
Sample records for circulating recombinant form

  1. Emergence of recombinant forms in geographic regions with co-circulating HIV subtypes in the dynamic HIV-1 epidemic

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Ming [Los Alamos National Laboratory; Letiner, Thomas K [Los Alamos National Laboratory; Korber, Bette T [Los Alamos National Laboratory; Foley, Brian [Los Alamos National Laboratory


    We have reexamined the subtype designations of {approx}10,000 subtype A, B, C, G, and AG, BC, BF recombinant sequences, and compared the results of the new analysis with their published designations. Intersubtype recombinants dominate HIV epidemics in three different geographical regions. The circulating recombinant from (CRF) CRF02-AG, common in West Central Africa, appears to result from a recombination event that occurred early in the divergence between subtypes A and G, although additional more recent recombination events may have contributed to the breakpoint pattern in this recombinant lineage as well. The Chinese recombinant epidemic strains CRF07 and CRF08, in contrast, result from recent recombinations between more contemporary strains. Nevertheless, CRF07 and CRF08 contributed to many subsequent recombination events. The BF recombinant epidemics in two HIV-1 epicenters in South America are not independent and BF epidemics in South America have an unusually high fraction of unique recombinant forms (URFs) that have each been found only once and carry distinctive breakpoints. Taken together, these analyses reveal a complex and dynamic picture of the current HIV-1 epidemic, and suggest a means of grouping and tracking relationships between viruses through preservation of shared breakpints.

  2. Characterization of CRF56_cpx, a new circulating B/CRF02/G recombinant form identified in MSM in France. (United States)

    Leoz, Marie; Feyertag, Felix; Charpentier, Charlotte; Delaugerre, Constance; Wirden, Marc; Lemee, Veronique; Plantier, Jean-Christophe


    Several B/CRF02_AG Unique Recombinant Forms (URFs) have previously been identified in France. Here we show that one of them (URF5_B/02/G) is emerging in MSM, a high-risk population where HIV incidence and number of superinfections are increasing. We describe this new Circulating Recombinant Form, CRF56_cpx, estimate the time to its most recent common ancestor, investigate its origins and show that it probably shares common ancestors with strains from the East Mediterranean. PMID:24157908

  3. HIV-1 subtype distribution in the Gambia and the significant presence of CRF49_cpx, a novel circulating recombinant form

    Directory of Open Access Journals (Sweden)

    Foley Brian


    Full Text Available Abstract Background Detailed local HIV-1 sequence data are essential for monitoring the HIV epidemic, for maintaining sensitive sequence-based diagnostics, and to aid in designing vaccines. Results Reported here are full envelope sequences derived from 38 randomly selected HIV-1 infections identified at a Gambian clinic between 1991 and 2009. Special care was taken to generate sequences from circulating viral RNA as uncloned products, either by limiting dilution or single genome amplification polymerase chain reaction (PCR. Within these 38 isolates, eight were subtyped as A and 18 as CRF02_AG. A small number of subtype B, C, D viruses were identified. Surprising, however, was the identification of six isolates with subtype J-like envelopes, a subtype found normally in Central Africa and the Democratic Republic of the Congo (DRC, with gag p24 regions that clustered with subtype A sequences. Near full-length sequence from three of these isolates confirmed that these represent a novel circulating recombinant form of HIV-1, now named CRF49_cpx. Conclusions This study expands the HIV-1 sequence database from the Gambia and will provide important data for HIV diagnostics, patient care, and vaccine development.

  4. Phylodynamic analysis of porcine circovirus type 2 reveals global waves of emerging genotypes and the circulation of recombinant forms. (United States)

    Franzo, Giovanni; Cortey, Marti; Segalés, Joaquim; Hughes, Joseph; Drigo, Michele


    Since the first description of Porcine circovirus type 2 (PCV2), four genotypes (PCV2a, PCV2b, PCV2c and PCV2d) have been recognized and three of them have been shown to exhibit worldwide distribution. Here, the population dynamics of PCV2 has been reconstructed over time and the factors that have shaped its evolution determined. The results obtained confirm that PCV2 originated approximately at the beginning of the 20th century. The most recent common ancestor of genotypes PCV2a, PCV2b, PCV2c and PCV2d circulated in the 1950s, 1980s, 1960s and 1950s, respectively, and the population sizes of the individual genotypes remained low until the mid 90s, coinciding with the identification of PCV2 as a major pathogen of the pig industry. The population dynamics of PCV2 have been characterized by the appearance of periodic waves of distinct genotypes that, after an initial rise, spread following major swine commercial routes and were then superseded by subsequent emerging genotypes. Various recombinant forms displayed comparable population dynamics and spreading routes to those of major genotypes, suggesting that recombinant strains are able to compete with parental ones. The capsid gene is subjected to immune selection and evasion of the host immune response seems to be a major force for the emergence and spread of new genotypes. In contrast, the evolution of other genes appears to be constrained by the particular genomic organization of PCV2. In summary, obtained results suggest that changes in farming strategies, international trade, host population immunity, recombination and the constraints imposed by genome organization have all played a major role in the evolutionary dynamics of PCV2. PMID:27114187

  5. Production of Mucosally Transmissible SHIV Challenge Stocks from HIV-1 Circulating Recombinant Form 01_AE env Sequences.

    Directory of Open Access Journals (Sweden)

    Lawrence J Tartaglia


    Full Text Available Simian-human immunodeficiency virus (SHIV challenge stocks are critical for preclinical testing of vaccines, antibodies, and other interventions aimed to prevent HIV-1. A major unmet need for the field has been the lack of a SHIV challenge stock expressing circulating recombinant form 01_AE (CRF01_AE env sequences. We therefore sought to develop mucosally transmissible SHIV challenge stocks containing HIV-1 CRF01_AE env derived from acutely HIV-1 infected individuals from Thailand. SHIV-AE6, SHIV-AE6RM, and SHIV-AE16 contained env sequences that were >99% identical to the original HIV-1 isolate and did not require in vivo passaging. These viruses exhibited CCR5 tropism and displayed a tier 2 neutralization phenotype. These challenge stocks efficiently infected rhesus monkeys by the intrarectal route, replicated to high levels during acute infection, and established chronic viremia in a subset of animals. SHIV-AE16 was titrated for use in single, high dose as well as repetitive, low dose intrarectal challenge studies. These SHIV challenge stocks should facilitate the preclinical evaluation of vaccines, monoclonal antibodies, and other interventions targeted at preventing HIV-1 CRF01_AE infection.

  6. Molecular diversity of HIV-1 among people who inject drugs in Kuala Lumpur, Malaysia: massive expansion of circulating recombinant form (CRF 33_01B and emergence of multiple unique recombinant clusters.

    Directory of Open Access Journals (Sweden)

    Wei Zhen Chow

    Full Text Available Since the discovery of HIV-1 circulating recombinant form (CRF 33_01B in Malaysia in the early 2000 s, continuous genetic diversification and active recombination involving CRF33_01B and other circulating genotypes in the region including CRF01_AE and subtype B' of Thai origin, have led to the emergence of novel CRFs and unique recombinant forms. The history and magnitude of CRF33_01B transmission among various risk groups including people who inject drugs (PWID however have not been investigated despite the high epidemiological impact of CRF33_01B in the region. We update the most recent molecular epidemiology of HIV-1 among PWIDs recruited in Malaysia between 2010 and 2011 by population sequencing and phylogenetic analysis of 128 gag-pol sequences. HIV-1 CRF33_01B was circulating among 71% of PWIDs whilst a lower prevalence of other previously dominant HIV-1 genotypes [subtype B' (11% and CRF01_AE (5%] and CRF01_AE/B' unique recombinants (13% were detected, indicating a significant shift in genotype replacement in this population. Three clusters of CRF01_AE/B' recombinants displaying divergent yet phylogenetically-related mosaic genomes to CRF33_01B were identified and characterized, suggestive of an abrupt emergence of multiple novel CRF clades. Using rigorous maximum likelihood approach and the Bayesian Markov chain Monte Carlo (MCMC sampling of CRF33_01Bpol sequences to elucidate the past population dynamics, we found that the founder lineages of CRF33_01B were likely to have first emerged among PWIDs in the early 1990 s before spreading exponentially to various high and low-risk populations (including children who acquired infections from their mothers and later on became endemic around the early 2000 s. Taken together, our findings provide notable genetic evidence indicating the widespread expansion of CRF33_01B among PWIDs and into the general population. The emergence of numerous previously unknown recombinant clades highlights the

  7. Temporal and spatial dynamics of human immunodeficiency virus type 1 circulating recombinant forms 08_BC and 07_BC in Asia. (United States)

    Tee, Kok Keng; Pybus, Oliver G; Li, Xiao-Jie; Han, Xiaoxu; Shang, Hong; Kamarulzaman, Adeeba; Takebe, Yutaka


    Human immunodeficiency virus type 1 (HIV-1) CRF08_BC and CRF07_BC are two major recombinants descended from subtypes B' and C. Despite their massive epidemic impact in China, their migration patterns and divergence times remain unknown. Phylogenetic and population genetic analyses were performed on 228 HIV-1 sequences representing CRF08_BC, CRF07_BC, and subtype C strains from different locations across China, India, and Myanmar. Genome-specific rates of evolution and divergence times were estimated using a Bayesian Markov chain Monte Carlo framework under various evolutionary models. CRF08_BC originated in 1990.3 (95% credible region [CR], 1988.6 to 1991.9) in Yunnan province before spreading to Guangxi (south) and Liaoning (northeast) around 1995. Inside Guangxi region, the eastward expansion of CRF08_BC continued from Baise city (west) to Binyang (central) between 1997 and 1998 and later spread into Pingxiang around 1999 in the south, mainly through injecting drug users. Additionally, CRF07_BC diverged from its common ancestor in 1993.3 (95% CR, 1991.2 to 1995.2) before crossing the border into southern Taiwan in late 1990s. Phylogenetic analysis indicates that both CRF08_BC and CRF07_BC can trace their origins to Yunnan. The parental Indian subtype C lineage likely entered China around 1981.2 (95% CR, 1976.7 to 1985.9). Using a multiple unlinked locus model, we also showed that the dates of divergence calculated in this study may not be significantly affected by intrasubtype recombination among different lineages. This is the first phylodynamic study depicting the spatiotemporal dynamics of HIV/AIDS in East Asia. PMID:18596096

  8. Containment air circulation for optimal hydrogen recombination

    International Nuclear Information System (INIS)

    An accepted first-line defense for hydrogen mitigation is to design for the hydrogen to be rapidly mixed with the containment atmosphere and diluted to below flammability concentrations. Then, as hydrogen continues to be produced in the longer term, recombiners can be used to remove hydrogen: recombiners can be located in forced-air ducts or passive recombiners can be distributed within containment and the heat of recombination used to promote local air circulation. However, this principle does not eliminate the possibility of high hydrogen concentrations at locations removed from the recombiners. An improvement on this strategy is to arrange for a specific, buoyancy-driven, overall circulation of the containment atmosphere such that the recombiners can be located within the recirculation flow, immediately downstream of the hydrogen source. This would make the mixing process more predictable and solve the mass-transfer problem associated with distributed recombiners. Ideally, the recombiners would be located just above the hydrogen source so that the heat of recombination would assist the overall circulation. In this way, the hydrogen would be removed as close as possible to the source, thereby minimizing the amount of hydrogen immediately downstream of the source and reducing the hydrogen concentration to acceptable levels at other locations. Such a strategy requires the containment volume to be divided into an upflow path, past the hydrogen source and the recombiner, and a downflow path to complete the circuit. The flow could be generated actively using fans or passively using buoyancy forces arising from the difference in density of gases in the upfiow and downflow paths; the gases in the downflow path being cooled at an elevated heat sink. (author)

  9. Lipid peroxidation and total cholesterol in HAART-naive patients infected with circulating recombinant forms of human immunodeficiency virus type-1 in Cameroon.

    Directory of Open Access Journals (Sweden)

    Georges Teto

    not statistically significant with MDA. The different subtypes obtained after sequencing were CRF02_AG (43.3%, CRF01_AE (20%, A1 (23.3%, H (6.7%, and G (6.7%. None of the HIV-1 subtypes significantly influenced the levels of the biochemical parameters, but by grouping them as pure subtypes and circulating recombinant forms (CRFs, the CRF significantly influenced TC levels. TC was significantly lower in patients infected with CRF (0.87±0.27 g/l compared to patients infected with pure HIV-1 subtypes (1.32±0.68 g/l (p<0.017. MDA levels were also significantly higher in patients infected with HIV-1CRF01_AE (0.50±0.10 µM, compared to patients infected with CRF02_AG (0. 38±0. 08 µM (p<0.018. CONCLUSION: These results show that HIV infection in Cameroon is associated with significant decrease in TAA, LDLC, HDLC and TC, and increased MDA concentration and LPI indices which seem to be linked to the severity of HIV infection as assessed by CD4 cell count. The data suggests increased oxidative stress and lipid peroxidation in HIV-infected patients in Cameroon, and an influence of CRFs on TC and MDA levels.

  10. Field Evaluation of the gag-Based Heteroduplex Mobility Assay for Genetic Subtyping of Circulating Recombinant Forms of Human Immunodeficiency Virus Type 1 in Abidjan, Côte d'Ivoire


    Sawadogo, Souleymane; Adjé-Touré, Christiane; Bilé, Celestin E.; Ekpini, Rene E. A.; Chorba, Terence; John N. Nkengasong


    The gag-based heteroduplex mobility assay (gag-HMA) was evaluated for its ease and reliability in subtyping circulating recombinant forms (CRFs) of human immunodeficiency virus type 1 (HIV-1) in Côte d'Ivoire. One hundred thirty-two plasma samples were analyzed blindly for HIV-1 subtypes by sequencing the pol gene and by gag-HMA. DNA sequencing was used as the “gold standard.” Of the 132 samples sequenced, 108 (82%) were CRF02_AG, 14 (11%) were pure subtype A, 5 (4%) were subtype G, 3 (2%) we...

  11. The predominance of Human Immunodeficiency Virus type 1 (HIV-1 circulating recombinant form 02 (CRF02_AG in West Central Africa may be related to its replicative fitness

    Directory of Open Access Journals (Sweden)

    Butel Christelle


    Full Text Available Abstract Background CRF02_AG is the predominant HIV strain circulating in West and West Central Africa. The aim of this study was to test whether this predominance is associated with a higher in vitro replicative fitness relative to parental subtype A and G viruses. Primary HIV-1 isolates (10 CRF02_AG, 5 subtype A and 5 subtype G were obtained from a well-described Cameroonian cohort. Growth competition experiments were carried out at equal multiplicity of infection in activated T cells and monocyte-derived dendritic cells (MO-DC in parallel. Results Dual infection/competition experiments in activated T cells clearly indicated that CRF02_AG isolates had a significant replication advantage over the subtype A and subtype G viruses. The higher fitness of CRF02_AG was evident for isolates from patients with CD4+ T cell counts >200 cells/μL (non-AIDS or CD4+ T cell counts Conclusion We observed a higher ex vivo replicative fitness of CRF02_AG isolates compared to subtype A and G viruses from the same geographic region and showed that this was independent of the co-receptor tropism and irrespective of high or low CD4+ T cell count. This advantage in replicative fitness may contribute to the dominant spread of CRF02_AG over A and G subtypes in West and West Central Africa.

  12. Risk group characteristics and viral transmission clusters in South-East Asian patients infected with human immunodeficiency virus-1 (HIV-1) circulating recombinant form (CRF) 01_AE and subtype B. (United States)

    Oyomopito, Rebecca A; Chen, Yen-Ju; Sungkanuparph, Somnuek; Kantor, Rami; Merati, Tuti; Yam, Wing-Cheong; Sirisanthana, Thira; Li, Patrick C K; Kantipong, Pacharee; Phanuphak, Praphan; Lee, Chris K C; Kamarulzaman, Adeeba; Ditangco, Rossana; Huang, Szu-Wei; Sohn, Annette H; Law, Matthew; Chen, Yi Ming A


    Human immunodeficiency virus (HIV)-1 epidemics in Asian countries are driven by varying exposures. The epidemiology of the regional pandemic has been changing with the spread of HIV-1 to lower-risk populations through sexual transmission. Common HIV-1 genotypes include subtype B and circulating recombinant form (CRF) 01_AE. Our objective was to use HIV-1 genotypic data to better quantify local epidemics. TASER-M is a multicenter prospective cohort of HIV-infected patients. Associations between HIV exposure, patient sex, country of sample origin and HIV-1 genotype were evaluated by multivariate logistic regression. Phylogenetic methods were used on genotypic data to investigate transmission relationships. A total of 1086 patients from Thailand, Hong Kong, Malaysia and the Philippines were included in analyses. Proportions of male patients within countries varied (Thailand: 55.6%, Hong Kong: 86.1%, Malaysia: 81.4%, Philippines: 93.8%; p < 0.001) as did HIV exposures (heterosexual contact: Thailand: 85.7%, Hong Kong, 46.2%, Malaysia: 47.8%, Philippines: 25.0%; p < 0.001). After adjustment, we found increased subtype B infection among men who have sex with men, relative to heterosexual-reported exposures (odds ratio = 2.4, p < 0.001). We further describe four transmission clusters of eight to 15 treatment naïve, predominantly symptomatic patients (two each for subtype B and CRF01_AE). Risk-group subpopulations differed with respect to the infecting HIV-1 genotype. Homosexual exposure patients had higher odds of being infected with subtype B. Where HIV-1 genotypes circulate within countries or patient risk-groups, local monitoring of genotype-specific transmissions may play a role in focusing public health prevention strategies. Phylogenetic evaluations provide complementary information for surveillance and monitoring of viruses with high mutation rates such as HIV-1 and Ebola. PMID:26362956

  13. Frequent intra-subtype recombination among HIV-1 circulating in Tanzania.

    Directory of Open Access Journals (Sweden)

    Ireen E Kiwelu

    Full Text Available The study estimated the prevalence of HIV-1 intra-subtype recombinant variants among female bar and hotel workers in Tanzania. While intra-subtype recombination occurs in HIV-1, it is generally underestimated. HIV-1 env gp120 V1-C5 quasispecies from 45 subjects were generated by single-genome amplification and sequencing (median (IQR of 38 (28-50 sequences per subject. Recombination analysis was performed using seven methods implemented within the recombination detection program version 3, RDP3. HIV-1 sequences were considered recombinant if recombination signals were detected by at least three methods with p-values of ≤0.05 after Bonferroni correction for multiple comparisons. HIV-1 in 38 (84% subjects showed evidence for intra-subtype recombination including 22 with HIV-1 subtype A1, 13 with HIV-1 subtype C, and 3 with HIV-1 subtype D. The distribution of intra-patient recombination breakpoints suggested ongoing recombination and showed selective enrichment of recombinant variants in 23 (60% subjects. The number of subjects with evidence of intra-subtype recombination increased from 29 (69% to 36 (82% over one year of follow-up, although the increase did not reach statistical significance. Adjustment for intra-subtype recombination is important for the analysis of multiplicity of HIV infection. This is the first report of high prevalence of intra-subtype recombination in the HIV/AIDS epidemic in Tanzania, a region where multiple HIV-1 subtypes co-circulate. HIV-1 intra-subtype recombination increases viral diversity and presents additional challenges for HIV-1 vaccine design.

  14. Methods of forming a fluidized bed of circulating particles (United States)

    Marshall, Douglas W.


    There is disclosed an apparatus for forming a fluidized bed of circulating particles. In an embodiment, the apparatus includes a bottom portion having a sidewall, the sidewall defining a curvilinear profile, and the bottom portion configured to contain a bed of particles; and a gas inlet configured to produce a column of gas to carry entrained particles therein. There is disclosed a method of forming a fluidized bed of circulating particles. In an embodiment, the method includes positioning particles within a bottom portion having a sidewall, the sidewall defining a curvilinear profile; producing a column of gas directed upwardly through a gas inlet; carrying entrained particles in the column of gas to produce a fountain of particles over the fluidized bed of circulating particles and subside in the particle bed until being directed inwardly into the column of gas within the curvilinear profile.

  15. Studies of recombinant forms of Aleuria aurantia lectin


    Olausson, Johan


    The presented work describes construction and analysis of recombinantly produced forms of Aleuria aurantia lectin (AAL). The binding properties of the produced AAL forms were studied using techniques such as tryptophan fluorescence, hemagglutination analysis, ELISA and surface plasmon resonance analysis. Lectins are proteins that are ubiquitous in nature with the ability to bind specifically to different types of carbohydrates. The physiological function of different lectins is not always kno...

  16. Recombinant human granulocyte colony-stimulating factor increases circulating CD34-postive cells in patients with AIDS

    DEFF Research Database (Denmark)

    Nielsen, S D; Dam-Larsen, S; Nielsen, C;


    circulating hematopoietic progenitor cells (CD34 cells) in patients with AIDS, using the recombinant human granulocyte colony-stimulating factor (G-CSF). Eight patients with AIDS were treated with G-CSF for neutropenia (< 1.0 x 10(9)/l). Treatment consisted of daily subcutaneous injections with 300 micrograms...

  17. Attenuated vaccines can recombine to form virulent field viruses. (United States)

    Lee, Sang-Won; Markham, Philip F; Coppo, Mauricio J C; Legione, Alistair R; Markham, John F; Noormohammadi, Amir H; Browning, Glenn F; Ficorilli, Nino; Hartley, Carol A; Devlin, Joanne M


    Recombination between herpesviruses has been seen in vitro and in vivo under experimental conditions. This has raised safety concerns about using attenuated herpesvirus vaccines in human and veterinary medicine and adds to other known concerns associated with their use, including reversion to virulence and disease arising from recurrent reactivation of lifelong chronic infection. We used high-throughput sequencing to investigate relationships between emergent field strains and vaccine strains of infectious laryngotracheitis virus (ILTV, gallid herpesvirus 1). We show that independent recombination events between distinct attenuated vaccine strains resulted in virulent recombinant viruses that became the dominant strains responsible for widespread disease in Australian commercial poultry flocks. These findings highlight the risks of using multiple different attenuated herpesvirus vaccines, or vectors, in the same populations. PMID:22798607

  18. Genomic characterization of two novel HIV-1 unique (CRF01_AE/B) recombinant forms among men who have sex with men in Beijing, China. (United States)

    Li, Zheng; Li, Jia; Feng, Yi; Kalish, Marcia L; Lu, Hongyan; Yin, Lu; Liao, Lingjie; Qian, Han-Zhu; Frost, Simon D W; Ruan, Yuhua; Vermund, Sten H; Shao, Yiming; Xing, Hui


    We report here two novel HIV-1 recombinant forms (CRF01_AE/B) isolated from two HIV-positive male subjects infected through homosexual contact in Beijing, China. Recombination contributes substantially to the genetic diversity of HIV-1, and is likely to occur in populations in which multiple subtypes circulate. Molecular epidemiological studies showed that subtype B, CRF01_AE, and CRF07_BC are currently cocirculating in parallel among men who have sex with men (MSM) in China, providing the opportunity for the emergence of new recombinants. Phylogenetic analysis of near full-length genome (NFLG) sequences showed that the unique recombinant forms (URFs) were composed of gene regions from CRF01_AE and subtype B. The CRF01_AE region of the recombinants clustered together with a previously described cluster 4 lineage of CRF01_AE. The B regions of both the recombinants clustered within the B strains. The two recombinants were quite similar with six breakpoints in common. These data highlight the importance of continuous surveillance of the dynamic change of HIV-1 subtypes and new recombinants among the MSM population. PMID:26058342

  19. The contribution of recombination to heterozygosity differs among plant evolutionary lineages and life-forms

    Directory of Open Access Journals (Sweden)

    Verdú Miguel


    Full Text Available Abstract Background Despite its role as a generator of haplotypic variation, little is known about how the rates of recombination evolve across taxa. Recombination is a very labile force, susceptible to evolutionary and life trait related processes, which have also been correlated with general levels of genetic diversity. For example, in plants, it has been shown that long-lived outcrossing taxa, such as trees, have higher heterozygosity (He at SSRs and allozymes than selfing or annual species. However, some of these tree taxa have surprisingly low levels of nucleotide diversity at the DNA sequence level, which points to recombination as a potential generator of genetic diversity in these organisms. In this study, we examine how genome-wide and within-gene rates of recombination evolve across plant taxa, determine whether such rates are influenced by the life-form adopted by species, and evaluate if higher genome-wide rates of recombination translate into higher He values, especially in trees. Results Estimates of genome-wide (cM/Mb recombination rates from 81 higher plants showed a significant phylogenetic signal. The use of different comparative phylogenetic models demonstrated that there is a positive correlation between recombination rate and He (0.83 ± 0.29, and that trees have higher rates of genome-wide recombination than short-lived herbs and shrubs. A significant taxonomic component was further made evident by our models, as conifers exhibited lower recombination rates than angiosperms. This trend was also found at the within-gene level. Conclusions Altogether, our results illustrate how both common ancestry and life-history traits have to be taken into account for understanding the evolution of genetic diversity and genomic rates of recombination across plant species, and highlight the relevance of species life forms to explain general levels of diversity and recombination.

  20. Recombinant erythropoietin in humans has a prolonged effect on circulating erythropoietin isoform distribution

    DEFF Research Database (Denmark)

    Aachmann-Andersen, Niels Jacob; Just Christensen, Søren; Lisbjerg, Kristian;


    The membrane-assisted isoform immunoassay (MAIIA) quantitates erythropoietin (EPO) isoforms as percentages of migrated isoforms (PMI). We evaluated the effect of recombinant human EPO (rhEPO) on the distribution of EPO isoforms in plasma in a randomized, placebo-controlled, double-blinded, cross......-over study. 16 healthy subjects received either low-dose Epoetin beta (5000 IU on days 1, 3, 5, 7, 9, 11 and 13); high-dose Epoetin beta (30.000 IU on days 1, 2 and 3 and placebo on days 5, 7, 9, 11 and 13); or placebo on all days. PMI on days 4, 11 and 25 was determined by interaction of N......-acetyl glucosamine with the glycosylation dependent desorption of EPO isoforms. At day 25, plasma-EPO in both rhEPO groups had returned to values not different from the placebo group. PMI with placebo, reflecting the endogenous EPO isoforms, averaged 82.5 (10.3) % (mean (SD)). High-dose Epoetin beta decreased PMI on...

  1. Conformational variability of recombination R-triplex formed by the mammalian telomeric sequence


    Shchyolkina, A.; Kaluzhny, D.; O. Borisova; Arndt-Jovin, D; Jovin, T.; Zhurkin, V.


    Alignment of three nucleic acids strands, in which the third strand is identical to one of the DNA duplex strands, occurs in various cellular systems. In the case of telomeric t-loops, recognition between the DNA duplex and the homologous single strand is likely to be mediated by proteins through formation of the transient recombination-type R-triplex. Earlier, using 2-aminopurine as a fluorescent reporting base, we evaluated the thermodynamic characteristics of intramolecular R-triplex forme...

  2. Recombinant erythropoietin in humans has a prolonged effect on circulating erythropoietin isoform distribution.

    Directory of Open Access Journals (Sweden)

    Niels Jacob Aachmann-Andersen

    Full Text Available The membrane-assisted isoform immunoassay (MAIIA quantitates erythropoietin (EPO isoforms as percentages of migrated isoforms (PMI. We evaluated the effect of recombinant human EPO (rhEPO on the distribution of EPO isoforms in plasma in a randomized, placebo-controlled, double-blinded, cross-over study. 16 healthy subjects received either low-dose Epoetin beta (5000 IU on days 1, 3, 5, 7, 9, 11 and 13; high-dose Epoetin beta (30.000 IU on days 1, 2 and 3 and placebo on days 5, 7, 9, 11 and 13; or placebo on all days. PMI on days 4, 11 and 25 was determined by interaction of N-acetyl glucosamine with the glycosylation dependent desorption of EPO isoforms. At day 25, plasma-EPO in both rhEPO groups had returned to values not different from the placebo group. PMI with placebo, reflecting the endogenous EPO isoforms, averaged 82.5 (10.3 % (mean (SD. High-dose Epoetin beta decreased PMI on days 4 and 11 to 31.0 (4.2% (p<0.00001 and 45.2 (7.3% (p<0.00001. Low-dose Epoetin beta decreased PMI on days 4 and 11 to 46.0 (12.8% (p<0.00001 and 46.1 (10.4% (p<0.00001. In both rhEPO groups, PMI on day 25 was still decreased (high-dose Epoetin beta: 72.9 (19.4% (p=0.029; low-dose Epoetin beta: 73.1 (17.8% (p=0.039. In conclusion, Epoetin beta leaves a footprint in the plasma-EPO isoform pattern. MAIIA can detect changes in EPO isoform distribution up til at least three weeks after administration of Epoetin beta even though the total EPO concentration has returned to normal.

  3. Exercise-induced norepinephrine decreases circulating hematopoietic stem and progenitor cell colony-forming capacity.

    Directory of Open Access Journals (Sweden)

    Julia M Kröpfl

    Full Text Available A recent study showed that ergometry increased circulating hematopoietic stem and progenitor cell (CPC numbers, but reduced hematopoietic colony forming capacity/functionality under normoxia and normobaric hypoxia. Herein we investigated whether an exercise-induced elevated plasma free/bound norepinephrine (NE concentration could be responsible for directly influencing CPC functionality. Venous blood was taken from ten healthy male subjects (25.3+/-4.4 yrs before and 4 times after ergometry under normoxia and normobaric hypoxia (FiO2<0.15. The circulating hematopoietic stem and progenitor cell numbers were correlated with free/bound NE, free/bound epinephrine (EPI, cortisol (Co and interleukin-6 (IL-6. Additionally, the influence of exercise-induced NE and blood lactate (La on CPC functionality was analyzed in a randomly selected group of subjects (n = 6 in vitro under normoxia by secondary colony-forming unit granulocyte macrophage assays. Concentrations of free NE, EPI, Co and IL-6 were significantly increased post-exercise under normoxia/hypoxia. Ergometry-induced free NE concentrations found in vivo showed a significant impairment of CPC functionality in vitro under normoxia. Thus, ergometry-induced free NE was thought to trigger CPC mobilization 10 minutes post-exercise, but as previously shown impairs CPC proliferative capacity/functionality at the same time. The obtained results suggest that an ergometry-induced free NE concentration has a direct negative effect on CPC functionality. Cortisol may further influence CPC dynamics and functionality.

  4. Structure and stability of recombinant bovine odorant-binding protein: II. Unfolding of the monomeric forms (United States)

    Stepanenko, Olga V.; Roginskii, Denis O.; Stepanenko, Olesya V.; Kuznetsova, Irina M.


    In a family of monomeric odorant-binding proteins (OBPs), bovine OBP (bOBP), that lacks conserved disulfide bond found in other OBPs, occupies unique niche because of its ability to form domain-swapped dimers. In this study, we analyzed conformational stabilities of the recombinant bOBP and its monomeric variants, the bOBP-Gly121+ mutant containing an additional glycine residue after the residue 121 of the bOBP, and the GCC-bOBP mutant obtained from the bOBP-Gly121+ form by introduction of the Trp64Cys/His155Cys double mutation to restore the canonical disulfide bond. We also analyzed the effect of the natural ligand binding on the conformational stabilities of these bOBP variants. Our data are consistent with the conclusion that the unfolding-refolding pathways of the recombinant bOBP and its mutant monomeric forms bOBP-Gly121+ and GCC-bOBP are similar and do not depend on the oligomeric status of the protein. This clearly shows that the information on the unfolding-refolding mechanism is encoded in the structure of the bOBP monomers. However, the process of the bOBP unfolding is significantly complicated by the formation of the domain-swapped dimer, and the rates of the unfolding-refolding reactions essentially depend on the conditions in which the protein is located. PMID:27114857

  5. Conformational variability of recombination R-triplex formed by the mammalian telomeric sequence. (United States)

    Shchyolkina, Anna K; Kaluzhny, Dmitry N; Borisova, Olga F; Arndt-Jovin, Donna J; Jovin, Thomas M; Zhurkin, Victor B


    Alignment of three nucleic acids strands, in which the third strand is identical to one of the DNA duplex strands, occurs in various cellular systems. In the case of telomeric t-loops, recognition between the DNA duplex and the homologous single strand is likely to be mediated by proteins through formation of the transient recombination-type R-triplex. Earlier, using 2-aminopurine as a fluorescent reporting base, we evaluated the thermodynamic characteristics of intramolecular R-triplex formed by a mixed nucleotide sequence. Here, we used this approach to explore a propensity of the telomeric TTAGGG repeat to form the R-triplex. The circular dichroism spectral changes detected upon formation of the R-triplex suggest that this process is accompanied by specific conformational changes in DNA, including a local destabilization of the target duplex next to a GGG run revealed by the fluorescence of the reporting 2-aminopurine base. Surprisingly, stability of the R-triplex formed by telomeric sequence depends strikingly on the counter ion, being higher for Na(+) than for Li(+). Taken together these findings indicate a significant conformational variability of telomeric DNA in the context of recombination-type R-triplex, a phenomenon of possible biological relevance. PMID:26308235

  6. B-type Natriuretic Peptide circulating forms: Analytical and bioactivity issues. (United States)

    Yandle, Tim G; Richards, A Mark


    B-type Natriuretic Peptide (BNP), A-type and C-type Natriuretic Peptides (ANP and CNP) comprise a family of peptides that retain a common ring structure and conserved amino acid sequences. All are present in the heart, but only BNP and ANP are regarded as primarily cardiac secretory products. BNP and ANP, acting through a guanylyl cyclase receptor, increase sodium and water excretion by the kidney, induce vasodilation, reduce blood pressure, counteract the bioactivity of the renin-angiotensin-aldosterone and sympathetic nervous systems and possess anti-hypertrophic and anti-fibrotic properties. BNP is synthesised in cardiomyocytes first as the precursor peptide preproBNP. Removal of the signal peptide from preproBNP produces proBNP which is cleaved to produce the biologically active carboxy-terminal BNP peptide and the inactive N-terminal fragment, NT-proBNP. BNP, NT-proBNP, proBNP and the C-terminal portion of the BNP signal peptide have been detected in human plasma as well as multiple sub-forms including truncated forms of BNP and NT-proBNP, as well as variable glycosylation of NT-proBNP and proBNP. The origin of these circulating forms, their potential bioactivity and their detection by current analytical methods are presented in this review. PMID:26160054

  7. On stabilization of scattering resonances in recombination reaction that forms ozone (United States)

    Ivanov, Mikhail V.; Babikov, Dmitri


    Calculations of energy transfer in the recombination reaction that forms ozone are carried out within the framework of the mixed quantum/classical theory and using the dimensionally reduced 2D-model of ozone molecule, with bending motion neglected. Recombination rate coefficients are obtained at room temperature for symmetric and asymmetric isotopomers of singly and doubly substituted isotopologues. The processes of resonance formation, spontaneous decay, collisional dissociation, and stabilization by bath gas (Ar) are all characterized and taken into account within the steady-state approximation for kinetics. The focus is on stabilization step, where the mysterious isotopic η-effect was thought to originate from. Our results indicate no difference in cross sections for stabilization of scattering resonances in symmetric and asymmetric isotopomers. As practical results, the general and simple analytic models for stabilization and dissociation cross sections are presented, which can be applied to resonances in any ozone molecule, symmetric or asymmetric, singly or doubly substituted. Present calculations show some isotope effect that looks similar to the experimentally observed η-effect, and the origin of this phenomenon is in the rates of formation/decay of scattering resonances, determined by their widths, that are somewhat larger in asymmetric isotopomers than in their symmetric analogues. However, the approximate two-dimensional model used here is insufficient for consistent and reliable description of all features of the isotopic effect in ozone. Calculations using an accurate 3D model are still needed.

  8. Overexpression and characterization of dimeric and tetrameric forms of recombinant serine hydroxymethyltransferase from Bacillus stearothermophilus

    Indian Academy of Sciences (India)

    Venkatakrishna R Jala; V Prakash; N Appaji Rao; H S Savithri


    Serine hydroxymethyltransferase (SHMT), a pyridoxal-5′-phosphate (PLP) dependent enzyme catalyzes the interconversion of L-Ser and Gly using tetrahydrofolate as a substrate. The gene encoding for SHMT was amplified by PCR from genomic DNA of Bacillus stearothermophilus and the PCR product was cloned and overexpressed in Escherichia coli. The purified recombinant enzyme was isolated as a mixture of dimer (90%) and tetramer (10%). This is the first report demonstrating the existence of SHMT as a dimer and tetramer in the same organism. The specific activities at 37°C of the dimeric and tetrameric forms were 6.7 U/mg and 4.1 U/mg, respectively. The purified dimer was extremely thermostable with a m of 85°C in the presence of PLP and L-Ser. The temperature optimum of the dimer was 80°C with a specific activity of 32.4 U/mg at this temperature. The enzyme catalyzed tetrahydrofolate-independent reactions at a slower rate compared to the tetrahydrofolate-dependent retro-aldol cleavage of L-Ser. The interaction with substrates and their analogues indicated that the orientation of PLP ring of B. stearothermophilus SHMT was probably different from sheep liver cytosolic recombinant SHMT (scSHMT).

  9. Highly divergent subtypes and new recombinant forms prevail in the HIV/AIDS epidemic in Angola: new insights into the origins of the AIDS pandemic. (United States)

    Bártolo, Inês; Rocha, Cheila; Bartolomeu, José; Gama, António; Marcelino, Rute; Fonseca, Marlene; Mendes, Ana; Epalanga, Marta; Silva, Patrícia Cavaco; Taveira, Nuno


    Angola, located in South-Western Africa, has a remarkably low HIV/AIDS prevalence in the adult population (3.7%). It is bordered in the North by the Democratic Republic of Congo (DRC) and Republic of Congo that are at the origin of human HIV-1 infections. It is, therefore, likely that HIV-1 strains circulating in Angola are genetically diverse and representative of the origin of the HIV/AIDS epidemic. The aim of this work was to investigate in detail the genetic diversity and molecular epidemiology of HIV-1 in Angola. Almost 400 sequences were obtained from the gag (p17), pol (PR and RT) and/or env (C2C3) genes of 159 HIV-1 infected patients living in eight provinces of Angola (Benguela, Cabinda, Cuanza Norte, Luanda, Lunda Norte, Malange, Uíge, and Zaire) and their genotype was determined by phylogenetic analyses. Gene regions representing all HIV-1 group M clades were found as well as unclassifiable sequences. In env and pol (RT), two groups of sequences forming distinct sub-clusters within the subtype A radiation were found and may define new A5 and A6 sub-subtypes. Recombinant forms were found in almost half (47.1%) of the patients of which 36.0% were second-generation recombinants. Fifty-eight different patterns of recombination were found. The A subtype, including CRF02_AG, was represented in most recombinant viruses. Epidemiological data suggests that the AIDS epidemic in Angola has probably started as early as 1961, the major cause being the independence war, and spread to Portugal soon thereafter. The extraordinary degree of HIV-1 group M genetic diversity and evolution in Angola may pose unprecedented challenges to diagnostic, treatment and prevention of HIV-1 infection. PMID:18562253

  10. Exercise-induced norepinephrine decreases circulating hematopoietic stem and progenitor cell colony-forming capacity. (United States)

    Kröpfl, Julia M; Stelzer, Ingeborg; Mangge, Harald; Pekovits, Karin; Fuchs, Robert; Allard, Nathalie; Schinagl, Lukas; Hofmann, Peter; Dohr, Gottfried; Wallner-Liebmann, Sandra; Domej, Wolfgang; Müller, Wolfram


    A recent study showed that ergometry increased circulating hematopoietic stem and progenitor cell (CPC) numbers, but reduced hematopoietic colony forming capacity/functionality under normoxia and normobaric hypoxia. Herein we investigated whether an exercise-induced elevated plasma free/bound norepinephrine (NE) concentration could be responsible for directly influencing CPC functionality. Venous blood was taken from ten healthy male subjects (25.3+/-4.4 yrs) before and 4 times after ergometry under normoxia and normobaric hypoxia (FiO2exercise-induced NE and blood lactate (La) on CPC functionality was analyzed in a randomly selected group of subjects (n = 6) in vitro under normoxia by secondary colony-forming unit granulocyte macrophage assays. Concentrations of free NE, EPI, Co and IL-6 were significantly increased post-exercise under normoxia/hypoxia. Ergometry-induced free NE concentrations found in vivo showed a significant impairment of CPC functionality in vitro under normoxia. Thus, ergometry-induced free NE was thought to trigger CPC mobilization 10 minutes post-exercise, but as previously shown impairs CPC proliferative capacity/functionality at the same time. The obtained results suggest that an ergometry-induced free NE concentration has a direct negative effect on CPC functionality. Cortisol may further influence CPC dynamics and functionality. PMID:25180783

  11. Co-circulation and genomic recombination of coxsackievirus A16 and enterovirus 71 during a large outbreak of hand, foot, and mouth disease in Central China.

    Directory of Open Access Journals (Sweden)

    Weiyong Liu

    Full Text Available A total of 1844 patients with hand, foot, and mouth disease (HFMD, most of them were children of age 1-3-year-old, in Central China were hospitalized from 2011 to 2012. Among them, 422 were infected with coxsackievirus A16 (CVA16, 334 were infected with enterovirus 71 (EV71, 38 were co-infected with EV71 and CVA16, and 35 were infected with other enteroviruses. Molecular epidemiology analysis revealed that EV71 and CVA16 were detected year-round, but EV71 circulated mainly in July and CVA16 circulated predominantly in November, and incidence of HFMD was reduced in January and February and increased in March. Clinical data showed that hyperglycemia and neurologic complications were significantly higher in EV71-infected patients, while upper respiratory tract infection and C-reactive protein were significantly higher in CVA16-associated patients. 124 EV71 and 80 CVA16 strains were isolated, among them 56 and 68 EV71 strains were C4a and C4b, while 25 and 55 CVA16 strains were B1a and B1b, respectively. Similarity plots and bootscan analyses based on entire genomic sequences revealed that the three C4a sub-genotype EV71 strains were recombinant with C4b sub-genotype EV71 in 2B-2C region, and the three CVA16 strains were recombinant with EV71 in 2A-2B region. Thus, CVA16 and EV71 were the major causative agents in a large HFMD outbreak in Central China. HFMD incidence was high for children among household contact and was detected year-round, but outbreak was seasonal dependent. CVA16 B1b and EV71 C4b reemerged and caused a large epidemic in China after a quiet period of many years. Moreover, EV71 and CVA16 were co-circulated during the outbreak, which may have contributed to the genomic recombination between the pathogens. It should gain more attention as there may be an upward trend in co-circulation of the two pathogens globally and the new role recombination plays in the emergence of new enterovirus variants.

  12. Current trends of HIV recombination worldwide

    Directory of Open Access Journals (Sweden)

    Katherine A. Lau


    Full Text Available One of the major characteristics of HIV-1 is its high genetic variability and extensive heterogeneity. This characteristic is due to its molecular traits, which in turn allows it to vary, recombine, and diversify at a high frequency. As such, it generates complex molecular forms, termed recombinants, which evade the human immune system and so survive. There is no sequence constraint to the recombination pattern as it appears to occur at inter-group (between groups M and O, as well as inter- and intra-subtype within group M. Rapid emergence and active global transmission of HIV-1 recombinants, known as circulating recombinant forms (CRFs and unique recombinant forms (URFs, requires urgent attention. To date, 55 CRFs have been reported around the world. The first CRF01_AE originated from Central Africa but spread widely in Asia. The most recent CRF; CRF55_01B is a recombinant form of CRF01_AE and subtype B, although its origin is yet to be publicly disclosed. HIV-1 recombination is an ongoing event and plays an indispensable role in HIV epidemics in different regions. Africa, Asia and South America are identified as recombination hot-spots. They are affected by continual emergence and co-circulation of newly emerging CRFs and URFs, which are now responsible for almost 20% of HIV-1 infections worldwide. Better understanding of recombinants is necessary to determine their biological and molecular attributes.

  13. Long Circulating Micelles based on Helix Bundle-Forming Peptide-Polymer Conjugates (United States)

    Shu, Jessica; Dong, He; Dube, Nikhil; Seo, Jai Woong; Ma, Yu Fei; Ferrara, Katherine; Xu, Ting


    Stable, multi-functional organic nanoparticles that combine long in vivo circulation, the ability to cross vessel walls to reach tumor tissues and controlled disassembly for eventual clearance will have a significant impact in nanomedicine. Although current self-assemblies of amphiphiles provide a versatile platform to generate modular organic nanoparticles, it remains a significant challenge to simultaneously control nanoparticle size in the range of 10-30 nm, enhance particle stability and tailor disassembly within suitable timescales. We have advanced this goal by designing a new family of amphiphiles based on coiled-coil 3-helix bundle forming peptide-polymer conjugates. By attaching a polymer chain to the middle of a helical peptide, the protein tertiary structures are used to position entropic forces of compressed polymer chains comprising the headgroups so as to effectively slow down the subunit desorption rate and enhance the in vivo stability. The resultant monodispersed nanoparticles are composed of subunits, polymer chain with a common protein structure, i.e. coiled-coil helix bundle, and a lipid core, self-assembled nanoparticles have been engineered with tunable stability and disassembly.

  14. BF integrase genes of HIV-1 circulating in São Paulo, Brazil, with a recurrent recombination region. (United States)

    Iamarino, Atila; de Melo, Fernando Lucas; Braconi, Carla Torres; Zanotto, Paolo Marinho de Andrade


    Although some studies have shown diversity in HIV integrase (IN) genes, none has focused particularly on the gene evolving in epidemics in the context of recombination. The IN gene in 157 HIV-1 integrase inhibitor-naïve patients from the São Paulo State, Brazil, were sequenced tallying 128 of subtype B (23 of which were found in non-B genomes), 17 of subtype F (8 of which were found in recombinant genomes), 11 integrases were BF recombinants, and 1 from subtype C. Crucially, we found that 4 BF recombinant viruses shared a recurrent recombination breakpoint region between positions 4900 and 4924 (relative to the HXB2) that includes 2 gRNA loops, where the RT may stutter. Since these recombinants had independent phylogenetic origin, we argue that these results suggest a possible recombination hotspot not observed so far in BF CRF in particular, or in any other HIV-1 CRF in general. Additionally, 40% of the drug-naïve and 45% of the drug-treated patients had at least 1 raltegravir (RAL) or elvitegravir (EVG) resistance-associated amino acid change, but no major resistance mutations were found, in line with other studies. Importantly, V151I was the most common minor resistance mutation among B, F, and BF IN genes. Most codon sites of the IN genes had higher rates of synonymous substitutions (dS) indicative of a strong negative selection. Nevertheless, several codon sites mainly in the subtype B were found under positive selection. Consequently, we observed a higher genetic diversity in the B portions of the mosaics, possibly due to the more recent introduction of subtype F on top of an ongoing subtype B epidemics and a fast spread of subtype F alleles among the B population. PMID:22485165

  15. Changes in the Frequency and In Vivo Vessel Forming Ability of Rhesus Monkey Circulating Endothelial Colony Forming Cells (ECFC) Across the Lifespan (Birth to Aged)


    Shelley, W. Chris; Leapley, Alyssa C.; Huang, Lan; Critser, Paul J.; Mead, Laura E.; Zeng, Pingyu; Prater, Daniel; Ingram, David A.; Tarantal, Alice F; Yoder, Mervin C.


    We have identified a novel hierarchy of human endothelial colony forming cells (ECFC), which are functionally defined by their proliferative and clonogenic potential and in vivo vessel forming ability. Utilizing previously established clonogenic assays for defining different subpopulations of human ECFC, we now show that a hierarchy of ECFC, identical to the human system, can be isolated from the peripheral blood of rhesus monkeys (Macaca mulatta), and that the frequency of the circulating ce...

  16. Different recombinant forms of polyphenol oxidase A, a laccase from Marinomonas mediterranea. (United States)

    Tonin, Fabio; Rosini, Elena; Piubelli, Luciano; Sanchez-Amat, Antonio; Pollegioni, Loredano


    Polyphenol oxidase from the marine bacterium Marinomonas mediterranea (MmPPOA) is a membrane-bound, blue, multi-copper laccase of 695 residues. It possesses peculiar properties that distinguish it from known laccases, such as a broad substrate specificity (common to tyrosinases) and a high redox potential. In order to push the biotechnological application of this laccase, the full-length enzyme was overexpressed in Escherichia coli cells with and without a C-terminal His-tag. The previous form, named rMmPPOA-695-His, was purified to homogeneity by HiTrap chelating chromatography following solubilization by 1% SDS in the lysis buffer with an overall yield of ≈1 mg/L fermentation broth and a specific activity of 1.34 U/mg protein on 2,6-dimethoxyphenol as substrate. A truncated enzyme form lacking 58 residues at the N-terminus encompassing the putative membrane binding region, namely rMmPPOA-637-His, was successfully expressed in E. coli as soluble protein and was purified by using the same procedure set-up as for the full-length enzyme. Elimination of the N-terminal sequence decreased the specific activity 15-fold (which was partially restored in the presence of 1 M NaCl) and altered the secondary and tertiary structures and the pH dependence of optimal stability. The recombinant rMmPPOA-695-His showed kinetic properties on catechol higher than for known laccases, a very high thermal stability, and a strong resistance to NaCl, DMSO, and Tween-80, all properties that are required for specific, targeted industrial applications. PMID:27050199

  17. Recombinant PsbF from Synechococcus sp. PCC 7002 forms β:βhomodimeric cytochrome b559

    Institute of Scientific and Technical Information of China (English)


    All organisms with oxygenic photosynthesis contain two photosystems: photosystemⅠ(PSⅠ) and photosystem-Ⅱ-(PSⅡ). The minimal photosystem-Ⅱ-particles which are photochemically active contain three subunits: D1, D2 and cytochrome b559 (Cyt b559). The function of Cyt b559 remains unclear. We have successfully overexpressed the psbF gene, encoding the - subunit of Cyt b559, from a marine cyanobacterium Synechococcus sp. PCC 7002 as a fusion gene and obtained a redox-active form of Cyt b559. When the N-terminal GST protein of the fusion gene product was removed with thrombin, the PsbF protein was still redox-active, suggesting that the recombinant PsbF can form dimer in Escherichia coli. The absorption spectra of either the oxidized form or the reduced form of both GST fusion protein and the purified PsbF dimer and the difference spectra between the two forms are the same as that of the Cyt b559 isolated from the higher plants. Redox titration analysis of recombinant PsbF showed that the mid-point redox potential of the recombinant Cyt b559 was approximately 50 mV, which is close to the low potential of Cyt b559. The results are helpful to the understanding of localization and function of Cyt b559 on thylakoid membranes.

  18. Geographically and temporally distant natural recombinant isolates of Plum pox virus (PPV) are genetically very similar and form a unique PPV subgroup. (United States)

    Glasa, Miroslav; Palkovics, Laszlo; Komínek, Petr; Labonne, Gérard; Pittnerová, Sona; Kúdela, Otakar; Candresse, Thierry; Subr, Zdeno


    Natural recombinant Plum pox virus (PPV) isolates were detected in Albania, Bulgaria, Czech Republic, Germany, Hungary and Slovakia. Despite different geographical origins and dates of isolation, all the recombinant isolates were closely related at the molecular level and shared the same recombination breakpoint as well as a typical signature in their N-terminal coat protein sequence, suggesting a common origin. Biological assays with four recombinant isolates demonstrated their capacity to be aphid-transmitted to various Prunus hosts. One of these isolates had a threonine-to-isoleucine mutation in the conserved PTK motif of its HC-Pro and showed a drastically decreased, although not abolished, aphid transmissibility. The complete genome sequence of one of the recombinant isolates, BOR-3, was determined, as well as some partial sequences in the HC-Pro and P3 genes for additional natural recombinant isolates. Analysis of the phylogenetic relationships between the recombinant isolates and other sequenced PPV isolates confirmed that the recombinant isolates form a phylogenetically homogeneous lineage. In addition, this analysis revealed an ancient recombination event between the PPV-D and M subgroups, with a recombination breakpoint located in the P3 gene. Taken together, these results indicate that recombinant isolates represent an evolutionarily successful, homogeneous group of isolates with a common history and unique founding recombination event. The name PPV-Rec is proposed for this coherent ensemble of isolates. PMID:15302961

  19. Rad52 forms DMA repair and recombination centers during S phase

    DEFF Research Database (Denmark)

    Lisby, M.; Rothstein, R.; Mortensen, Uffe Hasbro


    cerevisiae, homologous recombination is the major pathway for repairing DNA double-strand breaks. The key role played by Rad52 in this pathway has been attributed to its ability to seek out and mediate annealing of homologous DNA strands. In this study, we find that S. cerevisiae Rad52 fused to green...

  20. Crystallization and molecular-replacement solution of a truncated form of human recombinant tetranectin

    DEFF Research Database (Denmark)

    Nielsen, B B; Kastrup, J S; Rasmussen, H;


    The two C-terminal domains, TN23 (residues 17-181), of human recombinant tetranectin, a plasminogen kringle 4 binding C-type lectin, have been crystallized in two different space groups. Using PEG 8000 as precipitant and at a pH of 8.5, crystals belonging to the monoclinic space group C2 are...

  1. Atomic-number dependence of the magnetic-sublevel population in the autoionization state formed in dielectronic recombination


    Hu, Zhimin; Li, Yueming; Han, Xiaoying; Kato, Daiji; Tong, Xiaomin; Watanabe, Hirofumi; Nakamura, Nobuyuki


    The magnetic-sublevel population of the autoionization state formed in dielectronic recombination (DR) of highly charged heavy ions has been experimentally investigated by combining two types of measurements with an electron beam ion trap. The two different measurements are the differential x-ray measurement at 90∘ with respect to the electron beam and the integral resonance-strength measurement. The alignment parameter, which denotes the magnetic-sublevel population distribution, has been ob...

  2. Bimolecular recombination reactions: K-adiabatic and K-active forms of the bimolecular master equations and analytic solutions (United States)

    Ghaderi, Nima


    Expressions for a K-adiabatic master equation for a bimolecular recombination rate constant krec are derived for a bimolecular reaction forming a complex with a single well or complexes with multiple well, where K is the component of the total angular momentum along the axis of least moment of inertia of the recombination product. The K-active master equation is also considered. The exact analytic solutions, i.e., the K-adiabatic and K-active steady-state population distribution function of reactive complexes, g(EJK) and g(EJ), respectively, are derived for the K-adiabatic and K-active master equation cases using properties of inhomogeneous integral equations (Fredholm type). The solutions accommodate arbitrary intermolecular energy transfer models, e.g., the single exponential, double exponential, Gaussian, step-ladder, and near-singularity models. At the high pressure limit, the krec for both the K-adiabatic and K-active master equations reduce, respectively, to the K-adiabatic and K-active bimolecular Rice-Ramsperger-Kassel-Marcus theory (high pressure limit expressions). Ozone and its formation from O + O2 are known to exhibit an adiabatic K. The ratio of the K-adiabatic to the K-active recombination rate constants for ozone formation at the high pressure limit is calculated to be ˜0.9 at 300 K. Results on the temperature and pressure dependence of the recombination rate constants and populations of O3 will be presented elsewhere.

  3. Characterization of two truncated forms of xylanase recombinantly expressed by Lactobacillus reuteri with an introduced rumen fungal xylanase gene. (United States)

    Cheng, Hsueh-Ling; Hu, Chun-Yi; Lin, Shiou-Hua; Wang, Jing-Ya; Liu, Je-Ruei; Chen, Yo-Chia


    The xylanase R8 gene (xynR8) from uncultured rumen fungi was cloned and successfully expressed in Lactobacillus reuteri. A xylanase activity of 132.1 U/mL was found in the broth of L. reuteri R8, the transformant containing pNZ3004 vector with xynR8 gene insertion. Two distinct forms of recombinant xylanase with different hydrophobicities and molecular weights were found in the broth after purification. According to the results of Western blotting, only the T7-tag, fused in the N-terminus of XynR8, could be bound to the expressed proteins, which indicated that the C-terminus of XynR8 had been truncated. These results, combined with tryptic digestion and mass spectrometry analyses, allow us to attribute the two xylanase forms to an optional cleavage of C-terminal sequences, and XynR8A, a 13 amino acid residues truncated form, and XynR8B, a 22 amino acid residues truncated form, were the main products in the extracellular fraction of L. reuteri R8. The specific activities of XynR8A and R8B were 1028 and 395 U/mg protein. Both forms of recombinant xylanase displayed a typical endoxylanase activity when they were reacted with xylan, but XynR8A demonstrated a better specific activity, catalytic efficiency and thermostability than XynR8B according to the results of enzyme characterization. These changes in enzyme properties were highly possibly caused by the present of the β-sheet in the C-terminal undeleted fragment of XynR8A. This study demonstrates that modified forms with different enzyme properties could be produced when a gene was recombinantly expressed by a L. reuteri transformant. PMID:25152410

  4. Effects of configuration interaction for dielectronic recombination of Na-like ions forming Mg-like ions

    International Nuclear Information System (INIS)

    Dielectronic recombination (DR) of Na-like ions forming Mg-like ions via excitation of a 2l core electron has been investigated for selected ions from Ca9+ to Zn19+. We find that configuration interaction (CI) between DR resonances with different captured electron principal quantum numbers n can lead to a significant reduction in resonance strengths for n ∼> 5. We also explored the effect of this multi-n CI for the total DR rate coefficient. DR rate coefficients can be reduced by up to ∼ 10% at temperatures where an ion is predicted to form in collisional ionization equilibrium and up to ∼ 15% at higher temperatures.

  5. Identification and characterization of a bacterial hyaluronidase and its production in recombinant form. (United States)

    Messina, Luciano; Gavira, Jose A; Pernagallo, Salvatore; Unciti-Broceta, Juan D; Sanchez Martin, Rosario M; Diaz-Mochon, Juan J; Vaccaro, Susanna; Conejero-Muriel, Mayte; Pineda-Molina, Estela; Caruso, Salvatore; Musumeci, Luca; Di Pasquale, Roberta; Pontillo, Angela; Sincinelli, Francesca; Pavan, Mauro; Secchieri, Cynthia


    Hyaluronidases (Hyals) are broadly used in medical applications to facilitate the dispersion and/or absorption of fluids or medications. This study reports the isolation, cloning, and industrial-scale recombinant production, purification and full characterization, including X-ray structure determination at 1.45 Å, of an extracellular Hyal from the nonpathogenic bacterium Streptomyces koganeiensis. The recombinant S. koganeiensis Hyal (rHyal_Sk) has a novel bacterial catalytic domain with high enzymatic activity, compared with commercially available Hyals, and is more thermostable and presents higher proteolytic resistance, with activity over a broad pH range. Moreover, rHyal_Sk exhibits remarkable substrate specificity for hyaluronic acid (HA) and poses no risk of animal cross-infection. PMID:27311405

  6. Stability and kinetic studies on recombinant pyroglutamyl peptidase I and two mutant forms


    Mtawae, Karima


    This thesis investigates the kinetic and stability characteristics of recombinant human brain pyroglutamyl peptidase PAPI, an omega exopeptidase which cleaves pyroglutamic acid from the N-terminus of peptides and proteins. Three classes of pyroglutamyl peptidase have been found in a variety of bacteria, plant, animal, and human tissues; the first class includes the bacterial and animal type 1, pyroglutamyl peptidase I. The genes encoding bacterial PAPI have been cloned and characterized previ...

  7. Production and characterisation of recombinant forms of human pulmonary surfactant protein C (SP-C)

    DEFF Research Database (Denmark)

    Lukovic, Dunja; Plasencia, Inés; Taberner, Francisco J;


    recombinant SP-C variants so obtained retained more than 50% alpha-helical content and showed surface activity comparable to the native protein, as measured by surface spreading of lipid/protein suspensions and from compression pi-A isotherms of lipid/protein films. Compared to the protein purified from......Surfactant protein C (SP-C) is an essential component for the surface tension-lowering activity of the pulmonary surfactant system. It contains a valine-rich alpha helix that spans the lipid bilayer, and is one of the most hydrophobic proteins known so far. SP-C is also an essential component of...

  8. Crystallization and molecular-replacement solution of a truncated form of human recombinant tetranectin

    DEFF Research Database (Denmark)

    Nielsen, Betina Bryde; Kastrup, Jette Sandholm Jensen; Rasmussen, Hanne B.; Graversen, J H; Etzerodt, Michael; Thøgersen, Hans Christian; Larsen, Ingrid K.

    The two C-terminal domains, TN23 (residues 17-181), of human recombinant tetranectin, a plasminogen kringle 4 binding C-type lectin, have been crystallized in two different space groups. Using PEG 8000 as precipitant and at a pH of 8.5, crystals belonging to the monoclinic space group C2 are obta...... has been collected from the monoclinic crystals. Using the structure of full-length tetranectin, a molecular-replacement solution has been obtained. The crystal packing shows that TN23 crystallizes as a trimer, with one trimer in the asymmetric unit....


    International Nuclear Information System (INIS)

    We have measured electron-ion recombination for Fe9+ forming Fe8+ and for Fe10+ forming Fe9+ using a merged beams arrangement at the TSR heavy-ion storage ring in Heidelberg, Germany. The measured merged beams recombination rate coefficients (MBRRC) for relative energies from 0 to 75 eV are presented, covering all dielectronic recombination (DR) resonances associated with 3s → 3p and 3p → 3d core transitions in the spectroscopic species Fe X and Fe XI, respectively. We compare our experimental results to state-of-the-art multiconfiguration Breit-Pauli (MCBP) calculations and find significant differences. Poor agreement between the measured and theoretical resonance structure is seen for collision energies below 48 eV for Fe X and below 35 eV for Fe XI. The integrated resonance strengths, though, are in reasonable agreement. At higher energies, good agreement is seen for the resonance structure but for the resonance strengths theory is significantly larger than experiment by a factor of ∼ 1.5 (2) for Fe X (Fe XI). From the measured MBRRC, we have extracted the DR contributions and transform them into plasma recombination rate coefficients (PRRCs) for astrophysical plasmas with temperatures in the range of 102-107 K. This range spans across the regimes where each ion forms in photoionized or in collisionally ionized plasmas. For both temperature regimes, the experimental uncertainties are 25% at a 90% confidence level. As expected based on predictions from active galactic nucleus observations as well as our previous laboratory and theoretical work on M-shell iron, the formerly recommended DR data severely underestimated the rate coefficient at temperatures relevant for photoionized gas. At these temperatures relevant for photoionized gas, we find agreement between our experimental results and MCBP theory. This is somewhat surprising given the poor agreement in MBRRC resonance structure. At the higher temperatures relevant for collisionally ionized gas, the MCBP

  10. Electron-Ion Recombination of Fe X Forming Fe IX and of Fe XI Forming Fe X: Laboratory Measurements and Theoretical Calculations (United States)

    Lestinsky, M.; Badnell, N. R.; Bernhardt, D.; Grieser, M.; Hoffmann, J.; Lukić, D.; Müller, A.; Orlov, D. A.; Repnow, R.; Savin, D. W.; Schmidt, E. W.; Schnell, M.; Schippers, S.; Wolf, A.; Yu, D.


    We have measured electron-ion recombination for Fe9+ forming Fe8+ and for Fe10+ forming Fe9+ using a merged beams arrangement at the TSR heavy-ion storage ring in Heidelberg, Germany. The measured merged beams recombination rate coefficients (MBRRC) for relative energies from 0 to 75 eV are presented, covering all dielectronic recombination (DR) resonances associated with 3s → 3p and 3p → 3d core transitions in the spectroscopic species Fe X and Fe XI, respectively. We compare our experimental results to state-of-the-art multiconfiguration Breit-Pauli (MCBP) calculations and find significant differences. Poor agreement between the measured and theoretical resonance structure is seen for collision energies below 48 eV for Fe X and below 35 eV for Fe XI. The integrated resonance strengths, though, are in reasonable agreement. At higher energies, good agreement is seen for the resonance structure but for the resonance strengths theory is significantly larger than experiment by a factor of ≈ 1.5 (2) for Fe X (Fe XI). From the measured MBRRC, we have extracted the DR contributions and transform them into plasma recombination rate coefficients (PRRCs) for astrophysical plasmas with temperatures in the range of 102-107 K. This range spans across the regimes where each ion forms in photoionized or in collisionally ionized plasmas. For both temperature regimes, the experimental uncertainties are 25% at a 90% confidence level. As expected based on predictions from active galactic nucleus observations as well as our previous laboratory and theoretical work on M-shell iron, the formerly recommended DR data severely underestimated the rate coefficient at temperatures relevant for photoionized gas. At these temperatures relevant for photoionized gas, we find agreement between our experimental results and MCBP theory. This is somewhat surprising given the poor agreement in MBRRC resonance structure. At the higher temperatures relevant for collisionally ionized gas, the MCBP

  11. Inhibition of hepatitis B virus DNA replicative intermediate forms by recombinant interferon-γ

    Institute of Scientific and Technical Information of China (English)

    Mohammad Khalid Parvez; Deepak Sehgal; Shiv Kumar Sarin; Seemi Farhat Basir; Shahid Jameel


    AIM: To evaluate the in vitro anti-HBV activity of recombinant human IFN-γ, alone and in combination with lamivudine.METHODS: A recombinant baculovirus-HBV/HepG2 culture system was developed which could support productive HBV infection in vitro. Expression of HBsAg and HBeAg in infected HepG2 culture medium was detected by commercial enzyme immunoassays. HBV DNA replication intermediates were detected in infected cells by Southern hybridization and viral DNA load was determined by dot hybridization.RESULTS: IFN-γ at 0.1 to 5 μg/L efficiently down regulated HBsAg expression in transduced HepG2 cells.At 5 μg/L, IFN-γ also suppressed HBV DNA replication in these cells. While treatment with a combination of lamivudine and IFN-γ showed no additive effect,sequential treatment first with lamivudine and then IFN-γ was found to be promising. In this culture system the best HBV suppression was observed with a pulse of 2 μmol/L lamivudine for two days, followed by 1 μg/L IFN-γ for another four days. Compared to treatment with lamivudine alone, the sequential use of 0.2 μmol/L lamivudine for two days, followed by 5 μg/L IFN-γ for six days showed a 72% reduction in HBV cccDNA pool.CONCLUSION: This in vitro study warrants further evaluation of a combination of IFN-γ and lamivudine,especially in IFN-α non-responder chronic hepatitis B patients. A reduced duration of lamivudine treatment would also restrict the emergence of drug-resistant HBV mutants.

  12. Comparative analysis of the molecular mechanisms of recombination in hepatitis C virus

    DEFF Research Database (Denmark)

    Galli, Andrea; Bukh, Jens


    Genetic recombination is an important evolutionary mechanism for RNA viruses. The significance of this phenomenon for hepatitis C virus (HCV) has recently become evident, with the identification of circulating recombinant forms in HCV-infected individuals and by novel data from studies permitted ...... review will focus on current data available on HCV recombination, also in relation to more detailed data from other RNA viruses.......Genetic recombination is an important evolutionary mechanism for RNA viruses. The significance of this phenomenon for hepatitis C virus (HCV) has recently become evident, with the identification of circulating recombinant forms in HCV-infected individuals and by novel data from studies permitted by...... advances in HCV cell culture systems and genotyping protocols. HCV is readily able to produce viable recombinants, using replicative and non-replicative molecular mechanisms. However, our knowledge of the required molecular mechanisms remains limited. Understanding how HCV recombines might be instrumental...

  13. Biophysical Properties of Scaffolds Modulate Human Blood Vessel Formation from Circulating Endothelial Colony-Forming Cells (United States)

    Critser, Paul J.; Yoder, Mervin C.

    A functional vascular system forms early in development and is continually remodeled throughout the life of the organism. Impairment to the regeneration or repair of this system leads to tissue ischemia, dysfunction, and disease. The process of vascular formation and remodeling is complex, relying on local microenvironmental cues, cytokine signaling, and multiple cell types to function properly. Tissue engineering strategies have attempted to exploit these mechanisms to develop functional vascular networks for the generation of artificial tissues and therapeutic strategies to restore tissue homeostasis. The success of these strategies requires the isolation of appropriate progenitor cell sources which are straightforward to obtain, display high proliferative potential, and demonstrate an ability to form functional vessels. Several populations are of interest including endothelial colony-forming cells, a subpopulation of endothelial progenitor cells. Additionally, the development of scaffolds to deliver and support progenitor cell survival and function is crucial for the formation of functional vascular networks. The composition and biophysical properties of these scaffolds have been shown to modulate endothelial cell behavior and vessel formation. However, further investigation is needed to better understand how these mechanical properties and biophysical properties impact vessel formation. Additionally, several other cell populations are involved in neoangiogenesis and formation of tissue parenchyma and an understanding of the potential impact of these cell populations on the biophysical properties of scaffolds will also be needed to advance these strategies. This chapter examines how the biophysical properties of matrix scaffolds can influence vessel formation and remodeling and, in particular, the impact on in vivo human endothelial progenitor cell vessel formation.


    Directory of Open Access Journals (Sweden)

    A. S. Korzhueva


    Full Text Available Abstract. The article concerns interactions between immunoglobulin A and recombinant P6, P7, P8 polypeptides, designed on the basis of externally localized Bac protein of the Group B streptococci, possessing IgA-binding activity.There is a current demand for immunochemical reagents that are strictly specific for IgA, in order to develop antigenic standards for detection of IgA levels in biological fluids, as well as for affinity purification of IgA and its fragments.To analyze an opportunity of the abovementioned application ways for these proteins, a special study was performed to assay an interaction capability of recombinant P6, P7, P8 polypeptides binding to Fc regions of different IgA forms (serum IgA, secretory IgA, subclasses of serum IgA – IgA1, IgA2. Selectivity of ligand binding was specially confirmed.It was found out that, among three presented polypeptides, the structure of recombinant P6 derivative proved to be optimal for IgA-binding ability of Bac protein.Structural features of IgA-binding fragments of Bac protein, i.e., binding site position on the IgA molecule (proximity to epitopes for three monoclonal antibodies, variability of the site structure, as well as resistance of binding site for P6, P7, P8 in IgA molecule against partial disulfide bonds reduction. (Med. Immunol., vol. 10, N 4-5, pp 327-336.

  15. Kosmotropic anions promote conversion of recombinant prion protein into a PrPSc-like misfolded form.

    Directory of Open Access Journals (Sweden)

    Rodrigo Diaz-Espinoza

    Full Text Available Prions are self-propagating proteins involved in transmissible spongiform encephalopaties in mammals. An aberrant conformation with amyloid-like features of a cell surface protein, termed prion protein (PrP, is thought to be the essential component of the infectious particle, though accessory co-factor molecules such as lipids and nucleotides may be involved. The cellular co-factors and environmental conditions implicated in PrP misfolding are not completely understood. To address this issue, several studies have been done inducing misfolding of recombinant PrP (recPrP into classical amyloid structures using partially denaturing conditions. In this work, we report that misfolding of recPrP into PrP(Sc-like aggregates can be induced by simply incubating the protein in the presence of kosmotropic salts at concentrations that are known to retain or increase the stability of the protein. We used a simple experimental reaction (protein, buffer and salts submitted to agitation/incubation cycles at physiological temperature and pH. The formation of protease resistant-recPrP was time and salt-concentration dependent and required the presence of kosmotropic anions such as F(- or SO(4(-2. The molecular weights of the protease resistant recPrP fragments are reminiscent of those found in degradation assays of bona fide PrP(Sc. The aggregates also exhibited PrP(Sc-like ultrastructural features including rod-shape morphology under electron microscope, high beta-sheet content and thioflavin-T positive signal. The formation of recPrP aggregates with PrP(Sc biochemical features under conditions closer to physiological in the absence of organic co-factor molecules provides a simple setup that may prove helpful to understand the molecular mechanism of PrP misfolding.

  16. Radio and infrared recombination studies of the southern massive star-forming region G333.6-0.2

    CERN Document Server

    Fujiyoshi, T; Caswell, J L; Moore, T J T; Lumsden, S L; Aitken, D K; Roche, P F; Fujiyoshi, Takuya; Smith, Craig H.; Caswell, James L.; Moore, Toby J. T.; Lumsden, Stuart L.; Aitken, David K.; Roche, Patrick F.


    We present high spatial resolution radio and near-infrared hydrogen recombination line observations of the southern massive star-forming region G333.6-0.2. The 3.4-cm continuum peak is found slightly offset from the infrared source. The H90alpha spectra show for the first time a double peak profile at some positions. The complex velocity structure may be accounted for by champagne outflows, which may also explain the offset between the radio and infrared sources. The 2.17-um Brackett gamma image and H90alpha map are combined to construct an extinction map which shows a trend probably set by the blister nature of the HII region. The total number of Lyman continuum photons in the central 50-arcsec is estimated to be equivalent to that emitted by up to 19 O7V stars.

  17. Production of Recombinant Human Papillomavirus Type 52 L1 Protein in Hansenula polymorpha Formed Virus-Like Particles. (United States)

    Liu, Cunbao; Yao, Yufeng; Yang, Xu; Bai, Hongmei; Huang, Weiwei; Xia, Ye; Ma, Yanbing


    Human papillomavirus (HPV) type 52 is a high-risk HPV responsible for cervical cancer. HPV type 52 is common around the world and is the most common in some Asian regions. The available prophylactic HPV vaccines protect only from HPV types 16 and 18. Supplementing economical vaccines that target HPV type 52 may satisfactorily complement available prophylactic vaccines. A codon-adapted HPV 52 L1 gene was expressed in the methylotrophic yeast Hansenula polymorpha, which is used as an industrial platform for economical hepatitis B surface antigen particle production in China. We found that the recombinant proteins produced in this expression system could form virus-like particles (VLPs) with diameters of approximately 50 nm. This study suggests that the HPV 52 VLPs produced in this platform may satisfactorily complement available prophylactic vaccines in fighting against HPVs prevalent in Asia. PMID:25639723

  18. Recombinant RXFP1-LDL-A module does not form dimers. (United States)

    Petrie, Emma J; Periguini, Matthew A; Bathgate, Ross A D; Gooley, Paul R


    The Relaxin receptor, RXFP1, is a complex G-protein coupled receptor (GPCR). It has a rhodopsin-like 7 transmembrane helix region and a large ecto-domain containing Leucine-rich repeats and a Low Desnsity Lipoprotein Class-A module at the N-terminus. RXFP1 and the closely related receptor for INSL3, RXFP2 are the only mammalian GPCRs to contain an LDL-A module. The LDL-A module has been shown to be essential for receptor signal activation. RXFP1, like other GPCRs, has been shown to form dimers however the interface upon association is currently unknown. As LDL-A modules are commonly found as repeats we hypothesized that the LDL-A module may associate at the dimer interface and play a role in receptor activation. To this end we analyzed the ability for the LDL-A module to oligomerise via Analytical Ultracentrifugation (AUC). PMID:24640556

  19. Lung Circulation. (United States)

    Suresh, Karthik; Shimoda, Larissa A


    The circulation of the lung is unique both in volume and function. For example, it is the only organ with two circulations: the pulmonary circulation, the main function of which is gas exchange, and the bronchial circulation, a systemic vascular supply that provides oxygenated blood to the walls of the conducting airways, pulmonary arteries and veins. The pulmonary circulation accommodates the entire cardiac output, maintaining high blood flow at low intravascular arterial pressure. As compared with the systemic circulation, pulmonary arteries have thinner walls with much less vascular smooth muscle and a relative lack of basal tone. Factors controlling pulmonary blood flow include vascular structure, gravity, mechanical effects of breathing, and the influence of neural and humoral factors. Pulmonary vascular tone is also altered by hypoxia, which causes pulmonary vasoconstriction. If the hypoxic stimulus persists for a prolonged period, contraction is accompanied by remodeling of the vasculature, resulting in pulmonary hypertension. In addition, genetic and environmental factors can also confer susceptibility to development of pulmonary hypertension. Under normal conditions, the endothelium forms a tight barrier, actively regulating interstitial fluid homeostasis. Infection and inflammation compromise normal barrier homeostasis, resulting in increased permeability and edema formation. This article focuses on reviewing the basics of the lung circulation (pulmonary and bronchial), normal development and transition at birth and vasoregulation. Mechanisms contributing to pathological conditions in the pulmonary circulation, in particular when barrier function is disrupted and during development of pulmonary hypertension, will also be discussed. © 2016 American Physiological Society. Compr Physiol 6:897-943, 2016. PMID:27065170

  20. Recombination analysis and structure prediction show correlation between breakpoint clusters and RNA hairpins in the pol gene of human immunodeficiency virus type 1 unique recombinant forms

    DEFF Research Database (Denmark)

    Galli, Andrea; Lai, Alessia; Corvasce, Stefano;


    Recombination is recognized as a primary force in human immunodeficiency virus type 1 (HIV-1) evolution, increasing viral diversity through reshuffling of genomic portions. The strand-switching activity of reverse transcriptase is required to complete HIV-1 replication and can occur randomly...

  1. Recombinant Forms of Leishmania amazonensis Excreted/Secreted Promastigote Surface Antigen (PSA Induce Protective Immune Responses in Dogs.

    Directory of Open Access Journals (Sweden)

    Elodie Petitdidier


    Full Text Available Preventive vaccination is a highly promising strategy for interrupting leishmaniasis transmission that can, additionally, contribute to elimination. A vaccine formulation based on naturally excreted secreted (ES antigens was prepared from L. infantum promastigote culture supernatant. This vaccine achieved successful results in Phase III trials and was licensed and marketed as CaniLeish. We recently showed that newly identified ES promastigote surface antigen (PSA, from both viable promastigotes and axenically-grown amastigotes, represented the major constituent and the highly immunogenic antigen of L. infantum and L. amazonensis ES products. We report here that three immunizations with either the recombinant ES LaPSA-38S (rPSA or its carboxy terminal part LaPSA-12S (Cter-rPSA, combined with QA-21 as adjuvant, confer high levels of protection in naive L. infantum-infected Beagle dogs, as checked by bone marrow parasite absence in respectively 78.8% and 80% of vaccinated dogs at 6 months post-challenge. The parasite burden in infected vaccinated dogs was significantly reduced compared to placebo group, as measured by q-PCR. Moreover, our results reveal humoral and cellular immune response clear-cut differences between vaccinated and control dogs. An early increase in specific IgG2 antibodies was observed in rPSA/QA-21- and Cter-rPSA/QA-21-immunized dogs only. They were found functionally active in vitro and were highly correlated with vaccine protection. In vaccinated protected dogs, IFN-γ and NO productions, as well as anti-leishmanial macrophage activity, were increased. These data strongly suggest that ES PSA or its carboxy-terminal part, in recombinant forms, induce protection in a canine model of zoonotic visceral leishmaniasis by inducing a Th1-dominant immune response and an appropriate specific antibody response. These data suggest that they could be considered as important active components in vaccine candidates.

  2. A recombinant two-module form of human properdin is an inhibitor of the complement alternative pathway. (United States)

    Kouser, Lubna; Abdul-Aziz, Munirah; Tsolaki, Anthony G; Singhal, Dipti; Schwaeble, Wilhelm J; Urban, Britta C; Khan, Haseeb A; Sim, Robert B; Kishore, Uday


    Properdin upregulates the alternative complement pathway by binding and stabilising the C3 convertase complex (C3bBb). Properdin is a soluble glycoprotein and its flexible rod-like 53kDa monomers form cyclic polymers (dimers, trimers, tetramers and pentamers). The properdin monomer consists of seven thrombospondin type I repeats (TSR 0-6), which are similar and homologous to domains found in circumsporozoite and thrombospondin-related anonymous proteins of Plasmodium species, ETP100 of Eimeria tenella, various complement components C6-C9, and thrombospondin I and II. Using deletion constructs, TSR4 and TSR5 of human properdin were implicated in C3b binding and stabilising C3 convertase. However, individually expressed TSR4 or TSR5 failed to bind properdin ligands. Here, we have expressed and characterized biologically active TSR4 and TSR5 together (TSR4+5) in tandem in Escherichia coli, fused to maltose-binding protein. MBP-TSR4+5 bind solid-phase C3b, sulfatides and glycosaminoglycans. In addition, functionally active recombinant TSR4+5 modules inhibit the alternative pathway of complement. PMID:27060503

  3. In vitro DNA replication of recombinant plasmid DNAs containing the origin of progeny replicative form DNA synthesis of phage phi X174.


    Zipursky, S. L.; Reinberg, D.; Hurwitz, J


    The origin of phage phi X174 progeny replicative form (RF) DNA synthesis has been inserted into the plasmid vector pBR322 and cloned. In direct contrast to pBR322, the recombinant superhelical plasmids can substitute for phi X174 RFI DNA as template in phi X174-specific reactions in vitro. We have shown that the recombinant plasmids: (i) are cleaved by the phi X174 A protein; (ii) support net synthesis of unit-length single-stranded circular DNA in the presence of the phi X174 A protein and E...

  4. Characterization and immunological activity of different forms of recombinant secreted Hc of botulinum neurotoxin serotype B products expressed in yeast


    Liu, Bo; Shi, DanYang; Chang, Shaohong; Gong, Xin; Yu, YunZhou; Sun, Zhiwei; Wu, Jun


    The recombinant Hc proteins of botulinum neurotoxins and tetanus toxin are exclusively produced by intracellular heterologous expression in Pichia pastoris for use in subunit vaccines; the same Hc proteins produced by secreted heterologous expression are hyper-glycosylated and immunologically inert. Here, several different recombinant secreted Hc proteins of botulinum neurotoxin serotype B (BHc) were expressed in yeast and we characterized and assessed their immunological activity in detail. ...

  5. Pro-angiogenic Hematopoietic Progenitor Cells and Endothelial Colony Forming Cells in Pathological Angiogenesis of Bronchial and Pulmonary Circulation


    Duong, Heng; Erzurum, Serpil; Asosingh, Kewal


    Dysregulation of angiogenesis is a common feature of many disease processes. Vascular remodeling is believed to depend on the participation of endothelial progenitor cells, but the identification of endothelial progenitors in postnatal neovascularization remains elusive. Current understanding posits a role for circulating pro-angiogenic hematopoietic cells, which interact with local endothelial cells to establish an environment that favors angiogenesis in physiologic and pathophysiologic resp...

  6. A full-dimensional model of ozone forming reaction: the absolute value of the recombination rate coefficient, its pressure and temperature dependencies. (United States)

    Teplukhin, Alexander; Babikov, Dmitri


    Rigorous calculations of scattering resonances in ozone are carried out for a broad range of rotational excitations. The accurate potential energy surface of Dawes is adopted, and a new efficient method for calculations of ro-vibrational energies, wave functions and resonance lifetimes is employed (which uses hyper-spherical coordinates, the sequential diagonalization/truncation approach, grid optimization and complex absorbing potential). A detailed analysis is carried out to characterize distributions of resonance energies and lifetimes, their rotational/vibrational content and their positions with respect to the centrifugal barrier. Emphasis is on the contribution of these resonances to the recombination process that forms ozone. It is found that major contributions come from localized resonances at energies near the top of the barrier. Delocalized resonances at higher energies should also be taken into account, while very narrow resonances at low energies (trapped far behind the centrifugal barrier) should be treated as bound states. The absolute value of the recombination rate coefficient, its pressure and temperature dependencies are obtained using the energy-transfer model developed in the earlier work. Good agreement with experimental data is obtained if one follows the suggestion of Troe, who argued that the energy transfer mechanism of recombination is responsible only for 55% of the recombination rate (with the remaining 45% coming from the competing chaperon mechanism). PMID:27364351

  7. Thrombin cleaves recombinant human thrombopoietin: One of the proteolytic events that generates truncated forms of thrombopoietin


    Kato, Takashi; Oda, Atsushi; Inagaki, Yoshimasa; Ohashi, Hideya; Matsumoto, Atsushi; Ozaki, Katsutoshi; Miyakawa, Yoshitaka; Watarai, Hiroshi; Fuju, Kazumi; Kokubo, Atsuko; Kadoya, Toshihiko; Ikeda, Yasuo; Miyazaki, Hiroshi


    A heterogeneity in the molecular weight (Mr) of thrombopoietin (TPO) has been reported. We found several thrombin cleavage sites in human, rat, murine, and canine TPOs, and also found that human TPO undergoes selective proteolysis by thrombin. Recombinant human TPO (rhTPO) was incubated with human platelets in the presence of calcium ions to allow the generation of thrombin, and was cleaved into low Mr peptide fragments. The cleavage was completely inhibited by hirudin, indicating that the pr...

  8. Characterization and immunological activity of different forms of recombinant secreted Hc of botulinum neurotoxin serotype B products expressed in yeast. (United States)

    Liu, Bo; Shi, DanYang; Chang, ShaoHong; Gong, Xin; Yu, YunZhou; Sun, ZhiWei; Wu, Jun


    The recombinant Hc proteins of botulinum neurotoxins and tetanus toxin are exclusively produced by intracellular heterologous expression in Pichia pastoris for use in subunit vaccines; the same Hc proteins produced by secreted heterologous expression are hyper-glycosylated and immunologically inert. Here, several different recombinant secreted Hc proteins of botulinum neurotoxin serotype B (BHc) were expressed in yeast and we characterized and assessed their immunological activity in detail. Recombinant low-glycosylated secreted BHc products (BSK) were also immunologically inert, similar to hyper-glycosylated BHc products (BSG), although deglycosylation restored their immunological activities. Unexpectedly, deglycosylated proBHc contained an unexpected pro-peptide of an α-factor signal and fortuitous N-linked glycosylation sites in the non-cleaved pro-peptide sequences, but not in the BHc sequences. Notably, a non-glycosylated secreted homogeneous BHc isoform (mBHc), which we successfully prepared after deleting the pro-peptide and removing its single potential glycosylation site, was immunologically active and could confer effective protective immunity, similarly to non-glycosylated rBHc. In summary, we conclude that a non-glycosylated secreted BHc isoform can be prepared in yeast by deleting the pro-peptide of the α-factor signal and mutating its single potential glycosylation site. This approach provides a rational and feasible strategy for the secretory expression of botulism or other toxin antigens. PMID:25567004

  9. Canine parvoviruses in New Zealand form a monophyletic group distinct from the viruses circulating in other parts of the world. (United States)

    Ohneiser, S A; Hills, S F; Cave, N J; Passmore, D; Dunowska, M


    Canine parvovirus 2 (CPV-2) is a well-recognized cause of acute haemorrhagic enteritis in dogs worldwide. The aim of the current study was to identify which CPV-2 subtypes circulate among dogs in New Zealand, and to investigate the evolutionary patterns of contemporary CPV-2 viruses. Faecal samples were collected from 79 dogs with suspected CPV-2 infection over the period of 13 months, and tested for the presence of CPV-2 DNA by PCR. Of 70 positive samples, 69 were subtyped as CPV-2a and one as CPV-2. A majority of CPV-2 positive samples were collected from unvaccinated or not-fully vaccinated puppies ≤6 months of age. The haplotype network produced from New Zealand CPV-2 sequences showed no structure when assessed based on location, vaccination status or age of the animals sampled. International haplotype network indicated that, unlike CPV-2 from other countries, the population of CPV-2 in New Zealand appeared to be monophyletic. PMID:26031569

  10. Lineage analysis of circulating Trypanosoma cruzi parasites and their association with clinical forms of Chagas disease in Bolivia.

    Directory of Open Access Journals (Sweden)

    Ramona del Puerto

    Full Text Available BACKGROUND: The causative agent of Chagas disease, Trypanosoma cruzi, is divided into 6 Discrete Typing Units (DTU: Tc I, IIa, IIb, IIc, IId and IIe. In order to assess the relative pathogenicities of different DTUs, blood samples from three different clinical groups of chronic Chagas disease patients (indeterminate, cardiac, megacolon from Bolivia were analyzed for their circulating parasites lineages using minicircle kinetoplast DNA polymorphism. METHODS AND FINDINGS: Between 2000 and 2007, patients sent to the Centro Nacional de Enfermedades Tropicales for diagnosis of Chagas from clinics and hospitals in Santa Cruz, Bolivia, were assessed by serology, cardiology and gastro-intestinal examinations. Additionally, patients who underwent colonectomies due to Chagasic magacolon at the Hospital Universitario Japonés were also included. A total of 306 chronic Chagas patients were defined by their clinical types (81 with cardiopathy, 150 without cardiopathy, 100 with megacolon, 144 without megacolon, 164 with cardiopathy or megacolon, 73 indeterminate and 17 cases with both cardiopathy and megacolon. DNA was extracted from 10 ml of peripheral venous blood for PCR analysis. The kinetoplast minicircle DNA (kDNA was amplified from 196 out of 306 samples (64.1%, of which 104 (53.3% were Tc IId, 4 (2.0% Tc I, 7 (3.6% Tc IIb, 1 (0.5% Tc IIe, 26 (13.3% Tc I/IId, 1 (0.5% Tc I/IIb/IId, 2 (1.0% Tc IIb/d and 51 (25.9% were unidentified. Of the 133 Tc IId samples, three different kDNA hypervariable region patterns were detected; Mn (49.6%, TPK like (48.9% and Bug-like (1.5%. There was no significant association between Tc types and clinical manifestations of disease. CONCLUSIONS: None of the identified lineages or sublineages was significantly associated with any particular clinical manifestations in the chronic Chagas patients in Bolivia.

  11. Characterization and purification of a protease in serum that cleaves proatrial natriuretic factor (ProANF) to its circulating forms

    International Nuclear Information System (INIS)

    Atrial natriuretic factor (ANF) is synthesized and stored in atrial cardiocytes as a 17-kilodalton (kDa), 126 amino acid polypeptide, proANF, but circulates as smaller, 24 and 28 amino acid peptide fragments of the carboxy terminus of proANF. This reports describes the purification and characterization of this proANF-cleaving protease from rat serum. The cleavages both of 35S-labeled proANF derived from rat atrial cell cultures, as assessed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE)/autoradiography, and of a synthetic p-nitroanilide-containing substrate were used as assays for the detection of enzyme activity. ProANF-cleaving activity was found in rat serum, with no such activity detectable in rat plasma. Fractionation of either whole serum or the purified enzyme by gel filtration chromatography revealed a single peak of activity corresponding to a protein with a Stokes radius of 45 A. Incubation of the purified enzyme with [3H]DFP followed by SDS-PAGE and autoradiography revealed a specifically labeled 38-kDa peptide, the substrate binding subunit. Analysis by high-performance liquid chromatography of the 3-kDa products resulting from the cleavage of 35S-labeled proANF by the purified enzyme revealed, as previously described with whole serum, two radiolabeled peptides which coeluted with the 28 and 24 amino acid C-terminal peptides. These observations imply a precursor-product relationship, with the initial cleavage of proANF to the 28 amino acid peptide, which is then cleaved to the 24 amino acid peptide. These studies indicate that the majority of proANF cleavage activity found in rat serum is represented by that of a distinct serine protease whose properties are different from a variety of well-characterized proteases. The role of this protease in the in vivo processing of proANF remains to be defined

  12. Recombinant Adeno-Associated Virus Vector Genomes Take the Form of Long-Lived, Transcriptionally Competent Episomes in Human Muscle. (United States)

    Schnepp, Bruce C; Chulay, Jeffrey D; Ye, Guo-Jie; Flotte, Terence R; Trapnell, Bruce C; Johnson, Philip R


    Gene augmentation therapy as a strategy to treat alpha-1 antitrypsin (AAT) deficiency has reached phase 2 clinical testing in humans. Sustained serum levels of AAT have been observed beyond one year after intramuscular administration of a recombinant adeno-associated virus (rAAV) vector expressing the AAT gene. In this study, sequential muscle biopsies obtained at 3 and 12 months after vector injection were examined for the presence of rAAV vector genomes. Each biopsy sample contained readily detectable vector DNA, the majority of which existed as double-stranded supercoiled and open circular episomes. Episomes persisted through 12 months, although at slightly lower levels than observed at 3 months. There was a clear dose response when comparing the low- and mid-vector-dose groups to the high-dose group. The highest absolute copy numbers were found in a high-dose subject, and serum AAT levels at 12 months confirmed that the high-dose group also had the highest sustained serum AAT levels. Sequence analysis revealed that the vast majority of episomes contained double-D inverted terminal repeats ranging from fully intact to severely deleted. Molecular clones of vector genomes derived directly from the biopsies were transcriptionally active, potentially identifying them as the source of serum AAT in the trial subjects. PMID:26650966

  13. Prognostic significance of circulating intact and cleaved forms of urokinase plasminogen activator receptor in inoperable chemotherapy treated cholangiocarcinoma patients

    DEFF Research Database (Denmark)

    Grunnet, M; Christensen, I J; Lassen, U;


    determine if pre-treatment serum levels of uPAR forms and a decrease in levels during chemotherapy are predictive of survival in patients with inoperable cholangiocarcinoma. DESIGN AND METHODS: Patients with inoperable cholangiocarcinoma were consecutively included in the training set (n=108). A test set......PAR(I-III)+uPAR(II-III) after 2cycles of chemotherapy was associated with poor survival (HR=1.79, 95% CI:1.08-2.97, p=0.023, n=57). This predictor, however, was not significant in the test set (p=0.21, 26 events in 27 patients). CONCLUSION: The baseline level of uPAR(I-III)+uPAR(II-III) is a predictor of survival in inoperable......BACKGROUND: High levels of intact and cleaved forms of the urokinase-type plasminogen activator receptor (uPAR) in both tissue and blood are associated with poor survival in several cancer diseases. The prognostic significance of uPAR in cholangiocarcinoma is unknown. The aims of this study were to...

  14. Multiple forms of human intestinal alkaline phosphatase: chemical and enzymatic properties, and circulating clearances of the fast- and slow-moving enzymes

    International Nuclear Information System (INIS)

    Two forms of alkaline phosphatase orthophosphoric monoester phosphohydrolase (alkaline optimum, EC have been purified from human small intestine by column chromatography on DEAE-cellulose and tyraminyl derivative affinity gel, and by preparative disc gel electrophoresis. Intestinal phosphatases were electrophoretically separated into two components, fast- and slow-moving enzymes, with apparent molecular weights of 140000 and 168000 and with subunit weights of 68000 and 80000, respectively. Organ distribution of injected 125I-labelled enzymes indicates that the desialylated hepatic enzyme was selectively distributed in liver, while the degalactosylated intestinal enzyme was incorporated into liver, lymph fluid, and small intestine. These results suggest that the pathway of circulating clearance of alkaline phosphatase has several routes. (Auth.)

  15. HIV-1 subtypes B and C unique recombinant forms (URFs and transmitted drug resistance identified in the Western Cape Province, South Africa.

    Directory of Open Access Journals (Sweden)

    Graeme Brendon Jacobs

    Full Text Available South Africa has the largest worldwide HIV/AIDS population with 5.6 million people infected and at least 2 million people on antiretroviral therapy. The majority of these infections are caused by HIV-1 subtype C. Using genotyping methods we characterized HIV-1 subtypes of the gag p24 and pol PR and RT fragments, from a cohort of female participants in the Western Cape Province, South Africa. These participants were recruited as part of a study to assess the combined brain and behavioural effects of HIV and early childhood trauma. The partial HIV-1 gag and pol fragments of 84 participants were amplified by PCR and sequenced. Different online tools and manual phylogenetic analysis were used for HIV-1 subtyping. Online tools included: REGA HIV Subtyping tool version 3; Recombinant Identification Program (RIP; Context-based Modeling for Expeditious Typing (COMET; jumping profile Hidden Markov Models (jpHMM webserver; and subtype classification using evolutionary algorithms (SCUEAL. HIV-1 subtype C predominates within the cohort with a prevalence of 93.8%. We also show, for the first time, the presence of circulating BC strains in at least 4.6% of our study cohort. In addition, we detected transmitted resistance associated mutations in 4.6% of analysed sequences. With tourism and migration rates to South Africa currently very high, we are detecting more and more HIV-1 URFs within our study populations. It is still unclear what role these unique strains will play in terms of long term antiretroviral treatment and what challenges they will pose to vaccine development. Nevertheless, it remains vitally important to monitor the HIV-1 diversity in South Africa and worldwide as the face of the epidemic is continually changing.

  16. Fetal Circulation (United States)

    ... Pressure High Blood Pressure Tools & Resources Stroke More Fetal Circulation Updated:Jul 8,2016 click to enlarge The ... fetal heart. These two bypass pathways in the fetal circulation make it possible for most fetuses to survive ...

  17. Low Frequency of Circulating CD8+ T Stem Cell Memory Cells in Chronic Chagasic Patients with Severe Forms of the Disease (United States)

    Mateus, Jose; Lasso, Paola; Pavia, Paula; Rosas, Fernando; Roa, Nubia; Valencia-Hernández, Carlos Andrés; González, John Mario; Puerta, Concepción J.; Cuéllar, Adriana


    Background CD8+ T cells have been shown to play a crucial role in Trypanosoma cruzi infection. Memory CD8+ T cells can be categorised based on their distinct differentiation stages and functional activities as follows: stem cell memory (TSCM), central memory (TCM), transitional memory (TTM), effector memory (TEM) and terminal effector (TTE) cells. Currently, the immune mechanisms that control T. cruzi in the chronic phase of the infection are unknown. Methodology/Principal Findings To characterise the CD8+ T cell subsets that could be participating in the control of T. cruzi infection, in this study, we compared total and T. cruzi-specific circulating CD8+ T cells with distinctive phenotypic and functional features in chronic chagasic patients (CCPs) with different degrees of cardiac dysfunction. We observed a decreased frequency of total TSCM along with an increased frequency of TTE in CCPs with severe disease. Antigen-specific TSCM cells were not detectable in CCPs with severe forms of the disease. A functional profile of CD8+ T cell subsets among CCPs revealed a high frequency of monofunctional CD8+ T cells in the most severe patients with IFN-γ+- or TNF-α+-producing cells. Conclusions/Significance These findings suggest that CD8+ TSCM cells may be associated with the immune response to T. cruzi and outcome of Chagas disease, given that these cells may be involved in repopulating the T cell pool that controls infection. PMID:25569149

  18. Immunization with a Recombinant, Pseudomonas fluorescens-Expressed, Mutant Form of Bacillus anthracis-Derived Protective Antigen Protects Rabbits from Anthrax Infection.

    Directory of Open Access Journals (Sweden)

    Matthew D Reed

    Full Text Available Protective antigen (PA, one of the components of the anthrax toxin, is the major component of human anthrax vaccine (Biothrax. Human anthrax vaccines approved in the United States and Europe consist of an alum-adsorbed or precipitated (respectively supernatant material derived from cultures of toxigenic, non-encapsulated strains of Bacillus anthracis. Approved vaccination schedules in humans with either of these vaccines requires several booster shots and occasionally causes adverse injection site reactions. Mutant derivatives of the protective antigen that will not form the anthrax toxins have been described. We have cloned and expressed both mutant (PA SNKE167-ΔFF-315-E308D and native PA molecules recombinantly and purified them. In this study, both the mutant and native PA molecules, formulated with alum (Alhydrogel, elicited high titers of anthrax toxin neutralizing anti-PA antibodies in New Zealand White rabbits. Both mutant and native PA vaccine preparations protected rabbits from lethal, aerosolized, B. anthracis spore challenge subsequent to two immunizations at doses of less than 1 μg.

  19. Single-column purification of the tag-free, recombinant form of the neuronal calcium sensor protein, hippocalcin expressed in Escherichia coli. (United States)

    Krishnan, Anuradha; Viviano, Jeffrey; Morozov, Yaroslav; Venkataraman, Venkat


    Hippocalcin is a 193 aa protein that is a member of the neuronal calcium sensor protein family, whose functions are regulated by calcium. Mice that lack the function of this protein are compromised in the long term potentiation aspect of memory generation. Recently, mutations in the gene have been linked with dystonia in human. The protein has no intrinsic enzyme activity but is known to bind to variety of target proteins. Very little information is available on how the protein executes its critical role in signaling pathways, except that it is regulated by binding of calcium. Further delineation of its function requires large amounts of pure protein. In this report, we present a single-step purification procedure that yields high quantities of the bacterially expressed, recombinant protein. The procedure may be adapted to purify the protein from inclusion bodies or cytosol in its myristoylated or non-myristoylated forms. MALDI-MS (in source decay) analyses demonstrates that the myristoylation occurs at the glycine residue. The protein is also biologically active as measured through tryptophan fluorescence, mobility shift and guanylate cyclase activity assays. Thus, further analyses of hippocalcin, both structural and functional, need no longer be limited by protein availability. PMID:27001424

  20. Optimization of a multi-gene HIV-1 recombinant subtype CRF02AG DNA vaccine for expression of multiple immunogenic forms

    International Nuclear Information System (INIS)

    We developed an AIDS vaccine for Western and West-Central Africa based on a DNA plasmid vector expressing HIV-1 recombinant subtype CRF02AG gag, pol, and env genes. To optimize the production of noninfectious HIV-like particles (VLPs) and potentially improve the effectiveness of the vaccine, we generated four potential vaccine constructs: the parental (IC2) and three modifications (IC25, IC48, and IC90) containing mutations within the HIV protease. While the parental construct IC2 expressed aggregates of Gag proteins, the IC25 construct resulted in the production of immature VLPs (the core comprises unprocessed Pr55Gag). The remaining two constructs (IC48 and IC90) produced mature VLPs (the core comprises processed capsid p24) in addition to immature VLPs and aggregates of Gag proteins. VLPs incorporated significant levels of mature gp120 envelope glycoprotein. Importantly, the mature VLPs were fusion competent and entered coreceptor-specific target cells. The production of multiple antigenic forms, including fusion-competent VLPs, by candidate DNA vaccine constructs may provide immunologic advantages for induction of protective cellular and humoral responses against HIV-1 proteins

  1. Production and characterization of novel recombinant adeno-associated virus replicative-form genomes: a eukaryotic source of DNA for gene transfer.

    Directory of Open Access Journals (Sweden)

    Lina Li

    Full Text Available Conventional non-viral gene transfer uses bacterial plasmid DNA containing antibiotic resistance genes, cis-acting bacterial sequence elements, and prokaryotic methylation patterns that may adversely affect transgene expression and vector stability in vivo. Here, we describe novel replicative forms of a eukaryotic vector DNA that consist solely of an expression cassette flanked by adeno-associated virus (AAV inverted terminal repeats. Extensive structural analyses revealed that this AAV-derived vector DNA consists of linear, duplex molecules with covalently closed ends (termed closed-ended, linear duplex, or "CELiD", DNA. CELiD vectors, produced in Sf9 insect cells, require AAV rep gene expression for amplification. Amounts of CELiD DNA produced from insect cell lines stably transfected with an ITR-flanked transgene exceeded 60 mg per 5 × 10(9 Sf9 cells, and 1-15 mg from a comparable number of parental Sf9 cells in which the transgene was introduced via recombinant baculovirus infection. In mice, systemically delivered CELiD DNA resulted in long-term, stable transgene expression in the liver. CELiD vectors represent a novel eukaryotic alternative to bacterial plasmid DNA.

  2. Comparative Analysis of Pore Formed with Percusive Reverse Circulation Drill and Percussion Drill%冲击反循环钻机与冲击钻机成孔对比分析

    Institute of Scientific and Technical Information of China (English)

    王凤龙; 王洪家


    According to the geological conditions of Zhujiang cable - stayed bridge in Chaoyang, the pore forming technology with percussive reverse circulation drill and conventional percussion drill is analyzed and com- pared from aspects of pore - forming time, slurry amount and pore - forming cost. It is proposed that percussive re- verse circulation drill is preferred for pore -forming under the similar geological conditions.%根据朝阳珠江斜拉桥的地质条件,对采用冲击反循环钻机和常规冲击钻机成孔技术,在成孔时间、泥浆用量、成孔成本等方面进行了分析比较,提出了在该类地质条件下应优先选用冲击反循环钻机成孔。

  3. Comparative immunogenicity of recombinant adenovirus-vectored vaccines expressing different forms of hemagglutinin (HA) proteins from the H5 serotype of influenza A viruses in mice. (United States)

    Hu, Xiangjing; Meng, Weixu; Dong, Zhenyuan; Pan, Weiqi; Sun, Caijun; Chen, Ling


    Recent outbreaks of highly pathogenic avian influenza (HPAI) H5N1 viruses in poultry and their subsequent transmission to humans have highlighted an urgent need to develop preventive vaccines in the event of a pandemic. In this paper we constructed recombinant adenovirus (rAd)-vectored influenza vaccines expressing different forms of H5 hemagglutinin (HA) from the A/Vietnam/1194/04 (VN/1194/04) virus, a wild-type HA, a sequence codon-optimized HA and a transmembrane (TM) domain-truncated HA. Compared to the rAd vectors expressing the wild-type HA (rAd-04wtHA) and the TM-truncated form of HA (rAd-04optHA-dTM), the rAd vectored vaccine with the sequence codon-optimized HA (rAd-04optHA) showed a tendency to induce much higher hemagglutinin inhibition (HI) antibody titers in mice immunized with a prime-boost vaccine. Furthermore, administration of the rAd-04optHA vaccine to mice could elicit cross-reactive immune responses against the antigenically distinct HK/482/97 virus. Additionally, we constructed another vector containing the codon-optimized HA of the A/Hong Kong/482/97 (HK/482/97) virus. Administration of a bivalent immunization formulation including the rAd-04optHA and rAd-97optHA vaccines to mice induced a stronger immune response against HK/482/97 virus than the monovalent formulation. Taken together, these findings may have some implications for the development of rAd-vectored vaccines in the event of the pandemic spread of HPAI. PMID:20883733

  4. Characterization of a distinct population of circulating human non-adherent endothelial forming cells and their recruitment via intercellular adhesion molecule-3.

    Directory of Open Access Journals (Sweden)

    Sarah L Appleby

    Full Text Available Circulating vascular progenitor cells contribute to the pathological vasculogenesis of cancer whilst on the other hand offer much promise in therapeutic revascularization in post-occlusion intervention in cardiovascular disease. However, their characterization has been hampered by the many variables to produce them as well as their described phenotypic and functional heterogeneity. Herein we have isolated, enriched for and then characterized a human umbilical cord blood derived CD133(+ population of non-adherent endothelial forming cells (naEFCs which expressed the hematopoietic progenitor cell markers (CD133, CD34, CD117, CD90 and CD38 together with mature endothelial cell markers (VEGFR2, CD144 and CD31. These cells also expressed low levels of CD45 but did not express the lymphoid markers (CD3, CD4, CD8 or myeloid markers (CD11b and CD14 which distinguishes them from 'early' endothelial progenitor cells (EPCs. Functional studies demonstrated that these naEFCs (i bound Ulex europaeus lectin, (ii demonstrated acetylated-low density lipoprotein uptake, (iii increased vascular cell adhesion molecule (VCAM-1 surface expression in response to tumor necrosis factor and (iv in co-culture with mature endothelial cells increased the number of tubes, tubule branching and loops in a 3-dimensional in vitro matrix. More importantly, naEFCs placed in vivo generated new lumen containing vasculature lined by CD144 expressing human endothelial cells (ECs. Extensive genomic and proteomic analyses of the naEFCs showed that intercellular adhesion molecule (ICAM-3 is expressed on their cell surface but not on mature endothelial cells. Furthermore, functional analysis demonstrated that ICAM-3 mediated the rolling and adhesive events of the naEFCs under shear stress. We suggest that the distinct population of naEFCs identified and characterized here represents a new valuable therapeutic target to control aberrant vasculogenesis.

  5. Generation of a soluble recombinant trimeric form of bovine CD40L and its potential use as a vaccine adjuvant in cows. (United States)

    Pujol, Julien; Bouillenne, Fabrice; Farnir, Frédéric; Dufrasne, Isabelle; Mainil, Jacques; Galleni, Moreno; Lekeux, Pierre; Bureau, Fabrice; Fiévez, Laurence


    Vaccination is the most cost-effective way to control infectious diseases in cattle. However, many infectious diseases leading to severe economical losses worldwide still remain for which a really effective and safe vaccine is not available. These diseases are most often due to intracellular pathogens such as bacteria or viruses, which are, by their localization, protected from antibiotics and/or CD4(+) T cell-dependent humoral responses. We therefore postulated that strategies leading to induction of not only CD4(+) T cell responses but also CD8(+) cytotoxic T lymphocyte (CTL) responses against infected cells should be privileged in the development of new vaccines against problematic intracellular pathogens in bovines. CD40 signaling in antigen-presenting cells may lead to the induction of robust CD4-independent CTL responses and several studies, especially in mice, have used CD40 stimulation to promote CD8(+) T cell-mediated immunity. For example, we have recently shown that immunization of mice with heat-killed Staphylococcus aureus (HKSA) and agonistic anti-CD40 monoclonal antibodies elicits strong CTL responses capable of protecting mice from subsequent staphylococcal mastitis. Unfortunately, there is at present no tool available to efficiently stimulate CD40 in cattle. In this study, we therefore first produced a soluble recombinant trimeric form of the natural bovine CD40 ligand (sboCD40LT). We then observed that sboCD40LT was able to potently stimulate bovine cells in vitro. Finally, we provide evidence that immunization of cows with sboCD40LT combined with HKSA was able to significantly increase the number of both HKSA-specific CD4(+) and CD8(+) T cells in the draining lymph nodes. In conclusion, we suggest that this new molecular tool could help in the development of vaccine strategies against bovine diseases caused by intracellular pathogens. PMID:26553560

  6. Efficacy of DNA vaccines forming e7 recombinant retroviral virus-like particles for the treatment of human papillomavirus-induced cancers. (United States)

    Lescaille, Geraldine; Pitoiset, Fabien; Macedo, Rodney; Baillou, Claude; Huret, Christophe; Klatzmann, David; Tartour, Eric; Lemoine, François M; Bellier, Bertrand


    Human papillomavirus (HPV) is involved in the development of anogenital tumors and also in the development of oropharyngeal head and neck carcinomas, where HPV-16, expressing the E6 and E7 oncoproteins, is the most frequent serotype. Although vaccines encoding L1 and L2 capsid HPV proteins are efficient for the prevention of HPV infection, they are inadequate for treating established tumors. Hence, development of innovative vaccine therapies targeting E6/E7 is important for controlling HPV-induced cancers. We have engineered a nononcogenic mutated E7-specific plasmo-retroVLP vaccine (pVLP-E7), consisting of plasmid DNA, that is able to form recombinant retrovirus-based virus-like particles (VLPs) that display E7 antigen into murine leukemia virus Gag proteins pseudotyped with vesicular stomatitis virus envelope glycoprotein (VSV-G). pVLP-E7 vaccinations were studied for their ability to generate specific immune responses and for induction of protective immunity against tumor cell challenge in preventive and therapeutic models. The produced VLPs induce the maturation of human dendritic cells in vitro and mount specific E7 T cell responses. Intradermic vaccinations of mice with pVLP-E7 show their efficacy to generate antigen-specific T cell responses, to prevent and protect animals from early TC-1 tumor development compared with standard DNA or VLP immunizations. The vaccine efficacy was also evaluated for advanced tumors in mice vaccinated at various time after the injection of TC-1 cells. Data show that pVLP-E7 vaccination can cure mice with already established tumors only when combined with Toll-like receptor-7 (TLR7) and TLR9 agonists. Our findings provide evidence that pVLPs, combining the advantages of DNA and VLP vaccines, appear to be a promising strategy for the treatment of HPV-induced cancers. PMID:23521528

  7. Response of digestive cysteine proteinases from the Colorado potato beetle (Leptinotarsa decemlineata) and the black vine weevil (Otiorynchus sulcatus) to a recombinant form of human stefin A. (United States)

    Michaud, D; Nguyen-Quoc, B; Vrain, T C; Fong, D; Yelle, S


    The effects of the cystatins, human stefin A (HSA) and oryzacystatin I (OCI) on digestive cysteine proteinases of the Colorado potato beetle (CPB), Leptinotarsa decemlineata, and the black vine weevil (BVW), Otiorynchus sulcatus, were assessed using complementary inhibition assays, cystatin-affinity chromatography, and recombinant forms of the two inhibitors. For both insects, either HSA and OCI used in excess (10 or 20 microM) caused partial and stable inhibition of total proteolytic (azocaseinase) activity, but unlike for OCI the HSA-mediated inhibitions were significantly increased when the inhibitor was used in large excess (100 microM). As demonstrated by complementary inhibition assays, this two-step inhibition of the insect proteases by HSA was due to the differential inactivation of two distinct cysteine proteinase populations in either insect extracts, the rapidly (strongly) inhibited population corresponding to the OCI-sensitive fraction. After removing the cystatin-sensitive proteinases from CPB and BVW midgut extracts using OCI- (or HSA-) affinity chromatography, the effects of the insect "non-target" proteases on the structural integrity of the two cystatins were assessed. While OCI remained essentially stable, HSA was subjected to hydrolysis without the accumulation of detectable stable intermediates, suggesting the presence of multiple exposed cleavage sites sensitive to the action of the insect proteases on this cystatin. This apparent susceptibility of HSA to proteolytic cleavage may partially explain its low efficiency to inactivate the insect OCI-insensitive cysteine proteinases when not used in large excess. It could also have major implications when planning the use of cystatin-expressing transgenic plants for the control of coleopteran pests. PMID:8920105

  8. Flow characteristics of Hijiori HDR reservoir form circulation test in 1995; Koon tantai Hijiori jikkenjo ni okeru shinbu choryuso yobi junkan shiken (1995 nendo) kekka to ryudo kaiseki

    Energy Technology Data Exchange (ETDEWEB)

    Fukushima, N.; Hyodo, M.; Shinohara, N.; Takasugi, S. [Geothermal Energy Research and Development Co. Ltd., Tokyo (Japan)


    This paper reports the result of a preliminary circulation test conducted in fiscal 1995 on a deep reservoir (at a depth of about 2200 m) in the Hijiori hot dry rock experimental field. One water injection well and two production wells were drilled to constitute a circulation loop, to which the circulation test was performed to investigate the flow characteristics thereof. The result revealed the following matters: total amount of injected water of 51500 m{sup 3} resulted in a total fluid recovery rate of about 40%; as a result of well stimulation given twice during the initial stage of the water injection, the continuity impedance in the vicinity of the injection well decreased largely (however, the continuity improvement upon the second attempt was considerably inferior to that from the first attempt); and increase in the water injection amount does not necessarily lead to increase in the production amount. The paper describes additionally that it is extremely difficult to interpret non-linearity between the injection and production amounts by using a model prepared previously with a main objective to analyze the Hijiori HDR circulation system. 1 ref., 9 figs., 1 tab.

  9. Spread of distinct human immunodeficiency virus type 1 AG recombinant lineages in Africa. (United States)

    Cornelissen, M; van Den Burg, R; Zorgdrager, F; Goudsmit, J


    To identify new subtype G human immunodeficiency virus type 1 (HIV-1) strains and AG recombinant forms, we collected 28 serum samples from immigrants to the Netherlands from 12 countries throughout Africa. Based on the gag sequences 22 isolates were identified as subtype A or G. Phylogenetic analysis of discontinuous regions of the gag (726 nt), pol (1176 nt) and env (276 nt) genes revealed 13 AG recombinants with the mosaic structure A(gag)/G(pol)/A(env), three with A(gag)/G(pol)/G(env) and one other with A(gag) /G(pol)/G(env), in addition to 'pure' subtypes A(gag)/A(pol)/A(env) (n=1) and G(gag)/G(pol)/G(env) (n=4). To analyse the crossover points in more detail, a new RT-PCR was developed resulting in a large contiguous sequence of 2600 nt from the gag region to half the pol region. All the 13 A(gag)/G(pol)/A(env) recombinants appeared to belong to the circulating recombinant form (CRF) AG (IbNG). The three A(gag)/G(pol) /G(env) recombinants differed from the CRF AG (IbNG) subtype, suggesting the identification of a new CRF subtype. The recovery of AG recombinants from African countries a thousand miles apart indicates the active spread of new recombinants. PMID:10644851

  10. Characterization of a Distinct Population of Circulating Human Non-Adherent Endothelial Forming Cells and Their Recruitment via Intercellular Adhesion Molecule-3


    Appleby, Sarah L.; Cockshell, Michaelia P.; Pippal, Jyotsna B.; Thompson, Emma J.; Barrett, Jeffrey M.; Katie Tooley; Shaundeep Sen; Wai Yan Sun; Randall Grose; Ian Nicholson; Vitalina Levina; Ira Cooke; Gert Talbo; Lopez, Angel F.; Bonder, Claudine S.


    Circulating vascular progenitor cells contribute to the pathological vasculogenesis of cancer whilst on the other hand offer much promise in therapeutic revascularization in post-occlusion intervention in cardiovascular disease. However, their characterization has been hampered by the many variables to produce them as well as their described phenotypic and functional heterogeneity. Herein we have isolated, enriched for and then characterized a human umbilical cord blood derived CD133(+) popul...

  11. Relative levels of the proprotein and cleavage‐activated form of circulating human anti‐Müllerian hormone are sexually dimorphic and variable during the life cycle


    Pankhurst, Michael W.; Chong, Yih Harng; McLennan, Ian S.


    Abstract Anti‐Müllerian hormone (AMH) is a gonadal hormone, which induces aspects of the male phenotype, and influences ovarian follicular recruitment. AMH is synthesized as a proprotein (proAMH), which is incompletely cleaved to the receptor‐competent AMHN ,C. AMH ELISAs have not distinguished between proAMH and AMHN ,C; consequently, the physiological ranges of circulating proAMH and AMHN ,C are unknown. A novel proAMH ELISA has been used to assay serum proAMH in humans. Total AMH was also ...

  12. The successful introduction of an adapted form of the mini extra corporeal circulation used for cardiac surgery in an obese patient

    Directory of Open Access Journals (Sweden)

    Sartini Patrizio


    Full Text Available Abstract Obese patients undergoing cardiac surgery have been shown to have a high risk of developing postoperative complications, specifically: increased length of hospital stay, readmission to intensive care unit, acute renal failure, deep sternal wound infections and new onset of atrial fibrillation. A custom-made circuit was created to allow the use of Mini Extra Corporeal Circulation (MECC but permitting the switch to a closed siphon drainage system in the case of difficulties. To limit artificial surface contact a small oxygenating device (Admiral, Eurosets was employed in spite of the patients size. This adapted circuit permits a feasible and safer approach to using MECC. This report suggests that smaller oxygenators could be integrated into clinical practice in an adult MECC configuration, even for more obese patients, limiting artificial surface contact.

  13. IgA in the horse: cloning of equine polymeric Ig receptor and J chain and characterization of recombinant forms of equine IgA


    Lewis, M J; Wagner, B.; Irvine, R M; Woof, J.M.


    As in other mammals, immunoglobulin A (IgA) in the horse has a key role in immune defense. To better dissect equine IgA function, we isolated complementary DNA (cDNA) clones for equine J chain and polymeric Ig receptor (pIgR). When coexpressed with equine IgA, equine J chain promoted efficient IgA polymerization. A truncated version of equine pIgR, equivalent to secretory component, bound with nanomolar affinity to recombinant equine and human dimeric IgA but not with monomeric IgA from eithe...

  14. Circulation economics

    DEFF Research Database (Denmark)

    Ingebrigtsen, Stig; Jakobsen, Ove


    Purpose - This paper is an attempt to advance the critical discussion regarding environmental and societal responsibility in economics and business. Design/methodology/approach - The paper presents and discusses as a holistic, organic perspective enabling innovative solutions to challenges...... concerning the responsible and efficient use of natural resources and the constructive interplay with culture. To reach the goal of sustainable development, the paper argues that it is necessary to make changes in several dimensions in mainstream economics. This change of perspective is called a turn towards...... presupposes a perspective integrating economic, natural and cultural values. Third, to organize the interplay between all stakeholders we introduce an arena for communicative cooperation. Originality/value - The paper concludes that circulation economics presupposes a change in paradigm, from a mechanistic...

  15. IgA in the horse: cloning of equine polymeric Ig receptor and J chain and characterization of recombinant forms of equine IgA. (United States)

    Lewis, M J; Wagner, B; Irvine, R M; Woof, J M


    As in other mammals, immunoglobulin A (IgA) in the horse has a key role in immune defense. To better dissect equine IgA function, we isolated complementary DNA (cDNA) clones for equine J chain and polymeric Ig receptor (pIgR). When coexpressed with equine IgA, equine J chain promoted efficient IgA polymerization. A truncated version of equine pIgR, equivalent to secretory component, bound with nanomolar affinity to recombinant equine and human dimeric IgA but not with monomeric IgA from either species. Searches of the equine genome localized equine J chain and pIgR to chromosomes 3 and 5, respectively, with J chain and pIgR coding sequence distributed across 4 and 11 exons, respectively. Comparisons of transcriptional regulatory sequences suggest that horse and human pIgR expression is controlled through common regulatory mechanisms that are less conserved in rodents. These studies pave the way for full dissection of equine IgA function and open up possibilities for immune-based treatment of equine diseases. PMID:20631692

  16. Soluble recombinant influenza vaccines.


    Fiers, W; Neirynck, S; Deroo, T; Saelens, X; Jou, W M


    Soluble, recombinant forms of influenza A virus haemagglutinin and neuraminidase have been produced in cells of lower eukaryotes, and shown in a mouse model to induce complete protective immunity against a lethal virus challenge. Soluble neuraminidase, produced in a baculovirus system, consisted of tetramers, dimers and monomers. Only the tetramers were enzymatically active. The immunogenicity decreased very considerably in the order tetra > di > mono. Therefore, we fused the head part of the...

  17. Stable expression of Shigella sonnei form I O-polysaccharide genes recombineered into the chromosome of live Salmonella oral vaccine vector Ty21a. (United States)

    Dharmasena, Madushini N; Hanisch, Brock W; Wai, Tint T; Kopecko, Dennis J


    Live, attenuated Salmonella enterica serovar Typhi strain Ty21a, a licensed oral typhoid fever vaccine, has also been employed for use as a vector to deliver protective antigens of Shigella and other pathogens. Importantly, lipopolysaccharide (LPS) alone has been shown to be a potent antigen for specific protection against shigellosis. We reported previously the plasmid cloning of heterologous LPS biosynthetic genes and the expression in Ty21a of either S. sonnei or of S. dysenteriae 1 LPS's. The resulting plasmids encoding Shigella LPS's were reasonably stable for >50 generations of growth in nonselective media, but still contained an antibiotic resistance marker that is objectionable to vaccine regulatory authorities. Deletion of this antibiotic-resistance marker inexplicably resulted in significant plasmid instability. Thus, we sought a method to insert the large ∼12kb S. sonnei LPS gene region into the chromosome, that would allow for subsequent removal of a selectable marker and would result in 100% genetic stability. Toward this objective, we optimized an existing recombination method to mediate the insertion of a ∼12kb region encoding the S. sonnei LPS genes into the Ty21a genome in a region that is nonfunctional due to mutation. The resulting strain Ty21a-Ss simultaneously expresses both homologous Ty21a and heterologous S. sonnei O-antigens. This chromosomal insert was shown to be 100% genetically stable in vitro and in vivo. Moreover, Ty21a-Ss elicited strong dual anti-LPS serum immune responses and 100% protection in mice against a virulent S. sonnei challenge. This new vaccine candidate, absolutely stable for vaccine manufacture, should provide combined protection against enteric fevers due to Salmonella serovar Typhi as shown previously (and some Paratyphi infections) and against shigellosis due to S. sonnei. PMID:23474241

  18. Multiple barriers to recombination between divergent HIV-1 variants revealed by a dual-marker recombination assay

    DEFF Research Database (Denmark)

    Nikolaitchik, Olga A; Galli, Andrea; Moore, Michael D;


    Recombination is a major force for generating human immunodeficiency virus type 1 (HIV-1) diversity and produces numerous recombinants circulating in the human population. We previously established a cell-based system using green fluorescent protein gene (gfp) as a reporter to study the mechanisms...

  19. Friend and Moloney murine leukemia viruses specifically recombine with different endogenous retroviral sequences to generate mink cell focus-forming viruses.


    Evans, L H; Cloyd, M W


    A group of mink cell focus-forming (MCF) viruses was derived by inoculation of NFS/N mice with Moloney murine leukemia virus (Mo-MuLV 1387) and was compared to a similarly derived group of MCF viruses from mice inoculated with Friend MuLV (Fr-MuLV 57). Antigenic analyses using monoclonal antibodies specific for MCF virus and xenotropic MuLV envelope proteins and genomic structural analyses by RNase T1-resistant oligonucleotide finger-printing indicated that the Moloney and Friend MCF viruses ...

  20. Comparison of two chemical cleavage methods for preparation of a truncated form of recombinant human insulin-like growth factor I from a secreted fusion protein. (United States)

    Forsberg, G; Baastrup, B; Brobjer, M; Lake, M; Jörnvall, H; Hartmanis, M


    We have produced a naturally occurring variant of human insulin-like growth factor I, truncated by three amino acids at the amino terminus. The polypeptide is obtained as a fusion protein in Escherichia coli. The fusion partner is a synthetic IgG-binding peptide. During fermentation the fusion protein is secreted into the medium, and is purified on IgG--Sepharose prior to cleavage. Two different genes for the fusion protein were used, allowing chemical cleavage at either a tryptophan linker or a methionine linker between the fusion partner and the growth factor, using N-chlorosuccinimide (NCS) or cyanogen bromide (CNBr) respectively. A partial CNBr cleavage yielded the native peptide, whereas the NCS cleavage yielded a product in which the single methionine had been oxidized to the sulfoxide. The forms from both cleavage methods exhibited biological activity and were characterized after purification to homogeneity. Both cleavage methods gave products having correct N- and C-terminal ends. The purified product had a biological activity equal to that of corresponding material from natural sources, 15 000 U/mg. Modified forms of truncated IGF-I were also identified, purified and characterized. Modifications such as proteolysis and misincorporation of norleucine for methionine occurred during biosynthesis, while oxidation of methionine took place during both fermentation and chemical cleavage. PMID:2696476

  1. Space-Time Radar Waveforms: Circulating Codes


    Babur, G.; Aubry, P.; Le Chevalier, F.


    This paper describes a concept of the circulating codes covering the whole class of the space-time codes. The circulating codes do not narrow the radiated pattern of the antenna array, thus providing a wide angular coverage, possibly tunable. In turn, the beam-forming on transmit is achievable by means of the signal processing in one (or each) receiver channel. The modelling results demonstrate the efficiency of the circulating codes based on their multidimensional ambiguity functions.

  2. RNA recombination in animal and plant viruses.


    Lai, M M


    An increasing number of animal and plant viruses have been shown to undergo RNA-RNA recombination, which is defined as the exchange of genetic information between nonsegmented RNAs. Only some of these viruses have been shown to undergo recombination in experimental infection of tissue culture, animals, and plants. However, a survey of viral RNA structure and sequences suggests that many RNA viruses were derived form homologous or nonhomologous recombination between viruses or between viruses ...

  3. Recombinant Technology and Probiotics

    Directory of Open Access Journals (Sweden)

    Icy D’Silva


    Full Text Available Recombinant technology has led the way to monumental advances in the development of useful molecules, including the development of safe probiotics. The development of novel approaches using recombinant technology and probiotics that allow accurate targeting of therapeutics to the mucosa is an interesting area of research. The creation and use of recombinant probiotics expressing recombinantovalbumin, recombinant ovalbumin mutants and yet-to-be-designed recombinant hypo/non-allergenic molecules offer the opportunity to further investigate their effects for food, nutrition, environment andhealth. This review highlights advances in native probiotics and recombinant probiotics expressing native and recombinant molecules for food, nutrition, environment and health.

  4. Access of Digitized Print Originals in US and UK Higher Education Libraries Combined with Print Circulation Indicates Increased Usage of Traditional Forms of Reading Materials. A Review of: Joint, Nicholas. “Is Digitisation the New Circulation?: Borrowing Trends, Digitisation and the nature of reading in US and UK Libraries.” Library Review 57.2 (2008: 87-95.

    Directory of Open Access Journals (Sweden)

    Kurt Blythe


    Full Text Available Objective – To discern the statistical accuracy of reports that print circulation is in decline in libraries, particularly higher education libraries in the United States (USand United Kingdom (UK, and to determine if circulation patterns reflect a changing dynamic in patron reading habits.Design – Comparative statistical analysis.Setting – Library circulation statistics from as early as 1982 to as recent as 2006, culled from various sources with specific references to statistics gathered by the National Endowment for the Arts (NEA, the Library and Information Statistics Unit (LISU, the Association of Research Libraries (ARL, the National Center for Education Statistics (NCES, and the Association of College and Research Libraries (ACRL.Subjects – Higher education institutions in the United States and United Kingdom, along with public libraries to a lesser extent.Methods – This study consists of an analysis of print circulation statistics in public and higher education libraries in the US and UK, combined with data on multimedia circulation in public libraries and instances of digital access in university libraries. Specifically, NEA statistics provided data on print readership levels in the US from 1982 to 2002; LISU statistics were analyzed for circulation figures and gate counts in UK public libraries; ARL statistics from 1996 to 2006 provided circulation data for large North American research libraries; NCES statistics from 1990 to 2004 contributed data on circulation in “tertiary level” US higher education libraries; and ACRL statistics were analyzed for more circulation numbers for US post-secondary education libraries. The study further includes data on UK trends in print readership and circulation in UK higher education libraries, and trends in US public library circulation of non-print materials.Main Results – Analysis of the data indicates that print circulation is down in US and UK public libraries and in ARL member

  5. Circulation of Stars (United States)

    Boitani, P.


    Since the dawn of man, contemplation of the stars has been a primary impulse in human beings, who proliferated their knowledge of the stars all over the world. Aristotle sees this as the product of primeval and perennial “wonder” which gives rise to what we call science, philosophy, and poetry. Astronomy, astrology, and star art (painting, architecture, literature, and music) go hand in hand through millennia in all cultures of the planet (and all use catasterisms to explain certain phenomena). Some of these developments are independent of each other, i.e., they take place in one culture independently of others. Some, on the other hand, are the product of the “circulation of stars.” There are two ways of looking at this. One seeks out forms, the other concentrates on the passing of specific lore from one area to another through time. The former relies on archetypes (for instance, with catasterism), the latter constitutes a historical process. In this paper I present some of the surprising ways in which the circulation of stars has occurred—from East to West, from East to the Far East, and from West to East, at times simultaneously.

  6. High Frequency of Human Enterovirus Species C Circulation in Madagascar


    Rakoto-Andrianarivelo, Mala; Rousset, Dominique; Razafindratsimandresy, Richter; Chevaliez, Stéphane; Guillot, Sophie; Balanant, Jean; Delpeyroux, Francis


    Four poliomyelitis outbreaks caused by vaccine-derived polioviruses have been reported recently, including one in Madagascar in 2002. In all cases, the viral strains involved were recombinant between poliovirus vaccine strains and nonpoliovirus strains, probably enterovirus species C. Nevertheless, little is known about the circulation and epidemiology of enteroviruses in the regions where these outbreaks occurred. To assess the circulation of enteroviruses (particularly enterovirus species C...

  7. Computer-aided design of stripline ferrite junction circulators (United States)

    Uzdy, Z.


    A general design procedure is presented for stripline Y-junction circulators employing solid dielectric between ground planes. The resonator design and impedance matching are derived in a form suitable for computer evaluation. The procedure is applicable to cases where either the circulator bandwidth or the ground plane spacing is specified. An experimental S-band switching circulator design illustrates the technique.

  8. Designer genes. Recombinant antibody fragments for biological imaging

    International Nuclear Information System (INIS)

    Monoclonal antibodies (MAbs), with high specificy and high affinity for their target antigens, can be utilized for delivery of agents such as radionuclides, enzymes, drugs or toxins in vivo. However, the implementation of radiolabeled antibodies as magic bullets for detection and treatment of diseases such as cancer has required addressing several shortcomings of murine MAbs. These include their immunogenicity, sub-optimal targeting and pharmacokinetic properties, and practical issues of production and radiolabeling. Genetic engineering provides a powerful approach for redesigning antibodies for use in oncologic applications in vivo. Recombinant fragments have been produced that retain high affinity for target antigens, and display a combination of rapid, high-level tumor targeting with concomitant clearance from normal tissues and the circulation in animal models. An important first step was cloning and engineering of antibody heavy and light chain variable domains into single-chain Fvs (molecular weight, 25-17 kDa), in which the variable regions are joined via a synthetic linker peptide sequence. Although scFvs themselves showed limited tumor uptake in preclinical and clinical studies, they provide a useful building block for intermediate sized recombinant fragments. Covalently linked dimers or non-covalent dimers of scFvs (also known as diabodies) show improved targeting and clearance properties due to their higher molecular weight (55kDa) and increased avidity. Further gains can be made by generation of larger recombinant fragments, such as the minibody, an scFv-CH3 fusion protein that self-assembles into a bivalent dimer of 80 kDa. A systematic evaluation of scFv, diabody, minibody, and intact antibody (based on comparison of tumor uptakes, tumor: blood activity ratios, and calculation of an Imaging Figure of Merit) can form the basis for selection of combinations of recombinant fragments and radionuclides for imaging applications. Ease of engineering and

  9. Recombinant DNA in Medicine


    Cederbaum, Stephen D.; Fareed, George C.; Lovett, Michael A.; Shapiro, Larry J.


    Studies in bacteria and bacterial viruses have led to methods to manipulate and recombine DNA in unique and reproducible ways and to amplify these recombined molecules millions of times. Once properly identified, the recombinant DNA molecules can be used in various ways useful in medicine and human biology. There are many applications for recombinant DNA technology. Cloned complementary DNA has been used to produce various human proteins in microorganisms. Insulin and growth hormone have been...

  10. Improving baculovirus recombination


    Zhao, Yuguang; Chapman, David A. G.; Jones, Ian M.


    Recombinant baculoviruses have established themselves as a favoured technology for the high-level expression of recombinant proteins. The construction of recombinant viruses, however, is a time consuming step that restricts consideration of the technology for high throughput developments. Here we use a targeted gene knockout technology to inactivate an essential viral gene that lies adjacent to the locus used for recombination. Viral DNA prepared from the knockout fails to initiate an infecti...

  11. Recombination of Globally Circulating Varicella-Zoster Virus


    Norberg, Peter; Depledge, Daniel P.; Kundu, Samit; Atkinson, Claire; Brown, Julianne; Haque, Tanzina; Hussaini, Yusuf; MacMahon, Eithne; Molyneaux, Pamela; Papaevangelou, Vassiliki; Sengupta, Nitu; Koay, Evelyn S. C.; Tang, Julian W.; Underhill, Gillian S; Grahn, Anna


    Varicella-zoster virus (VZV) is a human herpesvirus, which during primary infection typically causes varicella (chicken pox) and establishes lifelong latency in sensory and autonomic ganglia. Later in life, the virus may reactivate to cause herpes zoster (HZ; also known as shingles). To prevent these diseases, a live-attenuated heterogeneous vaccine preparation, vOka, is used routinely in many countries worldwide. Recent studies of another alphaherpesvirus, infectious laryngotracheitis virus,...

  12. Therapeutic Recombinant Monoclonal Antibodies (United States)

    Bakhtiar, Ray


    During the last two decades, the rapid growth of biotechnology-derived techniques has led to a myriad of therapeutic recombinant monoclonal antibodies with significant clinical benefits. Recombinant monoclonal antibodies can be obtained from a number of natural sources such as animal cell cultures using recombinant DNA engineering. In contrast to…

  13. Journalism as Cultures of Circulation

    DEFF Research Database (Denmark)

    Bødker, Henrik


    The universe of journalism has always consisted of interspersed texts, meanings and practices. Yet, much journalism research has often isolated either texts and/or contexts and as such assumed relations between professional practices, informed (rational) readers and (conceived) core texts...... of journalism. It is, however, more important than ever to shift attention away from texts to the processes through which they are circulated. This is partly because the many cultural forms of journalism (textual, institutional, technological, material, behavioural and imagined) are undergoing significant......, likes, comments, searches, journalist roles, writing and reading positions and identities etc. Such forms will be traced within the mediation of a specific event with the overall aim of beginning a theorization of the landscape of journalism as highly interrelated cultures of circulation....

  14. Purchase, circulation and fuel taxation


    Potter, Stephen


    During the last decade, the UK and many other developed nations have reformed existing forms of road transport taxation to address a number of transport policy goals. This has involved modifying the design of purchase, circulation and fuel taxation to promote: • More fuel efficient vehicles • Alternative fuel vehicles • Cleaner fuels (lower emissions and/or low carbon) • Modal shift and traffic volume • Congestion reduction This chapter particularly explores the use of...

  15. Experimental and numerical investigation of natural circulation phenomena in a rectangular natural circulation loop

    International Nuclear Information System (INIS)

    Natural circulation is the key phenomena in the passive cooling systems. Thus, it is important to study the flow characteristics and heat transfer behavior in natural circulation. The natural circulation phenomena in steady state and transient form is investigated using 3D CFD simulations, carried out using OpenFoam 2.2.0. The first part consists of a steady-state study, in which the results are validated by data available from a set of experiments conducted over a range of heater power (130W-360W). The second part consists of a transient study of flow development and establishment of natural circulation within this loop. (author)

  16. Photoionization and Recombination (United States)

    Nahar, Sultana N.


    Theoretically self-consistent calculations for photoionization and (e + ion) recombination are described. The same eigenfunction expansion for the ion is employed in coupled channel calculations for both processes, thus ensuring consistency between cross sections and rates. The theoretical treatment of (e + ion) recombination subsumes both the non-resonant recombination ("radiative recombination"), and the resonant recombination ("di-electronic recombination") processes in a unified scheme. In addition to the total, unified recombination rates, level-specific recombination rates and photoionization cross sections are obtained for a large number of atomic levels. Both relativistic Breit-Pauli, and non-relativistic LS coupling, calculations are carried out in the close coupling approximation using the R-matrix method. Although the calculations are computationally intensive, they yield nearly all photoionization and recombination parameters needed for astrophysical photoionization models with higher precision than hitherto possible, estimated at about 10-20% from comparison with experimentally available data (including experimentally derived DR rates). Results are electronically available for over 40 atoms and ions. Photoionization and recombination of He-, and Li-like C and Fe are described for X-ray modeling. The unified method yields total and complete (e+ion) recombination rate coefficients, that can not otherwise be obtained theoretically or experimentally.

  17. Microwave circulator design

    CERN Document Server

    Linkhart, Douglas K


    Circulator design has advanced significantly since the first edition of this book was published 25 years ago. The objective of this second edition is to present theory, information, and design procedures that will enable microwave engineers and technicians to design and build circulators successfully. This resource contains a discussion of the various units used in the circulator design computations, as well as covers the theory of operation. This book presents numerous applications, giving microwave engineers new ideas about how to solve problems using circulators. Design examples are provided, which demonstrate how to apply the information to real-world design tasks.

  18. Recombineering Homologous Recombination Constructs in Drosophila


    Carreira-Rosario, Arnaldo; Scoggin, Shane; Shalaby, Nevine A.; Williams, Nathan David; Hiesinger, P. Robin; Buszczak, Michael


    The continued development of techniques for fast, large-scale manipulation of endogenous gene loci will broaden the use of Drosophila melanogaster as a genetic model organism for human-disease related research. Recent years have seen technical advancements like homologous recombination and recombineering. However, generating unequivocal null mutations or tagging endogenous proteins remains a substantial effort for most genes. Here, we describe and demonstrate techniques for using recombineeri...

  19. Fundamental study of recombination and recombineering in Escherichia coli


    Sun, Xiaohang; Huang, Yang


    Recombination and recombineering systems have been used in Escherichia coli to recombinant DNA sequences. With endonuclease and DNA lipase the bacterial plasmid and target DNA fragment can bind together and recombinant for a new DNA sequences. Red Proteins have been used in recombineering system to perform the function as the enzymes in recombination system, and faster and easier than the other way of recombinant new DNA sequences in E.coli. In this report we get to know the pr...

  20. Schistosoma mansoni circulating polysaccharide and protein antigens recognized by sheep antisera in patients with different clinical forms of schistosomiasis before and after treatment Antígenos polissacarídicos e proteicos circulantes de Schistosoma mansoni reconhecidos por antissoros de carneiro em pacientes com diferentes formas clínicas da esquistossomose antes e após o tratamento


    Julia Maria Costa-Cruz; Sumie Hoshino-Shimizu; Antonio Walter Ferreira; Mario E. Camargo; Thales de Brito; Luiz Caetano da Silva


    Two sheep antisera, one of which raised against polysaccharide (Po) and other against protein (Pt) components of Schistosoma mansoni adult worms, were assessed by ELISA for their ability to detect circulating parasite antigens in patients with different clinical forms of chronic schistosomiasis mansoni. The former antiserum detected parasite antigens in liver granulomata and the latter in renal glomeruli from schistosomiasis patients and mice experimentally infected with S. mansoni. In genera...

  1. An effective tool for identifying HIV-1 subtypes B, C, CRF01_AE, their recombinant forms, and dual infections in Southeast Asia by the multi-region subtype specific PCR (MSSP) assay. (United States)

    Sakkhachornphop, Supachai; Kijak, Gustavo H; Beyrer, Chris; Razak, Myat Htoo; Sanders-Buell, Eric; Jittiwutikarn, Jaroon; Suriyanon, Vinai; Robb, Merlin L; Kim, Jerome H; Celentano, David D; McCutchan, Francine E; Tovanabutra, Sodsai


    The RV144 Thai vaccine trial has been the only vaccine study to show efficacy in preventing HIV infection. Ongoing molecular surveillance of HIV-1 in Southeast Asia is vital for vaccine development and evaluation. In this study a novel tool, the multi-region subtype specific PCR (MSSP) assay, that was able to identify subtypes B, C, CRF01_AE for Thailand, other Southeast Asian countries, India and China is described. The MSSP assay is based on a nested PCR strategy and amplifies eight short regions distributed along the HIV-1 genome using subtype-specific primers. A panel of 41 clinical DNA samples obtained primarily from opiate users in northern Thailand was used to test the assay performance. The MSSP assay provided 73-100% sensitivity and 100% specificity for the three subtypes in each genome region. The assay was then field-tested on 337 sera from HIV infected northern Thai drug users collected between 1999 and 2002. Subtype distribution was CRF01_AE 77.4% (n=261), subtype B 3.3% (n=11), CRF01_AE/B recombinant 12.2% (n=41), CRF01_AE/C recombinant 0.6% (n=2), and non-typeable 6.5% (n=22). The MSSP assay is a simple, cost-effective, and accurate genotyping tool for laboratory settings with limited resources and is sensitive enough to capture the recombinant genomes and dual infections. PMID:25725414

  2. Concepts in Assisted Circulation


    Lefemine, Armand A.; Dunbar, Jacob; DeLucia, Anthony


    Assisted circulation by extracorporeal and extracardiac bypass techniques must be based on the requirements of the heart and of the total body, though these may differ. The cardiac problem in cardiogenic shock is more likely to be a biventricular problem demanding decompression of both sides. Extra pulmonary oxygenation should be avoided because of complexity in long-term use. Principles of assisted circulation may be applied in an extra-thoracic temporary manner or as an intracorporeal long-...

  3. Phylogenetic evidence for intratypic recombinant events in a novel human adenovirus C that causes severe acute respiratory infection in children. (United States)

    Wang, Yanqun; Li, Yamin; Lu, Roujian; Zhao, Yanjie; Xie, Zhengde; Shen, Jun; Tan, Wenjie


    Human adenoviruses (HAdVs) are prevalent in hospitalized children with severe acute respiratory infection (SARI). Here, we report a unique recombinant HAdV strain (CBJ113) isolated from a HAdV-positive child with SARI. The whole-genome sequence was determined using Sanger sequencing and high-throughput sequencing. A phylogenetic analysis of the complete genome indicated that the CBJ113 strain shares a common origin with HAdV-C2, HAdV-C6, HAdV-C1, HAdV-C5, and HAdV-C57 and formed a novel subclade on the same branch as other HAdV-C subtypes. BootScan and single nucleotide polymorphism analyses showed that the CBJ113 genome has an intra-subtype recombinant structure and comprises gene regions mainly originating from two circulating viral strains: HAdV-1 and HAdV-2. The parental penton base, pVI, and DBP genes of the recombinant strain clustered with the HAdV-1 prototype strain, and the E1B, hexon, fiber, and 100 K genes of the recombinant clustered within the HAdV-2 subtype, meanwhile the E4orf1 and DNA polymerase genes of the recombinant shared the greatest similarity with those of HAdV-5 and HAdV-6, respectively. All of these findings provide insight into our understanding of the dynamics of the complexity of the HAdV-C epidemic. More extensive studies should address the pathogenicity and clinical characteristics of the novel recombinant. PMID:26960434

  4. Gaussian Fibonacci Circulant Type Matrices

    Directory of Open Access Journals (Sweden)

    Zhaolin Jiang


    Full Text Available Circulant matrices have become important tools in solving integrable system, Hamiltonian structure, and integral equations. In this paper, we prove that Gaussian Fibonacci circulant type matrices are invertible matrices for n>2 and give the explicit determinants and the inverse matrices. Furthermore, the upper bounds for the spread on Gaussian Fibonacci circulant and left circulant matrices are presented, respectively.

  5. Countermeasures and Investigation of Land Circulation in Less Developed Agricultural Area of Henan Province, China


    Li, Cong-guo


    Some places in Henan Province are investigated by using sample surveys and interviews. Result shows that land circulation in less developed agricultural area of Henan Province has the characteristics of small scale, single form, short period, and circulation land in economic core region. Problems in land circulation are as follows: slow transfer of rural surplus labor force, hard implementation of fundamental land circulation, complicated mentality towards rural land circulation, many misgi...

  6. Expression of Recombinant Antibodies


    Frenzel, André; Hust, Michael; Schirrmann, Thomas


    Recombinant antibodies are highly specific detection probes in research, diagnostics, and have emerged over the last two decades as the fastest growing class of therapeutic proteins. Antibody generation has been dramatically accelerated by in vitro selection systems, particularly phage display. An increasing variety of recombinant production systems have been developed, ranging from Gram-negative and positive bacteria, yeasts and filamentous fungi, insect cell lines, mammalian cells to transg...



    R. Naeije; CHESLER, N


    The pulmonary circulation is a high flow and low pressure circuit, with an average resistance of 1 mmHg.min.L−1 in young adults, increasing to 2.5 mmHg.min.L−1 over 4–6 decades of life. Pulmonary vascular mechanics at exercise are best described by distensible models. Exercise does not appear to affect the time constant of the pulmonary circulation or the longitudinal distribution of resistances. Very high flows are associated with high capillary pressures, up to a 20–25 mmHg threshold associ...

  8. Recombinant human erythropoietin in sports: a review

    Directory of Open Access Journals (Sweden)

    Rafael Maia de Almeida Bento


    Full Text Available Erythropoietin is an endogenous hormone of glicoproteic nature secreted by the kidneys and is the main regulator of the erythropoiesis. An alteration in its production generates a disturbance in the plasmatic concentration giving rise to several types of pathologies related to the hematopoietic system. The recombinant forms of erythropoietin have indiscriminately been used by athletes, mainly in endurance sports, by increasing the erythrocytes concentration, generating a better delivery of oxygen to the muscle tissue. The administration of recombinant erythropoietin was prohibited by the International Olympic Committee and its use considered as doping. This review has the intention to describe the physical, biological and pharmacokinetic properties of the endogenous erythropoietin, as well as its recombinant form, describing also its use in sports and the process of searching methodologies for its detection in doping control.

  9. The stripline circulator theory and practice

    CERN Document Server

    Helszajn, J


    Stripline circulator theory and applications from the world's foremost authority. The stripline junction circulator is a unique three-port non-reciprocal microwave junction used to connect a single antenna to both a transmitter and a receiver. Its operation relies on the interaction between an electron spin in a suitably magnetized insulator with an alternating radio frequency magnetic field. In its simplest form, it consists of a microwave planar gyromagnetic resonator symmetrically coupled by three transmission lines. This book explores the magnetic interaction involved in the stripline circ.

  10. Regulation of Meiotic Recombination

    Energy Technology Data Exchange (ETDEWEB)

    Gregory p. Copenhaver


    Meiotic recombination results in the heritable rearrangement of DNA, primarily through reciprocal exchange between homologous chromosome or gene conversion. In plants these events are critical for ensuring proper chromosome segregation, facilitating DNA repair and providing a basis for genetic diversity. Understanding this fundamental biological mechanism will directly facilitate trait mapping, conventional plant breeding, and development of genetic engineering techniques that will help support the responsible production and conversion of renewable resources for fuels, chemicals, and the conservation of energy (1-3). Substantial progress has been made in understanding the basal recombination machinery, much of which is conserved in organisms as diverse as yeast, plants and mammals (4, 5). Significantly less is known about the factors that regulate how often and where that basal machinery acts on higher eukaryotic chromosomes. One important mechanism for regulating the frequency and distribution of meiotic recombination is crossover interference - or the ability of one recombination event to influence nearby events. The MUS81 gene is thought to play an important role in regulating the influence of interference on crossing over. The immediate goals of this project are to use reverse genetics to identify mutants in two putative MUS81 homologs in the model plant Arabidopsis thaliana, characterize those mutants and initiate a novel forward genetic screen for additional regulators of meiotic recombination. The long-term goal of the project is to understand how meiotic recombination is regulated in higher eukaryotes with an emphasis on the molecular basis of crossover interference. The ability to monitor recombination in all four meiotic products (tetrad analysis) has been a powerful tool in the arsenal of yeast geneticists. Previously, the qrt mutant of Arabidopsis, which causes the four pollen products of male meiosis to remain attached, was developed as a facile system

  11. Tropical convective transport and the Walker circulation

    Directory of Open Access Journals (Sweden)

    J. S. Hosking


    Full Text Available We introduce a methodology to visualise rapid vertical and zonal tropical transport pathways. Using prescribed sea-surface temperatures in four monthly model integrations for 2005, preferred transport routes from the troposphere to the stratosphere are found in the model over the Maritime Continent (MC in November and February, i.e., boreal winter. In these months, the ascending branch of the Walker Circulation over the MC is formed in conjunction with strong deep convection, allowing fast transport into the stratosphere. At the same time, the downwelling branch of the Walker Circulation is enhanced over the East Pacific, compared to other months in 2005, reducing locally the upward transport from emissions below. We conclude that the Walker circulation plays an important role in the seasonality of fast tropical transport from the troposphere to the stratosphere and so impacts at the same time the potential supply of surface emissions.

  12. Fundamental Studies of Recombinant Hydrogenases

    Energy Technology Data Exchange (ETDEWEB)

    Adams, Michael W


    This research addressed the long term goals of understanding the assembly and organization of hydrogenase enzymes, of reducing them in size and complexity, of determining structure/function relationships, including energy conservation via charge separation across membranes, and in screening for novel H2 catalysts. A key overall goal of the proposed research was to define and characterize minimal hydrogenases that are produced in high yields and are oxygen-resistant. Remarkably, in spite of decades of research carried out on hydrogenases, it is not possible to readily manipulate or design the enzyme using molecular biology approaches since a recombinant form produced in a suitable host is not available. Such resources are essential if we are to understand what constitutes a “minimal” hydrogenase and design such catalysts with certain properties, such as resistance to oxygen, extreme stability and specificity for a given electron donor. The model system for our studies is Pyrococcus furiosus, a hyperthermophile that grows optimally at 100°C, which contains three different nickel-iron [NiFe-] containing hydrogenases. Hydrogenases I and II are cytoplasmic while the other, MBH, is an integral membrane protein that functions to both evolve H2 and pump protons. Three important breakthroughs were made during the funding period with P. furiosus soluble hydrogenase I (SHI). First, we produced an active recombinant form of SHI in E. coli by the co-expression of sixteen genes using anaerobically-induced promoters. Second, we genetically-engineered P. furiosus to overexpress SHI by an order of magnitude compared to the wild type strain. Third, we generated the first ‘minimal’ form of SHI, one that contained two rather than four subunits. This dimeric form was stable and active, and directly interacted with a pyruvate-oxidizing enzyme with any intermediate electron carrier. The research resulted in five peer-reviewed publications.

  13. Countermeasures and Investigation of Land Circulation in Less Developed Agricultural Area of Henan Province,China

    Institute of Scientific and Technical Information of China (English)


    Some places in Henan Province are investigated by using sample surveys and interviews. Result shows that land circulation in less developed agricultural area of Henan Province has the characteristics of small scale,single form,short period,and circulation land in economic core region. Problems in land circulation are as follows:slow transfer of rural surplus labor force,hard implementation of fundamental land circulation,complicated mentality towards rural land circulation,many misgivings about land circulation,the unformed social service system of land circulation,and imperfect agricultural risk prevention mechanism for circulated land use. Based on the characteristics of land circulation,suggestions for promoting the land circulation of less developed agricultural areas are put forward in order to solve the problems in land circulation and to lay the foundation for effective implementation of land circulation,such as speeding up the development of urbanization,developing the circulation of collective land,effectively implementing the laws and regulations of rural collective land circulation,transferring land according to law,establishing market mechanism of agricultural land circulation,promoting the agricultural industrialization,establishing market mechanism of agricultural land circulation,promoting the agricultural industrialization,energetically readjusting rural industrial structure,and developing economy with local characteristics.

  14. Quantum Electrodynamics Theory of Laser Assisted Recombination

    Institute of Scientific and Technical Information of China (English)

    敖淑艳; 程太旺; 李晓峰; 潘守甫; 傅盘铭


    Using a formal scattering theoretical approach, we develop a nonperturbative quantum electrodynamics theory to describe laser assisted recombination (LAR), in which an electron initially in the quantized Volkov state recombines with an ion and emits a high-energy photon with frequency defined by energy conservation laws.The transition probability is expressed as an analytic closed form and the spectrum of LAR reflects mainly the properties of general Bessel functions. For the case of a fast electron the LAR spectrum is confined in a well-defined range, while for a slow electron, the LAR spectrum exhibits a double-plateau structure.

  15. Recombination in ionized gases

    International Nuclear Information System (INIS)

    In this paper it is shown how capture-stabilized methodology (both macroscopic and microscopic) can provide a generic basis for a unified treatment of all of the above recombination mechanisms. A new semiclassical theory of dissociative recombination is also presented in an effort to gain further insight into the physics not included in the first-order treatment and difficult to extract from numerical quantal treatments based on configuration mixing and on multichannel quantum defect theory. A simple analytical expression more accurate than the standard first-order result is obtained for the cross section σ and rate coefficient α. (author)


    CERN Multimedia

    Mail Office


    Internal mail envelopes often finish up in large piles in certain offices, thus creating a shortage for other users of the mail service, who would be grateful if everyone with an unused stock could deposit them in their mail box, after attaching them together with an elastic band or a piece of string. The messengers will then collect them so that the Mail Office can put them back in circulation. Thank you for your understanding and collaboration.

  17. Sum rules for meson and baryon production in the quark recombination model

    International Nuclear Information System (INIS)

    A quark-recombination model with quark distributions according to a generalized Kuti-Weisskopf model is used. Mesons are formed by v-s (valence-sea) and s-s recombination, baryons by vvv, vvs, vss and sss recombination. Sum rules for energy momentum conservation, baryon number, valence and sea quarks are shown to constrain the recombination parameters of the model significantly. The resulting model is consistent with experimental data. While the sss recombination into baryons is found to be quite normal we find a strong enhancement of ss recombination into mesons. This enhanced ss term represents in the model the central meson production via gluons. (author)

  18. Recombinant DNA for Teachers. (United States)

    Duvall, James G., III


    A science teacher describes his experience at a workshop to learn to teach the Cold Spring Harbor DNA Science Laboratory Protocols. These protocols lead students through processes for taking E. coli cells and transforming them into a new antibiotic resistant strain. The workshop featured discussions of the role of DNA recombinant technology in…

  19. Recombineering Pseudomonas syringae (United States)

    Here we report the identification of functions that promote genomic recombination of linear DNA introduced into Pseudomonas cells by electroporation. The genes encoding these functions were identified in Pseudomonas syringae pv. syringae B728a based on similarity to the lambda Red Exo/Beta and RecE...

  20. Human recombinant lysosomal enzymes produced in microorganisms. (United States)

    Espejo-Mojica, Ángela J; Alméciga-Díaz, Carlos J; Rodríguez, Alexander; Mosquera, Ángela; Díaz, Dennis; Beltrán, Laura; Díaz, Sergio; Pimentel, Natalia; Moreno, Jefferson; Sánchez, Jhonnathan; Sánchez, Oscar F; Córdoba, Henry; Poutou-Piñales, Raúl A; Barrera, Luis A


    Lysosomal storage diseases (LSDs) are caused by accumulation of partially degraded substrates within the lysosome, as a result of a function loss of a lysosomal protein. Recombinant lysosomal proteins are usually produced in mammalian cells, based on their capacity to carry out post-translational modifications similar to those observed in human native proteins. However, during the last years, a growing number of studies have shown the possibility to produce active forms of lysosomal proteins in other expression systems, such as plants and microorganisms. In this paper, we review the production and characterization of human lysosomal proteins, deficient in several LSDs, which have been produced in microorganisms. For this purpose, Escherichia coli, Saccharomyces cerevisiae, Pichia pastoris, Yarrowia lipolytica, and Ogataea minuta have been used as expression systems. The recombinant lysosomal proteins expressed in these hosts have shown similar substrate specificities, and temperature and pH stability profiles to those produced in mammalian cells. In addition, pre-clinical results have shown that recombinant lysosomal enzymes produced in microorganisms can be taken-up by cells and reduce the substrate accumulated within the lysosome. Recently, metabolic engineering in yeasts has allowed the production of lysosomal enzymes with tailored N-glycosylations, while progresses in E. coli N-glycosylations offer a potential platform to improve the production of these recombinant lysosomal enzymes. In summary, microorganisms represent convenient platform for the production of recombinant lysosomal proteins for biochemical and physicochemical characterization, as well as for the development of ERT for LSD. PMID:26071627

  1. Teaching Form as Form

    DEFF Research Database (Denmark)

    Keiding, Tina Bering


    understanding of form per se, or, to use an expression from this text, of form as form. This challenge can be reduced to one question: how can design teaching support students in achieving not only the ability to recognize and describe different form-related concepts in existing design (i.e. analytical and...

  2. Resolvability in Circulant Graphs

    Institute of Scientific and Technical Information of China (English)

    Muhammad SALMAN; Imran JAVAID; Muhammad Anwar CHAUDHRY


    A set W of the vertices of a connected graph G is called a resolving set for G if for every two distinct vertices u,v ∈ V(G) there is a vertex w ∈ W such that d(u,w) ≠ d(v,w).A resolving set of minimum cardinality is called a metric basis for G and the number of vertices in a metric basis is called the metric dimension of G,denoted by dim(G).For a vertex u of G and a subset S of V(G),the distance between u and S is the number mins∈s d(u,s).A k-partition H ={S1,S2,...,Sk} of V(G) is called a resolving partition if for every two distinct vertices u,v ∈ V(G) there is a set Si in Π such that d(u,Si) ≠ d(v,Si).The minimum k for which there is a resolving k-partition of V(G) is called the partition dimension of G,denoted by pd(G).The circulant graph is a graph with vertex set Zn,an additive group ofintegers modulo n,and two vertices labeled i and j adjacent if and only if i - j (mod n) ∈ C,where C C Zn has the property that C =-C and 0(∈) C.The circulant graph is denoted by Xn,△ where A =|C|.In this paper,we study the metric dimension of a family of circulant graphs Xn,3 with connection set C ={1,-n/2,n - 1} and prove that dim(Xn,3) is independent of choice of n by showing that 3 for all n =0 (mod 4),dim(X,n,3) ={ 4 for all n =2 (mod 4).We also study the partition dimension of a family of circulant graphs Xn,4 with connection set C ={±1,±2} and prove that pd(Xn,4) is independent of choice of n and show that pd(X5,4) =5 and 3 forall odd n≥9,pd(Xn,4) ={ 4 for all even n ≥ 6 and n =7.

  3. Sum rules for meson and baryon production in the quark recombination model

    International Nuclear Information System (INIS)

    A quark recombination model with quark distributions according to a generalized Kuti-Weisskopf model is used. Mesons are formed by v-s (valence-sea) and s-s recombination, baryons by vvv, vvs, vss and sss recombination. Sum rules for energy momentum concervation, baryon number, valence and sea quarks are shown to constrain the recombination parameters of the model significantly. The resulting model is consistent with experimental data. (author)

  4. Trends in the electric field enhancement of dielectronic recombination cross sections

    International Nuclear Information System (INIS)

    The effect of external electric fields on the dielectronic recombination cross section of selected ions has been studied in the configuration-average, distorted wave approximation. By applying the linear-Stark approximation to the doubly-excited Rydberg states formed from resonant recombination, we examine the systematics of field-mixing effects on dielectronic recombination and determine the maximum field enhancement of dielectronic recombination cross sections. 8 references, 6 figures, 3 tables

  5. Antiangiogenic Gene Therapy of Cancer Utilizing a Recombinant Adenovirus to Elevate Systemic Endostatin Levels in Mice


    Feldman, Andrew L.; Restifo, Nicholas P; Alexander, H. Richard; Bartlett, David L.; Hwu, Patrick; Seth, Prem; Libutti, Steven K.


    Gene therapy represents a possible alternative to the chronic delivery of recombinant antiangiogenic proteins to cancer patients. Inducing normal host tissues to produce high circulating levels of these proteins may be more effective than targeting antiangiogenic genes to tumor tissue specifically. Previously reported gene therapy approaches in mice have achieved peak circulating endostatin levels of 8–33 ng/ml. Here we report plasma endostatin levels of 1770 ng/ml after administration of a r...

  6. Identifying recombinants in human and primate immunodeficiency virus sequence alignments using quartet scanning

    Directory of Open Access Journals (Sweden)

    Martin Darren P


    Full Text Available Abstract Background Recombination has a profound impact on the evolution of viruses, but characterizing recombination patterns in molecular sequences remains a challenging endeavor. Despite its importance in molecular evolutionary studies, identifying the sequences that exhibit such patterns has received comparatively less attention in the recombination detection framework. Here, we extend a quartet-mapping based recombination detection method to enable identification of recombinant sequences without prior specifications of either query and reference sequences. Through simulations we evaluate different recombinant identification statistics and significance tests. We compare the quartet approach with triplet-based methods that employ additional heuristic tests to identify parental and recombinant sequences. Results Analysis of phylogenetic simulations reveal that identifying the descendents of relatively old recombination events is a challenging task for all methods available, and that quartet scanning performs relatively well compared to the triplet based methods. The use of quartet scanning is further demonstrated by analyzing both well-established and putative HIV-1 recombinant strains. In agreement with recent findings, we provide evidence that the presumed circulating recombinant CRF02_AG is a 'pure' lineage, whereas the presumed parental lineage subtype G has a recombinant origin. We also demonstrate HIV-1 intrasubtype recombination, confirm the hybrid origin of SIV in chimpanzees and further disentangle the recombinant history of SIV lineages in a primate immunodeficiency virus data set. Conclusion Quartet scanning makes a valuable addition to triplet-based methods for identifying recombinant sequences without prior specifications of either query and reference sequences. The new method is available in the VisRD v.3.0 package

  7. Recombinant influenza vaccines. (United States)

    Sedova, E S; Shcherbinin, D N; Migunov, A I; Smirnov, Iu A; Logunov, D Iu; Shmarov, M M; Tsybalova, L M; Naroditskiĭ, B S; Kiselev, O I; Gintsburg, A L


    This review covers the problems encountered in the construction and production of new recombinant influenza vaccines. New approaches to the development of influenza vaccines are investigated; they include reverse genetics methods, production of virus-like particles, and DNA- and viral vector-based vaccines. Such approaches as the delivery of foreign genes by DNA- and viral vector-based vaccines can preserve the native structure of antigens. Adenoviral vectors are a promising gene-delivery platform for a variety of genetic vaccines. Adenoviruses can efficiently penetrate the human organism through mucosal epithelium, thus providing long-term antigen persistence and induction of the innate immune response. This review provides an overview of the practicability of the production of new recombinant influenza cross-protective vaccines on the basis of adenoviral vectors expressing hemagglutinin genes of different influenza strains. PMID:23346377



    Sedova, E.; Shcherbinin, D.; Migunov, A.; Smirnov, Iu; Logunov, D.; Shmarov, M.; Tsybalova, L.; Naroditskiĭ, B.; O. Kiselev; Gintsburg, A.


    This review covers the problems encountered in the construction and production of new recombinant influenza vaccines. New approaches to the development of influenza vaccines are investigated; they include reverse genetics methods, production of virus-like particles, and DNA- and viral vector-based vaccines. Such approaches as the delivery of foreign genes by DNA- and viral vector-based vaccines can preserve the native structure of antigens. Adenoviral vectors are a promising gene-delivery pla...

  9. Nonradiative recombination in semiconductors

    CERN Document Server

    Abakumov, VN; Yassievich, IN


    In recent years, great progress has been made in the understandingof recombination processes controlling the number of excessfree carriers in semiconductors under nonequilibrium conditions. As a result, it is now possible to give a comprehensivetheoretical description of these processes. The authors haveselected a number of experimental results which elucidate theunderlying physical problems and enable a test of theoreticalmodels. The following topics are dealt with: phenomenological theory ofrecombination, theoretical models of shallow and deep localizedstates, cascade model of carrier captu

  10. Scaling Analysis of Natural Circulation Flow Loop

    International Nuclear Information System (INIS)

    with the two-phase friction drop and void fraction. The resulting governing system has been solved numerically to predict the natural circulation flow rate that would be induced in the channel by the downward-facing boiling process for given flow area and inclination of the channel relative to the gravitational field. In order to compensate the geometric discrepancy between the experimental facility and prototypic core catcher system, the orifice was selected by the scaling analysis with relation of total form loss factor in the down-comer region and area ratio of the cooing channel to the down-comer

  11. General circulation of the Jovian stratosphere (United States)

    Medvedev, Alexander S.; Sethunadh, Jisesh; Hartogh, Paul

    The stratosphere of Jupiter is a convectively stable and coldest layer that extends for about 350 km above the tropopause. The dynamics of stratospheres of fast rotating gas giants differ from that of terrestrial-like planets, their modeling is more challenging, and is still little known despite a growing number of observations. We present results of simulations with a newly developed Jovian general circulation model, which covers the altitudes between one bar and one microbar. The results demonstrate a high sensitivity of the circulation to variations of eddy diffusion, which, in turn, depends on the model resolution and assumed background viscosity. In the lower stratosphere, the multiple circulation cells associated with the tropospheric alternating jets dominate. Higher, a weak two-cell equator-to-pole transport forms due to the influence of smaller-scale eddies. The strength and extent of this circulation are defined by the momentum supplied by shallow and vertically propagating waves, and are consistent with observations of the Shoemaker-Levi 9 comet traces. We will also discuss the dynamical implications of our recent finding that radiative forcing exponentially increases with height, rather than approximately constant throughout the Jovian stratosphere, as was thought before (see presentation of T. Kuroda at B0.3 session).

  12. Ocean General Circulation Models

    Energy Technology Data Exchange (ETDEWEB)

    Yoon, Jin-Ho; Ma, Po-Lun


    1. Definition of Subject The purpose of this text is to provide an introduction to aspects of oceanic general circulation models (OGCMs), an important component of Climate System or Earth System Model (ESM). The role of the ocean in ESMs is described in Chapter XX (EDITOR: PLEASE FIND THE COUPLED CLIMATE or EARTH SYSTEM MODELING CHAPTERS). The emerging need for understanding the Earth’s climate system and especially projecting its future evolution has encouraged scientists to explore the dynamical, physical, and biogeochemical processes in the ocean. Understanding the role of these processes in the climate system is an interesting and challenging scientific subject. For example, a research question how much extra heat or CO2 generated by anthropogenic activities can be stored in the deep ocean is not only scientifically interesting but also important in projecting future climate of the earth. Thus, OGCMs have been developed and applied to investigate the various oceanic processes and their role in the climate system.

  13. Trypanosoma cruzi: circulating antigens

    Directory of Open Access Journals (Sweden)

    V. Bongertz


    Full Text Available Circulating antigens were detected in sera of mice experimentally infected with a high close of Trypanosoma cruzi by reaction with sera from chronically infected mice. The immunodiffusion reaction between homologous acute and chronic sera produced four precipitation lines. By reaction with chronic mouse serum, circulating antingens were detected in sera from heavily infected hamsters, dogs, rabbits and in sera from chagasic patients. A reaction was also found in urine from acutely infected mice and dogs. Trypanosoma cruzi exoantigen was detected in trypanosome culture medium and in the supernatant of infected cell cultures. Attempts to isolate the antigens are described.Antígenos circulantes foram detectados em soros de camundongos infectados experimentalmente com elevadas doses de Trypanosoma cruzi pela reação com soros obtidos de camundongos em fase crônica de infecção. A reação de imunodifusão entre soros homólogos agudo e crônico produziu quatro linhas de precipitação. Por reação com soro crônico de camundongo antígenos circulantes foram detectados em soros de crícetos, cães e coelhos infectados com doses elevadas de Trypanosoma cruzi e em soros de pacientes chagásicos. Uma reação foi também observada com urina de camundongos e cães infectados de forma aguda. Exoantígeno de Trypanosoma cruzi foi detectado em meio de cultura de tripanosomas e em sobrenadantes de culturas de células infectadas. Tentativas de isolamento dos antigenos são descritas.

  14. Formation of germline chimera Gaok chicken used circulation primordial germ cells (circulation PGCs fresh and thawed

    Directory of Open Access Journals (Sweden)

    Kostaman T


    Full Text Available Formation of germline chimeras by transfer of chicken primordial germ cells (PGCs is one of the effective techniques for preservation and regeneration of genetic resources in chickens. This study attempted to form germline chimeras of Gaok chicken buy purifying circulated PGCs of donor embryo before it is transferred to the recipient (White Leghorn chickens=WL and studied the ability of recipient embryo on survival in incubators, and hatchability. This study used 200 fertile eggs of Gaok and 90 fertile WL breed all of the eggs was incubated at 380C and 60% humidity in a portable incubator. PGCs-circulation of the blood collected Gaok embryos at stage 14-16 were taken from the dorsal aorta, and then purified by centrifugation method using nycodenz. PGCs-circulation results further purification frozen in liquid nitrogen before being transferred to the recipient embryo. The results showed that for the development of embryos transferred to the fresh circulation of PGCs-circulation as many as 25 cells can survive up to day 14, while one of the transferred of 50 and 100 cells into recipient embryos was hatched (10%. On the contrari recipient embryos that are transferred to the frozen PGCs-circulation the embryos development was shorter, and only survived until day 10th (treatment 25 cells, day 14th (treatment of 50 cells and day 17th (treatment of 100 cells. It is concluded that the amount of PGCs-circulation embryos transferred to the recipient is one factor that influence the success of the development germline chimeras.

  15. Recombinant human erythropoietin in sports: a review


    Rafael Maia de Almeida Bento; Lúcia Menezes Pinto Damasceno; Francisco Radler Aquino Neto


    Erythropoietin is an endogenous hormone of glicoproteic nature secreted by the kidneys and is the main regulator of the erythropoiesis. An alteration in its production generates a disturbance in the plasmatic concentration giving rise to several types of pathologies related to the hematopoietic system. The recombinant forms of erythropoietin have indiscriminately been used by athletes, mainly in endurance sports, by increasing the erythrocytes concentration, generating a better delivery of ox...

  16. Recombinant Collagenlike Proteins (United States)

    Fertala, Andzej


    A group of collagenlike recombinant proteins containing high densities of biologically active sites has been invented. The method used to express these proteins is similar to a method of expressing recombinant procollagens and collagens described in U. S. Patent 5,593,859, "Synthesis of human procollagens and collagens in recombinant DNA systems." Customized collagenous proteins are needed for biomedical applications. In particular, fibrillar collagens are attractive for production of matrices needed for tissue engineering and drug delivery. Prior to this invention, there was no way of producing customized collagenous proteins for these and other applications. Heretofore, collagenous proteins have been produced by use of such biological systems as yeasts, bacteria, and transgenic animals and plants. These products are normal collagens that can also be extracted from such sources as tendons, bones, and hides. These products cannot be made to consist only of biologically active, specific amino acid sequences that may be needed for specific applications. Prior to this invention, it had been established that fibrillar collagens consist of domains that are responsible for such processes as interaction with cells, binding of growth factors, and interaction with a number of structural proteins present in the extracellular matrix. A normal collagen consists of a sequence of domains that can be represented by a corresponding sequence of labels, e.g., D1D2D3D4. A collagenlike protein of the present invention contains regions of collagen II that contain multiples of a single domain (e.g., D1D1D1D1 or D4D4D4D4) chosen for its specific biological activity. By virtue of the multiplicity of the chosen domain, the density of sites having that specific biological activity is greater than it is in a normal collagen. A collagenlike protein according to this invention can thus be made to have properties that are necessary for tissue engineering.

  17. Numerical Study of Passive Catalytic Recombiner for Hydrogen Mitigation

    Directory of Open Access Journals (Sweden)

    Pavan K Sharma


    Full Text Available A significant amount of hydrogen is expected to be released within the containment of a water cooled power reactor after a severe accident. To reduce the risk of deflagration/detonation various means for hydrogen control have been adopted all over the world. Passive catalytic recombiner with vertical flat catalytic plate is one of such hydrogen mitigating device. Passive catalytic recombiners are designed for the removal of hydrogen generated in order to limit the impact of possible hydrogen combustion. Inside a passive catalytic recombiner, numerous thin steel sheets coated with catalyst material are vertically arranged at the bottom opening of a sheet metal housing forming parallel flow channels for the surrounding gas atmosphere. Already below conventional flammability limits, hydrogen and oxygen react exothermally on the catalytic surfaces forming harmless steam. Detailed numerical simulations and experiments are required for an in-depth knowledge of such plate type catalytic recombiners. Specific finite volume based in-house CFD code has been developed to model and analyse the working of these recombiner. The code has been used to simulate the recombiner device used in the Gx-test series of Battelle-Model Containment (B-MC experiments. The present paper briefly describes the working principle of such passive catalytic recombiner and salient feature of the CFD model developed at Bhabha Atomic Research Centre (BARC. Finally results of the calculations and comparison with existing data are discussed.

  18. Primordial magnetogenesis before recombination

    CERN Document Server

    Fabre, Ophélia


    The origin of large magnetic fields in the Universe remains currently unknown. We investigate here a mechanism before recombination based on known physics. The source of the vorticity is due to the changes in the photon distribution function caused by the fluctuations in the background photons. We show that the magnetic field generated in the MHD limit, due to the Coulomb scattering, is of the order $10^{-49}$ G. We explicitly show that the magnetic fields generated from this process are sustainable and are not erased by resistive diffusion. We compare the results with current observations and discuss the implications.

  19. Stimulated radiative recombination of H{sup +} and He {sup +}

    Energy Technology Data Exchange (ETDEWEB)

    Rogelstad, M.L.; Mitchell, J.B.A. [Western Ontario Univ., Physics Dept., London, ON (Canada); Yousif, F.B. [UNAM, Inst. de Fisica, Cuernavaca (Mexico); Morgan, T.J. [Wesleyan Univ., Physics Dept., Middletown, CT (United States)


    Stimulated radiative recombination has been demonstrated experimentally in e{sup -}+H{sup +} and e{sup -} + He{sup +} collisions using a merged electron-ion beams apparatus with field ionization detection of the excited neutral products. Enhancement of the recombination over spontaneous recombination to form the n = 11, 12 and 13 levels of atomic hydrogen and the n = 11 and 12 levels of atomic helium by factors of between 1000 and 3000 have been found using a CO{sub 2} laser power of 8 W. Evidence for the resolution of fine-structure levels has been seen for the case of helium. (author).

  20. Computation of the q -th roots of circulant matrices

    Directory of Open Access Journals (Sweden)

    Pakizeh Mohammadi Khanghah


    Full Text Available In this paper‎, ‎we investigate the reduced form of circulant matrices‎ ‎and we show that the problem of computing the $q$-th roots of a‎ ‎nonsingular circulant matrix $A$ can be reduced to that of computing‎ ‎the $q$-th roots of two half size matrices $B-C$ and $B+C$. 

  1. TROPICAL METEOROLOGY & Climate: Hadley Circulation

    Energy Technology Data Exchange (ETDEWEB)

    Lu, Jian; Vecchi, Gabriel A.


    The Hadley circulation, a prominent circulation feature characterized by rising air near the Equator and sinking air in the subtropics, defines the position of dry subtropical areas and is a fundamental regulator of the earth’s energy and momentum budgets. The character of the Hadley circulation, and its related precipitation regimes, exhibits variation and change in response to both climate variability and radiative forcing changes. The strength and position of the Hadley circulation change from year to year paced by El Niño and La Niña events. Over the last few decades of the twentieth century, the Hadley cell has expanded poleward in both hemispheres, with changes in atmospheric composition (including stratospheric ozone depletion and greenhouse gas increases) thought to have contributed to its expansion. This article introduces the basic phenomenology and driving mechanism of the Hadley circulation and discusses its variations under both natural and anthropogenic climate forcings.

  2. Sino-Danish Brain Circulation

    DEFF Research Database (Denmark)

    Bertelsen, Rasmus Gjedssø; Du, Xiangyun; Søndergaard, Morten Karnøe


    China is faced with urgent needs to develop an economically and environmentally sustainable economy based on innovation and knowledge. Brain circulation and research and business investments from the outside are central for this development. Sino-American brain circulation and research...... and investment by overseas researchers and entrepreneurs are well described. In that case, the US is the center of global R&D and S&T. However, the brain circulation and research and investments between a small open Scandinavian economy, such as Denmark, and the huge developing economy of China are not well...... understood. In this case, Denmark is very highly developed, but a satellite in the global R&D and S&T system. With time and the growth of China as a R&D and S&T power house, both Denmark and China will benefit from brain circulation between them. Such brain circulation is likely to play a key role in flows...

  3. CRMAGE: CRISPR Optimized MAGE Recombineering


    Carlotta Ronda; Lasse Ebdrup Pedersen; Sommer, Morten O. A.; Alex Toftgaard Nielsen


    A bottleneck in metabolic engineering and systems biology approaches is the lack of efficient genome engineering technologies. Here, we combine CRISPR/Cas9 and λ Red recombineering based MAGE technology (CRMAGE) to create a highly efficient and fast method for genome engineering of Escherichia coli. Using CRMAGE, the recombineering efficiency was between 96.5% and 99.7% for gene recoding of three genomic targets, compared to between 0.68% and 5.4% using traditional recombineering. For modulat...

  4. E. coli Tarafından Sentezlenen Recombinant Soyacystatinin Karakterizasyonu


    AKPINAR, Özlem; AN, Haejung


    Recombinant (r-) soyacystatin was characterized for their inhibitory activity against papain and compared to egg white cystatin. r-Soyacystatin expressed in E. coli was purified 4.33 fold as a recombinant protein with phenyl-Sepharose and DEAE. Egg white cystatin was purified by using affinity chromatography on CM-papain-Sepharose. The specific interaction of r-soyacystatin and papain was detected on isoelectric focusing gel. Papain and r-soyacystatin formed a complex and the complex was res...

  5. Indiscriminate recombination in simian virus 40-infected monkey cells.


    Winocour, E; Keshet, I


    DNA transfection of African green monkey BSC-1 cells with simian virus 40 (SV40) DNA and bacterial virus phi X174 replicative form DNA ("cotransfection") yielded stocks containing SV40/phi X174 recombinant virus, which was detected by an infectious-center in situ plaque hybridization procedure and which was sensitive to anti-SV40 antiserum. The recombinant virus replicated during serial passage. Restriction endonuclease cleavage of the SV40/phi X174 DNA indicated that several different types ...

  6. Prominent mitochondrial DNA recombination intermediates in human heart muscle


    Kajander, Olli A; Karhunen, Pekka J.; Holt, Ian J.; Jacobs, Howard T.


    Recombination intermediates containing four-way (Holliday) junctions are generated during DNA repair and replication in many systems, including yeast mitochondrial DNA (mtDNA). In contrast, convincing evidence for recombination in mammalian mtDNA is lacking. We have used two-dimensional agarose-gel electrophoresis to analyse non-linear forms of mtDNA in human heart muscle. Replication intermediates from both the coupled and strand-asynchronous mtDNA replication pathways were detected. An addi...

  7. Multiple biological activities of human recombinant interleukin 1.


    Dinarello, C A; Cannon, J. G.; Mier, J W; Bernheim, H. A.; LoPreste, G; Lynn, D L; Love, R N; Webb, A C; Auron, P. E.; Reuben, R C


    Complementary DNA coding for human monocyte interleukin 1 (IL-1), pI 7 form, was expressed in Escherichia coli. During purification, IL-1 activity on murine T cells was associated with the recombinant protein. Homogeneous human recombinant IL-1 (hrIL-1) was tested in several assays to demonstrate the immunological and inflammatory properties attributed to this molecule. hrIL-1 induced proliferative responses in a cloned murine T cell in the presence of suboptimal concentrations of mitogen, wh...

  8. The next wave of recombinant and synthetic anticancer vaccines


    Irvine, Kari R.; Restifo, Nicholas P


    The identification of tumor-associated antigens (TAA) recognized by T lymphocytes makes the development of antigen-specific synthetic and recombinant vaccines possible. The expression of TAA within a recombinant vector increases control over the kinetics and quantity, the molecular form, and the subcellular location of the immunogen delivered. The next generation of antitumor vaccines employs cytokines and costimulatory molecules expressed in concert with TAA that are capable of augmenting th...

  9. Experimental observation of laser-stimulated radiative recombination

    International Nuclear Information System (INIS)

    Spontaneous radiative recombination between protons and electrons to form hydrogen atoms with 8≤n≤19 has been measured. CO2 laser light has been shown to induce stimulated radiative recombination to the n=11 and 12 levels with an inferred gain in the cross section of 1720±860 and 4790±2830 for a laser power of 12.6 and 15.3 W, respectively. This is in line with that predicted theoretically

  10. Natural Circulation with Boiling

    International Nuclear Information System (INIS)

    A number of parameters with dominant influence on the power level at hydrodynamic instability in natural circulation, two-phase flow, have been studied experimentally. The geometrical dependent quantities were: the system driving head, the boiling channel and riser dimensions, the single-phase as well as the two phase flow restrictions. The parameters influencing the liquid properties were the system pressure and the test section inlet subcooling. The threshold of instability was determined by plotting the noise characteristics in the mass flow records against power. The flow responses to artificially obtained power disturbances at instability conditions were also measured in order to study the nature of hydrodynamic instability. The results presented give a review over relatively wide ranges of the main parameters, mainly concerning the coolant performance in both single and parallel boiling channel flow. With regard to the power limits the experimental results verified that the single boiling channel performance was intimately related to that of the parallel channels. In the latter case the additional inter-channel factors with attenuating effects were studied. Some optimum values of the parameters were observed

  11. HIV-1 recombinants with multiple parental strains in low-prevalence, remote regions of Cameroon: Evolutionary relics?

    Directory of Open Access Journals (Sweden)

    Eyzaguirre Lindsay


    Full Text Available Abstract Background The HIV pandemic disseminated globally from Central West Africa, beginning in the second half of the twentieth century. To elucidate the virologic origins of the pandemic, a cross-sectional study was conducted of the genetic diversity of HIV-1 strains in villagers in 14 remote locations in Cameroon and in hospitalized and STI patients. DNA extracted from PBMC was PCR amplified from HIV(+ subjects. Partial pol amplicons (N = 164 and nearly full virus genomes (N = 78 were sequenced. Among the 3956 rural villagers studied, the prevalence of HIV infection was 4.9%; among the hospitalized and clinic patients, it was 8.6%. Results Virus genotypes fell into two distinctive groups. A majority of the genotyped strains (109/164 were the circulating recombinant form (CRF known to be endemic in West Africa and Central West Africa, CRF02_AG. The second most common genetic form (9/164 was the recently described CRF22_01A1, and the rest were a collection of 4 different subtypes (A2, D, F2, G and 6 different CRFs (-01, -11, -13, -18, -25, -37. Remarkably, 10.4% of HIV-1 genomes detected (17/164 were heretofore undescribed unique recombinant forms (URF present in only a single person. Nearly full genome sequencing was completed for 78 of the viruses of interest. HIV genetic diversity was commonplace in rural villages: 12 villages each had at least one newly detected URF, and 9 villages had two or more. Conclusions These results show that while CRF02_AG dominated the HIV strains in the rural villages, the remainder of the viruses had tremendous genetic diversity. Between the trans-species transmission of SIVcpz and the dispersal of pandemic HIV-1, there was a time when we hypothesize that nascent HIV-1 was spreading, but only to a limited extent, recombining with other local HIV-1, creating a large variety of recombinants. When one of those recombinants began to spread widely (i.e. became epidemic, it was recognized as a subtype. We

  12. The relationship between urbanization and commodity circulation: a theoretical and positive research

    Institute of Scientific and Technical Information of China (English)

    YAN Weilong


    "Town" and commodity circulation are two closely interrelated concepts.A town is born through the exchange of commodities;it is formed by an increase in trade efficiency.The trade efficiency caused by the density of economy is the standard of rationalization of the town scale.The development of a town promotes the development from simple commodity circulation to developed commodity circulation,while the difference in the level of urbanization is an important reason for differences in the circulation level.Therefore,the strategy of being guided by circulation will be a basic way to push forward urbanization healthily in China.

  13. Fibrinolytic Activity of Recombinant Mutant Streptokinase

    Directory of Open Access Journals (Sweden)

    Mahboobeh Mobarrez


    Full Text Available Background: Streptokinase is a bacterial protein produced by different beta hemolytic streptococci and widely used in thrombolytic treatment. The main disadvantage of using streptokinase is antibody formation which causes allergic reaction to neutralize effects of streptokinase therapy. Aim of this study was investigate of recombinant mutant streptokinase fibrinolytic activity.Materials and Methods: In this study recombinant mutant streptokinase without 42 amino acids from the C terminal region was purified by affinity S-Tag column chromatography and its fibrinolytic activity was studied.Results: The concentration of expressed and purified protein was 10 mg/ml. Its enzyme activity was assayed using zymography, radial caseinolytic activity and fibrin plate test methods and estimated quantitatively by casein digestion method compared to a commercial form.Conclusion: It was found that this product had the more volume and more enzymatic activity.

  14. Cell biology of mitotic recombination

    DEFF Research Database (Denmark)

    Lisby, Michael; Rothstein, Rodney


    Homologous recombination provides high-fidelity DNA repair throughout all domains of life. Live cell fluorescence microscopy offers the opportunity to image individual recombination events in real time providing insight into the in vivo biochemistry of the involved proteins and DNA molecules as w...

  15. The circulation physiology of agroecosystems

    Institute of Scientific and Technical Information of China (English)

    Cao Zhiping; Richard Dawson


    This paper represents an effort to enlarge the understanding of the biophysical foundation of agroecosystems by using an analogy with the circulation of the blood in the human body. The circulation function in the human body can be represented as arterial pressure. The factors affecting arterial pressure in the human body have direct counterparts in the cultivation-husbandry system. The relationship between circulation pressure and the factors affecting that pressure in the cultivation-husbandry system are similar to the relationship between the arterial pressure and factors affecting arterial pressure in the human body. Furthermore, circulation resistance in the cultivation-husbandry system can be shown to be analogous to the calculation of peripheral resistance in the human body by Poiseuille's formula.

  16. Tropical convective transport and the Walker circulation

    Directory of Open Access Journals (Sweden)

    J. S. Hosking


    Full Text Available We introduce a methodology to visualise rapid vertical and zonal tropical transport pathways. Using prescribed sea-surface temperatures in four monthly model integrations for 2005, we characterise preferred transport routes from the troposphere to the stratosphere in a high resolution climate model. Most efficient transport is modelled over the Maritime Continent (MC in November and February, i.e., boreal winter. In these months, the ascending branch of the Walker Circulation over the MC is formed in conjunction with strong deep convection, allowing fast transport into the stratosphere. In the model the upper tropospheric zonal winds associated with the Walker Circulation are also greatest in these months in agreement with ERA-Interim reanalysis data. We conclude that the Walker circulation plays an important role in the seasonality of fast tropical transport from the lower and middle troposphere to the upper troposphere and so impacts at the same time the potential supply of surface emissions to the tropical tropopause layer (TTL and subsequently to the stratosphere.

  17. Atmospheric Circulation of Terrestrial Exoplanets


    Showman, Adam P.; Wordsworth, Robin D.; Merlis, Timothy M.; Kaspi, Yohai


    The investigation of planets around other stars began with the study of gas giants, but is now extending to the discovery and characterization of super-Earths and terrestrial planets. Motivated by this observational tide, we survey the basic dynamical principles governing the atmospheric circulation of terrestrial exoplanets, and discuss the interaction of their circulation with the hydrological cycle and global-scale climate feedbacks. Terrestrial exoplanets occupy a wide range of physical a...

  18. Non-Enzymatic Template-Directed Recombination of RNAs

    Directory of Open Access Journals (Sweden)

    Marina A. Zenkova


    Full Text Available RNA non-enzymatic recombination reactions are of great interest within the hypothesis of the "RNA world", which argues that at some stage of prebiotic life development proteins were not yet engaged in biochemical reactions and RNA carried out both the information storage task and the full range of catalytic roles necessary in primitive self-replicating systems. Here we report on the study of recombination reaction occuring between two 96 nucleotides (nts fragments of RNAs under physiological conditions and governed by a short oligodeoxyribonucleotide template, partially complementary to sequences within each of the RNAs. Analysis of recombination products shows that ligation is predominantly template-directed, and occurs within the complementary complex with the template in "butt-to-butt" manner, in 1- or 3- nts bulges or in 2-3 nts internal loops. Minor recombination products formed in the template-independent manner are detected as well.

  19. Delayed recombination and standard rulers

    International Nuclear Information System (INIS)

    Measurements of baryonic acoustic oscillations (BAOs) in galaxy surveys have been recognized as a powerful tool for constraining dark energy. However, this method relies on the knowledge of the size of the acoustic horizon at recombination derived from cosmic microwave background (CMB) anisotropy measurements. This estimate is typically derived assuming a standard recombination scheme; additional radiation sources can delay recombination altering the cosmic ionization history and the cosmological inferences drawn from CMB and BAO data. In this paper we quantify the effect of delayed recombination on the determination of dark energy parameters from future BAO surveys such as the Baryon Oscillation Spectroscopic Survey and the Wide-Field Multi-Object Spectrograph. We find the impact to be small but still not negligible. In particular, if recombination is nonstandard (to a level still allowed by CMB data), but this is ignored, future surveys may incorrectly suggest the presence of a redshift-dependent dark energy component. On the other hand, in the case of delayed recombination, adding to the analysis one extra parameter describing deviations from standard recombination does not significantly degrade the error bars on dark energy parameters and yields unbiased estimates. This is due to the CMB-BAO complementarity.

  20. Collaborative form(s)

    DEFF Research Database (Denmark)

    Gunn, Wendy

    Gunn asks us to consider beauty as collaborative forms of action generated by moving between design by means of anthropology and anthropology by means of design. Specifically, she gives focus to play-like reflexions on practices of designing energy products, systems and infrastructure. Design...... anthropology engages groups of people within collaborative, interdisciplinary, inter-organizational design processes and co-analytic activities vs. the individual anthropologist conducting studies of people. In doing anthropology by means of design as Gatt and Ingold (2013) have shown, design is considered the...... premise designing as a social process and can be understood as a material engagement and constructive critique involving participant observation....

  1. Seasonal overturning circulation in the Red Sea: 2. Winter circulation

    KAUST Repository

    Yao, Fengchao


    The shallow winter overturning circulation in the Red Sea is studied using a 50 year high-resolution MITgcm (MIT general circulation model) simulation with realistic atmospheric forcing. The overturning circulation for a typical year, represented by 1980, and the climatological mean are analyzed using model output to delineate the three-dimensional structure and to investigate the underlying dynamical mechanisms. The horizontal model circulation in the winter of 1980 is dominated by energetic eddies. The climatological model mean results suggest that the surface inflow intensifies in a western boundary current in the southern Red Sea that switches to an eastern boundary current north of 24N. The overturning is accomplished through a cyclonic recirculation and a cross-basin overturning circulation in the northern Red Sea, with major sinking occurring along a narrow band of width about 20 km along the eastern boundary and weaker upwelling along the western boundary. The northward pressure gradient force, strong vertical mixing, and horizontal mixing near the boundary are the essential dynamical components in the model\\'s winter overturning circulation. The simulated water exchange is not hydraulically controlled in the Strait of Bab el Mandeb; instead, the exchange is limited by bottom and lateral boundary friction and, to a lesser extent, by interfacial friction due to the vertical viscosity at the interface between the inflow and the outflow. Key Points Sinking occurs in a narrow boundary layer along the eastern boundary Surface western boundary current switches into an eastern boundary current Water exchange in the Strait of Bab el Mandeb is not hydraulically controlled © 2014. American Geophysical Union. All Rights Reserved.

  2. The Invertibility, Explicit Determinants, and Inverses of Circulant and Left Circulant and g-Circulant Matrices Involving Any Continuous Fibonacci and Lucas Numbers

    Directory of Open Access Journals (Sweden)

    Zhaolin Jiang


    Full Text Available Circulant matrices play an important role in solving delay differential equations. In this paper, circulant type matrices including the circulant and left circulant and g-circulant matrices with any continuous Fibonacci and Lucas numbers are considered. Firstly, the invertibility of the circulant matrix is discussed and the explicit determinant and the inverse matrices by constructing the transformation matrices are presented. Furthermore, the invertibility of the left circulant and g-circulant matrices is also studied. We obtain the explicit determinants and the inverse matrices of the left circulant and g-circulant matrices by utilizing the relationship between left circulant, g-circulant matrices and circulant matrix, respectively.

  3. Spreader and recombiner for 15-30 GeV electron accelerator

    International Nuclear Information System (INIS)

    The spreader and the recombiner systems for a linear accelerator are described in detail. The beams in the spreader and recombiner have to be matched on one side to the beams in the linac and on the other to the beams in the arcs. The beam forming system and the optical arrangement of the spreader and recombiner is described, and beam dynamical calculations are presented. (K.A.) 16 figs

  4. Circulating Fibronectin Controls Tumor Growth

    Directory of Open Access Journals (Sweden)

    Anja von Au


    Full Text Available Fibronectin is ubiquitously expressed in the extracellular matrix, and experimental evidence has shown that it modulates blood vessel formation. The relative contribution of local and circulating fibronectin to blood vessel formation in vivo remains unknown despite evidence for unexpected roles of circulating fibronectin in various diseases. Using transgenic mouse models, we established that circulating fibronectin facilitates the growth of bone metastases by enhancing blood vessel formation and maturation. This effect is more relevant than that of fibronectin produced by endothelial cells and pericytes, which only exert a small additive effect on vessel maturation. Circulating fibronectin enhances its local production in tumors through a positive feedback loop and increases the amount of vascular endothelial growth factor (VEGF retained in the matrix. Both fibronectin and VEGF then cooperate to stimulate blood vessel formation. Fibronectin content in the tumor correlates with the number of blood vessels and tumor growth in the mouse models. Consistent with these results, examination of three separate arrays from patients with breast and prostate cancers revealed that a high staining intensity for fibronectin in tumors is associated with increased mortality. These results establish that circulating fibronectin modulates blood vessel formation and tumor growth by modifying the amount of and the response to VEGF. Furthermore, determination of the fibronectin content can serve as a prognostic biomarker for breast and prostate cancers and possibly other cancers.

  5. Cell encoding recombinant human erythropoietin

    Energy Technology Data Exchange (ETDEWEB)

    Beck, A.K.; Withy, R.M.; Zabrecky, J.R.; Masiello, N.C.


    This patent describes a C127 cell transformed with a recombinant DNA vector. It comprises: a DNA sequence encoding human erythropoietin, the transformed cell being capable of producing N-linked and O-linked glycosylated human erythropoietin.

  6. Three Decades of Recombinant DNA. (United States)

    Palmer, Jackie


    Discusses highlights in the development of genetic engineering, examining techniques with recombinant DNA, legal and ethical issues, GenBank (a national database of nucleic acid sequences), and other topics. (JN)

  7. Stable recombination hotspots in birds. (United States)

    Singhal, Sonal; Leffler, Ellen M; Sannareddy, Keerthi; Turner, Isaac; Venn, Oliver; Hooper, Daniel M; Strand, Alva I; Li, Qiye; Raney, Brian; Balakrishnan, Christopher N; Griffith, Simon C; McVean, Gil; Przeworski, Molly


    The DNA-binding protein PRDM9 has a critical role in specifying meiotic recombination hotspots in mice and apes, but it appears to be absent from other vertebrate species, including birds. To study the evolution and determinants of recombination in species lacking the gene that encodes PRDM9, we inferred fine-scale genetic maps from population resequencing data for two bird species: the zebra finch, Taeniopygia guttata, and the long-tailed finch, Poephila acuticauda. We found that both species have recombination hotspots, which are enriched near functional genomic elements. Unlike in mice and apes, most hotspots are shared between the two species, and their conservation seems to extend over tens of millions of years. These observations suggest that in the absence of PRDM9, recombination targets functional features that both enable access to the genome and constrain its evolution. PMID:26586757

  8. Combinatorics in Recombinational Population Genomics (United States)

    Parida, Laxmi

    The work that I will discuss is motivated by the need for understanding, and processing, the manifestations of recombination events in chromosome sequences. In this talk, we focus on two related problems. First, we explore the very general problem of reconstructability of pedigree history. How plausible is it to unravel the history of a complete unit (chromosome) of inheritance? The second problem deals with reconstructing the recombinational history of a collection of chromosomes.

  9. Progenitors of Recombining Supernova Remnants


    Moriya, Takashi J.


    Usual supernova remnants have either ionizing plasma or plasma in collisional ionization equilibrium, i.e., the ionization temperature is lower than or equal to the electron temperature. However, the existence of recombining supernova remnants, i.e., supernova remnants with the ionization temperature higher than the electron temperature, is recently confirmed. One suggested way to have recombining plasma in a supernova remnant is to have a dense circumstellar medium at the time of the superno...

  10. Do mitochondria recombine in humans?


    Eyre-Walker, A


    Until very recently, mitochondria were thought to be clonally inherited through the maternal line in most higher animals. However, three papers published in 2000 claimed population-genetic evidence of recombination in human mitochondrial DNA. Here I review the current state of the debate. I review the evidence for the two main pathways by which recombination might occur: through paternal leakage and via a mitochondrial DNA sequence in the nuclear genome. There is no strong evidence for either...

  11. Recombinant snake venom prothrombin activators


    Lövgren, Ann


    Three prothrombin activators; ecarin, which was originally isolated from the venom of the saw-scaled viper Echis carinatus, trocarin from the rough-scaled snake Tropidechis carinatus, and oscutarin from the Taipan snake Oxyuranus scutellatus, were expressed in mammalian cells with the purpose to obtain recombinant prothrombin activators that could be used to convert prothrombin to thrombin. We have previously reported that recombinant ecarin can efficiently generate thrombin without the need ...

  12. Delayed recombination and cosmic parameters

    International Nuclear Information System (INIS)

    Current cosmological constraints from cosmic microwave background anisotropies are typically derived assuming a standard recombination scheme, however additional resonance and ionizing radiation sources can delay recombination, altering the cosmic ionization history and the cosmological inferences drawn from the cosmic microwave background data. We show that for recent observations of the cosmic microwave background anisotropy, from the Wilkinson microwave anisotropy probe satellite mission (WMAP) 5-year survey and from the arcminute cosmology bolometer array receiver experiment, additional resonance radiation is nearly degenerate with variations in the spectral index, ns, and has a marked effect on uncertainties in constraints on the Hubble constant, age of the universe, curvature and the upper bound on the neutrino mass. When a modified recombination scheme is considered, the redshift of recombination is constrained to z*=1078±11, with uncertainties in the measurement weaker by 1 order of magnitude than those obtained under the assumption of standard recombination while constraints on the shift parameter are shifted by 1σ to R=1.734±0.028. From the WMAP5 data we obtain the following constraints on the resonance and ionization sources parameters: εαi<0.058 at 95% c.l.. Although delayed recombination limits the precision of parameter estimation from the WMAP satellite, we demonstrate that this should not be the case for future, smaller angular scales measurements, such as those by the Planck satellite mission.

  13. Atmospheric Circulation of Terrestrial Exoplanets

    CERN Document Server

    Showman, Adam P; Merlis, Timothy M; Kaspi, Yohai


    The investigation of planets around other stars began with the study of gas giants, but is now extending to the discovery and characterization of super-Earths and terrestrial planets. Motivated by this observational tide, we survey the basic dynamical principles governing the atmospheric circulation of terrestrial exoplanets, and discuss the interaction of their circulation with the hydrological cycle and global-scale climate feedbacks. Terrestrial exoplanets occupy a wide range of physical and dynamical conditions, only a small fraction of which have yet been explored in detail. Our approach is to lay out the fundamental dynamical principles governing the atmospheric circulation on terrestrial planets--broadly defined--and show how they can provide a foundation for understanding the atmospheric behavior of these worlds. We first survey basic atmospheric dynamics, including the role of geostrophy, baroclinic instabilities, and jets in the strongly rotating regime (the "extratropics") and the role of the Hadle...

  14. Circulating cancer stem cells: the importance to select. (United States)

    Yang, Ming-Hsin; Imrali, Ahmet; Heeschen, Christopher


    It has been demonstrated that even localized tumors without clinically apparent metastasis give rise to circulating tumor cells (CTCs). A growing number of technically diverse platforms are being developed for detecting/isolating CTCs in the circulating blood. Despite the technical challenges of isolating rare CTCs from blood, recent studies have already shown the predictive value of CTCs enumeration. Thus, it is becoming increasingly accepted that CTC numbers are linked to patients' outcome and may also be used to monitor treatment response and disease relapse, respectively. Further CTCs provide a non-invasive source for tumor material, 'liquid biopsy', which is particularly important for patients, where no biopsy material can be obtained or where serial biopsies of the tumor, e.g., following treatment, are practically impossible. On the other hand the molecular and biological characterization of CTCs has still remained at a rather experimental stage. Future studies are necessary to define CTC heterogeneity to establish the crucial role of circulating cancer stem cells for driving metastasis, which represent a distinct subpopulation of CTCs that bear metastasis-initiating capabilities based on their stemness properties and invasiveness and thus are critical for the patients' clinical outcome. As compared to non-tumorigenic/metastatic bulk CTCs, circulating cancer stem cells may not only be capable of evading from the primary tumor, but also escape from immune surveillance, survive in the circulating blood and subsequently form metastases in distant organs. Thus, circulating cancer stem cells represent a subset of exclusively tumorigenic cancer stem cells characterized by their invasive characteristics and are potential therapeutic targets for preventing disease progression. To date, only a few original reports and reviews have been published focusing on circulating cancer stem cells. This review discusses the potential importance of isolating and characterizing

  15. RPA homologs and ssDNA processing during meiotic recombination. (United States)

    Ribeiro, Jonathan; Abby, Emilie; Livera, Gabriel; Martini, Emmanuelle


    Meiotic homologous recombination is a specialized process that involves homologous chromosome pairing and strand exchange to guarantee proper chromosome segregation and genetic diversity. The formation and repair of DNA double-strand breaks (DSBs) during meiotic recombination differs from those during mitotic recombination in that the homologous chromosome rather than the sister chromatid is the preferred repair template. The processing of single-stranded DNA (ssDNA) formed on intermediate recombination structures is central to driving the specific outcomes of DSB repair during meiosis. Replication protein A (RPA) is the main ssDNA-binding protein complex involved in DNA metabolism. However, the existence of RPA orthologs in plants and the recent discovery of meiosis specific with OB domains (MEIOB), a widely conserved meiosis-specific RPA1 paralog, strongly suggest that multiple RPA complexes evolved and specialized to subdivide their roles during DNA metabolism. Here we review ssDNA formation and maturation during mitotic and meiotic recombination underlying the meiotic specific features. We describe and discuss the existence and properties of MEIOB and multiple RPA subunits in plants and highlight how they can provide meiosis-specific fates to ssDNA processing during homologous recombination. Understanding the functions of these RPA homologs and how they interact with the canonical RPA subunits is of major interest in the fields of meiosis and DNA repair. PMID:26520106

  16. Enhanced defects recombination in ion irradiated SiC

    Energy Technology Data Exchange (ETDEWEB)

    Izzo, G. [Department of Physics and Astronomy, Catania University, Via S. Sofia 64, 95123 Catania (Italy); Litrico, G., E-mail: grazia.litrico@ct.infn.i [Department of Physics and Astronomy, Catania University, Via S. Sofia 64, 95123 Catania (Italy); Grassia, F.; Calcagno, L.; Foti, G. [Department of Physics and Astronomy, Catania University, Via S. Sofia 64, 95123 Catania (Italy)


    Point defects induced in SiC by ion irradiation show a recombination at temperatures as low as 320 K and this process is enhanced after running current density ranging from 80 to 120 A/cm{sup 2}. Ion irradiation induces in SiC the formation of different defect levels and low-temperature annealing changes their concentration. Some levels (S{sub 0}, S{sub x} and S{sub 2}) show a recombination and simultaneously a new level (S{sub 1}) is formed. An enhanced recombination of defects is besides observed after running current in the diode at room temperature. The carriers introduction reduces the S{sub 2} trap concentration, while the remaining levels are not modified. The recombination is negligible up to a current density of 50 A/cm{sup 2} and increases at higher current density. The enhanced recombination of the S{sub 2} trap occurs at 300 K, which otherwise requires a 400 K annealing temperature. The process can be related to the electron-hole recombination at the associated defect.

  17. The effect of a single recombination event

    DEFF Research Database (Denmark)

    Schierup, Mikkel Heide; Jensen, Thomas Mailund; Wiuf, Carsten

    the effect of a recombination event is the genealogical type of the event and whether SNP variation is present that can reveal the genealogical consequences of the recombination event. Recombination events that only change some branch lengths in the genealogy have a very small, but detectable, effect....... The more lineages left when the recombination event occurs, the larger effect it has, implying that it is mainly young recombination events that we detect when estimating the rate. If the population is growing, though, more lineages are present back in time and relatively more ancient recombination...... shared by these two populations are expected to contribute compared to the effect of private recombination events...

  18. Induction of influenza-specific mucosal immunity by an attenuated recombinant Sendai virus.

    Directory of Open Access Journals (Sweden)

    Thuc-vy L Le

    Full Text Available BACKGROUND: Many pathogens initiate infection at the mucosal surfaces; therefore, induction of mucosal immune responses is a first level of defense against infection and is the most powerful means of protection. Although intramuscular injection is widely used for vaccination and is effective at inducing circulating antibodies, it is less effective at inducing mucosal antibodies. METHODOLOGY/PRINCIPAL FINDINGS: Here we report a novel recombinant, attenuated Sendai virus vector (GP42-H1 in which the hemagglutinin (HA gene of influenza A virus was introduced into the Sendai virus genome as an additional gene. Infection of CV-1 cells by GP42-H1 resulted in cell surface expression of the HA protein. Intranasal immunization of mice with 1,000 plaque forming units (pfu of GP42-H1 induced HA-specific IgG and IgA antibodies in the blood, bronchoalveolar lavage fluid, fecal pellet extracts and saliva. The HA-specific antibody titer induced by GP42-H1 closely resembles the titer induced by sublethal infection by live influenza virus; however, in contrast to infection by influenza virus, immunization with GP42-H1 did not result in disease symptoms or the loss of body weight. In mice that were immunized with GP42-H1 and then challenged with 5LD(50 (1250 pfu of influenza virus, no significant weight loss was observed and other visual signs of morbidity were not detected. CONCLUSIONS: These results demonstrate that the GP42-H1 Sendai virus recombinant is able to confer full protection from lethal infection by influenza virus, supporting the conclusion that it is a safe and effective mucosal vaccine vector.

  19. Unipolar outflows and global meridional circulations in rotating accretion flows

    CERN Document Server

    Igumenshchev, I V


    Using two-dimensional simulations of non-radiative viscous rotating black hole accretion flows, we show that the flows with alpha~0.1-0.3 self-organize to form stationary unipolar or bipolar outflows accompanied by global meridional circulations. The required energy comes, with efficiency implications are discussed.

  20. Functions and structures of eukaryotic recombination proteins

    International Nuclear Information System (INIS)

    We have found that Rad51 and RecA Proteins form strikingly similar structures together with dsDNA and ATP. Their right handed helical nucleoprotein filaments extend the B-form DNA double helixes to 1.5 times in length and wind the helix. The similarity and uniqueness of their structures must reflect functional homologies between these proteins. Therefore, it is highly probable that similar recombination proteins are present in various organisms of different evolutional states. We have succeeded to clone RAD51 genes from human, mouse, chicken and fission yeast genes, and found that the homologues are widely distributed in eukaryotes. The HsRad51 and MmRad51 or ChRad51 proteins consist of 339 amino acids differing only by 4 or 12 amino acids, respectively, and highly homologous to both yeast proteins, but less so to Dmcl. All of these proteins are homologous to the region from residues 33 to 240 of RecA which was named ''homologous core. The homologous core is likely to be responsible for functions common for all of them, such as the formation of helical nucleoprotein filament that is considered to be involved in homologous pairing in the recombination reaction. The mouse gene is transcribed at a high level in thymus, spleen, testis, and ovary, at lower level in brain and at a further lower level in some other tissues. It is transcribed efficiently in recombination active tissues. A clear functional difference of Rad51 homologues from RecA was suggested by the failure of heterologous genes to complement the deficiency of Scrad51 mutants. This failure seems to reflect the absence of a compatible partner, such as ScRad52 protein in the case of ScRad51 protein, between different species. Thus, these discoveries play a role of the starting point to understand the fundamental gene targeting in mammalian cells and in gene therapy. (J.P.N.)

  1. Xylose utilizing recombinant Saccharomyces cerevisiae strains

    Energy Technology Data Exchange (ETDEWEB)

    Walfridsson, M.


    Through metabolic engineering, S. cerevisiae was provided with the necessary enzymes required for xylose utilisation during ethanolic fermentation of xylose-rich lignocellulose raw materials. For xylitol production, S. cerevisiae was provided with the Pichia stipitis XYL1 gene encoding xylose reductase (XR). The in-vivo reduction and the following excretion of xylitol, requires a co-substrate for maintenance and cofactor regeneration. Xylitol yields close to 100% were obtained with the XYL1 containing S. cerevisiae. Introducing P. stipitis XYL1 and XYL2 genes, encoding XR and xylitol dehydrogenase (XDH), respectively, enabled S. cerevisiae to convert xylose to xylulose, via xylitol. During the screening work of P. stipitis XDH gene, another gene encoding a polyol dehydrogenase was isolated and cloned in S. cerevisiae. The gene was identified as a D-arabinitol dehydrogenase gene. In P. stipitis it may function as a redox sink by reducing D-ribulose to D-arabinitol. The metabolism through the pentose phosphate pathway (PPP) was enhanced by over-expressing the native genes TKL1 and TAL1 encoding transketolase and transaldolase, respectively, resulting in improved xylose utilisation. The XR and XDH activities in recombinant S. cerevisiae were produced at different levels by constructing yeast vectors in which the PGK1 and ADHI promoters controlled XYL1 and XYL2. With higher XDH than XR activities, less by-products, in the form of xylitol and glycerol, were formed by the recombinant S. cerevisiae strains. The Thermus thermophilus xylA gene encoding a thermostable xylose isomerase was cloned and expressed in S. cerevisiae. The recombinant xylose isomerase was actively produced and a new functional metabolic pathway was established in S. cerevisiae resulting in ethanol production from xylose. 150 refs, 3 figs, 4 tabs

  2. Investigations for designing catalytic recombiners

    International Nuclear Information System (INIS)

    In case of a severe accident in pressurised water reactors (PWR) a high amount of hydrogen up to about 20,000 m3 might be generated and released into the containments. The mixture consisting of hydrogen and oxygen may either burn or detonate, if ignited. In case of detonation the generated shock wave may endanger the components of the plant or the plant itself. Consequently, effective removal of hydrogen is required. The fact that hydrogen and oxygen react exo-thermally on catalytically acting surfaces already at low temperatures generating steam and heat is made use of in catalytic recombiners. They consist of substrates coated with catalyst (mainly platinum or palladium) which are arranged inside a casing. Being passively acting measures, recombiners do not need any additional energy supply. Experimental investigations on catalytic hydrogen recombination are conducted at FZJ (Forschungszentrum Juelich) using three test facilities. The results yield insight in the development potential of contemporary recombiner systems as well as of innovative systems. Detailed investigations on a recombiner section show strong temperature gradients over the surface of a catalytically coated sample. Dependent on the flow velocity, ignition temperature may be reached at the leading edge already at an inlet hydrogen concentration of about 5 vol.-%. The thermal strain of the substrate leads to considerable detachment of catalyst particles probably causing unintended ignition of the flammable mixture. Temperature peaks can be prevented effectively by leaving the first part of the plate uncoated. In order to avoid overheating of the catalyst elements of a recombiner even at high hydrogen concentrations a modular system of porous substrates is proposed. The metallic substrates are coated with platinum at low catalyst densities thus limiting the activity of the single specimen. A modular arrangement of these elements provides high recombination rates over a large hydrogen concentration

  3. Homologous Recombination in Negative Sense RNA Viruses


    Michael Worobey; Guan-Zhu Han


    Recombination is an important process that influences biological evolution at many different levels. More and more homologous recombination events have been reported among negative sense RNA viruses recently. While sporadic authentic examples indicate that homologous recombination does occur, recombination seems to be generally rare or even absent in most negative sense RNA viruses, and most of the homologous recombination events reported in the literature were likely generated artificially d...

  4. VanderLaan Circulant Type Matrices

    Directory of Open Access Journals (Sweden)

    Hongyan Pan


    Full Text Available Circulant matrices have become a satisfactory tools in control methods for modern complex systems. In the paper, VanderLaan circulant type matrices are presented, which include VanderLaan circulant, left circulant, and g-circulant matrices. The nonsingularity of these special matrices is discussed by the surprising properties of VanderLaan numbers. The exact determinants of VanderLaan circulant type matrices are given by structuring transformation matrices, determinants of well-known tridiagonal matrices, and tridiagonal-like matrices. The explicit inverse matrices of these special matrices are obtained by structuring transformation matrices, inverses of known tridiagonal matrices, and quasi-tridiagonal matrices. Three kinds of norms and lower bound for the spread of VanderLaan circulant and left circulant matrix are given separately. And we gain the spectral norm of VanderLaan g-circulant matrix.

  5. Conservation of Circulation in Magnetohydrodynamics

    CERN Document Server

    Bekenstein, J D; Bekenstein, Jacob D.; Oron, Asaf


    We demonstrate, both at the Newtonian and (general) relativistic levels, theexistence of a generalization of Kelvin's circulation theorem (for pure fluids)which is applicable to perfect magnetohydrodynamics. The argument is based onthe least action principle for magnetohydrodynamic flow. Examples of the newconservation law are furnished. The new theorem should be helpful inidentifying new kinds of vortex phenomena distinct from magnetic ropes or fluidvortices.

  6. Neural Control of the Circulation (United States)

    Thomas, Gail D.


    The purpose of this brief review is to highlight key concepts about the neural control of the circulation that graduate and medical students should be expected to incorporate into their general knowledge of human physiology. The focus is largely on the sympathetic nerves, which have a dominant role in cardiovascular control due to their effects to…

  7. Recombining WMAP: Constraints on ionizing and resonance radiation at recombination

    International Nuclear Information System (INIS)

    We place new constraints on sources of ionizing and resonance radiation at the epoch of the recombination process using the recent cosmic microwave background temperature and polarization spectra coming from the Wilkinson Microwave Anisotropy Probe (WMAP). We find that non-standard recombination scenarios are still consistent with the current data. In light of this we study the impact that such models can have on the determination of several cosmological parameters. In particular, the constraints on curvature and baryon density appear to be weakly affected by a modified recombination scheme. However, it may affect the current WMAP constraints on inflationary parameters such as the spectral index ns and its running. Physically motivated models, such as those based on primordial black holes or super heavy dark matter decay, are able to provide a good fit to the current data. Future observations in both temperature and polarization will be needed to more stringently test these models

  8. Recombination between Poliovirus and Coxsackie A Viruses of Species C: A Model of Viral Genetic Plasticity and Emergence

    Directory of Open Access Journals (Sweden)

    Francis Delpeyroux


    Full Text Available Genetic recombination in RNA viruses was discovered many years ago for poliovirus (PV, an enterovirus of the Picornaviridae family, and studied using PV or other picornaviruses as models. Recently, recombination was shown to be a general phenomenon between different types of enteroviruses of the same species. In particular, the interest for this mechanism of genetic plasticity was renewed with the emergence of pathogenic recombinant circulating vaccine-derived polioviruses (cVDPVs, which were implicated in poliomyelitis outbreaks in several regions of the world with insufficient vaccination coverage. Most of these cVDPVs had mosaic genomes constituted of mutated poliovaccine capsid sequences and part or all of the non-structural sequences from other human enteroviruses of species C (HEV-C, in particular coxsackie A viruses. A study in Madagascar showed that recombinant cVDPVs had been co-circulating in a small population of children with many different HEV-C types. This viral ecosystem showed a surprising and extensive biodiversity associated to several types and recombinant genotypes, indicating that intertypic genetic recombination was not only a mechanism of evolution for HEV-C, but an usual mode of genetic plasticity shaping viral diversity. Results suggested that recombination may be, in conjunction with mutations, implicated in the phenotypic diversity of enterovirus strains and in the emergence of new pathogenic strains. Nevertheless, little is known about the rules and mechanisms which govern genetic exchanges between HEV-C types, as well as about the importance of intertypic recombination in generating phenotypic variation. This review summarizes our current knowledge of the mechanisms of evolution of PV, in particular recombination events leading to the emergence of recombinant cVDPVs.

  9. Serendipitous identification of natural intergenotypic recombinants of hepatitis C in Ireland.

    LENUS (Irish Health Repository)

    Moreau, Isabelle


    BACKGROUND: Recombination between hepatitis C single stranded RNA viruses is a rare event. Natural viable intragenotypic and intergenotypic recombinants between 1b-1a, 1a-1c and 2k-1b, 2i-6p, respectively, have been reported. Diagnostically recombinants represent an intriguing challenge. Hepatitis C genotype is defined by interrogation of the sequence composition of the 5\\' untranslated region [5\\'UTR]. Occasionally, ambiguous specimens require further investigation of the genome, usually by interrogation of the NS5B region. The original purpose of this study was to confirm the existence of a suspected mixed genotype infection of genotypes 2 and 4 by clonal analysis at the NS5B region of the genome in two specimens from two separate individuals. This initial identification of genotype was based on analysis of the 5\\'UTR of the genome by reverse line probe hybridisation [RLPH]. RESULTS: The original diagnosis of a mixed genotype infection was not confirmed by clonal analysis of the NS5B region of the genome. The phylogenetic analysis indicated that both specimens were natural intergenotypic recombinant forms of HCV. The recombination was between genotypes 2k and 1b for both specimens. The recombination break point was identified as occurring within the NS2 region of the genome. CONCLUSION: The viral recombinants identified here resemble the recombinant form originally identified in Russia. The RLPH pattern observed in this study may be a signature indicative of this particular type of intergenotype recombinant of hepatitis C meriting clonal analysis of NS2.

  10. Modeling of Sulfur Retention in Circulating Fluidized Bed Coal Combustors

    Institute of Scientific and Technical Information of China (English)

    乔锐; 吕俊复; 刘青; 吴学安; 岳光溪


    A comprehensive model for predicting the sulfur retention performance in circulating fluidized bedcombustors was developed which involves the different residence times, the wide particle size distribution andthe different forms of sulfur in the coal. In addition, the reductive decomposition of CaSO4 is highlighted. Thesimulation results from the model show that the sulfur contents, the bed temperature, the sorbent particle sizedistribution and the sorbent activity or the maximum conversion rate can significantly influence the sulfuretention performance in circulating fluidized bed (CFB) combustors.``

  11. Co-circulation and evolution of polioviruses and species C enteroviruses in a district of Madagascar.

    Directory of Open Access Journals (Sweden)

    Mala Rakoto-Andrianarivelo


    Full Text Available Between October 2001 and April 2002, five cases of acute flaccid paralysis (AFP associated with type 2 vaccine-derived polioviruses (VDPVs were reported in the southern province of the Republic of Madagascar. To determine viral factors that favor the emergence of these pathogenic VDPVs, we analyzed in detail their genomic and phenotypic characteristics and compared them with co-circulating enteroviruses. These VDPVs appeared to belong to two independent recombinant lineages with sequences from the type 2 strain of the oral poliovaccine (OPV in the 5'-half of the genome and sequences derived from unidentified species C enteroviruses (HEV-C in the 3'-half. VDPV strains showed characteristics similar to those of wild neurovirulent viruses including neurovirulence in poliovirus-receptor transgenic mice. We looked for other VDPVs and for circulating enteroviruses in 316 stools collected from healthy children living in the small area where most of the AFP cases occurred. We found vaccine PVs, two VDPVs similar to those found in AFP cases, some echoviruses, and above all, many serotypes of coxsackie A viruses belonging to HEV-C, with substantial genetic diversity. Several coxsackie viruses A17 and A13 carried nucleotide sequences closely related to the 2C and the 3D(pol coding regions of the VDPVs, respectively. There was also evidence of multiple genetic recombination events among the HEV-C resulting in numerous recombinant genotypes. This indicates that co-circulation of HEV-C and OPV strains is associated with evolution by recombination, resulting in unexpectedly extensive viral diversity in small human populations in some tropical regions. This probably contributed to the emergence of recombinant VDPVs. These findings give further insight into viral ecosystems and the evolutionary processes that shape viral biodiversity.

  12. Inhomogeneous recombinations during cosmic reionization

    CERN Document Server

    Sobacchi, Emanuele


    By depleting the ionizing photon budget available to expand cosmic HII regions, recombining systems (or Lyman limit systems) can have a large impact during (and following) cosmic reionization. Unfortunately, directly resolving such structures in large-scale reionization simulations is computationally impractical. Instead, here we implement a sub-grid prescription for tracking inhomogeneous recombinations in the intergalactic medium. Building on previous work parameterizing photo-heating feedback on star-formation, we present large-scale, semi-numeric reionization simulations which self-consistently track the local (sub-grid) evolution of both sources and sinks of ionizing photons. Our simple, single-parameter model naturally results in both an extended reionization and a modest, slowly-evolving emissivity, consistent with observations. Recombinations are instrumental in slowing the growth of large HII regions, and damping the rapid rise of the ionizing background in the late stages of (and following) reioniza...

  13. Recombinant snake venom prothrombin activators. (United States)

    Lövgren, Ann


    Three prothrombin activators; ecarin, which was originally isolated from the venom of the saw-scaled viper Echis carinatus, trocarin from the rough-scaled snake Tropidechis carinatus, and oscutarin from the Taipan snake Oxyuranus scutellatus, were expressed in mammalian cells with the purpose to obtain recombinant prothrombin activators that could be used to convert prothrombin to thrombin. We have previously reported that recombinant ecarin can efficiently generate thrombin without the need for additional cofactors, but does not discriminate non-carboxylated prothrombin from biologically active γ-carboxylated prothrombin. Here we report that recombinant trocarin and oscutarin could not efficiently generate thrombin without additional protein co-factors. We confirm that both trocarin and oscutarin are similar to human coagulation Factor X (FX), explaining the need for additional cofactors. Sequencing of a genomic fragment containing 7 out of the 8 exons coding for oscutarin further confirmed the similarity to human FX. PMID:23111318

  14. Preparation and preliminary characterization of recombinant neurolysin for in vivo studies. (United States)

    Wangler, Naomi J; Jayaraman, Srinidhi; Zhu, Rui; Mechref, Yehia; Abbruscato, Thomas J; Bickel, Ulrich; Karamyan, Vardan T


    The goal of this study was to produce milligram quantities of pure, catalytically active, endotoxin-free recombinant neurolysin (rNln) in standard laboratory conditions for use as a research tool. To this end, we transformed E. coli cells with a plasmid construct for polyhistidine-tagged rNln, selected a high-expressing clone and determined the optimal time-point for translation of rNln. rNln was purified to homogeneity from the soluble pool of the cell lysate using Ni-NTA affinity and size-exclusion chromatography, followed by removal of endotoxins. Using this protocol ∼3mg pure, catalytically active and nearly endotoxin-free (≈0.003EU/μg protein) rNln was reproducibly obtained from 1l of culture. Lack of cytotoxicity of rNln preparation was documented in cultured mouse cells, whereas stability in whole mouse blood. Intraperitonealy administered rNln in mice reached the systemic circulation in intact and enzymatically active form with Tmax of 1h and T1/2 of ∼30min. Administration of rNln (2 and 10mg/kg) did not alter arterial blood pressure, heart rate, body temperature and blood glucose levels in mice. These studies demonstrate that the rNln preparation is suitable for cell culture and in vivo studies and can serve as a research tool to investigate the (patho)physiological function of this peptidase. PMID:27496565

  15. FORM development


    Vermaseren, J. A. M.


    I give an overview of FORM development based on a few pilot projects, explaining how they have influenced the FORM capabilities. Next I explain what is happnening right now in the field of Open Sourcing and the FORM Forum.

  16. The Congo Basin Walker circulation: dynamics and connections to precipitation (United States)

    Cook, Kerry H.; Vizy, Edward K.


    The existence, seasonality, and variability of a Congo Basin Walker circulation are investigated in reanalyses, and connections with rainfall are explored. A zonal overturning circulation along the equator connects rising motion in the Congo Basin and sinking in the eastern Atlantic during June through October. This timing is out of phase with precipitation over equatorial Africa, which greatest during spring and fall, and does not correlate with the seasonality of land temperatures. Rather, the zonally-overturning circulation only occurs when the Atlantic cold tongue has formed. Although the cold tongue formation is essential for setting up the Congo Basin Walker circulation, variations in equatorial eastern Atlantic sea surface temperatures are not associated with interannual variability in the strength of the circulation. When cold tongue SSTs are anomalously cool (warm), evaporation from the ocean surface is reduced (enhanced) and the westerly flow advects less (more) moisture into the base of the Congo Basin Walker circulation. This reduces (increases) the release of latent heat in the upbranch and weakens (strengthens) the Walker circulation. This process dominates the pure dry dynamical response to enhanced land/sea temperature differences, which has an opposite sign. A positive correlation connects low-level vertical velocity in the Congo basin with low-level vertical velocity and precipitation over West Africa. A wave response to anomalous vertical velocity in the Congo Basin in several reanalyses suggests a teleconnection into West Africa such that an anomalously strong (weak) upbranch is associated with anomalously strong (weak) rainfall over the Guinean coast and southern Sahel.

  17. Proper Sizing of Circulation Pumps

    DEFF Research Database (Denmark)

    Tommerup, Henrik M.; Nørgaard, Jørgen


    The paper describes the preliminary results from field tests of replacing various types of old pumps used for circulating water in heating systems in single- and double-family houses with new types of pumps. The tests were carried out in Denmark for the Danish Electricity Savings Trust, but the...... results can be applied to Europe in general. Despite the small sample of houses involved in the test, 15 houses, some rather safe conclusions can be drawn from the results, which showed that newly developed pumps with power consumption around 5-8 W, can perform the task of circulating the water...... sufficiently to keep the houses satisfactorily warm during the heating season of the test. The old replaced pumps used 5-10 times more power. In Europe alone, a gradual replacement of the present vastly oversized pumps with such small but sufficient pumps can save the construction of 17 large power plants as...

  18. Radioisotopic evaluation of portal circulation

    International Nuclear Information System (INIS)

    The use of a radio-tracer of portal circulation through the intestine, should prevent cruel punctures in the portal-vein or spleen as it is usually the case with traditional methods in the study of portal-system. The absorption of I-131 and Tc-99m, previously cheked in rabbits presented similar results in dogs. The time of circulation between terminal large-intestine and the liver (t-RF) was determined by external counting at hepatic level by recording radioactivity variation-time. In healthy animals the t-RF was from 20to 60 seconds, with average time of 42 seconds. In 2 animals with partial binding of portal-vein the t-RF went up to 110 and 120 seconds. (Author)

  19. Ocean circulation generated magnetic signals

    DEFF Research Database (Denmark)

    Manoj, C.; Kuvshinov, A.; Maus, S.;


    Conducting ocean water, as it flows through the Earth's magnetic field, generates secondary electric and magnetic fields. An assessment of the ocean-generated magnetic fields and their detectability may be of importance for geomagnetism and oceanography. Motivated by the clear identification of...... ocean tidal signatures in the CHAMP magnetic field data we estimate the ocean magnetic signals of steady flow using a global 3-D EM numerical solution. The required velocity data are from the ECCO ocean circulation experiment and alternatively from the OCCAM model for higher resolution. We assume an...... magnetic field, as compared to the ECCO simulation. Besides the expected signatures of the global circulation patterns, we find significant seasonal variability of ocean magnetic signals in the Indian and Western Pacific Oceans. Compared to seasonal variation, interannual variations produce weaker signals....

  20. The Sun's Shallow Meridional Circulation

    CERN Document Server

    Hathaway, David H


    The Sun's global meridional circulation is evident as a slow poleward flow at its surface. This flow is observed to carry magnetic elements poleward - producing the Sun's polar magnetic fields as a key part of the 11-year sunspot cycle. Current theories for the sunspot cycle assume that this surface flow is part of a circulation which sinks inward at the poles and turns equatorward at depths below 100 Mm. Here we use the advection of the Sun's convection cells by the meridional flow to map the flow velocity in latitude and depth. Our measurements show the largest cells clearly moving equatorward at depths below 35 Mm - the base of the Sun's surface shear layer. This surprisingly shallow return flow indicates the need for substantial revisions to solar/stellar dynamo theory.

  1. Experimental studies on catalytic hydrogen recombiners for light water reactors

    International Nuclear Information System (INIS)

    In the course of core melt accidents in nuclear power plants a large amount of hydrogen can be produced and form an explosive or even detonative gas mixture with aerial oxygen in the reactor building. In the containment atmosphere of pressurized water reactors hydrogen combines a phlogistically with the oxygen present to form water vapor even at room temperature. In the past, experimental work conducted at various facilities has contributed little or nothing to an understanding of the operating principles of catalytic recombiners. Hence, the purpose of the present study was to conduct detailed investigations on a section of a recombiner essentially in order to deepen the understanding of reaction kinetics and heat transport processes. The results of the experiments presented in this dissertation form a large data base of measurements which provides an insight into the processes taking place in recombiners. The reaction-kinetic interpretation of the measured data confirms and deepens the diffusion theory - proposed in an earlier study. Thus it is now possible to validate detailed numeric models representing the processes in recombiners. Consequently the present study serves to broaden and corroborate competence in this significant area of reactor technology. In addition, the empirical knowledge thus gained may be used for a critical reassessment of previous numeric model calculations. (orig.)

  2. Stability of Thermohaline circulation with respect to fresh water release

    CERN Document Server

    Patwardhan, Ajay


    The relatively warm climate found in the North- Western Europe is due to the gulf stream that circulates warm saline water from southern latitudes to Europe. In North Atlantic ocean the stream gives out a large amount of heat, cools down and sinks to the bottom to complete the Thermohaline circulation. There is considerable debate on the stability of the stream to inputs of fresh water from the melting ice in Greenland and Arctic. The circulation, being switched off, will have massive impact on the climate of Europe. Intergovernmental panel on climate change (IPCC) has warned of this danger in its recent report. Our aim is to model the Thermohaline circulation at the point where it sinks in the North-Atlantic. We create a two dimensional discrete map modeling the salinity gradient and vertical velocity of the stream. We look for how a perturbation in the form of fresh water release can destabilise the circulation by pushing the velocity below a certain threshold.

  3. Natural circulation systems: advantages and challenges

    International Nuclear Information System (INIS)

    This lecture briefly explains the principle of working of a natural circulation system, its various advantages and applications in nuclear and other industries. The major challenges to be overcome before the wide acceptance of natural circulation as the normal mode of coolant circulation in nuclear power reactors are briefly described. Classification of NCSs and the terminologies commonly encountered in natural circulation literature are also briefly explained. (author)

  4. The general circulation of the atmosphere


    Schneider, Tapio


    Theories of how Earth's surface climate may change in the future, of how it may have been in the past, and of how it is related to climates of other planets must build upon a theory of the general circulation of the atmosphere. The view of the atmospheric general circulation presented here focuses not on Earth's general circulation as such but on a continuum of idealized circulations with axisymmetric flow statistics. Analyses of observational data for Earth's atmosphere, simulations with ide...

  5. Conservation of circulation in magnetohydrodynamics (United States)

    Bekenstein; Oron


    We demonstrate at both the Newtonian and (general) relativistic levels the existence of a generalization of Kelvin's circulation theorem (for pure fluids) that is applicable to perfect magnetohydrodynamics. The argument is based on the least action principle for magnetohydrodynamic flow. Examples of the new conservation law are furnished. The new theorem should be helpful in identifying new kinds of vortex phenomena distinct from magnetic ropes or fluid vortices. PMID:11089118

  6. Electronic circulation of accounting documents


    Kremláčková, Kateřina


    This thesis describes a circulation of accounting documents in an accounting entity, deals with legal requirements of the entire process and discusses it as a part of an internal control system of the entity. In connection with the theme of the work there are also defined legislative conditions for using information and communication technologies and introduced possibilities of involving these technologies in the process of processing of the accounting documents. Above all the electronic data...

  7. An Overview of the Molecular Mechanisms of Recombinational DNA Repair. (United States)

    Kowalczykowski, Stephen C


    Recombinational DNA repair is a universal aspect of DNA metabolism and is essential for genomic integrity. It is a template-directed process that uses a second chromosomal copy (sister, daughter, or homolog) to ensure proper repair of broken chromosomes. The key steps of recombination are conserved from phage through human, and an overview of those steps is provided in this review. The first step is resection by helicases and nucleases to produce single-stranded DNA (ssDNA) that defines the homologous locus. The ssDNA is a scaffold for assembly of the RecA/RAD51 filament, which promotes the homology search. On finding homology, the nucleoprotein filament catalyzes exchange of DNA strands to form a joint molecule. Recombination is controlled by regulating the fate of both RecA/RAD51 filaments and DNA pairing intermediates. Finally, intermediates that mature into Holliday structures are disjoined by either nucleolytic resolution or topological dissolution. PMID:26525148

  8. Examples of natural circulation in PHWR

    International Nuclear Information System (INIS)

    The main objective of this lecture is to provide deep insight into the complex natural circulation phenomena in the core of a Pressurised Heavy Water Reactor. A detailed account of natural circulation tests conducted in an Indian PHWR is given in this lecture. This will enable the participants to appreciate the importance of natural circulation in a nuclear reactor to a greater extent. (author)

  9. Particle pollution changes the atmospheric circulation

    International Nuclear Information System (INIS)

    Industrial emissions and combustion of fossil fuels create large amounts of sulfate- and carbon containing soot particles. These mix with natural particles to change the natural aerosols. Such anthropogenic changes in the aerosols may have a great impact on the climate of the earth. Altered properties of the aerosols may change the atmosphere's absorption and reflection of solar radiation and contribute to heating or cooling. This is the direct effect. Changes in the properties of aerosols may also affect the number and size of recently formed cloud droplets. This may change the ability of the clouds to reflect solar radiation and to produce precipitation. This is the indirect effect. Recent research at the University of Oslo shows that anthropogenic particles significantly change the atmospheric circulation, in particular in the tropics, but also at European latitudes

  10. The use of recombinant activated coagulation factor VII for spine surgery


    Weiskopf, Richard B.


    This article focuses on our current understanding of the role of activated coagulation factor VII (FVIIa) in coagulation, the current evidence regarding the efficacy and safety of recombinant FVIIa (rFVIIa), and thoughts regarding the use of rFVIIa in spine surgery. rFVIIa is approved in many countries (including the European Union and the USA) for patients with hemophilia and inhibitors (antibodies) to coagulation factors VIII or IX. High circulating concentrations of FVIIa, achieved by exog...

  11. Molecular and population analyses of a recombination event in the catabolic plasmid pJP4. (United States)

    Larraín-Linton, Juanita; De la Iglesia, Rodrigo; Melo, Francisco; González, Bernardo


    Cupriavidus necator JMP134(pJP4) harbors a catabolic plasmid, pJP4, which confers the ability to grow on chloroaromatic compounds. Repeated growth on 3-chlorobenzoate (3-CB) results in selection of a recombinant strain, which degrades 3-CB better but no longer grows on 2,4-dichlorophenoxyacetate (2,4-D). We have previously proposed that this phenotype is due to a double homologous recombination event between inverted repeats of the multicopies of this plasmid within the cell. One recombinant form of this plasmid (pJP4-F3) explains this phenotype, since it harbors two copies of the chlorocatechol degradation tfd gene clusters, which are essential to grow on 3-CB, but has lost the tfdA gene, encoding the first step in degradation of 2,4-D. The other recombinant plasmid (pJP4-FM) should harbor two copies of the tfdA gene but no copies of the tfd gene clusters. A molecular analysis using a multiplex PCR approach to distinguish the wild-type plasmid pJP4 from its two recombinant forms, was carried out. Expected PCR products confirming this recombination model were found and sequenced. Few recombinant plasmid forms in cultures grown in several carbon sources were detected. Kinetic studies indicated that cells containing the recombinant plasmid pJP4-FM were not selectable by sole carbon source growth pressure, whereas those cells harboring recombinant plasmid pJP4-F3 were selected upon growth on 3-CB. After 12 days of repeated growth on 3-CB, the complete plasmid population in C. necator JMP134 apparently corresponds to this form. However, wild-type plasmid forms could be recovered after growing this culture on 2,4-D, indicating that different plasmid forms can be found in C. necator JMP134 at the population level. PMID:16980481

  12. CRMAGE: CRISPR Optimized MAGE Recombineering (United States)

    Ronda, Carlotta; Pedersen, Lasse Ebdrup; Sommer, Morten O. A.; Nielsen, Alex Toftgaard


    A bottleneck in metabolic engineering and systems biology approaches is the lack of efficient genome engineering technologies. Here, we combine CRISPR/Cas9 and λ Red recombineering based MAGE technology (CRMAGE) to create a highly efficient and fast method for genome engineering of Escherichia coli. Using CRMAGE, the recombineering efficiency was between 96.5% and 99.7% for gene recoding of three genomic targets, compared to between 0.68% and 5.4% using traditional recombineering. For modulation of protein synthesis (small insertion/RBS substitution) the efficiency was increased from 6% to 70%. CRMAGE can be multiplexed and enables introduction of at least two mutations in a single round of recombineering with similar efficiencies. PAM-independent loci were targeted using degenerate codons, thereby making it possible to modify any site in the genome. CRMAGE is based on two plasmids that are assembled by a USER-cloning approach enabling quick and cost efficient gRNA replacement. CRMAGE furthermore utilizes CRISPR/Cas9 for efficient plasmid curing, thereby enabling multiple engineering rounds per day. To facilitate the design process, a web-based tool was developed to predict both the λ Red oligos and the gRNAs. The CRMAGE platform enables highly efficient and fast genome editing and may open up promising prospective for automation of genome-scale engineering. PMID:26797514

  13. Controlled Release from Recombinant Polymers


    Price, Robert; Poursaid, Azadeh; Ghandehari, Hamidreza


    Recombinant polymers provide a high degree of molecular definition for correlating structure with function in controlled release. The wide array of amino acids available as building blocks for these materials lend many advantages including biorecognition, biodegradability, potential biocompatibility, and control over mechanical properties among other attributes. Genetic engineering and DNA manipulation techniques enable the optimization of structure for precise control over spatial and tempor...

  14. Preparing Recombinant Gonad Organ Cultures




    Authors: Blanche Capel and Jordan Batchvarov Corresponding author ([]()) ### INTRODUCTION It can be useful to assay migration between any two adjacent tissues during development. This protocol assays cell migration between the gonad and mesonephros using tissue recombination between genetically marked and unmarked tissue, combined with an organ culture technique. First, agar blocks are prepared in a custom-built mold. The size and sh...

  15. Evidence of recombination in Hepatitis C Virus populations infecting a hemophiliac patient

    Directory of Open Access Journals (Sweden)

    Cristina Juan


    Full Text Available Abstract Background/Aim Hepatitis C virus (HCV infection is an important cause of morbidity and mortality in patients affected by hereditary bleeding disorders. HCV, as others RNA virus, exploit all possible mechanisms of genetic variation to ensure their survival, such as recombination and mutation. In order to gain insight into the genetic variability of HCV virus strains circulating in hemophiliac patients, we have performed a phylogenetic analysis of HCV strains isolated from 10 patients with this kind of pathology. Methods Putative recombinant sequence was identified with the use of GARD program. Statistical support for the presence of a recombination event was done by the use of LARD program. Results A new intragenotypic recombinant strain (1b/1a was detected in 1 out of the 10 hemophiliac patient studied. The recombination event was located at position 387 of the HCV genome (relative to strain AF009606, sub-type 1a corresponding to the core gene region. Conclusion Although recombination may not appear to be common among natural populations of HCV it should be considered as a possible mechanism for generating genetic diversity in hemophiliacs patients.

  16. H2 recombination on interstellar grains

    International Nuclear Information System (INIS)

    From a consideration of relevant theoretical and experimental data it is concluded that H atoms (but not H2 molecules) will be chemisorbed on interstellar graphite grains, with H2 formation proceeding efficiently for graphite grain temperatures less than 70 K. It is argued that graphite grains will act as the principle sites for H2 formation, with a formation rate of Rapprox. =4 x 10/sup -17/ cm3 s/sup -1/. Heating by H2 molecules formed by surface recombination is analyzed in the context of the available experimental data, and a heating rate is derived and compared with other suggested cloud heating mechanisms. We conclude that H2 recombination will provide the largest heat source in diffuse clouds if the albedo of interstellar dust in the 912--1200 A region is high (approx.0.9), whereas if the albedo in this wavelength region is lower (approx.0.5), photoelectron ejection from grains will tend to predominate, and can explain observed cloud temperatures with a carbon depletion factor of approximately 2, a factor attributable to a normal interstellar abundance of graphite grains

  17. Spatially-Directed Assembly of a Heterotetrameric Cre-Lox Synapse Restricts Recombination Specificity


    Gelato, Kathy A.; Martin, Shelly S.; Liu, Patty H.; Saunders, April A.; Baldwin, Enoch P.


    The pseudo-fourfold homo-tetrameric synapse formed by Cre protein and target DNA restricts site-specific recombination to sequences containing dyad-symmetric Cre-binding repeats. Mixtures of engineered altered-specificity Cre monomers can form heterotetramers that recombine non-identical asymmetric sequences, allowing greater flexibility for target site selection in the genome of interest. However, the variety of tetramers allowed by random subunit association increases the chances of uninten...

  18. Recombinant DNA: History of the Controversy. (United States)

    Vigue, Charles L.; Stanziale, William G.


    The hazards associated with recombinant DNA research are presented along with some social implications and the development of recombinant DNA research guidelines by the National Institutes of Health. (SA)

  19. Recombinant innovation and endogenous technological transitions

    NARCIS (Netherlands)

    K. Frenken; L.R. Izquierdo; P. Zeppini


    We propose a model of technological transitions based on two different types of innovations. Branching innovations refer to technological improvements along a particular path, while recombinant innovations represent fusions of multiple paths. Recombinant innovations create "short-cuts" which reduce

  20. Live recombinant BHV/BRSV vaccine

    NARCIS (Netherlands)

    Keil, G.M.; Rijsewijk, F.A.M.


    The present invention refers to synthetic Bovine Respiratory Syncytium virus genes. Also the invention relates to live attenuated Bovine Herpesvirus recombinants carrying such synthetic genes. Furthermore, the invention relates to vaccines based on these live attenuated recombinants, for the protect

  1. Non-Radiative Carrier Recombination Enhanced by Two-Level Process: A First-Principles Study (United States)

    Yang, Ji-Hui; Shi, Lin; Wang, Lin-Wang; Wei, Su-Huai


    Non-radiative recombination plays an important role in the performance of optoelectronic semiconductor devices such as solar cells and light-emitting diodes. Most textbook examples assume that the recombination process occurs through a single defect level, where one electron and one hole are captured and recombined. Based on this simple picture, conventional wisdom is that only defect levels near the center of the bandgap can be effective recombination centers. Here, we present a new two-level recombination mechanism: first, one type of carrier is captured through a defect level forming a metastable state; then the local defect configuration rapidly changes to a stable state, where the other type of carrier is captured and recombined through another defect level. This novel mechanism is applied to the recombination center in CdTe. We show that this two-level process can significantly increase the recombination rate (by three orders of magnitude) in agreement with experiments. We expect that this two-level recombination process can exist in a wide range of semiconductors, so its effect should be carefully examined in characterizing optoelectronic materials.

  2. Expression and purification of recombinant polyomavirus VP2 protein and its interactions with polyomavirus proteins (United States)

    Cai, X.; Chang, D.; Rottinghaus, S.; Consigli, R. A.; Spooner, B. S. (Principal Investigator)


    Recombinant polyomavirus VP2 protein was expressed in Escherichia coli (RK1448), using the recombinant expression system pFPYV2. Recombinant VP2 was purified to near homogeneity by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, electroelution, and Extracti-Gel chromatography. Polyclonal serum to this protein which reacted specifically with recombinant VP2 as well as polyomavirus virion VP2 and VP3 on Western blots (immunoblots) was produced. Purified VP2 was used to establish an in vitro protein-protein interaction assay with polyomavirus structural proteins and purified recombinant VP1. Recombinant VP2 interacted with recombinant VP1, virion VP1, and the four virion histones. Recombinant VP1 coimmunoprecipitated with recombinant VP2 or truncated VP2 (delta C12VP2), which lacked the carboxy-terminal 12 amino acids. These experiments confirmed the interaction between VP1 and VP2 and revealed that the carboxyterminal 12 amino acids of VP2 and VP3 were not necessary for formation of this interaction. In vivo VP1-VP2 interaction study accomplished by cotransfection of COS-7 cells with VP2 and truncated VP1 (delta N11VP1) lacking the nuclear localization signal demonstrated that VP2 was capable of translocating delta N11VP1 into the nucleus. These studies suggest that complexes of VP1 and VP2 may be formed in the cytoplasm and cotransported to the nucleus for virion assembly to occur.

  3. Effect of gamma radiation on retroviral recombination.


    Hu, W S; Temin, H M


    To elucidate the mechanism(s) of retroviral recombination, we exposed virions to gamma radiation prior to infecting target cells. By using previously described spleen necrosis virus-based vectors containing multiple markers, recombinant proviruses were studied after a single round of retrovirus replication. The current models of retroviral recombination predict that breaking virion RNA should promote minus-strand recombination (forced copy-choice model), decrease or not affect plus-strand rec...

  4. Investigation on the influence of pressure and temperature on the ignition limits of hydrogen inside recombiners

    International Nuclear Information System (INIS)

    Passive Auto-catalytic Recombiners (PARs) are used to avoid excessive hydrogen accumulation inside the reactor containment in case of severe accident. Their behavior is based on the exothermic recombination of hydrogen into steam in presence of oxygen. This surface mechanism leads to an overheating of the catalytic plates and activates natural convection-driven circulation of gases in contact with the catalyst. The heat source induced by the PAR activity can then create local conditions for hydrogen gaseous combustion, as igniters do. This paper deals with the numerical simulation of the impact of thermal-hydraulic conditions on PAR hydrogen ignition limits. The separated effects of three main parameters (steam, pressure and temperature) are analyzed. Calculations using an IRSN dedicated CFD code, reveal that hydrogen ignition inside recombiners can be significantly accelerated or delayed according to the reactor containment atmosphere. (author)

  5. Circulating follistatin in relation to energy metabolism. (United States)

    Hansen, Jakob Schiøler; Plomgaard, Peter


    Recently, substantial evidence has emerged that the liver contributes significantly to the circulating levels of follistatin and that circulating follistatin is tightly regulated by the glucagon-to-insulin ratio. Both observations are based on investigations of healthy subjects. These novel findings challenge the present view of circulating follistatin in human physiology, being that circulating follistatin is a result of spill-over from para/autocrine actions in various tissues and cells. Follistatin as a liver-derived protein under the regulation of glucagon-to-insulin ratio suggests a relation to energy metabolism. In this narrative review, we attempt to reconcile the existing findings on circulating follistatin with the novel concept that circulating follistatin is a liver-derived molecule regulated by the glucagon-to-insulin ratio. The picture emerging is that conditions associated with elevated levels of circulating follistatin have a metabolic denominator with decreased insulin sensitivity and/or hyperglucagoneimia. PMID:27264073

  6. Intercompartmental Recombination of HIV-1 Contributes to env Intrahost Diversity and Modulates Viral Tropism and Sensitivity to Entry Inhibitors▿†‡


    Brown, Richard J. P.; Peters, Paul J; Caron, Catherine; Gonzalez-Perez, Maria Paz; Stones, Leanne; Ankghuambom, Chiambah; Pondei, Kemebradikumo; McClure, C. Patrick; Alemnji, George; Taylor, Stephen; Sharp, Paul M.; Clapham, Paul R.; Ball, Jonathan K.


    HIV-1 circulates within an infected host as a genetically heterogeneous viral population. Viral intrahost diversity is shaped by substitutional evolution and recombination. Although many studies have speculated that recombination could have a significant impact on viral phenotype, this has never been definitively demonstrated. We report here phylogenetic and subsequent phenotypic analyses of envelope genes obtained from HIV-1 populations present in different anatomical compartments. Assessmen...

  7. Expression in yeast (Pichia pastoris) of recombinant Cb-peritrophin-42 and Cbperitrophin- 48 isolated from Chrysomya bezziana (the Old World Screwworm fly)



    Pichia pastoris has been investigated as a means to express recombinant forms of two putative peritrophic membrane antigens from Chrysomya bezziana, Cb-peritrophin-42 (Cb42) and Cb-peritrophin-48 (Cb48). Recombinant Cb48 was expressed as a secreted and glycosylated protein. The yield of recombinant protein was 8 mg per litre of culture. In contrast, recombinant Cb42 was not expressed at detectable levels in Pichia pastoris, probably due to A + T rich sequence which may cause premature transcr...

  8. [Recombination in Drosophila in space flight]. (United States)

    Filatova, L P; Vaulina, E N; Lapteva, N Sh; Grozdova, T Ia


    An experiment with Drosophila melanogaster males was performed aboard the Artificial Satellite "Kosmos-1667". Mutagenic effects of a 7-day space flight on intergene recombination in chromosome 2 were studied. The space flight factors decreased the frequency of recombination. A model experiment on a laboratory centrifuge demonstrated insignificant increase in recombination frequency caused by acceleration. PMID:3135244

  9. High frequency of microsatellites in S. cerevisiae meiotic recombination hotspots

    Directory of Open Access Journals (Sweden)

    Pitt Joel PW


    recombination and microsatellites, including transcription, GC-content and transposable elements. Conclusion Our findings suggest that a mutation bias relating to recombination hotspots causing repeats to form and grow, and/or regulation of a subset of hotspots by simple sequences, may be significant processes in yeast. Some previous evidence has cast doubt on both of these possibilities, and as a result they have not been explored on a large scale, but the strength of the association we report suggests that they deserve further experimental testing.

  10. Selection of Recombinant Human Antibodies. (United States)

    Tomszak, Florian; Weber, Susanne; Zantow, Jonas; Schirrmann, Thomas; Hust, Michael; Frenzel, André


    Since the development of therapeutic antibodies the demand of recombinant human antibodies is steadily increasing. Traditionally, therapeutic antibodies were generated by immunization of rat or mice, the generation of hybridoma clones, cloning of the antibody genes and subsequent humanization and engineering of the lead candidates. In the last few years, techniques were developed that use transgenic animals with a human antibody gene repertoire. Here, modern recombinant DNA technologies can be combined with well established immunization and hybridoma technologies to generate already affinity maturated human antibodies. An alternative are in vitro technologies which enabled the generation of fully human antibodies from antibody gene libraries that even exceed the human antibody repertoire. Specific antibodies can be isolated from these libraries in a very short time and therefore reduce the development time of an antibody drug at a very early stage.In this review, we describe different technologies that are currently used for the in vitro and in vivo generation of human antibodies. PMID:27236551

  11. Mechanisms of sister chromatid recombination

    International Nuclear Information System (INIS)

    Studies using T948 as a model system have been carried out aimed at elucidating the mechanism of sister chromatid recombination (SCR). Characterization of U.V. light- and x-ray-induced SCR, the relationiship between SCR induction and DNA repair using rad mutations, and the relationship between SCR induction and the time of cell division using cdc mutations are presented. It has been supposed that SCR is induced at the phase of S-G2 following DNA replication, that postreplication break of DNA strands is strongly involved in the induction of SCR, and that induction type of SCR, i.e., conversion type or recombination type, is dependent upon the type of molecular damage of DNA. (Namekawa, K.)

  12. Recombinations of Busy Beaver Machines


    Bátfai, Norbert


    Many programmers belive that Turing-based machines cannot think. We also believe in this, however it is interesting to note that the most sophisticated machines are not programmed by human beings. We have only discovered them. In this paper, using well-known Busy Beaver and Placid Platypus machines, we generate further very similar, but not exactly the same machines. We have found a recombinated BB_5 machine which can make 70.740.809 steps before halting.

  13. Recombinant erythropoietin in clinical practice


    Ng, T; Marx, G.; Littlewood, T; Macdougall, I


    The introduction of recombinant human erythropoietin (RHuEPO) has revolutionised the treatment of patients with anaemia of chronic renal disease. Clinical studies have demonstrated that RHuEPO is also useful in various non-uraemic conditions including haematological and oncological disorders, prematurity, HIV infection, and perioperative therapies. Besides highlighting both the historical and functional aspects of RHuEPO, this review discusses the applications of RHuEPO in clinical practice a...

  14. Recombinant antibodies and tumor targeting


    Sheikholvaezin, Ali


    Different antibody derived constructs are rapidly advancing as putative tools for treatment of malignant diseases. Antibody engineering has added significant new technologies to modify size, affinities, solubility, stability and biodistribution properties for immunoconjugates. In the present thesis, the aim was to increase our knowledge on how new recombinant antibodies could be tailored to optimize localization to experimental tumors in mice. One hybridoma, producing the monoclonal antibody ...

  15. Workshop on Radio Recombination Lines

    CERN Document Server


    Since their first detection 15 years ago, radio recombination lines from several elements have been observed in a wide variety of objects including HII regions, planetary nebulae, molecular clouds, the diffuse interstellar medium, and recently, other galaxies. The observations span almost the entire range from 0.1 to 100 GHz, and employ both single­ djsh and aperture synthesis techniques. The theory of radio recombination lines has also advanced strongly, to the point where it is perhaps one of the best-understood in astro­ physics. In a parallel development, it has become possible over the last decade to study these same highly-excited atoms in the laboratory; this work provides further confirmation of the theoretical framework. However there has been continuing controversy over the astrophysical interpre­ tation of radio recombination line observations, especially regarding the role of stimulated emission. A workshop was held in Ottawa on 24-25 August, 1979, bringing together many of the active scientist...

  16. Intestinal circulation during inhalation anesthesia

    International Nuclear Information System (INIS)

    This study was designed to evaluate the influence of inhalational agents on the intestinal circulation in an isolated loop preparation. Sixty dogs were studied, using three intestinal segments from each dog. Selected intestinal segments were pumped with aortic blood at a constant pressure of 100 mmHg. A mixture of 86Rb and 9-microns spheres labeled with 141Ce was injected into the arterial cannula supplying the intestinal loop, while mesenteric venous blood was collected for activity counting. A very strong and significant correlation was found between rubidium clearance and microsphere entrapment (r = 0.97, P less than 0.0001). Nitrous oxide anesthesia was accompanied by a higher vascular resistance (VR), lower flow (F), rubidium clearance (Cl-Rb), and microspheres entrapment (Cl-Sph) than pentobarbital anesthesia, indicating that the vascular bed in the intestinal segment was constricted and flow (total and nutritive) decreased. Halothane, enflurane, and isoflurane anesthesia were accompanied by a much lower arteriovenous oxygen content difference (AVDO2) and oxygen uptake than pentobarbital or nitrous oxide. Compared with pentobarbital, enflurane anesthesia was not accompanied by marked differences in VR, F, Cl-Rb, and Cl-Sph; halothane at 2 MAC decreased VR and increased F and Cl-Rb while isoflurane increased VR and decreased F. alpha-Adrenoceptor blockade with phentolamine (1 mg . kg-1) abolished isoflurane-induced vasoconstriction, suggesting that the increase in VR was mediated via circulating catecholamines

  17. High-Resolution Mapping of Homologous Recombination Events in rad3 Hyper-Recombination Mutants in Yeast.

    Directory of Open Access Journals (Sweden)

    Sabrina L Andersen


    Full Text Available The Saccharomyces cerevisae RAD3 gene is the homolog of human XPD, an essential gene encoding a DNA helicase of the TFIIH complex involved in both nucleotide excision repair (NER and transcription. Some mutant alleles of RAD3 (rad3-101 and rad3-102 have partial defects in DNA repair and a strong hyper-recombination (hyper-Rec phenotype. Previous studies showed that the hyper-Rec phenotype associated with rad3-101 and rad3-102 can be explained as a consequence of persistent single-stranded DNA gaps that are converted to recombinogenic double-strand breaks (DSBs by replication. The systems previously used to characterize the hyper-Rec phenotype of rad3 strains do not detect the reciprocal products of mitotic recombination. We have further characterized these events using a system in which the reciprocal products of mitotic recombination are recovered. Both rad3-101 and rad3-102 elevate the frequency of reciprocal crossovers about 100-fold. Mapping of these events shows that three-quarters of these crossovers reflect DSBs formed at the same positions in both sister chromatids (double sister-chromatid breaks, DSCBs. The remainder reflects DSBs formed in single chromatids (single chromatid breaks, SCBs. The ratio of DSCBs to SCBs is similar to that observed for spontaneous recombination events in wild-type cells. We mapped 216 unselected genomic alterations throughout the genome including crossovers, gene conversions, deletions, and duplications. We found a significant association between the location of these recombination events and regions with elevated gamma-H2AX. In addition, there was a hotspot for deletions and duplications at the IMA2 and HXT11 genes near the left end of chromosome XV. A comparison of these data with our previous analysis of spontaneous mitotic recombination events suggests that a sub-set of spontaneous events in wild-type cells may be initiated by incomplete NER reactions, and that DSCBs, which cannot be repaired by sister

  18. Short telomeres initiate telomere recombination in primary and tumor cells.

    Directory of Open Access Journals (Sweden)

    Tammy A Morrish


    Full Text Available Human tumors that lack telomerase maintain telomeres by alternative lengthening mechanisms. Tumors can also form in telomerase-deficient mice; however, the genetic mechanism responsible for tumor growth without telomerase is unknown. In yeast, several different recombination pathways maintain telomeres in the absence of telomerase-some result in telomere maintenance with minimal effects on telomere length. To examine non-telomerase mechanisms for telomere maintenance in mammalian cells, we used primary cells and lymphomas from telomerase-deficient mice (mTR-/- and Emumyc+mTR-/- and CAST/EiJ mouse embryonic fibroblast cells. These cells were analyzed using pq-ratio analysis, telomere length distribution outliers, CO-FISH, Q-FISH, and multicolor FISH to detect subtelomeric recombination. Telomere length was maintained during long-term growth in vivo and in vitro. Long telomeres, characteristic of human ALT cells, were not observed in either late passage or mTR-/- tumor cells; instead, we observed only minimal changes in telomere length. Telomere length variation and subtelomeric recombination were frequent in cells with short telomeres, indicating that length maintenance is due to telomeric recombination. We also detected telomere length changes in primary mTR-/- cells that had short telomeres. Using mouse mTR+/- and human hTERT+/- primary cells with short telomeres, we found frequent length changes indicative of recombination. We conclude that telomere maintenance by non-telomerase mechanisms, including recombination, occurs in primary cells and is initiated by short telomeres, even in the presence of telomerase. Most intriguing, our data indicate that some non-telomerase telomere maintenance mechanisms occur without a significant increase in telomere length.

  19. Effect of gamma radiation on retroviral recombination. (United States)

    Hu, W S; Temin, H M


    To elucidate the mechanism(s) of retroviral recombination, we exposed virions to gamma radiation prior to infecting target cells. By using previously described spleen necrosis virus-based vectors containing multiple markers, recombinant proviruses were studied after a single round of retrovirus replication. The current models of retroviral recombination predict that breaking virion RNA should promote minus-strand recombination (forced copy-choice model), decrease or not affect plus-strand recombination (strand displacement/assimilation model), and shift plus-strand recombination towards the 3' end of the genome. However, we found that while gamma irradiation of virions reduced the amount of recoverable viral RNA, it did not primarily cause breaks. Thus, the frequency of selected recombinants was not significantly altered with greater doses of radiation. In spite of this, the irradiation did decrease the number of recombinants with only one internal template switch. As a result, the average number of additional internal template switches in the recombinant proviruses increased from 0.7 to 1.4 as infectivity decreased to 6%. The unselected internal template switches tended to be 5' of the selected crossover even in the recombinants from irradiated viruses, inconsistent with a plus-strand recombination mechanism. PMID:1602553

  20. The global marine phosphorus cycle: sensitivity to oceanic circulation


    Slomp, C. P.; P. Van Cappellen


    A new mass balance model for the coupled marine cycles of phosphorus (P) and carbon (C) is used to examine the relationships between oceanic circulation, primary productivity, and sedimentary burial of reactive P and particulate organic C (POC), on geological time scales. The model explicitly represents the exchanges of water and particulate matter between the continental shelves and the open ocean, and it accounts for the redox-dependent burial of POC and the various forms of reactive P (iro...

  1. Circulating tumor cells in newly diagnosed inflammatory breast cancer


    Mego, Michal; Giordano, Antonio; De Giorgi, Ugo; Masuda, Hiroko; Hsu, Limin; Giuliano, Mario; Fouad, Tamer M.; Dawood, Shaheenah; Ueno, Naoto T.; Valero, Vicente; Andreopoulou, Eleni; Alvarez, Ricardo H.; Wendy A Woodward; Hortobagyi, Gabriel N; Cristofanilli, Massimo


    Introduction Circulating tumor cells (CTCs) are an independent prognostic factor for progression-free survival (PFS) and overall survival (OS) in patients with metastatic breast cancer. Inflammatory breast cancer (IBC) is one of the most aggressive forms of breast cancer. The prognostic value of a CTC count in newly diagnosed IBC has not been established. The aim of this study was to assess the prognostic value of a baseline CTC count in patients with newly diagnosed IBC. Methods This retrosp...

  2. In vivo kinetics of [sup 99m]Tc labeled recombinant tissue plasminogen activator in rabbits

    Energy Technology Data Exchange (ETDEWEB)

    Itoh, Kazuo; Ieko, Masahiro; Hiraguchi, Etsuro; Kitayama, Hide; Tsukamoto, Eriko (Hokkaido Univ., Sapporo (Japan). School of Medicine)


    Our previous studies demonstrated that [sup 99m]Tc labeled recombinant tissue plasminiogen activator (rt-PA) retained high affinity with fibrin in vitro but showed unexpectedly low uptake in fresh thrombi in vivo. The present study was performed to determine the in vivo kinetics of radiolabeled t-PA in the rabbit. Sequential images and blood samples after the intravenous administration of [sup 99m]Tc labeled rt-PA in thrombus-bearing rabbits were taken. The radioactivity and immunological level of t-PA and PAI-1 in the solution eluted to each fraction by gel permeation chromatography were measured by means of a well scintillation counter and enzyme-linked immunosorbent assay (ELISA). Most of the radioactivity was eluted in the fraction (Fr.7) of larger molecular weight than that (Fr.9) of intact t-PA. The level of intact rt-PA was increased with a regimen involving the preadministration of cold rt-PA which was followed by the administration of hot rt-PA. The level of PAI-1 in plasma showed an increased rebound 15 minutes after the intravenous injection. These results suggest two possible reasons why rt-PA retains high affinity with fibrin in vitro, once radiolabeled, but was ineffective in delineating fresh thrombi with a gamma camera: (1) some plasma components such as PAI-1 combine with circulating radiolabeled rt-PA and form a larger molecule immediately and/or (2) radiolabeled rt-PA is modulated as a consequence of the radiolabeling and forms a larger molecule than intact rt-PA. (author).

  3. A blood circulation model for reference man

    Energy Technology Data Exchange (ETDEWEB)

    Leggett, R.W.; Eckerman, K.F. [Oak Ridge National Lab., TN (United States). Health Sciences Research Div.; Williams, L.R. [Indiana Univ., South Bend, IN (United States). Div. of Liberal Arts and Sciences


    This paper describes a dynamic blood circulation model that predicts the movement and gradual dispersal of a bolus of material in the circulation after its intravascular injection into an adult human. The main purpose of the model is to improve the dosimetry of internally deposited radionuclides that decay in the circulation to a significant extent. The total blood volume is partitioned into the blood contents of 24 separate organs or tissues, right heart chambers, left heart chambers, pulmonary circulation, arterial outflow to the systemic tissues (aorta and large arteries), and venous return from the systemic tissues (large veins). As a compromise between physical reality and computational simplicity, the circulation of blood is viewed as a system of first-order transfers between blood pools, with the delay time depending on the mean transit time across the pool. The model allows consideration of incomplete, tissue-dependent extraction of material during passage through the circulation and return of material from tissues to plasma.

  4. Proton to pion ratio at RHIC from dynamical quark recombination

    CERN Document Server

    Ayala, Alejandro; Paic, Guy; Toledo-Sanchez, Genaro


    We propose an scenario to study, from a dynamical point of view, the thermal recombination of quarks in the midsts of a relativistic heavy-ion collision. We coin the term dynamical quark recombination to refer to the process of quark-antiquark and three-quark clustering, to form mesons and baryons, respectively, as a function of energy density. Using the string-flip model we show that the probabilities to form such clusters differ. We apply these ideas to the calculation of the proton and pion spectra in a Bjorken-like scenario that incorporates the evolution of these probabilities with proper time and compute the proton to pion ratio, comparing to recent RHIC data at the highest energy. We show that for a standard choice of parameters, this ratio reaches one, though the maximum is very sensitive to the initial evolution proper time.

  5. Circulation of Venus upper mesosphere. (United States)

    Zasova, Ludmila; Gorinov, Dmitry; Shakun, Alexey; Altieri, Francesca; Migliorini, Alessandra; Piccioni, Giuseppe; Drossart, Pierre


    Observation of the O2 1.27 μm airglow intensity distribution on the night side of Venus is one of the methods of study of the circulation in upper mesosphere 90-100 km. VIRTIS-M on board Venus Express made these observations in nadir and limb modes in Southern and Northern hemispheres respectively. Global map of the O2 night glow is published (Piccioni et al. 2009). In this work we use for analysis only data, obtained with exposure > 3 s to avoid high noisy data. It was found that intensity of emission decreases to poles and to terminators (similar to Piccioni et al.2009) in both hemispheres, which gives evidence for existence of SS-AS circulation with transport of the air masses through poles and terminators with ascending/descending flows at SS/AS areas. However, asymmetry of distribution of intensity of airglow is observed in both hemispheres. Global map for southern hemisphere (from nadir data) has good statistics at φ > 10-20° S and pretty poor at low latitude. Maximum emission is shifted from midnight by 1 - 2 hours to the evening (22-23h) and deep minimum of emission is found at LT=2-4 h at φ > 20° S. This asymmetry is extended up to equatorial region, however statistic is poor there. No evident indication for existence of the Retrograde Zonal Superrotation (RZS) is found: maximum emission in this case, which is resulting from downwards flow, should be shifted to the morning. The thermal tides, gravity waves are evidently influence on the night airglow distribution. VIRTIS limb observations cover the low northern latitudes and they are more sparse at higher latitudes. Intensity of airglow at φ = 0 - 20° N shows wide maximum, which is shifted by 1- 2 h from midnight to morning terminator. This obviously indicates that observed O2 night glow distribution in low North latitudes is explained by a superposition of SS-AS flow and RZS circulation at 95-100 km. This behavior is similar to the NO intensity distribution, obtained by SPICAV.

  6. A reliable method to concentrate circulating DNA. (United States)

    Bryzgunova, Olga; Bondar, Anna; Morozkin, Evgeniy; Mileyko, Vladislav; Vlassov, Valentin; Laktionov, Pavel


    Concentration of circulating DNA probes is required to increase the amount of DNA involved in subsequent study (by polymerase chain reaction, sequencing, and microarray). This work was dedicated to the comparison of five different methods used for concentration of DNA circulating in blood. Precipitation of circulating DNA with acetone in the presence of triethylamine provides minimal DNA loss, high reproducibility, and at least three times higher DNA yield in comparison with the standard ethanol protocol. PMID:20828533

  7. Linear thermal circulator based on Coriolis forces. (United States)

    Li, Huanan; Kottos, Tsampikos


    We show that the presence of a Coriolis force in a rotating linear lattice imposes a nonreciprocal propagation of the phononic heat carriers. Using this effect we propose the concept of Coriolis linear thermal circulator which can control the circulation of a heat current. A simple model of three coupled harmonic masses on a rotating platform permits us to demonstrate giant circulating rectification effects for moderate values of the angular velocities of the platform. PMID:25768443

  8. The Ten Relationships in Rural Land Circulation


    Cai, Zhirong; Ren, Shuo; Zhang, Zhigang


    The ten relationships during land circulation are discussed. Among them, the relationship between peasant household and government indicates that government should only carry out its service and regulatory functions and farmers should be the main body of land circulation, because peasants usually have no discourse power during land circulation. In the relationship between land ownership and contracting management right, we mainly discuss the transfer of land contracting management right and p...

  9. Tumor-derived circulating endothelial cell clusters in colorectal cancer.

    KAUST Repository

    Cima, Igor


    Clusters of tumor cells are often observed in the blood of cancer patients. These structures have been described as malignant entities for more than 50 years, although their comprehensive characterization is lacking. Contrary to current consensus, we demonstrate that a discrete population of circulating cell clusters isolated from the blood of colorectal cancer patients are not cancerous but consist of tumor-derived endothelial cells. These clusters express both epithelial and mesenchymal markers, consistent with previous reports on circulating tumor cell (CTC) phenotyping. However, unlike CTCs, they do not mirror the genetic variations of matched tumors. Transcriptomic analysis of single clusters revealed that these structures exhibit an endothelial phenotype and can be traced back to the tumor endothelium. Further results show that tumor-derived endothelial clusters do not form by coagulation or by outgrowth of single circulating endothelial cells, supporting a direct release of clusters from the tumor vasculature. The isolation and enumeration of these benign clusters distinguished healthy volunteers from treatment-naïve as well as pathological early-stage (≤IIA) colorectal cancer patients with high accuracy, suggesting that tumor-derived circulating endothelial cell clusters could be used as a means of noninvasive screening for colorectal cancer. In contrast to CTCs, tumor-derived endothelial cell clusters may also provide important information about the underlying tumor vasculature at the time of diagnosis, during treatment, and throughout the course of the disease.

  10. Numerical Study of the Effects of Topography and Urbanization on the Local Atmospheric Circulations over the Beijing-Tianjin-Hebei, China

    Directory of Open Access Journals (Sweden)

    Yucong Miao


    Full Text Available The effects of the topography and urbanization on the local atmospheric circulations over the Beijing-Tianjin-Hebei (BTH region were studied by the weather research and forecasting (WRF model, as well as the interactions among these local atmospheric circulations. It was found that, in the summer day time, the multiscale thermally induced local atmospheric circulations may exist and interact in the same time over the BTH region; the topography played a role in the strengthening of the sea breeze circulations; after sunset, the inland progress of sea breeze was slowed down by the opposite mountain breeze; when the land breeze circulation dominated the Bohai bay, the mountain breeze circulation can couple with the land breeze circulation to form a large circulation ranging from the coastline to the mountains. And the presence of cities cannot change the general state of the sea-land breeze (SLB circulation and mountain-valley breeze (MVB circulation but acted to modify these local circulations slightly. Meanwhile, the development of the urban heat island (UHI circulation was also strongly influenced by the nearby SLB circulation and MVB circulation.

  11. Role of Circulating Fibrocytes in Cardiac Fibrosis (United States)

    Lin, Rong-Jie; Su, Zi-Zhuo; Liang, Shu-Min; Chen, Yu-Yang; Shu, Xiao-Rong; Nie, Ru-Qiong; Wang, Jing-Feng; Xie, Shuang-Lun


    Objective: It is revealed that circulating fibrocytes are elevated in patients/animals with cardiac fibrosis, and this review aims to provide an introduction to circulating fibrocytes and their role in cardiac fibrosis. Data Sources: This review is based on the data from 1994 to present obtained from PubMed. The search terms were “circulating fibrocytes” and “cardiac fibrosis”. Study Selection: Articles and critical reviews, which are related to circulating fibrocytes and cardiac fibrosis, were selected. Results: Circulating fibrocytes, which are derived from hematopoietic stem cells, represent a subset of peripheral blood mononuclear cells exhibiting mixed morphological and molecular characteristics of hematopoietic and mesenchymal cells (CD34+/CD45+/collagen I+). They can produce extracellular matrix and many cytokines. It is shown that circulating fibrocytes participate in many fibrotic diseases, including cardiac fibrosis. Evidence accumulated in recent years shows that aging individuals and patients with hypertension, heart failure, coronary heart disease, and atrial fibrillation have more circulating fibrocytes in peripheral blood and/or heart tissue, and this elevation of circulating fibrocytes is correlated with the degree of fibrosis in the hearts. Conclusions: Circulating fibrocytes are effector cells in cardiac fibrosis. PMID:26831236

  12. Improvement of Classification of Enterprise Circulating Funds

    Directory of Open Access Journals (Sweden)

    Rohanova Hanna O.


    Full Text Available The goal of the article lies in revelation of possibilities of increase of efficiency of managing enterprise circulating funds by means of improvement of their classification features. Having analysed approaches of many economists to classification of enterprise circulating funds, systemised and supplementing them, the article offers grouping classification features of enterprise circulating funds. In the result of the study the article offers an expanded classification of circulating funds, which clearly shows the role of circulating funds in managing enterprise finance and economy in general. The article supplements and groups classification features of enterprise circulating funds by: the organisation level, functioning character, sources of formation and their cost, and level of management efficiency. The article shows that the provided grouping of classification features of circulating funds allows exerting all-sided and purposeful influence upon indicators of efficiency of circulating funds functioning and facilitates their rational management in general. The prospect of further studies in this direction is identification of the level of attraction of loan resources by production enterprises for financing circulating funds.

  13. A blood circulation model for reference man

    International Nuclear Information System (INIS)

    A dynamic blood circulation model that predicts the movement and gradual dispersion of a bolus of material in the circulation after its intravenous injection into an adult human. The main purpose of the model is improve the dosimetry of internally deposited radionuclides that decay in the circulation to a significant extent. The model partitions the blood volume into 24 separate organs or tissues, right heart chamber, left heart chamber, pulmonary circulation, arterial outflow to the aorta and large arteries, and venous return via the large veins. Model results were compared to data obtained from injection of carbon 11 labeled carbon monoxide or rubidium 86

  14. Intercompartmental recombination of HIV-1 contributes to env intrahost diversity and modulates viral tropism and sensitivity to entry inhibitors. (United States)

    Brown, Richard J P; Peters, Paul J; Caron, Catherine; Gonzalez-Perez, Maria Paz; Stones, Leanne; Ankghuambom, Chiambah; Pondei, Kemebradikumo; McClure, C Patrick; Alemnji, George; Taylor, Stephen; Sharp, Paul M; Clapham, Paul R; Ball, Jonathan K


    HIV-1 circulates within an infected host as a genetically heterogeneous viral population. Viral intrahost diversity is shaped by substitutional evolution and recombination. Although many studies have speculated that recombination could have a significant impact on viral phenotype, this has never been definitively demonstrated. We report here phylogenetic and subsequent phenotypic analyses of envelope genes obtained from HIV-1 populations present in different anatomical compartments. Assessment of env compartmentalization from immunologically discrete tissues was assessed utilizing a single genome amplification approach, minimizing in vitro-generated artifacts. Genetic compartmentalization of variants was frequently observed. In addition, multiple incidences of intercompartment recombination, presumably facilitated by low-level migration of virus or infected cells between different anatomic sites and coinfection of susceptible cells by genetically divergent strains, were identified. These analyses demonstrate that intercompartment recombination is a fundamental evolutionary mechanism that helps to shape HIV-1 env intrahost diversity in natural infection. Analysis of the phenotypic consequences of these recombination events showed that genetic compartmentalization often correlates with phenotypic compartmentalization and that intercompartment recombination results in phenotype modulation. This represents definitive proof that recombination can generate novel combinations of phenotypic traits which differ subtly from those of parental strains, an important phenomenon that may have an impact on antiviral therapy and contribute to HIV-1 persistence in vivo. PMID:21471230

  15. Irregular Labellings of Circulant Graphs


    Anholcer, Marcin


    We investigate the \\textit{irregularity strength} ($s(G)$) and \\textit{total vertex irregularity strength} ($tvs(G)$) of circulant graphs $Ci_n(1,2,...,k)$ and prove that $tvs(Ci_n(1,2,...,k))=\\lceil\\frac{n+2k}{2k+1}\\rceil$, while $s(Ci_n(1,2,...,k))=\\lceil\\frac{n+2k-1}{2k}\\rceil$ except the case when $(n \\bmod 4k = 2k+1 \\wedge k\\bmod 2=1) \\vee n=2k+1$ and $s(Ci_n(1,2,...,k))=\\lceil\\frac{n+2k-1}{2k}\\rceil+1$.

  16. Inflammatory response and extracorporeal circulation. (United States)

    Kraft, Florian; Schmidt, Christoph; Van Aken, Hugo; Zarbock, Alexander


    Patients undergoing cardiac surgery with extracorporeal circulation (EC) frequently develop a systemic inflammatory response syndrome. Surgical trauma, ischaemia-reperfusion injury, endotoxaemia and blood contact to nonendothelial circuit compounds promote the activation of coagulation pathways, complement factors and a cellular immune response. This review discusses the multiple pathways leading to endothelial cell activation, neutrophil recruitment and production of reactive oxygen species and nitric oxide. All these factors may induce cellular damage and subsequent organ injury. Multiple organ dysfunction after cardiac surgery with EC is associated with an increased morbidity and mortality. In addition to the pathogenesis of organ dysfunction after EC, this review deals with different therapeutic interventions aiming to alleviate the inflammatory response and consequently multiple organ dysfunction after cardiac surgery. PMID:26060024

  17. The aerodynamics of circulation control (United States)

    Wood, N. J.


    Two dimensional subsonic wind tunnel tests were conducted on a 20% thickness: chord ratio circulation controlled elliptic aerofoil section equipped with forward and reverse blowing slots. Overall performance measurements were made over a range of trailing edge blowing momentum coefficients from 0 to 0.04; some included the effect of leading edge blowing. A detailed investigation of the trailing edge wall jet, using split film probes, hot wire probes and total head tubes, provided measurements of mean velocity components, Reynolds normal and shear stresses, and radial static pressure. The closure of the two dimensional angular momentum and continuity equations was examined using the measured data, with and without correction, and the difficulty of obtaining a satisfactory solution illustrated. Suggestions regarding the nature of the flow field which should aid the understanding of Coanda effect and the theoretical solution of highly curved wall jet flows are presented.

  18. Short Telomeres Initiate Telomere Recombination in Primary and Tumor Cells


    Morrish, Tammy A.; Greider, Carol W


    Human tumors that lack telomerase maintain telomeres by alternative lengthening mechanisms. Tumors can also form in telomerase-deficient mice; however, the genetic mechanism responsible for tumor growth without telomerase is unknown. In yeast, several different recombination pathways maintain telomeres in the absence of telomerase-some result in telomere maintenance with minimal effects on telomere length. To examine non-telomerase mechanisms for telomere maintenance in mammalian cells, we us...

  19. The many facets of homologous recombination at telomeres


    Clémence Claussin; Michael Chang


    The ends of linear chromosomes are capped by nucleoprotein structures called telomeres. A dysfunctional telomere may resemble a DNA double-strand break (DSB), which is a severe form of DNA damage. The presence of one DSB is sufficient to drive cell cycle arrest and cell death. Therefore cells have evolved mechanisms to repair DSBs such as homologous recombination (HR). HR-mediated repair of telomeres can lead to genome instability, a hallmark of cancer cells, wh...

  20. Bacteriophage recombination systems and biotechnical applications. (United States)

    Nafissi, Nafiseh; Slavcev, Roderick


    Bacteriophage recombination systems have been widely used in biotechnology for modifying prokaryotic species, for creating transgenic animals and plants, and more recently, for human cell gene manipulation. In contrast to homologous recombination, which benefits from the endogenous recombination machinery of the cell, site-specific recombination requires an exogenous source of recombinase in mammalian cells. The mechanism of bacteriophage evolution and their coexistence with bacterial cells has become a point of interest ever since bacterial viruses' life cycles were first explored. Phage recombinases have already been exploited as valuable genetic tools and new phage enzymes, and their potential application to genetic engineering and genome manipulation, vectorology, and generation of new transgene delivery vectors, and cell therapy are attractive areas of research that continue to be investigated. The significance and role of phage recombination systems in biotechnology is reviewed in this paper, with specific focus on homologous and site-specific recombination conferred by the coli phages, λ, and N15, the integrase from the Streptomyces phage, ΦC31, the recombination system of phage P1, and the recently characterized recombination functions of Yersinia phage, PY54. Key steps of the molecular mechanisms involving phage recombination functions and their application to molecular engineering, our novel exploitations of the PY54-derived recombination system, and its application to the development of new DNA vectors are discussed. PMID:24442504

  1. The many facets of homologous recombination at telomeres

    Directory of Open Access Journals (Sweden)

    Clémence Claussin


    Full Text Available The ends of linear chromosomes are capped by nucleoprotein structures called telomeres. A dysfunctional telomere may resemble a DNA double-strand break (DSB, which is a severe form of DNA damage. The presence of one DSB is sufficient to drive cell cycle arrest and cell death. Therefore cells have evolved mechanisms to repair DSBs such as homologous recombination (HR. HR-mediated repair of telomeres can lead to genome instability, a hallmark of cancer cells, which is why such repair is normally inhibited. However, some HR-mediated processes are required for proper telomere function. The need for some recombination activities at telomeres but not others necessitates careful and complex regulation, defects in which can lead to catastrophic consequences. Furthermore, some cell types can maintain telomeres via telomerase-independent, recombination-mediated mechanisms. In humans, these mechanisms are called alternative lengthening of telomeres (ALT and are used in a subset of human cancer cells. In this review, we summarize the different recombination activities occurring at telomeres and discuss how they are regulated. Much of the current knowledge is derived from work using yeast models, which is the focus of this review, but relevant studies in mammals are also included.

  2. CRMAGE: CRISPR Optimized MAGE Recombineering

    DEFF Research Database (Denmark)

    Ronda, Carlotta; Pedersen, Lasse Ebdrup; Sommer, Morten Otto Alexander;


    A bottleneck in metabolic engineering and systems biology approaches is the lack of efficient genome engineering technologies. Here, we combine CRISPR/Cas9 and λ Red recombineering based MAGE technology (CRMAGE) to create a highly efficient and fast method for genome engineering of Escherichia coli...... assembled by a USER-cloning approach enabling quick and cost efficient gRNA replacement. CRMAGE furthermore utilizes CRISPR/Cas9 for efficient plasmid curing, thereby enabling multiple engineering rounds per day. To facilitate the design process, a web-based tool was developed to predict both the λ Red...

  3. New recombinant vaccines for the prevention of meningococcal B disease

    Directory of Open Access Journals (Sweden)

    Taha MK


    Full Text Available Muhamed-Kheir Taha, Ala-Eddine DeghmaneInstitut Pasteur, Unit of Invasive Bacterial Infections and National Reference Center for Meningococci, Paris, FranceAbstract: Meningococcal disease is a life-threatening invasive infection (mainly septicemia and meningitis that occurs as epidemic or sporadic cases. The causative agent, Neisseria meningitidis or meningococcus, is a capsulated Gram-negative bacterium. Current vaccines are prepared from the capsular polysaccharides (that also determine serogroups and are available against strains of serogroups A, C, Y, and W-135 that show variable distribution worldwide. Plain polysaccharide vaccines were first used and subsequently conjugate vaccines with enhanced immunogenicity were introduced. The capsular polysaccharide of meningococcal serogroup B is poorly immunogenic due to similarity to the human neural cells adhesion molecule. Tailor-made, strain-specific vaccines have been developed to control localized and clonal outbreaks due to meningococci of serogroup B but no “universal” vaccine is yet available. This unmet medical need was recently overcome using several subcapsular proteins to allow broad range coverage of strains and to reduce the risk of escape variants due to genetic diversity of the meningococcus. Several vaccines are under development that target major or minor surface proteins. One vaccine (Bexsero®; Novartis, under registration, is a multicomponent recombinant vaccine that showed an acceptable safety profile and covers around 80% of the currently circulating serogroup B isolates. However, its reactogenicity in infants seems to be high and the long term persistence of the immune response needs to be determined. Its activity on carriage, and therefore transmission, is under evaluation. Indirect protection is expected through restricting strain circulation and acquisition. This vaccine covers the circulating strains according to the presence of the targeted antigens in the

  4. The Circulation of Shakespeare Adaptations in Eastern Europe


    Nicolaescu Mădălina


    The paper discusses the stage adaptations of Shakespeare's Hamlet and Romeo and Juliet that were circulated in the German Länders and the Habsburg Empire in the late 18th and early 19th century. The various forms of re-writing Shakespeare are linked with processes re-contextualizing the text and are discussed as forms of localizing a transnational Shakespeare. The analysis zooms in on the contexts of performance of the German adaptations in two Transylvanian cities. The paper highlights the c...

  5. Recombination induced by triple-helix-targeted DNA damage in mammalian cells.


    Faruqi, A F; Seidman, M M; Segal, D J; Carroll, D; Glazer, P M


    Gene therapy has been hindered by the low frequency of homologous recombination in mammalian cells. To stimulate recombination, we investigated the use of triple-helix-forming oligonucleotides (TFOs) to target DNA damage to a selected site within cells. By treating cells with TFOs linked to psoralen, recombination was induced within a simian virus 40 vector carrying two mutant copies of the supF tRNA reporter gene. Gene conversion events, as well as mutations at the target site, were also obs...

  6. Comparison of 2 synthetically generated recombinant prions


    Zhang, Yi; Wang, Fei; Wang, Xinhe; Zhang, Zhihong; Xu, Yuanyuan; Yu, Guohua; Yuan, Chonggang; Ma, Jiyan


    Prion is a protein-conformation-based infectious agent causing fatal neurodegenerative diseases in humans and animals. Our previous studies revealed that in the presence of cofactors, infectious prions can be synthetically generated in vitro with bacterially expressed recombinant prion protein (PrP). Once initiated, the recombinant prion is able to propagate indefinitely via serial protein misfolding cyclic amplification (sPMCA). In this study, we compared 2 separately initiated recombinant p...

  7. Impact of recombination on bacterial evolution


    Didelot, Xavier; Maiden, Martin C. J.


    Genetic exchange plays a defining role in the evolution of many bacteria. The recent accumulation of nucleotide sequence data from multiple members of diverse bacterial genera has facilitated comparative studies that have revealed many features of this process. Here we focus on genetic exchange that has involved homologous recombination and illustrate how nucleotide sequence data have furthered our understanding of: (i) the frequency of recombination; (ii) the impact of recombination in diffe...

  8. Recombination rate variation in closely related species


    Smukowski, C S; Noor, M A F


    Despite their importance to successful meiosis and various evolutionary processes, meiotic recombination rates sometimes vary within species or between closely related species. For example, humans and chimpanzees share virtually no recombination hotspot locations in the surveyed portion of the genomes. However, conservation of recombination rates between closely related species has also been documented, raising an apparent contradiction. Here, we evaluate how and why conflicting patterns of r...

  9. Role of ubiquitination in meiotic recombination repair

    Institute of Scientific and Technical Information of China (English)


    Programmed and unprogrammed double-strand breaks (DSBs) often arise from such physiological requirements as meiotic recombination, and exogenous insults, such as ionizing radiation (IR). Due to deleterious impacts on genome stability, DSBs must be appropriately processed and repaired in a regulatory manner. Recent investigations have indicated that ubiquitination is a critical factor in DNA damage response and meiotic recombination repair. This review summarizes the effects of proteins and complexes associated with ubiquitination with regard to homologous recombination (HR)-dependent DSB repair.

  10. Consequences of recombination on traditional phylogenetic analysis

    DEFF Research Database (Denmark)

    Schierup, M H; Hein, J


    We investigate the shape of a phylogenetic tree reconstructed from sequences evolving under the coalescent with recombination. The motivation is that evolutionary inferences are often made from phylogenetic trees reconstructed from population data even though recombination may well occur (mtDNA or...... recombination leads to a large overestimation of the substitution rate heterogeneity and the loss of the molecular clock. These results are discussed in relation to viral and mtDNA data sets. Udgivelsesdato: 2000-Oct...

  11. Unit group of algebra of circulant matrices

    Directory of Open Access Journals (Sweden)

    Rajendra Sharma


    Full Text Available Let Crn(Fp denote the algebra of nXn circulant matrices over Fp, finite field of order p of prime characteristic p. The order of the unit groups U(Cr3(Fp, U(Cr4(Fp and U(Cr5(Fp of algebras of circulant matrices over Fp are characterized.

  12. Introduction to instabilities in natural circulation systems

    International Nuclear Information System (INIS)

    This lecture reviews the various natural circulation instabilities and their classification instabilities observed during various stages of natural circulation such as single-phase, boiling inception and fully developed two-phase flow are described. The mechanisms causing the instabilities are also briefly described. (author)

  13. Kelvin's Canonical Circulation Theorem in Hall Magnetohydrodynamics

    CERN Document Server

    Shivamoggi, B K


    The purpose of this paper is to show that, thanks to the restoration of the legitimate connection between the current density and the plasma flow velocity in Hall magnetohydrodynamics (MHD), Kelvin's Circulation Theorem becomes valid in Hall MHD. The ion-flow velocity in the usual circulation integral is now replaced by the canonical ion-flow velocity.

  14. Processing of triplex-directed psoralen DNA interstrand crosslinks by recombination mechanisms


    Liu, Yaobin; Nairn, Rodney S.; Vasquez, Karen M.


    Gene targeting via homologous recombination (HR) is an important application in biotechnology and medicine. However, in mammalian cells HR is much less efficient than random integration. Triplex-forming oligonucleotides (TFOs) linked to DNA damaging agents (e.g. psoralen) can stimulate HR, providing the potential to improve gene therapy applications. To elucidate factors affecting TFO-directed psoralen interstrand crosslink (ICL)-induced recombination, we constructed a series of plasmids with...

  15. Recombinant equine interleukin-1β induces putative mediators of articular cartilage degradation in equine chondrocytes


    Tung, J. T.; Fenton, J. I.; Arnold, C; Alexander, L.; Yuzbasiyan-Gurkan, V.; Venta, P J; Peters, T. L.; Orth, M W; Richardson, D. W.; Caron, J P


    Interleukin-1 is considered a central mediator of cartilage loss in osteoarthritis in several species, however an equine recombinant form of this cytokine is not readily available for in vitro use in equine osteoarthritis research. Equine recombinant interleukin-1β was cloned and expressed and its effects on the expression and activity of selected chondrocytic proteins implicated in cartilage matrix degradation were characterized. Reverse transcriptase polymerase chain reaction methods were u...

  16. 14C-age tracers in global ocean circulation models (United States)

    Koeve, W.; Wagner, H.; Kähler, P.; Oschlies, A.


    The natural abundance of 14C in total CO2 dissolved in seawater (DIC) is a property applied to evaluate the water age structure and circulation in the ocean and in ocean models. In this study we use three different representations of the global ocean circulation augmented with a suite of idealised tracers to study the potential and limitations of using natural 14C to determine water age, which is the time elapsed since a body of water has been in contact with the atmosphere. We find that, globally, bulk 14C-age is dominated by two equally important components, one associated with ageing, i.e. the time component of circulation, and one associated with a "preformed 14C-age". The latter quantity exists because of the slow and incomplete atmosphere-ocean equilibration of 14C particularly in high latitudes where many water masses form. In the ocean's interior, preformed 14C-age behaves like a passive tracer. The relative contribution of the preformed component to bulk 14C-age varies regionally within a given model, but also between models. Regional variability in the Atlantic Ocean is associated with the mixing of waters with very different end members of preformed 14C-age. Here, variations in the preformed component over space and time mask the circulation component to an extent that its patterns are not detectable from bulk 14C-age. Between models, the variability of preformed 14C-age can also be considerable (factor of 2), related to the combination of physical model parameters, which influence circulation dynamics or gas exchange. The preformed component was found to be very sensitive to gas exchange and moderately sensitive to ice cover. In our model evaluation, the choice of the gas-exchange constant from within the currently accepted range of uncertainty had such a strong influence on preformed and bulk 14C-age that if model evaluation would be based on bulk 14C-age, it could easily impair the evaluation and tuning of a model's circulation on global and regional

  17. 14C-age tracers in global ocean circulation models

    Directory of Open Access Journals (Sweden)

    W. Koeve


    Full Text Available The natural abundance of 14C in total CO2 dissolved in seawater is a property applied to evaluate the water age structure and circulation in the ocean and in ocean models. In this study we use three different representations of the global ocean circulation augmented with a suite of idealised tracers to study the potential and limitations of using natural 14C to determine water age, the time elapsed since a body of water had contact with the atmosphere. We find that, globally, bulk 14C-age is dominated by two equally important components, one associated with aging, i.e. the time component of circulation and one associated with a "preformed 14C-age". This latter quantity exists because of the slow and incomplete atmosphere/ocean equilibration of 14C in particular in high latitudes where many water masses form. The relative contribution of the preformed component to bulk 14C-age varies regionally within a given model, but also between models. Regional variability, e.g. in the Atlantic Ocean is associated with the mixing of waters with very different end members of preformed 14C-age. In the Atlantic, variations in the preformed component over space and time mask the circulation component to an extent that its patterns are not detectable from bulk 14C-age alone. Between models the variability of age can also be considerable (factor of 2, related to the combinations of physical model parameters, which influence circulation dynamics, and gas exchange in the models. The preformed component was found to be very sensitive to gas exchange and moderately sensitive to ice cover. In our model evaluation exercise, the choice of the gas exchange constant from within the current range of uncertainty had such a strong influence on preformed and bulk 14C-age that if model evaluation would be based on bulk 14C-age it could easily impair the evaluation and tuning of a models circulation on global and regional scales. Based on the results of this study, we propose

  18. Human Insulin from Recombinant DNA Technology (United States)

    Johnson, Irving S.


    Human insulin produced by recombinant DNA technology is the first commercial health care product derived from this technology. Work on this product was initiated before there were federal guidelines for large-scale recombinant DNA work or commercial development of recombinant DNA products. The steps taken to facilitate acceptance of large-scale work and proof of the identity and safety of such a product are described. While basic studies in recombinant DNA technology will continue to have a profound impact on research in the life sciences, commercial applications may well be controlled by economic conditions and the availability of investment capital.

  19. Experimental recombination rates for highly charged ions

    International Nuclear Information System (INIS)

    Recent studies of recombination between free electrons and highly charged ions using electron coolers of heavy-ion storage rings have produced accurate rate coefficients of interest for plasma modeling and diagnostics. Some surprises were discovered which can lead to revisions of recombination models. With bare ions one finds at low energy a strong and puzzling deviation from radiative recombination theory. Dielectronic recombination with C3+, N4+) show that jj coupling gives essential contributions to the cross section also for light ions. (author)

  20. Genetic recombination in plant-infecting messenger-sense RNA viruses: overview and research perspectives

    Directory of Open Access Journals (Sweden)

    Jozef Julian Bujarski


    Full Text Available RNA recombination is one of the driving forces of genetic variability in (+-strand RNA viruses. Various types of RNA-RNA crossovers were described including crosses between the same or different viral RNAs or between viral and cellular RNAs. Likewise, a variety of molecular mechanisms are known to support RNA recombination, such as replicative events (based on internal or end-to-end replicase switchings along with nonreplicative joining among RNA fragments of viral and/or cellular origin. Such mechanisms as RNA decay or RNA interference are responsible for RNA fragmentation and trans-esterification reactions which are likely accountable for ligation of RNA fragments. Numerous host factors were found to affect the profiles of viral RNA recombinants and significant differences in recombination frequency were observed among various RNA viruses. Comparative analyses of viral sequences allowed for the development of evolutionary models in order to explain adaptive phenotypic changes and co-evolving sites. Many questions remain to be answered by forthcoming RNA recombination research. (i How various factors modulate the ability of viral replicase to switch templates, (ii What is the intracellular location of RNA-RNA template switchings, (iii Mechanisms and factors responsible for non-replicative RNA recombination, (iv Mechanisms of integration of RNA viral sequences with cellular genomic DNA, and (v What is the role of RNA splicing and ribozyme activity. From an evolutionary stand point, it is not known how RNA viruses parasitize new host species via recombination, nor is it obvious what the contribution of RNA recombination is among other RNA modification pathways. We do not understand why the frequency of RNA recombination varies so much among RNA viruses and the status of RNA recombination as a form of sex is not well documented.

  1. Simulation of hydrogen mitigation in catalytic recombiner. Part-II: Formulation of a CFD model

    Energy Technology Data Exchange (ETDEWEB)

    Prabhudharwadkar, Deoras M. [Department of Mechanical Engineering, Indian Institute of Technology-Bombay, Powai, Mumbai 400076 (India); Iyer, Kannan N., E-mail: [Department of Mechanical Engineering, Indian Institute of Technology-Bombay, Powai, Mumbai 400076 (India)


    Research highlights: Hydrogen transport in containment with recombiners is a multi-scale problem. A novel methodology worked out to lump the recombiner characteristics. Results obtained using commercial code FLUENT are cast in the form of correlations. Hence, coarse grids can obtain accurate distribution of H{sub 2} in containment. Satisfactory working of the methodology is clearly demonstrated. - Abstract: This paper aims at formulation of a model compatible with CFD code to simulate hydrogen distribution and mitigation using a Passive Catalytic Recombiner in the Nuclear power plant containments. The catalytic recombiner is much smaller in size compared to the containment compartments. In order to fully resolve the recombination processes during the containment simulations, it requires the geometric details of the recombiner to be modelled and a very fine mesh size inside the recombiner channels. This component when integrated with containment mixing calculations would result in a large number of mesh elements which may take large computational times to solve the problem. This paper describes a method to resolve this simulation difficulty. In this exercise, the catalytic recombiner alone was first modelled in detail using the best suited option to describe the reaction rate. A detailed parametric study was conducted, from which correlations for the heat of reaction (hence the rate of reaction) and the heat transfer coefficient were obtained. These correlations were then used to model the recombiner channels as single computational cells providing necessary volumetric sources/sinks to the energy and species transport equations. This avoids full resolution of these channels, thereby allowing larger mesh size in the recombiners. The above mentioned method was successfully validated using both steady state and transient test problems and the results indicate very satisfactory modelling of the component.

  2. Genomic lineages of Rhizobium etli revealed by the extent of nucleotide polymorphisms and low recombination

    Directory of Open Access Journals (Sweden)

    González Víctor


    Full Text Available Abstract Background Most of the DNA variations found in bacterial species are in the form of single nucleotide polymorphisms (SNPs, but there is some debate regarding how much of this variation comes from mutation versus recombination. The nitrogen-fixing symbiotic bacteria Rhizobium etli is highly variable in both genomic structure and gene content. However, no previous report has provided a detailed genomic analysis of this variation at nucleotide level or the role of recombination in generating diversity in this bacterium. Here, we compared draft genomic sequences versus complete genomic sequences to obtain reliable measures of genetic diversity and then estimated the role of recombination in the generation of genomic diversity among Rhizobium etli. Results We identified high levels of DNA polymorphism in R. etli, and found that there was an average divergence of 4% to 6% among the tested strain pairs. DNA recombination events were estimated to affect 3% to 10% of the genomic sample analyzed. In most instances, the nucleotide diversity (π was greater in DNA segments with recombinant events than in non-recombinant segments. However, this degree of recombination was not sufficiently large to disrupt the congruence of the phylogenetic trees, and further evaluation of recombination in strains quartets indicated that the recombination levels in this species are proportionally low. Conclusion Our data suggest that R. etli is a species composed of separated lineages with low homologous recombination among the strains. Horizontal gene transfer, particularly via the symbiotic plasmid characteristic of this species, seems to play an important role in diversity but the lineages maintain their evolutionary cohesiveness.

  3. Keynes's Lost Distinction Between Industrial and Financial Circulation of Money

    DEFF Research Database (Denmark)

    Jespersen, Jesper


    . In particular, banks should be divided into two categories: industrial or business banks, where deposits are used as means of payment (and covered by a State guarantee), and financial banks, where deposits carry an interest, but are not guaranteed by legal arrangement. This regulation would limit the...... amount of means of payment to what is required for production and trade, and would still make it possible for the central bank to pursue a flexible monetary policy. This insight can be obtained by combining monetary circuit theory and Keynes's analysis of industrial and financial circulation, as put......Although financial circulation is an important part of banks' balance sheets in the form of savings deposits, this is hardly discussed in monetary circuit theory. In this paper, we argue that monetary circuit theory would be more coherent if it were expanded to incorporate some aspects of Keynes...

  4. Transient and stability analysis in single-phase natural circulation

    Energy Technology Data Exchange (ETDEWEB)

    Mousavian, Seyed Khalil E-mail:; Misale, Mario; D' Auria, Francesco; Salehi, Mahmoud A


    This paper presents the mathematical modeling of single-phase natural circulation of the University of Genoa's rectangular loop (LOOP no. 1) by a computer program and using RELAP5 system code. The mass, momentum and energy conservation equations in transient form were solved numerically using the finite difference method. One-dimensional linear stability analysis was performed for the single-phase natural circulation loop and the numerical perturbation technique was used in this analysis. The Nyquist criterion was employed to find the stability map of the LOOP no. 1. The obtained transient results using the first order upwind scheme of the fluid temperatures in various sectors of the LOOP no. 1 are compared with the results obtained from the RELAP5 system code and available experimental data.

  5. Bond graph model for prediction of PWR natural circulation

    International Nuclear Information System (INIS)

    In operation of a Pressurized Water Reactor, natural circulation is an efficient, passive heat transfer mechanism for cooling. It is often employed for heat removal in operational transients, especially in long-term decay-heat removal operation. To simulate the dynamics of natural circulation, a bond graph representation of the PWR primary system and causal manipulation of the field equations has been modeled. The bond graph method calls for establishing the dynamic equations of multiport systems in state-variable form. Using the analogy of circuit elements in electrical networks, a bond graph consists of multiport capacitances, inertances, dissipations, sources of effort and flow, transformers, gyrators, and ideal junction elements. By treating each component in a PWR primary loop as a multiport element in the bond graph, a set of state-space equations representing the thermal/hydraulic responses of the loop is obtained. The state equations are then solved iteratively by using the program DYSIS developed by MIT

  6. Mineralization of Hydroxyapatite Regulated by Recombinant Human-like Collagen

    Institute of Scientific and Technical Information of China (English)


    We reported recombinant human-like type I collagen inducing growth of hydroxyapatite crystals in vitro in the form of self-assembly of nano-fibrils of mineralized collagen resembling extracellular matrix, which obey the same rules, but is superior to the collagen derived from animal tissues because the latter may carry diseases of animals and cause immunological reactions. The mineralized collagen fibrils aligned parallel to each other to form mineralized collagen fibers. Hydroxyapatite nanocrystals grew on the surface of these collagen fibrils with the c-axis of nanocrystals of HA orienting along the longitudinal axis of the fibrils.

  7. Comparison of in vivo effects of human recombinant IL 1 and human recombinant IL 6 in mice

    International Nuclear Information System (INIS)

    IL 1 and IL 6 share a number of biological activities, including induction of fever, neutrophilia and acute phase response, and IL 1 induces IL 6 production by fibroblasts and macrophages. Therefore, it was proposed that IL 6 mediates many of the activities of IL 1. To test this hypothesis in vivo, we assessed induction of IL 6 following IL 1 alpha administration to mice and tested IL 6 for radioprotection and induction of early (CSF) and late (fibrinogen and SAA) acute phase reactants. IL 1 alpha given to mice ip induced, in a dose dependent manner, detectable IL 6 in circulation, with maximal titers at 2-4 hrs. However, unlike IL 1 which is 10-1000 ng/mouse of human recombinant IL 6 did not result in increased survival of mice following lethal irradiation. In fact, such treatment given 20 hrs before LD50/30 doses of radiation resulted in reduced survival of mice. However, IL 6 augmented the radioprotective effect of IL 1. IL 1 in doses above 10 ng/mouse induced within 2 to 6 hrs a dose dependent increase in CSF in circulation, but IL 6 did not induce detectable levels of CSF at 2, 6 and 20 hrs after administration. Administration of IL 6 to mice produced a dose dependent increase in circulating fibrinogen and SAA. Similarly, administration of IL 1 resulted in much greater increases in levels of fibrinogen and SAA. Therefore, IL 1 is a more effective inducer of fibrinogen and SAA in mice than is IL 6. Although definitive conclusions concerning the relative roles for IL 1 and IL 6 in vivo will await availability of anti IL 1 and anti-IL 6 antibodies, our data do not support the suggestion that the above IL 1 effects can be attributed solely to IL 6

  8. Ion-electron recombination in merged-beams experiments

    International Nuclear Information System (INIS)

    In the present thesis, studies of recombination processes applying the technique of merged beams of fast ions and electrons are described. The main advantage of this technique is that the low relative velocity of ions and electrons necessary for these investigations can be achieved, at the same time as the velocity of the ions relative to the molecules of the residual gas is high. The high ion velocity leads to a very low reaction cross section for the leading contribution to the background signal, the capture of electrons in collisions with residual gas molecules. The experimental technique is described, emphasizing the electron beam velocity distribution and its relation to the energy resolution of the experiments. The presentation of the process of electron cooling is aimed at introducing this process as a tool for merged-beams experiments in storage rings rather than investigating the process itself. The non-resonant process of radiative recombination for non-fully stripped ions, showing evidence of incomplete screening is presented. Experimental investigation of dielectronic recombination is presented. Results of measurements of this process for He-like ions form the Aarhus single-pass experiment and the Heidelberg storage ring experiment are compared. Recombination is reduced from being the aim of the investigation to being a tool for high-precision measurements of the lifetimes of the 1s2s 3S metastable states of HE-like ions of boron, carbon, and nitrogen, performed at the Heidelberg storage ring. The experiment is concerned with the process of dissociative recombination of molecular hydrogen ions. The discussion of this experiment emphasizes the distribution of population on the different vibrational levels of the ions in the initial state. In particular, a laser photo-dissociation technique was introduced to reduce the number of initial levels in the experiment. (EG) 24 refs

  9. Effective conductance method for the primordial recombination spectrum (United States)

    Ali-Haïmoud, Yacine


    As atoms formed for the first time during primordial recombination, they emitted bound-bound and free-bound radiation leading to spectral distortions to the cosmic microwave background. These distortions might become observable in the future with high-sensitivity spectrometers, and provide a new window into physical conditions in the early universe. The standard multilevel atom method habitually used to compute the recombination spectrum is computationally expensive, impeding a detailed quantitative exploration of the information contained in spectral distortions thus far. In this work it is shown that the emissivity in optically thin allowed transitions can be factored into a computationally expensive but cosmology-independent part and a computationally cheap, cosmology-dependent part. The slow part of the computation consists in pre-computing temperature-dependent effective “conductances,” linearly relating line or continuum intensity to departures from Saha equilibrium of the lowest-order excited states (2s and 2p), that can be seen as “voltages.” The computation of these departures from equilibrium as a function of redshift is itself very fast, thanks to the effective multilevel atom method introduced in an earlier work. With this factorization, the recurring cost of a single computation of the recombination spectrum is only a fraction of a second on a standard laptop, more than four orders of magnitude shorter than standard computations. The spectrum from helium recombination can be efficiently computed in an identical way, and a fast code computing the full primordial recombination spectrum with this method will be made publicly available soon.

  10. Protective efficacy of a recombinant vaccinia virus in vaccinia-immune mice. (United States)

    Andrew, M E


    Recombinant viral vectors offer a potential means of vaccinating against diseases for which there are no current safe vaccines. One of the criteria on which a viral vaccine vector would be selected is that it either circulates in the human or livestock population without producing overt disease (e.g. adenovirus) or has a history as a safe vaccine (e.g. vaccinia virus). However, this selection criterion also means that the target population is likely to have circulating antibodies that are specific to the vaccine vector. Since a percentage of the world's population has been vaccinated during the World Health Organization's Smallpox Eradication Campaign, such antibody titres, which are likely to lower vaccine efficacy, have been raised as an objection to the use of recombinant vaccinia viruses as vaccines. We have tested the effect of vaccinia-specific immunity on the protective efficacy of a recombinant virus, VV-PR8-HA6 (1) which expresses the haemagglutinin of the influenza virus A/PR/8/34. PMID:2613281

  11. Serendipitous identification of natural Intergenotypic recombinants of hepatitis C in Ireland

    Directory of Open Access Journals (Sweden)

    Kenny-Walsh Elizabeth


    Full Text Available Abstract Background Recombination between hepatitis C single stranded RNA viruses is a rare event. Natural viable intragenotypic and intergenotypic recombinants between 1b-1a, 1a-1c and 2k-1b, 2i-6p, respectively, have been reported. Diagnostically recombinants represent an intriguing challenge. Hepatitis C genotype is defined by interrogation of the sequence composition of the 5' untranslated region [5'UTR]. Occasionally, ambiguous specimens require further investigation of the genome, usually by interrogation of the NS5B region. The original purpose of this study was to confirm the existence of a suspected mixed genotype infection of genotypes 2 and 4 by clonal analysis at the NS5B region of the genome in two specimens from two separate individuals. This initial identification of genotype was based on analysis of the 5'UTR of the genome by reverse line probe hybridisation [RLPH]. Results The original diagnosis of a mixed genotype infection was not confirmed by clonal analysis of the NS5B region of the genome. The phylogenetic analysis indicated that both specimens were natural intergenotypic recombinant forms of HCV. The recombination was between genotypes 2k and 1b for both specimens. The recombination break point was identified as occurring within the NS2 region of the genome. Conclusion The viral recombinants identified here resemble the recombinant form originally identified in Russia. The RLPH pattern observed in this study may be a signature indicative of this particular type of intergenotype recombinant of hepatitis C meriting clonal analysis of NS2.

  12. Numerical Modeling of Ocean Circulation (United States)

    Miller, Robert N.


    The modelling of ocean circulation is important not only for its own sake, but also in terms of the prediction of weather patterns and the effects of climate change. This book introduces the basic computational techniques necessary for all models of the ocean and atmosphere, and the conditions they must satisfy. It describes the workings of ocean models, the problems that must be solved in their construction, and how to evaluate computational results. Major emphasis is placed on examining ocean models critically, and determining what they do well and what they do poorly. Numerical analysis is introduced as needed, and exercises are included to illustrate major points. Developed from notes for a course taught in physical oceanography at the College of Oceanic and Atmospheric Sciences at Oregon State University, this book is ideal for graduate students of oceanography, geophysics, climatology and atmospheric science, and researchers in oceanography and atmospheric science. Features examples and critical examination of ocean modelling and results Demonstrates the strengths and weaknesses of different approaches Includes exercises to illustrate major points and supplement mathematical and physical details

  13. Some Aspects Concerning Convective Circulation Mode of Heat Transfer in Furnace to Wood Heat Treatment


    Nadia Potoceanu


    The paper presented the most aspects of convective circulate mode of heat transfer : heat transfer through the boundary layer formed at the surface of the heat generator; heat transfer in the heat carrier and heat transfer through the boundary layer formed at the heated surface

  14. Quark and gluon decay functions in QCD and recombination model

    International Nuclear Information System (INIS)

    Inclusive longitudinal-momentum distributions of pions in jets initiated by quarks and gluons are determined in perturbative QCD and recombination model. The quark and antiquark joint distributions in jets are first calculated in the leading-order approximation at high Q2. Gluons in the jets are completely converted to quark pairs. From the overall distribution q anti q pairs with definite quantum numbers then recombine to form pions. The recombination function for the process is well determined in the valon model. No adjustable parameters are involved in these calculations, and no data at low Q2 are used as phenomenological input. The result for the quark decay functions can be compared with data on e+e- annihilation, and the agreement is very good in both shape and normalization. Predictions for the gluon decay functions are presented, but they cannot yet be checked by experiments. The x and Q2 dependences of both types of decay functions have been parametrized in simple form suitable for use in theoretical and experimental applications. 17 figures, 1 table

  15. Heterogeneity in recombinant protein production

    DEFF Research Database (Denmark)

    Schalén, Martin; Johanson, Ted; Lundin, Luisa;


    A crucial step in biotechnology is the scale-up process. Normally, lab scale verification and optimization of production processes and strains are performed in small reactors with perfect mixing and hence the cells experience a homogenous environment. The gradients that occur in industrial scale...... bioreactors are often not taken into consideration in these experiments. Gradients occur due to insufficient mixing in the reactor, and affect the process in a variety of ways. When cells travel through the reactor and encounter different substrate concentrations, oxygen availability, pH, temperature, etc....... the cell physiology is affected. Cells are stressed, and this may severely affect growth, by-product accumulation, biomass yield and recombinant product yield. The stress caused by exposure to divergent microenvironments, genetic differences of individual cells, differing cell cycle stage and cell age...

  16. Interannual variability of the Adriatic Sea circulation (United States)

    Beg Paklar, Gordana; Sepic, Jadranka; Grbec, Branka; Dzoic, Tomislav; Kovac, Zarko; Ivatek-Sahdan, Stjepan


    The Regional Ocean Modeling System (ROMS) was implemented in order to reproduce interannual variability of the Adriatic Sea circulation. Simulations and model result analysis were performed for a three-year period from 1st January 2011 to 31st December 2013. ROMS model run was forced with realistic atmospheric fields obtained from meteorological model Aladin, climatological river discharges, tides and Mediterranean circulation imposed at the southern open boundary. Atmospheric forcing included momentum, heat and water fluxes calculated interactively from the Aladin surface fields during ROMS model simulations. Model results were compared with available CTD and ADCP measurements and discussed in the light of the climatological circulation and thermohaline properties of the Adriatic Sea and its coastal areas. Interannual variability in the Adriatic circulation is related to the prevailing atmospheric conditions, changes in the hydrological conditions and water mass exchange at the Otranto Strait. Basic features of the Adriatic circulation - basin-wide cyclonic circulation with several embedded smaller cyclonic gyres around main pits - are well reproduced by ROMS model. Modelled temperatures and salinities are within corresponding seasonal intervals, although measured profiles generally indicate stronger stratification than modelled ones. Summer circulation in 2011 with current reversal obtained along the eastern Adriatic coast was related to the sampling results of the early fish stages as well as to ARGO drifter movements. Simulated fields from the Adriatic scale model were used to prescribe the initial and open boundary conditions for the interannual simulation in the middle Adriatic coastal domain.

  17. Transfer line from the PSB to the PS (recombination)

    CERN Multimedia


    After sequential ejection of 5 bunches from each of the 4 rings of the Booster (originally 800 MeV, now 1.4 GeV), the 4 batches are brought to the same vertical level, so as to form a string of 20 bunches, filling the circumference of the PS. This vertical "recombination" is performed in the transfer line, using vertical bending magnets, septa and kickers. Here we see the section where the beam from ring 4 (the top one) is brought down to the level of ring 3, and the beam from ring 1 up to the level of ring 2. Further downstream (to the right, outside this picture), level 2 is brought up to level 3, identical to that of the PS. After this original recombination scheme, other ways of combining the 4 beams, vertically and/or longitudinally, were developed and used in operation.

  18. Effective conductance method for the primordial recombination spectrum

    CERN Document Server

    Ali-Haïmoud, Yacine


    As atoms formed for the first time during primordial recombination, they emitted bound-bound and free-bound radiation leading to spectral distortions to the cosmic microwave background. These distortions might become observable in the future with high-sensitivity spectrometers, and provide a new window into physical conditions in the early universe. The standard multilevel atom method habitually used to compute the recombination spectrum is computationally expensive, impeding a detailed quantitative exploration of the information contained in spectral distortions thus far. In this work it is shown that the emissivity in optically thin allowed transitions can be factored into a computationally expensive but cosmology-independent part and a computationally cheap, cosmology-dependent part. The slow part of the computation consists in pre-computing temperature-dependent effective "conductances", linearly relating line or continuum intensity to departures from Saha equilibrium of the lowest-order excited states (2...

  19. Genetically Engineered Poxviruses for Recombinant Gene Expression, Vaccination, and Safety (United States)

    Moss, Bernard


    Vaccinia virus, no longer required for immunization against smallpox, now serves as a unique vector for expressing genes within the cytoplasm of mammalian cells. As a research tool, recombinant vaccinia viruses are used to synthesize and analyze the structure--function relationships of proteins, determine the targets of humoral and cell-mediated immunity, and investigate the types of immune response needed for protection against specific infectious diseases and cancer. The vaccine potential of recombinant vaccinia virus has been realized in the form of an effective oral wild-life rabies vaccine, although no product for humans has been licensed. A genetically altered vaccinia virus that is unable to replicate in mammalian cells and produces diminished cytopathic effects retains the capacity for high-level gene expression and immunogenicity while promising exceptional safety for laboratory workers and potential vaccine recipients.

  20. Transgenic Expression of the Recombinant Phytase in Rice (Oryza sativa)

    Institute of Scientific and Technical Information of China (English)

    LIU Qiao-quan; LI Qian-feng; JIANG Li; ZHANG Da-jiang; WANG Hong-mei; GU Ming-hong; YAO Quan-hong


    In most of the cereal crop, phytic acid is the main storage form of phosphorus, which can decrease the bioavailability of phosphate. Transgenic expression of phytase is regarded as an efficient way to release phosphate from phytate in transgenic plants.In this study, a plant expression vector, containing the recombinant phytase gene driven by the maize ubiquitin (Ubi) promoter was constructed and introduced into an elite rice variety via Agrobacterium-mediated transformation. During the experiment, a total of 15 independent transgenic rice lines were regenerated. The results of PCR and Southern blot indicated that the target gene was integrated into the genome of transgenic rice plants. Moreover, the RT-PCR analysis of total RNAs extracted from the immature seeds of several transgenic lines showed that the recombinant phytase gene could be normally expressed. The inorganic phosphorus content, both in the mature seeds and the leaf was significantly higher in the transgenic plants than in the untransformed wild type.

  1. Cell biology of homologous recombination in yeast

    DEFF Research Database (Denmark)

    Eckert-Boulet, Nadine Valerie; Rothstein, Rodney; Lisby, Michael


    Homologous recombination is an important pathway for error-free repair of DNA lesions, such as single- and double-strand breaks, and for rescue of collapsed replication forks. Here, we describe protocols for live cell imaging of single-lesion recombination events in the yeast Saccharomyces...

  2. Recombinant organisms for production of industrial products


    Adrio, Jose-Luis; Demain, Arnold L.


    A revolution in industrial microbiology was sparked by the discoveries of ther double-stranded structure of DNA and the development of recombinant DNA technology. Traditional industrial microbiology was merged with molecular biology to yield improved recombinant processes for the industrial production of primary and secondary metabolites, protein biopharmaceuticals and industrial enzymes. Novel genetic techniques such as metabolic engineering, combinatorial biosynthesis and molecular breeding...

  3. Theoretic Study of CⅡ Recombination Line

    Institute of Scientific and Technical Information of China (English)

    彭永伦; 王民盛; 韩小英; 李家明


    Using the R-matrix method, we carry out theoretical calculations for recombination line λ 8794 A(3d'-3p') of CⅡ, which is important to estimate the abundances of carbon in planetary nebulae. Our calculations are based on three sets of target orbital basis, through which we elucidate the electron correlation and static polarization effects in the dielectronic recombination processes.

  4. Recombinant Vaccinia Virus: Immunization against Multiple Pathogens (United States)

    Perkus, Marion E.; Piccini, Antonia; Lipinskas, Bernard R.; Paoletti, Enzo


    The coding sequences for the hepatitis B virus surface antigen, the herpes simplex virus glycoprotein D, and the influenza virus hemagglutinin were inserted into a single vaccinia virus genome. Rabbits inoculated intravenously or intradermally with this polyvalent vaccinia virus recombinant produced antibodies reactive to all three authentic foreign antigens. In addition, the feasibility of multiple rounds of vaccination with recombinant vaccinia virus was demonstrated.

  5. Electron-ion recombination at low energy

    International Nuclear Information System (INIS)

    The work is based on results obtained with a merged-beams experiment. A beam of electronics with a well characterized density and energy distribution was merged with a fast, monoenergetic ion beam. Results have been obtained for radiative recombination and dielectronic recombination at low relative energies (0 to ∼70eV). The obtained energy resolution was improved by about a factor of 30. High vacuum technology was used to suppress interactions with electrons from the environments. The velocity distribution of the electron beam was determined. State-selective dielectronic-recombination measurements were performable. Recombination processes were studied. The theoretical background for radiative recombination and Kramers' theory are reviewed. The quantum mechanical result and its relation to the semiclassical theory is discussed. Radiative recombination was also measured with several different non-bare ions, and the applicability of the semiclassical theory to non-bare ions was investigated. The use of an effective charge is discussed. For dielectronic recombination, the standard theoretical approach in the isolated resonance and independent-processes approximation is debated. The applicability of this method was tested. The theory was able to reproduce most of the experimental data except when the recombination process was sensitive to couplings between different electronic configurations. The influence of external perturbing electrostatic fields is discussed. (AB) (31 refs.)

  6. Recombinant Swinepox Virus for Veterinary Vaccine Development. (United States)

    Fan, Hong-Jie; Lin, Hui-Xing


    Poxvirus-vectors have been widely used in vaccine development for several important human and animal diseases; some of these vaccines have been licensed and used extensively. Swinepox virus (SPV) is well suited to develop recombinant vaccines because of its large packaging capacity for recombinant DNA, its host range specificity, and its ability to induce appropriate immune responses. PMID:26458836

  7. Development of CO2 circulators

    International Nuclear Information System (INIS)

    The development of the basic machine types we have supplied has not been without problems. The Windscale AGR (the prototype AGR) was a small 1.2 MW vertically up circulator with an inlet temperature of 237 deg. C (459 deg. F). Oil leakage problems occurred and were cured in the works test facility and the machine went into service with no other problems. The Horizontal 5 MW machines for Hinkley/Hunterston were not so fortunate with vibration problems, interface corrosion problems (effecting the whole reactor) and material dimensional stability problems. Oil ingress problems did not show up in test work but were later reported from site. These reports were initially exagerated due to the measuring techniques which took the operators some time to resolve. In the vertical 5 MW machines for Hartlepool and Heysham 1 there are two interesting factors, firstly a spar failure and secondly shaft axial stability. Many of the problems were due to modifications at site or our inability to model all aspects of site installation from which lessons for the future can be learned. The latest stations Torness and Heysham II incorporate these lessons. The machines have been designed with so much margin that during the resolution of the reactor control rod gag problems the machines were run continuously at 20% overload (6.3 MW). From an initial accident case of 350 deg. C inlet temperature, this increased to 458 deg. C and now stands at 585 deg. C. No modifications to the impeller were required. The site experience to date is good with no operational problems reported. (author). 4 figs

  8. Complete Genome Sequence of a Novel Natural Recombinant H5N5 Influenza Virus from Ducks in Central China


    Zou, Wei; Guo, Xuebo; Li, Shuyun; Yang, Ying; Jin, Meilin


    We reported the complete genome sequence of an H5N5 avian influenza virus (AIV) that was first isolated from duck in central China in 2010. Genomic sequence and phylogenetic analyses showed that this virus was a recombinant between H5N1 AIV circulated in southeastern Asia and an N5 subtype influenza virus. These data are beneficial for investigating the epidemiology and ecology of AIVs in central China.

  9. Thrombolysis in anterior versus posterior circulation strokes: timing of recanalization, ischemic tolerance, and other differences. (United States)

    Pagola, Jorge; Ribo, Marc; Alvarez-Sabin, José; Rubiera, Marta; Santamarina, Estevo; Maisterra, Olga; Delgado-Mederos, Raquel; Ortega, Gemma; Quintana, Manuel; Molina, Carlos A


    Previous studies have suggested a greater ischemic tolerance in posterior circulation as compared to anterior cerebral circulation. We aimed to investigate whether a differential response exists between anterior and posterior circulation strokes. Two hundred and four middle cerebral artery (MCA) patients and 28 basilar artery occlusion (BAO) patients treated with intravenous recombinant tissue plasminogen activator were included. Transcranial Doppler assessed recanalization at different time points. Patients were divided in three groups: total time of ischemia (TTI)24 hours. We calculated the percentage of recovery (admission National Institutes of Health Stroke Scale [NIHSS]- discharge NIHSS/admission NIHSS)×100. Mean time to treatment was longer in BAO patients (P=.031). Early recanalization was more frequent among MCA occlusions (41% vs 29%; P=.039); the rate of persisting occlusion at 24 hours was similar (P=.933). Clinical recovery according to TTI was similar in each group: 24 hours: BAO -44%/MCA 11% (P=.23). For each hour of ischemia MCA patients worsened 1.78% (P=.035) and BAO 1.76% (P=.421). MCA occlusions compared to BAO were independently associated with hemorrhagic transformation (OR: 8.2; P=.043). Our data do not support the theory of increased ischemic tolerance in posterior circulation. Despite longer time-to-treatment, BAO were more resistant to hemorrhagic transformations. PMID:20040010

  10. Contrasting roles of interallelic recombination at the HLA-A and HLA-B loci

    Energy Technology Data Exchange (ETDEWEB)

    Hughes, A.L.; Hughes, M.K. (Pennsylvania State Univ., University Park (United States)); Watkins, D.I. (Univ. of Wisconsin, Madison (United States))


    A statistical study of DNA sequences of alleles at the highly polymorphic class I MHC loci of humans, HLA-A and HLA-B, showed evidence of both large-scale recombination events(involving recombination of exons 1-2 of one allele with exons 3-8 of another) and small scale recombination events (involving apparent exchange of short DNA segments). The latter events occurred disproportionately in the region of the gene encoding the antigen recognition site (ARS) of the class I molecule. Furthermore, they involved the ARS codons which are under the strongest selection favoring allelic diversity at the amino acid level. Thus, the frequency of recombinant alleles appears to have been increased by some form of balancing selection (such as overdominant selection) favoring heterozygosity in the ARS. These analyses also revealed a striking difference between the A and B loci. Recombination events appear to have occurred about twice as frequently at the B locus, and recombinants at the B locus were significantly more likely to affect polymorphic sites in the ARS. At the A locus, there are well-defined allelic lineages that have persisted since prior to the human-chimpanzee divergence; but at the B locus, there is no evidence for such long-lasting allelic lineages. Thus, relatively frequent interallelic recombination has apparently been a feature of the long-term evolution of the B locus but not of the A locus. 45 refs., 4 figs., 5 tabs.

  11. Recombination in Glomus intraradices, a supposed ancient asexual arbuscular mycorrhizal fungus

    Directory of Open Access Journals (Sweden)

    Sanders Ian R


    Full Text Available Abstract Background Arbuscular mycorrhizal fungi (AMF are important symbionts of most plant species, promoting plant diversity and productivity. This symbiosis is thought to have contributed to the early colonisation of land by plants. Morphological stasis over 400 million years and the lack of an observed sexual stage in any member of the phylum Glomeromycota led to the controversial suggestion of AMF being ancients asexuals. Evidence for recombination in AMF is contradictory. Results We addressed the question of recombination in the AMF Glomus intraradices by sequencing 11 polymorphic nuclear loci in 40 morphologically identical isolates from one field. Phylogenetic relationships among genotypes showed a reticulate network pattern providing a rationale to test for recombination. Five statistical tests predicted multiple recombinant regions in the genome of a core set of isolates. In contrast, five clonal lineages had fixed a large number of differences. Conclusion Our data show that AMF from one field have undergone recombination but that clonal lineages coexist. This finding has important consequences for understanding AMF evolution, co-evolution of AMF and plants and highlights the potential for commercially introduced AMF inoculum recombining with existing local populations. Finally, our results reconcile seemingly contradictory studies on whether AMF are clonal or form recombining populations.

  12. Molecular requirements for radiation-activated recombination

    International Nuclear Information System (INIS)

    Purpose/Objective: The major stumbling block to successful gene therapy today is poor gene transfer. We hypothesized that ionizing radiation might activate cellular recombination, and so improve stable gene transfer. We further hypothesized that known DNA-damage-repair proteins might also be important in radiation-activated recombination. Materials and Methods: The effect of irradiation on stable gene transfer efficiency was determined in human (A549 and 39F) and rodent (NIH/3T3) cell lines. Continuous low dose rate and multiple radiation fractions were also tested. Nuclear extracts were made and the effect of irradiation on inter-plasmid recombination/ligation determined. Multiple DNA damage-repair deficient cell lines were tested for radiation-activated recombination. Results: A significant radiation dose-dependent improvement in stable plasmid transfection (by as much as 1300 fold) is demonstrated in neoplastic and primary cells. An improvement in transient plasmid transfection is also seen, with as much as 85% of cells transiently expressing b-galactosidase (20-50 fold improvement). Stable transfection is only improved for linearized or nicked plasmids. Cells have improved gene transfer for at least 96 hours after irradiation. Both fractionated and continuous low dose rate irradiation are effective at improving stable gene transfer in mammalian cells, thus making relatively high radiation dose delivery clinically feasible. Inter-plasmid recombination is radiation dose dependent in nuclear extract assays, and the type of overhang (3', 5' or blunt end) significantly affects recombination efficiency and the type of product. The most common end-joining activity involves filling-in of the overhang followed by blunt end ligation. Adenovirus is a linear, double stranded DNA virus. We demonstrate that adenoviral infection efficiency is increased by irradiation. The duration of transgene expression is lengthened because the virus integrates with high efficiency (∼10

  13. Natural Circulation Performance in Nuclear Power Plants

    International Nuclear Information System (INIS)

    The present paper deals with a study of natural circulation in PWR systems, The study consists of two parts: in the first one, natural circulation in experimental facilities simulating PWR plants was analyzed. This made it possible to gather a broad data base which was assumed as a reference for the subsequent part of the research. Seven Nuclear Power Plants nodalizations and additional experimental data from ''non-PWR'' facilities have been considered in the second part of the paper. Conclusions are drawn about natural circulation capabilities derived for the seven Nuclear Power Plants nodalizations and from data base pertinent to three ''non-PWR'' facilities. (author)

  14. Natural circulation performance in nuclear power plants

    International Nuclear Information System (INIS)

    The present paper deals with a study of natural circulation in PWR systems. The study consists of two parts: in the first one, natural circulation in experimental facilities simulating PWR plants was analysed. This made it possible to gather a broad data base which was assumed as a reference for the subsequent part of the research. Seven Nuclear Power Plants nodalization and additional experimental data from 'non-PWR' facilities have been considered in the second part of the paper. Conclusions are drawn about natural circulation capabilities derived for the seven Nuclear Power Plants nodalization and from data base pertinent to three 'non-PWR' facilities. (author)

  15. General Circulation Modeling of the Jovian stratosphere (United States)

    Sethunadh, J.; Medvedev, A. S.; Hartogh, P.


    The middle atmosphere of Jupiter (1 bar to 1 μ bar) is primarily driven by the heat generated in the interior and by radiative heating and cooling. The stratosphere of Jupiter is less studied, and the mechanisms behind many observed phenomena (e.g.,QQO) in the middle atmosphere as well as the stratospheric circulation patterns remain unknown. We have developed a new General Circulation Model (GCM) to simulate the middle atmospheres of gas giants, which can give important insights to the stratospheric circulation and to the physical and dynamical processes underlying the observed middle atmospheric phenomena.

  16. Circulating miRNA and cancer diagnosis

    Institute of Scientific and Technical Information of China (English)


    miRNAs are a class of small RNA molecules with regulatory function, and play an important role in tumor development and progression. It has been demonstrated that tumor-derived miRNAs exist in the circulating nucleic acids of cancer patients. This phenomenon implies that detection of the circulating miRNA may be an effective method for non-invasive diagnosis of cancer. In this review, we summarize the applications of the circulating miRNA as biomarkers in cancer diagnosis, as well as the latest research progress in this area.

  17. V(D)J recombination deficiencies. (United States)

    de Villartay, Jean-Pierre


    V(D)J recombination not only comprises the molecular mechanism that insures diversity of the immune system but also constitutes a critical checkpoint in the developmental program of B- and T-lymphocytes. The analysis of human patients with Severe Combined Immune Deficiency (SCID) has contributed to the understanding of the biochemistry of the V(D)J recombination reaction. The molecular study V(D)J recombination settings in humans, mice and in cellular mutants has allowed to unravel the process of Non Homologous End Joining (NHEJ), one of the key pathway that insure proper repair of DNA double strand breaks (dsb), whether they occur during V(D)J recombination or secondary to other DNA injuries. Two NHEJ factors, Artemis and Cernunnos, were indeed discovered through the study of human V(D)J recombination defective human SCID patients. PMID:19731800

  18. Stress analysis of passive hydrogen autocatalytic recombiner

    International Nuclear Information System (INIS)

    Background: Passive hydrogen autocatalytic recombiner is a device for eliminating hydrogen in the containment of the nuclear power plant when severe accident occurs, avoiding hydrogen explosion. After the Fukushima nuclear accident, the nuclear power plants pay more attention to the role of Passive hydrogen autocatalytic recombiner. Purpose: This paper studies the stresses of passive hydrogen autocatalytic recombiner under the seismic and LOCA conditions, Methods: Modeling by using the finite element software ANSYS, the impacts of airflow load under the LOCA conditions are considered reasonably and the strength of passive hydrogen autocatalytic recombiner is also evaluated according RCC-M, Results: The results show that the model can meet the requirement of the standard document. Conclusions: This paper will provide technical support for stress analysis and evaluation of passive hydrogen autocatalytic recombiner. (authors)

  19. Form Matters


    Hedegaard Larsen, Morten


    This thesis investigates the reasons for our (in the Western World) preference for shopping (for food) in supermarkets? What social and performative historical developments might explain this preference? And what are the consequences of this preference? Historical descriptions of the performativity of the food market from the first Agora’s to the supermarkets of the 21st century as well as from theatre’s and Western performance spaces will form the comparative analytical basis, together wi...

  20. Vaccine escape recombinants emerge after pneumococcal vaccination in the United States.

    Directory of Open Access Journals (Sweden)

    Angela B Brueggemann


    Full Text Available The heptavalent pneumococcal conjugate vaccine (PCV7 was introduced in the United States (US in 2000 and has significantly reduced invasive pneumococcal disease; however, the incidence of nonvaccine serotype invasive disease, particularly due to serotype 19A, has increased. The serotype 19A increase can be explained in part by expansion of a genotype that has been circulating in the US prior to vaccine implementation (and other countries since at least 1990, but also by the emergence of a novel "vaccine escape recombinant" pneumococcal strain. This strain has a genotype that previously was only associated with vaccine serotype 4, but now expresses a nonvaccine serotype 19A capsule. Based on prior evidence for capsular switching by recombination at the capsular locus, the genetic event that resulted in this novel serotype/genotype combination might be identifiable from the DNA sequence of individual pneumococcal strains. Therefore, the aim of this study was to characterise the putative recombinational event(s at the capsular locus that resulted in the change from a vaccine to a nonvaccine capsular type. Sequencing the capsular locus flanking regions of 51 vaccine escape (progeny, recipient, and putative donor pneumococci revealed a 39 kb recombinational fragment, which included the capsular locus, flanking regions, and two adjacent penicillin-binding proteins, and thus resulted in a capsular switch and penicillin nonsusceptibility in a single genetic event. Since 2003, 37 such vaccine escape strains have been detected, some of which had evolved further. Furthermore, two new types of serotype 19A vaccine escape strains emerged in 2005. To our knowledge, this is the first time a single recombinational event has been documented in vivo that resulted in both a change of serotype and penicillin nonsusceptibility. Vaccine escape by genetic recombination at the capsular locus has the potential to reduce PCV7 effectiveness in the longer term.

  1. High-resolution structure of the recombinant sweet-tasting protein thaumatin I

    International Nuclear Information System (INIS)

    The structure of a recombinant form of the sweet-tasting protein thaumatin I was determined at 1.1 Å resolution and refined to an Rwork of 9.1% and an Rfree of 11.7%. Comparisons with plant thaumatin revealed the electron density of recombinant thaumatin I to be significantly improved, especially around Asn46 and Ser63. Thaumatin, an intensely sweet-tasting plant protein, elicits a sweet taste at a concentration of 50 nM. The crystal structure of a recombinant form of thaumatin I produced in the yeast Pichia pastoris has been determined to a resolution of 1.1 Å. The model was refined with anisotropic B parameters and riding H atoms. A comparison of the diffraction data and refinement statistics for recombinant thaumatin I with those for plant thaumatin I revealed no significant differences in the diffraction data. The R values for recombinant thaumatin I and plant thaumatin I (Fo > 4σ) were 9.11% and 9.91%, respectively, indicating the final model to be of good quality. Notably, the electron-density maps around Asn46 and Ser63, which differ between thaumatin variants, were significantly improved. Furthermore, a number of H atoms became visible in an OMIT map and could be assigned. The high-quality structure of recombinant thaumatin with H atoms should provide details about sweetness determinants in thaumatin and provide valuable insights into the mechanism of its interaction with taste receptors

  2. EOP MIT General Circulation Model (MITgcm) (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This data contains a regional implementation of the Massachusetts Institute of Technology general circulation model (MITgcm) at a 1-km spatial resolution for the...

  3. Global warming and changes in ocean circulation

    Energy Technology Data Exchange (ETDEWEB)

    Duffy, P.B.; Caldeira, K.C.


    This final report provides an overview of the goals and accomplishments of this project. Modeling and observational work has raised the possibility that global warming may cause changes in the circulation of the ocean. If such changes would occur they could have important climatic consequences. The first technical goal of this project was to investigate some of these possible changes in ocean circulation in a quantitative way, using a state-of -the-art numerical model of the ocean. Another goal was to develop our ocean model, a detailed three-dimensional numerical model of the ocean circulation and ocean carbon cycles. A major non-technical goal was to establish LLNL as a center of excellence in modelling the ocean circulation and carbon cycle.

  4. Sedimentary response to ocean gateway circulation changes (United States)

    Heinze, Christoph; Crowley, Thomas J.


    Previous modeling studies suggested that changes in ocean gateways may have exerted a dramatic influence on the ocean circulation. In this pilot study we extend those results to examining the potential ramifications of circulation changes on the sedimentary record. A version of the Hamburg carbon cycle/sediment model is used in these sensitivity experiments. Results indicate that internal reorganization of the ocean circulation can potentially cause very large regional changes in lysocline depth (1500-3000 m) and opal deposition. These shifts are sometimes comparable in magnitude to those imposed by changes in external forcing (e.g., climate, sea level, and weathering). Comparisons of the model response with the geologic record indicate some significant levels of first-order agreement. This exercise suggests that opportunities now exist for physically based modeling of past sediment responses to circulation and climate changes.

  5. GCFR main helium circulator and electric drive

    International Nuclear Information System (INIS)

    One of the major objectives of the helium circulators for the gas-cooled fast breeder reactor (GCFR) is to achieve the highest possible operational reliability. This is no simple task considering the plant system integration requirements, auxiliary support systems, all possible transient requirements, and resulting complexity in supplying the driving power, primary coolant flow control, and lubrication and sealing. Therefore, the design of the circulator itself is highly dependent on the type of prime mover selected to drive the circulator, e.g., series turbine, parallel turbine, or electric motor. The circulator main drive has evolved from the series steam turbine drive into the variable-speed, synchronous electric motor drive mounted externally to the reactor and controlled by thyristor variable frequency controller. This design is a result of 18 months of joint effort by General Atomic Company and Westinghouse Electric Corporation

  6. Ku86 deficiency leads to reduced intrachromosomal homologous recombination in vivo in mice. (United States)

    Reliene, Ramune; Bishop, Alexander J R; Li, Gloria; Schiestl, Robert H


    Ku70 and Ku86 together with DNA-PKcs form the DNA-dependent protein kinase (DNA-PK) complex that is involved in DNA double-strand break repair by nonhomologous end joining. We investigated the effect of Ku86 mutation on intrachromosomal homologous recombination (HR) resulting in deletions in vivo in mice. We quantified such deletion events using a phenotypic pigmentation assay. Deletion of one copy of a 70 kb DNA duplication in the pink-eyed unstable (pun) allele results in reversion to the wildtype pink-eyed dilution (p) gene, allowing black pigment accumulation in cells of the retinal pigment epithelium (RPE). We found that the frequency of homologous recombination was significantly reduced in Ku86 deficient mice. Furthermore, the proliferation of cells in which recombination events occurred was reduced and developmentally delayed in the Ku86 deficient mice. These data indicate a role for Ku86 directly or indirectly in homologous recombination in vivo. PMID:14706343

  7. Three-dimensional decomposition method of global atmospheric circulation

    Institute of Scientific and Technical Information of China (English)


    By adopting the idea of three-dimensional Walker, Hadley and Rossby stream functions, the global atmospheric circulation can be considered as the sum of three stream functions from a global per- spective. Therefore, a mathematical model of three-dimensional decomposition of global atmospheric circulation is proposed and the existence and uniqueness of the model are proved. Besides, the model includes a numerical method leading to no truncation error in the discrete three-dimensional grid points. Results also show that the three-dimensional stream functions exist and are unique for a given velocity field. The mathematical model shows the generalized form of three-dimensional stream func- tions equal to the velocity field in representing the features of atmospheric motion. Besides, the vertical velocity calculated through the model can represent the main characteristics of the vertical motion. In sum, the three-dimensional decomposition of atmospheric circulation is convenient for the further in- vestigation of the features of global atmospheric motions.

  8. Natural circulation in PWR for asymmetric secondary conditions

    International Nuclear Information System (INIS)

    Natural circulation in the primary loop of PWRs offers an essential means of removing the shutdown decay heat during accidents and is an important safety issue due to its passive mechanism. The flow is driven by the buoyancy force arisen by the average coolant density difference between the heat source and the heat sink. In order to examine the thermal-hydraulic behavior and heat removal capability by the natural circulation of system in transients or accident conditions, the experimental facility (SNUF) is constructed on the model of KORI unit 1 and 2 with the scaling factor of 1/710 by volume. With SNUF, a series of experiments is performed to understand the characteristics of natural circulation. Form the steady-state experiments, it is turned out that the loop mass flow rate is in pro potion to core power and to reciprocal of loop temperature difference. From the transient experiments, the core heat can be removed for active secondary heat sinks including the condition that one steam generator degrades its heat removal capability such as feed line break accident or loss of normal feedwater

  9. The Atlantic Meridional Overturning Circulation's Response to Variable Buoyancy Forcing (United States)

    Butler, Edward; Oliver, Kevin; Hirschi, Joël


    The Meridional Overturning Circulation (MOC) is a large-scale global circulation of water (and heat) throughout the world's ocean. It is an integral part of the climate system, responsible for significant anomalous warming of the North Atlantic region. Much of our current understanding of the MOC is based on equilibrium theories. However, the MOC is not a steady circulation and exhibits variability across a broad range of timescales. We examine the transient response of global ocean overturning, with particular emphasis on the Atlantic MOC (AMOC), to periodic variations in the North Atlantic meridional density gradient on decadal, centennial, and millennial timescales within the Nucleus for European Modelling of the Ocean (NEMO) model framework. We use the ORCA2 global ocean configuration of NEMO (with realistic topography and a horizontal resolution of 2°) and impose periodic variations in air temperature over the North Atlantic. In response, we see large oscillations in the strength of the AMOC which peak in magnitude at 128-year timescales. A scaling relationship of the form Ψ ~ ΔρH2 (in which Δρ is a measure of meridional density gradient and H is the depth scale of maximal overturning) is found to hold for the AMOC in these transient simulations with strongest correlations observed at centennial timescales. We explore the validity of this scaling relationship across a broad range of spatial and temporal scales and discuss its validity in a global context.

  10. Automorphic Forms

    DEFF Research Database (Denmark)

    von Essen, Flemming Brændgaard

    Hecke characters in the points 4 and 6. It is well known, that all zeros of the Eisenstein series Ek wrt. SL2(Z) in the standard fundamental domain has modulus 1. We show that this is also true for #n Ek, where # is a certain differential operator. We then proceed to study logarithms of multiplier...... systems. For automorphic forms wrt. Hecke triangle groups and Fuchsian groups with no elliptic elements and genus 0, we show that some logarithms of multiplier systems can be interpreted as a linking number. Finally we show a "twisted" version of the prime geodesics theorem, and logarithms of multiplier...

  11. Towards personalised therapy for von Willebrand disease: a future role for recombinant products. (United States)

    Favaloro, Emmanuel J


    von Willebrand disease (VWD) is reportedly the most common bleeding disorder and is caused by deficiencies and/or defects in the adhesive plasma protein von Willebrand factor (VWF). Functionally, normal VWF prevents bleeding by promoting both primary and secondary haemostasis. In respect to primary haemostasis, VWF binds to both platelets and sub-endothelial matrix components, especially collagen, to anchor platelets to damaged vascular tissue and promote thrombus formation. VWF also stabilises and protects factor VIII in the circulation, delivering FVIII to the site of injury, which then facilitates secondary haemostasis and fibrin formation/thrombus stabilisation. As a result of this, patients with VWD suffer a bleeding diathesis reflective of a primary defect caused by defective/deficient VWF, which in some patients is compounded by a reduction in FVIII. Management of VWD, therefore, chiefly entails replacement of VWF, and sometimes also FVIII, to protect against bleeding. The current report principally focuses on the future potential for "personalised" management of VWD, given the emerging options in recombinant therapies. Recombinant VWF has been developed and is undergoing clinical trials, and this promising therapy may soon change the way in which VWD is managed. In particular, we can envisage a personalised treatment approach using recombinant VWF, with or without recombinant FVIII, depending on the type of VWD, the extent of deficiencies, and the period and duration of treatment. PMID:27136426

  12. Complete genomic sequence analysis of infectious bronchitis virus Ark DPI strain and its evolution by recombination

    Directory of Open Access Journals (Sweden)

    Gelb Jack


    Full Text Available Abstract An infectious bronchitis virus Arkansas DPI (Ark DPI virulent strain was sequenced, analyzed and compared with many different IBV strains and coronaviruses. The genome of Ark DPI consists of 27,620 nucleotides, excluding poly (A tail, and comprises ten open reading frames. Comparative sequence analysis of Ark DPI with other IBV strains shows striking similarity to the Conn, Gray, JMK, and Ark 99, which were circulating during that time period. Furthermore, comparison of the Ark genome with other coronaviruses demonstrates a close relationship to turkey coronavirus. Among non-structural genes, the 5'untranslated region (UTR, 3C-like proteinase (3CLpro and the polymerase (RdRp sequences are 100% identical to the Gray strain. Among structural genes, S1 has 97% identity with Ark 99; S2 has 100% identity with JMK and 96% to Conn; 3b 99%, and 3C to N is 100% identical to Conn strain. Possible recombination sites were found at the intergenic region of spike gene, 3'end of S1 and 3a gene. Independent recombination events may have occurred in the entire genome of Ark DPI, involving four different IBV strains, suggesting that genomic RNA recombination may occur in any part of the genome at number of sites. Hence, we speculate that the Ark DPI strain originated from the Conn strain, but diverged and evolved independently by point mutations and recombination between field strains.

  13. Development of a simple and rapid protocol for the production of customized intertypic recombinant polioviruses. (United States)

    Bessaud, Maël; Delpeyroux, Francis


    The three attenuated strains Sabin are used as oral vaccine to immunize against poliomyelitis in many countries. Low vaccine coverage can allow these strains to circulate among non-immunized people, accumulating genetic modifications through nucleotide substitutions and recombination with non-polio enteroviruses. These modifications can induce a loss of attenuation, so promoting the emergence of pathogenic vaccine-derived polioviruses responsible for poliomyelitis outbreaks. In vitro-engineered chimeric viruses containing both Sabin and non-polio sequences constitute a powerful tool for understanding the constraints that drive and limit the recombination events between the Sabin strains and other enteroviruses and to understand the consequences on the viral phenotypic properties of substitutions of large genomic regions due to recombination events. A method was optimized that allowed the rapid production of customized Sabin-derived viruses. By using sequences from Sabin 2 and 3 polioviruses and from non-polio field enteroviruses, several recombinant genomes were engineered by using fusion PCR. The corresponding viruses were recovered after cell transfection. This method was found able to generate rapidly a wide range of unnatural viruses with multiple breakpoints that can be chosen precisely. Furthermore, this method is also suitable to engineer nucleotide deletions, insertions and/or substitutions within a given genome, so increasing the number of unnatural viruses that can be studied. PMID:22939977

  14. A coupled, zonally averages atmosphere-ocean model: Variability of the thermohaline circulation

    International Nuclear Information System (INIS)

    Two experiments with a recently developed zonally averaged climate model which includes the ocean's thermohaline circulation are performed. The first experiment simulates a global thermohaline circulation in which deep water is formed in the North Atlantic, flows as a deep current into the Pacific basin and then upwells. The water is returned as a near-surface flow through the Indian Ocean into the South Atlantic. The present model reproduces a global deep circulation under present-day forcing and shows that the zonal atmospheric water vapor transport is of importance. The second experiment studies the effect of glacial meltwater runoff at different latitudes on the thermohaline circulation, meridional heat flux and surface air temperature. Depending on the strength and position of the forcing anomaly, severe cooling can be observed in high northern latitudes. The mechanism may provide further insight into the Younger Dryas climate event


    Institute of Scientific and Technical Information of China (English)

    Yurui Lin; Linzhang Lu


    In this paper,we present a useful result on the structures of circulant inverse Mis not a positive matrix and not equal to c0I,then A is an inverse M-matrix if and only if there exists a positive integer k,which is a proper factor of n,such that cjk>0 for The result is then extended to the so-called generalized circulant inverse M-matrices.

  16. Dynamic Transition Theory for Thermohaline Circulation


    Ma, Tian; Wang, Shouhong


    The main objective of this and its accompanying articles is to derive a mathematical theory associated with the thermohaline circulations (THC). This article provides a general transition and stability theory for the Boussinesq system, governing the motion and states of the large-scale ocean circulation. First, it is shown that the first transition is either to multiple steady states or to oscillations (periodic solutions), determined by the sign of a nondimensional parameter $K$, depending o...

  17. Efficient Circulation of Railway Rolling Stock


    Alfieri, Arianna; Groot, Rutger; Kroon, Leo; Schrijver, Lex


    textabstractRailway rolling stock (locomotives, carriages, and train units) is one of the most significant cost sources for operatorsof passenger trains, both public and private. Rolling stock costsare due to material acquisition, power supply, and material maintenance. The efficient circulation of rolling stock material is therefore one of the objectives pursued. In this paper we focus on the circulation of train units on a single line. In order to utilize the train units on this line in an ...

  18. The Nordic Seas circulation and exchanges.


    Hawker, E.J.


    The Nordic Seas provide the main oceanic connection between the Arctic and the deep global oceans via dense overflows between Greenland and Scotland, into the North Atlantic. An understanding of the circulation and exchanges of this region is vital for any consideration of the implications of high latitude climate change to variability in the Atlantic thermohaline circulation and consequences for regional (European) climate. This thesis makes use of a unique data set of near synoptic hyd...

  19. Local phenomena associated with natural circulation

    International Nuclear Information System (INIS)

    The objective of this lecture is to impart to the participants an adequate knowledge of various phenomena encountered in the natural circulation systems of a nuclear reactor. All the components of the primary system of a nuclear reactor are described and phenomena occurring in each of them are explained. A comprehensive coverage of related thermohydraulic relationships is provided which will enable the participants to carryout the process design of a natural circulation system. (author)

  20. Southern Meridional Atmospheric Circulation Associated with IOD

    Institute of Scientific and Technical Information of China (English)

    LIU Na; CHEN Hongxia


    Using the monthly wind and sea surface temperature (SST) data, southern meridional atmospheric circulation cells associated with the Indian Ocean Dipole Mode (IOD) events in the Indian Ocean are for the first time described and examined. The divergent wind and pressure vertical velocity are employed for the identification of atmospheric circulation cells. During the four different phases of the positive IOD events, the anomalous meridional Hadley circulation over the western Indian Ocean shows that the air rises in the tropics, flows poleward in the upper troposphere, sinks in the subtropics, and returns back to the tropics in the lower troposphere. The anomalous Hadley circulation over the eastern Indian Ocean is opposite to that over the western Indian Ocean. During positive IOD events, the meridional Hadley circulation over the eastern Indian Ocean is weakened while it is strengthened over the western Indian Ocean. Correlation analysis between the IOD index and the indices of the Hadley cells also proves that, the atmospheric circulation patterns are evident in every IOD event over the period of record.

  1. Enceladus' Interior: A Liquid Circulation Model (United States)

    Matson, Dennis L.; Johnson, Torrence; Lunine, Jonathan; Castillo-Rogez, Julie

    We are studying a model for Enceladus' interior in which the water, gas, dust and heat are supplied to the plumes by a relatively deeply circulating brine solution. Data indicates such a source for the erupting material. On the basis of ammonia in the plume gas Waite et al. [1] suggested that the jets might originate from a liquid water region under Enceladus' icy surface. Postberg et al. [2] noted that the presence of ". . . grains that are rich in sodium salts (0.5-2 percent by mass). . . can arise only if the plumes originate from liquid water." Waite et al. [1] also regard the some of the plume chemicals as evidence for interactions with an ice layer presumably overlying the liquid water reservoir. They suggest that this could be in the form of dissociation of clathrate hydrates [3]. Additionally, there is a large heat flow of more than 15 GW [4, 5] coming out of Enceladus' south polar region. We consider a model that brings heat and chemical species up to the surface from a reservoir or "ocean" located below the ice crust that may be many tens of kilometers thick. Water transits to the surface via vertical conduits. The Cassini INMS data suggest that the water has a relatively large gas content of order a few percent. As the water travels upward and the pressure is released, exolving gases form bubbles. Since the bubbly liquid is less dense than the ice, it moves upward. (This part of the model is a variant of the "Perrier Ocean" Europa model of Crawford and Stevenson [6]. A similar model was studied for Ganymede by Murchie and Head [7].) Postberg et al. [2] model the plume eruptions that result from the water, gases, salts, and other chemicals that our circulation model provides. In the near-surface reservoir feeding the plumes, bubbles reaching the surface of the water pop and throw a very fine spray. Some of these very small droplets of brine exit with the plume gas and provide the observed salt-rich dust particles [2]. Much of the water-borne heat is

  2. Global climate and ocean circulation on an aquaplanet ocean-atmosphere general circulation model


    Smith, R.; Dubois, C.; Marotzke, J.


    A low-resolution coupled ocean–atmosphere general circulation model (OAGCM) is used to study the characteristics of the large-scale ocean circulation and its climatic impacts in a series of global coupled aquaplanet experiments. Three configurations, designed to produce fundamentally different ocean circulation regimes, are considered. The first has no obstruction to zonal flow, the second contains a low barrier that blocks zonal flow in the ocean at all latitudes, creating a single enclosed ...

  3. Recombination of cold electrons with cooled ions

    International Nuclear Information System (INIS)

    Recombination, one of the possible reactions of cold electrons with ions, has several important applications, besides being of fundamental interest. Astrophysical objects are studied through their radiation spectra emitted from electron-ion recombination. Plasma modeling and diagnostics are based on the knowledge of recombination cross sections. It is the proposed mechanism for anti-hydrogen production in a trap filled with antiprotons and positrons. The most fundamental process of recombination is radiative recombination (RR): Zq+ + e→ Z(q-1)+ + hν. Here, we discuss measurements of recombination rate coefficients in absolute scale between free electrons and ions at the electron cooler of the CRYRING storage ring at MSL, Stockholm. Surprisingly, there is a consistent disagreement between the measured rates and the rates obtained from theoretical descriptions of RR. It could be shown that this deviation depends on external fields, such as a weak magnetic field in the interaction region. Another effect presented is the enhancement by two orders of magnitude of the recombination rates into a certain quantum state of the atom in a strong laser field. We will discuss these results with respect to their implications for the formation of anti-hydrogen atoms in a Penning trap. (authors)

  4. Optimal Expression Condition of Recombinant RAP

    Institute of Scientific and Technical Information of China (English)

    ZHANG Jie; ZHANG Hong; BI Hao; LIU Zhiguo; GUO Jianli; QU Shen


    In order to construct the expression recombinant of human receptor associated protein (RAP), optimize its expression condition and obtain the recombinant protein after expression with high efficiency, two prokaryotic expression vectors-pT7-PL and pET-28a(+) were used to construct the expression recombinant containing RAP cDNA, and the expression efficiency of two kinds of expression E. coli of BL21 strains was compared. The effect of different induction conditions on the expression of recombinant RAP was observed. After recombinant protein was purified with Ni+-nitrilotriacetic acid (Ni+-NTA) affinity chromatogram, its binding ability with microphage was observed. The results showed that two recombinant plasmids both obtained high expression of RAP. The expression levels of RAP in plasmid pT7-PL-RAP in BL21 (DE3, plysS) strain were significantly higher than in BL21 (DE3) strain. The expression of pT7-PL-RAP in the presence of chloramphenicol was higher than in the absence of chloramphenicol, and most of the inducible expressed RAP was soluble. The RAP which was purified by Ni+-NTA resin could strongly bind with the RAW264.7 cells rich in low density lipoprotein receptor (LDLR) family receptors. It was concluded that the expression condition of recombinant RAP was optimized and functional RAP was obtained, which offered a good foundation for the further production of RAP as research tool.

  5. The spacing of Langmuir circulation under modest wind

    Institute of Scientific and Technical Information of China (English)

    LI Shuang; SONG Jinbao


    Spacing characteristics of Langmuir circulation (LC) are computed by large eddy simulation (LES) model under modest wind.LC is an organized vertical motion,evidenced as buoyant materials forming lines nearly parallel to the wind direction.The horizontal distribution of velocity computed by LES shows clear lines formed by LC.These lines grow and parallel to each other for a while,which we call the stable state,before they finally form Y-junctions.We computed spacing between every two parallel lines by averaging them under the stable state.Statistically,spacing results of 154 tests (seven wind speed cases of 22 test runs each) show high correlations berween spacing and wind speed,as well as mixed layer depth.The relationship of spacing and wind is important for future LC parameterization of upper-ocean mixing.

  6. Detection and Characterization of Circulating Tumor Cells (United States)

    Bruce, Richard


    Circulating tumor cells (CTCs) occur in blood below the concentration of 1 cell in a hundred thousand white blood cells and can provide prognostic and diagnostic information about the underlying disease. While numeration of CTCs has provided useful information on progression-free and overall survival, it does not provide guidance of treatment choice. Since CTCs are presumed contain features of the metastatic tissue, characterization of cancer markers on these cells could help selection of treatment. At such low concentrations, reliable location and identification of these cells represents a significant technical challenge. Automated digital microscopy (ADM) provides high levels of sensitivity, but the analysis time is prohibitively long for a clinical assay. Enrichment methods have been developed to reduce sample size but can result in cell loss. A major barrier in reliable enrichment stems from the biological heterogeneity of CTCs, exhibited in a wide range of genetic, biochemical, immunological and biological characteristics. We have developed an approach that uses fiber-optic array scanning technology (FAST) to detect CTCs. Here, laser-printing optics are used to excite 300,000 cells/sec, and fluorescence from immuno-labels is collected in an array of optical fibers that forms a wide collection aperture. The FAST cytometer can locate CTCs at a rate that is 500 times faster than an ADM with comparable sensitivity and improved specificity. With this high scan rate, no enrichment of CTCs is required. The target can be a cytoplasm protein with a very high expression level, which reduces sensitivity to CTC heterogeneity. We use this method to measure expression levels of multiple markers on CTCs to help predict effective cancer treatment.

  7. Circulation model for water circulation and purification in a water Cerenkov detector

    Institute of Scientific and Technical Information of China (English)

    LU Hao-Qi; YANG Chang-Gen; WANG Ling-Yu; XU Ji-Lei; WANG aui-Guang; WANG Zhi-Min; WANG Yi-Fang


    Owing to its low cost and good transparency, highly purified water is widely used as a medium in large water Cerenkov detector experiments. The water circulation and purification system is usually needed to keep the water in good quality. In this work, a practical circulation model is built to describe the variation of the water resistivity in the circulation process and compared with the data obtained from a prototype experiment. The successful test of the model makes it useful in the future design and optimization of the circulation/purification system.

  8. Recombination every day: abundant recombination in a virus during a single multi-cellular host infection.

    Directory of Open Access Journals (Sweden)

    Remy Froissart


    Full Text Available Viral recombination can dramatically impact evolution and epidemiology. In viruses, the recombination rate depends on the frequency of genetic exchange between different viral genomes within an infected host cell and on the frequency at which such co-infections occur. While the recombination rate has been recently evaluated in experimentally co-infected cell cultures for several viruses, direct quantification at the most biologically significant level, that of a host infection, is still lacking. This study fills this gap using the cauliflower mosaic virus as a model. We distributed four neutral markers along the viral genome, and co-inoculated host plants with marker-containing and wild-type viruses. The frequency of recombinant genomes was evaluated 21 d post-inoculation. On average, over 50% of viral genomes recovered after a single host infection were recombinants, clearly indicating that recombination is very frequent in this virus. Estimates of the recombination rate show that all regions of the genome are equally affected by this process. Assuming that ten viral replication cycles occurred during our experiment-based on data on the timing of coat protein detection-the per base and replication cycle recombination rate was on the order of 2 x 10(-5 to 4 x 10(-5. This first determination of a virus recombination rate during a single multi-cellular host infection indicates that recombination is very frequent in the everyday life of this virus.

  9. Recombination in narrow-gapped semiconductors

    International Nuclear Information System (INIS)

    In narrow-gapped semiconductors of the type Hgsub(1-x)Cdsub(x)Te as well as in lead chalcogenides and their mixed crystals with energy gaps of some tenths of eV, the band-band recombination processes dominate if the samples are sufficiently perfect in their crystal lattices. The relative importance of the radiative or Auger recombination depends on the width of the energy gap and the charge carrier concentration. In the extreme case of very narrow energy gaps plasmon and one-electron recombination occurs additionally

  10. A ring-shaped recombination chamber for hadron therapy dosimetry

    International Nuclear Information System (INIS)

    An innovative recombination chamber has been designed for estimation of stray radiation doses and quality factors in hadron therapy. The chamber allows for determination of absorbed dose and recombination index of radiation quality in phantoms at small distances from simulated organs. The chamber body and electrodes are ring shaped, so the beam may be directed through the empty centre of the ring. The ionisation of the filling gas is caused by secondary or scattered radiation and can be related to the dose absorbed in the tissues close to the irradiated target volume. A recently designed and constructed ring-shaped recombination chamber successfully passed first operational tests. The measurements performed on a proton eye therapy beam line showed potential usefulness of the chamber for determination of the scattered radiation dose in the vicinity of the beam. In the future, the chamber can be applied both for patient dosimetry and for monitoring changes in the scattered radiation field, associated with different configurations of the elements forming the proton beam line. (authors)


    Directory of Open Access Journals (Sweden)

    M. G. Kiselev


    Full Text Available The procedure for parameters definition of sawing preparations two-dimensional circulating movement, including the form of a trajectory and a direction of circulating movement is submitted. The procedure and hardware description for time measurement of the cutting tool and processable preparation contact interaction in conditions of its periodic circulating movement is given.

  12. Fis is required for illegitimate recombination during formation of lambda bio transducing phage.


    Shanado, Y; Kato, J; Ikeda, H


    Specialized transducing particles of phage lambda are formed by illegitimate recombination during prophage induction. We examined the effects of an Esherichia coli int, xis, himA, himD, or fis mutation on illegitimate recombination during formation of lambda Spi- phage, a class of lambda bio transducing phage. This type of phage is distinguishable from the docL and docR particles, which contain one cohesive end and are formed by cutting of the cos site, by plaque formation of lambda bio on Es...

  13. Data on the identity and myristoylation state of recombinant, purified hippocalcin. (United States)

    Krishnan, Anuradha; Viviano, Jeffrey; Morozov, Yaroslav; Venkataraman, Venkat


    In this data article we report on the purity and post translation modification of bacterially expressed and purified recombinant hippocalcin (HPCA): a member of the neuronal calcium sensor protein family, whose functions are regulated by calcium. MALDI-TOF in source decay (ISD) analysis was used to identify both the myristoylated or non-myristoylated forms of the protein. MALDI-TOF ISD data on the identity of the protein, amino acid sequence and myristoylation efficiency are provided. This data relates to the article "Single-Column Purification of the Tag-free, Recombinant Form of the Neuronal Calcium Sensor Protein, Hippocalcin Expressed in Eschericia coli" [1]. PMID:27284566

  14. Structure of Recombinant Rabies Virus Nucleoprotein-RNA Complex and Identification of the Phosphoprotein Binding site


    Schoehn, Guy; Iseni, Frédéric; Mavrakis, Manos; Blondel, Danielle; Ruigrok, Rob W H


    Rabies virus nucleoprotein (N) was produced in insect cells, in which it forms nucleoprotein-RNA (N-RNA) complexes that are biochemically and biophysically indistinguishable from rabies virus N-RNA. We selected recombinant N-RNA complexes that were bound to short insect cellular RNAs which formed small rings containing 9 to 11 N monomers. We also produced recombinant N-RNA rings and viral N-RNA that were treated with trypsin and that had lost the C-terminal quarter of the nucleoprotein. Tryps...

  15. Obtaining classical swine fever virus E2 recombinant protein and DNA-vaccine on the basis of one subunit

    International Nuclear Information System (INIS)

    Three forms of E2 recombinant protein were expressed in E. coli. Swine sera obtained against different forms of the recombinant protein were cross-studied with indirect ELISA. Using individual proteins as an antigen, only 15% of sera against other forms of protein reacted positively, while 100% of heterologous sera showed positive reaction with fused protein. Challenge experiments showed the existence of protective action only from the individual protein. Specificity and activity of sera obtained from the animals after control challenge was confirmed in a blocking variant of ELISA. Genetic construction used a eukaryotic vector that contained the E2 protein gene. Immunization of mice with the resulting DNA induced synthesis of specific antibodies, the titre of which increased considerably after additional single immunization with the E2 recombinant protein, expressed in E. coli. This demonstrated the effectiveness of animal priming by DNA vaccine, and the possibility of using the E2 recombinant protein in E. coli for booster vaccination. (author)

  16. Hydrogen mitigation by catalytic recombiners and ignition during severe accidents

    International Nuclear Information System (INIS)

    A large amount of hydrogen is expected to be released within a large dry containment of a PWR shortly after the onset of a severe accident, leading to core melting. According to local gas concentrations, turbulence and structural configurations within the containment, the released hydrogen can reach the boundary of deflagration or under certain conditions cause local detonations threatening the containment integrity. During the last few years, several concepts of mitigation have been developed to limit the hydrogen concentrations and extensive efforts have been given to investigate the use of catalytic recombiners as well as the use of deliberate ignition within the contemplated framework of a 'Dual-concept'. Although the recent recommendation of the German Reactor Safety Commission (RSK) foresees the sole application of catalytic recombiners to remove hydrogen during severe accident, a review is planned within two years for the partial and directed additional application of early ignitions or post dilution of the atmosphere of the compartments in conjunction with the recombiners installed. This presentation will review the results of large number of experiments performed both in small scale and large scale to qualify the recombiners. It is also the subject of the presentation to address the requirements for proper and secure functioning of the catalyzers under the existing boundary conditions during the severe accidents. These requirements ask for measures, starting from the proper selection of catalysts, multi purposed catalytic devices and their protection against contamination during the standby condition as well as against aerosol deposition and surface poisoning during the propagation of an accident. A short review of the results to large scale experiments with the combined application of catalytic devices and igniters form also a part of this presentation. (author). 8 refs., 2 tabs., 7 figs

  17. Recombinant Human Papillomavirus (HPV) Quadrivalent Vaccine (United States)

    This page contains brief information about recombinant human papillomavirus (HPV) quadrivalent vaccine and a collection of links to more information about the use of this vaccine, research results, and ongoing clinical trials.

  18. Recombinant Human Papillomavirus (HPV) Bivalent Vaccine (United States)

    This page contains brief information about recombinant human papillomavirus (HPV) bivalent vaccine and a collection of links to more information about the use of this vaccine, research results, and ongoing clinical trials.

  19. Recombinant Human Papillomavirus (HPV) Nonavalent Vaccine (United States)

    This page contains brief information about recombinant human papillomavirus (HPV) nonavalent vaccine and a collection of links to more information about the use of this vaccine, research results, and ongoing clinical trials.

  20. RNAi and heterochromatin repress centromeric meiotic recombination

    DEFF Research Database (Denmark)

    Ellermeier, Chad; Higuchi, Emily C; Phadnis, Naina;


    During meiosis, the formation of viable haploid gametes from diploid precursors requires that each homologous chromosome pair be properly segregated to produce an exact haploid set of chromosomes. Genetic recombination, which provides a physical connection between homologous chromosomes, is....... Surprisingly, one mutant derepressed for recombination in the heterochromatic mating-type region during meiosis and several mutants derepressed for centromeric gene expression during mitotic growth are not derepressed for centromeric recombination during meiosis. These results reveal a complex relation between...... types of repression by heterochromatin. Our results also reveal a previously undemonstrated role for RNAi and heterochromatin in the repression of meiotic centromeric recombination and, potentially, in the prevention of birth defects by maintenance of proper chromosome segregation during meiosis....

  1. Genetic Analyses of Meiotic Recombination in Arabidopsis

    Institute of Scientific and Technical Information of China (English)


    Meiosis is essential for sexual reproduction and recombination is a critical step required for normal meiosis. Understanding the underlying molecular mechanisms that regulate recombination ie important for medical, agricultural and ecological reasons. Readily available molecular and cytological tools make Arabidopsis an excellent system to study meiosis. Here we review recent developments in molecular genetic analyses on meiotic recombination. These Include studies on plant homologs of yeast and animal genes, as well as novel genes that were first identified in plants. The characterizations of these genes have demonstrated essential functions from the initiation of recombination by double-strand breaks to repair of such breaks, from the formation of double-Holliday junctions to possible resolution of these junctions, both of which are critical for crossover formation. The recent advances have ushered a new era in plant meiosis, in which the combination of genetics, genomics, and molecular cytology can uncover important gene functions.

  2. Recombinant vaccines: experimental and applied aspects

    DEFF Research Database (Denmark)

    Lorenzen, Niels


    Development of vaccines for aquaculture fish represent an important applied functional aspect of fish immunology research. Particularly in the case of recombinant vaccines, where a single antigen is usually expected to induce immunity to a specific pathogen, knowledge of mechanisms involved in...... induction of a protective immune response may become vital. The few recombinant vaccines licensd so far, despite much research during the last decade, illustrate that this is not a straightforward matter. However, as vaccine technology as well as our knowledge of the fish immune system is steadily improved......, these fields will open up a number of interesting research objectives of mutual benefit. Recent aspects of recombinant protein vaccines, live recombinant vaccines and DNA vaccines are discussed....

  3. An asymptotic sampling formula for the coalescent with Recombination

    CERN Document Server

    Jenkins, Paul A; 10.1214/09-AAP646


    Ewens sampling formula (ESF) is a one-parameter family of probability distributions with a number of intriguing combinatorial connections. This elegant closed-form formula first arose in biology as the stationary probability distribution of a sample configuration at one locus under the infinite-alleles model of mutation. Since its discovery in the early 1970s, the ESF has been used in various biological applications, and has sparked several interesting mathematical generalizations. In the population genetics community, extending the underlying random-mating model to include recombination has received much attention in the past, but no general closed-form sampling formula is currently known even for the simplest extension, that is, a model with two loci. In this paper, we show that it is possible to obtain useful closed-form results in the case the population-scaled recombination rate $\\rho$ is large but not necessarily infinite. Specifically, we consider an asymptotic expansion of the two-locus sampling formu...

  4. Efficient generation of recombinant adenoviral vectors by Cre-lox recombination in vitro.


    Aoki, K.; Barker, C.; Danthinne, X; Imperiale, M J; Nabel, G. J.


    BACKGROUND: Although recombinant adenovirus vectors are attractive for use in gene expression studies and therapeutic applications, the construction of these vectors remains relatively time-consuming. We report here a strategy that simplifies the production of adenoviruses using the Cre-loxP system. MATERIALS AND METHODS: Full-length recombinant adenovirus DNA was generated in vitro by Cre-mediated recombination between loxP sites in a linearized shuttle plasmid containing a transgene and ade...

  5. Intermolecular recombination assay for mammalian cells that produces recombinants carrying both homologous and nonhomologous junctions.


    Brouillette, S; Chartrand, P


    We present an intermolecular recombination assay for mammalian cells that does not involve the reconstitution of a selectable marker. It is based on the generation of a shuttle vector by recombination between a bacterial and a mammalian vector. The recombinants can thus be amplified in mammalian cells, isolated by plasmid rescue in an Escherichia coli RecA- host, and identified by in situ hybridization, by using mammalian vector sequences as probes. Since both parental molecules can share def...

  6. Signals From the Epoch of Cosmological Recombination


    Sunyaev, R. A.; Chluba, J.


    The physical ingredients to describe the epoch of cosmological recombination are amazingly simple and well-understood. This fact allows us to take into account a very large variety of physical processes, still finding potentially measurable consequences for the energy spectrum and temperature anisotropies of the Cosmic Microwave Background (CMB). In this contribution we provide a short historical overview in connection with the cosmological recombination epoch and its connection to the CMB. A...

  7. Tunnel surface recombination in optoelectronic device modeling (United States)

    Ptashchenko, Alexander A.; Ptashchenko, Fedor A.


    The rate of tunnel surface recombination (TSR) in a p-n structure has been calculated as a function of the excitation level and temperature in a semiclassical approximation under the assumption that the excess energy of a recombining electron is transferred to phonons or to a photon. The approximating analytical expressions obtained are applied in calculations of the effect of TSR on the characteristics of photodiodes, solar cells, light-emitting diodes and diode lasers.

  8. Recombinant DNA production of spider silk proteins


    Tokareva, Olena; Michalczechen-Lacerda, Valquíria A; Rech, Elíbio L; Kaplan, David L.


    Spider dragline silk is considered to be the toughest biopolymer on Earth due to an extraordinary combination of strength and elasticity. Moreover, silks are biocompatible and biodegradable protein-based materials. Recent advances in genetic engineering make it possible to produce recombinant silks in heterologous hosts, opening up opportunities for large-scale production of recombinant silks for various biomedical and material science applications. We review the current strategies to produce...

  9. Algae-based oral recombinant vaccines


    Specht, Elizabeth A.; Mayfield, Stephen P


    Recombinant subunit vaccines are some of the safest and most effective vaccines available, but their high cost and the requirement of advanced medical infrastructure for administration make them impractical for many developing world diseases. Plant-based vaccines have shifted that paradigm by paving the way for recombinant vaccine production at agricultural scale using an edible host. However, enthusiasm for “molecular pharming” in food crops has waned in the last decade due to difficulty in ...

  10. Dielectronic recombination of hydrogen-like ions

    International Nuclear Information System (INIS)

    Decay dynamics of dielectronic recombination (DR) processes of H-like titanium ions was investigated with an electron beam ion trap. In the DR of H-like ions a K-shell vacancy is available even after the decay of the doubly excited state produced by the recombination. Therefore secondary X-ray emission is possible. An observed X-ray spectrum of DR obtained in the present experiment was well reproduced theoretically by taking into account the secondary X-rays

  11. Recombination-deficient mutant of Streptococcus faecalis.


    Yagi, Y; Clewell, D B


    An ultraviolet radiation-sensitive derivative of Streptococcus faecalis strain JH2-2 was isolated and found to be deficient in recombination, using a plasmid-plasmid recombination system. The strain was sensitive to chemical agents which interact with deoxyribonucleic acid and also underwent deoxyribonucleic acid degradation after ultraviolet irradiation. Thus, the mutant has properties similar to those of recA strains of Escherichia coli.

  12. Multiple recombinants in two dengue virus, serotype-2 isolates from patients from Oaxaca, Mexico

    Directory of Open Access Journals (Sweden)

    Cisneros Alejandro


    Full Text Available Abstract Background Dengue (DEN is a serious cause of mortality and morbidity in the world including Mexico, where the infection is endemic. One of the states with the highest rate of dengue cases is Oaxaca. The cause of DEN is a positive-sense RNA virus, the dengue virus (DENV that evolves rapidly increasing its variability due to the absence of a repair mechanism that leads to approximately one mutational event per genome replication; which results in enhancement of viral adaptation, including the escape from host immune responses. Additionally, recombination may play a role in driving the evolution of DENV, which may potentially affect virulence and cause host tropism changes. Recombination in DENV has not been described in Mexican strains, neither has been described the relevance in virus evolution in an endemic state such as Oaxaca where the four serotypes of DENV are circulating. Results To study whether there are isolates from Oaxaca having recombination, we obtained the sequence of 6 different isolates of DENV-2 Asian/American genotype from the outbreak 2005-6, one clone of the C(91-prM-E-NS1(2400 structural genes, and 10 clones of the E gene from the isolate MEX_OAX_1656_05. Evidence of recombination was found by using different methods along with two softwares: RDP3 and GARD. The Oaxaca MEX_OAX_1656_05 and MEX_OAX_1038_05 isolates sequenced in this study were recombinant viruses that incorporate the genome sequence from the Cosmopolitan genotype. Furthermore, the clone of the E gene namely MEX_OAX_165607_05 from this study was also recombinant, incorporating genome sequence from the American genotype. Conclusions This is the first report of recombination in DENV-2 in Mexico. Given such a recombinant activity new genomic combinations were produced, this could play a significant role in the DENV evolution and must be considered as a potentially important mechanism generating genetic variation in this virus with serious implications for

  13. Recombination of U92+ ions with electrons

    International Nuclear Information System (INIS)

    Recombination of fully stripped U92+ ions with electrons has been investigated at the Experimental Storage Ring (ESR) in Darmstadt. Absolute recombination rate coefficients have been measured for relative energies from 0 to 33 eV. For energies greater than 20 meV the experimental result is well described by the theory for radiative recombination (RR). Below 20 meV the experimental rate increasingly exceeds the RR calculation as observed previously in the recombination of light bare ions as well as of Bi83+. This low-energy rate enhancement is shown to scale as Z2.6 for bare ions, where Z is the atomic number of the ion. The U92+ recombination rate enhancement is insensitive to changes of the electron density. Variation of the magnetic guiding field strength from 80 mT to 120 mT resulted in oscillations of the recombination rate at 0 eV. The oscillations are partly attributed to changes of the transverse electron temperature accompanying the change of the magnetic guiding field strength; partly they may be caused by uncompensated small changes of the interaction angle between the two beams. (orig.)

  14. Kinetic mechanism of plasma recombination in methane, ethane and propane after high-voltage nanosecond discharge (United States)

    Anokhin, E. M.; Popov, M. A.; Kochetov, I. V.; Starikovskiy, A. Yu; Aleksandrov, N. L.


    The results of the experimental and numerical study of high-voltage nanosecond discharge afterglow in pure methane, ethane and propane are presented for room temperature and pressures from 2 to 20 Torr. Time-resolved electron density during the plasma decay was measured with a microwave interferometer for initial electron densities in the range between 5  ×  1010 and 3  ×  1012 cm‑3 and the effective recombination coefficients were obtained. Measured effective recombination coefficients increased with gas pressure and were much higher than the recombination coefficients for simple molecular hydrocarbon ions. The properties of plasma in the discharge afterglow were numerically simulated by solving the balance equations for charged particles and electron temperature. Calculations showed that electrons had time to thermalize prior to the recombination. The measured data were interpreted under the assumption that cluster hydrocarbon ions are formed during the plasma decay that is controlled by the dissociative electron recombination with these ions at electron room temperature. Based on the analysis of the experimental data, the rates of three-body formation of cluster ions and recombination coefficients for these ions were estimated.

  15. Reduction of sidewall interface recombination in GaAs and InGaAs active regions (United States)

    Strand, Timothy Andrew

    In the continual effort to reduce the operating current in semiconductor lasers, the first step is always to reduce the size of the device. When we do so, however, we encounter a new set of challenges. As the device size decreases, the "walls close in" on the electrons and holes, that is, the sidewalls of the device become so close together that the electrons and holes can diffuse to them before recombining radiatively. The device sidewalls, are often littered with carrier traps, which act as nonradiative recombination sites for the electrons and holes. This wasted current, a small fraction of the total in larger devices, becomes the dominant current mechanism in small devices. In this work we present two techniques for limiting this sidewall interface recombination. The first uses semiconductor regrowth to remove the recombination sites that are normally formed at the air-exposed sidewalls. We use buried, in-plane lasers to demonstrate a reduction in the sidewall recombination rate by a factor of forty. In the second technique, we show that the sidewall interface recombination can also be reduced by preventing the carriers from diffusing to the sidewalls. We demonstrate two methods for reducing this lateral carrier diffusion; segmented GaAs quantum wells, and InGaAs quantum dots. In the former, we demonstrate a reduction in the low-temperature lateral carrier diffusion constant by a factor of forty-six (versus a comparable GaAs quantum well).


    Directory of Open Access Journals (Sweden)

    S. A. Pavlenko


    Full Text Available Integration of informational computer technologies allowed to reorganize and optimize some processes due to decrease of circulation of documents, unification of documentation forms and others.

  17. Circulating polymerase chain reaction chips utilizing multiple-membrane activation (United States)

    Wang, Chih-Hao; Chen, Yi-Yu; Liao, Chia-Sheng; Hsieh, Tsung-Min; Luo, Ching-Hsing; Wu, Jiunn-Jong; Lee, Huei-Huang; Lee, Gwo-Bin


    This paper reports a new micromachined, circulating, polymerase chain reaction (PCR) chip for nucleic acid amplification. The PCR chip is comprised of a microthermal control module and a polydimethylsiloxane (PDMS)-based microfluidic control module. The microthermal control modules are formed with three individual heating and temperature-sensing sections, each modulating a specific set temperature for denaturation, annealing and extension processes, respectively. Micro-pneumatic valves and multiple-membrane activations are used to form the microfluidic control module to transport sample fluids through three reaction regions. Compared with other PCR chips, the new chip is more compact in size, requires less time for heating and cooling processes, and has the capability to randomly adjust time ratios and cycle numbers depending on the PCR process. Experimental results showed that detection genes for two pathogens, Streptococcus pyogenes (S. pyogenes, 777 bps) and Streptococcus pneumoniae (S. pneumoniae, 273 bps), can be successfully amplified using the new circulating PCR chip. The minimum number of thermal cycles to amplify the DNA-based S. pyogenes for slab gel electrophoresis is 20 cycles with an initial concentration of 42.5 pg µl-1. Experimental data also revealed that a high reproducibility up to 98% could be achieved if the initial template concentration of the S. pyogenes was higher than 4 pg µl-1. The preliminary results of the current paper were presented at the 19th IEEE International Conference on Micro Electro Mechanical Systems (IEEE MEMS 2006), Istanbul, Turkey, 22-26 January, 2006.

  18. Experimental study of the natural circulation phenomena

    International Nuclear Information System (INIS)

    The objective of this paper is to study the natural circulation in experimental loops and extend the results to nuclear facilities. New generation of compact nuclear power plants use the natural circulation as cooling and residual heat removal systems in case of accidents or shutdown. Lately the interest in this phenomenon, by scientific community, has increased. The experimental loop, described in this paper, was assembled at Escola Politecnica - USP at the Chemical Engineering Department. It is the goal to generate information to help with the understanding of the one and two phase natural circulation phenomena. Some experiments were performed with different levels of heat power and different flow of the cooling water at the secondary circuit. The data generated from these experiments are going to be used to validate some computational thermal hydraulic codes. Experimental results for one and two phase regimes are presented as well as the proposed model to simulate the flow regimes with the RELAP5 code. (author)


    International Nuclear Information System (INIS)

    Through the process of thermal ionization, intense stellar irradiation renders hot Jupiter atmospheres electrically conductive. Simultaneously, lateral variability in the irradiation drives the global circulation with peak wind speeds of the order of ∼km s–1. In turn, the interactions between the atmospheric flows and the background magnetic field give rise to Lorentz forces that can act to perturb the flow away from its purely hydrodynamical counterpart. Using analytical theory and numerical simulations, we show here that significant deviations away from axisymmetric circulation are unstable in presence of a non-negligible axisymmetric magnetic field. Specifically, our results suggest that dayside-to-nightside flows, often obtained within the context of three-dimensional circulation models, only exist on objects with anomalously low magnetic fields, while the majority of highly irradiated exoplanetary atmospheres are entirely dominated by zonal jets

  20. Use of natural circulation flow map

    International Nuclear Information System (INIS)

    Natural circulation in complex systems, considering the experimental simulators of PWR and the experience gained in analyzing natural circulation experiments performed in those systems are referred to. In particular, the NC scenarios occurring at different values of the primary system mass inventory are studied. Data have been gathered and analyzed coming from the experimental facilities (PWR simulators, or Integral Test Facilities, ITF) named Semiscale, Spes, Lobi, Bethsy, Pkl and Lstf. The case of PWR design, the NC should be seen as the fundamental mechanism for removing core following accidents or events that cause unavailability of primary circulation pumps. The NC phenomenon constitutes the basis for the layout of the primary system with core located in the bottom of vessel and steam generators a few meters above the top of the active fuel

  1. Cryogenic hydrogen circulation system of neutron source

    International Nuclear Information System (INIS)

    Cold neutron sources of reactors and spallation neutron sources are classic high flux neutron sources in operation all over the world. Cryogenic fluids such as supercritical or supercooled hydrogen are commonly selected as a moderator to absorb the nuclear heating from proton beams. By comparing supercritical hydrogen circulation systems and supercooled hydrogen circulation systems, the merits and drawbacks in both systems are summarized. When supercritical hydrogen circulates as the moderator, severe pressure fluctuations caused by temperature changes will occur. The pressure control system used to balance the system pressure, which consists of a heater as an active controller for thermal compensation and an accumulator as a passive volume controller, is preliminarily studied. The results may provide guidelines for design and operation of other cryogenic hydrogen system for neutron sources under construction

  2. Intercompartmental Recombination of HIV-1 Contributes to env Intrahost Diversity and Modulates Viral Tropism and Sensitivity to Entry Inhibitors▿†‡ (United States)

    Brown, Richard J. P.; Peters, Paul J.; Caron, Catherine; Gonzalez-Perez, Maria Paz; Stones, Leanne; Ankghuambom, Chiambah; Pondei, Kemebradikumo; McClure, C. Patrick; Alemnji, George; Taylor, Stephen; Sharp, Paul M.; Clapham, Paul R.; Ball, Jonathan K.


    HIV-1 circulates within an infected host as a genetically heterogeneous viral population. Viral intrahost diversity is shaped by substitutional evolution and recombination. Although many studies have speculated that recombination could have a significant impact on viral phenotype, this has never been definitively demonstrated. We report here phylogenetic and subsequent phenotypic analyses of envelope genes obtained from HIV-1 populations present in different anatomical compartments. Assessment of env compartmentalization from immunologically discrete tissues was assessed utilizing a single genome amplification approach, minimizing in vitro-generated artifacts. Genetic compartmentalization of variants was frequently observed. In addition, multiple incidences of intercompartment recombination, presumably facilitated by low-level migration of virus or infected cells between different anatomic sites and coinfection of susceptible cells by genetically divergent strains, were identified. These analyses demonstrate that intercompartment recombination is a fundamental evolutionary mechanism that helps to shape HIV-1 env intrahost diversity in natural infection. Analysis of the phenotypic consequences of these recombination events showed that genetic compartmentalization often correlates with phenotypic compartmentalization and that intercompartment recombination results in phenotype modulation. This represents definitive proof that recombination can generate novel combinations of phenotypic traits which differ subtly from those of parental strains, an important phenomenon that may have an impact on antiviral therapy and contribute to HIV-1 persistence in vivo. PMID:21471230

  3. Quantification of bronchial circulation perfusion in rats (United States)

    Wietholt, Christian; Molthen, Robert C.; Haworth, Steven T.; Roerig, David L.; Dawson, Christopher A.; Clough, Anne V.


    The bronchial circulation is thought to be the primary blood supply for pulmonary carcinomas. Thus, we have developed a method for imaging and quantifying changes in perfusion in the rat lung due to development of the bronchial circulation. A dual-modality micro-CT/SPECT system was used to detect change in perfusion in two groups of rats: controls and those with a surgically occluded left pulmonary artery. Both groups were imaged following injections on separate days i) 2mCi of Tc99m labeled macroaggregated albumin (MAA) into the left carotid artery (IA) and ii) a similar injection into the femoral vein (IV). The IA injection resulted in Tc99m accumulation in capillaries of the systemic circulation including the bronchial circulation, whereas the IV resulted in Tc99m accumulation in the pulmonary capillaries. Ordered subset expectation maximization (OSEM) was used to reconstruct the SPECT image volumes and a Feldkamp algorithm was used to reconstruct the micro-CT image volumes. The micro-CT and SPECT volumes were registered, the SPECT image volume was segmented using the right and left lung boundaries defined from the micro-CT volume, and the ratio of IA radioactivity accumulation in the left lung to IV radioactivity accumulation in both lungs was used as a measure of left lung flow via the bronchial circulation. This ratio was ~0.02 for the untreated rats compared to the treated animals that had an increased flow ratio of ~0.21 40 days after left pulmonary artery occlusion. This increase in flow to the occluded left lung via the bronchial circulation suggests this will be a useful model for further investigating antiangiogenic treatments.

  4. Experimental study of natural circulation circuit

    Energy Technology Data Exchange (ETDEWEB)

    Lemos, Wanderley F.; Su, Jian, E-mail:, E-mail: [Coordenacao dos Programas de Pos-Graduacao de Engenharia (LASME/COPPE/UFRJ), Rio de Janeiro, RJ (Brazil). Lab. de Simulacao e Metodos Numericos; Faccini, Jose L.H., E-mail: [Instituto de Engenharia Nuclear (LTE/IEN/CNEN-RJ), Rio de Janeiro, RJ (Brazil). Lab. de Termo-Hidraulica Experimental


    This work presents an experimental study about fluid flows behavior in natural circulation, under conditions of single-phase flow. The experiment was performed through experimental thermal-hydraulic circuit built at IEN. This test equipment has performance similar to passive system of residual heat removal present in Advanced Pressurized Water Reactors (APWR). This experimental study aims to observing and analyzing the natural circulation phenomenon, using this experimental circuit that was dimensioned and built based on concepts of similarity and scale. This philosophy allows the analysis of natural circulation behavior in single-phase flow conditions proportionally to the functioning real conditions of a nuclear reactor. The experiment was performed through procedures to initialization of hydraulic feeding of primary and secondary circuits and electrical energizing of resistors installed inside heater. Power controller has availability to adjust values of electrical power to feeding resistors, in order to portray several conditions of energy decay of nuclear reactor in a steady state. Data acquisition system allows the measurement and monitoring of the evolution of the temperature in various points through thermocouples installed in strategic points along hydraulic circuit. The behavior of the natural circulation phenomenon was monitored by graphical interface on computer screen, showing the temperature evolutions of measuring points and results stored in digital spreadsheets. The results stored in digital spreadsheets allowed the getting of data to graphic construction and discussion about natural circulation phenomenon. Finally, the calculus of Reynolds number allowed the establishment for a correlation of friction in function of geometric scales of length, heights and cross section of tubing, considering a natural circulation flow throughout in the region of hot leg. (author)

  5. Fort St. Vrain circulator operating experience

    International Nuclear Information System (INIS)

    Fort St. Vrain, on the system of Public Service Company of Colorado, is the only high-temperature gas-cooled power reactor in the United States. Four helium circulators are utilized in this plant to transfer heat from the reactor to the steam generators. These unique machines have a single stage axial flow helium compressor driven by a single stage steam turbine. A single stage water driven (pelton wheel) turbine is the back-up drive utilizing either feed water, condensate, or fire water as the driving fluid. Developmental testing of the circulators was accomplished prior to installation into Fort St. Vrain. A combined machine operating history of approximately 250,000 hours has shown these machines to be of conservative design and proven mechanical integrity. However, many problems have been encountered in operating the complex auxiliaries which are necessary for successful circulator and plant operation. It has been 15 years since initial installation of the circulators occurred at Fort St. Vrain. During this time, a number of significant issues had to be resolved dealing specifically with machine performance. These events include cavitation damage of the pelton wheels during the initial plant hot functional testing, cracks in the water turbine buckets and cervic coupling, static shutdown seal bellows failure, and, most recently, degradation of components within the steam drive assembly. Unreliable operation particularly with the circulator auxiliaries has been a focus of attention by Public Service Company of Colorado. Actions to replace or significantly modify the existing circulators and their auxiliaries are currently awaiting decisions concerning the long-term future of the Fort St. Vrain plant. (author). 10 refs, 7 figs, 2 tabs

  6. Recombination analysis based on the complete genome of bocavirus

    Directory of Open Access Journals (Sweden)

    Chen Shengxia


    Full Text Available Abstract Bocavirus include bovine parvovirus, minute virus of canine, porcine bocavirus, gorilla bocavirus, and Human bocaviruses 1-4 (HBoVs. Although recent reports showed that recombination happened in bocavirus, no systematical study investigated the recombination of bocavirus. The present study performed the phylogenetic and recombination analysis of bocavirus over the complete genomes available in GenBank. Results confirmed that recombination existed among bocavirus, including the likely inter-genotype recombination between HBoV1 and HBoV4, and intra-genotype recombination among HBoV2 variants. Moreover, it is the first report revealing the recombination that occurred between minute viruses of canine.

  7. Studies on Mucosal Immunity Induced by Transmissible Gastroenteritis Virus Nucleocapsid Protein Recombinant Lactobacillus casei in Mice and Sow

    Institute of Scientific and Technical Information of China (English)

    WANG Gui-hua; HOU Xi-lin; YU Li-yun; LIU Jian-kui; WEI Chun-hua


    Mucosal immunity plays an important role in protecting pigs against transmissible gastroenteritis virus (TGEV) infection. To elicit mucosal immune response against TGEV, we developed a surface antigen display system using the poly-γ-glutamate synthetase A (pgsA) protein of Bacillus subtilis as an anchoring matrix to express recombinant fusion proteins of pgsA and nucleocapsid protein of TGEV in Lactobacillus casei. Surface location of fusion protein was verified by ELISA and indirect immunofluorescence test. Oral and intranasal inoculations of pregnant sow and mice with recombinant L. casei resulted in high levels of serum immunoglobulin G (IgG) and secretory immunogiobulin A (sIgA) against recombinant N protein as demonstrated by ELISA. More importantly, the level of specific slgA in colostrum significantly increased compared with that of IgG. The serum lgG levels of the piglets increased after suckling coiostrum produced by sows was previously inoculated with recombinant L. casei. These results indicate that immunization with recombinant L. casei expressing TGEV N protein on its surface elicited high levels of specific slgA and circulating lgG against TGEV N protein.

  8. Immunogenicity and protective efficacy of recombinant Modified Vaccinia virus Ankara candidate vaccines delivering West Nile virus envelope antigens. (United States)

    Volz, Asisa; Lim, Stephanie; Kaserer, Martina; Lülf, Anna; Marr, Lisa; Jany, Sylvia; Deeg, Cornelia A; Pijlman, Gorben P; Koraka, Penelope; Osterhaus, Albert D M E; Martina, Byron E; Sutter, Gerd


    West Nile virus (WNV) cycles between insects and wild birds, and is transmitted via mosquito vectors to horses and humans, potentially causing severe neuroinvasive disease. Modified Vaccinia virus Ankara (MVA) is an advanced viral vector for developing new recombinant vaccines against infectious diseases and cancer. Here, we generated and evaluated recombinant MVA candidate vaccines that deliver WNV envelope (E) antigens and fulfil all the requirements to proceed to clinical testing in humans. Infections of human and equine cell cultures with recombinant MVA demonstrated efficient synthesis and secretion of WNV envelope proteins in mammalian cells non-permissive for MVA replication. Prime-boost immunizations in BALB/c mice readily induced circulating serum antibodies binding to recombinant WNV E protein and neutralizing WNV in tissue culture infections. Vaccinations in HLA-A2.1-/HLA-DR1-transgenic H-2 class I-/class II-knockout mice elicited WNV E-specific CD8+ T cell responses. Moreover, the MVA-WNV candidate vaccines protected C57BL/6 mice against lineage 1 and lineage 2 WNV infection and induced heterologous neutralizing antibodies. Thus, further studies are warranted to evaluate these recombinant MVA-WNV vaccines in other preclinical models and use them as candidate vaccine in humans. PMID:26939903

  9. Quenching phenomena in natural circulation loop

    Energy Technology Data Exchange (ETDEWEB)

    Umekawa, Hisashi; Ozawa, Mamoru [Kansai Univ., Osaka (Japan); Ishida, Naoki [Daihatsu Motor Company, Osaka (Japan)


    Quenching phenomena has been investigated experimentally using circulation loop of liquid nitrogen. During the quenching under natural circulation, the heat transfer mode changes from film boiling to nucleate boiling, and at the same time flux changes with time depending on the vapor generation rate and related two-phase flow characteristics. Moreover, density wave oscillations occur under a certain operating condition, which is closely related to the dynamic behavior of the cooling curve. The experimental results indicates that the occurrence of the density wave oscillation induces the deterioration of effective cooling of the heat surface in the film and the transition boiling regions, which results in the decrease in the quenching velocity.

  10. The circulation of the Mozambique channel (United States)

    Sætre, Roald; Da Silva, António Jorge


    Based on hydrographic data from 1977 to 1980 off the coast of Mozambique and historical data from the Mozambique Channel, the general circulation pattern of the area is described. The circulation pattern is characterized by the influence of three anticyclonic gyres covering the northern, the central, and the southern parts of the channel. Additionally, smaller cyclonic eddies are observed, of which some probably are topographically induced. The results strongly indicate that in the upper 1000 m the role of the Mozambique Current as one of the tributaries to the Agulhas Current is of minor significance and draw into question the concept of the Mozambique Current as a continuous one.

  11. Blowing Circulation Control on a Seaplane Airfoil (United States)

    Guo, B. D.; Liu, P. Q.; Qu, Q. L.


    RANS simulations are presented for blowing circulation control on a seaplane airfoil. Realizable k-epsilon turbulent model and pressure-based coupled algorithm with second-order discretization were adopted to simulate the compressible flow. Both clear and simple flap configuration were simulated with blowing momentum coefficient Cμ = 0, 0.15 and 0.30. The results show that blowing near the airfoil trailing edge could enhance the Coanda effect, delay the flow separation, and increase the lift coefficient dramatically. The blowing circulation control is promising to apply to taking off and landing of an amphibious aircraft or seaplane.

  12. Applications of Circulation Control, Yesterday and Today


    Jonathan Kweder; Chad C. Panthe; James E. Smit


    Circulation control, an aerodynamic method of changing the properties of an airfoil, such as lift, camber and angle of attack, has been used in several unique ways since its inception, as an enhancement to fixed wing aircraft, in the 1960’s. Early in the research venture, this technology was used on the main wing of an aircraft in conjunction with a Coandă surface, such as a rounded trailing edge or a deployable flap. Research during this time proved to be the foundation of the circulation co...

  13. Applications of Circulation Control, Yesterday and Today

    Directory of Open Access Journals (Sweden)

    Jonathan Kweder


    Full Text Available Circulation control, an aerodynamic method of changing the properties of an airfoil, such as lift, camber and angle of attack, has been used in several unique ways since its inception, as an enhancement to fixed wing aircraft, in the 1960’s. Early in the research venture, this technology was used on the main wing of an aircraft in conjunction with a Coandă surface, such as a rounded trailing edge or a deployable flap. Research during this time proved to be the foundation of the circulation control technology and showed that small amounts of exit jet velocity could have a large impact on the aerodynamics of an airfoil. In the 1970’s the inspirations that drove circulation control research changed from design work to optimization of the parameters which were found to have the most effect on circulation control. These studies included slot placement, favorable momentum coefficient, and pressurization benefits and determents. This research period also allowed for expansion of the uses of circulation control to submarine/hydrodynamic and rotary wing applications. Newest research has brought on several propeller driven applications and the recent push for efficient renewable research has allowed circulation control research technologies to evolve into use in wind turbine and water turbine applications. The idea being that with circulation control the turbine can adapt easier to the changing wind velocity and direction and ultimately capture more power than an un-augmented turbine. As with most new and novel technologies there is a process and time delay associated with their development and ultimate application. For some technologies the market, or the supporting hardware, are lacking and sometimes the technology has strong advocacies for yet to be fulfilled expectations. In most of these cases a strong idea will re-surface repeatedly until the art has matured, or the better solution is found. This paper will focus on the previously developed

  14. The Circulation of Shakespeare Adaptations in Eastern Europe

    Directory of Open Access Journals (Sweden)

    Nicolaescu Mădălina


    Full Text Available The paper discusses the stage adaptations of Shakespeare's Hamlet and Romeo and Juliet that were circulated in the German Länders and the Habsburg Empire in the late 18th and early 19th century. The various forms of re-writing Shakespeare are linked with processes re-contextualizing the text and are discussed as forms of localizing a transnational Shakespeare. The analysis zooms in on the contexts of performance of the German adaptations in two Transylvanian cities. The paper highlights the cultural and linguistic negotiations performed when further translating the already multilayered rewritings of the Shakespearean text and focuses on a Romanian translation of a German adaptation of Hamlet.

  15. Engineering of recombinant crystallization chaperones


    Koide, Shohei


    The preparation of diffraction quality crystals remains the major bottleneck in macromolecular x-ray crystallography. A crystallization chaperone is an auxiliary protein, such as fragments of monoclonal antibodies, that binds to and increases the crystallization probability of a target molecule of interest. Such chaperones reduce conformational heterogeneity, mask counterproductive surfaces while extending surfaces predisposed to forming crystal contacts, and provide phasing information. Crys...

  16. Proglucagon Promoter Cre-Mediated AMPK Deletion in Mice Increases Circulating GLP-1 Levels and Oral Glucose Tolerance (United States)

    Sayers, Sophie R.; Reimann, Frank; Gribble, Fiona M.; Parker, Helen; Zac-Varghese, Sagen; Bloom, Stephen R.; Foretz, Marc; Viollet, Benoit; Rutter, Guy A.


    Background Enteroendocrine L-cells synthesise and release the gut hormone glucagon-like peptide-1 (GLP-1) in response to food transit. Deletion of the tumour suppressor kinase LKB1 from proglucagon-expressing cells leads to the generation of intestinal polyps but no change in circulating GLP-1 levels. Here, we explore the role of the downstream kinase AMP-activated protein kinase (AMPK) in these cells. Method Loss of AMPK from proglucagon-expressing cells was achieved using a preproglucagon promoter-driven Cre (iGluCre) to catalyse recombination of floxed alleles of AMPKα1 and α2. Oral and intraperitoneal glucose tolerance were measured using standard protocols. L-cell mass was measured by immunocytochemistry. Hormone and peptide levels were measured by electrochemical-based luminescence detection or radioimmunoassay. Results Recombination with iGluCre led to efficient deletion of AMPK from intestinal L- and pancreatic alpha-cells. In contrast to mice rendered null for LKB1 using the same strategy, mice deleted for AMPK displayed an increase (WT: 0.05 ± 0.01, KO: 0.09±0.02%, p<0.01) in L-cell mass and elevated plasma fasting (WT: 5.62 ± 0.800 pg/ml, KO: 14.5 ± 1.870, p<0.01) and fed (WT: 15.7 ± 1.48pg/ml, KO: 22.0 ± 6.62, p<0.01) GLP-1 levels. Oral, but not intraperitoneal, glucose tolerance was significantly improved by AMPK deletion, whilst insulin and glucagon levels were unchanged despite an increase in alpha to beta cell ratio (WT: 0.23 ± 0.02, KO: 0.33 ± 0.03, p<0.01). Conclusion AMPK restricts L-cell growth and GLP-1 secretion to suppress glucose tolerance. Targeted inhibition of AMPK in L-cells may thus provide a new therapeutic strategy in some forms of type 2 diabetes. PMID:27010458

  17. Proglucagon Promoter Cre-Mediated AMPK Deletion in Mice Increases Circulating GLP-1 Levels and Oral Glucose Tolerance.

    Directory of Open Access Journals (Sweden)

    Sophie R Sayers

    Full Text Available Enteroendocrine L-cells synthesise and release the gut hormone glucagon-like peptide-1 (GLP-1 in response to food transit. Deletion of the tumour suppressor kinase LKB1 from proglucagon-expressing cells leads to the generation of intestinal polyps but no change in circulating GLP-1 levels. Here, we explore the role of the downstream kinase AMP-activated protein kinase (AMPK in these cells.Loss of AMPK from proglucagon-expressing cells was achieved using a preproglucagon promoter-driven Cre (iGluCre to catalyse recombination of floxed alleles of AMPKα1 and α2. Oral and intraperitoneal glucose tolerance were measured using standard protocols. L-cell mass was measured by immunocytochemistry. Hormone and peptide levels were measured by electrochemical-based luminescence detection or radioimmunoassay.Recombination with iGluCre led to efficient deletion of AMPK from intestinal L- and pancreatic alpha-cells. In contrast to mice rendered null for LKB1 using the same strategy, mice deleted for AMPK displayed an increase (WT: 0.05 ± 0.01, KO: 0.09±0.02%, p<0.01 in L-cell mass and elevated plasma fasting (WT: 5.62 ± 0.800 pg/ml, KO: 14.5 ± 1.870, p<0.01 and fed (WT: 15.7 ± 1.48pg/ml, KO: 22.0 ± 6.62, p<0.01 GLP-1 levels. Oral, but not intraperitoneal, glucose tolerance was significantly improved by AMPK deletion, whilst insulin and glucagon levels were unchanged despite an increase in alpha to beta cell ratio (WT: 0.23 ± 0.02, KO: 0.33 ± 0.03, p<0.01.AMPK restricts L-cell growth and GLP-1 secretion to suppress glucose tolerance. Targeted inhibition of AMPK in L-cells may thus provide a new therapeutic strategy in some forms of type 2 diabetes.

  18. Performance testing of passive autocatalytic recombiners (PARs)

    International Nuclear Information System (INIS)

    Passive autocatalytic recombiners (PARs) have been under consideration in the U.S. as a combustible gas control system in advanced light water reactor (ALWR) containments for design basis and severe accidents. PARs do not require a source of power. Instead they use palladium or platinum as a catalyst to recombine hydrogen and oxygen gases into water vapor upon contact with the catalyst. Energy from the recombination of hydrogen with oxygen is released at a relatively slow but continuous rate into the containment which prevents the pressure from becoming too high. The heat produced creates strong buoyancy effects which increases the influx of the surrounding gases to the recombiner. These natural convective flow currents promote mixing of combustible gases in the containment. PARs are self-starting and self-feeding under a very wide range of conditions. The recombination rate of the PAR system needs to be great enough to keep the concentration of hydrogen (or oxygen) below acceptable limits. There are several catalytic recombiner concepts under development worldwide. The USNRC is evaluating a specific design of a PAR which is in an advanced stage of engineering development and has been proposed for ALWR designs. Sandia National laboratories (SNL), under the sponsorship and the direction of the USNRC, is conducting an experimental program to evaluate the performance of PARs. The PAR will be tested at the SURTSEY facility at SNL. The test plan currently includes the following experiments: experiments will be conducted to define the startup characteristics of PARs (i.e., to define what is the lowest hydrogen concentration that the PAR starts recombining the hydrogen with oxygen); experiments will be used to define the hydrogen depletion rate of PARs as a function of hydrogen concentration; and experiments will be used to define the PAR performance in the presence of high concentrations of steam. (author)

  19. DNA intermediates of meiotic recombination in synchronous S. pombe at optimal temperature. (United States)

    Hyppa, Randy W; Fowler, Kyle R; Cipak, Lubos; Gregan, Juraj; Smith, Gerald R


    Crossovers formed by recombination between homologous chromosomes are important for proper homolog segregation during meiosis and for generation of genetic diversity. Optimal molecular analysis of DNA intermediates of recombination requires synchronous cultures. We previously described a mutant, pat1-as2, of the fission yeast Schizosaccharomyces pombe that undergoes synchronous meiosis at 25°C when an ATP analog is added to the culture. Here, we compare recombination intermediates in pat1-as2 at 25°C with those in the widely used pat1-114 temperature-sensitive mutant at 34°C, a temperature higher than optimal. DNA double-strand breaks at most hotspots are similarly abundant in the two conditions but, remarkably, a few hotspots are distinctly deficient at 25°C. In both conditions, Holliday junctions at DNA break hotspots form more frequently between sister chromatids than between homologs, but a novel species, perhaps arising from invasion by only one end of broken DNA, is more readily observed at 25°C. Our results confirm the validity of previous assays of recombination intermediates in S. pombe and provide new information on the mechanism of meiotic recombination. PMID:24089141

  20. Coherent phase control in laser-assisted radiative recombination and x-ray generation

    International Nuclear Information System (INIS)

    We investigate electron-ion recombination in a powerful bichromatic laser field of frequencies ωL and 3ωL and consider the dependence of the recombination probabilities on the relative phase φ of the two field components. During this process a certain number of laser photons can be absorbed or emitted, yielding a spectrum of harmonics of the form ωX Ep-vector+ nωL+Iio+Uptot, where Ep-vector is the initial electron energy, n the number of emitted or absorbed laser photons ωL, Iio the ionization energy and Uptot the total ponderomotive energy of the bichromatic laser field. This process is of interest for the generation of high-frequency fields during the laser heating of plasmas. We shall evaluate the nonlinear recombination probabilities as a function of the relative phase φ of the two field components using the inverse form of the Keldysh-Faisal-Reiss model, also taking into account in an approximate way the Coulomb effects of the ion on the recombining electron. Moreover, we shall compare our quantum mechanical results with those obtained from a classical theory of recombination, developed recently, based on Bohr's correspondence principle. (author)

  1. Brain Gain or Brain Circulation? U.S. Doctoral Recipients Returning to South Korea (United States)

    Lee, Jenny J.; Kim, Dongbin


    This study explored the reasons for current reverse mobility patterns in South Korea and how the country benefits from returning U.S. doctoral recipients in the forms of brain gain and brain circulation. Based on interviews of Korean faculty who studied in the U.S., this study found that while the political economy might help to explain why Korean…

  2. Ultra-filtration rhenium extraction out of circulating waters of copper production

    International Nuclear Information System (INIS)

    Possibility of effective rhenium extraction via complex formation - ultra-filtration out of circulating waters, forming in copper ores concentration is shown. The most selectivity to rhenium is found for polyelectrolyte VA-212, among different tested water-soluble polymers containing groups of quaternary ammonium base. The method for regeneration of polyelectrolyte is proposed, possibility of its multiple usage for rhenium extraction is shown

  3. Effects of spin-forbidden resonances on the recombination of Be-like Si and Be-like Ne

    Energy Technology Data Exchange (ETDEWEB)

    Orban, I; Boehm, S; Schuch, R [Department of Physics, Stockholm University, 10691 Stockholm (Sweden); Loch, S D [Department of Physics, Auburn University, Auburn, AL 36849 (United States); Glans, P, E-mail: [Department of Engineering, Physics and Mathematics, Mid Sweden University, 85170 Sundsvall (Sweden)


    Recombination through doubly excited states that can be formed only through spin-flip of the excited electrons can give very strong contributions to the recombination rate of Be-like ions. We demonstrate this, in this paper, with the electron-ion recombination spectra of Be-like Ne{sup 6+} and Be-like Si{sup 10+}, recently measured at the CRYRING storage ring. These resonances have significant effects on the plasma rate coefficients. We show that neglect or imprecise calculation of these resonances is responsible for large spreads observed between various theoretical results from the literature.

  4. Compensatory role for Rad52 during recombinational repair in Ustilago maydis

    DEFF Research Database (Denmark)

    Kojic, Milorad; Mao, Ninghui; Zhou, Qingwen;


    spontaneous mutator activity, allelic recombination or meiosis. GFP-Rad51 foci were formed in rad52 cells following DNA damage, but were initially less intense than normal suggesting a possible role for Rad52 in formation of the Rad51 nucleoprotein filament. A search for interacting genes that confer a...

  5. Tuning of Collagen Triple-Helix Stability in Recombinant Telechelic Polymers

    NARCIS (Netherlands)

    Silva, da C.I.; Skrzeszewska, P.J.; Golinska, M.D.; Werten, M.W.T.; Eggink, G.; Wolf, de F.A.


    The melting properties of various triblock copolymers with random coil middle blocks (100–800 amino acids) and triple helix-forming (Pro-Gly-Pro)n end blocks (n = 6–16) were compared. These gelatin-like molecules were produced as secreted proteins by recombinant yeast. The investigated series shows

  6. Graded Recombination Layers for Multijunction Photovoltaics

    KAUST Repository

    Koleilat, Ghada I.


    Multijunction devices consist of a stack of semiconductor junctions having bandgaps tuned across a broad spectrum. In solar cells this concept is used to increase the efficiency of photovoltaic harvesting, while light emitters and detectors use it to achieve multicolor and spectrally tunable behavior. In series-connected current-matched multijunction devices, the recombination layers must allow the hole current from one cell to recombine, with high efficiency and low voltage loss, with the electron current from the next cell. We recently reported a tandem solar cell in which the recombination layer was implemented using a progression of n-type oxides whose doping densities and work functions serve to connect, with negligible resistive loss at solar current densities, the constituent cells. Here we present the generalized conditions for design of efficient graded recombination layer solar devices. We report the number of interlayers and the requirements on work function and doping of each interlayer, to bridge an work function difference as high as 1.6 eV. We also find solutions that minimize the doping required of the interlayers in order to minimize optical absorption due to free carriers in the graded recombination layer (GRL). We demonstrate a family of new GRL designs experimentally and highlight the benefits of the progression of dopings and work functions in the interlayers. © 2012 American Chemical Society.

  7. Transient characteristic analysis of integral pressurized water reactor from forced circulation to natural circulation

    International Nuclear Information System (INIS)

    Natural circulation of nuclear reactor has heat dumpling capacity, which can improve the inherent safety of reactor. In this paper, the conceptional design of integrated pressurized water reactor was studied and RELAP5/MOD3.4 was used to analyze transient characteristic in the process from forced circulation to natural circulation. What's more, the influence of reactor power, resistance, moment of inertia of main pump, and various operation strategies on transient characteristic in this conversion process were also studied. (authors)

  8. On Pareto theory of circulation of elites


    Ricardo P\\'erez-Marco


    We prove that Pareto theory of circulation of elites results from our wealth evolution model, Kelly criterion for optimal betting and Keynes' observation of "animal spirits" that drive the economy and cause that human financial decisions are prone to excess risk-taking.

  9. General circulation modeling of the Jupiter stratosphere (United States)

    Sethunadh, J.; Medvedev, A. S.; Hartogh, P.


    The stratosphere of Jupiter extends for more than 350 km above the cloud top. It is driven almost equally by the radiative heating and cooling within the atmosphere, and by heat from below. We present first results of simulations with the newly developed general circulation model (GCM).

  10. Detecting Holocene changes in thermohaline circulation


    L. D. Keigwin; Boyle, E. A.


    Throughout the last glacial cycle, reorganizations of deep ocean water masses were coincident with rapid millennial-scale changes in climate. Climate changes have been less severe during the present interglacial, but evidence for concurrent deep ocean circulation change is ambiguous.

  11. A Circulation Model for Busy Public Libraries. (United States)

    Bagust, A.


    Develops stochastic model of library borrowing using Negative Binomial distribution applied to circulation data obtained from Huddersfield Public Library. Evidence concerning process of popularity decay is presented and method is given by which relegation tests can be constructed to maintain optimum turnover. Eight references and statistical…

  12. Circulating amounts of osteoprotegerin and RANK ligand

    DEFF Research Database (Denmark)

    Abrahamsen, Bo; Hjelmborg, Jacob Vb; Kostenuik, Paul;


    UNLABELLED: Osteoprotegerin (OPG) is a circulating receptor that inhibits osteoclastogenesis by binding to RANK ligand (RANKL). OPG knock-out animals develop severe osteoporosis. Treatment with OPG lowers bone resorption and increases BMD. OPG production is influenced by a wide range of hormones ...

  13. Human immunodeficiency virus type 1 specific cytotoxic T lymphocyte responses in Chinese infected with HIV-1 B'/C Recombinant (CRF07_BC

    Directory of Open Access Journals (Sweden)

    Yu Xu G


    Full Text Available Abstract Background The characterization of HIV-1-specific T cell responses in people infected with locally circulating HIV-1 strain will facilitate the development of HIV-1 vaccine. Sixty intravenous drug users infected with HIV-1 circulating recombinant form 07_BC (CRF07_BC, which has been spreading rapidly in western China from north to south, were recruited from Xinjiang, China to assess the HIV-1-specific T cell responses at single peptide level with overlapping peptides (OLP covering the whole concensus clades B and C proteome. Results The median of the total magnitude and total number of OLPs recognized by CTL responses were 10925 SFC/million PBMC and 25 OLPs, respectively, when tested by clade C peptides, which was significantly higher than when tested by clade B peptides. The immunodominant regions, which cover 14% (58/413 of the HIV-1 proteome, are widely distributed throughout the HIV-1 proteome except in Tat, Vpu and Pol-PR, with Gag, Pol-RT, Pol-Int and Nef being most frequently targeted. The subdominant epitopes are mostly located in p24, Nef, integrase, Vpr and Vif. Of the responses directed to clade C OLPs, 61.75% (972/1574 can be observed when tested with corresponding clade B OLPs. However, Pol-PR and Vpu tend to be targeted in the clade B sequence rather than the clade C sequence, which is in line with the recombinant pattern of CRF07_BC. Stronger and broader CTL responses in subjects with CD4 cell counts ranging from 200 to 400/mm3 were observed when compared to those with less than 200/mm3 or more than 400/mm3, though there have been no significant correlations identified between the accumulative CTL responses or overall breadth and CD4 cell count or plasma viral load. Conclusion This is the first study conducted to comprehensively address T cell responses in Chinese subjects infected with HIV-1 CRF07_BC in which subtle differences in cross-reactivity were observed, though similar patterns of overall immune responses were

  14. Long non-coding RNAs are major contributors to transcriptome changes in sunflower meiocytes with different recombination rates


    Flórez-Zapata, Nathalia M. V.; Reyes-Valdés, M. Humberto; Martínez, Octavio


    Background Meiosis is a form of specialized cell division that marks the transition from diploid meiocyte to haploid gamete, and provides an opportunity for genetic reassortment through recombination. Experimental data indicates that, relative to their wild ancestors, cultivated sunflower varieties show a higher recombination rate during meiosis. To better understand the molecular basis for this difference, we compared gene expression in male sunflower meiocytes in prophase I isolated from a ...

  15. The Meiotic Recombination Checkpoint Suppresses NHK-1 Kinase to Prevent Reorganisation of the Oocyte Nucleus in Drosophila


    Lancaster, Oscar M.; Breuer, Manuel; Cullen, C. Fiona; Ito, Takashi; Ohkura, Hiroyuki


    The meiotic recombination checkpoint is a signalling pathway that blocks meiotic progression when the repair of DNA breaks formed during recombination is delayed. In comparison to the signalling pathway itself, however, the molecular targets of the checkpoint that control meiotic progression are not well understood in metazoans. In Drosophila, activation of the meiotic checkpoint is known to prevent formation of the karyosome, a meiosis-specific organisation of chromosomes, but the molecular ...

  16. Triple-Helix Formation Induces Recombination in Mammalian Cells via a Nucleotide Excision Repair-Dependent Pathway


    Faruqi, A. Fawad; Datta, Hirock J.; Carroll, Dana; Seidman, Michael M.; Glazer, Peter M.


    The ability to stimulate recombination in a site-specific manner in mammalian cells may provide a useful tool for gene knockout and a valuable strategy for gene therapy. We previously demonstrated that psoralen adducts targeted by triple-helix-forming oligonucleotides (TFOs) could induce recombination between tandem repeats of a supF reporter gene in a simian virus 40 vector in monkey COS cells. Based on work showing that triple helices, even in the absence of associated psoralen adducts, are...

  17. Cleavage of recombinant proteins at poly-His sequences by Co(II) and Cu(II)


    Andberg, Martina; Jäntti, Jussi; Heilimo, Sara; Pihkala, Päivi; Paananen, Arja; Koskinen, Ari M P; Söderlund, Hans; Linder, Markus B


    Improved ways to cleave peptide chains at engineered sites easily and specifically would form useful tools for biochemical research. Uses of such methods include the activation or inactivation of enzymes or the removal of tags for enhancement of recombinant protein expression or tags used for purification of recombinant proteins. In this work we show by gel electrophoresis and mass spectroscopy that salts of Co(II) and Cu(II) can be used to cleave fusion proteins specifically at sites where s...

  18. Crystallization of recombinant bifunctional nuclease TBN1 from tomato

    International Nuclear Information System (INIS)

    Glycosylated recombinant bifunctional nuclease from tomato has been crystallized and preliminary X-ray diffraction analysis was performed. The endonuclease TBN1 from Solanum lycopersicum (tomato) was expressed in Nicotiana benthamiana leaves and purified with suitable quality and in suitable quantities for crystallization experiments. Two crystal forms (orthorhombic and rhombohedral) were obtained and X-ray diffraction experiments were performed. The presence of natively bound Zn2+ ions was confirmed by X-ray fluorescence and by an absorption-edge scan. X-ray diffraction data were collected from the orthorhombic (resolution of 5.2 Å) and rhombohedral (best resolution of 3.2 Å) crystal forms. SAD, MAD and MR methods were applied for solution of the phase problem, with partial success. TBN1 contains three Zn2+ ions in a similar spatial arrangement to that observed in nuclease P1 from Penicillium citrinum

  19. Observations of the summer Red Sea circulation (United States)

    Sofianos, Sarantis S.; Johns, William E.


    Aiming at exploring and understanding the summer circulation in the Red Sea, a cruise was conducted in the basin during the summer of 2001 involving hydrographic, meteorological, and direct current observations. The most prominent feature, characteristic of the summer circulation and exchange with the Indian Ocean, is a temperature, salinity, and oxygen minimum located around a depth of 75 m at the southern end of the basin, associated with Gulf of Aden Intermediate Water inflowing from the Gulf of Aden during the summer season as an intruding subsurface layer. Stirring and mixing with ambient waters lead to marked increases in temperature (from 16.5 to almost 33°C) and salinity (from 35.7 to more than 38 psu) in this layer by the time it reaches midbasin. The observed circulation presents a very vigorous pattern with strong variability and intense features that extend the width of the basin. A permanent cyclone, detected in the northern Red Sea, verifies previous observations and modeling studies, while in the central sector of the basin a series of very strong anticyclones were observed with maximum velocities exceeding 1 m/s. The three-layer flow pattern, representative of the summer exchange between the Red Sea and the Gulf of Aden, is observed in the strait of Bab el Mandeb. In the southern part of the basin the layer flow is characterized by strong banking of the inflows and outflows against the coasts. Both surface and intermediate water masses involved in the summer Red Sea circulation present prominent spatial variability in their characteristics, indicating that the eddy field and mixing processes play an important role in the summer Red Sea circulation.

  20. Decontamination of CAGR gas circulator components

    International Nuclear Information System (INIS)

    This paper describes the development and full-scale trial of two methods for removal of radioactive contamination on the surfaces of CAGR gas circulator components. The two methods described are a particle impact cleaning (PIC) decontamination technique and an electrochemical technique, 'electro-swabbing', which is based on the principle of decontamination by electro-polishing. In developing these techniques it was necessary to take account of the physical and chemical nature of the surface deposits on the gas circulator components; these were shown to consist of magnetite-type oxide and carbonaceous material. In order to follow the progress of the decontamination it was also necessary to develop a surface sampling technique which was effective and precise under these conditions; an electrochemical technique, employing similar principles to the electro-swabbing process, was developed for this purpose. The full-scale trial of the PIC decontamination technique was carried out on an inlet guide vane (IGV) assembly, this having been identified as the component from the gas circulator which contributes most to the radiation dose accumulated during routine circulator maintenance. The technique was shown to be practically viable and some 99% of the radioactive contamination was readily removed from the treated surfaces with only negligible surface damage being caused. The full-scale trial of the electro-swabbing decontamination technique was carried out on a gas circulator impeller. High decontamination factors were again achieved with ≥ 99% of the radioactive contamination being removed from the treated surfaces. The technique has practical limitations in terms of handling and treatment of waste-arisings. However, the use of specially-designed swabbing electrodes may allow the treatment of constricted geometries inaccessible to techniques such as PIC. The technique is also highly suitable for the treatment of soft-finish materials and of components fabricated from a

  1. Effects of Microtopography on Overmarsh Circulation (United States)

    Sullivan, J. C.; Torres, R.; Garrett, A.


    Authors: J.C. Sullivan, R. Torres, A.J. Garrett In this study we systematically degrade a high-resolution, high precision salt marsh DEM and characterize the effects of DEM smoothing on overmarsh circulation. The question driving this effort is: How much topographic detail is needed to accurately simulate salt marsh circulation? The hydrodynamic model Delft3D was applied to data from a previous dye-tracer study in a 2 km2 semi-enclosed salt marsh basin at Skidaway Institute of Oceanography near Savannah, Georgia, USA. Overmarsh circulation was simulated for each smoothed DEM over a 5 day period corresponding to spring tide conditions. Results show that flood and ebb pathways differ significantly, but this effect is less apparent as the DEM is smoothed. Also, the flushing time (Tf) decreases with smoothing leading to greater dilution of a dye tracer with each tidal cycle. Observations at the macro, meso and micro scale show that flood and ebb flows become stronger through a consistent set of flow paths, including intertidal creeks, and differences in overmarsh circulation are more apparent in low marsh and channel head areas. This work shows that accurate representation of overmarsh circulation requires that the DEM resolve creek and low lying marsh structures at a spatial scale of 2-4m, but not necessarily the smallest tidal creeks (< 1m in width and depth). The next phase of this work will be to incorporate spatial variations in vegetation cover using RULLI (Remote Ultra Low-Light Imaging) remote sensing technology developed by the Department of Energy.

  2. Circulation factors affecting precipitation over Bulgaria (United States)

    Nojarov, Peter


    The objective of this paper is to determine the influence of circulation factors on precipitation in Bulgaria. The study succeeds investigation on the influence of circulation factors on air temperatures in Bulgaria, as the focus here is directed toward precipitation amounts. Circulation factors are represented through two circulation indices, showing west-east or south-north transport of air masses over Bulgaria and four teleconnection indices (patterns)—North Atlantic Oscillation, East Atlantic, East Atlantic/Western Russia, and Scandinavian. Omega values at 700-hPa level show vertical motions in the atmosphere. Annual precipitation trends are mixed and not statistically significant. A significant decrease of precipitation in Bulgaria is observed in November due to the strengthening of the eastward transport of air masses (strengthening of EA teleconnection pattern) and anticyclonal weather (increase of descending motions in the atmosphere). There is also a precipitation decrease in May and June due to the growing influence of the Azores High. An increase of precipitation happens in September. All this leads to a redistribution of annual precipitation course, but annual precipitation amounts remain the same. However, this redistribution has a negative impact on agriculture and winter ski tourism. Zonal circulation has a larger influence on precipitation in Bulgaria compared to meridional. Eastward transport throughout the year leads to lower than the normal precipitation, and vice versa. With regard to the four teleconnection patterns, winter precipitation in Bulgaria is determined mainly by EA/WR teleconnection pattern, spring and autumn by EA teleconnection pattern, and summer by SCAND teleconnection pattern.

  3. Development Strategies for Rural Key Circulation Service Network

    Institute of Scientific and Technical Information of China (English)


    The rural key circulation service network is an important channel for ensuring agricultural products’entry to market and urban industrial products’entry to rural areas.Through in-depth survey and research,we took a look at development changes and current situations of three circulation service networks,namely,circulation of nondurable consumer goods,circulation of agricultural means of production,and circulation of agricultural products.Based on several key problems in rural circulation service network,such as logistics problem,delivery problem,backward transaction mode,and the last kilometer information,we put forward corresponding development countermeasures.

  4. Jet fragmentation via recombination of parton showers (United States)

    Han, Kyong Chol; Fries, Rainer J.; Ko, Che Ming


    We propose to model hadronization of parton showers in QCD jets through a hybrid approach involving quark recombination and string fragmentation. This is achieved by allowing gluons at the end of the perturbative shower evolution to undergo a nonperturbative splitting into quark and antiquark pairs, then applying a Monte Carlo version of instantaneous quark recombination, and finally subjecting remnant quarks (those which have not found a recombination partner) to Lund string fragmentation. When applied to parton showers from the pythia Monte Carlo event generator, the final hadron spectra from our calculation compare quite well to pythia jets that have been hadronized with the default Lund string fragmentation. Our new approach opens up the possibility to generalize hadronization to jets embedded in a quark gluon plasma.

  5. Derivation of revised formulae for eddy viscous forces used in the ocean general circulation model (United States)

    Chou, Ru Ling


    Presented is a re-derivation of the eddy viscous dissipation tensor commonly used in present oceanographic general circulation models. When isotropy is imposed, the currently-used form of the tensor fails to return to the laplacian operator. In this paper, the source of this error is identified in a consistent derivation of the tensor in both rectangular and earth spherical coordinates, and the correct form of the eddy viscous tensor is presented.

  6. Evaluation of a research circulation control airfoil using Navier-Stokes methods (United States)

    Shrewsbury, George D.


    The compressible Reynolds time averaged Navier-Stokes equations were used to obtain solutions for flows about a two dimensional circulation control airfoil. The governing equations were written in conservation form for a body-fitted coordinate system and solved using an Alternating Direction Implicit (ADI) procedure. A modified algebraic eddy viscosity model was used to define the turbulent characteristics of the flow, including the wall jet flow over the Coanda surface at the trailing edge. Numerical results are compared to experimental data obtained for a research circulation control airfoil geometry. Excellent agreement with the experimental results was obtained.

  7. Application of PDCA circulation in quality control for production of steam generator pipe

    International Nuclear Information System (INIS)

    PDCA Circulation (Plan, Do, Check, Action) is applied in quality-control management during the welding process of Titanium alloy steam generator pipe. The weld defects is controlled effectively and the ratio of certified weld rose steadily, which achieve its target (90%). Experiments and engineering application show that, if the process-control could be carried out according to the PDCA circulation, activity which affect quality could be ensured to be controlled effectively without being omitted, and finally, steadily and dependable manufacture techniques could be formed so that the quality of products can be improved perpetually. (authors)

  8. Purification and crystallization of human Cu/Zn superoxide dismutase recombinantly produced in the protozoan Leishmania tarentolae

    International Nuclear Information System (INIS)

    The structures of two new crystal forms of human Cu/Zn superoxide dismutase produced in the eukaryotic expression host L. tarentolae are reported. The rapid and inexpensive production of high-quality eukaryotic proteins in recombinant form still remains a challenge in structural biology. Here, a protein-expression system based on the protozoan Leishmania tarentolae was used to produce human Cu/Zn superoxide dismutase (SOD1) in recombinant form. Sequential integration of the SOD1 expression cassettes was demonstrated to lead to a linear increase in expression levels to up to 30 mg per litre. Chromatographic purification resulted in 90% pure recombinant protein, with a final yield of 6.5 mg per litre of culture. The protein was crystallized and the structures of two new crystal forms were determined. These results demonstrate the suitability of the L. tarentolae expression system for structural research

  9. Comparison of recombination models in organic bulk heterojunction solar cells

    International Nuclear Information System (INIS)

    Recombination in bulk-heterojunction (BHJ) organic solar cells is the key loss mechanism, and it directly affects characteristic parameters such as power conversion efficiency, short-circuit current, open-circuit voltage, and fill factor. However, which recombination mechanism dominates the loss in organic materials is unclear at present. In this work, we simulate state-of-art BHJ solar cells using five recombination models, including direct recombination, Langevin recombination, charge transfer state recombination, trap-assisted recombination, and recombination via tail. All processes are strongly dependent on charge carrier mobility and exhibit a similar recombination distribution in active layer. For high mobilities, all models present a similar behavior along with the increased mobilities, whereas, there are slight differences in open-circuit voltage between trap/tail model and other ones at lower mobilities, resulting from the interaction between photo-carriers and dark-carriers

  10. Synthesis, purification, and characterization of an Arg152 → Glu site-directed mutant of recombinant human blood clotting factor VII

    International Nuclear Information System (INIS)

    Coagulation factor VII circulates in blood as a single-chain zymogen of a serine protease and is converted to its activated two-chain form, factor VIIa, by cleavage of an internal peptide bond located at Arg152-Ile153. Previous studies using serine protease active-site inhibitors suggest that zymogen factor VII may possess sufficient proteolytic activity to initiate the extrinsic pathway of blood coagulation. In order to assess the putative intrinsic proteolytic activity of single-chain factor VII, the authors have constructed a site-specific mutant of recombinant human factor VII in which arginine-152 has been replaced with a glutamic acid residue. Mutant factor VII was purified in a single step from culture supernatants of baby hamster kidney cells transfected with a plasmid containing the sequence for Arg152 → Glu factor VII using a calcium-dependent, murine anti-factor VII monoclonal antibody column. The clotting activity of mutant factor VII was completely inhibited following incubation with dansyl-Glu-Gly-Arg chloromethyl ketone, suggesting that the apparent clotting activity of mutant factor VII was due to a contaminating serine protease. Immunoblots of mutant factor VII with human factor IXa revealed no cleavage, whereas incubation of mutant factor VII with human factor Xa resulted in cleavage of mutant factor VII and the formation of a lower molecular weight degradation product migrating at Mr∼40 000. The results are consistent with the proposal that zymogen factor VII possesses no intrinsic proteolytic activity toward factor X or factor IX

  11. Characterization of recombinant high pI Barley α-Glucosidase

    DEFF Research Database (Denmark)

    Næsted, Henrik; Svensson, Birte

    α-glucosidase activity in barley seeds plays a crucial role in embryonic development. The concerted action of α-glucosidase, α-amylase, β-amylase, and limit dextrinase serve as the machinery responsible for the supply of glucose as energy source for the developing embryo in the germinating seed...... (MacGregor A.W.). Here we present the recent results of the expression and characterization of the recombinant full length barley high pI α-glucosidase in Pichia Pastoris. In order to facilitate in the range of mg protein yield, a clone representing an N-terminal hexa histidine tagged recombinant form...

  12. Poly(ADP-ribose) polymerase (PARP-1) has a controlling role in homologous recombination


    Schultz, Niklas; Lopez, Elena; Saleh-Gohari, Nasrollah; Helleday, Thomas


    Cells with non-functional poly(ADP-ribose) polymerase (PARP-1) show increased levels of sister chromatid exchange, suggesting a hyper recombination phenotype in these cells. To further investigate the involvement of PARP-1 in homologous recombination (HR) we investigated how PARP-1 affects nuclear HR sites (Rad51 foci) and HR repair of an endonuclease-induced DNA double-strand break (DSB). Several proteins involved in HR localise to Rad51 foci and HR-deficient cells fail to form Rad51 foci in...

  13. SIR epidemics in monogamous populations with recombination

    CERN Document Server

    Zanette, Damián H


    We study the propagation of an SIR (susceptible-infectious-recovered) disease over an agent population which, at any instant, is fully divided into couples of agents. Couples are occasionally allowed to exchange their members. This process of couple recombination can compensate the instantaneous disconnection of the interaction pattern and thus allow for the propagation of the infection. We study the incidence of the disease as a function of its infectivity and of the recombination rate of couples, thus characterizing the interplay between the epidemic dynamics and the evolution of the population's interaction pattern.

  14. Phylogenetic Studies of the Three RNA Silencing Suppressor Genes of South American CTV Isolates Reveal the Circulation of a Novel Genetic Lineage

    Directory of Open Access Journals (Sweden)

    María José Benítez-Galeano


    Full Text Available Citrus Tristeza Virus (CTV is the most economically important virus of citrus worldwide. Genetic diversity and population structure of CTV isolates from all citrus growing areas from Uruguay were analyzed by RT-PCR and cloning of the three RNA silencing suppressor genes (p25, p20 and p23. Bayesian phylogenetic analysis revealed the circulation of three known genotypes (VT, T3, T36 in the country, and the presence of a new genetic lineage composed by isolates from around the world, mainly from South America. Nucleotide and amino acid identity values for this new genetic lineage were both higher than 97% for the three analyzed regions. Due to incongruent phylogenetic relationships, recombination analysis was performed using Genetic Algorithms for Recombination Detection (GARD and SimPlot software. Recombination events between previously described CTV isolates were detected. High intra-sample variation was found, confirming the co-existence of different genotypes into the same plant. This is the first report describing: (1 the genetic diversity of Uruguayan CTV isolates circulating in the country and (2 the circulation of a novel CTV genetic lineage, highly present in the South American region. This information may provide assistance to develop an effective cross-protection program.

  15. Phylogenetic Studies of the Three RNA Silencing Suppressor Genes of South American CTV Isolates Reveal the Circulation of a Novel Genetic Lineage. (United States)

    Benítez-Galeano, María José; Rubio, Leticia; Bertalmío, Ana; Maeso, Diego; Rivas, Fernando; Colina, Rodney


    Citrus Tristeza Virus (CTV) is the most economically important virus of citrus worldwide. Genetic diversity and population structure of CTV isolates from all citrus growing areas from Uruguay were analyzed by RT-PCR and cloning of the three RNA silencing suppressor genes (p25, p20 and p23). Bayesian phylogenetic analysis revealed the circulation of three known genotypes (VT, T3, T36) in the country, and the presence of a new genetic lineage composed by isolates from around the world, mainly from South America. Nucleotide and amino acid identity values for this new genetic lineage were both higher than 97% for the three analyzed regions. Due to incongruent phylogenetic relationships, recombination analysis was performed using Genetic Algorithms for Recombination Detection (GARD) and SimPlot software. Recombination events between previously described CTV isolates were detected. High intra-sample variation was found, confirming the co-existence of different genotypes into the same plant. This is the first report describing: (1) the genetic diversity of Uruguayan CTV isolates circulating in the country and (2) the circulation of a novel CTV genetic lineage, highly present in the South American region. This information may provide assistance to develop an effective cross-protection program. PMID:26205407

  16. No evidence of circulating autoantibodies against osteoprotegerin in patients with celiac disease

    Institute of Scientific and Technical Information of China (English)

    Tiziana Larussa; Evelina Suraci; Immacolata Nazionale; Isabella Leone; Tiziana Montalcini; Ludovico Abenavoli; Maria Imeneo


    AIM:To investigate risk factors for low bone mineral density (BMD) in celiac disease (CD) patients,focusing on circulating autoantibodies against osteoprotegerin (OPG).METHODS:Seventy asymptomatic CD adult patients on gluten-free diet (GFD) and harbouring persistent negative CD-related serology were recruited.Conventional risk factors for osteoporosis (e.g.,age,sex,menopausal status,history of fractures,smoke,and body mass index) were checked and BMD was assessed by dual energy X ray absorptiometry.Serum calcium and parathyroid hormone (PTH) levels were evaluated.Thirty-eight patients underwent repeat duodenal biopsy.Serum samples from a selected sub-group of 30 patients,who were also typed for human leukocyte antigen (HLA) DQ2 and DQ8 haplotype,were incubated with homodimeric recombinant human OPG and tested by western blotting with an anti-OPG antibody after immunoprecipitation.RESULTS:Despite persistent negative CD-related serology and strict adherence to GFD,49 out of the 70 (74%) patients displayed low BMD.Among these patients,13 (24%) showed osteoporosis and 36 (76%)osteopenia.With the exception of age,conventional risk factors for osteoporosis did not differ between patients with normal and low BMD.Circulating serum calcium and PTH levels were normal in all patients.Duodenal mucosa healing was found in 31 (82%) out of 38 patients who underwent repeat duodenal biopsy with 20 (64%) still displaying low BMD.The remaining 7 patients had an incomplete normalization of duodenal mucosa with 6 (84%) showing low BMD.No evidence of circulating antibodies against OPG was found in the serum of 30 celiac patients who were tested for,independent of BMD,duodenal histology,and HLA status.CONCLUSION:If any,the role of circulating autoantibodies against OPG in the pathogenesis of bone derangement in patients with CD is not a major one.

  17. Circulation patterns in active lava lakes (United States)

    Redmond, T. C.; Lev, E.


    Active lava lakes provide a unique window into magmatic conduit processes. We investigated circulation patterns of 4 active lava lakes: Kilauea's Halemaumau crater, Mount Erebus, Erta Ale and Nyiragongo, and in an artificial "lava lake" constructed at the Syracuse University Lava Lab. We employed visual and thermal video recordings collected at these volcanoes and use computer vision techniques to extract time-dependent, two-dimensional surface velocity maps. The large amount of data available from Halemaumau enabled us to identify several characteristic circulation patterns. One such pattern is a rapid acceleration followed by rapid deceleration, often to a level lower than the pre-acceleration level, and then a slow recovery. Another pattern is periodic asymmetric peaks of gradual acceleration and rapid deceleration, or vice versa, previously explained by gas pistoning. Using spectral analysis, we find that the dominant period of circulation cycles at approximately 30 minutes, 3 times longer than the dominant period identified previously for Mount Erebus. Measuring a complete surface velocity field allowed us to map and follow locations of divergence and convergence, therefore upwelling and downwelling, thus connecting the surface flow with that at depth. At Nyiragongo, the location of main upwelling shifts gradually, yet is usually at the interior of the lake, for Erebus it is usually along the perimeter yet often there is catastrophic downwelling at the interior; For Halemaumau upwelling/downwelling position is almost always on the perimeter. In addition to velocity fields, we developed an automated tool for counting crustal plates at the surface of the lava lakes, and found a correlation, and a lag time, between changes if circulation vigor and the average size of crustal plates. Circulation in the artificial basaltic lava "lake" was limited by its size and degree of foaming, yet we measured surface velocities and identify patterns. Maximum surface velocity

  18. Circulation of Antarctic intermediate water in the South Indian Ocean (United States)

    Fine, Rana A.


    Chlorofluorocarbon (CFC) and hydrographic data collected on the R.R.S. Charles Darwin Cruise 29 along 32°S during November-December 1987, are used to examine the circulation in the South Indian Ocean. The emphasis is on Antarctic Intermediate Water (AAIW); bottom waters and mode waters are also examined. Bottom waters entering in the western boundary of the Crozet Basin (about 60°E) and in the Mozambique Basin (about 40°E) have low concentrations of anthropogenic CFCs. The rest of the bottom and deep waters up to about 2000 m have concentrations that are below blank levels. Above the intermediate waters there are injections of mode waters, which are progressively denser in the eastward direction. They form a broad subsurface CFC maximum between 200 and 400 m. The injections of recently ventilated (with respect to CFCs and oxygen) Subantarctic Mode Waters (SAMWs) at different densities indicate that there is considerable exchange between the subtropical and subantarctic regions. The tracer data presented show that the circulation of AAIW in the South Indian Ocean is different from that in the South Atlantic and South Pacific oceans in several ways. (1) The most recently ventilated AAIW is observed in a compact anticyclonic gyre west of 72°E. The shallow topography (e.g. that extending northeastward from the Kerguelen Plateau) may deflect and limit the eastward extent of the most recently ventilated AAIW. As a consequence, there is a zonal offset in the South Indian Ocean of the location of the most recently ventilated SAMW and AAIW, which does not occur in the other two oceans. The strongest component of SAMW is in the east, while the AAIW is strongest in the western-central South Indian Ocean. The offset results in a higher vertical gradient in CFCs in the east. (2) The Agulhas Current may impede input of AAIW along the western boundary. (3) Tracers are consistent with an inter-ocean flow from the South Pacific into the Eastern Indian Ocean, similar to the

  19. Complete genome sequence of a coxsackievirus B3 recombinant isolated from an aseptic meningitis outbreak in eastern China. (United States)

    Zhang, Wenqiang; Lin, Xiaojuan; Jiang, Ping; Tao, Zexin; Liu, Xiaolin; Ji, Feng; Wang, Tongzhan; Wang, Suting; Lv, Hui; Xu, Aiqiang; Wang, Haiyan


    Coxsackievirus B3 (CV-B3) has frequently been associated with aseptic meningitis outbreaks in China. To identify sequence motifs related to aseptic meningitis and to construct an infectious clone, the genome sequence of 08TC170, a representative strain isolated from cerebrospinal fluid (CSF) samples from an outbreak in Shandong in 2008, was determined, and the coding regions for P1-P3 and VP1 were aligned. The first 21 and last 20 residues were "TTAAAACAGCCTGTGGGTTGT" and "ATTCTCCGCATTCGGTGCGG", respectively. The whole genome consisted of 7401 nucleotides, sharing 80.8 % identity with the prototype strain Nancy and low sequence similarity with members of clusters A-C. In contrast, 08TC170 showed high sequence similarity to members of cluster D. An especially high level of sequence identity (≥97.7 %) was found within a branch constituted by 08TC170 and four Chinese strains that clustered together in all of the P1-P3 phylogenic trees. In addition, 08TC170 also possessed a close relationship to the Hong Kong strain 26362/08 in VP1. Similarity plot analysis showed that 08TC170 was most similar to the Chinese CV-B3 strain SSM in P1 and the partial P2 coding region but to the CV-B5 or E-6 strain in 2C and following regions. A T277A mutation was found in 08TC170 and other strains isolated in 2008-2010, but not in strains isolated before 2008, which had high sequence similarity and formed the cluster A277. The results suggested that 08TC170 was the product of both intertypic recombination and point mutation, whose effects on viral neurovirulence will be investigated in a further study. The high homology between 08TC170 and other strains revealed their co-circulation in mainland China and Hong Kong and indicates that further surveillance is needed. PMID:27236460

  20. Species association of hepatitis B virus (HBV in non-human apes; evidence for recombination between gorilla and chimpanzee variants.

    Directory of Open Access Journals (Sweden)

    Sinéad Lyons

    Full Text Available Hepatitis B virus (HBV infections are widely distributed in humans, infecting approximately one third of the world's population. HBV variants have also been detected and genetically characterised from Old World apes; Gorilla gorilla (gorilla, Pan troglodytes (chimpanzee, Pongo pygmaeus (orang-utan, Nomascus nastusus and Hylobates pileatus (gibbons and from the New World monkey, Lagothrix lagotricha (woolly monkey. To investigate species-specificity and potential for cross species transmission of HBV between sympatric species of apes (such as gorillas and chimpanzees in Central Africa or between humans and chimpanzees or gorillas, variants of HBV infecting captive wild-born non-human primates were genetically characterised. 9 of 62 chimpanzees (11.3% and two from 11 gorillas (18% were HBV-infected (15% combined frequency, while other Old world monkey species were negative. Complete genome sequences were obtained from six of the infected chimpanzee and both gorillas; those from P. t .ellioti grouped with previously characterised variants from this subspecies. However, variants recovered from P. t. troglodytes HBV variants also grouped within this clade, indicative of transmission between sub-species, forming a paraphyletic clade. The two gorilla viruses were phylogenetically distinct from chimpanzee and human variants although one showed evidence for a recombination event with a P.t.e.-derived HBV variant in the partial X and core gene region. Both of these observations provide evidence for circulation of HBV between different species and sub-species of non-human primates, a conclusion that differs from the hypothesis if of strict host specificity of HBV genotypes.

  1. Detecting key structural features within highly recombined genes.

    Directory of Open Access Journals (Sweden)

    John E Wertz


    Full Text Available Many microorganisms exhibit high levels of intragenic recombination following horizontal gene transfer events. Furthermore, many microbial genes are subject to strong diversifying selection as part of the pathogenic process. A multiple sequence alignment is an essential starting point for many of the tools that provide fundamental insights on gene structure and evolution, such as phylogenetics; however, an accurate alignment is not always possible to attain. In this study, a new analytic approach was developed in order to better quantify the genetic organization of highly diversified genes whose alleles do not align. This BLAST-based method, denoted BLAST Miner, employs an iterative process that places short segments of highly similar sequence into discrete datasets that are designated "modules." The relative positions of modules along the length of the genes, and their frequency of occurrence, are used to identify sequence duplications, insertions, and rearrangements. Partial alleles of sof from Streptococcus pyogenes, encoding a surface protein under host immune selection, were analyzed for module content. High-frequency Modules 6 and 13 were identified and examined in depth. Nucleotide sequences corresponding to both modules contain numerous duplications and inverted repeats, whereby many codons form palindromic pairs. Combined with evidence for a strong codon usage bias, data suggest that Module 6 and 13 sequences are under selection to preserve their nucleic acid secondary structure. The concentration of overlapping tandem and inverted repeats within a small region of DNA is highly suggestive of a mechanistic role for Module 6 and 13 sequences in promoting aberrant recombination. Analysis of pbp2X alleles from Streptococcus pneumoniae, encoding cell wall enzymes that confer antibiotic resistance, supports the broad applicability of this tool in deciphering the genetic organization of highly recombined genes. BLAST Miner shares with

  2. Recombinant microorganisms for increased production of organic acids (United States)

    Yi, Jian; Kleff, Susanne; Guettler, Michael V


    Disclosed are recombinant microorganisms for producing organic acids. The recombinant microorganisms express a polypeptide that has the enzymatic activity of an enzyme that is utilized in the pentose phosphate cycle. The recombinant microorganism may include recombinant Actinobacillus succinogenes that has been transformed to express a Zwischenferment (Zwf) gene. The recombinant microorganisms may be useful in fermentation processes for producing organic acids such as succinic acid and lactic acid. Also disclosed are novel plasmids that are useful for transforming microorganisms to produce recombinant microorganisms that express enzymes such as Zwf.

  3. Expression and Characterization of the Recombinant Human FLT-3 Ligand Extracellular Domain in Pichia Pastoris

    Institute of Scientific and Technical Information of China (English)

    Zongtang Huang; Xishan Hao


    OBJECTIVE The FLT-3 ligand (fms-like tyrosine kinase receptor-3 ligand, FL) is a recently described growth factor affecting early hematopoietic progenitor cells. The FL plays a key role in the growth and differentiation of primitive hematopoietic cells. To yield a high-level of recombinant human FL protein, a recombinant Pichia Pastoris (P. pastoris)strain was constructed.METHODS An artificial expression frame, with the same encoding protein sequence for the FL extracellular domain cDNA, was synthesized by using favored genetic codons of P. pastoris. P. pastoris strain KM71 cells were transformed with the endonuclease Bgl Ⅱ linearized recombined plasmid, pPIC9K-FL. The plasmid then was linerized in the 5'AOX1 site and integrated into the yeast KM71 genome. KM71 was transformed with pPIC9K plasmids as a control for the production of recombinant protein.Southern blotting and Northern blotting tests were used to screen the genotype of the recombined strain. Biological activity was demonstrated in vitro with culturing of CD34+cells.RESULTS The recombinant human FL protein expressed into the yeast culture supertant was identified on the basis of its molecular weight and Western blotting analysis. Numerous bands were observed in the 10~100 kDa molecular mass range. SDS-PAGE showed that the expressed product, a 20 kDa protein, was secreted into the medium in the form of a soluble molecule. Western-blot analyses showed good antigenicity and specificity against polyclonal antibodies. A sharp band and a smeared band were observed at a molecular mass of approximately 20 kDa by Western blotting. The recombinant human FL protein was the major protein component observed in the culture supernatant. The highest yield (108 mg/L) was obtained when expression was induced with 0.5% methanol for 96 h. Deglycosylation with PNGase F resulted in a decrease in apparent molecular mass from 20 kDa to 18 kDa forming three bands all of which were also detected by rabbit anti-FL antibodies

  4. Simulation and analysis of the mesoscale circulation in the northwestern Mediterranean Sea

    Directory of Open Access Journals (Sweden)

    V. Echevin

    Full Text Available The large-scale and mesoscale circulation of the northwestern Mediterranean Sea are simulated with an eddy-resolving primitive-equation regional model (RM of 1/16° resolution embedded in a general circulation model (GM of the Mediterranean Sea of 1/8° resolution. The RM is forced by a monthly climatology of heat fluxes, precipitation and wind stress. The GM, which uses the same atmospheric forcing, provides initial and boundary conditions for the RM. Analysis of the RM results shows that several realistic features of the large-scale and mesoscale circulation are evident in this region. The mean cyclonic circulation is in good agreement with observations. Mesoscale variability is intense along the coasts of Sardinia and Corsica, in the Gulf of Lions and in the Catalan Sea. The length scales of the Northern Current meanders along the Provence coast and in the Gulf of Lions’ shelf are in good agreement with observations. Winter Intermediate Water is formed along most of the north-coast shelves, between the Gulf of Genoa and Cape Creus. Advection of this water by the mean cyclonic circulation generates a complex eddy field in the Catalan Sea. Intense anticyclonic eddies are generated northeast of the Balearic Islands. These results are in good agreement with mesoscale activity inferred from satellite altimetric data. This work demonstrates the feasibility of a down-scaling system composed of a general-circulation, a regional and a coastal model, which is one of the goals of the Mediterranean Forecasting System Pilot Project.

    Key words. Oceanography: physical (currents; eddies and mesoscale processes; general circulation

  5. Effects of farmer social status and plant biocultural value on seed circulation networks in Vanuatu

    Directory of Open Access Journals (Sweden)

    Mathieu Thomas


    Full Text Available Seed circulation among farmers, which is embedded in composite social networks, is a key process in the dynamics of seed systems that shape crop diversity. We analyzed the daily circulation of biological objects, i.e., cultivated plants (31 species, 284 landraces, within a community of first-generation migrants (16 households, 30 persons living on the island of Vanua Lava in the South Pacific archipelago nation of Vanuatu. By combining participant observation, ethnobiological inventories, and social network analysis, we investigated how farmer social status and plant biocultural value affect plant circulation. Plant biocultural value was estimated by referring to their local classification according to uses, cultivation practices, growing environments, and biological properties. An aggregate plant circulation network (577 events and three subnetworks (i.e., for starchy, side dish, or snack food categories sharing the same 30 nodes were analyzed using exponential random graph models. Evidence that farmer social status influences the patterns of plant circulation was found through the distribution of structural parameters of the network, including: dyadic reciprocity; in-degree, out-degree, and their correlation; triadic cycling; and transitivity. At the scale of the aggregate network, direct or indirect reciprocity was not observed. Instead, a high out-degree (i.e., being a more frequent giver and a negative correlation between in-degree and out-degree both confer prestige and reinforce hierarchy. These results suggest that some of the social dynamics of the Melanesian-type Big Man political system may persist, even though the system itself no longer exists in traditional form. Moreover, based on our comparative analysis of the three subnetworks, farmer social status appears to influence greatly the circulation of plants with high biocultural value while having little influence on plants with low biocultural value. Farmer social status and plant

  6. Expression of Recombinant Streptokinase from Streptococcus Pyogenes and Its Reaction with Infected Human and Murine Sera

    Directory of Open Access Journals (Sweden)

    Neda Molaee


    Full Text Available   Objective(s: Streptokinase (SKa is an antigenic protein which is secreted by Streptococcus pyogenes. Streptokinase induces inflammation by complement activation, which may play a role in post infectious diseases. In the present study, recombinant streptokinase from S. pyogenes was produced and showed that recombinant SKa protein was recognized by infected human sera using Western blot analysis.   Materials and Methods: In this study, the ska gene from S. pyogenes was amplified and cloned into pET32a which is a prokaryotic expression vector. pET32a-ska was transformed to Escherichia coli BL21 (DE3 pLysS and gene expression was induced by IPTG. Protein production was improved by modification of composition of the bacterial culture media and altering the induction time by IPTG. The expressed protein was purified by affinity chromatography using the Ni-NTA resin. The integrity of the product was confirmed by Westernblot analysis using infected mice. Serum reactivity of five infected individuals was further analyzed against the recombinant SKa protein. Results: Data indicated that recombinant SKa protein from S. pyogenes can be recognized by patient and mice sera. The concentration of the purified recombinant protein was 3.2 mg/L of initial culture. The highest amount of the expressed protein after addition of IPTG was obtained in a bacterial culture without glucose with the culture optical density of 0.8 (OD600 = 0.8. Conclusion : Present data shows, recombinant SKa protein has same epitopes with natural form of this antigen. Recombinant SKa also seemed to be a promising antigen for the serologic diagnosis of S. pyogenes infections.

  7. Differential rotation in a solar-driven quasi-axisymmetric circulation. [of planetary atmospheres (United States)

    Mayr, H. G.; Harris, I.; Chan, K. L.


    The concept of a quasi-axisymmetric circulation is used to explore the global scale dynamics of planetary atmospheres. A numerical circulation model applicable to Jupiter is presented, and an analytical study is performed elucidating the conditions leading to differential rotation in an atmosphere which is convectively unstable. A linear system forced by solar differential heating is considered, with nonlinear effects arising from advection being represented in the form of eddy diffusion. An empirical, latitudinal spectrum of the observed zonal wind field on Jupiter is discussed. Numerical solutions are presented which reveal banded wind fields with alternating and equatorial zonal jets and a multicellular Ferrel-Thomson meridional circulation consistent with the observed cloud striations on Jupiter. The vertical derivatives are parameterized to construct a simplified one-layer model.

  8. Meridional Circulation From Differential Rotation in an Adiabatically Stratified Solar/Stellar Convection Zone

    CERN Document Server

    Dikpati, Mausumi


    Meridional circulation in stellar convection zones is not generally well observed, but may be critical for MHD dynamos. Coriolis forces from differential rotation (DR) play a large role in determining what the meridional circulation is. Here we consider whether a stellar DR that is constant on cylinders concentric with the rotation axis can drive a meridional circulation.Conventional wisdom says that it can not. Using two related forms of governing equations that respectively estimate the longitudinal components of the curl of meridional mass flux and the vorticity, we show that such DR will drive a meridional flow. This is because to satisfy anelastic mass conservation, non-spherically symmetric pressure contours must be present for all DRs, not just ones that depart from constancy on cylinders concentric with the rotation axis. Therefore the fluid is always baroclinic if DR is present, because, in anelastic systems, the perturbation pressure must satisfy a Poisson type equation, as well as an equation of st...

  9. Numerical simulation of tropical-cyclone circulation using Arakawa-Schubert cumulus parametrization

    International Nuclear Information System (INIS)

    Tropical cyclone is simulated from a weak balanced vortex in a numerical model using Arakawa-Schubert cumulus parametrization scheme. A six-level axisymmetric primitive equation model incorporating the cumulus effects is designed for this study. The model consists of four layers in the free atmosphere and one layer for a mixed layer. Three cloud types with tops at 12 km, 8 km and 4 km are possible to form in this model. The results of this numerical experiment clearly indicate the development of a tropical cyclone and the model-derived circulation and structure of the cyclone agree with the observed features. The intensification of the cyclone, the development of radial-vertical circulation and the formation of the eye are well simulated in this experiment. It may be inferred that this parametrization scheme realistically produces tropical-cyclone circulation and will be useful in studies of tropical systems

  10. Numerical method for studying the circulation patterns of a fluid in a cavity

    International Nuclear Information System (INIS)

    The method incorporates three circulation-inducing mechanisms: (1) buoyancy induced by nonuniform initial distribution of heat throughout the fluid, (2) buoyancy induced by removal of heat from the fluid, and (3) forced convection induced by withdrawal of heated fluid and return of cooled fluid. A two-dimensional computer program, CIRCO, based on the Marker-and-Cell (MAC) technique, is used to study the circulation patterns. The report discusses the code and illustrates its capabilities by means of examples from studies conducted for the Pacer project, which investigates the concept of producing electrical power from energy released by thermonuclear explosions in a salt dome. Efficient engineering for withdrawing energy from the cavity requires an understanding of the circulation patterns of the heated fluid. CIRCO provides this information in the form of computer-generated plots

  11. New and old complex recombinant HIV-1 strains among patients with primary infection in 1996–2006 in France: The French ANRS CO06 primo cohort study

    Directory of Open Access Journals (Sweden)

    Peeters Martine


    Full Text Available Abstract Background Prevalence of HIV-1 non-B subtypes has increased overtime in patients diagnosed at the time of primary infection (PHI in France. Our objective was to characterize in detail non-B strains which could not be genetically classified into the known subtypes/Circulating Recombinant Forms (CRFs. Methods Among 744 patients enrolled in the ANRS PRIMO Cohort since 1996, 176 (23.7% were infected with HIV-1 non-B strains. The subtype/CRF could not be identified in RT for 15 (2%. The V3-V5 env region was sequenced and 3 strains (04FR-KZS, 06FR-CRN, 04FR-AUK were full-length sequenced. Phylogenetic and bootscan analyses were used to characterize the mosaic structures. Results Among V3-V5 sequences, 6 were divergent A, 2 distantly related to E or D, 2 C, 1 B and 2 remained unclassified. 04FR-KZS, isolated in a Congolese woman infected in France, clustered with 2 previously described viruses from the Democratic Republic of Congo. They represent CRF27_cpx involving A/E/G/H/J/K/U subtypes. 06FR-CRN, isolated in a homosexual Caucasian patient, was a B/C/U recombinant involving a Brazilian C strain. 04FR-AUK, isolated in a Congolese patient infected in France, was a A/K/CRF09/U recombinant clustering from gag to vif with HIV-1 MAL. Others PHI were further observed in 2006–2007 with 1 KZS and 5 CRN-like viruses, suggesting their spread in France. Conclusion This study illustrates the increasing HIV-1 diversity in France associating new (06FR-CRN and old (CRF27_cpx and "MAL-like" 04FR-AUK strains, which are rare in their region of origin but may have a possible founder effect in France. Our results strengthen the French guidelines recommending viro-epidemiological surveillance of HIV-1 diversity.


    Artificial circulation and hypolimnetic aeration are management techniques for oxygenating eutrophic lakes subject to water quality problems, algal blooms, and fishkills. Artificial circulation is achieved by injecting diffused air into lower waters, by mechanial pumping of water...

  13. Silent Circulation of Ross River Virus in French Polynesia

    Directory of Open Access Journals (Sweden)

    Maite Aubry


    Discussion: Our results support the existence of autochthonous RRV transmission and suggest that this pathogen has silently circulated in French Polynesia. These findings raise the question of possible undetected circulation of RRV in other Pacific Island Countries and Territories.

  14. Production and Analysis of Biological Properties of Recombinant Human Apolipoprotein A-I. (United States)

    Ryabchenko, A V; Kotova, M V; Tverdohleb, N V; Knyazev, R A; Polyakov, L M


    Production of recombinant human apolipoprotein A-I (apoA-I) in E. coli cells is described and its biological properties are compared with those of natural protein. Recombinant apoA-I was isolated as a chimeric polypeptide and then processed to a mature form apoA-I (rapo-I). We studied the ability of the resulting protein to penetrate into hepatocyte nuclei and regulate the rate of DNA biosynthesis in complex with estriol. Penetration of rapoA-I conjugated with FITC into hepatocyte nuclei was demonstrated. rapoA-I-estriol and apoA-I-estriol complexes induced similar increase in DNA biosynthesis rate in isolated hepatocytes, which confi rms functional similarity of the obtained recombinant mature protein (rapoA-I) and native human apoA-I. PMID:26612626

  15. Generation of monoclonal antibodies for the assessment of protein purification by recombinant ribosomal coupling

    DEFF Research Database (Denmark)

    Kristensen, Janni; Sperling-Petersen, Hans Uffe; Mortensen, Kim Kusk;


    We recently described a conceptually novel method for the purification of recombinant proteins with a propensity to form inclusion bodies in the cytoplasm of Escherichia coli. Recombinant proteins were covalently coupled to the E. coli ribosome by fusing them to ribosomal protein 23 (rpL23....... We therefore purified rpL23-GFP-His, rpL23-His and GFP from E. coli recombinants using affinity, ion exchange and hydrophobic interaction chromatography. These proteins could be purified with yields of 150, 150 and 1500 microg per gram cellular wet weight, respectively. However, rpL23-GFP-His could...... purified by Protein G Sepharose affinity chromatography. The purified antibodies were used to evaluate the separation of ribosomes from GFP, streptavidin, murine interleukin-6, a phagedisplay antibody and yeast elongation factor 1A by centrifugation, when ribosomes with covalently coupled target protein...

  16. Schizosaccharomyces pombe Mms1 channels repair of perturbed replication into Rhp51 independent homologous recombination

    DEFF Research Database (Denmark)

    Vejrup-Hansen, Rasmus; Mizuno, Ken'Ichi; Miyabe, Izumi;


    In both Schizosaccharomyces pombe and Saccharomyces cerevisiae, Mms22 and Mms1 form a complex with important functions in the response to DNA damage, loss of which leads to perturbations during replication. Furthermore, in S. cerevisiae, Mms1 has been suggested to function in concert with a Cullin......-like protein, Rtt101/Cul8, a potential paralog of Cullin 4. We performed epistasis analysis between ¿mms1 and mutants of pathways with known functions in genome integrity, and measured the recruitment of homologous recombination proteins to blocked replication forks and recombination frequencies. We show that...... particularly important when a single strand break is converted into a double strand break during replication. Genetic data connect Mms1 to a Mus81 and Rad22(Rad52) dependent, but Rhp51 independent, branch of homologous recombination. This is supported by results demonstrating that Mms1 is recruited to a site...

  17. Isolation and characterization of recombinant human casein kinase II subunits alpha and beta from bacteria

    DEFF Research Database (Denmark)

    Grankowski, N; Boldyreff, B; Issinger, O G


    cDNA encoding the casein kinase II (CKII) subunits alpha and beta of human origin were expressed in Escherichia coli using expression vector pT7-7. Significant expression was obtained with E. coli BL21(DE3). The CKII subunits accounted for approximately 30% of the bacterial protein; however, most...... of the expressed proteins were produced in an insoluble form. The recombinant CKII alpha subunit was purified by DEAE-cellulose chromatography, followed by phosphocellulose and heparin-agarose chromatography. The recombinant CKII beta subunit was extracted from the insoluble pellet and purified in a...... single step on phosphocellulose. From 10 g bacterial cells, the yield of soluble protein was 12 mg alpha subunit and 5 mg beta subunit. SDS/PAGE analysis of the purified recombinant proteins indicated molecular masses of 42 kDa and 26 kDa for the alpha and beta subunits, respectively, in agreement with...

  18. Densified waste form and method for forming

    Energy Technology Data Exchange (ETDEWEB)

    Garino, Terry J.; Nenoff, Tina M.; Sava Gallis, Dorina Florentina


    Materials and methods of making densified waste forms for temperature sensitive waste material, such as nuclear waste, formed with low temperature processing using metallic powder that forms the matrix that encapsulates the temperature sensitive waste material. The densified waste form includes a temperature sensitive waste material in a physically densified matrix, the matrix is a compacted metallic powder. The method for forming the densified waste form includes mixing a metallic powder and a temperature sensitive waste material to form a waste form precursor. The waste form precursor is compacted with sufficient pressure to densify the waste precursor and encapsulate the temperature sensitive waste material in a physically densified matrix.

  19. Densified waste form and method for forming

    Energy Technology Data Exchange (ETDEWEB)

    Garino, Terry J.; Nenoff, Tina M.; Sava Gallis, Dorina Florentina


    Materials and methods of making densified waste forms for temperature sensitive waste material, such as nuclear waste, formed with low temperature processing using metallic powder that forms the matrix that encapsulates the temperature sensitive waste material. The densified waste form includes a temperature sensitive waste material in a physically densified matrix, the matrix is a compacted metallic powder. The method for forming the densified waste form includes mixing a metallic powder and a temperature sensitive waste material to form a waste form precursor. The waste form precursor is compacted with sufficient pressure to densify the waste precursor and encapsulate the temperature sensitive waste material in a physically densified matrix.

  20. Anti-cyclonic circulation driven by the estuarine circulation in a gulf type ROFI (United States)

    Fujiwara, T.; Sanford, L. P.; Nakatsuji, K.; Sugiyama, Y.


    Baroclinic residual circulation processes are examined in gulf type Regions Of Freshwater Influence (ROFIs), which have large rivers discharging into a rounded head wider than the Rossby internal deformation radius. Theoretical and observational investigations concentrate on Ise Bay, Japan, with supporting data from Osaka Bay and Tokyo Bay. Simplified analytical solutions are derived to describe the primary features of the circulation. Three dimensional residual current data collected using moored current meters and shipboard acoustic doppler current profilers (ADCPs), satellite imagery and density structure data observed using STDs, are presented for comparison to the theoretical predictions. There are three key points to understanding the resulting circulation in gulf type ROFIs. First, there are likely to be three distinct water masses: the river plume, a brackish upper layer, and a higher salinity lower layer. Second, baroclinic processes in gulf type ROFIs are influenced by the Earth's rotation at first order. Residual currents are quasi-geostrophic and potential vorticity is approximately conserved. Third, the combined effects of a classical longitudinal estuarine circulation and the Earth's rotation are both necessary to produce the resulting circulation. Anti-cyclonic vorticity is generated in the upper layer by the horizontal divergence associated with upward entrainment, which is part of the estuarine circulation. The interaction between anti-cyclonic vorticity and horizontal divergence results in two regions of qualitatively different circulation, with gyre-like circulation near the bay head and uniformly seaward anti-cyclonicly sheared flow further towards the mouth. The stagnation point separating the two regions is closer to (further away from) the bay head for stronger (weaker) horizontal divergence, respectively. The vorticity and spin-up time of this circulation are-(ƒ-ω 1)/2 and h/2w 0, respectively, where ƒ is the Coriolis parameter, ω 1 is

  1. A multicentre, double blind, randomised, placebo controlled trial of anakinra (Kineret), a recombinant interleukin 1 receptor antagonist, in patients with rheumatoid arthritis treated with background methotrexate


    Cohen, S.; Moreland, L; Cush, J; Greenwald, M.; Block, S; Shergy, W.; Hanrahan, P; Kraishi, M; Patel, A; Sun, G; Bear, M


    Objective: To assess the efficacy and safety of 100 mg daily anakinra (Kineret), a recombinant form of the naturally occurring interleukin 1 receptor antagonist, plus methotrexate (MTX) in reducing the signs and symptoms of rheumatoid arthritis (RA).

  2. Cognitive problems related to vertebrobasilar circulation. (United States)

    Koçer, Abdulkadir


    Neurodegenerative disorders are characterized by decreased regional cerebral blood flow. Supporting this concept, both cognitive training exercises and physical activity promote blood flow increase and correlate with healthy cognitive aging. The terminal branches of the posterior circulation supply blood to areas of the brain, such as the thalamus, hippocampus, occipital lobe, and cerebellum, involved with important intellectual functions, particularly recent memory, visual-spatial functioning, and visuomotor adaptations. Amnesia and visual agnosia may be a complication of not only posterior circulation infarctions but also vertebrobasilar insufficiency (VBI) without accompanying structural infarcts. The cognitive impairment maybe a manifestation of transient attacks and may persist beyond resolution of symptoms related to ischemia. Early recognition of cognitive deficits in the VBI patient is important because several recent reports show stent placements or medical treatment may improve cognition. PMID:26738337

  3. The circulation of care in transnational families

    Directory of Open Access Journals (Sweden)

    Laura Merla


    Full Text Available This article presents an approach to transnational family solidarity in terms of the “circulation of care”. This approach is based on a multidimensional vision of care-giving that goes beyond the personal care given to a dependent person. It takes the whole family network as its unit of analysis, and uses it to show the multiplicity of actors and the roles they play in the maintenance of transnational family solidarity in the long term. The article provides an analysis model of the institutional contexts that partially constitute the resources necessary for the circulation of care, recognising that other factors, such as the history of intra-family relationships, influence the dynamics at play.

  4. Natural circulation in pressurized water reactors

    International Nuclear Information System (INIS)

    Several analytical modelling have been done for steady-state and slow transients conditions, besides more sophisticated studies considering two and three dimensional effects in a very simple geometry. Under severe accident conditions for PWR a code to analyse natural circulation has been developed by Westinghouse. This paper discusses the problem of natural circulation in a complex geometry similar to that of nuclear power plants. A first experiment has been done at the integral test facility of 'Co-ordination of Special Projects-Ministry of Naval Affairs' (Coordenadoria para Projetos Especiais -Ministerio da Marinha, COPESP) for several flux conditions. The results obtained were compared with numerical simulations for the steady-state regime. 09 refs, 05 figs, 01 tab. (B.C.A.)

  5. Meridional circulation in turbulent protoplanetary disks

    CERN Document Server

    Fromang, Sebastien; Masset, Frederic


    Based on viscous disk theory, a number of recent studies have suggested the existence of a large scale meridional circulation in protoplanetary disks. Such a flow could account for the presence of crystalline silicates, among which Calcium and Aluminium-rich Inclusions (CAIs), at large distances from the sun. This paper aims at examining whether such large scale flows exist in turbulent protoplanetary disks. High resolution global hydrodynamical and magnetohydrodynamical numerical simulations of turbulent protoplanetary disks are used to infer the properties of the flow in such disks. By performing hydrodynamic simulations using explicit viscosity, we demonstrate that our numerical setup does not suffer from any numerical artifact. The aforementioned meridional circulation is readily recovered in viscous and laminar disks. In MHD simulations, the magneto-rotational instability drives turbulence in the disks. Averaging out the turbulent fluctuations over long timescale, the results fail to show any large scale...

  6. The design of large natural circulation BWR's

    International Nuclear Information System (INIS)

    Boiling water reactors (BWR) with natural circulation are applied for capacities up to 60 MWe. Based on scale studies, however, it appears that larger production units are more efficient. It is recommended to investigate the bottlenecks in realizing larger reactors (>1000 MWe). The aim of the study on the title subject is to study to what extent the production capacity of BWRs with natural circulation can be increased. Based on data from the literature a simple analytic method has been chosen and existing BWR designs were compared. Capacities of 1300 MWe appear to be possible. These reactors will have a smaller pin diameter and a lower water supply temperature. Also steam separators with a minor pressure reduction must be available. The reliability of the stability measurement must be increased. Based on the results of this investigation the priorities for research on the design of future BWRs have been determined

  7. Formation and plasma circulation of solar prominences

    CERN Document Server

    Xia, Chun


    Solar prominences are long-lived cool and dense plasma curtains in the hot and rarefied outer solar atmosphere or corona. The physical mechanism responsible for their formation and especially for their internal plasma circulation has been uncertain for decades. The observed ubiquitous down flows in quiescent prominences are difficult to interpret as plasma with high conductivity seems to move across horizontal magnetic field lines. Here we present three-dimensional numerical simulations of prominence formation and evolution in an elongated magnetic flux rope as a result of in-situ plasma condensations fueled by continuous plasma evaporation from the solar chromosphere. The prominence is born and maintained in a fragmented, highly dynamic state with continuous reappearance of multiple blobs and thread structures that move mainly downward dragging along mass-loaded field lines. The prominence plasma circulation is characterized by the dynamic balance between the drainage of prominence plasma back to the chromos...

  8. Genetic recombination of Herpes simplex virus, the role of the host cell and UV-irradiation of the virus

    International Nuclear Information System (INIS)

    Recombination frequencies for two sets of genetic markers of Herpes simplex virus were determined in various host cells with and without ultraviolet irradiation of the virus. UV irradiation increased the recombination frequency in all the cell types studied in direct proportion to the unrepaired lethal damage. In human skin fibroblasts derived from a patient with xeroderma pigmentosum (XP) of complementation group A, a given dose of UV stimulated recombination more than that in fibroblasts from normal individuals. On the other hand, UV stimulation of HSV recombination was slightly less than normal in fibroblasts derived from a patient with a variant form XP and from an ataxia telangiectasia patient. Caffeine, an agent known to inhibit repair of UV damage, reduced recombination in most of the cell types studied but did not suppress the UV-induced increase in recombination. These findings suggest that for virus DNA with the same number of unrepaired UV-lesions, each of the tested cell types promoted HSV-recombination to an equivalent extent. (orig.)

  9. Natural circulation and stability limits in advanced plants: The Galilean law

    International Nuclear Information System (INIS)

    In our previous papers natural circulation instability problem have been examined. In particular, we analytically demonstrated the link between critical heart flux (CHF) and instability, and the limitations of the present CHF data. We derived an analytical solution for the static instability in natural circulation. We proceed in this paper to build on these novel ideas and physical principles. We focus on the role of gravity in the analysis and prediction of instability. We derive the non-dimensional correlation of natural circulation flowrate, and link this with our physical analysis of instability in parallel-channel systems. We derive the exact form of the unstable limit, and discuss the important effect of zero gravity on the solution. For static instability, the result is a cubic equation for the quality. We solve for the limiting cases to obtain a new explicit result. The effect of gravity on upflow and downflow is shown to be significant for high subcoolings. By combining the natural-circulation and stability results, we demonstrate a new result which analytically describes the limits on natural-circulation operation. This result is relevant to small breaks and transients, as well as to defining the design envelope for safe operation

  10. The global ocean circulation on a retrograde rotating earth


    Kamphuis, V.; Huisman, S.E.; Dijkstra, H. A.


    To understand the three-dimensional ocean circulation patterns that have occurred in past continental geometries, it is crucial to study the role of the present-day continental geometry and surface (wind stress and buoyancy) forcing on the present-day global ocean circulation. This circulation, often referred to as the Conveyor state, is characterised by an Atlantic Meridional Overturning Circulation (MOC) with a deep water formation at northern latitudes and the absence of ...

  11. Radiative recombination of excitons in amorphous semiconductors

    International Nuclear Information System (INIS)

    A theory for calculating the radiative lifetime of excitons in amorphous semiconductors is presented. Four possibilities of excitonic radiative recombination are considered and the corresponding rates are derived at thermal equilibrium. The radiative lifetime is calculated from the inverse of the maximum rate for all the four possibilities. Results agree very well with experiments

  12. Genetic Recombination as a Chemical Reaction Network


    Müller, Stefan; Hofbauer, Josef


    The process of genetic recombination can be seen as a chemical reaction network with mass-action kinetics. We review the known results on existence, uniqueness, and global stability of an equilibrium in every compatibility class and for all rate constants, from both the population genetics and the reaction networks point of view.

  13. Science: The Recombinant DNA Advisory Committee. (United States)

    Wright, Susan


    Reports on the status of the Recombinant DNA Advisory Committee (RAC) and attempts to rationalize Suburban Highway Policy. Effective communication among members of the RAC is a current problem facing the committee. A federal transportation priority spending policy is suggested during these times of money and fuel shortages. (MA)

  14. Recombinant Bovine Growth Hormone Criticism Grows. (United States)

    Gaard, Greta


    Discusses concerns related to the use of recombinant bovine growth hormone in the United States and other countries. Analyses the issue from the perspectives of animal rights, human health, world hunger, concerns of small and organic farmers, costs to the taxpayer, and environmental questions. A sidebar discusses Canadian review of the hormone.…

  15. Vaccine development using recombinant DNA technology (United States)

    Vaccines induce an immune response in the host that subsequently recognizes infectious agents and helps fight off the disease; vaccines must do this without causing the disease. This paper reviews the development of recombinant DNA technologies as a means of providing new ways for attenuating diseas...

  16. Selected techniques in recombinant DNA technology

    International Nuclear Information System (INIS)

    Recombined DNA technology comprises a complex of techniques in the fields of nucleic acid biochemistry and molecular biology. This presentation gives an introduction, a brief description and example of the procedures of some of the basic techniques in the DNA cloning work currently used. 8 refs

  17. Recombinant DNA: Scientific and Social Perspectives. (United States)

    Vandegrift, Vaughn


    This article is designed to inform chemical educators not engaged in this technology as to the nature and methods used in the technology, the reasons for scientific and social concern, and the attempts made to assuage concerns involving recombinant DNA research. (author/BB)

  18. Production and delivery of recombinant subunit vaccines


    Andersson, Christin


    Recombinant strategies are today dominating in thedevelopment of modern subunit vaccines. This thesis describesstrategies for the production and recovery of protein subunitimmunogens, and how genetic design of the expression vectorscan be used to adapt the immunogens for incorporation intoadjuvant systems. In addition, different strategies fordelivery of subunit vaccines by RNA or DNA immunization havebeen investigated. Attempts to create general production strategies forrecombinant protein i...

  19. Asthma and Therapeutics: Recombinant Therapies in Asthma

    Directory of Open Access Journals (Sweden)

    Cockcroft Donald W


    Full Text Available Abstract Numerous recombinant therapies are being investigated for the treatment of asthma. This report reviews the current status of several of these novel agents. Anti-immunoglobulin (IgE (omalizumab, Xolair markedly inhibits all aspects of the allergen challenge in subjects who have reduction of free serum IgE to undetectable levels. Several clinical studies in atopic asthma have demonstrated benefit by improved symptoms and lung function and a reduction in corticosteroid requirements. Early use in atopic asthmatics may be even more effective. Several approaches target interleukin (IL-4. Soluble IL-4 receptor has been shown to effectively replace inhaled corticosteroid; further studies are under way. Recombinant anti-IL-5 and recombinant IL-12 inhibit blood and sputum eosinophils and allergen-induced eosinophilia without any effect on airway responsiveness, allergen-induced airway responses, or allergen-induced airway hyperresponsiveness. Efalizumab, a recombinant antibody that inhibits lymphocyte trafficking, is effective in psoriasis. A bronchoprovocation study showed a reduction in allergen-induced late asthmatic response and allergen-induced eosinophilia, which suggests that it should be effective in clinical asthma. These exciting novel therapies provide not only promise of new therapies for asthma but also valuable tools for investigation of asthma mechanisms.

  20. Catalytic hydrogen recombination for nuclear containments

    International Nuclear Information System (INIS)

    Catalytic recombiners appear to be a credible option for hydrogen mitigation in nuclear containments. The passive operation, versatility and ease of back fitting are appealing for existing stations and new designs. Recently, a generation of wet-proofed catalyst materials have been developed at AECL which are highly specific to H2-O2, are active at ambient temperatures and are being evaluated for containment applications. Two types of catalytic recombiners were evaluated for hydrogen removal in containments based on the AECL catalyst. The first is a catalytic combustor for application in existing air streams such as provided by fans or ventilation systems. The second is an autocatalytic recombiner which uses the enthalpy of reaction to produce natural convective flow over the catalyst elements. Intermediate-scale results obtained in 6 m3 and 10 m3 spherical and cylindrical vessels are given to demonstrate self-starting limits, operating limits, removal capacity, scaling parameters, flow resistance, mixing behaviour in the vicinity of an operating recombiner and sensitivity to poisoning, fouling and radiation. (author). 13 refs., 10 figs