
Sample records for circulating recombinant form

  1. Emergence of recombinant forms in geographic regions with co-circulating HIV subtypes in the dynamic HIV-1 epidemic

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Ming [Los Alamos National Laboratory; Letiner, Thomas K [Los Alamos National Laboratory; Korber, Bette T [Los Alamos National Laboratory; Foley, Brian [Los Alamos National Laboratory


    We have reexamined the subtype designations of {approx}10,000 subtype A, B, C, G, and AG, BC, BF recombinant sequences, and compared the results of the new analysis with their published designations. Intersubtype recombinants dominate HIV epidemics in three different geographical regions. The circulating recombinant from (CRF) CRF02-AG, common in West Central Africa, appears to result from a recombination event that occurred early in the divergence between subtypes A and G, although additional more recent recombination events may have contributed to the breakpoint pattern in this recombinant lineage as well. The Chinese recombinant epidemic strains CRF07 and CRF08, in contrast, result from recent recombinations between more contemporary strains. Nevertheless, CRF07 and CRF08 contributed to many subsequent recombination events. The BF recombinant epidemics in two HIV-1 epicenters in South America are not independent and BF epidemics in South America have an unusually high fraction of unique recombinant forms (URFs) that have each been found only once and carry distinctive breakpoints. Taken together, these analyses reveal a complex and dynamic picture of the current HIV-1 epidemic, and suggest a means of grouping and tracking relationships between viruses through preservation of shared breakpints.

  2. Phylodynamic analysis of porcine circovirus type 2 reveals global waves of emerging genotypes and the circulation of recombinant forms. (United States)

    Franzo, Giovanni; Cortey, Marti; Segalés, Joaquim; Hughes, Joseph; Drigo, Michele


    Since the first description of Porcine circovirus type 2 (PCV2), four genotypes (PCV2a, PCV2b, PCV2c and PCV2d) have been recognized and three of them have been shown to exhibit worldwide distribution. Here, the population dynamics of PCV2 has been reconstructed over time and the factors that have shaped its evolution determined. The results obtained confirm that PCV2 originated approximately at the beginning of the 20th century. The most recent common ancestor of genotypes PCV2a, PCV2b, PCV2c and PCV2d circulated in the 1950s, 1980s, 1960s and 1950s, respectively, and the population sizes of the individual genotypes remained low until the mid 90s, coinciding with the identification of PCV2 as a major pathogen of the pig industry. The population dynamics of PCV2 have been characterized by the appearance of periodic waves of distinct genotypes that, after an initial rise, spread following major swine commercial routes and were then superseded by subsequent emerging genotypes. Various recombinant forms displayed comparable population dynamics and spreading routes to those of major genotypes, suggesting that recombinant strains are able to compete with parental ones. The capsid gene is subjected to immune selection and evasion of the host immune response seems to be a major force for the emergence and spread of new genotypes. In contrast, the evolution of other genes appears to be constrained by the particular genomic organization of PCV2. In summary, obtained results suggest that changes in farming strategies, international trade, host population immunity, recombination and the constraints imposed by genome organization have all played a major role in the evolutionary dynamics of PCV2. PMID:27114187

  3. Heads or Tails: Genotyping of Hepatitis C Virus Concerning the 2k/1b Circulating Recombinant Form (United States)

    Schuermans, Wim; Orlent, Hans; Desombere, Isabelle; Descheemaeker, Patrick; Van Vlierberghe, Hans; Geerts, Anja; Verhelst, Xavier; Reynders, Marijke; Padalko, Elizaveta


    As different hepatitis C virus (HCV) genotypes respond differently to initiated therapy, correct HCV genotyping is essential. A potential risk for misclassification of the intergenotypic HCV circulating recombinant form (CRF) 2k/1b strains exists, depending on the genotyping method used. The aim was to investigate the differences in HCV genotyping methods with regard to CRF 2k/1b and to gain insight in the prevalence of the CRF 2k/1b. Genotyping results by Versant HCV Genotype Assay were compared with nonstructural protein 5B (NS5B) sequencing. In total, from November 2001 until March 2015, 3296 serum samples were analyzed by Versant HCV Genotype Assay. As misclassified CRF is harbored among HCV genotype 2, we further focused our search on 142 (4.3%) samples positive for HCV genotype 2. On 116 (81.7%) retrieved samples, the NS5B sequencing was performed. Twelve out of the 116 retrieved samples (10.3%) were classified as CRF 2k/1b by sequencing of the NS5B region. Ten of these 12 samples were originally misclassified as genotype 2a or 2c, while 2 of them were misclassified as genotype 2. Our results show that the current prevalence of CRF 2k/1b is underestimated. The importance of correct HCV genotyping is emphasized, considering the tailored choice of treatment regimen and overall prognosis. PMID:27563879

  4. Production of Mucosally Transmissible SHIV Challenge Stocks from HIV-1 Circulating Recombinant Form 01_AE env Sequences.

    Directory of Open Access Journals (Sweden)

    Lawrence J Tartaglia


    Full Text Available Simian-human immunodeficiency virus (SHIV challenge stocks are critical for preclinical testing of vaccines, antibodies, and other interventions aimed to prevent HIV-1. A major unmet need for the field has been the lack of a SHIV challenge stock expressing circulating recombinant form 01_AE (CRF01_AE env sequences. We therefore sought to develop mucosally transmissible SHIV challenge stocks containing HIV-1 CRF01_AE env derived from acutely HIV-1 infected individuals from Thailand. SHIV-AE6, SHIV-AE6RM, and SHIV-AE16 contained env sequences that were >99% identical to the original HIV-1 isolate and did not require in vivo passaging. These viruses exhibited CCR5 tropism and displayed a tier 2 neutralization phenotype. These challenge stocks efficiently infected rhesus monkeys by the intrarectal route, replicated to high levels during acute infection, and established chronic viremia in a subset of animals. SHIV-AE16 was titrated for use in single, high dose as well as repetitive, low dose intrarectal challenge studies. These SHIV challenge stocks should facilitate the preclinical evaluation of vaccines, monoclonal antibodies, and other interventions targeted at preventing HIV-1 CRF01_AE infection.

  5. Identification of an HIV-1 BG Intersubtype Recombinant Form (CRF73_BG), Partially Related to CRF14_BG, Which Is Circulating in Portugal and Spain. (United States)

    Fernández-García, Aurora; Delgado, Elena; Cuevas, María Teresa; Vega, Yolanda; Montero, Vanessa; Sánchez, Mónica; Carrera, Cristina; López-Álvarez, María José; Miralles, Celia; Pérez-Castro, Sonia; Cilla, Gustavo; Hinojosa, Carmen; Pérez-Álvarez, Lucía; Thomson, Michael M


    HIV-1 exhibits a characteristically high genetic diversity, with the M group, responsible for the pandemic, being classified into nine subtypes, 72 circulating recombinant forms (CRFs) and numerous unique recombinant forms (URFs). Here we characterize the near full-length genome sequence of an HIV-1 BG intersubtype recombinant virus (X3208) collected in Galicia (Northwest Spain) which exhibits a mosaic structure coincident with that of a previously characterized BG recombinant virus (9601_01), collected in Germany and epidemiologically linked to Portugal, and different from currently defined CRFs. Similar recombination patterns were found in partial genome sequences from three other BG recombinant viruses, one newly derived, from a virus collected in Spain, and two retrieved from databases, collected in France and Portugal, respectively. Breakpoint coincidence and clustering in phylogenetic trees of these epidemiologically-unlinked viruses allow to define a new HIV-1 CRF (CRF73_BG). CRF73_BG shares one breakpoint in the envelope with CRF14_BG, which circulates in Portugal and Spain, and groups with it in a subtype B envelope fragment, but the greatest part of its genome does not appear to derive from CRF14_BG, although both CRFs share as parental strain the subtype G variant circulating in the Iberian Peninsula. Phylogenetic clustering of partial pol and env segments from viruses collected in Portugal and Spain with X3208 and 9691_01 indicates that CRF73_BG is circulating in both countries, with proportions of around 2-3% Portuguese database HIV-1 isolates clustering with CRF73_BG. The fact that an HIV-1 recombinant virus characterized ten years ago as a URF has been shown to represent a CRF suggests that the number of HIV-1 CRFs may be much greater than currently known.

  6. Molecular diversity of HIV-1 among people who inject drugs in Kuala Lumpur, Malaysia: massive expansion of circulating recombinant form (CRF 33_01B and emergence of multiple unique recombinant clusters.

    Directory of Open Access Journals (Sweden)

    Wei Zhen Chow

    Full Text Available Since the discovery of HIV-1 circulating recombinant form (CRF 33_01B in Malaysia in the early 2000 s, continuous genetic diversification and active recombination involving CRF33_01B and other circulating genotypes in the region including CRF01_AE and subtype B' of Thai origin, have led to the emergence of novel CRFs and unique recombinant forms. The history and magnitude of CRF33_01B transmission among various risk groups including people who inject drugs (PWID however have not been investigated despite the high epidemiological impact of CRF33_01B in the region. We update the most recent molecular epidemiology of HIV-1 among PWIDs recruited in Malaysia between 2010 and 2011 by population sequencing and phylogenetic analysis of 128 gag-pol sequences. HIV-1 CRF33_01B was circulating among 71% of PWIDs whilst a lower prevalence of other previously dominant HIV-1 genotypes [subtype B' (11% and CRF01_AE (5%] and CRF01_AE/B' unique recombinants (13% were detected, indicating a significant shift in genotype replacement in this population. Three clusters of CRF01_AE/B' recombinants displaying divergent yet phylogenetically-related mosaic genomes to CRF33_01B were identified and characterized, suggestive of an abrupt emergence of multiple novel CRF clades. Using rigorous maximum likelihood approach and the Bayesian Markov chain Monte Carlo (MCMC sampling of CRF33_01Bpol sequences to elucidate the past population dynamics, we found that the founder lineages of CRF33_01B were likely to have first emerged among PWIDs in the early 1990 s before spreading exponentially to various high and low-risk populations (including children who acquired infections from their mothers and later on became endemic around the early 2000 s. Taken together, our findings provide notable genetic evidence indicating the widespread expansion of CRF33_01B among PWIDs and into the general population. The emergence of numerous previously unknown recombinant clades highlights the

  7. Molecular diversity of HIV-1 among people who inject drugs in Kuala Lumpur, Malaysia: massive expansion of circulating recombinant form (CRF) 33_01B and emergence of multiple unique recombinant clusters. (United States)

    Chow, Wei Zhen; Ong, Lai Yee; Razak, Siti Humaira; Lee, Yeat Mei; Ng, Kim Tien; Yong, Yean Kong; Azmel, Azureen; Takebe, Yutaka; Al-Darraji, Haider Abdulrazzaq Abed; Kamarulzaman, Adeeba; Tee, Kok Keng


    Since the discovery of HIV-1 circulating recombinant form (CRF) 33_01B in Malaysia in the early 2000 s, continuous genetic diversification and active recombination involving CRF33_01B and other circulating genotypes in the region including CRF01_AE and subtype B' of Thai origin, have led to the emergence of novel CRFs and unique recombinant forms. The history and magnitude of CRF33_01B transmission among various risk groups including people who inject drugs (PWID) however have not been investigated despite the high epidemiological impact of CRF33_01B in the region. We update the most recent molecular epidemiology of HIV-1 among PWIDs recruited in Malaysia between 2010 and 2011 by population sequencing and phylogenetic analysis of 128 gag-pol sequences. HIV-1 CRF33_01B was circulating among 71% of PWIDs whilst a lower prevalence of other previously dominant HIV-1 genotypes [subtype B' (11%) and CRF01_AE (5%)] and CRF01_AE/B' unique recombinants (13%) were detected, indicating a significant shift in genotype replacement in this population. Three clusters of CRF01_AE/B' recombinants displaying divergent yet phylogenetically-related mosaic genomes to CRF33_01B were identified and characterized, suggestive of an abrupt emergence of multiple novel CRF clades. Using rigorous maximum likelihood approach and the Bayesian Markov chain Monte Carlo (MCMC) sampling of CRF33_01Bpol sequences to elucidate the past population dynamics, we found that the founder lineages of CRF33_01B were likely to have first emerged among PWIDs in the early 1990 s before spreading exponentially to various high and low-risk populations (including children who acquired infections from their mothers) and later on became endemic around the early 2000 s. Taken together, our findings provide notable genetic evidence indicating the widespread expansion of CRF33_01B among PWIDs and into the general population. The emergence of numerous previously unknown recombinant clades highlights the escalating

  8. Lipid peroxidation and total cholesterol in HAART-naive patients infected with circulating recombinant forms of human immunodeficiency virus type-1 in Cameroon.

    Directory of Open Access Journals (Sweden)

    Georges Teto

    not statistically significant with MDA. The different subtypes obtained after sequencing were CRF02_AG (43.3%, CRF01_AE (20%, A1 (23.3%, H (6.7%, and G (6.7%. None of the HIV-1 subtypes significantly influenced the levels of the biochemical parameters, but by grouping them as pure subtypes and circulating recombinant forms (CRFs, the CRF significantly influenced TC levels. TC was significantly lower in patients infected with CRF (0.87±0.27 g/l compared to patients infected with pure HIV-1 subtypes (1.32±0.68 g/l (p<0.017. MDA levels were also significantly higher in patients infected with HIV-1CRF01_AE (0.50±0.10 µM, compared to patients infected with CRF02_AG (0. 38±0. 08 µM (p<0.018. CONCLUSION: These results show that HIV infection in Cameroon is associated with significant decrease in TAA, LDLC, HDLC and TC, and increased MDA concentration and LPI indices which seem to be linked to the severity of HIV infection as assessed by CD4 cell count. The data suggests increased oxidative stress and lipid peroxidation in HIV-infected patients in Cameroon, and an influence of CRFs on TC and MDA levels.

  9. The predominance of Human Immunodeficiency Virus type 1 (HIV-1 circulating recombinant form 02 (CRF02_AG in West Central Africa may be related to its replicative fitness

    Directory of Open Access Journals (Sweden)

    Butel Christelle


    Full Text Available Abstract Background CRF02_AG is the predominant HIV strain circulating in West and West Central Africa. The aim of this study was to test whether this predominance is associated with a higher in vitro replicative fitness relative to parental subtype A and G viruses. Primary HIV-1 isolates (10 CRF02_AG, 5 subtype A and 5 subtype G were obtained from a well-described Cameroonian cohort. Growth competition experiments were carried out at equal multiplicity of infection in activated T cells and monocyte-derived dendritic cells (MO-DC in parallel. Results Dual infection/competition experiments in activated T cells clearly indicated that CRF02_AG isolates had a significant replication advantage over the subtype A and subtype G viruses. The higher fitness of CRF02_AG was evident for isolates from patients with CD4+ T cell counts >200 cells/μL (non-AIDS or CD4+ T cell counts Conclusion We observed a higher ex vivo replicative fitness of CRF02_AG isolates compared to subtype A and G viruses from the same geographic region and showed that this was independent of the co-receptor tropism and irrespective of high or low CD4+ T cell count. This advantage in replicative fitness may contribute to the dominant spread of CRF02_AG over A and G subtypes in West and West Central Africa.

  10. Risk group characteristics and viral transmission clusters in South-East Asian patients infected with human immunodeficiency virus-1 (HIV-1) circulating recombinant form (CRF) 01_AE and subtype B. (United States)

    Oyomopito, Rebecca A; Chen, Yen-Ju; Sungkanuparph, Somnuek; Kantor, Rami; Merati, Tuti; Yam, Wing-Cheong; Sirisanthana, Thira; Li, Patrick C K; Kantipong, Pacharee; Phanuphak, Praphan; Lee, Chris K C; Kamarulzaman, Adeeba; Ditangco, Rossana; Huang, Szu-Wei; Sohn, Annette H; Law, Matthew; Chen, Yi Ming A


    Human immunodeficiency virus (HIV)-1 epidemics in Asian countries are driven by varying exposures. The epidemiology of the regional pandemic has been changing with the spread of HIV-1 to lower-risk populations through sexual transmission. Common HIV-1 genotypes include subtype B and circulating recombinant form (CRF) 01_AE. Our objective was to use HIV-1 genotypic data to better quantify local epidemics. TASER-M is a multicenter prospective cohort of HIV-infected patients. Associations between HIV exposure, patient sex, country of sample origin and HIV-1 genotype were evaluated by multivariate logistic regression. Phylogenetic methods were used on genotypic data to investigate transmission relationships. A total of 1086 patients from Thailand, Hong Kong, Malaysia and the Philippines were included in analyses. Proportions of male patients within countries varied (Thailand: 55.6%, Hong Kong: 86.1%, Malaysia: 81.4%, Philippines: 93.8%; p < 0.001) as did HIV exposures (heterosexual contact: Thailand: 85.7%, Hong Kong, 46.2%, Malaysia: 47.8%, Philippines: 25.0%; p < 0.001). After adjustment, we found increased subtype B infection among men who have sex with men, relative to heterosexual-reported exposures (odds ratio = 2.4, p < 0.001). We further describe four transmission clusters of eight to 15 treatment naïve, predominantly symptomatic patients (two each for subtype B and CRF01_AE). Risk-group subpopulations differed with respect to the infecting HIV-1 genotype. Homosexual exposure patients had higher odds of being infected with subtype B. Where HIV-1 genotypes circulate within countries or patient risk-groups, local monitoring of genotype-specific transmissions may play a role in focusing public health prevention strategies. Phylogenetic evaluations provide complementary information for surveillance and monitoring of viruses with high mutation rates such as HIV-1 and Ebola. PMID:26362956

  11. Frequent intra-subtype recombination among HIV-1 circulating in Tanzania.

    Directory of Open Access Journals (Sweden)

    Ireen E Kiwelu

    Full Text Available The study estimated the prevalence of HIV-1 intra-subtype recombinant variants among female bar and hotel workers in Tanzania. While intra-subtype recombination occurs in HIV-1, it is generally underestimated. HIV-1 env gp120 V1-C5 quasispecies from 45 subjects were generated by single-genome amplification and sequencing (median (IQR of 38 (28-50 sequences per subject. Recombination analysis was performed using seven methods implemented within the recombination detection program version 3, RDP3. HIV-1 sequences were considered recombinant if recombination signals were detected by at least three methods with p-values of ≤0.05 after Bonferroni correction for multiple comparisons. HIV-1 in 38 (84% subjects showed evidence for intra-subtype recombination including 22 with HIV-1 subtype A1, 13 with HIV-1 subtype C, and 3 with HIV-1 subtype D. The distribution of intra-patient recombination breakpoints suggested ongoing recombination and showed selective enrichment of recombinant variants in 23 (60% subjects. The number of subjects with evidence of intra-subtype recombination increased from 29 (69% to 36 (82% over one year of follow-up, although the increase did not reach statistical significance. Adjustment for intra-subtype recombination is important for the analysis of multiplicity of HIV infection. This is the first report of high prevalence of intra-subtype recombination in the HIV/AIDS epidemic in Tanzania, a region where multiple HIV-1 subtypes co-circulate. HIV-1 intra-subtype recombination increases viral diversity and presents additional challenges for HIV-1 vaccine design.

  12. Frequent intra-subtype recombination among HIV-1 circulating in Tanzania. (United States)

    Kiwelu, Ireen E; Novitsky, Vladimir; Margolin, Lauren; Baca, Jeannie; Manongi, Rachel; Sam, Noel; Shao, John; McLane, Mary F; Kapiga, Saidi H; Essex, M


    The study estimated the prevalence of HIV-1 intra-subtype recombinant variants among female bar and hotel workers in Tanzania. While intra-subtype recombination occurs in HIV-1, it is generally underestimated. HIV-1 env gp120 V1-C5 quasispecies from 45 subjects were generated by single-genome amplification and sequencing (median (IQR) of 38 (28-50) sequences per subject). Recombination analysis was performed using seven methods implemented within the recombination detection program version 3, RDP3. HIV-1 sequences were considered recombinant if recombination signals were detected by at least three methods with p-values of ≤0.05 after Bonferroni correction for multiple comparisons. HIV-1 in 38 (84%) subjects showed evidence for intra-subtype recombination including 22 with HIV-1 subtype A1, 13 with HIV-1 subtype C, and 3 with HIV-1 subtype D. The distribution of intra-patient recombination breakpoints suggested ongoing recombination and showed selective enrichment of recombinant variants in 23 (60%) subjects. The number of subjects with evidence of intra-subtype recombination increased from 29 (69%) to 36 (82%) over one year of follow-up, although the increase did not reach statistical significance. Adjustment for intra-subtype recombination is important for the analysis of multiplicity of HIV infection. This is the first report of high prevalence of intra-subtype recombination in the HIV/AIDS epidemic in Tanzania, a region where multiple HIV-1 subtypes co-circulate. HIV-1 intra-subtype recombination increases viral diversity and presents additional challenges for HIV-1 vaccine design. PMID:23940702

  13. Studies of recombinant forms of Aleuria aurantia lectin


    Olausson, Johan


    The presented work describes construction and analysis of recombinantly produced forms of Aleuria aurantia lectin (AAL). The binding properties of the produced AAL forms were studied using techniques such as tryptophan fluorescence, hemagglutination analysis, ELISA and surface plasmon resonance analysis. Lectins are proteins that are ubiquitous in nature with the ability to bind specifically to different types of carbohydrates. The physiological function of different lectins is not always kno...

  14. [A new unique HIV-1 recombinant form detected in Belarus]. (United States)

    Eremin, V F; Gasich, E L; Sosinovich, S V


    Republican Research-and-Practical Center for Epidemiology and Microbiology, Ministry of Health of Belarus, Minsk The paper presents data on the molecular genetic characteristics of a new HIV-1 recombinant form. The study has shown that the virus is referred to as HIV-1 subtype B in terms of the gag gene and HIV-1 subtype A in terms of the pol and env genes. At the same time the new isolate is closer, in terms of the gag gene, to the HIV-1 DQ207943 strain isolated in Georgia, in terms of the pol gene, to the HIV-1 AF413987.1 strain isolated in Ukraine and, in terms of the env gene to the HIV-1 AY500393 strain isolated in Russia. Thus, the described new HIV-1 recombinant form has the following structure: BgagApolAenv. The gag, pol, and env gene sequences from the new unique HIV-1 recombinant form have been registered in the international database EMBL/Genbank/DDBJ under accession numbers FR775442.1, FN995656.1, and FR775443.1.

  15. Recombinant human granulocyte colony-stimulating factor increases circulating CD34-postive cells in patients with AIDS

    DEFF Research Database (Denmark)

    Nielsen, S D; Dam-Larsen, S; Nielsen, C;


    circulating hematopoietic progenitor cells (CD34 cells) in patients with AIDS, using the recombinant human granulocyte colony-stimulating factor (G-CSF). Eight patients with AIDS were treated with G-CSF for neutropenia (< 1.0 x 10(9)/l). Treatment consisted of daily subcutaneous injections with 300 micrograms...

  16. Genomic characterization of two novel HIV-1 unique (CRF01_AE/B) recombinant forms among men who have sex with men in Beijing, China. (United States)

    Li, Zheng; Li, Jia; Feng, Yi; Kalish, Marcia L; Lu, Hongyan; Yin, Lu; Liao, Lingjie; Qian, Han-Zhu; Frost, Simon D W; Ruan, Yuhua; Vermund, Sten H; Shao, Yiming; Xing, Hui


    We report here two novel HIV-1 recombinant forms (CRF01_AE/B) isolated from two HIV-positive male subjects infected through homosexual contact in Beijing, China. Recombination contributes substantially to the genetic diversity of HIV-1, and is likely to occur in populations in which multiple subtypes circulate. Molecular epidemiological studies showed that subtype B, CRF01_AE, and CRF07_BC are currently cocirculating in parallel among men who have sex with men (MSM) in China, providing the opportunity for the emergence of new recombinants. Phylogenetic analysis of near full-length genome (NFLG) sequences showed that the unique recombinant forms (URFs) were composed of gene regions from CRF01_AE and subtype B. The CRF01_AE region of the recombinants clustered together with a previously described cluster 4 lineage of CRF01_AE. The B regions of both the recombinants clustered within the B strains. The two recombinants were quite similar with six breakpoints in common. These data highlight the importance of continuous surveillance of the dynamic change of HIV-1 subtypes and new recombinants among the MSM population. PMID:26058342

  17. Frequent Intra-Subtype Recombination among HIV-1 Circulating in Tanzania


    Ireen E Kiwelu; Vladimir Novitsky; Lauren Margolin; Jeannie Baca; Rachel Manongi; Noel Sam; John Shao; McLane, Mary F.; Saidi H Kapiga; Essex, M


    The study estimated the prevalence of HIV-1 intra-subtype recombinant variants among female bar and hotel workers in Tanzania. While intra-subtype recombination occurs in HIV-1, it is generally underestimated. HIV-1 env gp120 V1-C5 quasispecies from 45 subjects were generated by single-genome amplification and sequencing (median (IQR) of 38 (28-50) sequences per subject). Recombination analysis was performed using seven methods implemented within the recombination detection program version 3,...

  18. Frequent Intra-Subtype Recombination among HIV-1 Circulating in Tanzania


    Ireen E Kiwelu; Novitsky, Vladimir; Margolin, Lauren; Baca, Jeannie; Manongi, Rachel; Sam, Noel; Shao, John; McLane, Mary F.; Saidi H Kapiga; Essex, M


    The study estimated the prevalence of HIV-1 intra-subtype recombinant variants among female bar and hotel workers in Tanzania. While intra-subtype recombination occurs in HIV-1, it is generally underestimated. HIV-1 env gp120 V1-C5 quasispecies from 45 subjects were generated by single-genome amplification and sequencing (median (IQR) of 38 (28–50) sequences per subject). Recombination analysis was performed using seven methods implemented within the recombination detection program version 3,...

  19. The contribution of recombination to heterozygosity differs among plant evolutionary lineages and life-forms

    Directory of Open Access Journals (Sweden)

    Verdú Miguel


    Full Text Available Abstract Background Despite its role as a generator of haplotypic variation, little is known about how the rates of recombination evolve across taxa. Recombination is a very labile force, susceptible to evolutionary and life trait related processes, which have also been correlated with general levels of genetic diversity. For example, in plants, it has been shown that long-lived outcrossing taxa, such as trees, have higher heterozygosity (He at SSRs and allozymes than selfing or annual species. However, some of these tree taxa have surprisingly low levels of nucleotide diversity at the DNA sequence level, which points to recombination as a potential generator of genetic diversity in these organisms. In this study, we examine how genome-wide and within-gene rates of recombination evolve across plant taxa, determine whether such rates are influenced by the life-form adopted by species, and evaluate if higher genome-wide rates of recombination translate into higher He values, especially in trees. Results Estimates of genome-wide (cM/Mb recombination rates from 81 higher plants showed a significant phylogenetic signal. The use of different comparative phylogenetic models demonstrated that there is a positive correlation between recombination rate and He (0.83 ± 0.29, and that trees have higher rates of genome-wide recombination than short-lived herbs and shrubs. A significant taxonomic component was further made evident by our models, as conifers exhibited lower recombination rates than angiosperms. This trend was also found at the within-gene level. Conclusions Altogether, our results illustrate how both common ancestry and life-history traits have to be taken into account for understanding the evolution of genetic diversity and genomic rates of recombination across plant species, and highlight the relevance of species life forms to explain general levels of diversity and recombination.

  20. Circulating intact and cleaved forms of the urokinase-type plasminogen activator receptor

    DEFF Research Database (Denmark)

    Røndbjerg, Tine Thurison; Christensen, Ib J; Lund, Ida K;


    BACKGROUND: High levels of circulating forms of the urokinase-type plasminogen activator receptor (uPAR) are significantly associated to poor prognosis in cancer patients. Our aim was to determine biological variations and reference intervals of the uPAR forms in blood, and in addition, to test t...

  1. Conformational variability of recombination R-triplex formed by the mammalian telomeric sequence


    Shchyolkina, A.; Kaluzhny, D.; O. Borisova; Arndt-Jovin, D; Jovin, T.; Zhurkin, V.


    Alignment of three nucleic acids strands, in which the third strand is identical to one of the DNA duplex strands, occurs in various cellular systems. In the case of telomeric t-loops, recognition between the DNA duplex and the homologous single strand is likely to be mediated by proteins through formation of the transient recombination-type R-triplex. Earlier, using 2-aminopurine as a fluorescent reporting base, we evaluated the thermodynamic characteristics of intramolecular R-triplex forme...

  2. Recombination Amplitude Calculations of Noble Gases, in Length and Acceleration Forms, beyond Strong Field Approximation

    CERN Document Server

    Bhardwaj, Siddharth; Hong, Kyung-Han; Lai, Chien-Jen; Kaertner, Franz X; Santra, Robin


    Transition of an electron from a free to a bound state is critical in determining the qualitative shape of the spectrum in high-order harmonic generation (HHG), and in tomographic imaging of orbitals. We calculate and compare the recombination amplitude, from a continuum state described by a plane wave and an outgoing scattering eigenstate, to the bound state for the noble gases that are commonly used in HHG. These calculations are based on the single active electron model and the Hartree-Fock-Slater method, using both the length form and the acceleration form of the dipole matrix element. We confirm that the recombination amplitude versus emitted photon energy strongly depends upon the wavefunction used to describe the free electron. Depending on the choice of the wavefunction and the dipole form, the square of the absolute value of the recombination amplitude can differ by almost two orders of magnitude near the experimentally measured Cooper minima. Moreover, only the outgoing scattering eigenstates with t...

  3. Electron-ion Recombination of Fe XII forming Fe XI: Laboratory Measurements and Theoretical Calculations

    CERN Document Server

    Novotný, O; Bernhardt, D; Grieser, M; Hahn, M; Krantz, C; Lestinsky, M; Müller, A; Repnow, R; Schippers, S; Wolf, A; Savin, D W


    We have measured electron-ion recombination for Fe XII forming Fe XI using a merged beams configuration at the heavy-ion storage ring TSR located at the Max Planck Institute for Nuclear Physics in Heidelberg, Germany. The measured merged beams recombination rate coefficient (MBRRC) for collision energies from 0 to 1500 eV is presented. This work uses a new method for determining the absolute MBRRC based on a comparison of the ion beam decay rate with and without the electron beam on. For energies below 75 eV, the spectrum is dominated by dielectronic recombination (DR) resonances associated with 3s-3p and 3p-3d core excitations. At higher energies we observe contributions from 3-N' and 2-N' core excitations DR. We compare our experimental results to state-of-the-art multi-configuration Breit-Pauli (MCBP) calculations and find significant differences, both in resonance energies and strengths. We have extracted the DR contributions from the measured MBRRC data and transformed them into a plasma recombination ra...

  4. Recombinant erythropoietin in humans has a prolonged effect on circulating erythropoietin isoform distribution.

    Directory of Open Access Journals (Sweden)

    Niels Jacob Aachmann-Andersen

    Full Text Available The membrane-assisted isoform immunoassay (MAIIA quantitates erythropoietin (EPO isoforms as percentages of migrated isoforms (PMI. We evaluated the effect of recombinant human EPO (rhEPO on the distribution of EPO isoforms in plasma in a randomized, placebo-controlled, double-blinded, cross-over study. 16 healthy subjects received either low-dose Epoetin beta (5000 IU on days 1, 3, 5, 7, 9, 11 and 13; high-dose Epoetin beta (30.000 IU on days 1, 2 and 3 and placebo on days 5, 7, 9, 11 and 13; or placebo on all days. PMI on days 4, 11 and 25 was determined by interaction of N-acetyl glucosamine with the glycosylation dependent desorption of EPO isoforms. At day 25, plasma-EPO in both rhEPO groups had returned to values not different from the placebo group. PMI with placebo, reflecting the endogenous EPO isoforms, averaged 82.5 (10.3 % (mean (SD. High-dose Epoetin beta decreased PMI on days 4 and 11 to 31.0 (4.2% (p<0.00001 and 45.2 (7.3% (p<0.00001. Low-dose Epoetin beta decreased PMI on days 4 and 11 to 46.0 (12.8% (p<0.00001 and 46.1 (10.4% (p<0.00001. In both rhEPO groups, PMI on day 25 was still decreased (high-dose Epoetin beta: 72.9 (19.4% (p=0.029; low-dose Epoetin beta: 73.1 (17.8% (p=0.039. In conclusion, Epoetin beta leaves a footprint in the plasma-EPO isoform pattern. MAIIA can detect changes in EPO isoform distribution up til at least three weeks after administration of Epoetin beta even though the total EPO concentration has returned to normal.

  5. Phylogenetic analyses of Norovirus strains detected in Uruguay reveal the circulation of the novel GII.P7/GII.6 recombinant variant. (United States)

    Fajardo, Álvaro; Tort, Fernando López; Victoria, Matías; Fumian, Tulio M; Miagostovich, Marize P; Leite, José Paulo G; Cristina, Juan; Colina, Rodney


    Noroviruses (NoV) are one of the major etiological agent of acute gastroenteritis (AGE) outbreaks worldwide. Distinct NoV genotypes have been associated with different transmission patterns and disease severity in humans. Therefore, it is important to identify genetically different NoV genotypes circulating in a particular region. However, genotyping has become a challenge due to recombination events occurring mainly nearby ORF1/ORF2 junction of NoV genome, leading to distinct genotypes with polymerase and capsid regions derived from parenteral strains. Taking this into account, ORF1/ORF2 sequences were obtained from NoV strains collected from patients with AGE in Uruguay. This study reveals in silico evidences of recombination events taking place in four out of six strains analyzed for which its polymerase gene and its capsid region correspond to GII.P7 and to GII.6 genotype, respectively. These results also reveal the circulation of a GII.P7/GII.6 recombinant variant in the natural populations of NoV strains in the northwestern region of Uruguay. As far as we know this is the first report about the circulation of a NoV GII.P7/GII.6 recombinant variant in the Americas.

  6. Exercise-induced norepinephrine decreases circulating hematopoietic stem and progenitor cell colony-forming capacity.

    Directory of Open Access Journals (Sweden)

    Julia M Kröpfl

    Full Text Available A recent study showed that ergometry increased circulating hematopoietic stem and progenitor cell (CPC numbers, but reduced hematopoietic colony forming capacity/functionality under normoxia and normobaric hypoxia. Herein we investigated whether an exercise-induced elevated plasma free/bound norepinephrine (NE concentration could be responsible for directly influencing CPC functionality. Venous blood was taken from ten healthy male subjects (25.3+/-4.4 yrs before and 4 times after ergometry under normoxia and normobaric hypoxia (FiO2<0.15. The circulating hematopoietic stem and progenitor cell numbers were correlated with free/bound NE, free/bound epinephrine (EPI, cortisol (Co and interleukin-6 (IL-6. Additionally, the influence of exercise-induced NE and blood lactate (La on CPC functionality was analyzed in a randomly selected group of subjects (n = 6 in vitro under normoxia by secondary colony-forming unit granulocyte macrophage assays. Concentrations of free NE, EPI, Co and IL-6 were significantly increased post-exercise under normoxia/hypoxia. Ergometry-induced free NE concentrations found in vivo showed a significant impairment of CPC functionality in vitro under normoxia. Thus, ergometry-induced free NE was thought to trigger CPC mobilization 10 minutes post-exercise, but as previously shown impairs CPC proliferative capacity/functionality at the same time. The obtained results suggest that an ergometry-induced free NE concentration has a direct negative effect on CPC functionality. Cortisol may further influence CPC dynamics and functionality.

  7. Conformational variability of recombination R-triplex formed by the mammalian telomeric sequence. (United States)

    Shchyolkina, Anna K; Kaluzhny, Dmitry N; Borisova, Olga F; Arndt-Jovin, Donna J; Jovin, Thomas M; Zhurkin, Victor B


    Alignment of three nucleic acids strands, in which the third strand is identical to one of the DNA duplex strands, occurs in various cellular systems. In the case of telomeric t-loops, recognition between the DNA duplex and the homologous single strand is likely to be mediated by proteins through formation of the transient recombination-type R-triplex. Earlier, using 2-aminopurine as a fluorescent reporting base, we evaluated the thermodynamic characteristics of intramolecular R-triplex formed by a mixed nucleotide sequence. Here, we used this approach to explore a propensity of the telomeric TTAGGG repeat to form the R-triplex. The circular dichroism spectral changes detected upon formation of the R-triplex suggest that this process is accompanied by specific conformational changes in DNA, including a local destabilization of the target duplex next to a GGG run revealed by the fluorescence of the reporting 2-aminopurine base. Surprisingly, stability of the R-triplex formed by telomeric sequence depends strikingly on the counter ion, being higher for Na(+) than for Li(+). Taken together these findings indicate a significant conformational variability of telomeric DNA in the context of recombination-type R-triplex, a phenomenon of possible biological relevance. PMID:26308235

  8. Development of gel-forming lyophilized formulation with recombinant human thrombin. (United States)

    Murányi, Andrej; Bartoš, Peter; Tichý, Eduard; Lazová, Jana; Pšenková, Jana; Žabka, Marián


    The objective of this work was development and evaluation of gel-forming lyophilized formulation with recombinant human thrombin for topical administration. The influence of pH, ionic strength and buffer type on protein stability was evaluated as part of the pre-formulation screening studies. Results indicated an optimal pH from 6.0 to 7.0 and increased stability with increasing content of sodium chloride. The tested buffer types had no significant effect on thrombin stability. For further development, thermosensitive Pluronic® F-127 was employed as a bulking and gelling agent. Physical and mechanical characterization and viscosity measurement confirmed the gel-forming properties of the formulation at the application temperature of 32 °C. Several techniques (addition of well-soluble polyols, different freezing protocols and reconstitution under vacuum) were tested to decrease the reconstitution time. The obtained results revealed that a vacuum in the vial headspace is crucial for acceptable reconstitution. The freeze drying process has no negative impact on recombinant thrombin stability, and this was confirmed by reverse-phase-HPLC, activity assay and optical density measurements.

  9. B-type Natriuretic Peptide circulating forms: Analytical and bioactivity issues. (United States)

    Yandle, Tim G; Richards, A Mark


    B-type Natriuretic Peptide (BNP), A-type and C-type Natriuretic Peptides (ANP and CNP) comprise a family of peptides that retain a common ring structure and conserved amino acid sequences. All are present in the heart, but only BNP and ANP are regarded as primarily cardiac secretory products. BNP and ANP, acting through a guanylyl cyclase receptor, increase sodium and water excretion by the kidney, induce vasodilation, reduce blood pressure, counteract the bioactivity of the renin-angiotensin-aldosterone and sympathetic nervous systems and possess anti-hypertrophic and anti-fibrotic properties. BNP is synthesised in cardiomyocytes first as the precursor peptide preproBNP. Removal of the signal peptide from preproBNP produces proBNP which is cleaved to produce the biologically active carboxy-terminal BNP peptide and the inactive N-terminal fragment, NT-proBNP. BNP, NT-proBNP, proBNP and the C-terminal portion of the BNP signal peptide have been detected in human plasma as well as multiple sub-forms including truncated forms of BNP and NT-proBNP, as well as variable glycosylation of NT-proBNP and proBNP. The origin of these circulating forms, their potential bioactivity and their detection by current analytical methods are presented in this review. PMID:26160054

  10. Overexpression and characterization of dimeric and tetrameric forms of recombinant serine hydroxymethyltransferase from Bacillus stearothermophilus

    Indian Academy of Sciences (India)

    Venkatakrishna R Jala; V Prakash; N Appaji Rao; H S Savithri


    Serine hydroxymethyltransferase (SHMT), a pyridoxal-5′-phosphate (PLP) dependent enzyme catalyzes the interconversion of L-Ser and Gly using tetrahydrofolate as a substrate. The gene encoding for SHMT was amplified by PCR from genomic DNA of Bacillus stearothermophilus and the PCR product was cloned and overexpressed in Escherichia coli. The purified recombinant enzyme was isolated as a mixture of dimer (90%) and tetramer (10%). This is the first report demonstrating the existence of SHMT as a dimer and tetramer in the same organism. The specific activities at 37°C of the dimeric and tetrameric forms were 6.7 U/mg and 4.1 U/mg, respectively. The purified dimer was extremely thermostable with a m of 85°C in the presence of PLP and L-Ser. The temperature optimum of the dimer was 80°C with a specific activity of 32.4 U/mg at this temperature. The enzyme catalyzed tetrahydrofolate-independent reactions at a slower rate compared to the tetrahydrofolate-dependent retro-aldol cleavage of L-Ser. The interaction with substrates and their analogues indicated that the orientation of PLP ring of B. stearothermophilus SHMT was probably different from sheep liver cytosolic recombinant SHMT (scSHMT).

  11. Exercise-induced norepinephrine decreases circulating hematopoietic stem and progenitor cell colony-forming capacity. (United States)

    Kröpfl, Julia M; Stelzer, Ingeborg; Mangge, Harald; Pekovits, Karin; Fuchs, Robert; Allard, Nathalie; Schinagl, Lukas; Hofmann, Peter; Dohr, Gottfried; Wallner-Liebmann, Sandra; Domej, Wolfgang; Müller, Wolfram


    A recent study showed that ergometry increased circulating hematopoietic stem and progenitor cell (CPC) numbers, but reduced hematopoietic colony forming capacity/functionality under normoxia and normobaric hypoxia. Herein we investigated whether an exercise-induced elevated plasma free/bound norepinephrine (NE) concentration could be responsible for directly influencing CPC functionality. Venous blood was taken from ten healthy male subjects (25.3+/-4.4 yrs) before and 4 times after ergometry under normoxia and normobaric hypoxia (FiO2exercise-induced NE and blood lactate (La) on CPC functionality was analyzed in a randomly selected group of subjects (n = 6) in vitro under normoxia by secondary colony-forming unit granulocyte macrophage assays. Concentrations of free NE, EPI, Co and IL-6 were significantly increased post-exercise under normoxia/hypoxia. Ergometry-induced free NE concentrations found in vivo showed a significant impairment of CPC functionality in vitro under normoxia. Thus, ergometry-induced free NE was thought to trigger CPC mobilization 10 minutes post-exercise, but as previously shown impairs CPC proliferative capacity/functionality at the same time. The obtained results suggest that an ergometry-induced free NE concentration has a direct negative effect on CPC functionality. Cortisol may further influence CPC dynamics and functionality. PMID:25180783

  12. Circulating Antigens Levels in Different Clinical Forms of the Schistosoma mansoni Infection

    Directory of Open Access Journals (Sweden)

    Yerkes Pereira e Silva


    Full Text Available With the aim to evaluate the circulating cathodic antigen (CCA levels in relation to the different clinical phases of Schistosoma sp. infection a sandwich ELISA using monoclonal antibody 5H11 was performed. The sera of three groups of 25 Brazilian patients with acute, intestinal and hepatosplenic forms of S. mansoni infection were tested and compared to a non-infected control group. Patients and control groups were matched for age and sex and the number of eggs per gram of feces was equally distributed among the three patient groups. Sensitivity of 100%, 72%, 52% of the assay was observed for the intestinal, hepatosplenic and acute toxemic groups respectively. The specificity was 100%. Intestinal and hepatosplenic groups presented CCA levels significantly higher in comparison to those observed for acute patients (F-ratio = 2,524; p = 0.000 and F-ratio = 6,314; p = 0.015 respectively. There was no significant difference of CCA serum levels between hepatosplenic and intestinal groups (F-ratio = 1,026; p = 0.316.

  13. Co-circulation and genomic recombination of coxsackievirus A16 and enterovirus 71 during a large outbreak of hand, foot, and mouth disease in Central China.

    Directory of Open Access Journals (Sweden)

    Weiyong Liu

    Full Text Available A total of 1844 patients with hand, foot, and mouth disease (HFMD, most of them were children of age 1-3-year-old, in Central China were hospitalized from 2011 to 2012. Among them, 422 were infected with coxsackievirus A16 (CVA16, 334 were infected with enterovirus 71 (EV71, 38 were co-infected with EV71 and CVA16, and 35 were infected with other enteroviruses. Molecular epidemiology analysis revealed that EV71 and CVA16 were detected year-round, but EV71 circulated mainly in July and CVA16 circulated predominantly in November, and incidence of HFMD was reduced in January and February and increased in March. Clinical data showed that hyperglycemia and neurologic complications were significantly higher in EV71-infected patients, while upper respiratory tract infection and C-reactive protein were significantly higher in CVA16-associated patients. 124 EV71 and 80 CVA16 strains were isolated, among them 56 and 68 EV71 strains were C4a and C4b, while 25 and 55 CVA16 strains were B1a and B1b, respectively. Similarity plots and bootscan analyses based on entire genomic sequences revealed that the three C4a sub-genotype EV71 strains were recombinant with C4b sub-genotype EV71 in 2B-2C region, and the three CVA16 strains were recombinant with EV71 in 2A-2B region. Thus, CVA16 and EV71 were the major causative agents in a large HFMD outbreak in Central China. HFMD incidence was high for children among household contact and was detected year-round, but outbreak was seasonal dependent. CVA16 B1b and EV71 C4b reemerged and caused a large epidemic in China after a quiet period of many years. Moreover, EV71 and CVA16 were co-circulated during the outbreak, which may have contributed to the genomic recombination between the pathogens. It should gain more attention as there may be an upward trend in co-circulation of the two pathogens globally and the new role recombination plays in the emergence of new enterovirus variants.

  14. Production and characterisation of recombinant forms of human pulmonary surfactant protein C (SP-C)

    DEFF Research Database (Denmark)

    Lukovic, Dunja; Plasencia, Inés; Taberner, Francisco J;


    -C-derived peptides or recombinant humanized SP-C for inclusion in new preparations for therapeutic use. We describe herein the recombinant production in bacterial cultures of SP-C variants containing phenylalanines instead of the palmitoylated cysteines of the native protein, as fusions to the hydrophilic nuclease...

  15. Recombinant p35 from bacteria can form Interleukin (IL-)12, but Not IL-35. (United States)

    Aparicio-Siegmund, Samadhi; Moll, Jens M; Lokau, Juliane; Grusdat, Melanie; Schröder, Jutta; Plöhn, Svenja; Rose-John, Stefan; Grötzinger, Joachim; Lang, Philipp A; Scheller, Jürgen; Garbers, Christoph


    The Interleukin (IL)-12 family contains several heterodimeric composite cytokines which share subunits among each other. IL-12 consists of the subunits p40 (shared with IL-23) and p35. p35 is shared with the composite cytokine IL-35 which comprises of the p35/EBI3 heterodimer (EBI3 shared with IL-27). IL-35 signals via homo- or heterodimers of IL-12Rβ2, gp130 and WSX-1, which are shared with IL-12 and IL-27 receptor complexes, respectively. p35 was efficiently secreted in complex with p40 as IL-12 but not with EBI3 as IL-35 in several transfected cell lines tested which complicates the analysis of IL-35 signal transduction. p35 and p40 but not p35 and EBI3 form an inter-chain disulfide bridge. Mutation of the responsible cysteine residue (p40C197A) reduced IL-12 formation and activity only slightly. Importantly, the p40C197A mutation prevented the formation of antagonistic p40 homodimers which enabled the in vitro reconstitution of biologically active IL-12 with p35 produced in bacteria (p35bac). Reconstitution of IL-35 with p35bac and EBI3 did, however, fail to induce signal transduction in Ba/F3 cells expressing IL-12Rβ2 and gp130. In summary, we describe the in vitro reconstitution of IL-12, but fail to produce recombinant IL-35 by this novel approach.

  16. Different recombinant forms of polyphenol oxidase A, a laccase from Marinomonas mediterranea. (United States)

    Tonin, Fabio; Rosini, Elena; Piubelli, Luciano; Sanchez-Amat, Antonio; Pollegioni, Loredano


    Polyphenol oxidase from the marine bacterium Marinomonas mediterranea (MmPPOA) is a membrane-bound, blue, multi-copper laccase of 695 residues. It possesses peculiar properties that distinguish it from known laccases, such as a broad substrate specificity (common to tyrosinases) and a high redox potential. In order to push the biotechnological application of this laccase, the full-length enzyme was overexpressed in Escherichia coli cells with and without a C-terminal His-tag. The previous form, named rMmPPOA-695-His, was purified to homogeneity by HiTrap chelating chromatography following solubilization by 1% SDS in the lysis buffer with an overall yield of ≈1 mg/L fermentation broth and a specific activity of 1.34 U/mg protein on 2,6-dimethoxyphenol as substrate. A truncated enzyme form lacking 58 residues at the N-terminus encompassing the putative membrane binding region, namely rMmPPOA-637-His, was successfully expressed in E. coli as soluble protein and was purified by using the same procedure set-up as for the full-length enzyme. Elimination of the N-terminal sequence decreased the specific activity 15-fold (which was partially restored in the presence of 1 M NaCl) and altered the secondary and tertiary structures and the pH dependence of optimal stability. The recombinant rMmPPOA-695-His showed kinetic properties on catechol higher than for known laccases, a very high thermal stability, and a strong resistance to NaCl, DMSO, and Tween-80, all properties that are required for specific, targeted industrial applications. PMID:27050199

  17. Electron-ion Recombination of Fe X forming Fe IX and of Fe XI forming Fe X: Laboratory Measurements and Theoretical Calculations

    CERN Document Server

    Lestinsky, M; Bernhardt, D; Grieser, M; Hoffmann, J; Lukić, D; Müller, A; Orlov, D A; Repnow, R; Savin, D W; Schmidt, E W; Schnell, M; Schippers, S; Wolf, A; Yu, D


    We have measured electron-ion recombination for Fe$^{9+}$ forming Fe$^{8+}$ and for Fe$^{10+}$ forming Fe$^{9+}$ using merged beams at the TSR heavy-ion storage-ring in Heidelberg. The measured merged beams recombination rate coefficients (MBRRC) for relative energies from 0 to 75 eV are presented, covering all dielectronic recombination (DR) resonances associated with 3s->3p and 3p->3d core transitions in the spectroscopic species Fe X and Fe XI, respectively. We compare our experimental results to multi-configuration Breit-Pauli (MCBP) calculations and find significant differences. From the measured MBRRC we have extracted the DR contributions and transform them into plasma recombination rate coefficients (PRRC) for astrophysical plasmas with temperatures from 10^2 to 10^7 K. This spans across the regimes where each ion forms in photoionized or in collisionally ionized plasmas. For both temperature regimes the experimental uncertainties are 25% at a 90% confidence level. The formerly recommended DR data sev...

  18. Electron-ion recombination measurements motivated by AGN X-ray absorption features: Fe XIV forming Fe XIII

    CERN Document Server

    Schmidt, E W; Müller, A; Lestinsky, M; Sprenger, F; Grieser, M; Repnow, R; Wolf, A; Brandau, C; Lukic, D; Schnell, M; Savin, D W


    Recent spectroscopic models of active galactic nuclei (AGN) have indicated that the recommended electron-ion recombination rate coefficients for iron ions with partially filled M-shells are incorrect in the temperature range where these ions form in photoionized plasmas. We have investigated this experimentally for Fe XIV forming Fe XIII. The recombination rate coefficient was measured employing the electron-ion merged beams method at the Heidelberg heavy-ion storage-ring TSR. The measured energy range of 0-260 eV encompassed all dielectronic recombination (DR) 1s2 2s2 2p6 3l 3l' 3l'' nl''' resonances associated with the 3p1/2 -> 3p3/2, 3s -> 3p, 3p -> 3d and 3s -> 3d core excitations within the M-shell of the Fe XIV 1s2 2s2 2p6 3s2 3p parent ion. This range also includes the 1s2 2s2 2p6 3l 3l' 4l'' nl''' resonances associated with 3s -> 4l'' and 3p -> 4l'' core excitations. We find that in the temperature range 2--14 eV, where Fe XIV is expected to form in a photoionized plasma, the Fe XIV recombination rate...

  19. Recombinant PsbF from Synechococcus sp. PCC 7002 forms β:βhomodimeric cytochrome b559

    Institute of Scientific and Technical Information of China (English)


    All organisms with oxygenic photosynthesis contain two photosystems: photosystemⅠ(PSⅠ) and photosystem-Ⅱ-(PSⅡ). The minimal photosystem-Ⅱ-particles which are photochemically active contain three subunits: D1, D2 and cytochrome b559 (Cyt b559). The function of Cyt b559 remains unclear. We have successfully overexpressed the psbF gene, encoding the - subunit of Cyt b559, from a marine cyanobacterium Synechococcus sp. PCC 7002 as a fusion gene and obtained a redox-active form of Cyt b559. When the N-terminal GST protein of the fusion gene product was removed with thrombin, the PsbF protein was still redox-active, suggesting that the recombinant PsbF can form dimer in Escherichia coli. The absorption spectra of either the oxidized form or the reduced form of both GST fusion protein and the purified PsbF dimer and the difference spectra between the two forms are the same as that of the Cyt b559 isolated from the higher plants. Redox titration analysis of recombinant PsbF showed that the mid-point redox potential of the recombinant Cyt b559 was approximately 50 mV, which is close to the low potential of Cyt b559. The results are helpful to the understanding of localization and function of Cyt b559 on thylakoid membranes.

  20. Geographically and temporally distant natural recombinant isolates of Plum pox virus (PPV) are genetically very similar and form a unique PPV subgroup. (United States)

    Glasa, Miroslav; Palkovics, Laszlo; Komínek, Petr; Labonne, Gérard; Pittnerová, Sona; Kúdela, Otakar; Candresse, Thierry; Subr, Zdeno


    Natural recombinant Plum pox virus (PPV) isolates were detected in Albania, Bulgaria, Czech Republic, Germany, Hungary and Slovakia. Despite different geographical origins and dates of isolation, all the recombinant isolates were closely related at the molecular level and shared the same recombination breakpoint as well as a typical signature in their N-terminal coat protein sequence, suggesting a common origin. Biological assays with four recombinant isolates demonstrated their capacity to be aphid-transmitted to various Prunus hosts. One of these isolates had a threonine-to-isoleucine mutation in the conserved PTK motif of its HC-Pro and showed a drastically decreased, although not abolished, aphid transmissibility. The complete genome sequence of one of the recombinant isolates, BOR-3, was determined, as well as some partial sequences in the HC-Pro and P3 genes for additional natural recombinant isolates. Analysis of the phylogenetic relationships between the recombinant isolates and other sequenced PPV isolates confirmed that the recombinant isolates form a phylogenetically homogeneous lineage. In addition, this analysis revealed an ancient recombination event between the PPV-D and M subgroups, with a recombination breakpoint located in the P3 gene. Taken together, these results indicate that recombinant isolates represent an evolutionarily successful, homogeneous group of isolates with a common history and unique founding recombination event. The name PPV-Rec is proposed for this coherent ensemble of isolates. PMID:15302961

  1. Rad52 forms DMA repair and recombination centers during S phase

    DEFF Research Database (Denmark)

    Lisby, M.; Rothstein, R.; Mortensen, Uffe Hasbro


    cerevisiae, homologous recombination is the major pathway for repairing DNA double-strand breaks. The key role played by Rad52 in this pathway has been attributed to its ability to seek out and mediate annealing of homologous DNA strands. In this study, we find that S. cerevisiae Rad52 fused to green...

  2. Atomic-number dependence of the magnetic-sublevel population in the autoionization state formed in dielectronic recombination


    Hu, Zhimin; Li, Yueming; Han, Xiaoying; Kato, Daiji; Tong, Xiaomin; Watanabe, Hirofumi; Nakamura, Nobuyuki


    The magnetic-sublevel population of the autoionization state formed in dielectronic recombination (DR) of highly charged heavy ions has been experimentally investigated by combining two types of measurements with an electron beam ion trap. The two different measurements are the differential x-ray measurement at 90∘ with respect to the electron beam and the integral resonance-strength measurement. The alignment parameter, which denotes the magnetic-sublevel population distribution, has been ob...

  3. Bimolecular recombination reactions: K-adiabatic and K-active forms of the bimolecular master equations and analytic solutions (United States)

    Ghaderi, Nima


    Expressions for a K-adiabatic master equation for a bimolecular recombination rate constant krec are derived for a bimolecular reaction forming a complex with a single well or complexes with multiple well, where K is the component of the total angular momentum along the axis of least moment of inertia of the recombination product. The K-active master equation is also considered. The exact analytic solutions, i.e., the K-adiabatic and K-active steady-state population distribution function of reactive complexes, g(EJK) and g(EJ), respectively, are derived for the K-adiabatic and K-active master equation cases using properties of inhomogeneous integral equations (Fredholm type). The solutions accommodate arbitrary intermolecular energy transfer models, e.g., the single exponential, double exponential, Gaussian, step-ladder, and near-singularity models. At the high pressure limit, the krec for both the K-adiabatic and K-active master equations reduce, respectively, to the K-adiabatic and K-active bimolecular Rice-Ramsperger-Kassel-Marcus theory (high pressure limit expressions). Ozone and its formation from O + O2 are known to exhibit an adiabatic K. The ratio of the K-adiabatic to the K-active recombination rate constants for ozone formation at the high pressure limit is calculated to be ˜0.9 at 300 K. Results on the temperature and pressure dependence of the recombination rate constants and populations of O3 will be presented elsewhere.

  4. Characterization of two truncated forms of xylanase recombinantly expressed by Lactobacillus reuteri with an introduced rumen fungal xylanase gene. (United States)

    Cheng, Hsueh-Ling; Hu, Chun-Yi; Lin, Shiou-Hua; Wang, Jing-Ya; Liu, Je-Ruei; Chen, Yo-Chia


    The xylanase R8 gene (xynR8) from uncultured rumen fungi was cloned and successfully expressed in Lactobacillus reuteri. A xylanase activity of 132.1 U/mL was found in the broth of L. reuteri R8, the transformant containing pNZ3004 vector with xynR8 gene insertion. Two distinct forms of recombinant xylanase with different hydrophobicities and molecular weights were found in the broth after purification. According to the results of Western blotting, only the T7-tag, fused in the N-terminus of XynR8, could be bound to the expressed proteins, which indicated that the C-terminus of XynR8 had been truncated. These results, combined with tryptic digestion and mass spectrometry analyses, allow us to attribute the two xylanase forms to an optional cleavage of C-terminal sequences, and XynR8A, a 13 amino acid residues truncated form, and XynR8B, a 22 amino acid residues truncated form, were the main products in the extracellular fraction of L. reuteri R8. The specific activities of XynR8A and R8B were 1028 and 395 U/mg protein. Both forms of recombinant xylanase displayed a typical endoxylanase activity when they were reacted with xylan, but XynR8A demonstrated a better specific activity, catalytic efficiency and thermostability than XynR8B according to the results of enzyme characterization. These changes in enzyme properties were highly possibly caused by the present of the β-sheet in the C-terminal undeleted fragment of XynR8A. This study demonstrates that modified forms with different enzyme properties could be produced when a gene was recombinantly expressed by a L. reuteri transformant. PMID:25152410

  5. Identification and characterization of a bacterial hyaluronidase and its production in recombinant form. (United States)

    Messina, Luciano; Gavira, Jose A; Pernagallo, Salvatore; Unciti-Broceta, Juan D; Sanchez Martin, Rosario M; Diaz-Mochon, Juan J; Vaccaro, Susanna; Conejero-Muriel, Mayte; Pineda-Molina, Estela; Caruso, Salvatore; Musumeci, Luca; Di Pasquale, Roberta; Pontillo, Angela; Sincinelli, Francesca; Pavan, Mauro; Secchieri, Cynthia


    Hyaluronidases (Hyals) are broadly used in medical applications to facilitate the dispersion and/or absorption of fluids or medications. This study reports the isolation, cloning, and industrial-scale recombinant production, purification and full characterization, including X-ray structure determination at 1.45 Å, of an extracellular Hyal from the nonpathogenic bacterium Streptomyces koganeiensis. The recombinant S. koganeiensis Hyal (rHyal_Sk) has a novel bacterial catalytic domain with high enzymatic activity, compared with commercially available Hyals, and is more thermostable and presents higher proteolytic resistance, with activity over a broad pH range. Moreover, rHyal_Sk exhibits remarkable substrate specificity for hyaluronic acid (HA) and poses no risk of animal cross-infection. PMID:27311405

  6. Stability and kinetic studies on recombinant pyroglutamyl peptidase I and two mutant forms


    Mtawae, Karima


    This thesis investigates the kinetic and stability characteristics of recombinant human brain pyroglutamyl peptidase PAPI, an omega exopeptidase which cleaves pyroglutamic acid from the N-terminus of peptides and proteins. Three classes of pyroglutamyl peptidase have been found in a variety of bacteria, plant, animal, and human tissues; the first class includes the bacterial and animal type 1, pyroglutamyl peptidase I. The genes encoding bacterial PAPI have been cloned and characterized previ...


    International Nuclear Information System (INIS)

    We have measured electron-ion recombination for Fe9+ forming Fe8+ and for Fe10+ forming Fe9+ using a merged beams arrangement at the TSR heavy-ion storage ring in Heidelberg, Germany. The measured merged beams recombination rate coefficients (MBRRC) for relative energies from 0 to 75 eV are presented, covering all dielectronic recombination (DR) resonances associated with 3s → 3p and 3p → 3d core transitions in the spectroscopic species Fe X and Fe XI, respectively. We compare our experimental results to state-of-the-art multiconfiguration Breit-Pauli (MCBP) calculations and find significant differences. Poor agreement between the measured and theoretical resonance structure is seen for collision energies below 48 eV for Fe X and below 35 eV for Fe XI. The integrated resonance strengths, though, are in reasonable agreement. At higher energies, good agreement is seen for the resonance structure but for the resonance strengths theory is significantly larger than experiment by a factor of ∼ 1.5 (2) for Fe X (Fe XI). From the measured MBRRC, we have extracted the DR contributions and transform them into plasma recombination rate coefficients (PRRCs) for astrophysical plasmas with temperatures in the range of 102-107 K. This range spans across the regimes where each ion forms in photoionized or in collisionally ionized plasmas. For both temperature regimes, the experimental uncertainties are 25% at a 90% confidence level. As expected based on predictions from active galactic nucleus observations as well as our previous laboratory and theoretical work on M-shell iron, the formerly recommended DR data severely underestimated the rate coefficient at temperatures relevant for photoionized gas. At these temperatures relevant for photoionized gas, we find agreement between our experimental results and MCBP theory. This is somewhat surprising given the poor agreement in MBRRC resonance structure. At the higher temperatures relevant for collisionally ionized gas, the MCBP

  8. Electron-Ion Recombination of Fe X Forming Fe IX and of Fe XI Forming Fe X: Laboratory Measurements and Theoretical Calculations (United States)

    Lestinsky, M.; Badnell, N. R.; Bernhardt, D.; Grieser, M.; Hoffmann, J.; Lukić, D.; Müller, A.; Orlov, D. A.; Repnow, R.; Savin, D. W.; Schmidt, E. W.; Schnell, M.; Schippers, S.; Wolf, A.; Yu, D.


    We have measured electron-ion recombination for Fe9+ forming Fe8+ and for Fe10+ forming Fe9+ using a merged beams arrangement at the TSR heavy-ion storage ring in Heidelberg, Germany. The measured merged beams recombination rate coefficients (MBRRC) for relative energies from 0 to 75 eV are presented, covering all dielectronic recombination (DR) resonances associated with 3s → 3p and 3p → 3d core transitions in the spectroscopic species Fe X and Fe XI, respectively. We compare our experimental results to state-of-the-art multiconfiguration Breit-Pauli (MCBP) calculations and find significant differences. Poor agreement between the measured and theoretical resonance structure is seen for collision energies below 48 eV for Fe X and below 35 eV for Fe XI. The integrated resonance strengths, though, are in reasonable agreement. At higher energies, good agreement is seen for the resonance structure but for the resonance strengths theory is significantly larger than experiment by a factor of ≈ 1.5 (2) for Fe X (Fe XI). From the measured MBRRC, we have extracted the DR contributions and transform them into plasma recombination rate coefficients (PRRCs) for astrophysical plasmas with temperatures in the range of 102-107 K. This range spans across the regimes where each ion forms in photoionized or in collisionally ionized plasmas. For both temperature regimes, the experimental uncertainties are 25% at a 90% confidence level. As expected based on predictions from active galactic nucleus observations as well as our previous laboratory and theoretical work on M-shell iron, the formerly recommended DR data severely underestimated the rate coefficient at temperatures relevant for photoionized gas. At these temperatures relevant for photoionized gas, we find agreement between our experimental results and MCBP theory. This is somewhat surprising given the poor agreement in MBRRC resonance structure. At the higher temperatures relevant for collisionally ionized gas, the MCBP

  9. Crystallization and molecular-replacement solution of a truncated form of human recombinant tetranectin

    DEFF Research Database (Denmark)

    Nielsen, B B; Kastrup, J S; Rasmussen, H;


    The two C-terminal domains, TN23 (residues 17-181), of human recombinant tetranectin, a plasminogen kringle 4 binding C-type lectin, have been crystallized in two different space groups. Using PEG 8000 as precipitant and at a pH of 8.5, crystals belonging to the monoclinic space group C2...... are obtained, with unit-cell parameters a = 160.4, b = 44.7, c = 107.5 A, beta = 127.6 degrees. Using sodium formate as precipitant and at a pH of 5.0, TN23 crystallizes in a rhombohedral space group, with unit-cell parameters a = b = c = 107.4 A, alpha = beta = gamma = 78.3 degrees. A full data set to 4...

  10. Inhibition of hepatitis B virus DNA replicative intermediate forms by recombinant interferon-γ

    Institute of Scientific and Technical Information of China (English)

    Mohammad Khalid Parvez; Deepak Sehgal; Shiv Kumar Sarin; Seemi Farhat Basir; Shahid Jameel


    AIM: To evaluate the in vitro anti-HBV activity of recombinant human IFN-γ, alone and in combination with lamivudine.METHODS: A recombinant baculovirus-HBV/HepG2 culture system was developed which could support productive HBV infection in vitro. Expression of HBsAg and HBeAg in infected HepG2 culture medium was detected by commercial enzyme immunoassays. HBV DNA replication intermediates were detected in infected cells by Southern hybridization and viral DNA load was determined by dot hybridization.RESULTS: IFN-γ at 0.1 to 5 μg/L efficiently down regulated HBsAg expression in transduced HepG2 cells.At 5 μg/L, IFN-γ also suppressed HBV DNA replication in these cells. While treatment with a combination of lamivudine and IFN-γ showed no additive effect,sequential treatment first with lamivudine and then IFN-γ was found to be promising. In this culture system the best HBV suppression was observed with a pulse of 2 μmol/L lamivudine for two days, followed by 1 μg/L IFN-γ for another four days. Compared to treatment with lamivudine alone, the sequential use of 0.2 μmol/L lamivudine for two days, followed by 5 μg/L IFN-γ for six days showed a 72% reduction in HBV cccDNA pool.CONCLUSION: This in vitro study warrants further evaluation of a combination of IFN-γ and lamivudine,especially in IFN-α non-responder chronic hepatitis B patients. A reduced duration of lamivudine treatment would also restrict the emergence of drug-resistant HBV mutants.

  11. Biophysical Properties of Scaffolds Modulate Human Blood Vessel Formation from Circulating Endothelial Colony-Forming Cells (United States)

    Critser, Paul J.; Yoder, Mervin C.

    A functional vascular system forms early in development and is continually remodeled throughout the life of the organism. Impairment to the regeneration or repair of this system leads to tissue ischemia, dysfunction, and disease. The process of vascular formation and remodeling is complex, relying on local microenvironmental cues, cytokine signaling, and multiple cell types to function properly. Tissue engineering strategies have attempted to exploit these mechanisms to develop functional vascular networks for the generation of artificial tissues and therapeutic strategies to restore tissue homeostasis. The success of these strategies requires the isolation of appropriate progenitor cell sources which are straightforward to obtain, display high proliferative potential, and demonstrate an ability to form functional vessels. Several populations are of interest including endothelial colony-forming cells, a subpopulation of endothelial progenitor cells. Additionally, the development of scaffolds to deliver and support progenitor cell survival and function is crucial for the formation of functional vascular networks. The composition and biophysical properties of these scaffolds have been shown to modulate endothelial cell behavior and vessel formation. However, further investigation is needed to better understand how these mechanical properties and biophysical properties impact vessel formation. Additionally, several other cell populations are involved in neoangiogenesis and formation of tissue parenchyma and an understanding of the potential impact of these cell populations on the biophysical properties of scaffolds will also be needed to advance these strategies. This chapter examines how the biophysical properties of matrix scaffolds can influence vessel formation and remodeling and, in particular, the impact on in vivo human endothelial progenitor cell vessel formation.

  12. Production of recombinant orange-spotted grouper (Epinephelus coioides) follicle-stimulating hormone (FSH) in single-chain form and dimer form by Pichia pastoris and their biological activities. (United States)

    Chen, Jun; Zhang, Yanhong; Tang, Zhiguo; Mao, Jiewei; Kuang, Zhonglei; Qin, Chaobin; Li, Wensheng


    FSH is a key regulator of steroidogenesis and gonadal growth in teleosts. However, function of FSH is elusive in grouper due to the lack of purified and native FSH. In the present study, we reported production of bioactive orange-spotted grouper (Epinephelus coioides) FSH in dimer form and single-chain form by Pichia pastoris. Dimer form of recombinant grouper FSH (rgFSHba) was accomplished by co-expressing mature FSHb-subunit and a-subunit genes. Fusion of mature FSHb-subunit and a-subunit genes together linking with a polypeptide (4×(Gly-Ser)-Gly-Thr) gene generated single-chain form of recombinant grouper FSH (rgFSHb-a). Recombinant grouper common α-subunit (rgCga) and FSHb-subunit (rgFSHb) were also separately produced. Recombinant proteins were verified by Western blot and mass spectrometry assays, and characterized by deglycosylation analysis. Deglycosylation assay suggested that glycosylation of recombinant FSH mainly occurred on common a-subunit. Bioactivities of recombinant proteins were initially evaluated by activating grouper FSH receptor, and further demonstrated by incubating ovarian fragments of adult grouper and intraperitoneal injection in juvenile female grouper. Two forms of recombinant FSH presented similar biological activities of activating FSH receptor and stimulating in vitro testosterone (T) and estradiol-17β (E2) secretion, though the dimer form functioned slightly weaker than the single-chain form. However, injections of rgFSHb-a or rgFSHba could significantly increase serum T and E2 levels, induce early ovarian development, reduce hypothalamic gnrh1 mRNA level, and increase hypothalamic cyp19a1b mRNA level. Data in this study suggested that recombinant gonadotropin could be produced in dimer form or single-chain form by P. pastoris, and FSH could regulate steroidogenesis and early ovarian development in juvenile grouper.

  13. Accumulation of large non-circular forms of the chromosome in recombination-defective mutants of Escherichia coli

    Directory of Open Access Journals (Sweden)

    Handa Naofumi


    Full Text Available Abstract Background Double-strand breakage of chromosomal DNA is obviously a serious threat to cells because various activities of the chromosome depend on its integrity. However, recent experiments suggest that such breakage may occur frequently during "normal" growth in various organisms – from bacteria through vertebrates, possibly through arrest of a replication fork at some endogenous DNA damage. Results In order to learn how the recombination processes contribute to generation and processing of the breakage, large (> 2000 kb linear forms of Escherichia coli chromosome were detected by pulsed-field gel electrophoresis in various recombination-defective mutants. The mutants were analyzed in a rich medium, in which the wild-type strain showed fewer of these huge broken chromosomes than in a synthetic medium, and the following results were obtained: (i Several recB and recC null mutants (in an otherwise rec+ background accumulated these huge linear forms, but several non-null recBCD mutants (recD, recC1001, recC1002, recC1003, recC1004, recC2145, recB2154, and recB2155 did not. (ii In a recBC sbcA background, in which RecE-mediated recombination is active, recA, recJ, recQ, recE, recT, recF, recO, and recR mutations led to their accumulation. The recJ mutant accumulated many linear forms, but this effect was suppressed by a recQ mutation. (iii The recA, recJ, recQ, recF and recR mutations led to their accumulation in a recBC sbcBC background. The recJ mutation showed the largest amount of these forms. (iv No accumulation was detected in mutants affecting resolution of Holliday intermediates, recG, ruvAB and ruvC, in any of these backgrounds. Conclusion These results are discussed in terms of stepwise processing of chromosomal double-strand breaks.

  14. Kosmotropic anions promote conversion of recombinant prion protein into a PrPSc-like misfolded form.

    Directory of Open Access Journals (Sweden)

    Rodrigo Diaz-Espinoza

    Full Text Available Prions are self-propagating proteins involved in transmissible spongiform encephalopaties in mammals. An aberrant conformation with amyloid-like features of a cell surface protein, termed prion protein (PrP, is thought to be the essential component of the infectious particle, though accessory co-factor molecules such as lipids and nucleotides may be involved. The cellular co-factors and environmental conditions implicated in PrP misfolding are not completely understood. To address this issue, several studies have been done inducing misfolding of recombinant PrP (recPrP into classical amyloid structures using partially denaturing conditions. In this work, we report that misfolding of recPrP into PrP(Sc-like aggregates can be induced by simply incubating the protein in the presence of kosmotropic salts at concentrations that are known to retain or increase the stability of the protein. We used a simple experimental reaction (protein, buffer and salts submitted to agitation/incubation cycles at physiological temperature and pH. The formation of protease resistant-recPrP was time and salt-concentration dependent and required the presence of kosmotropic anions such as F(- or SO(4(-2. The molecular weights of the protease resistant recPrP fragments are reminiscent of those found in degradation assays of bona fide PrP(Sc. The aggregates also exhibited PrP(Sc-like ultrastructural features including rod-shape morphology under electron microscope, high beta-sheet content and thioflavin-T positive signal. The formation of recPrP aggregates with PrP(Sc biochemical features under conditions closer to physiological in the absence of organic co-factor molecules provides a simple setup that may prove helpful to understand the molecular mechanism of PrP misfolding.

  15. Production of Recombinant Human Papillomavirus Type 52 L1 Protein in Hansenula polymorpha Formed Virus-Like Particles. (United States)

    Liu, Cunbao; Yao, Yufeng; Yang, Xu; Bai, Hongmei; Huang, Weiwei; Xia, Ye; Ma, Yanbing


    Human papillomavirus (HPV) type 52 is a high-risk HPV responsible for cervical cancer. HPV type 52 is common around the world and is the most common in some Asian regions. The available prophylactic HPV vaccines protect only from HPV types 16 and 18. Supplementing economical vaccines that target HPV type 52 may satisfactorily complement available prophylactic vaccines. A codon-adapted HPV 52 L1 gene was expressed in the methylotrophic yeast Hansenula polymorpha, which is used as an industrial platform for economical hepatitis B surface antigen particle production in China. We found that the recombinant proteins produced in this expression system could form virus-like particles (VLPs) with diameters of approximately 50 nm. This study suggests that the HPV 52 VLPs produced in this platform may satisfactorily complement available prophylactic vaccines in fighting against HPVs prevalent in Asia. PMID:25639723

  16. Recombinant RXFP1-LDL-A module does not form dimers. (United States)

    Petrie, Emma J; Periguini, Matthew A; Bathgate, Ross A D; Gooley, Paul R


    The Relaxin receptor, RXFP1, is a complex G-protein coupled receptor (GPCR). It has a rhodopsin-like 7 transmembrane helix region and a large ecto-domain containing Leucine-rich repeats and a Low Desnsity Lipoprotein Class-A module at the N-terminus. RXFP1 and the closely related receptor for INSL3, RXFP2 are the only mammalian GPCRs to contain an LDL-A module. The LDL-A module has been shown to be essential for receptor signal activation. RXFP1, like other GPCRs, has been shown to form dimers however the interface upon association is currently unknown. As LDL-A modules are commonly found as repeats we hypothesized that the LDL-A module may associate at the dimer interface and play a role in receptor activation. To this end we analyzed the ability for the LDL-A module to oligomerise via Analytical Ultracentrifugation (AUC). PMID:24640556

  17. Recombination analysis and structure prediction show correlation between breakpoint clusters and RNA hairpins in the pol gene of human immunodeficiency virus type 1 unique recombinant forms

    DEFF Research Database (Denmark)

    Galli, Andrea; Lai, Alessia; Corvasce, Stefano;


    Recombination is recognized as a primary force in human immunodeficiency virus type 1 (HIV-1) evolution, increasing viral diversity through reshuffling of genomic portions. The strand-switching activity of reverse transcriptase is required to complete HIV-1 replication and can occur randomly...

  18. Recombinant Forms of Leishmania amazonensis Excreted/Secreted Promastigote Surface Antigen (PSA) Induce Protective Immune Responses in Dogs (United States)

    Petitdidier, Elodie; Pagniez, Julie; Papierok, Gérard; Vincendeau, Philippe; Lemesre, Jean-Loup; Bras-Gonçalves, Rachel


    Preventive vaccination is a highly promising strategy for interrupting leishmaniasis transmission that can, additionally, contribute to elimination. A vaccine formulation based on naturally excreted secreted (ES) antigens was prepared from L. infantum promastigote culture supernatant. This vaccine achieved successful results in Phase III trials and was licensed and marketed as CaniLeish. We recently showed that newly identified ES promastigote surface antigen (PSA), from both viable promastigotes and axenically-grown amastigotes, represented the major constituent and the highly immunogenic antigen of L. infantum and L. amazonensis ES products. We report here that three immunizations with either the recombinant ES LaPSA-38S (rPSA) or its carboxy terminal part LaPSA-12S (Cter-rPSA), combined with QA-21 as adjuvant, confer high levels of protection in naive L. infantum-infected Beagle dogs, as checked by bone marrow parasite absence in respectively 78.8% and 80% of vaccinated dogs at 6 months post-challenge. The parasite burden in infected vaccinated dogs was significantly reduced compared to placebo group, as measured by q-PCR. Moreover, our results reveal humoral and cellular immune response clear-cut differences between vaccinated and control dogs. An early increase in specific IgG2 antibodies was observed in rPSA/QA-21- and Cter-rPSA/QA-21-immunized dogs only. They were found functionally active in vitro and were highly correlated with vaccine protection. In vaccinated protected dogs, IFN-γ and NO productions, as well as anti-leishmanial macrophage activity, were increased. These data strongly suggest that ES PSA or its carboxy-terminal part, in recombinant forms, induce protection in a canine model of zoonotic visceral leishmaniasis by inducing a Th1-dominant immune response and an appropriate specific antibody response. These data suggest that they could be considered as important active components in vaccine candidates. PMID:27223609

  19. Recombinant Forms of Leishmania amazonensis Excreted/Secreted Promastigote Surface Antigen (PSA Induce Protective Immune Responses in Dogs.

    Directory of Open Access Journals (Sweden)

    Elodie Petitdidier


    Full Text Available Preventive vaccination is a highly promising strategy for interrupting leishmaniasis transmission that can, additionally, contribute to elimination. A vaccine formulation based on naturally excreted secreted (ES antigens was prepared from L. infantum promastigote culture supernatant. This vaccine achieved successful results in Phase III trials and was licensed and marketed as CaniLeish. We recently showed that newly identified ES promastigote surface antigen (PSA, from both viable promastigotes and axenically-grown amastigotes, represented the major constituent and the highly immunogenic antigen of L. infantum and L. amazonensis ES products. We report here that three immunizations with either the recombinant ES LaPSA-38S (rPSA or its carboxy terminal part LaPSA-12S (Cter-rPSA, combined with QA-21 as adjuvant, confer high levels of protection in naive L. infantum-infected Beagle dogs, as checked by bone marrow parasite absence in respectively 78.8% and 80% of vaccinated dogs at 6 months post-challenge. The parasite burden in infected vaccinated dogs was significantly reduced compared to placebo group, as measured by q-PCR. Moreover, our results reveal humoral and cellular immune response clear-cut differences between vaccinated and control dogs. An early increase in specific IgG2 antibodies was observed in rPSA/QA-21- and Cter-rPSA/QA-21-immunized dogs only. They were found functionally active in vitro and were highly correlated with vaccine protection. In vaccinated protected dogs, IFN-γ and NO productions, as well as anti-leishmanial macrophage activity, were increased. These data strongly suggest that ES PSA or its carboxy-terminal part, in recombinant forms, induce protection in a canine model of zoonotic visceral leishmaniasis by inducing a Th1-dominant immune response and an appropriate specific antibody response. These data suggest that they could be considered as important active components in vaccine candidates.

  20. Spectroscopic and kinetic properties of a recombinant form of the flavin domain of spinach NADH: nitrate reductase. (United States)

    Quinn, G B; Trimboli, A J; Prosser, I M; Barber, M J


    The C-terminal 268 residues of the spinach assimilatory NADH:nitrate reductase amino acid sequence that correspond to the flavin-containing domain of the enzyme have been selectively amplified and expressed as a recombinant protein in Escherichia coli. The recombinant protein, which was produced in both soluble and insoluble forms, was purified to homogeneity using a combination of ammonium sulfate precipitation, affinity chromatography on 5'-ADP-agarose and FPLC gel filtration. The purified domain exhibited a molecular weight of approximately 30 kDa, estimated by polyacrylamide gel electrophoresis, and a molecular mass of 30,169 for the apoprotein determined by mass spectrometry, which also confirmed the presence of FAD. The UV/visible spectrum was typical of a flavoprotein, with maxima at 272, 386, and 461 nm in the oxidized form while CD spectroscopy yielded both positive and negative maxima at 313 and 382 nm and 461 and 484 nm, respectively. The purified domain showed immunological cross-reactivity with anti-spinach nitrate reductase polyclonal antibodies while both N-terminal and internal amino acid sequencing of isolated peptides confirmed the fidelity of the domain's primary sequence. The protein retained NADH-ferricyanide reductase activity (Vmax=84 micromol NADH consumer/min/nmol FAD) with Km's of 17 and 34 microM for NADH and ferricyanide, respectively, with a pH optimum of approximately 6.5 A variety of NADH-analogs could also function as electron donors, though with decreased efficiency, the most effective being reduced nicotinamide hypoxanthine dinucleotide (V(max) = 35 micromol NHDH consumer/min/nmol FAD) and Km = 22 microM). NAD+ was demonstrated to be a competitive inhibitor (Ki = 1.9 mM) while analysis of inhibition by a variety of NAD+-analogs indicated the most efficient inhibitor to be ADP (Ki = 0.2 mM), with analogs devoid of either the phosphate, ribose, or adenine moieties proving to be markedly less-efficient inhibitors. The isolated domain

  1. Comparative analysis of the molecular mechanisms of recombination in hepatitis C virus

    DEFF Research Database (Denmark)

    Galli, Andrea; Bukh, Jens


    Genetic recombination is an important evolutionary mechanism for RNA viruses. The significance of this phenomenon for hepatitis C virus (HCV) has recently become evident, with the identification of circulating recombinant forms in HCV-infected individuals and by novel data from studies permitted...... by advances in HCV cell culture systems and genotyping protocols. HCV is readily able to produce viable recombinants, using replicative and non-replicative molecular mechanisms. However, our knowledge of the required molecular mechanisms remains limited. Understanding how HCV recombines might be instrumental...... will focus on current data available on HCV recombination, also in relation to more detailed data from other RNA viruses....

  2. A recombinant two-module form of human properdin is an inhibitor of the complement alternative pathway. (United States)

    Kouser, Lubna; Abdul-Aziz, Munirah; Tsolaki, Anthony G; Singhal, Dipti; Schwaeble, Wilhelm J; Urban, Britta C; Khan, Haseeb A; Sim, Robert B; Kishore, Uday


    Properdin upregulates the alternative complement pathway by binding and stabilising the C3 convertase complex (C3bBb). Properdin is a soluble glycoprotein and its flexible rod-like 53kDa monomers form cyclic polymers (dimers, trimers, tetramers and pentamers). The properdin monomer consists of seven thrombospondin type I repeats (TSR 0-6), which are similar and homologous to domains found in circumsporozoite and thrombospondin-related anonymous proteins of Plasmodium species, ETP100 of Eimeria tenella, various complement components C6-C9, and thrombospondin I and II. Using deletion constructs, TSR4 and TSR5 of human properdin were implicated in C3b binding and stabilising C3 convertase. However, individually expressed TSR4 or TSR5 failed to bind properdin ligands. Here, we have expressed and characterized biologically active TSR4 and TSR5 together (TSR4+5) in tandem in Escherichia coli, fused to maltose-binding protein. MBP-TSR4+5 bind solid-phase C3b, sulfatides and glycosaminoglycans. In addition, functionally active recombinant TSR4+5 modules inhibit the alternative pathway of complement. PMID:27060503

  3. Characterization and immunological activity of different forms of recombinant secreted Hc of botulinum neurotoxin serotype B products expressed in yeast


    Liu, Bo; Shi, DanYang; Chang, Shaohong; Gong, Xin; Yu, YunZhou; Sun, Zhiwei; Wu, Jun


    The recombinant Hc proteins of botulinum neurotoxins and tetanus toxin are exclusively produced by intracellular heterologous expression in Pichia pastoris for use in subunit vaccines; the same Hc proteins produced by secreted heterologous expression are hyper-glycosylated and immunologically inert. Here, several different recombinant secreted Hc proteins of botulinum neurotoxin serotype B (BHc) were expressed in yeast and we characterized and assessed their immunological activity in detail. ...

  4. The key role for local base order in the generation of multiple forms of China HIV-1 B'/C intersubtype recombinants

    Directory of Open Access Journals (Sweden)

    Wei Ji-Fu


    Full Text Available Abstract Background HIV-1 is a retrovirus with high rate of recombination. Increasing experimental studies in vitro indicated that local hairpin structure of RNA was associated with recombination by favoring RT pausing and promoting strand transfer. A method to estimate the potential to form stem-loop structure by calculating the folding of randomized sequence difference (FORS-D has been used to investigate the relationship between secondary structure and evolutionary pressure in some genome. It showed that gene regions under strong positive "Darwinian" selection were associated with positive FORS-D values. In the present study, the sequences of HIV-1 subtypes B' and C, both of which represent the parent strains of CRF07_BC, CRF08_BC and China URFs, were selected to investigate the relationship between natural recombination and secondary structure by calculating the FORS-D values. Results The apparent higher negative FORS-D value region appeared in the gag-pol gene region (nucleotide 0–3000 of HIV-1 subtypes B' and C. Thirteen (86.7 % of 15 mosaic fragments and 17 (81 % of 21 recombination breakpoints occurred in this higher negative FORS-D region. This strongly suggested that natural recombination did not occur randomly throughout the HIV genome, and that there might be preferred (or hot regions or sites for recombination. The FORS-D analysis of breakpoints showed that most breakpoints of recombinants were located in regions with higher negative FORS-D values (P = 0.0053, and appeared to have a higher negative average FORS-D value than the whole genome (P = 0.0007. The regression analysis also indicated that FORS-D values correlated negatively with breakpoint overlap. Conclusion High negative FORS-D values represent high, base order determined stem-loop potentials and influence mainly the formation of stem-loop structures. Therefore, the present results suggested for the first time that occurrence of natural recombination was associated with

  5. Pro-angiogenic Hematopoietic Progenitor Cells and Endothelial Colony Forming Cells in Pathological Angiogenesis of Bronchial and Pulmonary Circulation


    Duong, Heng; Erzurum, Serpil; Asosingh, Kewal


    Dysregulation of angiogenesis is a common feature of many disease processes. Vascular remodeling is believed to depend on the participation of endothelial progenitor cells, but the identification of endothelial progenitors in postnatal neovascularization remains elusive. Current understanding posits a role for circulating pro-angiogenic hematopoietic cells, which interact with local endothelial cells to establish an environment that favors angiogenesis in physiologic and pathophysiologic resp...

  6. A full-dimensional model of ozone forming reaction: the absolute value of the recombination rate coefficient, its pressure and temperature dependencies. (United States)

    Teplukhin, Alexander; Babikov, Dmitri


    Rigorous calculations of scattering resonances in ozone are carried out for a broad range of rotational excitations. The accurate potential energy surface of Dawes is adopted, and a new efficient method for calculations of ro-vibrational energies, wave functions and resonance lifetimes is employed (which uses hyper-spherical coordinates, the sequential diagonalization/truncation approach, grid optimization and complex absorbing potential). A detailed analysis is carried out to characterize distributions of resonance energies and lifetimes, their rotational/vibrational content and their positions with respect to the centrifugal barrier. Emphasis is on the contribution of these resonances to the recombination process that forms ozone. It is found that major contributions come from localized resonances at energies near the top of the barrier. Delocalized resonances at higher energies should also be taken into account, while very narrow resonances at low energies (trapped far behind the centrifugal barrier) should be treated as bound states. The absolute value of the recombination rate coefficient, its pressure and temperature dependencies are obtained using the energy-transfer model developed in the earlier work. Good agreement with experimental data is obtained if one follows the suggestion of Troe, who argued that the energy transfer mechanism of recombination is responsible only for 55% of the recombination rate (with the remaining 45% coming from the competing chaperon mechanism). PMID:27364351

  7. Characterization and immunological activity of different forms of recombinant secreted Hc of botulinum neurotoxin serotype B products expressed in yeast. (United States)

    Liu, Bo; Shi, DanYang; Chang, ShaoHong; Gong, Xin; Yu, YunZhou; Sun, ZhiWei; Wu, Jun


    The recombinant Hc proteins of botulinum neurotoxins and tetanus toxin are exclusively produced by intracellular heterologous expression in Pichia pastoris for use in subunit vaccines; the same Hc proteins produced by secreted heterologous expression are hyper-glycosylated and immunologically inert. Here, several different recombinant secreted Hc proteins of botulinum neurotoxin serotype B (BHc) were expressed in yeast and we characterized and assessed their immunological activity in detail. Recombinant low-glycosylated secreted BHc products (BSK) were also immunologically inert, similar to hyper-glycosylated BHc products (BSG), although deglycosylation restored their immunological activities. Unexpectedly, deglycosylated proBHc contained an unexpected pro-peptide of an α-factor signal and fortuitous N-linked glycosylation sites in the non-cleaved pro-peptide sequences, but not in the BHc sequences. Notably, a non-glycosylated secreted homogeneous BHc isoform (mBHc), which we successfully prepared after deleting the pro-peptide and removing its single potential glycosylation site, was immunologically active and could confer effective protective immunity, similarly to non-glycosylated rBHc. In summary, we conclude that a non-glycosylated secreted BHc isoform can be prepared in yeast by deleting the pro-peptide of the α-factor signal and mutating its single potential glycosylation site. This approach provides a rational and feasible strategy for the secretory expression of botulism or other toxin antigens. PMID:25567004

  8. Identification of a recombinant inulin fructotransferase (difructose dianhydride III forming) from Arthrobacter sp. 161MFSha2.1 with high specific activity and remarkable thermostability. (United States)

    Wang, Xiao; Yu, Shuhuai; Zhang, Tao; Jiang, Bo; Mu, Wanmeng


    Difructose dianhydride III (DFA III) is a functional carbohydrate produced from inulin by inulin fructotransferase (IFTase, EC In this work, an IFTase gene from Arthrobacter sp. 161MFSha2.1 was cloned and expressed in Escherachia coli. The recombinant enzyme was purified by metal affinity chromatography. It showed significant inulin hydrolysis activity, and the produced main product from inulin was determined as DFA III by nuclear magnetic resonance analysis. The molecular mass of the purified protein was calculated to be 43 and 125 kDa by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and gel filtration, respectively, suggesting the native enzyme might be a homotrimer. The recombinant enzyme showed maximal activity as 2391 units/mg at pH 6.5 and 55 °C. It displayed the highest thermostability among previously reported IFTases (DFA III forming) and was stable up to 80 °C for 4 h of incubation. The smallest substrate was determined as nystose. The conversion ratio of inulin to DFA III reached 81% when 100 g/L inulin was catalyzed by 80 nM recombinant enzyme for 20 min at pH 6.5 and 55 °C. All of these data indicated that the IFTase (DFA III forming) from Arthrobacter sp. 161MFSha2.1 had great potential for industrial DFA III production.

  9. The short form of the recombinant CAL-A-type lipase UM03410 from the smut fungus Ustilago maydis exhibits an inherent trans-fatty acid selectivity. (United States)

    Brundiek, Henrike; Saß, Stefan; Evitt, Andrew; Kourist, Robert; Bornscheuer, Uwe T


    The Ustilago maydis lipase UM03410 belongs to the mostly unexplored Candida antarctica lipase (CAL-A) subfamily. The two lipases with [corrected] the highest identity are a lipase from Sporisorium reilianum and the prototypic CAL-A. In contrast to the other CAL-A-type lipases, this hypothetical U. maydis lipase is annotated to possess a prolonged N-terminus of unknown function. Here, we show for the first time the recombinant expression of two versions of lipase UM03410: the full-length form (lipUMf) and an Nterminally truncated form (lipUMs). For comparison to the prototype, the expression of recombinant CAL-A in E. coli was investigated. Although both forms of lipase UM03410 could be expressed functionally in E. coli, the N-terminally truncated form (lipUMs) demonstrated significantly higher activities towards p-nitrophenyl esters. The functional expression of the N-terminally truncated lipase was further optimized by the appropriate choice of the E. coli strain, lowering the cultivation temperature to 20 °C and enrichment of the cultivation medium with glucose. Primary characteristics of the recombinant lipase are its pH optimum in the range of 6.5-7.0 and its temperature optimum at 55 °C. As is typical for lipases, lipUM03410 shows preference for long chain fatty acid esters with myristic acid ester (C14:0 ester) being the most preferred one.More importantly, lipUMs exhibits an inherent preference for C18:1Δ9 trans and C18:1Δ11 trans-fatty acid esters similar to CAL-A. Therefore, the short form of this U. maydis lipase is the only other currently known lipase with a distinct trans-fatty acid selectivity.

  10. A novel strategy for acetonitrile wastewater treatment by using a recombinant bacterium with biofilm-forming and nitrile-degrading capability. (United States)

    Li, Chunyan; Yue, Zhenlei; Feng, Fengzhao; Xi, Chuanwu; Zang, Hailian; An, Xuejiao; Liu, Keran


    There is a great need for efficient acetonitrile removal technology in wastewater treatment to reduce the discharge of this pollutant in untreated wastewater. In this study, a nitrilase gene (nit) isolated from a nitrile-degrading bacterium (Rhodococcus rhodochrous BX2) was cloned and transformed into a biofilm-forming bacterium (Bacillus subtilis N4) that expressed the recombinant protein upon isopropylthio-β-galactoside (IPTG) induction. The recombinant bacterium (B. subtilis N4-pHT01-nit) formed strong biofilms and had nitrile-degrading capability. Further testing demonstrated that biofilms formed by B. subtilis N4-pHT01-nit were highly resistant to loading shock from acetonitrile and almost completely degraded the initial concentration of acetonitrile (800 mg L(-1)) within 24 h in a moving bed biofilm reactor (MBBR) after operation for 35 d. The bacterial composition of the biofilm, identified by high-throughput sequencing, in a reactor in which the B. subtilis N4-pHT01-nit bacterium was introduced indicated that the engineered bacterium was successfully immobilized in the reactor and became dominant genus. This work demonstrates that an engineered bacterium with nitrile-degrading and biofilm-forming capacity can improve the degradation of contaminants in wastewater. This approach offers a novel strategy for enhancing the biological oxidation of toxic pollutants in wastewater.

  11. Characterization and purification of a protease in serum that cleaves proatrial natriuretic factor (ProANF) to its circulating forms

    International Nuclear Information System (INIS)

    Atrial natriuretic factor (ANF) is synthesized and stored in atrial cardiocytes as a 17-kilodalton (kDa), 126 amino acid polypeptide, proANF, but circulates as smaller, 24 and 28 amino acid peptide fragments of the carboxy terminus of proANF. This reports describes the purification and characterization of this proANF-cleaving protease from rat serum. The cleavages both of 35S-labeled proANF derived from rat atrial cell cultures, as assessed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE)/autoradiography, and of a synthetic p-nitroanilide-containing substrate were used as assays for the detection of enzyme activity. ProANF-cleaving activity was found in rat serum, with no such activity detectable in rat plasma. Fractionation of either whole serum or the purified enzyme by gel filtration chromatography revealed a single peak of activity corresponding to a protein with a Stokes radius of 45 A. Incubation of the purified enzyme with [3H]DFP followed by SDS-PAGE and autoradiography revealed a specifically labeled 38-kDa peptide, the substrate binding subunit. Analysis by high-performance liquid chromatography of the 3-kDa products resulting from the cleavage of 35S-labeled proANF by the purified enzyme revealed, as previously described with whole serum, two radiolabeled peptides which coeluted with the 28 and 24 amino acid C-terminal peptides. These observations imply a precursor-product relationship, with the initial cleavage of proANF to the 28 amino acid peptide, which is then cleaved to the 24 amino acid peptide. These studies indicate that the majority of proANF cleavage activity found in rat serum is represented by that of a distinct serine protease whose properties are different from a variety of well-characterized proteases. The role of this protease in the in vivo processing of proANF remains to be defined

  12. Lineage analysis of circulating Trypanosoma cruzi parasites and their association with clinical forms of Chagas disease in Bolivia.

    Directory of Open Access Journals (Sweden)

    Ramona del Puerto

    Full Text Available BACKGROUND: The causative agent of Chagas disease, Trypanosoma cruzi, is divided into 6 Discrete Typing Units (DTU: Tc I, IIa, IIb, IIc, IId and IIe. In order to assess the relative pathogenicities of different DTUs, blood samples from three different clinical groups of chronic Chagas disease patients (indeterminate, cardiac, megacolon from Bolivia were analyzed for their circulating parasites lineages using minicircle kinetoplast DNA polymorphism. METHODS AND FINDINGS: Between 2000 and 2007, patients sent to the Centro Nacional de Enfermedades Tropicales for diagnosis of Chagas from clinics and hospitals in Santa Cruz, Bolivia, were assessed by serology, cardiology and gastro-intestinal examinations. Additionally, patients who underwent colonectomies due to Chagasic magacolon at the Hospital Universitario Japonés were also included. A total of 306 chronic Chagas patients were defined by their clinical types (81 with cardiopathy, 150 without cardiopathy, 100 with megacolon, 144 without megacolon, 164 with cardiopathy or megacolon, 73 indeterminate and 17 cases with both cardiopathy and megacolon. DNA was extracted from 10 ml of peripheral venous blood for PCR analysis. The kinetoplast minicircle DNA (kDNA was amplified from 196 out of 306 samples (64.1%, of which 104 (53.3% were Tc IId, 4 (2.0% Tc I, 7 (3.6% Tc IIb, 1 (0.5% Tc IIe, 26 (13.3% Tc I/IId, 1 (0.5% Tc I/IIb/IId, 2 (1.0% Tc IIb/d and 51 (25.9% were unidentified. Of the 133 Tc IId samples, three different kDNA hypervariable region patterns were detected; Mn (49.6%, TPK like (48.9% and Bug-like (1.5%. There was no significant association between Tc types and clinical manifestations of disease. CONCLUSIONS: None of the identified lineages or sublineages was significantly associated with any particular clinical manifestations in the chronic Chagas patients in Bolivia.

  13. The role of recombination in the emergence of a complex and dynamic HIV epidemic

    Directory of Open Access Journals (Sweden)

    Morgenstern Burkhard


    Full Text Available Abstract Background Inter-subtype recombinants dominate the HIV epidemics in three geographical regions. To better understand the role of HIV recombinants in shaping the current HIV epidemic, we here present the results of a large-scale subtyping analysis of 9435 HIV-1 sequences that involve subtypes A, B, C, G, F and the epidemiologically important recombinants derived from three continents. Results The circulating recombinant form CRF02_AG, common in West Central Africa, appears to result from recombination events that occurred early in the divergence between subtypes A and G, followed by additional recent recombination events that contribute to the breakpoint pattern defining the current recombinant lineage. This finding also corrects a recent claim that G is a recombinant and a descendant of CRF02, which was suggested to be a pure subtype. The BC and BF recombinants in China and South America, respectively, are derived from recent recombination between contemporary parental lineages. Shared breakpoints in South America BF recombinants indicate that the HIV-1 epidemics in Argentina and Brazil are not independent. Therefore, the contemporary HIV-1 epidemic has recombinant lineages of both ancient and more recent origins. Conclusions Taken together, we show that these recombinant lineages, which are highly prevalent in the current HIV epidemic, are a mixture of ancient and recent recombination. The HIV pandemic is moving towards having increasing complexity and higher prevalence of recombinant forms, sometimes existing as "families" of related forms. We find that the classification of some CRF designations need to be revised as a consequence of (1 an estimated > 5% error in the original subtype assignments deposited in the Los Alamos sequence database; (2 an increasing number of CRFs are defined while they do not readily fit into groupings for molecular epidemiology and vaccine design; and (3 a dynamic HIV epidemic context.

  14. Prognostic significance of circulating intact and cleaved forms of urokinase plasminogen activator receptor in inoperable chemotherapy treated cholangiocarcinoma patients

    DEFF Research Database (Denmark)

    Grunnet, M; Christensen, I J; Lassen, U;


    determine if pre-treatment serum levels of uPAR forms and a decrease in levels during chemotherapy are predictive of survival in patients with inoperable cholangiocarcinoma. DESIGN AND METHODS: Patients with inoperable cholangiocarcinoma were consecutively included in the training set (n=108). A test set......PAR(I-III)+uPAR(II-III) after 2cycles of chemotherapy was associated with poor survival (HR=1.79, 95% CI:1.08-2.97, p=0.023, n=57). This predictor, however, was not significant in the test set (p=0.21, 26 events in 27 patients). CONCLUSION: The baseline level of uPAR(I-III)+uPAR(II-III) is a predictor of survival in inoperable......BACKGROUND: High levels of intact and cleaved forms of the urokinase-type plasminogen activator receptor (uPAR) in both tissue and blood are associated with poor survival in several cancer diseases. The prognostic significance of uPAR in cholangiocarcinoma is unknown. The aims of this study were to...

  15. HIV-1 subtypes B and C unique recombinant forms (URFs and transmitted drug resistance identified in the Western Cape Province, South Africa.

    Directory of Open Access Journals (Sweden)

    Graeme Brendon Jacobs

    Full Text Available South Africa has the largest worldwide HIV/AIDS population with 5.6 million people infected and at least 2 million people on antiretroviral therapy. The majority of these infections are caused by HIV-1 subtype C. Using genotyping methods we characterized HIV-1 subtypes of the gag p24 and pol PR and RT fragments, from a cohort of female participants in the Western Cape Province, South Africa. These participants were recruited as part of a study to assess the combined brain and behavioural effects of HIV and early childhood trauma. The partial HIV-1 gag and pol fragments of 84 participants were amplified by PCR and sequenced. Different online tools and manual phylogenetic analysis were used for HIV-1 subtyping. Online tools included: REGA HIV Subtyping tool version 3; Recombinant Identification Program (RIP; Context-based Modeling for Expeditious Typing (COMET; jumping profile Hidden Markov Models (jpHMM webserver; and subtype classification using evolutionary algorithms (SCUEAL. HIV-1 subtype C predominates within the cohort with a prevalence of 93.8%. We also show, for the first time, the presence of circulating BC strains in at least 4.6% of our study cohort. In addition, we detected transmitted resistance associated mutations in 4.6% of analysed sequences. With tourism and migration rates to South Africa currently very high, we are detecting more and more HIV-1 URFs within our study populations. It is still unclear what role these unique strains will play in terms of long term antiretroviral treatment and what challenges they will pose to vaccine development. Nevertheless, it remains vitally important to monitor the HIV-1 diversity in South Africa and worldwide as the face of the epidemic is continually changing.

  16. Recombinant HA1 produced in E. coli forms functional oligomers and generates strain-specific SRID potency antibodies for pandemic influenza vaccines. (United States)

    Khurana, Surender; Larkin, Christopher; Verma, Swati; Joshi, Manju B; Fontana, Juan; Steven, Alasdair C; King, Lisa R; Manischewitz, Jody; McCormick, William; Gupta, Rajesh K; Golding, Hana


    Vaccine production and initiation of mass vaccination is a key factor in rapid response to new influenza pandemic. During the 2009-2010 H1N1 pandemic, several bottlenecks were identified, including the delayed availability of vaccine potency reagents. Currently, antisera for the single-radial immunodiffusion (SRID) potency assay are generated in sheep immunized repeatedly with HA released and purified after bromelain-treatment of influenza virus grown in eggs. This approach was a major bottleneck for pandemic H1N1 (H1N1pdm09) potency reagent development in 2009. Alternative approaches are needed to make HA immunogens for generation of SRID reagents in the shortest possible time. In this study, we found that properly folded recombinant HA1 globular domain (rHA1) from several type A viruses including H1N1pdm09 and two H5N1 viruses could be produced efficiently using a bacterial expression system and subsequent purification. The rHA1 proteins were shown to form functional oligomers of trimers, similar to virus derived HA, and elicited high titer of neutralizing antibodies in rabbits and sheep. Importantly, the immune sera formed precipitation rings with reference antigens in the SRID assay in a dose-dependent manner. The HA contents in multiple H1N1 vaccine products from different manufacturers (and in several lots) as determined with the rHA1-generated sheep sera were similar to the values obtained with a traditionally generated sheep serum from NIBSC. We conclude that bacterially expressed recombinant HA1 proteins can be produced rapidly and used to generate SRID potency reagents shortly after new influenza strains with pandemic potential are identified.

  17. Fetal Circulation (United States)

    ... Pressure High Blood Pressure Tools & Resources Stroke More Fetal Circulation Updated:Jul 8,2016 click to enlarge The ... fetal heart. These two bypass pathways in the fetal circulation make it possible for most fetuses to survive ...

  18. Comparative Analysis of Pore Formed with Percusive Reverse Circulation Drill and Percussion Drill%冲击反循环钻机与冲击钻机成孔对比分析

    Institute of Scientific and Technical Information of China (English)

    王凤龙; 王洪家


    According to the geological conditions of Zhujiang cable - stayed bridge in Chaoyang, the pore forming technology with percussive reverse circulation drill and conventional percussion drill is analyzed and com- pared from aspects of pore - forming time, slurry amount and pore - forming cost. It is proposed that percussive re- verse circulation drill is preferred for pore -forming under the similar geological conditions.%根据朝阳珠江斜拉桥的地质条件,对采用冲击反循环钻机和常规冲击钻机成孔技术,在成孔时间、泥浆用量、成孔成本等方面进行了分析比较,提出了在该类地质条件下应优先选用冲击反循环钻机成孔。

  19. Immunization with a Recombinant, Pseudomonas fluorescens-Expressed, Mutant Form of Bacillus anthracis-Derived Protective Antigen Protects Rabbits from Anthrax Infection.

    Directory of Open Access Journals (Sweden)

    Matthew D Reed

    Full Text Available Protective antigen (PA, one of the components of the anthrax toxin, is the major component of human anthrax vaccine (Biothrax. Human anthrax vaccines approved in the United States and Europe consist of an alum-adsorbed or precipitated (respectively supernatant material derived from cultures of toxigenic, non-encapsulated strains of Bacillus anthracis. Approved vaccination schedules in humans with either of these vaccines requires several booster shots and occasionally causes adverse injection site reactions. Mutant derivatives of the protective antigen that will not form the anthrax toxins have been described. We have cloned and expressed both mutant (PA SNKE167-ΔFF-315-E308D and native PA molecules recombinantly and purified them. In this study, both the mutant and native PA molecules, formulated with alum (Alhydrogel, elicited high titers of anthrax toxin neutralizing anti-PA antibodies in New Zealand White rabbits. Both mutant and native PA vaccine preparations protected rabbits from lethal, aerosolized, B. anthracis spore challenge subsequent to two immunizations at doses of less than 1 μg.

  20. A Gel Formulation Containing a New Recombinant Form of Manganese Superoxide Dismutase: A Clinical Experience Based on Compassionate Use-Safety of a Case Report

    Directory of Open Access Journals (Sweden)

    Lucia Grumetto


    Full Text Available Background. We report a case of bilateral posterior subcapsular cataracts (PSCs in a 24-year-old man with an allergic conjunctivitis history caused by a long-term therapy with glucocorticoids. Case Presentation. The patient showed a visual acuity of 9/10 for both eyes. He followed a therapy with ketotifen and bilastine for four years. During the last six months before our evaluation, he was treated with chloramphenicol and betamethasone, interrupted for onset of cataracts and increased intraocular pressure. We treated him with ophthalmic gel preparation containing a new recombinant form of manganese superoxide dismutase (rMnSOD at a concentration of 12.5 μg/mL, only for the right eye, while left eye was treated with standard protocol of Bendazac-lysine g 0.5. Conclusion. This case report shows the protective effects of rMnSOD versus PSC disease, probably due to the capacity of rMnSOD of countering free radical species.

  1. Optimization of a multi-gene HIV-1 recombinant subtype CRF02AG DNA vaccine for expression of multiple immunogenic forms

    International Nuclear Information System (INIS)

    We developed an AIDS vaccine for Western and West-Central Africa based on a DNA plasmid vector expressing HIV-1 recombinant subtype CRF02AG gag, pol, and env genes. To optimize the production of noninfectious HIV-like particles (VLPs) and potentially improve the effectiveness of the vaccine, we generated four potential vaccine constructs: the parental (IC2) and three modifications (IC25, IC48, and IC90) containing mutations within the HIV protease. While the parental construct IC2 expressed aggregates of Gag proteins, the IC25 construct resulted in the production of immature VLPs (the core comprises unprocessed Pr55Gag). The remaining two constructs (IC48 and IC90) produced mature VLPs (the core comprises processed capsid p24) in addition to immature VLPs and aggregates of Gag proteins. VLPs incorporated significant levels of mature gp120 envelope glycoprotein. Importantly, the mature VLPs were fusion competent and entered coreceptor-specific target cells. The production of multiple antigenic forms, including fusion-competent VLPs, by candidate DNA vaccine constructs may provide immunologic advantages for induction of protective cellular and humoral responses against HIV-1 proteins

  2. Production and characterization of novel recombinant adeno-associated virus replicative-form genomes: a eukaryotic source of DNA for gene transfer.

    Directory of Open Access Journals (Sweden)

    Lina Li

    Full Text Available Conventional non-viral gene transfer uses bacterial plasmid DNA containing antibiotic resistance genes, cis-acting bacterial sequence elements, and prokaryotic methylation patterns that may adversely affect transgene expression and vector stability in vivo. Here, we describe novel replicative forms of a eukaryotic vector DNA that consist solely of an expression cassette flanked by adeno-associated virus (AAV inverted terminal repeats. Extensive structural analyses revealed that this AAV-derived vector DNA consists of linear, duplex molecules with covalently closed ends (termed closed-ended, linear duplex, or "CELiD", DNA. CELiD vectors, produced in Sf9 insect cells, require AAV rep gene expression for amplification. Amounts of CELiD DNA produced from insect cell lines stably transfected with an ITR-flanked transgene exceeded 60 mg per 5 × 10(9 Sf9 cells, and 1-15 mg from a comparable number of parental Sf9 cells in which the transgene was introduced via recombinant baculovirus infection. In mice, systemically delivered CELiD DNA resulted in long-term, stable transgene expression in the liver. CELiD vectors represent a novel eukaryotic alternative to bacterial plasmid DNA.

  3. Characterization of a distinct population of circulating human non-adherent endothelial forming cells and their recruitment via intercellular adhesion molecule-3.

    Directory of Open Access Journals (Sweden)

    Sarah L Appleby

    Full Text Available Circulating vascular progenitor cells contribute to the pathological vasculogenesis of cancer whilst on the other hand offer much promise in therapeutic revascularization in post-occlusion intervention in cardiovascular disease. However, their characterization has been hampered by the many variables to produce them as well as their described phenotypic and functional heterogeneity. Herein we have isolated, enriched for and then characterized a human umbilical cord blood derived CD133(+ population of non-adherent endothelial forming cells (naEFCs which expressed the hematopoietic progenitor cell markers (CD133, CD34, CD117, CD90 and CD38 together with mature endothelial cell markers (VEGFR2, CD144 and CD31. These cells also expressed low levels of CD45 but did not express the lymphoid markers (CD3, CD4, CD8 or myeloid markers (CD11b and CD14 which distinguishes them from 'early' endothelial progenitor cells (EPCs. Functional studies demonstrated that these naEFCs (i bound Ulex europaeus lectin, (ii demonstrated acetylated-low density lipoprotein uptake, (iii increased vascular cell adhesion molecule (VCAM-1 surface expression in response to tumor necrosis factor and (iv in co-culture with mature endothelial cells increased the number of tubes, tubule branching and loops in a 3-dimensional in vitro matrix. More importantly, naEFCs placed in vivo generated new lumen containing vasculature lined by CD144 expressing human endothelial cells (ECs. Extensive genomic and proteomic analyses of the naEFCs showed that intercellular adhesion molecule (ICAM-3 is expressed on their cell surface but not on mature endothelial cells. Furthermore, functional analysis demonstrated that ICAM-3 mediated the rolling and adhesive events of the naEFCs under shear stress. We suggest that the distinct population of naEFCs identified and characterized here represents a new valuable therapeutic target to control aberrant vasculogenesis.

  4. Nearshore circulation

    NARCIS (Netherlands)

    Battjes, J.A.; Sobey, R.J.; Stive, M.J.F.


    Shelf circulation is driven primarily by wind- and tide-induced forces. It is laterally only weakly constrained so that the geostrophic (Coriolis) acceleration is manifest in the response. Nearshore circulation on the other hand is dominated by wave-induced forces associated with shallow-water. wave

  5. Efficacy of DNA vaccines forming e7 recombinant retroviral virus-like particles for the treatment of human papillomavirus-induced cancers. (United States)

    Lescaille, Geraldine; Pitoiset, Fabien; Macedo, Rodney; Baillou, Claude; Huret, Christophe; Klatzmann, David; Tartour, Eric; Lemoine, François M; Bellier, Bertrand


    Human papillomavirus (HPV) is involved in the development of anogenital tumors and also in the development of oropharyngeal head and neck carcinomas, where HPV-16, expressing the E6 and E7 oncoproteins, is the most frequent serotype. Although vaccines encoding L1 and L2 capsid HPV proteins are efficient for the prevention of HPV infection, they are inadequate for treating established tumors. Hence, development of innovative vaccine therapies targeting E6/E7 is important for controlling HPV-induced cancers. We have engineered a nononcogenic mutated E7-specific plasmo-retroVLP vaccine (pVLP-E7), consisting of plasmid DNA, that is able to form recombinant retrovirus-based virus-like particles (VLPs) that display E7 antigen into murine leukemia virus Gag proteins pseudotyped with vesicular stomatitis virus envelope glycoprotein (VSV-G). pVLP-E7 vaccinations were studied for their ability to generate specific immune responses and for induction of protective immunity against tumor cell challenge in preventive and therapeutic models. The produced VLPs induce the maturation of human dendritic cells in vitro and mount specific E7 T cell responses. Intradermic vaccinations of mice with pVLP-E7 show their efficacy to generate antigen-specific T cell responses, to prevent and protect animals from early TC-1 tumor development compared with standard DNA or VLP immunizations. The vaccine efficacy was also evaluated for advanced tumors in mice vaccinated at various time after the injection of TC-1 cells. Data show that pVLP-E7 vaccination can cure mice with already established tumors only when combined with Toll-like receptor-7 (TLR7) and TLR9 agonists. Our findings provide evidence that pVLPs, combining the advantages of DNA and VLP vaccines, appear to be a promising strategy for the treatment of HPV-induced cancers. PMID:23521528

  6. Flow characteristics of Hijiori HDR reservoir form circulation test in 1995; Koon tantai Hijiori jikkenjo ni okeru shinbu choryuso yobi junkan shiken (1995 nendo) kekka to ryudo kaiseki

    Energy Technology Data Exchange (ETDEWEB)

    Fukushima, N.; Hyodo, M.; Shinohara, N.; Takasugi, S. [Geothermal Energy Research and Development Co. Ltd., Tokyo (Japan)


    This paper reports the result of a preliminary circulation test conducted in fiscal 1995 on a deep reservoir (at a depth of about 2200 m) in the Hijiori hot dry rock experimental field. One water injection well and two production wells were drilled to constitute a circulation loop, to which the circulation test was performed to investigate the flow characteristics thereof. The result revealed the following matters: total amount of injected water of 51500 m{sup 3} resulted in a total fluid recovery rate of about 40%; as a result of well stimulation given twice during the initial stage of the water injection, the continuity impedance in the vicinity of the injection well decreased largely (however, the continuity improvement upon the second attempt was considerably inferior to that from the first attempt); and increase in the water injection amount does not necessarily lead to increase in the production amount. The paper describes additionally that it is extremely difficult to interpret non-linearity between the injection and production amounts by using a model prepared previously with a main objective to analyze the Hijiori HDR circulation system. 1 ref., 9 figs., 1 tab.

  7. Recombination instability

    DEFF Research Database (Denmark)

    D'Angelo, N.


    A recombination instability is considered which may arise in a plasma if the temperature dependence of the volume recombination coefficient, alpha, is sufficiently strong. Two cases are analyzed: (a) a steady-state plasma produced in a neutral gas by X-rays or high energy electrons; and (b...

  8. Characterization of a Distinct Population of Circulating Human Non-Adherent Endothelial Forming Cells and Their Recruitment via Intercellular Adhesion Molecule-3


    Appleby, Sarah L.; Cockshell, Michaelia P.; Pippal, Jyotsna B.; Thompson, Emma J.; Barrett, Jeffrey M.; Katie Tooley; Shaundeep Sen; Wai Yan Sun; Randall Grose; Ian Nicholson; Vitalina Levina; Ira Cooke; Gert Talbo; Lopez, Angel F.; Bonder, Claudine S.


    Circulating vascular progenitor cells contribute to the pathological vasculogenesis of cancer whilst on the other hand offer much promise in therapeutic revascularization in post-occlusion intervention in cardiovascular disease. However, their characterization has been hampered by the many variables to produce them as well as their described phenotypic and functional heterogeneity. Herein we have isolated, enriched for and then characterized a human umbilical cord blood derived CD133(+) popul...

  9. Spread of distinct human immunodeficiency virus type 1 AG recombinant lineages in Africa. (United States)

    Cornelissen, M; van Den Burg, R; Zorgdrager, F; Goudsmit, J


    To identify new subtype G human immunodeficiency virus type 1 (HIV-1) strains and AG recombinant forms, we collected 28 serum samples from immigrants to the Netherlands from 12 countries throughout Africa. Based on the gag sequences 22 isolates were identified as subtype A or G. Phylogenetic analysis of discontinuous regions of the gag (726 nt), pol (1176 nt) and env (276 nt) genes revealed 13 AG recombinants with the mosaic structure A(gag)/G(pol)/A(env), three with A(gag)/G(pol)/G(env) and one other with A(gag) /G(pol)/G(env), in addition to 'pure' subtypes A(gag)/A(pol)/A(env) (n=1) and G(gag)/G(pol)/G(env) (n=4). To analyse the crossover points in more detail, a new RT-PCR was developed resulting in a large contiguous sequence of 2600 nt from the gag region to half the pol region. All the 13 A(gag)/G(pol)/A(env) recombinants appeared to belong to the circulating recombinant form (CRF) AG (IbNG). The three A(gag)/G(pol) /G(env) recombinants differed from the CRF AG (IbNG) subtype, suggesting the identification of a new CRF subtype. The recovery of AG recombinants from African countries a thousand miles apart indicates the active spread of new recombinants. PMID:10644851

  10. Development and experiment about recombination heating circulation defrosting system of mini cold storage house%微型冷库复合加热循环除霜系统的研制与试验

    Institute of Scientific and Technical Information of China (English)

    赵松松; 杨昭; 陈爱强; 张娜; 陈明锋; 刘兴华


    针对冷冻冷藏库传统除霜方法高能耗、冷库温湿度波动大等缺陷,通过设计系统除霜结构,完善控制策略,研发了一种智能除霜方法。复合加热循环除霜采用时间—压差联合智能控制策略界定最佳除霜点,配备排管辅助制冷技术,基于欧姆龙PLC高精度控制系统使各设备协同完成除霜过程。对复合加热循环除霜系统进行试验研究,对比分析不同除霜方法的工作性能及能耗情况。结果显示:相比于传统电加热除霜,复合加热循环除霜过程冷库温度波动减小3.8℃,相对湿度波动降低21.1百分点,除霜时间缩短14 min,系统除霜节能率达34.5%。%In recent years, mini cold storage house has developed rapidly. The evaporator is extremely easy to frost as a result of locating in the condition of low temperature and high humidity. However, defrosting energy consumption accounts for more than 10% of system’s total energy consumption. To overcome the defect about high energy consumption, temperature and humidity fluctuation of traditional defrosting technology in mini cold storage house, we investigated a new framework by changing the structure of the defrosting system and optimizing the control technology. Firstly, we developed a new defrosting system named as recombination heating circulation defrosting (RHCD) based on overhead coil auxiliary refrigeration. After that, the time-differential pressure (TDP) combining intelligent control method was used innovatively to determine the best defrosting point. Finally, OMRON programmable logic controller was applied to combine some devices to finish the defrosting. In the defrosting process, the electric-air valves installed on the incubator were closed timely to restrain heat and vapor into the cold storage house, and hot air flow was forced to circulate in the bypass channel under the working of blowers. Meanwhile overhead coil auxiliary refrigeration system was

  11. Relative levels of the proprotein and cleavage‐activated form of circulating human anti‐Müllerian hormone are sexually dimorphic and variable during the life cycle


    Pankhurst, Michael W.; Chong, Yih Harng; McLennan, Ian S.


    Abstract Anti‐Müllerian hormone (AMH) is a gonadal hormone, which induces aspects of the male phenotype, and influences ovarian follicular recruitment. AMH is synthesized as a proprotein (proAMH), which is incompletely cleaved to the receptor‐competent AMHN ,C. AMH ELISAs have not distinguished between proAMH and AMHN ,C; consequently, the physiological ranges of circulating proAMH and AMHN ,C are unknown. A novel proAMH ELISA has been used to assay serum proAMH in humans. Total AMH was also ...

  12. Circulation economics

    DEFF Research Database (Denmark)

    Ingebrigtsen, Stig; Jakobsen, Ove


    presupposes a perspective integrating economic, natural and cultural values. Third, to organize the interplay between all stakeholders we introduce an arena for communicative cooperation. Originality/value - The paper concludes that circulation economics presupposes a change in paradigm, from a mechanistic...

  13. Viral replication is enhanced by an HIV-1 intersubtype recombination-derived Vpu protein

    Directory of Open Access Journals (Sweden)

    Salomón Horacio


    Full Text Available Abstract Background Multiple HIV-1 intersubtype recombinants have been identified in human populations. Previous studies from our lab group have shown that the epidemic in Argentina is characterized by the high prevalence of a circulating recombinant form, CRF12_BF, and many related BF recombinant forms. In these genomic structures a recombination breakpoint frequently involved the vpu coding region. Due to the scarce knowledge of Vpu participation in the virion release process and its impact on pathogenesis and of the functional capacities of intersubtype recombinant Vpu proteins, the aim of this work was to perform a comparative analysis on virion release capacity and relative replication capacity among viral variants harboring either a BF recombinant Vpu or a subtype B Vpu. Results Our results showed that BF recombinant Vpu was associated to an increased viral particles production when compared to WT B variant in tetherin-expressing cell lines. This observation was tested in the context of a competition assay between the above mentioned variants. The results showed that the replication of the BF Vpu-harboring variant was more efficient in cell cultures than subtype B, reaching a higher frequency in the viral population in a short period of time. Conclusion This study showed that as a result of intersubtype recombination, a structurally re-organized HIV-1 Vpu has an improved in vitro capacity of enhancing viral replication, and provides evidence of the changes occurring in this protein function that could play an important role in the successful spread of intersubtype recombinant variants.

  14. IgA in the horse: cloning of equine polymeric Ig receptor and J chain and characterization of recombinant forms of equine IgA. (United States)

    Lewis, M J; Wagner, B; Irvine, R M; Woof, J M


    As in other mammals, immunoglobulin A (IgA) in the horse has a key role in immune defense. To better dissect equine IgA function, we isolated complementary DNA (cDNA) clones for equine J chain and polymeric Ig receptor (pIgR). When coexpressed with equine IgA, equine J chain promoted efficient IgA polymerization. A truncated version of equine pIgR, equivalent to secretory component, bound with nanomolar affinity to recombinant equine and human dimeric IgA but not with monomeric IgA from either species. Searches of the equine genome localized equine J chain and pIgR to chromosomes 3 and 5, respectively, with J chain and pIgR coding sequence distributed across 4 and 11 exons, respectively. Comparisons of transcriptional regulatory sequences suggest that horse and human pIgR expression is controlled through common regulatory mechanisms that are less conserved in rodents. These studies pave the way for full dissection of equine IgA function and open up possibilities for immune-based treatment of equine diseases. PMID:20631692

  15. Soluble recombinant influenza vaccines.


    Fiers, W; Neirynck, S; Deroo, T; Saelens, X; Jou, W M


    Soluble, recombinant forms of influenza A virus haemagglutinin and neuraminidase have been produced in cells of lower eukaryotes, and shown in a mouse model to induce complete protective immunity against a lethal virus challenge. Soluble neuraminidase, produced in a baculovirus system, consisted of tetramers, dimers and monomers. Only the tetramers were enzymatically active. The immunogenicity decreased very considerably in the order tetra > di > mono. Therefore, we fused the head part of the...

  16. Multiple barriers to recombination between divergent HIV-1 variants revealed by a dual-marker recombination assay

    DEFF Research Database (Denmark)

    Nikolaitchik, Olga A; Galli, Andrea; Moore, Michael D;


    Recombination is a major force for generating human immunodeficiency virus type 1 (HIV-1) diversity and produces numerous recombinants circulating in the human population. We previously established a cell-based system using green fluorescent protein gene (gfp) as a reporter to study the mechanisms...

  17. Comparison of two chemical cleavage methods for preparation of a truncated form of recombinant human insulin-like growth factor I from a secreted fusion protein. (United States)

    Forsberg, G; Baastrup, B; Brobjer, M; Lake, M; Jörnvall, H; Hartmanis, M


    We have produced a naturally occurring variant of human insulin-like growth factor I, truncated by three amino acids at the amino terminus. The polypeptide is obtained as a fusion protein in Escherichia coli. The fusion partner is a synthetic IgG-binding peptide. During fermentation the fusion protein is secreted into the medium, and is purified on IgG--Sepharose prior to cleavage. Two different genes for the fusion protein were used, allowing chemical cleavage at either a tryptophan linker or a methionine linker between the fusion partner and the growth factor, using N-chlorosuccinimide (NCS) or cyanogen bromide (CNBr) respectively. A partial CNBr cleavage yielded the native peptide, whereas the NCS cleavage yielded a product in which the single methionine had been oxidized to the sulfoxide. The forms from both cleavage methods exhibited biological activity and were characterized after purification to homogeneity. Both cleavage methods gave products having correct N- and C-terminal ends. The purified product had a biological activity equal to that of corresponding material from natural sources, 15 000 U/mg. Modified forms of truncated IGF-I were also identified, purified and characterized. Modifications such as proteolysis and misincorporation of norleucine for methionine occurred during biosynthesis, while oxidation of methionine took place during both fermentation and chemical cleavage. PMID:2696476

  18. AECL passive autocatalytic recombiners

    Energy Technology Data Exchange (ETDEWEB)

    Gardner, L.B.; Marcinkowska, K. [Atomic Energy of Canada Limited, Chalk River, Ontario (Canada)


    Atomic Energy of Canada Limited's (AECL) Passive Autocatalytic Recombiner (PAR) is a passive device used for hydrogen mitigation under post-accident conditions in nuclear reactor containment. The PAR employs a proprietary AECL catalyst which promotes the exothermal reaction between hydrogen and oxygen to form water vapour. The heat of reaction combined with the PAR geometry establishes a convective flow through the recombiner, where ambient hydrogen-rich gas enters the PAR inlet and hot, humid, hydrogen-depleted gas exits the outlet. AECL's PAR has been extensively qualified for CANDU and light water reactors (LWRs), and has been supplied to France, Finland, Ukraine, South Korea and is currently being deployed in Canadian nuclear power plants. (author)

  19. AECL passive autocatalytic recombiners

    Energy Technology Data Exchange (ETDEWEB)

    Gardner, L.B.; Marcinkowska, K. [Atomic Energy of Canada Limited, Chalk River, Ontario (Canada)


    Atomic Energy of Canada Limited's (AECL) Passive Autocatalytic Recombiner (PAR) is a passive device used for hydrogen mitigation under post-accident conditions in nuclear reactor containment. The PAR employs a proprietary AECL catalyst which promotes the exothermal reaction between hydrogen and oxygen to form water vapour. The heat of reaction combined with the PAR geometry establishes a convective flow through the recombiner, where ambient hydrogen-rich gas enters the PAR inlet and hot, humid, hydrogen-depleted gas exits the outlet. AECL's PAR has been extensively qualified for CANDU and light water reactors (LWRs), and has been supplied to France, Finland, Ukraine, South Korea and is currently being deployed in Canadian nuclear power plants. (author)

  20. Plasmid recombination in Haemophilus influenzae

    Energy Technology Data Exchange (ETDEWEB)

    McCarthy, D.


    DNA recombination in exponential phase and competent Haemophilus influenzae was measured by an electron microscopic assay that relies on the conversion of plasmid RSF0885 monomers into multimeric forms. Dimer circles were present at a frequency of 2% in plasmid preparations from competent Rd (wild-type) cells; multimers were present at a frequency of 0.2% in preparations from exponential phase cells. Thus, plasmid recombination was stimulated in competent cells. Multimer formation occurred efficiently in cells of the transformation defective mutant rec2, implying that the rec2 gene product is not required for plasmid recombination. However, the absence of multimer plasmids in preparations from competent cells of the transformation defective mutant rec1 suggests that the rec1 gene product is required. Digestion of purified plasmids with restriction endonuclease PvuII, which makes a single cut in the monomer, revealed the presence of recombination intermediates composed of two linear plasmids joined to form two pairs of arms resembling the Greek letter chi. Length measurements of these arms taken from a population of recombination intermediates gave evidence that the plasmids were joined at sites of homology. The distributions of individual DNA strands, at the intersections of the four arms, could be resolved in some recombination intermediates and were of two types. The first type of junction appeared as a single-stranded arm appended to each corner. The second type of junction consisted of a single strand of DNA linking the two linear plasmids at a site of homology. The single-stranded linker was frequently situated at the edge of a short gap on one of the plasmids in the pair. The fine structures of the recombinational joints have been interpreted in terms of previously proposed models of recombination.

  1. On So's conjecture for integral circulant graphs

    Directory of Open Access Journals (Sweden)

    J.W. Sander


    According to a conjecture of {\\sc So} two integral circulant graphs are isomorphic if and only if they are isospectral, i.e. they have the same eigenvalues (counted with multiplicities. We prove a weaker form of this conjecture, namely, that two integral circulant graphs with multiplicative divisor sets are isomorphic if and only if their spectral vectors coincide.

  2. Access of Digitized Print Originals in US and UK Higher Education Libraries Combined with Print Circulation Indicates Increased Usage of Traditional Forms of Reading Materials. A Review of: Joint, Nicholas. “Is Digitisation the New Circulation?: Borrowing Trends, Digitisation and the nature of reading in US and UK Libraries.” Library Review 57.2 (2008: 87-95.

    Directory of Open Access Journals (Sweden)

    Kurt Blythe


    Full Text Available Objective – To discern the statistical accuracy of reports that print circulation is in decline in libraries, particularly higher education libraries in the United States (USand United Kingdom (UK, and to determine if circulation patterns reflect a changing dynamic in patron reading habits.Design – Comparative statistical analysis.Setting – Library circulation statistics from as early as 1982 to as recent as 2006, culled from various sources with specific references to statistics gathered by the National Endowment for the Arts (NEA, the Library and Information Statistics Unit (LISU, the Association of Research Libraries (ARL, the National Center for Education Statistics (NCES, and the Association of College and Research Libraries (ACRL.Subjects – Higher education institutions in the United States and United Kingdom, along with public libraries to a lesser extent.Methods – This study consists of an analysis of print circulation statistics in public and higher education libraries in the US and UK, combined with data on multimedia circulation in public libraries and instances of digital access in university libraries. Specifically, NEA statistics provided data on print readership levels in the US from 1982 to 2002; LISU statistics were analyzed for circulation figures and gate counts in UK public libraries; ARL statistics from 1996 to 2006 provided circulation data for large North American research libraries; NCES statistics from 1990 to 2004 contributed data on circulation in “tertiary level” US higher education libraries; and ACRL statistics were analyzed for more circulation numbers for US post-secondary education libraries. The study further includes data on UK trends in print readership and circulation in UK higher education libraries, and trends in US public library circulation of non-print materials.Main Results – Analysis of the data indicates that print circulation is down in US and UK public libraries and in ARL member

  3. Circulation of Stars (United States)

    Boitani, P.


    Since the dawn of man, contemplation of the stars has been a primary impulse in human beings, who proliferated their knowledge of the stars all over the world. Aristotle sees this as the product of primeval and perennial “wonder” which gives rise to what we call science, philosophy, and poetry. Astronomy, astrology, and star art (painting, architecture, literature, and music) go hand in hand through millennia in all cultures of the planet (and all use catasterisms to explain certain phenomena). Some of these developments are independent of each other, i.e., they take place in one culture independently of others. Some, on the other hand, are the product of the “circulation of stars.” There are two ways of looking at this. One seeks out forms, the other concentrates on the passing of specific lore from one area to another through time. The former relies on archetypes (for instance, with catasterism), the latter constitutes a historical process. In this paper I present some of the surprising ways in which the circulation of stars has occurred—from East to West, from East to the Far East, and from West to East, at times simultaneously.

  4. Recombinant Technology and Probiotics

    Directory of Open Access Journals (Sweden)

    Icy D’Silva


    Full Text Available Recombinant technology has led the way to monumental advances in the development of useful molecules, including the development of safe probiotics. The development of novel approaches using recombinant technology and probiotics that allow accurate targeting of therapeutics to the mucosa is an interesting area of research. The creation and use of recombinant probiotics expressing recombinantovalbumin, recombinant ovalbumin mutants and yet-to-be-designed recombinant hypo/non-allergenic molecules offer the opportunity to further investigate their effects for food, nutrition, environment andhealth. This review highlights advances in native probiotics and recombinant probiotics expressing native and recombinant molecules for food, nutrition, environment and health.

  5. A newly emerging HIV-1 recombinant lineage (CRF58_01B) disseminating among people who inject drugs in Malaysia. (United States)

    Chow, Wei Zhen; Takebe, Yutaka; Syafina, Nur Ezreen; Prakasa, Malarvelli Soorya; Chan, Kok Gan; Al-Darraji, Haider Abdulrazzaq Abed; Koh, Clayton; Kamarulzaman, Adeeba; Tee, Kok Keng


    The HIV epidemic is primarily characterised by the circulation of HIV-1 group M (main) comprising of 11 subtypes and sub-subtypes (A1, A2, B-D, F1, F2, G, H, J, and K) and to date 55 circulating recombinant forms (CRFs). In Southeast Asia, active inter-subtype recombination involving three main circulating genotypes--subtype B (including subtype B', the Thai variant of subtype B), CRF01_AE, and CRF33_01B--have contributed to the emergence of novel unique recombinant forms. In the present study, we conducted the molecular epidemiological surveillance of HIV-1 gag-RT genes among 258 people who inject drugs (PWIDs) in Kuala Lumpur, Malaysia, between 2009 and 2011 whereby a novel CRF candidate was recently identified. The near full-length genome sequences obtained from six epidemiologically unlinked individuals showed identical mosaic structures consisting of subtype B' and CRF01_AE, with six unique recombination breakpoints in the gag-RT, pol, and env regions. Among the high-risk population of PWIDs in Malaysia, which was predominantly infected by CRF33_01B (>70%), CRF58_01B circulated at a low but significant prevalence (2.3%, 6/258). Interestingly, the CRF58_01B shared two unique recombination breakpoints with other established CRFs in the region: CRF33_01B, CRF48_01B, and CRF53_01B in the gag gene, and CRF15_01B (from Thailand) in the env gene. Extended Bayesian Markov chain Monte Carlo sampling analysis showed that CRF58_01B and other recently discovered CRFs were most likely to have originated in Malaysia, and that the recent spread of recombinant lineages in the country had little influence from neighbouring countries. The isolation, genetic characterization, and evolutionary features of CRF58_01B among PWIDs in Malaysia signify the increasingly complex HIV-1 diversity in Southeast Asia that may hold an implication on disease treatment, control, and prevention.

  6. Journalism as Cultures of Circulation

    DEFF Research Database (Denmark)

    Bødker, Henrik


    The universe of journalism has always consisted of interspersed texts, meanings and practices. Yet, much journalism research has often isolated either texts and/or contexts and as such assumed relations between professional practices, informed (rational) readers and (conceived) core texts...... of journalism. It is, however, more important than ever to shift attention away from texts to the processes through which they are circulated. This is partly because the many cultural forms of journalism (textual, institutional, technological, material, behavioural and imagined) are undergoing significant......, likes, comments, searches, journalist roles, writing and reading positions and identities etc. Such forms will be traced within the mediation of a specific event with the overall aim of beginning a theorization of the landscape of journalism as highly interrelated cultures of circulation....

  7. Designer genes. Recombinant antibody fragments for biological imaging

    International Nuclear Information System (INIS)

    Monoclonal antibodies (MAbs), with high specificy and high affinity for their target antigens, can be utilized for delivery of agents such as radionuclides, enzymes, drugs or toxins in vivo. However, the implementation of radiolabeled antibodies as magic bullets for detection and treatment of diseases such as cancer has required addressing several shortcomings of murine MAbs. These include their immunogenicity, sub-optimal targeting and pharmacokinetic properties, and practical issues of production and radiolabeling. Genetic engineering provides a powerful approach for redesigning antibodies for use in oncologic applications in vivo. Recombinant fragments have been produced that retain high affinity for target antigens, and display a combination of rapid, high-level tumor targeting with concomitant clearance from normal tissues and the circulation in animal models. An important first step was cloning and engineering of antibody heavy and light chain variable domains into single-chain Fvs (molecular weight, 25-17 kDa), in which the variable regions are joined via a synthetic linker peptide sequence. Although scFvs themselves showed limited tumor uptake in preclinical and clinical studies, they provide a useful building block for intermediate sized recombinant fragments. Covalently linked dimers or non-covalent dimers of scFvs (also known as diabodies) show improved targeting and clearance properties due to their higher molecular weight (55kDa) and increased avidity. Further gains can be made by generation of larger recombinant fragments, such as the minibody, an scFv-CH3 fusion protein that self-assembles into a bivalent dimer of 80 kDa. A systematic evaluation of scFv, diabody, minibody, and intact antibody (based on comparison of tumor uptakes, tumor: blood activity ratios, and calculation of an Imaging Figure of Merit) can form the basis for selection of combinations of recombinant fragments and radionuclides for imaging applications. Ease of engineering and

  8. Recombinant DNA in Medicine


    Cederbaum, Stephen D.; Fareed, George C.; Lovett, Michael A.; Shapiro, Larry J.


    Studies in bacteria and bacterial viruses have led to methods to manipulate and recombine DNA in unique and reproducible ways and to amplify these recombined molecules millions of times. Once properly identified, the recombinant DNA molecules can be used in various ways useful in medicine and human biology. There are many applications for recombinant DNA technology. Cloned complementary DNA has been used to produce various human proteins in microorganisms. Insulin and growth hormone have been...

  9. Improving baculovirus recombination


    Zhao, Yuguang; Chapman, David A. G.; Jones, Ian M.


    Recombinant baculoviruses have established themselves as a favoured technology for the high-level expression of recombinant proteins. The construction of recombinant viruses, however, is a time consuming step that restricts consideration of the technology for high throughput developments. Here we use a targeted gene knockout technology to inactivate an essential viral gene that lies adjacent to the locus used for recombination. Viral DNA prepared from the knockout fails to initiate an infecti...

  10. Experimental and numerical investigation of natural circulation phenomena in a rectangular natural circulation loop

    International Nuclear Information System (INIS)

    Natural circulation is the key phenomena in the passive cooling systems. Thus, it is important to study the flow characteristics and heat transfer behavior in natural circulation. The natural circulation phenomena in steady state and transient form is investigated using 3D CFD simulations, carried out using OpenFoam 2.2.0. The first part consists of a steady-state study, in which the results are validated by data available from a set of experiments conducted over a range of heater power (130W-360W). The second part consists of a transient study of flow development and establishment of natural circulation within this loop. (author)

  11. Microwave circulator design

    CERN Document Server

    Linkhart, Douglas K


    Circulator design has advanced significantly since the first edition of this book was published 25 years ago. The objective of this second edition is to present theory, information, and design procedures that will enable microwave engineers and technicians to design and build circulators successfully. This resource contains a discussion of the various units used in the circulator design computations, as well as covers the theory of operation. This book presents numerous applications, giving microwave engineers new ideas about how to solve problems using circulators. Design examples are provided, which demonstrate how to apply the information to real-world design tasks.

  12. Photoionization and Recombination (United States)

    Nahar, Sultana N.


    Theoretically self-consistent calculations for photoionization and (e + ion) recombination are described. The same eigenfunction expansion for the ion is employed in coupled channel calculations for both processes, thus ensuring consistency between cross sections and rates. The theoretical treatment of (e + ion) recombination subsumes both the non-resonant recombination ("radiative recombination"), and the resonant recombination ("di-electronic recombination") processes in a unified scheme. In addition to the total, unified recombination rates, level-specific recombination rates and photoionization cross sections are obtained for a large number of atomic levels. Both relativistic Breit-Pauli, and non-relativistic LS coupling, calculations are carried out in the close coupling approximation using the R-matrix method. Although the calculations are computationally intensive, they yield nearly all photoionization and recombination parameters needed for astrophysical photoionization models with higher precision than hitherto possible, estimated at about 10-20% from comparison with experimentally available data (including experimentally derived DR rates). Results are electronically available for over 40 atoms and ions. Photoionization and recombination of He-, and Li-like C and Fe are described for X-ray modeling. The unified method yields total and complete (e+ion) recombination rate coefficients, that can not otherwise be obtained theoretically or experimentally.

  13. Recombineering Homologous Recombination Constructs in Drosophila


    Carreira-Rosario, Arnaldo; Scoggin, Shane; Shalaby, Nevine A.; Williams, Nathan David; Hiesinger, P. Robin; Buszczak, Michael


    The continued development of techniques for fast, large-scale manipulation of endogenous gene loci will broaden the use of Drosophila melanogaster as a genetic model organism for human-disease related research. Recent years have seen technical advancements like homologous recombination and recombineering. However, generating unequivocal null mutations or tagging endogenous proteins remains a substantial effort for most genes. Here, we describe and demonstrate techniques for using recombineeri...

  14. Identification and Characterization of CRF02_AG, CRF06_cpx, and CRF09_cpx Recombinant Subtypes in Mali, West Africa (United States)

    Koita, Ousmane; Dabitao, Djeneba; Dao, Sounkalo; Ibrah, Mahamadou; Sogoba, Dramane; Dewar, Robin L.; Berg, Steve C.; Jiang, Min-Kang; Parta, Mark; Washington, Janice A.; Polis, Michael A.; Lane, H. Clifford; Tounkara, Anatole


    Abstract Multiple HIV-1 subtypes and circulating recombinant forms (CRFs) are known to cocirculate in Africa. In West Africa, the high prevalence of CRF02_AG, and cocirculation of subtype A, CRF01_AE, CRF06_cpx, and other complex intersubtype recombinants has been well documented. Mali, situated in the heart of West Africa, is likely to be affected by the spread of recombinant subtypes. However, the dynamics of the spread of HIV-1 recombinant subtypes as well as nonrecombinant HIV-1 group M subtypes in this area have not been systematically assessed. Herein, we undertook genetic analyses on full-length env sequences derived from HIV-1-infected individuals living in the capital city of Mali, Bamako. Of 23 samples we examined, 16 were classified as CRF02_AG and three had a subsubtype A3. Among the remaining HIV-1 strains, CRF06_cpx and CRF09_cpx were each found in two patients. Comparison of phylogenies for six matched pol and full-length env sequences revealed that two strains had discordant subtype/CRF designations between the pol and env regions: one had A3polCRF02_AGenv and the other had CRF02_AGpolA3env. Taken together, our study demonstrated the high prevalence of CRF02_AG and complexity of circulating HIV-1 strains in Mali. It also provided evidence of ongoing virus evolution of CRF02_AG, as illustrated by the emergence of more complex CRF02_AG/A3 intersubtype recombinants in this area. PMID:19182920

  15. Mountains and Tropical Circulation (United States)

    Naiman, Z.; Goodman, P. J.; Krasting, J. P.; Malyshev, S.; Russell, J. L.; Stouffer, R. J.


    Observed tropical convection exhibits zonal asymmetries that strongly influence spatial precipitation patterns. The drivers of changes to this zonally-asymmetric Walker circulation on decadal and longer timescales have been the focus of significant recent research. Here we use two state-of-the-art earth system models to explore the impact of earth's mountains on the Walker circulation. When all land-surface topography is removed, the Walker circulation weakens by 33-59%. There is a ~30% decrease in global, large-scale upward vertical wind velocities in the middle of the troposphere, but only minor changes in global average convective mass flux, precipitation, surface and sea-surface temperatures. The zonally symmetric Hadley circulation is also largely unchanged. Following the spatial pattern of changes to large-scale vertical wind velocities, precipitation becomes less focused over the tropics. The weakening of the Walker circulation, but not the Hadley circulation, is similar to the behavior of climate models during radiative forcing experiments: in our simulations, the weakening is associated with changes in vertical wind velocities, rather than the hydrologic cycle. These results indicate suggest that mountain heights may significantly influence the Walker circulation on geologic time scales, and observed changes in tropical precipitation over millions of years may have been forced by changes in tropical orography.

  16. Initiation of meiotic recombination in Ustilago maydis. (United States)

    Kojic, Milorad; Sutherland, Jeanette H; Pérez-Martín, José; Holloman, William K


    A central feature of meiosis is the pairing and recombination of homologous chromosomes. Ustilago maydis, a biotrophic fungus that parasitizes maize, has long been utilized as an experimental system for studying recombination, but it has not been clear when in the life cycle meiotic recombination initiates. U. maydis forms dormant diploid teliospores as the end product of the infection process. Upon germination, teliospores complete meiosis to produce four haploid basidiospores. Here we asked whether the meiotic process begins when teliospores germinate or at an earlier stage in development. When teliospores homozygous for a cdc45 mutation temperature sensitive for DNA synthesis were germinated at the restrictive temperature, four nuclei became visible. This implies that teliospores have already undergone premeiotic DNA synthesis and suggests that meiotic recombination initiates at a stage of infection before teliospores mature. Determination of homologous recombination in plant tissue infected with U. maydis strains heteroallelic for the nar1 gene revealed that Nar(+) recombinants were produced at a stage before teliospore maturation. Teliospores obtained from a spo11Δ cross were still able to germinate but the process was highly disturbed and the meiotic products were imbalanced in chromosomal complement. These results show that in U. maydis, homologous recombination initiates during the infection process and that meiosis can proceed even in the absence of Spo11, but with loss of genomic integrity.

  17. Gaussian Fibonacci Circulant Type Matrices

    Directory of Open Access Journals (Sweden)

    Zhaolin Jiang


    Full Text Available Circulant matrices have become important tools in solving integrable system, Hamiltonian structure, and integral equations. In this paper, we prove that Gaussian Fibonacci circulant type matrices are invertible matrices for n>2 and give the explicit determinants and the inverse matrices. Furthermore, the upper bounds for the spread on Gaussian Fibonacci circulant and left circulant matrices are presented, respectively.

  18. Rare HIV-1 Subtype J Genomes and a New H/U/CRF02_AG Recombinant Genome Suggests an Ancient Origin of HIV-1 in Angola. (United States)

    Bártolo, Inês; Calado, Rita; Borrego, Pedro; Leitner, Thomas; Taveira, Nuno


    Angola has an extremely diverse HIV-1 epidemic fueled in part by the frequent interchange of people with the Democratic Republic of Congo (DRC) and Republic of Congo (RC). Characterization of HIV-1 strains circulating in Angola should help to better understand the origin of HIV-1 subtypes and recombinant forms and their transmission dynamics. In this study we characterize the first near full-length HIV-1 genomic sequences from HIV-1 infected individuals from Angola. Samples were obtained in 1993 from three HIV-1 infected patients living in Cabinda, Angola. Near full-length genomic sequences were obtained from virus isolates. Maximum likelihood phylogenetic tree inference and analyses of potential recombination patterns were performed to evaluate the sequence classifications and origins. Phylogenetic and recombination analyses revealed that one virus was a pure subtype J, another mostly subtype J with a small uncertain region, and the final virus was classified as a H/U/CRF02_AG recombinant. Consistent with their epidemiological data, the subtype J sequences were more closely related to each other than to other J sequences previously published. Based on the env gene, taxa from Angola occur throughout the global subtype J phylogeny. HIV-1 subtypes J and H are present in Angola at low levels since at least 1993. Low transmission efficiency and/or high recombination potential may explain their limited epidemic success in Angola and worldwide. The high diversity of rare subtypes in Angola suggests that Angola was part of the early establishment of the HIV-1 pandemic.

  19. Recombinant methods and materials

    Energy Technology Data Exchange (ETDEWEB)

    Roizman, B.; Post, L.E.


    This patent describes a method for stably effecting the insertion or deletion of a selected DNA sequence at a specific site in a viral genome. The method consists of: (1) isolating from the genome a linear DNA fragment comprising both (a) the specific site determined for insertion or deletion of selected DNA sequence and (b) flanking DNA sequences normally preceding and following the site; (2) preparing first and second altered genome fragments from the fragment isolated in step (1). (a) the first altered fragment comprising the fragment comprising a thymidine kinase gene in a position intermediate the ends of the fragment, and (b) the second altered fragment comprising the fragment having the selected DNA sequence inserted therein or deleted therefrom; (3) contacting the genome with the first altered fragment under conditions permitting recombination at sites of DNA sequence homology, selecting for a recombinant genome comprising the thymidine kinase gene, and isolating the recombinant genome; and (4) contacting the recombinant genome isolated in step (3) with the second altered fragment under conditions permitting recombination at sites of DNA sequence homology, selecting for a recombinant genome lacking the thymidine kinase gene, and isolating the recombinant genome product.

  20. Circulant Double Coverings of a Circulant Graph of Valency Five

    Institute of Scientific and Technical Information of China (English)

    Rong Quan FENG; Jin Ho KWAK


    Enumerating the isomorphism classes of several types of graph covering projections is one of the central research topics in enumerative topological graph theory. A covering of G is called circulant if its covering graph is circulant. Recently, the authors [Discrete Math., 277, 73-85 (2004)]enumerated the isomorphism classes of circulant double coverings of a certain type, called a typicalcovering, and showed that no double covering of a circulant graph of valency three is circulant. Also, in [Graphs and Combinatorics, 21, 386-400 (2005)], the isomorphism classes of circulant double coverings of a circulant graph of valency four are enumerated. In this paper, the isomorphism classes of circulant double coverings of a circulant graph of valency five are enumerated.



    R. Naeije; CHESLER, N


    The pulmonary circulation is a high flow and low pressure circuit, with an average resistance of 1 mmHg.min.L−1 in young adults, increasing to 2.5 mmHg.min.L−1 over 4–6 decades of life. Pulmonary vascular mechanics at exercise are best described by distensible models. Exercise does not appear to affect the time constant of the pulmonary circulation or the longitudinal distribution of resistances. Very high flows are associated with high capillary pressures, up to a 20–25 mmHg threshold associ...

  2. HIV-1 epidemiology and circulating subtypes in the countryside of South Brazil

    Directory of Open Access Journals (Sweden)

    Carina Sperotto Librelotto


    Full Text Available INTRODUCTION: Human immunodeficiency virus type 1 (HIV-1 has spread worldwide, with several subtypes and circulating recombinant forms. Brazil has an incidence of 20.5 HIV-1/acquired immunodeficiency syndrome (AIDS patients per 100,000 inhabitants; however, the Southernmost State of Rio Grande do Sul (RS has more than twice the number of HIV-1-infected people (41.3/100,000 inhabitants and a different pattern of subtype frequencies, as previously reported in studies conducted in the capital (Porto Alegre and its metropolitan region. This study examined HIV-1/AIDS epidemiological and molecular aspects in the countryside of Rio Grande do Sul. METHODS: Socio-demographic, clinical and risk behavioral characteristics were obtained from HIV-1-positive adult patients using a structured questionnaire. HIV-1 subtypes were determined by nested-polymerase chain reaction (PCR and sequencing of the pol and env genes. RESULTS: The study sample included 149 (55% women patients with a mean age of 41.8 ± 11.9 years. Most (73.8% patients had a low education level and reported heterosexual practices as the most (91.9% probable transmission route. HIV-1 subtypes were detected in 26 patients: 18 (69.2% infected with subtype C, six (23.1% infected with subtype B and two (7.7% infected with BC recombinant forms. CONCLUSIONS: These data highlight the increasing number of HIV-1 subtype C infections in the countryside of South Brazil.

  3. Expression of Recombinant Antibodies


    Frenzel, André; Hust, Michael; Schirrmann, Thomas


    Recombinant antibodies are highly specific detection probes in research, diagnostics, and have emerged over the last two decades as the fastest growing class of therapeutic proteins. Antibody generation has been dramatically accelerated by in vitro selection systems, particularly phage display. An increasing variety of recombinant production systems have been developed, ranging from Gram-negative and positive bacteria, yeasts and filamentous fungi, insect cell lines, mammalian cells to transg...

  4. Recombinant human erythropoietin in sports: a review

    Directory of Open Access Journals (Sweden)

    Rafael Maia de Almeida Bento


    Full Text Available Erythropoietin is an endogenous hormone of glicoproteic nature secreted by the kidneys and is the main regulator of the erythropoiesis. An alteration in its production generates a disturbance in the plasmatic concentration giving rise to several types of pathologies related to the hematopoietic system. The recombinant forms of erythropoietin have indiscriminately been used by athletes, mainly in endurance sports, by increasing the erythrocytes concentration, generating a better delivery of oxygen to the muscle tissue. The administration of recombinant erythropoietin was prohibited by the International Olympic Committee and its use considered as doping. This review has the intention to describe the physical, biological and pharmacokinetic properties of the endogenous erythropoietin, as well as its recombinant form, describing also its use in sports and the process of searching methodologies for its detection in doping control.

  5. Mitochondrial recombination increases with age in Podospora anserina

    NARCIS (Netherlands)

    van Diepeningen, Anne D; Goedbloed, Daniël J; Slakhorst, S Marijke; Koopmanschap, A Bertha; Maas, Marc F P M; Hoekstra, Rolf F; Debets, Alfons J M


    With uniparental inheritance of mitochondria, there seems little reason for homologous recombination in mitochondria, but the machinery for mitochondrial recombination is quite well-conserved in many eukaryote species. In fungi and yeasts heteroplasmons may be formed when strains fuse and transfer o

  6. Regulation of Meiotic Recombination

    Energy Technology Data Exchange (ETDEWEB)

    Gregory p. Copenhaver


    Meiotic recombination results in the heritable rearrangement of DNA, primarily through reciprocal exchange between homologous chromosome or gene conversion. In plants these events are critical for ensuring proper chromosome segregation, facilitating DNA repair and providing a basis for genetic diversity. Understanding this fundamental biological mechanism will directly facilitate trait mapping, conventional plant breeding, and development of genetic engineering techniques that will help support the responsible production and conversion of renewable resources for fuels, chemicals, and the conservation of energy (1-3). Substantial progress has been made in understanding the basal recombination machinery, much of which is conserved in organisms as diverse as yeast, plants and mammals (4, 5). Significantly less is known about the factors that regulate how often and where that basal machinery acts on higher eukaryotic chromosomes. One important mechanism for regulating the frequency and distribution of meiotic recombination is crossover interference - or the ability of one recombination event to influence nearby events. The MUS81 gene is thought to play an important role in regulating the influence of interference on crossing over. The immediate goals of this project are to use reverse genetics to identify mutants in two putative MUS81 homologs in the model plant Arabidopsis thaliana, characterize those mutants and initiate a novel forward genetic screen for additional regulators of meiotic recombination. The long-term goal of the project is to understand how meiotic recombination is regulated in higher eukaryotes with an emphasis on the molecular basis of crossover interference. The ability to monitor recombination in all four meiotic products (tetrad analysis) has been a powerful tool in the arsenal of yeast geneticists. Previously, the qrt mutant of Arabidopsis, which causes the four pollen products of male meiosis to remain attached, was developed as a facile system

  7. Tropical convective transport and the Walker circulation

    Directory of Open Access Journals (Sweden)

    J. S. Hosking


    Full Text Available We introduce a methodology to visualise rapid vertical and zonal tropical transport pathways. Using prescribed sea-surface temperatures in four monthly model integrations for 2005, preferred transport routes from the troposphere to the stratosphere are found in the model over the Maritime Continent (MC in November and February, i.e., boreal winter. In these months, the ascending branch of the Walker Circulation over the MC is formed in conjunction with strong deep convection, allowing fast transport into the stratosphere. At the same time, the downwelling branch of the Walker Circulation is enhanced over the East Pacific, compared to other months in 2005, reducing locally the upward transport from emissions below. We conclude that the Walker circulation plays an important role in the seasonality of fast tropical transport from the troposphere to the stratosphere and so impacts at the same time the potential supply of surface emissions.

  8. Countermeasures and Investigation of Land Circulation in Less Developed Agricultural Area of Henan Province,China

    Institute of Scientific and Technical Information of China (English)


    Some places in Henan Province are investigated by using sample surveys and interviews. Result shows that land circulation in less developed agricultural area of Henan Province has the characteristics of small scale,single form,short period,and circulation land in economic core region. Problems in land circulation are as follows:slow transfer of rural surplus labor force,hard implementation of fundamental land circulation,complicated mentality towards rural land circulation,many misgivings about land circulation,the unformed social service system of land circulation,and imperfect agricultural risk prevention mechanism for circulated land use. Based on the characteristics of land circulation,suggestions for promoting the land circulation of less developed agricultural areas are put forward in order to solve the problems in land circulation and to lay the foundation for effective implementation of land circulation,such as speeding up the development of urbanization,developing the circulation of collective land,effectively implementing the laws and regulations of rural collective land circulation,transferring land according to law,establishing market mechanism of agricultural land circulation,promoting the agricultural industrialization,establishing market mechanism of agricultural land circulation,promoting the agricultural industrialization,energetically readjusting rural industrial structure,and developing economy with local characteristics.


    CERN Multimedia

    Mail Office


    Internal mail envelopes often finish up in large piles in certain offices, thus creating a shortage for other users of the mail service, who would be grateful if everyone with an unused stock could deposit them in their mail box, after attaching them together with an elastic band or a piece of string. The messengers will then collect them so that the Mail Office can put them back in circulation. Thank you for your understanding and collaboration.

  10. Recombinant Helicobacter pylori catalase

    Institute of Scientific and Technical Information of China (English)

    Yang Bai; Ya-Li Zhang; Jian-Feng Jin; Ji-De Wang; Zhao-Shan Zhang


    AIM: To construct a recombinant strain which highly expresses catalase of Helicobacter pylori(H.pylori) and assay the activity of H. pylori catalase.METHODS: The catalase DNA was amplified from H. pylori chromosomal DNA with PCR techniques and inserted into the prokaryotie expression vector pET-22b (+), and then was transformed into the BL21 (DE3) E. coli strain which expressed catalase recombinant protein. The activity of H.pylori catalase was assayed by the Beers & Sizers.RESULTS: DNA sequence analysis showed that the sequence of catalase DNA was the same as GenBank's research. The catalase recombinant protein amounted to 24.4 % of the total bacterial protein after induced with IPTG for 3 hours at 37 ℃ and the activity of H. pylori catalase was high in the BL21 (DE3) E. coli strain.CONCLUSION: A clone expressing high activity H. pylori catalase is obtained, laying a good foundation for further studies.

  11. Fundamental Studies of Recombinant Hydrogenases

    Energy Technology Data Exchange (ETDEWEB)

    Adams, Michael W


    This research addressed the long term goals of understanding the assembly and organization of hydrogenase enzymes, of reducing them in size and complexity, of determining structure/function relationships, including energy conservation via charge separation across membranes, and in screening for novel H2 catalysts. A key overall goal of the proposed research was to define and characterize minimal hydrogenases that are produced in high yields and are oxygen-resistant. Remarkably, in spite of decades of research carried out on hydrogenases, it is not possible to readily manipulate or design the enzyme using molecular biology approaches since a recombinant form produced in a suitable host is not available. Such resources are essential if we are to understand what constitutes a “minimal” hydrogenase and design such catalysts with certain properties, such as resistance to oxygen, extreme stability and specificity for a given electron donor. The model system for our studies is Pyrococcus furiosus, a hyperthermophile that grows optimally at 100°C, which contains three different nickel-iron [NiFe-] containing hydrogenases. Hydrogenases I and II are cytoplasmic while the other, MBH, is an integral membrane protein that functions to both evolve H2 and pump protons. Three important breakthroughs were made during the funding period with P. furiosus soluble hydrogenase I (SHI). First, we produced an active recombinant form of SHI in E. coli by the co-expression of sixteen genes using anaerobically-induced promoters. Second, we genetically-engineered P. furiosus to overexpress SHI by an order of magnitude compared to the wild type strain. Third, we generated the first ‘minimal’ form of SHI, one that contained two rather than four subunits. This dimeric form was stable and active, and directly interacted with a pyruvate-oxidizing enzyme with any intermediate electron carrier. The research resulted in five peer-reviewed publications.

  12. Quantum Electrodynamics Theory of Laser Assisted Recombination

    Institute of Scientific and Technical Information of China (English)

    敖淑艳; 程太旺; 李晓峰; 潘守甫; 傅盘铭


    Using a formal scattering theoretical approach, we develop a nonperturbative quantum electrodynamics theory to describe laser assisted recombination (LAR), in which an electron initially in the quantized Volkov state recombines with an ion and emits a high-energy photon with frequency defined by energy conservation laws.The transition probability is expressed as an analytic closed form and the spectrum of LAR reflects mainly the properties of general Bessel functions. For the case of a fast electron the LAR spectrum is confined in a well-defined range, while for a slow electron, the LAR spectrum exhibits a double-plateau structure.

  13. Recombination in ionized gases

    International Nuclear Information System (INIS)

    In this paper it is shown how capture-stabilized methodology (both macroscopic and microscopic) can provide a generic basis for a unified treatment of all of the above recombination mechanisms. A new semiclassical theory of dissociative recombination is also presented in an effort to gain further insight into the physics not included in the first-order treatment and difficult to extract from numerical quantal treatments based on configuration mixing and on multichannel quantum defect theory. A simple analytical expression more accurate than the standard first-order result is obtained for the cross section σ and rate coefficient α. (author)

  14. Sum rules for meson and baryon production in the quark recombination model

    International Nuclear Information System (INIS)

    A quark-recombination model with quark distributions according to a generalized Kuti-Weisskopf model is used. Mesons are formed by v-s (valence-sea) and s-s recombination, baryons by vvv, vvs, vss and sss recombination. Sum rules for energy momentum conservation, baryon number, valence and sea quarks are shown to constrain the recombination parameters of the model significantly. The resulting model is consistent with experimental data. While the sss recombination into baryons is found to be quite normal we find a strong enhancement of ss recombination into mesons. This enhanced ss term represents in the model the central meson production via gluons. (author)

  15. Formas de presença do outro na circulação dos discursos / The forms of the presence of the other in the circulation of discourses

    Directory of Open Access Journals (Sweden)

    Dóris de Arruda C. da Cunha


    Full Text Available RESUMO: O artigo analisa formas de alteridade em cartas de leitores. Fundamentado na análise/teoria dialógica do discurso, retoma discussões recentes sobre as diversas interpretações da obra de Bakhtin, sobre a questão da autoria vinculada aos fundamentos epistemológicos do pensamento de Bakhtin e de Volochinov, os quais explicam as diferentes descrições do discurso de outrem nas obras dos dois autores. A análise do corpus mostra a inter-relação das formas de presença do outro com o gênero, o ponto de vista e a argumentação.ABSTRACT: This paper analyzes the forms of alterity in newspapers’ letters to the editor. Based on the dialogic discursive theory, it examines recent discussions on the interpretation of Bakthin’s writings, especially the question of authorship which is related to the epistemological basis of Bakhtin and Volochinov’s thought, which explain the different descriptions of the others’ discourses in the authors’ work. The analysis of the corpus demonstrates the interrelation between the forms in which the presence of the other appear and the genre, the point of view and the argumentation.

  16. Recombinant DNA for Teachers. (United States)

    Duvall, James G., III


    A science teacher describes his experience at a workshop to learn to teach the Cold Spring Harbor DNA Science Laboratory Protocols. These protocols lead students through processes for taking E. coli cells and transforming them into a new antibiotic resistant strain. The workshop featured discussions of the role of DNA recombinant technology in…

  17. Recombineering Pseudomonas syringae (United States)

    Here we report the identification of functions that promote genomic recombination of linear DNA introduced into Pseudomonas cells by electroporation. The genes encoding these functions were identified in Pseudomonas syringae pv. syringae B728a based on similarity to the lambda Red Exo/Beta and RecE...

  18. Modelled Circulation In Storfjorden (United States)

    Skogseth, R.; Asplin, L.

    The model area Storfjorden is situated between the islands Spitsbergen, Barentsöya and Edgeöya at the Svalbard Archipelago. The entrance of Storfjorden is defined by a shallow bank Storfjordbanken and some small islands Tusenöyane in southeast, and by an 115m deep sill at about 76 45' N in the south. Maximum depth in Storfjorden is 190m, which is surrounded by gradually shallower shelves in the north, the east and southeast. A steep bottom slope is present on the western side of Storfjorden. He- leysundet and Freemansundet, two sounds between respectively Spitsbergen and Bar- entsöya, and Barentsöya and Edgeöya, define two narrow and shallow entrances in the north and northeast connecting Storfjorden with the northwestern Barents Sea. Strong tidal currents exist in Heleysundet (4-5ms-1) and Freemansundet (2-3ms-1), but the general circulation in Storfjorden is not well known. The coastal current in Storfjor- den is cyclonic directed into Storfjorden south of Edgeöya from the East Spitsbergen Current and out of Storfjorden south of Spitsbergen where it is called Sørkappstrøm- men. A three-dimensional sigma layered numerical ocean model called Bergen Ocean Model (BOM) was used to simulate the circulation in Storfjorden with Freemansundet opened. Two simulations were carried out, one with heat flux (100 Wm-2) and one without heat flux from the ocean to the atmosphere. The heat flux was applied only in the proper fjord area north of the sill and not outside as a crude approximation of the effects of a polynya in the sea ice cover during winter. Both simulations had a 4km horizontal resolution and 21 sigma layers. The model is forced by winds (from the NCEP reanalyzed fields) and tides. Initial fields are from the DNMI/IMR climatol- ogy. The model simulation without heat flux gave a circulation heavily dependent on tidal forcing, showing strong tidal currents up to 2ms-1 in Freemansundet, between Tusenöyane and on Storfjordbanken southwest of Edgeöya. Earlier

  19. The protein corona of circulating PEGylated liposomes. (United States)

    Palchetti, Sara; Colapicchioni, Valentina; Digiacomo, Luca; Caracciolo, Giulio; Pozzi, Daniela; Capriotti, Anna Laura; La Barbera, Giorgia; Laganà, Aldo


    Following systemic administration, liposomes are covered by a 'corona' of proteins, and preserving the surface functionality is challenging. Coating the liposome surface with polyethylene glycol (PEG) is the most widely used anti-opsonization strategy, but it cannot fully preclude protein adsorption. To date, protein binding has been studied following in vitro incubation to predict the fate of liposomes in vivo, while dynamic incubation mimicking in vivo conditions remains largely unexplored. The main aim of this investigation was to determine whether shear stress, produced by physiologically relevant dynamic flow, could influence the liposome-protein corona. The corona of circulating PEGylated liposome was thoroughly compared with that formed by incubation in vitro. Systematic comparison in terms of size, surface charge and quantitative composition was made by dynamic light scattering, microelectrophoresis and nano-liquid chromatography tandem mass spectrometry (nanoLC-MS/MS). Size of coronas formed under static vs. dynamic incubation did not appreciably differ from each other. On the other side, the corona of circulating liposomes was more negatively charged than its static counterpart. Of note, the variety of protein species in the corona formed in a dynamic flow was significantly wider. Collectively, these results demonstrated that the corona of circulating PEGylated liposomes can be considerably different from that formed in a static fluid. This seems to be a key factor to predict the biological activity of a liposomal formulation in a physiological environment.

  20. Resolvability in Circulant Graphs

    Institute of Scientific and Technical Information of China (English)

    Muhammad SALMAN; Imran JAVAID; Muhammad Anwar CHAUDHRY


    A set W of the vertices of a connected graph G is called a resolving set for G if for every two distinct vertices u,v ∈ V(G) there is a vertex w ∈ W such that d(u,w) ≠ d(v,w).A resolving set of minimum cardinality is called a metric basis for G and the number of vertices in a metric basis is called the metric dimension of G,denoted by dim(G).For a vertex u of G and a subset S of V(G),the distance between u and S is the number mins∈s d(u,s).A k-partition H ={S1,S2,...,Sk} of V(G) is called a resolving partition if for every two distinct vertices u,v ∈ V(G) there is a set Si in Π such that d(u,Si) ≠ d(v,Si).The minimum k for which there is a resolving k-partition of V(G) is called the partition dimension of G,denoted by pd(G).The circulant graph is a graph with vertex set Zn,an additive group ofintegers modulo n,and two vertices labeled i and j adjacent if and only if i - j (mod n) ∈ C,where C C Zn has the property that C =-C and 0(∈) C.The circulant graph is denoted by Xn,△ where A =|C|.In this paper,we study the metric dimension of a family of circulant graphs Xn,3 with connection set C ={1,-n/2,n - 1} and prove that dim(Xn,3) is independent of choice of n by showing that 3 for all n =0 (mod 4),dim(X,n,3) ={ 4 for all n =2 (mod 4).We also study the partition dimension of a family of circulant graphs Xn,4 with connection set C ={±1,±2} and prove that pd(Xn,4) is independent of choice of n and show that pd(X5,4) =5 and 3 forall odd n≥9,pd(Xn,4) ={ 4 for all even n ≥ 6 and n =7.

  1. Circulating current control for parallel interleaved VSCs connected in whiffletree configuration

    DEFF Research Database (Denmark)

    Bede, L.; Gohil, G.; Ciobotaru, M.;


    these circulating currents the VSCs are interconnected through Coupled Inductors (CIs), which form a whiffletree configuration, and they are used to suppress the switching frequency circulating current. On the other hand, the CIs are highly sensitive to fundamental frequency circulating currents, which may saturate...

  2. North Atlantic Circulation (United States)

    Molinari, R.; Bryan, K.; Schott, F.

    The intensity of the North Atlantic winddriven and thermohaline circulation and the close proximity of many oceanographic installations make the North Atlantic a particularly favored region of the world ocean from the standpoint of research in ocean circulation. Recent increases in available data and advances in numerical modeling techniques served as the impetus to convene a joint workshop of modelers and observers working on the North Atlantic with the Scientific Committee on Oceanic Research (SCOR) Working Group (WG) 68 (“North Atlantic Circulation”). Goals of the workshop were to provide an update on data sets and models and to discuss the poleward heat flux problem and possible monitoring strategies. The joint Workshop/SCOR WG-68 meeting was convened by F. Schott (chairman of the working group; Rosenstiel School of Marine and Atmospheric Science, Miami, Fla.), K. Bryan (National Oceanic and Atmospheric Administration/ Geophysical Fluid Dynamics Laboratory (NOAA/GFDL)), and R. Molinari (NOAA/Atlantic Oceanographic and Meteorological Laboratory (NOAA/AOML)).

  3. Sum rules for meson and baryon production in the quark recombination model

    International Nuclear Information System (INIS)

    A quark recombination model with quark distributions according to a generalized Kuti-Weisskopf model is used. Mesons are formed by v-s (valence-sea) and s-s recombination, baryons by vvv, vvs, vss and sss recombination. Sum rules for energy momentum concervation, baryon number, valence and sea quarks are shown to constrain the recombination parameters of the model significantly. The resulting model is consistent with experimental data. (author)

  4. Trends in the electric field enhancement of dielectronic recombination cross sections

    International Nuclear Information System (INIS)

    The effect of external electric fields on the dielectronic recombination cross section of selected ions has been studied in the configuration-average, distorted wave approximation. By applying the linear-Stark approximation to the doubly-excited Rydberg states formed from resonant recombination, we examine the systematics of field-mixing effects on dielectronic recombination and determine the maximum field enhancement of dielectronic recombination cross sections. 8 references, 6 figures, 3 tables

  5. Teaching Form as Form

    DEFF Research Database (Denmark)

    Keiding, Tina Bering


    means that form serves both as the connective value and as the concept for reflection. In other words, form is observed as form, not anything else. The didactical challenge of teaching form as form is accentuated by students’ everyday-based pre-orientation towards function at the expense of form...... reveal highly-structured courses, which alternates systematically between steering and free experimental activities. Consistent with a strong focus on content and the student’s interaction with content, the contributions hardly address the role of the teacher or the interplay between teachers...... and students. This is not to say that teachers do not engage in teaching. They clearly do and obviously play a major role in the progression in course structure and reflection on the student’s learning. My point is that, by neglecting the role of the teacher and the interplay between the teacher and students...

  6. Antiangiogenic Gene Therapy of Cancer Utilizing a Recombinant Adenovirus to Elevate Systemic Endostatin Levels in Mice


    Feldman, Andrew L.; Restifo, Nicholas P; Alexander, H. Richard; Bartlett, David L.; Hwu, Patrick; Seth, Prem; Libutti, Steven K.


    Gene therapy represents a possible alternative to the chronic delivery of recombinant antiangiogenic proteins to cancer patients. Inducing normal host tissues to produce high circulating levels of these proteins may be more effective than targeting antiangiogenic genes to tumor tissue specifically. Previously reported gene therapy approaches in mice have achieved peak circulating endostatin levels of 8–33 ng/ml. Here we report plasma endostatin levels of 1770 ng/ml after administration of a r...

  7. Identifying recombinants in human and primate immunodeficiency virus sequence alignments using quartet scanning

    Directory of Open Access Journals (Sweden)

    Martin Darren P


    Full Text Available Abstract Background Recombination has a profound impact on the evolution of viruses, but characterizing recombination patterns in molecular sequences remains a challenging endeavor. Despite its importance in molecular evolutionary studies, identifying the sequences that exhibit such patterns has received comparatively less attention in the recombination detection framework. Here, we extend a quartet-mapping based recombination detection method to enable identification of recombinant sequences without prior specifications of either query and reference sequences. Through simulations we evaluate different recombinant identification statistics and significance tests. We compare the quartet approach with triplet-based methods that employ additional heuristic tests to identify parental and recombinant sequences. Results Analysis of phylogenetic simulations reveal that identifying the descendents of relatively old recombination events is a challenging task for all methods available, and that quartet scanning performs relatively well compared to the triplet based methods. The use of quartet scanning is further demonstrated by analyzing both well-established and putative HIV-1 recombinant strains. In agreement with recent findings, we provide evidence that the presumed circulating recombinant CRF02_AG is a 'pure' lineage, whereas the presumed parental lineage subtype G has a recombinant origin. We also demonstrate HIV-1 intrasubtype recombination, confirm the hybrid origin of SIV in chimpanzees and further disentangle the recombinant history of SIV lineages in a primate immunodeficiency virus data set. Conclusion Quartet scanning makes a valuable addition to triplet-based methods for identifying recombinant sequences without prior specifications of either query and reference sequences. The new method is available in the VisRD v.3.0 package



    Sedova, E.; Shcherbinin, D.; Migunov, A.; Smirnov, Iu; Logunov, D.; Shmarov, M.; Tsybalova, L.; Naroditskiĭ, B.; O. Kiselev; Gintsburg, A.


    This review covers the problems encountered in the construction and production of new recombinant influenza vaccines. New approaches to the development of influenza vaccines are investigated; they include reverse genetics methods, production of virus-like particles, and DNA- and viral vector-based vaccines. Such approaches as the delivery of foreign genes by DNA- and viral vector-based vaccines can preserve the native structure of antigens. Adenoviral vectors are a promising gene-delivery pla...

  9. Ocean General Circulation Models

    Energy Technology Data Exchange (ETDEWEB)

    Yoon, Jin-Ho; Ma, Po-Lun


    1. Definition of Subject The purpose of this text is to provide an introduction to aspects of oceanic general circulation models (OGCMs), an important component of Climate System or Earth System Model (ESM). The role of the ocean in ESMs is described in Chapter XX (EDITOR: PLEASE FIND THE COUPLED CLIMATE or EARTH SYSTEM MODELING CHAPTERS). The emerging need for understanding the Earth’s climate system and especially projecting its future evolution has encouraged scientists to explore the dynamical, physical, and biogeochemical processes in the ocean. Understanding the role of these processes in the climate system is an interesting and challenging scientific subject. For example, a research question how much extra heat or CO2 generated by anthropogenic activities can be stored in the deep ocean is not only scientifically interesting but also important in projecting future climate of the earth. Thus, OGCMs have been developed and applied to investigate the various oceanic processes and their role in the climate system.

  10. Percutaneous interventions in Fontan circulation

    Directory of Open Access Journals (Sweden)

    Eduardo Franco


    Conclusions: Interventional catheterization procedures are often necessary to reach and maintain the fragile Fontan circulation, mainly in patients with right morphology systemic ventricles and fenestrated Fontan conduits.

  11. Formation of germline chimera Gaok chicken used circulation primordial germ cells (circulation PGCs fresh and thawed

    Directory of Open Access Journals (Sweden)

    Kostaman T


    Full Text Available Formation of germline chimeras by transfer of chicken primordial germ cells (PGCs is one of the effective techniques for preservation and regeneration of genetic resources in chickens. This study attempted to form germline chimeras of Gaok chicken buy purifying circulated PGCs of donor embryo before it is transferred to the recipient (White Leghorn chickens=WL and studied the ability of recipient embryo on survival in incubators, and hatchability. This study used 200 fertile eggs of Gaok and 90 fertile WL breed all of the eggs was incubated at 380C and 60% humidity in a portable incubator. PGCs-circulation of the blood collected Gaok embryos at stage 14-16 were taken from the dorsal aorta, and then purified by centrifugation method using nycodenz. PGCs-circulation results further purification frozen in liquid nitrogen before being transferred to the recipient embryo. The results showed that for the development of embryos transferred to the fresh circulation of PGCs-circulation as many as 25 cells can survive up to day 14, while one of the transferred of 50 and 100 cells into recipient embryos was hatched (10%. On the contrari recipient embryos that are transferred to the frozen PGCs-circulation the embryos development was shorter, and only survived until day 10th (treatment 25 cells, day 14th (treatment of 50 cells and day 17th (treatment of 100 cells. It is concluded that the amount of PGCs-circulation embryos transferred to the recipient is one factor that influence the success of the development germline chimeras.

  12. Recombinant human erythropoietin in sports: a review


    Rafael Maia de Almeida Bento; Lúcia Menezes Pinto Damasceno; Francisco Radler Aquino Neto


    Erythropoietin is an endogenous hormone of glicoproteic nature secreted by the kidneys and is the main regulator of the erythropoiesis. An alteration in its production generates a disturbance in the plasmatic concentration giving rise to several types of pathologies related to the hematopoietic system. The recombinant forms of erythropoietin have indiscriminately been used by athletes, mainly in endurance sports, by increasing the erythrocytes concentration, generating a better delivery of ox...

  13. Computation of the q -th roots of circulant matrices

    Directory of Open Access Journals (Sweden)

    Pakizeh Mohammadi Khanghah


    Full Text Available In this paper‎, ‎we investigate the reduced form of circulant matrices‎ ‎and we show that the problem of computing the $q$-th roots of a‎ ‎nonsingular circulant matrix $A$ can be reduced to that of computing‎ ‎the $q$-th roots of two half size matrices $B-C$ and $B+C$. 

  14. Sino-Danish Brain Circulation

    DEFF Research Database (Denmark)

    Bertelsen, Rasmus Gjedssø; Du, Xiangyun; Søndergaard, Morten Karnøe


    China is faced with urgent needs to develop an economically and environmentally sustainable economy based on innovation and knowledge. Brain circulation and research and business investments from the outside are central for this development. Sino-American brain circulation and research...... and investment by overseas researchers and entrepreneurs are well described. In that case, the US is the center of global R&D and S&T. However, the brain circulation and research and investments between a small open Scandinavian economy, such as Denmark, and the huge developing economy of China are not well...... understood. In this case, Denmark is very highly developed, but a satellite in the global R&D and S&T system. With time and the growth of China as a R&D and S&T power house, both Denmark and China will benefit from brain circulation between them. Such brain circulation is likely to play a key role in flows...

  15. TROPICAL METEOROLOGY & Climate: Hadley Circulation

    Energy Technology Data Exchange (ETDEWEB)

    Lu, Jian; Vecchi, Gabriel A.


    The Hadley circulation, a prominent circulation feature characterized by rising air near the Equator and sinking air in the subtropics, defines the position of dry subtropical areas and is a fundamental regulator of the earth’s energy and momentum budgets. The character of the Hadley circulation, and its related precipitation regimes, exhibits variation and change in response to both climate variability and radiative forcing changes. The strength and position of the Hadley circulation change from year to year paced by El Niño and La Niña events. Over the last few decades of the twentieth century, the Hadley cell has expanded poleward in both hemispheres, with changes in atmospheric composition (including stratospheric ozone depletion and greenhouse gas increases) thought to have contributed to its expansion. This article introduces the basic phenomenology and driving mechanism of the Hadley circulation and discusses its variations under both natural and anthropogenic climate forcings.

  16. Numerical Study of Passive Catalytic Recombiner for Hydrogen Mitigation

    Directory of Open Access Journals (Sweden)

    Pavan K Sharma


    Full Text Available A significant amount of hydrogen is expected to be released within the containment of a water cooled power reactor after a severe accident. To reduce the risk of deflagration/detonation various means for hydrogen control have been adopted all over the world. Passive catalytic recombiner with vertical flat catalytic plate is one of such hydrogen mitigating device. Passive catalytic recombiners are designed for the removal of hydrogen generated in order to limit the impact of possible hydrogen combustion. Inside a passive catalytic recombiner, numerous thin steel sheets coated with catalyst material are vertically arranged at the bottom opening of a sheet metal housing forming parallel flow channels for the surrounding gas atmosphere. Already below conventional flammability limits, hydrogen and oxygen react exothermally on the catalytic surfaces forming harmless steam. Detailed numerical simulations and experiments are required for an in-depth knowledge of such plate type catalytic recombiners. Specific finite volume based in-house CFD code has been developed to model and analyse the working of these recombiner. The code has been used to simulate the recombiner device used in the Gx-test series of Battelle-Model Containment (B-MC experiments. The present paper briefly describes the working principle of such passive catalytic recombiner and salient feature of the CFD model developed at Bhabha Atomic Research Centre (BARC. Finally results of the calculations and comparison with existing data are discussed.

  17. Recombinant Collagenlike Proteins (United States)

    Fertala, Andzej


    A group of collagenlike recombinant proteins containing high densities of biologically active sites has been invented. The method used to express these proteins is similar to a method of expressing recombinant procollagens and collagens described in U. S. Patent 5,593,859, "Synthesis of human procollagens and collagens in recombinant DNA systems." Customized collagenous proteins are needed for biomedical applications. In particular, fibrillar collagens are attractive for production of matrices needed for tissue engineering and drug delivery. Prior to this invention, there was no way of producing customized collagenous proteins for these and other applications. Heretofore, collagenous proteins have been produced by use of such biological systems as yeasts, bacteria, and transgenic animals and plants. These products are normal collagens that can also be extracted from such sources as tendons, bones, and hides. These products cannot be made to consist only of biologically active, specific amino acid sequences that may be needed for specific applications. Prior to this invention, it had been established that fibrillar collagens consist of domains that are responsible for such processes as interaction with cells, binding of growth factors, and interaction with a number of structural proteins present in the extracellular matrix. A normal collagen consists of a sequence of domains that can be represented by a corresponding sequence of labels, e.g., D1D2D3D4. A collagenlike protein of the present invention contains regions of collagen II that contain multiples of a single domain (e.g., D1D1D1D1 or D4D4D4D4) chosen for its specific biological activity. By virtue of the multiplicity of the chosen domain, the density of sites having that specific biological activity is greater than it is in a normal collagen. A collagenlike protein according to this invention can thus be made to have properties that are necessary for tissue engineering.

  18. Primordial magnetogenesis before recombination

    CERN Document Server

    Fabre, Ophélia


    The origin of large magnetic fields in the Universe remains currently unknown. We investigate here a mechanism before recombination based on known physics. The source of the vorticity is due to the changes in the photon distribution function caused by the fluctuations in the background photons. We show that the magnetic field generated in the MHD limit, due to the Coulomb scattering, is of the order $10^{-49}$ G. We explicitly show that the magnetic fields generated from this process are sustainable and are not erased by resistive diffusion. We compare the results with current observations and discuss the implications.

  19. Stimulated radiative recombination of H{sup +} and He {sup +}

    Energy Technology Data Exchange (ETDEWEB)

    Rogelstad, M.L.; Mitchell, J.B.A. [Western Ontario Univ., Physics Dept., London, ON (Canada); Yousif, F.B. [UNAM, Inst. de Fisica, Cuernavaca (Mexico); Morgan, T.J. [Wesleyan Univ., Physics Dept., Middletown, CT (United States)


    Stimulated radiative recombination has been demonstrated experimentally in e{sup -}+H{sup +} and e{sup -} + He{sup +} collisions using a merged electron-ion beams apparatus with field ionization detection of the excited neutral products. Enhancement of the recombination over spontaneous recombination to form the n = 11, 12 and 13 levels of atomic hydrogen and the n = 11 and 12 levels of atomic helium by factors of between 1000 and 3000 have been found using a CO{sub 2} laser power of 8 W. Evidence for the resolution of fine-structure levels has been seen for the case of helium. (author).

  20. E. coli Tarafından Sentezlenen Recombinant Soyacystatinin Karakterizasyonu


    AKPINAR, Özlem; AN, Haejung


    Recombinant (r-) soyacystatin was characterized for their inhibitory activity against papain and compared to egg white cystatin. r-Soyacystatin expressed in E. coli was purified 4.33 fold as a recombinant protein with phenyl-Sepharose and DEAE. Egg white cystatin was purified by using affinity chromatography on CM-papain-Sepharose. The specific interaction of r-soyacystatin and papain was detected on isoelectric focusing gel. Papain and r-soyacystatin formed a complex and the complex was res...

  1. Experimental observation of laser-stimulated radiative recombination

    International Nuclear Information System (INIS)

    Spontaneous radiative recombination between protons and electrons to form hydrogen atoms with 8≤n≤19 has been measured. CO2 laser light has been shown to induce stimulated radiative recombination to the n=11 and 12 levels with an inferred gain in the cross section of 1720±860 and 4790±2830 for a laser power of 12.6 and 15.3 W, respectively. This is in line with that predicted theoretically

  2. Moment closure in a Moran model with recombination

    CERN Document Server

    Baake, Ellen


    We extend the Moran model with single-crossover recombination to include general recombination and mutation. We show that, in the case without resampling, the expectations of products of marginal processes defined via partitions of sites form a closed hierarchy, which is exhaustively described by a finite system of differential equations. One thus has the exceptional situation of moment closure in a nonlinear system. Surprisingly, this property is lost when resampling (i.e., genetic drift) is included.

  3. Multiple biological activities of human recombinant interleukin 1.


    Dinarello, C A; Cannon, J. G.; Mier, J W; Bernheim, H. A.; LoPreste, G; Lynn, D L; Love, R N; Webb, A C; Auron, P. E.; Reuben, R C


    Complementary DNA coding for human monocyte interleukin 1 (IL-1), pI 7 form, was expressed in Escherichia coli. During purification, IL-1 activity on murine T cells was associated with the recombinant protein. Homogeneous human recombinant IL-1 (hrIL-1) was tested in several assays to demonstrate the immunological and inflammatory properties attributed to this molecule. hrIL-1 induced proliferative responses in a cloned murine T cell in the presence of suboptimal concentrations of mitogen, wh...

  4. The next wave of recombinant and synthetic anticancer vaccines


    Irvine, Kari R.; Restifo, Nicholas P


    The identification of tumor-associated antigens (TAA) recognized by T lymphocytes makes the development of antigen-specific synthetic and recombinant vaccines possible. The expression of TAA within a recombinant vector increases control over the kinetics and quantity, the molecular form, and the subcellular location of the immunogen delivered. The next generation of antitumor vaccines employs cytokines and costimulatory molecules expressed in concert with TAA that are capable of augmenting th...

  5. The relationship between urbanization and commodity circulation: a theoretical and positive research

    Institute of Scientific and Technical Information of China (English)

    YAN Weilong


    "Town" and commodity circulation are two closely interrelated concepts.A town is born through the exchange of commodities;it is formed by an increase in trade efficiency.The trade efficiency caused by the density of economy is the standard of rationalization of the town scale.The development of a town promotes the development from simple commodity circulation to developed commodity circulation,while the difference in the level of urbanization is an important reason for differences in the circulation level.Therefore,the strategy of being guided by circulation will be a basic way to push forward urbanization healthily in China.

  6. Primordial magnetogenesis before recombination (United States)

    Fabre, Ophélia; Shankaranarayanan, S.


    The origin of large magnetic fields in the Universe remains currently unknown. We investigate here a mechanism before recombination based on known physics. The source of the vorticity is due to the changes in the photon distribution function caused by the fluctuations in the background photons. We show that the magnetic field generated in the MHD limit, due to the Coulomb scattering, is of the order 10-49 G on a coherence scale of 10 kpc. We explicitly show that the magnetic fields generated from this process are sustainable and are not erased by resistive diffusion. We compare the results with current observations and discuss the implications. Our seed magnetic fields are generated on small scales whereas the main mechanisms studied in the literature are on scale bigger than 1 Mpc. However, compared to more exotic theories generating seed magnetic fields on similar scales, the strength of our fields are generally smaller.

  7. Recombination energy in double white dwarf formation

    CERN Document Server

    Nandez, Jose L A; Lombardi, James C


    In this Letter we investigate the role of recombination energy during a common envelope event. We confirm that taking this energy into account helps to avoid the formation of the circumbinary envelope commonly found in previous studies. For the first time, we can model a complete common envelope event, with a clean compact double white dwarf binary system formed at the end. The resulting binary orbit is almost perfectly circular. In addition to considering recombination energy, we also show that between 1/4 and 1/2 of the released orbital energy is taken away by the ejected material. We apply this new method to the case of the double-white dwarf system WD 1101+364, and we find that the progenitor system at the start of the common envelope event consisted of a $\\sim1.5M_\\odot$ red giant star in a $\\sim 30$ day orbit with a white dwarf companion.

  8. The circulation physiology of agroecosystems

    Institute of Scientific and Technical Information of China (English)

    Cao Zhiping; Richard Dawson


    This paper represents an effort to enlarge the understanding of the biophysical foundation of agroecosystems by using an analogy with the circulation of the blood in the human body. The circulation function in the human body can be represented as arterial pressure. The factors affecting arterial pressure in the human body have direct counterparts in the cultivation-husbandry system. The relationship between circulation pressure and the factors affecting that pressure in the cultivation-husbandry system are similar to the relationship between the arterial pressure and factors affecting arterial pressure in the human body. Furthermore, circulation resistance in the cultivation-husbandry system can be shown to be analogous to the calculation of peripheral resistance in the human body by Poiseuille's formula.

  9. Collaborative form(s)

    DEFF Research Database (Denmark)

    Gunn, Wendy

    the process of research rather than its object. In its temporal orientation, anthropology by means of design moves, ‘…forward with people in tandem with their desires and aspirations rather than going back over times passed’ (ibid 2013: 141). Doing design by means of anthropology takes as its most fundamental......Gunn asks us to consider beauty as collaborative forms of action generated by moving between design by means of anthropology and anthropology by means of design. Specifically, she gives focus to play-like reflexions on practices of designing energy products, systems and infrastructure. Design...

  10. Elevated circulating somatostatin levels in acromegaly. (United States)

    Arosio, M; Porretti, S; Epaminonda, P; Giavoli, C; Gebbia, C; Penati, C; Beck-Peccoz, P; Peracchi, M


    GH increases hypothalamic somatostatin (SS) synthesis and secretion but it is unknown if chronic GH excess, as found in acromegaly, may influence circulating SS levels, that are mainly of enteropancreatic source and affect several gastrointestinal functions, including motility. Circulating SS occurs in several post-translational forms including somatostatin-14 (SS-14), somatostatin-28 (SS-28) and other small peptides. The aim of the present study was to characterize the fasting and postprandial pattern of plasma circulating somatostatin in normal subjects and patients with acromegaly. Fasting total SS and SS-28 levels were measured in 32 subjects, 16 acromegalic patients with a new diagnosis (A) (8 F, 8 M, median age 48) and 16 matched healthy volunteers (C) (8 F, 8 M, median age 45). SS was also determined after a standard solid-liquid meal (550 kCal) in 24 of the subjects (12 C and 12 A). Fasting SS and SS-28 were significantly higher in acromegalic patients as compared to healthy subjects. In the former, a positive correlation was found between IGF-I and SS levels (r = 0.525 p acromegaly. Excess GH/IGF-I could be a causal factor in somatostatin hypersecretion. Conceivably this abnormality might play a role in some alterations of gastrointestinal function of acromegalic patients such as prolonged bowel transit.

  11. Tropical convective transport and the Walker circulation

    Directory of Open Access Journals (Sweden)

    J. S. Hosking


    Full Text Available We introduce a methodology to visualise rapid vertical and zonal tropical transport pathways. Using prescribed sea-surface temperatures in four monthly model integrations for 2005, we characterise preferred transport routes from the troposphere to the stratosphere in a high resolution climate model. Most efficient transport is modelled over the Maritime Continent (MC in November and February, i.e., boreal winter. In these months, the ascending branch of the Walker Circulation over the MC is formed in conjunction with strong deep convection, allowing fast transport into the stratosphere. In the model the upper tropospheric zonal winds associated with the Walker Circulation are also greatest in these months in agreement with ERA-Interim reanalysis data. We conclude that the Walker circulation plays an important role in the seasonality of fast tropical transport from the lower and middle troposphere to the upper troposphere and so impacts at the same time the potential supply of surface emissions to the tropical tropopause layer (TTL and subsequently to the stratosphere.

  12. Cell biology of mitotic recombination

    DEFF Research Database (Denmark)

    Lisby, Michael; Rothstein, Rodney


    Homologous recombination provides high-fidelity DNA repair throughout all domains of life. Live cell fluorescence microscopy offers the opportunity to image individual recombination events in real time providing insight into the in vivo biochemistry of the involved proteins and DNA molecules as w...

  13. Atmospheric Circulation of Terrestrial Exoplanets


    Showman, Adam P.; Wordsworth, Robin D.; Merlis, Timothy M.; Kaspi, Yohai


    The investigation of planets around other stars began with the study of gas giants, but is now extending to the discovery and characterization of super-Earths and terrestrial planets. Motivated by this observational tide, we survey the basic dynamical principles governing the atmospheric circulation of terrestrial exoplanets, and discuss the interaction of their circulation with the hydrological cycle and global-scale climate feedbacks. Terrestrial exoplanets occupy a wide range of physical a...

  14. Bimolecular recombination in organic photovoltaics. (United States)

    Lakhwani, Girish; Rao, Akshay; Friend, Richard H


    The recombination of electrons and holes is a major loss mechanism in photovoltaic devices that controls their performance. We review scientific literature on bimolecular recombination (BR) in bulk heterojunction organic photovoltaic devices to bring forward existing ideas on the origin and nature of BR and highlight both experimental and theoretical work done to quantify its extent. For these systems, Langevin theory fails to explain BR, and recombination dynamics turns out to be dependent on mobility, temperature, electric field, charge carrier concentration, and trapped charges. Relationships among the photocurrent, open-circuit voltage, fill factor, and morphology are discussed. Finally, we highlight the recent emergence of a molecular-level picture of recombination, taking into account the spin and delocalization of charges. Together with the macroscopic picture of recombination, these new insights allow for a comprehensive understanding of BR and provide design principles for future materials and devices.

  15. Non-Enzymatic Template-Directed Recombination of RNAs

    Directory of Open Access Journals (Sweden)

    Marina A. Zenkova


    Full Text Available RNA non-enzymatic recombination reactions are of great interest within the hypothesis of the "RNA world", which argues that at some stage of prebiotic life development proteins were not yet engaged in biochemical reactions and RNA carried out both the information storage task and the full range of catalytic roles necessary in primitive self-replicating systems. Here we report on the study of recombination reaction occuring between two 96 nucleotides (nts fragments of RNAs under physiological conditions and governed by a short oligodeoxyribonucleotide template, partially complementary to sequences within each of the RNAs. Analysis of recombination products shows that ligation is predominantly template-directed, and occurs within the complementary complex with the template in "butt-to-butt" manner, in 1- or 3- nts bulges or in 2-3 nts internal loops. Minor recombination products formed in the template-independent manner are detected as well.

  16. Purification of recombinant ovalbumin from inclusion bodies of Escherichia coli. (United States)

    Upadhyay, Vaibhav; Singh, Anupam; Panda, Amulya K


    Recombinant ovalbumin expressed in bacterial host is essentially free from post-translational modifications and can be useful in understanding the structure-function relationship of the protein. In this study, ovalbumin was expressed in Escherichia coli in the form of inclusion bodies. Ovalbumin inclusion bodies were solubilized using urea and refolded by decreasing the urea concentration by dilution. Refolded protein was purified by anion exchange chromatography. Overall recovery of purified recombinant ovalbumin from inclusion bodies was about 30% with 98% purity. Purified recombinant ovalbumin was characterized by mass spectrometry, circular dichroism and fluorescence spectroscopy. Recombinant ovalbumin was shown to be resistant to trypsin using protease resistance assay. This indicated proper refolding of ovalbumin from inclusion bodies of E. coli. This method provides a simple way of producing ovalbumin free of post-translational modifications.

  17. Analysis of interchromosomal mitotic recombination. (United States)

    McGill, C B; Shafer, B K; Higgins, D R; Strathern, J N


    A novel synthetic locus is described that provides a simple assay system for characterizing mitotic recombinants. The locus consists of the TRP1 and HIS3 genes inserted into chromosome III of S. cerevisiae between the CRY1 and MAT loci. Defined trp1 and his3 alleles have been generated that allow the selection of interchromosomal recombinants in this interval. Trp+ or His+ recombinants can be divided into several classes based on coupling of the other alleles in the interval. The tight linkage of the CRY1 and MAT loci, combined with the drug resistance and cell type phenotypes that they respectively control, facilitates the classification of the recombinants without resorting to tetrad dissection. We present the distribution of spontaneous recombinants among the classes defined by this analysis. The data suggest that the recombination intermediate can have regions of symmetric strand exchange and that co-conversion tracts can extend over 1-3 kb. Continuous conversion tracts are favored over discontinuous tracts. The distribution among the classes defined by this analysis is altered in recombinants induced by UV irradiation.

  18. Seasonal overturning circulation in the Red Sea: 2. Winter circulation

    KAUST Repository

    Yao, Fengchao


    The shallow winter overturning circulation in the Red Sea is studied using a 50 year high-resolution MITgcm (MIT general circulation model) simulation with realistic atmospheric forcing. The overturning circulation for a typical year, represented by 1980, and the climatological mean are analyzed using model output to delineate the three-dimensional structure and to investigate the underlying dynamical mechanisms. The horizontal model circulation in the winter of 1980 is dominated by energetic eddies. The climatological model mean results suggest that the surface inflow intensifies in a western boundary current in the southern Red Sea that switches to an eastern boundary current north of 24N. The overturning is accomplished through a cyclonic recirculation and a cross-basin overturning circulation in the northern Red Sea, with major sinking occurring along a narrow band of width about 20 km along the eastern boundary and weaker upwelling along the western boundary. The northward pressure gradient force, strong vertical mixing, and horizontal mixing near the boundary are the essential dynamical components in the model\\'s winter overturning circulation. The simulated water exchange is not hydraulically controlled in the Strait of Bab el Mandeb; instead, the exchange is limited by bottom and lateral boundary friction and, to a lesser extent, by interfacial friction due to the vertical viscosity at the interface between the inflow and the outflow. Key Points Sinking occurs in a narrow boundary layer along the eastern boundary Surface western boundary current switches into an eastern boundary current Water exchange in the Strait of Bab el Mandeb is not hydraulically controlled © 2014. American Geophysical Union. All Rights Reserved.

  19. The Invertibility, Explicit Determinants, and Inverses of Circulant and Left Circulant and g-Circulant Matrices Involving Any Continuous Fibonacci and Lucas Numbers

    Directory of Open Access Journals (Sweden)

    Zhaolin Jiang


    Full Text Available Circulant matrices play an important role in solving delay differential equations. In this paper, circulant type matrices including the circulant and left circulant and g-circulant matrices with any continuous Fibonacci and Lucas numbers are considered. Firstly, the invertibility of the circulant matrix is discussed and the explicit determinant and the inverse matrices by constructing the transformation matrices are presented. Furthermore, the invertibility of the left circulant and g-circulant matrices is also studied. We obtain the explicit determinants and the inverse matrices of the left circulant and g-circulant matrices by utilizing the relationship between left circulant, g-circulant matrices and circulant matrix, respectively.

  20. Aspergillus: sex and recombination. (United States)

    Varga, János; Szigeti, Gyöngyi; Baranyi, Nikolett; Kocsubé, Sándor; O'Gorman, Céline M; Dyer, Paul S


    The genus Aspergillus is one of the most widespread groups of fungi on Earth, comprised of about 300-350 species with very diverse lifestyles. Most species produce asexual propagula (conidia) on conidial heads. Despite their ubiquity, a sexual cycle has not yet been identified for most of the aspergilli. Where sexual reproduction is present, species exhibit either homothallic (self fertile) or heterothallic (obligate outcrossing) breeding systems. A parasexual cycle has also been described in some Aspergillus species. As in other fungi, sexual reproduction is governed by mating-type (MAT) genes, which determine sexual identity and are involved in regulating later stages of sexual development. Previous population genetic studies have indicated that some supposedly asexual aspergilli exhibit evidence of a recombining population structure, suggesting the presence of a cryptic sexual cycle. In addition, genome analyses have revealed networks of genes necessary for sexual reproduction in several Aspergillus species, again consistent with latent sexuality in these fungi. Knowledge of MAT gene presence has then successfully been applied to induce sexual reproduction between MAT1-1 and MAT1-2 isolates of certain supposedly asexual aspergilli. Recent progress in understanding the extent and significance of sexual reproduction is described here, with special emphasis on findings that are relevant to clinically important aspergilli. PMID:25118872

  1. Recombinant allergens for allergen-specific immunotherapy: 10 years anniversary of immunotherapy with recombinant allergens. (United States)

    Valenta, Rudolf; Linhart, B; Swoboda, I; Niederberger, V


    The broad applicability of allergen-specific immunotherapy for the treatment and eventually prevention of IgE-mediated allergy is limited by the poor quality and allergenic activity of natural allergen extracts that are used for the production of current allergy vaccines. Today, the genetic code of the most important allergens has been deciphered; recombinant allergens equalling their natural counterparts have been produced for diagnosis and immunotherapy, and a large panel of genetically modified allergens with reduced allergenic activity has been characterized to improve safety of immunotherapy and explore allergen-specific prevention strategies. Successful immunotherapy studies have been performed with recombinant allergens and hypoallergenic allergen derivatives and will lead to the registration of the first recombinant allergen-based vaccines in the near future. There is no doubt that recombinant allergen-based vaccination strategies will be generally applicable to most allergen sources, including respiratory, food and venom allergens and allow to produce safe allergy vaccines for the treatment of the most common forms of IgE-mediated allergies.

  2. [Circulating nucleic acids and infertility]. (United States)

    Scalici, E; Mullet, T; Ferrières Hoa, A; Gala, A; Loup, V; Anahory, T; Belloc, S; Hamamah, S


    Circulating nucleic acids (cell-free DNA and microRNAs) have for particularity to be easily detectable in the biological fluids of the body. Therefore, they constitute biomarkers of interest in female and male infertility care. Indeed, in female, they can be used to detect ovarian reserve disorders (polycystic ovary syndrome and low functional ovarian reserve) as well as to assess follicular microenvironment quality. Moreover, in men, their expression levels can vary in case of spermatogenesis abnormalities. Finally, circulating nucleic acids have also the ability to predict successfully the quality of in vitro embryo development. Their multiple contributions during assisted reproductive technology (ART) make of them biomarkers of interest, for the development of new diagnostic and/or prognostic tests, applied to our specialty. Circulating nucleic acids would so offer the possibility of personalized medical care for infertile couples in ART. PMID:26298813

  3. Atmospheric Circulation of Terrestrial Exoplanets

    CERN Document Server

    Showman, Adam P; Merlis, Timothy M; Kaspi, Yohai


    The investigation of planets around other stars began with the study of gas giants, but is now extending to the discovery and characterization of super-Earths and terrestrial planets. Motivated by this observational tide, we survey the basic dynamical principles governing the atmospheric circulation of terrestrial exoplanets, and discuss the interaction of their circulation with the hydrological cycle and global-scale climate feedbacks. Terrestrial exoplanets occupy a wide range of physical and dynamical conditions, only a small fraction of which have yet been explored in detail. Our approach is to lay out the fundamental dynamical principles governing the atmospheric circulation on terrestrial planets--broadly defined--and show how they can provide a foundation for understanding the atmospheric behavior of these worlds. We first survey basic atmospheric dynamics, including the role of geostrophy, baroclinic instabilities, and jets in the strongly rotating regime (the "extratropics") and the role of the Hadle...

  4. Controlled release from recombinant polymers. (United States)

    Price, Robert; Poursaid, Azadeh; Ghandehari, Hamidreza


    Recombinant polymers provide a high degree of molecular definition for correlating structure with function in controlled release. The wide array of amino acids available as building blocks for these materials lend many advantages including biorecognition, biodegradability, potential biocompatibility, and control over mechanical properties among other attributes. Genetic engineering and DNA manipulation techniques enable the optimization of structure for precise control over spatial and temporal release. Unlike the majority of chemical synthetic strategies used, recombinant DNA technology has allowed for the production of monodisperse polymers with specifically defined sequences. Several classes of recombinant polymers have been used for controlled drug delivery. These include, but are not limited to, elastin-like, silk-like, and silk-elastinlike proteins, as well as emerging cationic polymers for gene delivery. In this article, progress and prospects of recombinant polymers used in controlled release will be reviewed.

  5. Cell encoding recombinant human erythropoietin

    Energy Technology Data Exchange (ETDEWEB)

    Beck, A.K.; Withy, R.M.; Zabrecky, J.R.; Masiello, N.C.


    This patent describes a C127 cell transformed with a recombinant DNA vector. It comprises: a DNA sequence encoding human erythropoietin, the transformed cell being capable of producing N-linked and O-linked glycosylated human erythropoietin.

  6. Proper Sizing of Circulation Pumps

    DEFF Research Database (Denmark)

    Tommerup, Henrik M.; Nørgaard, Jørgen


    , but the results can be applied to Europe in general. Despite the small sample of houses involved in the test, 15 houses, some rather safe conclusions can be drawn from the results, which showed that newly developed pumps with power consumption around 5-8 W, can perform the task of circulating the water...... as well as their pollution during operation. Policy measures are proposed of how to ensure that in the future only such energy saving pumps are installed. Furthermore, on the basis of the historic experiences with circulation pumps some con¬clusions are drawn on how to investigate, develop and market new...

  7. Progenitors of Recombining Supernova Remnants


    Moriya, Takashi J.


    Usual supernova remnants have either ionizing plasma or plasma in collisional ionization equilibrium, i.e., the ionization temperature is lower than or equal to the electron temperature. However, the existence of recombining supernova remnants, i.e., supernova remnants with the ionization temperature higher than the electron temperature, is recently confirmed. One suggested way to have recombining plasma in a supernova remnant is to have a dense circumstellar medium at the time of the superno...

  8. Recombinant snake venom prothrombin activators


    Lövgren, Ann


    Three prothrombin activators; ecarin, which was originally isolated from the venom of the saw-scaled viper Echis carinatus, trocarin from the rough-scaled snake Tropidechis carinatus, and oscutarin from the Taipan snake Oxyuranus scutellatus, were expressed in mammalian cells with the purpose to obtain recombinant prothrombin activators that could be used to convert prothrombin to thrombin. We have previously reported that recombinant ecarin can efficiently generate thrombin without the need ...

  9. Enhanced defects recombination in ion irradiated SiC

    Energy Technology Data Exchange (ETDEWEB)

    Izzo, G. [Department of Physics and Astronomy, Catania University, Via S. Sofia 64, 95123 Catania (Italy); Litrico, G., E-mail: grazia.litrico@ct.infn.i [Department of Physics and Astronomy, Catania University, Via S. Sofia 64, 95123 Catania (Italy); Grassia, F.; Calcagno, L.; Foti, G. [Department of Physics and Astronomy, Catania University, Via S. Sofia 64, 95123 Catania (Italy)


    Point defects induced in SiC by ion irradiation show a recombination at temperatures as low as 320 K and this process is enhanced after running current density ranging from 80 to 120 A/cm{sup 2}. Ion irradiation induces in SiC the formation of different defect levels and low-temperature annealing changes their concentration. Some levels (S{sub 0}, S{sub x} and S{sub 2}) show a recombination and simultaneously a new level (S{sub 1}) is formed. An enhanced recombination of defects is besides observed after running current in the diode at room temperature. The carriers introduction reduces the S{sub 2} trap concentration, while the remaining levels are not modified. The recombination is negligible up to a current density of 50 A/cm{sup 2} and increases at higher current density. The enhanced recombination of the S{sub 2} trap occurs at 300 K, which otherwise requires a 400 K annealing temperature. The process can be related to the electron-hole recombination at the associated defect.

  10. Recombination and population inversion in plasmas generated by tunneling ionization. (United States)

    Pert, G J


    Above-threshold ionization (ATI) ionization by linearly polarized light has been proposed by several authors as a means of driving recombination lasers in the soft x-ray spectral region. The pump radiation generates a cold electron plasma with ions in a single ionization stage, which is an ideal starting condition for strong recombination. Population inversions form during the recombination cascade to the ground state of the next ionization stage. In the absence of any relaxation the electron distribution is strongly peaked near zero energy. However, a number of different processes all heat the cold electrons towards Maxwellian, and may thereby reduce the recombination rate in the higher levels. Using numerical models we investigate these relaxation processes and their effect on recombination. We show that the recombination can be well described by the standard cascade model, provided an appropriate temperature is used. We examine two cases in detail, hydrogen-like lithium where the inversion is with respect to the ground state, and lithium-like nitrogen where it is with the first excited state. The two cases differ markedly in the degree of relaxation achieved, and in the duration of the population inversion.

  11. Unipolar outflows and global meridional circulations in rotating accretion flows

    CERN Document Server

    Igumenshchev, I V


    Using two-dimensional simulations of non-radiative viscous rotating black hole accretion flows, we show that the flows with alpha~0.1-0.3 self-organize to form stationary unipolar or bipolar outflows accompanied by global meridional circulations. The required energy comes, with efficiency implications are discussed.

  12. Norovirus Recombinant Strains Isolated from Gastroenteritis Outbreaks in Southern Brazil, 2004–2011 (United States)

    Leite, José Paulo Gagliardi; Miagostovich, Marize Pereira


    Noroviruses are recognized as one of the leading causes of viral acute gastroenteritis, responsible for almost 50% of acute gastroenteritis outbreaks worldwide. The positive single-strand RNA genome of noroviruses presents a high mutation rate and these viruses are constantly evolving by nucleotide mutation and genome recombination. Norovirus recombinant strains have been detected as causing acute gastroenteritis outbreaks in several countries. However, in Brazil, only one report of a norovirus recombinant strain (GII.P7/GII.20) has been described in the northern region so far. For this study, 38 norovirus strains representative of outbreaks, 11 GII.4 and 27 non-GII.4, were randomly selected and amplified at the ORF1/ORF2 junction. Genetic recombination was identified by constructing phylogenetic trees of the polymerase and capsid genes, and further SimPlot and Bootscan analysis of the ORF1/ORF2 overlap. Sequence analysis revealed that 23 out of 27 (85%) non-GII.4 noroviruses were recombinant strains, characterized as: GII.P7/GII.6 (n = 9); GIIP.g/GII.12 (n = 4); GII.P16/GII.3 (n = 4); GII.Pe/GII.17 (n = 2); GII.P7/GII.14 (n = 1); GII.P13/GII.17 (n = 1); GII.P21/GII.3 (n = 1); and GII.P21/GII.13 (n = 1). On the other hand, among the GII.4 variants analyzed (Den Haag_2006b and New Orleans_2009) no recombination was observed. These data revealed the great diversity of norovirus recombinant strains associated with outbreaks, and describe for the first time these recombinant types circulating in Brazil. Our results obtained in southern Brazil corroborate the previous report for the northern region, demonstrating that norovirus recombinant strains are circulating more frequently than we expected. In addition, these results emphasize the relevance of including ORF1/ORF2-based analysis in surveillance studies as well as the importance of characterizing strains from other Brazilian regions to obtain epidemiological data for norovirus recombinant strains circulating in the

  13. [Enzymatic control of homologous recombination in Escherichia coli cells and hyper-recombination]. (United States)

    Bakhlanova, I V; Dudkina, A V; Baĭtin, D M


    The RecA protein is a major enzyme of homologous recombination in bacterial cell. Forming a right-handed helical filament on ssDNA, it provides a homology search between two DNA molecules and homologous strand exchange. The RecA protein not only defends the cell from exposure to ionizing radiation and UV-irradiation, but also ensures the recombination process in the course of normal cell growth. A number of wild-type or mutant RecA proteins demonstrate increased recombinogenic properties in vitro and in vivo as compared with the wild-type RecA protein from Escherichia coli, which leads to hyper-recombination. The hyper-rec activity of RecA proteins during the recombination process in many depends on the filamentation dynamics on ssDNA and DNA-transferase properties. Changes in filamentation and DNA-transferase abilities of RecA protein may be the result of not only specific amino-acid substitutions, but also the functioning of the cell enzymatic apparatus, including such proteins as RecO, RecR, RecF, RecX, DinI, SSB, PsiB. To date, the function of each of these proteins is identified at the molecular level. However, the role of some of them in the cell metabolism remains to be seen. Increase in recombination in vivo is not always useful for a cell and faces various limitations. Moreover, in the bacterial cell some mechanisms are activated, that cause genomic reorganization, directed to suppress the expression of hyper-active RecA protein. The ways of hyper-active RecA protein regulation are very interesting, and they are studied in different model systems. PMID:23808153

  14. Induction of influenza-specific mucosal immunity by an attenuated recombinant Sendai virus.

    Directory of Open Access Journals (Sweden)

    Thuc-vy L Le

    Full Text Available BACKGROUND: Many pathogens initiate infection at the mucosal surfaces; therefore, induction of mucosal immune responses is a first level of defense against infection and is the most powerful means of protection. Although intramuscular injection is widely used for vaccination and is effective at inducing circulating antibodies, it is less effective at inducing mucosal antibodies. METHODOLOGY/PRINCIPAL FINDINGS: Here we report a novel recombinant, attenuated Sendai virus vector (GP42-H1 in which the hemagglutinin (HA gene of influenza A virus was introduced into the Sendai virus genome as an additional gene. Infection of CV-1 cells by GP42-H1 resulted in cell surface expression of the HA protein. Intranasal immunization of mice with 1,000 plaque forming units (pfu of GP42-H1 induced HA-specific IgG and IgA antibodies in the blood, bronchoalveolar lavage fluid, fecal pellet extracts and saliva. The HA-specific antibody titer induced by GP42-H1 closely resembles the titer induced by sublethal infection by live influenza virus; however, in contrast to infection by influenza virus, immunization with GP42-H1 did not result in disease symptoms or the loss of body weight. In mice that were immunized with GP42-H1 and then challenged with 5LD(50 (1250 pfu of influenza virus, no significant weight loss was observed and other visual signs of morbidity were not detected. CONCLUSIONS: These results demonstrate that the GP42-H1 Sendai virus recombinant is able to confer full protection from lethal infection by influenza virus, supporting the conclusion that it is a safe and effective mucosal vaccine vector.

  15. Conservation of Circulation in Magnetohydrodynamics

    CERN Document Server

    Bekenstein, J D; Bekenstein, Jacob D.; Oron, Asaf


    We demonstrate, both at the Newtonian and (general) relativistic levels, theexistence of a generalization of Kelvin's circulation theorem (for pure fluids)which is applicable to perfect magnetohydrodynamics. The argument is based onthe least action principle for magnetohydrodynamic flow. Examples of the newconservation law are furnished. The new theorem should be helpful inidentifying new kinds of vortex phenomena distinct from magnetic ropes or fluidvortices.

  16. Neural Control of the Circulation (United States)

    Thomas, Gail D.


    The purpose of this brief review is to highlight key concepts about the neural control of the circulation that graduate and medical students should be expected to incorporate into their general knowledge of human physiology. The focus is largely on the sympathetic nerves, which have a dominant role in cardiovascular control due to their effects to…

  17. VanderLaan Circulant Type Matrices

    Directory of Open Access Journals (Sweden)

    Hongyan Pan


    Full Text Available Circulant matrices have become a satisfactory tools in control methods for modern complex systems. In the paper, VanderLaan circulant type matrices are presented, which include VanderLaan circulant, left circulant, and g-circulant matrices. The nonsingularity of these special matrices is discussed by the surprising properties of VanderLaan numbers. The exact determinants of VanderLaan circulant type matrices are given by structuring transformation matrices, determinants of well-known tridiagonal matrices, and tridiagonal-like matrices. The explicit inverse matrices of these special matrices are obtained by structuring transformation matrices, inverses of known tridiagonal matrices, and quasi-tridiagonal matrices. Three kinds of norms and lower bound for the spread of VanderLaan circulant and left circulant matrix are given separately. And we gain the spectral norm of VanderLaan g-circulant matrix.

  18. Generation of monoclonal antibodies for the assessment of protein purification by recombinant ribosomal coupling

    DEFF Research Database (Denmark)

    Kristensen, Janni; Sperling-Petersen, Hans Uffe; Mortensen, Kim Kusk;


    We recently described a conceptually novel method for the purification of recombinant proteins with a propensity to form inclusion bodies in the cytoplasm of Escherichia coli. Recombinant proteins were covalently coupled to the E. coli ribosome by fusing them to ribosomal protein 23 (rpL23) follo...


    Institute of Scientific and Technical Information of China (English)



    Abraham Lempel et al[1] made a connection between linear codes and systems of bilinear forms over finite fields. In this correspondence, a new simple proof of a theorem in [1] is presented; in addition, the encoding process and the decoding procedure of RS codes are simplified via circulant matrices. Finally, the results show that the correspondence between bilinear forms and linear codes is not unique.

  20. Modeling of Sulfur Retention in Circulating Fluidized Bed Coal Combustors

    Institute of Scientific and Technical Information of China (English)

    乔锐; 吕俊复; 刘青; 吴学安; 岳光溪


    A comprehensive model for predicting the sulfur retention performance in circulating fluidized bedcombustors was developed which involves the different residence times, the wide particle size distribution andthe different forms of sulfur in the coal. In addition, the reductive decomposition of CaSO4 is highlighted. Thesimulation results from the model show that the sulfur contents, the bed temperature, the sorbent particle sizedistribution and the sorbent activity or the maximum conversion rate can significantly influence the sulfuretention performance in circulating fluidized bed (CFB) combustors.``

  1. Keynes's Lost Distinction Between Industrial and Financial Circulation of Money

    DEFF Research Database (Denmark)

    Jespersen, Jesper


    Although financial circulation is an important part of banks' balance sheets in the form of savings deposits, this is hardly discussed in monetary circuit theory. In this paper, we argue that monetary circuit theory would be more coherent if it were expanded to incorporate some aspects of Keynes...... of means of payment to what is required for production and trade, and would still make it possible for the central bank to pursue a flexible monetary policy. This insight can be obtained by combining monetary circuit theory and Keynes's analysis of industrial and financial circulation, as put forward...

  2. Recombination between Poliovirus and Coxsackie A Viruses of Species C: A Model of Viral Genetic Plasticity and Emergence

    Directory of Open Access Journals (Sweden)

    Francis Delpeyroux


    Full Text Available Genetic recombination in RNA viruses was discovered many years ago for poliovirus (PV, an enterovirus of the Picornaviridae family, and studied using PV or other picornaviruses as models. Recently, recombination was shown to be a general phenomenon between different types of enteroviruses of the same species. In particular, the interest for this mechanism of genetic plasticity was renewed with the emergence of pathogenic recombinant circulating vaccine-derived polioviruses (cVDPVs, which were implicated in poliomyelitis outbreaks in several regions of the world with insufficient vaccination coverage. Most of these cVDPVs had mosaic genomes constituted of mutated poliovaccine capsid sequences and part or all of the non-structural sequences from other human enteroviruses of species C (HEV-C, in particular coxsackie A viruses. A study in Madagascar showed that recombinant cVDPVs had been co-circulating in a small population of children with many different HEV-C types. This viral ecosystem showed a surprising and extensive biodiversity associated to several types and recombinant genotypes, indicating that intertypic genetic recombination was not only a mechanism of evolution for HEV-C, but an usual mode of genetic plasticity shaping viral diversity. Results suggested that recombination may be, in conjunction with mutations, implicated in the phenotypic diversity of enterovirus strains and in the emergence of new pathogenic strains. Nevertheless, little is known about the rules and mechanisms which govern genetic exchanges between HEV-C types, as well as about the importance of intertypic recombination in generating phenotypic variation. This review summarizes our current knowledge of the mechanisms of evolution of PV, in particular recombination events leading to the emergence of recombinant cVDPVs.

  3. Co-circulation and evolution of polioviruses and species C enteroviruses in a district of Madagascar.

    Directory of Open Access Journals (Sweden)

    Mala Rakoto-Andrianarivelo


    Full Text Available Between October 2001 and April 2002, five cases of acute flaccid paralysis (AFP associated with type 2 vaccine-derived polioviruses (VDPVs were reported in the southern province of the Republic of Madagascar. To determine viral factors that favor the emergence of these pathogenic VDPVs, we analyzed in detail their genomic and phenotypic characteristics and compared them with co-circulating enteroviruses. These VDPVs appeared to belong to two independent recombinant lineages with sequences from the type 2 strain of the oral poliovaccine (OPV in the 5'-half of the genome and sequences derived from unidentified species C enteroviruses (HEV-C in the 3'-half. VDPV strains showed characteristics similar to those of wild neurovirulent viruses including neurovirulence in poliovirus-receptor transgenic mice. We looked for other VDPVs and for circulating enteroviruses in 316 stools collected from healthy children living in the small area where most of the AFP cases occurred. We found vaccine PVs, two VDPVs similar to those found in AFP cases, some echoviruses, and above all, many serotypes of coxsackie A viruses belonging to HEV-C, with substantial genetic diversity. Several coxsackie viruses A17 and A13 carried nucleotide sequences closely related to the 2C and the 3D(pol coding regions of the VDPVs, respectively. There was also evidence of multiple genetic recombination events among the HEV-C resulting in numerous recombinant genotypes. This indicates that co-circulation of HEV-C and OPV strains is associated with evolution by recombination, resulting in unexpectedly extensive viral diversity in small human populations in some tropical regions. This probably contributed to the emergence of recombinant VDPVs. These findings give further insight into viral ecosystems and the evolutionary processes that shape viral biodiversity.

  4. Serendipitous identification of natural intergenotypic recombinants of hepatitis C in Ireland.

    LENUS (Irish Health Repository)

    Moreau, Isabelle


    BACKGROUND: Recombination between hepatitis C single stranded RNA viruses is a rare event. Natural viable intragenotypic and intergenotypic recombinants between 1b-1a, 1a-1c and 2k-1b, 2i-6p, respectively, have been reported. Diagnostically recombinants represent an intriguing challenge. Hepatitis C genotype is defined by interrogation of the sequence composition of the 5\\' untranslated region [5\\'UTR]. Occasionally, ambiguous specimens require further investigation of the genome, usually by interrogation of the NS5B region. The original purpose of this study was to confirm the existence of a suspected mixed genotype infection of genotypes 2 and 4 by clonal analysis at the NS5B region of the genome in two specimens from two separate individuals. This initial identification of genotype was based on analysis of the 5\\'UTR of the genome by reverse line probe hybridisation [RLPH]. RESULTS: The original diagnosis of a mixed genotype infection was not confirmed by clonal analysis of the NS5B region of the genome. The phylogenetic analysis indicated that both specimens were natural intergenotypic recombinant forms of HCV. The recombination was between genotypes 2k and 1b for both specimens. The recombination break point was identified as occurring within the NS2 region of the genome. CONCLUSION: The viral recombinants identified here resemble the recombinant form originally identified in Russia. The RLPH pattern observed in this study may be a signature indicative of this particular type of intergenotype recombinant of hepatitis C meriting clonal analysis of NS2.

  5. The Congo Basin Walker circulation: dynamics and connections to precipitation (United States)

    Cook, Kerry H.; Vizy, Edward K.


    The existence, seasonality, and variability of a Congo Basin Walker circulation are investigated in reanalyses, and connections with rainfall are explored. A zonal overturning circulation along the equator connects rising motion in the Congo Basin and sinking in the eastern Atlantic during June through October. This timing is out of phase with precipitation over equatorial Africa, which greatest during spring and fall, and does not correlate with the seasonality of land temperatures. Rather, the zonally-overturning circulation only occurs when the Atlantic cold tongue has formed. Although the cold tongue formation is essential for setting up the Congo Basin Walker circulation, variations in equatorial eastern Atlantic sea surface temperatures are not associated with interannual variability in the strength of the circulation. When cold tongue SSTs are anomalously cool (warm), evaporation from the ocean surface is reduced (enhanced) and the westerly flow advects less (more) moisture into the base of the Congo Basin Walker circulation. This reduces (increases) the release of latent heat in the upbranch and weakens (strengthens) the Walker circulation. This process dominates the pure dry dynamical response to enhanced land/sea temperature differences, which has an opposite sign. A positive correlation connects low-level vertical velocity in the Congo basin with low-level vertical velocity and precipitation over West Africa. A wave response to anomalous vertical velocity in the Congo Basin in several reanalyses suggests a teleconnection into West Africa such that an anomalously strong (weak) upbranch is associated with anomalously strong (weak) rainfall over the Guinean coast and southern Sahel.

  6. Characterization of quantum circulant networks having perfect state transfer (United States)

    Bašić, Milan


    In this paper we answer the question of when circulant quantum spin networks with nearest-neighbor couplings can give perfect state transfer. The network is described by a circulant graph G, which is characterized by its circulant adjacency matrix A. Formally, we say that there exists a perfect state transfer (PST) between vertices {a,bin V(G)} if | F( τ) ab | = 1, for some positive real number τ, where F( t) = exp(i At). Saxena et al. (Int J Quantum Inf 5:417-430, 2007) proved that | F( τ) aa | = 1 for some {ain V(G)} and {tauin {R}^+} if and only if all eigenvalues of G are integer (that is, the graph is integral). The integral circulant graph ICG n ( D) has the vertex set Z n = {0, 1, 2, . . . , n - 1} and vertices a and b are adjacent if {gcd(a-b,n)in D} , where {D subseteq {d : d mid n, 1 ≤ d < n}} . These graphs are highly symmetric and have important applications in chemical graph theory. We show that ICG n ( D) has PST if and only if {nin 4{N}} and {D=widetilde{D_3} \\cup D_2\\cup 2D_2\\cup 4D_2|cup {n/2^a}} , where {widetilde{D_3}={din D | n/din 8{N}}, D_2= {din D | n/din 8{N}+4}{setminus}{n/4}} and {ain{1,2}} . We have thus answered the question of complete characterization of perfect state transfer in integral circulant graphs raised in Angeles-Canul et al. (Quantum Inf Comput 10(3&4):0325-0342, 2010). Furthermore, we also calculate perfect quantum communication distance (distance between vertices where PST occurs) and describe the spectra of integral circulant graphs having PST. We conclude by giving a closed form expression calculating the number of integral circulant graphs of a given order having PST.

  7. Recombinant snake venom prothrombin activators. (United States)

    Lövgren, Ann


    Three prothrombin activators; ecarin, which was originally isolated from the venom of the saw-scaled viper Echis carinatus, trocarin from the rough-scaled snake Tropidechis carinatus, and oscutarin from the Taipan snake Oxyuranus scutellatus, were expressed in mammalian cells with the purpose to obtain recombinant prothrombin activators that could be used to convert prothrombin to thrombin. We have previously reported that recombinant ecarin can efficiently generate thrombin without the need for additional cofactors, but does not discriminate non-carboxylated prothrombin from biologically active γ-carboxylated prothrombin. Here we report that recombinant trocarin and oscutarin could not efficiently generate thrombin without additional protein co-factors. We confirm that both trocarin and oscutarin are similar to human coagulation Factor X (FX), explaining the need for additional cofactors. Sequencing of a genomic fragment containing 7 out of the 8 exons coding for oscutarin further confirmed the similarity to human FX. PMID:23111318

  8. Heterogeneity in recombinant protein production

    DEFF Research Database (Denmark)

    Schalén, Martin; Johanson, Ted; Lundin, Luisa;


    . the cell physiology is affected. Cells are stressed, and this may severely affect growth, by-product accumulation, biomass yield and recombinant product yield. The stress caused by exposure to divergent microenvironments, genetic differences of individual cells, differing cell cycle stage and cell age, all...... contribute to make a population in a fermenter heterogeneous, resulting in cell-to-cell variation in physiological parameters of the microbial culture. Our study aims at investigating how population heterogeneity and recombinant protein production is affected by environmental gradients in bioreactors...... are simulated in small bioreactors and the population heterogeneity can be visualised by analysing single cells with flow cytometry. This can give new insights to cell physiology and recombinant protein production at the industrial scale....

  9. Preparation and preliminary characterization of recombinant neurolysin for in vivo studies. (United States)

    Wangler, Naomi J; Jayaraman, Srinidhi; Zhu, Rui; Mechref, Yehia; Abbruscato, Thomas J; Bickel, Ulrich; Karamyan, Vardan T


    The goal of this study was to produce milligram quantities of pure, catalytically active, endotoxin-free recombinant neurolysin (rNln) in standard laboratory conditions for use as a research tool. To this end, we transformed E. coli cells with a plasmid construct for polyhistidine-tagged rNln, selected a high-expressing clone and determined the optimal time-point for translation of rNln. rNln was purified to homogeneity from the soluble pool of the cell lysate using Ni-NTA affinity and size-exclusion chromatography, followed by removal of endotoxins. Using this protocol ∼3mg pure, catalytically active and nearly endotoxin-free (≈0.003EU/μg protein) rNln was reproducibly obtained from 1l of culture. Lack of cytotoxicity of rNln preparation was documented in cultured mouse cells, whereas stability in whole mouse blood. Intraperitonealy administered rNln in mice reached the systemic circulation in intact and enzymatically active form with Tmax of 1h and T1/2 of ∼30min. Administration of rNln (2 and 10mg/kg) did not alter arterial blood pressure, heart rate, body temperature and blood glucose levels in mice. These studies demonstrate that the rNln preparation is suitable for cell culture and in vivo studies and can serve as a research tool to investigate the (patho)physiological function of this peptidase. PMID:27496565

  10. Radioisotopic evaluation of portal circulation

    International Nuclear Information System (INIS)

    The use of a radio-tracer of portal circulation through the intestine, should prevent cruel punctures in the portal-vein or spleen as it is usually the case with traditional methods in the study of portal-system. The absorption of I-131 and Tc-99m, previously cheked in rabbits presented similar results in dogs. The time of circulation between terminal large-intestine and the liver (t-RF) was determined by external counting at hepatic level by recording radioactivity variation-time. In healthy animals the t-RF was from 20to 60 seconds, with average time of 42 seconds. In 2 animals with partial binding of portal-vein the t-RF went up to 110 and 120 seconds. (Author)

  11. Ocean circulation generated magnetic signals

    DEFF Research Database (Denmark)

    Manoj, C.; Kuvshinov, A.; Maus, S.;


    Conducting ocean water, as it flows through the Earth's magnetic field, generates secondary electric and magnetic fields. An assessment of the ocean-generated magnetic fields and their detectability may be of importance for geomagnetism and oceanography. Motivated by the clear identification...... of ocean tidal signatures in the CHAMP magnetic field data we estimate the ocean magnetic signals of steady flow using a global 3-D EM numerical solution. The required velocity data are from the ECCO ocean circulation experiment and alternatively from the OCCAM model for higher resolution. We assume...... of the magnetic field, as compared to the ECCO simulation. Besides the expected signatures of the global circulation patterns, we find significant seasonal variability of ocean magnetic signals in the Indian and Western Pacific Oceans. Compared to seasonal variation, interannual variations produce weaker signals....

  12. The effect of a single recombination event

    DEFF Research Database (Denmark)

    Schierup, Mikkel Heide; Jensen, Thomas Mailund; Wiuf, Carsten

    We investigate the variance in how visible a single recombination event is in a SNP data set as a function of the type of recombination event and its age. Data is simulated under the coalescent with recombination and inference is by the popular composite likelihood methods. The major determinant...... of the effect of a recombination event is the genealogical type of the event and whether SNP variation is present that can reveal the genealogical consequences of the recombination event. Recombination events that only change some branch lengths in the genealogy have a very small, but detectable, effect....... The more lineages left when the recombination event occurs, the larger effect it has, implying that it is mainly young recombination events that we detect when estimating the rate. If the population is growing, though, more lineages are present back in time and relatively more ancient recombination events...

  13. Conservation of circulation in magnetohydrodynamics (United States)

    Bekenstein; Oron


    We demonstrate at both the Newtonian and (general) relativistic levels the existence of a generalization of Kelvin's circulation theorem (for pure fluids) that is applicable to perfect magnetohydrodynamics. The argument is based on the least action principle for magnetohydrodynamic flow. Examples of the new conservation law are furnished. The new theorem should be helpful in identifying new kinds of vortex phenomena distinct from magnetic ropes or fluid vortices. PMID:11089118

  14. Electronic circulation of accounting documents


    Kremláčková, Kateřina


    This thesis describes a circulation of accounting documents in an accounting entity, deals with legal requirements of the entire process and discusses it as a part of an internal control system of the entity. In connection with the theme of the work there are also defined legislative conditions for using information and communication technologies and introduced possibilities of involving these technologies in the process of processing of the accounting documents. Above all the electronic data...

  15. Natural circulation systems: advantages and challenges

    International Nuclear Information System (INIS)

    This lecture briefly explains the principle of working of a natural circulation system, its various advantages and applications in nuclear and other industries. The major challenges to be overcome before the wide acceptance of natural circulation as the normal mode of coolant circulation in nuclear power reactors are briefly described. Classification of NCSs and the terminologies commonly encountered in natural circulation literature are also briefly explained. (author)

  16. Stability of Thermohaline circulation with respect to fresh water release

    CERN Document Server

    Patwardhan, Ajay


    The relatively warm climate found in the North- Western Europe is due to the gulf stream that circulates warm saline water from southern latitudes to Europe. In North Atlantic ocean the stream gives out a large amount of heat, cools down and sinks to the bottom to complete the Thermohaline circulation. There is considerable debate on the stability of the stream to inputs of fresh water from the melting ice in Greenland and Arctic. The circulation, being switched off, will have massive impact on the climate of Europe. Intergovernmental panel on climate change (IPCC) has warned of this danger in its recent report. Our aim is to model the Thermohaline circulation at the point where it sinks in the North-Atlantic. We create a two dimensional discrete map modeling the salinity gradient and vertical velocity of the stream. We look for how a perturbation in the form of fresh water release can destabilise the circulation by pushing the velocity below a certain threshold.

  17. Molecular analysis of Porcine Circovirus Type 2 strains from Uruguay: evidence for natural occurring recombination. (United States)

    Ramos, Natalia; Mirazo, Santiago; Castro, Gustavo; Arbiza, Juan


    Porcine Circovirus Type 2 (PCV2) is a worldwide distributed virus and is considered an important emerging pathogen related to several distinct disease syndromes in pigs. Genomic structure consists of three major open reading frames (ORFs). ORF1 (rep gene) encodes replication-related proteins, ORF2 (cap gene) encodes the capsid protein and ORF3 encodes a protein putatively involved in virus-induced apoptosis. Based on cap gene sequences, PCV2 strains are classified into two main genotypes, PCV2a with five clusters (2A-2E) and PCV2b with three clusters (1A-1C). According to previous theoretical studies, PCV2 strains can eventually undergo intra and inter-genotype recombination, mainly within the rep gene. Ever since, several evidences of recombination in the field have been reported and confirmed this hypothesis. In South America, data regarding molecular characterization of PCV2 strains is still scant. Genotyping studies in the region have concluded that PCV2b is the predominant circulating genotype in the region and till now, no recombinant strains have ever been reported. In this work we thoroughly characterized at the molecular level Uruguayan PCV2 strains by extensive sequence data analysis. Moreover, recombination software tools were applied to explore and characterize eventual occurrence of natural recombination events. Two recombinant PCV2 strains were detected in this study, as a consequence of an inter-genotype recombination event between PCV2b-1A and PCV2a-2D, as the major and minor parent, respectively. According to recombination software analysis, in both cases the event occurred within the ORF1. Herein, extensive viral sequence dataset is provided, including the characterization of the first PCV2 recombinant strains ever reported in South America. Additionally, our results suggested a multi-centered source of PCV2 infection in Uruguay, which probably involved Brazilian and European origins.

  18. Internal variability of the thermohaline ocean circulation

    NARCIS (Netherlands)

    Raa, Lianke Alinda te


    Variations in the ocean circulation can strongly influence climate due to the large heat transport by the ocean currents. Variability of the thermohaline ocean circulation, the part of the ocean circulation driven by density gradients, occurs typically on (inter)decadal and longer time scales and is

  19. Experimental studies on catalytic hydrogen recombiners for light water reactors

    International Nuclear Information System (INIS)

    In the course of core melt accidents in nuclear power plants a large amount of hydrogen can be produced and form an explosive or even detonative gas mixture with aerial oxygen in the reactor building. In the containment atmosphere of pressurized water reactors hydrogen combines a phlogistically with the oxygen present to form water vapor even at room temperature. In the past, experimental work conducted at various facilities has contributed little or nothing to an understanding of the operating principles of catalytic recombiners. Hence, the purpose of the present study was to conduct detailed investigations on a section of a recombiner essentially in order to deepen the understanding of reaction kinetics and heat transport processes. The results of the experiments presented in this dissertation form a large data base of measurements which provides an insight into the processes taking place in recombiners. The reaction-kinetic interpretation of the measured data confirms and deepens the diffusion theory - proposed in an earlier study. Thus it is now possible to validate detailed numeric models representing the processes in recombiners. Consequently the present study serves to broaden and corroborate competence in this significant area of reactor technology. In addition, the empirical knowledge thus gained may be used for a critical reassessment of previous numeric model calculations. (orig.)

  20. Circulation of HIV-1 CRF02_AG among MSM Population in Central Italy: A Molecular Epidemiology-Based Study

    Directory of Open Access Journals (Sweden)

    Massimo Giuliani


    Full Text Available Introduction. The evolutionary and demographic history of the circular recombinant form CRF02_AG in a selected retrospective group of HIV-1 infected men who have sex with men (MSM resident in Central Italy was investigated. Methods. A total of 55 HIV-1 subtype CRF02_AG pol sequences were analyzed using Bayesian methods and a relaxed molecular clock to reconstruct their dated phylogeny and estimate population dynamics. Results. Dated phylogeny indicated that the HIV-1 CRF02_AG strains currently circulating in Central Italy originated in the early 90's. Bayesian phylogenetic analysis revealed the existence of a main HIV-1 CRF02_AG clade, introduced in the area of Rome before 2000 and subsequently differentiated in two different subclades with a different date of introduction (2000 versus 2005. All the sequences within clusters were interspersed, indicating that the MSM analyzed form a close and restricted network where the individuals, also moving within different clinical centers, attend the same places to meet and exchange sex. Conclusions. It was suggested that the HIV-1 CRF02_AG epidemic entered central Italy in the early 1990s, with a similar trend observed in western Europe.

  1. An Overview of the Molecular Mechanisms of Recombinational DNA Repair. (United States)

    Kowalczykowski, Stephen C


    Recombinational DNA repair is a universal aspect of DNA metabolism and is essential for genomic integrity. It is a template-directed process that uses a second chromosomal copy (sister, daughter, or homolog) to ensure proper repair of broken chromosomes. The key steps of recombination are conserved from phage through human, and an overview of those steps is provided in this review. The first step is resection by helicases and nucleases to produce single-stranded DNA (ssDNA) that defines the homologous locus. The ssDNA is a scaffold for assembly of the RecA/RAD51 filament, which promotes the homology search. On finding homology, the nucleoprotein filament catalyzes exchange of DNA strands to form a joint molecule. Recombination is controlled by regulating the fate of both RecA/RAD51 filaments and DNA pairing intermediates. Finally, intermediates that mature into Holliday structures are disjoined by either nucleolytic resolution or topological dissolution. PMID:26525148

  2. Mechanisms underlying allergy vaccination with recombinant hypoallergenic allergen derivatives. (United States)

    Linhart, Birgit; Valenta, Rudolf


    Hundred years ago therapeutic vaccination with allergen-containing extracts has been introduced as a clinically effective, disease-modifying, allergen-specific and long-lasting form of therapy for allergy, a hypersensitivity disease affecting more than 25% of the population. Today, the structures of most of the disease-causing allergens have been elucidated and recombinant hypoallergenic allergen derivatives with reduced allergenic activity have been engineered to reduce side effects during allergen-specific immunotherapy (SIT). These recombinant hypoallergens have been characterized in vitro, in experimental animal models and in clinical trials in allergic patients. This review provides a summary of the molecular, immunological and preclinical evaluation criteria applied for this new generation of allergy vaccines. Furthermore, we summarize the mechanisms underlying SIT with recombinant hypoallergens which are thought to be responsible for their therapeutic effect.

  3. Molecular and population analyses of a recombination event in the catabolic plasmid pJP4. (United States)

    Larraín-Linton, Juanita; De la Iglesia, Rodrigo; Melo, Francisco; González, Bernardo


    Cupriavidus necator JMP134(pJP4) harbors a catabolic plasmid, pJP4, which confers the ability to grow on chloroaromatic compounds. Repeated growth on 3-chlorobenzoate (3-CB) results in selection of a recombinant strain, which degrades 3-CB better but no longer grows on 2,4-dichlorophenoxyacetate (2,4-D). We have previously proposed that this phenotype is due to a double homologous recombination event between inverted repeats of the multicopies of this plasmid within the cell. One recombinant form of this plasmid (pJP4-F3) explains this phenotype, since it harbors two copies of the chlorocatechol degradation tfd gene clusters, which are essential to grow on 3-CB, but has lost the tfdA gene, encoding the first step in degradation of 2,4-D. The other recombinant plasmid (pJP4-FM) should harbor two copies of the tfdA gene but no copies of the tfd gene clusters. A molecular analysis using a multiplex PCR approach to distinguish the wild-type plasmid pJP4 from its two recombinant forms, was carried out. Expected PCR products confirming this recombination model were found and sequenced. Few recombinant plasmid forms in cultures grown in several carbon sources were detected. Kinetic studies indicated that cells containing the recombinant plasmid pJP4-FM were not selectable by sole carbon source growth pressure, whereas those cells harboring recombinant plasmid pJP4-F3 were selected upon growth on 3-CB. After 12 days of repeated growth on 3-CB, the complete plasmid population in C. necator JMP134 apparently corresponds to this form. However, wild-type plasmid forms could be recovered after growing this culture on 2,4-D, indicating that different plasmid forms can be found in C. necator JMP134 at the population level. PMID:16980481

  4. Preparing Recombinant Gonad Organ Cultures




    Authors: Blanche Capel and Jordan Batchvarov Corresponding author ([]()) ### INTRODUCTION It can be useful to assay migration between any two adjacent tissues during development. This protocol assays cell migration between the gonad and mesonephros using tissue recombination between genetically marked and unmarked tissue, combined with an organ culture technique. First, agar blocks are prepared in a custom-built mold. The size and sh...

  5. Controlled Release from Recombinant Polymers


    Price, Robert; Poursaid, Azadeh; Ghandehari, Hamidreza


    Recombinant polymers provide a high degree of molecular definition for correlating structure with function in controlled release. The wide array of amino acids available as building blocks for these materials lend many advantages including biorecognition, biodegradability, potential biocompatibility, and control over mechanical properties among other attributes. Genetic engineering and DNA manipulation techniques enable the optimization of structure for precise control over spatial and tempor...

  6. Functional, Responsive Materials Assembled from Recombinant Oleosin (United States)

    Hammer, Daniel

    Biological cells are surrounded by a plasma membrane made primarily of phospholipids that form a bilayer. This membrane is permselective and compartmentalizes the cell. A simple form of artificial cell is the vesicle, in which a phospholipid bilayer membrane surrounds an aqueous solution. However, there is no a priori reason why a membrane needs to be made of phospholipids. It could be made of any surfactant that forms a bilayer. We have assembled membranes and other structures from the recombinant plant protein oleosin. The ability to assemble from a recombinant protein means that every molecule is identical, we have complete control over the sequence, and hence can build in designer functionality with high fidelity, including adhesion and enzymatic activity. Such incorporation is trivial using the tools of molecular biology. We find that while many variants of oleosin make membranes, others make micelles and sheets. We show how the type of supramolecular structure can be altered by the conditions of solvent, such as ionic strength, and the architecture of the surfactant itself. We show that protease cleavable domains can be incorporated within oleosin, and be engineered to protect other functional domains such as adhesive motifs, to make responsive materials whose activity and shape depend on the action of proteases. We will also present the idea of making ``Franken''-oleosins, where large domains of native oleosin are replaced with domains from other functional proteins, to make hybrids conferred by the donor protein. Thus, we can view oleosin as a template upon which a vast array of designer functionalities can be imparted..

  7. Evidence of recombination in Hepatitis C Virus populations infecting a hemophiliac patient

    Directory of Open Access Journals (Sweden)

    Cristina Juan


    Full Text Available Abstract Background/Aim Hepatitis C virus (HCV infection is an important cause of morbidity and mortality in patients affected by hereditary bleeding disorders. HCV, as others RNA virus, exploit all possible mechanisms of genetic variation to ensure their survival, such as recombination and mutation. In order to gain insight into the genetic variability of HCV virus strains circulating in hemophiliac patients, we have performed a phylogenetic analysis of HCV strains isolated from 10 patients with this kind of pathology. Methods Putative recombinant sequence was identified with the use of GARD program. Statistical support for the presence of a recombination event was done by the use of LARD program. Results A new intragenotypic recombinant strain (1b/1a was detected in 1 out of the 10 hemophiliac patient studied. The recombination event was located at position 387 of the HCV genome (relative to strain AF009606, sub-type 1a corresponding to the core gene region. Conclusion Although recombination may not appear to be common among natural populations of HCV it should be considered as a possible mechanism for generating genetic diversity in hemophiliacs patients.

  8. H2 recombination on interstellar grains

    International Nuclear Information System (INIS)

    From a consideration of relevant theoretical and experimental data it is concluded that H atoms (but not H2 molecules) will be chemisorbed on interstellar graphite grains, with H2 formation proceeding efficiently for graphite grain temperatures less than 70 K. It is argued that graphite grains will act as the principle sites for H2 formation, with a formation rate of Rapprox. =4 x 10/sup -17/ cm3 s/sup -1/. Heating by H2 molecules formed by surface recombination is analyzed in the context of the available experimental data, and a heating rate is derived and compared with other suggested cloud heating mechanisms. We conclude that H2 recombination will provide the largest heat source in diffuse clouds if the albedo of interstellar dust in the 912--1200 A region is high (approx.0.9), whereas if the albedo in this wavelength region is lower (approx.0.5), photoelectron ejection from grains will tend to predominate, and can explain observed cloud temperatures with a carbon depletion factor of approximately 2, a factor attributable to a normal interstellar abundance of graphite grains

  9. Circulating follistatin in relation to energy metabolism. (United States)

    Hansen, Jakob Schiøler; Plomgaard, Peter


    Recently, substantial evidence has emerged that the liver contributes significantly to the circulating levels of follistatin and that circulating follistatin is tightly regulated by the glucagon-to-insulin ratio. Both observations are based on investigations of healthy subjects. These novel findings challenge the present view of circulating follistatin in human physiology, being that circulating follistatin is a result of spill-over from para/autocrine actions in various tissues and cells. Follistatin as a liver-derived protein under the regulation of glucagon-to-insulin ratio suggests a relation to energy metabolism. In this narrative review, we attempt to reconcile the existing findings on circulating follistatin with the novel concept that circulating follistatin is a liver-derived molecule regulated by the glucagon-to-insulin ratio. The picture emerging is that conditions associated with elevated levels of circulating follistatin have a metabolic denominator with decreased insulin sensitivity and/or hyperglucagoneimia. PMID:27264073

  10. Live recombinant BHV/BRSV vaccine

    NARCIS (Netherlands)

    Keil, G.M.; Rijsewijk, F.A.M.


    The present invention refers to synthetic Bovine Respiratory Syncytium virus genes. Also the invention relates to live attenuated Bovine Herpesvirus recombinants carrying such synthetic genes. Furthermore, the invention relates to vaccines based on these live attenuated recombinants, for the protect

  11. Recombinant innovation and endogenous technological transitions

    NARCIS (Netherlands)

    K. Frenken; L.R. Izquierdo; P. Zeppini


    We propose a model of technological transitions based on two different types of innovations. Branching innovations refer to technological improvements along a particular path, while recombinant innovations represent fusions of multiple paths. Recombinant innovations create "short-cuts" which reduce

  12. Expression and purification of recombinant polyomavirus VP2 protein and its interactions with polyomavirus proteins (United States)

    Cai, X.; Chang, D.; Rottinghaus, S.; Consigli, R. A.; Spooner, B. S. (Principal Investigator)


    Recombinant polyomavirus VP2 protein was expressed in Escherichia coli (RK1448), using the recombinant expression system pFPYV2. Recombinant VP2 was purified to near homogeneity by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, electroelution, and Extracti-Gel chromatography. Polyclonal serum to this protein which reacted specifically with recombinant VP2 as well as polyomavirus virion VP2 and VP3 on Western blots (immunoblots) was produced. Purified VP2 was used to establish an in vitro protein-protein interaction assay with polyomavirus structural proteins and purified recombinant VP1. Recombinant VP2 interacted with recombinant VP1, virion VP1, and the four virion histones. Recombinant VP1 coimmunoprecipitated with recombinant VP2 or truncated VP2 (delta C12VP2), which lacked the carboxy-terminal 12 amino acids. These experiments confirmed the interaction between VP1 and VP2 and revealed that the carboxyterminal 12 amino acids of VP2 and VP3 were not necessary for formation of this interaction. In vivo VP1-VP2 interaction study accomplished by cotransfection of COS-7 cells with VP2 and truncated VP1 (delta N11VP1) lacking the nuclear localization signal demonstrated that VP2 was capable of translocating delta N11VP1 into the nucleus. These studies suggest that complexes of VP1 and VP2 may be formed in the cytoplasm and cotransported to the nucleus for virion assembly to occur.

  13. Non-Radiative Carrier Recombination Enhanced by Two-Level Process: A First-Principles Study (United States)

    Yang, Ji-Hui; Shi, Lin; Wang, Lin-Wang; Wei, Su-Huai


    Non-radiative recombination plays an important role in the performance of optoelectronic semiconductor devices such as solar cells and light-emitting diodes. Most textbook examples assume that the recombination process occurs through a single defect level, where one electron and one hole are captured and recombined. Based on this simple picture, conventional wisdom is that only defect levels near the center of the bandgap can be effective recombination centers. Here, we present a new two-level recombination mechanism: first, one type of carrier is captured through a defect level forming a metastable state; then the local defect configuration rapidly changes to a stable state, where the other type of carrier is captured and recombined through another defect level. This novel mechanism is applied to the recombination center in CdTe. We show that this two-level process can significantly increase the recombination rate (by three orders of magnitude) in agreement with experiments. We expect that this two-level recombination process can exist in a wide range of semiconductors, so its effect should be carefully examined in characterizing optoelectronic materials.

  14. Investigation on the influence of pressure and temperature on the ignition limits of hydrogen inside recombiners

    International Nuclear Information System (INIS)

    Passive Auto-catalytic Recombiners (PARs) are used to avoid excessive hydrogen accumulation inside the reactor containment in case of severe accident. Their behavior is based on the exothermic recombination of hydrogen into steam in presence of oxygen. This surface mechanism leads to an overheating of the catalytic plates and activates natural convection-driven circulation of gases in contact with the catalyst. The heat source induced by the PAR activity can then create local conditions for hydrogen gaseous combustion, as igniters do. This paper deals with the numerical simulation of the impact of thermal-hydraulic conditions on PAR hydrogen ignition limits. The separated effects of three main parameters (steam, pressure and temperature) are analyzed. Calculations using an IRSN dedicated CFD code, reveal that hydrogen ignition inside recombiners can be significantly accelerated or delayed according to the reactor containment atmosphere. (author)

  15. Transmission distortion affecting human noncrossover but not crossover recombination: a hidden source of meiotic drive.

    Directory of Open Access Journals (Sweden)

    Linda Odenthal-Hesse


    Full Text Available Meiotic recombination ensures the correct segregation of homologous chromosomes during gamete formation and contributes to DNA diversity through both large-scale reciprocal crossovers and very localised gene conversion events, also known as noncrossovers. Considerable progress has been made in understanding factors such as PRDM9 and SNP variants that influence the initiation of recombination at human hotspots but very little is known about factors acting downstream. To address this, we simultaneously analysed both types of recombinant molecule in sperm DNA at six highly active hotspots, and looked for disparity in the transmission of allelic variants indicative of any cis-acting influences. At two of the hotspots we identified a novel form of biased transmission that was exclusive to the noncrossover class of recombinant, and which presumably arises through differences between crossovers and noncrossovers in heteroduplex formation and biased mismatch repair. This form of biased gene conversion is not predicted to influence hotspot activity as previously noted for SNPs that affect recombination initiation, but does constitute a powerful and previously undetected source of recombination-driven meiotic drive that by extrapolation may affect thousands of recombination hotspots throughout the human genome. Intriguingly, at both of the hotspots described here, this drive favours strong (G/C over weak (A/T base pairs as might be predicted from the well-established correlations between high GC content and recombination activity in mammalian genomes.

  16. Transmission distortion affecting human noncrossover but not crossover recombination: a hidden source of meiotic drive. (United States)

    Odenthal-Hesse, Linda; Berg, Ingrid L; Veselis, Amelia; Jeffreys, Alec J; May, Celia A


    Meiotic recombination ensures the correct segregation of homologous chromosomes during gamete formation and contributes to DNA diversity through both large-scale reciprocal crossovers and very localised gene conversion events, also known as noncrossovers. Considerable progress has been made in understanding factors such as PRDM9 and SNP variants that influence the initiation of recombination at human hotspots but very little is known about factors acting downstream. To address this, we simultaneously analysed both types of recombinant molecule in sperm DNA at six highly active hotspots, and looked for disparity in the transmission of allelic variants indicative of any cis-acting influences. At two of the hotspots we identified a novel form of biased transmission that was exclusive to the noncrossover class of recombinant, and which presumably arises through differences between crossovers and noncrossovers in heteroduplex formation and biased mismatch repair. This form of biased gene conversion is not predicted to influence hotspot activity as previously noted for SNPs that affect recombination initiation, but does constitute a powerful and previously undetected source of recombination-driven meiotic drive that by extrapolation may affect thousands of recombination hotspots throughout the human genome. Intriguingly, at both of the hotspots described here, this drive favours strong (G/C) over weak (A/T) base pairs as might be predicted from the well-established correlations between high GC content and recombination activity in mammalian genomes. PMID:24516398

  17. Recombinant erythropoietin in humans has a prolonged effect on circulating erythropoietin isoform distribution

    DEFF Research Database (Denmark)

    Aachmann-Andersen, Niels Jacob; Just Christensen, Søren; Lisbjerg, Kristian;


    -acetyl glucosamine with the glycosylation dependent desorption of EPO isoforms. At day 25, plasma-EPO in both rhEPO groups had returned to values not different from the placebo group. PMI with placebo, reflecting the endogenous EPO isoforms, averaged 82.5 (10.3) % (mean (SD)). High-dose Epoetin beta decreased PMI...

  18. Intercompartmental Recombination of HIV-1 Contributes to env Intrahost Diversity and Modulates Viral Tropism and Sensitivity to Entry Inhibitors▿†‡


    Brown, Richard J. P.; Peters, Paul J; Caron, Catherine; Gonzalez-Perez, Maria Paz; Stones, Leanne; Ankghuambom, Chiambah; Pondei, Kemebradikumo; McClure, C. Patrick; Alemnji, George; Taylor, Stephen; Sharp, Paul M.; Clapham, Paul R.; Ball, Jonathan K.


    HIV-1 circulates within an infected host as a genetically heterogeneous viral population. Viral intrahost diversity is shaped by substitutional evolution and recombination. Although many studies have speculated that recombination could have a significant impact on viral phenotype, this has never been definitively demonstrated. We report here phylogenetic and subsequent phenotypic analyses of envelope genes obtained from HIV-1 populations present in different anatomical compartments. Assessmen...

  19. Determination of recombination in Mycoplasma hominis

    DEFF Research Database (Denmark)

    Jacobsen, Iben Søgaard; Boesen, Thomas; Mygind, Tina;


    indicating the presence of recombination. In order to test for intergenic recombination, phylogenetic trees were reconstructed for each of the genes but no well-supported bifurcating phylogenetic trees could be obtained. The genes were tested for intragenic recombination using the correlation between linkage...

  20. Some aspects on four quarks recombination

    CERN Document Server

    Sanchez, G Toledo


    We have performed a 3-D Monte Carlo simulation of a system composed of two identical light quarks ($qq$) and two identical antiquarks ($\\bar Q\\bar Q$) and determined whether it is energetically more favorable to form a tetraquark or two mesons, as a function of the interparticle separation distance which, for a fixed number of particles, can be identified as a particle density. In this proceedings, we highlight the main results and elaborate on the implications in properties like the correlation function for two-mesons and characterize the isolated diquark correlation function. We analize the four-body potential evolution and exhibit its linear behavior as a function of the invariant distance. We track the dynamical flipping among configurations to determine the recombination probability, exhibiting the importance of the tetraquark state.

  1. Circulating Biomarker Panels in Alzheimer's Disease. (United States)

    Zafari, Sachli; Backes, Christina; Meese, Eckart; Keller, Andreas


    The early diagnosis of diseases frequently represents an important unmet clinical need supporting in-time treatment of pathologies. This also applies to neurodegenerative diseases such as Alzheimer's disease (AD), the most common form of dementia, estimated to affect millions of individuals worldwide. The respective diagnostic and prognostic markers, especially for the preclinical stages of AD, are expected to improve patients' outcome significantly. In the last decades, many approaches to detecting AD have been developed, including markers to discover changes in amyloid-β levels [from cerebrospinal fluid (CSF) or using positron emission tomography] or other brain imaging technologies such as structural magnetic resonance imaging (MRI), functional-connectivity MRI or task-related functional MRI. A major challenge is the detection of AD using minimally or even noninvasive biomarkers from body fluids such as plasma or serum. Circulating biomarker candidates based on mRNAs or proteins measured from blood cells, plasma or serum have been proposed for various pathologies including AD. As for other diseases, there is a tendency to use marker signatures obtained by high-throughput approaches, which allow the generation of profiles of hundreds to thousands of biomarkers simultaneously [microarrays, mass spectrometry or next-generation sequencing (NGS)]. Beyond mRNAs and proteins, recent approaches have measured small noncoding RNA (so-called microRNA) profiles in AD patients' blood samples using NGS or array-based technologies. Generally, the development of marker panels is in its early stages and requires further, substantial clinical validation. In this review, we provide an overview of different circulating AD biomarkers, starting with a brief summary of CSF markers and focusing on novel biomarker signatures such as small noncoding RNA profiles.

  2. Selection of Recombinant Human Antibodies. (United States)

    Tomszak, Florian; Weber, Susanne; Zantow, Jonas; Schirrmann, Thomas; Hust, Michael; Frenzel, André


    Since the development of therapeutic antibodies the demand of recombinant human antibodies is steadily increasing. Traditionally, therapeutic antibodies were generated by immunization of rat or mice, the generation of hybridoma clones, cloning of the antibody genes and subsequent humanization and engineering of the lead candidates. In the last few years, techniques were developed that use transgenic animals with a human antibody gene repertoire. Here, modern recombinant DNA technologies can be combined with well established immunization and hybridoma technologies to generate already affinity maturated human antibodies. An alternative are in vitro technologies which enabled the generation of fully human antibodies from antibody gene libraries that even exceed the human antibody repertoire. Specific antibodies can be isolated from these libraries in a very short time and therefore reduce the development time of an antibody drug at a very early stage.In this review, we describe different technologies that are currently used for the in vitro and in vivo generation of human antibodies. PMID:27236551

  3. Mechanisms of sister chromatid recombination

    International Nuclear Information System (INIS)

    Studies using T948 as a model system have been carried out aimed at elucidating the mechanism of sister chromatid recombination (SCR). Characterization of U.V. light- and x-ray-induced SCR, the relationiship between SCR induction and DNA repair using rad mutations, and the relationship between SCR induction and the time of cell division using cdc mutations are presented. It has been supposed that SCR is induced at the phase of S-G2 following DNA replication, that postreplication break of DNA strands is strongly involved in the induction of SCR, and that induction type of SCR, i.e., conversion type or recombination type, is dependent upon the type of molecular damage of DNA. (Namekawa, K.)

  4. Indian Ocean circulation and productivity during the last glacial cycle

    Digital Repository Service at National Institute of Oceanography (India)

    Piotrowski, A.M.; Banakar, V.K.; Scrivner, A.E.; Elderfield, H.; Galy, A.; Dennis, A.

    paleoclimate changes. In the modern global ocean circulation system, likened to a conveyor belt, deep-water masses, which are formed in the sub- polar North Atlantic and in the circum-Antarctic, ventilate the entire deep ocean, while surface currents return... heat and salt meridionally and between different ocean basins, directly affecting regional climate (e.g. Gulf Stream in the Atlantic, El Nino in the Pacific) and may modulate deep-water formation rates. The deep ocean is the largest dynamic...

  5. Circulating tumor cells in newly diagnosed inflammatory breast cancer


    Mego, Michal; Giordano, Antonio; De Giorgi, Ugo; Masuda, Hiroko; Hsu, Limin; Giuliano, Mario; Fouad, Tamer M.; Dawood, Shaheenah; Ueno, Naoto T.; Valero, Vicente; Andreopoulou, Eleni; Alvarez, Ricardo H.; Wendy A Woodward; Hortobagyi, Gabriel N; Cristofanilli, Massimo


    Introduction Circulating tumor cells (CTCs) are an independent prognostic factor for progression-free survival (PFS) and overall survival (OS) in patients with metastatic breast cancer. Inflammatory breast cancer (IBC) is one of the most aggressive forms of breast cancer. The prognostic value of a CTC count in newly diagnosed IBC has not been established. The aim of this study was to assess the prognostic value of a baseline CTC count in patients with newly diagnosed IBC. Methods This retrosp...

  6. Recombinant erythropoietin in clinical practice


    Ng, T; Marx, G.; Littlewood, T; Macdougall, I


    The introduction of recombinant human erythropoietin (RHuEPO) has revolutionised the treatment of patients with anaemia of chronic renal disease. Clinical studies have demonstrated that RHuEPO is also useful in various non-uraemic conditions including haematological and oncological disorders, prematurity, HIV infection, and perioperative therapies. Besides highlighting both the historical and functional aspects of RHuEPO, this review discusses the applications of RHuEPO in clinical practice a...

  7. Recombinant antibodies and tumor targeting


    Sheikholvaezin, Ali


    Different antibody derived constructs are rapidly advancing as putative tools for treatment of malignant diseases. Antibody engineering has added significant new technologies to modify size, affinities, solubility, stability and biodistribution properties for immunoconjugates. In the present thesis, the aim was to increase our knowledge on how new recombinant antibodies could be tailored to optimize localization to experimental tumors in mice. One hybridoma, producing the monoclonal antibody ...

  8. High-Resolution Mapping of Homologous Recombination Events in rad3 Hyper-Recombination Mutants in Yeast.

    Directory of Open Access Journals (Sweden)

    Sabrina L Andersen


    Full Text Available The Saccharomyces cerevisae RAD3 gene is the homolog of human XPD, an essential gene encoding a DNA helicase of the TFIIH complex involved in both nucleotide excision repair (NER and transcription. Some mutant alleles of RAD3 (rad3-101 and rad3-102 have partial defects in DNA repair and a strong hyper-recombination (hyper-Rec phenotype. Previous studies showed that the hyper-Rec phenotype associated with rad3-101 and rad3-102 can be explained as a consequence of persistent single-stranded DNA gaps that are converted to recombinogenic double-strand breaks (DSBs by replication. The systems previously used to characterize the hyper-Rec phenotype of rad3 strains do not detect the reciprocal products of mitotic recombination. We have further characterized these events using a system in which the reciprocal products of mitotic recombination are recovered. Both rad3-101 and rad3-102 elevate the frequency of reciprocal crossovers about 100-fold. Mapping of these events shows that three-quarters of these crossovers reflect DSBs formed at the same positions in both sister chromatids (double sister-chromatid breaks, DSCBs. The remainder reflects DSBs formed in single chromatids (single chromatid breaks, SCBs. The ratio of DSCBs to SCBs is similar to that observed for spontaneous recombination events in wild-type cells. We mapped 216 unselected genomic alterations throughout the genome including crossovers, gene conversions, deletions, and duplications. We found a significant association between the location of these recombination events and regions with elevated gamma-H2AX. In addition, there was a hotspot for deletions and duplications at the IMA2 and HXT11 genes near the left end of chromosome XV. A comparison of these data with our previous analysis of spontaneous mitotic recombination events suggests that a sub-set of spontaneous events in wild-type cells may be initiated by incomplete NER reactions, and that DSCBs, which cannot be repaired by sister

  9. Workshop on Radio Recombination Lines

    CERN Document Server


    Since their first detection 15 years ago, radio recombination lines from several elements have been observed in a wide variety of objects including HII regions, planetary nebulae, molecular clouds, the diffuse interstellar medium, and recently, other galaxies. The observations span almost the entire range from 0.1 to 100 GHz, and employ both single­ djsh and aperture synthesis techniques. The theory of radio recombination lines has also advanced strongly, to the point where it is perhaps one of the best-understood in astro­ physics. In a parallel development, it has become possible over the last decade to study these same highly-excited atoms in the laboratory; this work provides further confirmation of the theoretical framework. However there has been continuing controversy over the astrophysical interpre­ tation of radio recombination line observations, especially regarding the role of stimulated emission. A workshop was held in Ottawa on 24-25 August, 1979, bringing together many of the active scientist...

  10. Short telomeres initiate telomere recombination in primary and tumor cells.

    Directory of Open Access Journals (Sweden)

    Tammy A Morrish


    Full Text Available Human tumors that lack telomerase maintain telomeres by alternative lengthening mechanisms. Tumors can also form in telomerase-deficient mice; however, the genetic mechanism responsible for tumor growth without telomerase is unknown. In yeast, several different recombination pathways maintain telomeres in the absence of telomerase-some result in telomere maintenance with minimal effects on telomere length. To examine non-telomerase mechanisms for telomere maintenance in mammalian cells, we used primary cells and lymphomas from telomerase-deficient mice (mTR-/- and Emumyc+mTR-/- and CAST/EiJ mouse embryonic fibroblast cells. These cells were analyzed using pq-ratio analysis, telomere length distribution outliers, CO-FISH, Q-FISH, and multicolor FISH to detect subtelomeric recombination. Telomere length was maintained during long-term growth in vivo and in vitro. Long telomeres, characteristic of human ALT cells, were not observed in either late passage or mTR-/- tumor cells; instead, we observed only minimal changes in telomere length. Telomere length variation and subtelomeric recombination were frequent in cells with short telomeres, indicating that length maintenance is due to telomeric recombination. We also detected telomere length changes in primary mTR-/- cells that had short telomeres. Using mouse mTR+/- and human hTERT+/- primary cells with short telomeres, we found frequent length changes indicative of recombination. We conclude that telomere maintenance by non-telomerase mechanisms, including recombination, occurs in primary cells and is initiated by short telomeres, even in the presence of telomerase. Most intriguing, our data indicate that some non-telomerase telomere maintenance mechanisms occur without a significant increase in telomere length.

  11. A blood circulation model for reference man

    Energy Technology Data Exchange (ETDEWEB)

    Leggett, R.W.; Eckerman, K.F. [Oak Ridge National Lab., TN (United States). Health Sciences Research Div.; Williams, L.R. [Indiana Univ., South Bend, IN (United States). Div. of Liberal Arts and Sciences


    This paper describes a dynamic blood circulation model that predicts the movement and gradual dispersal of a bolus of material in the circulation after its intravascular injection into an adult human. The main purpose of the model is to improve the dosimetry of internally deposited radionuclides that decay in the circulation to a significant extent. The total blood volume is partitioned into the blood contents of 24 separate organs or tissues, right heart chambers, left heart chambers, pulmonary circulation, arterial outflow to the systemic tissues (aorta and large arteries), and venous return from the systemic tissues (large veins). As a compromise between physical reality and computational simplicity, the circulation of blood is viewed as a system of first-order transfers between blood pools, with the delay time depending on the mean transit time across the pool. The model allows consideration of incomplete, tissue-dependent extraction of material during passage through the circulation and return of material from tissues to plasma.

  12. Nondisjunction of chromosome 15: Origin and recombination

    Energy Technology Data Exchange (ETDEWEB)

    Robinson, W.P.; Bernasconi, F.; Schinzel, A.A.; Mutirangura, A.; Ledbetter, D.H. (Baylor College of Medicine, Houston, TX (United States)); Langlois, S. (Univ. of Britisch Columbia, Vancouver (Canada)); Morris, M.A.; Malcolm, S.


    Thirty-two cases of uniparental disomy (UPD), ascertained from Prader-Willi syndrome patients (N=27) and Angelman syndrome patients (N-5), are used to investigate the pattern of recombination associated with nondisjunction of chromosome 15. In addition, the meiotic stage of nondisjunction is inferred by using markers mapping near the centromere. Two basic approaches to the analysis of recombination in specific pairwise intervals along the chromosome. This method shows a significant reduction in recombination for two of five intervals examined. Second, the observed frequency of each recombinant class (i.e., zero, one, two, three, or more observable crossovers) is compared with expected values. This is useful for testing whether the reduction in recombination can be attributed solely to a proportion of cases with no recombination at all (because of asynapsis), with the remaining groups showing normal recombination (or even excess recombination), or whether recombination is uniformly reduced. Analysis of maternal UPD(15) data shows a slight reduction in the multiple-recombinant classes, with a corresponding increase in both the zero- and one-recombinant classes over expected values. The majority, more than 82%, of the extra chromosomes in maternal UPD(15) cases are due to meiotic I nondisjunction events. In contrast, more paternal UPD(15) cases so far examined appear to have a postzygotic origin of the extra paternal chromosome. 33 refs., 1 fig., 7 tabs.

  13. Circulation of Venus upper mesosphere. (United States)

    Zasova, Ludmila; Gorinov, Dmitry; Shakun, Alexey; Altieri, Francesca; Migliorini, Alessandra; Piccioni, Giuseppe; Drossart, Pierre


    Observation of the O2 1.27 μm airglow intensity distribution on the night side of Venus is one of the methods of study of the circulation in upper mesosphere 90-100 km. VIRTIS-M on board Venus Express made these observations in nadir and limb modes in Southern and Northern hemispheres respectively. Global map of the O2 night glow is published (Piccioni et al. 2009). In this work we use for analysis only data, obtained with exposure > 3 s to avoid high noisy data. It was found that intensity of emission decreases to poles and to terminators (similar to Piccioni et al.2009) in both hemispheres, which gives evidence for existence of SS-AS circulation with transport of the air masses through poles and terminators with ascending/descending flows at SS/AS areas. However, asymmetry of distribution of intensity of airglow is observed in both hemispheres. Global map for southern hemisphere (from nadir data) has good statistics at φ > 10-20° S and pretty poor at low latitude. Maximum emission is shifted from midnight by 1 - 2 hours to the evening (22-23h) and deep minimum of emission is found at LT=2-4 h at φ > 20° S. This asymmetry is extended up to equatorial region, however statistic is poor there. No evident indication for existence of the Retrograde Zonal Superrotation (RZS) is found: maximum emission in this case, which is resulting from downwards flow, should be shifted to the morning. The thermal tides, gravity waves are evidently influence on the night airglow distribution. VIRTIS limb observations cover the low northern latitudes and they are more sparse at higher latitudes. Intensity of airglow at φ = 0 - 20° N shows wide maximum, which is shifted by 1- 2 h from midnight to morning terminator. This obviously indicates that observed O2 night glow distribution in low North latitudes is explained by a superposition of SS-AS flow and RZS circulation at 95-100 km. This behavior is similar to the NO intensity distribution, obtained by SPICAV.

  14. Linear thermal circulator based on Coriolis forces. (United States)

    Li, Huanan; Kottos, Tsampikos


    We show that the presence of a Coriolis force in a rotating linear lattice imposes a nonreciprocal propagation of the phononic heat carriers. Using this effect we propose the concept of Coriolis linear thermal circulator which can control the circulation of a heat current. A simple model of three coupled harmonic masses on a rotating platform permits us to demonstrate giant circulating rectification effects for moderate values of the angular velocities of the platform.

  15. The Ten Relationships in Rural Land Circulation


    Cai, Zhirong; Ren, Shuo; Zhang, Zhigang


    The ten relationships during land circulation are discussed. Among them, the relationship between peasant household and government indicates that government should only carry out its service and regulatory functions and farmers should be the main body of land circulation, because peasants usually have no discourse power during land circulation. In the relationship between land ownership and contracting management right, we mainly discuss the transfer of land contracting management right and p...

  16. Recombinant Enzyme Replacement Therapy in Hypophosphatasia. (United States)

    Hofmann, Christine; Jakob, Franz; Seefried, Lothar; Mentrup, Birgit; Graser, Stephanie; Plotkin, Horacio; Girschick, Hermann J; Liese, Johannes


    Hypophosphatasia (HPP) is a rare monogenetic and multisystemic disease with involvement of different organs, including bone, muscle, kidney, lung, gastrointestinal tract and the nervous system. The exact metabolic mechanisms of the effects of TNAP deficiency in different tissues are not understood in detail. There is no approved specific treatment for HPP; therefore symptomatic treatment in order to improve the clinical features is of major interest. Enzyme replacement therapy (ERT) is a relatively new type of treatment based on the principle of administering a medical treatment replacing a defective or absent enzyme. Recently ERT with a bone targeted recombinant human TNAP molecule has been reported to be efficient in ten severely affected patients and improved survival of life threatening forms. These results are very promising especially with regard to the skeletal phenotype but it is unclear whether ERT also has beneficial effects for craniosynostosis and in other affected tissues in HPP such as brain and kidney. Long-term data are not yet available and further systematic clinical trials are needed. It is also necessary to establish therapeutic approaches to help patients who are affected by less severe forms of HPP but also suffer from a significant reduction in quality of life. Further basic research on TNAP function and role in different tissues and on its physiological substrates is critical to gain a better insight in the pathogenesis in HPP. This and further experiences in new therapeutic strategies may improve the prognosis and quality of life of patients with all forms of HPP.

  17. Tumor-derived circulating endothelial cell clusters in colorectal cancer.

    KAUST Repository

    Cima, Igor


    Clusters of tumor cells are often observed in the blood of cancer patients. These structures have been described as malignant entities for more than 50 years, although their comprehensive characterization is lacking. Contrary to current consensus, we demonstrate that a discrete population of circulating cell clusters isolated from the blood of colorectal cancer patients are not cancerous but consist of tumor-derived endothelial cells. These clusters express both epithelial and mesenchymal markers, consistent with previous reports on circulating tumor cell (CTC) phenotyping. However, unlike CTCs, they do not mirror the genetic variations of matched tumors. Transcriptomic analysis of single clusters revealed that these structures exhibit an endothelial phenotype and can be traced back to the tumor endothelium. Further results show that tumor-derived endothelial clusters do not form by coagulation or by outgrowth of single circulating endothelial cells, supporting a direct release of clusters from the tumor vasculature. The isolation and enumeration of these benign clusters distinguished healthy volunteers from treatment-naïve as well as pathological early-stage (≤IIA) colorectal cancer patients with high accuracy, suggesting that tumor-derived circulating endothelial cell clusters could be used as a means of noninvasive screening for colorectal cancer. In contrast to CTCs, tumor-derived endothelial cell clusters may also provide important information about the underlying tumor vasculature at the time of diagnosis, during treatment, and throughout the course of the disease.

  18. Numerical Study of the Effects of Topography and Urbanization on the Local Atmospheric Circulations over the Beijing-Tianjin-Hebei, China

    Directory of Open Access Journals (Sweden)

    Yucong Miao


    Full Text Available The effects of the topography and urbanization on the local atmospheric circulations over the Beijing-Tianjin-Hebei (BTH region were studied by the weather research and forecasting (WRF model, as well as the interactions among these local atmospheric circulations. It was found that, in the summer day time, the multiscale thermally induced local atmospheric circulations may exist and interact in the same time over the BTH region; the topography played a role in the strengthening of the sea breeze circulations; after sunset, the inland progress of sea breeze was slowed down by the opposite mountain breeze; when the land breeze circulation dominated the Bohai bay, the mountain breeze circulation can couple with the land breeze circulation to form a large circulation ranging from the coastline to the mountains. And the presence of cities cannot change the general state of the sea-land breeze (SLB circulation and mountain-valley breeze (MVB circulation but acted to modify these local circulations slightly. Meanwhile, the development of the urban heat island (UHI circulation was also strongly influenced by the nearby SLB circulation and MVB circulation.

  19. The aerodynamics of circulation control (United States)

    Wood, N. J.


    Two dimensional subsonic wind tunnel tests were conducted on a 20% thickness: chord ratio circulation controlled elliptic aerofoil section equipped with forward and reverse blowing slots. Overall performance measurements were made over a range of trailing edge blowing momentum coefficients from 0 to 0.04; some included the effect of leading edge blowing. A detailed investigation of the trailing edge wall jet, using split film probes, hot wire probes and total head tubes, provided measurements of mean velocity components, Reynolds normal and shear stresses, and radial static pressure. The closure of the two dimensional angular momentum and continuity equations was examined using the measured data, with and without correction, and the difficulty of obtaining a satisfactory solution illustrated. Suggestions regarding the nature of the flow field which should aid the understanding of Coanda effect and the theoretical solution of highly curved wall jet flows are presented.

  20. Irregular Labellings of Circulant Graphs


    Anholcer, Marcin


    We investigate the \\textit{irregularity strength} ($s(G)$) and \\textit{total vertex irregularity strength} ($tvs(G)$) of circulant graphs $Ci_n(1,2,...,k)$ and prove that $tvs(Ci_n(1,2,...,k))=\\lceil\\frac{n+2k}{2k+1}\\rceil$, while $s(Ci_n(1,2,...,k))=\\lceil\\frac{n+2k-1}{2k}\\rceil$ except the case when $(n \\bmod 4k = 2k+1 \\wedge k\\bmod 2=1) \\vee n=2k+1$ and $s(Ci_n(1,2,...,k))=\\lceil\\frac{n+2k-1}{2k}\\rceil+1$.

  1. Inflammatory response and extracorporeal circulation. (United States)

    Kraft, Florian; Schmidt, Christoph; Van Aken, Hugo; Zarbock, Alexander


    Patients undergoing cardiac surgery with extracorporeal circulation (EC) frequently develop a systemic inflammatory response syndrome. Surgical trauma, ischaemia-reperfusion injury, endotoxaemia and blood contact to nonendothelial circuit compounds promote the activation of coagulation pathways, complement factors and a cellular immune response. This review discusses the multiple pathways leading to endothelial cell activation, neutrophil recruitment and production of reactive oxygen species and nitric oxide. All these factors may induce cellular damage and subsequent organ injury. Multiple organ dysfunction after cardiac surgery with EC is associated with an increased morbidity and mortality. In addition to the pathogenesis of organ dysfunction after EC, this review deals with different therapeutic interventions aiming to alleviate the inflammatory response and consequently multiple organ dysfunction after cardiac surgery. PMID:26060024

  2. Role of Circulating Fibrocytes in Cardiac Fibrosis

    Institute of Scientific and Technical Information of China (English)

    Rong-Jie Lin; Zi-Zhuo Su; Shu-Min Liang; Yu-Yang Chen; Xiao-Rong Shu; Ru-Qiong Nie; Jing-Feng Wang


    Objective: It is revealed that circulating fibrocytes are elevated in patients/animals with cardiac fibrosis, and this review aims to provide an introduction to circulating fibrocytes and their role in cardiac fibrosis.Data Sources: This review is based on the data from 1994 to present obtained from PubMed.The search terms were "circulating fibrocytes" and "cardiac fibrosis".Study Selection: Articles and critical reviews, which are related to circulating fibrocytes and cardiac fibrosis, were selected.Results: Circulating fibrocytes, which are derived from hematopoietic stem cells, represent a subset of peripheral blood mononuclear cells exhibiting mixed morphological and molecular characteristics ofhematopoietic and mesenchymal cells (CD34+/CD45+/collagen I+).They can produce extracellular matrix and many cytokines.It is shown that circulating fibrocytes participate in many fibrotic diseases, including cardiac fibrosis.Evidence accumulated in recent years shows that aging individuals and patients with hypertension, heart failure, coronary heart disease, and atrial fibrillation have more circulating fibrocytes in peripheral blood and/or heart tissue, and this elevation of circulating fibrocytes is correlated with the degree of fibrosis in the hearts.Conclusions: Circulating fibrocytes are effector cells in cardiac fibrosis.

  3. The Rank of Integral Circulant Graphs

    Institute of Scientific and Technical Information of China (English)

    ZHOU Hou-qing


    A graph is called an integral graph if it has an integral spectrum i.e., all eigen-values are integers. A graph is called circulant graph if it is Cayley graph on the circulant group, i.e., its adjacency matrix is circulant. The rank of a graph is defined to be the rank of its adjacency matrix. This importance of the rank, due to applications in physics, chemistry and combinatorics. In this paper, using Ramanujan sums, we study the rank of integral circulant graphs and gave some simple computational formulas for the rank and provide an example which shows the formula is sharp.

  4. A brief etymology of the collateral circulation. (United States)

    Faber, James E; Chilian, William M; Deindl, Elisabeth; van Royen, Niels; Simons, Michael


    It is well known that the protective capacity of the collateral circulation falls short in many individuals with ischemic disease of the heart, brain, and lower extremities. In the past 15 years, opportunities created by molecular and genetic tools, together with disappointing outcomes in many angiogenic trials, have led to a significant increase in the number of studies that focus on: understanding the basic biology of the collateral circulation; identifying the mechanisms that limit the collateral circulation's capacity in many individuals; devising methods to measure collateral extent, which has been found to vary widely among individuals; and developing treatments to increase collateral blood flow in obstructive disease. Unfortunately, accompanying this increase in reports has been a proliferation of vague terms used to describe the disposition and behavior of this unique circulation, as well as the increasing misuse of well-ensconced ones by new (and old) students of collateral circulation. With this in mind, we provide a brief glossary of readily understandable terms to denote the formation, adaptive growth, and maladaptive rarefaction of collateral circulation. We also propose terminology for several newly discovered processes that occur in the collateral circulation. Finally, we include terms used to describe vessels that are sometimes confused with collaterals, as well as terms describing processes active in the general arterial-venous circulation when ischemic conditions engage the collateral circulation. We hope this brief review will help unify the terminology used in collateral research.

  5. Improvement of Classification of Enterprise Circulating Funds

    Directory of Open Access Journals (Sweden)

    Rohanova Hanna O.


    Full Text Available The goal of the article lies in revelation of possibilities of increase of efficiency of managing enterprise circulating funds by means of improvement of their classification features. Having analysed approaches of many economists to classification of enterprise circulating funds, systemised and supplementing them, the article offers grouping classification features of enterprise circulating funds. In the result of the study the article offers an expanded classification of circulating funds, which clearly shows the role of circulating funds in managing enterprise finance and economy in general. The article supplements and groups classification features of enterprise circulating funds by: the organisation level, functioning character, sources of formation and their cost, and level of management efficiency. The article shows that the provided grouping of classification features of circulating funds allows exerting all-sided and purposeful influence upon indicators of efficiency of circulating funds functioning and facilitates their rational management in general. The prospect of further studies in this direction is identification of the level of attraction of loan resources by production enterprises for financing circulating funds.

  6. Circulating omentin concentration increases after weight loss

    Directory of Open Access Journals (Sweden)

    Ricart Wifredo


    Full Text Available Abstract Background Omentin-1 is a novel adipokine expressed in visceral adipose tissue and negatively associated with insulin resistance and obesity. We aimed to study the effects of weight loss-induced improved insulin sensitivity on circulating omentin concentrations. Methods Circulating omentin-1 (ELISA concentration in association with metabolic variables was measured in 35 obese subjects (18 men, 17 women before and after hypocaloric weight loss. Results Baseline circulating omentin-1 concentrations correlated negatively with BMI (r = -0.58, p Conclusion As previously described with adiponectin, circulating omentin-1 concentrations increase after weight loss-induced improvement of insulin sensitivity.

  7. Proton to pion ratio at RHIC from dynamical quark recombination

    CERN Document Server

    Ayala, Alejandro; Paic, Guy; Toledo-Sanchez, Genaro


    We propose an scenario to study, from a dynamical point of view, the thermal recombination of quarks in the midsts of a relativistic heavy-ion collision. We coin the term dynamical quark recombination to refer to the process of quark-antiquark and three-quark clustering, to form mesons and baryons, respectively, as a function of energy density. Using the string-flip model we show that the probabilities to form such clusters differ. We apply these ideas to the calculation of the proton and pion spectra in a Bjorken-like scenario that incorporates the evolution of these probabilities with proper time and compute the proton to pion ratio, comparing to recent RHIC data at the highest energy. We show that for a standard choice of parameters, this ratio reaches one, though the maximum is very sensitive to the initial evolution proper time.

  8. Expression, purification, and immobilization of recombinant tamavidin 2 fusion proteins. (United States)

    Takakura, Yoshimitsu; Oka, Naomi; Tsunashima, Masako


    Tamavidin 2 is a fungal avidin-like protein that binds biotin with high affinity. Unlike avidin or streptavidin, tamavidin 2 in soluble form is produced at high levels in Escherichia coli. In this chapter, we describe a method for immobilization and purification of recombinant proteins with the use of tamavidin 2 as an affinity tag. The protein fused to tamavidin 2 is tightly immobilized and simultaneously purified on biotinylated magnetic microbeads without loss of activity. PMID:24943317

  9. Short Telomeres Initiate Telomere Recombination in Primary and Tumor Cells


    Morrish, Tammy A.; Greider, Carol W


    Human tumors that lack telomerase maintain telomeres by alternative lengthening mechanisms. Tumors can also form in telomerase-deficient mice; however, the genetic mechanism responsible for tumor growth without telomerase is unknown. In yeast, several different recombination pathways maintain telomeres in the absence of telomerase-some result in telomere maintenance with minimal effects on telomere length. To examine non-telomerase mechanisms for telomere maintenance in mammalian cells, we us...

  10. The many facets of homologous recombination at telomeres


    Clémence Claussin; Michael Chang


    The ends of linear chromosomes are capped by nucleoprotein structures called telomeres. A dysfunctional telomere may resemble a DNA double-strand break (DSB), which is a severe form of DNA damage. The presence of one DSB is sufficient to drive cell cycle arrest and cell death. Therefore cells have evolved mechanisms to repair DSBs such as homologous recombination (HR). HR-mediated repair of telomeres can lead to genome instability, a hallmark of cancer cells, wh...

  11. The roles of serum CXCL16 in circulating Tregs and gastrointestinal stromal tumor cells (United States)

    Xing, Ya-Nan; Zhang, Jun-Yan; Xu, Hui-Mian


    Gastrointestinal stromal tumors (GIST) are the most common sarcomas of the digestive system. Abnormal expression of CXCL16 and its sole receptor, CXCR6, has been demonstrated in many cancers. However, no studies have shown the relationship between CXCL16 or CXCR6 expression and GIST. In this study, we detected CXCL16 and CXCR6 expression in GIST patient samples by using immunohistochemistry analysis and Western blot analysis. Serum CXCL16 level was determined by using enzyme-linked immunosorbent assay. Circulating Tregs were isolated by using flow cytometry. MTT assay, cell cycle assay, and transwell assay were used to test the effects of recombinant CXCL16 on Tregs and GIST cells in vitro. The levels of CXCL16 and CXCR6 protein were higher in cancer tissues than in normal tissues. Serum CXCL16 level and circulating Tregs were higher in GIST patients than that in the healthy volunteers. CXCL16, CXCR6, serum CXCL16, and circulating Tregs were significantly associated with a decreased survival time of patients. Relative to control cells, high concentration recombinant CXCL16 treated Tregs and GIST cells exhibited lower proliferation and mobility rates as assessed by MTT assay and transwell assay, respectively. Taken together, CXCL16 was observed to mediate the inhibitory effects in Tregs and GIST cells, and these involved suppression of the MEK/ERK signaling pathway. PMID:27418838

  12. Intercompartmental recombination of HIV-1 contributes to env intrahost diversity and modulates viral tropism and sensitivity to entry inhibitors. (United States)

    Brown, Richard J P; Peters, Paul J; Caron, Catherine; Gonzalez-Perez, Maria Paz; Stones, Leanne; Ankghuambom, Chiambah; Pondei, Kemebradikumo; McClure, C Patrick; Alemnji, George; Taylor, Stephen; Sharp, Paul M; Clapham, Paul R; Ball, Jonathan K


    HIV-1 circulates within an infected host as a genetically heterogeneous viral population. Viral intrahost diversity is shaped by substitutional evolution and recombination. Although many studies have speculated that recombination could have a significant impact on viral phenotype, this has never been definitively demonstrated. We report here phylogenetic and subsequent phenotypic analyses of envelope genes obtained from HIV-1 populations present in different anatomical compartments. Assessment of env compartmentalization from immunologically discrete tissues was assessed utilizing a single genome amplification approach, minimizing in vitro-generated artifacts. Genetic compartmentalization of variants was frequently observed. In addition, multiple incidences of intercompartment recombination, presumably facilitated by low-level migration of virus or infected cells between different anatomic sites and coinfection of susceptible cells by genetically divergent strains, were identified. These analyses demonstrate that intercompartment recombination is a fundamental evolutionary mechanism that helps to shape HIV-1 env intrahost diversity in natural infection. Analysis of the phenotypic consequences of these recombination events showed that genetic compartmentalization often correlates with phenotypic compartmentalization and that intercompartment recombination results in phenotype modulation. This represents definitive proof that recombination can generate novel combinations of phenotypic traits which differ subtly from those of parental strains, an important phenomenon that may have an impact on antiviral therapy and contribute to HIV-1 persistence in vivo. PMID:21471230

  13. A thermal hydraulic analysis model for catalytic hydrogen recombiners in the containment vessel of a BWR

    Energy Technology Data Exchange (ETDEWEB)

    Fujii, Tadashi; Fujimoto, Kiyoshi [Power and Industrial Systems Rand D Division, Hitachi LTD., HItachi Ibaraki (Japan); Yamanari, Shouzou; Yoshinari, Yasuo


    Passive catalytic recombiners have been developed as a safety system to lower flammable gases concentrations in a nuclear power plant accident. Passive catalytic recombiners are of very simple construction and free of active components, which hold the promise of better plant economy, maintainability and reliability. In evaluation of the performance of the recombiners, the clarification of the diffusion and mixing behaviors of flammable gases in the primary containment vessel (PCV) is desirable. The diffusion/mixing behaviors of flammable gases are affected by natural circulation flow induced by the exothermic reaction of the recombiner, forced flow due to the PCV spray and interference by the obstacles in the PCV (such as pipings and components). As an analytical tool to deal with thermal hydraulic behaviors for passive catalytic recombiners, the authors have studied applicability of a three-dimensional analysis code. From the viewpoint of analytical capabilities, the authors selected the STAR-CD code. This paper describes the applicability of the code, including verification analysis and preliminary evaluation for a BWR plant. (author)

  14. Bacteriophage recombination systems and biotechnical applications. (United States)

    Nafissi, Nafiseh; Slavcev, Roderick


    Bacteriophage recombination systems have been widely used in biotechnology for modifying prokaryotic species, for creating transgenic animals and plants, and more recently, for human cell gene manipulation. In contrast to homologous recombination, which benefits from the endogenous recombination machinery of the cell, site-specific recombination requires an exogenous source of recombinase in mammalian cells. The mechanism of bacteriophage evolution and their coexistence with bacterial cells has become a point of interest ever since bacterial viruses' life cycles were first explored. Phage recombinases have already been exploited as valuable genetic tools and new phage enzymes, and their potential application to genetic engineering and genome manipulation, vectorology, and generation of new transgene delivery vectors, and cell therapy are attractive areas of research that continue to be investigated. The significance and role of phage recombination systems in biotechnology is reviewed in this paper, with specific focus on homologous and site-specific recombination conferred by the coli phages, λ, and N15, the integrase from the Streptomyces phage, ΦC31, the recombination system of phage P1, and the recently characterized recombination functions of Yersinia phage, PY54. Key steps of the molecular mechanisms involving phage recombination functions and their application to molecular engineering, our novel exploitations of the PY54-derived recombination system, and its application to the development of new DNA vectors are discussed.

  15. Bacteriophage recombination systems and biotechnical applications. (United States)

    Nafissi, Nafiseh; Slavcev, Roderick


    Bacteriophage recombination systems have been widely used in biotechnology for modifying prokaryotic species, for creating transgenic animals and plants, and more recently, for human cell gene manipulation. In contrast to homologous recombination, which benefits from the endogenous recombination machinery of the cell, site-specific recombination requires an exogenous source of recombinase in mammalian cells. The mechanism of bacteriophage evolution and their coexistence with bacterial cells has become a point of interest ever since bacterial viruses' life cycles were first explored. Phage recombinases have already been exploited as valuable genetic tools and new phage enzymes, and their potential application to genetic engineering and genome manipulation, vectorology, and generation of new transgene delivery vectors, and cell therapy are attractive areas of research that continue to be investigated. The significance and role of phage recombination systems in biotechnology is reviewed in this paper, with specific focus on homologous and site-specific recombination conferred by the coli phages, λ, and N15, the integrase from the Streptomyces phage, ΦC31, the recombination system of phage P1, and the recently characterized recombination functions of Yersinia phage, PY54. Key steps of the molecular mechanisms involving phage recombination functions and their application to molecular engineering, our novel exploitations of the PY54-derived recombination system, and its application to the development of new DNA vectors are discussed. PMID:24442504

  16. The many facets of homologous recombination at telomeres

    Directory of Open Access Journals (Sweden)

    Clémence Claussin


    Full Text Available The ends of linear chromosomes are capped by nucleoprotein structures called telomeres. A dysfunctional telomere may resemble a DNA double-strand break (DSB, which is a severe form of DNA damage. The presence of one DSB is sufficient to drive cell cycle arrest and cell death. Therefore cells have evolved mechanisms to repair DSBs such as homologous recombination (HR. HR-mediated repair of telomeres can lead to genome instability, a hallmark of cancer cells, which is why such repair is normally inhibited. However, some HR-mediated processes are required for proper telomere function. The need for some recombination activities at telomeres but not others necessitates careful and complex regulation, defects in which can lead to catastrophic consequences. Furthermore, some cell types can maintain telomeres via telomerase-independent, recombination-mediated mechanisms. In humans, these mechanisms are called alternative lengthening of telomeres (ALT and are used in a subset of human cancer cells. In this review, we summarize the different recombination activities occurring at telomeres and discuss how they are regulated. Much of the current knowledge is derived from work using yeast models, which is the focus of this review, but relevant studies in mammals are also included.

  17. CRMAGE: CRISPR Optimized MAGE Recombineering

    DEFF Research Database (Denmark)

    Ronda, Carlotta; Pedersen, Lasse Ebdrup; Sommer, Morten Otto Alexander;


    A bottleneck in metabolic engineering and systems biology approaches is the lack of efficient genome engineering technologies. Here, we combine CRISPR/Cas9 and λ Red recombineering based MAGE technology (CRMAGE) to create a highly efficient and fast method for genome engineering of Escherichia coli...... that are assembled by a USER-cloning approach enabling quick and cost efficient gRNA replacement. CRMAGE furthermore utilizes CRISPR/Cas9 for efficient plasmid curing, thereby enabling multiple engineering rounds per day. To facilitate the design process, a web-based tool was developed to predict both the λ Red...

  18. New recombinant vaccines for the prevention of meningococcal B disease

    Directory of Open Access Journals (Sweden)

    Taha MK


    Full Text Available Muhamed-Kheir Taha, Ala-Eddine DeghmaneInstitut Pasteur, Unit of Invasive Bacterial Infections and National Reference Center for Meningococci, Paris, FranceAbstract: Meningococcal disease is a life-threatening invasive infection (mainly septicemia and meningitis that occurs as epidemic or sporadic cases. The causative agent, Neisseria meningitidis or meningococcus, is a capsulated Gram-negative bacterium. Current vaccines are prepared from the capsular polysaccharides (that also determine serogroups and are available against strains of serogroups A, C, Y, and W-135 that show variable distribution worldwide. Plain polysaccharide vaccines were first used and subsequently conjugate vaccines with enhanced immunogenicity were introduced. The capsular polysaccharide of meningococcal serogroup B is poorly immunogenic due to similarity to the human neural cells adhesion molecule. Tailor-made, strain-specific vaccines have been developed to control localized and clonal outbreaks due to meningococci of serogroup B but no “universal” vaccine is yet available. This unmet medical need was recently overcome using several subcapsular proteins to allow broad range coverage of strains and to reduce the risk of escape variants due to genetic diversity of the meningococcus. Several vaccines are under development that target major or minor surface proteins. One vaccine (Bexsero®; Novartis, under registration, is a multicomponent recombinant vaccine that showed an acceptable safety profile and covers around 80% of the currently circulating serogroup B isolates. However, its reactogenicity in infants seems to be high and the long term persistence of the immune response needs to be determined. Its activity on carriage, and therefore transmission, is under evaluation. Indirect protection is expected through restricting strain circulation and acquisition. This vaccine covers the circulating strains according to the presence of the targeted antigens in the

  19. Kelvin's Canonical Circulation Theorem in Hall Magnetohydrodynamics

    CERN Document Server

    Shivamoggi, B K


    The purpose of this paper is to show that, thanks to the restoration of the legitimate connection between the current density and the plasma flow velocity in Hall magnetohydrodynamics (MHD), Kelvin's Circulation Theorem becomes valid in Hall MHD. The ion-flow velocity in the usual circulation integral is now replaced by the canonical ion-flow velocity.

  20. Recombination induced by triple-helix-targeted DNA damage in mammalian cells.


    Faruqi, A F; Seidman, M M; Segal, D J; Carroll, D; Glazer, P M


    Gene therapy has been hindered by the low frequency of homologous recombination in mammalian cells. To stimulate recombination, we investigated the use of triple-helix-forming oligonucleotides (TFOs) to target DNA damage to a selected site within cells. By treating cells with TFOs linked to psoralen, recombination was induced within a simian virus 40 vector carrying two mutant copies of the supF tRNA reporter gene. Gene conversion events, as well as mutations at the target site, were also obs...

  1. 14C-age tracers in global ocean circulation models (United States)

    Koeve, W.; Wagner, H.; Kähler, P.; Oschlies, A.


    The natural abundance of 14C in total CO2 dissolved in seawater (DIC) is a property applied to evaluate the water age structure and circulation in the ocean and in ocean models. In this study we use three different representations of the global ocean circulation augmented with a suite of idealised tracers to study the potential and limitations of using natural 14C to determine water age, which is the time elapsed since a body of water has been in contact with the atmosphere. We find that, globally, bulk 14C-age is dominated by two equally important components, one associated with ageing, i.e. the time component of circulation, and one associated with a "preformed 14C-age". The latter quantity exists because of the slow and incomplete atmosphere-ocean equilibration of 14C particularly in high latitudes where many water masses form. In the ocean's interior, preformed 14C-age behaves like a passive tracer. The relative contribution of the preformed component to bulk 14C-age varies regionally within a given model, but also between models. Regional variability in the Atlantic Ocean is associated with the mixing of waters with very different end members of preformed 14C-age. Here, variations in the preformed component over space and time mask the circulation component to an extent that its patterns are not detectable from bulk 14C-age. Between models, the variability of preformed 14C-age can also be considerable (factor of 2), related to the combination of physical model parameters, which influence circulation dynamics or gas exchange. The preformed component was found to be very sensitive to gas exchange and moderately sensitive to ice cover. In our model evaluation, the choice of the gas-exchange constant from within the currently accepted range of uncertainty had such a strong influence on preformed and bulk 14C-age that if model evaluation would be based on bulk 14C-age, it could easily impair the evaluation and tuning of a model's circulation on global and regional

  2. 14C-age tracers in global ocean circulation models

    Directory of Open Access Journals (Sweden)

    W. Koeve


    Full Text Available The natural abundance of 14C in total CO2 dissolved in seawater is a property applied to evaluate the water age structure and circulation in the ocean and in ocean models. In this study we use three different representations of the global ocean circulation augmented with a suite of idealised tracers to study the potential and limitations of using natural 14C to determine water age, the time elapsed since a body of water had contact with the atmosphere. We find that, globally, bulk 14C-age is dominated by two equally important components, one associated with aging, i.e. the time component of circulation and one associated with a "preformed 14C-age". This latter quantity exists because of the slow and incomplete atmosphere/ocean equilibration of 14C in particular in high latitudes where many water masses form. The relative contribution of the preformed component to bulk 14C-age varies regionally within a given model, but also between models. Regional variability, e.g. in the Atlantic Ocean is associated with the mixing of waters with very different end members of preformed 14C-age. In the Atlantic, variations in the preformed component over space and time mask the circulation component to an extent that its patterns are not detectable from bulk 14C-age alone. Between models the variability of age can also be considerable (factor of 2, related to the combinations of physical model parameters, which influence circulation dynamics, and gas exchange in the models. The preformed component was found to be very sensitive to gas exchange and moderately sensitive to ice cover. In our model evaluation exercise, the choice of the gas exchange constant from within the current range of uncertainty had such a strong influence on preformed and bulk 14C-age that if model evaluation would be based on bulk 14C-age it could easily impair the evaluation and tuning of a models circulation on global and regional scales. Based on the results of this study, we propose

  3. Cosmic Forms

    CERN Document Server

    Kleman, Maurice


    The continuous 1D defects of an isotropic homogeneous material in an Euclidean 3D space are classified by a construction method, the Volterra process (VP). We employ the same method to classify the continuous 2D defects (which we call \\textit{cosmic forms}) of a vacuum in a 4D maximally symmetric spacetime. These defects fall into three different classes: i)- $m$-forms, akin to 3D space disclinations, related to ordinary rotations and analogous to Kibble's global cosmic strings (except that being continuous any deficit angle is allowed); ii)- $t$-forms, related to Lorentz boosts (hyperbolic rotations); iii)- $r$-forms, never been considered so far, related to null rotations. A detailed account of their metrics is presented. Their inner structure in many cases appears as a non-singular \\textit{core} separated from the outer part by a timelike hypersurface with distributional curvature and/or torsion, yielding new types of geometrical interactions with cosmic dislocations and other cosmic disclinations. Whereas...

  4. Processing of triplex-directed psoralen DNA interstrand crosslinks by recombination mechanisms


    Liu, Yaobin; Nairn, Rodney S.; Vasquez, Karen M.


    Gene targeting via homologous recombination (HR) is an important application in biotechnology and medicine. However, in mammalian cells HR is much less efficient than random integration. Triplex-forming oligonucleotides (TFOs) linked to DNA damaging agents (e.g. psoralen) can stimulate HR, providing the potential to improve gene therapy applications. To elucidate factors affecting TFO-directed psoralen interstrand crosslink (ICL)-induced recombination, we constructed a series of plasmids with...

  5. Recombination and population mosaic of a multifunctional viral gene, adeno-associated virus cap.

    Directory of Open Access Journals (Sweden)

    Yasuhiro Takeuchi

    Full Text Available Homologous recombination is a dominant force in evolution and results in genetic mosaics. To detect evidence of recombination events and assess the biological significance of genetic mosaics, genome sequences for various viral populations of reasonably large size are now available in the GenBank. We studied a multi-functional viral gene, the adeno-associated virus (AAV cap gene, which codes for three capsid proteins, VP1, VP2 and VP3. VP1-3 share a common C-terminal domain corresponding to VP3, which forms the viral core structure, while the VP1 unique N-terminal part contains an enzymatic domain with phospholipase A2 activity. Our recombinant detection program (RecI revealed five novel recombination events, four of which have their cross-over points in the N-terminal, VP1 and VP2 unique region. Comparison of phylogenetic trees for different cap gene regions confirmed discordant phylogenies for the recombinant sequences. Furthermore, differences in the phylogenetic tree structures for the VP1 unique (VP1u region and the rest of cap highlighted the mosaic nature of cap gene in the AAV population: two dominant forms of VP1u sequences were identified and these forms are linked to diverse sequences in the rest of cap gene. This observation together with the finding of frequent recombination in the VP1 and 2 unique regions suggests that this region is a recombination hot spot. Recombination events in this region preserve protein blocks of distinctive functions and contribute to convergence in VP1u and divergence of the rest of cap. Additionally the possible biological significance of two dominant VP1u forms is inferred.

  6. Recombinant equine interleukin-1β induces putative mediators of articular cartilage degradation in equine chondrocytes


    Tung, J. T.; Fenton, J. I.; Arnold, C; Alexander, L.; Yuzbasiyan-Gurkan, V.; Venta, P J; Peters, T. L.; Orth, M W; Richardson, D. W.; Caron, J P


    Interleukin-1 is considered a central mediator of cartilage loss in osteoarthritis in several species, however an equine recombinant form of this cytokine is not readily available for in vitro use in equine osteoarthritis research. Equine recombinant interleukin-1β was cloned and expressed and its effects on the expression and activity of selected chondrocytic proteins implicated in cartilage matrix degradation were characterized. Reverse transcriptase polymerase chain reaction methods were u...

  7. Comparison of 2 synthetically generated recombinant prions


    Zhang, Yi; Wang, Fei; Wang, Xinhe; Zhang, Zhihong; Xu, Yuanyuan; Yu, Guohua; Yuan, Chonggang; Ma, Jiyan


    Prion is a protein-conformation-based infectious agent causing fatal neurodegenerative diseases in humans and animals. Our previous studies revealed that in the presence of cofactors, infectious prions can be synthetically generated in vitro with bacterially expressed recombinant prion protein (PrP). Once initiated, the recombinant prion is able to propagate indefinitely via serial protein misfolding cyclic amplification (sPMCA). In this study, we compared 2 separately initiated recombinant p...

  8. How well do we understand cosmological recombination?


    Wong, Wan Yan; Moss, Adam; Scott, Douglas


    The major theoretical limitation for extracting cosmological parameters from the CMB sky lies in the precision with which we can calculate the cosmological recombination process. Uncertainty in the details of hydrogen and helium recombination could effectively increase the errors or bias the values of the cosmological parameters derived from the Planck satellite, for example. Here we modify the cosmological recombination code RECFAST by introducing one more parameter to reproduce the recent n...

  9. Role of ubiquitination in meiotic recombination repair

    Institute of Scientific and Technical Information of China (English)


    Programmed and unprogrammed double-strand breaks (DSBs) often arise from such physiological requirements as meiotic recombination, and exogenous insults, such as ionizing radiation (IR). Due to deleterious impacts on genome stability, DSBs must be appropriately processed and repaired in a regulatory manner. Recent investigations have indicated that ubiquitination is a critical factor in DNA damage response and meiotic recombination repair. This review summarizes the effects of proteins and complexes associated with ubiquitination with regard to homologous recombination (HR)-dependent DSB repair.

  10. Keynes's Lost Distinction Between Industrial and Financial Circulation of Money

    DEFF Research Database (Denmark)

    Jespersen, Jesper


    . In particular, banks should be divided into two categories: industrial or business banks, where deposits are used as means of payment (and covered by a State guarantee), and financial banks, where deposits carry an interest, but are not guaranteed by legal arrangement. This regulation would limit the...... amount of means of payment to what is required for production and trade, and would still make it possible for the central bank to pursue a flexible monetary policy. This insight can be obtained by combining monetary circuit theory and Keynes's analysis of industrial and financial circulation, as put......Although financial circulation is an important part of banks' balance sheets in the form of savings deposits, this is hardly discussed in monetary circuit theory. In this paper, we argue that monetary circuit theory would be more coherent if it were expanded to incorporate some aspects of Keynes...

  11. Transient and stability analysis in single-phase natural circulation

    Energy Technology Data Exchange (ETDEWEB)

    Mousavian, Seyed Khalil E-mail:; Misale, Mario; D' Auria, Francesco; Salehi, Mahmoud A


    This paper presents the mathematical modeling of single-phase natural circulation of the University of Genoa's rectangular loop (LOOP no. 1) by a computer program and using RELAP5 system code. The mass, momentum and energy conservation equations in transient form were solved numerically using the finite difference method. One-dimensional linear stability analysis was performed for the single-phase natural circulation loop and the numerical perturbation technique was used in this analysis. The Nyquist criterion was employed to find the stability map of the LOOP no. 1. The obtained transient results using the first order upwind scheme of the fluid temperatures in various sectors of the LOOP no. 1 are compared with the results obtained from the RELAP5 system code and available experimental data.

  12. Numerical Modeling of Ocean Circulation (United States)

    Miller, Robert N.


    The modelling of ocean circulation is important not only for its own sake, but also in terms of the prediction of weather patterns and the effects of climate change. This book introduces the basic computational techniques necessary for all models of the ocean and atmosphere, and the conditions they must satisfy. It describes the workings of ocean models, the problems that must be solved in their construction, and how to evaluate computational results. Major emphasis is placed on examining ocean models critically, and determining what they do well and what they do poorly. Numerical analysis is introduced as needed, and exercises are included to illustrate major points. Developed from notes for a course taught in physical oceanography at the College of Oceanic and Atmospheric Sciences at Oregon State University, this book is ideal for graduate students of oceanography, geophysics, climatology and atmospheric science, and researchers in oceanography and atmospheric science. Features examples and critical examination of ocean modelling and results Demonstrates the strengths and weaknesses of different approaches Includes exercises to illustrate major points and supplement mathematical and physical details

  13. Rapid purification of recombinant histones.

    Directory of Open Access Journals (Sweden)

    Henrike Klinker

    Full Text Available The development of methods to assemble nucleosomes from recombinant histones decades ago has transformed chromatin research. Nevertheless, nucleosome reconstitution remains time consuming to this day, not least because the four individual histones must be purified first. Here, we present a streamlined purification protocol of recombinant histones from bacteria. We termed this method "rapid histone purification" (RHP as it circumvents isolation of inclusion bodies and thereby cuts out the most time-consuming step of traditional purification protocols. Instead of inclusion body isolation, whole cell extracts are prepared under strongly denaturing conditions that directly solubilize inclusion bodies. By ion exchange chromatography, the histones are purified from the extracts. The protocol has been successfully applied to all four canonical Drosophila and human histones. RHP histones and histones that were purified from isolated inclusion bodies had similar purities. The different purification strategies also did not impact the quality of octamers reconstituted from these histones. We expect that the RHP protocol can be readily applied to the purification of canonical histones from other species as well as the numerous histone variants.

  14. Human Insulin from Recombinant DNA Technology (United States)

    Johnson, Irving S.


    Human insulin produced by recombinant DNA technology is the first commercial health care product derived from this technology. Work on this product was initiated before there were federal guidelines for large-scale recombinant DNA work or commercial development of recombinant DNA products. The steps taken to facilitate acceptance of large-scale work and proof of the identity and safety of such a product are described. While basic studies in recombinant DNA technology will continue to have a profound impact on research in the life sciences, commercial applications may well be controlled by economic conditions and the availability of investment capital.

  15. Genomic lineages of Rhizobium etli revealed by the extent of nucleotide polymorphisms and low recombination

    Directory of Open Access Journals (Sweden)

    González Víctor


    Full Text Available Abstract Background Most of the DNA variations found in bacterial species are in the form of single nucleotide polymorphisms (SNPs, but there is some debate regarding how much of this variation comes from mutation versus recombination. The nitrogen-fixing symbiotic bacteria Rhizobium etli is highly variable in both genomic structure and gene content. However, no previous report has provided a detailed genomic analysis of this variation at nucleotide level or the role of recombination in generating diversity in this bacterium. Here, we compared draft genomic sequences versus complete genomic sequences to obtain reliable measures of genetic diversity and then estimated the role of recombination in the generation of genomic diversity among Rhizobium etli. Results We identified high levels of DNA polymorphism in R. etli, and found that there was an average divergence of 4% to 6% among the tested strain pairs. DNA recombination events were estimated to affect 3% to 10% of the genomic sample analyzed. In most instances, the nucleotide diversity (π was greater in DNA segments with recombinant events than in non-recombinant segments. However, this degree of recombination was not sufficiently large to disrupt the congruence of the phylogenetic trees, and further evaluation of recombination in strains quartets indicated that the recombination levels in this species are proportionally low. Conclusion Our data suggest that R. etli is a species composed of separated lineages with low homologous recombination among the strains. Horizontal gene transfer, particularly via the symbiotic plasmid characteristic of this species, seems to play an important role in diversity but the lineages maintain their evolutionary cohesiveness.

  16. Genetic recombination in plant-infecting messenger-sense RNA viruses: overview and research perspectives

    Directory of Open Access Journals (Sweden)

    Jozef Julian Bujarski


    Full Text Available RNA recombination is one of the driving forces of genetic variability in (+-strand RNA viruses. Various types of RNA-RNA crossovers were described including crosses between the same or different viral RNAs or between viral and cellular RNAs. Likewise, a variety of molecular mechanisms are known to support RNA recombination, such as replicative events (based on internal or end-to-end replicase switchings along with nonreplicative joining among RNA fragments of viral and/or cellular origin. Such mechanisms as RNA decay or RNA interference are responsible for RNA fragmentation and trans-esterification reactions which are likely accountable for ligation of RNA fragments. Numerous host factors were found to affect the profiles of viral RNA recombinants and significant differences in recombination frequency were observed among various RNA viruses. Comparative analyses of viral sequences allowed for the development of evolutionary models in order to explain adaptive phenotypic changes and co-evolving sites. Many questions remain to be answered by forthcoming RNA recombination research. (i How various factors modulate the ability of viral replicase to switch templates, (ii What is the intracellular location of RNA-RNA template switchings, (iii Mechanisms and factors responsible for non-replicative RNA recombination, (iv Mechanisms of integration of RNA viral sequences with cellular genomic DNA, and (v What is the role of RNA splicing and ribozyme activity. From an evolutionary stand point, it is not known how RNA viruses parasitize new host species via recombination, nor is it obvious what the contribution of RNA recombination is among other RNA modification pathways. We do not understand why the frequency of RNA recombination varies so much among RNA viruses and the status of RNA recombination as a form of sex is not well documented.

  17. Simulation of hydrogen mitigation in catalytic recombiner. Part-II: Formulation of a CFD model

    Energy Technology Data Exchange (ETDEWEB)

    Prabhudharwadkar, Deoras M. [Department of Mechanical Engineering, Indian Institute of Technology-Bombay, Powai, Mumbai 400076 (India); Iyer, Kannan N., E-mail: [Department of Mechanical Engineering, Indian Institute of Technology-Bombay, Powai, Mumbai 400076 (India)


    Research highlights: Hydrogen transport in containment with recombiners is a multi-scale problem. A novel methodology worked out to lump the recombiner characteristics. Results obtained using commercial code FLUENT are cast in the form of correlations. Hence, coarse grids can obtain accurate distribution of H{sub 2} in containment. Satisfactory working of the methodology is clearly demonstrated. - Abstract: This paper aims at formulation of a model compatible with CFD code to simulate hydrogen distribution and mitigation using a Passive Catalytic Recombiner in the Nuclear power plant containments. The catalytic recombiner is much smaller in size compared to the containment compartments. In order to fully resolve the recombination processes during the containment simulations, it requires the geometric details of the recombiner to be modelled and a very fine mesh size inside the recombiner channels. This component when integrated with containment mixing calculations would result in a large number of mesh elements which may take large computational times to solve the problem. This paper describes a method to resolve this simulation difficulty. In this exercise, the catalytic recombiner alone was first modelled in detail using the best suited option to describe the reaction rate. A detailed parametric study was conducted, from which correlations for the heat of reaction (hence the rate of reaction) and the heat transfer coefficient were obtained. These correlations were then used to model the recombiner channels as single computational cells providing necessary volumetric sources/sinks to the energy and species transport equations. This avoids full resolution of these channels, thereby allowing larger mesh size in the recombiners. The above mentioned method was successfully validated using both steady state and transient test problems and the results indicate very satisfactory modelling of the component.

  18. Some Aspects Concerning Convective Circulation Mode of Heat Transfer in Furnace to Wood Heat Treatment


    Nadia Potoceanu


    The paper presented the most aspects of convective circulate mode of heat transfer : heat transfer through the boundary layer formed at the surface of the heat generator; heat transfer in the heat carrier and heat transfer through the boundary layer formed at the heated surface

  19. Some Aspects Concerning Convective Circulation Mode of Heat Transfer in Furnace to Wood Heat Treatment

    Directory of Open Access Journals (Sweden)

    Nadia Potoceanu


    Full Text Available The paper presented the most aspects of convective circulate mode of heat transfer : heat transfer through the boundary layer formed at the surface of the heat generator; heat transfer in the heat carrier and heat transfer through the boundary layer formed at the heated surface

  20. Mineralization of Hydroxyapatite Regulated by Recombinant Human-like Collagen

    Institute of Scientific and Technical Information of China (English)


    We reported recombinant human-like type I collagen inducing growth of hydroxyapatite crystals in vitro in the form of self-assembly of nano-fibrils of mineralized collagen resembling extracellular matrix, which obey the same rules, but is superior to the collagen derived from animal tissues because the latter may carry diseases of animals and cause immunological reactions. The mineralized collagen fibrils aligned parallel to each other to form mineralized collagen fibers. Hydroxyapatite nanocrystals grew on the surface of these collagen fibrils with the c-axis of nanocrystals of HA orienting along the longitudinal axis of the fibrils.

  1. Comparison of in vivo effects of human recombinant IL 1 and human recombinant IL 6 in mice

    International Nuclear Information System (INIS)

    IL 1 and IL 6 share a number of biological activities, including induction of fever, neutrophilia and acute phase response, and IL 1 induces IL 6 production by fibroblasts and macrophages. Therefore, it was proposed that IL 6 mediates many of the activities of IL 1. To test this hypothesis in vivo, we assessed induction of IL 6 following IL 1 alpha administration to mice and tested IL 6 for radioprotection and induction of early (CSF) and late (fibrinogen and SAA) acute phase reactants. IL 1 alpha given to mice ip induced, in a dose dependent manner, detectable IL 6 in circulation, with maximal titers at 2-4 hrs. However, unlike IL 1 which is 10-1000 ng/mouse of human recombinant IL 6 did not result in increased survival of mice following lethal irradiation. In fact, such treatment given 20 hrs before LD50/30 doses of radiation resulted in reduced survival of mice. However, IL 6 augmented the radioprotective effect of IL 1. IL 1 in doses above 10 ng/mouse induced within 2 to 6 hrs a dose dependent increase in CSF in circulation, but IL 6 did not induce detectable levels of CSF at 2, 6 and 20 hrs after administration. Administration of IL 6 to mice produced a dose dependent increase in circulating fibrinogen and SAA. Similarly, administration of IL 1 resulted in much greater increases in levels of fibrinogen and SAA. Therefore, IL 1 is a more effective inducer of fibrinogen and SAA in mice than is IL 6. Although definitive conclusions concerning the relative roles for IL 1 and IL 6 in vivo will await availability of anti IL 1 and anti-IL 6 antibodies, our data do not support the suggestion that the above IL 1 effects can be attributed solely to IL 6

  2. Ion-electron recombination in merged-beams experiments

    International Nuclear Information System (INIS)

    In the present thesis, studies of recombination processes applying the technique of merged beams of fast ions and electrons are described. The main advantage of this technique is that the low relative velocity of ions and electrons necessary for these investigations can be achieved, at the same time as the velocity of the ions relative to the molecules of the residual gas is high. The high ion velocity leads to a very low reaction cross section for the leading contribution to the background signal, the capture of electrons in collisions with residual gas molecules. The experimental technique is described, emphasizing the electron beam velocity distribution and its relation to the energy resolution of the experiments. The presentation of the process of electron cooling is aimed at introducing this process as a tool for merged-beams experiments in storage rings rather than investigating the process itself. The non-resonant process of radiative recombination for non-fully stripped ions, showing evidence of incomplete screening is presented. Experimental investigation of dielectronic recombination is presented. Results of measurements of this process for He-like ions form the Aarhus single-pass experiment and the Heidelberg storage ring experiment are compared. Recombination is reduced from being the aim of the investigation to being a tool for high-precision measurements of the lifetimes of the 1s2s 3S metastable states of HE-like ions of boron, carbon, and nitrogen, performed at the Heidelberg storage ring. The experiment is concerned with the process of dissociative recombination of molecular hydrogen ions. The discussion of this experiment emphasizes the distribution of population on the different vibrational levels of the ions in the initial state. In particular, a laser photo-dissociation technique was introduced to reduce the number of initial levels in the experiment. (EG) 24 refs

  3. Effective conductance method for the primordial recombination spectrum (United States)

    Ali-Haïmoud, Yacine


    As atoms formed for the first time during primordial recombination, they emitted bound-bound and free-bound radiation leading to spectral distortions to the cosmic microwave background. These distortions might become observable in the future with high-sensitivity spectrometers, and provide a new window into physical conditions in the early universe. The standard multilevel atom method habitually used to compute the recombination spectrum is computationally expensive, impeding a detailed quantitative exploration of the information contained in spectral distortions thus far. In this work it is shown that the emissivity in optically thin allowed transitions can be factored into a computationally expensive but cosmology-independent part and a computationally cheap, cosmology-dependent part. The slow part of the computation consists in pre-computing temperature-dependent effective “conductances,” linearly relating line or continuum intensity to departures from Saha equilibrium of the lowest-order excited states (2s and 2p), that can be seen as “voltages.” The computation of these departures from equilibrium as a function of redshift is itself very fast, thanks to the effective multilevel atom method introduced in an earlier work. With this factorization, the recurring cost of a single computation of the recombination spectrum is only a fraction of a second on a standard laptop, more than four orders of magnitude shorter than standard computations. The spectrum from helium recombination can be efficiently computed in an identical way, and a fast code computing the full primordial recombination spectrum with this method will be made publicly available soon.

  4. Interannual variability of the Adriatic Sea circulation (United States)

    Beg Paklar, Gordana; Sepic, Jadranka; Grbec, Branka; Dzoic, Tomislav; Kovac, Zarko; Ivatek-Sahdan, Stjepan


    The Regional Ocean Modeling System (ROMS) was implemented in order to reproduce interannual variability of the Adriatic Sea circulation. Simulations and model result analysis were performed for a three-year period from 1st January 2011 to 31st December 2013. ROMS model run was forced with realistic atmospheric fields obtained from meteorological model Aladin, climatological river discharges, tides and Mediterranean circulation imposed at the southern open boundary. Atmospheric forcing included momentum, heat and water fluxes calculated interactively from the Aladin surface fields during ROMS model simulations. Model results were compared with available CTD and ADCP measurements and discussed in the light of the climatological circulation and thermohaline properties of the Adriatic Sea and its coastal areas. Interannual variability in the Adriatic circulation is related to the prevailing atmospheric conditions, changes in the hydrological conditions and water mass exchange at the Otranto Strait. Basic features of the Adriatic circulation - basin-wide cyclonic circulation with several embedded smaller cyclonic gyres around main pits - are well reproduced by ROMS model. Modelled temperatures and salinities are within corresponding seasonal intervals, although measured profiles generally indicate stronger stratification than modelled ones. Summer circulation in 2011 with current reversal obtained along the eastern Adriatic coast was related to the sampling results of the early fish stages as well as to ARGO drifter movements. Simulated fields from the Adriatic scale model were used to prescribe the initial and open boundary conditions for the interannual simulation in the middle Adriatic coastal domain.

  5. Quark and gluon decay functions in QCD and recombination model

    International Nuclear Information System (INIS)

    Inclusive longitudinal-momentum distributions of pions in jets initiated by quarks and gluons are determined in perturbative QCD and recombination model. The quark and antiquark joint distributions in jets are first calculated in the leading-order approximation at high Q2. Gluons in the jets are completely converted to quark pairs. From the overall distribution q anti q pairs with definite quantum numbers then recombine to form pions. The recombination function for the process is well determined in the valon model. No adjustable parameters are involved in these calculations, and no data at low Q2 are used as phenomenological input. The result for the quark decay functions can be compared with data on e+e- annihilation, and the agreement is very good in both shape and normalization. Predictions for the gluon decay functions are presented, but they cannot yet be checked by experiments. The x and Q2 dependences of both types of decay functions have been parametrized in simple form suitable for use in theoretical and experimental applications. 17 figures, 1 table

  6. Development of CO2 circulators

    International Nuclear Information System (INIS)

    The development of the basic machine types we have supplied has not been without problems. The Windscale AGR (the prototype AGR) was a small 1.2 MW vertically up circulator with an inlet temperature of 237 deg. C (459 deg. F). Oil leakage problems occurred and were cured in the works test facility and the machine went into service with no other problems. The Horizontal 5 MW machines for Hinkley/Hunterston were not so fortunate with vibration problems, interface corrosion problems (effecting the whole reactor) and material dimensional stability problems. Oil ingress problems did not show up in test work but were later reported from site. These reports were initially exagerated due to the measuring techniques which took the operators some time to resolve. In the vertical 5 MW machines for Hartlepool and Heysham 1 there are two interesting factors, firstly a spar failure and secondly shaft axial stability. Many of the problems were due to modifications at site or our inability to model all aspects of site installation from which lessons for the future can be learned. The latest stations Torness and Heysham II incorporate these lessons. The machines have been designed with so much margin that during the resolution of the reactor control rod gag problems the machines were run continuously at 20% overload (6.3 MW). From an initial accident case of 350 deg. C inlet temperature, this increased to 458 deg. C and now stands at 585 deg. C. No modifications to the impeller were required. The site experience to date is good with no operational problems reported. (author). 4 figs

  7. Automorphic Forms

    DEFF Research Database (Denmark)

    von Essen, Flemming Brændgaard

    -functions for Hecke characters in the points 4 and 6. It is well known, that all zeros of the Eisenstein series Ek wrt. SL2(Z) in the standard fundamental domain has modulus 1. We show that this is also true for #n Ek, where # is a certain differential operator. We then proceed to study logarithms of multiplier...... systems. For automorphic forms wrt. Hecke triangle groups and Fuchsian groups with no elliptic elements and genus 0, we show that some logarithms of multiplier systems can be interpreted as a linking number. Finally we show a "twisted" version of the prime geodesics theorem, and logarithms of multiplier...

  8. Circulating miRNA and cancer diagnosis

    Institute of Scientific and Technical Information of China (English)


    miRNAs are a class of small RNA molecules with regulatory function, and play an important role in tumor development and progression. It has been demonstrated that tumor-derived miRNAs exist in the circulating nucleic acids of cancer patients. This phenomenon implies that detection of the circulating miRNA may be an effective method for non-invasive diagnosis of cancer. In this review, we summarize the applications of the circulating miRNA as biomarkers in cancer diagnosis, as well as the latest research progress in this area.

  9. Natural Circulation Performance in Nuclear Power Plants

    International Nuclear Information System (INIS)

    The present paper deals with a study of natural circulation in PWR systems, The study consists of two parts: in the first one, natural circulation in experimental facilities simulating PWR plants was analyzed. This made it possible to gather a broad data base which was assumed as a reference for the subsequent part of the research. Seven Nuclear Power Plants nodalizations and additional experimental data from ''non-PWR'' facilities have been considered in the second part of the paper. Conclusions are drawn about natural circulation capabilities derived for the seven Nuclear Power Plants nodalizations and from data base pertinent to three ''non-PWR'' facilities. (author)

  10. Thrombolysis in anterior versus posterior circulation strokes: timing of recanalization, ischemic tolerance, and other differences. (United States)

    Pagola, Jorge; Ribo, Marc; Alvarez-Sabin, José; Rubiera, Marta; Santamarina, Estevo; Maisterra, Olga; Delgado-Mederos, Raquel; Ortega, Gemma; Quintana, Manuel; Molina, Carlos A


    Previous studies have suggested a greater ischemic tolerance in posterior circulation as compared to anterior cerebral circulation. We aimed to investigate whether a differential response exists between anterior and posterior circulation strokes. Two hundred and four middle cerebral artery (MCA) patients and 28 basilar artery occlusion (BAO) patients treated with intravenous recombinant tissue plasminogen activator were included. Transcranial Doppler assessed recanalization at different time points. Patients were divided in three groups: total time of ischemia (TTI)24 hours. We calculated the percentage of recovery (admission National Institutes of Health Stroke Scale [NIHSS]- discharge NIHSS/admission NIHSS)×100. Mean time to treatment was longer in BAO patients (P=.031). Early recanalization was more frequent among MCA occlusions (41% vs 29%; P=.039); the rate of persisting occlusion at 24 hours was similar (P=.933). Clinical recovery according to TTI was similar in each group: 24 hours: BAO -44%/MCA 11% (P=.23). For each hour of ischemia MCA patients worsened 1.78% (P=.035) and BAO 1.76% (P=.421). MCA occlusions compared to BAO were independently associated with hemorrhagic transformation (OR: 8.2; P=.043). Our data do not support the theory of increased ischemic tolerance in posterior circulation. Despite longer time-to-treatment, BAO were more resistant to hemorrhagic transformations. PMID:20040010

  11. Circulation of multiple serotypes of highly divergent enterovirus C in the Xinjiang Uighur Autonomous Region of China. (United States)

    Zhang, Yong; Sun, Qiang; Cui, Hui; Yan, Dongmei; Fan, Qin; Song, Yang; Zhu, Shuangli; Li, Xiaolei; Huang, Guohong; Ji, Tianjiao; Hu, Lan; Wang, Dongyan; Yang, Qian; Xu, Wenbo


    Poliomyelitis associated with circulating vaccine-derived polioviruses (cVDPVs) is a serious public health issue in the post-eradication era, and the occurrence of recombinant cVDPVs emphasizes the need to elucidate enterovirus C (EV-C) epidemiology. Stool samples were collected from 826 healthy children in Southern Xinjiang in 2011 to investigate EV-C circulation and epidemiology. Thirty-six EV-Cs were isolated and assigned to eight EV-C serotypes by molecular serotyping, suggesting the circulation of diverse EV-Cs in Xinjiang. Phylogenetic analysis showed that the Xinjiang EV-C strains had larger variation compared to the prototype and other modern strains. Additionally, the results showed unique characteristics of Xinjiang EV-Cs, such as the cytopathicity of CV-A1 strains to RD cells; the high divergence in CV-A11, CV-A13, CV-A17, and CV-A20 strains; the divergence of Xinjiang CV-A24 from AHC-related CV-A24 variant stains distributed worldwide; and the circulation of two novel EV-C serotypes (EV-C96 and EV-C99). Evaluations of this dense and diverse EV-C ecosystem will help elucidate the processes shaping enteroviral biodiversity. This study will improve our understanding of the evolution of enteroviruses and the recombination potential between polioviruses and other EV-Cs. PMID:27642136

  12. Effective conductance method for the primordial recombination spectrum

    CERN Document Server

    Ali-Haïmoud, Yacine


    As atoms formed for the first time during primordial recombination, they emitted bound-bound and free-bound radiation leading to spectral distortions to the cosmic microwave background. These distortions might become observable in the future with high-sensitivity spectrometers, and provide a new window into physical conditions in the early universe. The standard multilevel atom method habitually used to compute the recombination spectrum is computationally expensive, impeding a detailed quantitative exploration of the information contained in spectral distortions thus far. In this work it is shown that the emissivity in optically thin allowed transitions can be factored into a computationally expensive but cosmology-independent part and a computationally cheap, cosmology-dependent part. The slow part of the computation consists in pre-computing temperature-dependent effective "conductances", linearly relating line or continuum intensity to departures from Saha equilibrium of the lowest-order excited states (2...

  13. Transgenic Expression of the Recombinant Phytase in Rice (Oryza sativa)

    Institute of Scientific and Technical Information of China (English)

    LIU Qiao-quan; LI Qian-feng; JIANG Li; ZHANG Da-jiang; WANG Hong-mei; GU Ming-hong; YAO Quan-hong


    In most of the cereal crop, phytic acid is the main storage form of phosphorus, which can decrease the bioavailability of phosphate. Transgenic expression of phytase is regarded as an efficient way to release phosphate from phytate in transgenic plants.In this study, a plant expression vector, containing the recombinant phytase gene driven by the maize ubiquitin (Ubi) promoter was constructed and introduced into an elite rice variety via Agrobacterium-mediated transformation. During the experiment, a total of 15 independent transgenic rice lines were regenerated. The results of PCR and Southern blot indicated that the target gene was integrated into the genome of transgenic rice plants. Moreover, the RT-PCR analysis of total RNAs extracted from the immature seeds of several transgenic lines showed that the recombinant phytase gene could be normally expressed. The inorganic phosphorus content, both in the mature seeds and the leaf was significantly higher in the transgenic plants than in the untransformed wild type.

  14. Transfer line from the PSB to the PS (recombination)

    CERN Multimedia


    After sequential ejection of 5 bunches from each of the 4 rings of the Booster (originally 800 MeV, now 1.4 GeV), the 4 batches are brought to the same vertical level, so as to form a string of 20 bunches, filling the circumference of the PS. This vertical "recombination" is performed in the transfer line, using vertical bending magnets, septa and kickers. Here we see the section where the beam from ring 4 (the top one) is brought down to the level of ring 3, and the beam from ring 1 up to the level of ring 2. Further downstream (to the right, outside this picture), level 2 is brought up to level 3, identical to that of the PS. After this original recombination scheme, other ways of combining the 4 beams, vertically and/or longitudinally, were developed and used in operation.

  15. Heterosis and recombination effects on pig reproductive traits. (United States)

    Cassady, J P; Young, L D; Leymaster, K A


    The objective was to estimate breed, heterosis, and recombination effects on pig reproductive traits in two different four-breed composite populations. Breeds included Yorkshire, Landrace, Large White, and Chester White in Exp. 1 and Duroc, Hampshire, Pietrain, and Spot in Exp. 2. Data were recorded on purebred pigs, two-breed cross pigs, and pigs from generations F1 through F6, where F1 pigs were the first generation of a four-breed cross. Litter traits were considered a trait of the gilt. There were 868 first parity litters in Exp. 1 and 865 in Exp. 2. Direct heterosis significantly increased sow weight at 110 d of gestation and litter weight at 14 and 28 d (weaning) in both experiments. Direct heterosis significantly increased number of nipples, weight at puberty, lactation weight loss, litter size, and litter birth weight in Exp. 2. Gestation length in Exp. 1 and age at puberty in Exp. 1 and Exp. 2 were significantly decreased by direct heterosis. Maternal heterosis significantly increased age at puberty in Exp. 2 and decreased sow weight at 110 d of gestation in Exp. 1. Recombination significantly increased sow weight at 110 d of gestation and tended to increase total number born and litter birth weight in Exp. 1. Recombination significantly decreased age at puberty in Exp. 2. Litter heterosis significantly increased number of pigs at 14 and 28 d; litter weights at birth, 14, and 28 d; and tended to increase lactation weight loss in Exp. 1. Litter heterosis decreased litter size in Exp. 2. Maternal heterosis and recombination effects had a sampling correlation of -0.97 in Exp. 1 and -0.91 in Exp. 2 for number of fully formed pigs. Therefore, maternal heterosis and recombination effects were summed, and their net effect was tested. This net effect tended to increase number of nipples, lactation weight loss, and litter birth weight and significantly increased number of fully formed pigs in Exp. 1. Direct, maternal, and litter heterosis and recombination effects

  16. Titania Photocatalysis beyond Recombination: A Critical Review

    Directory of Open Access Journals (Sweden)

    Bunsho Ohtani


    Full Text Available This short review paper shows the significance of recombination of a photoexcited electron and a hole in conduction and valence bands, respectively, of a titania photocatalyst, since recombination has not yet been fully understood and has not been evaluated adequately during the past several decades of research on heterogeneous photocatalysis.

  17. Recombinant organisms for production of industrial products


    Adrio, Jose-Luis; Demain, Arnold L.


    A revolution in industrial microbiology was sparked by the discoveries of ther double-stranded structure of DNA and the development of recombinant DNA technology. Traditional industrial microbiology was merged with molecular biology to yield improved recombinant processes for the industrial production of primary and secondary metabolites, protein biopharmaceuticals and industrial enzymes. Novel genetic techniques such as metabolic engineering, combinatorial biosynthesis and molecular breeding...

  18. RNAi and heterochromatin repress centromeric meiotic recombination

    DEFF Research Database (Denmark)

    Ellermeier, Chad; Higuchi, Emily C; Phadnis, Naina;


    to genetic disabilities, including birth defects. The basis by which centromeric meiotic recombination is repressed has been largely unknown. We report here that, in fission yeast, RNAi functions and Clr4-Rik1 (histone H3 lysine 9 methyltransferase) are required for repression of centromeric recombination...

  19. Cell biology of homologous recombination in yeast

    DEFF Research Database (Denmark)

    Eckert-Boulet, Nadine Valerie; Rothstein, Rodney; Lisby, Michael


    Homologous recombination is an important pathway for error-free repair of DNA lesions, such as single- and double-strand breaks, and for rescue of collapsed replication forks. Here, we describe protocols for live cell imaging of single-lesion recombination events in the yeast Saccharomyces cerevi...

  20. Theoretic Study of CⅡ Recombination Line

    Institute of Scientific and Technical Information of China (English)

    彭永伦; 王民盛; 韩小英; 李家明


    Using the R-matrix method, we carry out theoretical calculations for recombination line λ 8794 A(3d'-3p') of CⅡ, which is important to estimate the abundances of carbon in planetary nebulae. Our calculations are based on three sets of target orbital basis, through which we elucidate the electron correlation and static polarization effects in the dielectronic recombination processes.

  1. Electron-ion recombination at low energy

    International Nuclear Information System (INIS)

    The work is based on results obtained with a merged-beams experiment. A beam of electronics with a well characterized density and energy distribution was merged with a fast, monoenergetic ion beam. Results have been obtained for radiative recombination and dielectronic recombination at low relative energies (0 to ∼70eV). The obtained energy resolution was improved by about a factor of 30. High vacuum technology was used to suppress interactions with electrons from the environments. The velocity distribution of the electron beam was determined. State-selective dielectronic-recombination measurements were performable. Recombination processes were studied. The theoretical background for radiative recombination and Kramers' theory are reviewed. The quantum mechanical result and its relation to the semiclassical theory is discussed. Radiative recombination was also measured with several different non-bare ions, and the applicability of the semiclassical theory to non-bare ions was investigated. The use of an effective charge is discussed. For dielectronic recombination, the standard theoretical approach in the isolated resonance and independent-processes approximation is debated. The applicability of this method was tested. The theory was able to reproduce most of the experimental data except when the recombination process was sensitive to couplings between different electronic configurations. The influence of external perturbing electrostatic fields is discussed. (AB) (31 refs.)

  2. Lysostaphin: use of a recombinant bactericidal enzyme as a mastitis therapeutic. (United States)

    Oldham, E R; Daley, M J


    A recombinant mucolytic protein, lysostaphin, was evaluated as a potential intramammary therapeutic for Staphylococcus aureus mastitis in dairy cattle. Lysostaphin, a product of Staphylococcus simulans, enzymatically degrades the cell wall of Staphylococcus aureus and is bactericidal. Thirty Holstein-Freisian dairy cattle in their first lactation were infected with Staphylococcus aureus (Newbould 305, ATCC 29740) in all quarters. Infections were established and monitored for somatic cell counts and Staphylococcus aureus colony-forming units 3 wk prior to subsequent treatment. Infected animals were injected through the teat canal with a single dose of recombinant lysostaphin (dose response 1 to 500 mg) or after three successive p.m. milkings with 100 mg of recombinant lysostaphin in 60 ml of sterile phosphate-buffered saline. Animals were considered cured if the milk remained free of Staphylococcus aureus for a total of 28 milkings after last treatment. Kinetic analysis of immunologically active recombinant lysostaphin demonstrated that a minimum bactericidal concentration was maintained in the milk for up to 36 to 48 h after a single infusion of 100 mg of recombinant lysostaphin. The cure rate of quarters receiving recombinant lysostaphin (100 mg in sterile phosphate-buffered saline, administered over three consecutive p.m. milkings) was 20% compared with 29% for sodium cephapirin in saline and 57% for a commercial antibiotic formulation, respectively. An improved formulation of recombinant lysostaphin may prove to be an effective alternative to antibiotic therapy for bovine mastitis.

  3. Recombination in Glomus intraradices, a supposed ancient asexual arbuscular mycorrhizal fungus

    Directory of Open Access Journals (Sweden)

    Sanders Ian R


    Full Text Available Abstract Background Arbuscular mycorrhizal fungi (AMF are important symbionts of most plant species, promoting plant diversity and productivity. This symbiosis is thought to have contributed to the early colonisation of land by plants. Morphological stasis over 400 million years and the lack of an observed sexual stage in any member of the phylum Glomeromycota led to the controversial suggestion of AMF being ancients asexuals. Evidence for recombination in AMF is contradictory. Results We addressed the question of recombination in the AMF Glomus intraradices by sequencing 11 polymorphic nuclear loci in 40 morphologically identical isolates from one field. Phylogenetic relationships among genotypes showed a reticulate network pattern providing a rationale to test for recombination. Five statistical tests predicted multiple recombinant regions in the genome of a core set of isolates. In contrast, five clonal lineages had fixed a large number of differences. Conclusion Our data show that AMF from one field have undergone recombination but that clonal lineages coexist. This finding has important consequences for understanding AMF evolution, co-evolution of AMF and plants and highlights the potential for commercially introduced AMF inoculum recombining with existing local populations. Finally, our results reconcile seemingly contradictory studies on whether AMF are clonal or form recombining populations.

  4. Contrasting roles of interallelic recombination at the HLA-A and HLA-B loci

    Energy Technology Data Exchange (ETDEWEB)

    Hughes, A.L.; Hughes, M.K. (Pennsylvania State Univ., University Park (United States)); Watkins, D.I. (Univ. of Wisconsin, Madison (United States))


    A statistical study of DNA sequences of alleles at the highly polymorphic class I MHC loci of humans, HLA-A and HLA-B, showed evidence of both large-scale recombination events(involving recombination of exons 1-2 of one allele with exons 3-8 of another) and small scale recombination events (involving apparent exchange of short DNA segments). The latter events occurred disproportionately in the region of the gene encoding the antigen recognition site (ARS) of the class I molecule. Furthermore, they involved the ARS codons which are under the strongest selection favoring allelic diversity at the amino acid level. Thus, the frequency of recombinant alleles appears to have been increased by some form of balancing selection (such as overdominant selection) favoring heterozygosity in the ARS. These analyses also revealed a striking difference between the A and B loci. Recombination events appear to have occurred about twice as frequently at the B locus, and recombinants at the B locus were significantly more likely to affect polymorphic sites in the ARS. At the A locus, there are well-defined allelic lineages that have persisted since prior to the human-chimpanzee divergence; but at the B locus, there is no evidence for such long-lasting allelic lineages. Thus, relatively frequent interallelic recombination has apparently been a feature of the long-term evolution of the B locus but not of the A locus. 45 refs., 4 figs., 5 tabs.

  5. Global warming and changes in ocean circulation

    Energy Technology Data Exchange (ETDEWEB)

    Duffy, P.B.; Caldeira, K.C.


    This final report provides an overview of the goals and accomplishments of this project. Modeling and observational work has raised the possibility that global warming may cause changes in the circulation of the ocean. If such changes would occur they could have important climatic consequences. The first technical goal of this project was to investigate some of these possible changes in ocean circulation in a quantitative way, using a state-of -the-art numerical model of the ocean. Another goal was to develop our ocean model, a detailed three-dimensional numerical model of the ocean circulation and ocean carbon cycles. A major non-technical goal was to establish LLNL as a center of excellence in modelling the ocean circulation and carbon cycle.

  6. EOP MIT General Circulation Model (MITgcm) (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This data contains a regional implementation of the Massachusetts Institute of Technology general circulation model (MITgcm) at a 1-km spatial resolution for the...

  7. Sedimentary response to ocean gateway circulation changes (United States)

    Heinze, Christoph; Crowley, Thomas J.


    Previous modeling studies suggested that changes in ocean gateways may have exerted a dramatic influence on the ocean circulation. In this pilot study we extend those results to examining the potential ramifications of circulation changes on the sedimentary record. A version of the Hamburg carbon cycle/sediment model is used in these sensitivity experiments. Results indicate that internal reorganization of the ocean circulation can potentially cause very large regional changes in lysocline depth (1500-3000 m) and opal deposition. These shifts are sometimes comparable in magnitude to those imposed by changes in external forcing (e.g., climate, sea level, and weathering). Comparisons of the model response with the geologic record indicate some significant levels of first-order agreement. This exercise suggests that opportunities now exist for physically based modeling of past sediment responses to circulation and climate changes.

  8. Presence of CRF09_cpx and complex CRF02_AG/CRF09_cpx recombinant HIV type 1 strains in Côte d'Ivoire, West Africa. (United States)

    Toni, Thomas; Adjé-Touré, Christiane; Vidal, Nicole; Minga, Albert; Huet, Charlotte; Borger, Marie-Yolande; Recordon-Pinson, Patricia; Masquelier, Bernard; Nolan, Monica; Nkengasong, John; Fleury, Hervé J; Delaporte, Eric; Peeters, Martine


    Based on partial env and pol (protease and RT) subtyping, we recently documented that the majority (>80%) of the HIV-1 strains that circulate in Côte d'Ivoire were CRF02_AG and about 11% were recombinants or could not be clearly assigned to a known subtype or CRF. In order to determine in more detail the precise structure of these viruses we sequenced the full-length genomes for six such strains. Bootscan and phylogenetic tree analysis showed that four strains were complex and unique CRF02_AG/CRF09_cpx recombinants, one was a CRF02_AG/CRF06_cpx recombinant, and one was a pure CRF09_cpx. Reanalysis of the remaining recombinants asserted the predominance of CRF09_cpx within intersubtype recombinants and circulation of CRF09_cpx in Côte d'Ivoire. More detailed analysis of the CRF09_cpx strains revealed also that part of the pol gene belonged to subtype K. This is the first time that such recombinants are described.

  9. Three-dimensional decomposition method of global atmospheric circulation

    Institute of Scientific and Technical Information of China (English)


    By adopting the idea of three-dimensional Walker, Hadley and Rossby stream functions, the global atmospheric circulation can be considered as the sum of three stream functions from a global per- spective. Therefore, a mathematical model of three-dimensional decomposition of global atmospheric circulation is proposed and the existence and uniqueness of the model are proved. Besides, the model includes a numerical method leading to no truncation error in the discrete three-dimensional grid points. Results also show that the three-dimensional stream functions exist and are unique for a given velocity field. The mathematical model shows the generalized form of three-dimensional stream func- tions equal to the velocity field in representing the features of atmospheric motion. Besides, the vertical velocity calculated through the model can represent the main characteristics of the vertical motion. In sum, the three-dimensional decomposition of atmospheric circulation is convenient for the further in- vestigation of the features of global atmospheric motions.

  10. The Atlantic Meridional Overturning Circulation's Response to Variable Buoyancy Forcing (United States)

    Butler, Edward; Oliver, Kevin; Hirschi, Joël


    The Meridional Overturning Circulation (MOC) is a large-scale global circulation of water (and heat) throughout the world's ocean. It is an integral part of the climate system, responsible for significant anomalous warming of the North Atlantic region. Much of our current understanding of the MOC is based on equilibrium theories. However, the MOC is not a steady circulation and exhibits variability across a broad range of timescales. We examine the transient response of global ocean overturning, with particular emphasis on the Atlantic MOC (AMOC), to periodic variations in the North Atlantic meridional density gradient on decadal, centennial, and millennial timescales within the Nucleus for European Modelling of the Ocean (NEMO) model framework. We use the ORCA2 global ocean configuration of NEMO (with realistic topography and a horizontal resolution of 2°) and impose periodic variations in air temperature over the North Atlantic. In response, we see large oscillations in the strength of the AMOC which peak in magnitude at 128-year timescales. A scaling relationship of the form Ψ ~ ΔρH2 (in which Δρ is a measure of meridional density gradient and H is the depth scale of maximal overturning) is found to hold for the AMOC in these transient simulations with strongest correlations observed at centennial timescales. We explore the validity of this scaling relationship across a broad range of spatial and temporal scales and discuss its validity in a global context.

  11. The Nordic Seas circulation and exchanges.


    Hawker, E.J.


    The Nordic Seas provide the main oceanic connection between the Arctic and the deep global oceans via dense overflows between Greenland and Scotland, into the North Atlantic. An understanding of the circulation and exchanges of this region is vital for any consideration of the implications of high latitude climate change to variability in the Atlantic thermohaline circulation and consequences for regional (European) climate. This thesis makes use of a unique data set of near synoptic hyd...

  12. Efficient Circulation of Railway Rolling Stock


    Alfieri, Arianna; Groot, Rutger; Kroon, Leo; Schrijver, Lex


    textabstractRailway rolling stock (locomotives, carriages, and train units) is one of the most significant cost sources for operatorsof passenger trains, both public and private. Rolling stock costsare due to material acquisition, power supply, and material maintenance. The efficient circulation of rolling stock material is therefore one of the objectives pursued. In this paper we focus on the circulation of train units on a single line. In order to utilize the train units on this line in an ...

  13. An online educational atmospheric global circulation model (United States)

    Navarro, T.; Schott, C.; Forget, F.


    As part of online courses on exoplanets of Observatoire de Paris, an online tool designed to vizualise outputs of the Laboratoire de Métérologie Dynamique (LMD) Global Circulation Model (GCM) for various atmospheric circulation regimes has been developed. It includes the possibility for students to visualize 1D and 2D plots along with animations of atmospheric quantities such as temperature, winds, surface pressure, mass flux, etc... from a state-of-the-art model.


    Institute of Scientific and Technical Information of China (English)

    Yurui Lin; Linzhang Lu


    In this paper,we present a useful result on the structures of circulant inverse Mis not a positive matrix and not equal to c0I,then A is an inverse M-matrix if and only if there exists a positive integer k,which is a proper factor of n,such that cjk>0 for The result is then extended to the so-called generalized circulant inverse M-matrices.

  15. A coupled, zonally averages atmosphere-ocean model: Variability of the thermohaline circulation

    International Nuclear Information System (INIS)

    Two experiments with a recently developed zonally averaged climate model which includes the ocean's thermohaline circulation are performed. The first experiment simulates a global thermohaline circulation in which deep water is formed in the North Atlantic, flows as a deep current into the Pacific basin and then upwells. The water is returned as a near-surface flow through the Indian Ocean into the South Atlantic. The present model reproduces a global deep circulation under present-day forcing and shows that the zonal atmospheric water vapor transport is of importance. The second experiment studies the effect of glacial meltwater runoff at different latitudes on the thermohaline circulation, meridional heat flux and surface air temperature. Depending on the strength and position of the forcing anomaly, severe cooling can be observed in high northern latitudes. The mechanism may provide further insight into the Younger Dryas climate event

  16. Vaccine escape recombinants emerge after pneumococcal vaccination in the United States.

    Directory of Open Access Journals (Sweden)

    Angela B Brueggemann


    Full Text Available The heptavalent pneumococcal conjugate vaccine (PCV7 was introduced in the United States (US in 2000 and has significantly reduced invasive pneumococcal disease; however, the incidence of nonvaccine serotype invasive disease, particularly due to serotype 19A, has increased. The serotype 19A increase can be explained in part by expansion of a genotype that has been circulating in the US prior to vaccine implementation (and other countries since at least 1990, but also by the emergence of a novel "vaccine escape recombinant" pneumococcal strain. This strain has a genotype that previously was only associated with vaccine serotype 4, but now expresses a nonvaccine serotype 19A capsule. Based on prior evidence for capsular switching by recombination at the capsular locus, the genetic event that resulted in this novel serotype/genotype combination might be identifiable from the DNA sequence of individual pneumococcal strains. Therefore, the aim of this study was to characterise the putative recombinational event(s at the capsular locus that resulted in the change from a vaccine to a nonvaccine capsular type. Sequencing the capsular locus flanking regions of 51 vaccine escape (progeny, recipient, and putative donor pneumococci revealed a 39 kb recombinational fragment, which included the capsular locus, flanking regions, and two adjacent penicillin-binding proteins, and thus resulted in a capsular switch and penicillin nonsusceptibility in a single genetic event. Since 2003, 37 such vaccine escape strains have been detected, some of which had evolved further. Furthermore, two new types of serotype 19A vaccine escape strains emerged in 2005. To our knowledge, this is the first time a single recombinational event has been documented in vivo that resulted in both a change of serotype and penicillin nonsusceptibility. Vaccine escape by genetic recombination at the capsular locus has the potential to reduce PCV7 effectiveness in the longer term.

  17. Coacervate microspheres as carriers of recombinant adenoviruses. (United States)

    Kalyanasundaram, S; Feinstein, S; Nicholson, J P; Leong, K W; Garver, R I


    The therapeutic utility of recombinant adenoviruses (rAds) is limited in part by difficulties in directing the viruses to specific sites and by the requirement for bolus administration, both of which limit the efficiency of target tissue infection. As a first step toward overcoming these limitations, rAds were encapsulated in coacervate microspheres comprised of gelatin and alginate followed by stabilization with calcium ions. Ultrastructural evaluation showed that the microspheres formed in this manner were 0.8-10 microM in diameter, with viruses evenly distributed. The microspheres achieved a sustained release of adenovirus with a nominal loss of bioactivity. The pattern of release and the total amount of virus released was modified by changes in microsphere formulation. Administration of the adenovirus-containing microspheres to human tumor nodules engrafted in mice showed that the viral transgene was transferred to the tumor cells. It is concluded that coacervate microspheres can be used to encapsulate bioactive rAd and release it in a time-dependent manner.

  18. Dielectronic Recombination In Active Galactic Nuclei (United States)

    Lukic, D. V.; Schnell, M.; Savin, D. W.; Altun, Z.; Badnell, N.; Brandau, C.; Schmidt, E. W.; Mueller, A.; Schippers, S.; Sprenger, F.; Lestinsky, M.; Wolf, A.


    XMM-Newton and Chandra observations of active galactic nuclei (AGN) show rich spectra of X-ray absorption lines. These observations have detected a broad unresolved transition array (UTA) between approx. 15-17 A. This is attributed to inner-shell photoexcitation of M-shell iron ions. Modeling these UTA features is currently limited by uncertainties in the low-temperature dielectronic recombination (DR) data for M-shell iron. In order to resolve this issue, and to provide reliable iron M-shell DR data for plasma modeling, we are carrying out a series of laboratory measurements using the heavy-ion Test Storage Ring (TSR) at the Max-Plank-Institute for Nuclear Physics in Heidelberg, Germany. Currently, laboratory measurements of low temperature DR can only be performed at storage rings. We use the DR data obtained at TSR, to calculate rate coefficients for plasma modeling and to benchmark theoretical DR calculations. Here we report our recent experimental results for DR of Fe XIV forming Fe XIII.

  19. Enceladus' Interior: A Liquid Circulation Model (United States)

    Matson, Dennis L.; Johnson, Torrence; Lunine, Jonathan; Castillo-Rogez, Julie

    We are studying a model for Enceladus' interior in which the water, gas, dust and heat are supplied to the plumes by a relatively deeply circulating brine solution. Data indicates such a source for the erupting material. On the basis of ammonia in the plume gas Waite et al. [1] suggested that the jets might originate from a liquid water region under Enceladus' icy surface. Postberg et al. [2] noted that the presence of ". . . grains that are rich in sodium salts (0.5-2 percent by mass). . . can arise only if the plumes originate from liquid water." Waite et al. [1] also regard the some of the plume chemicals as evidence for interactions with an ice layer presumably overlying the liquid water reservoir. They suggest that this could be in the form of dissociation of clathrate hydrates [3]. Additionally, there is a large heat flow of more than 15 GW [4, 5] coming out of Enceladus' south polar region. We consider a model that brings heat and chemical species up to the surface from a reservoir or "ocean" located below the ice crust that may be many tens of kilometers thick. Water transits to the surface via vertical conduits. The Cassini INMS data suggest that the water has a relatively large gas content of order a few percent. As the water travels upward and the pressure is released, exolving gases form bubbles. Since the bubbly liquid is less dense than the ice, it moves upward. (This part of the model is a variant of the "Perrier Ocean" Europa model of Crawford and Stevenson [6]. A similar model was studied for Ganymede by Murchie and Head [7].) Postberg et al. [2] model the plume eruptions that result from the water, gases, salts, and other chemicals that our circulation model provides. In the near-surface reservoir feeding the plumes, bubbles reaching the surface of the water pop and throw a very fine spray. Some of these very small droplets of brine exit with the plume gas and provide the observed salt-rich dust particles [2]. Much of the water-borne heat is

  20. Surgical myocardial revascularization without extracorporeal circulation

    Directory of Open Access Journals (Sweden)

    Salomón Soriano Ordinola Rojas


    Full Text Available OBJECTIVE: To assess the immediate postoperative period of patients undergoing myocardial revascularization without extracorporeal circulation with different types of grafts. METHODS: One hundred and twelve patients, 89 (79.5% of whom were males, were revascularized without extracorporeal circulation. Their ages ranged from 39 to 85 years. The criteria for indicating myocardial revascularization without extracorporeal circulation were as follows: revascularized coronary artery caliber > 1.5 mm, lack of intramyocardial trajectory on coronary angiography, noncalcified coronary arteries, and tolerance of the heart to the different rotation maneuvers. RESULTS: Myocardial revascularization without extracorporeal circulation was performed in 112 patients. Three were converted to extracorporeal circulation, which required a longer hospital stay but did not impact mortality. During the procedure, the following events were observed: atrial fibrillation in 10 patients, ventricular fibrillation in 4, total transient atrioventricular block in 2, ventricular extrasystoles in 58, use of a device to retrieve red blood cells in 53, blood transfusion in 8, and arterial hypotension in 89 patients. Coronary angiography was performed in 20 patients on the seventh postoperative day when the grafts were patent. CONCLUSION: Myocardial revascularization without extracorporeal circulation is a reproducible technique that is an alternative for treating ischemic heart disease.

  1. Southern Meridional Atmospheric Circulation Associated with IOD

    Institute of Scientific and Technical Information of China (English)

    LIU Na; CHEN Hongxia


    Using the monthly wind and sea surface temperature (SST) data, southern meridional atmospheric circulation cells associated with the Indian Ocean Dipole Mode (IOD) events in the Indian Ocean are for the first time described and examined. The divergent wind and pressure vertical velocity are employed for the identification of atmospheric circulation cells. During the four different phases of the positive IOD events, the anomalous meridional Hadley circulation over the western Indian Ocean shows that the air rises in the tropics, flows poleward in the upper troposphere, sinks in the subtropics, and returns back to the tropics in the lower troposphere. The anomalous Hadley circulation over the eastern Indian Ocean is opposite to that over the western Indian Ocean. During positive IOD events, the meridional Hadley circulation over the eastern Indian Ocean is weakened while it is strengthened over the western Indian Ocean. Correlation analysis between the IOD index and the indices of the Hadley cells also proves that, the atmospheric circulation patterns are evident in every IOD event over the period of record.

  2. Global climate and ocean circulation on an aquaplanet ocean-atmosphere general circulation model


    Smith, R.; Dubois, C.; Marotzke, J.


    A low-resolution coupled ocean–atmosphere general circulation model (OAGCM) is used to study the characteristics of the large-scale ocean circulation and its climatic impacts in a series of global coupled aquaplanet experiments. Three configurations, designed to produce fundamentally different ocean circulation regimes, are considered. The first has no obstruction to zonal flow, the second contains a low barrier that blocks zonal flow in the ocean at all latitudes, creating a single enclosed ...

  3. The spacing of Langmuir circulation under modest wind

    Institute of Scientific and Technical Information of China (English)

    LI Shuang; SONG Jinbao


    Spacing characteristics of Langmuir circulation (LC) are computed by large eddy simulation (LES) model under modest wind.LC is an organized vertical motion,evidenced as buoyant materials forming lines nearly parallel to the wind direction.The horizontal distribution of velocity computed by LES shows clear lines formed by LC.These lines grow and parallel to each other for a while,which we call the stable state,before they finally form Y-junctions.We computed spacing between every two parallel lines by averaging them under the stable state.Statistically,spacing results of 154 tests (seven wind speed cases of 22 test runs each) show high correlations berween spacing and wind speed,as well as mixed layer depth.The relationship of spacing and wind is important for future LC parameterization of upper-ocean mixing.

  4. Ionometric determination of chloride ion in circulating and waste waters

    Energy Technology Data Exchange (ETDEWEB)

    Bebeshko, G.I.; Afanas' eva, V.I.; Danielova, I.I.; Dmitriev, M.A.; Radchenko, A.F.


    The authors attempt to develop selective ionometric methods to determine chloride ion in waste and circulating waters from technological ore processing, containing significant amounts of sulfide ion and various flotation reagents. These waters contain practically no cations that form hard to dissolve compounds with chloride ion such as Ag/sup +/, Cu/sup +/, Hg/sup +/ or Pb/sup 2 +/. The chloride ion concentration in water varies between 10 and 100 mg/liter. Information is shown on the concentration of the main anions and flotation reagents in waters that were analyzed.

  5. Delivery of Echinococcus granulosus antigen EG95 to mice and sheep using recombinant vaccinia virus. (United States)

    Dutton, S; Fleming, S B; Ueda, N; Heath, D D; Hibma, M H; Mercer, A A


    The tapeworm Echinococcus granulosus is the causative agent of hydatid disease and affects sheep, cattle, dogs and humans worldwide. It has a two-stage life cycle existing as worms in the gut of infected dogs (definitive host) and as cysts in herbivores and humans (intermediate host). The disease is debilitating and can be life threatening where the cysts interfere with organ function. Interruption of the hydatid life cycle in the intermediate host by vaccination may be a way to control the disease, and a protective oncosphere antigen EG95 has been shown to protect animals against challenge with E. granulosus eggs. We explored the use of recombinant vaccinia virus as a delivery vehicle for EG95. Mice and sheep were immunized with the recombinant vector, and the result monitored at the circulating antibody level. In addition, sera from immunized mice were assayed for the ability to kill E. granulosus oncospheres in vitro. Mice immunized once intranasally developed effective oncosphere-killing antibody by day 42 post-infection. Antibody responses and oncosphere killing were correlated and were significantly enhanced by boosting mice with either EG95 protein or recombinant vector. Sheep antibody responses to the recombinant vector or to EG95 protein mirrored those in mice.

  6. Towards personalised therapy for von Willebrand disease: a future role for recombinant products. (United States)

    Favaloro, Emmanuel J


    von Willebrand disease (VWD) is reportedly the most common bleeding disorder and is caused by deficiencies and/or defects in the adhesive plasma protein von Willebrand factor (VWF). Functionally, normal VWF prevents bleeding by promoting both primary and secondary haemostasis. In respect to primary haemostasis, VWF binds to both platelets and sub-endothelial matrix components, especially collagen, to anchor platelets to damaged vascular tissue and promote thrombus formation. VWF also stabilises and protects factor VIII in the circulation, delivering FVIII to the site of injury, which then facilitates secondary haemostasis and fibrin formation/thrombus stabilisation. As a result of this, patients with VWD suffer a bleeding diathesis reflective of a primary defect caused by defective/deficient VWF, which in some patients is compounded by a reduction in FVIII. Management of VWD, therefore, chiefly entails replacement of VWF, and sometimes also FVIII, to protect against bleeding. The current report principally focuses on the future potential for "personalised" management of VWD, given the emerging options in recombinant therapies. Recombinant VWF has been developed and is undergoing clinical trials, and this promising therapy may soon change the way in which VWD is managed. In particular, we can envisage a personalised treatment approach using recombinant VWF, with or without recombinant FVIII, depending on the type of VWD, the extent of deficiencies, and the period and duration of treatment. PMID:27136426

  7. Complete genomic sequence analysis of infectious bronchitis virus Ark DPI strain and its evolution by recombination. (United States)

    Ammayappan, Arun; Upadhyay, Chitra; Gelb, Jack; Vakharia, Vikram N


    An infectious bronchitis virus Arkansas DPI (Ark DPI) virulent strain was sequenced, analyzed and compared with many different IBV strains and coronaviruses. The genome of Ark DPI consists of 27,620 nucleotides, excluding poly (A) tail, and comprises ten open reading frames. Comparative sequence analysis of Ark DPI with other IBV strains shows striking similarity to the Conn, Gray, JMK, and Ark 99, which were circulating during that time period. Furthermore, comparison of the Ark genome with other coronaviruses demonstrates a close relationship to turkey coronavirus. Among non-structural genes, the 5'untranslated region (UTR), 3C-like proteinase (3CLpro) and the polymerase (RdRp) sequences are 100% identical to the Gray strain. Among structural genes, S1 has 97% identity with Ark 99; S2 has 100% identity with JMK and 96% to Conn; 3b 99%, and 3C to N is 100% identical to Conn strain. Possible recombination sites were found at the intergenic region of spike gene, 3'end of S1 and 3a gene. Independent recombination events may have occurred in the entire genome of Ark DPI, involving four different IBV strains, suggesting that genomic RNA recombination may occur in any part of the genome at number of sites. Hence, we speculate that the Ark DPI strain originated from the Conn strain, but diverged and evolved independently by point mutations and recombination between field strains.

  8. Complete genomic sequence analysis of infectious bronchitis virus Ark DPI strain and its evolution by recombination

    Directory of Open Access Journals (Sweden)

    Gelb Jack


    Full Text Available Abstract An infectious bronchitis virus Arkansas DPI (Ark DPI virulent strain was sequenced, analyzed and compared with many different IBV strains and coronaviruses. The genome of Ark DPI consists of 27,620 nucleotides, excluding poly (A tail, and comprises ten open reading frames. Comparative sequence analysis of Ark DPI with other IBV strains shows striking similarity to the Conn, Gray, JMK, and Ark 99, which were circulating during that time period. Furthermore, comparison of the Ark genome with other coronaviruses demonstrates a close relationship to turkey coronavirus. Among non-structural genes, the 5'untranslated region (UTR, 3C-like proteinase (3CLpro and the polymerase (RdRp sequences are 100% identical to the Gray strain. Among structural genes, S1 has 97% identity with Ark 99; S2 has 100% identity with JMK and 96% to Conn; 3b 99%, and 3C to N is 100% identical to Conn strain. Possible recombination sites were found at the intergenic region of spike gene, 3'end of S1 and 3a gene. Independent recombination events may have occurred in the entire genome of Ark DPI, involving four different IBV strains, suggesting that genomic RNA recombination may occur in any part of the genome at number of sites. Hence, we speculate that the Ark DPI strain originated from the Conn strain, but diverged and evolved independently by point mutations and recombination between field strains.

  9. Circulation model for water circulation and purification in a water Cerenkov detector

    Institute of Scientific and Technical Information of China (English)

    LU Hao-Qi; YANG Chang-Gen; WANG Ling-Yu; XU Ji-Lei; WANG aui-Guang; WANG Zhi-Min; WANG Yi-Fang


    Owing to its low cost and good transparency, highly purified water is widely used as a medium in large water Cerenkov detector experiments. The water circulation and purification system is usually needed to keep the water in good quality. In this work, a practical circulation model is built to describe the variation of the water resistivity in the circulation process and compared with the data obtained from a prototype experiment. The successful test of the model makes it useful in the future design and optimization of the circulation/purification system.

  10. Electron Recombination in a Dense Hydrogen Plasma

    Energy Technology Data Exchange (ETDEWEB)

    Jana, M.R.; Johnstone, C.; Kobilarcik, T.; Koizumi, G.M.; Moretti, A.; Popovic, M.; Tollestrup, A.V.; Yonehara, K.; /Fermilab; Leonova, M.A.; Schwarz, T.A.; /Fermilab; Chung, M.; /Unlisted /IIT, Chicago /Fermilab /MUONS Inc., Batavia /Turin Polytechnic


    A high pressure hydrogen gas filled RF cavity was subjected to an intense proton beam to study the evolution of the beam induced plasma inside the cavity. Varying beam intensities, gas pressures and electric fields were tested. Beam induced ionized electrons load the cavity, thereby decreasing the accelerating gradient. The extent and duration of this degradation has been measured. A model of the recombination between ionized electrons and ions is presented, with the intent of producing a baseline for the physics inside such a cavity used in a muon accelerator. Analysis of the data taken during the summer of 2011 shows that self recombination takes place in pure hydrogen gas. The decay of the number of electrons in the cavity once the beam is turned off indicates self recombination rather than attachment to electronegative dopants or impurities. The cross section of electron recombination grows for larger clusters of hydrogen and so at the equilibrium of electron production and recombination in the cavity, processes involving H{sub 5}{sup +} or larger clusters must be taking place. The measured recombination rates during this time match or exceed the analytic predicted values. The accelerating gradient in the cavity recovers fully in time for the next beam pulse of a muon collider. Exactly what the recombination rate is and how much the gradient degrades during the 60 ns muon collider beam pulse will be extrapolated from data taken during the spring of 2012.

  11. Optimal Expression Condition of Recombinant RAP

    Institute of Scientific and Technical Information of China (English)

    ZHANG Jie; ZHANG Hong; BI Hao; LIU Zhiguo; GUO Jianli; QU Shen


    In order to construct the expression recombinant of human receptor associated protein (RAP), optimize its expression condition and obtain the recombinant protein after expression with high efficiency, two prokaryotic expression vectors-pT7-PL and pET-28a(+) were used to construct the expression recombinant containing RAP cDNA, and the expression efficiency of two kinds of expression E. coli of BL21 strains was compared. The effect of different induction conditions on the expression of recombinant RAP was observed. After recombinant protein was purified with Ni+-nitrilotriacetic acid (Ni+-NTA) affinity chromatogram, its binding ability with microphage was observed. The results showed that two recombinant plasmids both obtained high expression of RAP. The expression levels of RAP in plasmid pT7-PL-RAP in BL21 (DE3, plysS) strain were significantly higher than in BL21 (DE3) strain. The expression of pT7-PL-RAP in the presence of chloramphenicol was higher than in the absence of chloramphenicol, and most of the inducible expressed RAP was soluble. The RAP which was purified by Ni+-NTA resin could strongly bind with the RAW264.7 cells rich in low density lipoprotein receptor (LDLR) family receptors. It was concluded that the expression condition of recombinant RAP was optimized and functional RAP was obtained, which offered a good foundation for the further production of RAP as research tool.

  12. Recombination every day: abundant recombination in a virus during a single multi-cellular host infection.

    Directory of Open Access Journals (Sweden)

    Remy Froissart


    Full Text Available Viral recombination can dramatically impact evolution and epidemiology. In viruses, the recombination rate depends on the frequency of genetic exchange between different viral genomes within an infected host cell and on the frequency at which such co-infections occur. While the recombination rate has been recently evaluated in experimentally co-infected cell cultures for several viruses, direct quantification at the most biologically significant level, that of a host infection, is still lacking. This study fills this gap using the cauliflower mosaic virus as a model. We distributed four neutral markers along the viral genome, and co-inoculated host plants with marker-containing and wild-type viruses. The frequency of recombinant genomes was evaluated 21 d post-inoculation. On average, over 50% of viral genomes recovered after a single host infection were recombinants, clearly indicating that recombination is very frequent in this virus. Estimates of the recombination rate show that all regions of the genome are equally affected by this process. Assuming that ten viral replication cycles occurred during our experiment-based on data on the timing of coat protein detection-the per base and replication cycle recombination rate was on the order of 2 x 10(-5 to 4 x 10(-5. This first determination of a virus recombination rate during a single multi-cellular host infection indicates that recombination is very frequent in the everyday life of this virus.

  13. Recombination analysis of Soybean mosaic virus sequences reveals evidence of RNA recombination between distinct pathotypes

    Directory of Open Access Journals (Sweden)

    Babu Mohan


    Full Text Available Abstract RNA recombination is one of the two major factors that create RNA genome variability. Assessing its incidence in plant RNA viruses helps understand the formation of new isolates and evaluate the effectiveness of crop protection strategies. To search for recombination in Soybean mosaic virus (SMV, the causal agent of a worldwide seed-borne, aphid-transmitted viral soybean disease, we obtained all full-length genome sequences of SMV as well as partial sequences encoding the N-terminal most (P1 protease and the C-terminal most (capsid protein; CP viral protein. The sequences were analyzed for possible recombination events using a variety of automatic and manual recombination detection and verification approaches. Automatic scanning identified 3, 10, and 17 recombination sites in the P1, CP, and full-length sequences, respectively. Manual analyses confirmed 10 recombination sites in three full-length SMV sequences. To our knowledge, this is the first report of recombination between distinct SMV pathotypes. These data imply that different SMV pathotypes can simultaneously infect a host cell and exchange genetic materials through recombination. The high incidence of SMV recombination suggests that recombination plays an important role in SMV evolution. Obtaining additional full-length sequences will help elucidate this role.

  14. Recombination every day: abundant recombination in a virus during a single multi-cellular host infection. (United States)

    Froissart, Remy; Roze, Denis; Uzest, Marilyne; Galibert, Lionel; Blanc, Stephane; Michalakis, Yannis


    Viral recombination can dramatically impact evolution and epidemiology. In viruses, the recombination rate depends on the frequency of genetic exchange between different viral genomes within an infected host cell and on the frequency at which such co-infections occur. While the recombination rate has been recently evaluated in experimentally co-infected cell cultures for several viruses, direct quantification at the most biologically significant level, that of a host infection, is still lacking. This study fills this gap using the cauliflower mosaic virus as a model. We distributed four neutral markers along the viral genome, and co-inoculated host plants with marker-containing and wild-type viruses. The frequency of recombinant genomes was evaluated 21 d post-inoculation. On average, over 50% of viral genomes recovered after a single host infection were recombinants, clearly indicating that recombination is very frequent in this virus. Estimates of the recombination rate show that all regions of the genome are equally affected by this process. Assuming that ten viral replication cycles occurred during our experiment-based on data on the timing of coat protein detection-the per base and replication cycle recombination rate was on the order of 2 x 10(-5) to 4 x 10(-5). This first determination of a virus recombination rate during a single multi-cellular host infection indicates that recombination is very frequent in the everyday life of this virus. PMID:15737066

  15. Obtaining classical swine fever virus E2 recombinant protein and DNA-vaccine on the basis of one subunit

    International Nuclear Information System (INIS)

    Three forms of E2 recombinant protein were expressed in E. coli. Swine sera obtained against different forms of the recombinant protein were cross-studied with indirect ELISA. Using individual proteins as an antigen, only 15% of sera against other forms of protein reacted positively, while 100% of heterologous sera showed positive reaction with fused protein. Challenge experiments showed the existence of protective action only from the individual protein. Specificity and activity of sera obtained from the animals after control challenge was confirmed in a blocking variant of ELISA. Genetic construction used a eukaryotic vector that contained the E2 protein gene. Immunization of mice with the resulting DNA induced synthesis of specific antibodies, the titre of which increased considerably after additional single immunization with the E2 recombinant protein, expressed in E. coli. This demonstrated the effectiveness of animal priming by DNA vaccine, and the possibility of using the E2 recombinant protein in E. coli for booster vaccination. (author)

  16. An asymptotic sampling formula for the coalescent with Recombination

    CERN Document Server

    Jenkins, Paul A; 10.1214/09-AAP646


    Ewens sampling formula (ESF) is a one-parameter family of probability distributions with a number of intriguing combinatorial connections. This elegant closed-form formula first arose in biology as the stationary probability distribution of a sample configuration at one locus under the infinite-alleles model of mutation. Since its discovery in the early 1970s, the ESF has been used in various biological applications, and has sparked several interesting mathematical generalizations. In the population genetics community, extending the underlying random-mating model to include recombination has received much attention in the past, but no general closed-form sampling formula is currently known even for the simplest extension, that is, a model with two loci. In this paper, we show that it is possible to obtain useful closed-form results in the case the population-scaled recombination rate $\\rho$ is large but not necessarily infinite. Specifically, we consider an asymptotic expansion of the two-locus sampling formu...

  17. Manipulation of Homologous and Homoeologous Chromosome Recombination in Wheat. (United States)

    Lukaszewski, Adam J


    Given the sizes of the three genomes in wheat (A, B, and D) and a limited number of chiasmata formed in meiosis, recombination by crossing-over is a very rare event. It is also restricted to very similar homologues; the pairing homoeologous (Ph) system of wheat prevents differentiated chromosomes from pairing and crossing-over. This chapter presents an overview and describes several systems by which the frequency or density of crossing-over can be increased, both in homologues and homoeologues. It also presents the standard system of E.R. Sears for engineering alien chromosome transfers into wheat. PMID:27511168

  18. Population inversion in plasmas generated during recombination cascades. (United States)

    Pert, G J


    The collisional-radiative model for hydrogenlike ions is used to investigate the scaling of recombination at low temperatures in order to identify the necessary conditions of electron density and temperature, which will allow population inversion between the first excited state and the ground state to be developed. Numerical calculations show that at low temperatures the population growth in the hydrogenic states can be represented by similarity relations. The physical origin of these forms is presented. A table of minimum densities at which inversion will occur is given as a function of temperature for ions of arbitrary atomic number.


    Directory of Open Access Journals (Sweden)

    S. A. Pavlenko


    Full Text Available Integration of informational computer technologies allowed to reorganize and optimize some processes due to decrease of circulation of documents, unification of documentation forms and others.

  20. Genetic Analyses of Meiotic Recombination in Arabidopsis

    Institute of Scientific and Technical Information of China (English)


    Meiosis is essential for sexual reproduction and recombination is a critical step required for normal meiosis. Understanding the underlying molecular mechanisms that regulate recombination ie important for medical, agricultural and ecological reasons. Readily available molecular and cytological tools make Arabidopsis an excellent system to study meiosis. Here we review recent developments in molecular genetic analyses on meiotic recombination. These Include studies on plant homologs of yeast and animal genes, as well as novel genes that were first identified in plants. The characterizations of these genes have demonstrated essential functions from the initiation of recombination by double-strand breaks to repair of such breaks, from the formation of double-Holliday junctions to possible resolution of these junctions, both of which are critical for crossover formation. The recent advances have ushered a new era in plant meiosis, in which the combination of genetics, genomics, and molecular cytology can uncover important gene functions.

  1. Recombinant allergens: what does the future hold? (United States)

    Valenta, Rudolf; Niespodziana, Katarzyna; Focke-Tejkl, Margit; Marth, Katharina; Huber, Hans; Neubauer, Angela; Niederberger, Verena


    This year we are celebrating not only the centenary of allergen-specific immunotherapy but also the 10-year anniversary of the first administration of recombinant allergen-based vaccines to allergic patients. By using recombinant DNA technology, defined and safe allergy vaccines can be produced that allow us to overcome many, if not all, of the problems associated with the use of natural allergen extracts, such as insufficient quality, allergenic activity, and poor immunogenicity. Here we provide an update of clinical studies with recombinant allergen-based vaccines, showing that some of these vaccines have undergone successful clinical evaluation up to phase III studies. Furthermore, we introduce a strategy for allergen-specific immunotherapy based on recombinant fusion proteins consisting of viral carrier proteins and allergen-derived peptides without allergenic activity, which holds the promise of being free of side effects and eventually being useful for prophylactic vaccination.

  2. Recombinant Human Papillomavirus (HPV) Nonavalent Vaccine (United States)

    This page contains brief information about recombinant human papillomavirus (HPV) nonavalent vaccine and a collection of links to more information about the use of this vaccine, research results, and ongoing clinical trials.

  3. Recombinant Human Papillomavirus (HPV) Bivalent Vaccine (United States)

    This page contains brief information about recombinant human papillomavirus (HPV) bivalent vaccine and a collection of links to more information about the use of this vaccine, research results, and ongoing clinical trials.

  4. Recombinant Human Papillomavirus (HPV) Quadrivalent Vaccine (United States)

    This page contains brief information about recombinant human papillomavirus (HPV) quadrivalent vaccine and a collection of links to more information about the use of this vaccine, research results, and ongoing clinical trials.

  5. Regulation of Homologous Recombination by SUMOylation

    DEFF Research Database (Denmark)

    Pinela da Silva, Sonia Cristina

    factors such as the homologous recombination (HR) machinery. HR constitutes the main DSB repair pathway in Saccharomyces cerevisiae and despite being largely considered an error-free process and essential for genome stability, uncontrolled recombination can lead to loss of heterozygosity, translocations....... In this study I present new insights for the role of SUMOylation in regulating HR by dissecting the role of SUMO in the interaction between the central HR-mediator protein Rad52 and its paralogue Rad59 and the outcome of recombination. This data provides evidence for the importance of SUMO in promoting protein......-protein interactions at the sites of repair, enabling effective Rad51-mediated recombination through the concerted action of the Rad52-Rad59 complex and the helicase Srs2. In addition, I also peer into the role of Rad52 SUMOylation in the context of persistent DSBs and telomere homeostasis. Furthermore, I characterize...

  6. Recombinant human-like collagen directed growth of hydroxyapatite nanocrystals (United States)

    Zhai, Y.; Cui, F. Z.


    Bones are biocomposites with hierarchical structure that require controlled mineral deposition during their self-assembly to form tissues with unique mechanical properties. Type I collagen proteins, acidic extracellular matrix proteins, play a critical role in mineral formation and many researches on artificial bones have been made inspired by nature using type I collagen derived from animal tissues. Here we report that recombinant human-like type I collagen, an acidic protein, can direct growth of hydroxyapatite (HA) nanocrystals in vitro in the form of self-assembly of nano-fibrils of mineralized collagen resembling extracellular matrix. The mineralized collagen fibrils aligned parallel to each other to form mineralized collagen fibers. HA nanocrystals grew on the surface of these collagen fibrils with the c-axis of nanocrystals of HA orienting along the longitudinal axis of the fibrils. These artificial analogs of bone have a potential clinical application in bone repair.

  7. NAO-ocean circulation interactions in a coupled general circulation model

    Energy Technology Data Exchange (ETDEWEB)

    Bellucci, A. [Centro Euro-Mediterraneo per i Cambiamenti Climatici, Bologna (Italy); Gualdi, S.; Navarra, A. [Centro Euro-Mediterraneo per i Cambiamenti Climatici, Bologna (Italy); Istituto Nazionale di Geofisica e Vulcanologia, Bologna (Italy); Scoccimarro, E. [Istituto Nazionale di Geofisica e Vulcanologia, Bologna (Italy)


    The interplay between the North Atlantic Oscillation (NAO) and the large scale ocean circulation is inspected in a twentieth century simulation conducted with a state-of-the-art coupled general circulation model. Significant lead-lag covariance between oceanic and tropospheric variables suggests that the system supports a damped oscillatory mode involving an active ocean-atmosphere coupling, with a typical NAO-like space structure and a 5 years timescale, qualitatively consistent with a mid-latitude delayed oscillator paradigm. The two essential processes governing the oscillation are (1) a negative feedback between ocean gyre circulation and the high latitude SST meridional gradient and (2) a positive feedback between SST and the NAO. The atmospheric NAO pattern appears to have a weaker projection on the ocean meridional overturning, compared to the gyre circulation, which leads to a secondary role for the thermohaline circulation in driving the meridional heat transport, and thus the oscillatory mode. (orig.)

  8. Hadron Correlations from Recombination and Fragmentation

    CERN Document Server

    Fries, R J


    We review the formalism of quark recombination applied to the hadronization of a quark gluon plasma. Evidence in favor of the quark recombination model is outlined. Recent work on parton correlations, leading to detectable correlations between hadrons, is discussed. Hot spots from completely quenched jets are a likely source of such correlations which appear to be jet-like. It will be discussed how such a picture compares with measurement of associated hadron yields at RHIC.

  9. Signals From the Epoch of Cosmological Recombination


    Sunyaev, R. A.; Chluba, J.


    The physical ingredients to describe the epoch of cosmological recombination are amazingly simple and well-understood. This fact allows us to take into account a very large variety of physical processes, still finding potentially measurable consequences for the energy spectrum and temperature anisotropies of the Cosmic Microwave Background (CMB). In this contribution we provide a short historical overview in connection with the cosmological recombination epoch and its connection to the CMB. A...

  10. Algae-based oral recombinant vaccines


    Specht, Elizabeth A.; Mayfield, Stephen P


    Recombinant subunit vaccines are some of the safest and most effective vaccines available, but their high cost and the requirement of advanced medical infrastructure for administration make them impractical for many developing world diseases. Plant-based vaccines have shifted that paradigm by paving the way for recombinant vaccine production at agricultural scale using an edible host. However, enthusiasm for “molecular pharming” in food crops has waned in the last decade due to difficulty in ...

  11. Consequences of recombination on traditional phylogenetic analysis

    DEFF Research Database (Denmark)

    Schierup, M H; Hein, J


    We investigate the shape of a phylogenetic tree reconstructed from sequences evolving under the coalescent with recombination. The motivation is that evolutionary inferences are often made from phylogenetic trees reconstructed from population data even though recombination may well occur (mtDNA o...... to a large overestimation of the substitution rate heterogeneity and the loss of the molecular clock. These results are discussed in relation to viral and mtDNA data sets. Udgivelsesdato: 2000-Oct...

  12. Circulating polymerase chain reaction chips utilizing multiple-membrane activation (United States)

    Wang, Chih-Hao; Chen, Yi-Yu; Liao, Chia-Sheng; Hsieh, Tsung-Min; Luo, Ching-Hsing; Wu, Jiunn-Jong; Lee, Huei-Huang; Lee, Gwo-Bin


    This paper reports a new micromachined, circulating, polymerase chain reaction (PCR) chip for nucleic acid amplification. The PCR chip is comprised of a microthermal control module and a polydimethylsiloxane (PDMS)-based microfluidic control module. The microthermal control modules are formed with three individual heating and temperature-sensing sections, each modulating a specific set temperature for denaturation, annealing and extension processes, respectively. Micro-pneumatic valves and multiple-membrane activations are used to form the microfluidic control module to transport sample fluids through three reaction regions. Compared with other PCR chips, the new chip is more compact in size, requires less time for heating and cooling processes, and has the capability to randomly adjust time ratios and cycle numbers depending on the PCR process. Experimental results showed that detection genes for two pathogens, Streptococcus pyogenes (S. pyogenes, 777 bps) and Streptococcus pneumoniae (S. pneumoniae, 273 bps), can be successfully amplified using the new circulating PCR chip. The minimum number of thermal cycles to amplify the DNA-based S. pyogenes for slab gel electrophoresis is 20 cycles with an initial concentration of 42.5 pg µl-1. Experimental data also revealed that a high reproducibility up to 98% could be achieved if the initial template concentration of the S. pyogenes was higher than 4 pg µl-1. The preliminary results of the current paper were presented at the 19th IEEE International Conference on Micro Electro Mechanical Systems (IEEE MEMS 2006), Istanbul, Turkey, 22-26 January, 2006.

  13. Circulating Endothelial Microparticles in Diabetes Mellitus

    Directory of Open Access Journals (Sweden)

    A. F. Tramontano


    Full Text Available Background. Endothelial Microparticles (EMPs are small vesicles shed from activated or apoptotic endothelial cells and involved in cellular cross-talk. Whether EMP immunophenotypes vary according to stimulus in Diabetes Mellitus (DM is not known. We studied the cellular adhesion molecule (CAM profile of circulating EMPs in patients with and without Diabetes Mellitus type 2, who were undergoing elective cardiac catheterization. Methods and Results. EMPs were analyzed by flow cytometry. The absolute median number of EMPs (EMPs/L specific for CD31, CD105, and CD106 was significantly increased in the DM population. The ratio of CD62E/CD31 EMP populations reflected an apoptotic process. Conclusion. Circulating CD31+, CD105+, and CD106+ EMPs were significantly elevated in patients with DM. EMPs were the only independent predictors of DM in our study cohort. In addition, the EMP immunophenotype reflected an apoptotic process. Circulating EMPs may provide new options for risk assessment.

  14. Walker circulation in a transient climate (United States)

    Plesca, Elina; Grützun, Verena; Buehler, Stefan A.


    The tropical overturning circulations modulate the heat exchange across the tropics and between the tropics and the poles. The anthropogenic influence on the climate system will affect these circulations, impacting the dynamics of the Earth system. In this work we focus on the Walker circulation. We investigate its temporal and spatial dynamical changes and their link to other climate features, such as surface and sea-surface temperature patterns, El-Niño Southern Oscillation (ENSO), and ocean heat-uptake, both at global and regional scale. In order to determine the impact of anthropogenic climate change on the tropical circulation, we analyze the outputs of 28 general circulation models (GCMs) from the CMIP5 project. We use the experiment with 1% year-1 increase in CO2 concentration from pre-industrial levels to quadrupling of the concentration. Consistent with previous studies (ex. Ma and Xie 2013), we find that for this experiment most GCMs associate a weakening Walker circulation to a warming transient climate. Due to the role of the Walker Pacific cell in the meridional heat and moisture transport across the tropical Pacific and also the connection to ENSO, we find that a weakened Walker circulation correlates with more extreme El-Niño events, although without a change in their frequency. The spatial analysis of the Pacific Walker cell suggests an eastward displacement of the ascending branch, which is consistent with positive SST anomalies over the tropical Pacific and the link of the Pacific Walker cell to ENSO. Recent studies (ex. England et al. 2014) have linked a strengthened Walker circulation to stronger ocean heat uptake, especially in the western Pacific. The inter-model comparison of the correlation between Walker circulation intensity and ocean heat uptake does not convey a robust response for the investigated experiment. However, there is some evidence that a stronger weakening of the Walker circulation is linked to a higher transient climate

  15. Multiple recombinants in two dengue virus, serotype-2 isolates from patients from Oaxaca, Mexico

    Directory of Open Access Journals (Sweden)

    Cisneros Alejandro


    Full Text Available Abstract Background Dengue (DEN is a serious cause of mortality and morbidity in the world including Mexico, where the infection is endemic. One of the states with the highest rate of dengue cases is Oaxaca. The cause of DEN is a positive-sense RNA virus, the dengue virus (DENV that evolves rapidly increasing its variability due to the absence of a repair mechanism that leads to approximately one mutational event per genome replication; which results in enhancement of viral adaptation, including the escape from host immune responses. Additionally, recombination may play a role in driving the evolution of DENV, which may potentially affect virulence and cause host tropism changes. Recombination in DENV has not been described in Mexican strains, neither has been described the relevance in virus evolution in an endemic state such as Oaxaca where the four serotypes of DENV are circulating. Results To study whether there are isolates from Oaxaca having recombination, we obtained the sequence of 6 different isolates of DENV-2 Asian/American genotype from the outbreak 2005-6, one clone of the C(91-prM-E-NS1(2400 structural genes, and 10 clones of the E gene from the isolate MEX_OAX_1656_05. Evidence of recombination was found by using different methods along with two softwares: RDP3 and GARD. The Oaxaca MEX_OAX_1656_05 and MEX_OAX_1038_05 isolates sequenced in this study were recombinant viruses that incorporate the genome sequence from the Cosmopolitan genotype. Furthermore, the clone of the E gene namely MEX_OAX_165607_05 from this study was also recombinant, incorporating genome sequence from the American genotype. Conclusions This is the first report of recombination in DENV-2 in Mexico. Given such a recombinant activity new genomic combinations were produced, this could play a significant role in the DENV evolution and must be considered as a potentially important mechanism generating genetic variation in this virus with serious implications for

  16. Construction of recombinant industrial Saccharomyces cerevisiae strain with bglS gene insertion into PEP4 locus by homologous recombination

    Institute of Scientific and Technical Information of China (English)

    Qiang ZHANG; Qi-he CHEN; Ming-liang FU; Jin-ling WANG; Hong-bo ZHANG; Guo-qing HE


    The bglS gene encoding endo-1,3-1,4-β-glucanase from Bacillus subtilis was cloned and sequenced in this study. The bglS expression cassette, including PGK1 promoter, bglS gene fused to the signal sequence of the yeast mating pheromone α-factor (MFals), and ADH1 terminator with G418-resistance as the selected marker, was constructed. Then one of the PEP4 allele of Saccharomyces cerevisiae WZ65 strain was replaced by bglS expression cassette using chromosomal integration of polymerase chain reaction (PCR)-mediated homologous recombination, and the bglS gene was expressed simultaneously. The recombinant strain S. cerevisiae (SC-βG) was preliminarily screened by the clearing hydrolysis zone formed after the barley β-glucan was hydrolyzed in the plate and no proteinase A (PrA) activity was measured in fermenting liquor. The results of PCR analysis ofgenome DNA showed that one of the PEP4 allele had been replaced and bglS gene had been inserted into the locus of PEP4 gene in recombinant strains. Different endo-1,3-1,4-β-glucanase assay methods showed that the recombinant strain SC-βG had high endo-1,3-1,4-β-glucanase expression level with the maximum of 69.3 U/(h-ml) after 60 h of incubation. Meanwhile, the Congo Red method was suitable for the determination of endo-1,3-1,4-β-glucanase activity during the actual brewing process. The current research implies that the constructed yeast strain could be utilized to improve the industrial brewing property of beer.

  17. Recombination rate predicts inversion size in Diptera. (United States)

    Cáceres, M; Barbadilla, A; Ruiz, A


    Most species of the Drosophila genus and other Diptera are polymorphic for paracentric inversions. A common observation is that successful inversions are of intermediate size. We test here the hypothesis that the selected property is the recombination length of inversions, not their physical length. If so, physical length of successful inversions should be negatively correlated with recombination rate across species. This prediction was tested by a comprehensive statistical analysis of inversion size and recombination map length in 12 Diptera species for which appropriate data are available. We found that (1) there is a wide variation in recombination map length among species; (2) physical length of successful inversions varies greatly among species and is inversely correlated with the species recombination map length; and (3) neither the among-species variation in inversion length nor the correlation are observed in unsuccessful inversions. The clear differences between successful and unsuccessful inversions point to natural selection as the most likely explanation for our results. Presumably the selective advantage of an inversion increases with its length, but so does its detrimental effect on fertility due to double crossovers. Our analysis provides the strongest and most extensive evidence in favor of the notion that the adaptive value of inversions stems from their effect on recombination.

  18. Recombination of U92+ ions with electrons

    International Nuclear Information System (INIS)

    Recombination of fully stripped U92+ ions with electrons has been investigated at the Experimental Storage Ring (ESR) in Darmstadt. Absolute recombination rate coefficients have been measured for relative energies from 0 to 33 eV. For energies greater than 20 meV the experimental result is well described by the theory for radiative recombination (RR). Below 20 meV the experimental rate increasingly exceeds the RR calculation as observed previously in the recombination of light bare ions as well as of Bi83+. This low-energy rate enhancement is shown to scale as Z2.6 for bare ions, where Z is the atomic number of the ion. The U92+ recombination rate enhancement is insensitive to changes of the electron density. Variation of the magnetic guiding field strength from 80 mT to 120 mT resulted in oscillations of the recombination rate at 0 eV. The oscillations are partly attributed to changes of the transverse electron temperature accompanying the change of the magnetic guiding field strength; partly they may be caused by uncompensated small changes of the interaction angle between the two beams. (orig.)

  19. Dissociation of recombinant prion autocatalysis from infectivity. (United States)

    Noble, Geoffrey P; Supattapone, Surachai


    Within the mammalian prion field, the existence of recombinant prion protein (PrP) conformers with self-replicating (ie. autocatalytic) activity in vitro but little to no infectious activity in vivo challenges a key prediction of the protein-only hypothesis of prion replication--that autocatalytic PrP conformers should be infectious. To understand this dissociation of autocatalysis from infectivity, we recently performed a structural and functional comparison between a highly infectious and non-infectious pair of autocatalytic recombinant PrP conformers derived from the same initial prion strain. (1) We identified restricted, C-terminal structural differences between these 2 conformers and provided evidence that these relatively subtle differences prevent the non-infectious conformer from templating the conversion of native PrP(C) substrates containing a glycosylphosphatidylinositol (GPI) anchor. (1) In this article we discuss a model, consistent with these findings, in which recombinant PrP, lacking post-translational modifications and associated folding constraints, is capable of adopting a wide variety of autocatalytic conformations. Only a subset of these recombinant conformers can be adopted by post-translationally modified native PrP(C), and this subset represents the recombinant conformers with high specific infectivity. We examine this model's implications for the generation of highly infectious recombinant prions and the protein-only hypothesis of prion replication.

  20. Comparison of two generation-recombination terms in the Poisson-Nernst-Planck model

    Energy Technology Data Exchange (ETDEWEB)

    Lelidis, I. [Solid State Section, Department of Physics, University of Athens, Panepistimiopolis, Zografos, Athens 157 84 (Greece); Department of Applied Science and Technology, Politecnico di Torino, Corso Duca degli Abruzzi 24, 10129 Torino (Italy); Universite de Picardie Jules Verne, Laboratoire de Physique des Systemes Complexes, 33 rue Saint-Leu 80039, Amiens (France); Barbero, G. [Department of Applied Science and Technology, Politecnico di Torino, Corso Duca degli Abruzzi 24, 10129 Torino (Italy); Sfarna, A. [Solid State Section, Department of Physics, University of Athens, Panepistimiopolis, Zografos, Athens 157 84 (Greece)


    Two phenomenological forms proposed to take into account the generation-recombination phenomenon of ions are investigated. The first form models the phenomenon as a chemical reaction, containing two coefficients describing the dissociation of neutral particles in ions, and the recombination of ions to give neutral particles. The second form is based on the assumption that in thermodynamical equilibrium, a well-defined density of ions is stable. Any deviation from the equilibrium density gives rise to a source term proportional to the deviation, whose phenomenological coefficient plays the role of a life time. The analysis is performed by evaluating the electrical response of an electrolytic cell to an external stimulus for both forms. For simplicity we assume that the electrodes are blocking, that there is only a group of negative and positive ions, and that the negative ions are immobile. For the second form, two cases are considered: (i) the generation-recombination phenomenon is due to an intrinsic mechanism, and (ii) the production of ions is triggered by an external source of energy, as in a solar cell. We show that the predictions of the two models are different at the impedance as well as at the admittance level. In particular, the first model predicts the existence of two plateaux for the real part of the impedance, whereas the second one predicts just one. It follows that impedance spectroscopy measurements could give information on the model valid for the generation-recombination of ions.

  1. Experimental study of natural circulation circuit

    Energy Technology Data Exchange (ETDEWEB)

    Lemos, Wanderley F.; Su, Jian, E-mail:, E-mail: [Coordenacao dos Programas de Pos-Graduacao de Engenharia (LASME/COPPE/UFRJ), Rio de Janeiro, RJ (Brazil). Lab. de Simulacao e Metodos Numericos; Faccini, Jose L.H., E-mail: [Instituto de Engenharia Nuclear (LTE/IEN/CNEN-RJ), Rio de Janeiro, RJ (Brazil). Lab. de Termo-Hidraulica Experimental


    This work presents an experimental study about fluid flows behavior in natural circulation, under conditions of single-phase flow. The experiment was performed through experimental thermal-hydraulic circuit built at IEN. This test equipment has performance similar to passive system of residual heat removal present in Advanced Pressurized Water Reactors (APWR). This experimental study aims to observing and analyzing the natural circulation phenomenon, using this experimental circuit that was dimensioned and built based on concepts of similarity and scale. This philosophy allows the analysis of natural circulation behavior in single-phase flow conditions proportionally to the functioning real conditions of a nuclear reactor. The experiment was performed through procedures to initialization of hydraulic feeding of primary and secondary circuits and electrical energizing of resistors installed inside heater. Power controller has availability to adjust values of electrical power to feeding resistors, in order to portray several conditions of energy decay of nuclear reactor in a steady state. Data acquisition system allows the measurement and monitoring of the evolution of the temperature in various points through thermocouples installed in strategic points along hydraulic circuit. The behavior of the natural circulation phenomenon was monitored by graphical interface on computer screen, showing the temperature evolutions of measuring points and results stored in digital spreadsheets. The results stored in digital spreadsheets allowed the getting of data to graphic construction and discussion about natural circulation phenomenon. Finally, the calculus of Reynolds number allowed the establishment for a correlation of friction in function of geometric scales of length, heights and cross section of tubing, considering a natural circulation flow throughout in the region of hot leg. (author)

  2. Kinetic mechanism of plasma recombination in methane, ethane and propane after high-voltage nanosecond discharge (United States)

    Anokhin, E. M.; Popov, M. A.; Kochetov, I. V.; Starikovskiy, A. Yu; Aleksandrov, N. L.


    The results of the experimental and numerical study of high-voltage nanosecond discharge afterglow in pure methane, ethane and propane are presented for room temperature and pressures from 2 to 20 Torr. Time-resolved electron density during the plasma decay was measured with a microwave interferometer for initial electron densities in the range between 5  ×  1010 and 3  ×  1012 cm‑3 and the effective recombination coefficients were obtained. Measured effective recombination coefficients increased with gas pressure and were much higher than the recombination coefficients for simple molecular hydrocarbon ions. The properties of plasma in the discharge afterglow were numerically simulated by solving the balance equations for charged particles and electron temperature. Calculations showed that electrons had time to thermalize prior to the recombination. The measured data were interpreted under the assumption that cluster hydrocarbon ions are formed during the plasma decay that is controlled by the dissociative electron recombination with these ions at electron room temperature. Based on the analysis of the experimental data, the rates of three-body formation of cluster ions and recombination coefficients for these ions were estimated.

  3. Reduction of sidewall interface recombination in GaAs and InGaAs active regions (United States)

    Strand, Timothy Andrew

    In the continual effort to reduce the operating current in semiconductor lasers, the first step is always to reduce the size of the device. When we do so, however, we encounter a new set of challenges. As the device size decreases, the "walls close in" on the electrons and holes, that is, the sidewalls of the device become so close together that the electrons and holes can diffuse to them before recombining radiatively. The device sidewalls, are often littered with carrier traps, which act as nonradiative recombination sites for the electrons and holes. This wasted current, a small fraction of the total in larger devices, becomes the dominant current mechanism in small devices. In this work we present two techniques for limiting this sidewall interface recombination. The first uses semiconductor regrowth to remove the recombination sites that are normally formed at the air-exposed sidewalls. We use buried, in-plane lasers to demonstrate a reduction in the sidewall recombination rate by a factor of forty. In the second technique, we show that the sidewall interface recombination can also be reduced by preventing the carriers from diffusing to the sidewalls. We demonstrate two methods for reducing this lateral carrier diffusion; segmented GaAs quantum wells, and InGaAs quantum dots. In the former, we demonstrate a reduction in the low-temperature lateral carrier diffusion constant by a factor of forty-six (versus a comparable GaAs quantum well).

  4. First circulating beam in the AA

    CERN Multimedia


    On 3 July 1980, two years after project authorization, beam circulated for the first time in the AA. It was a 3.56 GeV/c proton test beam. We see an expecting crowd, minutes before the happy event. The persons are too numerous to name them all, but the 3 most prominent ones are at the centre (left to right): Roy Billinge (Joint AA Project Leader, with his hand on the control box), Eifionydd Jones (white shirt), Simon van der Meer (spiritus rector and Joint AA Project Leader). The first antiprotons were injected, made to circulate and cooled soon after, on 14 July 1980.

  5. Blowing Circulation Control on a Seaplane Airfoil (United States)

    Guo, B. D.; Liu, P. Q.; Qu, Q. L.


    RANS simulations are presented for blowing circulation control on a seaplane airfoil. Realizable k-epsilon turbulent model and pressure-based coupled algorithm with second-order discretization were adopted to simulate the compressible flow. Both clear and simple flap configuration were simulated with blowing momentum coefficient Cμ = 0, 0.15 and 0.30. The results show that blowing near the airfoil trailing edge could enhance the Coanda effect, delay the flow separation, and increase the lift coefficient dramatically. The blowing circulation control is promising to apply to taking off and landing of an amphibious aircraft or seaplane.

  6. Quenching phenomena in natural circulation loop

    Energy Technology Data Exchange (ETDEWEB)

    Umekawa, Hisashi; Ozawa, Mamoru [Kansai Univ., Osaka (Japan); Ishida, Naoki [Daihatsu Motor Company, Osaka (Japan)


    Quenching phenomena has been investigated experimentally using circulation loop of liquid nitrogen. During the quenching under natural circulation, the heat transfer mode changes from film boiling to nucleate boiling, and at the same time flux changes with time depending on the vapor generation rate and related two-phase flow characteristics. Moreover, density wave oscillations occur under a certain operating condition, which is closely related to the dynamic behavior of the cooling curve. The experimental results indicates that the occurrence of the density wave oscillation induces the deterioration of effective cooling of the heat surface in the film and the transition boiling regions, which results in the decrease in the quenching velocity.

  7. Applications of Circulation Control, Yesterday and Today


    Jonathan Kweder; Chad C. Panthe; James E. Smit


    Circulation control, an aerodynamic method of changing the properties of an airfoil, such as lift, camber and angle of attack, has been used in several unique ways since its inception, as an enhancement to fixed wing aircraft, in the 1960’s. Early in the research venture, this technology was used on the main wing of an aircraft in conjunction with a Coandă surface, such as a rounded trailing edge or a deployable flap. Research during this time proved to be the foundation of the circulation co...

  8. Applications of Circulation Control, Yesterday and Today

    Directory of Open Access Journals (Sweden)

    Jonathan Kweder


    Full Text Available Circulation control, an aerodynamic method of changing the properties of an airfoil, such as lift, camber and angle of attack, has been used in several unique ways since its inception, as an enhancement to fixed wing aircraft, in the 1960’s. Early in the research venture, this technology was used on the main wing of an aircraft in conjunction with a Coandă surface, such as a rounded trailing edge or a deployable flap. Research during this time proved to be the foundation of the circulation control technology and showed that small amounts of exit jet velocity could have a large impact on the aerodynamics of an airfoil. In the 1970’s the inspirations that drove circulation control research changed from design work to optimization of the parameters which were found to have the most effect on circulation control. These studies included slot placement, favorable momentum coefficient, and pressurization benefits and determents. This research period also allowed for expansion of the uses of circulation control to submarine/hydrodynamic and rotary wing applications. Newest research has brought on several propeller driven applications and the recent push for efficient renewable research has allowed circulation control research technologies to evolve into use in wind turbine and water turbine applications. The idea being that with circulation control the turbine can adapt easier to the changing wind velocity and direction and ultimately capture more power than an un-augmented turbine. As with most new and novel technologies there is a process and time delay associated with their development and ultimate application. For some technologies the market, or the supporting hardware, are lacking and sometimes the technology has strong advocacies for yet to be fulfilled expectations. In most of these cases a strong idea will re-surface repeatedly until the art has matured, or the better solution is found. This paper will focus on the previously developed

  9. The Circulation of Shakespeare Adaptations in Eastern Europe

    Directory of Open Access Journals (Sweden)

    Nicolaescu Mădălina


    Full Text Available The paper discusses the stage adaptations of Shakespeare's Hamlet and Romeo and Juliet that were circulated in the German Länders and the Habsburg Empire in the late 18th and early 19th century. The various forms of re-writing Shakespeare are linked with processes re-contextualizing the text and are discussed as forms of localizing a transnational Shakespeare. The analysis zooms in on the contexts of performance of the German adaptations in two Transylvanian cities. The paper highlights the cultural and linguistic negotiations performed when further translating the already multilayered rewritings of the Shakespearean text and focuses on a Romanian translation of a German adaptation of Hamlet.

  10. Intercompartmental Recombination of HIV-1 Contributes to env Intrahost Diversity and Modulates Viral Tropism and Sensitivity to Entry Inhibitors▿†‡ (United States)

    Brown, Richard J. P.; Peters, Paul J.; Caron, Catherine; Gonzalez-Perez, Maria Paz; Stones, Leanne; Ankghuambom, Chiambah; Pondei, Kemebradikumo; McClure, C. Patrick; Alemnji, George; Taylor, Stephen; Sharp, Paul M.; Clapham, Paul R.; Ball, Jonathan K.


    HIV-1 circulates within an infected host as a genetically heterogeneous viral population. Viral intrahost diversity is shaped by substitutional evolution and recombination. Although many studies have speculated that recombination could have a significant impact on viral phenotype, this has never been definitively demonstrated. We report here phylogenetic and subsequent phenotypic analyses of envelope genes obtained from HIV-1 populations present in different anatomical compartments. Assessment of env compartmentalization from immunologically discrete tissues was assessed utilizing a single genome amplification approach, minimizing in vitro-generated artifacts. Genetic compartmentalization of variants was frequently observed. In addition, multiple incidences of intercompartment recombination, presumably facilitated by low-level migration of virus or infected cells between different anatomic sites and coinfection of susceptible cells by genetically divergent strains, were identified. These analyses demonstrate that intercompartment recombination is a fundamental evolutionary mechanism that helps to shape HIV-1 env intrahost diversity in natural infection. Analysis of the phenotypic consequences of these recombination events showed that genetic compartmentalization often correlates with phenotypic compartmentalization and that intercompartment recombination results in phenotype modulation. This represents definitive proof that recombination can generate novel combinations of phenotypic traits which differ subtly from those of parental strains, an important phenomenon that may have an impact on antiviral therapy and contribute to HIV-1 persistence in vivo. PMID:21471230

  11. Proglucagon Promoter Cre-Mediated AMPK Deletion in Mice Increases Circulating GLP-1 Levels and Oral Glucose Tolerance.

    Directory of Open Access Journals (Sweden)

    Sophie R Sayers

    Full Text Available Enteroendocrine L-cells synthesise and release the gut hormone glucagon-like peptide-1 (GLP-1 in response to food transit. Deletion of the tumour suppressor kinase LKB1 from proglucagon-expressing cells leads to the generation of intestinal polyps but no change in circulating GLP-1 levels. Here, we explore the role of the downstream kinase AMP-activated protein kinase (AMPK in these cells.Loss of AMPK from proglucagon-expressing cells was achieved using a preproglucagon promoter-driven Cre (iGluCre to catalyse recombination of floxed alleles of AMPKα1 and α2. Oral and intraperitoneal glucose tolerance were measured using standard protocols. L-cell mass was measured by immunocytochemistry. Hormone and peptide levels were measured by electrochemical-based luminescence detection or radioimmunoassay.Recombination with iGluCre led to efficient deletion of AMPK from intestinal L- and pancreatic alpha-cells. In contrast to mice rendered null for LKB1 using the same strategy, mice deleted for AMPK displayed an increase (WT: 0.05 ± 0.01, KO: 0.09±0.02%, p<0.01 in L-cell mass and elevated plasma fasting (WT: 5.62 ± 0.800 pg/ml, KO: 14.5 ± 1.870, p<0.01 and fed (WT: 15.7 ± 1.48pg/ml, KO: 22.0 ± 6.62, p<0.01 GLP-1 levels. Oral, but not intraperitoneal, glucose tolerance was significantly improved by AMPK deletion, whilst insulin and glucagon levels were unchanged despite an increase in alpha to beta cell ratio (WT: 0.23 ± 0.02, KO: 0.33 ± 0.03, p<0.01.AMPK restricts L-cell growth and GLP-1 secretion to suppress glucose tolerance. Targeted inhibition of AMPK in L-cells may thus provide a new therapeutic strategy in some forms of type 2 diabetes.

  12. Studies on Mucosal Immunity Induced by Transmissible Gastroenteritis Virus Nucleocapsid Protein Recombinant Lactobacillus casei in Mice and Sow

    Institute of Scientific and Technical Information of China (English)

    WANG Gui-hua; HOU Xi-lin; YU Li-yun; LIU Jian-kui; WEI Chun-hua


    Mucosal immunity plays an important role in protecting pigs against transmissible gastroenteritis virus (TGEV) infection. To elicit mucosal immune response against TGEV, we developed a surface antigen display system using the poly-γ-glutamate synthetase A (pgsA) protein of Bacillus subtilis as an anchoring matrix to express recombinant fusion proteins of pgsA and nucleocapsid protein of TGEV in Lactobacillus casei. Surface location of fusion protein was verified by ELISA and indirect immunofluorescence test. Oral and intranasal inoculations of pregnant sow and mice with recombinant L. casei resulted in high levels of serum immunoglobulin G (IgG) and secretory immunogiobulin A (sIgA) against recombinant N protein as demonstrated by ELISA. More importantly, the level of specific slgA in colostrum significantly increased compared with that of IgG. The serum lgG levels of the piglets increased after suckling coiostrum produced by sows was previously inoculated with recombinant L. casei. These results indicate that immunization with recombinant L. casei expressing TGEV N protein on its surface elicited high levels of specific slgA and circulating lgG against TGEV N protein.

  13. Brain Gain or Brain Circulation? U.S. Doctoral Recipients Returning to South Korea (United States)

    Lee, Jenny J.; Kim, Dongbin


    This study explored the reasons for current reverse mobility patterns in South Korea and how the country benefits from returning U.S. doctoral recipients in the forms of brain gain and brain circulation. Based on interviews of Korean faculty who studied in the U.S., this study found that while the political economy might help to explain why Korean…

  14. Engineering of recombinant crystallization chaperones


    Koide, Shohei


    The preparation of diffraction quality crystals remains the major bottleneck in macromolecular x-ray crystallography. A crystallization chaperone is an auxiliary protein, such as fragments of monoclonal antibodies, that binds to and increases the crystallization probability of a target molecule of interest. Such chaperones reduce conformational heterogeneity, mask counterproductive surfaces while extending surfaces predisposed to forming crystal contacts, and provide phasing information. Crys...

  15. Influence of external circulation on sludge characteristics during start-up of internal circulation reactor

    Institute of Scientific and Technical Information of China (English)

    DING Jian-nan; WANG Dian-zuo


    The start-up of external circulation-added internal circulation(IC) reactor was finished in 26 d, 32 d fewer than that of IC reactor. To evaluate the influence of the added external circulation on the development of granular sludge, the characteristics of the granular sludge taken from the two tested laboratory-scale reactors during start-up were studied. The results show that the added external circulation can enhance biomass granulation, accelerate granule development and improve sludge characteristics. At the end of start-up, the granular size of sludge in external circulation-added IC reactor greatly increases with a size distribution much better than that of sludge in IC reactor. The granular sludge originated from external circulation-added IC reactor contains more extracellular polymers and has a greater settling velocity than that from IC reactor. Methanogenic activity of the granular sludge from the external circulation-added IC reactor started 26 d ago reaches 358.23 mL·g-1·d-1, 1.66 and 1.20 times as great as that of the sludge from the IC reactor started 26 d and 58 d ago respectively.

  16. Combination of intratypic and intertypic recombinant events in EV71: a novel evidence for the "triple-recombinant" strains of genotype A viruses in Mainland China from 2008 to 2010. (United States)

    Liu, Yongjuan; Zhang, Fengfeng; Fu, Chong; Wu, Suying; Chen, Xiong; Shi, Yingying; Zhou, Bingfei; Zhang, Lianglu; Zhang, Yingying; Han, Song; Yin, Jun; Peng, Biwen; He, Xiaohua; Liu, Wanhong


    The first Enterovirus 71 (EV71) strain isolated in 1969 was classified as genotype A. It is interesting that the genotype A disappeared nearly 40 years until its re-emergence in mainland China in 2008-2010. Few studies on genetic characterization of the re-emerged genotype A viruses have been reported. In this study, a series of analyses were performed on molecular epidemiology and genome recombination of genotype A viruses in China. Phylogenetic analysis indicated that except for 17 reported genotype A strains and 3 orphan strains (C0, C3 and B5), almost all EV71 strains in mainland China were belonging to subgenotype C4 during 1987-2011. The subgenotype C4 was further divided into 3 clades C4a1, C4a2, and C4b. The genotype A viruses co-circulated with the predominant clade C4a2 and the re-emerged clade C4b both in eastern and central China in 2008-2009. Moreover, comprehensive recombination analysis showed that the genotype A viruses were "triple-recombinant" by combination of intratypic and intertypic recombination. Intertypic recombination between the oldest C4b strain (SHZH98) and Coxsackievirus A5 (CVA5) and intratypic recombination between the SHZH98 and C1 strains both with one junction in 5'-UTR were observed for some specific C4a2 strains and the re-emerged C4b strain, respectively. And intratypic recombination between the re-emerged C4b strain and the specific C4a2 strains with one junction in 5'-UTR was observed for the Chinese genotype A viruses. Taken together, these results provided potential explanations for the genesis of Chinese genotype A viruses which were significant for preventing and controlling outbreaks.

  17. Performance testing of passive autocatalytic recombiners (PARs)

    Energy Technology Data Exchange (ETDEWEB)

    Blanchat, T. [Sandia National Laboratories, Albuquerque, NM (United States); Malliakos, A. [U.S. Nuclear Regulatory Commission, Washington, DC (United States)


    Passive autocatalytic recombiners (PARs) have been under consideration in the U.S. as a combustible gas control system in advanced light water reactor (ALWR) containments for design basis and severe accidents. PARs do not require a source of power. Instead they use palladium or platinum as a catalyst to recombine hydrogen and oxygen gases into water vapor upon contact with the catalyst. Energy from the recombination of hydrogen with oxygen is released at a relatively slow but continuous rate into the containment which prevents the pressure from becoming too high. The heat produced creates strong buoyancy effects which increases the influx of the surrounding gases to the recombiner. These natural convective flow currents promote mixing of combustible gases in the containment. PARs are self-starting and self-feeding under a very wide range of conditions. The recombination rate of the PAR system needs to be great enough to keep the concentration of hydrogen (or oxygen) below acceptable limits. There are several catalytic recombiner concepts under development worldwide. The USNRC is evaluating a specific design of a PAR which is in an advanced stage of engineering development and has been proposed for ALWR designs. Sandia National laboratories (SNL), under the sponsorship and the direction of the USNRC, is conducting an experimental program to evaluate the performance of PARs. The PAR will be tested at the SURTSEY facility at SNL. The test plan currently includes the following experiments: experiments will be conducted to define the startup characteristics of PARs (i.e., to define what is the lowest hydrogen concentration that the PAR starts recombining the hydrogen with oxygen); experiments will be used to define the hydrogen depletion rate of PARs as a function of hydrogen concentration; and experiments will be used to define the PAR performance in the presence of high concentrations of steam. (author)

  18. DNA intermediates of meiotic recombination in synchronous S. pombe at optimal temperature. (United States)

    Hyppa, Randy W; Fowler, Kyle R; Cipak, Lubos; Gregan, Juraj; Smith, Gerald R


    Crossovers formed by recombination between homologous chromosomes are important for proper homolog segregation during meiosis and for generation of genetic diversity. Optimal molecular analysis of DNA intermediates of recombination requires synchronous cultures. We previously described a mutant, pat1-as2, of the fission yeast Schizosaccharomyces pombe that undergoes synchronous meiosis at 25°C when an ATP analog is added to the culture. Here, we compare recombination intermediates in pat1-as2 at 25°C with those in the widely used pat1-114 temperature-sensitive mutant at 34°C, a temperature higher than optimal. DNA double-strand breaks at most hotspots are similarly abundant in the two conditions but, remarkably, a few hotspots are distinctly deficient at 25°C. In both conditions, Holliday junctions at DNA break hotspots form more frequently between sister chromatids than between homologs, but a novel species, perhaps arising from invasion by only one end of broken DNA, is more readily observed at 25°C. Our results confirm the validity of previous assays of recombination intermediates in S. pombe and provide new information on the mechanism of meiotic recombination. PMID:24089141

  19. Redefining circulating tumor cells by image processing

    NARCIS (Netherlands)

    Ligthart, S.T.


    Circulating tumor cells (CTC) in the blood of patients with metastatic carcinomas are associated with poor survival and can be used to guide therapy. However, CTC are very heterogeneous in size and shape, and are present at very low frequencies. Missing or misjudging a few events may have great cons

  20. On Pareto theory of circulation of elites


    Ricardo P\\'erez-Marco


    We prove that Pareto theory of circulation of elites results from our wealth evolution model, Kelly criterion for optimal betting and Keynes' observation of "animal spirits" that drive the economy and cause that human financial decisions are prone to excess risk-taking.

  1. A Circulation Model for Busy Public Libraries. (United States)

    Bagust, A.


    Develops stochastic model of library borrowing using Negative Binomial distribution applied to circulation data obtained from Huddersfield Public Library. Evidence concerning process of popularity decay is presented and method is given by which relegation tests can be constructed to maintain optimum turnover. Eight references and statistical…

  2. [Circulating "tumor markers" in gastrointestinal tumors]. (United States)

    Borlinghaus, P; Lamerz, R


    Tumor markers (TM) of the neoplastic cell can be divided into non-shedded substances and antigens shedded in blood, urine or other body fluids. For clinicians circulating TM are more important. All relevant circulating TM are not useful in screening of asymptomatic patients because of insufficient sensitivity and specificity. With caution they are useful in the observation of risk groups. Circulating TM have their main significance as additional parameters in monitoring symptomatic patients with malignancies. Several follow up determinations are more important than one single measurement. During follow up of tumor patients TM should not be checked automatically if there are no diagnostic or therapeutical consequences. The clinically most important circulating TM in non-hormone secreting tumors of the gastrointestinal tract are the oncofetal antigens CEA and AFP and antigens defined by monoclonal antibodies e. g. CA 19-9 and CA 72-4. AFP is the primary TM in hepatocellular carcinoma, often elevated in hepatoblastoma and always normal in cholangiocellular carcinoma. CEA is the TM of first choice in patients with colorectal carcinomas and liver metastasis. CA 19-9 is TM of first choice in pancreatic carcinoma and additionally of diagnostic value in cholangiocellular carcinoma and tumors of the bile ducts. In cancer of the stomach CA 19-9 and CEA are secondary TM in combination with CA 72-4 as primary TM. Care should be taken that slight and moderate elevations of TM can be observed in benign diseases of liver, pancreas and bowel.

  3. Detecting Holocene changes in thermohaline circulation


    Keigwin, L. D.; Boyle, E.A.


    Throughout the last glacial cycle, reorganizations of deep ocean water masses were coincident with rapid millennial-scale changes in climate. Climate changes have been less severe during the present interglacial, but evidence for concurrent deep ocean circulation change is ambiguous.

  4. Detecting holocene changes in thermohaline circulation. (United States)

    Keigwin, L D; Boyle, E A


    Throughout the last glacial cycle, reorganizations of deep ocean water masses were coincident with rapid millennial-scale changes in climate. Climate changes have been less severe during the present interglacial, but evidence for concurrent deep ocean circulation change is ambiguous. PMID:10677463

  5. Unsteady flow about a circulation control airfoil

    Institute of Scientific and Technical Information of China (English)

    刘晶昌; 孙茂; 吴礼义


    The unsteady flow around a circulation control (CC) airfoil was investigated with Navier-Stokes method,which includes the flow around CC airfoil with pulsating jet,the flow around oscillating CC airfoil,and the flow around oscillating CC airfoil with pulsating jet.Dynamic properties of the flow and the aerodynamic forces were rewaled.

  6. Effects of spin-forbidden resonances on the recombination of Be-like Si and Be-like Ne

    Energy Technology Data Exchange (ETDEWEB)

    Orban, I; Boehm, S; Schuch, R [Department of Physics, Stockholm University, 10691 Stockholm (Sweden); Loch, S D [Department of Physics, Auburn University, Auburn, AL 36849 (United States); Glans, P, E-mail: [Department of Engineering, Physics and Mathematics, Mid Sweden University, 85170 Sundsvall (Sweden)


    Recombination through doubly excited states that can be formed only through spin-flip of the excited electrons can give very strong contributions to the recombination rate of Be-like ions. We demonstrate this, in this paper, with the electron-ion recombination spectra of Be-like Ne{sup 6+} and Be-like Si{sup 10+}, recently measured at the CRYRING storage ring. These resonances have significant effects on the plasma rate coefficients. We show that neglect or imprecise calculation of these resonances is responsible for large spreads observed between various theoretical results from the literature.

  7. Techno-economic evaluation of an inclusion body solubilization and recombinant protein refolding process

    NARCIS (Netherlands)

    Freydell, E.J.; Wielen, van der L.A.M.; Eppink, M.H.M.; Ottens, M.


    Expression of recombinant proteins in Escherichia coli is normally accompanied by the formation of inclusion bodies (IBs). To obtain the protein product in an active (native) soluble form, the IBs must be first solubilized, and thereafter, the soluble, often denatured and reduced protein must be ref

  8. Tuning of Collagen Triple-Helix Stability in Recombinant Telechelic Polymers

    NARCIS (Netherlands)

    Silva, da C.I.; Skrzeszewska, P.J.; Golinska, M.D.; Werten, M.W.T.; Eggink, G.; Wolf, de F.A.


    The melting properties of various triblock copolymers with random coil middle blocks (100–800 amino acids) and triple helix-forming (Pro-Gly-Pro)n end blocks (n = 6–16) were compared. These gelatin-like molecules were produced as secreted proteins by recombinant yeast. The investigated series shows

  9. Circulation factors affecting precipitation over Bulgaria (United States)

    Nojarov, Peter


    The objective of this paper is to determine the influence of circulation factors on precipitation in Bulgaria. The study succeeds investigation on the influence of circulation factors on air temperatures in Bulgaria, as the focus here is directed toward precipitation amounts. Circulation factors are represented through two circulation indices, showing west-east or south-north transport of air masses over Bulgaria and four teleconnection indices (patterns)—North Atlantic Oscillation, East Atlantic, East Atlantic/Western Russia, and Scandinavian. Omega values at 700-hPa level show vertical motions in the atmosphere. Annual precipitation trends are mixed and not statistically significant. A significant decrease of precipitation in Bulgaria is observed in November due to the strengthening of the eastward transport of air masses (strengthening of EA teleconnection pattern) and anticyclonal weather (increase of descending motions in the atmosphere). There is also a precipitation decrease in May and June due to the growing influence of the Azores High. An increase of precipitation happens in September. All this leads to a redistribution of annual precipitation course, but annual precipitation amounts remain the same. However, this redistribution has a negative impact on agriculture and winter ski tourism. Zonal circulation has a larger influence on precipitation in Bulgaria compared to meridional. Eastward transport throughout the year leads to lower than the normal precipitation, and vice versa. With regard to the four teleconnection patterns, winter precipitation in Bulgaria is determined mainly by EA/WR teleconnection pattern, spring and autumn by EA teleconnection pattern, and summer by SCAND teleconnection pattern.

  10. Decontamination of CAGR gas circulator components

    International Nuclear Information System (INIS)

    This paper describes the development and full-scale trial of two methods for removal of radioactive contamination on the surfaces of CAGR gas circulator components. The two methods described are a particle impact cleaning (PIC) decontamination technique and an electrochemical technique, 'electro-swabbing', which is based on the principle of decontamination by electro-polishing. In developing these techniques it was necessary to take account of the physical and chemical nature of the surface deposits on the gas circulator components; these were shown to consist of magnetite-type oxide and carbonaceous material. In order to follow the progress of the decontamination it was also necessary to develop a surface sampling technique which was effective and precise under these conditions; an electrochemical technique, employing similar principles to the electro-swabbing process, was developed for this purpose. The full-scale trial of the PIC decontamination technique was carried out on an inlet guide vane (IGV) assembly, this having been identified as the component from the gas circulator which contributes most to the radiation dose accumulated during routine circulator maintenance. The technique was shown to be practically viable and some 99% of the radioactive contamination was readily removed from the treated surfaces with only negligible surface damage being caused. The full-scale trial of the electro-swabbing decontamination technique was carried out on a gas circulator impeller. High decontamination factors were again achieved with ≥ 99% of the radioactive contamination being removed from the treated surfaces. The technique has practical limitations in terms of handling and treatment of waste-arisings. However, the use of specially-designed swabbing electrodes may allow the treatment of constricted geometries inaccessible to techniques such as PIC. The technique is also highly suitable for the treatment of soft-finish materials and of components fabricated from a

  11. Effects of Microtopography on Overmarsh Circulation (United States)

    Sullivan, J. C.; Torres, R.; Garrett, A.


    Authors: J.C. Sullivan, R. Torres, A.J. Garrett In this study we systematically degrade a high-resolution, high precision salt marsh DEM and characterize the effects of DEM smoothing on overmarsh circulation. The question driving this effort is: How much topographic detail is needed to accurately simulate salt marsh circulation? The hydrodynamic model Delft3D was applied to data from a previous dye-tracer study in a 2 km2 semi-enclosed salt marsh basin at Skidaway Institute of Oceanography near Savannah, Georgia, USA. Overmarsh circulation was simulated for each smoothed DEM over a 5 day period corresponding to spring tide conditions. Results show that flood and ebb pathways differ significantly, but this effect is less apparent as the DEM is smoothed. Also, the flushing time (Tf) decreases with smoothing leading to greater dilution of a dye tracer with each tidal cycle. Observations at the macro, meso and micro scale show that flood and ebb flows become stronger through a consistent set of flow paths, including intertidal creeks, and differences in overmarsh circulation are more apparent in low marsh and channel head areas. This work shows that accurate representation of overmarsh circulation requires that the DEM resolve creek and low lying marsh structures at a spatial scale of 2-4m, but not necessarily the smallest tidal creeks (< 1m in width and depth). The next phase of this work will be to incorporate spatial variations in vegetation cover using RULLI (Remote Ultra Low-Light Imaging) remote sensing technology developed by the Department of Energy.

  12. Observations of the summer Red Sea circulation (United States)

    Sofianos, Sarantis S.; Johns, William E.


    Aiming at exploring and understanding the summer circulation in the Red Sea, a cruise was conducted in the basin during the summer of 2001 involving hydrographic, meteorological, and direct current observations. The most prominent feature, characteristic of the summer circulation and exchange with the Indian Ocean, is a temperature, salinity, and oxygen minimum located around a depth of 75 m at the southern end of the basin, associated with Gulf of Aden Intermediate Water inflowing from the Gulf of Aden during the summer season as an intruding subsurface layer. Stirring and mixing with ambient waters lead to marked increases in temperature (from 16.5 to almost 33°C) and salinity (from 35.7 to more than 38 psu) in this layer by the time it reaches midbasin. The observed circulation presents a very vigorous pattern with strong variability and intense features that extend the width of the basin. A permanent cyclone, detected in the northern Red Sea, verifies previous observations and modeling studies, while in the central sector of the basin a series of very strong anticyclones were observed with maximum velocities exceeding 1 m/s. The three-layer flow pattern, representative of the summer exchange between the Red Sea and the Gulf of Aden, is observed in the strait of Bab el Mandeb. In the southern part of the basin the layer flow is characterized by strong banking of the inflows and outflows against the coasts. Both surface and intermediate water masses involved in the summer Red Sea circulation present prominent spatial variability in their characteristics, indicating that the eddy field and mixing processes play an important role in the summer Red Sea circulation.

  13. Recombination and population structure in Salmonella enterica.

    Directory of Open Access Journals (Sweden)

    Xavier Didelot


    Full Text Available Salmonella enterica is a bacterial pathogen that causes enteric fever and gastroenteritis in humans and animals. Although its population structure was long described as clonal, based on high linkage disequilibrium between loci typed by enzyme electrophoresis, recent examination of gene sequences has revealed that recombination plays an important evolutionary role. We sequenced around 10% of the core genome of 114 isolates of enterica using a resequencing microarray. Application of two different analysis methods (Structure and ClonalFrame to our genomic data allowed us to define five clear lineages within S. enterica subspecies enterica, one of which is five times older than the other four and two thirds of the age of the whole subspecies. We show that some of these lineages display more evidence of recombination than others. We also demonstrate that some level of sexual isolation exists between the lineages, so that recombination has occurred predominantly between members of the same lineage. This pattern of recombination is compatible with expectations from the previously described ecological structuring of the enterica population as well as mechanistic barriers to recombination observed in laboratory experiments. In spite of their relatively low level of genetic differentiation, these lineages might therefore represent incipient species.

  14. Graded Recombination Layers for Multijunction Photovoltaics

    KAUST Repository

    Koleilat, Ghada I.


    Multijunction devices consist of a stack of semiconductor junctions having bandgaps tuned across a broad spectrum. In solar cells this concept is used to increase the efficiency of photovoltaic harvesting, while light emitters and detectors use it to achieve multicolor and spectrally tunable behavior. In series-connected current-matched multijunction devices, the recombination layers must allow the hole current from one cell to recombine, with high efficiency and low voltage loss, with the electron current from the next cell. We recently reported a tandem solar cell in which the recombination layer was implemented using a progression of n-type oxides whose doping densities and work functions serve to connect, with negligible resistive loss at solar current densities, the constituent cells. Here we present the generalized conditions for design of efficient graded recombination layer solar devices. We report the number of interlayers and the requirements on work function and doping of each interlayer, to bridge an work function difference as high as 1.6 eV. We also find solutions that minimize the doping required of the interlayers in order to minimize optical absorption due to free carriers in the graded recombination layer (GRL). We demonstrate a family of new GRL designs experimentally and highlight the benefits of the progression of dopings and work functions in the interlayers. © 2012 American Chemical Society.

  15. Recombinant expression systems for allergen vaccines. (United States)

    Singh, Mohan B; Bhalla, Prem L


    Allergen immunotherapy of future is likely to be based on allergy vaccines that contain engineered allergens modified to abolish or substantially reduce their IgE-binding activity in order to remove the risk of unwanted anaphylactic responses. The development of efficient systems for the production of recombinant allergens in sufficient quantities is requirement for establishing use of engineered allergens as components of allergy vaccines. This review outlines relative advantages and disadvantages of various heterologous systems for production of recombinant allergens. Microbial systems are most convenient and cost effective platforms for the production of recombinant allergens. However, lack of post-translational processing implies that some allergens have to be expressed in eukaryotic systems for proper folding and post-translational modifications such as glycosylation. Yeast systems can yield high levels of recombinant allergens but often are associated with hyper- glycosylation problems. Mammalian cell culture systems offer suitable post -translational modifications but are nearly hundred fold more expensive than microbial systems. The use of plants as bio-factories for production of recombinant allergens is emerging as a very attractive option as plants-based production system offer several advantages over other expression systems such as post translational processing of proteins, low production costs, scale up ability and enhanced safety due to absence of animal or human pathogens.

  16. Human immunodeficiency virus type 1 specific cytotoxic T lymphocyte responses in Chinese infected with HIV-1 B'/C Recombinant (CRF07_BC

    Directory of Open Access Journals (Sweden)

    Yu Xu G


    Full Text Available Abstract Background The characterization of HIV-1-specific T cell responses in people infected with locally circulating HIV-1 strain will facilitate the development of HIV-1 vaccine. Sixty intravenous drug users infected with HIV-1 circulating recombinant form 07_BC (CRF07_BC, which has been spreading rapidly in western China from north to south, were recruited from Xinjiang, China to assess the HIV-1-specific T cell responses at single peptide level with overlapping peptides (OLP covering the whole concensus clades B and C proteome. Results The median of the total magnitude and total number of OLPs recognized by CTL responses were 10925 SFC/million PBMC and 25 OLPs, respectively, when tested by clade C peptides, which was significantly higher than when tested by clade B peptides. The immunodominant regions, which cover 14% (58/413 of the HIV-1 proteome, are widely distributed throughout the HIV-1 proteome except in Tat, Vpu and Pol-PR, with Gag, Pol-RT, Pol-Int and Nef being most frequently targeted. The subdominant epitopes are mostly located in p24, Nef, integrase, Vpr and Vif. Of the responses directed to clade C OLPs, 61.75% (972/1574 can be observed when tested with corresponding clade B OLPs. However, Pol-PR and Vpu tend to be targeted in the clade B sequence rather than the clade C sequence, which is in line with the recombinant pattern of CRF07_BC. Stronger and broader CTL responses in subjects with CD4 cell counts ranging from 200 to 400/mm3 were observed when compared to those with less than 200/mm3 or more than 400/mm3, though there have been no significant correlations identified between the accumulative CTL responses or overall breadth and CD4 cell count or plasma viral load. Conclusion This is the first study conducted to comprehensively address T cell responses in Chinese subjects infected with HIV-1 CRF07_BC in which subtle differences in cross-reactivity were observed, though similar patterns of overall immune responses were

  17. Development Strategies for Rural Key Circulation Service Network

    Institute of Scientific and Technical Information of China (English)


    The rural key circulation service network is an important channel for ensuring agricultural products’entry to market and urban industrial products’entry to rural areas.Through in-depth survey and research,we took a look at development changes and current situations of three circulation service networks,namely,circulation of nondurable consumer goods,circulation of agricultural means of production,and circulation of agricultural products.Based on several key problems in rural circulation service network,such as logistics problem,delivery problem,backward transaction mode,and the last kilometer information,we put forward corresponding development countermeasures.

  18. Cleavage of recombinant proteins at poly-His sequences by Co(II) and Cu(II)


    Andberg, Martina; Jäntti, Jussi; Heilimo, Sara; Pihkala, Päivi; Paananen, Arja; Koskinen, Ari M P; Söderlund, Hans; Linder, Markus B


    Improved ways to cleave peptide chains at engineered sites easily and specifically would form useful tools for biochemical research. Uses of such methods include the activation or inactivation of enzymes or the removal of tags for enhancement of recombinant protein expression or tags used for purification of recombinant proteins. In this work we show by gel electrophoresis and mass spectroscopy that salts of Co(II) and Cu(II) can be used to cleave fusion proteins specifically at sites where s...

  19. Long non-coding RNAs are major contributors to transcriptome changes in sunflower meiocytes with different recombination rates


    Flórez-Zapata, Nathalia M. V.; Reyes-Valdés, M. Humberto; Martínez, Octavio


    Background Meiosis is a form of specialized cell division that marks the transition from diploid meiocyte to haploid gamete, and provides an opportunity for genetic reassortment through recombination. Experimental data indicates that, relative to their wild ancestors, cultivated sunflower varieties show a higher recombination rate during meiosis. To better understand the molecular basis for this difference, we compared gene expression in male sunflower meiocytes in prophase I isolated from a ...

  20. Triple-Helix Formation Induces Recombination in Mammalian Cells via a Nucleotide Excision Repair-Dependent Pathway


    Faruqi, A. Fawad; Datta, Hirock J.; Carroll, Dana; Seidman, Michael M.; Glazer, Peter M.


    The ability to stimulate recombination in a site-specific manner in mammalian cells may provide a useful tool for gene knockout and a valuable strategy for gene therapy. We previously demonstrated that psoralen adducts targeted by triple-helix-forming oligonucleotides (TFOs) could induce recombination between tandem repeats of a supF reporter gene in a simian virus 40 vector in monkey COS cells. Based on work showing that triple helices, even in the absence of associated psoralen adducts, are...

  1. Derivation of revised formulae for eddy viscous forces used in the ocean general circulation model (United States)

    Chou, Ru Ling


    Presented is a re-derivation of the eddy viscous dissipation tensor commonly used in present oceanographic general circulation models. When isotropy is imposed, the currently-used form of the tensor fails to return to the laplacian operator. In this paper, the source of this error is identified in a consistent derivation of the tensor in both rectangular and earth spherical coordinates, and the correct form of the eddy viscous tensor is presented.

  2. Application of PDCA circulation in quality control for production of steam generator pipe

    International Nuclear Information System (INIS)

    PDCA Circulation (Plan, Do, Check, Action) is applied in quality-control management during the welding process of Titanium alloy steam generator pipe. The weld defects is controlled effectively and the ratio of certified weld rose steadily, which achieve its target (90%). Experiments and engineering application show that, if the process-control could be carried out according to the PDCA circulation, activity which affect quality could be ensured to be controlled effectively without being omitted, and finally, steadily and dependable manufacture techniques could be formed so that the quality of products can be improved perpetually. (authors)

  3. Evaluation of a research circulation control airfoil using Navier-Stokes methods (United States)

    Shrewsbury, George D.


    The compressible Reynolds time averaged Navier-Stokes equations were used to obtain solutions for flows about a two dimensional circulation control airfoil. The governing equations were written in conservation form for a body-fitted coordinate system and solved using an Alternating Direction Implicit (ADI) procedure. A modified algebraic eddy viscosity model was used to define the turbulent characteristics of the flow, including the wall jet flow over the Coanda surface at the trailing edge. Numerical results are compared to experimental data obtained for a research circulation control airfoil geometry. Excellent agreement with the experimental results was obtained.

  4. Densified waste form and method for forming

    Energy Technology Data Exchange (ETDEWEB)

    Garino, Terry J.; Nenoff, Tina M.; Sava Gallis, Dorina Florentina


    Materials and methods of making densified waste forms for temperature sensitive waste material, such as nuclear waste, formed with low temperature processing using metallic powder that forms the matrix that encapsulates the temperature sensitive waste material. The densified waste form includes a temperature sensitive waste material in a physically densified matrix, the matrix is a compacted metallic powder. The method for forming the densified waste form includes mixing a metallic powder and a temperature sensitive waste material to form a waste form precursor. The waste form precursor is compacted with sufficient pressure to densify the waste precursor and encapsulate the temperature sensitive waste material in a physically densified matrix.

  5. Densified waste form and method for forming

    Energy Technology Data Exchange (ETDEWEB)

    Garino, Terry J.; Nenoff, Tina M.; Sava Gallis, Dorina Florentina


    Materials and methods of making densified waste forms for temperature sensitive waste material, such as nuclear waste, formed with low temperature processing using metallic powder that forms the matrix that encapsulates the temperature sensitive waste material. The densified waste form includes a temperature sensitive waste material in a physically densified matrix, the matrix is a compacted metallic powder. The method for forming the densified waste form includes mixing a metallic powder and a temperature sensitive waste material to form a waste form precursor. The waste form precursor is compacted with sufficient pressure to densify the waste precursor and encapsulate the temperature sensitive waste material in a physically densified matrix.

  6. A Global Jet/Circulation Model for Young Stars

    CERN Document Server

    Lery, T; Fiege, J D; Ray, T P; Frank, A; Bacciotti, F


    Powerful, highly collimated jets, surrounded by bipolar molecular outflows, are commonly observed near Young Stellar Objects (YSOs). In the usual theoretical picture of star formation, a jet is ejected from a magnetized accretion disk, with a molecular outflow being driven either by the jet or by a wider wind coming from the disk. Here, we propose an alternative global model for the flows surrounding YSOs. In addition to a central accretion-ejection engine driving the jet, the molecular outflow is powered by the infalling matter and follows a circulation pattern around the central object without necessarily being entrained by a jet. It is shown that the model produces a heated pressure-driven outflow with magneto-centrifugal acceleration and collimation. We report solutions for the three different parts of this self-similar model, i.e. the jet, the infalling envelope and the circulating matter that eventually forms the molecular outflow. This new picture of the accretion/outflow phase provides a possible expl...

  7. Circulating RNA Molecules as Biomarkers in Liver Disease (United States)

    Enache, Liviu S.; Enache, Elena L.; Ramière, Christophe; Diaz, Olivier; Bancu, Ligia; Sin, Anca; André, Patrice


    Liver disease is a major cause of morbidity and mortality worldwide. As in other fields of medicine, there is a stringent need for non-invasive markers to improve patient diagnostics, monitoring and prognostic ability in liver pathology. Cell-free circulating RNA molecules have been recently acknowledged as an important source of potential medical biomarkers. However, many aspects related to the biology of these molecules remain to be elucidated. In this review, we summarize current concepts related to the origin, transportation and possible functions of cell-free RNA. We outline current development of extracellular RNA-based biomarkers in the main forms of non-inherited liver disease: chronic viral hepatitis, hepatocellular carcinoma, non-alcoholic fatty liver, hepato-toxicity, and liver transplantation. Despite recent technological advances, the lack of standardization in the assessment of these markers makes their adoption into clinical practice difficult. We thus finally review the main factors influencing quantification of circulating RNA. These factors should be considered in the reporting and interpretation of current findings, as well as in the proper planning of future studies, to improve reliability and reproducibility of results. PMID:25272224

  8. Purification and crystallization of human Cu/Zn superoxide dismutase recombinantly produced in the protozoan Leishmania tarentolae

    International Nuclear Information System (INIS)

    The structures of two new crystal forms of human Cu/Zn superoxide dismutase produced in the eukaryotic expression host L. tarentolae are reported. The rapid and inexpensive production of high-quality eukaryotic proteins in recombinant form still remains a challenge in structural biology. Here, a protein-expression system based on the protozoan Leishmania tarentolae was used to produce human Cu/Zn superoxide dismutase (SOD1) in recombinant form. Sequential integration of the SOD1 expression cassettes was demonstrated to lead to a linear increase in expression levels to up to 30 mg per litre. Chromatographic purification resulted in 90% pure recombinant protein, with a final yield of 6.5 mg per litre of culture. The protein was crystallized and the structures of two new crystal forms were determined. These results demonstrate the suitability of the L. tarentolae expression system for structural research

  9. Rabbit Hemorrhagic Disease Virus Variant Recombinant VP60 Protein Induces Protective Immunogenicity. (United States)

    Yang, Dong-Kun; Kim, Ha-Hyun; Nah, Jin-Ju; Song, Jae-Young


    Rabbit hemorrhagic disease virus (RHDV) is highly contagious and often causes fatal disease that affects both wild and domestic rabbits of the species Oryctolagus cuniculus. A highly pathogenic RHDV variant (RHDVa) has been circulation in the Korean rabbit population since 2007 and has a devastating effect on the rabbit industry in Korea. A highly pathogenic RHDVa was isolated from naturally infected rabbits, and the gene encoding the VP60 protein was cloned into a baculovirus transfer vector and expressed in insect cells. The hemagglutination titer of the Sf-9 cell lysate infected with recombinant VP60 baculovirus was 131,072 units/50 μl and of the supernatant 4,096 units/50 μl. Guinea pigs immunized twice intramuscularly with a trial inactivated RHDVa vaccine containing recombinant VP60 contained 2,152 hemagglutination inhibition (HI) geometric mean titers. The 8-week-old white rabbits inoculated with one vaccine dose were challenged with a lethal RHDVa 21 days later and showed 100% survival rates. The recombinant VP60 protein expressed in a baculovirus system induced high HI titers in guinea pigs and rendered complete protection, which led to the development of a novel inactivated RHDVa vaccine. PMID:26198122

  10. Synthesis, purification, and characterization of an Arg152 → Glu site-directed mutant of recombinant human blood clotting factor VII

    International Nuclear Information System (INIS)

    Coagulation factor VII circulates in blood as a single-chain zymogen of a serine protease and is converted to its activated two-chain form, factor VIIa, by cleavage of an internal peptide bond located at Arg152-Ile153. Previous studies using serine protease active-site inhibitors suggest that zymogen factor VII may possess sufficient proteolytic activity to initiate the extrinsic pathway of blood coagulation. In order to assess the putative intrinsic proteolytic activity of single-chain factor VII, the authors have constructed a site-specific mutant of recombinant human factor VII in which arginine-152 has been replaced with a glutamic acid residue. Mutant factor VII was purified in a single step from culture supernatants of baby hamster kidney cells transfected with a plasmid containing the sequence for Arg152 → Glu factor VII using a calcium-dependent, murine anti-factor VII monoclonal antibody column. The clotting activity of mutant factor VII was completely inhibited following incubation with dansyl-Glu-Gly-Arg chloromethyl ketone, suggesting that the apparent clotting activity of mutant factor VII was due to a contaminating serine protease. Immunoblots of mutant factor VII with human factor IXa revealed no cleavage, whereas incubation of mutant factor VII with human factor Xa resulted in cleavage of mutant factor VII and the formation of a lower molecular weight degradation product migrating at Mr∼40 000. The results are consistent with the proposal that zymogen factor VII possesses no intrinsic proteolytic activity toward factor X or factor IX

  11. Warm World Ocean Thermohaline Circulation Model (United States)

    Zimov, N.; Zimov, S. A.


    Modern day ocean circulation is dominated by thermal convection with cold waters subsiding in the Northern Atlantic, filling the ocean interior with cold and heavy water. However, ocean circulation diminished during the last glaciation and consequently the downwelling of the cold. Therefore interior ocean water temperatures must have been affected by other mechanisms which are negligible in the current state. We propose that the submergence of highly saline water from warm seas with high rates of evaporation (like the Red or Mediterranean Sea) was a major factor controlling ocean circulation during the last glaciation. Even today, waters in these poorly connected seas are the heaviest waters in the World ocean (1.029 g/cm3). The second mechanism affecting ocean temperature is the geothermal heat flux. With no heat exchange between the atmosphere and the ocean, geothermal heat flux through the ocean floor is capable of increasing ocean temperature by tens of degrees C over a 100 thousand year glacial cycle. To support these hypotheses we present an ocean box model that describes thermohaline circulation in the World Ocean. According to the model parameters, all water circulation is driven by the water density gradient. Boxes include high-latitude seas, high salinity seas, surface ocean, glaciers, and rift and lateral zones of the ocean interior. External heat sources are radiative forcing, affected by Milankovich cycles, and geothermal heat flux. Additionally this model accounts for the heat produced by organic rain decay. Taking all input parameters close to currently observed values, the model manages to recreate the glacial-interglacial cycles. During the glacial periods only haline circulation takes place, the ocean is strongly stratified, and the interior ocean accumulates heat while high-latitudes accumulate ice. 112,000 years after glaciation starts, water density on the ocean bottom becomes equal to the density of water in high-latitude seas, strong thermal

  12. Phylogenetic Studies of the Three RNA Silencing Suppressor Genes of South American CTV Isolates Reveal the Circulation of a Novel Genetic Lineage

    Directory of Open Access Journals (Sweden)

    María José Benítez-Galeano


    Full Text Available Citrus Tristeza Virus (CTV is the most economically important virus of citrus worldwide. Genetic diversity and population structure of CTV isolates from all citrus growing areas from Uruguay were analyzed by RT-PCR and cloning of the three RNA silencing suppressor genes (p25, p20 and p23. Bayesian phylogenetic analysis revealed the circulation of three known genotypes (VT, T3, T36 in the country, and the presence of a new genetic lineage composed by isolates from around the world, mainly from South America. Nucleotide and amino acid identity values for this new genetic lineage were both higher than 97% for the three analyzed regions. Due to incongruent phylogenetic relationships, recombination analysis was performed using Genetic Algorithms for Recombination Detection (GARD and SimPlot software. Recombination events between previously described CTV isolates were detected. High intra-sample variation was found, confirming the co-existence of different genotypes into the same plant. This is the first report describing: (1 the genetic diversity of Uruguayan CTV isolates circulating in the country and (2 the circulation of a novel CTV genetic lineage, highly present in the South American region. This information may provide assistance to develop an effective cross-protection program.

  13. Phylogenetic Studies of the Three RNA Silencing Suppressor Genes of South American CTV Isolates Reveal the Circulation of a Novel Genetic Lineage. (United States)

    Benítez-Galeano, María José; Rubio, Leticia; Bertalmío, Ana; Maeso, Diego; Rivas, Fernando; Colina, Rodney


    Citrus Tristeza Virus (CTV) is the most economically important virus of citrus worldwide. Genetic diversity and population structure of CTV isolates from all citrus growing areas from Uruguay were analyzed by RT-PCR and cloning of the three RNA silencing suppressor genes (p25, p20 and p23). Bayesian phylogenetic analysis revealed the circulation of three known genotypes (VT, T3, T36) in the country, and the presence of a new genetic lineage composed by isolates from around the world, mainly from South America. Nucleotide and amino acid identity values for this new genetic lineage were both higher than 97% for the three analyzed regions. Due to incongruent phylogenetic relationships, recombination analysis was performed using Genetic Algorithms for Recombination Detection (GARD) and SimPlot software. Recombination events between previously described CTV isolates were detected. High intra-sample variation was found, confirming the co-existence of different genotypes into the same plant. This is the first report describing: (1) the genetic diversity of Uruguayan CTV isolates circulating in the country and (2) the circulation of a novel CTV genetic lineage, highly present in the South American region. This information may provide assistance to develop an effective cross-protection program. PMID:26205407

  14. Comparison of recombination models in organic bulk heterojunction solar cells

    International Nuclear Information System (INIS)

    Recombination in bulk-heterojunction (BHJ) organic solar cells is the key loss mechanism, and it directly affects characteristic parameters such as power conversion efficiency, short-circuit current, open-circuit voltage, and fill factor. However, which recombination mechanism dominates the loss in organic materials is unclear at present. In this work, we simulate state-of-art BHJ solar cells using five recombination models, including direct recombination, Langevin recombination, charge transfer state recombination, trap-assisted recombination, and recombination via tail. All processes are strongly dependent on charge carrier mobility and exhibit a similar recombination distribution in active layer. For high mobilities, all models present a similar behavior along with the increased mobilities, whereas, there are slight differences in open-circuit voltage between trap/tail model and other ones at lower mobilities, resulting from the interaction between photo-carriers and dark-carriers

  15. No evidence of circulating autoantibodies against osteoprotegerin in patients with celiac disease

    Institute of Scientific and Technical Information of China (English)

    Tiziana Larussa; Evelina Suraci; Immacolata Nazionale; Isabella Leone; Tiziana Montalcini; Ludovico Abenavoli; Maria Imeneo


    AIM:To investigate risk factors for low bone mineral density (BMD) in celiac disease (CD) patients,focusing on circulating autoantibodies against osteoprotegerin (OPG).METHODS:Seventy asymptomatic CD adult patients on gluten-free diet (GFD) and harbouring persistent negative CD-related serology were recruited.Conventional risk factors for osteoporosis (e.g.,age,sex,menopausal status,history of fractures,smoke,and body mass index) were checked and BMD was assessed by dual energy X ray absorptiometry.Serum calcium and parathyroid hormone (PTH) levels were evaluated.Thirty-eight patients underwent repeat duodenal biopsy.Serum samples from a selected sub-group of 30 patients,who were also typed for human leukocyte antigen (HLA) DQ2 and DQ8 haplotype,were incubated with homodimeric recombinant human OPG and tested by western blotting with an anti-OPG antibody after immunoprecipitation.RESULTS:Despite persistent negative CD-related serology and strict adherence to GFD,49 out of the 70 (74%) patients displayed low BMD.Among these patients,13 (24%) showed osteoporosis and 36 (76%)osteopenia.With the exception of age,conventional risk factors for osteoporosis did not differ between patients with normal and low BMD.Circulating serum calcium and PTH levels were normal in all patients.Duodenal mucosa healing was found in 31 (82%) out of 38 patients who underwent repeat duodenal biopsy with 20 (64%) still displaying low BMD.The remaining 7 patients had an incomplete normalization of duodenal mucosa with 6 (84%) showing low BMD.No evidence of circulating antibodies against OPG was found in the serum of 30 celiac patients who were tested for,independent of BMD,duodenal histology,and HLA status.CONCLUSION:If any,the role of circulating autoantibodies against OPG in the pathogenesis of bone derangement in patients with CD is not a major one.

  16. Probabilistic divergence measures for detecting interspecies recombination. (United States)

    Husmeier, D; Wright, F


    This paper proposes a graphical method for detecting interspecies recombination in multiple alignments of DNA sequences. A fixed-size window is moved along a given DNA sequence alignment. For every position, the marginal posterior probability over tree topologies is determined by means of a Markov chain Monte Carlo simulation. Two probabilistic divergence measures are plotted along the alignment, and are used to identify recombinant regions. The method is compared with established detection methods on a set of synthetic benchmark sequences and two real-world DNA sequence alignments.

  17. Thermal Recombination: Beyond the Valence Quark Approximation

    CERN Document Server

    Müller, B; Bass, S A


    Quark counting rules derived from recombination models agree well with data on hadron production at intermediate transverse momenta in relativistic heavy-ion collisions. They convey a simple picture of hadrons consisting only of valence quarks. We discuss the inclusion of higher Fock states that add sea quarks and gluons to the hadron structure. We show that, when recombination occurs from a thermal medium, hadron spectra remain unaffected by the inclusion of higher Fock states. However, the quark number scaling for elliptic flow is somewhat affected. We discuss the implications for our understanding of data from the Relativistic Heavy Ion Collider.

  18. SIR epidemics in monogamous populations with recombination

    CERN Document Server

    Zanette, Damián H


    We study the propagation of an SIR (susceptible-infectious-recovered) disease over an agent population which, at any instant, is fully divided into couples of agents. Couples are occasionally allowed to exchange their members. This process of couple recombination can compensate the instantaneous disconnection of the interaction pattern and thus allow for the propagation of the infection. We study the incidence of the disease as a function of its infectivity and of the recombination rate of couples, thus characterizing the interplay between the epidemic dynamics and the evolution of the population's interaction pattern.

  19. Effects of farmer social status and plant biocultural value on seed circulation networks in Vanuatu

    Directory of Open Access Journals (Sweden)

    Mathieu Thomas


    Full Text Available Seed circulation among farmers, which is embedded in composite social networks, is a key process in the dynamics of seed systems that shape crop diversity. We analyzed the daily circulation of biological objects, i.e., cultivated plants (31 species, 284 landraces, within a community of first-generation migrants (16 households, 30 persons living on the island of Vanua Lava in the South Pacific archipelago nation of Vanuatu. By combining participant observation, ethnobiological inventories, and social network analysis, we investigated how farmer social status and plant biocultural value affect plant circulation. Plant biocultural value was estimated by referring to their local classification according to uses, cultivation practices, growing environments, and biological properties. An aggregate plant circulation network (577 events and three subnetworks (i.e., for starchy, side dish, or snack food categories sharing the same 30 nodes were analyzed using exponential random graph models. Evidence that farmer social status influences the patterns of plant circulation was found through the distribution of structural parameters of the network, including: dyadic reciprocity; in-degree, out-degree, and their correlation; triadic cycling; and transitivity. At the scale of the aggregate network, direct or indirect reciprocity was not observed. Instead, a high out-degree (i.e., being a more frequent giver and a negative correlation between in-degree and out-degree both confer prestige and reinforce hierarchy. These results suggest that some of the social dynamics of the Melanesian-type Big Man political system may persist, even though the system itself no longer exists in traditional form. Moreover, based on our comparative analysis of the three subnetworks, farmer social status appears to influence greatly the circulation of plants with high biocultural value while having little influence on plants with low biocultural value. Farmer social status and plant

  20. Simulation and analysis of the mesoscale circulation in the northwestern Mediterranean Sea

    Directory of Open Access Journals (Sweden)

    V. Echevin

    Full Text Available The large-scale and mesoscale circulation of the northwestern Mediterranean Sea are simulated with an eddy-resolving primitive-equation regional model (RM of 1/16° resolution embedded in a general circulation model (GM of the Mediterranean Sea of 1/8° resolution. The RM is forced by a monthly climatology of heat fluxes, precipitation and wind stress. The GM, which uses the same atmospheric forcing, provides initial and boundary conditions for the RM. Analysis of the RM results shows that several realistic features of the large-scale and mesoscale circulation are evident in this region. The mean cyclonic circulation is in good agreement with observations. Mesoscale variability is intense along the coasts of Sardinia and Corsica, in the Gulf of Lions and in the Catalan Sea. The length scales of the Northern Current meanders along the Provence coast and in the Gulf of Lions’ shelf are in good agreement with observations. Winter Intermediate Water is formed along most of the north-coast shelves, between the Gulf of Genoa and Cape Creus. Advection of this water by the mean cyclonic circulation generates a complex eddy field in the Catalan Sea. Intense anticyclonic eddies are generated northeast of the Balearic Islands. These results are in good agreement with mesoscale activity inferred from satellite altimetric data. This work demonstrates the feasibility of a down-scaling system composed of a general-circulation, a regional and a coastal model, which is one of the goals of the Mediterranean Forecasting System Pilot Project.

    Key words. Oceanography: physical (currents; eddies and mesoscale processes; general circulation

  1. Meridional Circulation From Differential Rotation in an Adiabatically Stratified Solar/Stellar Convection Zone

    CERN Document Server

    Dikpati, Mausumi


    Meridional circulation in stellar convection zones is not generally well observed, but may be critical for MHD dynamos. Coriolis forces from differential rotation (DR) play a large role in determining what the meridional circulation is. Here we consider whether a stellar DR that is constant on cylinders concentric with the rotation axis can drive a meridional circulation.Conventional wisdom says that it can not. Using two related forms of governing equations that respectively estimate the longitudinal components of the curl of meridional mass flux and the vorticity, we show that such DR will drive a meridional flow. This is because to satisfy anelastic mass conservation, non-spherically symmetric pressure contours must be present for all DRs, not just ones that depart from constancy on cylinders concentric with the rotation axis. Therefore the fluid is always baroclinic if DR is present, because, in anelastic systems, the perturbation pressure must satisfy a Poisson type equation, as well as an equation of st...

  2. Differential rotation in a solar-driven quasi-axisymmetric circulation. [of planetary atmospheres (United States)

    Mayr, H. G.; Harris, I.; Chan, K. L.


    The concept of a quasi-axisymmetric circulation is used to explore the global scale dynamics of planetary atmospheres. A numerical circulation model applicable to Jupiter is presented, and an analytical study is performed elucidating the conditions leading to differential rotation in an atmosphere which is convectively unstable. A linear system forced by solar differential heating is considered, with nonlinear effects arising from advection being represented in the form of eddy diffusion. An empirical, latitudinal spectrum of the observed zonal wind field on Jupiter is discussed. Numerical solutions are presented which reveal banded wind fields with alternating and equatorial zonal jets and a multicellular Ferrel-Thomson meridional circulation consistent with the observed cloud striations on Jupiter. The vertical derivatives are parameterized to construct a simplified one-layer model.

  3. Numerical method for studying the circulation patterns of a fluid in a cavity

    International Nuclear Information System (INIS)

    The method incorporates three circulation-inducing mechanisms: (1) buoyancy induced by nonuniform initial distribution of heat throughout the fluid, (2) buoyancy induced by removal of heat from the fluid, and (3) forced convection induced by withdrawal of heated fluid and return of cooled fluid. A two-dimensional computer program, CIRCO, based on the Marker-and-Cell (MAC) technique, is used to study the circulation patterns. The report discusses the code and illustrates its capabilities by means of examples from studies conducted for the Pacer project, which investigates the concept of producing electrical power from energy released by thermonuclear explosions in a salt dome. Efficient engineering for withdrawing energy from the cavity requires an understanding of the circulation patterns of the heated fluid. CIRCO provides this information in the form of computer-generated plots

  4. Silent Circulation of Ross River Virus in French Polynesia

    Directory of Open Access Journals (Sweden)

    Maite Aubry


    Discussion: Our results support the existence of autochthonous RRV transmission and suggest that this pathogen has silently circulated in French Polynesia. These findings raise the question of possible undetected circulation of RRV in other Pacific Island Countries and Territories.

  5. Species association of hepatitis B virus (HBV in non-human apes; evidence for recombination between gorilla and chimpanzee variants.

    Directory of Open Access Journals (Sweden)

    Sinéad Lyons

    Full Text Available Hepatitis B virus (HBV infections are widely distributed in humans, infecting approximately one third of the world's population. HBV variants have also been detected and genetically characterised from Old World apes; Gorilla gorilla (gorilla, Pan troglodytes (chimpanzee, Pongo pygmaeus (orang-utan, Nomascus nastusus and Hylobates pileatus (gibbons and from the New World monkey, Lagothrix lagotricha (woolly monkey. To investigate species-specificity and potential for cross species transmission of HBV between sympatric species of apes (such as gorillas and chimpanzees in Central Africa or between humans and chimpanzees or gorillas, variants of HBV infecting captive wild-born non-human primates were genetically characterised. 9 of 62 chimpanzees (11.3% and two from 11 gorillas (18% were HBV-infected (15% combined frequency, while other Old world monkey species were negative. Complete genome sequences were obtained from six of the infected chimpanzee and both gorillas; those from P. t .ellioti grouped with previously characterised variants from this subspecies. However, variants recovered from P. t. troglodytes HBV variants also grouped within this clade, indicative of transmission between sub-species, forming a paraphyletic clade. The two gorilla viruses were phylogenetically distinct from chimpanzee and human variants although one showed evidence for a recombination event with a P.t.e.-derived HBV variant in the partial X and core gene region. Both of these observations provide evidence for circulation of HBV between different species and sub-species of non-human primates, a conclusion that differs from the hypothesis if of strict host specificity of HBV genotypes.

  6. Complete genome sequence of a coxsackievirus B3 recombinant isolated from an aseptic meningitis outbreak in eastern China. (United States)

    Zhang, Wenqiang; Lin, Xiaojuan; Jiang, Ping; Tao, Zexin; Liu, Xiaolin; Ji, Feng; Wang, Tongzhan; Wang, Suting; Lv, Hui; Xu, Aiqiang; Wang, Haiyan


    Coxsackievirus B3 (CV-B3) has frequently been associated with aseptic meningitis outbreaks in China. To identify sequence motifs related to aseptic meningitis and to construct an infectious clone, the genome sequence of 08TC170, a representative strain isolated from cerebrospinal fluid (CSF) samples from an outbreak in Shandong in 2008, was determined, and the coding regions for P1-P3 and VP1 were aligned. The first 21 and last 20 residues were "TTAAAACAGCCTGTGGGTTGT" and "ATTCTCCGCATTCGGTGCGG", respectively. The whole genome consisted of 7401 nucleotides, sharing 80.8 % identity with the prototype strain Nancy and low sequence similarity with members of clusters A-C. In contrast, 08TC170 showed high sequence similarity to members of cluster D. An especially high level of sequence identity (≥97.7 %) was found within a branch constituted by 08TC170 and four Chinese strains that clustered together in all of the P1-P3 phylogenic trees. In addition, 08TC170 also possessed a close relationship to the Hong Kong strain 26362/08 in VP1. Similarity plot analysis showed that 08TC170 was most similar to the Chinese CV-B3 strain SSM in P1 and the partial P2 coding region but to the CV-B5 or E-6 strain in 2C and following regions. A T277A mutation was found in 08TC170 and other strains isolated in 2008-2010, but not in strains isolated before 2008, which had high sequence similarity and formed the cluster A277. The results suggested that 08TC170 was the product of both intertypic recombination and point mutation, whose effects on viral neurovirulence will be investigated in a further study. The high homology between 08TC170 and other strains revealed their co-circulation in mainland China and Hong Kong and indicates that further surveillance is needed. PMID:27236460

  7. Anti-cyclonic circulation driven by the estuarine circulation in a gulf type ROFI (United States)

    Fujiwara, T.; Sanford, L. P.; Nakatsuji, K.; Sugiyama, Y.


    Baroclinic residual circulation processes are examined in gulf type Regions Of Freshwater Influence (ROFIs), which have large rivers discharging into a rounded head wider than the Rossby internal deformation radius. Theoretical and observational investigations concentrate on Ise Bay, Japan, with supporting data from Osaka Bay and Tokyo Bay. Simplified analytical solutions are derived to describe the primary features of the circulation. Three dimensional residual current data collected using moored current meters and shipboard acoustic doppler current profilers (ADCPs), satellite imagery and density structure data observed using STDs, are presented for comparison to the theoretical predictions. There are three key points to understanding the resulting circulation in gulf type ROFIs. First, there are likely to be three distinct water masses: the river plume, a brackish upper layer, and a higher salinity lower layer. Second, baroclinic processes in gulf type ROFIs are influenced by the Earth's rotation at first order. Residual currents are quasi-geostrophic and potential vorticity is approximately conserved. Third, the combined effects of a classical longitudinal estuarine circulation and the Earth's rotation are both necessary to produce the resulting circulation. Anti-cyclonic vorticity is generated in the upper layer by the horizontal divergence associated with upward entrainment, which is part of the estuarine circulation. The interaction between anti-cyclonic vorticity and horizontal divergence results in two regions of qualitatively different circulation, with gyre-like circulation near the bay head and uniformly seaward anti-cyclonicly sheared flow further towards the mouth. The stagnation point separating the two regions is closer to (further away from) the bay head for stronger (weaker) horizontal divergence, respectively. The vorticity and spin-up time of this circulation are-(ƒ-ω 1)/2 and h/2w 0, respectively, where ƒ is the Coriolis parameter, ω 1 is

  8. Circulating low IL-23: IL-35 cytokine ratio promotes progression associated with poor prognosisin breast cancer. (United States)

    Chen, Guanghui; Liang, Yanfang; Guan, Xin; Chen, Hui; Liu, Qiankun; Lin, Bihua; Chen, Can; Huang, Mingyuan; Chen, Jianan; Wu, Weiquan; Liang, Yi; Zhou, Keyuan; Zeng, Jincheng


    The interleukin (IL)-12 family, composed of heterodimeric cytokines including IL-12 (formed by IL-12p35 and IL-12p40 subunits), IL-23 (formed by IL-23p19 and IL-12p40 subunits), IL-27 (formed by IL-27p28 and EBI3 subunits) and IL-35 (formed by IL-12p35 and EBI3 subunits), establishes a link between innate and adaptive immunity that involves different immune effector cells and cytokines to tumors. However, the role of IL-12 family in breast cancer (BC) progression and prognosis remains unclear. In the present study, we demonstrated evidence indicating that EBI3, IL-12p35 and IL-12p40 but not IL-23p19 or IL-27p28 were highly expressed in BC tissues, suggested that tumor derived EBI3, IL-12p35 and IL-12p40 were associated with tumor progression. Circulating IL-12 and IL-23 low expressed, but IL-27 and IL-35 high expressed in BC patients, especially circulating IL-23 associated with IL-35 to mediate BC tumor resection. Ki-67, p53 and EGFR expression on BC tissues, as well as CA125, CA153 and CA199 levels on BC bloods increased when circulating IL-23: IL-35 ratio decreased. Together, for the first time, our data suggest that circulating IL-23: IL-35 ratio may be an important indicator association with BC progression and prognosis. However, further research should be carried out to assess the implications of circulating IL-23: IL-35 ratio in a larger sample size.

  9. Formation and plasma circulation of solar prominences

    CERN Document Server

    Xia, Chun


    Solar prominences are long-lived cool and dense plasma curtains in the hot and rarefied outer solar atmosphere or corona. The physical mechanism responsible for their formation and especially for their internal plasma circulation has been uncertain for decades. The observed ubiquitous down flows in quiescent prominences are difficult to interpret as plasma with high conductivity seems to move across horizontal magnetic field lines. Here we present three-dimensional numerical simulations of prominence formation and evolution in an elongated magnetic flux rope as a result of in-situ plasma condensations fueled by continuous plasma evaporation from the solar chromosphere. The prominence is born and maintained in a fragmented, highly dynamic state with continuous reappearance of multiple blobs and thread structures that move mainly downward dragging along mass-loaded field lines. The prominence plasma circulation is characterized by the dynamic balance between the drainage of prominence plasma back to the chromos...

  10. [William Harvey, discoverer of the blood circulation]. (United States)

    v Mühlendahl, K E


    William Harvey (1578-1657), living at the turn to modern times, scientifically speaking, was an eminent physician and scientist. He developed the concept of the circulation of the blood and his findings have proved to be correct in nearly all details to this day. He published his physiological findings and interpretations in a small, albeit epoch-making, volume: Exercitatio anatomica de motu cordis et sanguinis in animalibus, published in Frankfurt in 1628. On the occasion of the 350th anniversary of his death on June 3, 2007, this essay commemorates the work of this important physician, illustrating his brilliant conception of the blood circulation by quoting passages from De motu cordis et sanguinis.

  11. Modeling mesoscale circulation of the Black Sea (United States)

    Korotenko, K. A.


    An eddy-resolving (1/30)° version of the DieCAST low-dissipative model, adapted to the Black Sea circulation, is presented. Under mean climatological forcing, the model realistically reproduces major dominant large-scale and mesoscale structures of seasonal sea circulation, including the Rim Current, coastal anticyclonic eddies, mushroom currents, etc. Due to its extremely low dissipation and high resolution, the model makes it possible to trace the development of the baroclinic instability along the Turkish and Caucasian coasts, reproduce mesoscale structures generated by this mechanism, and assess the scales of these structures. The model also realistically reproduces short-term effects of bora winds on the evolution of subsurface layer structures.

  12. Meridional circulation in turbulent protoplanetary disks

    CERN Document Server

    Fromang, Sebastien; Masset, Frederic


    Based on viscous disk theory, a number of recent studies have suggested the existence of a large scale meridional circulation in protoplanetary disks. Such a flow could account for the presence of crystalline silicates, among which Calcium and Aluminium-rich Inclusions (CAIs), at large distances from the sun. This paper aims at examining whether such large scale flows exist in turbulent protoplanetary disks. High resolution global hydrodynamical and magnetohydrodynamical numerical simulations of turbulent protoplanetary disks are used to infer the properties of the flow in such disks. By performing hydrodynamic simulations using explicit viscosity, we demonstrate that our numerical setup does not suffer from any numerical artifact. The aforementioned meridional circulation is readily recovered in viscous and laminar disks. In MHD simulations, the magneto-rotational instability drives turbulence in the disks. Averaging out the turbulent fluctuations over long timescale, the results fail to show any large scale...

  13. Circulation control STOL aircraft design aspects (United States)

    Loth, John L.


    Since Davidson patented Circulation Control Airfoils in 1960, there have been only 2 aircraft designed and flown with circulation control (CC). Designing with CC is complex for the following reasons: the relation between lift increase and blowing momentum is nonlinear; for good cruise performance one must change the wing geometry in flight from a round to a sharp trailing edge. The bleed air from the propulsion engines or an auxiliary compressor, must be used efficiently. In designing with CC, the propulsion and control aspects are just as important as aerodynamics. These design aspects were examined and linearized equations are presented in order to facilitate a preliminary analysis of the performance potential of CC. The thrust and lift requirements for takeoff make the calculated runway length very sensitive to the bleed air ratio. Thrust vectoring improves performance and can offset nose down pitching moments. The choice of blowing jet to free stream velocity ratio determines the efficiency of applying bleed air power.

  14. The design of large natural circulation BWR's

    International Nuclear Information System (INIS)

    Boiling water reactors (BWR) with natural circulation are applied for capacities up to 60 MWe. Based on scale studies, however, it appears that larger production units are more efficient. It is recommended to investigate the bottlenecks in realizing larger reactors (>1000 MWe). The aim of the study on the title subject is to study to what extent the production capacity of BWRs with natural circulation can be increased. Based on data from the literature a simple analytic method has been chosen and existing BWR designs were compared. Capacities of 1300 MWe appear to be possible. These reactors will have a smaller pin diameter and a lower water supply temperature. Also steam separators with a minor pressure reduction must be available. The reliability of the stability measurement must be increased. Based on the results of this investigation the priorities for research on the design of future BWRs have been determined

  15. Genetically Encoded Voltage Indicators in Circulation Research. (United States)

    Kaestner, Lars; Tian, Qinghai; Kaiser, Elisabeth; Xian, Wenying; Müller, Andreas; Oberhofer, Martin; Ruppenthal, Sandra; Sinnecker, Daniel; Tsutsui, Hidekazu; Miyawaki, Atsushi; Moretti, Alessandra; Lipp, Peter


    Membrane potentials display the cellular status of non-excitable cells and mediate communication between excitable cells via action potentials. The use of genetically encoded biosensors employing fluorescent proteins allows a non-invasive biocompatible way to read out the membrane potential in cardiac myocytes and other cells of the circulation system. Although the approaches to design such biosensors date back to the time when the first fluorescent-protein based Förster Resonance Energy Transfer (FRET) sensors were constructed, it took 15 years before reliable sensors became readily available. Here, we review different developments of genetically encoded membrane potential sensors. Furthermore, it is shown how such sensors can be used in pharmacological screening applications as well as in circulation related basic biomedical research. Potentials and limitations will be discussed and perspectives of possible future developments will be provided.

  16. Posterior circulation revascularization to manage vertebrobasilar occlusion

    Directory of Open Access Journals (Sweden)

    SHANG Yan-guo


    Full Text Available Objective To discuss the technique and effect of posterior circulation revascularization to manage vertebrobasilar occlusion. Methods Nine patients with vertebrobasilar occlusion were treated by using occipital artery-posterior inferior cerebellar artery bypass, superficial temporal artery-superior cerebellar artery bypass, superficial temporal artery-posterior cerebral artery bypass and occipital artery-vertebral artery bypass with radial artery graft. Results Intraoperative indocyanine green angiography showed all the bypass arteries were patent. Postoperative DSA or CTA showed bypass arteries patent in 8 patients, among whom seven patients got obvious improvement on MR or CT perfusion. One patient died of heart failure on the 15th day postoperative. During the follow-up of eight patients, no stroke reoccurred, four patients got back to nearly normal life. Conclusion Most of the patients with vertebrobasilar occlusion could benefit from the posterior circulation revascularization, which should be confirmed by randomized controlled clinical trials in the future.

  17. Detecting key structural features within highly recombined genes.

    Directory of Open Access Journals (Sweden)

    John E Wertz


    Full Text Available Many microorganisms exhibit high levels of intragenic recombination following horizontal gene transfer events. Furthermore, many microbial genes are subject to strong diversifying selection as part of the pathogenic process. A multiple sequence alignment is an essential starting point for many of the tools that provide fundamental insights on gene structure and evolution, such as phylogenetics; however, an accurate alignment is not always possible to attain. In this study, a new analytic approach was developed in order to better quantify the genetic organization of highly diversified genes whose alleles do not align. This BLAST-based method, denoted BLAST Miner, employs an iterative process that places short segments of highly similar sequence into discrete datasets that are designated "modules." The relative positions of modules along the length of the genes, and their frequency of occurrence, are used to identify sequence duplications, insertions, and rearrangements. Partial alleles of sof from Streptococcus pyogenes, encoding a surface protein under host immune selection, were analyzed for module content. High-frequency Modules 6 and 13 were identified and examined in depth. Nucleotide sequences corresponding to both modules contain numerous duplications and inverted repeats, whereby many codons form palindromic pairs. Combined with evidence for a strong codon usage bias, data suggest that Module 6 and 13 sequences are under selection to preserve their nucleic acid secondary structure. The concentration of overlapping tandem and inverted repeats within a small region of DNA is highly suggestive of a mechanistic role for Module 6 and 13 sequences in promoting aberrant recombination. Analysis of pbp2X alleles from Streptococcus pneumoniae, encoding cell wall enzymes that confer antibiotic resistance, supports the broad applicability of this tool in deciphering the genetic organization of highly recombined genes. BLAST Miner shares with

  18. Expression and Characterization of the Recombinant Human FLT-3 Ligand Extracellular Domain in Pichia Pastoris

    Institute of Scientific and Technical Information of China (English)

    Zongtang Huang; Xishan Hao


    OBJECTIVE The FLT-3 ligand (fms-like tyrosine kinase receptor-3 ligand, FL) is a recently described growth factor affecting early hematopoietic progenitor cells. The FL plays a key role in the growth and differentiation of primitive hematopoietic cells. To yield a high-level of recombinant human FL protein, a recombinant Pichia Pastoris (P. pastoris)strain was constructed.METHODS An artificial expression frame, with the same encoding protein sequence for the FL extracellular domain cDNA, was synthesized by using favored genetic codons of P. pastoris. P. pastoris strain KM71 cells were transformed with the endonuclease Bgl Ⅱ linearized recombined plasmid, pPIC9K-FL. The plasmid then was linerized in the 5'AOX1 site and integrated into the yeast KM71 genome. KM71 was transformed with pPIC9K plasmids as a control for the production of recombinant protein.Southern blotting and Northern blotting tests were used to screen the genotype of the recombined strain. Biological activity was demonstrated in vitro with culturing of CD34+cells.RESULTS The recombinant human FL protein expressed into the yeast culture supertant was identified on the basis of its molecular weight and Western blotting analysis. Numerous bands were observed in the 10~100 kDa molecular mass range. SDS-PAGE showed that the expressed product, a 20 kDa protein, was secreted into the medium in the form of a soluble molecule. Western-blot analyses showed good antigenicity and specificity against polyclonal antibodies. A sharp band and a smeared band were observed at a molecular mass of approximately 20 kDa by Western blotting. The recombinant human FL protein was the major protein component observed in the culture supernatant. The highest yield (108 mg/L) was obtained when expression was induced with 0.5% methanol for 96 h. Deglycosylation with PNGase F resulted in a decrease in apparent molecular mass from 20 kDa to 18 kDa forming three bands all of which were also detected by rabbit anti-FL antibodies

  19. Recombinant microorganisms for increased production of organic acids

    Energy Technology Data Exchange (ETDEWEB)

    Yi, Jian; Kleff, Susanne; Guettler, Michael V


    Disclosed are recombinant microorganisms for producing organic acids. The recombinant microorganisms express a polypeptide that has the enzymatic activity of an enzyme that is utilized in the pentose phosphate cycle. The recombinant microorganism may include recombinant Actinobacillus succinogenes that has been transformed to express a Zwischenferment (Zwf) gene. The recombinant microorganisms may be useful in fermentation processes for producing organic acids such as succinic acid and lactic acid. Also disclosed are novel plasmids that are useful for transforming microorganisms to produce recombinant microorganisms that express enzymes such as Zwf.

  20. Cluster Dynamics in a Circulating Fluidized Bed

    Energy Technology Data Exchange (ETDEWEB)

    Guenther, C.P.; Breault, R.W.


    A common hydrodynamic feature in industrial scale circulating fluidized beds is the presence of clusters. The continuous formation and destruction of clusters strongly influences particle hold-up, pressure drop, heat transfer at the wall, and mixing. In this paper fiber optic data is analyzed using discrete wavelet analysis to characterize the dynamic behavior of clusters. Five radial positions at three different axial locations under five different operating were analyzed using discrete wavelets. Results are summarized with respect to cluster size and frequency.

  1. First circulating beam in the AA

    CERN Multimedia


    On 3 July 1980, two years after project authorization, beam circulated for the first time in the AA. It was a 3.5 GeV/c proton test beam. We see an expecting crowd, minutes before the happy event. The persons are to numerous to name them all. Heribert Koziol, apparently asleep, is answering the call from an impatient director. See also 8007094.

  2. Water circulation forecasting in Spanish harbours


    Grifoll, Manel; Jordá, Gabriel; Sotillo, Marcos G.; Ferrer, Luis; Espino, Manuel; Sánchez-Arcilla, Agustín; Álvarez-Fanjul, Enrique


    This paper describes the first harbour circulation forecasting system implemented in Spain. The configuration design was based on previous analyses of the morphologic and hydrodynamic behaviour of three harbours: Barcelona, Tarragona and Bilbao. A nested system of oceanic models was implemented, with a scope ranging from the regional scale (with a mean horizontal resolution of 5 km) to the harbour scale (with a mean horizontal resolution of 40 m). A set of sensitivity tests was carried out in...

  3. The creation and circulation of public geographies


    Kitchin, Rob; Linehan, Denis; O'Callaghan, Cian; Lawton, Philip


    In response to the commentaries, we discuss further how social media disrupts and remakes the creation and circulation of geographical knowledges and potentially reconfigures the moral economy of the social sciences. In particular, we examine questions of what is meant by public geography, the publics which such geographies serve, alternative and complementary approaches to social media, the politics of authorship within collective blogs, the politics and mechanisms of knowledge c...

  4. Parallel Computing of Ocean General Circulation Model

    Institute of Scientific and Technical Information of China (English)


    This paper discusses the parallel computing of the thirdgeneration Ocea n General Circulation Model (OGCM) from the State Key Laboratory of Numerical Mo deling for Atmospheric Science and Geophysical Fluid Dynamics(LASG),Institute of Atmosphere Physics(IAP). Meanwhile, several optimization strategies for paralle l computing of OGCM (POGCM) on Scalable Shared Memory Multiprocessor (S2MP) are presented. Using Message Passing Interface (MPI), we obtain super linear speedup on SGI Origin 2000 for parallel OGCM(POGCM) after optimization.

  5. Circulating fluidized bed boilers design and operations

    CERN Document Server

    Basu, Prabir


    This book provides practicing engineers and students with insight into the design and operation of circulating fluidized bed (CFB) boilers. Through a combination of theoretical concepts and practical experience, this book gives the reader a basic understanding of the many aspects of this subject.Important environmental considerations, including solid waste disposal and predicted emissions, are addressed individually in separate chapters. This book places an emphasis on combustion, hydrodynamics, heat transfer, and material issues, and illustrates these concepts with numerous examples of pres

  6. Circulating somatostatin. Physiological regulator of pancreatic function?


    Gyr, K; Beglinger, C; Köhler, E; Trautzl, U; Keller, U.; Bloom, S R


    The present study was designed to determine whether somatostatin is released into the circulation in sufficient amounts to regulate exocrine and endocrine pancreatic function and to evaluate the possible role of somatostatin as a hormonal regulator of the pancreas. Mean plasma somatostatin levels (SLI) increased from 11 +/- 2 pmol liter-1 to peak concentrations of 18 +/- 2 in six healthy male volunteers after a steak meal (P less than 0.05). Infusion of somatostatin inhibited hormone-induced ...

  7. Expression of Recombinant Streptokinase from Streptococcus Pyogenes and Its Reaction with Infected Human and Murine Sera

    Directory of Open Access Journals (Sweden)

    Neda Molaee


    Full Text Available   Objective(s: Streptokinase (SKa is an antigenic protein which is secreted by Streptococcus pyogenes. Streptokinase induces inflammation by complement activation, which may play a role in post infectious diseases. In the present study, recombinant streptokinase from S. pyogenes was produced and showed that recombinant SKa protein was recognized by infected human sera using Western blot analysis.   Materials and Methods: In this study, the ska gene from S. pyogenes was amplified and cloned into pET32a which is a prokaryotic expression vector. pET32a-ska was transformed to Escherichia coli BL21 (DE3 pLysS and gene expression was induced by IPTG. Protein production was improved by modification of composition of the bacterial culture media and altering the induction time by IPTG. The expressed protein was purified by affinity chromatography using the Ni-NTA resin. The integrity of the product was confirmed by Westernblot analysis using infected mice. Serum reactivity of five infected individuals was further analyzed against the recombinant SKa protein. Results: Data indicated that recombinant SKa protein from S. pyogenes can be recognized by patient and mice sera. The concentration of the purified recombinant protein was 3.2 mg/L of initial culture. The highest amount of the expressed protein after addition of IPTG was obtained in a bacterial culture without glucose with the culture optical density of 0.8 (OD600 = 0.8. Conclusion : Present data shows, recombinant SKa protein has same epitopes with natural form of this antigen. Recombinant SKa also seemed to be a promising antigen for the serologic diagnosis of S. pyogenes infections.

  8. Natural circulation and stability limits in advanced plants: The Galilean law

    International Nuclear Information System (INIS)

    In our previous papers natural circulation instability problem have been examined. In particular, we analytically demonstrated the link between critical heart flux (CHF) and instability, and the limitations of the present CHF data. We derived an analytical solution for the static instability in natural circulation. We proceed in this paper to build on these novel ideas and physical principles. We focus on the role of gravity in the analysis and prediction of instability. We derive the non-dimensional correlation of natural circulation flowrate, and link this with our physical analysis of instability in parallel-channel systems. We derive the exact form of the unstable limit, and discuss the important effect of zero gravity on the solution. For static instability, the result is a cubic equation for the quality. We solve for the limiting cases to obtain a new explicit result. The effect of gravity on upflow and downflow is shown to be significant for high subcoolings. By combining the natural-circulation and stability results, we demonstrate a new result which analytically describes the limits on natural-circulation operation. This result is relevant to small breaks and transients, as well as to defining the design envelope for safe operation

  9. V(D)J recombination frequency is affected by the sequence interposed between a pair of recombination signals: sequence comparison reveals a putative recombinational enhancer element

    DEFF Research Database (Denmark)

    Roch, F A; Hobi, R; Berchtold, M W;


    The immunoglobulin heavy chain intron enhancer (Emu) not only stimulates transcription but also V(D)J recombination of chromosomally integrated recombination substrates. We aimed at reproducing this effect in recombination competent cells by transient transfection of extrachromosomal substrates...... respectively, can markedly affect the frequency of V(D)J recombination. We report that the entire Emu, the Emu core as well as its flanking 5' and 3' matrix associated regions (5' and 3' MARs) upregulate V(D)J recombination while the downstream section of the 3' MAR of Emu does not. Also, prokaryotic sequences...

  10. Recombinant human antithrombin III: rhATIII. (United States)


    GTC Biotherapeutics (formerly Genzyme Transgenics Corporation) is developing a transgenic form of antithrombin III known as recombinant human antithrombin III [rhATIII]. It is produced by inserting human DNA into the cells of goats so that the targeted protein is excreted in the milk of the female offspring. The transgenic goats have been cloned in collaboration with the Louisiana State University Agriculture Center. GTC Biotherapeutics is conducting clinical trials of rhATIII in coagulation disorders. rhATIII is believed to be both safer and more cost-effective than the currently available plasma-derived product. rhATIII is also being investigated in cancer and acute lung injury. Genzyme Transgenics Corporation, originally a subsidiary of Genzyme Corporation, changed its name to GTC Biotherapeutics in June 2002; it is no longer a subsidiary of Genzyme Corporation. GTC Biotherapeutics is seeking partners for the commercialisation of rhATIII. Restructuring of GTC Biotherapeutics to support its commercialisation programmes was announced in February 2004. Genzyme Transgenics Corporation was developing rhATIII in association with Genzyme General (Genzyme Corporation) in the ATIII LLC joint venture, but in November 2000 a letter of intent was signed for the reacquisition of the rights by Genzyme Transgenics Corporation. It was announced in February 2001 that this reacquisition was not going to be completed and that the development of rhATIII was to continue with ATIII LLC. However, in July 2001, Genzyme Transgenics Corporation reacquired all the rights in the transgenic antithrombin III programme. SMI Genzyme Ltd, a joint venture between Sumitomo Metal Industries, Japan, and Genzyme Transgenics Corporation, USA, was set up to fund development of transgenic antithrombin III in Asia. However, in October 2000, Genzyme Transgenics Corporation reacquired, from Sumitomo Metal Industries, the rights to its technology for production of medicines from milk in 18 Asian countries

  11. When Prostate Cancer Circulates in the Bloodstream

    Directory of Open Access Journals (Sweden)

    Virginie Vlaeminck-Guillem


    Full Text Available Management of patients with prostate cancer is currently based on imperfect clinical, biological, radiological and pathological evaluation. Prostate cancer aggressiveness, including metastatic potential, remains difficult to accurately estimate. In an attempt to better adapt therapeutics to an individual (personalized medicine, reliable evaluation of the intrinsic molecular biology of the tumor is warranted, and particularly for all tumor sites (primary tumors and secondary sites at any time of the disease progression. As a consequence of their natural tendency to grow (passive invasion or as a consequence of an active blood vessel invasion by metastase-initiating cells, tumors shed various materials into the bloodstream. Major efforts have been recently made to develop powerful and accurate methods able to detect, quantify and/or analyze all these circulating tumor materials: circulating tumors cells, disseminating tumor cells, extracellular vesicles (including exosomes, nucleic acids, etc. The aim of this review is to summarize current knowledge about these circulating tumor materials and their applications in translational research.

  12. Acoustic streaming and Sun's meridional circulation (United States)

    Valverde, Jose Manuel


    A vast number of physical processes involving oscillations of a bounded viscous fluid are relevantly influenced by acoustic streaming. When this happens a steady circulation of fluid develops in a thin boundary adjacent to the interface. Some examples are refracted sound waves, a fluid inside a spherical cavity undergoing torsional oscillations or a pulsating liquid droplet. Steady streaming around circular interfaces consists of a hemispherically symmetric recirculation of fluid from the equatorial plane to the polar axes closely resembling the meridional circulation pattern observed in the Sun's convection zone that determines the solar cycle. In this paper, it is argued that the acoustic pulsations exhibited by the Sun would lead to acoustic streaming in the boundary of the convection zone. A simple estimation using a typical dominant frequency of 3 mHz and the observed surface oscillation amplitude yields a steady streaming velocity us ∼ 10 m s‑1, which is on the order of the meridional circulation velocity observed in the Sun's convection zone.

  13. Circulation in a Short Cylindrical Couette System

    Energy Technology Data Exchange (ETDEWEB)

    Akira Kageyama; Hantao Ji; Jeremy Goodman


    In preparation for an experimental study of magnetorotational instability (MRI) in liquid metal, we explore Couette flows having height comparable to the gap between cylinders, centrifugally stable rotation, and high Reynolds number. Experiments in water are compared with numerical simulations. The flow is very different from that of an ideal, infinitely long Couette system. Simulations show that endcaps co-rotating with the outer cylinder drive a strong poloidal circulation that redistributes angular momentum. Predicted toroidal flow profiles agree well with experimental measurements. Spin-down times scale with Reynolds number as expected for laminar Ekman circulation; extrapolation from two-dimensional simulations at Re less than or equal to 3200 agrees remarkably well with experiment at Re approximately equal to 106. This suggests that turbulence does not dominate the effective viscosity. Further detailed numerical studies reveal a strong radially inward flow near both endcaps. After turning vertically along the inner cylinder, these flows converge at the midplane and depart the boundary in a radial jet. To minimize this circulation in the MRI experiment, endcaps consisting of multiple, differentially rotating rings are proposed. Simulations predict that an adequate approximation to the ideal Couette profile can be obtained with a few rings.

  14. Schizosaccharomyces pombe Mms1 channels repair of perturbed replication into Rhp51 independent homologous recombination

    DEFF Research Database (Denmark)

    Vejrup-Hansen, Rasmus; Mizuno, Ken'Ichi; Miyabe, Izumi;


    In both Schizosaccharomyces pombe and Saccharomyces cerevisiae, Mms22 and Mms1 form a complex with important functions in the response to DNA damage, loss of which leads to perturbations during replication. Furthermore, in S. cerevisiae, Mms1 has been suggested to function in concert with a Cullin......-like protein, Rtt101/Cul8, a potential paralog of Cullin 4. We performed epistasis analysis between ¿mms1 and mutants of pathways with known functions in genome integrity, and measured the recruitment of homologous recombination proteins to blocked replication forks and recombination frequencies. We show that...... particularly important when a single strand break is converted into a double strand break during replication. Genetic data connect Mms1 to a Mus81 and Rad22(Rad52) dependent, but Rhp51 independent, branch of homologous recombination. This is supported by results demonstrating that Mms1 is recruited to a site...

  15. Expression and analysis of the glycosylation properties of recombinant human erythropoietin expressed in Pichia pastoris

    Directory of Open Access Journals (Sweden)

    Ser Huy Teh


    Full Text Available The Pichia pastoris expression system was used to produce recombinant human erythropoietin, a protein synthesized by the adult kidney and responsible for the regulation of red blood cell production. The entire recombinant human erythropoietin (rhEPO gene was constructed using the Splicing by Overlap Extension by PCR (SOE-PCR technique, cloned and expressed through the secretory pathway of the Pichia expression system. Recombinant erythropoietin was successfully expressed in P. pastoris. The estimated molecular mass of the expressed protein ranged from 32 kDa to 75 kDa, with the variation in size being attributed to the presence of rhEPO glycosylation analogs. A crude functional analysis of the soluble proteins showed that all of the forms were active in vivo.

  16. Production and Analysis of Biological Properties of Recombinant Human Apolipoprotein A-I. (United States)

    Ryabchenko, A V; Kotova, M V; Tverdohleb, N V; Knyazev, R A; Polyakov, L M


    Production of recombinant human apolipoprotein A-I (apoA-I) in E. coli cells is described and its biological properties are compared with those of natural protein. Recombinant apoA-I was isolated as a chimeric polypeptide and then processed to a mature form apoA-I (rapo-I). We studied the ability of the resulting protein to penetrate into hepatocyte nuclei and regulate the rate of DNA biosynthesis in complex with estriol. Penetration of rapoA-I conjugated with FITC into hepatocyte nuclei was demonstrated. rapoA-I-estriol and apoA-I-estriol complexes induced similar increase in DNA biosynthesis rate in isolated hepatocytes, which confi rms functional similarity of the obtained recombinant mature protein (rapoA-I) and native human apoA-I. PMID:26612626

  17. Mesoscale circulation along the Sakhalin Island eastern coast

    CERN Document Server

    Prants, S V; Budyansky, M V; Uleysky, M Yu


    The seasonal and interannual variability of mesoscale circulation along the eastern coast of the Sakhalin Island in the Okhotsk Sea is investigated using AVISO velocity field and oceanographic data for the period from 1993 to 2016. It is found that mesoscale cyclones with the horizontal dimension of about 100 km occur there predominantly during summer, whereas anticyclones occur predominantly during fall and winter. The cyclones are generated due to the coastal upwelling forced by northward winds and the positive wind stress curl along the Sakhalin coast. The anticyclones are formed due to an inflow of low-salinity Amur-River waters from the Sakhalin Gulf intensified by southward winds and the negative wind stress curl in the cold season. The mesoscale cyclones support the high biological productivity at the eastern Sakhalin shelf in July - August.

  18. The Coronary Circulation as a Target of Cardioprotection. (United States)

    Heusch, Gerd


    The atherosclerotic coronary vasculature is not only the culprit but also a victim of myocardial ischemia/reperfusion injury. Manifestations of such injury are increased vascular permeability and edema, endothelial dysfunction and impaired vasomotion, microembolization of atherothrombotic debris, stasis with intravascular cell aggregates, and finally, in its most severe form, capillary destruction with hemorrhage. In animal experiments, local and remote ischemic pre- and postconditioning not only reduce infarct size but also these manifestations of coronary vascular injury, as do drugs which recruit signal transduction steps of conditioning. Clinically, no-reflow is frequently seen after interventional reperfusion, and it carries an adverse prognosis. The translation of cardioprotective interventions to clinical practice has been difficult to date. Only 4 drugs (brain natriuretic peptide, exenatide, metoprolol, and esmolol) stand unchallenged to date in reducing infarct size in patients with reperfused acute myocardial infarction; unfortunately, for these drugs, no information on their impact on the ischemic/reperfused coronary circulation is available. PMID:27174955

  19. [Circulating immune complexes in the pathogenesis of recurrent erysipelas]. (United States)

    Frolov, A F; Rychnev, V E; Frolov, V M; Bala, M A


    The dynamics of circulating immune complexes (CIC) in comparison with the level of SH-groups of serum deproteinate and other characteristics of cell-mediated and humoral immunity (the reaction of the inhibition of antibodies, the levels of T-cells and their main subpopulations) was studied in 103 erysipelas patients and in 46 persons having had the disease at the acute period of this infection and at the periods between relapses. The elevated levels of CIC and SH-groups of serum deproteinate were found to be directly correlated with the inhibition index. The study showed that, as a rule, in patients with the elevated level of CIC the frequently relapsing form of erysipelas, accompanied by the formation of relative hypersuppressor-type secondary immunodeficiency and by a decrease in the functional activity of dermal macrophages, was observed. PMID:2936048

  20. 19 CFR 207.63 - Circulation of draft questionnaires. (United States)


    ... 19 Customs Duties 3 2010-04-01 2010-04-01 false Circulation of draft questionnaires. 207.63... SUBSIDIZED EXPORTS TO THE UNITED STATES Five-Year Reviews § 207.63 Circulation of draft questionnaires. (a) The Director shall circulate draft questionnaires to the parties for comment in each full review....

  1. Algorithms for Finding the Inverses of Factor Block Circulant Matrices

    Institute of Scientific and Technical Information of China (English)


    In this paper, algorithms for finding the inverse of a factor block circulant matrix,a factor block retrocirculant matrix and partitioned matrix with factor block circulant blocks over the complex field are presented respectively. In addition, two algorithms for the inverse of a factor block circulant matrix over the quaternion division algebra are proposed.

  2. A multicentre, double blind, randomised, placebo controlled trial of anakinra (Kineret), a recombinant interleukin 1 receptor antagonist, in patients with rheumatoid arthritis treated with background methotrexate


    Cohen, S.; Moreland, L; Cush, J; Greenwald, M.; Block, S; Shergy, W.; Hanrahan, P; Kraishi, M; Patel, A; Sun, G; Bear, M


    Objective: To assess the efficacy and safety of 100 mg daily anakinra (Kineret), a recombinant form of the naturally occurring interleukin 1 receptor antagonist, plus methotrexate (MTX) in reducing the signs and symptoms of rheumatoid arthritis (RA).

  3. IL-33 promotes the migration and proliferation of circulating fibrocytes from patients with allergen-exacerbated asthma

    Energy Technology Data Exchange (ETDEWEB)

    Bianchetti, Lorenza, E-mail: [Avail Biomedical Research Institute, Basel (Switzerland); Laboratory of Cytopathology and Cytogenetics, Italian ABR Operative Unit, Milan (Italy); Marini, Maurizio A., E-mail: [Multispecialty Outpatient Clinic and Diagnostic Center, Milan (Italy); Isgro, Mirko, E-mail: [Avail Biomedical Research Institute, Basel (Switzerland); Laboratory of Cytopathology and Cytogenetics, Italian ABR Operative Unit, Milan (Italy); Bellini, Alberto, E-mail: [Avail Biomedical Research Institute, Basel (Switzerland); Schmidt, Matthias, E-mail: [Avail Biomedical Research Institute, Basel (Switzerland); Mattoli, Sabrina, E-mail: [Avail Biomedical Research Institute, Basel (Switzerland)


    Highlights: Black-Right-Pointing-Pointer IL-33 is considered a new therapeutic target for reducing inflammation in asthma. Black-Right-Pointing-Pointer This study shows that IL-33 is a potent chemoattractant for fibrocytes in asthma. Black-Right-Pointing-Pointer IL-33 also promotes fibrocyte proliferation without reducing collagen production. Black-Right-Pointing-Pointer The study uncovers a novel non-inflammatory, profibrotic function of IL-33. -- Abstract: The release of IL-33 increases in the bronchial mucosa of asthmatic patients in relation to disease severity and several studies have demonstrated that IL-33 may enhance airway inflammation in asthma. This study tested the hypothesis that IL-33 may also contribute to the development of irreversible structural changes in asthma by favoring the airway recruitment and profibrotic function of circulating fibrocytes during episodes of allergen-induced asthma exacerbation. The circulating fibrocytes from patients with allergen-exacerbated asthma (PwAA) showed increased expression of the specific IL-33 receptor component ST2L in comparison with the cells from non-asthmatic individuals (NAI). Recombinant IL-33 induced the migration of circulating fibrocytes from PwAA at clinically relevant concentrations and stimulated their proliferation in a concentration-dependent manner between 0.1 and 10 ng/ml, without affecting the constitutive release of type I collagen. The recombinant protein did not induce similar responses in circulating fibrocytes from NAI. This study uncovers an important mechanism through which fibrocytes may accumulate in the airways of allergic asthmatics when their disease is not adequately controlled by current treatment and provides novel information on the function of IL-33 in asthma.

  4. IL-33 promotes the migration and proliferation of circulating fibrocytes from patients with allergen-exacerbated asthma

    International Nuclear Information System (INIS)

    Highlights: ► IL-33 is considered a new therapeutic target for reducing inflammation in asthma. ► This study shows that IL-33 is a potent chemoattractant for fibrocytes in asthma. ► IL-33 also promotes fibrocyte proliferation without reducing collagen production. ► The study uncovers a novel non-inflammatory, profibrotic function of IL-33. -- Abstract: The release of IL-33 increases in the bronchial mucosa of asthmatic patients in relation to disease severity and several studies have demonstrated that IL-33 may enhance airway inflammation in asthma. This study tested the hypothesis that IL-33 may also contribute to the development of irreversible structural changes in asthma by favoring the airway recruitment and profibrotic function of circulating fibrocytes during episodes of allergen-induced asthma exacerbation. The circulating fibrocytes from patients with allergen-exacerbated asthma (PwAA) showed increased expression of the specific IL-33 receptor component ST2L in comparison with the cells from non-asthmatic individuals (NAI). Recombinant IL-33 induced the migration of circulating fibrocytes from PwAA at clinically relevant concentrations and stimulated their proliferation in a concentration-dependent manner between 0.1 and 10 ng/ml, without affecting the constitutive release of type I collagen. The recombinant protein did not induce similar responses in circulating fibrocytes from NAI. This study uncovers an important mechanism through which fibrocytes may accumulate in the airways of allergic asthmatics when their disease is not adequately controlled by current treatment and provides novel information on the function of IL-33 in asthma.

  5. Detection and isolation of circulating melanoma cells using photoacoustic flowmetry. (United States)

    O'Brien, Christine M; Rood, Kyle; Sengupta, Shramik; Gupta, Sagar K; DeSouza, Thiago; Cook, Aaron; Viator, John A


    Circulating tumor cells (CTCs) are those cells that have separated from a macroscopic tumor and spread through the blood and lymph systems to seed secondary tumors(1,2,3). CTCs are indicators of metastatic disease and their detection in blood samples may be used to diagnose cancer and monitor a patient's response to therapy. Since CTCs are rare, comprising about one tumor cell among billions of normal blood cells in advanced cancer patients, their detection and enumeration is a difficult task. We exploit the presence of pigment in most melanoma cells to generate photoacoustic, or laser induced ultrasonic waves in a custom flow cytometer for detection of circulating melanoma cells (CMCs)(4,5). This process entails separating a whole blood sample using centrifugation and obtaining the white blood cell layer. If present in whole blood, CMCs will separate with the white blood cells due to similar density. These cells are resuspended in phosphate buffered saline (PBS) and introduced into the flowmeter. Rather than a continuous flow of the blood cell suspension, we induced two phase flow in order to capture these cells for further study. In two phase flow, two immiscible liquids in a microfluidic system meet at a junction and form alternating slugs of liquid(6,7). PBS suspended white blood cells and air form microliter slugs that are sequentially irradiated with laser light. The addition of a surfactant to the liquid phase allows uniform slug formation and the user can create different sized slugs by altering the flow rates of the two phases. Slugs of air and slugs of PBS with white blood cells contain no light absorbers and hence, do not produce photoacoustic waves. However, slugs of white blood cells that contain even single CMCs absorb laser light and produce high frequency acoustic waves. These slugs that generate photoacoustic waves are sequestered and collected for cytochemical staining for verification of CMCs. PMID:22143421

  6. Recombinant protein blends: silk beyond natural design. (United States)

    Dinjaski, Nina; Kaplan, David L


    Recombinant DNA technology and new material concepts are shaping future directions in biomaterial science for the design and production of the next-generation biomaterial platforms. Aside from conventionally used synthetic polymers, numerous natural biopolymers (e.g., silk, elastin, collagen, gelatin, alginate, cellulose, keratin, chitin, polyhydroxyalkanoates) have been investigated for properties and manipulation via bioengineering. Genetic engineering provides a path to increase structural and functional complexity of these biopolymers, and thereby expand the catalog of available biomaterials beyond that which exists in nature. In addition, the integration of experimental approaches with computational modeling to analyze sequence-structure-function relationships is starting to have an impact in the field by establishing predictive frameworks for determining material properties. Herein, we review advances in recombinant DNA-mediated protein production and functionalization approaches, with a focus on hybrids or combinations of proteins; recombinant protein blends or 'recombinamers'. We highlight the potential biomedical applications of fibrous protein recombinamers, such as Silk-Elastin Like Polypeptides (SELPs) and Silk-Bacterial Collagens (SBCs). We also discuss the possibility for the rationale design of fibrous proteins to build smart, stimuli-responsive biomaterials for diverse applications. We underline current limitations with production systems for these proteins and discuss the main trends in systems/synthetic biology that may improve recombinant fibrous protein design and production.

  7. Algae-based oral recombinant vaccines. (United States)

    Specht, Elizabeth A; Mayfield, Stephen P


    Recombinant subunit vaccines are some of the safest and most effective vaccines available, but their high cost and the requirement of advanced medical infrastructure for administration make them impractical for many developing world diseases. Plant-based vaccines have shifted that paradigm by paving the way for recombinant vaccine production at agricultural scale using an edible host. However, enthusiasm for "molecular pharming" in food crops has waned in the last decade due to difficulty in developing transgenic crop plants and concerns of contaminating the food supply. Microalgae could be poised to become the next candidate in recombinant subunit vaccine production, as they present several advantages over terrestrial crop plant-based platforms including scalable and contained growth, rapid transformation, easily obtained stable cell lines, and consistent transgene expression levels. Algae have been shown to accumulate and properly fold several vaccine antigens, and efforts are underway to create recombinant algal fusion proteins that can enhance antigenicity for effective orally delivered vaccines. These approaches have the potential to revolutionize the way subunit vaccines are made and delivered - from costly parenteral administration of purified protein, to an inexpensive oral algae tablet with effective mucosal and systemic immune reactivity. PMID:24596570

  8. Genetic Recombination as a Chemical Reaction Network


    Müller, Stefan; Hofbauer, Josef


    The process of genetic recombination can be seen as a chemical reaction network with mass-action kinetics. We review the known results on existence, uniqueness, and global stability of an equilibrium in every compatibility class and for all rate constants, from both the population genetics and the reaction networks point of view.

  9. Why do bacteria engage in homologous recombination?

    NARCIS (Netherlands)

    Vos, M.


    Microbiologists have long recognized that the uptake and incorporation of homologous DNA from outside the cell is a common feature of bacteria, with important implications for their evolution. However, the exact reasons why bacteria engage in homologous recombination remain elusive. This Opinion art

  10. Evidence for homologous recombination in Chikungunya Virus. (United States)

    Casal, Pablo E; Chouhy, Diego; Bolatti, Elisa M; Perez, Germán R; Stella, Emma J; Giri, Adriana A


    Chikungunya Virus (CHIKV), a mosquito-transmitted alphavirus, causes acute fever and joint pain in humans. Recently, endemic CHIKV infection outbreaks have jeopardized public health in wider geographical regions. Here, we analyze the phylogenetic associations of CHIKV and explore the potential recombination events on 152 genomic isolates deposited in GenBank database. The CHIKV genotypes [West African, Asian, East/Central/South African (ECSA)], and a clear division of ECSA clade into three sub-groups (I-II-III), were defined by Bayesian analysis; similar results were obtained using E1 gene sequences. A nucleotide identity-based approach is provided to facilitate CHIKV classification within ECSA clade. Using seven methods to detect recombination, we found a statistically significant event (p-values range: 1.14×10(-7)-4.45×10(-24)) located within the nsP3 coding region. This finding was further confirmed by phylogenetic networks (PHI Test, p=0.004) and phylogenetic tree incongruence analysis. The recombinant strain, KJ679578/India/2011 (ECSA III), derives from viruses of ECSA III and ECSA I. Our study demonstrates that recombination is an additional mechanism of genetic diversity in CHIKV that might assist in the cross-species transmission process.

  11. Algae-based oral recombinant vaccines. (United States)

    Specht, Elizabeth A; Mayfield, Stephen P


    Recombinant subunit vaccines are some of the safest and most effective vaccines available, but their high cost and the requirement of advanced medical infrastructure for administration make them impractical for many developing world diseases. Plant-based vaccines have shifted that paradigm by paving the way for recombinant vaccine production at agricultural scale using an edible host. However, enthusiasm for "molecular pharming" in food crops has waned in the last decade due to difficulty in developing transgenic crop plants and concerns of contaminating the food supply. Microalgae could be poised to become the next candidate in recombinant subunit vaccine production, as they present several advantages over terrestrial crop plant-based platforms including scalable and contained growth, rapid transformation, easily obtained stable cell lines, and consistent transgene expression levels. Algae have been shown to accumulate and properly fold several vaccine antigens, and efforts are underway to create recombinant algal fusion proteins that can enhance antigenicity for effective orally delivered vaccines. These approaches have the potential to revolutionize the way subunit vaccines are made and delivered - from costly parenteral administration of purified protein, to an inexpensive oral algae tablet with effective mucosal and systemic immune reactivity.

  12. Algae-based oral recombinant vaccines

    Directory of Open Access Journals (Sweden)

    Elizabeth A Specht


    Full Text Available Recombinant subunit vaccines are some of the safest and most effective vaccines available, but their high cost and the requirement of advanced medical infrastructure for administration make them impractical for many developing world diseases. Plant-based vaccines have shifted that paradigm by paving the way for recombinant vaccine production at agricultural scale using an edible host. However, enthusiasm for molecular pharming in food crops has waned in the last decade due to difficulty in developing transgenic crop plants and concerns of contaminating the food supply. Microalgae are poised to become the next candidate in recombinant subunit vaccine production, and they present several advantages over terrestrial crop plant-based platforms including scalable and contained growth, rapid transformation, easily obtained stable cell lines, and consistent transgene expression levels. Algae have been shown to accumulate and properly fold several vaccine antigens, and efforts are underway to create recombinant algal fusion proteins that can enhance antigenicity for effective orally-delivered vaccines. These approaches have the potential to revolutionize the way subunit vaccines are made and delivered – from costly parenteral administration of purified protein, to an inexpensive oral algae tablet with effective mucosal and system immune reactivity.

  13. Vaccine development using recombinant DNA technology (United States)

    Vaccines induce an immune response in the host that subsequently recognizes infectious agents and helps fight off the disease; vaccines must do this without causing the disease. This paper reviews the development of recombinant DNA technologies as a means of providing new ways for attenuating diseas...

  14. Selected techniques in recombinant DNA technology

    International Nuclear Information System (INIS)

    Recombined DNA technology comprises a complex of techniques in the fields of nucleic acid biochemistry and molecular biology. This presentation gives an introduction, a brief description and example of the procedures of some of the basic techniques in the DNA cloning work currently used. 8 refs

  15. Recombinant DNA: Scientific and Social Perspectives. (United States)

    Vandegrift, Vaughn


    This article is designed to inform chemical educators not engaged in this technology as to the nature and methods used in the technology, the reasons for scientific and social concern, and the attempts made to assuage concerns involving recombinant DNA research. (author/BB)

  16. Recombinant vaccines: experimental and applied aspects

    DEFF Research Database (Denmark)

    Lorenzen, Niels


    Development of vaccines for aquaculture fish represent an important applied functional aspect of fish immunology research. Particularly in the case of recombinant vaccines, where a single antigen is usually expected to induce immunity to a specific pathogen, knowledge of mechanisms involved in in...

  17. Asthma and Therapeutics: Recombinant Therapies in Asthma

    Directory of Open Access Journals (Sweden)

    Cockcroft Donald W


    Full Text Available Abstract Numerous recombinant therapies are being investigated for the treatment of asthma. This report reviews the current status of several of these novel agents. Anti-immunoglobulin (IgE (omalizumab, Xolair markedly inhibits all aspects of the allergen challenge in subjects who have reduction of free serum IgE to undetectable levels. Several clinical studies in atopic asthma have demonstrated benefit by improved symptoms and lung function and a reduction in corticosteroid requirements. Early use in atopic asthmatics may be even more effective. Several approaches target interleukin (IL-4. Soluble IL-4 receptor has been shown to effectively replace inhaled corticosteroid; further studies are under way. Recombinant anti-IL-5 and recombinant IL-12 inhibit blood and sputum eosinophils and allergen-induced eosinophilia without any effect on airway responsiveness, allergen-induced airway responses, or allergen-induced airway hyperresponsiveness. Efalizumab, a recombinant antibody that inhibits lymphocyte trafficking, is effective in psoriasis. A bronchoprovocation study showed a reduction in allergen-induced late asthmatic response and allergen-induced eosinophilia, which suggests that it should be effective in clinical asthma. These exciting novel therapies provide not only promise of new therapies for asthma but also valuable tools for investigation of asthma mechanisms.

  18. Recombinant protein blends: silk beyond natural design. (United States)

    Dinjaski, Nina; Kaplan, David L


    Recombinant DNA technology and new material concepts are shaping future directions in biomaterial science for the design and production of the next-generation biomaterial platforms. Aside from conventionally used synthetic polymers, numerous natural biopolymers (e.g., silk, elastin, collagen, gelatin, alginate, cellulose, keratin, chitin, polyhydroxyalkanoates) have been investigated for properties and manipulation via bioengineering. Genetic engineering provides a path to increase structural and functional complexity of these biopolymers, and thereby expand the catalog of available biomaterials beyond that which exists in nature. In addition, the integration of experimental approaches with computational modeling to analyze sequence-structure-function relationships is starting to have an impact in the field by establishing predictive frameworks for determining material properties. Herein, we review advances in recombinant DNA-mediated protein production and functionalization approaches, with a focus on hybrids or combinations of proteins; recombinant protein blends or 'recombinamers'. We highlight the potential biomedical applications of fibrous protein recombinamers, such as Silk-Elastin Like Polypeptides (SELPs) and Silk-Bacterial Collagens (SBCs). We also discuss the possibility for the rationale design of fibrous proteins to build smart, stimuli-responsive biomaterials for diverse applications. We underline current limitations with production systems for these proteins and discuss the main trends in systems/synthetic biology that may improve recombinant fibrous protein design and production. PMID:26686863


    King, L.D.P.


    A hydrogen-oxygen recombiner is described for use with water-boiler type reactors. The catalyst used is the wellknown platinized alumina, and the novelty lies in the structural arrangement used to prevent flashback through the gas input system. The recombiner is cylindrical, the gases at the input end being deflected by a baffle plate through a first flashback shield of steel shot into an annular passage adjacent to and extending the full length of the housing. Below the baffle plate the gases flow first through an outer annular array of alumina pellets which serve as a second flashback shield, a means of distributing the flowing gases evenly and as a means of reducing radiation losses to the walls. Thereafter the gases flow inio the centrally disposed catalyst bed where recombination is effected. The steam and uncombined gases flow into a centrally disposed cylindrical passage inside the catalyst bod and thereafter out through the exit port. A high rate of recombination is effected.

  20. Haemostatic effects of recombinant coagulation factor VIIa

    NARCIS (Netherlands)

    Lisman, Johannes Antonius


    Recombinant coagulation factor VIIa (rFVIIa) has recently become available for treatment of patients with inhibitor-complicated haemophilia. It has been postulated that rFVIIa could become a universal haemostatic agent. Case reports and small studies confirm efficacy and safety of rFVIIa in a variet