collisions at the LHC at centre-of-mass energies of 7 and 8 TeV is presented. Measurements of the tt̅ production cross section (σtt̅ in various decay channels, including analyses of differential σtt̅ distributions and a study of jet multiplicity in tt̅ production, as well as searches for tt̅ resonances using boosted top techniques and standard methods, are discussed.

  3. Bound Polaron Pair Formation in Poly (phenylenevinylenes)

    Science.gov (United States)

    Rothberg, Lewis

    The following sections are included: * INTRODUCTION * PHOTOGENERATED YIELD OF SINGLET EXCITONS * AGGREGRATION EFFECTS ON EXCITED STATE PHOTO-GENERATION * ASSIGNMENT TO BOUND POLARON PAIRS AND DISCUSSION * PROBLEMS WITH THE BOUND POLARON PAIR PICTURE AND CONCLUSION * REFERENCES

  4. LOD wars: The affected-sib-pair paradigm strikes back!

    Energy Technology Data Exchange (ETDEWEB)

    Farrall, M. [Wellcome Trust Centre for Human Genetics, Oxford (United Kingdom)

    1997-03-01

    In a recent letter, Greenberg et al. aired their concerns that the affected-sib-pair (ASP) approach was becoming excessively popular, owing to misconceptions and ignorance of the properties and limitations of both the ASP and the classic LOD-score approaches. As an enthusiast of using the ASP approach to map susceptibility genes for multifactorial traits, I would like to contribute a few comments and explanatory notes in defense of the ASP paradigm. 18 refs.

  5. Drift wave in pair-ion plasma

    Indian Academy of Sciences (India)

    Samiran Ghosh; Nikhil Chakrabarti; Manoranjan Khan; M R Gupta

    2013-02-01

    The conditions for the existence of low-frequency electrostatic drift wave in pair-ion plasma are discussed. It is shown that the temperature and/or mass difference of both species could produce drift wave in a pair-ion plasma. The results are discussed in the context of the fullerene pair-ion plasma experiment.

  6. On one-sided torsion pair

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    Motivated by the concept of a torsion pair in a pre-triangulated category induced by Beligiannis and Reiten, the notion of a left (right) torsion pair in the left (right) triangulated category is introduced and investigated. We provide new connections between different aspects of torsion pairs in one-sided triangulated categories, pre-triangulated categories, stable categories and derived categories.

  7. Homolog pairing and segregation in Drosophila meiosis.

    Science.gov (United States)

    McKee, B D

    2009-01-01

    Pairing of homologous chromosomes is fundamental to their reliable segregation during meiosis I and thus underlies sexual reproduction. In most eukaryotes homolog pairing is confined to prophase of meiosis I and is accompanied by frequent exchanges, known as crossovers, between homologous chromatids. Crossovers give rise to chiasmata, stable interhomolog connectors that are required for bipolar orientation (orientation to opposite poles) of homologs during meiosis I. Drosophila is unique among model eukaryotes in exhibiting regular homolog pairing in mitotic as well as meiotic cells. I review the results of recent molecular studies of pairing in both mitosis and meiosis in Drosophila. These studies show that homolog pairing is continuous between pre-meiotic mitosis and meiosis but that pairing frequencies and patterns are altered during the mitotic-meiotic transition. They also show that, with the exception of X-Y pairing in male meiosis, which is mediated specifically by the 240-bp rDNA spacer repeats, chromosome pairing is not restricted to specific sites in either mitosis or meiosis. Instead, virtually all chromosome regions, both heterochromatic and euchromatic, exhibit autonomous pairing capacity. Mutations that reduce the frequencies of both mitotic and meiotic pairing have been recently described, but no mutations that abolish pairing completely have been discovered, and the genetic control of pairing in Drosophila remains to be elucidated.

  8. Perturbations of vortex ring pairs

    CERN Document Server

    Gubser, Steven S; Parikh, Sarthak

    2015-01-01

    We study pairs of co-axial vortex rings starting from the action for a classical bosonic string in a three-form background. We complete earlier work on the phase diagram of classical orbits by explicitly considering the case where the circulations of the two vortex rings are equal and opposite. We then go on to study perturbations, focusing on cases where the relevant four-dimensional transfer matrix splits into two-dimensional blocks. When the circulations of the rings have the same sign, instabilities are mostly limited to wavelengths smaller than a dynamically generated length scale at which single-ring instabilities occur. When the circulations have the opposite sign, larger wavelength instabilities can occur.

  9. QUANTUM CRYPTOGRAPHY WITH PHOTON PAIRS

    Directory of Open Access Journals (Sweden)

    Anand Sharma,

    2010-07-01

    Full Text Available Quantum cryptographic systems use quantum mechanical concepts that are based on qubit superposition of states, and on the no cloning or no copying theorem to establish unbreakable cipher keys. The basic idea of quantum cryptography is to send the key in the form of photons over a public channel, encoding the zeros and one on quantum states in such a way that any eavesdropping attempt can be detected. Using optical communications the most commonly quantum mechanical property used is the polarization state of photon. However, in most quantum cryptographic algorithms a random polarization state is required. The photons are ideal for low loss transport, either in free space or in optical fibers, i.e. we have the full arsenal of fiber optic technology at our disposal. In this paper we are describing the process of quantum cryptography with photon pairs.

  10. Paired states on a torus

    Energy Technology Data Exchange (ETDEWEB)

    Cristofano, Gerardo E-mail: gerardo.cristofano@na.infn.it; Maiella, Giuseppe E-mail: giuseppe.maiella@na.infn.it; Marotta, Vincenzo E-mail: vincenzo.marotta@na.infn.it; Niccoli, Giuliano E-mail: giuliano.niccoli@na.infn.it

    2002-10-14

    We analyze the modular properties of the effective CFT description for paired states, proposed in G. Cristofano, G. Maiella, V. Marrota, Mod. Phys. Lett. A 15 (2000) 1679, corresponding to the non-standard filling {nu}=((1)/(p+1)). We construct its characters for the twisted and the untwisted sector and the diagonal partition function. We show that the degrees of freedom entering our partition function naturally go to complete a Z{sub 2}-orbifold construction of the CFT for the Halperin state. Different behaviours for the p even and p odd cases are also studied. Finally it is shown that the tunneling phenomenon selects out a twist invariant CFT which is identified with the Moore-Read model.

  11. The identification of physical close galaxy pairs

    CERN Document Server

    Soares, D S L

    2007-01-01

    A classification scheme for close pairs of galaxies is proposed. The scheme is motivated by the fact that the majority of apparent close pairs are in fact wide pairs in three-dimensional space. This is demonstrated by means of numerical simulations of random samples of binary galaxies and the scrutiny of the resulting projected and spatial separation distributions. Observational strategies for classifying close pairs according to the scheme are suggested. As a result, physical -- i.e., bound and spatially -- close pairs are identified.

  12. On Minus Paired-Domination in Graphs

    Institute of Scientific and Technical Information of China (English)

    邢化明; 孙良

    2003-01-01

    The study of minus paired-domination of a graph G=(V,E) is initiated. Let SV be any paired-dominating set of G, a minus paired-dominating function is a function of the form f∶V→{-1,0,1} such that f(v)=1 for v∈S, f(v)≤0 for v∈V-S, and f(N[v])≥1 for all v∈V. The weight of a minus paired-dominating function f is w(f)=∑f(v), over all vertices v∈V. The minus paired-domination number of a graph G is γ-p(G)=min{w(f)|f is a minus paired-dominating function of G}. On the basis of the minus paired-domination number of a graph G defined, some of its properties are discussed.

  13. Cumulative Paired φ-Entropy

    Directory of Open Access Journals (Sweden)

    Ingo Klein

    2016-07-01

    Full Text Available A new kind of entropy will be introduced which generalizes both the differential entropy and the cumulative (residual entropy. The generalization is twofold. First, we simultaneously define the entropy for cumulative distribution functions (cdfs and survivor functions (sfs, instead of defining it separately for densities, cdfs, or sfs. Secondly, we consider a general “entropy generating function” φ, the same way Burbea et al. (IEEE Trans. Inf. Theory 1982, 28, 489–495 and Liese et al. (Convex Statistical Distances; Teubner-Verlag, 1987 did in the context of φ-divergences. Combining the ideas of φ-entropy and cumulative entropy leads to the new “cumulative paired φ-entropy” ( C P E φ . This new entropy has already been discussed in at least four scientific disciplines, be it with certain modifications or simplifications. In the fuzzy set theory, for example, cumulative paired φ-entropies were defined for membership functions, whereas in uncertainty and reliability theories some variations of C P E φ were recently considered as measures of information. With a single exception, the discussions in the scientific disciplines appear to be held independently of each other. We consider C P E φ for continuous cdfs and show that C P E φ is rather a measure of dispersion than a measure of information. In the first place, this will be demonstrated by deriving an upper bound which is determined by the standard deviation and by solving the maximum entropy problem under the restriction of a fixed variance. Next, this paper specifically shows that C P E φ satisfies the axioms of a dispersion measure. The corresponding dispersion functional can easily be estimated by an L-estimator, containing all its known asymptotic properties. C P E φ is the basis for several related concepts like mutual φ-information, φ-correlation, and φ-regression, which generalize Gini correlation and Gini regression. In addition, linear rank tests for scale that

  14. Report on Pairing-based Cryptography.

    Science.gov (United States)

    Moody, Dustin; Peralta, Rene; Perlner, Ray; Regenscheid, Andrew; Roginsky, Allen; Chen, Lily

    2015-01-01

    This report summarizes study results on pairing-based cryptography. The main purpose of the study is to form NIST's position on standardizing and recommending pairing-based cryptography schemes currently published in research literature and standardized in other standard bodies. The report reviews the mathematical background of pairings. This includes topics such as pairing-friendly elliptic curves and how to compute various pairings. It includes a brief introduction to existing identity-based encryption (IBE) schemes and other cryptographic schemes using pairing technology. The report provides a complete study of the current status of standard activities on pairing-based cryptographic schemes. It explores different application scenarios for pairing-based cryptography schemes. As an important aspect of adopting pairing-based schemes, the report also considers the challenges inherent in validation testing of cryptographic algorithms and modules. Based on the study, the report suggests an approach for including pairing-based cryptography schemes in the NIST cryptographic toolkit. The report also outlines several questions that will require further study if this approach is followed.

  15. Pulsational-Pair Instability Supernovae

    CERN Document Server

    Woosley, S E

    2016-01-01

    The final evolution of stars in the mass range 60 - 150 solar masses is explored. Depending upon their mass loss and rotation rates, many of these stars will end their lives as pulsational pair-instability supernovae. Even a non-rotating 70 solar mass star is pulsationally unstable during oxygen shell burning and can power a sub-luminous supernova. Rotation decreases the limit further. For more massive stars, the pulsations are less frequent, span a longer time, and are more powerful. Violent pulsations eject not only any residual low density envelope, but also that fraction of the helium core mass outside about 35 - 50 solar masses. The remaining core of helium and heavy elements continues to evolve, ultimately forming an iron core of about 2.5 solar masses that probably collapses to a black hole. A variety of observational transients result with total durations ranging from days to 10,000 years, and luminosities from 10$^{41}$ to 10$^{44}$ erg s$^{-1}$. Many transients resemble ordinary Type IIp supernovae,...

  16. Genome filtering using methylation-sensitive restriction enzymes with six-base pair recognition sites

    Science.gov (United States)

    The large fraction of repetitive DNA in many plant genomes has complicated all aspects of DNA sequencing and assembly, and thus techniques that enrich for genes and low-copy sequences have been employed to isolate gene space. Methyl sensitive restriction enzymes with six base pair recognition sites...

  17. Pair programming in education: a literature review

    Science.gov (United States)

    Hanks, Brian; Fitzgerald, Sue; McCauley, Renée; Murphy, Laurie; Zander, Carol

    2011-06-01

    This article provides a review of educational research literature focused on pair programming in the undergraduate computer science curriculum. Research suggests that the benefits of pair programming include increased success rates in introductory courses, increased retention in the major, higher quality software, higher student confidence in solutions, and improvement in learning outcomes. Moreover, there is some evidence that women, in particular, benefit from pair programming. The literature also provides evidence that the transition from paired to solo programming is easy for students. The greatest challenges for paired students appear to concern scheduling and partner compatibility. This review also considers practical issues such as assigning partners, teaching students to work in pairs, and assessing individual contributions, and concludes with a discussion of open research questions.

  18. Filipino au pairs on the move

    DEFF Research Database (Denmark)

    Dalgas, Karina Märcher

    2016-01-01

    Most Filipina au pairs in Denmark send remittances back home, and for many, au pairing forms part of longer-term migration trajectories. This article explores how Filipina au pairs try to carve out a future for themselves abroad. It shows that they navigate within tight webs of financial interdep...... by including the migrants’ broader social network within the frame of research.......Most Filipina au pairs in Denmark send remittances back home, and for many, au pairing forms part of longer-term migration trajectories. This article explores how Filipina au pairs try to carve out a future for themselves abroad. It shows that they navigate within tight webs of financial...... interdependence, whilst they continuously form their trajectories in relation to opportunities and restraints posed along the way by their local and transnational social relations. The article argues that examinations of migration trajectories benefit from broadening the research out in both time and space...

  19. Galaxy pairs align with galactic filaments

    CERN Document Server

    Tempel, Elmo

    2015-01-01

    Context. Gravitational collapse theory and numerical simulations suggest that the velocity field within large-scale galaxy filaments is dominated by motions along the filaments. Aims. Our aim is to check whether observational data reveal any preferred orientation of galaxy pairs with respect to the underlying filaments as a result of the expectedly anisotropic velocity field. Methods. We use galaxy pairs and galaxy filaments identified from the Sloan Digital Sky Survey data. For filament extraction, we use the Bisous model that is based the marked point process technique. During the filament detection, we use the centre point of each pair instead of the positions of galaxies to avoid a built-in influence of pair orientation on the filament construction. For pairs lying within filaments (3012 cases), we calculate the angle between the line connecting galaxies of each pair and their host filament. To avoid redshift-space distortions, the angle is measured in the plain of the sky. Results. The alignment analysis...

  20. Ensemble treatments of thermal pairing in nuclei

    Science.gov (United States)

    Hung, Nguyen Quang; Dang, Nguyen Dinh

    2009-10-01

    A systematic comparison is conducted for pairing properties of finite systems at nonzero temperature as predicted by the exact solutions of the pairing problem embedded in three principal statistical ensembles, namely the grandcanonical ensemble, canonical ensemble and microcanonical ensemble, as well as the unprojected (FTBCS1+SCQRPA) and Lipkin-Nogami projected (FTLN1+SCQRPA) theories that include the quasiparticle number fluctuation and coupling to pair vibrations within the self-consistent quasiparticle random-phase approximation. The numerical calculations are performed for the pairing gap, total energy, heat capacity, entropy, and microcanonical temperature within the doubly-folded equidistant multilevel pairing model. The FTLN1+SCQRPA predictions are found to agree best with the exact grand-canonical results. In general, all approaches clearly show that the superfluid-normal phase transition is smoothed out in finite systems. A novel formula is suggested for extracting the empirical pairing gap in reasonable agreement with the exact canonical results.

  1. Ordered pairing in liquid metallic hydrogen

    Science.gov (United States)

    Carlsson, A. E.; Ashcroft, N. W.

    1983-01-01

    We study two possible types of pairing involving the protons of a proposed low-temperature liquid phase metallic hydrogen. Electron-proton pairing, which can result in an insulating phase, is investigated by using an approximate solution of an Eliashberg-type equation for the anomalous self-energy. A very low estimate of the transition temperature is obtained by including proton correlations in the effective interaction. For proton-proton pairing, we derive a new proton pair potential based on the Abrikosov wave function. This potential includes the electron-proton interaction to all orders and has a much larger well depth than is obtained with linear screening methods. This suggests the possibility of either a superfluid paired phase analogous to that in He-3, or alternatively a phase with true molecular pairing.

  2. Multipair approach to pairing in nuclei

    CERN Document Server

    Sambataro, M

    2012-01-01

    The ground state of a general pairing Hamiltonian for a finite nuclear system is constructed as a product of collective, real, distinct pairs. These are determined sequentially via an iterative variational procedure that resorts to diagonalizations of the Hamiltonian in restricted model spaces. Different applications of the method are provided that include comparisons with exact and projected BCS results. The quantities that are examined are correlation energies, occupation numbers and pair transfer matrix elements. In a first application within the picket-fence model, the method is seen to generate the exact ground state for pairing strengths confined in a given range. Further applications of the method concern pairing in spherically symmetric mean fields and include simple exactly solvable models as well as some realistic calculations for middle-shell Sn isotopes. In the latter applications, two different ways of defining the pairs are examined: either with J=0 or with no well-defined angular momentum. The ...

  3. Becoming independent through au pair migration

    DEFF Research Database (Denmark)

    Dalgas, Karina Märcher

    2015-01-01

    . This article argues that, despite this critique, au pairing does play an important formative role for young Filipinas because it opens up for experiences abroad that enable them to be recognised as independent adults in Philippine society. Rather than autonomy, however, au pairs define their independence......Over the past decade, growing numbers of young Filipinas have entered Denmark on the au pair scheme. While its official aim is to broaden the cultural horizons of youth, researchers generally view Filipina au pairing as a form of labour migration using au pairs as inexpensive domestic workers...... in terms of their capacity to assume responsibility for others, thereby achieving a position of social respect. Based on ethnographic fieldwork in Denmark and the Philippines, this article explores how young Filipinas use the social, economic, and cultural resources they gain from their au pair stay abroad...

  4. Top pair production distributions at the Tevatron

    Directory of Open Access Journals (Sweden)

    Takeuchi Yuji

    2013-05-01

    Full Text Available At the Tevatron, the top quark is mainly produced in pairs through the strong interaction and decays before forming hadrons. Thus the kinematical distributions at top pair production possess rich information on the tt¯$tar t$ production vertex including polarizations of top and anti-top quarks. In this article, recent measurements on top quark pair production distributions at Tevatron (CDF and DO are presented.

  5. Lax pairs for deformed Minkowski spacetimes

    CERN Document Server

    Kyono, Hideki; Yoshida, Kentaroh

    2015-01-01

    We proceed to study Yang-Baxter deformations of 4D Minkowski spacetime based on a conformal embedding. We first revisit a Melvin background and argue a Lax pair by adopting a simple replacement law invented in 1509.00173. This argument enables us to deduce a general expression of Lax pair. Then the anticipated Lax pair is shown to work for arbitrary classical $r$-matrices with Poinca\\'e generators. As other examples, we present Lax pairs for pp-wave backgrounds, the Hashimoto-Sethi background, the Spradlin-Takayanagi-Volovich background.

  6. Transrelativistic pair plasmas in AGN jets

    DEFF Research Database (Denmark)

    Bottcher, M.; Pohl, M.; Schlickeiser, R.

    1999-01-01

    Models of relativistic jets filled with ultrarelativistic pair plasma are very successful in explaining the broadband radiation of gamma-ray blazars. Assuming that the initial injection and cooling of ultrarelativistic pair plasma in an AGN jet has occurred, producing the observed high-energy gamma......-ray radiation, we investigate the further evolution of the pair plasma as it continues to move out from the central engine. The effects of thermalization and reacceleration, the emission of pair bremsstrahlung and annihilation radiation and the bulk Compton process, and the possible application to MeV blazars...

  7. COTORSION PAIRS OVER FINITE GROUP GRADED RINGS

    Institute of Scientific and Technical Information of China (English)

    MENG Fan-yun; SUN Ju-xiang

    2015-01-01

    In this paper, we study the relation of cotorsion pairs between the graded and ungraded cases. By using the graded theory and the relative homological algebra, we first consider the relationship of cotorsion pairs in R-mod and S = R∗G-mod when R is any ring and G is a finite group. Then we study rigid cotorsion pairs in R-gr and consider the relationship of cotorsion pairs between R-gr and R-mod when R is a ring graded by a finite group G with|G|−1 ∈R.

  8. Optimal scaling of paired comparison data

    NARCIS (Netherlands)

    van de Velden, M.

    2004-01-01

    In this paper we consider the analysis of paired comparisons using optimal scaling techniques. In particular, we will, inspired by Guttman's approach for quantifying paired comparisons, formulate a new method to obtain optimal scaling values for the subjects. We will compare our results with those o

  9. Exploring Pair Programming Benefits for MIS Majors

    Science.gov (United States)

    Dongo, Tendai; Reed, April H.; O'Hara, Margaret

    2016-01-01

    Pair programming is a collaborative programming practice that places participants in dyads, working in tandem at one computer to complete programming assignments. Pair programming studies with Computer Science (CS) and Software Engineering (SE) majors have identified benefits such as technical productivity, program/design quality, academic…

  10. Open string pair creation from worldsheet instantons

    Energy Technology Data Exchange (ETDEWEB)

    Schubert, Christian [Max-Planck-Institut fuer Gravitationsphysik, Albert-Einstein-Institut, Muehlenberg 1, D-14476 Potsdam (Germany); Torrielli, Alessandro [Institute for Theoretical Physics and Spinoza Institute, Utrecht University, Leuvenlaan 4, 3584 CE Utrecht (Netherlands)

    2010-10-08

    Worldline instantons provide a particularly elegant way to derive Schwinger's well-known formula for the pair creation rate due to a constant electric field in quantum electrodynamics. In this communication, we show how to extend this method to the corresponding problem of open string pair creation. (fast track communication)

  11. Prime pairs and the zeta function

    NARCIS (Netherlands)

    Korevaar, J.

    2009-01-01

    Are there infinitely many prime pairs with given even difference? Most mathematicians think so. Using a strong arithmetic hypothesis, Goldston, Pintz and Yildirim have recently shown that there are infinitely many pairs of primes differing by at most sixteen. There is extensive numerical support for

  12. Bidirectional Synonym Ratings of 464 Noun Pairs.

    Science.gov (United States)

    Whitten, William B.; And Others

    1979-01-01

    Each of 464 noun pairs was rated for synonymy on a seven-point scale by college students to provide an extensive set of synonym pairs for use as stimuli in experiments, and to evaluate the effects of word encoding order on perceived synonymy. (SW)

  13. Pairing in a dry Fermi sea.

    Science.gov (United States)

    Maier, T A; Staar, P; Mishra, V; Chatterjee, U; Campuzano, J C; Scalapino, D J

    2016-06-17

    In the traditional Bardeen-Cooper-Schrieffer theory of superconductivity, the amplitude for the propagation of a pair of electrons with momentum k and -k has a log singularity as the temperature decreases. This so-called Cooper instability arises from the presence of an electron Fermi sea. It means that an attractive interaction, no matter how weak, will eventually lead to a pairing instability. However, in the pseudogap regime of the cuprate superconductors, where parts of the Fermi surface are destroyed, this log singularity is suppressed, raising the question of how pairing occurs in the absence of a Fermi sea. Here we report Hubbard model numerical results and the analysis of angular-resolved photoemission experiments on a cuprate superconductor. In contrast to the traditional theory, we find that in the pseudogap regime the pairing instability arises from an increase in the strength of the spin-fluctuation pairing interaction as the temperature decreases rather than the Cooper log instability.

  14. Muon pair production in relativistic nuclear collisions

    CERN Document Server

    Hencken, K; Serbo, V G

    2006-01-01

    The exclusive production of one $\\mu^+\\mu^-$ pair in collisions of two ultra-relativistic nuclei is considered. We present the simple method for calculation of the Born cross section for this process. Then we found that the Coulomb corrections to this cross section (which correspond to multi-photon exchange of the produced $\\mu^{\\pm}$ with nuclei) are small while the unitarity corrections are large. This is in sharp contrast to the exclusive $e^+e^-$ pair production where the Coulomb corrections to the Born cross section are large while the unitarity corrections are small. We calculated also the cross section for the production of one $\\mu^+\\mu^-$ pair and several $e^+e^-$ pairs in the leading logarithmic approximation. Using this cross section we found that the inclusive production of $\\mu^+\\mu^-$ pair coincides in this approximation with its Born value.

  15. Genotypic variation in tetraploid wheat affecting homoeologous pairing in hybrids with Aegilops peregrina.

    Science.gov (United States)

    Ozkan, H; Feldman, M

    2001-12-01

    The Ph1 gene has long been considered the main factor responsible for the diploid-like meiotic behavior of polyploid wheat. This dominant gene, located on the long arm of chromosome 5B (5BL), suppresses pairing of homoeologous chromosomes in polyploid wheat and in their hybrids with related species. Here we report on the discovery of genotypic variation among tetraploid wheats in the control of homoeologous pairing. Compared with the level of homoeologous pairing in hybrids between Aegilops peregrina and the bread wheat cultivar Chinese Spring (CS), significantly higher levels of homoeologous pairing were obtained in hybrids between Ae. peregrina and CS substitution lines in which chromosome 5B of CS was replaced by either 5B of Triticum turgidum ssp. dicoccoides line 09 (TTD09) or 5G of Triticum timopheevii ssp. timopheevii line 01 (TIMO1). Similarly, a higher level of homoeologous pairing was found in the hybrid between Ae. peregrina and a substitution line of CS in which chromosome arm 5BL of line TTD140 substituted for 5BL of CS. It appears that the observed effect on the level of pairing is exerted by chromosome arm 5BL of T turgidum ssp. dicoccoides, most probably by an allele of Ph1. Searching for variation in the control of homoeologous pairing among lines of wild tetraploid wheat, either T turgidum ssp. dicoccoides or T timopheevii ssp. armeniacum, showed that hybrids between Ae. peregrina and lines of these two wild wheats exhibited three different levels of homoeologous pairing: low, low intermediate, and high intermediate. The low-intermediate and high-intermediate genotypes may possess weak alleles of Ph1. The three different T turgidum ssp. dicoccoides pairing genotypes were collected from different geographical regions in Israel, indicating that this trait may have an adaptive value. The availability of allelic variation at the Ph1 locus may facilitate the mapping, tagging, and eventually the isolation of this important gene.

  16. Solubilization and fractionation of paired helical filaments.

    Science.gov (United States)

    González, P J; Correas, I; Avila, J

    1992-09-01

    Paired helical filaments isolated from brains of two different patients with Alzheimer's disease were extensively treated with the ionic detergent, sodium dodecyl sulphate. Filaments were solubilized at different extents, depending on the brain examined, thus suggesting the existence of two types of paired helical filaments: sodium dodecyl sulphate-soluble and insoluble filaments. In the first case, the number of structures resembling paired helical filaments greatly decreased after the detergent treatment, as observed by electron microscopy. Simultaneously, a decrease in the amount of sedimentable protein was also observed upon centrifugation of the sodium dodecyl sulfate-treated paired helical filaments. A sodium dodecyl sulphate-soluble fraction was isolated as a supernatant after low-speed centrifugation of the sodium dodecyl sulphate-treated paired helical filaments. The addition of the non-ionic detergent Nonidet-P40 to this fraction resulted in the formation of paired helical filament-like structures. When the sodium dodecyl sulphate-soluble fraction was further fractionated by high-speed centrifugation, three subfractions were observed: a supernatant, a pellet and a thin layer between these two subfractions. No paired helical filaments were observed in any of these subfractions, even after addition of Nonidet P-40. However, when they were mixed back together, the treatment with Nonidet P-40 resulted in the visualization of paired helical filament-like structures. These results suggest that at least two different components are needed for the reconstitution of paired helical filaments as determined by electron microscopy. The method described here may allow the study of the components involved in the formation of paired helical filaments and the identification of possible factors capable of blocking this process.

  17. Pure Pairing Modes in Trapped Fermion Systems

    Science.gov (United States)

    Capuzzi, P.; Hernández, E. S.; Szybisz, L.

    2013-05-01

    We present numerical predictions for the shape of the pairing fluctuations in harmonically trapped atomic 6Li with two spin projections, based on the fluiddynamical description of cold fermions with pairing interactions. In previous works it has been shown that when the equilibrium of a symmetric mixture is perturbed, the linearized fluiddynamic equations decouple into two sets, one containing the sound mode of fermion superfluids and the other the pairing mode. The latter corresponds to oscillations of the modulus of the complex gap and is driven by the kinetic energy densities of the particles and of the pairs. Assuming proportionality between the heat flux and the energy gradient, the particle kinetic energy undergoes a diffusive behavior and the diffusion parameter is the key parameter for the relaxation time scale. We examine a possible range of values for this parameter and find that the shape of the pairing oscillation is rather insensitive to the precise value of the transport coefficient. Moreover, the pairing fluctuation is largely confined to the center of the trap, and the energy of the pairing mode is consistent with the magnitude of the equilibrium gap.

  18. P-wave Cooper pair splitting

    Directory of Open Access Journals (Sweden)

    Henning Soller

    2012-07-01

    Full Text Available Background: Splitting of Cooper pairs has recently been realized experimentally for s-wave Cooper pairs. A split Cooper pair represents an entangled two-electron pair state, which has possible application in on-chip quantum computation. Likewise the spin-activity of interfaces in nanoscale tunnel junctions has been investigated theoretically and experimentally in recent years. However, the possible implications of spin-active interfaces in Cooper pair splitters so far have not been investigated.Results: We analyze the current and the cross correlation of currents in a superconductor–ferromagnet beam splitter, including spin-active scattering. Using the Hamiltonian formalism, we calculate the cumulant-generating function of charge transfer. As a first step, we discuss characteristics of the conductance for crossed Andreev reflection in superconductor–ferromagnet beam splitters with s-wave and p-wave superconductors and no spin-active scattering. In a second step, we consider spin-active scattering and show how to realize p-wave splitting using only an s-wave superconductor, through the process of spin-flipped crossed Andreev reflection. We present results for the conductance and cross correlations.Conclusion: Spin-activity of interfaces in Cooper pair splitters allows for new features in ordinary s-wave Cooper pair splitters, that can otherwise only be realized by using p-wave superconductors. In particular, it provides access to Bell states that are different from the typical spin singlet state.

  19. Somatic pairing of chromosome 19 in renal oncocytoma is associated with deregulated EGLN2-mediated [corrected] oxygen-sensing response.

    Directory of Open Access Journals (Sweden)

    Julie M Koeman

    Full Text Available Chromosomal abnormalities, such as structural and numerical abnormalities, are a common occurrence in cancer. The close association of homologous chromosomes during interphase, a phenomenon termed somatic chromosome pairing, has been observed in cancerous cells, but the functional consequences of somatic pairing have not been established. Gene expression profiling studies revealed that somatic pairing of chromosome 19 is a recurrent chromosomal abnormality in renal oncocytoma, a neoplasia of the adult kidney. Somatic pairing was associated with significant disruption of gene expression within the paired regions and resulted in the deregulation of the prolyl-hydroxylase EGLN2 [corrected] a key protein that regulates the oxygen-dependent degradation of hypoxia-inducible factor (HIF. Overexpression of EGLN2 [corrected] in renal oncocytoma increased ubiquitin-mediated destruction of HIF and concomitantly suppressed the expression of several HIF-target genes, including the pro-death BNIP3L gene. The transcriptional changes that are associated with somatic pairing of chromosome 19 mimic the transcriptional changes that occur following DNA amplification. Therefore, in addition to numerical and structural chromosomal abnormalities, alterations in chromosomal spatial dynamics should be considered as genomic events that are associated with tumorigenesis. The identification of EGLN2 as a significantly deregulated gene that maps within the paired chromosome region directly implicates defects in the oxygen-sensing network to the biology of renal oncocytoma.

  20. An Easy-To-Use Combination Four-Terminal-Pair/Two-Terminal-Pair AC Transformer Bridge.

    Science.gov (United States)

    Jeffery, A; Shields, J Q; Lee, L H

    1998-01-01

    A new four-terminal-pair bridge, capable of achieving a relative standard uncertainty of 1×10(-9), was constructed at the National Institute of Standards and Technology by converting a two-terminal-pair bridge. The conversion requires only the addition of components which are easily removed if two-terminal-pair measurements are to be made. The design and testing of this bridge is described. The new four-terminal-pair bridge requires fewer auxiliary balances than the present four-terminal-pair bridge employed at NIST, which makes it much easier to use. This new design can be used to compare capacitance, resistance, and inductance standards.

  1. Pair supersolid with atom-pair hopping on the state-dependent triangular lattice

    Science.gov (United States)

    Zhang, Wanzhou; Yin, Ruoxi; Wang, Yancheng

    2013-11-01

    We systematically study an extended Bose-Hubbard model with atom hopping and atom-pair hopping in the presence of a three-body constraint on the triangular lattice. By means of large-scale quantum Monte Carlo simulations, the ground-state phase diagram is studied. We find a first-order transition between the atomic superfluid phase and the pair superfluid phase when the ratio of the atomic hopping and the atom-pair hopping is adapted. The first-order transition remains unchanged under various conditions. We then focus on the interplay among the atom-pair hopping, the on-site repulsion, and the nearest-neighbor repulsion. With on-site repulsion present, we observe first-order transitions between the Mott insulators and pair superfluid driven by the pair hopping. With the nearest-neighbor repulsion turning on, three typical solid phases with 2/3, 1, and 4/3 filling emerge at small atom-pair hopping region. A stable pair supersolid phase is found at small on-site repulsion. This is due to the three-body constraint and the pair hopping, which essentially make the model a quasihardcore boson system. Thus the pair supersolid state emerges basing on the order-by-disorder mechanism, by which hardcore bosons avoid classical frustration on the triangular lattice. Without on-site repulsion, the transitions between the pair supersolid and the atom superfluid or pair superfluid are first order, except for the particle-hole symmetric point. With weak on-site repulsion and atom hopping turning on, the transition between the pair supersolid and pair superfluid phase becomes continuous. The transition between solid and pair supersolid is three-dimensional XY university, with dynamical exponent z=1 and correlation exponent ν=0.67155. The thermal melting of pair supersolid belongs to the two-dimensional Ising university. We check both energetic and mechanical balance of pair supersolid phase. Lowering the three-body constraint, no pair supersolid is found due to the absence of

  2. English for au pairs the au pair's guide to learning English

    CERN Document Server

    Curtis, Lucy

    2014-01-01

    English for Au Pairs has interlinked stories about a group of au pairs new to England. Marta, an 18-year-old from Poland arrives in the UK to work as an au pair. Throughout her year-long stay she has many different experiences - some bad, some good - but with the support of her host family she finds new friends and improves her English. English for Au Pairs offers insight into the joys and difficulties of being an au pair while at the same time reinforcing English language learning through grammar explanations and exercises.

  3. Pair Creation at Large Inherent Angles

    Energy Technology Data Exchange (ETDEWEB)

    Chen, P.; Tauchi, T.; Schroeder, D.V.; /SLAC

    2007-04-25

    In the next-generation linear colliders, the low-energy e{sup +}e{sup -} pairs created during the collision of high-energy e{sup +}e{sup -} beams would cause potential deleterious background problems to the detectors. At low collider energies, the pairs are made essentially by the incoherent process, where the pair is created by the interaction of beamstrahlung photons on the individual particles in the oncoming beam. This problem was first identified by Zolotarev, et al[1]. At energies where the beamstrahlung parameter {Upsilon} lies approximately in the range 0.6 {approx}< {Upsilon} {approx}< 100, pair creation from the beamstrahlung photons is dominated by a coherent process, first noted by Chen[2]. The seriousness of this pair creation problem lies in the transverse momenta that the pair particles carry when leaving the interaction point (IP) with large angles. One source of transverse momentum is from the kick by the field of the oncoming beam which results in an outcoming angle {theta} {proportional_to} 1/{radical}x, where x is the fractional energy of the particle relative to the initial beam particle energy[2,3]. As was shown in Ref. 131, there in fact exists an energy threshold for the coherent pairs, where x{sub th} {approx}> 1/2{Upsilon}. Thus within a tolerable exiting angle, there exists an upper limit for {Upsilon} where all coherent pairs would leave the detector through the exhaust port[4]. A somewhat different analysis has been done by Schroeder[5]. In the next generation of linear colliders, as it occurs, the coherent pairs can be exponentially suppressed[2] by properly choosing the {Upsilon}({approx}< 0.6). When this is achieved, the incoherent pairs becomes dominant. Since the central issue is the transverse momentum for particles with large angles, we notice that there is another source for it. Namely, when the pair particles are created at low energies, the intrinsic angles of these pairs when produced may already be large. This issue was

  4. Implementation of Cryptosystems Based on Tate Pairing

    Institute of Scientific and Technical Information of China (English)

    Lei Hu; Jun-Wu Dong; Ding-Yi Pei

    2005-01-01

    Tate pairings over elliptic curves are important in cryptography since they can be used to construct efficient identity-based cryptosystems, and their implementation dominantly determines the efficiencies of the cryptosystems. In this paper, the implementation of a cryptosystem is provided based on the Tate pairing over a supersingular elliptic curve of MOV degree 3. The implementation is primarily designed to re-use low-level codes developed in implementation of usual elliptic curve cryptosystems. The paper studies how to construct the underlying ground field and its extension to accelerate the finite field arithmetic, and presents a technique to speedup the time-consuming powering in the Tate pairing algorithm.

  5. Implementation of New Pairing Technique for Studying the Effectiveness of Pairs on Persona and Programming

    Directory of Open Access Journals (Sweden)

    HARSIMARJEET KHURANA

    2011-01-01

    Full Text Available This paper reports on a study in which persona for the category of paired and solo students were compared on the parameter like program clarity, presentation, satisfaction level and confidence level, also the effectiveness of pairs in a JAVA programming language and the impact of pairs on each other. In this study same programs were given to all the category of paired and solo students. Finding reported in this paper are that pairing students were more likely to turn in working programs, and these programs were correctly implemented with more required features as compared to solo students. It has been observed that pairing of intelligent, average and poor with themselves has not shown significant differences but we have seen significant differences with combination of pairs.

  6. Rho GTPase-formin pairs in cytoskeletal remodelling.

    Science.gov (United States)

    Eisenmann, Kathryn M; Peng, Jun; Wallar, Bradley J; Alberts, Arthur S

    2005-01-01

    Diaphanous-related formins (Drfs) are members of a conserved formin family of actin-nucleating proteins and are thought to act as Rho GTPase effectors in signal transduction pathways that govern gene expression, cytoskeletal remodelling and cell division. In vitro evidence suggests that the three mammalian Drf proteins--mDia1, mDia2 and mDia3-have distinct GTPase-binding specificities. However, much of our current understanding of GTPase-Drf partnerships in mammalian cell signalling is based on expression studies using Drfs missing their unique GTPase-binding domains. We have employed fluorescence resonance energy transfer (FRET) and gene targeting approaches to identify the function of different GTPase-formin pairs in cell signalling. These studies have allowed us to uncover new roles for Drf proteins in cytoskeletal remodelling and novel regulatory mechanisms whereby GTPases influence formin function. Our genetic experiments strongly suggest that Drfs cooperate with other GTPase effector proteins, including the gene product of the Wiskott-Aldrich syndrome gene, WASP, during the regulation of cell proliferation. Further, the Drf gene knockout experiments indicate that this family of formins has a role in cancer pathophysiology.

  7. Comments on Coulomb pairing in aromatic hydrocarbons

    CERN Document Server

    Huber, D L

    2013-01-01

    Recently reported anomalies in the double-photonionization spectra of aromatic molecules such as benzene, naphthalene, anthracene and coronene are attributed to Coulomb-pair resonances of pi electrons.

  8. Four square mile survey pair count instructions

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This standard operating procedure (SOP) provides guidance for conducting bird pair count measurements on wetlands for the HAPETs Four-Square-Mile survey. This set of...

  9. Pairing properties of realistic effective interactions

    Directory of Open Access Journals (Sweden)

    Gargano A.

    2016-01-01

    Full Text Available We investigate the pairing properties of an effective shell-model interaction defined within a model space outside 132Sn and derived by means of perturbation theory from the CD-Bonn free nucleon-nucleon potential. It turns out that the neutron pairing component of the effective interaction is significantly weaker than the proton one, which accounts for the large pairing gap difference observed in the two-valence identical particle nuclei 134Sn and 134Te. The role of the contribution arising from one particle-one hole excitations in determining the pairing force is discussed and its microscopic structure is also analyzed in terms of the multipole decomposition.

  10. Colors of Dynamically Associated Asteroid Pairs

    CERN Document Server

    Moskovitz, Nicholas

    2012-01-01

    Recent dynamical studies have identified pairs of asteroids that reside in nearly identical heliocentric orbits. Possible formation scenarios for these systems include dissociation of binary asteroids, collisional disruption of a single parent body, or spin-up and rotational fission of a rubble-pile. Aside from detailed dynamical analyses and measurement of rotational light curves, little work has been done to investigate the colors or spectra of these unusual objects. A photometric and spectroscopic survey was conducted to determine the reflectance properties of asteroid pairs. New observations were obtained for a total of 34 individual asteroids. Additional photometric measurements were retrieved from the Sloan Digital Sky Survey Moving Object Catalog. Colors or spectra for a total of 42 pair components are presented here. The main findings of this work are: (1) the components in the observed pair systems have the same colors within the uncertainties of this survey, and (2) the color distribution of asteroi...

  11. Subthreshold pair production in short laser pulses

    OpenAIRE

    Nousch, T.; Seipt, D.; Kampfer, B.; Titov, A. I.

    2012-01-01

    The $e^+e^-$ pair production by a probe photon traversing a linearly polarized laser pulse is treated as generalized nonlinear Breit-Wheeler process. For short laser pulses with very few oscillations of the electromagnetic field we find below the perturbative weak-field threshold $\\sqrt{s} = 2m$ a similar enhancement of the pair production rate as for circular polarization. The strong subthreshold enhancement is traced back to the finite bandwidth of the laser pulse. A folding model is develo...

  12. Alternative DNA base pairing through metal coordination.

    Science.gov (United States)

    Clever, Guido H; Shionoya, Mitsuhiko

    2012-01-01

    Base-pairing in the naturally occurring DNA and RNA oligonucleotide duplexes is based on π-stacking, hydrogen bonding, and shape complementarity between the nucleobases adenine, thymine, guanine, and cytosine as well as on the hydrophobic-hydrophilic balance in aqueous media. This complex system of multiple supramolecular interactions is the product of a long-term evolutionary process and thus highly optimized to serve its biological functions such as information storage and processing. After the successful implementation of automated DNA synthesis, chemists have begun to introduce artificial modifications inside the core of the DNA double helix in order to study various aspects of base pairing, generate new base pairs orthogonal to the natural ones, and equip the biopolymer with entirely new functions. The idea to replace the hydrogen bonding interactions with metal coordination between ligand-like nucleosides and suitable transition metal ions culminated in the development of a plethora of artificial base-pairing systems termed "metal base-pairs" which were shown to strongly enhance the DNA duplex stability. Furthermore, they show great potential for the use of DNA as a molecular wire in nanoscale electronic architectures. Although single electrons have proven to be transmitted by natural DNA over a distance of several base pairs, the high ohmic resistance of unmodified oligonucleotides was identified as a serious obstacle. By exchanging some or all of the Watson-Crick base pairs in DNA with metal complexes, this problem may be solved. In the future, these research efforts are supposed to lead to DNA-like materials with superior conductivity for nano-electronic applications. Other fields of potential application such as DNA-based supramolecular architecture and catalysis may be strongly influenced by these developments as well. This text is meant to illustrate the basic concepts of metal-base pairing and give an outline over recent developments in this field.

  13. Seniority zero pair coupled cluster doubles theory.

    Science.gov (United States)

    Stein, Tamar; Henderson, Thomas M; Scuseria, Gustavo E

    2014-06-07

    Coupled cluster theory with single and double excitations accurately describes weak electron correlation but is known to fail in cases of strong static correlation. Fascinatingly, however, pair coupled cluster doubles (p-CCD), a simplified version of the theory limited to pair excitations that preserve the seniority of the reference determinant (i.e., the number of unpaired electrons), has mean field computational cost and is an excellent approximation to the full configuration interaction (FCI) of the paired space provided that the orbital basis defining the pairing scheme is adequately optimized. In previous work, we have shown that optimization of the pairing scheme in the seniority zero FCI leads to a very accurate description of static correlation. The same conclusion extends to p-CCD if the orbitals are optimized to make the p-CCD energy stationary. We here demonstrate these results with numerous examples. We also explore the contributions of different seniority sectors to the coupled cluster doubles (CCD) correlation energy using different orbital bases. We consider both Hartree-Fock and Brueckner orbitals, and the role of orbital localization. We show how one can pair the orbitals so that the role of the Brueckner orbitals at the CCD level is retained at the p-CCD level. Moreover, we explore ways of extending CCD to accurately describe strongly correlated systems.

  14. Formation of asteroid pairs by rotational fission.

    Science.gov (United States)

    Pravec, P; Vokrouhlický, D; Polishook, D; Scheeres, D J; Harris, A W; Galád, A; Vaduvescu, O; Pozo, F; Barr, A; Longa, P; Vachier, F; Colas, F; Pray, D P; Pollock, J; Reichart, D; Ivarsen, K; Haislip, J; Lacluyze, A; Kusnirák, P; Henych, T; Marchis, F; Macomber, B; Jacobson, S A; Krugly, Yu N; Sergeev, A V; Leroy, A

    2010-08-26

    Pairs of asteroids sharing similar heliocentric orbits, but not bound together, were found recently. Backward integrations of their orbits indicated that they separated gently with low relative velocities, but did not provide additional insight into their formation mechanism. A previously hypothesized rotational fission process may explain their formation-critical predictions are that the mass ratios are less than about 0.2 and, as the mass ratio approaches this upper limit, the spin period of the larger body becomes long. Here we report photometric observations of a sample of asteroid pairs, revealing that the primaries of pairs with mass ratios much less than 0.2 rotate rapidly, near their critical fission frequency. As the mass ratio approaches 0.2, the primary period grows long. This occurs as the total energy of the system approaches zero, requiring the asteroid pair to extract an increasing fraction of energy from the primary's spin in order to escape. We do not find asteroid pairs with mass ratios larger than 0.2. Rotationally fissioned systems beyond this limit have insufficient energy to disrupt. We conclude that asteroid pairs are formed by the rotational fission of a parent asteroid into a proto-binary system, which subsequently disrupts under its own internal system dynamics soon after formation.

  15. Pair Production in Low Luminosity Galactic Nuclei

    CERN Document Server

    Moscibrodzka, Monika; Dolence, Joshua C; Shiokawa, Hotaka

    2011-01-01

    Electron-positron pairs may be produced near accreting black holes by a variety of physical processes, and the resulting pair plasma may be accelerated and collimated into a relativistic jet. Here we use a self-consistent dynamical and radiative model to investigate pair production by \\gamma\\gamma collisions in weakly radiative accretion flows around a black hole of mass M and accretion rate \\dot{M}. Our flow model is drawn from general relativistic magnetohydrodynamic simulations, and our radiation field is computed by a Monte Carlo transport scheme assuming the electron distribution function is thermal. We argue that the pair production rate scales as r^{-6} M^{-1} \\dot{M}^{6}. We confirm this numerically and calibrate the scaling relation. This relation is self-consistent in a wedge in M, \\dot{M} parameter space. If \\dot{M} is too low the implied pair density over the poles of the black hole is below the Goldreich-Julian density and \\gamma\\gamma pair production is relatively unimportant; if \\dot{M} is too ...

  16. Effect of Drug Pair of Coptis Chinensis and Evodia Rutatecarpa on Blood Pressure,Plasma Endothelin and Calcitonin Gene - related Peptide in Spontaneous Hypertension Rats%药对黄连、吴茱萸对高血压大鼠血压和血浆ET、CGRP的影响

    Institute of Scientific and Technical Information of China (English)

    卜宪峥; 吴华芹; 胡元会; 褚瑜光; 宋庆桥; 王师菡

    2011-01-01

    Objective To investigate the effects of drug pair of coptis chinensis and evodia rutatecarpa on blood pressure.the content of plasma endothelin(ET) .and calcitonin gene - related peptide (CGRP) in spontaneous hypertension rats(SHR). Methods Twenty - four SHR were randomly divided into model group(n = 8) .nifedipine group(n = 8) given nifedipine .and Lianyu decoction group(w=8) given Lianyu oral liquid by continuously gavages. Eight normal Wistar - Kyoto rats(WKY) were as control (WKY group). WKY group and Model group were given normal saline. After treatment for 4 weeks* blood pressure,the content of plasma ET and CGRP were measured. Results Compared with model group, the blood pressure in Lian - Yu decoction group was significantly lower (P<0. 01). The content of ET was decreased (P<0. 05) .while the content of plasma CGRP was greatly increased (P<0. 01) in Lianyu decoction group. Conclusion Drug pair of coptis chinensis and evodia rutatecarpa could significantly reduce blood pressure in SHR, which might be related to reduce the content of plasma ET and increase the content of plasma CGRP.%目的 观察药对黄连、吴茱萸对自发性高血压大鼠(SHR)血压和血管活性物质内皮素(ET)、降钙素基因相关肽(CGRP)含量的影响.方法将24只SHR随机分为模型组(Model组)、硝苯地平组(Nif组)、连萸药对组(LY组),每组8只,以正常WKY大鼠为对照组(WKY组),8只,共4组.WKY组和Model组予以生理盐水,Nif组予以硝苯地平溶液,中药组予以相应配伍剂量的浓煎剂,连续灌胃4周,测量大鼠灌胃前和灌胃4周末大鼠尾动脉的收缩压.第4周末同时测定大鼠血浆中ET、CGRP的含量.结果 与Model组比较,中药组大鼠4周后血压水平明显降低(P<0.05),血浆ET含量降低(P<0.05),CGRP的含量明显升高(P<0.05),但与Nif组相比无统计学意义.结论 药对黄连、吴茱萸对SHR有明显的降压作用,其机制可能与降低血浆中ET的含量,增加CGRP的含量有关.

  17. Fundamental aspects of recoupled pair bonds. I. Recoupled pair bonds in carbon and sulfur monofluoride

    Energy Technology Data Exchange (ETDEWEB)

    Dunning, Thom H., E-mail: thdjr@uw.edu; Xu, Lu T.; Takeshita, Tyler Y. [Department of Chemistry, University of Illinois at Urbana-Champaign, 600 S. Mathews Avenue, Urbana, Illinois 61801 (United States)

    2015-01-21

    The number of singly occupied orbitals in the ground-state atomic configuration of an element defines its nominal valence. For carbon and sulfur, with two singly occupied orbitals in their {sup 3}P ground states, the nominal valence is two. However, in both cases, it is possible to form more bonds than indicated by the nominal valence—up to four bonds for carbon and six bonds for sulfur. In carbon, the electrons in the 2s lone pair can participate in bonding, and in sulfur the electrons in both the 3p and 3s lone pairs can participate. Carbon 2s and sulfur 3p recoupled pair bonds are the basis for the tetravalence of carbon and sulfur, and 3s recoupled pair bonds enable sulfur to be hexavalent. In this paper, we report generalized valence bond as well as more accurate calculations on the a{sup 4}Σ{sup −} states of CF and SF, which are archetypal examples of molecules that possess recoupled pair bonds. These calculations provide insights into the fundamental nature of recoupled pair bonds and illustrate the key differences between recoupled pair bonds formed with the 2s lone pair of carbon, as a representative of the early p-block elements, and recoupled pair bonds formed with the 3p lone pair of sulfur, as a representative of the late p-block elements.

  18. Heterogeneity between primary colon carcinoma and paired lymphatic and hepatic metastases.

    Science.gov (United States)

    Lan, Huanrong; Jin, Ketao; Xie, Bojian; Han, Na; Cui, Binbin; Cao, Feilin; Teng, Lisong

    2012-11-01

    Heterogeneity is one of the recognized characteristics of human tumors, and occurs on multiple levels in a wide range of tumors. A number of studies have focused on the heterogeneity found in primary tumors and related metastases with the consideration that the evaluation of metastatic rather than primary sites could be of clinical relevance. Numerous studies have demonstrated particularly high rates of heterogeneity between primary colorectal tumors and their paired lymphatic and hepatic metastases. It has also been proposed that the heterogeneity between primary colon carcinomas and their paired lymphatic and hepatic metastases may result in different responses to anticancer therapies. The heterogeneity in primary colon carcinoma and corresponding metastases by genome‑wide gene expression analysis has not been extensively studied. In the present study, we investigated the differentially expressed genes between a primary colon carcinoma specimen (obtained from a 40-year-old female colon carcinoma patient with lymphatic and hepatic metastases) and its paired lymphatic and hepatic metastases by genome-wide gene expression analysis using GeneChip HGU133Plus2.0 expression arrays. Our results demonstrate that genome-wide gene expression varies between primary colon carcinoma and its paired lymphatic and hepatic metastases.

  19. Generalized pairing strategies-a bridge from pairing strategies to colorings

    Directory of Open Access Journals (Sweden)

    Győrffy Lajos

    2016-12-01

    Full Text Available In this paper we define a bridge between pairings and colorings of the hypergraphs by introducing a generalization of pairs called t-cakes for t ∈ ℕ, t ≥ 2. For t = 2 the 2-cakes are the same as the well-known pairs of system of distinct representatives, that can be turned to pairing strategies in Maker-Breaker hypergraph games, see Hales and Jewett [12]. The two-colorings are the other extremity of t-cakes, in which the whole ground set of the hypergraph is one big cake that we divide into two parts (color classes. Starting from the pairings (2-cake placement and two-colorings we define the generalized t-cake placements where we pair p elements by q elements (p, q ∈ ℕ, 1 ≤ p, q < t, p + q = t.

  20. Theoretical study of pair density wave superconductors

    Science.gov (United States)

    Zheng, Zhichao

    In conventional superconductors, the Cooper pairs are formed from quasiparticles. We explore another type of superconducting state, a pair density wave (PDW) order, which spontaneously breaks some of the translational and point group symmetries. In a PDW superconductor, the order parameter is a periodic function of the center-of-mass coordinate, and the spatial average value of the superconducting order parameter vanishes. In the early 1960s, following the success of the BCS theory of superconductivity, Fulde and Ferrell and Larkin and Ovchinnikov (FFLO) developed theories of inhomogeneous superconducting states. Because of this Zeeman splitting in a magnetic field, the Cooper pairs having a nonzero center-of-mass momentum are more stable than the normal pairing, leading to the FFLO state. Experiments suggest possible occurrence of the FFLO state in the heavy-fermion compound CeCoIn5, and in quasi-low-dimensional organic superconductors. FFLO phases have also been argued to be of importance in understanding ultracold atomic Fermi gases and in the formation of color superconductivity in high density quark matter. In all Fermi superfluids known at the present time, Cooper pairs are composed of particles with spin 1/2. The spin component of a pair wave function can be characterized by its total spin S = 0 (singlet) and S = 1 (triplet). In the discovered broken inversion superconductors CePt3Si, Li2Pt3B, and Li2Pd3B, the magnetic field leads to novel inhomogeneous superconducting states, namely the helical phase and the multiple-q phase. Its order parameter exhibits periodicity similar to FFLO phase, and the consequences of both phases are same: the enhancement of transition temperature as a function of magnetic field. We have studied the PDW phases in broken parity superconductors with vortices included. By studying PDW vortex states, we find the usual Abrikosov vortex solution is unstable against a new solution with fractional vortex pairs. We have also studied the

  1. Pairing instabilities of Dirac composite fermions

    Science.gov (United States)

    Milovanović, M. V.; Ćirić, M. Dimitrijević; Juričić, V.

    2016-09-01

    Recently, a Dirac (particle-hole symmetric) description of composite fermions in the half-filled Landau level (LL) was proposed [D. T. Son, Phys. Rev. X 5, 031027 (2015), 10.1103/PhysRevX.5.031027], and we study its possible consequences on BCS (Cooper) pairing of composite fermions (CFs). One of the main consequences is the existence of anisotropic states in single-layer and bilayer systems, which was previously suggested in Jeong and Park [J. S. Jeong and K. Park, Phys. Rev. B 91, 195119 (2015), 10.1103/PhysRevB.91.195119]. We argue that in the half-filled LL in the single-layer case the gapped states may sustain anisotropy, because isotropic pairings may coexist with anisotropic ones. Furthermore, anisotropic pairings with the addition of a particle-hole symmetry-breaking mass term may evolve into rotationally symmetric states, i.e., Pfaffian states of Halperin-Lee-Read (HLR) ordinary CFs. On the basis of the Dirac formalism, we argue that in the quantum Hall bilayer at total filling factor 1, with decreasing distance between the layers, weak pairing of p -wave paired CFs is gradually transformed from Dirac to ordinary, HLR-like, with a concomitant decrease in the CF number. Global characterization of low-energy spectra based on the Dirac CFs agrees well with previous calculations performed by exact diagonalization on a torus. Finally, we discuss features of the Dirac formalism when applied in this context.

  2. Pairing and specific heat in hot nuclei

    CERN Document Server

    Gambacurta, Danilo; Sandulescu, Nicu

    2013-01-01

    The thermodynamics of pairing phase-transition in nuclei is studied in the canonical ensemble and treating the pairing correlations in a finite-temperature variation after projection BCS approach (FT-VAP). Due to the restoration of particle number conservation, the pairing gap and the specific heat calculated in the FT-VAP approach vary smoothly with the temperature, indicating a gradual transition from the superfluid to the normal phase, as expected in finite systems. We have checked that the predictions of the FT-VAP approach are very accurate when compared to the results obtained by an exact diagonalization of the pairing Hamiltonian. The influence of pairing correlations on specific heat is analysed for the isotopes $^{161,162}$Dy and $^{171,172}$Yb. It is shown that the FT-VAP approach, applied with a level density provided by mean field calculations and supplemented, at high energies, by the level density of the back-shifted Fermi gas model, can approximate reasonably well the main properties of specifi...

  3. The environment of low redshift quasar pairs

    CERN Document Server

    Sandrinelli, Angela; Treves, Aldo; Farina, Emanuele Paolo; Uslenghi, Michela

    2014-01-01

    We investigate the properties of the galaxy environment of a sample of 14 low redshift (z $<$ 0.85) quasar physical pairs extracted from SDSS DR10 archives. The pairs have a systemic radial velocity difference $\\Delta V_\\parallel \\leqslant$ 600 $km \\ s^{-1}$ (based on [OIII]5007 \\AA \\ line) and projected distance $ R_\\bot \\leqslant$ 600 kpc. The physical association of the pairs is statistically confirmed at a level of $\\sim$ 90 %. For most of the images of these quasars we are able to resolve their host galaxies that turn out to be on average similar to those of quasars not in pairs. We also found that quasars in a pair are on average in region of modest galaxy overdensity extending up 0.5 Mpc from the QSO. This galaxy overdensity is indistinguishable from that of a homogeneous sample of isolated quasars at the same redshift and with similar host galaxy luminosity. These results, albeit derived from a small (but homogeneous) sample of objects, suggest that the rare activation of two quasars with small phy...

  4. String pair production in non homogeneous backgrounds

    CERN Document Server

    Bolognesi, Stefano; Tallarita, Gianni

    2016-01-01

    We consider string pair production in non homogeneous electric backgrounds. We study several particular configurations which can be addressed with the Euclidean world-sheet instanton technique, the analogue of the world-line instanton for particles. In the first case the string is suspended between two D-branes in flat space-time, in the second case the string lives in AdS and terminates on one D-brane (this realizes the holographic Schwinger effect). In some regions of parameter space the result is well approximated by the known analytical formulas, either the particle pair production in non-homogeneous background or the string pair production in homogeneous background. In other cases we see effects which are intrinsically stringy and related to the non-homogeneity of the background. The pair production is enhanced already for particles in time dependent electric field backgrounds. The string nature enhances this even further. For spacial varying electrical background fields the string pair production is les...

  5. Vector boson pair production at hadron colliders

    CERN Document Server

    Adamson, K L

    2002-01-01

    We calculate the contribution of gluon-gluon induced processes to vector boson pair production at hadron colliders, specifically the production of WZ, W gamma and Z gamma pairs. We calculate the tree level processes gg -> WZqq-bqr, gg -> W gamma qq-bar and gg -> Z gamma qq-bar, and the one loop process gg -> Z gamma. We use the helicity method and include the decay of the W and Z bosons into leptons in the narrow width approximation. We include anomalous triple gauge couplings in all of our vector boson pair production calculations. In order to integrate over the qq-bar final state phase space we use an extended version of the subtraction method to NNLO and cancel collinear singularities explicitly. The general subtraction terms that are obtained apply to all vector boson pair production processes. Due to the large gluon density at low x, the gluon induced terms of vector boson pair production are expected to be the dominant NNLO QCD correction, relevant at LHC energies. However, we show that due to a cancell...

  6. Hard photodisintegration of a proton pair

    Science.gov (United States)

    Pomerantz, I.; Bubis, N.; Allada, K.; Beck, A.; Beck, S.; Berman, B. L.; Boeglin, W.; Camsonne, A.; Canan, M.; Chirapatpimol, K.; Cisbani, E.; Cusanno, F.; de Jager, C. W.; Dutta, C.; Garibaldi, F.; Geagla, O.; Gilman, R.; Glister, J.; Higinbotham, D. W.; Jiang, X.; Katramatou, A. T.; Khrosinkova, E.; Lee, B. W.; LeRose, J. J.; Lindgren, R.; McCullough, E.; Meekins, D.; Michaels, R.; Moffit, B.; Petratos, G. G.; Piasetzky, E.; Qian, X.; Qiang, Y.; Rodriguez, I.; Ron, G.; Saha, A.; Sarty, A. J.; Sawatzky, B.; Schulte, E.; Shneor, R.; Sparveris, N.; Subedi, R.; Strauch, S.; Sulkosky, V.; Wang, Y.; Wojtsekhowski, B.; Yan, X.; Yao, H.; Zhan, X.; Zheng, X.

    2010-02-01

    We present a study of high energy photodisintegration of proton-pairs through the γ+He3→p+p+n channel. Photon energies, Eγ, from 0.8 to 4.7 GeV were used in kinematics corresponding to a proton pair with high relative momentum and a neutron nearly at rest. The s scaling of the cross section, as predicted by the constituent counting rule for two nucleon photodisintegration, was observed for the first time. The onset of the scaling is at a higher energy and the cross section is significantly lower than for deuteron (pn pair) photodisintegration. For Eγ below the scaling region, the scaled cross section was found to present a strong energy-dependent structure not observed in deuteron photodisintegration.

  7. The inverse problem for Schwinger pair production

    Directory of Open Access Journals (Sweden)

    F. Hebenstreit

    2016-02-01

    Full Text Available The production of electron–positron pairs in time-dependent electric fields (Schwinger mechanism depends non-linearly on the applied field profile. Accordingly, the resulting momentum spectrum is extremely sensitive to small variations of the field parameters. Owing to this non-linear dependence it is so far unpredictable how to choose a field configuration such that a predetermined momentum distribution is generated. We show that quantum kinetic theory along with optimal control theory can be used to approximately solve this inverse problem for Schwinger pair production. We exemplify this by studying the superposition of a small number of harmonic components resulting in predetermined signatures in the asymptotic momentum spectrum. In the long run, our results could facilitate the observation of this yet unobserved pair production mechanism in quantum electrodynamics by providing suggestions for tailored field configurations.

  8. Narrowband Photon Pair Source for Quantum Networks

    CERN Document Server

    Monteiro, F; Sanguinetti, B; Zbinden, H; Thew, R T

    2013-01-01

    We demonstrate a compact photon pair source based on a periodically poled lithium niobate nonlinear crystal in a cavity. The cavity parameters are chosen such that the emitted photon pair modes can be matched in the region of telecom ultra dense wavelength division multiplexing (U-DWDM) channel spacings. This approach provides efficient, low-loss, mode selection that is compatible with standard telecommunication networks. Photons with a coherence time of 8.6 ns (116 MHz) are produced and their purity is demonstrated. A source brightness of 134 pairs(s.mW.MHz)$^{-1}$ is reported. The high level of purity and compatibility with standard telecom networks is of great importance for complex quantum communication networks.

  9. Categorical Pairs and the Indicative Shift

    CERN Document Server

    Kauffman, Louis H

    2011-01-01

    This paper introduces the notion of a categorical pair, a pair of categories (C,C') such that every morphism in C is an object in C'. Categorical pairs are precursors to 2-categories. Arrows in C' can express relationships among the morphisms of C. In particular we show that by using a model of the linguistic process of naming, we can ensure that every morphism in C has an indirect self-reference of the form a -----> Fa where this arrow occurs in the category C'. This result is shown to generalize and clarify known fixed point theorems in logic and categories, and is applied to Goedel's Incompleteness Theorem, the Cantor Diagonal Process and the Lawvere Fixed Point Theorem. In particular we show that the indirect self-reference that is central to Goedel's Theorem is an instance of a general pattern here called the indicative shift.

  10. The inverse problem for Schwinger pair production

    Energy Technology Data Exchange (ETDEWEB)

    Hebenstreit, F., E-mail: hebenstreit@itp.unibe.ch

    2016-02-10

    The production of electron–positron pairs in time-dependent electric fields (Schwinger mechanism) depends non-linearly on the applied field profile. Accordingly, the resulting momentum spectrum is extremely sensitive to small variations of the field parameters. Owing to this non-linear dependence it is so far unpredictable how to choose a field configuration such that a predetermined momentum distribution is generated. We show that quantum kinetic theory along with optimal control theory can be used to approximately solve this inverse problem for Schwinger pair production. We exemplify this by studying the superposition of a small number of harmonic components resulting in predetermined signatures in the asymptotic momentum spectrum. In the long run, our results could facilitate the observation of this yet unobserved pair production mechanism in quantum electrodynamics by providing suggestions for tailored field configurations.

  11. Holographic EPR Pairs, Wormholes and Radiation

    CERN Document Server

    Chernicoff, Mariano; Pedraza, Juan F

    2013-01-01

    As evidence for the ER=EPR conjecture, it has recently been observed that the string that is holographically dual to an entangled quark-antiquark pair separating with (asymptotically) uniform acceleration has a wormhole on its worldsheet. We point out that a two-sided horizon and a wormhole actually appear for much more generic quark-antiquark trajectories, which is consistent with the fact that the members of an EPR pair need not be permanently out of causal contact. The feature that determines whether the causal structure of the string worldsheet is trivial or not turns out to be the emission of gluonic radiation by the dual quark and antiquark. In the strongly-coupled gauge theory, it is only when radiation is emitted that one obtains an unambiguous separation of the pair into entangled subsystems, and this is what is reflected on the gravity side by the existence of the worldsheet horizon.

  12. An inverse problem for Schwinger pair production

    CERN Document Server

    Hebenstreit, Florian

    2016-01-01

    The production of electron-positron pairs in time-dependent electric fields (Schwinger mechanism) depends non-linearly on the applied field profile. Accordingly, the resulting momentum spectrum is extremely sensitive to small variations of the field parameters. Owing to this non-linear dependence it is so far unpredictable how to choose a field configuration such that a predetermined momentum distribution is generated. We show that quantum kinetic theory along with optimal control theory can be used to approximately solve this inverse problem for Schwinger pair production. We exemplify this by studying the superposition of a small number of harmonic components resulting in predetermined signatures in the asymptotic momentum spectrum. In the long run, our results could facilitate the observation of this yet unobserved pair production mechanism in quantum electrodynamics by providing suggestions for tailored field configurations.

  13. Mad-Maximized Higgs Pair Analyses

    CERN Document Server

    Kling, Felix; Schichtel, Peter

    2016-01-01

    We study Higgs pair production with a subsequent decay to a pair of photons and a pair of bottoms at the LHC. We use the log-likelihood ratio to identify the kinematic regions which either allow us to separate the di-Higgs signal from backgrounds or to determine the Higgs self-coupling. We find that both regions are separate enough to ensure that details of the background modelling will not affect the determination of the self-coupling. Assuming dominant statistical uncertainties we determine the best precision with which the Higgs self- coupling can be probed in this channel. We finally comment on the same questions at a future 100 TeV collider.

  14. Schwinger Pair Production in Pulsed Electric Fields

    CERN Document Server

    Kim, Sang Pyo; Ruffini, Remo

    2012-01-01

    We numerically investigate the temporal behavior and the structure of longitudinal momentum spectrum and the field polarity effect on pair production in pulsed electric fields in scalar quantum electrodynamics (QED). Using the evolution operator expressed in terms of the particle and antiparticle operators, we find the exact quantum states under the influence of electric pulses and measure the number of pairs of the Minkowski particle and antiparticle. The number of pairs, depending on the configuration of electric pulses, exhibits rich structures in the longitudinal momentum spectrum and undergoes diverse dynamical behaviors at the onset of the interaction but always either converges to a momentum-dependent constant or oscillates around a momentum-dependent time average after the completion of fields.

  15. DNA pairing is an important step in the process of targeted nucleotide exchange.

    Science.gov (United States)

    Drury, Miya D; Kmiec, Eric B

    2003-02-01

    Modified single-stranded DNA oligonucleotides can direct the repair of genetic mutations in yeast, plant and mammalian cells. The mechanism by which these molecules exert their effect is being elucidated, but the first phase is likely to involve the homologous alignment of the single strand with its complementary sequence in the target gene. In this study, we establish the importance of such DNA pairing in facilitating the gene repair event. Oligonucleotide-directed repair occurs at a low frequency in an Escherichia coli strain (DH10B) lacking the RECA DNA pairing function. Repair activity can be rescued by using purified RecA protein to catalyze the assimilation of oligonucleotide vectors into a plasmid containing a mutant kanamycin resistance gene in vitro. Electroporation of the preformed complex into DH10B cells results in high levels of gene repair activity, evidenced by the appearance of kanamycin-resistant colonies. Gene repair is dependent on the formation of a double-displacement loop (double-D-loop), a recombination intermediate containing two single-stranded oligonucleotides hybridized to opposite strands of the plasmid at the site of the point mutation. The heightened level of stability of the double-D-loop enables it to serve as an active template for the DNA repair events. The data establish DNA pairing and the formation of the double-D-loop as important first steps in the process of gene repair.

  16. Fostering multiculturalism: the English Conversation Pairs Program.

    Science.gov (United States)

    Smith, B E; Elander, E

    1995-01-01

    Exposure to and personal interactions with people of diverse cultures foster an acceptance of multiculturalism. To this end, the English Conversation Pairs Program provides weekly conversation sessions between students who are native speakers of English (NSE) and students who speak English as a second language (ESL). Attitudes of twenty-two NSE students are surveyed before and after participation in the Conversation Pairs Program. This paper discusses (a) NSE students' perceptions of the program, (b) perceived changes in cultural sensitivity of NSE students, (c) activities which enhance and/or hamper program effectiveness, and (d) variables which influence program effectiveness.

  17. Subthreshold pair production in short laser pulses

    CERN Document Server

    Nousch, T; Kampfer, B; Titov, A I

    2012-01-01

    The $e^+e^-$ pair production by a probe photon traversing a linearly polarized laser pulse is treated as generalized nonlinear Breit-Wheeler process. For short laser pulses with very few oscillations of the electromagnetic field we find below the perturbative weak-field threshold $\\sqrt{s} = 2m$ a similar enhancement of the pair production rate as for circular polarization. The strong subthreshold enhancement is traced back to the finite bandwidth of the laser pulse. A folding model is developed which accounts for the interplay of the frequency spectrum and the intensity distribution in the course of the pulse.

  18. Breaking of Cooper pairs in 108Pd

    Science.gov (United States)

    Rahmatinejad, A.; Kakavand, T.; Razavi, R.

    2016-04-01

    In this paper, breaking of Cooper pairs in 108Pd is investigated within the canonical ensemble framework and the BCS model. Our results show an evidence of two phase transitions, which are related to neutron and proton systems. Also, with consideration of pairing interaction, the role of neutron and proton systems in entropy, spin cutoff parameter and as a result in the moment of inertia are investigated. The results show minor role for the proton system at low temperatures and approximately equal roles for both neutron and proton systems after the critical temperature. Good agreement was observed between obtained results and the experimental data.

  19. Nilpotent orbits in real symmetric pairs

    CERN Document Server

    Dietrich, Heiko; Ruggeri, Daniele; Trigiante, Mario

    2016-01-01

    In the classification of stationary solutions in extended supergravities with symmetric scalar manifolds, the nilpotent orbits of a real symmetric pair play an important role. In this paper we discuss two approaches to determining the nilpotent orbits of a real symmetric pair. We apply our methods to an explicit example, and thereby classify the nilpotent orbits of SL_2(R)^4 acting on the fourth tensor power of the natural 2-dimensional SL_2(R)-module. This makes it possible to classify all stationary solutions of the so-called STU-supergravity model.

  20. Pairing Phase Transitions of Matter under Rotation

    CERN Document Server

    Jiang, Yin

    2016-01-01

    The phases and properties of matter under global rotation have attracted much interest recently. In this paper we investigate the pairing phenomena in a system of fermions under the presence of rotation. We find that there is a generic suppression effect on pairing states with zero angular momentum. We demonstrate this effect with the chiral condensation and the color superconductivity in hot dense QCD matter as explicit examples. In the case of chiral condensation, a new phase diagram in the temperature-rotation parameter space is found, with a nontrivial critical point.

  1. Age-dependent trajectories differ between within-pair and extra-pair paternity success.

    Science.gov (United States)

    Hsu, Y-H; Simons, M J P; Schroeder, J; Girndt, A; Winney, I S; Burke, T; Nakagawa, S

    2017-02-24

    Reproductive success is associated with age in many taxa, increasing in early life followed by reproductive senescence. In socially monogamous but genetically polygamous species, this generates the interesting possibility of differential trajectories of within-pair and extra-pair siring success with age in males. We investigate these relationships simultaneously using within-individual analyses with 13 years of data from an insular house sparrow (Passer domesticus) population. As expected, we found that both within- and extra-pair paternity success increased with age, followed by a senescence-like decline. However, the age trajectories of within- and extra-pair paternity successes differed significantly, with the extra-pair paternity success increasing faster, although not significantly, in early life, and showing a delayed decline by 1.5 years on average later in life compared to within-pair paternity success. These different trajectories indicate that the two alternative mating tactics should have age-dependent pay-offs. Males may partition their reproductive effort between within- and extra-pair matings depending on their current age to reap the maximal combined benefit from both strategies. The interplay between these mating strategies and age-specific mortality may explain the variation in rates of extra-pair paternity observed within and between species.

  2. Communication: Multipole approximations of distant pair energies in local correlation methods with pair natural orbitals

    Science.gov (United States)

    Werner, Hans-Joachim

    2016-11-01

    The accuracy of multipole approximations for distant pair energies in local second-order Møller-Plesset perturbation theory (LMP2) as introduced by Hetzer et al. [Chem. Phys. Lett. 290, 143 (1998)] is investigated for three chemical reactions involving molecules with up to 92 atoms. Various iterative and non-iterative approaches are compared, using different energy thresholds for distant pair selection. It is demonstrated that the simple non-iterative dipole-dipole approximation, which has been used in several recent pair natural orbitals (PNO)-LMP2 and PNO-LCCSD (local coupled-cluster with singles and doubles) methods, may underestimate the distant pair energies by up to 50% and can lead to significant errors in relative energies, unless very tight thresholds are used. The accuracy can be much improved by including higher multipole orders and by optimizing the distant pair amplitudes iteratively along with all other amplitudes. A new approach is presented in which very small special PNO domains for distant pairs are used in the iterative approach. This reduces the number of distant pair amplitudes by 3 orders of magnitude and keeps the additional computational effort for the iterative optimization of distant pair amplitudes minimal.

  3. Extracting an entangled photon pair from collectively decohered pairs at a telecommunication wavelength.

    Science.gov (United States)

    Tsujimoto, Yoshiaki; Sugiura, Yukihiro; Ando, Makoto; Katsuse, Daisuke; Ikuta, Rikizo; Yamamoto, Takashi; Koashi, Masato; Imoto, Nobuyuki

    2015-05-18

    We experimentally demonstrated entanglement extraction scheme by using photons at the telecommunication band for optical-fiber-based quantum communications. We generated two pairs of non-degenerate polarization entangled photons at 780 nm and 1551 nm by spontaneous parametric down-conversion and distributed the two photons at 1551 nm through a collective phase damping channel which gives the same amount of random phase shift on the two photons. Through local operation and classical communication, we extracted an entangled photon pair from two phase-disturbed photon pairs. An observed fidelity of the extracted photon pair to a maximally entangled photon pair was 0.73 ± 0.07 which clearly shows the recovery of entanglement.

  4. Genes and Gene Therapy

    Science.gov (United States)

    ... correctly, a child can have a genetic disorder. Gene therapy is an experimental technique that uses genes to ... or prevent disease. The most common form of gene therapy involves inserting a normal gene to replace an ...

  5. Identification of coupling DNA motif pairs on long-range chromatin interactions in human K562 cells

    KAUST Repository

    Wong, Ka-Chun

    2015-09-27

    Motivation: The protein-DNA interactions between transcription factors (TFs) and transcription factor binding sites (TFBSs, also known as DNA motifs) are critical activities in gene transcription. The identification of the DNA motifs is a vital task for downstream analysis. Unfortunately, the long-range coupling information between different DNA motifs is still lacking. To fill the void, as the first-of-its-kind study, we have identified the coupling DNA motif pairs on long-range chromatin interactions in human. Results: The coupling DNA motif pairs exhibit substantially higher DNase accessibility than the background sequences. Half of the DNA motifs involved are matched to the existing motif databases, although nearly all of them are enriched with at least one gene ontology term. Their motif instances are also found statistically enriched on the promoter and enhancer regions. Especially, we introduce a novel measurement called motif pairing multiplicity which is defined as the number of motifs that are paired with a given motif on chromatin interactions. Interestingly, we observe that motif pairing multiplicity is linked to several characteristics such as regulatory region type, motif sequence degeneracy, DNase accessibility and pairing genomic distance. Taken into account together, we believe the coupling DNA motif pairs identified in this study can shed lights on the gene transcription mechanism under long-range chromatin interactions. © The Author 2015. Published by Oxford University Press.

  6. Evacuation dynamics of asymmetrically coupled pedestrian pairs

    CERN Document Server

    Müller, Frank

    2016-01-01

    We propose and analyze extended floor field cellular automaton models for evacuation dynamics of inhomogeneous pedestrian pairs which are coupled by asymmetric group interactions. Such pairs consist of a leader, who mainly determines the couple's motion and a follower, who has a defined tendency to follow the leader. Examples for such pairs are mother and child or two siblings of different age. We examine the system properties and compare them to the case of a homogeneous crowd. We find a strong impact on evacuation times for the regime of strong pair coupling due to the occurrence of a clogging phenomenon. In addition we obtain a non-trivial dependence of evacuation times on the followers' coupling to the static floor field, which carries the information of the shortest way to the exit location. In particular we find that systems with fully passive followers, who are solely coupled to their leaders, show lower evacuation times than homogeneous systems where all pedestrians have an equal tendency to move towa...

  7. Quantum physics: Photons paired with phonons

    Science.gov (United States)

    Blencowe, Miles

    2016-02-01

    The force exerted by light on an object has been used to pair photons with quantum units of mechanical vibration. This paves the way for mechanical oscillators to act as interfaces between photons and other quantum systems. See Letter p.313

  8. Comparing complexities of pairs of modules

    CERN Document Server

    Dao, Hailong

    2009-01-01

    Let $R$ be a local ring and $M,N$ be finitely generated $R$-modules. The complexity of $(M,N)$, denoted by $\\cxx RMN$, measures the polynomial growth rate of the number of generators of the modules $\\Ext nRMN$. In this paper we study several basic equalities and inequalities involving complexities of different pairs of modules.

  9. Diagnostics for conformity of paired quantitative measurements.

    Science.gov (United States)

    Hawkins, Douglas M

    2002-07-15

    Matched pairs data arise in many contexts - in case-control clinical trials, for example, and from cross-over designs. They also arise in experiments to verify the equivalence of quantitative assays. This latter use (which is the main focus of this paper) raises difficulties not always seen in other matched pairs applications. Since the designs deliberately vary the analyte levels over a wide range, issues of variance dependent on mean, calibrations of differing slopes, and curvature all need to be added to the usual model assumptions such as normality. Violations in any of these assumptions invalidate the conventional matched pairs analysis. A graphical method, due to Bland and Altman, of looking at the relationship between the average and the difference of the members of the pairs is shown to correspond to a formal testable regression model. Using standard regression diagnostics, one may detect and diagnose departures from the model assumptions and remedy them - for example using variable transformations. Examples of different common scenarios and possible approaches to handling them are shown.

  10. Ion Pairing in Alkali Nitrate Electrolyte Solutions.

    Science.gov (United States)

    Xie, Wen Jun; Zhang, Zhen; Gao, Yi Qin

    2016-03-10

    In this study, we investigate the thermodynamics of alkali nitrate salt solutions, especially the formation of contact ion pairs between alkali cation and nitrate anion. The ion-pairing propensity shows an order of LiNO3 activity coefficients and suggest that the empirical "law of matching water affinity" is followed by these alkali nitrate salt solutions. The spatial patterns of contact ion pairs are different in the three salt solutions studied here: Li(+) forms the contact ion pair with only one oxygen of the nitrate while Na(+) and K(+) can also be shared by two oxygens of the nitrate. In reproducing the salt activity coefficient using Kirkwood-Buff theory, we find that it is essential to include electronic polarization for Li(+) which has a high charge density. The electronic continuum correction for nonpolarizable force field significantly improves the agreement between the calculated activity coefficients and their experimental values. This approach also improves the performance of the force field on salt solubility. From these two aspects, this study suggests that electronic continuum correction can be a promising approach to force-field development for ions with high charge densities.

  11. 22 CFR 62.31 - Au pairs.

    Science.gov (United States)

    2010-04-01

    ... her prior experience, skills, or training in the care of special needs children and the host family has reviewed and acknowledged in writing the au pair's prior experience, skills, or training so... participant with more than one host family; (4) A report by a certified public accountant, conducted...

  12. Externally definable sets and dependent pairs

    CERN Document Server

    Chernikov, Artem

    2010-01-01

    We prove that externally definable sets in first order NIP theories have honest definitions, giving a new proof of Shelah's expansion theorem. Also we discuss a weak notion of stable embeddedness true in this context. Those results are then used to prove a general theorem on dependent pairs, which in particular answers a question of Baldwin and Benedikt on naming an indiscernible sequence.

  13. Building a control sample for galaxy pairs

    CERN Document Server

    Perez, Josefa; Blaizot, Jeremy

    2009-01-01

    Several observational works have attempted to isolate the effects of galaxy interactions by comparing galaxies in pairs with isolated galaxies. However, different authors have proposed different ways to build these so-called control samples (CS). By using mock galaxy catalogues of the SDSS-DR4 built up from the Millennium Simulation, we explore how the way of building a CS might introduce biases which could affect the interpretation of results. We make use of the fact that the physics of interactions is not included in the semianalytic model, to infer that any difference between the mock control and pair samples can be ascribed to selection biases. Thus, we find that galaxies in pairs artificially tend to be older and more bulge-dominated, and to have less cold gas and different metallicities than their isolated counterparts. Also because of a biased selection, galaxies in pairs tend to live in higher density environments, and in haloes of larger masses. We find that imposing constraints on redshift, stellar ...

  14. Two New CPM Pairs in Libra

    Science.gov (United States)

    Ahad, Abdul

    2014-10-01

    In this paper two new double stars are reported in the constellation of Libra that are currently not in the WDS catalog, the components of which share common proper motions. On observed photometric characteristics, calibration of distances, and other assumptions, all the indications are that both pairs comprise possible wide physical systems.

  15. A Novel Approach for Collaborative Pair Programming

    Science.gov (United States)

    Goel, Sanjay; Kathuria, Vanshi

    2010-01-01

    The majority of an engineer's time in the software industry is spent working with other programmers. Agile methods of software development like eXtreme Programming strongly rely upon practices like daily meetings and pair programming. Hence, the need to learn the skill of working collaboratively is of primary importance for software developers.…

  16. Pair Negotiation When Developing English Speaking Tasks

    Science.gov (United States)

    Bohórquez Suárez, Ingrid Liliana; Gómez Sará, Mary Mily; Medina Mosquera, Sindy Lorena

    2011-01-01

    This study analyzes what characterizes the negotiations of seventh graders at a public school in Bogotá when working in pairs to develop speaking tasks in EFL classes. The inquiry is a descriptive case study that follows the qualitative paradigm. As a result of analyzing the data, we obtained four consecutive steps that characterize students'…

  17. Chemical Nonlinearities and Radical Pair Lifetime Estimation

    Science.gov (United States)

    Robinson, Gregory

    2013-03-01

    Much attention has recently developed around chemical reactions that depend on applied static magnetic fields as weak as earth's. This interest is largely motivated by experiments that implicate the role of spin-selective radical pair recombination in biological magnetic sensing. Existing literature uses a straightforward calculation to approximate the expected lifetime of coherent radical pairs as a function of the minimum RF amplitude that is observed to disrupt magnetic navigation, apparently by decohering the radical pair via electronic Zeeman excitations. But we show that chemical nonlinearities can preclude direct computation of coherent pair lifetime without considering the cellular signalling mechanisms involved, and discuss whether it can explain the surprising fragility of some animals' compass sense. In particular, we demonstrate that an autocatalytic cycle can introduce threshold effects on the disruption sensitivity to applied oscillatory magnetic fields. We will show examples in the mean-field limit and consider the consequences of noise and fluctuations in the Freidlin-Wentzell picture of perturbed dynamical systems.

  18. Near-Ring Radicals and Class Pairs

    Institute of Scientific and Technical Information of China (English)

    L.Godloza; N.J.Groenewald; W.A.Olivier

    2005-01-01

    For near-ring ideal mappings p1 and p2, we investigate radical theoretical properties of and the relationship among the class pairs (p1: p2), (Sp2: Sp1) and (Rp2:Rp1). Conditions on p1 and p2 are given for a general class pair to form a radical class of various types. These types include the Plotkin and KA-radical varieties. A number of examples are shown to motivate the suitability of the theory of Hoehnke-radicals over KA-radicals when radical pairs of near-rings are studied. In particular, it is shown that (pc: P3) forms a KA-radical class, where Pc denotes the class of completely prime nearrings and P3 the class of 3-prime near-rings. This gives another near-ring generalization of the 2-primal ring concept. The theory of radical pairs are also used to show that in general the class of 3-semiprime near-rings is not the semisimple class of the 3-prime radical.

  19. RNA Matchmaking: Finding Cellular Pairing Partners.

    Science.gov (United States)

    Graveley, Brenton R

    2016-07-21

    RNA structure is intimately related to function, yet methods to identify base-paired RNA strands in a transcriptome-wide manner in cells have remained elusive. One recent paper in Cell and two in Molecular Cell describe related methods to identify RNA sequences that interact in living cells, setting the stage for breakthroughs in our understanding of RNA structure and function.

  20. Computing Hypercrossed Complex Pairings in Digital Images

    Directory of Open Access Journals (Sweden)

    Simge Öztunç

    2013-01-01

    Full Text Available We consider an additive group structure in digital images and introduce the commutator in digital images. Then we calculate the hypercrossed complex pairings which generates a normal subgroup in dimension 2 and in dimension 3 by using 8-adjacency and 26-adjacency.

  1. Asynchronous replication and autosome-pair non-equivalence in human embryonic stem cells.

    Directory of Open Access Journals (Sweden)

    Devkanya Dutta

    Full Text Available A number of mammalian genes exhibit the unusual properties of random monoallelic expression and random asynchronous replication. Such exceptional genes include genes subject to X inactivation and autosomal genes including odorant receptors, immunoglobulins, interleukins, pheromone receptors, and p120 catenin. In differentiated cells, random asynchronous replication of interspersed autosomal genes is coordinated at the whole chromosome level, indicative of chromosome-pair non-equivalence. Here we have investigated the replication pattern of the random asynchronously replicating genes in undifferentiated human embryonic stem cells, using fluorescence in situ hybridization based assay. We show that allele-specific replication of X-linked genes and random monoallelic autosomal genes occur in human embryonic stem cells. The direction of replication is coordinated at the whole chromosome level and can cross the centromere, indicating the existence of autosome-pair non-equivalence in human embryonic stem cells. These results suggest that epigenetic mechanism(s that randomly distinguish between two parental alleles are emerging in the cells of the inner cell mass, the source of human embryonic stem cells.

  2. Multiconfiguration Pair-Density Functional Theory.

    Science.gov (United States)

    Li Manni, Giovanni; Carlson, Rebecca K; Luo, Sijie; Ma, Dongxia; Olsen, Jeppe; Truhlar, Donald G; Gagliardi, Laura

    2014-09-09

    We present a new theoretical framework, called Multiconfiguration Pair-Density Functional Theory (MC-PDFT), which combines multiconfigurational wave functions with a generalization of density functional theory (DFT). A multiconfigurational self-consistent-field (MCSCF) wave function with correct spin and space symmetry is used to compute the total electronic density, its gradient, the on-top pair density, and the kinetic and Coulomb contributions to the total electronic energy. We then use a functional of the total density, its gradient, and the on-top pair density to calculate the remaining part of the energy, which we call the on-top-density-functional energy in contrast to the exchange-correlation energy of Kohn-Sham DFT. Because the on-top pair density is an element of the two-particle density matrix, this goes beyond the Hohenberg-Kohn theorem that refers only to the one-particle density. To illustrate the theory, we obtain first approximations to the required new type of density functionals by translating conventional density functionals of the spin densities using a simple prescription, and we perform post-SCF density functional calculations using the total density, density gradient, and on-top pair density from the MCSCF calculations. Double counting of dynamic correlation or exchange does not occur because the MCSCF energy is not used. The theory is illustrated by applications to the bond energies and potential energy curves of H2, N2, F2, CaO, Cr2, and NiCl and the electronic excitation energies of Be, C, N, N(+), O, O(+), Sc(+), Mn, Co, Mo, Ru, N2, HCHO, C4H6, c-C5H6, and pyrazine. The method presented has a computational cost and scaling similar to MCSCF, but a quantitative accuracy, even with the present first approximations to the new types of density functionals, that is comparable to much more expensive multireference perturbation theory methods.

  3. A context dependent pair hidden Markov model for statistical alignment

    CERN Document Server

    Arribas-Gil, Ana

    2011-01-01

    This article proposes a novel approach to statistical alignment of nucleotide sequences by introducing a context dependent structure on the substitution process in the underlying evolutionary model. We propose to estimate alignments and context dependent mutation rates relying on the observation of two homologous sequences. The procedure is based on a generalized pair-hidden Markov structure, where conditional on the alignment path, the nucleotide sequences follow a Markov distribution. We use a stochastic approximation expectation maximization (saem) algorithm to give accurate estimators of parameters and alignments. We provide results both on simulated data and vertebrate genomes, which are known to have a high mutation rate from CG dinucleotide. In particular, we establish that the method improves the accuracy of the alignment of a human pseudogene and its functional gene.

  4. Modelling of top quark pairs production in association with Standard Model bosons or heavy quark pairs.

    CERN Document Server

    Moreno Llacer, Maria; The ATLAS collaboration

    2016-01-01

    Production of top quark pairs in association with heavy Standard Model bosons or with heavy flavour quark-pairs is important both as a signal and a background in several ATLAS analyses. Strong constraints on such processes cannot at present be obtained from data, and therefore their modeling by Monte Carlo simulation as well as the associated uncertainties are important. This poster documents the Monte Carlo samples currently being used in ATLAS for the ttH and ttV (V=W,Z vector bosons) and tt+bottom and charm quark pairs processes for sqrt(s)=13 TeV proton-proton collisions.

  5. Differing von Hippel Lindau genotype in paired primary and metastatic tumors in patients with clear cell renal cell carcinoma

    Directory of Open Access Journals (Sweden)

    Susan A.J. Vaziri

    2012-05-01

    Full Text Available In sporadic clear cell renal cell carcinoma (CCRCC, the von Hippel Lindau (VHL gene is inactivated by mutation or methylation in the majority of primary (P tumors. Due to differing effects of wild-type (WT and mutant (MT VHL gene on downstream signaling pathways regulating angiogenesis, VHL gene status could impact clinical outcome. In CCRCC, comparative genomic hybridization (CGH analysis studies have reported genetic differences between paired P and metastatic (M tumors. We thus sequenced the VHL gene in paired tumor specimens from 10 patients to determine a possible clonal relationship between the P tumor and M lesion(s in patients with CCRCC. Using paraffin embedded specimens, genomic DNA from microdissected samples (>80% tumor of paired P tumor and M lesions from all 10 patients, as well as in normal tissue from 6 of these cases, was analyzed. The DNA was used for PCR-based amplification of each of the 3 exons of the VHL gene. Sequences derived from amplified samples were compared to the wild-type VHL gene sequence (GeneBank Accession No. AF010238. Methylation status of the VHL gene was determined using VHL methylation-specific PCR primers after DNA bisulfite modification. In 4/10 (40% patients the VHL gene status differed between the P tumor and the M lesion. As expected, when the VHL gene was mutated in both the P tumor and M lesion, the mutation was identical. Further, while the VHL genotype differed between the primary tumor in different kidneys or multiple metastatic lesions in the same patient, the VHL germline genotype in the normal adjacent tissue was always wild-type irrespective of the VHL gene status in the P tumor. These results demonstrate for the first time that the VHL gene status can be different between paired primary and metastatic tissue in patients with CCRCC.

  6. Dual Resolution Images from Paired Fingerprint Cards

    Science.gov (United States)

    NIST Dual Resolution Images from Paired Fingerprint Cards (PC database for purchase)   NIST Special Database 30 is being distributed for use in development and testing of fingerprint compression and fingerprint matching systems. The database allows the user to develop and evaluate data compression algorithms for fingerprint images scanned at both 19.7 ppmm (500 dpi) and 39.4 ppmm (1000 dpi). The data consist of 36 ten-print paired cards with both the rolled and plain images scanned at 19.7 and 39.4 pixels per mm. A newer version of the compression/decompression software on the CDROM can be found at the website http://www.nist.gov/itl/iad/ig/nigos.cfm as part of the NBIS package.

  7. Pair distribution of ions in Coulomb lattice

    CERN Document Server

    Witt, H E D; Chugunov, A I; Baiko, D A; Yakovlev, D G

    2003-01-01

    The pair distribution function g(r) ident to g(x, y, z) and the radial pair distribution function g(r) of ions in body-centred-cubic and face-centred-cubic Coulomb crystals are calculated within the harmonic-lattice (HL) approximation in a wide temperature range, from the high-temperature classical limit (T >> h-bar w sub p , w sub p being the ion plasma frequency) to the low-temperature quantum limit (T || h-bar w sub p). In the classical limit, g(r) is also calculated by the Monte Carlo (MC) method. MC and HL results are demonstrated to be in good agreement. With decreasing T, the correlation peaks of g(r) and g(r) become narrower. At T || h-bar w sub p they become temperature independent (determined by zero-point ion vibrations).

  8. Asymmetric pair distribution functions in catalysts

    DEFF Research Database (Denmark)

    Clausen, B. S.; Nørskov, Jens Kehlet

    2000-01-01

    The structural parameters, i.e., coordination numbers, bond distances and disorder obtained from the analysis of EXAFS spectra may sometimes be significantly influenced by errors introduced due to the inadequacy of the analysis method applied. Especially in the case of heterogeneous catalysts...... it has been realized that often there is a need to use an improved EXAFS data analysis compared to the simple harmonic approach which works well for well-defined bulk structures. This is due to the fact that catalysts contain highly dispersed or disordered structures with pair distribution functions......, will be described. The method is based on an analysis of the pair distribution functions derived from molecular dynamics simulations of small metal particles and its reliability is demonstrated by comparing structural parameters obtained from independent X-ray diffraction experiments....

  9. Top pair production measurements at ATLAS.

    CERN Document Server

    AUTHOR|(INSPIRE)INSPIRE-00445370

    2016-01-01

    Measurements of the inclusive and differential top-quark pair cross sections in proton-proton collisions at both 8 TeV and 13 TeV with the ATLAS detector at the Large Hadron Collider are presented. The inclusive measurements reach high precision and are compared to the best available theoretical calculations. Differential measurements of the kinematic properties of the top quark production are also discussed. These measurements, including results using boosted tops, probe our understanding of top pair production in the TeV regime. The results, extrapolated to particle and parton level, are compared to Monte Carlo generators implementing LO and NLO matrix elements matched with parton showers and NNLO QCD calculations.

  10. Superrotations and Black Hole Pair Creation

    CERN Document Server

    Strominger, Andrew

    2016-01-01

    Recent work has shown that the symmetries of classical gravitational scattering in asymptotically flat spacetimes include, at the linearized level, infinitesimal superrotations. These act like Virasoro generators on the celestial sphere at null infinity. However, due to the singularities in these generators, the physical status of finite superrotations has remained unclear. Here we address this issue in the context of the breaking of a cosmic string via quantum black hole pair nucleation. This process is described by a gravitational instanton known as the $C$-metric. After pair production, the black holes are pulled by the string to null infinity with a constant acceleration. At late times the string decays and the spacetime settles into a vacuum state. We show that the early and late spacetimes before and after string decay differ by a finite superrotation. This provides a physical interpretation of superrotations. They act on spacetimes which are asymptotically flat everywhere except at isolated singulariti...

  11. Locomotion gaits of a rotating cylinder pair

    Science.gov (United States)

    van Rees, Wim M.; Novati, Guido; Koumoutsakos, Petros; Mahadevan, L.

    2015-11-01

    Using 2D numerical simulations of the Navier-Stokes equations, we demonstrate that a simple pair of rotating cylinders can display a range of locomotion patterns of biological and engineering interest. Steadily counter-rotating the cylinders causes the pair to move akin to a vortex dipole for low rotation rates, but as the rotational velocity is increased the direction of motion reverses. Unsteady rotations lead to different locomotion gaits that resemble jellyfish (for in-phase rotations) and undulating swimmers (for out-of-phase rotations). The small number of parameters for this simple system allows us to systematically map the phase space of these gaits, and allows us to understand the underlying physical mechanisms using a minimal model with implications for biological locomotion and engineered analogs.

  12. Transmission properties of cryogenic twisted pair filters

    Energy Technology Data Exchange (ETDEWEB)

    Song, Woon; Rehman, Mushtaq; Chong, Yonuk [Korea Research Institute of Standards and Science, Daejeon (Korea, Republic of); Ryu, Sangwan [Chonnam National University, Gwangju (Korea, Republic of)

    2010-12-15

    We fabricated a cryogenic low pass filter that consists of twisted pairs of manganin wires wrapped in copper tape and measured its transmission characteristics at frequencies up to 18 GHz. The dependence of the microwave transmission characteristics on the filter length was studied, which showed that a filter of length 1.0 m had a 70-dB attenuation at 1 GHz. We also studied the dependence of common- and differential-mode transmission on the number of twists per unit length and found that the number of twists per unit length affects differential-mode transmission but not common-mode transmission. Because the shielded twisted pair filter is more compact than a conventional copper powder filter, it can solve the space and thermal load issues when many cables are required for precision electronic transport experiments at low temperatures.

  13. Schwinger pair production with ultracold atoms

    Science.gov (United States)

    Kasper, V.; Hebenstreit, F.; Oberthaler, M. K.; Berges, J.

    2016-09-01

    We consider a system of ultracold atoms in an optical lattice as a quantum simulator for electron-positron pair production in quantum electrodynamics (QED). For a setup in one spatial dimension, we investigate the nonequilibrium phenomenon of pair production including the backreaction leading to plasma oscillations. Unlike previous investigations on quantum link models, we focus on the infinite-dimensional Hilbert space of QED and show that it may be well approximated by experiments employing Bose-Einstein condensates interacting with fermionic atoms. Numerical calculations based on functional integral techniques give a unique access to the physical parameters required to realize QED phenomena in a cold atom experiment. In particular, we use our approach to consider quantum link models in a yet unexplored parameter regime and give bounds for their ability to capture essential features of the physics. The results suggest a paradigmatic change towards realizations using coherent many-body states for quantum simulations of high-energy particle physics phenomena.

  14. A search for resonant Z pair production

    Energy Technology Data Exchange (ETDEWEB)

    Boveia, Antonio [Univ. of California, Santa Barbara, CA (United States)

    2008-12-01

    I describe a search for anomalous production of Z pairs through a new massive resonance X in 2.5-2.9 fb-1 of p$\\bar{p}$ collisions at √s = 1.96 TeV using the CDFII Detector at the Fermilab Tevatron. I reconstruct Z pairs through their decays to electrons, muons, and quarks. To achieve perhaps the most efficient lepton reconstruction ever used at CDF, I apply a thorough understanding of the detector and new reconstruction software heavily revised for this purpose. In particular, I have designed and employ new general-purpose algorithms for tracking at large η in order to increase muon acceptance. Upon analyzing the unblinded signal samples, I observe no X → ZZ candidates and set upper limits on the production cross section using a Kaluza-Klein graviton-like acceptance.

  15. General pairing interactions and pair truncation approximations for fermions in a single-j shell

    CERN Document Server

    Zhao, Y M; Ginocchio, J N; Yoshinaga, N

    2003-01-01

    We investigate Hamiltonians with attractive interactions between pairs of fermions coupled to angular momentum J. We show that pairs with spin J are reasonable building blocks for the low-lying states. For systems with only a J = Jmax pairing interaction, eigenvalues are found to be approximately integers for a large array of states, in particular for those with total angular momenta I le 2j. For I=0 eigenstates of four fermions in a single-j shell we show that there is only one non-zero eigenvalue. We address these observations using the nucleon pair approximation of the shell model and relate our results with a number of currently interesting problems.

  16. Na+ Cl- ion pair association in water-DMSO mixtures: Effect of ion pair model potentials

    Indian Academy of Sciences (India)

    ATANU SARKAR; ANUPAM CHATTERJEE; S C TIWARI; B L TEMBE

    2016-06-01

    Potentials of Mean Force (PMF) for the Na+ Cl- ion pair in water–dimethyl sulfoxide (DMSO)mixtures for three DMSO mole fractions have been computed using constrained Molecular Dynamics (MD)simulations and confirmed by dynamical trajectories and residence times of the ion pair at various inter-ionicseparations. The three ion-ion direct potentials used are 12-6-1, exp-6-1 and exp-8-6-1. The physical picturethat emerges is that there is a strong contact ion pair (CIP) and strong to moderate solvent separated ion pair(SSIP) in these solutions. Analysis of local ion clusters shows that ions are dominantly solvated by watermolecules. The 12-6-1 potential model predicts running coordination numbers closest to experimental data.

  17. Does base-pairing strength play a role in microRNA repression?

    OpenAIRE

    2012-01-01

    In this paper, the authors explore the possibility that the base-pairing strength of miRNA–mRNA target plays a role in microRNA-mediated gene regulation. The authors found a significant correlation between the physiological temperature of the organism and the average G/C content of its miRNAs. This study suggests that an organism adapts its miRNA–target free energy according to its physiological temperature, thus highlighting the importance of base-pairing strength in miRNA activity.

  18. Radiation damping in metal nanoparticle pairs.

    Science.gov (United States)

    Dahmen, Christian; Schmidt, Benjamin; von Plessen, Gero

    2007-02-01

    The radiation damping rate of plasmon resonances in pairs of spherical gold nanoparticles is calculated. The radiative line width of the plasmon resonance indicates significant far-field coupling between the nanoparticles over distances many times the particle diameter. The radiation damping of the coupled particle-plasmon mode alternates between superradiant and subradiant behavior when the particle spacing is varied. At small particle spacings where near-field coupling occurs, the radiation damping rate lies far below that of an isolated particle.

  19. Search for Scalar Leptoquark Pairs Decaying to $\

    CERN Document Server

    Acosta, D; Affolder, T; Akimoto, T; Albrow, M G; Ambrose, D; Amerio, S; Amidei, D; Anastassov, A; Anikeev, K; Annovi, A; Antos, J; Aoki, M; Apollinari, G; Arisawa, T; Arguin, J F; Artikov, A; Ashmanskas, W; Attal, A; Azfar, F; Azzi-Bacchetta, P; Bacchetta, N; Bachacou, H; Badgett, W; Barbaro-Galtieri, A; Barker, G J; Barnes, V E; Barnett, B A; Baroiant, S; Barone, M; Bauer, G; Bedeschi, F; Behari, S; Belforte, S; Bellettini, G; Bellinger, J; Ben-Haim, E; Benjamin, D; Beretvas, A; Bhatti, A A; Binkley, M; Bisello, D; Bishai, M; Blair, R E; Blocker, C; Bloom, K; Blumenfeld, B; Bocci, A; Bodek, A; Bölla, G; Bolshov, A; Booth, P S L; Bortoletto, D; Boudreau, J; Bourov, S; Bromberg, C; Brubaker, E; Budagov, Yu A; Budd, H S; Burkett, K; Busetto, G; Bussey, P; Byrum, K L; Cabrera, S; Campanelli, M; Campbell, M; Canepa, A; Casarsa, M; Carlsmith, D; Carron, S; Carosi, R; Cavalli-Sforza, M; Castro, A; Catastini, P; Cauz, D; Cerri, A; Cerrito, L; Chapman, J; Chen, C; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, I; Cho, K; Chokheli, D; Chou, J P; Chu, M L; Chuang, S; Chung, J Y; Chung, W H; Chung, Y S; Ciobanu, C I; Ciocci, M A; Clark, A G; Clark, D; Coca, M; Connolly, A; Convery, M; Conway, J; Cooper, B; Cordelli, M; Cortiana, G; Cranshaw, J; Cuevas-Maestro, J; Culbertson, R; Currat, C; Cyr, D; Dagenhart, D; Da Ronco, S; D'Auria, S; De Barbaro, P; De Cecco, S; De Lentdecker, G; Dell'Agnello, S; Dell'Orso, Mauro; Demers, S; Demortier, L; Deninno, M; De Pedis, D; Derwent, P F; Dionisi, C; Dittmann, J R; Doerr, C; Doksus, P; Dominguez, A; Donati, S; Donega, M; Donini, J; D'Onofrio, M; Dorigo, T; Drollinger, V; Ebina, K; Eddy, N; Ely, R; Erbacher, R; Erdmann, M; Errede, D; Errede, S; Eusebi, R; Fang, H C; Farrington, S; Fedorko, I; Fedorko, W T; Feild, R G; Feindt, M; Fernández, J P; Ferretti, C; Field, R D; Flanagan, G; Flaugher, B; Flores-Castillo, L R; Foland, A; Forrester, S; Foster, G W; Franklin, M; Freeman, J C; Fujii, Y; Furic, I; Gajjar, A; Gallas, A; Galyardt, J; Gallinaro, M; García-Sciveres, M; Garfinkel, A F; Gay, C; Gerberich, H; Gerdes, D W; Gerchtein, E; Giagu, S; Giannetti, P; Gibson, A; Gibson, K; Ginsburg, C; Giolo, K; Giordani, M; Giunta, M; Giurgiu, G; Glagolev, V; Glenzinski, D; Gold, M; Goldschmidt, N; Goldstein, D; Goldstein, J; Gómez, G; Gómez-Ceballos, G; Goncharov, M; González, O; Gorelov, I; Goshaw, A T; Gotra, Yu; Goulianos, K; Gresele, A; Griffiths, M; Grosso-Pilcher, C; Grundler, U; Günther, M; Guimarães da Costa, J; Haber, C; Hahn, K; Hahn, S R; Halkiadakis, E; Hamilton, A; Han, B Y; Handler, R; Happacher, F; Hara, K; Hare, M; Harr, R F; Harris, R M; Hartmann, F; Hatakeyama, K; Hauser, J; Hays, C; Hayward, H; Heider, E; Heinemann, B; Heinrich, J; Hennecke, M; Herndon, M; Hill, C; Hirschbuehl, D; Höcker, A; Hoffman, K D; Holloway, A; Hou, S; Houlden, M A; Huffman, B T; Huang, Y; Hughes, R E; Huston, J; Ikado, K; Incandela, J R; Introzzi, G; Iori, M; Ishizawa, Y; Issever, C; Ivanov, A; Iwata, Y; Iyutin, B; James, E; Jang, D; Jarrell, J; Jeans, D; Jensen, H; Jeon, E J; Jones, M; Joo, K K; Jun, S; Junk, T R; Kamon, T; Kang, J; Karagoz-Unel, M; Karchin, P E; Kartal, S; Kato, Y; Kemp, Y; Kephart, R; Kerzel, U; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, J E; Kim, M J; Kim, M S; Kim, S B; Kim, S H; Kim, T H; Kim, Y K; King, B T; Kirby, M; Kirsch, L; Klimenko, S; Knuteson, B; Ko, B R; Kobayashi, H; Koehn, P; Kong, D J; Kondo, K; Konigsberg, J; Kordas, K; Korn, A J; Korytov, A; Kotelnikov, K; Kotwal, A V; Kovalev, A; Kraus, J; Kravchenko, I; Kreymer, A; Kroll, J; Kruse, M; Krutelyov, V; Kuhlmann, S E; Kuznetsova, N; Laasanen, A T; Lai, S; Lami, S; Lammel, S; Lancaster, J; Lancaster, M; Lander, R; Lannon, K; Lath, A; Latino, G; Lauhakangas, R; Lazzizzera, I; Le, Y; Lecci, C; LeCompte, T; Lee, J; Lee, S W; Lefèvre, R; Leonardo, N; Leone, S; Lewis, J D; Li, K; Lin, C; Lin, C S; Lindgren, M; Liss, T M; Litvintsev, D O; Liu, T; Liu, Y; Lockyer, N S; Loginov, A; Loreti, M; Loverre, P F; Lu, R S; Lucchesi, D; Lujan, P; Lukens, P; Lungu, G; Lyons, L; Lys, J; Lysak, R; MacQueen, D; Madrak, R; Maeshima, K; Maksimovic, P; Malferrari, L; Manca, G; Marginean, R; Martin, M; Martin, A; Martin, V; Martínez, M; Maruyama, T; Matsunaga, H; Mattson, M; Mazzanti, P; McFarland, K S; McGivern, D; McIntyre, P M; McNamara, P; NcNulty, R; Menzemer, S; Menzione, A; Merkel, P; Mesropian, C; Messina, A; Miao, T; Miladinovic, N; Miller, L; Miller, R; Miller, J S; Miquel, R; Miscetti, S; Mitselmakher, G; Miyamoto, A; Miyazaki, Y; Moggi, N; Mohr, B; Moore, R; Morello, M; Mukherjee, A; Mulhearn, M; Müller, T; Mumford, R; Munar, A; Murat, P; Nachtman, J; Nahn, S; Nakamura, I; Nakano, I; Napier, A; Napora, R; Naumov, D V; Necula, V; Niell, F; Nielsen, J; Nelson, C; Nelson, T; Neu, C; Neubauer, M S; Newman-Holmes, C; Nicollerat, A S; Nigmanov, T; Nodulman, L; Norniella, O; Österberg, K; Ogawa, T; Oh, S H; Oh, Y D; Ohsugi, T; Okusawa, T; Oldeman, R G C; Orava, R; Orejudos, W; Pagliarone, C; Palencia, E; Paoletti, R; Papadimitriou, V; Pashapour, S; Patrick, J; Pauletta, G; Paulini, M; Pauly, T; Paus, C; Pellett, D; Penzo, Aldo L; Phillips, T J; Piacentino, G; Piedra, J; Pitts, K T; Plager, C; Pompos, A; Pondrom, L; Pope, G; Poukhov, O; Prakoshyn, F; Pratt, T; Pronko, A; Proudfoot, J; Ptohos, F; Punzi, G; Rademacker, J; Rahaman, A; Rakitine, A; Rappoccio, S; Ratnikov, F; Ray, H; Reichold, A; Reisert, B; Rekovic, V; Renton, P B; Rescigno, M; Rimondi, F; Rinnert, K; Ristori, L; Robertson, W J; Robson, A; Rodrigo, T; Rolli, S; Rosenson, L; Roser, R; Rossin, R; Rott, C; Russ, J; Rusu, V; Ruiz, A; Ryan, D; Saarikko, H; Sabik, S; Safonov, A; Saint-Denis, R; Sakumoto, W K; Salamanna, G; Saltzberg, D; Sánchez, C; Sansoni, A; Santi, L; Sarkar, S; Sato, K; Savard, P; Savoy-Navarro, A; Schlabach, P; Schmidt, E E; Schmidt, M P; Schmitt, M; Scodellaro, L; Scribano, A; Scuri, F; Sedov, A; Seidel, S; Seiya, Y; Semeria, F; Sexton-Kennedy, L; Sfiligoi, I; Shapiro, M D; Shears, T G; Shepard, P F; Sherman, D; Shimojima, M; Shochet, M; Shon, Y; Shreyber, I; Sidoti, A; Siegrist, J; Siket, M; Sill, A; Sinervo, P; Sissakian, A N; Skiba, A; Slaughter, A J; Sliwa, K; Smirnov, D; Smith, J R; Snider, F D; Snihur, R; Soha, A; Somalwar, S V; Spalding, J; Spezziga, M; Spiegel, L; Spinella, F; Spiropulu, M; Squillacioti, P; Stadie, H; Stelzer, B; Stelzer-Chilton, O; Strologas, J; Stuart, D; Sukhanov, A; Sumorok, K; Sun, H; Suzuki, T; Taffard, A C; Tafirout, R; Takach, S F; Takano, H; Takashima, R; Takeuchi, Y; Takikawa, K; Tanaka, M; Tanaka, R; Tanimoto, N; Tapprogge, Stefan; Tecchio, M; Teng, P K; Terashi, K; Tesarek, R J; Tether, S; Thom, J; Thompson, A S; Thomson, E; Tipton, P; Tiwari, V; Tkaczyk, S; Toback, D; Tollefson, K; Tomura, T; Tonelli, D; Tonnesmann, M; Torre, S; Torretta, D; Tourneur, S; Trischuk, W; Tseng, J; Tsuchiya, R; Tsuno, S; Tsybychev, D; Turini, N; Turner, M; Ukegawa, F; Unverhau, T; Uozumi, S; Usynin, D; Vacavant, L; Vaiciulis, A W; Varganov, A; Vataga, E; Vejcik, S; Velev, G V; Veszpremi, V; Veramendi, G; Vickey, T; Vidal, R; Vila, I; Vilar, R; Vollrath, I; Volobuev, I P; Von der Mey, M; Wagner, P; Wagner, R G; Wagner, R L; Wagner, W; Wallny, R; Walter, T; Yamashita, T; Yamamoto, K; Wan, Z; Wang, M J; Wang, S M; Warburton, A; Ward, B; Waschke, S; Waters, D; Watts, T; Weber, M; Wester, W C; Whitehouse, B; Wicklund, A B; Wicklund, E; Williams, H H; Wilson, P; Winer, B L; Wittich, P; Wolbers, S; Wolter, M; Worcester, M; Worm, S; Wright, T; Wu, X; Würthwein, F; Wyatt, A; Yagil, A; Yang, U K; Yao, W; Yeh, G P; Yi, K; Yoh, J; Yoon, P; Yorita, K; Yoshida, T; Yu, I; Yu, S; Yu, Z; Yun, J C; Zanello, L; Zanetti, A; Zaw, I; Zetti, F; Zhou, J; Zsenei, A; Zucchelli, S

    2004-01-01

    We report on a search for the pair production of scalar leptoquarks, $LQ$, using 191 pb$^{-1}$ of proton-antiproton collision data recorded by the CDF experiment during Run II of the Tevatron. The leptoquarks are sought via their decay into a neutrino and quark yielding missing transverse energy and several jets of large transverse energy. No evidence for leptoquark production is observed, and limits are set on $\\sigma(p\\bar p\\to LQ\\bar{LQ} X \\to \

  20. Are all Linear Paired Comparison Models Equivalent

    Science.gov (United States)

    1990-09-01

    Previous authors (Jackson and Fleckenstein 1957, Mosteller 1958, Noether 1960) have found that different models of paired comparisons data lead to simi...ponential distribution with a location parameter (Mosteller 1958, Noether 1960). Formal statements describing the limiting behavior of the gamma...that are not convolu- tion type linear models (the uniform model considered by Smith (1956), Mosteller (1958), Noether (1960)) and other convolution

  1. Quantum Computation by Pairing Trapped Ultracold Ions

    Institute of Scientific and Technical Information of China (English)

    冯芒; 朱熙文; 高克林; 施磊

    2001-01-01

    Superpositional wavefunction oscillations for the implementation of quantum algorithms modify the desired interference required for the quantum computation. We propose a scheme with trapped ultracold ion-pairs beingqubits to diminish the detrimental effect of the wavefunction oscillations, which is applied to the two-qubitGrover's search. It can be also found that the qubits in our scheme are more robust against the decoherencecaused by the environment, and the model is scalable.

  2. On the pairing effects in triaxial nuclei

    Energy Technology Data Exchange (ETDEWEB)

    Oudih, M. R. [Laboratoire de Physique Théorique, Faculté de Physique,USTHB BP 32, El Alia, 16111 Bab Ezzouar, Algiers (Algeria); Fellah, M.; Allal, N. H. [Centre de Recherche Nucléaire d' Alger, 2 Bd. Frantz Fanon, BP. 399 Alger-Gare, Algiers, Algeria and Laboratoire de Physique Théorique, Faculté de Physique,USTHB BP 32, El Alia, 16111 Bab Ezzouar, Algiers (Algeria)

    2014-03-05

    Triaxial deformation effect on the pairing correlations is studied in the framework of the Skyrme Hartree-Fock-Bogoliubov theory. Quantities such as binding energy, gap parameter and particle-number fluctuation are considered in neutron-rich Mo isotopes. The results are compared with those of axially symmetric calculation and with available experimental data. The role played by the particle-number projection is outlined.

  3. Pair fireball precursors of neutron star mergers

    Science.gov (United States)

    Metzger, Brian D.; Zivancev, Charles

    2016-10-01

    If at least one neutron star (NS) is magnetized in a binary NS merger, then the orbital motion of the conducting companion during the final inspiral induces a strong voltage and current along the magnetic field lines connecting the NSs. If a modest fraction η of the extracted electromagnetic power extracted accelerates relativistic particles, the resulting gamma-ray emission a compact volume will result in the formation of an electron-positron pair fireball. Applying a steady-state pair wind model, we quantify the detectability of the precursor fireball with gamma-ray satellites. For η ˜ 1 the gamma-ray detection horizon of Dmax ≈ 10(Bd/1014 G)3/4 Mpc is much closer than the Advanced Laser Interferometer Gravitational-Wave Observatory (LIGO)/Virgo horizon of 200 Mpc, unless the NS surface magnetic field strength is very large, B_d ≲ 10^{15} G. Given the quasi-isotropic nature of the emission, mergers with weaker NS fields could contribute a nearby population of short gamma-ray bursts. Power not dissipated close to the binary is carried to infinity along the open field lines by a large-scale Poynting flux. Reconnection within this outflow, well outside of the pair photosphere, provides a potential site for non-thermal emission, such as a coherent millisecond radio burst.

  4. Exclusive production of W pairs in CMS

    Directory of Open Access Journals (Sweden)

    Silveira Da

    2014-04-01

    Full Text Available We report the results on the search for exclusive production of W pairs in the LHC with data collected by the Compact Muon Solenoid detector in proton-proton collisions at √s = 7 TeV. The analysis comprises the two-photon production of a W pairs, pp → pW+ W− p → p νe± νµ∓ p. Two events are observed in data for pT(ℓ > 4 GeV, |η(ℓ| 20 GeV, in agreement with the standard model prediction of 2.2 ± 0.4 signal events with 0.84 ± 0.15 background events. Moreover, a study of the tail of the lepton pair transverse momentum distribution is performed to search for an evidence of anomalous quartic gauge couplings in the γγ → W+ W− vertex. As no events are observed in data, it results in a model-independent upper limits for the anomalous W quartic gauge couplings aW0,C/Λ2, which are of the order of 10−4.

  5. Chiral baryon in the coherent pair approximation

    CERN Document Server

    Aly, T S T

    1999-01-01

    We revisit the work of K. Goeke, M. Harvey, F. Grümmer, and J. N. Urbano (Phys. Rev. {\\bf D37}, 754 (1988)) who considered a chiral model for the nucleon based on the linear sigma model with scalar-isoscalar scalar-isovector mesons coupled to quarks and solved using the coherent-pair approximation. In this way the quantum pion field can be treated in a non-perturbative fashion. In this work we review this model and the coherent pair approximation correcting several errors in the earlier work. We minimize the expectation value of the chiral hamiltonian in the ansatz coherent-pair ground state configuration and solve the resulting equations for nucleon quantum numbers. We calculate the canonical set of nucleon observables and compare with the Hedgehog model and experiment. Using the corrected equations yield slightly different values for nucleon observables but do not correct the large virial deviation in the $\\pi$-nucleon coupling. Our results therefore do not significantly alter the conclusions of Goeke, et ...

  6. Gene Ontology

    Directory of Open Access Journals (Sweden)

    Gaston K. Mazandu

    2012-01-01

    Full Text Available The wide coverage and biological relevance of the Gene Ontology (GO, confirmed through its successful use in protein function prediction, have led to the growth in its popularity. In order to exploit the extent of biological knowledge that GO offers in describing genes or groups of genes, there is a need for an efficient, scalable similarity measure for GO terms and GO-annotated proteins. While several GO similarity measures exist, none adequately addresses all issues surrounding the design and usage of the ontology. We introduce a new metric for measuring the distance between two GO terms using the intrinsic topology of the GO-DAG, thus enabling the measurement of functional similarities between proteins based on their GO annotations. We assess the performance of this metric using a ROC analysis on human protein-protein interaction datasets and correlation coefficient analysis on the selected set of protein pairs from the CESSM online tool. This metric achieves good performance compared to the existing annotation-based GO measures. We used this new metric to assess functional similarity between orthologues, and show that it is effective at determining whether orthologues are annotated with similar functions and identifying cases where annotation is inconsistent between orthologues.

  7. Reduced rDNA Copy Number Does Not Affect “Competitive” Chromosome Pairing in XYY Males of Drosophila melanogaster

    OpenAIRE

    Keith A. Maggert

    2014-01-01

    The ribosomal DNA (rDNA) arrays are causal agents in X-Y chromosome pairing in meiosis I of Drosophila males. Despite broad variation in X-linked and Y-linked rDNA copy number, polymorphisms in regulatory/spacer sequences between rRNA genes, and variance in copy number of interrupting R1 and R2 retrotransposable elements, there is little evidence that different rDNA arrays affect pairing efficacy. I investigated whether induced rDNA copy number polymorphisms affect chromosome pairing in a “co...

  8. A genome-wide association study of monozygotic twin-pairs suggests a locus related to variability of serum high-density lipoprotein cholesterol

    DEFF Research Database (Denmark)

    Surakka, Ida; Whitfield, John B; Perola, Markus;

    2012-01-01

    Genome-wide association analysis on monozygotic twin-pairs offers a route to discovery of gene environment interactions through testing for variability loci associated with sensitivity to individual environment/lifestyle. We present a genome-wide scan of loci associated with intra-pair difference...

  9. Physical Galaxy Pairs and Their Effects on Star Formation

    CERN Document Server

    Selim, I M; Bendary, R

    2014-01-01

    We present 776 truly physical galaxy pairs, 569 of them are close pairs and 208 false pairs from Karachentsev (1972) and Reduzzi & Rampazzo (1995) catalogues, which contains 1012 galaxy pairs. Also we carried out star formation activity through the far-infrared emission (FIR) in physical (truly) interacting galaxies in some galaxy pairs and compared them with projection (optical) interacting galaxy pairs. We focused on the triggering of star formation by interactions and analyzed the enhancement of star formation activity in terms of truly physical galaxy pairs. The large fraction of star formation activity is probably due to the activity in the exchange of matter between the truly companions. The star formation rate (SFR) of galaxies in truly galaxy pairs is found to be more enhanced than the apparent pairs.

  10. Morphology Transformation in Pairs of Galaxies The Local Sample

    CERN Document Server

    Junqueira, S; Infante, L; Junqueira, Selma; Mello, Duilia F. de; Infante, Leopoldo

    1997-01-01

    We present photometric analysis of a local sample of 14 isolated pairs of galaxies. The photometric properties analyzed in the local pairs are: colors, morphology, tidal effects and activity. We verify that close pairs have an excess of early-type galaxies and many elliptical galaxies in this pairs are, in fact, lenticular galaxies. Many late-pairs in our sample show strong tidal damage and blue star formation regions. We conclude that pairs of different morphologies may have passed through different evolution processes which violently transformed their morphology. Pairs with at least one early-type component may be descendents of groups of galaxies. However, late-type pairs are probably long-lived showing clearly signs of interaction. Some of them could be seen as an early stage of mergers. These photometric database will be used for future comparison with more distant pairs in order to study galaxy evolution.

  11. Isolated Main Galaxy Pairs from the SDSS Data Release 4

    Institute of Scientific and Technical Information of China (English)

    Xin-Fa Deng; Yi-Qing Chen; Ping Wu; Cheng-Hong Luo; Ji-Zhou He

    2006-01-01

    From the Main galaxy data of the SDSS Data Release 4 (SDSS4), we have identified close galaxy pairs at neighbourhood radius R = 100 kpc by three-dimensional cluster analysis. Using the criterion that an "isolated galaxy pair" must be separated from its "nearest neighbor" by more than 500 kpc, we constructed an isolated galaxy pair sample of 1158 pairs.We also constructed a random pair sample by randomly selecting 1158 galaxy pairs from the Main galaxy sample, which has the same redshift distribution as the isolated galaxy pair sample, and in which the two components of any pair have the same redshifts. Comparative studies of luminosity and size between the members of the galaxy pairs are performed. We find and further confirm there is no tendency for paired galaxies to have similar luminosities or sizes. From the isolated pair sample we also selected a subsample with the magnitude limit of the primary raised by 2 magnitudes, so as to include pairs in which the secondary is 2 magnitudes fainter than the primary. This subsample contains 82 pairs. A random pair sample is similarly constructed.

  12. HIV-1 sequence variation between isolates from mother-infant transmission pairs

    Energy Technology Data Exchange (ETDEWEB)

    Wike, C.M.; Daniels, M.R.; Furtado, M.; Wolinsky, M.; Korber, B.; Hutto, C.; Munoz, J.; Parks, W.; Saah, A.

    1991-12-31

    To examine the sequence diversity of human immunodeficiency virus type 1 (HIV-1) between known transmission sets, sequences from the V3 and V4-V5 region of the env gene from 4 mother-infant pairs were analyzed. The mean interpatient sequence variation between isolates from linked mother-infant pairs was comparable to the sequence diversity found between isolates from other close contacts. The mean intrapatient variation was significantly less in the infants` isolates then the isolates from both their mothers and other characterized intrapatient sequence sets. In addition, a distinct and characteristic difference in the glycosylation pattern preceding the V3 loop was found between each linked transmission pair. These findings indicate that selection of specific genotypic variants, which may play a role in some direct transmission sets, and the duration of infection are important factors in the degree of diversity seen between the sequence sets.

  13. Gene therapy in periodontics.

    Science.gov (United States)

    Chatterjee, Anirban; Singh, Nidhi; Saluja, Mini

    2013-03-01

    GENES are made of DNA - the code of life. They are made up of two types of base pair from different number of hydrogen bonds AT, GC which can be turned into instruction. Everyone inherits genes from their parents and passes them on in turn to their children. Every person's genes are different, and the changes in sequence determine the inherited differences between each of us. Some changes, usually in a single gene, may cause serious diseases. Gene therapy is 'the use of genes as medicine'. It involves the transfer of a therapeutic or working gene copy into specific cells of an individual in order to repair a faulty gene copy. Thus it may be used to replace a faulty gene, or to introduce a new gene whose function is to cure or to favorably modify the clinical course of a condition. It has a promising era in the field of periodontics. Gene therapy has been used as a mode of tissue engineering in periodontics. The tissue engineering approach reconstructs the natural target tissue by combining four elements namely: Scaffold, signaling molecules, cells and blood supply and thus can help in the reconstruction of damaged periodontium including cementum, gingival, periodontal ligament and bone.

  14. Top quark pair production at the LHC

    Energy Technology Data Exchange (ETDEWEB)

    Baernreuther, Peter

    2012-06-28

    One of the most interesting and manifold processes in the Standard Model of elementary particle physics is the top quark pair production. It enabled the discovery of the top quark at the Tevatron in 1995 and the determination of many of its properties. By means of a precise measurement and calculation of the cross section of top quark pair production it is possible to extract the top quark mass. Improvements in the gluon parton distribution functions (important for the Higgs boson production) or improvements in the prediction of the Higgs mass are also closely linked with the top quark pair production. Furthermore, the production process plays an important role in the discovery of new physics. On the one hand the top quark pair decays form the largest part of the background in many BSM models, on the other hand BSM physics can be detected directly in the decay process by investigating the charge symmetry or the invariant mass spectrum. At the LHC it will be possible for the first time to produce a large amount of top quarks; thereby the statistical errors of the observables will be strongly reduced. The enormous increase in the production rate has two reasons. On the one hand, the acceleration energy of the LHC (14 TeV and 7 TeV) is significantly greater than that of the Tevatron (1.96 Tev). This leads to an increase of the cross section by a factor of 100 ({proportional_to}7.3 pb at the Tevatron to {proportional_to}800 pb at 14 TeV LHC). On the other hand, the luminosity of the LHC outperforms the Tevatron by a factor of 10-100. The reduced experimental errors for the observables demand an improvement of the theoretical error. The experimental accuracy of the LHC and the great relevance of the process led to an intensive activity of different research groups in order to improve the calculation of the cross section of top quark pair production. This work presents for the first time a complete numerical result for the full NNLO correction for the top quark pair

  15. Augmenting Think-Pair-Share with Simulations

    Science.gov (United States)

    Lee, Kevin M.; Siedell, C. M.; Prather, E. E.; CATS

    2009-01-01

    Computer simulations are valuable tools for the teaching and learning of introductory astronomy. They enable students to link together small pieces of information into mental models of complex physical systems that are far beyond their everyday experience. They can also be used to authentically test a student's conceptual understanding of a physical system by asking the student to make predictions regarding its behavior. Students receive formative feedback by testing their predictions in simulations. Think-Pair-Share - the posing of conceptual questions to students and having them vote on the answer before and after discussion with their peers - can benefit considerably from the incorporation of simulations. Simulations can be used for delivering content that precedes Think-Pair-Share, as the prompt the questions is based upon, or as a feedback tool to illustrate the answer to a question. These techniques are utilized in ClassAction - a collection of materials designed to enhance the metacognitive skills of Astro 101 students by promoting interactive engagement and providing rapid feedback. The main focus is dynamic conceptual questions largely based upon graphics that can be projected in the classroom. Many questions are available in a Flash computer database and instructors have the capability to recast these questions into alternate permutations based on their own preferences and student responses. Outlines, graphics, and simulations are included which instructors can use to provide feedback. This poster provides examples of simulation usage in Think-Pair-Share related to sky motions, lunar phases, and stellar properties. A multi-institutional classroom validation study of ClassAction is currently underway as a Collaboration of Astronomy Teaching Scholars (CATS) research project. All materials are publicly available at http://astro.unl.edu. We would like to thank the NSF for funding under Grant Nos. 0404988 and 0715517, a CCLI Phase III Grant for the

  16. Series-Coupled Pairs of Silica Microresonators

    Science.gov (United States)

    Savchenkov, Anatoliy; Iltchenko, Vladimir; Maleki, Lute; Handley, Tim

    2009-01-01

    Series-coupled pairs of whispering-gallery-mode optical microresonators have been demonstrated as prototypes of stable, narrow-band-pass photonic filters. Characteristics that are generally considered desirable in a photonic or other narrow-band-pass filter include response as nearly flat as possible across the pass band, sharp roll-off, and high rejection of signals outside the pass band. A single microresonator exhibits a Lorentzian filter function: its peak response cannot be made flatter and its roll-off cannot be made sharper. However, as a matter of basic principle applicable to resonators in general, it is possible to (1) use multiple resonators, operating in series or parallel, to obtain a roll-off sharper, and out-of-band rejection greater, relative to those of a Lorentzian filter function and (2) to make the peak response (the response within the pass band) flatter by tuning the resonators to slightly different resonance frequencies that span the pass band. The first of the two microresonators in each series-coupled pair was a microtorus made of germania-doped silica (containing about 19 mole percent germania), which is a material used for the cores of some optical fibers. The reasons for choosing this material is that exposing it to ultraviolet light causes it to undergo a chemical change that changes its index of refraction and thereby changes the resonance frequency. Hence, this material affords the means to effect the desired slight relative detuning of the two resonators. The second microresonator in each pair was a microsphere of pure silica. The advantage of making one of the resonators a torus instead of a sphere is that its spectrum of whispering-gallery-mode resonances is sparser, as needed to obtain a frequency separation of at least 100 GHz between resonances of the filter as a whole.

  17. Invisible Decays in Higgs Pair Production

    CERN Document Server

    Banerjee, Shankha; Spannowsky, Michael

    2016-01-01

    Observation of Higgs pair production is an important long term objective of the LHC physics program as it will shed light on the scalar potential of the Higgs field and the nature of electroweak symmetry breaking. While numerous studies have examined the impact of new physics on di-Higgs production, little attention has been given to the well-motivated possibility of exotic Higgs decays in this channel. Here we investigate the consequences of exotic invisible Higgs decays in di-Higgs production. We outline a search sensitive to such invisible decays in the $b\\bar b+{\

  18. Mated Fingerprint Card Pairs 2 (MFCP2)

    Science.gov (United States)

    NIST Mated Fingerprint Card Pairs 2 (MFCP2) (PC database for purchase)   NIST Special Database 14 is being distributed for use in development and testing of automated fingerprint classification and matching systems on a set of images which approximate a natural horizontal distribution of the National Crime Information Center (NCIC) fingerprint classes. A newer version of the compression/decompression software on the CDROM can be found at the website http://www.nist.gov/itl/iad/ig/nigos.cfm as part of the NBIS package.

  19. A Guide to Fluorescent Protein FRET Pairs

    Science.gov (United States)

    Bajar, Bryce T.; Wang, Emily S.; Zhang, Shu; Lin, Michael Z.; Chu, Jun

    2016-01-01

    Förster or fluorescence resonance energy transfer (FRET) technology and genetically encoded FRET biosensors provide a powerful tool for visualizing signaling molecules in live cells with high spatiotemporal resolution. Fluorescent proteins (FPs) are most commonly used as both donor and acceptor fluorophores in FRET biosensors, especially since FPs are genetically encodable and live-cell compatible. In this review, we will provide an overview of methods to measure FRET changes in biological contexts, discuss the palette of FP FRET pairs developed and their relative strengths and weaknesses, and note important factors to consider when using FPs for FRET studies. PMID:27649177

  20. Pair creation in noncommutative space-time

    Science.gov (United States)

    Hamil, B.; Chetouani, L.

    2016-09-01

    By taking two interactions, the Volkov plane wave and a constant electromagnetic field, the probability related to the process of pair creation from the vacuum is exactly and analytically determined via the Schwinger method in noncommutative space-time. For the plane wave, it is shown that the probability is simply null and for the electromagnetic wave it is found that the expression of the probability has a similar form to that obtained by Schwinger in a commutative space-time. For a certain critical value of H, the probability is simply equal to 1.

  1. Pair Negotiation When Developing English Speaking Tasks

    Directory of Open Access Journals (Sweden)

    Ingrid Liliana Bohórquez Suárez

    2011-12-01

    Full Text Available This study analyzes what characterizes the negotiations of seventh graders at a public school in Bogotá when working in pairs to develop speaking tasks in EFL classes. The inquiry is a descriptive case study that follows the qualitative paradigm. As a result of analyzing the data, we obtained four consecutive steps that characterize students’ negotiations: Establishing a connection with a partner to work with, proposing practical alternatives, refusing mates’ propositions, and making practical decisions. Moreover, we found that the constant performance of the process of negotiation provokes students to construct a sociolinguistic identity that allows agreements to emerge.

  2. Generalized magnetofluid connections in pair plasmas

    Energy Technology Data Exchange (ETDEWEB)

    Asenjo, Felipe A., E-mail: felipe.asenjo@uai.cl [Facultad de Ingeniería y Ciencias, Universidad Adolfo Ibáñez, Santiago 7941169 (Chile); Comisso, Luca, E-mail: lcomisso@princeton.edu [Department of Astrophysical Sciences and Princeton Plasma Physics Laboratory, Princeton University, Princeton, New Jersey 08544 (United States); Dipartimento Energia, Politecnico di Torino, Torino 10129, Italy and Istituto dei Sistemi Complessi-CNR, Roma 00185 (Italy); Mahajan, Swadesh M., E-mail: mahajan@mail.utexas.edu [Institute for Fusion Studies, The University of Texas at Austin, Austin, Texas 78712 (United States)

    2015-12-15

    We extend the magnetic connection theorem of ideal magnetohydrodynamics to nonideal relativistic pair plasmas. Adopting a generalized Ohm's law, we prove the existence of generalized magnetofluid connections that are preserved by the plasma dynamics. We show that these connections are related to a general antisymmetric tensor that unifies the electromagnetic and fluid fields. The generalized magnetofluid connections set important constraints on the plasma dynamics by forbidding transitions between configurations with different magnetofluid connectivity. An approximated solution is explicitly shown where the corrections due to current inertial effects are found.

  3. Symmetries, Supersymmetries, and Pairing in Nuclei

    CERN Document Server

    Balantekin, A B

    2011-01-01

    These summer school lectures cover the use of algebraic techniques in various subfields of nuclear physics. After a brief description of groups and algebras, concepts of dynamical symmetry, dynamical supersymmetry, and supersymmetric quantum mechanics are introduced. Appropriate tools such as quasiparticles, quasispin, and Bogoliubov transformations are discussed with an emphasis on group theoretical foundations of these tools. To illustrate these concepts three physics applications are worked out in some detail: i) Pairing in nuclear physics; ii) Subbarrier fusion and associated group transformations; and iii) Symmetries of neutrino mass and of a related neutrino many-body problem.

  4. Efficient Certificateless Signcryption Scheme from Weil Pairing

    Directory of Open Access Journals (Sweden)

    Gang Yu

    2011-08-01

    Full Text Available Certificateless signcryption has both the advantage of certificateless public key cryptography, which overcome the escrow problem inherited from identity based cryptography without the use of certificates as in traditional public key cryptography, and signcryption which can fulfill both the functions of signature and encryption in a logical signal step. In this paper, we explicit the security model for certificateless signcryption and propose an efficient certificateless signcryption scheme from Weil pairings. The new scheme not only can be proved to be secure in our model but also can simultaneously provide public verifiability and forward security. Furthermore, compared with existing schemes, the new scheme is more efficient.

  5. A biometric signcryption scheme without bilinear pairing

    Science.gov (United States)

    Wang, Mingwen; Ren, Zhiyuan; Cai, Jun; Zheng, Wentao

    2013-03-01

    How to apply the entropy in biometrics into the encryption and remote authentication schemes to simplify the management of keys is a hot research area. Utilizing Dodis's fuzzy extractor method and Liu's original signcryption scheme, a biometric identity based signcryption scheme is proposed in this paper. The proposed scheme is more efficient than most of the previous proposed biometric signcryption schemes for that it does not need bilinear pairing computation and modular exponentiation computation which is time consuming largely. The analysis results show that under the CDH and DL hard problem assumption, the proposed scheme has the features of confidentiality and unforgeability simultaneously.

  6. Pairs trading the commodity futures curve

    OpenAIRE

    Nikkanen, A. (Antti)

    2013-01-01

    I create a pairs trade on the commodity futures curve, which captures the roll returns of commodity futures and minimizes the standard deviation of the returns. The end results is a strategy that has an annualized arithmetic return of 6,04% and an annualized standard deviation of 2,01%. Transaction costs and liquidity are also accounted for. The goal was to create and backtest a trading strategy that tries to capture the roll return component of commodity futures returns. In order to redu...

  7. Catalysis of Schwinger Vacuum Pair Production

    CERN Document Server

    Dunne, Gerald V; Schützhold, Ralf

    2009-01-01

    We propose a new catalysis mechanism for non-perturbative vacuum electron-positron pair production, by superimposing a plane-wave X-ray probe beam with a strongly focused optical laser pulse, such as is planned at the Extreme Light Infrastructure (ELI) facility. We compute the absorption coefficient arising from vacuum polarization effects for photons below threshold in a strong electric field. This set-up should facilitate the (first) observation of this non-perturbative QED effect with planned light sources such as ELI yielding an envisioned intensity of order 10^{26}W/cm^2.

  8. Nuclear orbital and spin scissors with pairing

    Directory of Open Access Journals (Sweden)

    Balbutsev Evgeny

    2016-01-01

    Full Text Available Nuclear scissors modes are considered in the frame of the Wigner function moments method generalized to take into account spin degrees of freedom and pair correlations simultaneously. A new source of nuclear magnetism, connected with counter-rotation of spins up and down around the symmetry axis (hidden angular momenta, is discovered. Its inclusion into the theory allows one to improve substantially the agreement with experimental data in the description of energies and transition probabilities of scissors modes in rare earth nuclei.

  9. Cooper pairs spintronics in triplet spin valves.

    Science.gov (United States)

    Romeo, F; Citro, R

    2013-11-27

    We study a spin valve with a triplet superconductor spacer intercalated between two ferromagnets with noncollinear magnetizations. We show that the magnetoresistance of the triplet spin valve depends on the relative orientations of the d vector, characterizing the superconducting order parameter, and the magnetization directions of the ferromagnetic layers. For devices characterized by a long superconductor, the effects of a polarized current sustained by Cooper pairs only are observed. In this regime, a supermagnetoresistance effect emerges, and the chiral symmetry of the order parameter of the superconducting spacer is easily recognized. Our findings open new perspectives in designing spintronics devices based on the cooperation of ferromagnetic and triplet correlations.

  10. Pair correlation function for spin glasses

    Science.gov (United States)

    Fernández, Julio F.; Alonso, Juan J.

    2012-10-01

    We extract a pair correlation function (PCF) from probability distributions of the spin-overlap parameter q. The distributions come from Monte Carlo simulations. A measure, w, of the thermal fluctuations of magnetic patterns follows from the PCFs. We also obtain rms deviations (over different system samples) δp away from average probabilities for q. For the linear system sizes L that we have studied, w and δp are independent of L in the Edwards-Anderson model but scale as 1/L and L, respectively, in the Sherrington-Kirkpatrick model.

  11. Paired structures and bipolar knowledge representation

    DEFF Research Database (Denmark)

    Montero, Javier; Bustince, Humberto; Franco, Camilo

    In this strictly positional paper we propose a general approach to bipolar knowledge representation, where the meaning of concepts can be modelled by examining their decomposition into opposite and neutral categories. In particular, it is the semantic relationship between the opposite categories...... and at the same time the type of neutrality rising in between opposites. Based on this first level of bipolar knowledge representation, paired structures in fact offer the means to characterize a specific bipolar valuation scale depending on the meaning of the concept that has to be verified. In this sense...

  12. Z Boson Pair-Production at LEP

    CERN Document Server

    Achard, P; Aguilar-Benítez, M; Alcaraz, J; Alemanni, G; Allaby, James V; Aloisio, A; Alviggi, M G; Anderhub, H; Andreev, V P; Anselmo, F; Arefev, A; Azemoon, T; Aziz, T; Bagnaia, P; Bajo, A; Baksay, G; Baksay, L; Baldew, S V; Banerjee, S; Banerjee, Sw; Barczyk, A; Barillère, R; Bartalini, P; Basile, M; Batalova, N; Battiston, R; Bay, A; Becattini, F; Becker, U; Behner, F; Bellucci, L; Berbeco, R; Berdugo, J; Berges, P; Bertucci, B; Betev, B L; Biasini, M; Biglietti, M; Biland, A; Blaising, J J; Blyth, S C; Bobbink, Gerjan J; Böhm, A; Boldizsar, L; Borgia, B; Bottai, S; Bourilkov, D; Bourquin, Maurice; Braccini, S; Branson, J G; Brochu, F; Burger, J D; Burger, W J; Cai, X D; Capell, M; Cara Romeo, G; Carlino, G; Cartacci, A M; Casaus, J; Cavallari, F; Cavallo, N; Cecchi, C; Cerrada, M; Chamizo-Llatas, M; Chang, Y H; Chemarin, M; Chen, A; Chen, G; Chen, G M; Chen, H F; Chen, H S; Chiefari, G; Cifarelli, Luisa; Cindolo, F; Clare, I; Clare, R; Coignet, G; Colino, N; Costantini, S; de la Cruz, B; Cucciarelli, S; van Dalen, J A; De Asmundis, R; Déglon, P L; Debreczeni, J; Degré, A; Dehmelt, K; Deiters, K; Della Volpe, D; Delmeire, E; Denes, P; De Notaristefani, F; De Salvo, A; Diemoz, M; Dierckxsens, M; Dionisi, C; Dittmar, M; Doria, A; Dova, M T; Duchesneau, D; Duda, M; Echenard, B; Eline, A; El-Hage, A; El-Mamouni, H; Engler, A; Eppling, F J; Extermann, P; Falagán, M A; Falciano, S; Favara, A; Fay, J; Fedin, O; Felcini, M; Ferguson, T; Fesefeldt, H S; Fiandrini, E; Field, J H; Filthaut, Frank; Fisher, P H; Fisher, W; Fisk, I; Forconi, G; Freudenreich, Klaus; Furetta, C; Galaktionov, Yu; Ganguli, S N; García-Abia, P; Gataullin, M; Gentile, S; Giagu, S; Gong, Z F; Grenier, G; Grimm, O; Grünewald, M W; Guida, M; van Gulik, R; Gupta, V K; Gurtu, A; Gutay, L J; Haas, D; Hatzifotiadou, D; Hebbeker, T; Hervé, A; Hirschfelder, J; Hofer, H; Hohlmann, M; Holzner, G; Hou, S R; Hu, Y; Jin, B N; Jones, L W; de Jong, P; Josa-Mutuberria, I; Käfer, D; Kaur, M; Kienzle-Focacci, M N; Kim, J K; Kirkby, Jasper; Kittel, E W; Klimentov, A; König, A C; Kopal, M; Koutsenko, V F; Kräber, M H; Krämer, R W; Krüger, A; Kunin, A; Ladrón de Guevara, P; Laktineh, I; Landi, G; Lebeau, M; Lebedev, A; Lebrun, P; Lecomte, P; Lecoq, P; Le Coultre, P; Le Goff, J M; Leiste, R; Levtchenko, M; Levchenko, P M; Li, C; Likhoded, S; Lin, C H; Lin, W T; Linde, Frank L; Lista, L; Liu, Z A; Lohmann, W; Longo, E; Lü, Y S; Luci, C; Luminari, L; Lustermann, W; Ma Wen Gan; Malgeri, L; Malinin, A; Maña, C; Mans, J; Martin, J P; Marzano, F; Mazumdar, K; McNeil, R R; Mele, S; Merola, L; Meschini, M; Metzger, W J; Mihul, A; Milcent, H; Mirabelli, G; Mnich, J; Mohanty, G B; Muanza, G S; Muijs, A J M; Musicar, B; Musy, M; Nagy, S; Natale, S; Napolitano, M; Nessi-Tedaldi, F; Newman, H; Nisati, A; Novák, T; Nowak, H; Ofierzynski, R A; Organtini, G; Pal, I; Palomares, C; Paolucci, P; Paramatti, R; Passaleva, G; Patricelli, S; Paul, T; Pauluzzi, M; Paus, C; Pauss, Felicitas; Pedace, M; Pensotti, S; Perret-Gallix, D; Petersen, B; Piccolo, D; Pierella, F; Pioppi, M; Piroué, P A; Pistolesi, E; Plyaskin, V; Pohl, M; Pozhidaev, V; Pothier, J; Prokofev, D; Prokofiev, D O; Quartieri, J; Rahal-Callot, G; Rahaman, M A; Raics, P; Raja, N; Ramelli, R; Rancoita, P G; Ranieri, R; Raspereza, A V; Razis, P A; Ren, D; Rescigno, M; Reucroft, S; Riemann, S; Riles, K; Roe, B P; Romero, L; Rosca, A; Rosier-Lees, S; Roth, S; Rosenbleck, C; Roux, B; Rubio, J A; Ruggiero, G; Rykaczewski, H; Sakharov, A; Saremi, S; Sarkar, S; Salicio, J; Sánchez, E; Schäfer, C; Shchegelskii, V; Schopper, Herwig Franz; Schotanus, D J; Sciacca, C; Servoli, L; Shevchenko, S; Shivarov, N; Shoutko, V; Shumilov, E; Shvorob, A V; Son, D; Souga, C; Spillantini, P; Steuer, M; Stickland, D P; Stoyanov, B; Strässner, A; Sudhakar, K; Sultanov, G G; Sun, L Z; Sushkov, S; Suter, H; Swain, J D; Szillási, Z; Tang, X W; Tarjan, P; Tauscher, Ludwig; Taylor, L; Tellili, B; Teyssier, D; Timmermans, C; Ting, Samuel C C; Ting, S M; Tonwar, S C; Tóth, J; Tully, C; Tung, K L; Ulbricht, J; Valente, E; Van de Walle, R T; Vásquez, R; Veszpremi, V; Vesztergombi, G; Vetlitskii, I; Vicinanza, D; Viertel, Gert M; Villa, S; Vivargent, M; Vlachos, S; Vodopyanov, I; Vogel, H; Vogt, H; Vorobev, I; Vorobyov, A A; Wadhwa, M; Wang, Q; Wang, X L; Wang, Z M; Weber, M; Wienemann, P; Wilkens, H; Wynhoff, S; Xia, L; Xu, Z Z; Yamamoto, J; Yang, B Z; Yang, C G; Yang, H J; Yang, M; Yeh, S C; Zalite, A; Zalite, Yu; Zhang, Z P; Zhao, J; Zhu, G Y; Zhu, R Y; Zhuang, H L; Zichichi, A; Zimmermann, B; Zöller, M

    2003-01-01

    Events stemming from the pair-production of Z bosons in e^+e^- collisions are studied using 217.4 pb^-1 of data collected with the L3 detector at centre-of-mass energies from 200 GeV up to 209 GeV. The special case of events with b quarks is also investigated. Combining these events with those collected at lower centre-of-mass energies, the Standard Model predictions for the production mechanism are verified. In addition, limits are set on anomalous couplings of neutral gauge bosons and on effects of extra space dimensions.

  13. Pair formation in the herbivorous rabbitfish Siganus doliatus.

    Science.gov (United States)

    Brandl, S J; Bellwood, D R

    2013-06-01

    This study investigated the basis of pair formation in the abundant herbivorous rabbitfish Siganus doliatus on Orpheus Island, Great Barrier Reef. Pair formation was the most common social system in S. doliatus, with 67.4% of all individuals occurring in pairs. Pairs were stable (i.e. individuals remained with the same partner throughout the study) and pair members were found within 5 m of each other 82.9% of the time. Of the examined pairs, 25% were homosexual resulting in a proportion of heterosexual pairs (75%) that was significantly lower than expected if pairs were formed solely for reproductive reasons. Therefore, although reproduction appears to be the main driver of pair formation in S. doliatus, other factors are likely to influence this behaviour. The high density of individuals on the reef crest (5.7 ± 0 .9 individuals 200 m(-2); mean ± s.e.) and extensively overlapping home ranges of pairs indicated that the defence of territories plays no role in pair formation. Instead, it appears that pair formation in S. doliatus is driven, in part, by other, non-reproductive, ecological factors. It is suggested that pair formation allows for increased vigilance against predation and enables S. doliatus to execute a novel feeding behaviour.

  14. The nuclear receptor E75A has a novel pair-rule-like function in patterning the milkweed bug, Oncopeltus fasciatus.

    Science.gov (United States)

    Erezyilmaz, Deniz F; Kelstrup, Hans C; Riddiford, Lynn M

    2009-10-01

    Genetic studies of the fruit fly Drosophila have revealed a hierarchy of segmentation genes (maternal, gap, pair-rule and HOX) that subdivide the syncytial blastoderm into sequentially finer-scale coordinates. Within this hierarchy, the pair-rule genes translate gradients of information into periodic stripes of expression. How pair-rule genes function during the progressive mode of segmentation seen in short and intermediate-germ insects is an ongoing question. Here we report that the nuclear receptor Of'E75A is expressed with double segment periodicity in the head and thorax. In the abdomen, Of'E75A is expressed in a unique pattern during posterior elongation, and briefly resembles a sequence that is typical of pair-rule genes. Depletion of Of'E75A mRNA caused loss of a subset of odd-numbered parasegments, as well as parasegment 6. Because these parasegments straddle segment boundaries, we observe fusions between adjacent segments. Finally, expression of Of'E75A in the blastoderm requires even-skipped, which is a gap gene in Oncopeltus. These data show that the function of Of'E75A during embryogenesis shares many properties with canonical pair-rule genes in other insects. They further suggest that parasegment specification may occur through irregular and episodic pair-rule-like activity.

  15. THE NUCLEAR RECEPTOR E75A HAS A NOVEL PAIR-RULE-LIKE FUNCTION IN PATTERNING THE MILKWEED BUG, ONCOPELTUS FASCIATUS

    Science.gov (United States)

    Erezyilmaz, Deniz F.; Kelstrup, Hans C.; Riddiford, Lynn M.

    2009-01-01

    Genetic studies of the fruit fly Drosophila have revealed a hierarchy of segmentation genes (maternal, gap, pair-rule and HOX) that subdivide the syncytial blastoderm into sequentially finer scale coordinates. Within this hierarchy, the pair-rule genes translate gradients of information into periodic stripes of expression. How pair-rule genes function during the progressive mode of segmentation seen in short and intermediate-germ insects is an ongoing question. Here we report that the nuclear receptor Of’E75A is expressed with double segment periodicity in the head and thorax. In the abdomen, Of’E75A is expressed in a unique pattern during posterior elongation, and briefly resembles a sequence that is typical of pair-rule genes. Depletion of Of’E75A mRNA caused loss of a subset of odd-numbered parasegments, as well as parasegment 6. Because these parasegments straddle segment boundaries, we observe fusions between adjacent segments. Finally, expression of Of’E75A in the blastoderm requires even-skipped, which is a gap gene in Oncopeltus. These data show that the function of Of’E75A during embryogenesis shares many properties with canonical pair-rule genes in other insects. They further suggest that parasegment specification may occur through irregular and episodic pair-rule-like activity. PMID:19580803

  16. Optimisation of a quantum pair space thruster

    Directory of Open Access Journals (Sweden)

    Valeriu DRAGAN

    2012-06-01

    Full Text Available The paper addresses the problem of propulsion for long term space missions. Traditionally a space propulsion unit has a propellant mass which is ejected trough a nozzle to generate thrust; this is also the case with inert gases energized by an on-board power unit. Unconventional methods for propulsion include high energy LASERs that rely on the momentum of photons to generate thrust. Anti-matter has also been proposed for energy storage. Although the momentum of ejected gas is significantly higher, the LASER propulsion offers the perspective of unlimited operational time – provided there is a power source. The paper will propose the use of the quantum pair formation for generating a working mass, this is different than conventional anti-matter thrusters since the material particles generated are used as propellant not as energy storage.Two methods will be compared: LASER and positron-electron, quantum pair formation. The latter will be shown to offer better momentum above certain energy levels.For the demonstrations an analytical solution is obtained and provided in the form of various coefficients. The implications are, for now, theoretical however the practicality of an optimized thruster using such particles is not to be neglected for long term space missions.

  17. Pair Production Constraints on Superluminal Neutrinos Revisited

    Energy Technology Data Exchange (ETDEWEB)

    Brodsky, Stanley J.; /SLAC; Gardner, Susan; /Kentucky U.

    2012-02-16

    We revisit the pair creation constraint on superluminal neutrinos considered by Cohen and Glashow in order to clarify which types of superluminal models are constrained. We show that a model in which the superluminal neutrino is effectively light-like can evade the Cohen-Glashow constraint. In summary, any model for which the CG pair production process operates is excluded because such timelike neutrinos would not be detected by OPERA or other experiments. However, a superluminal neutrino which is effectively lightlike with fixed p{sup 2} can evade the Cohen-Glashow constraint because of energy-momentum conservation. The coincidence involved in explaining the SN1987A constraint certainly makes such a picture improbable - but it is still intrinsically possible. The lightlike model is appealing in that it does not violate Lorentz symmetry in particle interactions, although one would expect Hughes-Drever tests to turn up a violation eventually. Other evasions of the CG constraints are also possible; perhaps, e.g., the neutrino takes a 'short cut' through extra dimensions or suffers anomalous acceleration in matter. Irrespective of the OPERA result, Lorentz-violating interactions remain possible, and ongoing experimental investigation of such possibilities should continue.

  18. Schwinger pair production with ultracold atoms

    Directory of Open Access Journals (Sweden)

    V. Kasper

    2016-09-01

    Full Text Available We consider a system of ultracold atoms in an optical lattice as a quantum simulator for electron–positron pair production in quantum electrodynamics (QED. For a setup in one spatial dimension, we investigate the nonequilibrium phenomenon of pair production including the backreaction leading to plasma oscillations. Unlike previous investigations on quantum link models, we focus on the infinite-dimensional Hilbert space of QED and show that it may be well approximated by experiments employing Bose–Einstein condensates interacting with fermionic atoms. Numerical calculations based on functional integral techniques give a unique access to the physical parameters required to realize QED phenomena in a cold atom experiment. In particular, we use our approach to consider quantum link models in a yet unexplored parameter regime and give bounds for their ability to capture essential features of the physics. The results suggest a paradigmatic change towards realizations using coherent many-body states for quantum simulations of high-energy particle physics phenomena.

  19. Pair Fireball Precursors of Neutron Star Mergers

    CERN Document Server

    Metzger, Brian D

    2016-01-01

    If at least one neutron star (NS) is magnetized in a binary NS merger, then the orbital motion of the conducting companion through its dipole field during the final inspiral induces a strong voltage and current along the magnetic field lines connecting the two objects. If a modest fraction eta of the electromagnetic power extracted during the inspiral is used to accelerate relativistic particles, the resulting gamma-ray emission in such a compact volume will result in the formation of a thermal electron-positron pair fireball. Applying the steady-state pair wind model of Paczynski (1986), we quantify the luminosities and temperatures of the precursor fireball and its detectability with gamma-ray satellites. Under the assumption that eta ~ 1, the gamma-ray detection horizon of Dmax ~ 20(Bd/1e14 G) is much closer than the Advanced LIGO/Virgo horizon of 200 Mpc, unless the surface magnetic field of the NS is very strong, Bd > 1e15 G. Given the quasi-isotropic nature of the emission, a sub-population of mergers w...

  20. Parenting and Psychopathology in Sibling Pairs

    Directory of Open Access Journals (Sweden)

    Jiri Modestin

    2008-06-01

    Full Text Available Background: The current study explored the relationship between parenting experience in childhood as a specific aspect of the non-shared environment and the amount of psychopathology in adulthood. Sampling and Methods: 27 same-sex sibling pairs were studied. In each pair, one proband was a psychiatric outpatient, the other proband a non-patient. All probands filled in the Parental Bonding Instrument (PBI and the Symptom Checklist-90-Revised (SCL-90-R. Results: The patients rated higher on practically all SCL-90-R scales whereas no significant differences were found with regard to the PBI ratings. With only one exception, there were no significant correlations between PBI and SCL-90-R ratings in the group of patients. In contrast, all SCL-90-R subscales correlated negatively with paternal care and half of them positively with paternal control in patients' healthy siblings. Conclusions: The degree of paternal care seems to be most closely related with lack of mental symptoms in psychiatric non-patients. In contrast, parenting does not seem to play a substantial role in patients, presenting with a higher degree of psychopathology. Obviously, environmental factors become less important, the more pronounced the pathology.

  1. Low level of extra-pair paternity between nearest neighbors results from female preference for high-quality males in the yellow-rumped flycatcher (Ficedula zanthopygia)

    Science.gov (United States)

    E, Mingju; Gong, Ye; Yu, Jiangping; Zhang, Siyu; Fan, Qianxi; Jiang, Yunlei

    2017-01-01

    Extra-pair copulation is considered to be a means by which females can modify their initial mate choice, and females might obtain indirect benefits to offspring fitness by engaging in this behavior. Here, we examined the patterns of extra-pair paternity and female preferences in the yellow-rumped flycatcher (Ficedula zanthopygia). We found that female yellow-rumped flycatchers are more likely to choose larger and relatively highly heterozygous males than their social mates as extra-pair mates, that the genetic similarity of pairs that produced mixed-paternity offspring did not differ from the similarity of pairs producing only within-pair offspring, and that extra-pair offspring were more heterozygous than their half-siblings. These findings support the good genes hypothesis but do not exclude the compatibility hypothesis. Most female yellow-rumped flycatchers attained extra-pair paternity with distant males rather than their nearest accessible neighboring males, and no differences in genetic and phenotypic characteristics were detected between cuckolded males and their nearest neighbors. There was no evidence that extra-pair mating by female flycatchers reduced inbreeding. Moreover, breeding density, breeding synchrony and their interaction did not affect the occurrence of extra-pair paternity in this species. Our results suggest that the variation in extra-pair paternity distribution between nearest neighbors in some passerine species might result from female preference for highly heterozygous males. PMID:28257431

  2. A Search for pair production of the LSP $\\tilde{\

    CERN Document Server

    Sahin, M; Sultansoy, S; Yilmaz, M

    2012-01-01

    In this work we consider pair production of LSP tau-sneutrinos at the Compact Lineer Collider. We assume that tau-sneutrinos decays in to e\\textmu pair via RPV interactions. Backgroundless subprocess $e{}^{-}e^{+}\\rightarrow\\tilde{\

  3. Superluminal Spot Pair Events in Astronomical Settings: Sweeping Beams

    CERN Document Server

    Nemiroff, Robert J

    2014-01-01

    Sweeping beams of light can cast spots moving with superluminal speeds across scattering surfaces. Such faster-than-light speeds are well-known phenomena that do not violate special relativity. It is shown here that under certain circumstances, superluminal spot pair creation and annihilation events can occur that provide unique information to observers. These spot pair events are {\\it not} particle pair events -- they are the sudden creation or annihilation of a pair of relatively illuminated spots on a scattering surface. Real spot pair illumination events occur unambiguously on the scattering surface when spot speeds diverge, while virtual spot pair events are observer dependent and perceived only when real spot radial speeds cross the speed of light. Specifically, a virtual spot pair creation event will be observed when a real spot's speed toward the observer drops below $c$, while a virtual spot pair annihilation event will be observed when a real spot's radial speed away from the observer rises above $c...

  4. Nuclear Pairing from Two-body Microscopic Forces: Analysis of the Cooper Pair Wavefunctions

    CERN Document Server

    Finelli, P; Holt, J W

    2014-01-01

    In a recent paper we studied the behavior of the pairing gaps $\\Delta_F$ as a function of the Fermi momentum $k_F$ for neutron and nuclear matter in all relevant angular momentum channels where superfluidity is believed to naturally emerge. The calculations employed realistic chiral nucleon-nucleon potentials with the inclusion of three-body forces and self-energy effects. In this contribution, after a detailed description of the numerical method we employed in the solution of the BCS equations, we will show a preliminary analysis of the Cooper pair wavefunctions.

  5. Higher derived brackets, strong homotopy associative algebras and Loday pairs

    CERN Document Server

    Uchino, K

    2009-01-01

    We give a quick method of constructing strong homotopy associative algebras. This method is an associative version of (higher) derived bracket construction in the category of Lie/Leibniz algebras. We try to unify the two derived bracket constructions. For that aim we introduce a new type of algebra ``Loday pair", which is a noncommutative version of classical Leibniz pair. We give a coalgebra description of Loday pairs and study a derived bracket construction for Loday pairs.

  6. Photon pair source via two coupling single quantum emitters

    Institute of Scientific and Technical Information of China (English)

    彭勇刚; 郑雨军

    2015-01-01

    We study the two coupling two-level single molecules driven by an external field as a photon pair source. The proba-bility of emitting two photons, P2, is employed to describe the photon pair source quality in a short time, and the correlation coefficient RAB is employed to describe the photon pair source quality in a long time limit. The results demonstrate that the coupling single quantum emitters can be considered as a stable photon pair source.

  7. Extensions of Bessel sequences to dual pairs of frames

    DEFF Research Database (Denmark)

    Christensen, Ole; Kim, Hong Oh; Kim, Rae Young

    2013-01-01

    Tight frames in Hilbert spaces have been studied intensively for the past years. In this paper we demonstrate that it often is an advantage to use pairs of dual frames rather than tight frames. We show that in any separable Hilbert space, any pairs of Bessel sequences can be extended to a pair of...... be extended to a pair of dual frames. © 2012 Elsevier Inc. All rights reserved....

  8. Differentially Methylated DNA Regions in Monozygotic Twin Pairs Discordant for Rheumatoid Arthritis

    DEFF Research Database (Denmark)

    Svendsen, Anders J; Gervin, Kristina; Lyle, Robert;

    2016-01-01

    OBJECTIVES: In an explorative epigenome-wide association study (EWAS) to search for gene independent, differentially methylated DNA positions and regions (DMRs) associated with rheumatoid arthritis (RA) by studying monozygotic (MZ) twin pairs discordant for RA. METHODS: Genomic DNA was isolated......: We identified several differentially methylated regions associated with RA, which may represent environmental effects or consequences of the disease and plausible biological pathways pertinent to the pathogenesis of RA....

  9. A chemical approach to mapping nucleosomes at base pair resolution in yeast.

    Science.gov (United States)

    Brogaard, Kristin R; Xi, Liqun; Wang, Ji-Ping; Widom, Jonathan

    2012-01-01

    Most eukaryotic DNA exists in DNA-protein complexes known as nucleosomes. The exact locations of nucleosomes along the genome play a critical role in chromosome functions and gene regulation. However, the current methods for nucleosome mapping do not provide the necessary accuracy to identify the precise nucleosome locations. Here we describe a new experimental approach that directly maps nucleosome center locations in vivo genome-wide at single base pair resolution.

  10. Fountain-Gould Left Orders for Associative Pairs

    Institute of Scientific and Technical Information of China (English)

    José A. ANQUELA; Teresa CORT(E)S; Miguel G(O)MEZ LOZANO; Mercedes SILES MOLINA

    2006-01-01

    In this paper, we introduce a notion of weak Fountain-Gould left order for associative pairs and give a Goldie-like theory of associative pairs which are weak Fountain-Gould left orders in semiprime pairs coinciding with their socles.

  11. Three-photon annihilation of the electron-positron pairs

    OpenAIRE

    Frolov, A. M.

    2008-01-01

    Three-photon annihilation of the electron-positron pairs (= $(e^{-}, e^{+})-$pairs) is considered in the electron rest frame. The energy of the incident positron can be arbitrary. The analytical expression for the cross-section of three-photon annihilation of the $(e^{-},e^{+})-$pair has been derived and investigated.

  12. Influence of pairing in double beta decay of48Ca

    Indian Academy of Sciences (India)

    Prianka Roy; Shashi K Dhiman

    2010-03-01

    Two-neutrino decay matrix elements and half-life of 48Ca are calculated after including neutron–proton pairing correlations in projected Hartree–Fock–Bogoliubov (PHFB) formalism. The GT matrix elements in 2 decay are reduced due to broader smearing of Fermi surfaces. Half-life results for 2 decay of 48Ca with np pairing are better than without pairing.

  13. Au pair på ulige vilkår

    DEFF Research Database (Denmark)

    Christiansen, Connie Carøe

    2008-01-01

    Antallet af au pairs i Danmark fra Fillipinerne er steget markant i de seneste år. Mens danske myndigheder betragter au pair-ordningen som kulturudveksling blandt unge mennesker, ser fillipinske au pairs derimod den som en mulighed for at tjene penge så de kan forsørge deres egen familie i Fillip...

  14. Using Pair Programming to Teach CAD Based Engineering Graphics

    Science.gov (United States)

    Leland, Robert P.

    2010-01-01

    Pair programming was introduced into a course in engineering graphics that emphasizes solid modeling using SolidWorks. In pair programming, two students work at a single computer, and periodically trade off roles as driver (hands on the keyboard and mouse) and navigator (discuss strategy and design issues). Pair programming was used in a design…

  15. Evidence for homosexuality gene

    Energy Technology Data Exchange (ETDEWEB)

    Pool, R.

    1993-07-16

    A genetic analysis of 40 pairs of homosexual brothers has uncovered a region on the X chromosome that appears to contain a gene or genes for homosexuality. When analyzing the pedigrees of homosexual males, the researcheres found evidence that the trait has a higher likelihood of being passed through maternal genes. This led them to search the X chromosome for genes predisposing to homosexuality. The researchers examined the X chromosomes of pairs of homosexual brothers for regions of DNA that most or all had in common. Of the 40 sets of brothers, 33 shared a set of five markers in the q28 region of the long arm of the X chromosome. The linkage has a LOD score of 4.0, which translates into a 99.5% certainty that there is a gene or genes in this area that predispose males to homosexuality. The chief researcher warns, however, that this one site cannot explain all instances of homosexuality, since there were some cases where the trait seemed to be passed paternally. And even among those brothers where there was no evidence that the trait was passed paternally, seven sets of brothers did not share the Xq28 markers. It seems likely that homosexuality arises from a variety of causes.

  16. Depicting the MeV realm with the Compton Pair-Production Telescope (ComPair)

    Science.gov (United States)

    Ferrara, Elizabeth C.; Buson, Sara; ComPair Mission Team

    2017-01-01

    The energy band from a few hundred keV to a few hundred MeV offers a unique window for studying both thermal and the non-thermal astrophysical processes. Important science can be gleaned from investigations of emission mechanisms and environments of the most extreme objects that populate this mostly unexplored energy range.The Compton-Pair Telescope (ComPair) is a next-generation mission concept building on the pioneering observations by COMPTEL, on the Compton Gamma-Ray Observatory, and the heritage of recent successful missions, such as Fermi-LAT, AGILE, AMS and PAMELA. With its capability of detecting both Compton-scattering events at lower energy and pair-production events at higher energy, ComPair can explore the energy regime from 0.2 keV to > 500 MeV with unprecedented sensitivity. We describe the concept of this wide-aperture instrument and discuss its power to address fundamental questions from a broad variety of astrophysical topics.

  17. Disruption, beamstrahlung, and beamstrahlung pair creation

    Energy Technology Data Exchange (ETDEWEB)

    Chen, P.

    1988-12-01

    The two major effects from the interaction of e/sup /minus//e/sup +/ beams---beamstrahlung and disruption---are reviewed, with emphasis on flat beam collisions. For the disruption effects we discuss the luminosity enhancement factor, the maximum and rms disruption angles, and the ''kink instability''. All the results are obtained from computer simulations, and scaling laws based on these are deduced whenever possible. For the beamstrahlung effects, we concentrate only on the final electron energy spectrum and the deflection angle associated with low energy particles. In addition to the generic studies on the beam-beam effects, we also list the relevant beam-beam parameters obtained from simulations on two sample designs: the TLC and the ILC. As an addendum, the newly discovered phenomenon of coherent beamstrahlung pair creation, together with the incoherent process, are discussed. 18 refs., 15 figs., 1 tab.

  18. Indium-carbon pairs in germanium

    Energy Technology Data Exchange (ETDEWEB)

    Tessema, G; Vianden, R [Helmholtz Institut fuer Strahlen-und Kernphysik, Universitaet Bonn, Nussallee 14-16, 53115 Bonn (Germany)

    2003-08-06

    The interactions of carbon with the probe nucleus {sup 111}In have been studied in germanium using the perturbed angular correlation method, which has the ability to detect the microscopic environments of the probe atom by means of the interaction of the nuclear moments of the probe with the surrounding electromagnetic fields. At high dose carbon implantation in germanium two complexes have been identified by their unique quadrupole interaction frequencies. An interaction frequency of {nu}{sub Q1} = 207(1) MHz ({eta} = 0.16(3)) appeared at annealing temperatures below 650 deg. C. Above 650 deg. C, it was replaced by a second interaction frequency of {nu}{sub Q2} 500(1) MHz ({eta} = 0). The frequencies are attributed to two different carbon-indium pairs. The orientation of the corresponding electric field gradients and the thermal stability of the defect complexes are studied.

  19. Dust trapping in inviscid vortex pairs

    CERN Document Server

    Angilella, Jean-Regis

    2010-01-01

    The motion of tiny heavy particles transported in a co-rotating vortex pair, with or without particle inertia and sedimentation, is investigated. The dynamics of non-inertial sedimenting particles is shown to be chaotic, under the combined effect of gravity and of the circular displacement of the vortices. This phenomenon is very sensitive to particle inertia, if any. By using nearly hamiltonian dynamical system theory for the particle motion equation written in the rotating reference frame, one can show that small inertia terms of the particle motion equation strongly modify the Melnikov function of the homoclinic trajectories and heteroclinic cycles of the unperturbed system, as soon as the particle response time is of the order of the settling time (Froude number of order unity). The critical Froude number above which chaotic motion vanishes and a regular centrifugation takes place is obtained from this Melnikov analysis and compared to numerical simulations. Particles with a finite inertia, and in the abs...

  20. Photogeneration of polaron pairs in conducting polymers

    Science.gov (United States)

    Conwell, E. M.; Mizes, H. A.

    1995-03-01

    It is usually assumed that when photogeneration in a conducting polymer results in an electron and hole on separate chains they form negative and positive polarons that can move independently of each other. We show, on the basis of the small carrier yield per photon seen in picosecond photoconductivity, the different behavior of photoinduced absorption (PA) in dilute solution and thin films, and the spectral distribution of the PA in thin films, that photogenerated positive and negative polarons in poly(p-phenylene vinylene), polythiophene, and polyacetylene are, for the most part, bound in pairs by their Coulomb attraction. We also show that PA data give evidence for a gap of 2.8 eV, and thus an exciton binding energy of 0.4 eV, in poly(p-phenylene vinylene).

  1. Aluminium Diphosphamethanides: Hidden Frustrated Lewis Pairs.

    Science.gov (United States)

    Styra, Steffen; Radius, Michael; Moos, Eric; Bihlmeier, Angela; Breher, Frank

    2016-07-04

    The synthesis and characterisation of two aluminium diphosphamethanide complexes, [Al(tBu)2 {κ(2) P,P'-Mes*PCHPMes*}] (3) and [Al(C6 F5 )2 {κ(2) P,P'-Mes*PCHPMes*}] (4), and the silylated analogue, Mes*PCHP(SiMe3 )Mes* (5), are reported. The aluminium complexes feature four-membered PCPAl core structures consisting of diphosphaallyl ligands. The silylated phosphine 5 was found to be a valuable precursor for the synthesis of 4 as it cleanly reacts with the diaryl aluminium chloride [(C6 F5 )2 AlCl]2 . The aluminium complex 3 reacts with molecular dihydrogen at room temperature under formation of the acyclic σ(2) λ(3) ,σ(3) λ(3) -diphosphine Mes*PCHP(H)Mes* and the corresponding dialkyl aluminium hydride [tBu2 AlH]3 . Thus, 3 belongs to the family of so-called hidden frustrated Lewis pairs.

  2. Authenticating Tripartite Key Agreement Protocol with Pairings

    Institute of Scientific and Technical Information of China (English)

    Sheng-Li Liu; Fang-Guo Zhang; Ke-Fei Chen

    2004-01-01

    In this paper, an authenticated tripartite key agreement protocol is proposed, which is an ID-based one with pairings. This protocol involves only one round. The authenticity of the protocol is assured by a special signature scheme, so that messages carrying the information of two ephemeral keys can be broadcasted authentically by an entity. Consequently, one instance of the protocol results in eight session keys for three entities. In other word, one instance of the protocol generates a session key, which is eight times longer than those obtained from traditional key agreement protocols. Security attributes of the protocol are presented, and the computational overhead and bandwidth of the broadcast messages are analyzed as well.

  3. Pairing in bulk nuclear matter beyond BCS

    CERN Document Server

    Ding, D; Dickhoff, W H; Dussan, H; Rios, A; Polls, A

    2014-01-01

    The influence of short-range correlations on the spectral distribution of neutrons is incorporated in the solution of the gap equation for the ${}^3P_2-{}^3F_2$ coupled channel in pure neutron matter. This effect is studied for different realistic interactions including one based on chiral perturbation theory. The gap in this channel vanishes at all relevant densities due to the treatment of these correlations. We also consider the effect of long-range correlations by including polarization terms in addition to the bare interaction which allow the neutrons to exchange density and spin fluctuations governed by the strength of Landau parameters allowed to have reasonable values consistent with the available literature. Preliminary results indicate that reasonable values of these parameters do not generate a gap in the ${}^3P_2-{}^3F_2$ coupled channel either for all three realistic interactions although the pairing interaction becomes slightly more attractive.

  4. Frustrated Lewis pairs: Design and reactivity

    Indian Academy of Sciences (India)

    Sanjoy Mukherjee; Pakkirisamy Thilagar

    2015-02-01

    The interaction of a Lewis acid with a Lewis base results in the formation of a Lewis acid–base adduct. Understanding Lewis acids and bases is central to conceptualizing chemical interactions and constitutes a major portion of metal–ligand chemistry. Sterically encumbered/constrained Lewis pairs cannot form acid–base adducts, but such ‘Frustrated Lewis Pairs’ (FLPs), with their unquenched electronic demands can be elegantly used to simultaneously react with a third species, resulting in unusual reactivity of small molecules. Such unusual reactions, explored only in the last few years, have found several applications, e.g., heterolytic splitting of H2, activation of small molecules (CO2, N2O, etc.). FLPs have opened new opportunities in synthetic chemistry, covering organic, main group as well as transition metal chemistry. The design strategies adopted for FLP systems and their unique reactivity are discussed here.

  5. Holographic Vortex Pair Annihilation in Superfluid Turbulence

    CERN Document Server

    Du, Yiqiang; Tian, Yu; Zhang, Hongbao

    2014-01-01

    We make a first principles investigation of the dynamical evolution of vortex number in a two-dimensional (2D) turbulent superfluid by holography through numerically solving its highly non-trivial gravity dual. With the randomly placed vortices and antivortices prepared as initial states, we find that the temporal evolution of the vortex number can be well fit statistically by two-body decay due to the vortex pair annihilation featured relaxation process remarkably from a very early time on. In particular, subtracted by the universal offset, the power law fit indicates that our holographic turbulent superfluid exhibits an apparently different decay pattern from the superfluid recently experimented in highly oblate Bose-Einstein condensates.

  6. Neutron area monitor with TLD pairs

    Energy Technology Data Exchange (ETDEWEB)

    Guzman G, K. A.; Borja H, C. G.; Valero L, C.; Hernandez D, V. M.; Vega C, H. R., E-mail: ing_karen_guzman@yahoo.com.mx [Universidad Autonoma de Zacatecas, Unidad Academica de Estudios Nucleares, Calle Cipres No. 10. Fracc. La Penuela, 98068 Zacatecas (Mexico)

    2011-11-15

    The response of a passive neutron area monitor with pairs of thermoluminescent dosimeters has been calculated using the Monte Carlo code MCNP5. The response was calculated for one TLD 600 located at the center of a polyethylene cylinder, as moderator. When neutrons collide with the moderator lose their energy reaching the TLD with thermal energies where the ambient dose equivalent is calculated. The response was calculated for 47 monoenergetic neutron sources ranging from 1E(-9) to 20 MeV. Response was calculated using two irradiation geometries, one with an upper source and another with a lateral source. For both irradiation schemes the response was calculated with the TLDs in two positions, one parallel to the source and another perpendicular to the source. The advantage of this passive neutron monitor area is that can be used in locations with intense, pulsed and mixed radiation fields. (Author)

  7. Passive neutron area monitor with TLD pairs

    Energy Technology Data Exchange (ETDEWEB)

    Guzman G, K. A.; Borja H, C. G.; Valero L, C.; Hernandez D, V. M.; Vega C, H. R., E-mail: fermineutron@yahoo.com [Universidad Autonoma de Zacatecas, Unidad Academica de Estudios Nucleares, Cipres No. 10, Fracc. La Penuela, 98068 Zacatecas (Mexico)

    2012-06-15

    The response of a passive neutron area monitor with pairs of thermoluminescent dosimeters (TLD) has been calculated using the Monte Carlo code MCNP5. The response was calculated for one TLD 600 located at the center of a polyethylene moderator. The response was calculated for 47 monoenergetic neutron sources ranging from 1E(-9) to 20 MeV. Response was calculated using two irradiation geometries, one with an upper source and another with a lateral source. For both irradiation schemes the response was calculated with the TLD in two positions, one parallel to the source and another perpendicular to the source. The advantage of this passive neutron monitor area is that can be used in locations with intense, pulsed and mixed radiation fields like those in radiotherapy vault rooms with linear accelerators. (Author)

  8. An advanced KB mirror pair for microfocusing

    CERN Document Server

    Ferme, J J

    2001-01-01

    A new range of micro-focusing mirrors based on KB pairs has been developed by SESO for Beamline Nanospectroscopy at the Elettra Storage Ring in Trieste, Italy. Both the focusing and the aspheric shape are adjustable with stepper motors. The goal of the beamline is to have a high photon density spot with a variable size in the experimental chamber over the whole soft X-ray range. The estimated dimension of the final spot should be smaller than 4 mu m sup 2 FWHM, with a photon density of the order of 10 sup 1 sup 3 photons/s mu m sup 2; this may be achieved only by accepting an angular divergence on these mirrors of between 5 and 10 mrad. This condition can be fulfilled only with elliptical (or plane elliptical) mirrors with very limited residual slope errors (below 1 mu rad RMS) that are able to correct even small focal distance errors.

  9. Ultracompact quantum splitter of degenerate photon pairs

    CERN Document Server

    He, Jiakun; Casas-Bedoya, Alvaro; Zhang, Yanbing; Xiong, Chunle; Eggleton, Benjamin J

    2015-01-01

    Integrated sources of indistinguishable photons have attracted a lot of attention because of their applications in quantum communication and optical quantum computing. Here, we demonstrate an ultra-compact quantum splitter for degenerate single photons based on a monolithic chip incorporating Sagnac loop and a micro-ring resonator with a footprint of 0.011 mm2, generating and deterministically splitting indistinguishable photon pairs using time-reversed Hong-Ou-Mandel interference. The ring resonator provides enhanced photon generation rate, and the Sagnac loop ensures the photons travel through equal path lengths and interfere with the correct phase to enable the reversed HOM effect to take place. In the experiment, we observed a HOM dip visibility of 94.5 +- 3.3 %, indicating the photons generated by the degenerate single photon source are in a suitable state for further integration with other components for quantum applications, such as controlled-NOT gates.

  10. Imaging with power controlled source pairs

    CERN Document Server

    Bardsley, Patrick

    2015-01-01

    Scatterers in a homogeneous medium are imaged by probing the medium with two point sources of waves modulated by correlated signals and by measuring only intensities at one single receiver. For appropriately chosen source pairs, we show that full waveform array measurements can be recovered from such intensity measurements by solving a linear least squares problem. The least squares solution can be used to image with Kirchhoff migration, even if the solution is determined only up to a known one-dimensional nullspace. The same imaging strategy can be used when the medium is probed with point sources driven by correlated Gaussian processes and autocorrelations are measured at a single location. Since autocorrelations are robust to noise, this can be used for imaging when the probing wave is drowned in background noise.

  11. Kink pair production and dislocation motion

    Science.gov (United States)

    Fitzgerald, S. P.

    2016-12-01

    The motion of extended defects called dislocations controls the mechanical properties of crystalline materials such as strength and ductility. Under moderate applied loads, this motion proceeds via the thermal nucleation of kink pairs. The nucleation rate is known to be a highly nonlinear function of the applied load, and its calculation has long been a theoretical challenge. In this article, a stochastic path integral approach is used to derive a simple, general, and exact formula for the rate. The predictions are in excellent agreement with experimental and computational investigations, and unambiguously explain the origin of the observed extreme nonlinearity. The results can also be applied to other systems modelled by an elastic string interacting with a periodic potential, such as Josephson junctions in superconductors.

  12. Local pair natural orbitals for excited states

    Science.gov (United States)

    Helmich, Benjamin; Hättig, Christof

    2011-12-01

    We explore how in response calculations for excitation energies with wavefunction based (e.g., coupled cluster) methods the number of double excitation amplitudes can be reduced by means of truncated pair natural orbital (PNO) expansions and localized occupied orbitals. Using the CIS(D) approximation as a test model, we find that the number of double excitation amplitudes can be reduced dramatically with minor impact on the accuracy if the excited state wavefunction is expanded in state-specific PNOs generated from an approximate first-order guess wavefunction. As for ground states, the PNO truncation error can also for excitation energies be controlled by a single threshold related to generalized natural occupation numbers. The best performance is found with occupied orbitals which are localized by the Pipek-Mezey localization. For a large test set of excited states we find with this localization that already a PNO threshold of 10-8-10-7, corresponding to an average of only 40-80 PNOs per pair, is sufficient to keep the PNO truncation error for vertical excitation energies below 0.01 eV. This is a significantly more rapid convergence with the number doubles amplitudes than in domain-based local response approaches. We demonstrate that the number of significant excited state PNOs scales asymptotically linearly with the system size in the worst case of completely delocalized excitations and sub-linearly whenever the chromophore does not increase with the system size. Moreover, we observe that the flexibility of state-specific PNOs to adapt to the character of an excitation allows for an almost unbiased treatment of local, delocalized and charge transfer excited states.

  13. Local pair natural orbitals for excited states.

    Science.gov (United States)

    Helmich, Benjamin; Hättig, Christof

    2011-12-07

    We explore how in response calculations for excitation energies with wavefunction based (e.g., coupled cluster) methods the number of double excitation amplitudes can be reduced by means of truncated pair natural orbital (PNO) expansions and localized occupied orbitals. Using the CIS(D) approximation as a test model, we find that the number of double excitation amplitudes can be reduced dramatically with minor impact on the accuracy if the excited state wavefunction is expanded in state-specific PNOs generated from an approximate first-order guess wavefunction. As for ground states, the PNO truncation error can also for excitation energies be controlled by a single threshold related to generalized natural occupation numbers. The best performance is found with occupied orbitals which are localized by the Pipek-Mezey localization. For a large test set of excited states we find with this localization that already a PNO threshold of 10(-8)-10(-7), corresponding to an average of only 40-80 PNOs per pair, is sufficient to keep the PNO truncation error for vertical excitation energies below 0.01 eV. This is a significantly more rapid convergence with the number doubles amplitudes than in domain-based local response approaches. We demonstrate that the number of significant excited state PNOs scales asymptotically linearly with the system size in the worst case of completely delocalized excitations and sub-linearly whenever the chromophore does not increase with the system size. Moreover, we observe that the flexibility of state-specific PNOs to adapt to the character of an excitation allows for an almost unbiased treatment of local, delocalized and charge transfer excited states.

  14. NMR analysis of base-pair opening kinetics in DNA

    Science.gov (United States)

    Szulik, Marta W.; Voehler, Markus; Stone, Michael P.

    2014-01-01

    Base pairing in nucleic acids plays a crucial role in their structure and function. Differences in the base pair opening and closing kinetics of individual double stranded DNA sequences or between chemically modified base pairs provide insight into the recognition of these base pairs by DNA processing enzymes. This unit describes how to quantify the kinetics for localized base pairs by observing changes in the imino proton signals by nuclear magnetic resonance spectroscopy. The determination of all relevant parameters using state of the art techniques and NMR instrumentation, including cryoprobes, is discussed. PMID:25501592

  15. Finite size effects in stimulated laser pair production

    CERN Document Server

    Heinzl, Thomas; Marklund, Mattias

    2010-01-01

    We consider stimulated pair production in a strong laser background, using the language of lightcone field theory. In an infinite plane wave, we show that the lightcone momentum transfer to the pair must be a multiple of the laser frequency, which results in the usual interpretation of multi-photon production of pairs with an effective mass. In a pulse, the momentum transfer is continuous, exhibiting resonant behaviour for effective mass pair production. We show that this is completely analogous to a diffraction process, and that the fine structure of the emission rate is that of a diffraction pattern resulting from interference of the produced pairs' wavefunctions.

  16. Scheduler for multiprocessor system switch with selective pairing

    Energy Technology Data Exchange (ETDEWEB)

    Gara, Alan; Gschwind, Michael Karl; Salapura, Valentina

    2015-01-06

    System, method and computer program product for scheduling threads in a multiprocessing system with selective pairing of processor cores for increased processing reliability. A selective pairing facility is provided that selectively connects, i.e., pairs, multiple microprocessor or processor cores to provide one highly reliable thread (or thread group). The method configures the selective pairing facility to use checking provide one highly reliable thread for high-reliability and allocate threads to corresponding processor cores indicating need for hardware checking. The method configures the selective pairing facility to provide multiple independent cores and allocate threads to corresponding processor cores indicating inherent resilience.

  17. Pairing reentrance in warm rotating $^{104}$Pd nucleus

    CERN Document Server

    Hung, N Quang; Agrawal, B K; Datar, V M; Mitra, A; Chakrabarty, D R

    2015-01-01

    Pairing reentrance phenomenon in the warm rotating $^{104}$Pd nucleus is studied within the Bardeen-Cooper-Schrieffer (BCS)-based approach (the FTBCS1). The theory takes into account the effect of quasiparticle number fluctuations on the pairing field at finite temperature and angular momentum within the pairing model plus noncollective rotation along the symmetry axis. The numerical calculations for the pairing gaps and nuclear level densities (NLD), of which an anomalous enhancement has been experimentally observed at low excitation energy $E^*$ and high angular momentum $J$, show that the pairing reentrance is seen in the behavior of pairing gap obtained within the FTBCS1 at low $E$ and high $J$. This leads to the enhancement of the FTBCS1 level densities, in good agreement with the experimental observation. This agreement indicates that the observed enhancement of the NLD might be the first experimental detection of the pairing reentrance in a finite nucleus.

  18. Sequence-specific high mobility group box factors recognize 10-12-base pair minor groove motifs

    DEFF Research Database (Denmark)

    van Beest, M; Dooijes, D; van De Wetering, M;

    2000-01-01

    of promoter elements controlled by the yeast genes ste11 and Rox1 has indicated strict conservation of a larger DNA motif. By site selection, we identify a highly specific 12-base pair motif for Ste11, AGAACAAAGAAA. Similarly, we show that Tcf1, MatMc, and Sox4 bind unique, highly specific DNA motifs of 12......, 12, and 10 base pairs, respectively. Footprinting with a deletion mutant of Ste11 reveals a novel interaction between the 3' base pairs of the extended DNA motif and amino acids C-terminal to the HMG domain. The sequence-specific interaction of Ste11 with these 3' base pairs contributes significantly......Sequence-specific high mobility group (HMG) box factors bind and bend DNA via interactions in the minor groove. Three-dimensional NMR analyses have provided the structural basis for this interaction. The cognate HMG domain DNA motif is generally believed to span 6-8 bases. However, alignment...

  19. Predicting co-complexed protein pairs using genomic and proteomic data integration

    Directory of Open Access Journals (Sweden)

    King Oliver D

    2004-04-01

    Full Text Available Abstract Background Identifying all protein-protein interactions in an organism is a major objective of proteomics. A related goal is to know which protein pairs are present in the same protein complex. High-throughput methods such as yeast two-hybrid (Y2H and affinity purification coupled with mass spectrometry (APMS have been used to detect interacting proteins on a genomic scale. However, both Y2H and APMS methods have substantial false-positive rates. Aside from high-throughput interaction screens, other gene- or protein-pair characteristics may also be informative of physical interaction. Therefore it is desirable to integrate multiple datasets and utilize their different predictive value for more accurate prediction of co-complexed relationship. Results Using a supervised machine learning approach – probabilistic decision tree, we integrated high-throughput protein interaction datasets and other gene- and protein-pair characteristics to predict co-complexed pairs (CCP of proteins. Our predictions proved more sensitive and specific than predictions based on Y2H or APMS methods alone or in combination. Among the top predictions not annotated as CCPs in our reference set (obtained from the MIPS complex catalogue, a significant fraction was found to physically interact according to a separate database (YPD, Yeast Proteome Database, and the remaining predictions may potentially represent unknown CCPs. Conclusions We demonstrated that the probabilistic decision tree approach can be successfully used to predict co-complexed protein (CCP pairs from other characteristics. Our top-scoring CCP predictions provide testable hypotheses for experimental validation.

  20. PairWise Neighbours database: overlaps and spacers among prokaryote genomes

    Directory of Open Access Journals (Sweden)

    Garcia-Vallvé Santiago

    2009-06-01

    Full Text Available Abstract Background Although prokaryotes live in a variety of habitats and possess different metabolic and genomic complexity, they have several genomic architectural features in common. The overlapping genes are a common feature of the prokaryote genomes. The overlapping lengths tend to be short because as the overlaps become longer they have more risk of deleterious mutations. The spacers between genes tend to be short too because of the tendency to reduce the non coding DNA among prokaryotes. However they must be long enough to maintain essential regulatory signals such as the Shine-Dalgarno (SD sequence, which is responsible of an efficient translation. Description PairWise Neighbours is an interactive and intuitive database used for retrieving information about the spacers and overlapping genes among bacterial and archaeal genomes. It contains 1,956,294 gene pairs from 678 fully sequenced prokaryote genomes and is freely available at the URL http://genomes.urv.cat/pwneigh. This database provides information about the overlaps and their conservation across species. Furthermore, it allows the wide analysis of the intergenic regions providing useful information such as the location and strength of the SD sequence. Conclusion There are experiments and bioinformatic analysis that rely on correct annotations of the initiation site. Therefore, a database that studies the overlaps and spacers among prokaryotes appears to be desirable. PairWise Neighbours database permits the reliability analysis of the overlapping structures and the study of the SD presence and location among the adjacent genes, which may help to check the annotation of the initiation sites.

  1. Les livres pairs d’Alfred Jarry

    Directory of Open Access Journals (Sweden)

    Julien Schuh

    2008-10-01

    Full Text Available Dans les Gestes et opinions du Dr Faustroll, pataphysicien, Alfred Jarry décrit une bibliothèque idéale, composée de 27 ouvrages qu’il nomme mystérieusement des « livres pairs ». Dans cette liste, on trouve aussi bien des œuvres canoniques du symbolisme (Mallarmé, Verlaine, Poe traduit par Baudelaire, des titres des amis de Jarry et des piliers des revues de l’époque (Rachilde, Gustave Kahn, Léon Bloy, que des ouvrages que l’on assimile davantage aux lectures enfantines (un conte de Marceline Desbordes-Valmore, les Mille et une Nuits, le théâtre de Florian ou des textes hors-catégorie (l’œuvre de Rabelais, l’évangile de Luc, les Chants de Maldoror. Beaucoup de critiques se sont interrogés sur la notion de « parité », sur l’égalité supposée entre ces ouvrages n’appartenant pas aux mêmes catégories littéraires. Mais l’intérêt de cette liste n’est pas de fournir un classement, ou d’affirmer l’équivalence de toutes les formes textuelles, comme on l’analyse souvent, en faisant de Jarry un chantre du nihilisme qui chercherait à pervertir les hiérarchies littéraires pour montrer la vacuité du sens. Au contraire, en faisant débuter le Faustroll par une liste d’ouvrages, Jarry met en place les conditions de réception de son texte, dans une posture très littéraire. L’espace délimité par la liste des auteurs pairs fonctionne comme un portrait spirituel de Jarry-littérateur, et livre le contexte selon lequel son discours doit être reçu. La bibliothèque du Dr Faustroll fixe les références que le lecteur pourra voir convoquer dans le texte, et circonscrit l’espace littéraire dans lequel peut fonctionner cet ouvrage.

  2. Frustrated Lewis Pair Behavior of Intermolecular Annine/B(C6F5)(3) Pairs

    NARCIS (Netherlands)

    Voss, Tanja; Mahdi, Tayseer; Otten, Edwin; Froehlich, Roland; Kehr, Gerald; Stephan, Douglas W.; Erker, Gerhard

    2012-01-01

    Reactions of N,N-dimethylaniline, N-isopropyl-aniline, 1,4-C6H4(CH(2)NHtBu)(2), and benzyldimethylamine with the Lewis acid B(C6F5)(3) have been studied. In the case of N,N-dirnethylaniline the combination of the Lewis acid and base forms an almost completely noninteracting frustrated Lewis pair, wh

  3. Observing Pair-Work Task in an English Speaking Class

    Directory of Open Access Journals (Sweden)

    Diana Achmad

    2014-01-01

    Full Text Available This paper reports on students’ pair-work interactions to develop their speaking skills in an ELT classroom which consisted of international learners. A number of 16 learners of intermediate proficiency with IELTS score band 5.5 were observed. The teacher had paired those he considered among them to be the more competent ones (hereafter, stronger with the less competent ones (hereafter, weaker; therefore, eight pairs were observed during the lesson. The task given to the students was to express ‘Agree and Disagree’ in the context of giving opinions related to social life. Based on the observations, the task was successfully implemented by six pairs; thus, the two others faced some problems. From the first pair, it was seen that the stronger student had intimated the weaker one into speaking during the task. The other pair, who was both of the same native, did not converse in English as expected and mostly used their native language to speak with one another presumably due to respect from the stronger student towards the weaker one. In situations like this, when pair-work becomes unproductive, rotating pairs is recommended to strengthen information sharing and assigning roles to avoid a student from taking over the activity from his or her pair. In conclusion, pairing international learners with mixed speaking proficiency by teachers must be conducted as effectively as possible by initially identifying their ability and learning culture to profoundly expand the students’ language resources.

  4. Efficient Implementation of the Pairing on Mobilephones Using BREW

    Science.gov (United States)

    Yoshitomi, Motoi; Takagi, Tsuyoshi; Kiyomoto, Shinsaku; Tanaka, Toshiaki

    Pairing based cryptosystems can accomplish novel security applications such as ID-based cryptosystems, which have not been constructed efficiently without the pairing. The processing speed of the pairing based cryptosystems is relatively slow compared with the other conventional public key cryptosystems. However, several efficient algorithms for computing the pairing have been proposed, namely Duursma-Lee algorithm and its variant ηT pairing. In this paper, we present an efficient implementation of the pairing over some mobilephones. Moreover, we compare the processing speed of the pairing with that of the other standard public key cryptosystems, i. e. RSA cryptosystem and elliptic curve cryptosystem. Indeed the processing speed of our implementation in ARM9 processors on BREW achieves under 100 milliseconds using the supersingular curve over F397. In addition, the pairing is more efficient than the other public key cryptosystems, and the pairing can be achieved enough also on BREW mobilephones. It has become efficient enough to implement security applications, such as short signature, ID-based cryptosystems or broadcast encryption, using the pairing on BREW mobilephones.

  5. Natural versus artificial creation of base pairs in DNA: origin of nucleobases from the perspectives of unnatural base pair studies.

    Science.gov (United States)

    Hirao, Ichiro; Kimoto, Michiko; Yamashige, Rie

    2012-12-18

    Since life began on Earth, the four types of bases (A, G, C, and T(U)) that form two sets of base pairs have remained unchanged as the components of nucleic acids that replicate and transfer genetic information. Throughout evolution, except for the U to T modification, the four base structures have not changed. This constancy within the genetic code raises the question of how these complicated nucleotides were generated from the molecules in a primordial soup on the early Earth. At some prebiotic stage, the complementarity of base pairs might have accelerated the generation and accumulation of nucleotides or oligonucleotides. We have no clues whether one pair of nucleobases initially appeared on the early Earth during this process or a set of two base pairs appeared simultaneously. Recently, researchers have developed new artificial pairs of nucleobases (unnatural base pairs) that function alongside the natural base pairs. Some unnatural base pairs in duplex DNA can be efficiently and faithfully amplified in a polymerase chain reaction (PCR) using thermostable DNA polymerases. The addition of unnatural base pair systems could expand the genetic alphabet of DNA, thus providing a new mechanism for the generation novel biopolymers by the site-specific incorporation of functional components into nucleic acids and proteins. Furthermore, the process of unnatural base pair development might provide clues to the origin of the natural base pairs in a primordial soup on the early Earth. In this Account, we describe the development of three representative types of unnatural base pairs that function as a third pair of nucleobases in PCR and reconsider the origin of the natural nucleic acids. As researchers developing unnatural base pairs, they use repeated "proof of concept" experiments. As researchers design new base pairs, they improve the structures that function in PCR and eliminate those that do not. We expect that this process is similar to the one functioning in the

  6. Pulsar Pair Cascades in Magnetic Fields with Offset Polar Caps

    Science.gov (United States)

    Harding, Alice K.; Muslimov, Alex G.

    2012-01-01

    Neutron star magnetic fields may have polar caps (PC) that are offset from the dipole axis, through field-line sweepback near the light cylinder or non-symmetric currents within the star. The effects of such offsets on electron-positron pair cascades are investigated, using simple models of dipole magnetic fields with small distortions that shift the PCs by different amounts or directions. Using a Monte Carlo pair cascade simulation, we explore the changes in the pair spectrum, multiplicity and energy flux across the PC, as well as the trends in pair flux and pair energy flux with spin-down luminosity, L(sub sd). We also give an estimate of the distribution of heating flux from returning positrons on the PC for different offsets. We find that even modest offsets can produce significant increases in pair multiplicity, especially for pulsars that are near or beyond the pair death lines for centered PCs, primarily because of higher accelerating fields. Pair spectra cover several decades in energy, with the spectral range of millisecond pulsars (MSPs) two orders of magnitude higher than for normal pulsars, and PC offsets allow significant extension of all spectra to lower pair energies. We find that the total PC pair luminosity L(sub pair) is proportional to L(sub sd), with L(sub pair) approximates 10(exp -3) L(sub sd) for normal pulsars and L(sub pair) approximates 10(exp -2) L(sub sd) for MSPs. Remarkably, the total PC heating luminosity for even large offsets increases by less than a factor of two, even though the PC area increases by much larger factors, because most of the heating occurs near the magnetic axis.

  7. Top Quark Pair Production in ATLAS

    CERN Document Server

    Gellerstedt, Karl

    2012-10-05

    The Large Hadron Collider (LHC) at the international particle physics laboratory CERN in Switzerland is currently the most powerful particle accelerator on earth. This thesis presents analyses of proton-proton collisions at the energy sqrt{s} = 7 TeV, recorded by ATLAS, one of the detectors at the LHC. The goal of the LHC and its detectors is to find new phenomena not described by the Standard Model (SM) of particle physics. The top quark is the heaviest known elementary particle and it is produced in very large numbers at the LHC. Measuring the production cross-section of top pairs (ttbar) is important for many reasons: for validating the strong production mechanism of the SM, for commissioning and calibration of the detector and analysis software and because several scenarios for physics beyond the SM predict changes to the ttbar production cross-section. Five different measurements of the ttbar cross-section will be presented in this thesis. The first three are measurements of the total cross-section, the ...

  8. Arbitrated Quantum Signature protocol using EPR pairs

    Directory of Open Access Journals (Sweden)

    Jun Zhang

    2012-11-01

    Full Text Available Arbitrated signature provides that the signatory signs a message with his private key by quantum cryptography, while the signature receiver verifies the signature with the arbitrator’s assistance. In this work, security analysis was given to the arbitrated quantum signature (AQS and results showed that the receiver Bob and the attacker can forge the signature. Then this paper gives a new quantum one-time pads encryption method, which is suit for the quantum signature. At last, a new AQS protocol using Einstein-Podoisky-Rosen (EPR pairs is proposed. By using of  quantum key distribution (QKD and new quantum one-time pads, the new scheme can resist Shor’s attack. The new scheme has following advantages: (1 The scheme reduces the complexity of implementation and provides a higher efficiency in transmission; (2 Compares with some AQS schemes, the scheme can avoid being disavowed by the receiver; (3 Compares with other AQS schemes, the scheme also guarantees the arbitrator cannot forge the signature and it also ensure the receiver and other attacker cannot forge the signature.

  9. Pair Triplet Association Rule Generation in Streams

    Directory of Open Access Journals (Sweden)

    Manisha Thool

    2013-08-01

    Full Text Available Many applications involve the generation and analysis of a new kind of data, called stream data, where data flows in and out of an observation platform or window dynamically. Such data streams have the unique features such as huge or possibly infinite volume, dynamically changing, flowing in or out in a fixed order, allowing only one or a small number of scans. An important problem in data stream mining is that of finding frequent items in the stream. This problem finds application across several domains such as financial systems, web traffic monitoring, internet advertising, retail and e-business. This raises new issues that need to be considered when developing association rule mining technique for stream data. The Space-Saving algorithm reports both frequent and top-k elements with tight guarantees on errors. We also develop the notion of association rules in streams of elements. The Streaming-Rules algorithm is integrated with Space-Saving algorithm to report 1-1 association rules with tight guarantees on errors, using minimal space, and limited processing per element and we are using Apriori algorithm for static datasets and generation of association rules and implement Streaming-Rules algorithm for pair, triplet association rules. We compare the top- rules of static datasets with output of stream datasets and find percentage of error.

  10. AGT, Burge pairs and minimal models

    CERN Document Server

    Bershtein, M

    2014-01-01

    We consider the AGT correspondence in the context of the conformal field theory M^{p, p'} x M^H, where M^{p, p'} is the minimal model based on the Virasoro algebra V^{p, p'} labeled by two co-prime integers {p, p'}, 1 < p < p', and M^H is the free boson theory based on the Heisenberg algebra H. Using Nekrasov's instanton partition functions without modification to compute conformal blocks in M^{p, p'} x M^H leads to ill-defined or incorrect expressions. Let B^{p, p', H}_n be a conformal block in M^{p, p'} x M^H, with n consecutive channels \\chi_{\\i}, \\i = 1, ..., n, and let \\chi_{\\i} carry states from H^{p, p'}_{r_{\\i}, s_{\\i}} x F, where H^{p, p'}_{r_{\\i}, s_{\\i}} is an irreducible highest-weight V^{p, p'}-representation, labeled by two integers {r_{\\i}, s_{\\i}}, 0 < r_{\\i} < p, 0 < s_{\\i} < p', and F is the Fock space of H. We show that restricting the states that flow in \\chi_{\\i}, \\i = 1, ..., n, to states labeled by partition pairs {Y_1^{\\i}, Y_2^{\\i}} that satisfy Y^{\\i, T}_{2, \\sigma}...

  11. Multidimensional Simulations of Rotating Pair Instability Supernovae

    CERN Document Server

    Chatzopoulos, E; Couch, S M

    2013-01-01

    We study the effects of rotation on the dynamics, energetics and Ni-56 production of Pair Instability Supernova explosions by performing rotating two-dimensional ("2.5-D") hydrodynamics simulations. We calculate the evolution of eight low metallicity (Z = 10^-3, 10^-4 Zsun) massive (135-245 Msun) PISN progenitors with initial surface rotational velocities 50% that of the critical Keplerian value using the stellar evolution code MESA. We allow for both the inclusion and the omission of the effects of magnetic fields in the angular momentum transport and in chemical mixing, resulting in slowly-rotating and rapidly-rotating final carbon-oxygen cores, respectively. Increased rotation for carbon-oxygen cores of the same mass and chemical stratification leads to less energetic PISN explosions that produce smaller amounts of Ni-56 due to the effect of the angular momentum barrier that develops and slows the dynamical collapse. We find a non-monotonic dependence of Ni-56 production on rotational velocity in situation...

  12. Invisible decays in Higgs boson pair production

    Science.gov (United States)

    Banerjee, Shankha; Batell, Brian; Spannowsky, Michael

    2017-02-01

    Observation of Higgs pair production is an important long term objective of the LHC physics program as it will shed light on the scalar potential of the Higgs field and the nature of electroweak symmetry breaking. While numerous studies have examined the impact of new physics on di-Higgs production, little attention has been given to the well-motivated possibility of exotic Higgs decays in this channel. Here we investigate the consequences of exotic invisible Higgs decays in di-Higgs production. We outline a search sensitive to such invisible decays in the b b ¯+ ET channel. We demonstrate that probing invisible branching ratios of order 10% during the LHC's high-luminosity run will be challenging, but in resonance enhanced di-Higgs production, this final state can become crucial to establish the existence of physics beyond the Standard Model at collider energies. We also briefly discuss the outlook for other exotic Higgs decay modes and the potential to observe such exotic decays in the di-Higgs channel.

  13. An Identity Based Aggregate Signature from Pairings

    Directory of Open Access Journals (Sweden)

    Yike Yu

    2011-04-01

    Full Text Available An aggregate signature is a useful digital signature that supports aggregation: Given n signatures on n distinct messages from n distinct users, aggregate signature scheme is possible to aggregate all these signature into a single short signature. This single signature, along with the n original messages will convince any verifier that the n users did indeed sign the n original messages respectively (i.e., for i=1,...,n user i signed message  mi. In this paper, we propose an identity based aggregate signature scheme which requires constant pairing operations in the verification and the size of aggregate signature is independent of the number of signers. We prove that the proposed signature scheme is secure against existential forgery under adaptively chosen message and identity attack in the random oracle model assuming the intractability of the computational Diffie-Hellman problem.

  14. Four pairs of gene–gene interactions associated with increased risk for type 2 diabetes (CDKN2BAS–KCNJ11, obesity (SLC2A9–IGF2BP2, FTO–APOA5, and hypertension (MC4R–IGF2BP2 in Chinese women

    Directory of Open Access Journals (Sweden)

    M.H. Wang

    2014-12-01

    Full Text Available Metabolic disorders including type 2 diabetes, obesity and hypertension have growing prevalence globally every year. Genome-wide association studies have successfully identified many genetic markers associated to these diseases, but few studied their interaction effects. In this study, twenty candidate SNPs from sixteen genes are selected, and a lasso-multiple regression approach is implemented to consider the SNP–SNP interactions among them in an Asian population. It is found out that the main effects of the markers are weak but the interactions among the candidates showed a significant association to diseases. SNPs from genes CDKN2BAS and KCNJ11 are significantly associated to risk for developing diabetes, and SNPs from FTO and APOA5 might interact to play an important role for the onset of hypertension.

  15. Gene-gene interaction between tuberculosis candidate genes in a South African population.

    Science.gov (United States)

    de Wit, Erika; van der Merwe, Lize; van Helden, Paul D; Hoal, Eileen G

    2011-02-01

    In a complex disease such as tuberculosis (TB) it is increasingly evident that gene-gene interactions play a far more important role in an individual's susceptibility to develop the disease than single polymorphisms on their own, as one gene can enhance or hinder the expression of another gene. Gene-gene interaction analysis is a new approach to elucidate susceptibility to TB. The possibility of gene-gene interactions was assessed, focusing on 11 polymorphisms in nine genes (DC-SIGN, IFN-γ, IFNGR1, IL-8, IL-1Ra, MBL, NRAMP1, RANTES, and SP-D) that have been associated with TB, some repeatedly. An optimal model, which best describes and predicts TB case-control status, was constructed. Significant interactions were detected between eight pairs of variants. The models fitted the observed data extremely well, with p activation is greatly enhanced by IFN-γ and IFN-γ response elements that are present in the human NRAMP1 promoter region, providing further evidence for their interaction. This study enabled us to test the theory that disease outcome may be due to interaction of several gene effects. With eight instances of statistically significant gene-gene interactions, the importance of epistasis is clearly identifiable in this study. Methods for studying gene-gene interactions are based on a multilocus and multigene approach, consistent with the nature of complex-trait diseases, and may provide the paradigm for future genetic studies of TB.

  16. Pair distribution functions of silicon/silicon nitride interfaces

    Science.gov (United States)

    Cao, Deng; Bachlechner, Martina E.

    2006-03-01

    Using molecular dynamics simulations, we investigate different mechanical and structural properties of the silicon/silicon nitride interface. One way to characterize the structure as tensile strain is applied parallel to the interface is to calculate pair distribution functions for specific atom types. The pair distribution function gives the probability of finding a pair of atoms a distance r apart, relative to the probability expected for a completely random distribution at the same density. The pair distribution functions for bulk silicon nitride reflect the fracture of the silicon nitride film at about 8 % and the fact that the centerpiece of the silicon nitride film returns to its original structure after fracture. The pair distribution functions for interface silicon atoms reveal the formation of bonds for originally unbound atom pairs, which is indicative of the interstitial-vacancy defect that causes failure in silicon.

  17. Analysis of food pairing in regional cuisines of India

    CERN Document Server

    Jain, Anupam; Bagler, Ganesh

    2015-01-01

    Any national cuisine is a sum total of its variety of regional cuisines, which are the cultural and historical identifiers of their respective regions. India is home to a number of regional cuisines that showcase its culinary diversity. Here, we study recipes from eight different regional cuisines of India spanning various geographies and climates. We investigate the phenomenon of food pairing which examines compatibility of two ingredients in a recipe in terms of their shared flavor compounds. Food pairing was enumerated at the level of cuisine, recipes as well as ingredient pairs by quantifying flavor sharing between pairs of ingredients. Our results indicate that each regional cuisine follows negative food pairing pattern; more the extent of flavor sharing between two ingredients, lesser their co-occurrence in that cuisine. We find that frequency of ingredient usage is central in rendering the characteristic food pairing in each of these cuisines. Spice and dairy emerged as the most significant ingredient ...

  18. Spin polarization transfer by the radical pair mechanism

    Energy Technology Data Exchange (ETDEWEB)

    Zarea, Mehdi, E-mail: m-zarea@northwestern.edu; Ratner, Mark A.; Wasielewski, Michael R. [Department of Chemistry and Argonne-Northwestern Solar Energy Research (ANSER) Center, Northwestern University, Evanston, Illinois 60208-3113 (United States)

    2015-08-07

    In a three-site representation, we study a spin polarization transfer from radical pair spins to a nearby electron or nuclear spin. The quantum dynamics of the radical pair spins is governed by a constant exchange interaction between the radical pair spins which have different Zeeman frequencies. Radical pair spins can recombine to the singlet ground state or to lower energy triplet states. It is then shown that the coherent dynamics of the radical pair induces spin polarization on the nearby third spin in the presence of a magnetic field. The spin polarization transfer depends on the difference between Zeeman frequencies, the singlet and triplet recombination rates, and on the exchange and dipole-dipole interactions between the different spins. In particular, the sign of the polarization depends on the exchange coupling between radical pair spins and also on the difference between singlet and triplet recombination rate constants.

  19. Classes of source pairs in interference and diffraction

    CERN Document Server

    Castaneda, R

    2003-01-01

    A description of interference and diffraction based on the concept of class of source pairs is presented. It is the set of pairs of sources whose contributions to the interference or diffraction patterns exhibit the same phase difference. Each class of source pairs provides a specific cosine-like modulation on the intensity distribution of pattern, in such a way that the set provides an expansion of the intensity distribution of the pattern in an orthogonal basis. From this point of view, the classes of source pairs are the effective elementary sources for those intensity distributions. The characteristics of the classes of source pairs can be accurately determined by Fourier transforming the intensity distribution of the patterns. The central value of this Fourier spectrum is related to the number of individual sources. The remaining values will provide two crucial descriptors of the classes: their positions on the Fourier transform domain will be corresponding to the separation vector of the class of pairs ...

  20. Paired-permanent approach to valence bond theory

    Institute of Scientific and Technical Information of China (English)

    吴玮; 吴安安; 莫亦荣; 张乾二

    1996-01-01

    A new function called paired-permanent is defined and widely discussed, and a practicable procedure for evaluations of paired-permanents is proposed, which is similar to the Laplace method for determinants. Using the concept of paired-permanents, an efficient algorithm is presented for evaluating the Hamiltonian and overlap matrix elements in the spin-free form of valence bond (VB) theory. With the new algorithm, a spin-free wavefunction is simply written as a paired-permanent, and an overlap matrix element may be obtained by evaluating a corresponding paired-permanent. Meanwhile, the Hamiltonian matrix element is expressed in terms of the summation of the products of electronic integrals and the corresponding sub-paired-permanents

  1. Paired teaching for faculty professional development in teaching

    CERN Document Server

    Stang, Jared B

    2015-01-01

    Paired (or co-)teaching is an arrangement in which two faculty are collaboratively responsible for all aspects of teaching a course. By pairing an instructor experienced in research-based instructional strategies (RBIS) with an instructor with little or no experience in RBIS, paired teaching can be used to promote the adoption of RBIS. Using data from post-course interviews with the novice instructors of four such arrangements, we seek to understand the factors that make for effective professional development in teaching via paired teaching. Learning about teaching for the novice instructors was found to be mediated both by the approach of the novice instructor to the paired teaching and the previous teaching experience of the novice instructor. Additionally, the structure of the pair-taught course and the sequence of teaching assignments for the novice instructor both play roles in lowering the barrier to novice instructors adopting RBIS.

  2. Diffraction of collinear correlated photon pairs by an ultrasonic wave

    CERN Document Server

    Kwiek, Piotr

    2013-01-01

    The phenomenon of collinear photon pairs diffraction by an ultrasonic wave is investigated for Bragg incidence. A BBO crystal was used for producing collinear correlated photon pairs via type-I spontaneous parametric down-conversion. The experimental setup for diffraction of collinear correlated photon pairs was tested based on Malus' law for pairs of photons. The obtained results do not support the L. B. Deng's theory of 2012, presented in his work entitled "Diffraction of entangled photon pairs by ultrasonic waves" [Front. Phys. 7, 239 (2012)] . An alternative simple theoretical description of interaction of collinear photon pairs with ultrasonic waves is shown in the present paper which reveals very good agreement with corresponding experimental data.

  3. Pairing Nambu-Goldstone modes within nuclear density functional theory

    CERN Document Server

    Hinohara, Nobuo

    2016-01-01

    We show that the Nambu-Goldstone formalism of the broken gauge symmetry in the presence of the $T=1$ pairing condensate offers a quantitative description of the binding energy differences of open-shell superfluid nuclei. We conclude that the pairing rotational moments of inertia are excellent pairing indicators, which are free from ambiguities attributed to odd-mass systems. We offer a new, unified interpretation of the binding-energy differences traditionally viewed in the shell model picture as signatures of the valence nucleon properties. We present the first systematic analysis of the off-diagonal pairing rotational moments of inertia, and demonstrate the mixing of the neutron and proton pairing rotational modes in the ground states of even-even nuclei. Finally, we discuss the importance of mass measurements of neutron-rich nuclei for constraining the pairing energy density functional.

  4. On the polar cap cascade pair multiplicity of young pulsars

    CERN Document Server

    Timokhin, A N

    2015-01-01

    We study the efficiency of pair production in polar caps of young pulsars under a variety of conditions to estimate the maximum possible multiplicity of pair plasma in pulsar magnetospheres. We develop a semi-analytic model for calculation of cascade multiplicity which allows efficient exploration of the parameter space and corroborate it with direct numerical simulations. Pair creation processes are considered separately from particle acceleration in order to assess different factors affecting cascade efficiency, with acceleration of primary particles described by recent self-consistent non-stationary model of pair cascades. We argue that the most efficient cascades operate in the curvature radiation/synchrotron regime, the maximum multiplicity of pair plasma in pulsar magnetospheres is ~few x 10^5. The multiplicity of pair plasma in magnetospheres of young energetic pulsars weakly depends on the strength of the magnetic field and the radius of curvature of magnetic field lines and has a stronger dependence ...

  5. Theory of phase segregation in DNA assemblies containing two different base-pair sequence types

    Science.gov (United States)

    (O’ Lee, Dominic J.; Wynveen, Aaron; Kornyshev, Alexei A.

    2017-01-01

    Spontaneous pairing of homologous DNA sequences—a challenging subject in molecular biophysics, often referred to as ‘homology recognition’—has been observed in vitro for several DNA systems. One of these experiments involved liquid crystalline quasi-columnar phases formed by a mixture of two kinds of double stranded DNA oligomer. Both oligomer types were of the same length and identical stoichiometric base-pair composition, but the base-pairs followed a different order. Phase segregation of the two DNA types was observed in the experiments, with the formation of boundaries between domains rich in molecules of one type (order) of base pair sequence. We formulate here a modified ‘X–Y model’ for phase segregation in such assemblies, obtain approximate solutions of the model, compare analytical results to Monte Carlo simulations, and rationalise past experimental observations. This study, furthermore, reveals the factors that affect the degree of segregation. Such information could be used in planning new versions of similar segregation experiments, needed for deepening our understanding of forces that might be involved, e.g., in gene–gene recognition.

  6. ssDNA Pairing Accuracy Increases When Abasic Sites Divide Nucleotides into Small Groups.

    Directory of Open Access Journals (Sweden)

    Alexandra Peacock-Villada

    Full Text Available Accurate sequence dependent pairing of single-stranded DNA (ssDNA molecules plays an important role in gene chips, DNA origami, and polymerase chain reactions. In many assays accurate pairing depends on mismatched sequences melting at lower temperatures than matched sequences; however, for sequences longer than ~10 nucleotides, single mismatches and correct matches have melting temperature differences of less than 3°C. We demonstrate that appropriately grouping of 35 bases in ssDNA using abasic sites increases the difference between the melting temperature of correct bases and the melting temperature of mismatched base pairings. Importantly, in the presence of appropriately spaced abasic sites mismatches near one end of a long dsDNA destabilize the annealing at the other end much more effectively than in systems without the abasic sites, suggesting that the dsDNA melts more uniformly in the presence of appropriately spaced abasic sites. In sum, the presence of appropriately spaced abasic sites allows temperature to more accurately discriminate correct base pairings from incorrect ones.

  7. Paired structures and other opposite-based models

    DEFF Research Database (Denmark)

    Rodríguez, J. Tinguaro; Franco, Camilo; Gómez, Daniel;

    2015-01-01

    In this paper we present a new class of fuzzy sets, paired fuzzy sets, that tries to overcome any conflict between families of fuzzy sets that share a main characteristic: that they are generated from two basic opposite fuzzy sets. Hence, the first issue is to formalize the notion of opposition, ...... as a particular paired structure when the classical fuzzy negation is considered; on the other hand, the relationship of this model with bipolarity is reconsidered from our paired view....

  8. Can Cooper pairs in benzene lead to Efimov states?

    Science.gov (United States)

    Squire, R. H.; March, N. H.; Rubio, A.

    2015-02-01

    Cooper pairs have been experimentally verified in benzene at 38.3 eV. We have proposed previously that the six most loosely bound electrons in benzene form three equivalent Cooper pairs. We further propose in this manuscript that these three weakly interacting bosons (Cooper pairs) should form an infinite number of Efimov states (possibly Booromean rings) which is what a photon of high energy will then encounter.

  9. Marker-based filtering of bilingual phrase pairs for SMT

    OpenAIRE

    Sánchez-Martínez, Felipe; Way, Andy

    2009-01-01

    State-of-the-art statistical machine translation systems make use of a large translation table obtained after scoring a set of bilingual phrase pairs automatically extracted from a parallel corpus. The number of bilingual phrase pairs extracted from a pair of aligned sentences grows exponentially as the length of the sentences increases; therefore, the number of entries in the phrase table used to carry out the translation may become unmanageable, especially when online, ‘on demand’ translati...

  10. ROTATION CURVES IN (E+S ISOLATED GALAXY PAIRS

    Directory of Open Access Journals (Sweden)

    E. M. Huerta

    2009-01-01

    Full Text Available As part of a broad investigation to quantify the effects of interaction in the evolution of disk galaxies, we measured rotation curves of 102 spirals in mixed morphology pairs (E+S, drawn from the Karachantsev catalogue of isolated pairs of galaxies. In this summary we simply present characteristic rotation curves of spirals in isolated (E+S pairs, in preparation for a future comparison with isolated spirals in a Tully-Fisher diagram.

  11. Paired structures and other opposite-based models

    DEFF Research Database (Denmark)

    Rodríguez, J. Tinguaro; Franco, Camilo; Gómez, Daniel

    2015-01-01

    to a more complex valuation structure that still keeps the essence of being paired. In this way several neutral fuzzy sets can appear, in particular indeterminacy, ambivalence and conflict. Two consequences are then presented: on one hand, we will show how Atanassov´s Intuitionistic Fuzzy Sets can be viewed...... as a particular paired structure when the classical fuzzy negation is considered; on the other hand, the relationship of this model with bipolarity is reconsidered from our paired view....

  12. Genome divergence during evolutionary diversification as revealed in replicate lake-stream stickleback population pairs.

    Science.gov (United States)

    Roesti, Marius; Hendry, Andrew P; Salzburger, Walter; Berner, Daniel

    2012-06-01

    Evolutionary diversification is often initiated by adaptive divergence between populations occupying ecologically distinct environments while still exchanging genes. The genetic foundations of this divergence process are largely unknown and are here explored through genome scans in multiple independent lake-stream population pairs of threespine stickleback. We find that across the pairs, overall genomic divergence is associated with the magnitude of divergence in phenotypes known to be under divergent selection. Along this same axis of increasing diversification, genomic divergence becomes increasingly biased towards the centre of chromosomes as opposed to the peripheries. We explain this pattern by within-chromosome variation in the physical extent of hitchhiking, as recombination is greatly reduced in chromosome centres. Correcting for this effect suggests that a great number of genes distributed widely across the genome are involved in the divergence into lake vs. stream habitats. Analyzing additional allopatric population pairs, however, reveals that strong divergence in some genomic regions has been driven by selection unrelated to lake-stream ecology. Our study highlights a major contribution of large-scale variation in recombination rate to generating heterogeneous genomic divergence and indicates that elucidating the genetic basis of adaptive divergence might be more challenging than currently recognized.

  13. Conditional targeting of Ispd using paired Cas9 nickase and a single DNA template in mice

    Directory of Open Access Journals (Sweden)

    Angus Yiu-fai Lee

    2014-01-01

    Full Text Available CRISPR/Cas9 technology is a highly promising genome editing tool in the mouse, potentially overcoming the costs and time required for more traditional gene targeting methods in embryonic stem (ES cells. Recently, compared to the wildtype nuclease, paired Cas9 nickase (Cas9n combined with single guide RNA (sgRNA molecules has been found to enhance the specificity of genome editing while reducing off-target effects. Paired Cas9n has been shown to be as efficient as Cas9 for generating insertion and deletion (indel mutations by non-homologous end joining and targeted deletion in the genome. However, an efficient and reliable approach to the insertion of loxP sites flanking critical exon(s to create a conditional allele of a target gene remains an elusive goal. In this study, we microinjected Cas9n RNA with sgRNAs together with a single DNA template encoding two loxP sites flanking (floxing exon 2 of the isoprenoid synthase containing domain (Ispd into the pronucleus and cytoplasm of C57BL/6NCr one-cell stage zygotes. After surgical transfer, one F0 mouse expressing a conditional allele was produced (at a frequency of ∼8% of live pups born. The floxed allele was transmitted through the germline to F1 progeny, and could be successfully recombined using Cre recombinase. This study indicates that conditional targeting can be accomplished effectively using paired Cas9n and a single DNA template.

  14. Paired Straight Hearth Furnace - Transformational Ironmaking Process

    Energy Technology Data Exchange (ETDEWEB)

    Lu, Wei-Kao [McMaster Univ., Hamilton, ON (Canada); Debski, Paul [Andritz Metals Inc.,Canonsburg, PA (United States)

    2014-11-19

    The U. S. steel industry has reduced its energy intensity per ton of steel shipped by 33% since 1990. However, further significant gains in energy efficiency will require the development of new, transformational iron and steelmaking processes. The Paired Straight Hearth Furnace (PSH) process is an emerging alternative high productivity, direct reduced iron (DRI) technology that may achieve very low fuel rates and has the potential to replace blast furnace ironmaking. The PSH furnace can operate independently or may be coupled with other melting technologies to produce liquid hot metal that is both similar to blast furnace iron and suitable as a feedstock for basic oxygen steelmaking furnaces. The PSH process uses non-metallurgical coal as a reductant to convert iron oxides such as iron ore and steelmaking by-product oxides to DRI pellets. In this process, a multi-layer, nominally 120mm tall bed of composite “green balls” made from oxide, coal and binder is built up and contained within a moving refractory hearth. The pellet bed absorbs radiant heat energy during exposure to the high temperature interior refractory surfaces of the PSH while generating a strongly reducing gas atmosphere in the bed that yields a highly metalized DRI product. The PSH concept has been well tested in static hearth experiments. A moving bed design is being developed. The process developers believe that if successful, the PSH process has the potential to replace blast furnaces and coke ovens at a fraction of the operating and capital cost while using about 30% less energy relative to current blast furnace technology. DRI output could also feed electric arc furnaces (EAFs) by displacing a portion of the scrap charge.

  15. The interacting pair MKN 305/306

    Science.gov (United States)

    Dietrich, Matthias

    1990-11-01

    Direct images and spectra at different slit positions of the interacting system Mkn 305/306 are discussed. Both galaxies show starburst properties due to tidal interaction. The morphology and velocity structure of Mkn 306 reveals the strongest warp of a stellar disk so far known. The galaxies Mkn 305 and Mkn 306 form a double system with 30 arcsec separation and having a common envelope at mB greater than or equal to 24.5. Furthermore a small tidal tail west of Mkn 305A, an isophote twist of Mkn 305 and the near identical redshifts of the two galaxies prove that this is a physical pair. Mkn 306 itself was classified as a double nucleus galaxy (Petrosyan et al., 1978). The optical morphology of Mkn 306 has the form of an integral sign which is similar to the radio morphology of strongly warped galaxies (Bottema et al., 1987). But in the optical the warp of the stellar component is normally far weaker than in the radio for the HI-gas. Therefore the authors investigate whether the double nucleus structure of Mkn 306 is real or an artifact due to an extreme warp in the optical. The origin for the warp phenomenon is not clear yet. Direct images of the galaxy system were taken with the Calar Alto 2.2m telescope in the B-band and at La Silla in the r-band using the 2.2m telescope; low dispersion spectra (240 A/mm) as well as high dispersion spectra (56 A/mm) for studying the velocity field were taken with the Calar Alto 3.5m telescope at different position angles. Also a spectrum of Mkn 305 was taken at Calar Alto with the 3.5m telescope covering the whole spectral range (240 A/mm).

  16. Mated Fingerprint Card Pairs (Volumes 1-5)

    Science.gov (United States)

    NIST Mated Fingerprint Card Pairs (Volumes 1-5) (PC database for purchase)   The NIST database of mated fingerprint card pairs (Special Database 9) consists of multiple volumes. Currently five volumes have been released. Each volume will be a 3-disk set with each CD-ROM containing 90 mated card pairs of segmented 8-bit gray scale fingerprint images (900 fingerprint image pairs per CD-ROM). A newer version of the compression/decompression software on the CDROM can be found at the website http://www.nist.gov/itl/iad/ig/nigos.cfm as part of the NBIS package.

  17. Pairing theory of high Tc and low Tc superconductors

    Science.gov (United States)

    Sang, Boo Nam

    1994-09-01

    New solutions for Tc, the order parameter, and the density of states are obtained, based on the fact that pairs are formed within the pairing interaction range, TD (Debye), via the BCS pairing theory (not the BCS results). They are valiid for all ify = {T D}/{πT c}, and are applicable to low Tc (LTC) and high Tc (HTS) superconductors. The order parameter variation with y is shown to account for all features of HTS. A new density of states via the zero order parameter outside the pairing interaction range is found to account for low energy states observed in HTS. For large y (LTS), the BCS results are reproduced.

  18. Winter pairs of ruddy shelducks at Lashihai Lake, southwest China.

    Science.gov (United States)

    Quan, Ruichang; Cui, Liangwei

    2013-04-01

    It has been suggested that pairing behavior during winter in migratory ducks represents a trade-off between costs (defense of the female) and benefits (early access to females). To investigate the benefits and costs for both sexes in wintering pairs of ruddy shelducks (Tadorna ferruginea), we compared time budgets for paired males and females, and surveyed the sex ratio of the birds wintering at Lashihai Lake, southwest China. The behavior of the paired ruddy shelducks was monitored for 5 activity types: feeding, resting (including sleeping), preening, drinking and warning. Feeding was the most dominant activity. The feeding time of both sexes increased as the winter season progressed. However, the paired females always spent significantly more time feeding and less time warning than the paired males. Paired ruddy shelducks had access to better feeding grounds than unpaired individuals, resulting in a food benefit for paired individuals over single individuals. Because the sex ratio of the wintering population was strongly male biased (M:F = 1.44:1.00), the paired male also gained the benefit of accessing a female in advance of the breeding season.

  19. Excluded volume effect enhances the homology pairing of model chromosomes

    Science.gov (United States)

    Takamiya, Kazunori; Yamamoto, Keisuke; Isami, Shuhei; Nishimori, Hiraku; Awazu, Akinori

    To investigate the structural dynamics of the homology pairing of polymers, we mod- eled the scenario of homologous chromosome pairings during meiosis in Schizosaccharomyces pombe, one of the simplest model organisms of eukaryotes. We consider a simple model consist- ing of pairs of homologous polymers with the same structures that are confined in a cylindrical container, which represents the local parts of chromosomes contained in an elongated nucleus of S. pombe. Brownian dynamics simulations of this model showed that the excluded volume effects among non-homological chromosomes and the transitional dynamics of nuclear shape serve to enhance the pairing of homologous chromosomes.

  20. Efficient Tate pairing computation using double-base chains

    Institute of Scientific and Technical Information of China (English)

    ZHAO ChangAn; ZHANG FangGuo; HUANG JiWu

    2008-01-01

    Pairing-based cryptosystems have developed very fast in the last few years. The effi-ciencies of these cryptosystems depend on the computation of the bilinear pairings. In this paper, a new efficient algorithm based on double-base chains for computing the Tate pairing is proposed for odd characteristic p > 3. The inherent sparseness of double-base number system reduces the computational cost for computing the Tate pairing evidently. The new algorithm is 9% faster than the previous fastest method for the embedding degree k = 6.

  1. Heterospecific pairing and hybridization between Nasutitermes corniger and N. ephratae

    Science.gov (United States)

    Hartke, Tamara R.; Rosengaus, Rebeca B.

    2011-09-01

    The sympatric neotropical termites Nasutitermes corniger and Nasutitermes ephratae are clearly distinguishable based on morphology, nest architecture, defensive secretion composition, and molecular markers. However, given the extensive ecological, geographical, and behavioral overlap of these closely related species, the potential for interbreeding may exist. To explore this possibility, heterospecific pairs were formed experimentally to examine courtship and colony-establishment behaviors, and reproductive potential. Courtship and nest construction behavior occurred in heterospecific pairs in a similar manner to that of conspecific pairs. Survival of pairs depended upon the species of the female partner. N. ephratae females paired with N. corniger males produced as many offspring as conspecific pairs. N. corniger females mated to N. ephratae males, however, produced significantly fewer offspring at 60 days post-establishment than the reciprocal cross or conspecific N. ephratae or N. corniger pairs. This was also the only pairing in which any aggression was observed. Heterospecific pairs and groups formed in mate choice mesocosms, suggesting that species recognition between these two termites is not an important aspect of mate choice. Overall, species mismatch tolerance and hybrid offspring viability are high. The present data, together with previous evidence from defensive secretions and isozyme analysis, suggest that hybridization may periodically occur in nature, and that reproductive barriers between these two species may be incomplete. Hybridization could provide a rare but important source of genetic diversity and may ensure mating opportunities for the more abundant sex of alates in each species.

  2. A Bell pair in a generic random matrix environment

    CERN Document Server

    Pineda, C; Pineda, Carlos; Seligman, Thomas H.

    2006-01-01

    Two non-interacting qubits are coupled to an environment. Both coupling and environment are represented by random matrix ensembles. The initial state of the pair is a Bell state, though we also consider arbitrary pure states. Decoherence of the pair is evaluated analytically in terms of purity; Monte Carlo calculations confirm these results and also yield the concurrence of the pair. Entanglement within the pair accelerates decoherence. Numerics display the relation between concurrence and purity known for Werner states, allowing us to give a formula for concurrence decay.

  3. Bell pair in a generic random matrix environment

    Science.gov (United States)

    Pineda, Carlos; Seligman, Thomas H.

    2007-01-01

    Two noninteracting qubits are coupled to an environment. Both coupling and environment are chosen as random matrices to obtain generic results. The initial state of the pair ranges from a Bell state to a product state. Decoherence of the pair is evaluated analytically in terms of purity; Monte Carlo calculations confirm these results and also yield concurrence of the pair. Entanglement within the pair accelerates decoherence. Numerics displays the relation between concurrence and purity known for Werner states. A closed albeit heuristic formula for concurrence decay ensues.

  4. Excluded volume effect enhances the homology pairing of model chromosomes

    CERN Document Server

    Takamiya, Kazunori; Isami, Shuhei; Nishimori, Hiraku; Awazu, Akinori

    2015-01-01

    To investigate the structural dynamics of the homology pairing of polymers, we mod- eled the scenario of homologous chromosome pairings during meiosis in Schizosaccharomyces pombe, one of the simplest model organisms of eukaryotes. We consider a simple model consist- ing of pairs of homologous polymers with the same structures that are confined in a cylindrical container, which represents the local parts of chromosomes contained in an elongated nucleus of S. pombe. Brownian dynamics simulations of this model showed that the excluded volume effects among non-homological chromosomes and the transitional dynamics of nuclear shape serve to enhance the pairing of homologous chromosomes.

  5. Effective t-J model of pairing: singlet versus triplet

    Directory of Open Access Journals (Sweden)

    J.Spałek

    2008-09-01

    Full Text Available The t-J model is regarded as a canonical model of spin-singlet pairing induced by the kinetic exchange interaction also responsible for an antiferromagnetic ordering in the strongly correlated narrow-band systems. In the orbitally degenerate systems both ferromagnetic and antiferromagnetic kinetic exchange interactions occur. I briefly review the analogy between the singlet and triplet types of pairing, as well as draw some general conclusions about the pairing induced by these exchange interactions. The general discussion is also illustrated with a concrete case of a two-dimensional lattice with the spin triplet pairing.

  6. Regulation of pairing between broken DNA-containing chromatin regions by Ku80, DNA-PKcs, ATM, and 53BP1

    Science.gov (United States)

    Yamauchi, Motohiro; Shibata, Atsushi; Suzuki, Keiji; Suzuki, Masatoshi; Niimi, Atsuko; Kondo, Hisayoshi; Miura, Miwa; Hirakawa, Miyako; Tsujita, Keiko; Yamashita, Shunichi; Matsuda, Naoki

    2017-01-01

    Chromosome rearrangement is clinically and physiologically important because it can produce oncogenic fusion genes. Chromosome rearrangement requires DNA double-strand breaks (DSBs) at two genomic locations and misrejoining between the DSBs. Before DSB misrejoining, two DSB-containing chromatin regions move and pair with each other; however, the molecular mechanism underlying this process is largely unknown. We performed a spatiotemporal analysis of ionizing radiation-induced foci of p53-binding protein 1 (53BP1), a marker for DSB-containing chromatin. We found that some 53BP1 foci were paired, indicating that the two damaged chromatin regions neighboured one another. We searched for factors regulating the foci pairing and found that the number of paired foci increased when Ku80, DNA-PKcs, or ATM was absent. In contrast, 53BP1 depletion reduced the number of paired foci and dicentric chromosomes—an interchromosomal rearrangement. Foci were paired more frequently in heterochromatin than in euchromatin in control cells. Additionally, the reduced foci pairing in 53BP1-depleted cells was rescued by concomitant depletion of a heterochromatin building factor such as Krüppel-associated box-associated protein 1 or chromodomain helicase DNA-binding protein 3. These findings indicate that pairing between DSB-containing chromatin regions was suppressed by Ku80, DNA-PKcs, and ATM, and this pairing was promoted by 53BP1 through chromatin relaxation. PMID:28155885

  7. HIM-8 binds to the X chromosome pairing center and mediateschromosome-specific meiotic synapsis

    Energy Technology Data Exchange (ETDEWEB)

    Phillips, Carolyn M.; Wong, Chihunt; Bhalla, Needhi; Carlton,Peter M.; Weiser, Pinky; Meneely, Philip M.; Dernburg, Abby F.

    2005-06-05

    The him-8 gene is essential for proper meiotic segregationof the X chromosomes in C. elegans. Herewe show that loss of him-8function causes profound X-chromosome-specific defects in homolog pairingand synapsis.him-8 encodes a C2H2 zinc finger protein that is expressedduring meiosis andconcentrates at a site on the X chromosome known as themeiotic Pairing Center (PC). A role for HIM-8 in PC function is supportedby genetic interactions between PC lesions and him-8 mutations.HIM-8-bound chromosome sites associate with the nuclear envelope (NE)throughout meiotic prophase. Surprisingly, a point mutation in him-8 thatretains both chromosome binding and NE localization fails to stabilizepairing or promote synapsis. These observations indicate thatstabilization of homolog pairing is an active process in which thetethering of chromosome sites to the NE may be necessary but is notsufficient.

  8. Higgs Pair Production in Models with Universal Extra Dimensions

    CERN Document Server

    de Sandes, Hiroshi

    2007-01-01

    In this letter we study the process of gluon fusion into a pair of Higgs bosons in a model with one universal extra dimension. We find that the contributions from the extra top quark Kaluza-Klein excitations lead to a Higgs pair production cross section that can be significantly altered compared to the Standard Model value for small values of the compactification scale.

  9. POSITRON ELECTRON PAIR SPECTROMETRY WITH SELECTIVE MINI-ORANGE DEVICES

    NARCIS (Netherlands)

    VANKLINKEN, J; BALANDA, A; HOOGDUIN, JM; KAPER, H; MEIRING, WJ; BOKEMEYER, H; DEBOER, FWN; KRAFT, D; STIEBING, KE

    1992-01-01

    Pair spectrometers have been developed with mini-orange filters and adapted Si(Li) detectors. They have been employed in searches for resonant Bhabha scattering and viable axions. They are of implicit value for studies of pair creation with the high resolution of solid state detectors, with the high

  10. Electron Spin Pairing in High-Tc Superconductors

    Institute of Scientific and Technical Information of China (English)

    郭卫; 韩汝珊

    2001-01-01

    An electron pairing theory based on effective electron spin coupling mediated by antiferromagnetically correlated local moments is presented to account for high-Tc phenomena. We show that Kondo scattering and the suppression of the antiferromagnetic superexchange between Cu2+ moments lead to local triplet pairing, the mechanism underlying high-Tc superconductivity.

  11. Validation of Geant4 Electron Pair Production by Photons

    CERN Document Server

    Begalli, Marcia; Pia, Maria Grazia; Saracco, Paolo G

    2013-01-01

    The first results of a project in progress for the validation of the simulation of electron-positron pair production are presented. They concern the pair production cross section in a low energy range close to the production threshold. The results hint to effects due to the granularity of tabulated cross sections.

  12. On e(+)e(-) pair production by colliding electromagnetic pulses

    NARCIS (Netherlands)

    Narozhny, NB; Bulanov, SS; Mur, VD; Popov, VS

    2004-01-01

    Electron-positron pair production from vacuum in an electromagnetic field created by two counterpropagating focused laser pulses interacting with each other is analyzed. The dependence of the number of produced pairs on the intensity of a laser pulse and the focusing parameter is studied with a real

  13. Solving the Airline Crew Pairing Problem using Subsequence Generation

    DEFF Research Database (Denmark)

    Rasmussen, Matias Sevel; Lusby, Richard Martin; Ryan, David M.;

    Good and fast solutions to the airline crew pairing problem are highly interesting for the airline industry, as crew costs are the biggest expenditure after fuel for an airline. The crew pairing problem is typically modelled as a set partitioning problem and solved by column generation. However...

  14. Solving the Airline Crew Pairing Problem using Subsequence Generation

    DEFF Research Database (Denmark)

    Rasmussen, Matias Sevel; Ryan, David M.; Lusby, Richard Martin;

    2010-01-01

    Good and fast solutions to the airline crew pairing problem are highly interesting for the airline industry, as crew costs are the biggest expenditure after fuel for an airline. The crew pairing problem is typically modelled as a set partitioning problem and solved by column generation. However...

  15. Subsequence Generation for the Airline Crew Pairing Problem

    DEFF Research Database (Denmark)

    Rasmussen, Matias Sevel; Lusby, Richard Martin; Ryan, David;

    Good and fast solutions to the airline crew pairing problem are highly interesting for the airline industry, as crew costs are the biggest expenditure after fuel for an airline. The crew pairing problem is typically modelled as a set partitioning problem and solved by column generation. However...

  16. A Macroscopic Analogue of the Nuclear Pairing Potential

    Science.gov (United States)

    Dunlap, Richard A.

    2013-01-01

    A macroscopic system involving permanent magnets is used as an analogue to nucleons in a nucleus to illustrate the significance of the pairing interaction. This illustrates that the view of the total nuclear energy based only on the nucleon occupancy of the energy levels can yield erroneous results and it is only when the pairing interaction is…

  17. Gender pairing and bargaining—Beware the same sex!

    NARCIS (Netherlands)

    M. Sutter; R. Bosman; M.G. Kocher; F. van Winden

    2009-01-01

    We study the influence of gender and gender pairing on economic decision making in an experimental two-person bargaining game where the other party’s gender is known to both actors. We find that (1) gender per se has no significant effect on behavior, whereas (2) gender pairing systematically affect

  18. Comparing Pair and Small Group Interactions on Oral Tasks

    Science.gov (United States)

    Lasito,; Storch, Neomy

    2013-01-01

    Although pair and small group activities are commonly used in second language (L2) classrooms, there are very few studies which can inform teachers about whether it is best to have students work in pairs or in small groups. In this study, conducted in a junior high school in Indonesia with learners of English as a Foreign Language (EFL), we…

  19. Finding Question-Answer Pairs from Online Forums

    DEFF Research Database (Denmark)

    Cong, Gao; Wang, Long; Lin, Chin-Yew;

    2008-01-01

    Online forums contain a huge amount of valuable user generated content. In this paper we address the problem of extracting question-answer pairs from forums. Question-answer pairs extracted from forums can be used to help Question Answering services (e.g. Yahoo! Answers) among other applications....

  20. Regimes of Pulsar Pair Formation and Particle Energetics

    CERN Document Server

    Harding, A K; Muslimov, A G; Harding, Alice K.; Zhang, Alexander G. Muslimov & Bing

    2002-01-01

    We investigate the conditions required for the production of electron-positron pairs above a pulsar polar cap (PC) and the influence of pair production on the energetics of the primary particle acceleration. Assuming space-charge limited flow acceleration including the inertial frame-dragging effect, we allow both one-photon and two-photon pair production by either curvature radiation (CR) photons or photons resulting from inverse-Compton scattering of thermal photons from the PC by primary electrons. We find that, while only the younger pulsars can produce pairs through CR, nearly all known radio pulsars are capable of producing pairs through non-resonant inverse-Compton scatterings. The effect of the neutron star equations of state on the pair death lines is explored. We show that pair production is facilitated in more compact stars and more massive stars. Therefore accretion of mass by pulsars in binary systems may allow pair production in most of the millisecond pulsar population. We also find that two-ph...

  1. Galaxy pairs as a probe for mergers at z ~ 2

    DEFF Research Database (Denmark)

    Man, A.W.S.; Zirm, Andrew Wasmuth; Toft, Sune

    2011-01-01

    In this work I investigate the redshift evolution of pair fraction of a sample of 196 massive galaxies from z = 0 to 3, selected from the COSMOS field. We find that on average a massive galaxy undergoes ~ 1.1 \\pm 0.5 major merger since z = 3. I will review the current limitations of using the pair...

  2. Observing Pair-Work Task in an English Speaking Class

    Science.gov (United States)

    Achmad, Diana; Yusuf, Yunisrina Qismullah

    2014-01-01

    This paper reports on students' pair-work interactions to develop their speaking skills in an ELT classroom which consisted of international learners. A number of 16 learners of intermediate proficiency with IELTS score band 5.5 were observed. The teacher had paired those he considered among them to be the more competent ones (hereafter, stronger)…

  3. One-on-One: Pairing Male and Female Writers.

    Science.gov (United States)

    Moore, Lisa

    1989-01-01

    Describes an approach that pairs every male-authored novel, play, short story, or poem taught in the English curriculum with one written by a woman. Illustrates this approach in a course pairing Emily Dickinson and Walt Whitman. Provides an annotated list of works that examine the subject of gender issues in schools. (MM)

  4. Thermal pairing and giant dipole resonance in highly excited nuclei

    CERN Document Server

    Dang, Nguyen Dinh

    2014-01-01

    Recent results are reported showing the effects of thermal pairing in highly excited nuclei. It is demonstrated that thermal pairing included in the phonon damping model (PDM) is responsible for the nearly constant width of the giant dipole resonance (GDR) at low temperature $T $ 170 MeV.

  5. Partitions of nonzero elements of a finite field into pairs

    CERN Document Server

    Karasev, R N

    2010-01-01

    In this paper we prove two theorems. Informally, they claim that the nonzero elements of a finite field with odd characteristic can be partitioned into pairs with prescribed difference (maybe, with some alternatives) in each pair. We also consider some generalizations of these results to packing translates in a finite or infinite field.

  6. Relativistic Quasiparticle Random Phase Approximation with a Separable Pairing Force

    Institute of Scientific and Technical Information of China (English)

    TIAN Yuan; MA Zhong-Yu; Ring Peter

    2009-01-01

    In our previous work [Phys. Lett. (to be published), Chin. Phys. Lett. 23 (2006) 3226], we introduced a separable pairing force for relativistic Hartree-Bogoliubov calculations. This force was adjusted to reproduce the pairing properties of the Gogny force in nuclear matter. By using the well known techniques of Talmi and Moshinsky it can be expanded in a series of separable terms and converges quickly after a few terms. It was found that the pairing properties can be depicted on almost the same footing as the original pairing interaction, not only in nuclear matter, but also in finite nuclei. In this study, we construct a relativistic quasiparticle random phase approximation (RQRPA ) with this separable pairing interaction and calculate the excitation energies of the first excited 2+ .states and reduced B(E2; 0+ → 2+) transition rates for a chain of Sn isotopes in RQRPA. Compared with the results of the full Gogny force, we find that this simple separable pairing interaction can describe the pairing properties of the excited vibrational states as well as the original pairing interaction.

  7. The Dynamics of Galaxy Pairs in a Cosmological Setting

    CERN Document Server

    Moreno, Jorge; Ellison, Sara L; Patton, David R; Torrey, Paul; Moster, Benjamin P

    2013-01-01

    We use the Millennium Simulation, and an abundance-matching framework, to investigate the dynamical behaviour of galaxy pairs embedded in a cosmological context. Our main galaxy-pair sample, selected to have separations under 250 kpc/h, consists of over 1.3 million pairs at redshift z = 0, with stellar masses greater than 10^9 Msun, probing mass ratios down to 1:1000. We use dark matter halo membership and energy to classify our galaxy pairs. In terms of halo membership, central-satellite pairs tend to be in isolation (in relation to external more massive galaxies), are energetically- bound to each other, and are also weakly-bound to a neighbouring massive galaxy. Satellite-satellite pairs, instead, inhabit regions in close proximity to a more massive galaxy, are energetically-unbound, and are often bound to that neighbour. We find that 60% of our paired galaxies are bound to both their companion and to a third external object. Moreover, only 9% of our pairs resemble the kind of systems described by idealised...

  8. Electrostatic pair creation and recombination in quantum plasmas

    CERN Document Server

    Marklund, M; Shukla, P K; Stenflo, L; Dieckmann, M E; Parviainen, M

    2006-01-01

    The collective production of electron-positron pairs by electrostatic waves in quantum plasmas is investigated. In particular, a semi-classical governing set of equation for a self-consistent treatment of pair creation by the Schwinger mechanism in a quantum plasma is derived.

  9. Solving the Airline Crew Pairing Problem using Subsequence Generation

    DEFF Research Database (Denmark)

    Rasmussen, Matias Sevel; Ryan, David; Lusby, Richard Martin;

    2009-01-01

    Good and fast solutions to the airline crew pairing problem are highly interesting for the airline industry, as crew costs are the biggest expenditure after fuel for an airline. The crew pairing problem is typically modelled as a set partitioning problem and solved by column generation. However...

  10. Machine learning for multi-view eye-pair detection

    NARCIS (Netherlands)

    Karaaba, Mahir Faik; Schomaker, Lambert; Wiering, Marco

    2014-01-01

    While face and eye detection is well known research topics in the field of object detection, eye-pair detection has not been much researched. Finding the location and size of an eye-pair in an image containing a face can enable a face recognition application to extract features from a face correspon

  11. Teleportation of Quantum States through Mixed Entangled Pairs

    Institute of Scientific and Technical Information of China (English)

    ZHENG Shi-Biao

    2006-01-01

    @@ We describe a protocol for quantum state teleportation via mixed entangled pairs. With the help of an ancilla,near-perfect teleportation might be achieved. For pure entangled pairs, perfect teleportation might be achieved with a certain probability without using an ancilla. The protocol is generalized to teleportation of multiparticle states and quantum secret sharing.

  12. Bright-dark incoherently coupled photovoltaic soliton pair

    Institute of Scientific and Technical Information of China (English)

    Hou Chun-Feng; Pei Yan-Bo; Zhou Zhong-Xiang; Sun Xiu-Dong

    2005-01-01

    The coupling between two mutually incoherent optical beams that propagate collinearly in open-circuit photovoltaic photorefractive media is investigated. It is shown that an incoherently coupled bright-dark spatial soliton pair can be formed due to photovoltaic effect. The physical properties of such a soliton pair are also discussed.

  13. Multiple Pattern Matching Algorithm using Pair-count

    Directory of Open Access Journals (Sweden)

    Raju Bhukya

    2011-07-01

    Full Text Available Pattern matching occurs in various applications, ranging from simple text searching in word processors to identification of common motifs in DNA sequences in computational biology. The problem of exact pattern matching has been well studied and a number of efficient algorithms already exist. However these exact pattern matching algorithms are of little help when they are applied to finding patterns in DNA sequences. Pattern matching in a DNA sequence or pattern searching from a large data base is a major research area in computational biology. To extract pattern from a large sequence it takes more time, in order to reduce searching time we have proposed an approach that reduces the search time with accurate retrieval of the matched pattern from the given sequence of any size of a file. Executing patterns from a large DNA or protein data is a computationally intensive task. As performance plays a major role in extracting patterns from a given DNA sequence or from a large database independent of the size of the sequence. More efficient approaches related to multiple pattern matching techniques are becoming more important for finding the functional as well as the structural properties of the proteins and genes. One of the major problems in genomic field is to perform pattern comparison on DNA and protein sequences. In the current approach we explore a new technique which avoids unnecessary comparisons in the DNA sequence and gives the accurate retrieval of the pattern called a multiple pattern matching algorithm using pair count. The proposed technique gives very good performance related to DNA sequence analysis for querying of publicly available genome sequence data. By using this method the number of comparisons gradually decreases and comparison per character ratio of the proposed algorithm reduces accordingly when compared to the some of the existing popular methods. The experimental results show that there is considerable amount of performance

  14. Exposure to pairs of Aeromonas strains enhances virulence in the Caenorhabditis elegans infection model

    Science.gov (United States)

    Mosser, Thomas; Talagrand-Reboul, Emilie; Colston, Sophie M.; Graf, Joerg; Figueras, Maria J.; Jumas-Bilak, Estelle; Lamy, Brigitte

    2015-01-01

    Aeromonad virulence remains poorly understood, and is difficult to predict from strain characteristics. In addition, infections are often polymicrobial (i.e., are mixed infections), and 5–10% of such infections include two distinct aeromonads, which has an unknown impact on virulence. In this work, we studied the virulence of aeromonads recovered from human mixed infections. We tested them individually and in association with other strains with the aim of improving our understanding of aeromonosis. Twelve strains that were recovered in pairs from six mixed infections were tested in a virulence model of the worm Caenorhabditis elegans. Nine isolates were weak worm killers (median time to death, TD50, ≥7 days) when administered alone. Two pairs showed enhanced virulence, as indicated by a significantly shortened TD50 after co-infection vs. infection with a single strain. Enhanced virulence was also observed for five of the 14 additional experimental pairs, and each of these pairs included one strain from a natural synergistic pair. These experiments indicated that synergistic effects were frequent and were limited to pairs that were composed of strains belonging to different species. The genome content of virulence-associated genes failed to explain virulence synergy, although some virulence-associated genes that were present in some strains were absent from their companion strain (e.g., T3SS). The synergy observed in virulence when two Aeromonas isolates were co-infected stresses the idea that consideration should be given to the fact that infection does not depend only on single strain virulence but is instead the result of a more complex interaction between the microbes involved, the host and the environment. These results are of interest for other diseases in which mixed infections are likely and in particular for water-borne diseases (e.g., legionellosis, vibriosis), in which pathogens may display enhanced virulence in the presence of the right partner. This

  15. An Intelligent Model for Pairs Trading Using Genetic Algorithms.

    Science.gov (United States)

    Huang, Chien-Feng; Hsu, Chi-Jen; Chen, Chi-Chung; Chang, Bao Rong; Li, Chen-An

    2015-01-01

    Pairs trading is an important and challenging research area in computational finance, in which pairs of stocks are bought and sold in pair combinations for arbitrage opportunities. Traditional methods that solve this set of problems mostly rely on statistical methods such as regression. In contrast to the statistical approaches, recent advances in computational intelligence (CI) are leading to promising opportunities for solving problems in the financial applications more effectively. In this paper, we present a novel methodology for pairs trading using genetic algorithms (GA). Our results showed that the GA-based models are able to significantly outperform the benchmark and our proposed method is capable of generating robust models to tackle the dynamic characteristics in the financial application studied. Based upon the promising results obtained, we expect this GA-based method to advance the research in computational intelligence for finance and provide an effective solution to pairs trading for investment in practice.

  16. Nonperturbative signatures in pair production for general elliptic polarization fields

    CERN Document Server

    Li, Z L; Xie, B S; Shen, B F; Fu, L B; Liu, J

    2015-01-01

    The momentum signatures in nonperturbative multiphoton pair production for general elliptic polarization electric fields are investigated by employing the real-time Dirac-Heisenberg-Wigner formalism. For a linearly polarized electric field we find that the positions of the nodes in momenta spectra of created pairs depend only on the electric field frequency. The polarization of external fields could not only change the node structures or even make the nodes disappear but also change the thresholds of pair production. The momentum signatures associated to the node positions in which the even-number-photon pair creation process is forbid could be used to distinguish the orbital angular momentum of created pairs on the momenta spectra. These distinguishable momentum signatures could be relevant for providing the output information of created particles and also the input information of ultrashort laser pulses.

  17. Tracking the coherent generation of polaron pairs in conjugated polymers

    Science.gov (United States)

    de Sio, Antonietta; Troiani, Filippo; Maiuri, Margherita; Réhault, Julien; Sommer, Ephraim; Lim, James; Huelga, Susana F.; Plenio, Martin B.; Rozzi, Carlo Andrea; Cerullo, Giulio; Molinari, Elisa; Lienau, Christoph

    2016-12-01

    The optical excitation of organic semiconductors not only generates charge-neutral electron-hole pairs (excitons), but also charge-separated polaron pairs with high yield. The microscopic mechanisms underlying this charge separation have been debated for many years. Here we use ultrafast two-dimensional electronic spectroscopy to study the dynamics of polaron pair formation in a prototypical polymer thin film on a sub-20-fs time scale. We observe multi-period peak oscillations persisting for up to about 1 ps as distinct signatures of vibronic quantum coherence at room temperature. The measured two-dimensional spectra show pronounced peak splittings revealing that the elementary optical excitations of this polymer are hybridized exciton-polaron-pairs, strongly coupled to a dominant underdamped vibrational mode. Coherent vibronic coupling induces ultrafast polaron pair formation, accelerates the charge separation dynamics and makes it insensitive to disorder. These findings open up new perspectives for tailoring light-to-current conversion in organic materials.

  18. Stationary Vortices and Pair Currents in a Trapped Fermion Superfluid

    Science.gov (United States)

    Capuzzi, P.; Hernández, E. S.; Szybisz, L.

    2015-05-01

    We examine the effects of stationary vortices in superfluid Li atoms at zero temperature in the frame of the recently developed fluiddynamical scheme, that includes the pair density and its associated pair current and pair kinetic energy in addition to the fields appearing in the hydrodynamical description of normal fluids. In this frame, the presence of any particle velocity field gives rise to the appearance of a pair current. As an illustration, we consider a stationary vortex with cylindrical geometry in an unpolarized fluid, and examine the effects of the rotational velocity field on the spatial structure of the equilibrium gap and the profiles of the pair current. We show that the latter is intrinsically complex and its imaginary part is the source of a radial drift for the velocity field. We discuss the consequences on the stationary regime.

  19. Purification of an unpolarized spin ensemble into entangled singlet pairs

    CERN Document Server

    Greiner, Johannes N; Wrachtrup, Jörg

    2016-01-01

    Dynamical polarization of nuclear spin ensembles is of central importance for magnetic resonance studies, precision sensing and for applications in quantum information theory. Here we propose a scheme to generate long-lived singlet pairs in an unpolarized nuclear spin ensemble which is dipolar coupled to the electron spins of a Nitrogen Vacancy center in diamond. The quantum mechanical back-action induced by frequent spin-selective readout of the NV centers allows the nuclear spins to pair up into maximally entangled singlet pairs. Counterintuitively, the robustness of the pair formation to dephasing noise improves with increasing size of the spin ensemble. We also show how the paired nuclear spin state allows for enhanced sensing capabilities of NV centers in diamond.

  20. Watching the coherent birth of polaron pairs in conjugated polymers

    CERN Document Server

    De Sio, Antonietta; Maiuri, Margherita; Réhault, Julien; Sommer, Ephraim; Lim, James; Huelga, Susana F; Plenio, Martin B; Rozzi, Carlo Andrea; Cerullo, Giulio; Molinari, Elisa; Lienau, Christoph

    2016-01-01

    Organic semiconductors have the remarkable property that their optical excitation not only generates charge-neutral electron-hole pairs (excitons) but also charge-separated polaron pairs with high yield. The microscopic mechanisms underlying this charge separation have been debated for many years. Here we use ultrafast two-dimensional electronic spectroscopy to study the dynamics of polaron pair formation in a prototypical polymer thin film on a sub-20-fs time scale. We observe multi-period peak oscillations persisting for up to about 1 ps as distinct signatures of vibronic quantum coherence at room temperature. The measured two-dimensional spectra show pronounced peak splittings revealing that the elementary optical excitations of this polymer are hybridized exciton-polaron-pairs, strongly coupled to a dominant underdamped vibrational mode. Coherent vibronic coupling induces ultrafast polaron pair formation, accelerates the charge separation dynamics and makes it insensitive to disorder. These findings open ...

  1. Paired structures in logical and semiotic models of natural language

    DEFF Research Database (Denmark)

    Rodríguez, J. Tinguaro; Franco, Camilo; Montero, Javier

    2014-01-01

    The evidence coming from cognitive psychology and linguistics shows that pairs of reference concepts (as e.g. good/bad, tall/short, nice/ugly, etc.) play a crucial role in the way we everyday use and understand natural languages in order to analyze reality and make decisions. Different situations...... and problems require different pairs of landmark concepts, since they provide the referential semantics in which the available information is understood accordingly to our goals in each context. In this way, a semantic valuation structure or system emerges from a pair of reference concepts and the way...... they oppose each other. Such structures allow representing the logic of new concepts according to the semantics of the references. We will refer to these semantic valuation structures as paired structures. Our point is that the semantic features of a paired structure could essentially depend on the semantic...

  2. Pulsar Pair Cascades in a Distorted Magnetic Dipole Field

    CERN Document Server

    Harding, Alice K

    2010-01-01

    We investigate the effect of a distorted neutron star dipole magnetic field on pulsar pair cascade multiplicity and pair death lines. Using a simple model for a distorted dipole field that produces an offset polar cap, we derive the accelerating electric field above the polar cap in space charge limited flow. We find that even a modest azimuthally asymmetric distortion can significantly increase the accelerating electric field on one side of the polar cap and, combined with a smaller field line radius of curvature, leads to larger pair multiplicity. The death line for producing pairs by curvature radiation moves downward in the P-Pdot diagram, allowing high pair multiplicities in a larger percentage of the radio pulsar population. These results could have important implications for the radio pulsar population, high energy pulsed emission and the pulsar contribution to cosmic ray positrons.

  3. Enumeration of non-crossing pairings on bit strings

    CERN Document Server

    Kemp, Todd; Rattan, Amarpreet; Smyth, Clifford

    2009-01-01

    A non-crossing pairing on a bitstring matches 1s and 0s in a manner such that the pairing diagram is nonintersecting. By considering such pairings on arbitrary bitstrings $1^{n_1} 0^{m_1} ... 1^{n_r} 0^{m_r}$, we generalize classical problems from the theory of Catalan structures. In particular, it is very difficult to find useful explicit formulas for the enumeration function $\\phi(n_1, m_1, ..., n_r, m_r)$, which counts the number of pairings as a function of the underlying bitstring. We determine explicit formulas for $\\phi$, and also prove general upper bounds in terms of Fuss-Catalan numbers by relating non-crossing pairings to other generalized Catalan structures (that are in some sense more natural). This enumeration problem arises in the theory of random matrices and free probability.

  4. Pairing-induced speedup of nuclear spontaneous fission

    CERN Document Server

    Sadhukhan, Jhilam; Nazarewicz, W; Sheikh, J A; Baran, A

    2014-01-01

    Collective inertia is strongly influenced at the level crossing at which quantum system changes diabatically its microscopic configuration. Pairing correlations tend to make the large-amplitude nuclear collective motion more adiabatic by reducing the effect of those configuration changes. Competition between pairing and level crossing is thus expected to have a profound impact on spontaneous fission lifetimes. To elucidate the role of nucleonic pairing on spontaneous fission, we study the dynamic fission trajectories of $^{264}$Fm and $^{240}$Pu using the state-of-the-art self-consistent framework. We employ the superfluid nuclear density functional theory with the Skyrme energy density functional SkM$^*$ and a density-dependent pairing interaction. Along with shape variables, proton and neutron pairing correlations are taken as collective coordinates. The collective inertia tensor is calculated within the nonperturbative cranking approximation. The fission paths are obtained by using the least action princip...

  5. A new threshold proxy signature scheme from bilinear pairings

    Institute of Scientific and Technical Information of China (English)

    QIAN Haifeng; CAO Zhenfu; XUE Qingshui

    2004-01-01

    Based on the GDH signature (short signature scheme) a probabilistic signature scheme is proposed in this paper with security proof. Then a new threshold proxy signature from bilinear pairings is proposed as well by using the new probabilistic signature scheme and the properties of the Gap Diffie-Hellman (GDH) group (where the Computational Diffie-Hellman problem is hard but the Decisional Diffie-Hellman problem is easy to solve). Our constructions are based on the recently proposed GDH signature scheme of Bonel et al.'s article. Bilinear pairings could be built from Weil pairing or Tate pairing. So most our constructions would be simpler, but still with high security. The proposed threshold proxy signature is the first one which is built from bilinear pairings. At the end of this paper security and performance of the threshold proxy signature scheme is also analyzed.

  6. Numerically optimal Runge-Kutta pairs with interpolants

    Science.gov (United States)

    Verner, J.

    2010-03-01

    Explicit Runge-Kutta pairs are known to provide efficient solutions to initial value differential equations with inexpensive derivative evaluations. Two criteria for selection are proposed with a view to deriving pairs of all orders 6(5) to 9(8) which minimize computation while achieving a user-specified accuracy. Coefficients of improved pairs, their stability regions and coefficients of appended optimal interpolatory Runge-Kutta formulas are provided on the author's website (www.math.sfu.ca/~jverner). This note reports results of tests on these pairs to illustrate their effectiveness in solving nonstiff initial value problems. These pairs and interpolants may be used for implementation, or else to provide comparison targets for other new types of methods such as explicit general linear methods.

  7. SRTM Stereo Pair: Wheeler Ridge, California

    Science.gov (United States)

    2000-01-01

    Wheeler Ridge and vicinity, California, is a site of major tectonic activity, both historically and over recent geologic time. The epicenter of the 7.5 magnitude Kern County earthquake occurred here on July 21,1952, and numerous geologic and topographic features indicate rapid geologic processes. The ridge itself (upper-right center) is a geologic fold that is growing out of the southern San Joaquin Valley. A prominent 'wind gap,' now used for passage of the California aquaduct (with the aid of a pumping station), is evidence that the ridge grew faster than tranversing streams could erode down. Nearby abrupt and/or landslid mountain fronts similarly indicate a vigorous tectonic setting here, just north of the San Andreas fault. The Interstate 5 freeway can be seen crossing agricultural fields on the right and entering the very rugged and steep Grapevine Canyon toward the bottom.This stereoscopic image was generated by draping a Landsat satellite image over a preliminary Shuttle Radar Topography Mission (SRTM) elevation model. Two differing perspectives were then calculated, one for each eye. They can be seen in 3-D by viewing the left image with the right eye and the right image with the left eye (cross-eyed viewing), or by downloading and printing the image pair and viewing them with a stereoscope. When stereoscopically merged, the result is a vertically exaggerated view of the Earth's surface in its full three dimensions. Landsat has been providing visible and infrared views of the Earth since 1972. SRTM elevation data matches the 30-meter resolution of most Landsat images and will substantially help in analyses of the large and growing Landsat image archive.The elevation data used in this image was acquired by SRTM aboard the Space Shuttle Endeavour, launched on February 11, 2000. SRTM used the same radar instrument that comprised the Spaceborne Imaging Radar-C/X-Band Synthetic Aperture Radar (SIR-C/X-SAR) that flew twice on the Space Shuttle Endeavour in 1994

  8. AGT, Burge pairs and minimal models

    Energy Technology Data Exchange (ETDEWEB)

    Bershtein, M. [Landau Institute for Theoretical Physics,Chernogolovka (Russian Federation); Institute for Information Transmission Problems,Moscow (Russian Federation); National Research University Higher School of Economics, International Laboratory of Representation Theory and Mathematical Physics, Independent University of Moscow, Moscow (Russian Federation); Foda, O. [Mathematics and Statistics, University of Melbourne,Parkville, VIC 3010 (Australia)

    2014-06-30

    We consider the AGT correspondence in the context of the conformal field theory M{sup p,p{sup ′}}⊗M{sup H}, where M{sup p,p{sup ′}} is the minimal model based on the Virasoro algebra V{sup p,p{sup ′}} labeled by two co-prime integers {p,p"′}, 1pairs {Y_1"ι,Y_2"ι} that satisfy Y{sub 2,σ}{sup ι,⊺}−Y{sub 1,σ+r{sub ι−1}{sup ι,⊺}}≥1−s{sub ι}, and Y{sub 1,σ}{sup ι,⊺}−Y{sub 2,σ+p−r{sub ι−1}{sup ι,⊺}}≥1−p{sup ′}+s{sub ι}, where Y{sub i,σ}{sup ι,⊺} is the σ-column of Y{sub i}{sup ι}, i∈{1,2}, we obtain a well-defined expression that we identify with B{sub n}{sup p,p{sup ′,H}}. We check the correctness of this expression for 1. Any 1-point B{sub 1}{sup p,p{sup ′,H}} on the torus, when the operator insertion is the identity, and 2. The 6-point B{sub 3}{sup 3,4,H} on the sphere that involves six Ising magnetic operators.

  9. Genomic evidence for adaptation by gene duplication.

    Science.gov (United States)

    Qian, Wenfeng; Zhang, Jianzhi

    2014-08-01

    Gene duplication is widely believed to facilitate adaptation, but unambiguous evidence for this hypothesis has been found in only a small number of cases. Although gene duplication may increase the fitness of the involved organisms by doubling gene dosage or neofunctionalization, it may also result in a simple division of ancestral functions into daughter genes, which need not promote adaptation. Hence, the general validity of the adaptation by gene duplication hypothesis remains uncertain. Indeed, a genome-scale experiment found similar fitness effects of deleting pairs of duplicate genes and deleting individual singleton genes from the yeast genome, leading to the conclusion that duplication rarely results in adaptation. Here we contend that the above comparison is unfair because of a known duplication bias among genes with different fitness contributions. To rectify this problem, we compare homologous genes from the budding yeast Saccharomyces cerevisiae and the fission yeast Schizosaccharomyces pombe. We discover that simultaneously deleting a duplicate gene pair in S. cerevisiae reduces fitness significantly more than deleting their singleton counterpart in S. pombe, revealing post-duplication adaptation. The duplicates-singleton difference in fitness effect is not attributable to a potential increase in gene dose after duplication, suggesting that the adaptation is owing to neofunctionalization, which we find to be explicable by acquisitions of binary protein-protein interactions rather than gene expression changes. These results provide genomic evidence for the role of gene duplication in organismal adaptation and are important for understanding the genetic mechanisms of evolutionary innovation.

  10. Effects of Worked Examples, Example-Problem Pairs, and Problem-Example Pairs Compared to Problem Solving

    NARCIS (Netherlands)

    Van Gog, Tamara; Kester, Liesbeth; Paas, Fred

    2010-01-01

    Van Gog, T., Kester, L., & Paas, F. (2010, August). Effects of worked examples, example-problem pairs, and problem-example pairs compared to problem solving. Paper presented at the Biannual EARLI SIG meeting of Instructional design and Learning and instruction with computers, Ulm, Germany.

  11. The Xenopus FcR family demonstrates continually high diversification of paired receptors in vertebrate evolution

    Directory of Open Access Journals (Sweden)

    Najakshin Alexander M

    2008-05-01

    Full Text Available Abstract Background Recent studies have revealed an unexpected diversity of domain architecture among FcR-like receptors that presumably fulfill regulatory functions in the immune system. Different species of mammals, as well as chicken and catfish have been found to possess strikingly different sets of these receptors. To better understand the evolutionary history of paired receptors, we extended the study of FcR-like genes in amphibian representatives Xenopus tropicalis and Xenopus laevis. Results The diploid genome of X. tropicalis contains at least 75 genes encoding paired FcR-related receptors designated XFLs. The allotetraploid X. laevis displays many similar genes primarily expressed in lymphoid tissues. Up to 35 domain architectures generated by combinatorial joining of six Ig-domain subtypes and two subtypes of the transmembrane regions were found in XFLs. None of these variants are shared by FcR-related proteins from other studied species. Putative activating XFLs associate with the FcRγ subunit, and their transmembrane domains are highly similar to those of activating mammalian KIR-related receptors. This argues in favor of a common origin for the FcR and the KIR families. Phylogenetic analysis shows that the entire repertoires of the Xenopus and mammalian FcR-related proteins have emerged after the amphibian-amniotes split. Conclusion FcR- and KIR-related receptors evolved through continual species-specific diversification, most likely by extensive domain shuffling and birth-and-death processes. This mode of evolution raises the possibility that the ancestral function of these paired receptors was a direct interaction with pathogens and that many physiological functions found in the mammalian receptors were secondary acquisitions or specializations.

  12. Plasma effects on fast pair beams. III. Oblique electrostatic growth rates for perpendicular Maxwellian pair beams

    Energy Technology Data Exchange (ETDEWEB)

    Supsar, Markus; Schlickeiser, Reinhard, E-mail: markus.supsar@tp4.rub.de, E-mail: rsch@tp4.rub.de [Institut für Theoretische Physik, Lehrstuhl IV: Weltraum- und Astrophysik, Ruhr-Universität Bochum, D-44780 Bochum (Germany)

    2014-03-10

    The distant universe is opaque to γ radiation from blazars due to gamma-gamma attenuation with extragalactic background light. This process produces electron-positron pair beams that interact with the intergalactic medium and are unstable to linear instabilities, particularly the electrostatic and Weibel instabilities. The electrostatic instability grows faster and so determines the dissipation of the free energy of the beam. Here, we generalize the calculation of the electrostatic growth rate to a beam plasma system with a Maxwellian perpendicular momentum spread and allow for oblique propagation directions. We show that the growth rate for the oblique electrostatic mode has a maximum value that is even higher than for a cold beam or for one with a constant perpendicular momentum spread.

  13. Virus-induced gene silencing and transient gene expression in soybean using Bean pod mottle virus infectious clones

    Science.gov (United States)

    Virus-induced gene silencing (VIGS) is a powerful and rapid approach for determining the functions of plant genes. The basis of VIGS is that a viral genome is engineered so that it can carry fragments of plant genes, typically in the 200-300 base pair size range. The recombinant viruses are used to ...

  14. Merging a Pair of Supermassive Black Holes

    Science.gov (United States)

    Kohler, Susanna

    2016-10-01

    hydrodynamically, simulating the final stages of the galaxy merger.When the separation of the two SMBHs is small enough, the authors extract a spherical region of 5 kpc from around the pair and evolve this as an N-body simulation.Finally, the separation of the SMBHs becomes so small (0.01 pc) that gravitational-wave emission is the dominant loss of energy driving the inspiral. The authors add post-Newtonian terms into the N-body simulation to account for this.Time evolution of the separation between the SMBHs, beginning with the hydrodynamical simulation (blue), then transitioning to the direct N-body calculation (red), and ending with the introduction of post-Newtonian terms (green) to account for gravitational-wave emission. [Adapted from Khan et al. 2016]Successful CoalescenceKhan and collaborators complex approach allows them to simulate the entire process of the merger and SMBH coalescence, resulting in several key determinations.First, they demonstrate that the SMBHs can coalesce on timescales of only tens of Myr, which is roughly two orders of magnitude smaller than what was typically estimated before. They find that gas dissipation before the merger is instrumental in creating the conditions that allow for this rapid orbital decay.The authors also demonstrate that the gravitational potential of the galaxy merger remnant is triaxial throughout the merger. Khan and collaborators simulations confirm that this non-spherical potential solves the final parsec problem by sending stars on plunging orbits around the SMBHs. These more distant stars cause the SMBHs to lose angular momentum through dynamical friction and continue their inspiral, even when the stars immediately surrounding the SMBHs have been depleted.This simulation isan important step toward a better understanding of SMBH mergers. Its outcomes are especially promising for future gravitational-wave campaigns, as the short SMBH coalescence timescales indicate that these mergers could indeed be observable

  15. A new sample of bright galaxy pairs in UZC

    CERN Document Server

    Focardi, P; Marinoni, S; Zitelli, V

    2006-01-01

    We present a new sample of bright galaxy pairs extracted applying an objective selection code to UZC catalog.The sample is volume limited to M$_{zw}$ = -18.9 +5 log ${\\it h}$ and contains 89 galaxy pairs.We analyze the kinematical, morphological and photometrical properties of galaxies belonging to this sample. We show that velocity separation, $| \\Delta v_{r} |$, between pair members is significantly lower in spiral type (S+S) pairs than in early-type (E+E) and mixed (E+S) pairs.This indicates that truly isolated galaxy pairs are more likely to be found among S+S pairs. We show that ellipticals are rare and underluminous in B and that late spirals (T $\\ge$ 4) are overluminous. We confirm that the formation of bright ellipticals is a phenomenon linked to group/cluster environment, while galaxy-galaxy interaction may enhance blue luminosity of disk galaxies through SF phenomena. This last statement is supported by the presence of strong FIR emission from early spirals in this sample and by the high frequency o...

  16. Twin photon pairs in a high-Q silicon microresonator

    Energy Technology Data Exchange (ETDEWEB)

    Rogers, Steven; Lu, Xiyuan [Department of Physics and Astronomy, University of Rochester, Rochester, New York 14627 (United States); Jiang, Wei C. [Institute of Optics, University of Rochester, Rochester, New York 14627 (United States); Lin, Qiang, E-mail: qiang.lin@rochester.edu [Institute of Optics, University of Rochester, Rochester, New York 14627 (United States); Department of Electrical and Computer Engineering, University of Rochester, Rochester, New York 14627 (United States)

    2015-07-27

    We report the generation of high-purity twin photon pairs through cavity-enhanced non-degenerate four-wave mixing (FWM) in a high-Q silicon microdisk resonator. Twin photon pairs are created within the same cavity mode and are consequently expected to be identical in all degrees of freedom. The device is able to produce twin photons at telecommunication wavelengths with a pair generation rate as large as (3.96 ± 0.03) × 10{sup 5} pairs/s, within a narrow bandwidth of 0.72 GHz. A coincidence-to-accidental ratio of 660 ± 62 was measured, the highest value reported to date for twin photon pairs, at a pair generation rate of (2.47 ± 0.04) × 10{sup 4} pairs/s. Through careful engineering of the dispersion matching window, we have reduced the ratio of photons resulting from degenerate FWM to non-degenerate FWM to less than 0.15.

  17. Effects on Galaxy Evolution: Pair Interactions versus Environment

    CERN Document Server

    Tonnesen, Stephanie

    2011-01-01

    In a hierarchical universe, mergers may be an important mechanism not only in increasing the mass of galaxies but also in driving the colour and morphological evolution of galaxies. We use a large sample of ~1000 simulated galaxies of stellar mass greater than 10^{9.6} solar masses (for ~4800 observations at multiple redshifts) from a high-resolution (0.46 kpc/h) cosmological simulation to determine under what circumstances being a member of a pair influences galaxy properties at z <= 0.2. We identify gravitationally bound pairs, and find a relative fraction of blue-blue (wet), red-red (dry), and blue-red (mixed) pairs that agrees with observations (Lin et al. 2010). All pairs tend to avoid the extreme environments of clusters and void centres. While pairs in groups can include galaxies that are both blue, both red, or one of each colour, in the field it is extraordinarily rare for pair galaxies to both be red. We find that, while physically bound pairs closer than 250 kpc/h tend to be bluer than the galax...

  18. When noisy neighbors are a blessing: analysis of gene expression noise identifies coregulated genes

    NARCIS (Netherlands)

    Junker, J.P.; van Oudenaarden, A.

    2012-01-01

    In this issue of Molecular Cell, Stewart-Ornstein et al. (2012) use systematic pair-wise correlation analysis of expression noise in a large number of yeast genes to identify clusters of functionally related genes and signaling pathways responsible for elevated noise.

  19. Analysis of Food Pairing in Regional Cuisines of India.

    Science.gov (United States)

    Jain, Anupam; N K, Rakhi; Bagler, Ganesh

    2015-01-01

    Any national cuisine is a sum total of its variety of regional cuisines, which are the cultural and historical identifiers of their respective regions. India is home to a number of regional cuisines that showcase its culinary diversity. Here, we study recipes from eight different regional cuisines of India spanning various geographies and climates. We investigate the phenomenon of food pairing which examines compatibility of two ingredients in a recipe in terms of their shared flavor compounds. Food pairing was enumerated at the level of cuisine, recipes as well as ingredient pairs by quantifying flavor sharing between pairs of ingredients. Our results indicate that each regional cuisine follows negative food pairing pattern; more the extent of flavor sharing between two ingredients, lesser their co-occurrence in that cuisine. We find that frequency of ingredient usage is central in rendering the characteristic food pairing in each of these cuisines. Spice and dairy emerged as the most significant ingredient classes responsible for the biased pattern of food pairing. Interestingly while individual spices contribute to negative food pairing, dairy products on the other hand tend to deviate food pairing towards positive side. Our data analytical study highlighting statistical properties of the regional cuisines, brings out their culinary fingerprints that could be used to design algorithms for generating novel recipes and recipe recommender systems. It forms a basis for exploring possible causal connection between diet and health as well as prospection of therapeutic molecules from food ingredients. Our study also provides insights as to how big data can change the way we look at food.

  20. Analysis of Food Pairing in Regional Cuisines of India.

    Directory of Open Access Journals (Sweden)

    Anupam Jain

    Full Text Available Any national cuisine is a sum total of its variety of regional cuisines, which are the cultural and historical identifiers of their respective regions. India is home to a number of regional cuisines that showcase its culinary diversity. Here, we study recipes from eight different regional cuisines of India spanning various geographies and climates. We investigate the phenomenon of food pairing which examines compatibility of two ingredients in a recipe in terms of their shared flavor compounds. Food pairing was enumerated at the level of cuisine, recipes as well as ingredient pairs by quantifying flavor sharing between pairs of ingredients. Our results indicate that each regional cuisine follows negative food pairing pattern; more the extent of flavor sharing between two ingredients, lesser their co-occurrence in that cuisine. We find that frequency of ingredient usage is central in rendering the characteristic food pairing in each of these cuisines. Spice and dairy emerged as the most significant ingredient classes responsible for the biased pattern of food pairing. Interestingly while individual spices contribute to negative food pairing, dairy products on the other hand tend to deviate food pairing towards positive side. Our data analytical study highlighting statistical properties of the regional cuisines, brings out their culinary fingerprints that could be used to design algorithms for generating novel recipes and recipe recommender systems. It forms a basis for exploring possible causal connection between diet and health as well as prospection of therapeutic molecules from food ingredients. Our study also provides insights as to how big data can change the way we look at food.

  1. Hybrid TLC-pair meter for the Sphinx Project

    Science.gov (United States)

    Wada, T.; Yamamoto, I.; Takahashi, N.; Misaki, A.

    1985-01-01

    The chief aims in THE SPHINX PROJECT are research of super lepton physics and new detector experiments. At the second phase of THE SPHINX PROJECT, a hybrid TLC-PAIR METER was designed for measuring high energy neutrino sources (E upsilon * TeV), searching high energy muon sources (E mu TeV) and measuring muon group (E mu 1 TeV). The principle of PAIR METER has been already proposed. In this TLC-PAIR METER, electromagnetic shower induced by cosmic ray muons are detected using TL (Thermoluminescence) sheets with position counters.

  2. Second generation silver(I-mediated imidazole base pairs

    Directory of Open Access Journals (Sweden)

    Susanne Hensel

    2014-09-01

    Full Text Available The imidazole–Ag(I–imidazole base pair is one of the best-investigated artificial metal-mediated base pairs. We show here that its stability can be further improved by formally replacing the imidazole moiety by a 2-methylimidazole or 4-methylimidazole moiety. A comparison of the thermal stability of several double helices shows that the addition of one equivalent of Ag(I leads to a 50% larger increase in the melting temperature when a DNA duplex with methylated imidazole nucleosides is applied. This significant effect can likely be attributed to a better steric shielding of the metal ion within the metal-mediated base pair.

  3. Parastatistical Factors for Cascade Emission of a Pair of Paraparticles

    CERN Document Server

    Nelson, Charles A; Mera, Calvin S; Shapiro, Alanna M

    2013-01-01

    The empirical absence to date of particles obeying parastatistics in high energy collider experiments might be due to their large masses and lack of gauge couplings. If there is a portal to such particles, they might be cascade emitted as a pair of para-Majorana neutrinos or as a pair of scalar paraparticles. In this paper, for an assumed portal Lagrangian, the associated parastatistical factors are obtained for the case of order p=2 parastatistics and the, in general differing factors, for the cases of emission of a non-degenerate or a degenerate pair of particles which obey normal statistics.

  4. Processing Constrained K Closest Pairs Query in Spatial Databases

    Institute of Scientific and Technical Information of China (English)

    LIU Xiaofeng; LIU Yunsheng; XIAO Yingyuan

    2006-01-01

    In this paper, constrained K closest pairs query is introduced, which retrieves the K closest pairs satisfying the given spatial constraint from two datasets. For data sets indexed by R-trees in spatial databases, three algorithms are presented for answering this kind of query. Among of them,two-phase Range+Join and Join+Range algorithms adopt the strategy that changes the execution order of range and closest pairs queries, and constrained heap-based algorithm utilizes extended distance functions to prune search space and minimize the pruning distance. Experimental results show that constrained heap-base algorithm has better applicability and performance than two-phase algorithms.

  5. Breathing solitary-pulse pairs in a linearly coupled system

    CERN Document Server

    Dana, Brenda; Bahabad, Alon

    2014-01-01

    It is shown that pairs of solitary pulses (SPs) in a linearly-coupled system with opposite group-velocity dispersions form robust breathing bound states. The system can be realized by temporal-modulation coupling of SPs with different carrier frequencies propagating in the same medium, or by coupling of SPs in a dual-core waveguide. Broad SP pairs are produced in a virtually exact form by means of the variational approximation. Strong nonlinearity tends to destroy the periodic evolution of the SP pairs.

  6. Pairs in the light-front and covariance

    CERN Document Server

    Pacheco-Bicudo-Cabral de Melo, J; Frederico, T; Sauer, P U

    1998-01-01

    The electromagnetic current of bound systems in the light-front is constructed in the Breit-Frame, in the limit of momentum transfer $q^+=(q^0+q^3)$ vanishing. In this limit, the pair creation term survives and it is responsible for the covariance of the current. The pair creation term is computed for the $j^+$ current of a spin one composite particle in the Breit-frame. The rotational symmetry of $j^+$ is violated if the pair term is not considered.

  7. Structure of 2,4-Diaminopyrimidine - Theobromine Alternate Base Pairs

    Science.gov (United States)

    Gengeliczki, Zsolt; Callahan, Michael P.; Kabelac, Martin; Rijs, Anouk M.; deVries, Mattanjah S.

    2011-01-01

    We report the structure of clusters of 2,4-diaminopyrimidine with 3,7-dimethylxanthine (theobromine) in the gas phase determined by IR-UV double resonance spectroscopy in both the near-IR and mid-IR regions in combination with ab initio computations. These clusters represent potential alternate nucleobase pairs, geometrically equivalent to guanine-cytosine. We have found the four lowest energy structures, which include the Watson-Crick base pairing motif. This Watson-Crick structure has not been observed by resonant two-photon ionization (R2PI) in the gas phase for the canonical DNA base pairs.

  8. Pair Production of Open Strings Relativistic versus Dissipative Dynamics

    CERN Document Server

    Acatrinei, C S

    1999-01-01

    We study the pair production of open strings in constant electric fields, using a general framework which encodes both relativistic string theory and generic linearly extended systems as well. In the relativistically invariant case we recover previous results, both for pair production and for the effective Born-Infeld action. We then derive a non-relativistic limit - where the propagation velocity along the string is much smaller than the velocity of light - obtaining quantum dissipation. We calculate the pair nucleation rate for this case, which could be relevant for applications.

  9. Intellectual similarity of virtual twin pairs: Developmental trends

    OpenAIRE

    2007-01-01

    Virtual twins (VTs) are same-age unrelated siblings reared together from infancy who replicate twinship, but without the genetic relatedness. A 2005 report from the ongoing Fullerton Virtual Twin Study found an IQ intraclass correlation of .26 (p < .01, n = 113 pairs) and a within-pair difference of 13.22 IQ points. The average age of VTs in that study was 8.10 years (SD = 8.56, range: 4.01–54.84 years). An opportunity to retest members of 43 VT pairs, 1.70–8.96 years after their time 1 asses...

  10. Manakov Soliton Pairs in Biased Photovoltaic Photorefractive Crystals

    Institute of Scientific and Technical Information of China (English)

    侯春风; 杜春光; 阿不都热苏力; 李师群

    2002-01-01

    We study, theoretically, incoherently coupled screening-photovoltaic soliton pairs in biased photovoltaic photorefractive crystals. It is shown that when the total intensity of two coupled solitons is much lower than the effective dark irradiance, the coupled soliton equations reduce to the Manakov equations. The dark-dark, bright-bright and dark-bright soliton pair solutions of these Manakov equations are obtained under an appropriate external bias field and a photovoltaic field, and the characteristics of these Manakov soliton pairs are also discussed in detail.

  11. Genes2FANs: connecting genes through functional association networks

    Directory of Open Access Journals (Sweden)

    Dannenfelser Ruth

    2012-07-01

    Full Text Available Abstract Background Protein-protein, cell signaling, metabolic, and transcriptional interaction networks are useful for identifying connections between lists of experimentally identified genes/proteins. However, besides physical or co-expression interactions there are many ways in which pairs of genes, or their protein products, can be associated. By systematically incorporating knowledge on shared properties of genes from diverse sources to build functional association networks (FANs, researchers may be able to identify additional functional interactions between groups of genes that are not readily apparent. Results Genes2FANs is a web based tool and a database that utilizes 14 carefully constructed FANs and a large-scale protein-protein interaction (PPI network to build subnetworks that connect lists of human and mouse genes. The FANs are created from mammalian gene set libraries where mouse genes are converted to their human orthologs. The tool takes as input a list of human or mouse Entrez gene symbols to produce a subnetwork and a ranked list of intermediate genes that are used to connect the query input list. In addition, users can enter any PubMed search term and then the system automatically converts the returned results to gene lists using GeneRIF. This gene list is then used as input to generate a subnetwork from the user’s PubMed query. As a case study, we applied Genes2FANs to connect disease genes from 90 well-studied disorders. We find an inverse correlation between the counts of links connecting disease genes through PPI and links connecting diseases genes through FANs, separating diseases into two categories. Conclusions Genes2FANs is a useful tool for interpreting the relationships between gene/protein lists in the context of their various functions and networks. Combining functional association interactions with physical PPIs can be useful for revealing new biology and help form hypotheses for further experimentation. Our

  12. Systematic structural characterization of metabolites in Arabidopsis via candidate substrate-product pair networks.

    Science.gov (United States)

    Morreel, Kris; Saeys, Yvan; Dima, Oana; Lu, Fachuang; Van de Peer, Yves; Vanholme, Ruben; Ralph, John; Vanholme, Bartel; Boerjan, Wout

    2014-03-01

    Plant metabolomics is increasingly used for pathway discovery and to elucidate gene function. However, the main bottleneck is the identification of the detected compounds. This is more pronounced for secondary metabolites as many of their pathways are still underexplored. Here, an algorithm is presented in which liquid chromatography-mass spectrometry profiles are searched for pairs of peaks that have mass and retention time differences corresponding with those of substrates and products from well-known enzymatic reactions. Concatenating the latter peak pairs, called candidate substrate-product pairs (CSPP), into a network displays tentative (bio)synthetic routes. Starting from known peaks, propagating the network along these routes allows the characterization of adjacent peaks leading to their structure prediction. As a proof-of-principle, this high-throughput cheminformatics procedure was applied to the Arabidopsis thaliana leaf metabolome where it allowed the characterization of the structures of 60% of the profiled compounds. Moreover, based on searches in the Chemical Abstract Service database, the algorithm led to the characterization of 61 compounds that had never been described in plants before. The CSPP-based annotation was confirmed by independent MS(n) experiments. In addition to being high throughput, this method allows the annotation of low-abundance compounds that are otherwise not amenable to isolation and purification. This method will greatly advance the value of metabolomics in systems biology.

  13. Grouped pair-wise comparison for subjective sound quality evaluation

    Institute of Scientific and Technical Information of China (English)

    MAO Dongxing; GAO Yali; YU Wuzhou; WANG Zuomin

    2006-01-01

    In subjective sound quality pair-wise comparison evaluation, test time grows with square of the number of sound stimulus. For this reason, subjective evaluation of large quantity of stimulus is difficult to carry out with pair-wise comparison method. A grouped pair-wise comparison (GPC) method is proposed to greatly decrease time and difficult of subjective comparison test, in which stimuli in the whole evaluation corpus are divided into N test groups,with reference-link stimuli configured in each group. Derived from subjective results of each group, final results of all stimuli are reconstructed, and their perceptual attributes of sound quality can be analyzed. With car interior noise as example, realization of subjective sound quality evaluation with GPC method is introduced. The results of GPC evaluation are in good agreement with those obtained from paired comparison and semantic differential methods.

  14. Using Single Colors and Color Pairs to Communicate Basic Tastes

    Directory of Open Access Journals (Sweden)

    Andy T. Woods

    2016-07-01

    Full Text Available Recently, it has been demonstrated that people associate each of the basic tastes (e.g., sweet, sour, bitter, and salty with specific colors (e.g., red, green, black, and white. In the present study, we investigated whether pairs of colors (both associated with a particular taste or taste word would give rise to stronger associations relative to pairs of colors that were associated with different tastes. We replicate the findings of previous studies highlighting the existence of a robust crossmodal correspondence between individual colors and basic tastes. However, while there was evidence that pairs of colors could indeed communicate taste information more consistently than single colors, our participants took more than twice as long to match the color pairs with tastes than the single colors. Possible reasons for these results are discussed.

  15. Wind power wetland survey and duck pair count instructions

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — Initial Survey Instructions for wind power wetland survey and duck pair count instructions for Kulm Wetland Management District. This survey has two surveying...

  16. An electrically injected photon-pair source at room temperature

    CERN Document Server

    Boitier, Fabien; Autebert, Claire; Lemaître, Aristide; Galopin, Elisabeth; Manquest, Christophe; Sirtori, Carlo; Favero, Ivan; Leo, Giuseppe; Ducci, Sara

    2013-01-01

    One of the main challenges for future quantum information technologies is miniaturization and integration of high performance components in a single chip. In this context, electrically driven sources of non-classical states of light have a clear advantage over optically driven ones. Here we demonstrate the first electrically driven semiconductor source of photon pairs working at room temperature and telecom wavelength. The device is based on type-II intracavity Spontaneous Parametric Down-Conversion in an AlGaAs laser diode and generates pairs at 1.57 $\\mu$m. Time-correlation measurements of the emitted pairs give an internal generation efficiency of $7 \\times 10^{-11}$ pairs/injected electron. The capability of our platform to support generation, manipulation and detection of photons opens the way to the demonstration of massively parallel systems for complex quantum operations.

  17. Effect of base pairing on the electrochemical oxidation of guanine.

    Science.gov (United States)

    Costentin, Cyrille; Hajj, Viviane; Robert, Marc; Savéant, Jean-Michel; Tard, Cédric

    2010-07-28

    The effect of base pairing by cytosine on the electrochemical oxidation of guanine is examined by means of cyclic voltammetry on carefully purified reactants in a solvent, CHCl(3), which strongly favors the formation of an H-bonded pair. The thermodynamics and kinetics of the oxidation reaction are not strongly influenced by the formation of the pair. They are actually similar to those of the reaction in which 2,6-lutidine, an encumbered base that cannot form a pair with guanine, replaces cytosine. The reaction does not entail a concerted proton-electron mechanism, as attested by the absence of H/D isotope effect. It rather involves the rate-determining formation of the cation radical, followed by its deprotonation and dimerization of the resulting neutral radical in competition with its further oxidation.

  18. A flexible algorithm for calculating pair interactions on SIMD architectures

    CERN Document Server

    Páll, Szilárd

    2013-01-01

    Calculating interactions or correlations between pairs of particles is typically the most time-consuming task in particle simulation or correlation analysis. Straightforward implementations using a double loop over particle pairs have traditionally worked well, especially since compilers usually do a good job of unrolling the inner loop. In order to reach high performance on modern CPU and accelerator architectures, single-instruction multiple-data (SIMD) parallelization has become essential. Avoiding memory bottlenecks is also increasingly important and requires reducing the ratio of memory to arithmetic operations. Moreover, when pairs only interact within a certain cut-off distance, good SIMD utilization can only be achieved by reordering input and output data, which quickly becomes a limiting factor. Here we present an algorithm for SIMD parallelization based on grouping a fixed number of particles, e.g. 2, 4, or 8, into spatial clusters. Calculating all interactions between particles in a pair of such cl...

  19. Role of triplet polaron pairs in conjugated polymer photophysics

    Science.gov (United States)

    Wesely, Elizabeth; Rothberg, Lewis; Marchetti, Alfred; Chen, Shaw; Geng, Yanhou; Culligan, Sean

    2007-03-01

    We measure the decay of the long-lived fluorescence of a conjugated oligofluorene at temperatures from 300 K to 20 K. We conclude that nearly all of this emission arises from geminate recombination of photogenerated polaron pairs to reform the singlet exciton, and that charge pair recombination represents a significant contribution to the overall fluorescence quantum yield. The unusual nonmonotonic decay dynamics of the delayed fluorescence can be explained if we assume interconversion between singlet and triplet polaron pairs on the submicrosecond time scale. (˜500 ns.) We are able to model the decay of the delayed fluorescence by assuming activated recombination from a Gaussian energy distribution of singlet polaron pairs centered 0.2 eV below the excited state and having a standard deviation of 0.12 eV. The model is relevant to recent work involving the measurement of singlet-triplet branching ratios and to the yields of electroluminescent devices.

  20. Behaviour of entanglement and Cooper pairs under relativistic boosts

    CERN Document Server

    Palge, Veiko; Dunningham, Jacob A

    2011-01-01

    Recent work has shown how single-particle entangled states are transformed when boosted in relativistic frames for certain restricted geometries. Here we extend that work to consider completely general inertial boosts. We then apply our single particle results to multiparticle entanglements by focussing on Cooper pairs of electrons. We show that a standard Cooper pair state consisting of a spin-singlet acquires spin-triplet components in a relativistically boosted inertial frame, regardless of the geometry. We also show that, if we start with a spin-triplet pair, two out of the three triplet states acquire a singlet component, the size of which depends on the geometry. This transformation between the different singlet and triplet superconducting pairs may lead to a better understanding of unconventional superconductivity.

  1. Behavior of entanglement and Cooper pairs under relativistic boosts

    Energy Technology Data Exchange (ETDEWEB)

    Palge, Veiko; Dunningham, Jacob A. [School of Physics and Astronomy, University of Leeds, Leeds LS2 9JT (United Kingdom); Vedral, Vlatko [Clarendon Laboratory, University of Oxford, Parks Road, Oxford OX1 3PU (United Kingdom); Centre for Quantum Technologies, National University of Singapore, 3 Science Drive 2, Singapore 117543 (Singapore); Department of Physics, National University of Singapore, 2 Science Drive 3, Singapore 117542 (Singapore)

    2011-10-15

    Recent work [J. A. Dunningham, V. Palge, and V. Vedral, Phys. Rev. A 80, 044302 (2009)] has shown how single-particle entangled states are transformed when boosted in relativistic frames for certain restricted geometries. Here we extend that work to consider completely general inertial boosts. We then apply our single-particle results to multiparticle entanglements by focusing on Cooper pairs of electrons. We show that a standard Cooper pair state consisting of a spin-singlet acquires spin-triplet components in a relativistically boosted inertial frame, regardless of the geometry. We also show that, if we start with a spin-triplet pair, two out of the three triplet states acquire a singlet component, the size of which depends on the geometry. This transformation between the different singlet and triplet superconducting pairs may lead to a better understanding of unconventional superconductivity.

  2. Polarization operator approach to pair creation in short laser pulses

    CERN Document Server

    Meuren, Sebastian; Keitel, Christoph H; Di Piazza, Antonino

    2014-01-01

    We investigate the nonlinear Breit-Wheeler process inside short laser pulses, i.e. the creation of an electron-positron pair induced by a gamma photon inside a plane-wave background field. To obtain the total pair-creation probability we verify (to leading-order) the cutting rule for the polarization operator in the realm of strong-field QED by an explicit calculation. Furthermore, a double-integral representation for the leading-order contribution to the field-dependent part of the polarization operator is derived. The combination of both results yields a compact expression for the total pair-creation probability inside an arbitrary plane-wave background field. It is shown numerically that with presently available technology pair-creation probabilities of the order of ten percent could be reached for a single gamma photon.

  3. Instructions for use of standardized pair count field forms

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — Standardized instructions of waterfowl pair count forms for use in the Four-Square Mile survey on Wetland Management Districts. These forms have been designed for...

  4. Updates on Pairing Issues with the US Antarctic Meteorite Collection

    Science.gov (United States)

    Righter, K.; Satterwhite, C.; Schutt, J.

    2015-01-01

    The US Antarctic meteorite program has re-covered >21,000 meteorites since 1976, with thousands of those recovered from several icefields over multiple seasons, some-times spanning over a decade [1]. Pairing is assigned as best as possible at the time of classification, based on information from the field team, macro-scale hand sample features in the lab, and petrography, but later focused studies can reveal details that suggest re-evaluation of pairing groups. As a result, pairing groups are revealed over time, and must be continuously updated. Here we examine a few groups with known issues and give an update on some of the larger or more significant pairing groups.

  5. Dependence of Two-proton Radioactivity on Nuclear Pairing Models

    CERN Document Server

    Oishi, Tomohiro; Pastore, Alessandro

    2016-01-01

    The sensitivity of two-proton emitting decays to the nuclear pairing correlation is discussed within a time-dependent three-body model. We focus on the $^6$Be nucleus assuming $\\alpha + p + p$ configuration, and its decay process is described as a time-evolution of the three-body resonance state. A noticeable model-dependence of two-proton decay width is found by utilizing schematic density-dependent contact (SDDC) and the finite-range Minnesota pairing models. The model-dependence with the SDDC pairing interaction can be understood from the density distribution of the resonance state, which reflects a synergy of participating interactions. Our result suggests that two-proton decay width may be a suitable reference quantity to sophisticate the nuclear pairing model beyond the nucleon driplines.

  6. Pair Production in Near Extremal Kerr-Newman Black Holes

    CERN Document Server

    Chen, Chiang-Mei; Sun, Jia-Rui; Tang, Fu-Yi

    2016-01-01

    The spontaneous pair production of charged scalars in a near extremal Kerr-Newman (KN) black hole is analytically studied. It is shown that the existence condition for the pair production is equivalent to the violation of the Breitenlohner-Freedman bound in an AdS$_2$ space. The mean number of produced pairs in the extremal black hole has a thermal interpretation, in which the effective temperature for the Schwinger effect in the AdS$_2$ space persistently holds, while the mean number in the near extremal black hole has an additional factor of the Schwinger effect in the Rindler space. In addition, the holographic dual conformal field theory (CFT) descriptions of the charged scalar pair production are respectively realized both in the $J$ and $Q$ pictures in terms of the KN/CFTs correspondence.

  7. Latest theory developments for top pair production, generators and showering

    CERN Document Server

    Re, Emanuele

    2016-01-01

    I summarize the state of the art of cross-section computations and of available simulation tools for top-quark pair production in hadron collisions. Particular emphasis is put on recent theory developments relevant for LHC phenomenology.

  8. Model of pair aggregation on the Bethe lattice

    DEFF Research Database (Denmark)

    Baillet, M.V.-P.; Pacheco, A.F.; Gómez, J.B.

    1997-01-01

    We extend a recent model of aggregation of pairs of particles, analyzing the case in which the supporting framework is a Bethe lattice. The model exhibits a critical behavior of the percolation theory type....

  9. ttbar(+x) pair production at CMS and ATLAS

    CERN Document Server

    Seidel, Markus

    2016-01-01

    The production cross section of top quark pairs was measured by the ATLAS and CMS collaborations at the Large Hadron Collider (LHC) in pp collisions at 7-13.This report briefly summarizes the most recent results.

  10. Top quark pair cross section prospects in ATLAS

    CERN Document Server

    Gaponenko, Andrei

    2009-01-01

    The observation of the top quark will be an important milestone in ATLAS. This talk reviews methods that ATLAS plans to use to observe the top quark pair production process and measure its cross section.

  11. Pairing-fluctuation effect in d-wave superconductivity

    CERN Document Server

    Yan, X Z

    2003-01-01

    On the basis of a ladder-diagram approximation, we study the pairing-fluctuation effect in d-wave superconductivity. The single particles and pairs are treated on an equal footing. In the superconducting state, the predominant pairing fluctuation is due to the excitation of pairs to the states of the Goldstone mode. These bosonic degrees of freedom are relevant to the pseudogap physics in high-T sub c cuprates. The Green function of electrons is obtained as an analytic solution to a cubic equation. The superconducting order parameter and the transition temperature are substantially reduced from the values of the mean-field theory. The calculated phase boundary of the superconductivity can reasonably describe the experiment results for cuprates. (letter to the editor)

  12. Extended Homogeneous Balance Method and Lax Pairs, Backlund Transformation

    Institute of Scientific and Technical Information of China (English)

    BAI ChengLin

    2002-01-01

    Using the extended homogeneous balance method, which is very concise and primary, Lax pairs and Backlund transformation for most nonlinear evolution equations, such as the compound KdV-Burgers equation and nonlinear diffusion equation are obtained.

  13. Complexation of Nitrous Oxide by Frustrated Lewis Pairs

    NARCIS (Netherlands)

    Otten, Edwin; Neu, Rebecca C.; Stephan, Douglas W.

    2009-01-01

    Frustrated Lewis pairs comprised of a basic yet sterically encumbered phosphine with boron Lewis acids bind nitrous oxide to give intact PNNOB linkages. The synthesis, structure, and bonding of these species are described.

  14. Intellectual similarity of virtual twin pairs: Developmental trends.

    Science.gov (United States)

    Segal, Nancy L; McGuire, Shirley A; Havlena, June; Gill, Patricia; Hershberger, Scott L

    2007-05-01

    Virtual twins (VTs) are same-age unrelated siblings reared together from infancy who replicate twinship, but without the genetic relatedness. A 2005 report from the ongoing Fullerton Virtual Twin Study found an IQ intraclass correlation of .26 (p < .01, n = 113 pairs) and a within-pair difference of 13.22 IQ points. The average age of VTs in that study was 8.10 years (SD = 8.56, range: 4.01-54.84 years). An opportunity to retest members of 43 VT pairs, 1.70-8.96 years after their time 1 assessment, allowed additional analyses of genetic and environmental influences underlying general intellectual development. A decrease in the VT IQ correlation and an increase in the within-pair difference were indicated, consistent with increasing genetic and/or non-shared environmental influences and decreasing shared environmental influence on general intellectual development throughout childhood.

  15. Driven quantum tunneling and pair creation with graphene Landau levels

    CERN Document Server

    Gagnon, Denis; Dumont, Joey; Lefebvre, Catherine; MacLean, Steve

    2016-01-01

    Driven tunneling between graphene Landau levels is theoretically linked to the process of pair creation from vacuum, a prediction of quantum electrodynamics (QED). Landau levels are created by the presence of a strong, constant, quantizing magnetic field perpendicular to a graphene mono-layer. Following the formal analogy between QED and the description of low-energy excitations in graphene, solutions of the fully interacting Dirac equation are used to compute electron-hole pair creation driven by a circularly or linearly polarized field. This is achieved via the coupled channel method, a numerical scheme for the solution of the time-dependent Dirac equation in the presence of bound states. The case of a monochromatic driving field is first considered, followed by the more realistic case of a pulsed excitation. We show that the pulse duration yields an experimental control parameter over the maximal pair yield. Orders of magnitude of the pair yield are given for experimentally achievable magnetic fields and l...

  16. Amicable pairs and aliquot cycles for elliptic curves

    CERN Document Server

    Stange, Katherine E

    2009-01-01

    An amicable pair for an elliptic curve E/Q is a pair of primes (p,q) of good reduction for E satisfying #E(F_p) = q and #E(F_q) = p. In this paper we study elliptic amicable pairs and analogously defined longer elliptic aliquot cycles. We show that there exist elliptic curves with arbitrarily long aliqout cycles, but that CM elliptic curves (with j not 0) have no aliqout cycles of length greater than two. We give conjectural formulas for the frequency of amicable pairs. For CM curves, the derivation of precise conjectural formulas involves a detailed analysis of the values of the Grossencharacter evaluated at a prime ideal P in End(E) having the property that #E(F_P) is prime. This is especially intricate for the family of curves with j = 0.

  17. Immunoglobulin genes

    Energy Technology Data Exchange (ETDEWEB)

    Honjo, T. (Kyoto Univ. (Japan)); Alt, F.W. (Columbia Univ., Dobbs Ferry, NY (USA). Hudson Labs.); Rabbitts, T.H. (Medical Research Council, Cambridge (UK))

    1989-01-01

    This book reports on the structure, function, and expression of the genes encoding antibodies in normal and neoplastic cells. Topics covered are: B Cells; Organization and rearrangement of immunoglobin genes; Immunoglobin genes in disease; Immunoglobin gene expression; and Immunoglobin-related genes.

  18. Multi-pair excitations in an electron liquid

    Science.gov (United States)

    Bachlechner, M. E.; Holas, A.; Böhm, H. M.; Schinner, A.

    1996-07-01

    Single (particle-hole)-pair excitations, as described in the well-known Lindhard function, are restricted to a strip in the ( q, ω) plane — the so-called particle-hole continuum. We present a perturbational analysis of the dynamic dielectric function allowing a generalization of this property for n-pair contributions. Consequences for the electron energy-loss function and related quantities are discussed.

  19. Statistical mechanics of base stacking and pairing in DNA melting

    OpenAIRE

    Ivanov, Vassili; Zeng, Yan; Zocchi, Giovanni

    2004-01-01

    We propose a statistical mechanics model for DNA melting in which base stacking and pairing are explicitly introduced as distinct degrees of freedom. Unlike previous approaches, this model describes thermal denaturation of DNA secondary structure in the whole experimentally accessible temperature range. Base pairing is described through a zipper model, base stacking through an Ising model. We present experimental data on the unstacking transition, obtained exploiting the observation that at m...

  20. Nucleon-Pair Shell Model: Magnetic Excitations for Ba Isotopes

    Institute of Scientific and Technical Information of China (English)

    LUO YanAn; NING PingZhi

    2002-01-01

    Magnetic excitations for Ba isotopes are discussed within the nucleon-pair shell model trmicated iti the SDsubspace. With the SD pair determined by a surface-δ interaction, M1 transitions for 1344Ba are well fitted. The M1 andM3 transitions for 132Ba and 130Ba are also predicted. It is shown that the statement, the collective magnetic propertiesarc due to the orbital motion of nucleons, is approximately valid.

  1. Scalar Pair Production in the Aharonov-Bohm Potential

    CERN Document Server

    Shahin, G Y

    2005-01-01

    In the framework of QED, scalar pair production by a single linearly polarized high-energy photon in the presence of an external Aharonov-Bohm potential is investigated. The exact scattering solutions of the Klein-Gordon equation in cylindrically symmetric field are constructed and used to write the first order transition amplitude. The matrix elements and the corresponding differential scattering cross-section are calculated. The pair production at both the nonrelativistic and the ultrarelativistic limits is discussed.

  2. Pair creation and an x-ray free electron laser.

    Science.gov (United States)

    Alkofer, R; Hecht, M B; Roberts, C D; Schmidt, S M; Vinnik, D V

    2001-11-05

    Using a quantum kinetic equation we study the possibility that focused beams at proposed x-ray free electron laser facilities can initiate spontaneous electron-positron pair production from the QED vacuum. Under conditions reckoned achievable at planned facilities, repeated cycles of particle creation and annihilation will take place in tune with the laser frequency. The peak particle number density is insensitive to this frequency, and one can anticipate the production of a few hundred particle pairs per laser period.

  3. Semiclassical fermion pair creation in de Sitter spacetime

    Energy Technology Data Exchange (ETDEWEB)

    Stahl, Clément, E-mail: clement.stahl@icranet.org; Eckhard, Strobel, E-mail: eckhard.strobel@irap-phd.eu [ICRANet, Piazzale della Repubblica 10, 65122 Pescara (Italy); Dipartimento di Fisica, Università di Roma “La Sapienza”, Piazzale Aldo Moro 5, 00185 Rome (Italy); Université de Nice Sophia Antipolis, 28 Avenue de Valrose, 06103 Nice Cedex 2 (France)

    2015-12-17

    We present a method to semiclassically compute the pair creation rate of bosons and fermions in de Sitter spacetime. The results in the bosonic case agree with the ones in the literature. We find that for the constant electric field the fermionic and bosonic pair creation rate are the same. This analogy of bosons and fermions in the semiclassical limit is known from several flat spacetime examples.

  4. Pairs of periodic orbits with fixed homology difference

    DEFF Research Database (Denmark)

    Risager, Morten S.; Sharp, Richard

    2010-01-01

    We obtain an asymptotic formula for the number of pairs of closed orbits of a  weak-mixing transitive Anosov ¿ow whose homology classes have a ¿xed di¿erence.......We obtain an asymptotic formula for the number of pairs of closed orbits of a  weak-mixing transitive Anosov ¿ow whose homology classes have a ¿xed di¿erence....

  5. Relationship among malocclusion, number of occlusal pairs and mastication

    OpenAIRE

    Vanesa Rios-Vera; Alfonso Sánchez-Ayala; Plínio Mendes Senna; Gustavo Watanabe-Kanno; Altair Antoninha Del Bel Cury; Renata Cunha Matheus Rodrigues Garcia

    2010-01-01

    This study evaluated the relationship among malocclusion, number of occlusal pairs, masticatory performance, masticatory time and masticatory ability in completely dentate subjects. Eighty healthy subjects (mean age = 19.40 ± 4.14 years) were grouped according to malocclusion diagnosis (n = 16): Class I, Class Class II-2, Class III and Normocclusion (control). Number of occlusal pairs was determined clinically. Masticatory performance was evaluated by the sieving method, and the time used for...

  6. SD-Pair Shell Model for Identical Nuclear Systems

    Institute of Scientific and Technical Information of China (English)

    LUO Yan-An; PAN Feng; NING Ping-Zhi; Jerry P. Draayer

    2005-01-01

    @@ Typical spectra corresponding to vibrational, rotational and γ-soft cases were studied within the framework of nucleon-pair shell model truncated to SD-subspace. It is found that the three limiting cases all can be reproduced approximately. The analysis not only shows that the IBM indeed has a sound shell model foundation, but also confirms that the truncation scheme adopted in the SD-pair shell model seems to be reasonable.

  7. PAIR-DRILL DESIGN IN TEACHING INTERPRETATION COURSE

    Institute of Scientific and Technical Information of China (English)

    Yang; Yingming

    2001-01-01

    This article explores the benefits of pair-drill interpretationexercises to combat the problem of interpretation on ChineseNational College campus where there is no English speakingenvironment, and a lack of realistic interpretation practice. Tocreate a lively atmosphere whilst practicing teaching English-Chinese oral interpretation, the teacher designed a system ofpair-drill interpretation scenarios and learning projects. Underthe teacher’s guidance students pair up to practice interpretationboth inside and outside the classroom.

  8. Identifying interacting pairs of sites in infinite range Ising models

    CERN Document Server

    Galves, Antonio; Takahashi, Daniel Yasumasa

    2010-01-01

    We consider Ising models (pairwise interaction Gibbs probability measures) in $\\Z^d$ with an infinite range potential. We address the problem of identifying pairs of interacting sites from a finite sample of independent realisations of the Ising model. The sample contains only the values assigned by the Ising model to a finite set of sites in $\\Z^d$. Our main result is an upperbound for the probability with our estimator to misidentify the pairs of interacting sites in this finite set.

  9. Schwinger pairs production in a soft-wall model

    Science.gov (United States)

    Qu, Feng; Zeng, Ding-fang

    2016-12-01

    The Schwinger pairs production rate is calculated numerically in the soft-wall model with the help of a simpler method in determining the soft-wall's position beyond which probe strings connecting the Schwinger pairs do not fall into. The critical behavior of the production rate and linear part in the middle region are both studied carefully. The latter manifests interesting new features. The results are compared with those in previous hard-wall models.

  10. Pairing Field and Moments of Inertia of Superdeformed Nuclei

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    The dynamic moments of inertia of the experimental superdeformed bands observed in the A=190,150 and 60~80 mass regions were systematically analyzed. By getting together the different massregions the dramatic features of the dynamic moments of inertia were found and explained based on thecalculations of the pairing fields of SD nuclei with the anisotropic harmonic oscillator quadrupole pairingHartree-Fock-Bogolyubor model. The gradually rising behavior of J2 indicates that the SD states in the

  11. Pairing Field and Moments of Inertia of Superdeformed Nuclei

    Institute of Scientific and Technical Information of China (English)

    陈永静; 陈永寿; 陈辅新

    2002-01-01

    We have systematically analysed the dynamic moments of inertia of the experimental superdeformed (SD)bands observed in the A = 190, 150 and 60-80 mass regions as functions of rotational frequency. By combining the different mass regions, the dramatic features of the dynamic moments of inertia were found and explained based on the calculations of the pairing fields of SD nuclei with the anisotropic harmonic oscillator quadrupole pairing Hartree-Fock-Bogoliubov model.

  12. New Common Proper-Motion Pairs From the PPMX Catalog

    CERN Document Server

    Caballero, Rafael; Pozuelo-González, Sara; Fernández-Sánchez, Antonio

    2010-01-01

    We use data mining techniques for finding 82 previously unreported common proper motion pairs from the PPM-Extended catalogue. Special-purpose software automating the different phases of the process has been developed. The software simplifies the detection of the new pairs by integrating a set of basic operations over catalogues. The operations can be combined by the user in scripts representing different filtering criteria. This procedure facilitates testing the software and employing the same scripts for different projects.

  13. Feneric Fermi Size Enhancement of Pairing in Mesoscopic Fermi Systems

    CERN Document Server

    Farine, M; Schuck, P; Viñas, X

    2002-01-01

    The finite size dependent enhancement of pairing in mesoscopic Fermi systems is studied under the assumption that the BCS approach is valid and that the two body force is size independent. Different systems are investigated such as superconducting metallic grains and films as well as atomic nuclei. It is shown that the finite size enhancement of pairing in these systems is a surface effect which, when properly included, accounts for the data.

  14. Stochastic number projection method in the pairing-force problem

    CERN Document Server

    Capote, R; Capote, Roberto; Gonzalez, Augusto

    1999-01-01

    A new stochastic number projection method is proposed. The component of the BCS wave function corresponding to the right number of particles is obtained by means of a Metropolis algorithm in which the weight functions are constructed from the single-particle occupation probability. Either standard BCS or Lipkin-Nogami probability distributions can be used, thus the method is applicable for any pairing strength. The accuracy of the method is tested in the computation of pairing energies of model and real systems.

  15. Schwinger pairs production in a soft-wall model

    CERN Document Server

    Qu, Feng

    2016-01-01

    The Schwinger pairs production rate is calculated numerically in the soft-wall model with the help of a simpler method in determining the soft-wall's position beyond which probe strings connecting the Schwinger pairs do not fall into. Behaviours of the production rate in both the upper critical region and the middle linear part are studied carefully. The latter exhibits interesting new features un-noted previously. All results are presented in comparisons with hard-wall models.

  16. Pair-instability supernovae in the local universe

    Energy Technology Data Exchange (ETDEWEB)

    Whalen, Daniel J. [Zentrum für Astronomie, Institut für Theoretische Astrophysik, Universität Heidelberg, Albert-Ueberle-Str. 2, D-69120 Heidelberg (Germany); Smidt, Joseph [CCS-2, Los Alamos National Laboratory, Los Alamos, NM 87545 (United States); Heger, Alexander [Monash Centre for Astrophysics, Monash University, Victoria 3800 (Australia); Hirschi, Raphael [Astrophysics Group, EPSAM, University of Keele, Lennard-Jones Labs, Keele ST5 5BG (United Kingdom); Yusof, Norhasliza [Department of Physics, University of Malaysia, 50603 Kuala Lampur (Malaysia); Even, Wesley; Fryer, Chris L. [T-2, Los Alamos National Laboratory, Los Alamos, NM 87545 (United States); Stiavelli, Massimo [Space Telescope Science Institute, 3700 San Martin Drive, Baltimore, MD 21218 (United States); Chen, Ke-Jung [Department of Astronomy and Astrophysics, UCSC, Santa Cruz, CA 95064 (United States); Joggerst, Candace C. [XTD-3, Los Alamos National Laboratory, Los Alamos, NM 87545 (United States)

    2014-12-10

    The discovery of 150-300 M {sub ☉} stars in the Local Group and pair-instability supernova candidates at low redshifts has excited interest in this exotic explosion mechanism. Realistic light curves for pair-instability supernovae at near-solar metallicities are key to identifying and properly interpreting these events as more are found. We have modeled pair-instability supernovae of 150-500 M {sub ☉} Z ∼ 0.1-0.4 Z {sub ☉} stars. These stars lose up to 80% of their mass to strong line-driven winds and explode as bare He cores. We find that their light curves and spectra are quite different from those of Population III pair-instability explosions, which therefore cannot be used as templates for low-redshift events. Although non-zero metallicity pair-instability supernovae are generally dimmer than their Population III counterparts, in some cases they will be bright enough to be detected at the earliest epochs at which they can occur, the formation of the first galaxies at z ∼ 10-15. Others can masquerade as dim, short duration supernovae that are only visible in the local universe and that under the right conditions could be hidden in a wide variety of supernova classes. We also report for the first time that some pair-instability explosions can create black holes with masses of ∼100 M {sub ☉}.

  17. One-photon pair annihilation in magnetized relativistic plasmas

    Science.gov (United States)

    Harding, A. K.

    1986-01-01

    In supersonic magnetic fields, electron-positron pairs may annihilate into single photons producing spectral features above 1 MeV. The paper calculates the exact one-photon annihilation rate in the general case where pairs may annihilate from excited Landau states, extending the previous studies which were restricted to pairs in the ground state. Asymptotic expressions for annihilation spectra and rates in the limit of large pair quantum numbers are also derived. It is found that the rate of annihilation from excited states can exceed the rate from the ground state by orders of magnitude in fields less than about 2 x 10 to the 12th G. This allows one-photon annihilation to be competitive with the two-photon process at typical neutron star field strengths. Annihilation spectra from a Maxwellian pair plasma at transrelativistic temperatures show fine structure near threshold on a scale (h/2pi)omega sub B as the result of contributions from individual pair states, which blend into a smooth continuum at higher energies.

  18. Phase shifts of the paired wings of butterfly diagrams

    Institute of Scientific and Technical Information of China (English)

    Ke-Jun Li; Hong-Fei Liang; Wen Feng

    2010-01-01

    Sunspot groups observed by the Royal Greenwich Observatory/US Air Force/NOAA from 1874 May to 2008 November and the Carte Synoptique solar filaments from 1919 March to 1989 December are used to investigate the relative phase shift of the paired wings of butterfly diagrams of sunspot and filament activities.Latitudinal migration of sunspot groups(or filaments)does asynchronously occur in the northern and southern hemispheres,and there is a relative phase shift between the paired wings of their butterfly diagrams in a cycle,making the paired wings spatially asymmetrical on the solar equator.It is inferred that hemispherical solar activity strength should evolve in a similar way within the paired wings of a butterfly diagram in a cycle,demonstrating the paired wings phenomenon and showing the phase relationship between the northern and southern hemispherical solar activity strengths,as well as a relative phase shift between the paired wings of a butterfly diagram,which should bring about almost the same relative phase shift of hemispheric solar activity strength.

  19. The Phase Shifts of the Paired Wings of Butterfly Diagrams

    CERN Document Server

    Li, Kejun; Feng, Wen

    2010-01-01

    Sunspot groups observed by Royal Greenwich Observatory/US Air Force/NOAA from May 1874 to November 2008 and the Carte Synoptique solar filaments from March 1919 to December 1989 are used to investigate the relative phase shift of the paired wings of butterfly diagrams of sunspot and filament activities. Latitudinal migration of sunspot groups (or filaments) does asynchronously occur in the northern and southern hemispheres, and there is a relative phase shift between the paired wings of their butterfly diagrams in a cycle, making the paired wings spatially asymmetrical on the solar equator. It is inferred that hemispherical solar activity strength should evolve in a similar way within the paired wings of a butterfly diagram in a cycle, making the paired wings just and only keep the phase relationship between the northern and southern hemispherical solar activity strengths, but a relative phase shift between the paired wings of a butterfly diagram should bring about an almost same relative phase shift of hemis...

  20. Observer dependence of bubble nucleation and Schwinger pair production

    CERN Document Server

    Garriga, Jaume; Sasaki, Misao; Soda, Jiro; Vilenkin, Alexander

    2012-01-01

    Pair production in a constant electric field is closely analogous to bubble nucleation in a false vacuum. The classical trajectories of the pairs are Lorentz invariant, but it appears that this invariance should be broken by the nucleation process. Here, we use a model detector, consisting of other particles interacting with the pairs, to investigate how pair production is seen by different Lorentzian observers. We focus on the idealized situation where a constant external electric field is present for an infinitely long time, and we consider the in-vacuum state for a charged scalar field that describes the nucleating pairs. The in-vacuum is defined in terms of modes which are positive frequency in the remote past. Even though the construction uses a particular reference frame and a gauge where the vector potential is time dependent, we show explicitly that the resulting quantum state is Lorentz invariant. We then introduce a "detector" particle which interacts with the nucleated pairs, and show that all Lore...