WorldWideScience

Sample records for circulating human erythroid

  1. Let-7 microRNAs are developmentally regulated in circulating human erythroid cells

    Directory of Open Access Journals (Sweden)

    Reed Christopher

    2009-11-01

    Full Text Available Abstract Background MicroRNAs are ~22nt-long small non-coding RNAs that negatively regulate protein expression through mRNA degradation or translational repression in eukaryotic cells. Based upon their importance in regulating development and terminal differentiation in model systems, erythrocyte microRNA profiles were examined at birth and in adults to determine if changes in their abundance coincide with the developmental phenomenon of hemoglobin switching. Methods Expression profiling of microRNA was performed using total RNA from four adult peripheral blood samples compared to four cord blood samples after depletion of plasma, platelets, and nucleated cells. Labeled RNAs were hybridized to custom spotted arrays containing 474 human microRNA species (miRBase release 9.1. Total RNA from Epstein-Barr virus (EBV-transformed lymphoblastoid cell lines provided a hybridization reference for all samples to generate microRNA abundance profile for each sample. Results Among 206 detected miRNAs, 79% of the microRNAs were present at equivalent levels in both cord and adult cells. By comparison, 37 microRNAs were up-regulated and 4 microRNAs were down-regulated in adult erythroid cells (fold change > 2; p let-7 miRNA family consistently demonstrated increased abundance in the adult samples by array-based analyses that were confirmed by quantitative PCR (4.5 to 18.4 fold increases in 6 of 8 let-7 miRNA. Profiling studies of messenger RNA (mRNA in these cells additionally demonstrated down-regulation of ten let-7 target genes in the adult cells. Conclusion These data suggest that a consistent pattern of up-regulation among let-7 miRNA in circulating erythroid cells occurs in association with hemoglobin switching during the fetal-to-adult developmental transition in humans.

  2. Selective toxicity of dihydroartemisinin on human CD34+ erythroid cell differentiation

    International Nuclear Information System (INIS)

    Finaurini, Sara; Ronzoni, Luisa; Colancecco, Alessandra; Cattaneo, Alessandra; Cappellini, Maria Domenica; Ward, Stephen A.; Taramelli, Donatella

    2010-01-01

    Artemisinins are safely used in the combination therapy for uncomplicated malaria, but their employment during pregnancy is still controversial. In fact, animal studies reported that the active metabolite, dihydroartemisinin (DHA), causes embryonic erythrocytes depletion, when the treatment is performed during a critical period of time. The present study investigates the effect of DHA on human developmental erythropoiesis in order to characterize the target erythroid stage and to predict the window of susceptibility in human pregnancy. As a model for human developmental erythropoiesis, peripheral blood purified, CD34+ cells were committed towards erythrocytes and DHA (0.5 or 2 μM) was added to different erythroid stages during 14 days culture. Erythroid differentiation was investigated by cytofluorimetric analysis of Glycophorin A expression, by morphological analysis and erythroid globin gene expression analysis with real-time PCR. It was found that the effect of DHA was dependent on the maturation stage of erythroid cells. In fact when DHA was added to the pro- and basophilic erythroblasts caused a significant dose-dependent inhibition of cell proliferation and a significant delay of erythroid differentiation, as measured by morphological analysis, expression of Glycophorin A by immunofluorescence and of erythroid globin genes by real-time PCR. In contrast, the inhibition of stem cells and of early progenitors was transient and masked by the subsequent exponential cell growth. No effect was observed on mature erythroid stages. This is the first demonstration that DHA affects human erythropoiesis in vitro, in a dose- and time-dependent manner; the target population seems to be the pro-erythroblast and basophilic erythroblast stage, suggesting that DHA toxicity is limited to primitive human erythropoiesis. These findings outline the relevance of DHA dosage and timing to prevent embryotoxicity and support current WHO recommendations of avoiding malaria treatment

  3. Recombinant human parvovirus B19 vectors: erythroid cell-specific delivery and expression of transduced genes.

    Science.gov (United States)

    Ponnazhagan, S; Weigel, K A; Raikwar, S P; Mukherjee, P; Yoder, M C; Srivastava, A

    1998-06-01

    A novel packaging strategy combining the salient features of two human parvoviruses, namely the pathogenic parvovirus B19 and the nonpathogenic adeno-associated virus type 2 (AAV), was developed to achieve erythroid cell-specific delivery as well as expression of the transduced gene. The development of such a chimeric vector system was accomplished by packaging heterologous DNA sequences cloned within the inverted terminal repeats of AAV and subsequently packaging the DNA inside the capsid structure of B19 virus. Recombinant B19 virus particles were assembled, as evidenced by electron microscopy as well as DNA slot blot analyses. The hybrid vector failed to transduce nonerythroid human cells, such as 293 cells, as expected. However, MB-02 cells, a human megakaryocytic leukemia cell line which can be infected by B19 virus following erythroid differentiation with erythropoietin (N. C. Munshi, S. Z. Zhou, M. J. Woody, D. A. Morgan, and A. Srivastava, J. Virol. 67:562-566, 1993) but lacks the putative receptor for AAV (S. Ponnazhagan, X.-S. Wang, M. J. Woody, F. Luo, L. Y. Kang, M. L. Nallari, N. C. Munshi, S. Z. Zhou, and A. Srivastava, J. Gen. Virol. 77:1111-1122, 1996), were readily transduced by this vector. The hybrid vector was also found to specifically target the erythroid population in primary human bone marrow cells as well as more immature hematopoietic progenitor cells following erythroid differentiation, as evidenced by selective expression of the transduced gene in these target cells. Preincubation with anticapsid antibodies against B19 virus, but not anticapsid antibodies against AAV, inhibited transduction of primary human erythroid cells. The efficiency of transduction of primary human erythroid cells by the recombinant B19 virus vector was significantly higher than that by the recombinant AAV vector. Further development of the AAV-B19 virus hybrid vector system should prove beneficial in gene therapy protocols aimed at the correction of inherited and

  4. Recombinant Human Parvovirus B19 Vectors: Erythroid Cell-Specific Delivery and Expression of Transduced Genes

    Science.gov (United States)

    Ponnazhagan, Selvarangan; Weigel, Kirsten A.; Raikwar, Sudhanshu P.; Mukherjee, Pinku; Yoder, Mervin C.; Srivastava, Arun

    1998-01-01

    A novel packaging strategy combining the salient features of two human parvoviruses, namely the pathogenic parvovirus B19 and the nonpathogenic adeno-associated virus type 2 (AAV), was developed to achieve erythroid cell-specific delivery as well as expression of the transduced gene. The development of such a chimeric vector system was accomplished by packaging heterologous DNA sequences cloned within the inverted terminal repeats of AAV and subsequently packaging the DNA inside the capsid structure of B19 virus. Recombinant B19 virus particles were assembled, as evidenced by electron microscopy as well as DNA slot blot analyses. The hybrid vector failed to transduce nonerythroid human cells, such as 293 cells, as expected. However, MB-02 cells, a human megakaryocytic leukemia cell line which can be infected by B19 virus following erythroid differentiation with erythropoietin (N. C. Munshi, S. Z. Zhou, M. J. Woody, D. A. Morgan, and A. Srivastava, J. Virol. 67:562–566, 1993) but lacks the putative receptor for AAV (S. Ponnazhagan, X.-S. Wang, M. J. Woody, F. Luo, L. Y. Kang, M. L. Nallari, N. C. Munshi, S. Z. Zhou, and A. Srivastava, J. Gen. Virol. 77:1111–1122, 1996), were readily transduced by this vector. The hybrid vector was also found to specifically target the erythroid population in primary human bone marrow cells as well as more immature hematopoietic progenitor cells following erythroid differentiation, as evidenced by selective expression of the transduced gene in these target cells. Preincubation with anticapsid antibodies against B19 virus, but not anticapsid antibodies against AAV, inhibited transduction of primary human erythroid cells. The efficiency of transduction of primary human erythroid cells by the recombinant B19 virus vector was significantly higher than that by the recombinant AAV vector. Further development of the AAV-B19 virus hybrid vector system should prove beneficial in gene therapy protocols aimed at the correction of inherited

  5. The first trimester human placenta is a site for terminal maturation of primitive erythroid cells.

    Science.gov (United States)

    Van Handel, Ben; Prashad, Sacha L; Hassanzadeh-Kiabi, Nargess; Huang, Andy; Magnusson, Mattias; Atanassova, Boriana; Chen, Angela; Hamalainen, Eija I; Mikkola, Hanna K A

    2010-10-28

    Embryonic hematopoiesis starts via the generation of primitive red blood cells (RBCs) that satisfy the embryo's immediate oxygen needs. Although primitive RBCs were thought to retain their nuclei, recent studies have shown that primitive RBCs in mice enucleate in the fetal liver. It has been unknown whether human primitive RBCs enucleate, and what hematopoietic site might support this process. Our data indicate that the terminal maturation and enucleation of human primitive RBCs occurs in first trimester placental villi. Extravascular ζ-globin(+) primitive erythroid cells were found in placental villi between 5-7 weeks of development, at which time the frequency of enucleated RBCs was higher in the villous stroma than in circulation. RBC enucleation was further evidenced by the presence of primitive reticulocytes and pyrenocytes (ejected RBC nuclei) in the placenta. Extravascular RBCs were found to associate with placental macrophages, which contained ingested nuclei. Clonogenic macrophage progenitors of fetal origin were present in the chorionic plate of the placenta before the onset of fetoplacental circulation, after which macrophages had migrated to the villi. These findings indicate that placental macrophages may assist the enucleation process of primitive RBCs in placental villi, implying an unexpectedly broad role for the placenta in embryonic hematopoiesis.

  6. PI3 kinase is important for Ras, MEK and Erk activation of Epo-stimulated human erythroid progenitors

    Directory of Open Access Journals (Sweden)

    Schmidt Enrico K

    2004-05-01

    Full Text Available Abstract Background Erythropoietin is a multifunctional cytokine which regulates the number of erythrocytes circulating in mammalian blood. This is crucial in order to maintain an appropriate oxygen supply throughout the body. Stimulation of primary human erythroid progenitors (PEPs with erythropoietin (Epo leads to the activation of the mitogenic kinases (MEKs and Erks. How this is accomplished mechanistically remained unclear. Results Biochemical studies with human cord blood-derived PEPs now show that Ras and the class Ib enzyme of the phosphatidylinositol-3 kinase (PI3K family, PI3K gamma, are activated in response to minimal Epo concentrations. Surprisingly, three structurally different PI3K inhibitors block Ras, MEK and Erk activation in PEPs by Epo. Furthermore, Erk activation in PEPs is insensitive to the inhibition of Raf kinases but suppressed upon PKC inhibition. In contrast, Erk activation induced by stem cell factor, which activates c-Kit in the same cells, is sensitive to Raf inhibition and insensitive to PI3K and PKC inhibitors. Conclusions These unexpected findings contrast with previous results in human primary cells using Epo at supraphysiological concentrations and open new doors to eventually understanding how low Epo concentrations mediate the moderate proliferation of erythroid progenitors under homeostatic blood oxygen levels. They indicate that the basal activation of MEKs and Erks in PEPs by minimal concentrations of Epo does not occur through the classical cascade Shc/Grb2/Sos/Ras/Raf/MEK/Erk. Instead, MEKs and Erks are signal mediators of PI3K, probably the recently described PI3K gamma, through a Raf-independent signaling pathway which requires PKC activity. It is likely that higher concentrations of Epo that are induced by hypoxia, for example, following blood loss, lead to additional mitogenic signals which greatly accelerate erythroid progenitor proliferation.

  7. Erythroid differentiation of human induced pluripotent stem cells is independent of donor cell type of origin.

    Science.gov (United States)

    Dorn, Isabel; Klich, Katharina; Arauzo-Bravo, Marcos J; Radstaak, Martina; Santourlidis, Simeon; Ghanjati, Foued; Radke, Teja F; Psathaki, Olympia E; Hargus, Gunnar; Kramer, Jan; Einhaus, Martin; Kim, Jeong Beom; Kögler, Gesine; Wernet, Peter; Schöler, Hans R; Schlenke, Peter; Zaehres, Holm

    2015-01-01

    Epigenetic memory in induced pluripotent stem cells, which is related to the somatic cell type of origin of the stem cells, might lead to variations in the differentiation capacities of the pluripotent stem cells. In this context, induced pluripotent stem cells from human CD34(+) hematopoietic stem cells might be more suitable for hematopoietic differentiation than the commonly used fibroblast-derived induced pluripotent stem cells. To investigate the influence of an epigenetic memory on the ex vivo expansion of induced pluripotent stem cells into erythroid cells, we compared induced pluripotent stem cells from human neural stem cells and human cord blood-derived CD34(+) hematopoietic stem cells and evaluated their potential for differentiation into hematopoietic progenitor and mature red blood cells. Although genome-wide DNA methylation profiling at all promoter regions demonstrates that the epigenetic memory of induced pluripotent stem cells is influenced by the somatic cell type of origin of the stem cells, we found a similar hematopoietic induction potential and erythroid differentiation pattern of induced pluripotent stem cells of different somatic cell origin. All human induced pluripotent stem cell lines showed terminal maturation into normoblasts and enucleated reticulocytes, producing predominantly fetal hemoglobin. Differences were only observed in the growth rate of erythroid cells, which was slightly higher in the induced pluripotent stem cells derived from CD34(+) hematopoietic stem cells. More detailed methylation analysis of the hematopoietic and erythroid promoters identified similar CpG methylation levels in the induced pluripotent stem cell lines derived from CD34(+) cells and those derived from neural stem cells, which confirms their comparable erythroid differentiation potential. Copyright© Ferrata Storti Foundation.

  8. Establishment of immortalized human erythroid progenitor cell lines able to produce enucleated red blood cells.

    Directory of Open Access Journals (Sweden)

    Ryo Kurita

    Full Text Available Transfusion of red blood cells (RBCs is a standard and indispensable therapy in current clinical practice. In vitro production of RBCs offers a potential means to overcome a shortage of transfusable RBCs in some clinical situations and also to provide a source of cells free from possible infection or contamination by microorganisms. Thus, in vitro production of RBCs may become a standard procedure in the future. We previously reported the successful establishment of immortalized mouse erythroid progenitor cell lines that were able to produce mature RBCs very efficiently. Here, we have developed a reliable protocol for establishing immortalized human erythroid progenitor cell lines that are able to produce enucleated RBCs. These immortalized cell lines produce functional hemoglobin and express erythroid-specific markers, and these markers are upregulated following induction of differentiation in vitro. Most importantly, these immortalized cell lines all produce enucleated RBCs after induction of differentiation in vitro, although the efficiency of producing enucleated RBCs remains to be improved further. To the best of our knowledge, this is the first demonstration of the feasibility of using immortalized human erythroid progenitor cell lines as an ex vivo source for production of enucleated RBCs.

  9. Parvovirus B19 integration into human CD36+ erythroid progenitor cells.

    Science.gov (United States)

    Janovitz, Tyler; Wong, Susan; Young, Neal S; Oliveira, Thiago; Falck-Pedersen, Erik

    2017-11-01

    The pathogenic autonomous human parvovirus B19 (B19V) productively infects erythroid progenitor cells (EPCs). Functional similarities between B19V nonstructural protein (NS1), a DNA binding endonuclease, and the Rep proteins of Adeno-Associated Virus (AAV) led us to hypothesize that NS1 may facilitate targeted nicking of the human genome and B19 vDNA integration. We adapted an integration capture sequencing protocol (IC-Seq) to screen B19V infected human CD36+ EPCs for viral integrants, and discovered 40,000 unique B19V integration events distributed throughout the human genome. Computational analysis of integration patterns revealed strong correlations with gene intronic regions, H3K9me3 sites, and the identification of 41 base pair consensus sequence with an octanucleotide core motif. The octanucleotide core has homology to a single region of B19V, adjacent to the P6 promoter TATA box. We present the first direct evidence that B19V infection of erythroid progenitor cells disrupts the human genome and facilitates viral DNA integration. Copyright © 2017 Elsevier Inc. All rights reserved.

  10. Characterization of human erythroid burst-promoting activity derived from bone marrow conditioned media

    International Nuclear Information System (INIS)

    Porter, P.N.; Ogawa, M.

    1982-01-01

    Bone marrow conditioned media (BMCM) increases burst number and the incorporation of 59 Fe into heme by bursts when peripheral blood or bone marrow cells are cultured at limiting serum concentrations. Burst-promoting activity (BPA) has now been purified approximately 300-fold from this source by ion-exchange chromatography on DEAE-Sephadex and absorption chromatography on hydroxyapatite agarose gel. Marrow BPA increased burst number and hemoglobin (Hb) synthesis in a dose-dependent manner. A larger increase in Hb synthesis than in burst number was consistently observed, which was probably a consequence of the increase in the number of cells per burst that occurs in the presence of BPA. The role of BPA in culture could be distinguished from erythropoietin (Ep), since no bursts grew in the absence of Ep, whether or not BPA was present, and since it had no effect on the growth of erythroid colonies scored at day 5 of culture. Our purified fraction did not support the growth of CFU-C in culture. Activity was stable at temperatures of 70 degrees C or lower for 10 min; exposure to 80 degrees C resulted in approximately 50% loss of activity. BPA was completely inactivated by treatment at 100 degrees C for 10 min. Thus, human bone marrow cells produce a heat-sensitive factor that specifically promotes the growth of early erythroid progenitors in culture

  11. Identification of Stages of Erythroid Differentiation in Bone Marrow and Erythrocyte Subpopulations in Blood Circulation that Are Preferentially Lost in Autoimmune Hemolytic Anemia in Mouse.

    Directory of Open Access Journals (Sweden)

    Sreoshi Chatterjee

    Full Text Available Repeated weekly injections of rat erythrocytes produced autoimmune hemolytic anemia (AIHA in C57BL/6 mice after 5-6 weeks. Using the double in vivo biotinylation (DIB technique, recently developed in our laboratory, turnover of erythrocyte cohorts of different age groups during AIHA was monitored. Results indicate a significant decline in the proportion of reticulocytes, young and intermediate age groups of erythrocytes, but a significant increase in the proportion of old erythrocytes in blood circulation. Binding of the autoantibody was relatively higher to the young erythrocytes and higher levels of intracellular reactive oxygen species (ROS were also seen in these cells. Erythropoietic activity in the bone marrows and the spleen of AIHA induced mice was examined by monitoring the relative proportion of erythroid cells at various stages of differentiation in these organs. Cells at different stages of differentiation were enumerated flow cytometrically by double staining with anti-Ter119 and anti-transferrin receptor (CD71 monoclonal antibodies. Erythroid cells in bone marrow declined significantly in AIHA induced mice, erythroblast C being most affected (50% decline. Erythroblast C also recorded high intracellular ROS level along with increased levels of membrane-bound autoantibody. No such decline was observed in spleen. A model of AIHA has been proposed indicating that binding of autoantibodies may not be a sufficient condition for destruction of erythroid cells in bone marrow and in blood circulation. Last stage of erythropoietic differentiation in bone marrow and early stages of erythrocytes in blood circulation are specifically susceptible to removal in AIHA.

  12. Dihydroartemisinin inhibits the human erythroid cell differentiation by altering the cell cycle

    International Nuclear Information System (INIS)

    Finaurini, Sara; Basilico, Nicoletta; Corbett, Yolanda; D’Alessandro, Sarah; Parapini, Silvia; Olliaro, Piero; Haynes, Richard K.; Taramelli, Donatella

    2012-01-01

    Artemisinin derivatives such as dihydroartemisinin (DHA) induce significant depletion of early embryonic erythroblasts in animal models. We have reported previously that DHA specifically targets pro-erythroblasts and basophilic erythroblasts, when human CD34+ stem cells are differentiated toward the erythroid lineage, indicating that a window of susceptibility to artemisinins may exist also in human developmental erythropoiesis during pregnancy. To better investigate the toxicity of artemisinin derivatives, the structure–activity relationship was evaluated against the K562 leukaemia cell line, used as a model for differentiating early human erythroblasts. All artemisinins derivatives, except deoxyartemisinin, inhibited both spontaneous and induced erythroid differentiation, confirming that the peroxide bridge is responsible for the erythro-toxicity. On the contrary, cell growth was markedly reduced by DHA, artemisone and artesunate but not by artemisinin, 10-deoxoartemisinin or deoxy-artemisinin. The substituent at position C-10 is responsible only for the anti-proliferative effect, since 10-deoxoartemisinin did not reduce cell growth but arrested the differentiation of K562 cells. In particular, the results showed that DHA resulted the most potent and rapidly acting compound of the drug family, causing (i) the decreased expression of GpA surface receptors and the down regulation the γ-globin gene; (ii) the alteration of S phase of cell cycle and (iii) the induction of programmed cell death of early erythroblasts in a dose dependent manner within 24 h. In conclusion, these findings confirm that the active metabolite DHA is responsible for the erythro-toxicity of most of artemisinins used in therapy. Thus, as long as no further clinical data are available, current WHO recommendations of avoiding malaria treatment with artemisinins during the first trimester of pregnancy remain valid.

  13. Phosphorylated STAT5 directly facilitates parvovirus B19 DNA replication in human erythroid progenitors through interaction with the MCM complex.

    Science.gov (United States)

    Ganaie, Safder S; Zou, Wei; Xu, Peng; Deng, Xuefeng; Kleiboeker, Steve; Qiu, Jianming

    2017-05-01

    Productive infection of human parvovirus B19 (B19V) exhibits high tropism for burst forming unit erythroid (BFU-E) and colony forming unit erythroid (CFU-E) progenitor cells in human bone marrow and fetal liver. This exclusive restriction of the virus replication to human erythroid progenitor cells is partly due to the intracellular factors that are essential for viral DNA replication, including erythropoietin signaling. Efficient B19V replication also requires hypoxic conditions, which upregulate the signal transducer and activator of transcription 5 (STAT5) pathway, and phosphorylated STAT5 is essential for virus replication. In this study, our results revealed direct involvement of STAT5 in B19V DNA replication. Consensus STAT5-binding elements were identified adjacent to the NS1-binding element within the minimal origins of viral DNA replication in the B19V genome. Phosphorylated STAT5 specifically interacted with viral DNA replication origins both in vivo and in vitro, and was actively recruited within the viral DNA replication centers. Notably, STAT5 interacted with minichromosome maintenance (MCM) complex, suggesting that STAT5 directly facilitates viral DNA replication by recruiting the helicase complex of the cellular DNA replication machinery to viral DNA replication centers. The FDA-approved drug pimozide dephosphorylates STAT5, and it inhibited B19V replication in ex vivo expanded human erythroid progenitors. Our results demonstrated that pimozide could be a promising antiviral drug for treatment of B19V-related diseases.

  14. CTCF and CohesinSA-1 Mark Active Promoters and Boundaries of Repressive Chromatin Domains in Primary Human Erythroid Cells.

    Directory of Open Access Journals (Sweden)

    Laurie A Steiner

    Full Text Available CTCF and cohesinSA-1 are regulatory proteins involved in a number of critical cellular processes including transcription, maintenance of chromatin domain architecture, and insulator function. To assess changes in the CTCF and cohesinSA-1 interactomes during erythropoiesis, chromatin immunoprecipitation coupled with high throughput sequencing and mRNA transcriptome analyses via RNA-seq were performed in primary human hematopoietic stem and progenitor cells (HSPC and primary human erythroid cells from single donors.Sites of CTCF and cohesinSA-1 co-occupancy were enriched in gene promoters in HSPC and erythroid cells compared to single CTCF or cohesin sites. Cell type-specific CTCF sites in erythroid cells were linked to highly expressed genes, with the opposite pattern observed in HSPCs. Chromatin domains were identified by ChIP-seq with antibodies against trimethylated lysine 27 histone H3, a modification associated with repressive chromatin. Repressive chromatin domains increased in both number and size during hematopoiesis, with many more repressive domains in erythroid cells than HSPCs. CTCF and cohesinSA-1 marked the boundaries of these repressive chromatin domains in a cell-type specific manner.These genome wide data, changes in sites of protein occupancy, chromatin architecture, and related gene expression, support the hypothesis that CTCF and cohesinSA-1 have multiple roles in the regulation of gene expression during erythropoiesis including transcriptional regulation at gene promoters and maintenance of chromatin architecture. These data from primary human erythroid cells provide a resource for studies of normal and perturbed erythropoiesis.

  15. Biosynthesis of heme in immature erythroid cells. The regulatory step for heme formation in the human erythron

    International Nuclear Information System (INIS)

    Gardner, L.C.; Cox, T.M.

    1988-01-01

    Heme formation in reticulocytes from rabbits and rodents is subject to end product negative feedback regulation: intracellular free heme has been shown to control acquisition of transferrin iron for heme synthesis. To identify the site of control of heme biosynthesis in the human erythron, immature erythroid cells were obtained from peripheral blood and aspirated bone marrow. After incubation with human 59Fe transferrin, 2-[14C]glycine, or 4-[14C]delta-aminolevulinate, isotopic incorporation into extracted heme was determined. Addition of cycloheximide to increase endogenous free heme, reduced incorporation of labeled glycine and iron but not delta-aminolevulinate into cell heme. Incorporation of glycine and iron was also sensitive to inhibition by exogenous hematin (Ki, 30 and 45 microM, respectively) i.e. at concentrations in the range which affect cell-free protein synthesis in reticulocyte lysates. Hematin treatment rapidly diminished incorporation of intracellular 59Fe into heme by human erythroid cells but assimilation of 4-[14C]delta-aminolevulinate into heme was insensitive to inhibition by hematin (Ki greater than 100 microM). In human reticulocytes (unlike those from rabbits), addition of ferric salicylaldehyde isonicotinoylhydrazone, to increase the pre-heme iron pool independently of the transferrin cycle, failed to promote heme synthesis or modify feedback inhibition induced by hematin. In human erythroid cells (but not rabbit reticulocytes) pre-incubation with unlabeled delta-aminolevulinate or protoporphyrin IX greatly stimulated utilization of cell 59Fe for heme synthesis and also attenuated end product inhibition. In human erythroid cells heme biosynthesis is thus primarily regulated by feedback inhibition at one or more steps which lead to delta-aminolevulinate formation

  16. Human Cord Blood and Bone Marrow CD34+ Cells Generate Macrophages That Support Erythroid Islands.

    Directory of Open Access Journals (Sweden)

    Eyayu Belay

    Full Text Available Recently, we developed a small molecule responsive hyperactive Mpl-based Cell Growth Switch (CGS that drives erythropoiesis associated with macrophages in the absence of exogenous cytokines. Here, we compare the physical, cellular and molecular interaction between the macrophages and erythroid cells in CGS expanded CD34+ cells harvested from cord blood, marrow or G-CSF-mobilized peripheral blood. Results indicated that macrophage based erythroid islands could be generated from cord blood and marrow CD34+ cells but not from G-CSF-mobilized CD34+ cells. Additional studies suggest that the deficiency resides with the G-CSF-mobilized CD34+ derived monocytes. Gene expression and proteomics studies of the in vitro generated erythroid islands detected the expression of erythroblast macrophage protein (EMP, intercellular adhesion molecule 4 (ICAM-4, CD163 and DNASE2. 78% of the erythroblasts in contact with macrophages reached the pre reticulocyte orthochromatic stage of differentiation within 14 days of culture. The addition of conditioned medium from cultures of CD146+ marrow fibroblasts resulted in a 700-fold increase in total cell number and a 90-fold increase in erythroid cell number. This novel CD34+ cell derived erythroid island may serve as a platform to explore the molecular basis of red cell maturation and production under normal, stress and pathological conditions.

  17. Hypoxia-inducible factor 1-mediated human GATA1 induction promotes erythroid differentiation under hypoxic conditions.

    Science.gov (United States)

    Zhang, Feng-Lin; Shen, Guo-Min; Liu, Xiao-Ling; Wang, Fang; Zhao, Ying-Ze; Zhang, Jun-Wu

    2012-08-01

    Hypoxia-inducible factor promotes erythropoiesis through coordinated cell type-specific hypoxia responses. GATA1 is essential to normal erythropoiesis and plays a crucial role in erythroid differentiation. In this study, we show that hypoxia-induced GATA1 expression is mediated by HIF1 in erythroid cells. Under hypoxic conditions, significantly increased GATA1 mRNA and protein levels were detected in K562 cells and erythroid induction cultures of CD34(+) haematopoietic stem/progenitor cells. Enforced HIF1α expression increased GATA1 expression, while HIF1α knockdown by RNA interference decreased GATA1 expression. In silico analysis revealed one potential hypoxia response element (HRE). The results from reporter gene and mutation analysis suggested that this element is necessary for hypoxic response. Chromatin immunoprecipitation (ChIP)-PCR showed that the putative HRE was recognized and bound by HIF1 in vivo. These results demonstrate that the up-regulation of GATA1 during hypoxia is directly mediated by HIF1.The mRNA expression of some erythroid differentiation markers was increased under hypoxic conditions, but decreased with RNA interference of HIF1α or GATA1. Flow cytometry analysis also indicated that hypoxia, desferrioxamine or CoCl(2) induced expression of erythroid surface markers CD71 and CD235a, while expression repression of HIF1α or GATA1 by RNA interference led to a decreased expression of CD235a. These results suggested that HIF1-mediated GATA1 up-regulation promotes erythropoiesis in order to satisfy the needs of an organism under hypoxic conditions. © 2011 The Authors Journal of Cellular and Molecular Medicine © 2011 Foundation for Cellular and Molecular Medicine/Blackwell Publishing Ltd.

  18. Human primary erythroid cells as a more sensitive alternative in vitro hematological model for nanotoxicity studies: Toxicological effects of silver nanoparticles.

    Science.gov (United States)

    Rujanapun, Narawadee; Aueviriyavit, Sasitorn; Boonrungsiman, Suwimon; Rosena, Apiwan; Phummiratch, Duangkamol; Riolueang, Suchada; Chalaow, Nipon; Viprakasit, Vip; Maniratanachote, Rawiwan

    2015-12-01

    Although immortalized cells established from cancerous cells have been widely used for studies in nanotoxicology studies, the reliability of the results derived from immortalized cells has been questioned because of their different characteristics from normal cells. In the present study, human primary erythroid cells in liquid culture were used as an in vitro hematological cell model for investigation of the nanotoxicity of silver nanoparticles (AgNPs) and comparing the results to the immortalized hematological cell lines HL60 and K562. The AgNPs caused significant cytotoxic effects in the primary erythroid cells, as shown by the decreased cell viability and induction of intracellular ROS generation and apoptosis, whereas they showed much lower cytotoxic and apoptotic effects in HL60 and K562 cells and did not induced ROS generation in these cell lines. Scanning electron microcopy revealed an interaction of AgNPs to the cell membrane in both primary erythroid and immortalized cells. In addition, AgNPs induced hemolysis in the primary erythroid cells in a dose-dependent manner, and transmission electron microcopy analysis revealed that AgNPs damaged the erythroid cell membrane. Taken together, these results suggest that human primary erythroid cells in liquid culture are a more sensitive alternative in vitro hematological model for nanotoxicology studies. Copyright © 2015 Elsevier B.V. All rights reserved.

  19. Induction of erythroid differentiation in human erythroleukemia cells by depletion of malic enzyme 2.

    Directory of Open Access Journals (Sweden)

    Jian-Guo Ren

    2010-09-01

    Full Text Available Malic enzyme 2 (ME2 is a mitochondrial enzyme that catalyzes the conversion of malate to pyruvate and CO2 and uses NAD as a cofactor. Higher expression of this enzyme correlates with the degree of cell de-differentiation. We found that ME2 is expressed in K562 erythroleukemia cells, in which a number of agents have been found to induce differentiation either along the erythroid or the myeloid lineage. We found that knockdown of ME2 led to diminished proliferation of tumor cells and increased apoptosis in vitro. These findings were accompanied by differentiation of K562 cells along the erythroid lineage, as confirmed by staining for glycophorin A and hemoglobin production. ME2 knockdown also totally abolished growth of K562 cells in nude mice. Increased ROS levels, likely reflecting increased mitochondrial production, and a decreased NADPH/NADP+ ratio were noted but use of a free radical scavenger to decrease inhibition of ROS levels did not reverse the differentiation or apoptotic phenotype, suggesting that ROS production is not causally involved in the resultant phenotype. As might be expected, depletion of ME2 induced an increase in the NAD+/NADH ratio and ATP levels fell significantly. Inhibition of the malate-aspartate shuttle was insufficient to induce K562 differentiation. We also examined several intracellular signaling pathways and expression of transcription factors and intermediate filament proteins whose expression is known to be modulated during erythroid differentiation in K562 cells. We found that silencing of ME2 leads to phospho-ERK1/2 inhibition, phospho-AKT activation, increased GATA-1 expression and diminished vimentin expression. Metabolomic analysis, conducted to gain insight into intermediary metabolic pathways that ME2 knockdown might affect, showed that ME2 depletion resulted in high orotate levels, suggesting potential impairment of pyrimidine metabolism. Collectively our data point to ME2 as a potentially novel

  20. Identification of a human erythroid progenitor cell population which expresses the CD34 antigen and binds the plant lectin Ulex europaeus I.

    Science.gov (United States)

    Unverzagt, K L; Martinson, J; Lee, W; Stiff, P J; Williams, S; Bender, J G

    1996-01-01

    Two and three color flow cytometry of normal human bone marrow was used to identify CD34+ progenitor cells and examine their binding to the plant lectin Ulex europaeus I (Ulex). In normal bone marrow, 48.48 +/- 17.4% of the CD34+ cells bind to Ulex. Two color flow cytometry was used to sort CD34 + cells, and subsets of CD34+ cells, CD34+ Ulex+ and CD34+ Ulex-. These populations were sorted into colony assays to assess myeloid (CFU-GM) and erythroid (BFU-E) progenitors. The CD34+ Ulex+ subset was 84 +/- 14% BFU-E colonies (mean +/- S.D.) and had the highest cloning efficiency of 28 +/- 13%. Three color analysis of CD34+ Ulex+ cells showed staining with other erythroid (CD71, GlyA) antibodies and lack of stain. ing with myeloid (CD13, CD45RA) antibodies. These studies confirmed the erythroid characteristics of this subpopulation.

  1. Generation and Characterization of Erythroid Cells from Human Embryonic Stem Cells and Induced Pluripotent Stem Cells: An Overview

    Directory of Open Access Journals (Sweden)

    Kai-Hsin Chang

    2011-01-01

    Full Text Available Because of the imbalance in the supply and demand of red blood cells (RBCs, especially for alloimmunized patients or patients with rare blood phenotypes, extensive research has been done to generate therapeutic quantities of mature RBCs from hematopoietic stem cells of various sources, such as bone marrow, peripheral blood, and cord blood. Since human embryonic stem cells (hESCs and induced pluripotent stem cells (iPSCs can be maintained indefinitely in vitro, they represent potentially inexhaustible sources of donor-free RBCs. In contrast to other ex vivo stem-cell-derived cellular therapeutics, tumorigenesis is not a concern, as RBCs can be irradiated without marked adverse effects on in vivo function. Here, we provide a comprehensive review of the recent publications relevant to the generation and characterization of hESC- and iPSC-derived erythroid cells and discuss challenges to be met before the eventual realization of clinical usage of these cells.

  2. No changes in heme synthesis in human Friedreich´s ataxia erythroid progenitor cells.

    Science.gov (United States)

    Steinkellner, Hannes; Singh, Himanshu Narayan; Muckenthaler, Martina U; Goldenberg, Hans; Moganty, Rajeswari R; Scheiber-Mojdehkar, Barbara; Sturm, Brigitte

    2017-07-20

    Friedreich's ataxia (FRDA) is a neurodegenerative disease caused by reduced expression of the protein frataxin. Frataxin is thought to play a role in iron-sulfur cluster biogenesis and heme synthesis. In this study, we used erythroid progenitor stem cells obtained from FRDA patients and healthy donors to investigate the putative role, if any, of frataxin deficiency in heme synthesis. We used electrochemiluminescence and qRT-PCR for frataxin protein and mRNA quantification. We used atomic absorption spectrophotometry for iron levels and a photometric assay for hemoglobin levels. Protoporphyrin IX and Ferrochelatase were analyzed using auto-fluorescence. An "IronChip" microarray analysis followed by a protein-protein interaction analysis was performed. FRDA patient cells showed no significant changes in iron levels, hemoglobin synthesis, protoporphyrin IX levels, and ferrochelatase activity. Microarray analysis presented 11 genes that were significantly changed in all patients compared to controls. The genes are especially involved in oxidative stress, iron homeostasis and angiogenesis. The mystery about the involvement of frataxin on iron metabolism raises the question why frataxin deficiency in primary FRDA cells did not lead to changes in biochemical parameters of heme synthesis. It seems that alternative pathways can circumvent the impact of frataxin deficiency on heme synthesis. We show for the first time in primary FRDA patient cells that reduced frataxin levels are still sufficient for heme synthesis and possibly other mechanisms can overcome reduced frataxin levels in this process. Our data strongly support the fact that so far no anemia in FRDA patients was reported. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Nuclear Factor Erythroid 2 Regulates Human HSC Self-Renewal and T Cell Differentiation by Preventing NOTCH1 Activation.

    Science.gov (United States)

    Di Tullio, Alessandro; Passaro, Diana; Rouault-Pierre, Kevin; Purewal, Sukhveer; Bonnet, Dominique

    2017-07-11

    Nuclear factor erythroid-derived 2 (NF-E2) has been associated with megakaryocyte maturation and platelet production. Recently, an increased in NF-E2 activity has been implicated in myeloproliferative neoplasms. Here, we investigate the role of NF-E2 in normal human hematopoiesis. Knockdown of NF-E2 in the hematopoietic stem and progenitor cells (HSPCs) not only reduced the formation of megakaryocytes but also drastically impaired hematopoietic stem cell activity, decreasing human engraftment in immunodeficient (NSG) mice. This phenotype is likely to be related to both increased cell proliferation (p21-mediated) and reduced Notch1 protein expression, which favors HSPC differentiation over self-renewal. Strikingly, although NF-E2 silencing in HSPCs did not affect their myeloid and B cell differentiation in vivo, it almost abrogated T cell production in primary hosts, as confirmed by in vitro studies. This effect is at least partly due to Notch1 downregulation in NF-E2-silenced HSPCs. Together these data reveal that NF-E2 is an important driver of human hematopoietic stem cell maintenance and T lineage differentiation. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  4. Nuclear Factor Erythroid 2 Regulates Human HSC Self-Renewal and T Cell Differentiation by Preventing NOTCH1 Activation

    Directory of Open Access Journals (Sweden)

    Alessandro Di Tullio

    2017-07-01

    Full Text Available Nuclear factor erythroid-derived 2 (NF-E2 has been associated with megakaryocyte maturation and platelet production. Recently, an increased in NF-E2 activity has been implicated in myeloproliferative neoplasms. Here, we investigate the role of NF-E2 in normal human hematopoiesis. Knockdown of NF-E2 in the hematopoietic stem and progenitor cells (HSPCs not only reduced the formation of megakaryocytes but also drastically impaired hematopoietic stem cell activity, decreasing human engraftment in immunodeficient (NSG mice. This phenotype is likely to be related to both increased cell proliferation (p21-mediated and reduced Notch1 protein expression, which favors HSPC differentiation over self-renewal. Strikingly, although NF-E2 silencing in HSPCs did not affect their myeloid and B cell differentiation in vivo, it almost abrogated T cell production in primary hosts, as confirmed by in vitro studies. This effect is at least partly due to Notch1 downregulation in NF-E2-silenced HSPCs. Together these data reveal that NF-E2 is an important driver of human hematopoietic stem cell maintenance and T lineage differentiation.

  5. The negative impact of Wnt signaling on megakaryocyte and primitive erythroid progenitors derived from human embryonic stem cells

    Directory of Open Access Journals (Sweden)

    Prasuna Paluru

    2014-03-01

    Full Text Available The Wnt gene family consists of structurally related genes encoding secreted signaling molecules that have been implicated in many developmental processes, including regulation of cell fate and patterning during embryogenesis. Previously, we found that Wnt signaling is required for primitive or yolk sac-derived-erythropoiesis using the murine embryonic stem cell (ESC system. Here, we examine the effect of Wnt signaling on the formation of early hematopoietic progenitors derived from human ESCs. The first hematopoietic progenitor cells in the human ESC system express the pan-hematopoietic marker CD41 and the erythrocyte marker, glycophorin A or CD235. We have developed a novel serum-free, feeder-free, adherent differentiation system that can efficiently generate large numbers of CD41 + CD235+ cells. We demonstrate that this cell population contains progenitors not just for primitive erythroid and megakaryocyte cells but for the myeloid lineage as well and term this population the primitive common myeloid progenitor (CMP. Treatment of mesoderm-specified cells with Wnt3a led to a loss of hematopoietic colony-forming ability while the inhibition of canonical Wnt signaling with DKK1 led to an increase in the number of primitive CMPs. Canonical Wnt signaling also inhibits the expansion and/or survival of primitive erythrocytes and megakaryocytes, but not myeloid cells, derived from this progenitor population. These findings are in contrast to the role of Wnt signaling during mouse ESC differentiation and demonstrate the importance of the human ESC system in studying species-specific differences in development.

  6. The first trimester human placenta is a site for terminal maturation of primitive erythroid cells

    OpenAIRE

    Van Handel, Ben; Prashad, Sacha L.; Hassanzadeh-Kiabi, Nargess; Huang, Andy; Magnusson, Mattias; Atanassova, Boriana; Chen, Angela; Hamalainen, Eija I.; Mikkola, Hanna K. A.

    2010-01-01

    Embryonic hematopoiesis starts via the generation of primitive red blood cells (RBCs) that satisfy the embryo's immediate oxygen needs. Although primitive RBCs were thought to retain their nuclei, recent studies have shown that primitive RBCs in mice enucleate in the fetal liver. It has been unknown whether human primitive RBCs enucleate, and what hematopoietic site might support this process. Our data indicate that the terminal maturation and enucleation of human primitive RBCs occurs in fir...

  7. Monomethylfumarate induces γ-globin expression and fetal hemoglobin production in cultured human retinal pigment epithelial (RPE) and erythroid cells, and in intact retina.

    Science.gov (United States)

    Promsote, Wanwisa; Makala, Levi; Li, Biaoru; Smith, Sylvia B; Singh, Nagendra; Ganapathy, Vadivel; Pace, Betty S; Martin, Pamela M

    2014-05-13

    Sickle retinopathy (SR) is a major cause of vision loss in sickle cell disease (SCD). There are no strategies to prevent SR and treatments are extremely limited. The present study evaluated (1) the retinal pigment epithelial (RPE) cell as a hemoglobin producer and novel cellular target for fetal hemoglobin (HbF) induction, and (2) monomethylfumarate (MMF) as an HbF-inducing therapy and abrogator of oxidative stress and inflammation in SCD retina. Human globin gene expression was evaluated by RT-quantitative (q)PCR in the human RPE cell line ARPE-19 and in primary RPE cells isolated from Townes humanized SCD mice. γ-Globin promoter activity was monitored in KU812 stable dual luciferase reporter expressing cells treated with 0 to 1000 μM dimethylfumarate, MMF, or hydroxyurea (HU; positive control) by dual luciferase assay. Reverse transcriptase-qPCR, fluorescence-activated cell sorting (FACS), immunofluorescence, and Western blot techniques were used to evaluate γ-globin expression and HbF production in primary human erythroid progenitors, ARPE-19, and normal hemoglobin producing (HbAA) and homozygous β(s) mutation (HbSS) RPE that were treated similarly, and in MMF-injected (1000 μM) HbAA and HbSS retinas. Dihydroethidium labeling and nuclear factor (erythroid-derived 2)-like 2 (Nrf2), IL-1β, and VEGF expression were also analyzed. Retinal pigment epithelial cells express globin genes and synthesize adult and fetal hemoglobin MMF stimulated γ-globin expression and HbF production in cultured RPE and erythroid cells, and in HbSS mouse retina where it also reduced oxidative stress and inflammation. The production of hemoglobin by RPE suggests the potential involvement of this cell type in the etiology of SR. Monomethylfumarate influences multiple parameters consistent with improved retinal health in SCD and may therefore be of therapeutic potential in SR treatment. Copyright 2014 The Association for Research in Vision and Ophthalmology, Inc.

  8. A hanging drop culture method to study terminal erythroid differentiation.

    Science.gov (United States)

    Gutiérrez, Laura; Lindeboom, Fokke; Ferreira, Rita; Drissen, Roy; Grosveld, Frank; Whyatt, David; Philipsen, Sjaak

    2005-10-01

    To design a culture method allowing the quantitative and qualitative analysis of terminal erythroid differentiation. Primary erythroid progenitors derived either from mouse tissues or from human umbilical cord blood were differentiated using hanging drop cultures and compared to methylcellulose cultures. Cultured cells were analyzed by FACS to assess differentiation. We describe a practical culture method by adapting the previously described hanging drop culture system to conditions allowing terminal differentiation of primary erythroid progenitors. Using minimal volumes of media and small numbers of cells, we obtained quantitative terminal erythroid differentiation within two days of culture in the case of murine cells and 4 days in the case of human cells. The established methods for ex vivo culture of primary erythroid progenitors, such as methylcellulose-based burst-forming unit-erythroid (BFU-E) and colony-forming unit-erythroid (CFU-E) assays, allow the detection of committed erythroid progenitors but are of limited value to study terminal erythroid differentiation. We show that the application of hanging drop cultures is a practical alternative that, in combination with clonogenic assays, enables a comprehensive assessment of the behavior of primary erythroid cells ex vivo in the context of genetic and drug-induced perturbations.

  9. Exercise increases circulating GDF15 in humans

    Directory of Open Access Journals (Sweden)

    Maximilian Kleinert

    2018-03-01

    Full Text Available Objective: The growth differentiation factor 15 (GDF15 is a stress-sensitive circulating factor that regulates systemic energy balance. Since exercise is a transient physiological stress that has pleiotropic effects on whole-body energy metabolism, we herein explored the effect of exercise on a circulating GDF15 levels and b GDF15 release from skeletal muscle in humans. Methods: Seven healthy males either rested or exercised at 67% of their VO2max for 1 h and blood was sampled from the femoral artery and femoral vein before, during, and after exercise. Plasma GDF15 concentrations were determined in these samples. Results: Plasma GDF15 levels increased 34% with exercise (p < 0.001 and further increased to 64% above resting values at 120 min (p < 0.001 after the cessation of exercise. There was no difference between the arterial and venous GDF15 concentration before, during, and after exercise. During a resting control trial, GDF15 levels measured in the same subjects were unaltered. Conclusions: Vigorous submaximal exercise increases circulating GDF15 levels in humans, but skeletal muscle tissue does not appear to be the source. Keywords: Skeletal muscle, Growth differentiation factor 15, Recovery, Physical activity

  10. Exercise increases circulating GDF15 in humans

    DEFF Research Database (Denmark)

    Kleinert, Maximilian; Clemmensen, Christoffer; Sjøberg, Kim Anker

    2018-01-01

    OBJECTIVE: The growth differentiation factor 15 (GDF15) is a stress-sensitive circulating factor that regulates systemic energy balance. Since exercise is a transient physiological stress that has pleiotropic effects on whole-body energy metabolism, we herein explored the effect of exercise on a......) circulating GDF15 levels and b) GDF15 release from skeletal muscle in humans. METHODS: Seven healthy males either rested or exercised at 67% of their VO2max for 1 h and blood was sampled from the femoral artery and femoral vein before, during, and after exercise. Plasma GDF15 concentrations were determined...... in these samples. RESULTS: Plasma GDF15 levels increased 34% with exercise (p exercise. There was no difference between the arterial and venous GDF15 concentration before, during, and after exercise. During...

  11. Expression of P190 and P210 BCR/ABL1 in normal human CD34(+) cells induces similar gene expression profiles and results in a STAT5-dependent expansion of the erythroid lineage

    DEFF Research Database (Denmark)

    Järås, Marcus; Johnels, Petra; Agerstam, Helena

    2009-01-01

    OBJECTIVE: The P190 and P210 BCR/ABL1 fusion genes are mainly associated with different types of hematologic malignancies, but it is presently unclear whether they are functionally different following expression in primitive human hematopoietic cells. MATERIALS AND METHODS: We investigated...... and systematically compared the effects of retroviral P190 BCR/ABL1 and P210 BCR/ABL1 expression on cell proliferation, differentiation, and global gene expression in human CD34(+) cells from cord blood. RESULTS: Expression of either P190 BCR/ABL1 or P210 BCR/ABL1 resulted in expansion of erythroid cells...... and stimulated erythropoietin-independent burst-forming unit-erythroid colony formation. By using a lentiviral anti-signal transducer and activator of transcription 5 (STAT5) short-hairpin RNA, we found that both P190 BCR/ABL1- and P210 BCR/ABL1-induced erythroid cell expansion were STAT5-dependent. Under...

  12. Retroviral-mediated transfer and expression of human β-globin genes in cultured murine and human erythroid cells

    International Nuclear Information System (INIS)

    Weber-Benarous, A.; Cone, R.D.; London, I.M.; Mulligan, R.C.

    1988-01-01

    The authors cloned human β-globin DNA sequences from a genomic library prepared from DNA isolated from the human leukemia cell line K562 and have used the retroviral vector pZip-NeoSV(X)1 to introduce a 3.0-kilobase segment encompassing the globin gene into mouse erythroleukemia cells. Whereas the endogenous K562 β-globin gene is repressed in K562 cells, when introduced into mouse erythroleukemia cells by retroviral-mediated gene transfer, the β-globin gene from K562 cells was transcribed and induced 5-20-fold after treatment of the cells with dimethyl sulfoxide. The transcripts were correctly initiated, and expression and regulation of the K562 gene were identical to the expression of a normal human β-globin gene transferred into mouse erythroleukemia cells in the same way. They have also introduced the normal human β-globin gene into K562 cells using the same retrovirus vector. SP6 analysis of the RNA isolated from the transduced cells showed that the normal β-globin gene was transcribed at a moderately high level, before or after treatment with hemin. Based on these data, they suggest that the lack of expression of the endogenous β-globin gene in K562 cells does not result from an alteration in the gene itself and may not result from a lack of factor(s) necessary for β-lobin gene transcription. Retroviral-mediated transfer of the human β-globin gene may, however, uniquely influence expression of the gene K562 cells

  13. RECOMBINANT HUMAN MAST-CELL GROWTH-FACTOR SUPPORTS ERYTHROID COLONY FORMATION IN POLYCYTHEMIA-VERA IN THE PRESENCE AND ABSENCE OF ERYTHROPOIETIN AND SERUM

    NARCIS (Netherlands)

    MULLER, EW; DEWOLF, JTM; HENDRIKS, DW; ESSELINK, MT; HALIE, MR; VELLENGA, E

    The effect of mast cell growth factor (MGF) was studied on erythropoietin (Epo)-dependent and Epo-independent (''spontaneous'') erythroid colony formation in patients with polycythemia vera (PV). MGF stimulated both Epo-dependent and Epo-independent erythroid colony formation from PV peripheral

  14. DJ-1 Modulates Nuclear Erythroid 2-Related Factor-2-Mediated Protection in Human Primary Alveolar Type II Cells in Smokers.

    Science.gov (United States)

    Bahmed, Karim; Messier, Elise M; Zhou, Wenbo; Tuder, Rubin M; Freed, Curt R; Chu, Hong Wei; Kelsen, Steven G; Bowler, Russell P; Mason, Robert J; Kosmider, Beata

    2016-09-01

    Cigarette smoke (CS) is a main source of oxidative stress and a key risk factor for emphysema, which consists of alveolar wall destruction. Alveolar type (AT) II cells are in the gas exchange regions of the lung. We isolated primary ATII cells from deidentified organ donors whose lungs were not suitable for transplantation. We analyzed the cell injury obtained from nonsmokers, moderate smokers, and heavy smokers. DJ-1 protects cells from oxidative stress and induces nuclear erythroid 2-related factor-2 (Nrf2) expression, which activates the antioxidant defense system. In ATII cells isolated from moderate smokers, we found DJ-1 expression by RT-PCR, and Nrf2 and heme oxygenase (HO)-1 translocation by Western blotting and immunocytofluorescence. In ATII cells isolated from heavy smokers, we detected Nrf2 and HO-1 cytoplasmic localization. Moreover, we found high oxidative stress, as detected by 4-hydroxynonenal (4-HNE) (immunoblotting), inflammation by IL-8 and IL-6 levels by ELISA, and apoptosis by terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay in ATII cells obtained from heavy smokers. Furthermore, we detected early DJ-1 and late Nrf2 expression after ATII cell treatment with CS extract. We also overexpressed DJ-1 by adenovirus construct and found that this restored Nrf2 and HO-1 expression and induced nuclear translocation in heavy smokers. Moreover, DJ-1 overexpression also decreased ATII cell apoptosis caused by CS extract in vitro. Our results indicate that DJ-1 activates the Nrf2-mediated antioxidant defense system. Furthermore, DJ-1 overexpression can restore the impaired Nrf2 pathway, leading to ATII cell protection in heavy smokers. This suggests a potential therapeutic strategy for targeting DJ-1 in CS-related lung diseases.

  15. Hemozoin (malarial pigment directly promotes apoptosis of erythroid precursors.

    Directory of Open Access Journals (Sweden)

    Abigail A Lamikanra

    2009-12-01

    Full Text Available Severe malarial anemia is the most common syndrome of severe malaria in endemic areas. The pathophysiology of chronic malaria is characterised by a striking degree of abnormal development of erythroid precursors (dyserythropoiesis and an inadequate erythropoietic response in spite of elevated levels of erythropoietin. The cause of dyserythropoiesis is unclear although it has been suggested that bone-marrow macrophages release cytokines, chemokines or lipo-peroxides after exposure to hemozoin, a crystalloid form of undigested heme moieties from malarial infected erythrocytes, and so inhibit erythropoiesis. However, we have previously shown that hemozoin may directly inhibit erythroid development in vitro and the levels of hemozoin in plasma from patients with malarial anemia and hemozoin within the bone marrow was associated with reduced reticulocyte response. We hypothesized that macrophages may reduce, not enhance, the inhibitory effect of hemozoin on erythropoiesis. In an in vitro model of erythropoiesis, we now show that inhibition of erythroid cell development by hemozoin isolated from P. falciparum is characterised by delayed expression of the erythroid markers and increased apoptosis of progenitor cells. Crucially, macrophages appear to protect erythroid cells from hemozoin, consistent with a direct contribution of hemozoin to the depression of reticulocyte output from the bone marrow in children with malarial anemia. Moreover, hemozoin isolated from P. falciparum in vitro inhibits erythroid development independently of inflammatory mediators by inducing apoptotic pathways that not only involve activation of caspase 8 and cleavage of caspase 3 but also loss of mitochondrial potential. Taken together these data are consistent with a direct effect of hemozoin in inducing apoptosis in developing erythroid cells in malarial anemia. Accumulation of hemozoin in the bone marrow could therefore result in inadequate reticulocytosis in children that

  16. Unravelling pathways downstream Sox6 induction in K562 erythroid cells by proteomic analysis

    KAUST Repository

    Barbarani, Gloria; Ronchi, Antonella; Ruoppolo, Margherita; Santorelli, Lucia; Steinfelder, Robert; Elangovan, Sudharshan; Fugazza, Cristina; Caterino, Marianna

    2017-01-01

    are accompanied with a reduced survival of Sox6-/- red blood cells, resulting in a compensated anemia. Sox6-overexpression in K562 cells and in human primary ex vivo erythroid cultures enhances erythroid differentiation and leads to hemoglobinization, the hallmark

  17. Serum-free Erythroid Differentiation for Efficient Genetic Modification and High-Level Adult Hemoglobin Production.

    Science.gov (United States)

    Uchida, Naoya; Demirci, Selami; Haro-Mora, Juan J; Fujita, Atsushi; Raines, Lydia N; Hsieh, Matthew M; Tisdale, John F

    2018-06-15

    In vitro erythroid differentiation from primary human cells is valuable to develop genetic strategies for hemoglobin disorders. However, current erythroid differentiation methods are encumbered by modest transduction rates and high baseline fetal hemoglobin production. In this study, we sought to improve both genetic modification and hemoglobin production among human erythroid cells in vitro . To model therapeutic strategies, we transduced human CD34 + cells and peripheral blood mononuclear cells (PBMCs) with lentiviral vectors and compared erythropoietin-based erythroid differentiation using fetal-bovine-serum-containing media and serum-free media. We observed more efficient transduction (85%-93%) in serum-free media than serum-containing media (20%-69%), whereas the addition of knockout serum replacement (KSR) was required for serum-free media to promote efficient erythroid differentiation (96%). High-level adult hemoglobin production detectable by electrophoresis was achieved using serum-free media similar to serum-containing media. Importantly, low fetal hemoglobin production was observed in the optimized serum-free media. Using KSR-containing, serum-free erythroid differentiation media, therapeutic adult hemoglobin production was detected at protein levels with β-globin lentiviral transduction in both CD34 + cells and PBMCs from sickle cell disease subjects. Our in vitro erythroid differentiation system provides a practical evaluation platform for adult hemoglobin production among human erythroid cells following genetic manipulation.

  18. Evaluation of effects of various drugs on platelet functions using phorbol 12-myristate 13-acetate-induced megakaryocytic human erythroid leukemia cells

    Directory of Open Access Journals (Sweden)

    Tada T

    2016-09-01

    Full Text Available Tomoki Tada,1 Kensaku Aki,2 Wataru Oboshi,1,3 Kazuyoshi Kawazoe,4 Toshiyuki Yasui,5 Eiji Hosoi2 1Subdivision of Biomedical Laboratory Sciences, Graduate School of Health Sciences, Tokushima University, 2Department of Cells and Immunity Analytics, Institute of Biomedical Sciences, Tokushima University Graduate School, Tokushima, 3Department of Medical Technology, Kagawa Prefectural University of Health Sciences, Kagawa, 4Department of Clinical Pharmacy Practice Pedagogy, Institute of Biomedical Sciences, 5Department of Reproductive and Menopausal Medicine, Institute of Biomedical Sciences, Tokushima University Graduate School, Tokushima, Japan Background: The hyperfunction and activation of platelets have been strongly implicated in the development and recurrence of arterial occlusive disease, and various antiplatelet drugs are used to treat and prevent such diseases. New antiplatelet drugs and many other drugs have been developed, but some drugs may have adverse effects on platelet functions. Objective: The aim of this study was to establish an evaluation method for evaluating the effect and adverse effect of various drugs on platelet functions. Materials and methods: Human erythroid leukemia (HEL cells were used after megakaryocytic differentiation with phorbol 12-myristate 13-acetate as an alternative to platelets. Drugs were evaluated by changes in intracellular Ca2+ concentration ([Ca2+]i mobilization in Fura2-loaded phorbol 12-myristate 13-acetate-induced HEL cells. Aspirin and cilostazol were selected as antiplatelet drugs and ibuprofen and sodium valproate as other drugs. Results: There was a positive correlation between [Ca2+]i and platelet aggregation induced by thrombin. Aspirin (5.6–560 µM and cilostazol (5–10 µM significantly inhibited thrombin-induced increases in [Ca2+]i in a concentration-dependent manner. On the other hand, ibuprofen (8–200 µM and sodium valproate (50–1,000 µg/mL also significantly inhibited

  19. Melanin-concentrating hormone in peripheral circulation in the human.

    Science.gov (United States)

    Naufahu, J; Alzaid, F; Fiuza Brito, M; Doslikova, B; Valencia, T; Cunliffe, A; Murray, J F

    2017-03-01

    Melanin-concentrating hormone (MCH) is a hypothalamic neuropeptide with a well-characterised role in energy homeostasis and emergent roles in diverse physiologic functions such as arousal, mood and reproduction. Work to date has predominantly focused on its hypothalamic functions using animal models; however, little attention has been paid to its role in circulation in humans. The aims of this study were to (a) develop a radioimmunoassay for the detection of MCH in human plasma; (b) establish reference ranges for circulating MCH and (c) characterise the pattern of expression of circulating MCH in humans. A sensitive and specific RIA was developed and cross-validated by RP-HPLC and MS. The effective range was 19.5-1248 pg MCH/mL. Blood samples from 231 subjects were taken to establish a reference range of 19.5-55.4 pg/mL for fasting MCH concentrations. There were no significant differences between male and female fasting MCH concentrations; however, there were correlations between MCH concentrations and BMI in males and females with excess fat (P < 0.001 and P = 0.020) and between MCH concentrations and fat mass in females with excess fat (P = 0.038). Plasma MCH concentrations rose significantly after feeding in a group of older individuals (n = 50, males P = 0.006, females P = 0.023). There were no robust significant correlations between fasting or post-prandial MCH and resting metabolic rate, plasma glucose, insulin or leptin concentrations although there were correlations between circulating MCH and leptin concentrations in older individuals (P = 0.029). These results indicate that the role of circulating MCH may not be reflective of its regulatory hypothalamic role. © 2017 Society for Endocrinology.

  20. Nonrandom distribution of iron in circulating human transferrin.

    Science.gov (United States)

    Zak, O; Aisen, P

    1986-07-01

    By combining the urea gel electrophoresis technique of Makey and Seal with Western immunoblotting, a method has been developed for analyzing the distribution of iron between the two sites of circulating human transferrin. The new method avoids exposure of samples to a nonphysiologic pH that may promote removal or redistribution of iron from the protein; this facilitates examination of multiple samples at one time. Analysis of 21 freshly drawn specimens from normal human subjects confirms previous reports that iron is not randomly distributed in the specific sites of transferrin. Rather, there is a considerable range in the ratio of occupancies of N-terminal and C-terminal sites (N:C ratio), from 0.31 to 6.87 in the present study, with the N-terminal site predominantly occupied in most subjects. The N:C ratio correlates modestly with serum iron concentration (r = .54). Possible flaws in studies indicating a random occupancy of the specific sites of circulating transferrin may lie in the low pH to which samples may be exposed during procedures based on isoelectric focusing or in drawing inferences from data considering only total monoferric transferrin rather than the two distinguishable monoferric species.

  1. DJ-1 Modulates Nuclear Erythroid 2–Related Factor-2–Mediated Protection in Human Primary Alveolar Type II Cells in Smokers

    Science.gov (United States)

    Bahmed, Karim; Messier, Elise M.; Zhou, Wenbo; Tuder, Rubin M.; Freed, Curt R.; Chu, Hong Wei; Kelsen, Steven G.; Bowler, Russell P.; Mason, Robert J.

    2016-01-01

    Cigarette smoke (CS) is a main source of oxidative stress and a key risk factor for emphysema, which consists of alveolar wall destruction. Alveolar type (AT) II cells are in the gas exchange regions of the lung. We isolated primary ATII cells from deidentified organ donors whose lungs were not suitable for transplantation. We analyzed the cell injury obtained from nonsmokers, moderate smokers, and heavy smokers. DJ-1 protects cells from oxidative stress and induces nuclear erythroid 2–related factor-2 (Nrf2) expression, which activates the antioxidant defense system. In ATII cells isolated from moderate smokers, we found DJ-1 expression by RT-PCR, and Nrf2 and heme oxygenase (HO)-1 translocation by Western blotting and immunocytofluorescence. In ATII cells isolated from heavy smokers, we detected Nrf2 and HO-1 cytoplasmic localization. Moreover, we found high oxidative stress, as detected by 4-hydroxynonenal (4-HNE) (immunoblotting), inflammation by IL-8 and IL-6 levels by ELISA, and apoptosis by terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay in ATII cells obtained from heavy smokers. Furthermore, we detected early DJ-1 and late Nrf2 expression after ATII cell treatment with CS extract. We also overexpressed DJ-1 by adenovirus construct and found that this restored Nrf2 and HO-1 expression and induced nuclear translocation in heavy smokers. Moreover, DJ-1 overexpression also decreased ATII cell apoptosis caused by CS extract in vitro. Our results indicate that DJ-1 activates the Nrf2-mediated antioxidant defense system. Furthermore, DJ-1 overexpression can restore the impaired Nrf2 pathway, leading to ATII cell protection in heavy smokers. This suggests a potential therapeutic strategy for targeting DJ-1 in CS-related lung diseases. PMID:27093578

  2. THE EFFECTS OF IL-1 AND IL-4 ON THE EPO-INDEPENDENT ERYTHROID PROGENITOR IN POLYCYTHEMIA-VERA

    NARCIS (Netherlands)

    DEWOLF, JTM; HENDRIKS, DW; ESSELINK, MT; HALIE, MR; VELLENGA, E

    1994-01-01

    Human recombinant interleukin-1 (IL-1) was studied for its effects on the erythroid progenitors from normal subjects and from patients with polycythaemia vera (PV). No supportive effect of IL-1 was noticed on the normal, erythropoietin (Epo) dependent, erythroid burst-forming unit (BFU-E) using

  3. Historical aspects and relevance of the human coronary collateral circulation.

    Science.gov (United States)

    Seiler, Christian; Meier, Pascal

    2014-02-01

    In 1669, anastomoses between the right and left coronary artery were first documented by Richard Lower of Amsterdam. Using post-mortem imaging, a debate followed on the existence of structural inter-coronary anastomoses, which was not resolved before the first half of the 20 ieth century in case of the presence of coronary artery disease (CAD), and not before the early 1960 ies in case of the normal human coronary circulation by William Fulton. Functional coronary collateral measurements during coronary interventions were first performed only in the 1970 ies, respectively in the early 1980 ies. In humans, the existence of functional coronary collaterals in the absence of CAD has not been documented before 2003. Though the coronary collateral circulation has been recognized as an alternative source of blood supply to ischemic myocardium, its prognostic significance for the CAD population as a whole has been controversial until recently. The debate was due to different populations examined (acute versus chronic CAD, varying severity of CAD), to variable definitions of the term "prognosis", to insufficient statistical power of the investigation with rare occurrence of prognostic endpoints, to short duration of follow-up and to blunt instruments employed for collateral assessment. Individually, it has been acknowledged that a well functioning collateral supply to a myocardial area at risk for necrosis reduces infarct size, preserves ventricular function, prevents ventricular remodelling and aneurysm formation. Collectively, evidence has accumulated only recently that an extensive coronary collateral circulation is a beneficial prognosticator quoad vitam. In a recent meta-analysis on the topic, the risk ratio to die from any cause for high vs low or absent collateralization in patients with subacute myocardial infarction was 0.53 (95% confidence interval 0.15-1.92; p=0.335), and for patients with acute myocardial infarction, it was 0.63 (95% confidence interval 0

  4. Dynamics of GATA1 binding and expression response in a GATA1-induced erythroid differentiation system

    Directory of Open Access Journals (Sweden)

    Deepti Jain

    2015-06-01

    Full Text Available During the maturation phase of mammalian erythroid differentiation, highly proliferative cells committed to the erythroid lineage undergo dramatic changes in morphology and function to produce circulating, enucleated erythrocytes. These changes are caused by equally dramatic alterations in gene expression, which in turn are driven by changes in the abundance and binding patterns of transcription factors such as GATA1. We have studied the dynamics of GATA1 binding by ChIP-seq and the global expression responses by RNA-seq in a GATA1-dependent mouse cell line model for erythroid maturation, in both cases examining seven progressive stages during differentiation. Analyses of these data should provide insights both into mechanisms of regulation (early versus late targets and the consequences in cell physiology (e.g., distinctive categories of genes regulated at progressive stages of differentiation. The data are deposited in the Gene Expression Omnibus, series GSE36029, GSE40522, GSE49847, and GSE51338.

  5. Local Cytokine Concentrations and Oxygen Pressure Are Related to Maturation of the Collateral Circulation in Humans

    NARCIS (Netherlands)

    Schirmer, Stephan H.; van Royen, Niels; Moerland, Perry D.; Fledderus, Joost O.; Henriques, José P.; van der Schaaf, René J.; Vis, Marije M.; Baan, Jan; Koch, Karel T.; Horrevoets, Anton J. G.; Hoefer, Imo E.; Piek, Jan J.

    2009-01-01

    Objectives Our aim was to determine cytokine and oxygen gradients over the collateral circulation in humans. Background The molecular background of the maturation of the collateral circulation in response to coronary narrowing is poorly understood in humans, partly because of difficulties in

  6. The human coronary collateral circulation: development and clinical importance.

    Science.gov (United States)

    Seiler, Christian; Stoller, Michael; Pitt, Bertram; Meier, Pascal

    2013-09-01

    Coronary collaterals are an alternative source of blood supply to myocardium jeopardized by ischaemia. In comparison with other species, the human coronary collateral circulation is very well developed. Among individuals without coronary artery disease (CAD), there are preformed collateral arteries preventing myocardial ischaemia during a brief vascular occlusion in 20-25%. Determinants of such anastomoses are low heart rate and the absence of systemic arterial hypertension. In patients with CAD, collateral arteries preventing myocardial ischaemia during a brief occlusion are present in every third individual. Collateral flow sufficient to prevent myocardial ischaemia during coronary occlusion amounts to one-fifth to one-fourth the normal flow through the open vessel. Myocardial infarct size, the most important prognostic determinant after such an event, is the product of coronary artery occlusion time, area at risk for infarction, and the inverse of collateral supply. Well-developed coronary collateral arteries in patients with CAD mitigate myocardial infarcts and improve survival. Approximately one-fifth of patients with CAD cannot be revascularized by percutaneous coronary intervention or coronary artery bypass grafting. Therapeutic promotion of collateral growth is a valuable treatment strategy in those patients. It should aim at growth of large conductive collateral arteries (arteriogenesis). Potential arteriogenic approaches include the treatment with granulocyte colony-stimulating factor, physical exercise training, and external counterpulsation.

  7. Unravelling pathways downstream Sox6 induction in K562 erythroid cells by proteomic analysis

    KAUST Repository

    Barbarani, Gloria

    2017-10-20

    The Sox6 transcription factor is crucial for terminal maturation of definitive red blood cells. Sox6-null mouse fetuses present misshapen and nucleated erythrocytes, due to impaired actin assembly and cytoskeleton stability. These defects are accompanied with a reduced survival of Sox6-/- red blood cells, resulting in a compensated anemia. Sox6-overexpression in K562 cells and in human primary ex vivo erythroid cultures enhances erythroid differentiation and leads to hemoglobinization, the hallmark of erythroid maturation. To obtain an overview on processes downstream to Sox6 expression, we performed a differential proteomic analysis on human erythroid K562 cells overexpressing Sox6. Sox6-overexpression induces dysregulation of 64 proteins, involved in cytoskeleton remodeling and in protein synthesis, folding and trafficking, key processes for erythroid maturation. Moreover, 43 out of 64 genes encoding for differentially expressed proteins contain within their proximal regulatory regions sites that are bound by SOX6 according to ENCODE ChIP-seq datasets and are possible direct SOX6 targets. SAR1B, one of the most induced proteins upon Sox6 overexpression, shares a conserved regulatory module, composed by a double SOX6 binding site and a GATA1 consensus, with the adjacent SEC24 A gene. Since both genes encode for COPII components, this element could concur to the coordinated expression of these proteins during erythropoiesis.

  8. Activated T lymphocytes disappear from circulation during endotoxemia in humans

    DEFF Research Database (Denmark)

    Suarez Krabbe, Karen; Kemp, Helle Bruunsgaard; Qvist, Jesper

    2002-01-01

    of disappearance were characterized by an activated phenotype (CD45RA(-) CD45RO(+)) as well as a phenotype linked to apoptosis (CD95(+) CD28(-)). In conclusion, endotoxin-induced lymphopenia reflects the disappearance from the circulation of activated lymphocytes prone to undergo apoptosis....

  9. EPO Receptor Gain-of-Function Causes Hereditary Polycythemia, Alters CD34+ Cell Differentiation and Increases Circulating Endothelial Precursors

    Science.gov (United States)

    Perrotta, Silverio; Cucciolla, Valeria; Ferraro, Marcella; Ronzoni, Luisa; Tramontano, Annunziata; Rossi, Francesca; Scudieri, Anna Chiara; Borriello, Adriana; Roberti, Domenico; Nobili, Bruno; Cappellini, Maria Domenica; Oliva, Adriana; Amendola, Giovanni; Migliaccio, Anna Rita; Mancuso, Patrizia; Martin-Padura, Ines; Bertolini, Francesco; Yoon, Donghoon; Prchal, Josef T.; Della Ragione, Fulvio

    2010-01-01

    Background Gain-of-function of erythropoietin receptor (EPOR) mutations represent the major cause of primary hereditary polycythemia. EPOR is also found in non-erythroid tissues, although its physiological role is still undefined. Methodology/Principal Findings We describe a family with polycythemia due to a heterozygous mutation of the EPOR gene that causes a G→T change at nucleotide 1251 of exon 8. The novel EPOR G1251T mutation results in the replacement of a glutamate residue by a stop codon at amino acid 393. Differently from polycythemia vera, EPOR G1251T CD34+ cells proliferate and differentiate towards the erythroid phenotype in the presence of minimal amounts of EPO. Moreover, the affected individuals show a 20-fold increase of circulating endothelial precursors. The analysis of erythroid precursor membranes demonstrates a heretofore undescribed accumulation of the truncated EPOR, probably due to the absence of residues involved in the EPO-dependent receptor internalization and degradation. Mutated receptor expression in EPOR-negative cells results in EPOR and Stat5 phosphorylation. Moreover, patient erythroid precursors present an increased activation of EPOR and its effectors, including Stat5 and Erk1/2 pathway. Conclusions/Significance Our data provide an unanticipated mechanism for autosomal dominant inherited polycythemia due to a heterozygous EPOR mutation and suggest a regulatory role of EPO/EPOR pathway in human circulating endothelial precursors homeostasis. PMID:20700488

  10. Quantitative proteome profiling of normal human circulating microparticles

    DEFF Research Database (Denmark)

    Østergaard, Ole; Nielsen, Christoffer T; Iversen, Line V

    2012-01-01

    Circulating microparticles (MPs) are produced as part of normal physiology. Their numbers, origin, and composition change in pathology. Despite this, the normal MP proteome has not yet been characterized with standardized high-resolution methods. We here quantitatively profile the normal MP...... proteome using nano-LC-MS/MS on an LTQ-Orbitrap with optimized sample collection, preparation, and analysis of 12 different normal samples. Analytical and procedural variation were estimated in triply processed samples analyzed in triplicate from two different donors. Label-free quantitation was validated...... by the correlation of cytoskeletal protein intensities with MP numbers obtained by flow cytometry. Finally, the validity of using pooled samples was evaluated using overlap protein identification numbers and multivariate data analysis. Using conservative parameters, 536 different unique proteins were quantitated...

  11. A long term model of circulation. [human body

    Science.gov (United States)

    White, R. J.

    1974-01-01

    A quantitative approach to modeling human physiological function, with a view toward ultimate application to long duration space flight experiments, was undertaken. Data was obtained on the effect of weightlessness on certain aspects of human physiological function during 1-3 month periods. Modifications in the Guyton model are reviewed. Design considerations for bilateral interface models are discussed. Construction of a functioning whole body model was studied, as well as the testing of the model versus available data.

  12. Two different in vitro growth patterns for erythroid precursors in 18 patients with pure erythrocytosis

    International Nuclear Information System (INIS)

    Clement, S.; Eberlin, A.; Najean, Y.; Chedeville, A.

    1982-01-01

    Growth patterns of marrow and blood erythroid progenitors were studied in 18 cases of pure erythrocytosis using different doses of erythropoietin. 8 cases demonstrated ''spontaneous'' growth of CFU-E and blood BFU-E as observed in myeloproliferative disorders, but without an excess of circulating CFU-GM. 3 of these patients also had other symptoms of a pan-myelopathy. All these cases showed good sensitivity to 32 P myelo-suppression. 10 cases demonstrated growth patterns of erythroid progenitors similar to those observed in normal subjects, except for an excess of blood BFU-E, which suggests an abnormality of homeostatic regulation. In 5 of these cases, myelo-suppression was not effective. It is suggested that a stem cell study could differentiate patients with pure erythrocytosis due to ''autonomous'' abnormal stem cell growth from cases due to abnormal regulation factors, and that such a discrimination might be usefull for the choice of theraphy. (authors)

  13. A continuum model for pressure-flow relationship in human pulmonary circulation.

    Science.gov (United States)

    Huang, Wei; Zhou, Qinlian; Gao, Jian; Yen, R T

    2011-06-01

    A continuum model was introduced to analyze the pressure-flow relationship for steady flow in human pulmonary circulation. The continuum approach was based on the principles of continuum mechanics in conjunction with detailed measurement of vascular geometry, vascular elasticity and blood rheology. The pulmonary arteries and veins were considered as elastic tubes and the "fifth-power law" was used to describe the pressure-flow relationship. For pulmonary capillaries, the "sheet-flow" theory was employed and the pressure-flow relationship was represented by the "fourth-power law". In this paper, the pressure-flow relationship for the whole pulmonary circulation and the longitudinal pressure distribution along the streamlines were studied. Our computed data showed general agreement with the experimental data for the normal subjects and the patients with mitral stenosis and chronic bronchitis in the literature. In conclusion, our continuum model can be used to predict the changes of steady flow in human pulmonary circulation.

  14. Effects of ghrelin on circulating neuropeptide Y levels in humans.

    Science.gov (United States)

    Coiro, Vittorio; Saccani-Jotti, Gloria; Rubino, Pasquale; Manfredi, Guido; Melani, Andrea; Chiodera, Paolo

    2006-12-01

    Ghrelin is a 28 amino-acid peptide with a strong GH-releasing activity and a complex role in regulation of appetite, fuel utilization, body weight and composition. Neuropeptide Y (NPY) is a well-known stimulator of pathways favouring food intake and energy storage. Recently, studies in rodents suggested a possible mediation of ghrelin action by NPY. In contrast, until now no evidence of ghrelin-NPY interaction in humans has been provided. In the present study, we examined whether ghrelin influences NPY secretion in normal men. Twelve healthy normal men (aged 24-35 years; body mass index (BMI) 22.3+/-0.93 kg/m2) were tested twice at 08.00 AM on two different days, in random order at weekly intervals, after an overnight fast and rest in bed. An intravenous bolus of 1 microg/kg body weight ghrelin (esperimental test) or an equal amount of normal saline (control test) was injected at time 0. Blood was taken before and over 90 minutes after injections, and was used for the measurement of plasma NPY levels. Plasma levels of NPY slightly, but significantly rose in response to ghrelin, with a mean peak level at 15 min after injection, whereas no significant change was observed after saline administration. Our results show a significant enhancement of plasma NPY levels under ghrelin stimulation. To our knowledge, this is the first demonstration of a ghrelin-NPY interaction in humans, which may suggest a possible mediation of ghrelin action by NPY in humans.

  15. Rethinking International Migration of Human Capital and Brain Circulation: The Case of Chinese-Canadian Academics

    Science.gov (United States)

    Blachford, Dongyan Ru; Zhang, Bailing

    2014-01-01

    This article examines the dynamics of brain circulation through a historical review of the debates over international migration of human capital and a case study on Chinese-Canadian academics. Interviews with 22 Chinese-Canadian professors who originally came from China provide rich data regarding the possibilities and problems of the contemporary…

  16. Elevated circulating lipasin/betatrophin in human type 2 diabetes and obesity

    OpenAIRE

    Zhiyao Fu; Feven Berhane; Alemu Fite; Berhane Seyoum; Abdul B. Abou-Samra; Ren Zhang

    2014-01-01

    Lipasin (also known as C19ORF80, RIFL, ANGPTL8 and betatrophin) is a newly discovered circulating factor that regulates lipid metabolism and promotes pancreatic ?-cell proliferation. Whether circulating levels of lipasin in humans are altered in a) type 2 diabetes; b) obesity and c) the postprandial state, however, is unknown. The current study aimed to compare serum lipasin levels in those who were a) non-diabetic (N = 15) or diabetic (BMI- and age-matched; N = 14); b) lean or obese (N = 53 ...

  17. The Role of Circulating Slit2, the One of the Newly Batokines, in Human Diabetes Mellitus

    Directory of Open Access Journals (Sweden)

    Yea Eun Kang

    2017-09-01

    Full Text Available BackgroundSlit2 is a new secreted protein from adipose tissue that improves glucose hemostasis in mice; however, there is no study about the serum levels and precise role of Slit2 in human. The aim of this study is to explore the serum level of Slit2 in human, and to identify the role of Slit2 in diabetes mellitus (DM.MethodsThe participants of this study consist of 38 subjects with newly diagnosed DM, and 75 healthy subjects as a control group. Serum Slit2 levels were measured using an enzyme-linked immunosorbent assay. Relationship between circulating Slit2 and diabetic related factors was investigated in diabetic group compared with non-diabetic group. Additionally, the correlations between the serum level of Slit2 and diverse metabolic parameters were analyzed.ResultsCirculating Slit2 level was more decreased in diabetic group than in control group, but there was no significant difference statistically. Interestingly, serum levels of Slit2 were significantly negatively correlated to the serum concentrations of fasting glucose (coefficient r=–0.246, P=0.008, the serum concentrations of postprandial glucose (coefficient r=–0.233, P=0.017, and glycosylated hemoglobin (HbA1c; coefficient r=–0.357, P<0.001.ConclusionFrom our study, the first report of circulating Slit2 levels in human, circulating Slit2 level significantly negatively correlated with serum glucose and HbA1c. Our results suggest that the circulating Slit2 may play a role in maintainence of glucose homeostasis in human, even though exact contribution and mechanism are not yet known.

  18. Computational Prediction of Human Salivary Proteins from Blood Circulation and Application to Diagnostic Biomarker Identification

    Science.gov (United States)

    Wang, Jiaxin; Liang, Yanchun; Wang, Yan; Cui, Juan; Liu, Ming; Du, Wei; Xu, Ying

    2013-01-01

    Proteins can move from blood circulation into salivary glands through active transportation, passive diffusion or ultrafiltration, some of which are then released into saliva and hence can potentially serve as biomarkers for diseases if accurately identified. We present a novel computational method for predicting salivary proteins that come from circulation. The basis for the prediction is a set of physiochemical and sequence features we found to be discerning between human proteins known to be movable from circulation to saliva and proteins deemed to be not in saliva. A classifier was trained based on these features using a support-vector machine to predict protein secretion into saliva. The classifier achieved 88.56% average recall and 90.76% average precision in 10-fold cross-validation on the training data, indicating that the selected features are informative. Considering the possibility that our negative training data may not be highly reliable (i.e., proteins predicted to be not in saliva), we have also trained a ranking method, aiming to rank the known salivary proteins from circulation as the highest among the proteins in the general background, based on the same features. This prediction capability can be used to predict potential biomarker proteins for specific human diseases when coupled with the information of differentially expressed proteins in diseased versus healthy control tissues and a prediction capability for blood-secretory proteins. Using such integrated information, we predicted 31 candidate biomarker proteins in saliva for breast cancer. PMID:24324552

  19. Molecular pathways of early CD105-positive erythroid cells as compared with CD34-positive common precursor cells by flow cytometric cell-sorting and gene expression profiling

    International Nuclear Information System (INIS)

    Machherndl-Spandl, S; Suessner, S; Danzer, M; Proell, J; Gabriel, C; Lauf, J; Sylie, R; Klein, H-U; Béné, M C; Weltermann, A; Bettelheim, P

    2013-01-01

    Special attention has recently been drawn to the molecular network of different genes that are responsible for the development of erythroid cells. The aim of the present study was to establish in detail the immunophenotype of early erythroid cells and to compare the gene expression profile of freshly isolated early erythroid precursors with that of the CD34-positive (CD34 + ) compartment. Multiparameter flow cytometric analyses of human bone marrow mononuclear cell fractions (n=20) defined three distinct early erythroid stages. The gene expression profile of sorted early erythroid cells was analyzed by Affymetrix array technology. For 4524 genes, a differential regulation was found in CD105-positive erythroid cells as compared with the CD34 + progenitor compartment (2362 upregulated genes). A highly significant difference was observed in the expression level of genes involved in transcription, heme synthesis, iron and mitochondrial metabolism and transforming growth factor-β signaling. A comparison with recently published data showed over 1000 genes that as yet have not been reported to be upregulated in the early erythroid lineage. The gene expression level within distinct pathways could be illustrated directly by applying the Ingenuity software program. The results of gene expression analyses can be seen at the Gene Expression Omnibus repository

  20. Computational Characterization of Exogenous MicroRNAs that Can Be Transferred into Human Circulation.

    Directory of Open Access Journals (Sweden)

    Jiang Shu

    Full Text Available MicroRNAs have been long considered synthesized endogenously until very recent discoveries showing that human can absorb dietary microRNAs from animal and plant origins while the mechanism remains unknown. Compelling evidences of microRNAs from rice, milk, and honeysuckle transported to human blood and tissues have created a high volume of interests in the fundamental questions that which and how exogenous microRNAs can be transferred into human circulation and possibly exert functions in humans. Here we present an integrated genomics and computational analysis to study the potential deciding features of transportable microRNAs. Specifically, we analyzed all publicly available microRNAs, a total of 34,612 from 194 species, with 1,102 features derived from the microRNA sequence and structure. Through in-depth bioinformatics analysis, 8 groups of discriminative features have been used to characterize human circulating microRNAs and infer the likelihood that a microRNA will get transferred into human circulation. For example, 345 dietary microRNAs have been predicted as highly transportable candidates where 117 of them have identical sequences with their homologs in human and 73 are known to be associated with exosomes. Through a milk feeding experiment, we have validated 9 cow-milk microRNAs in human plasma using microRNA-sequencing analysis, including the top ranked microRNAs such as bta-miR-487b, miR-181b, and miR-421. The implications in health-related processes have been illustrated in the functional analysis. This work demonstrates the data-driven computational analysis is highly promising to study novel molecular characteristics of transportable microRNAs while bypassing the complex mechanistic details.

  1. Computational Characterization of Exogenous MicroRNAs that Can Be Transferred into Human Circulation

    Science.gov (United States)

    Shu, Jiang; Chiang, Kevin; Zempleni, Janos; Cui, Juan

    2015-01-01

    MicroRNAs have been long considered synthesized endogenously until very recent discoveries showing that human can absorb dietary microRNAs from animal and plant origins while the mechanism remains unknown. Compelling evidences of microRNAs from rice, milk, and honeysuckle transported to human blood and tissues have created a high volume of interests in the fundamental questions that which and how exogenous microRNAs can be transferred into human circulation and possibly exert functions in humans. Here we present an integrated genomics and computational analysis to study the potential deciding features of transportable microRNAs. Specifically, we analyzed all publicly available microRNAs, a total of 34,612 from 194 species, with 1,102 features derived from the microRNA sequence and structure. Through in-depth bioinformatics analysis, 8 groups of discriminative features have been used to characterize human circulating microRNAs and infer the likelihood that a microRNA will get transferred into human circulation. For example, 345 dietary microRNAs have been predicted as highly transportable candidates where 117 of them have identical sequences with their homologs in human and 73 are known to be associated with exosomes. Through a milk feeding experiment, we have validated 9 cow-milk microRNAs in human plasma using microRNA-sequencing analysis, including the top ranked microRNAs such as bta-miR-487b, miR-181b, and miR-421. The implications in health-related processes have been illustrated in the functional analysis. This work demonstrates the data-driven computational analysis is highly promising to study novel molecular characteristics of transportable microRNAs while bypassing the complex mechanistic details. PMID:26528912

  2. Elevated circulating lipasin/betatrophin in human type 2 diabetes and obesity.

    Science.gov (United States)

    Fu, Zhiyao; Berhane, Feven; Fite, Alemu; Seyoum, Berhane; Abou-Samra, Abdul B; Zhang, Ren

    2014-05-23

    Lipasin (also known as C19ORF80, RIFL, ANGPTL8 and betatrophin) is a newly discovered circulating factor that regulates lipid metabolism and promotes pancreatic β-cell proliferation. Whether circulating levels of lipasin in humans are altered in a) type 2 diabetes; b) obesity and c) the postprandial state, however, is unknown. The current study aimed to compare serum lipasin levels in those who were a) non-diabetic (N=15) or diabetic (BMI- and age-matched; N=14); b) lean or obese (N=53 totally) and c) fasting and 2 hours following a defined meal (N=12). Serum lipasin levels were determined by the enzyme-linked immunosorbent assay. Lipasin levels [mean±SEM] were increased by more than two fold (Plipasin levels were positively correlated with BMI (rho=0.49, Plipasin/betatrophin is nutritionally-regulated hepatokine that is increased in human type 2 diabetes and obesity.

  3. [Update on the biology of heme synthesis in erythroid cells].

    Science.gov (United States)

    Fujiwara, Tohru; Harigae, Hideo

    2015-02-01

    Heme is a prosthetic group of hemoproteins playing important roles in oxygen transport, detoxification, circadian rhythm, microRNA processing, regulation of transcription, and translation. The majority of heme (-85%) is synthesized in red blood cells mainly for hemoglobin production, whereas hepatocytes account for most of the rest, functioning primarily in the synthesis of cytochrome P450 enzymes and mitochondrial respiratory enzymes. Thus, failure of heme biosynthesis causes severe inherited or acquired disorders in humans, including porphyria and sideroblastic anemia. The heme biosynthetic pathway is composed of eight enzymes that work in either mitochondria or the cytoplasm, which have been extensively researched and frequently reviewed. On the other hand, the mechanisms governing transport and intracellular trafficking of heme intermediates, as well as their potential links to human diseases, are poorly understood. Herein, we focus on recent understanding of the heme biosynthetic pathway and on human disorders due to defective heme synthesis in erythroid cells, such as X-linked sideroblastic anemia and erythropoietic protoporphyria.

  4. The Repeated Administration of Resveratrol Has Measurable Effects on Circulating T-Cell Subsets in Humans

    Directory of Open Access Journals (Sweden)

    J. Luis Espinoza

    2017-01-01

    Full Text Available Preclinical studies have shown that resveratrol exerts immunomodulatory effects with potential clinical value in the amelioration of autoimmune disorders and cancer prevention; however, little is known about the in vivo effects of this naturally occurring polyphenol on human immune cells. We assessed the effects of repeated doses of resveratrol (1000 mg/day for 28 days on circulating immune cells in healthy Japanese individuals. Resveratrol was safe and well tolerated and was associated with significant increases in the numbers of circulating γδ T cells and regulatory T cells and resulted in small, yet significant, decreases in the plasma levels of the proinflammatory cytokines TNF-α and MCP-1 and a significant increase in the plasma antioxidant activity compared with the corresponding antioxidant baseline activity and with that in four control individuals. In in vitro studies, resveratrol significantly improved the growth of γδ T cells and regulatory T cells. These findings demonstrate that resveratrol has some clear biological effects on human circulating immune cells. Further studies are necessary to interpret the long-term immunological changes associated with resveratrol treatment.

  5. Dexamethasone targeted directly to macrophages induces macrophage niches that promote erythroid expansion

    DEFF Research Database (Denmark)

    Falchi, Mario; Varricchio, Lilian; Martelli, Fabrizio

    2015-01-01

    Cultures of human CD34(pos) cells stimulated with erythroid growth factors plus dexamethasone, a model for stress erythropoiesis, generate numerous erythroid cells plus a few macrophages (approx. 3%; 3:1 positive and negative for CD169). Interactions occurring between erythroblasts and macrophages...... in these cultures and the biological effects associated with these interactions were documented by live phase-contrast videomicroscopy. Macrophages expressed high motility interacting with hundreds/thousands of erythroblasts per hour. CD169(pos) macrophages established multiple rapid 'loose' interactions...... with proerythroblasts leading to formation of transient erythroblastic island-like structures. By contrast, CD169(neg) macrophages established 'tight' interactions with mature erythroblasts and phagocytosed these cells. 'Loose' interactions of CD169(pos) macrophages were associated with proerythroblast cytokinesis (the...

  6. Hydroxyurea inhibits parvovirus B19 replication in erythroid progenitor cells.

    Science.gov (United States)

    Bonvicini, Francesca; Bua, Gloria; Conti, Ilaria; Manaresi, Elisabetta; Gallinella, Giorgio

    2017-07-15

    Parvovirus B19 (B19V) infection is restricted to erythroid progenitor cells (EPCs) of the human bone marrow, leading to transient arrest of erythropoiesis and severe complications mainly in subjects with underlying hematological disorders or with immune system deficits. Currently, there are no specific antiviral drugs for B19V treatment, but identification of compounds inhibiting B19V replication can be pursued by a drug repositioning strategy. In this frame, the present study investigates the activity of hydroxyurea (HU), the only disease-modifying therapy approved for sickle cell disease (SCD), towards B19V replication in the two relevant cellular systems, the UT7/EpoS1 cell line and EPCs. Results demonstrate that HU inhibits B19V replication with EC 50 values of 96.2µM and 147.1µM in UT7/EpoS1 and EPCs, respectively, providing experimental evidence of the antiviral activity of HU towards B19V replication, and confirming the efficacy of a drug discovery process by drug repositioning strategy. The antiviral activity occurs in vitro at concentrations lower than those affecting cellular DNA replication and viability, and at levels measured in plasma samples of SCD patients undergoing HU therapy. HU might determine a dual beneficial effect on SCD patients, not only for the treatment of the disease but also towards a virus responsible for severe complications. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. Prospective identification of erythroid elements in cultured peripheral blood.

    Science.gov (United States)

    Miller, J L; Njoroge, J M; Gubin, A N; Rodgers, G P

    1999-04-01

    We have developed a prospective approach to identify the generation of erythroid cells derived from cultured peripheral blood mononuclear cells (PBMC) by monitoring the expression of the cell surface protein CD48. Unpurified populations of PBMC obtained from the buffy coats of normal volunteers were grown in suspension culture in the absence or presence of erythropoietin. A profile of surface CD48 expression permitted a flow cytometric identification of erythropoietin responsive populations at various stages of their maturation. In the absence of erythropoietin (EPO) supplemented media, the CD48- cells represented <5% of the total population of PBMC remaining in culture. In cultures supplemented with 1 U/mL EPO, the mean percentage of CD48- cells increased to 34.7 + 14.9% (p < 0.01) after 14 days in culture. Coordinated CD34 and CD71 (transferrin receptor) expression, morphology, gamma-globin transcription, and colony formation in methylcellulose were observed during the 14-day culture period. Flow cytometric monitoring of bulk cultured PBMC provides a simple and reliable means for the prospective or real-time study of human erythropoiesis.

  8. Effects of immunosuppression on circulating adeno-associated virus capsid-specific T cells in humans.

    Science.gov (United States)

    Parzych, Elizabeth M; Li, Hua; Yin, Xiangfan; Liu, Qin; Wu, Te-Lang; Podsakoff, Gregory M; High, Katherine A; Levine, Matthew H; Ertl, Hildegund C J

    2013-04-01

    In humans adeno-associated virus (AAV)-mediated gene transfer is followed by expansion of AAV capsid-specific T cells, evidence of cell damage, and loss of transgene product expression, implicating immunological rejection of vector-transduced cells, which may be prevented by immunosuppressive drugs. We undertook this study to assess the effect of immunosuppression (IS) used for organ transplantation on immune responses to AAV capsid antigens. Recipients of liver or kidney transplants were tested before and 4 weeks after induction of IS in comparison with matched samples from healthy human adults and an additional cohort with comorbid conditions similar to those of the transplant patients. Our data show that transplant patients and comorbid control subjects have markedly higher frequencies of circulating AAV capsid-specific T cells compared with healthy adults. On average, IS resulted in a reduction of AAV-specific CD4⁺ T cells, whereas numbers of circulating CD8⁺ effector and central memory T cells tended to increase. Independent of the type of transplant or the IS regimens, the trend of AAV capsid-specific T cell responses after drug treatment varied; in some patients responses were unaffected whereas others showed decreases or even pronounced increases, casting doubt on the usefulness of prophylactic IS for AAV vector recipients.

  9. Diurnal Variations of Human Circulating Cell-Free Micro-RNA.

    Directory of Open Access Journals (Sweden)

    Niels H H Heegaard

    Full Text Available A 24-hour light and dark cycle-dependent rhythmicity pervades physiological processes in virtually all living organisms including humans. These regular oscillations are caused by external cues to endogenous, independent biological time-keeping systems (clocks. The rhythm is reflected by gene expression that varies in a circadian and specific fashion in different organs and tissues and is regulated largely by dynamic epigenetic and post-transcriptional mechanisms. This leads to well-documented oscillations of specific electrolytes, hormones, metabolites, and plasma proteins in blood samples. An emerging, important class of gene regulators is short single-stranded RNA (micro-RNA, miRNA that interferes post-transcriptionally with gene expression and thus may play a role in the circadian variation of gene expression. MiRNAs are promising biomarkers by virtue of their disease-specific tissue expression and because of their presence as stable entities in the circulation. However, no studies have addressed the putative circadian rhythmicity of circulating, cell-free miRNAs. This question is important both for using miRNAs as biological markers and for clues to miRNA function in the regulation of circadian gene expression. Here, we investigate 92 miRNAs in plasma samples from 24 young male, healthy volunteers repeatedly sampled 9 times during a 24-hour stay in a regulated environment. We demonstrate that a third (26/79 of the measurable plasma miRNAs (using RT-qPCR on a microfluidic system exhibit a rhythmic behavior and are distributed in two main phase patterns. Some of these miRNAs weakly target known clock genes and many have strong targets in intracellular MAPK signaling pathways. These novel findings highlight the importance of considering bio-oscillations in miRNA biomarker studies and suggest the further study of a set of specific circulating miRNAs in the regulation and functioning of biological clocks.

  10. Leukemic blast cell colony formation in semisolid culture with erythropoietin: a case report of acute poorly differentiated erythroid leukemia.

    Science.gov (United States)

    Tomonaga, M; Jinnai, I; Tagawa, M; Amenomori, T; Nishino, K; Yao, E; Nonaka, H; Kuriyama, K; Yoshida, Y; Matsuo, T

    1987-02-01

    The bone marrow of a patient with acute undifferentiated leukemia developed unique colonies after a 14-day culture in erythropoietin (EPO)-containing methylcellulose. The colonies consisted of 20 to 200 nonhemoglobinized large blast cells. Cytogenetic analysis of single colonies revealed hypotetraploid karyotypes with several marker chromosomes that were identical to those found in directly sampled bone marrow. The concurrently formed erythroid bursts showed only normal karyotypes. No leukemic colony formation was observed in other culture systems with either colony-stimulating activity (CSA) or phytohemagglutinin-stimulated leukocyte-conditioned medium (PHA-LCM). The leukemic colonies exhibited a complete EPO-dose dependency similar to that of the patient's normal BFU-E. Although cytochemical and immunologic marker studies of the bone marrow cells failed to clarify the cell lineage of the leukemic cells with extraordinarily large cell size, ultrastructural study revealed erythroid differentiation such as siderosome formation in the cytoplasm and ferritin particles in the rhophecytosis invaginations. These findings indicate that the patient had poorly differentiated erythroid leukemia and that some of the clonogenic cells might respond to EPO in vitro. Corresponding to this biological feature, the leukemic cells were markedly decreased in number in response to repeated RBC transfusions, and partial remission was obtained. These observations suggest that erythroid leukemia distinct from erythroleukemia (M6) with a myeloblastic component, can develop as a minor entity of human acute leukemia.

  11. Enhancement of erythroid colony growth in culture by hemin

    International Nuclear Information System (INIS)

    Porter, P.N.; Meints, R.H.; Mesner, K.

    1979-01-01

    Hemin was found to enhance the growth of murine erythroid colonies in culture. In the presence of 100 mU/ml erythropoietin (EPO), the addition of hemin (0.05-0.2 mM) resulted in the growth of twice as many colonies as were obtained with EPO alone. Hemin also significantly increased erythroid colony formation in culture in the absence of added EPO. Hemoblobin synthesis as measured by the incorporation of 59 Fe into cyclohexanone extractable heme was augmented in culture by hemin. Neither Δ-aminolevulinic acid, a hemin precursor, nor FeCl 3 increased colony number. (author)

  12. Circulating Human Eosinophils Share a Similar Transcriptional Profile in Asthma and Other Hypereosinophilic Disorders.

    Science.gov (United States)

    Barnig, Cindy; Alsaleh, Ghada; Jung, Nicolas; Dembélé, Doulaye; Paul, Nicodème; Poirot, Anh; Uring-Lambert, Béatrice; Georgel, Philippe; de Blay, Fréderic; Bahram, Seiamak

    2015-01-01

    Eosinophils are leukocytes that are released into the peripheral blood in a phenotypically mature state and are capable of being recruited into tissues in response to appropriate stimuli. Eosinophils, traditionally considered cytotoxic effector cells, are leukocytes recruited into the airways of asthma patients where they are believed to contribute to the development of many features of the disease. This perception, however, has been challenged by recent findings suggesting that eosinophils have also immunomodulatory functions and may be involved in tissue homeostasis and wound healing. Here we describe a transcriptome-based approach-in a limited number of patients and controls-to investigate the activation state of circulating human eosinophils isolated by flow cytometry. We provide an overview of the global expression pattern in eosinophils in various relevant conditions, e.g., eosinophilic asthma, hypereosinophilic dermatological diseases, parasitosis and pulmonary aspergillosis. Compared to healthy subjects, circulating eosinophils isolated from asthma patients differed in their gene expression profile which is marked by downregulation of transcripts involved in antigen presentation, pathogen recognition and mucosal innate immunity, whereas up-regulated genes were involved in response to non-specific stimulation, wounding and maintenance of homeostasis. Eosinophils from other hypereosinophilic disorders displayed a very similar transcriptional profile. Taken together, these observations seem to indicate that eosinophils exhibit non-specific immunomodulatory functions important for tissue repair and homeostasis and suggest new roles for these cells in asthma immunobiology.

  13. Evaluation of Two Commercial Enzyme-Linked Immunosorbent Assay Kits for the Detection of Human Circulating Metrnl.

    Science.gov (United States)

    Zheng, Si-Li; Li, Zhi-Yong; Zhang, Zheng; Wang, Dong-Sheng; Xu, Jian; Miao, Chao-Yu

    2018-04-01

    Metrnl is a newly discovered secreted protein with neurotrophic activity and metabolic effect, while in earlier studies its circulating level in human was not explored. We evaluated two commercial enzyme-linked immunosorbent assay kits (DY7867-05, R&D Systems and SK00478-02, Aviscera Bioscience) for the detection of human circulating Metrnl. The DY7867-05 kit showed superiority over the SK00478-02 kit since it generated better curve fitting degree, smaller variation among tests, higher inter-assay reproducibility and better specificity, and could effectively detect human Metrnl in six types of blood samples. Subsequent analysis was performed using the DY7867-05 kit. Sample storage conditions were investigated. No gender difference in circulating Metrnl levels was found, while people with newly diagnosed type 2 diabetes mellitus (T2DM) had significantly lower Metrnl levels compared to the healthy controls.

  14. Circulating FGF21 in humans is potently induced by short term overfeeding of carbohydrates

    DEFF Research Database (Denmark)

    Lundsgaard, Annemarie; Fritzen, Andreas Mæchel; Sjøberg, Kim Anker

    2017-01-01

    OBJECTIVE: Fibroblast-growth factor 21 (FGF21) is thought to be important in metabolic regulation. Recently, low protein diets have been shown to increase circulating FGF21 levels. However, when energy contribution from dietary protein is lowered, other macronutrients, such as carbohydrates, must...... concentration increased 8-fold compared to CON (329 ± 99 vs. 39 ± 9 pg ml(-1), p FAT only a non-significant tendency (p = 0.073) to an increase in plasma FGF21 concentration was found. The increase in FGF21 concentration after CHO correlated closely (r = 0.88, p ... intake and increased plasma FGF21 concentration. CONCLUSION: Excess dietary carbohydrate, but not fat, led to markedly increased FGF21 secretion in humans, notably without protein restriction, and affected glucose and lipid homeostais....

  15. Radioimmunoassay of erythropoietin: circulating levels in normal and polycythemic human beings

    International Nuclear Information System (INIS)

    Garcia, J.F.; Ebbe, S.N.; Hollander, L.; Cutting, H.O.; Miller, M.E.; Cronkite, E.P.

    1982-01-01

    Techniques are described in detail for the RIA of human Ep in unextracted plasma or serum. With 100 μl of sample, the assay is sensitive at an Ep concentration of approximately 4 mU/ml, and when required, the sensitivity can be increased to 0.4 mU/ml, a range considerably less than the concentration observed in normal human beings. This is approximately 100 times more sensitive than existing in vivo bioassays for this hormone. Studies concerned with the validation of the Ep RIA show a high degree of correlation with the polycythemic mouse bioassay. Dilutions of a variety of human serum samples show a parallel relationship with the standard reference preparation for Ep. Validation of the RIA is further confirmed by observations of appropriate increases or decreases of circulating Ep levels in physiological and clinical conditions known to be associated with stimulation or suppression of Ep secretion. Significantly different mean serum concentrations of 17.2 mU/ml for normal male subjects and 18.8 mU/ml for normal female subjects were observed. Mean plasma Ep concentrations in patients with polycythemia vera are significantly decreased, and those of patients with secondary polycythemia are significantly increased as compared to plasma levels in normal subjects. These results demonstrate an initial practical value of the Ep RA in the hematology clinic, which will most certainly be expanded with its more extensive use

  16. TMEM14C is required for erythroid mitochondrial heme metabolism.

    Science.gov (United States)

    Yien, Yvette Y; Robledo, Raymond F; Schultz, Iman J; Takahashi-Makise, Naoko; Gwynn, Babette; Bauer, Daniel E; Dass, Abhishek; Yi, Gloria; Li, Liangtao; Hildick-Smith, Gordon J; Cooney, Jeffrey D; Pierce, Eric L; Mohler, Kyla; Dailey, Tamara A; Miyata, Non; Kingsley, Paul D; Garone, Caterina; Hattangadi, Shilpa M; Huang, Hui; Chen, Wen; Keenan, Ellen M; Shah, Dhvanit I; Schlaeger, Thorsten M; DiMauro, Salvatore; Orkin, Stuart H; Cantor, Alan B; Palis, James; Koehler, Carla M; Lodish, Harvey F; Kaplan, Jerry; Ward, Diane M; Dailey, Harry A; Phillips, John D; Peters, Luanne L; Paw, Barry H

    2014-10-01

    The transport and intracellular trafficking of heme biosynthesis intermediates are crucial for hemoglobin production, which is a critical process in developing red cells. Here, we profiled gene expression in terminally differentiating murine fetal liver-derived erythroid cells to identify regulators of heme metabolism. We determined that TMEM14C, an inner mitochondrial membrane protein that is enriched in vertebrate hematopoietic tissues, is essential for erythropoiesis and heme synthesis in vivo and in cultured erythroid cells. In mice, TMEM14C deficiency resulted in porphyrin accumulation in the fetal liver, erythroid maturation arrest, and embryonic lethality due to profound anemia. Protoporphyrin IX synthesis in TMEM14C-deficient erythroid cells was blocked, leading to an accumulation of porphyrin precursors. The heme synthesis defect in TMEM14C-deficient cells was ameliorated with a protoporphyrin IX analog, indicating that TMEM14C primarily functions in the terminal steps of the heme synthesis pathway. Together, our data demonstrate that TMEM14C facilitates the import of protoporphyrinogen IX into the mitochondrial matrix for heme synthesis and subsequent hemoglobin production. Furthermore, the identification of TMEM14C as a protoporphyrinogen IX importer provides a genetic tool for further exploring erythropoiesis and congenital anemias.

  17. Studies of globin gene expression in differentiating erythroid cells

    International Nuclear Information System (INIS)

    Sullivan, T.D.

    1985-01-01

    The author has addressed questions concerning globin gene expression and the loss of protein synthesis in the terminal stages of erythroid development. (1) The hypothesis that the rate of cell division affects the relative synthesis of γ and β globin in erythroid cells was investigated. The effect of hydroxyurea, aminopterin, or low culture temperature on the in vitro growth of erythroid progenitor cells and on the relative synthesis of γ and β globin was measured. No consistent change in γ globin synthesis was detected. (2) The hypothesis that the ratio of γ and β globin synthesis decreases during erythroid maturation because of differential mRNA stability was investigated. The half-lives of γ and β globin mRNAs and γ and β globin protein synthesis were measured in cultured reticulocytes. γ and β globin mRNAs were assayed by solution hybridization and by in vitro translation. Globin synthesis was determined by 3 H-leucine incorporation into the γ and β globin chains. γ and β globin mRNAs decay with similar half-lives in cultured reticulocytes. Therefore, the change in the ratio of γ and β globin synthesis during erythroid maturation cannot be explained by differences in mRNA stability and is likely to result from asynchronous transcription of the genes. These data suggest that protein synthesis in maturing reticulocytes is not limited by the quantity of mRNA but by the availability of translation factors. (3) The hypothesis was tested that the initiation factor GEF becomes limiting for protein synthesis during reticulocyte maturation

  18. Circulating FGF21 in humans is potently induced by short term overfeeding of carbohydrates.

    Science.gov (United States)

    Lundsgaard, Anne-Marie; Fritzen, Andreas M; Sjøberg, Kim A; Myrmel, Lene S; Madsen, Lise; Wojtaszewski, Jørgen F P; Richter, Erik A; Kiens, Bente

    2017-01-01

    Fibroblast-growth factor 21 (FGF21) is thought to be important in metabolic regulation. Recently, low protein diets have been shown to increase circulating FGF21 levels. However, when energy contribution from dietary protein is lowered, other macronutrients, such as carbohydrates, must be increased to meet eucaloric balance. This raises the possibility that intake of a diet rich in carbohydrates may induce an increase in plasma FGF21 levels per se. Here we studied the role of dietary carbohydrates on the levels of circulating FGF21 and concomitant physiologic effects by feeding healthy men a carbohydrate rich diet without reducing protein intake. A diet enriched in carbohydrates (80 E% carbohydrate; CHO) and a eucaloric control diet (CON) were provided to nine healthy men for three days. The energy intake during the CHO diet was increased (+75% energy) to ensure similar dietary protein intake in CHO and CON. To control for the effect of caloric surplus, we similarly overfed (+75% energy) the same subjects for three days with a fat-rich diet (78 E% fat; FAT), consisting of primarily unsaturated fatty acids. The three diets were provided in random order. After CHO, plasma FGF21 concentration increased 8-fold compared to CON (329 ± 99 vs. 39 ± 9 pg ml -1 , p FAT only a non-significant tendency (p = 0.073) to an increase in plasma FGF21 concentration was found. The increase in FGF21 concentration after CHO correlated closely (r = 0.88, p carbohydrate, but not fat, led to markedly increased FGF21 secretion in humans, notably without protein restriction, and affected glucose and lipid homeostais.

  19. Simultaneous quantification of 21 water soluble vitamin circulating forms in human plasma by liquid chromatography-mass spectrometry.

    Science.gov (United States)

    Meisser Redeuil, Karine; Longet, Karin; Bénet, Sylvie; Munari, Caroline; Campos-Giménez, Esther

    2015-11-27

    This manuscript reports a validated analytical approach for the quantification of 21 water soluble vitamins and their main circulating forms in human plasma. Isotope dilution-based sample preparation consisted of protein precipitation using acidic methanol enriched with stable isotope labelled internal standards. Separation was achieved by reversed-phase liquid chromatography and detection performed by tandem mass spectrometry in positive electrospray ionization mode. Instrumental lower limits of detection and quantification reached water soluble vitamins in human plasma single donor samples. The present report provides a sensitive and reliable approach for the quantification of water soluble vitamins and main circulating forms in human plasma. In the future, the application of this analytical approach will give more confidence to provide a comprehensive assessment of water soluble vitamins nutritional status and bioavailability studies in humans. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. Molecular characterization of human coronaviruses and their circulation dynamics in Kenya, 2009-2012.

    Science.gov (United States)

    Sipulwa, Lenata A; Ongus, Juliette R; Coldren, Rodney L; Bulimo, Wallace D

    2016-02-01

    Human Coronaviruses (HCoV) are a common cause of respiratory illnesses and are responsible for considerable morbidity and hospitalization across all age groups especially in individuals with compromised immunity. There are six known species of HCoV: HCoV-229E, HCoV-NL63, HCoV-HKU1, HCoV-OC43, MERS-CoV and SARS-HCoV. Although studies have shown evidence of global distribution of HCoVs, there is limited information on their presence and distribution in Kenya. HCoV strains that circulated in Kenya were retrospectively diagnosed and molecularly characterized. A total of 417 nasopharyngeal specimens obtained between January 2009 and December 2012 from around Kenya were analyzed by a real time RT-PCR using HCoV-specific primers. HCoV-positive specimens were subsequently inoculated onto monolayers of LL-CMK2 cells. The isolated viruses were characterized by RT-PCR amplification and sequencing of the partial polymerase (pol) gene. The prevalence of HCoV infection was as follows: out of the 417 specimens, 35 (8.4 %) were positive for HCoV, comprising 10 (2.4 %) HCoV-NL63, 12 (2.9 %) HCoV-OC43, 9 (2.1 %) HCoV-HKU1, and 4 (1 %) HCoV-229E. The Kenyan HCoV strains displayed high sequence homology to the prototypes and contemporaneous strains. Evolution analysis showed that the Kenyan HCoV-OC43 and HCoV-NL63 isolates were under purifying selection. Phylogenetic evolutionary analyses confirmed the identities of three HCoV-HKU1, five HCoV-NL63, eight HCoV-OC43 and three HCoV-229E. There were yearly variations in the prevalence and circulation patterns of individual HCoVs in Kenya. This paper reports on the first molecular characterization of human Coronaviruses in Kenya, which play an important role in causing acute respiratory infections among children.

  1. Correlation of circulating MMP-9 with white blood cell count in humans: effect of smoking.

    Directory of Open Access Journals (Sweden)

    Soren Snitker

    Full Text Available Matrix metalloproteinase-9 (MMP-9 is an emerging biomarker for several disease conditions, where white blood cell (WBC count is also elevated. In this study, we examined the relationship between MMP-9 and WBC levels in apparently healthy smoking and non-smoking human subjects.We conducted a cross-sectional study to assess the relationship of serum MMP-9 with WBC in 383 men and 356 women. Next, we divided the male population (women do not smoke in this population into three groups: never (n = 243, current (n = 76 and former (n = 64 smokers and compared the group differences in MMP-9 and WBC levels and their correlations within each group.Circulating MMP-9 and WBC count are significantly correlated in men (R(2 = 0.13, p<0.001 and women (R(2 = 0.19, p<0.001. After stratification by smoking status, MMP-9 level was significantly higher in current smokers (mean ± SE; 663.3±43.4 ng/ml, compared to never (529.7±20.6 and former smokers (568±39.3. WBC count was changed in a similar pattern. Meanwhile, the relationship became stronger in current smokers with increased correlation coefficient of r = 0.45 or R(2 = 0.21 (p<0.001 and steeper slope of ß = 1.16±0.30 (p<0.001 in current smokers, compared to r = 0.26 or R(2 = 0.07 (p<0.001 and ß = 0.34±0.10 (p<0.001 in never smokers.WBC count accounts for 13% and 19% of MMP-9 variance in men and women, respectively. In non-smoking men, WBC count accounts for 7% of MMP-9 variance, but in smoking subjects, it accounts for up to 21% of MMP-9 variance. Thus, we have discovered a previously unrecognized correlation between the circulating MMP-9 and WBC levels in humans.

  2. Numerical Models of Human Circulatory System under Altered Gravity: Brain Circulation

    Science.gov (United States)

    Kim, Chang Sung; Kiris, Cetin; Kwak, Dochan; David, Tim

    2003-01-01

    A computational fluid dynamics (CFD) approach is presented to model the blood flow through the human circulatory system under altered gravity conditions. Models required for CFD simulation relevant to major hemodynamic issues are introduced such as non-Newtonian flow models governed by red blood cells, a model for arterial wall motion due to fluid-wall interactions, a vascular bed model for outflow boundary conditions, and a model for auto-regulation mechanism. The three-dimensional unsteady incompressible Navier-Stokes equations coupled with these models are solved iteratively using the pseudocompressibility method and dual time stepping. Moving wall boundary conditions from the first-order fluid-wall interaction model are used to study the influence of arterial wall distensibility on flow patterns and wall shear stresses during the heart pulse. A vascular bed modeling utilizing the analogy with electric circuits is coupled with an auto-regulation algorithm for multiple outflow boundaries. For the treatment of complex geometry, a chimera overset grid technique is adopted to obtain connectivity between arterial branches. For code validation, computed results are compared with experimental data for steady and unsteady non-Newtonian flows. Good agreement is obtained for both cases. In sin-type Gravity Benchmark Problems, gravity source terms are added to the Navier-Stokes equations to study the effect of gravitational variation on the human circulatory system. This computational approach is then applied to localized blood flows through a realistic carotid bifurcation and two Circle of Willis models, one using an idealized geometry and the other model using an anatomical data set. A three- dimensional anatomical Circle of Willis configuration is reconstructed from human-specific magnetic resonance images using an image segmentation method. The blood flow through these Circle of Willis models is simulated to provide means for studying gravitational effects on the brain

  3. An advanced computational bioheat transfer model for a human body with an embedded systemic circulation.

    Science.gov (United States)

    Coccarelli, Alberto; Boileau, Etienne; Parthimos, Dimitris; Nithiarasu, Perumal

    2016-10-01

    In the present work, an elaborate one-dimensional thermofluid model for a human body is presented. By contrast to the existing pure conduction-/perfusion-based models, the proposed methodology couples the arterial fluid dynamics of a human body with a multi-segmental bioheat model of surrounding solid tissues. In the present configuration, arterial flow is included through a network of elastic vessels. More than a dozen solid segments are employed to represent the heat conduction in the surrounding tissues, and each segment is constituted by a multilayered circular cylinder. Such multi-layers allow flexible delineation of the geometry and incorporation of properties of different tissue types. The coupling of solid tissue and fluid models requires subdivision of the arterial circulation into large and small arteries. The heat exchange between tissues and arterial wall occurs by convection in large vessels and by perfusion in small arteries. The core region, including the heart, provides the inlet conditions for the fluid equations. In the proposed model, shivering, sweating, and perfusion changes constitute the basis of the thermoregulatory system. The equations governing flow and heat transfer in the circulatory system are solved using a locally conservative Galerkin approach, and the heat conduction in the surrounding tissues is solved using a standard implicit backward Euler method. To investigate the effectiveness of the proposed model, temperature field evolutions are monitored at different points of the arterial tree and in the surrounding tissue layers. To study the differences due to flow-induced convection effects on thermal balance, the results of the current model are compared against those of the widely used modelling methodologies. The results show that the convection significantly influences the temperature distribution of the solid tissues in the vicinity of the arteries. Thus, the inner convection has a more predominant role in the human body heat

  4. Enhanced inhibition of parvovirus B19 replication by cidofovir in extendedly exposed erythroid progenitor cells.

    Science.gov (United States)

    Bonvicini, Francesca; Bua, Gloria; Manaresi, Elisabetta; Gallinella, Giorgio

    2016-07-15

    Human parvovirus B19 (B19V) commonly induces self-limiting infections but can also cause severe clinical manifestations in patients with underlying haematological disorders or with immune system deficits. Currently, therapeutic options for B19V entirely rely on symptomatic and supportive treatments since a specific antiviral therapy is not yet available. Recently a first step in the research for active compounds inhibiting B19V replication has allowed identifying the acyclic nucleoside phosphonate cidofovir (CDV). Herein, the effect of CDV against B19V replication was characterized in human erythroid progenitor cells (EPCs) cultured and infected following different experimental approaches to replicate in vitro the infection of an expanding erythroid cell population in the bone marrow. B19V replication was selectively inhibited both in infected EPCs extendedly exposed to CDV 500μM (viral inhibition 82%) and in serially infected EPCs cultures with passage of the virus progeny, constantly under drug exposure (viral inhibition 99%). In addition, a potent inhibitory effect against B19V (viral inhibition 92%) was assessed in a short-term infection of EPCs treated with CDV 500μM 1day before viral infection. In the evaluated experimental conditions, the enhanced effect of CDV against B19V might be ascribed both to the increased intracellular drug concentration achieved by extended exposure, and to a progressive reduction in efficiency of the replicative process within treated EPCs population. Copyright © 2016 Elsevier B.V. All rights reserved.

  5. The role of DNA methylation in catechol-enhanced erythroid differentiation of K562 cells

    Energy Technology Data Exchange (ETDEWEB)

    Li, Xiao-Fei; Wu, Xiao-Rong; Xue, Ming; Wang, Yan; Wang, Jie; Li, Yang; Suriguga,; Zhang, Guang-Yao; Yi, Zong-Chun, E-mail: yizc@buaa.edu.cn

    2012-11-15

    Catechol is one of phenolic metabolites of benzene in vivo. Catechol is also widely used in pharmaceutical and chemical industries. In addition, fruits, vegetables and cigarette smoke also contain catechol. Our precious study showed that several benzene metabolites (phenol, hydroquinone, and 1,2,4-benzenetriol) inhibited erythroid differentiation of K562 cells. In present study, the effect of catechol on erythroid differentiation of K562 cells was investigated. Moreover, to address the role of DNA methylation in catechol-induced effect on erythroid differentiation in K562 cells, methylation levels of erythroid-specific genes were analyzed by Quantitative MassARRAY methylation analysis platform. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation in K562 cells in concentration- and time-dependent manners. The mRNA expression of erythroid specific genes, including α-globin, β-globin, γ-globin, erythroid 5-aminolevulinate synthase, erythroid porphobilinogen deaminase, and transcription factor GATA-1 genes, showed a significant concentration-dependent increase in catechol-treated K562 cells. The exposure to catechol caused a decrease in DNA methylation levels at a few CpG sites in some erythroid specific genes including α-globin, β-globin and erythroid porphobilinogen deaminase genes. These results indicated that catechol improved erythroid differentiation potency of K562 cells at least partly via up-regulating transcription of some erythroid related genes, and suggested that inhibition of DNA methylation might be involved in up-regulated expression of some erythroid related genes. -- Highlights: ► Catechol enhanced hemin-induced hemoglobin accumulation. ► Exposure to catechol resulted in up-regulated expression of erythroid genes. ► Catechol reduced methylation levels at some CpG sites in erythroid genes.

  6. The role of DNA methylation in catechol-enhanced erythroid differentiation of K562 cells

    International Nuclear Information System (INIS)

    Li, Xiao-Fei; Wu, Xiao-Rong; Xue, Ming; Wang, Yan; Wang, Jie; Li, Yang; Suriguga,; Zhang, Guang-Yao; Yi, Zong-Chun

    2012-01-01

    Catechol is one of phenolic metabolites of benzene in vivo. Catechol is also widely used in pharmaceutical and chemical industries. In addition, fruits, vegetables and cigarette smoke also contain catechol. Our precious study showed that several benzene metabolites (phenol, hydroquinone, and 1,2,4-benzenetriol) inhibited erythroid differentiation of K562 cells. In present study, the effect of catechol on erythroid differentiation of K562 cells was investigated. Moreover, to address the role of DNA methylation in catechol-induced effect on erythroid differentiation in K562 cells, methylation levels of erythroid-specific genes were analyzed by Quantitative MassARRAY methylation analysis platform. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation in K562 cells in concentration- and time-dependent manners. The mRNA expression of erythroid specific genes, including α-globin, β-globin, γ-globin, erythroid 5-aminolevulinate synthase, erythroid porphobilinogen deaminase, and transcription factor GATA-1 genes, showed a significant concentration-dependent increase in catechol-treated K562 cells. The exposure to catechol caused a decrease in DNA methylation levels at a few CpG sites in some erythroid specific genes including α-globin, β-globin and erythroid porphobilinogen deaminase genes. These results indicated that catechol improved erythroid differentiation potency of K562 cells at least partly via up-regulating transcription of some erythroid related genes, and suggested that inhibition of DNA methylation might be involved in up-regulated expression of some erythroid related genes. -- Highlights: ► Catechol enhanced hemin-induced hemoglobin accumulation. ► Exposure to catechol resulted in up-regulated expression of erythroid genes. ► Catechol reduced methylation levels at some CpG sites in erythroid genes.

  7. CD133 antibody conjugation to decellularized human heart valves intended for circulating cell capture.

    Science.gov (United States)

    Vossler, John D; Min Ju, Young; Williams, J Koudy; Goldstein, Steven; Hamlin, James; Lee, Sang Jin; Yoo, James J; Atala, Anthony

    2015-09-03

    The long term efficacy of tissue based heart valve grafts may be limited by progressive degeneration characterized by immune mediated inflammation and calcification. To avoid this degeneration, decellularized heart valves with functionalized surfaces capable of rapid in vivo endothelialization have been developed. The aim of this study is to examine the capacity of CD133 antibody-conjugated valve tissue to capture circulating endothelial progenitor cells (EPCs). Decellularized human pulmonary valve tissue was conjugated with CD133 antibody at varying concentrations and exposed to CD133 expressing NTERA-2 cl.D1 (NT2) cells in a microflow chamber. The amount of CD133 antibody conjugated on the valve tissue surface and the number of NT2 cells captured in the presence of shear stress was measured. Both the amount of CD133 antibody conjugated to the valve leaflet surface and the number of adherent NT2 cells increased as the concentration of CD133 antibody present in the surface immobilization procedure increased. The data presented in this study support the hypothesis that the rate of CD133(+) cell adhesion in the presence of shear stress to decellularized heart valve tissue functionalized by CD133 antibody conjugation increases as the quantity of CD133 antibody conjugated to the tissue surface increases.

  8. Mass spectrometry characterization of circulating human serum albumin microheterogeneity in patients with alcoholic hepatitis.

    Science.gov (United States)

    Naldi, Marina; Baldassarre, Maurizio; Domenicali, Marco; Giannone, Ferdinando Antonino; Bossi, Matteo; Montomoli, Jonathan; Sandahl, Thomas Damgaard; Glavind, Emilie; Vilstrup, Hendrik; Caraceni, Paolo; Bertucci, Carlo

    2016-04-15

    Human serum albumin (HSA) is the most abundant plasma protein, endowed with several biological properties unrelated to its oncotic power, such as antioxidant and free-radicals scavenging activities, binding and transport of many endogenous and exogenous substances, and regulation of endothelial function and inflammatory response. These non-oncotic activities are closely connected to the peculiarly dynamic structure of the albumin molecule. HSA undergoes spontaneous structural modifications, mainly by reaction with oxidants and saccharides; however, patients with cirrhosis show extensive post-transcriptional changes at several molecular sites of HSA, the degree of which parallels the severity of the disease. The present work reports the development and application of an innovative LC-MS analytical method for a rapid and reproducible determination of the relative abundance of HSA isoforms in plasma samples from alcoholic hepatitis (AH) patients. A condition of severe oxidative stress, similar to that observed in AH patients, is associated with profound changes in circulating HSA microheterogeneity. More interestingly, the high resolution provided by the analytical platform allowed the monitoring of novel oxidative products of HSA never reported before. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. Circulation of canine parvovirus among dogs living in human-wildlife interface in the Atlantic forest biome, Brazil

    Directory of Open Access Journals (Sweden)

    Flávia V. Vieira

    2017-12-01

    Full Text Available Despite of the role of domestic dogs as reservoirs for threatening viral diseases for wild carnivores, few studies have focused to identify circulation of viruses among dogs living in human/wildlife interfaces. To identify canine parvovirus (CPV types circulating in dogs living in an Atlantic forest biome, faecal samples (n = 100 were collected at the same period (one week corresponding to each of four areas, during 2014 to 2016 and corresponded to 100 different individuals. CPV was isolated in cell culture from 67 out 100 (67% samples from healthy dogs. Cytopathic effects were characterized by total or partial cell culture lysis. Genome sequences of CPV-2a (10%, CPV-2b (7% and CPV-2c (50% were concomitantly detected by PCR and nucleotide sequencing. The current study addresses the importance of monitoring CPV circulation among dogs presenting potential contact with wildlife species.

  10. Erythroid differentiation of fetal, newborn and adult haemopoietic stem cells

    International Nuclear Information System (INIS)

    Rencricca, N.J.; Howard, D.; Kubanek, B.; Stohlman, F.; Department of Biological Sciences, University of Lowell, Lowell, Massachusetts, USA)

    1976-01-01

    Erythroid regeneration was studied in lethally irradiated mice given transplants containing equivalent numbers of haemopoietic stem cells (i.e. CFU) from fetal liver, neonatal marrow or adult marrow. Adult marrow was taken from normal control mice, whose CFU for the most part were not in active cell cycle, as well as from phenylhydrazine-treated groups whose CFU were in similar state of proliferation (i.e. approximately 40-50% in DNA synthesis) as those derived from fetal liver and neonatal marrow. Splenic and femoral radioiron ( 59 Fe) incorporation were measured at intervals after transplantation and were found to begin earliest in mice given fetal liver, then in animals given neonatal marrow and latest in recipients of adult marrow. Peripheral reticulocytes showed a similar pattern of recovery. The data reported herein suggest that the differences in erythroid regeneration evoked by transplants of fetal liver, neonatal marrow or adult marrow, are not solely attributed to the degree of proliferation in the pluripotential stem cell compartment. These data may, however, suggest a shorter doubling time for cells comprising the fetal and newborn committed erythroid compartments. (author)

  11. Erythroid differentiation of fetal, newborn, and adult haemopoietic stem cells

    Energy Technology Data Exchange (ETDEWEB)

    Rencricca, N J; Howard, D; Kubanek, B; Stohlman, F [Boston Univ., Mass. (USA). School of Medicine; Department of Biological Sciences, University of Lowell, Lowell, Massachusetts, USA)

    1976-01-01

    Erythroid regeneration was studied in lethally irradiated mice given transplants containing equivalent numbers of haemopoietic stem cells (i.e. CFU) from fetal liver, neonatal marrow or adult marrow. Adult marrow was taken from normal control mice, whose CFU for the most part were not in active cell cycle, as well as from phenylhydrazine-treated groups whose CFU were in similar state of proliferation (i.e. approximately 40-50% in DNA synthesis) as those derived from fetal liver and neonatal marrow. Splenic and femoral radioiron (/sup 59/Fe) incorporation were measured at intervals after transplantation and were found to begin earliest in mice given fetal liver, then in animals given neonatal marrow and latest in recipients of adult marrow. Peripheral reticulocytes showed a similar pattern of recovery. The data reported herein suggest that the differences in erythroid regeneration evoked by transplants of fetal liver, neonatal marrow or adult marrow, are not solely attributed to the degree of proliferation in the pluripotential stem cell compartment. These data may, however, suggest a shorter doubling time for cells comprising the fetal and newborn committed erythroid compartments.

  12. MiR-27a Promotes Hemin-Induced Erythroid Differentiation of K562 Cells by Targeting CDC25B

    Directory of Open Access Journals (Sweden)

    Dongsheng Wang

    2018-03-01

    Full Text Available Background/Aims: MicroRNAs (miRNAs play a crucial role in erythropoiesis. MiR-23a∼27a∼24-2 clusters have been proven to take part in erythropoiesis via some proteins. CDC25B (cell division control Cdc2 phosphostase B is also the target of mir-27a; whether it regulates erythropoiesis and its mechanism are unknown. Methods: To evaluate the potential role of miR-27a during erythroid differentiation, we performed miR-27a gain- and loss-of-function experiments on hemin-induced K562 cells. We detected miR-27a expression after hemin stimulation at different time points. At the same time, the γ-globin gene also was measured via real-time PCR. According to the results of the chips, we screened the target protein of miR-27a through a dual-luciferase reporter assay and identified it via Western blot analyses. To evaluate the function of CDC25B, benzidine staining and flow cytometry were employed to detect the cell differentiation and cell cycle. Results: We found that miR-27a promotes hemin-induced erythroid differentiation of human K562 cells by targeting cell division cycle 25 B (CDC25B. Overexpression of miR-27a promotes the differentiation of hemin-induced K562 cells, as demonstrated by γ-globin overexpression. The inhibition of miR-27a expression suppresses erythroid differentiation, thus leading to a reduction in the γ-globin gene. CDC25B was identified as a new target of miR-27a during erythroid differentiation. Overexpression of miR-27a led to decreased CDC25B expression after hemin treatment, and CDC25B was up-regulated when miR-27a expression was inhibited. Moreover, the inhibition of CDC25B affected erythroid differentiation, as assessed by γ-globin expression. Conclusion: This study is the first report of the interaction between miR-27a and CDC25B, and it improves the understanding of miRNA functions during erythroid differentiation.

  13. Massive splenomegaly in acute erythroid leukaemia (FAB Class-M6): an unusual presentation.

    Science.gov (United States)

    Sherazi, Syed Furqan Haider; Butt, Zeeshan

    2012-09-01

    AML-M6 has a peak incidence in the seventh decade with slight male preponderance, and can also present at a younger age. The usual features are anaemia, thrombocytopenia, malaise, fatigue, easy bruising, epistaxis and petechiae. Splenomegaly may occur in 20-40 % of the cases but massive splenomegaly is rare presentation and have been only reported once in humans and once in animals. A 22 year Asian female, presented with fatigue, pallor, mild jaundice, exertional dyspnoea, epigastric pain, tender right hypochondrium and massive splenomegaly. Investigations revealed anaemia and thrombocytopenia, tear drop cells, basophilic stippling, piokilocytosis and anisochromia; increased uric acid and LDH. Abdominal ultrasound showed enlarged liver (22cm) and spleen (20cm). Bone marrow aspiration revealed 51% erythroid and 24% non-erythroid precursors, depressed leukopoeisis and megakarypoeisis. Erythroblasts were PAS and CD71 positive and also reacted to Antihaemoglobin-Antibody. This report highlights characteristic features and diagnostic criteria of erythroleukaemia, differential diagnosis of massive splenomegaly and their rare association.

  14. Serotype and genetic diversity of human rhinovirus strains that circulated in Kenya in 2008.

    Science.gov (United States)

    Milanoi, Sylvia; Ongus, Juliette R; Gachara, George; Coldren, Rodney; Bulimo, Wallace

    2016-05-01

    Human rhinoviruses (HRVs) are a well-established cause of the common cold and recent studies indicated that they may be associated with severe acute respiratory illnesses (SARIs) like pneumonia, asthma, and bronchiolitis. Despite global studies on the genetic diversity of the virus, the serotype diversity of these viruses across diverse geographic regions in Kenya has not been characterized. This study sought to characterize the serotype diversity of HRV strains that circulated in Kenya in 2008. A total of 517 archived nasopharyngeal samples collected in a previous respiratory virus surveillance program across Kenya in 2008 were selected. Participants enrolled were outpatients who presented with influenza-like (ILI) symptoms. Real-time RT-PCR was employed for preliminary HRV detection. HRV-positive samples were amplified using RT-PCR and thereafter the nucleotide sequences of the amplicons were determined followed by phylogenetic analysis. Twenty-five percent of the samples tested positive for HRV. Phylogenetic analysis revealed that the Kenyan HRVs clustered into three main species comprising HRV-A (54%), HRV-B (12%), and HRV-C (35%). Overall, 20 different serotypes were identified. Intrastrain sequence homology among the Kenyan strains ranged from 58% to 100% at the nucleotide level and 55% to 100% at the amino acid level. These results show that a wide range of HRV serotypes with different levels of nucleotide variation were present in Kenya. Furthermore, our data show that HRVs contributed substantially to influenza-like illness in Kenya in 2008. © 2016 The Authors. Influenza and Other Respiratory Viruses Published by John Wiley & Sons Ltd.

  15. Circulating levels of human salusin-β, a potent hemodynamic and atherogenesis regulator.

    Directory of Open Access Journals (Sweden)

    Kazumi Fujimoto

    Full Text Available Using bioinformatics analysis, we previously identified salusin-β, an endogenous bioactive peptide with diverse physiological activities. Salusin-β is abundantly expressed in the neuroendocrine system and in systemic endocrine cells/macrophages. Salusin-β acutely regulates hemodynamics and chronically induces atherosclerosis, but its unique physicochemical characteristics to tightly adhere to all types of plastic and glassware have prevented elucidation of its precise pathophysiological role. To quantitate plasma total salusin-β concentrations, we produced rabbit and chicken polyclonal antibodies against the C- and N-terminal end sequences, circumvented its sticky nature, and successfully established a sandwich enzyme-linked immunosorbent assay (ELISA. Salusin-β was abundantly present in the plasma of healthy volunteers, ranging from 1.9 to 6.6 nmol/L. Reverse phase-high performance liquid chromatography analysis showed that a single immunoreactive salusin-β peak coincided with synthetic authentic salusin-β. Plasma salusin-β concentrations were unaffected by postural changes and by potent vasopressin release stimuli, such as hypertonic saline infusion or smoking. However, salusin-β concentrations showed significant circadian variation; concentrations were high during the daytime and reached the lowest concentrations in the early morning. Plasma salusin-β levels in subjects with diabetes mellitus, coronary artery disease, and cerebrovascular disease showed distinctly higher levels than healthy controls. Patients with panhypopituitarism combined with complete central diabetes insipidus also showed significantly higher plasma salusin-β levels. Therefore, the ELISA system developed in this study will be useful for evaluating circulating total salusin-β levels and for confirming the presence of authentic salusin-β in human plasma. The obtained results suggest a limited contribution of the neuroendocrine system to peripheral total salusin

  16. Oxidative burst of circulating neutrophils following traumatic brain injury in human.

    Directory of Open Access Journals (Sweden)

    Yiliu Liao

    Full Text Available Besides secondary injury at the lesional site, Traumatic brain injury (TBI can cause a systemic inflammatory response, which may cause damage to initially unaffected organs and potentially further exacerbate the original injury. Here we investigated plasma levels of important inflammatory mediators, oxidative activity of circulating leukocytes, particularly focusing on neutrophils, from TBI subjects and control subjects with general trauma from 6 hours to 2 weeks following injury, comparing with values from uninjured subjects. We observed increased plasma level of inflammatory cytokines/molecules TNF-α, IL-6 and CRP, dramatically increased circulating leukocyte counts and elevated expression of TNF-α and iNOS in circulating leukocytes from TBI patients, which suggests a systemic inflammatory response following TBI. Our data further showed increased free radical production in leukocyte homogenates and elevated expression of key oxidative enzymes iNOS, COX-2 and NADPH oxidase (gp91(phox in circulating leukocytes, indicating an intense induction of oxidative burst following TBI, which is significantly greater than that in control subjects with general trauma. Furthermore, flow cytometry assay proved neutrophils as the largest population in circulation after TBI and showed significantly up-regulated oxidative activity and suppressed phagocytosis rate for circulating neutrophils following brain trauma. It suggests that the highly activated neutrophils might play an important role in the secondary damage, even outside the injured brain. Taken together, the potent systemic inflammatory response induced by TBI, especially the intensively increase oxidative activity of circulating leukocytes, mainly neutrophils, may lead to a systemic damage, dysfunction/damage of bystander tissues/organs and even further exacerbate secondary local damage. Controlling these pathophysiological processes may be a promising therapeutic strategy and will protect unaffected

  17. Circulating FGF21 in humans is potently induced by short term overfeeding of carbohydrates

    Directory of Open Access Journals (Sweden)

    Anne-Marie Lundsgaard

    2017-01-01

    Full Text Available Objective: Fibroblast-growth factor 21 (FGF21 is thought to be important in metabolic regulation. Recently, low protein diets have been shown to increase circulating FGF21 levels. However, when energy contribution from dietary protein is lowered, other macronutrients, such as carbohydrates, must be increased to meet eucaloric balance. This raises the possibility that intake of a diet rich in carbohydrates may induce an increase in plasma FGF21 levels per se. Here we studied the role of dietary carbohydrates on the levels of circulating FGF21 and concomitant physiologic effects by feeding healthy men a carbohydrate rich diet without reducing protein intake. Methods: A diet enriched in carbohydrates (80 E% carbohydrate; CHO and a eucaloric control diet (CON were provided to nine healthy men for three days. The energy intake during the CHO diet was increased (+75% energy to ensure similar dietary protein intake in CHO and CON. To control for the effect of caloric surplus, we similarly overfed (+75% energy the same subjects for three days with a fat-rich diet (78 E% fat; FAT, consisting of primarily unsaturated fatty acids. The three diets were provided in random order. Results: After CHO, plasma FGF21 concentration increased 8-fold compared to CON (329 ± 99 vs. 39 ± 9 pg ml−1, p < 0.05. In contrast, after FAT only a non-significant tendency (p = 0.073 to an increase in plasma FGF21 concentration was found. The increase in FGF21 concentration after CHO correlated closely (r = 0.88, p < 0.01 with increased leg glucose uptake (62%, p < 0.05 and increased hepatic glucose production (17%, p < 0.01, indicating increased glucose turnover. Plasma fatty acid (FA concentration was decreased by 68% (p < 0.01, supported by reduced subcutaneous adipose tissue HSL Ser660 phosphorylation (p < 0.01 and perilipin 1 protein content (p < 0.01, pointing to a suppression of adipose tissue lipolysis. Concomitantly, a 146% increase in the

  18. Nutraceutical augmentation of circulating endothelial progenitor cells and hematopoietic stem cells in human subjects.

    Science.gov (United States)

    Mikirova, Nina A; Jackson, James A; Hunninghake, Ron; Kenyon, Julian; Chan, Kyle W H; Swindlehurst, Cathy A; Minev, Boris; Patel, Amit N; Murphy, Michael P; Smith, Leonard; Ramos, Famela; Ichim, Thomas E; Riordan, Neil H

    2010-04-08

    The medical significance of circulating endothelial or hematopoietic progenitors is becoming increasing recognized. While therapeutic augmentation of circulating progenitor cells using G-CSF has resulted in promising preclinical and early clinical data for several degenerative conditions, this approach is limited by cost and inability to perform chronic administration. Stem-Kine is a food supplement that was previously reported to augment circulating EPC in a pilot study. Here we report a trial in 18 healthy volunteers administered Stem-Kine twice daily for a 2 week period. Significant increases in circulating CD133 and CD34 cells were observed at days 1, 2, 7, and 14 subsequent to initiation of administration, which correlated with increased hematopoietic progenitors as detected by the HALO assay. Augmentation of EPC numbers in circulation was detected by KDR-1/CD34 staining and colony forming assays. These data suggest Stem-Kine supplementation may be useful as a stimulator of reparative processes associated with mobilization of hematopoietic and endothelial progenitors.

  19. Nutraceutical augmentation of circulating endothelial progenitor cells and hematopoietic stem cells in human subjects

    Directory of Open Access Journals (Sweden)

    Minev Boris

    2010-04-01

    Full Text Available Abstract The medical significance of circulating endothelial or hematopoietic progenitors is becoming increasing recognized. While therapeutic augmentation of circulating progenitor cells using G-CSF has resulted in promising preclinical and early clinical data for several degenerative conditions, this approach is limited by cost and inability to perform chronic administration. Stem-Kine is a food supplement that was previously reported to augment circulating EPC in a pilot study. Here we report a trial in 18 healthy volunteers administered Stem-Kine twice daily for a 2 week period. Significant increases in circulating CD133 and CD34 cells were observed at days 1, 2, 7, and 14 subsequent to initiation of administration, which correlated with increased hematopoietic progenitors as detected by the HALO assay. Augmentation of EPC numbers in circulation was detected by KDR-1/CD34 staining and colony forming assays. These data suggest Stem-Kine supplementation may be useful as a stimulator of reparative processes associated with mobilization of hematopoietic and endothelial progenitors.

  20. Significant biochemical, biophysical and metabolic diversity in circulating human cord blood reticulocytes.

    Directory of Open Access Journals (Sweden)

    Benoît Malleret

    Full Text Available The transition from enucleated reticulocytes to mature normocytes is marked by substantial remodeling of the erythrocytic cytoplasm and membrane. Despite conspicuous changes, most studies describe the maturing reticulocyte as a homogenous erythropoietic cell type. While reticulocyte staging based on fluorescent RNA stains such as thiazole orange have been useful in a clinical setting; these 'sub-vital' stains may confound delicate studies on reticulocyte biology and may preclude their use in heamoparasite invasion studies.Here we use highly purified populations of reticulocytes isolated from cord blood, sorted by flow cytometry into four sequential subpopulations based on transferrin receptor (CD71 expression: CD71high, CD71medium, CD71low and CD71negative. Each of these subgroups was phenotyped in terms of their, morphology, membrane antigens, biomechanical properties and metabolomic profile.Superficially CD71high and CD71medium reticulocytes share a similar gross morphology (large and multilobular when compared to the smaller, smooth and increasingly concave reticulocytes as seen in the in the CD71low and CD71negativesamples. However, between each of the four sample sets we observe significant decreases in shear modulus, cytoadhesive capacity, erythroid receptor expression (CD44, CD55, CD147, CD235R, and CD242 and metabolite concentrations. Interestingly increasing amounts of boric acid was found in the mature reticulocytes.Reticulocyte maturation is a dynamic and continuous process, confounding efforts to rigidly classify them. Certainly this study does not offer an alternative classification strategy; instead we used a nondestructive sampling method to examine key phenotypic changes of in reticulocytes. Our study emphasizes a need to focus greater attention on reticulocyte biology.

  1. Increased platelet reactivity is associated with circulating platelet-monocyte complexes and macrophages in human atherosclerotic plaques.

    Directory of Open Access Journals (Sweden)

    Bert Rutten

    Full Text Available Platelet reactivity, platelet binding to monocytes and monocyte infiltration play a detrimental role in atherosclerotic plaque progression. We investigated whether platelet reactivity was associated with levels of circulating platelet-monocyte complexes (PMCs and macrophages in human atherosclerotic carotid plaques.Platelet reactivity was determined by measuring platelet P-selectin expression after platelet stimulation with increasing concentrations of adenosine diphosphate (ADP, in two independent cohorts: the Circulating Cells cohort (n = 244 and the Athero-Express cohort (n = 91. Levels of PMCs were assessed by flow cytometry in blood samples of patients who were scheduled for percutaneous coronary intervention (Circulating Cells cohort. Monocyte infiltration was semi-quantitatively determined by histological examination of atherosclerotic carotid plaques collected during carotid endarterectomy (Athero-Express cohort.We found increased platelet reactivity in patients with high PMCs as compared to patients with low PMCs (median (interquartile range: 4153 (1585-11267 area under the curve (AUC vs. 9633 (3580-21565 AUC, P<0.001. Also, we observed increased platelet reactivity in patients with high macrophage levels in atherosclerotic plaques as compared to patients with low macrophage levels in atherosclerotic plaques (mean ± SD; 8969 ± 3485 AUC vs. 7020 ± 3442 AUC, P = 0.02. All associations remained significant after adjustment for age, sex and use of drugs against platelet activation.Platelet reactivity towards ADP is associated with levels of PMCs and macrophages in human atherosclerotic carotid plaques.

  2. Hypoxia compounds exercise-induced free radical formation in humans; partitioning contributions from the cerebral and femoral circulation

    DEFF Research Database (Denmark)

    Bailey, Damian M; Rasmussen, Peter; Evans, Kevin A

    2018-01-01

    This study examined to what extent the human cerebral and femoral circulation contribute to free radical formation during basal and exercise-induced responses to hypoxia. Healthy participants (5♂, 5♀) were randomly assigned single-blinded to normoxic (21% O2) and hypoxic (10% O2) trials...... hypoxia (P free radical-mediated lipid peroxidation subsequent to inadequate antioxidant defense. This was pronounced during exercise across the femoral circulation in proportion to the increase in local O2 uptake (r = -0.397 to -0.459, P = 0.037 to 0...... with measurements taken at rest and 30min after cycling at 70% of maximal power output in hypoxia and equivalent relative and absolute intensities in normoxia. Blood was sampled from the brachial artery (a), internal jugular and femoral veins (v) for non-enzymatic antioxidants (HPLC), ascorbate radical (A...

  3. Profiling of circulating microRNAs after a bout of acute resistance exercise in humans.

    Directory of Open Access Journals (Sweden)

    Shuji Sawada

    Full Text Available Recent studies have revealed a new aspect of physiological regulation in which microRNAs (miRNAs play fundamental roles in diverse biological and pathological processes. Furthermore, it was recently discovered that miRNAs are stably secreted into blood and that circulating miRNAs may play important roles in cell-cell communication. Here, we examined whether the circulating miRNA profile is affected by acute resistance exercise. Twelve males performed a resistance exercise session (bench press and leg press, consisting of five sets of 10 repetitions at 70% of maximum strength, with a 1 min rest between sets. Blood samples were taken before exercise, and at 0 and 60 min, 1 day, and 3 days after exercise. The circulating miRNA profile was determined by microarray analysis. Quantitative real-time PCR confirmed that the miR-149* level increased three days after resistance exercise. In contrast, the miR-146a and miR-221 levels decreased three days after resistance exercise. Our findings suggest that circulating miRNA levels change in response to acute resistance exercise, and miRNAs may play important roles in resistance-exercise-induced adaptation.

  4. The effect of ceruloplasmin on erythroid precursor cells in the marrow of irradiated mice

    International Nuclear Information System (INIS)

    Suda, Toshio; Miura, Yasusada; Ozawa, Keiya; Yamada, Masaaki.

    1981-01-01

    The effect of ceruloplasmine on erythroid colony forming unit (CFU-e) of irradiated mice was investigated. Whole body #betta# ray irradiation of 100rad decreased the number of CFU-e from 154 to 40 per 4 * 10 4 myeloid nucleated cells. When human #betta#-globulin of 1 mg/kg or ceruloplasmin of 1 mg/kg was administrated immediately after irradiation, the number of CFU-e increased to that of more than normal and normal value in 2 days, respectively. In the case where ceruloplasmin was begun to administrated 7 days before irradiation, though the CFU-e number decreased from 144 to 44, the number increased to 317 after 2 days, and gradually decreased to the normal value by 16 days after irradiation. (Nakanishi, T)

  5. Bmi-1 Regulates Extensive Erythroid Self-Renewal

    Directory of Open Access Journals (Sweden)

    Ah Ram Kim

    2015-06-01

    Full Text Available Red blood cells (RBCs, responsible for oxygen delivery and carbon dioxide exchange, are essential for our well-being. Alternative RBC sources are needed to meet the increased demand for RBC transfusions projected to occur as our population ages. We previously have discovered that erythroblasts derived from the early mouse embryo can self-renew extensively ex vivo for many months. To better understand the mechanisms regulating extensive erythroid self-renewal, global gene expression data sets from self-renewing and differentiating erythroblasts were analyzed and revealed the differential expression of Bmi-1. Bmi-1 overexpression conferred extensive self-renewal capacity upon adult bone-marrow-derived self-renewing erythroblasts, which normally have limited proliferative potential. Importantly, Bmi-1 transduction did not interfere with the ability of extensively self-renewing erythroblasts (ESREs to terminally mature either in vitro or in vivo. Bmi-1-induced ESREs can serve to generate in vitro models of erythroid-intrinsic disorders and ultimately may serve as a source of cultured RBCs for transfusion therapy.

  6. The susceptibility of circulating human influenza viruses to tizoxanide, the active metabolite of nitazoxanide.

    Science.gov (United States)

    Tilmanis, Danielle; van Baalen, Carel; Oh, Ding Yuan; Rossignol, Jean-Francois; Hurt, Aeron C

    2017-11-01

    Nitazoxanide is a thiazolide compound that was originally developed as an anti-parasitic agent, but has recently been repurposed for the treatment of influenza virus infections. Thought to exert its anti-influenza activity via the inhibition of hemagglutinin maturation and intracellular trafficking in infected cells, the effectiveness of nitazoxanide in treating patients with non-complicated influenza is currently being assessed in phase III clinical trials. Here, we describe the susceptibility of 210 seasonal influenza viruses to tizoxanide, the active circulating metabolite of nitazoxanide. An optimised cell culture-based focus reduction assay was used to determine the susceptibility of A(H1N1)pdm09, A(H3N2), and influenza B viruses circulating in the southern hemisphere from the period March 2014 to August 2016. Tizoxanide showed potent in vitro antiviral activity against all influenza viruses tested, including neuraminidase inhibitor-resistant viruses, allowing the establishment of a baseline level of susceptibility for each subtype. Median EC 50 values (±IQR) of 0.48 μM (0.33-0.71), 0.62 μM (0.56-0.75), 0.66 μM (0.62-0.69), and 0.60 μM (0.51-0.67) were obtained for A(H1N1)pdm09, A(H3N2), B(Victoria lineage), and B(Yamagata lineage) influenza viruses respectively. There was no significant difference in the median baseline tizoxanide susceptibility for each influenza subtype tested. This is the first report on the susceptibility of circulating viruses to tizoxanide. The focus reduction assay format described is sensitive, robust, and less laborious than traditional cell based antiviral assays, making it highly suitable for the surveillance of tizoxanide susceptibility in circulating seasonal influenza viruses. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  7. Circulating Inflammatory Mediators as Potential Prognostic Markers of Human Colorectal Cancer.

    Directory of Open Access Journals (Sweden)

    Giuseppe Di Caro

    Full Text Available Cytokines and chemokines in the tumor microenvironment drive metastatic development and their serum levels might mirror the ongoing inflammatory reaction at the tumor site. Novel highly sensitive tools are needed to identify colorectal cancer patients at high risk of recurrence that should be more closely monitored during post-surgical follow up. Here we study whether circulating inflammatory markers might be used to predict recurrence in CRC patients.Circulating levels of the inflammatory cytokines IL-1, IL-6, IL-10, TNFalpha, CCL2, CXCL8, VEGF and the acute phase protein Pentraxin-3 were measured by ELISA in preoperative serum samples prospectively collected from a cohort of sixty-nine patients undergoing surgical resection for stage 0-IV CRC and associated with post-operative disease recurrence.Cox multivariate analysis showed that combined high levels (≥ROC cut off-value of CXCL8, VEGF and Pentraxin3 were associated with increased risk of disease recurrence [HR: 14.28; 95%CI: (3.13-65.1] independently of TNM staging. Kaplan-Meier analysis showed that CXCL8, VEGF and Pentraxin3 levels were significantly associated with worse survival (P<0.001.Circulating inflammatory mediators efficiently predicted postoperative recurrence after CRC surgery. Therefore, this study suggest that their validation in large-scale clinical trials may help in tailoring CRC post-surgical management.

  8. Expression of assayable residual stem cell damage in erythroid differentiation

    International Nuclear Information System (INIS)

    Huebner, G.E.; Miller, M.E.; Cronkite, E.P.

    1985-01-01

    In rodents, residual damage is inducible in hematopoietic stem cells by exposure to ionizing radiation or alkylating agents. This damage can b e assayed in mice by transferring bone marrow into lethally irradiated syngeneic recipients and subsequently measuring the incremental increase of-( 125 I)iodo-2'-deoxyuridine incorporation in spleens. In this study, bone marrow from mice treated 3 weeks previously with Methylnitrosourea (50 mg/kg) or 450 rad was injected into recipients in order to determine possible residual effects of treatment of erythroid cell differentiation following stem cell seeding. Such effects were detected by a reduced amount of 59 Fe incorporation into spleens, thus indicatin g transfer of residual stem cell damage to differentiating cells. (orig.)

  9. Reduction of erythroid progenitors in protein-energy malnutrition.

    Science.gov (United States)

    Borelli, Primavera; Blatt, Solange; Pereira, Juliana; de Maurino, Beatriz Beutler; Tsujita, Maristela; de Souza, Ana Cristina; Xavier, José Guilherme; Fock, Ricardo Ambrósio

    2007-02-01

    Protein-energy malnutrition is a syndrome in which anaemia together with multivitamin and mineral deficiency may be present. The pathophysiological mechanisms involved have not, however, yet been completely elucidated. The aim of the present study was to evaluate the pathophysiological processes that occur in this anaemia in animals that were submitted to protein-energy malnutrition, in particular with respect to Fe concentration and the proliferative activity of haemopoietic cells. For this, histological, histochemical, cell culture and immunophenotyping techniques were used. Two-month-old male Swiss mice were submitted to protein-energy malnutrition with a low-protein diet (20 g/kg) compared with control diet (400 g/kg). When the experimental group had attained a 20 % loss of their original body weight, the animals from both groups received, intravenously, 20 IU erythropoietin every other day for 14 d. Malnourished animals showed a decrease in red blood cells, Hb concentration and reticulocytopenia, as well as severe bone marrow and splenic atrophy. The results for serum Fe, total Fe-binding capacity, transferrin and erythropoietin in malnourished animals were no different from those of the control animals. Fe reserves in the spleen, liver and bone marrow were found to be greater in the malnourished animals. The mixed colony-forming unit assays revealed a smaller production of granulocyte-macrophage colony-forming units, erythroid burst-forming units, erythroid colony-forming units and CD45, CD117, CD119 and CD71 expression in the bone marrow and spleen cells of malnourished animals. These findings suggest that, in this protein-energy malnutrition model, anaemia is not caused by Fe deficiency or erythropoietin deficiency, but is a result of ineffective erythropoiesis.

  10. Detection of human collateral circulation by vasodilation-thallium-201 tomography

    International Nuclear Information System (INIS)

    Nienaber, C.A.; Salge, D.; Spielmann, R.P.; Montz, R.; Bleifeld, W.

    1990-01-01

    Coronary arteriolar vasodilation may provoke redistribution of flow to collateral-dependent jeopardized myocardium. To assess the physiologic significance of collaterals, 80 consecutive post-infarction patients (age 58 +/- 8 years) underwent vasodilation-redistribution thallium-201 tomographic imaging after administration of 0.56 mg of intravenous dipyridamole/kg body weight. Circumferential profile analysis of thallium-201 uptake and redistribution in representative left ventricular tomograms provided quantitative assessment of transient and fixed defects and separation between periinfarctional and distant inducible hypoperfusion. Tomographic perfusion data were correlated to wall motion and collateral circulation between distinct anatomic perfusion territories. Patients were grouped according to presence (59%) or absence (41%) of angiographically visible collateral channels to jeopardized myocardium. In the presence of collaterals, distant reversible defects were larger than in absence of collaterals (p less than 0.05); the extent of combined periinfarctional and distant redistribution was also larger in collateralized patients (p less than 0.025), whereas the size of the persistent perfusion defect was similar in both groups. By prospective analysis the tomographic perfusion pattern of combined periinfarctional and distant redistribution revealed a sensitivity of 85% and a specificity of 78% for the detection of significant collateral circulation in this group of patients. Thus, using the exhausted flow reserve as a diagnostic tool, vasodilation-thallium-201 tomography has the potential to identify and quantitate collateralized myocardium in post-infarction patients and may guide diagnostic and therapeutic decision-making

  11. Heritability of circulating growth factors involved in the angiogenesis in healthy human population.

    Science.gov (United States)

    Pantsulaia, I; Trofimov, S; Kobyliansky, E; Livshits, G

    2004-09-21

    The present study examined the extent of genetic and environmental influences on the populational variation of circulating growth factors (VEGF, EGF) involved in angiogenesis in healthy and ethnically homogeneous Caucasian families. The plasma levels of each of the studied biochemical indices were determined by enzyme-linked immunoassay in 478 healthy individuals aged 18-75 years. Quantitative genetic analysis showed that the VEGF and EGF variation was appreciably attributable to genetic effects, with heritability estimates of 79.9% and 48.4%, respectively. Yet, common environmental factors, shared by members of the same household, also played a significant role (P growth factor-beta 1 (TGF-beta 1) or tissue inhibitors of matrix metalloproteinases 1 (TIMP-1), likewise relevant for angiogenesis. Bivariate analysis revealed significant phenotypic correlations (P < 0.002) between all pairs of variables, thus indicating the possible existence of common genetic and environmental factors. The analysis suggested that the pleiotropic genetic effects were consistently the primary (or even the sole) source of correlation between all pairs of studied molecules. The results of our study affirm the existence of specific and common genetic pathways that commonly determine the greater part of the circulating variation of these molecules.

  12. Circulating levels of chromatin fragments are inversely correlated with anti-dsDNA antibody levels in human and murine systemic lupus erythematosus

    DEFF Research Database (Denmark)

    Jørgensen, Mariann H; Rekvig, Ole Petter; Jacobsen, Rasmus S

    2011-01-01

    Anti-dsDNA antibodies represent a central pathogenic factor in Lupus nephritis. Together with nucleosomes they deposit as immune complexes in the mesangial matrix and along basement membranes within the glomeruli. The origin of the nucleosomes and when they appear e.g. in circulation is not known...... an inverse correlation between anti-dsDNA antibodies and the DNA concentration in the circulation in both murine and human serum samples. High titer of anti-DNA antibodies in human sera correlated with reduced levels of circulating chromatin, and in lupus prone mice with deposition within glomeruli....... The inverse correlation between DNA concentration and anti-dsDNA antibodies may reflect antibody-dependent deposition of immune complexes during the development of lupus nephritis in autoimmune lupus prone mice. The measurement of circulating DNA in SLE sera by using qPCR may indicate and detect...

  13. Erythroblastic Sarcoma Presenting as Bilateral Ovarian Masses in an Infant with Pure Erythroid Leukemia

    Science.gov (United States)

    Wang, Huan-You; Huang, Lily Jun-shen; Garcia, Rolando; Li, Shiyong; Galliani, Carlos A.

    2010-01-01

    Pure erythroid leukemia is a rare subtype of acute erythroid leukemia that is characterized by a predominant erythroid population, and erythroblastic sarcoma has not yet been described in the English literature. Here we report a first case of erythroblastic sarcoma which presented as bilateral ovarian masses in a three and half month old baby girl with pure erythroid leukemia. Bone marrow aspirate and biopsy showed the marrow was completely replaced by large-sized blasts consistent with erythroblasts. Immunophenotypically, both the tumor cells from the ovarian mass and bone marrow blasts were positive for CD117, glycophorin A, and hemoglobin A, demonstrating erythroid differentiation. Reverse transcriptase polymerase chain reaction showed the tumor cells from ovarian mass expressed hemoglobin F and α1 spectrin, confirming their erythroid lineage. Conventional karyotype of the bone marrow aspirates revealed del(6) (q23q25) and trisomy 7 in all 21 cells examined. Fluorescence in situ hybridization of the ovarian mass demonstrated loss of C-MYB at 6q23 locus in 41% of the cells, and deletion of chromosome 7 and 7q in 37% and 66% of cells, respectively. Taken together, we showed, for the first time, that pure erythroid leukemia presented as a myeloid sarcoma in the form of ovarian masses. PMID:21237494

  14. Immunodetection of Fasciola gigantica Circulating Antigen in Sera of Infected Individuals for Laboratory Diagnosis of Human Fascioliasis

    Science.gov (United States)

    Attallah, Abdelfattah M.; Bughdadi, Faisal A.; El-Shazly, Atef M.

    2013-01-01

    Currently, the laboratory diagnosis of human fascioliasis is based on the parasitological examination of parasite eggs in stool specimens and serological detection of specific antibodies in serum samples, which are often unreliable diagnostic approaches. Ideally, a sensitive and specific diagnostic test for Fasciola infection should be based on the detection of circulating Fasciola antigen, which implies active infection. Here, a 27-kDa-molecular-mass antigen was identified in a Fasciola gigantica adult worm antigen preparation, excretory-secretory products, and sera from F. gigantica-infected individuals, and it was not detected in antigenic extracts of other parasites and sera from noninfected individuals. The target antigen was isolated and partially characterized as a protein. Immunoperoxidase staining located the target epitope within teguments and guts of F. gigantica adult worms. The performance characteristics of a newly developed enzyme-linked immunosorbent assay (ELISA) based on F. gigantica circulating antigen detection in serum (FgCA-27 ELISA) were investigated using sera of 120 parasitologically diagnosed F. gigantica-infected individuals and 80 noninfected individuals. The area under the receiving operating characteristic (ROC) curve (AUC) for ELISA was significantly high (AUC = 0.961, P 93%), and a significant correlation (r = 0.715, P fascioliasis. PMID:23945158

  15. Immunodetection of Fasciola gigantica circulating antigen in sera of infected individuals for laboratory diagnosis of human fascioliasis.

    Science.gov (United States)

    Attallah, Abdelfattah M; Bughdadi, Faisal A; El-Shazly, Atef M; Ismail, Hisham

    2013-10-01

    Currently, the laboratory diagnosis of human fascioliasis is based on the parasitological examination of parasite eggs in stool specimens and serological detection of specific antibodies in serum samples, which are often unreliable diagnostic approaches. Ideally, a sensitive and specific diagnostic test for Fasciola infection should be based on the detection of circulating Fasciola antigen, which implies active infection. Here, a 27-kDa-molecular-mass antigen was identified in a Fasciola gigantica adult worm antigen preparation, excretory-secretory products, and sera from F. gigantica-infected individuals, and it was not detected in antigenic extracts of other parasites and sera from noninfected individuals. The target antigen was isolated and partially characterized as a protein. Immunoperoxidase staining located the target epitope within teguments and guts of F. gigantica adult worms. The performance characteristics of a newly developed enzyme-linked immunosorbent assay (ELISA) based on F. gigantica circulating antigen detection in serum (FgCA-27 ELISA) were investigated using sera of 120 parasitologically diagnosed F. gigantica-infected individuals and 80 noninfected individuals. The area under the receiving operating characteristic (ROC) curve (AUC) for ELISA was significantly high (AUC = 0.961, P 93%), and a significant correlation (r = 0.715, P fascioliasis.

  16. Human Circulating Antibody-Producing B Cell as a Predictive Measure of Mucosal Immunity to Poliovirus.

    Science.gov (United States)

    Dey, Ayan; Molodecky, Natalie A; Verma, Harish; Sharma, Prashant; Yang, Jae Seung; Saletti, Giulietta; Ahmad, Mohammad; Bahl, Sunil K; Wierzba, Thomas F; Nandy, Ranjan K; Deshpande, Jagadish M; Sutter, Roland W; Czerkinsky, Cecil

    2016-01-01

    The "gold standard" for assessing mucosal immunity after vaccination with poliovirus vaccines consists in measuring virus excretion in stool after challenge with oral poliovirus vaccine (OPV). This testing is time and resource intensive, and development of alternative methods is a priority for accelerating polio eradication. We therefore evaluated circulating antibody-secreting cells (ASCs) as a potential means to evaluate mucosal immunity to poliovirus vaccine. 199 subjects, aged 10 years, and previously immunized repeatedly with OPV, were selected. Subjects were assigned to receive either a booster dose of inactivated poliovirus vaccine (IPV), bivalent OPV (bOPV), or no vaccine. Using a micro-modified whole blood-based ELISPOT assay designed for field setting, circulating poliovirus type-specific IgA- and IgG-ASCs, including gut homing α4β7+ ASCs, were enumerated on days 0 and 7 after booster immunization. In addition, serum samples collected on days 0, 28 and 56 were tested for neutralizing antibody titers against poliovirus types 1, 2, and 3. Stool specimens were collected on day 28 (day of bOPV challenge), and on days 31, 35 and 42 and processed for poliovirus isolation. An IPV dose elicited blood IgA- and IgG-ASC responses in 84.8 to 94.9% of subjects, respectively. In comparison, a bOPV dose evoked corresponding blood ASC responses in 20.0 to 48.6% of subjects. A significant association was found between IgA- and IgG-ASC responses and serum neutralizing antibody titers for poliovirus type 1, 2, 3 (ppoliovirus types 1, 2 and 3 was 62.7%, 89.8% and 45.8%, respectively. A significant association was observed between virus excretion and α4β7+ IgA- and/or IgG-ASC responses to poliovirus type 3 among immunized children; however, only a weak association was found for type 1 poliovirus. Our results suggest that virus-specific blood ASCs, especially for type 3 poliovirus, can serve as surrogate of mucosal immunity after vaccination. Further studies are needed to

  17. Incidence of Micronuclei inversly relates with apoptosis in human circulating lymphocytes

    International Nuclear Information System (INIS)

    Jocksic, G.; Djurovic, B.; Petrovic, S.

    2004-01-01

    In this study relationship between chromosome aberrations, micronuclei, radiosensitivity and apoptosis of circulating lymphocytes of radiation workers was evaluated. Exposed group comprises 34 individuals, radiology sts, of mean age 43,35±6.02; with 14.9±5.2 years of occupational exposition to ionizing radiation. In 10 out of 34 exchange aberrations were found (dicentrics and ring chromosomes). According to chromosomal findings exposed groups was divided on two subgroups:>> dicentric positive >dicentric negative > dicentric positive >dicentric >dicentric >dicentric >dicentric >dicentric<< negative respectively. Baseline micronuclei correlates negatively with apoptosis in both exposed groups (r=0.55m p<0.45) suggesting that chronical exposure to low doses of ionizing radiation disturb the balance between pro apoptotic and anti apoptotic signals in cells. Results of our study have shown that effects of radiation-induced cytotoxicity could be characterised employing flow cytometry as precise method for measuring degradation of internucleosaomal DNA. Inversly relationship between baseline micronuclei and percent of lymphocytes undergoing apoptosis is the most important finding in this study, suggesting that assay can discriminate differences in radiation-induced cytotoxicity between individuals occupationally exposed to low doses of ionising radiation. (Author)

  18. A systematic review of genetic diversity of human rotavirus circulating in South Korea.

    Science.gov (United States)

    Than, Van Thai; Jeong, Sunyoung; Kim, Wonyong

    2014-12-01

    Rotavirus infections continue to be the leading cause of severe diarrhea in young Korean children. Rotavirus data acquired from uninterrupted surveillance studies between 1989 and 2009 in South Korea were analyzed to better understand the genetic diversity and evolution. The relationship between rotaviruses and the currently licensed rotavirus vaccine viruses was also examined. The most prevalent rotavirus strains, with genotype G1P[8], followed by G3P[8], G4P[6], and G2P[4], accounted for approximately 76.7% of the total identified strains, and more recently, rotavirus G9P[8] has significance increased to be the fifth most common genotype. Phylogenetic analyses underscored the heterogeneity between viral populations within each genotype, with different lineages and sub-lineages. Although the currently licensed rotavirus vaccines are effective, safe, and economical, additional data from rotavirus monitoring is necessary to evaluate the efficacy of these vaccines for their sustained use in South Korea. The present study provides comprehensive and up-to-date information regarding the epidemiology, genetic diversity, and evolution of the circulating rotaviruses in South Korea. Crown Copyright © 2014. Published by Elsevier B.V. All rights reserved.

  19. Functional Evolution of Influenza Virus NS1 Protein in Currently Circulating Human 2009 Pandemic H1N1 Viruses.

    Science.gov (United States)

    Clark, Amelia M; Nogales, Aitor; Martinez-Sobrido, Luis; Topham, David J; DeDiego, Marta L

    2017-09-01

    In 2009, a novel H1N1 influenza virus emerged in humans, causing a global pandemic. It was previously shown that the NS1 protein from this human 2009 pandemic H1N1 (pH1N1) virus was an effective interferon (IFN) antagonist but could not inhibit general host gene expression, unlike other NS1 proteins from seasonal human H1N1 and H3N2 viruses. Here we show that the NS1 protein from currently circulating pH1N1 viruses has evolved to encode 6 amino acid changes (E55K, L90I, I123V, E125D, K131E, and N205S) with respect to the original protein. Notably, these 6 residue changes restore the ability of pH1N1 NS1 to inhibit general host gene expression, mainly by their ability to restore binding to the cellular factor CPSF30. This is the first report describing the ability of the pH1N1 NS1 protein to naturally acquire mutations that restore this function. Importantly, a recombinant pH1N1 virus containing these 6 amino acid changes in the NS1 protein (pH1N1/NSs-6mut) inhibited host IFN and proinflammatory responses to a greater extent than that with the parental virus (pH1N1/NS1-wt), yet virus titers were not significantly increased in cell cultures or in mouse lungs, and the disease was partially attenuated. The pH1N1/NSs-6mut virus grew similarly to pH1N1/NSs-wt in mouse lungs, but infection with pH1N1/NSs-6mut induced lower levels of proinflammatory cytokines, likely due to a general inhibition of gene expression mediated by the mutated NS1 protein. This lower level of inflammation induced by the pH1N1/NSs-6mut virus likely accounts for the attenuated disease phenotype and may represent a host-virus adaptation affecting influenza virus pathogenesis. IMPORTANCE Seasonal influenza A viruses (IAVs) are among the most common causes of respiratory infections in humans. In addition, occasional pandemics are caused when IAVs circulating in other species emerge in the human population. In 2009, a swine-origin H1N1 IAV (pH1N1) was transmitted to humans, infecting people then and up

  20. Activated Fps/Fes tyrosine kinase regulates erythroid differentiation and survival.

    Science.gov (United States)

    Sangrar, Waheed; Gao, Yan; Bates, Barbara; Zirngibl, Ralph; Greer, Peter A

    2004-10-01

    A substantial body of evidence implicates the cytoplasmic protein tyrosine kinase Fps/Fes in regulation of myeloid differentiation and survival. In this study we wished to determine if Fps/Fes also plays a role in the regulation of erythropoiesis. Mice tissue-specifically expressing a "gain-of-function" mutant fps/fes transgene (fps(MF)) encoding an activated variant of Fps/Fes (MFps), were used to explore the in vivo biological role of Fps/Fes. Erythropoiesis in these mice was assessed by hematological analysis, lineage marker analysis, bone-marrow colony assays, and biochemical approaches. fps(MF) mice displayed reductions in peripheral red cell counts. However, there was an accumulation of immature erythroid precursors, which displayed increased survival. Fps/Fes and the related Fer kinase were both detected in early erythroid progenitors/blasts and in mature red cells. Fps/Fes was also activated in response to erythropoietin (EPO) and stem cell factor (SCF), two critical factors in erythroid development. In addition, increased Stat5A/B activation and reduced Erk1/2 phosphorylation was observed in fps(MF) primary erythroid cells in response to EPO or SCF, respectively. These data support a role for Fps/Fes in regulating the survival and differentiation of erythroid cells through modulation of Stat5A/B and Erk kinase pathways induced by EPO and SCF. The increased numbers and survival of erythroid progenitors from fps(MF) mice, and their differential responsiveness to SCF and EPO, implicates Fps/Fes in the commitment of multilineage progenitors to the erythroid lineage. The anemic phenotype in fps(MF) mice suggests that downregulation of Fps/Fes activity might be required for terminal erythroid differentiation.

  1. Nuclear RNA sequencing of the mouse erythroid cell transcriptome.

    Directory of Open Access Journals (Sweden)

    Jennifer A Mitchell

    Full Text Available In addition to protein coding genes a substantial proportion of mammalian genomes are transcribed. However, most transcriptome studies investigate steady-state mRNA levels, ignoring a considerable fraction of the transcribed genome. In addition, steady-state mRNA levels are influenced by both transcriptional and posttranscriptional mechanisms, and thus do not provide a clear picture of transcriptional output. Here, using deep sequencing of nuclear RNAs (nucRNA-Seq in parallel with chromatin immunoprecipitation sequencing (ChIP-Seq of active RNA polymerase II, we compared the nuclear transcriptome of mouse anemic spleen erythroid cells with polymerase occupancy on a genome-wide scale. We demonstrate that unspliced transcripts quantified by nucRNA-seq correlate with primary transcript frequencies measured by RNA FISH, but differ from steady-state mRNA levels measured by poly(A-enriched RNA-seq. Highly expressed protein coding genes showed good correlation between RNAPII occupancy and transcriptional output; however, genome-wide we observed a poor correlation between transcriptional output and RNAPII association. This poor correlation is due to intergenic regions associated with RNAPII which correspond with transcription factor bound regulatory regions and a group of stable, nuclear-retained long non-coding transcripts. In conclusion, sequencing the nuclear transcriptome provides an opportunity to investigate the transcriptional landscape in a given cell type through quantification of unspliced primary transcripts and the identification of nuclear-retained long non-coding RNAs.

  2. Possible interaction between B1 retrotransposon-containing sequences and β(major) globin gene transcriptional activation during MEL cell erythroid differentiation.

    Science.gov (United States)

    Vizirianakis, Ioannis S; Tezias, Sotirios S; Amanatiadou, Elsa P; Tsiftsoglou, Asterios S

    2012-01-01

    Repetitive sequences consist of >50% of mammalian genomic DNAs and among these SINEs (short interspersed nuclear elements), e.g. B1 elements, account for 8% of the mouse genome. In an effort to delineate the molecular mechanism(s) involved in the blockade of the in vitro differentiation program of MEL (murine erythroleukaemia) cells by treatment with methylation inhibitors, we detected a DNA region of 559 bp in chromosome 7 located downstream of the 3'-end of the β(major) globin gene (designated B1-559) with unique characteristics. We have fully characterized this B1-559 region that includes a B1 element, several repeats of ATG initiation codons and consensus DNA-binding sites for erythroid-specific transcription factors NF-E2 (nuclear factor-erythroid-derived 2), GATA-1 and EKLF (erythroid Krüppel-like factor). Fragments derived from B1-559 incubated with nuclear extracts form protein complexes in both undifferentiated and differentiated MEL cells. Transient reporter-gene experiments in MEL and human erythroleukaemia K-562 cells with recombinant constructs containing B1-559 fragments linked to HS-2 (hypersensitive site-2) sequences of human β-globin gene LCR (locus control region) indicated potential cooperation upon erythropoiesis and globin gene expression. The possible interaction between the B1-559 region and β(major) globin gene transcriptional activation upon execution of erythroid MEL cell differentiation programme is discussed. © The Author(s) Journal compilation © 2012 Portland Press Limited

  3. Beyond the VAD: Human Factors Engineering for Mechanically Assisted Circulation in the 21st Century.

    Science.gov (United States)

    Throckmorton, Amy L; Patel-Raman, Sonna M; Fox, Carson S; Bass, Ellen J

    2016-06-01

    Thousands of ventricular assist devices (VADs) currently provide circulatory support to patients worldwide, and dozens of heart pump designs for adults and pediatric patients are under various stages of development in preparation for translation to clinical use. The successful bench-to-bedside development of a VAD involves a structured evaluation of possible system states, including human interaction with the device and auxiliary component usage in the hospital or home environment. In this study, we review the literature and present the current landscape of preclinical design and assessment, decision support tools and procedures, and patient-centered therapy. Gaps of knowledge are identified. The study findings support the need for more attention to user-centered design approaches for medical devices, such as mechanical circulatory assist systems, that specifically involve detailed qualitative and quantitative assessments of human-device interaction to mitigate risk and failure. Copyright © 2015 International Center for Artificial Organs and Transplantation and Wiley Periodicals, Inc.

  4. Influenza A Virus with a Human-Like N2 Gene Is Circulating in Pigs

    DEFF Research Database (Denmark)

    Breum, Solvej Østergaard; Hjulsager, Charlotte Kristiane; Trebbien, Ramona

    2013-01-01

    A novel reassortant influenza A virus, H1avN2hu, has been found in Danish swine. The virus contains an H1 gene similar to the hemagglutinin (HA) gene of H1N1 avian-like swine viruses and an N2 gene most closely related to the neuraminidase (NA) gene of human H3N2 viruses from the mid-1990s....

  5. Erythroid Kruppel-like factor (EKLF) is recruited to the γ-globin gene promoter as a co-activator and is required for γ-globin gene induction by short-chain fatty acid derivatives

    Science.gov (United States)

    Perrine, Susan P.; Mankidy, Rishikesh; Boosalis, Michael S.; Bieker, James J.; Faller, Douglas V.

    2011-01-01

    Objectives The erythroid Kruppel-like factor (EKLF) is an essential transcription factor for β-type globin gene switching, and specifically activates transcription of the adult β-globin gene promoter. We sought to determine if EKLF is also required for activation of the γ-globin gene by short-chain fatty acid (SCFA) derivatives, which are now entering clinical trials. Methods The functional and physical interaction of EKLF and co-regulatory molecules with the endogenous human globin gene promoters was studied in primary human erythroid progenitors and cell lines, using chromatin immunoprecipitation (ChIP) assays and genetic manipulation of the levels of EKLF and co-regulators. Results and conclusions Knockdown of EKLF prevents SCFA-induced expression of the γ-globin promoter in a stably expressed μLCRβprRlucAγprFluc cassette, and prevents induction of the endogenous γ-globin gene in primary human erythroid progenitors. EKLF is actively recruited to endogenous γ-globin gene promoters after exposure of primary human erythroid progenitors, and murine hematopoietic cell lines, to SCFA derivatives. The core ATPase BRG1 subunit of the human SWI/WNF complex, a ubiquitous multimeric complex that regulates gene expression by remodeling nucleosomal structure, is also required for γ-globin gene induction by SCFA derivatives. BRG1 is actively recruited to the endogenous γ-globin promoter of primary human erythroid progenitors by exposure to SCFA derivatives, and this recruitment is dependent upon the presence of EKLF. These findings demonstrate that EKLF, and the co-activator BRG1, previously demonstrated to be required for definitive or adult erythropoietic patterns of globin gene expression, are co-opted by SCFA derivatives to activate the fetal globin genes. PMID:19220418

  6. Circulating CXCR5+CD4+ T Follicular-Like Helper Cell and Memory B Cell Responses to Human Papillomavirus Vaccines

    Science.gov (United States)

    Matsui, Ken; Adelsberger, Joseph W.; Kemp, Troy J.; Baseler, Michael W.; Ledgerwood, Julie E.; Pinto, Ligia A.

    2015-01-01

    Through the interaction of T follicular helper (Tfh) cells and B cells, efficacious vaccines can generate high-affinity, pathogen-neutralizing antibodies, and memory B cells. Using CXCR5, CXCR3, CCR6, CCR7, PD1, and ICOS as markers, Tfh-like cells can be identified in the circulation and be classified into three functionally distinct subsets that are PD1+ICOS+, PD1+ ICOS-, or PD1-ICOS-. We used these markers to identify different subsets of CXCR5+CD4+ Tfh-like cells in response to highly immunogenic and efficacious vaccines for human papillomaviruses (HPV): Cervarix and Gardasil. In this small study, we used PBMC samples from 11 Gardasil recipients, and 8 Cervarix recipients from the Vaccine Research Center 902 Study to examine the induction of circulating Tfh-like cells and IgD-CD38HiCD27+ memory B cells by flow cytometry. PD1+ICOS+ CXCR3+CCR6-CXCR5+CD4+ (Tfh1-like) cells were induced and peaked on Day (D) 7 post-first vaccination, but not as much on D7 post-third vaccination. We also observed a trend toward increase in PD1+ICOS+ CXCR3-CCR6-CXCR5+CD4+ (Tfh2-like) cells for both vaccines, and PD1+ICOS+ CXCR3-CCR6+CXCR5+CD4+ (Tfh17-like) subset was induced by Cervarix post-first vaccination. There were also minimal changes in the other cellular subsets. In addition, Cervarix recipients had more memory B cells post-first vaccination than did Gardasil recipients at D14 and D30. We found frequencies of memory B cells at D30 correlated with anti-HPV16 and 18 antibody titers from D30, and the induction levels of memory B cells at D30 and PD1+ICOS+Tfh1-like cells at D7 post-first vaccination correlated for Cervarix. Our study showed that induction of circulating CXCR5+CD4+ Tfh-like subsets can be detected following immunization with HPV vaccines, and potentially be useful as a marker of immunogenicity of vaccines. However, further investigations should be extended to different cohorts with larger sample size to better understand the functions of these T cells, as well as

  7. Human rotavirus genotypes circulating in Brazil before and after a nationwide rotavirus vaccination program established in 2006

    Directory of Open Access Journals (Sweden)

    Caruzo TAR

    2011-04-01

    Full Text Available Thabata AR CaruzoGenetics, Evolution and Bioagents Department, Institute of Biology, State University of Campinas, Campinas, São Paulo, BrazilAbstract: Accounting for an estimated 600,000 deaths worldwide each year, rotaviruses are recognized as the most important etiologic agents causing severe acute gastroenteritis among children under the age of five years. In Brazil, until rotavirus vaccination was established in the public health system in 2006, acute gastroenteritis striking children under five years and caused by these viruses was clearly associated with 3.5 million episodes of diarrhea, 650,000 visits to outpatient health care facilities, 92,000 hospitalizations, and 850 deaths each year. After the introduction of the rotavirus vaccine in Brazil in March 2006, studies all over the country have been comparing rotavirus genotypes circulating in the recent pre- and postvaccination era. Most of these studies have reported a high prevalence of the G2P[4] genotype and also a decrease in rotavirus detection all over Brazil after the introduction of the vaccine. So far, these are preliminary studies, as a longer period of time is necessary to establish if this high prevalence of G2P[4] is due to selective pressure by the vaccine on the circulating viruses or to a normal genotype fluctuation, and if it will have any impact on vaccine efficacy in the future. This review describes results from the most recent studies addressing this issue and on rotavirus genotypic variability in Brazil.Keywords: human rotavirus, vaccine, genotypes, prevalence, Brazil

  8. Diurnal Variations of Human Circulating Cell-Free Micro-RNA

    DEFF Research Database (Denmark)

    Heegaard, Niels H H; Carlsen, Anting Liu; Lilje, Berit

    2016-01-01

    A 24-hour light and dark cycle-dependent rhythmicity pervades physiological processes in virtually all living organisms including humans. These regular oscillations are caused by external cues to endogenous, independent biological time-keeping systems (clocks). The rhythm is reflected by gene...... expression that varies in a circadian and specific fashion in different organs and tissues and is regulated largely by dynamic epigenetic and post-transcriptional mechanisms. This leads to well-documented oscillations of specific electrolytes, hormones, metabolites, and plasma proteins in blood samples...

  9. A soluble form of the high affinity IgE receptor, Fc-epsilon-RI, circulates in human serum.

    Directory of Open Access Journals (Sweden)

    Eleonora Dehlink

    Full Text Available Soluble IgE receptors are potential in vivo modulators of IgE-mediated immune responses and are thus important for our basic understanding of allergic responses. We here characterize a novel soluble version of the IgE-binding alpha-chain of Fc-epsilon-RI (sFcεRI, the high affinity receptor for IgE. sFcεRI immunoprecipitates as a protein of ∼40 kDa and contains an intact IgE-binding site. In human serum, sFcεRI is found as a soluble free IgE receptor as well as a complex with IgE. Using a newly established ELISA, we show that serum sFcεRI levels correlate with serum IgE in patients with elevated IgE. We also show that serum of individuals with normal IgE levels can be found to contain high levels of sFcεRI. After IgE-antigen-mediated crosslinking of surface FcεRI, we detect sFcεRI in the exosome-depleted, soluble fraction of cell culture supernatants. We further show that sFcεRI can block binding of IgE to FcεRI expressed at the cell surface. In summary, we here describe the alpha-chain of FcεRI as a circulating soluble IgE receptor isoform in human serum.

  10. Intercontinental circulation of human influenza A(H1N2) reassortant viruses during the 2001-2002 influenza season.

    Science.gov (United States)

    Xu, Xiyan; Smith, Catherine B; Mungall, Bruce A; Lindstrom, Stephen E; Hall, Henrietta E; Subbarao, Kanta; Cox, Nancy J; Klimov, Alexander

    2002-11-15

    Reassortant influenza A viruses bearing the H1 subtype of hemagglutinin (HA) and the N2 subtype of neuraminidase (NA) were isolated from humans in the United States, Canada, Singapore, Malaysia, India, Oman, Egypt, and several countries in Europe during the 2001-2002 influenza season. The HAs of these H1N2 viruses were similar to that of the A/New Caledonia/20/99(H1N1) vaccine strain both antigenically and genetically, and the NAs were antigenically and genetically related to those of recent human H3N2 reference strains, such as A/Moscow/10/99(H3N2). All 6 internal genes of the H1N2 reassortants examined originated from an H3N2 virus. This article documents the first widespread circulation of H1N2 reassortants on 4 continents. The current influenza vaccine is expected to provide good protection against H1N2 viruses, because it contains the A/New Caledonia/20/99(H1N1) and A/Moscow/10/99(H3N2)-like viruses, which have H1 and N2 antigens that are similar to those of recent H1N2 viruses.

  11. Inflammation-Induced Changes in Circulating T-Cell Subsets and Cytokine Production During Human Endotoxemia

    DEFF Research Database (Denmark)

    Ronit, Andreas; Plovsing, Ronni R; Gaardbo, Julie C

    2017-01-01

    administration. The frequency of anti-inflammatory Tregs increased (P = .033), whereas the frequency of proinflammatory CD4(+)CD161(+) cells decreased (P = .034). Endotoxemia was associated with impaired whole-blood production of tumor necrosis factor-α, interleukin-10, IL-6, IL-17, IL-2, and interferon......Observational clinical studies suggest the initial phase of sepsis may involve impaired cellular immunity. In the present study, we investigated temporal changes in T-cell subsets and T-cell cytokine production during human endotoxemia. Endotoxin (Escherichia coli lipopolysaccharide 4 ng......, HLA-DR(+)CD38(+) T cells were determined. Ex vivo whole-blood cytokine production and Toll-like receptor (TLR)-4 expression on Tregs were measured. Absolute number of CD3(+)CD4(+) (P = .026), CD3(+)CD8(+) (P = .046), Tregs (P = .023), and CD4(+)CD161(+) cells (P = .042) decreased after endotoxin...

  12. Enterohepatic circulation of nonconjugated bilirubin in rats fed with human milk

    International Nuclear Information System (INIS)

    Alonso, E.M.; Whitington, P.F.; Whitington, S.H.; Rivard, W.A.; Given, G.

    1991-01-01

    To test the hypothesis that enhanced intestinal absorption of bilirubin may contribute to prolonged nonconjugated hyperbilirubinemia in human milk-fed infants, we studied a cross-section of 36 healthy infants and mothers. Milk from mothers and serum from infants were collected at 16.3 +/- 2.4 days. Milk was studied for its effect on the absorption of bilirubin labeled with carbon 14 in rats and compared with buffer and iron-fortified infant formula (Similac With Iron). The percentage of a 1 mg bilirubin dose absorbed by the rat was 25.29 +/- 4.0% when it was administered into the duodenum with buffer, 4.67 +/- 2.4% with Similac formula, and 7.7 +/- 2.9% with human milk. Linear regression analysis, using the infant's serum nonconjugated bilirubin level as the dependent variable and the percentage of (14C)bilirubin absorbed by the rat with the corresponding mother's milk as the independent variable, revealed a significant correlation (r = 0.40; p = 0.016). Inspection of the data suggested that absorptive permissiveness correlated closely with infant serum bilirubin values greater than 24 mumol/L (1.4 mg/dl) (r = 0.55; p = 0.007), whereas in those with bilirubin values less than or equal to 24 mumol/L, there was no apparent correlation. Milk was also analyzed for beta-glucuronidase, nonesterified fatty acids, and the ability to inhibit glucuronosyltransferase activity of rat liver microsomes in vitro, none of which correlated with the infant's serum bilirubin. These data support the theory that enhanced intestinal absorption of bilirubin contributes to the jaundice associated with breast-feeding

  13. Diagnostic radionuclide imaging of amyloid: biological targeting by circulating human serum amyloid P component

    Energy Technology Data Exchange (ETDEWEB)

    Hawkins, P.N.; Lavender, J.P.; Myers, M.J.; Pepys, M.B.

    1988-06-25

    The specific molecular affinity of the normal plasma protein, serum amyloid P component (SAP), for all known types of amyloid fibrils was used to develop a new general diagnostic method for in-vivo radionuclide imaging of amyloid deposits. After intravenous injection of /sup 123/I-labelled purified human SAP there was specific uptake into amyloid deposits in all affected patients, 7 with systematic AL amyloid, 5 with AA amyloid, and 2 with ..beta../sub 2/M amyloid, in contrast to the complete absence of any tissue localisation in 5 control subjects. Distinctive high-resolution scintigraphic images, even of minor deposits in the carpal regions, bone marrow, or adrenals, were obtained. This procedure should yield much information on the natural history and the management of amyloidosis, the presence of which has hitherto been confirmed only by biopsy. Clearance and metabolic studies indicated that, in the presence of extensive amyloidosis, the rate of synthesis of SAP was greatly increased despite maintenance of normal plasma levels. Futhermore, once localised to amyloid deposits the /sup 123/I-SAP persisted for long periods and was apparently protected from its normal rapid degradation. These findings shed new light on the pathophysiology of amyloid and may have implications for therapeutic strategies based upon specific molecular targeting with SAP.

  14. Identification and characterization of riboflavin-binding proteins in human circulation

    International Nuclear Information System (INIS)

    Innis-Whitehouse, W.S.A.

    1988-01-01

    Riboflavin binding by plasma proteins from healthy human subjects was examined by equilibrium dialysis and binding was observed to vary over a greater than 10-fold range. Upon fractionation of plasma by gel filtration, the major riboflavin-binding components eluted with albumin and gamma-globulins. Albumin was purified and found to bind riboflavin only very weakly, although FMN and photo-chemical degradation products were more tightly bound. Most of the binding occurred in the gamma-globulin fraction and was attributed to immunoglobulins because the binding proteins and immunoglobulins copurified using various methods, were removed by treatment of plasma with protein A-agarose, and were coincident upon immuno-electrophoresis followed by autoradiography to detect [2- 14 C]-riboflavin. Binding differences among plasma samples were reflected in the binding recovered with the immunoglobulin fractions; however, there was not a direct relationship between the amount of immunoglobulin and the amount of [2- 14 C]riboflavin bound. Hence, it appeared that the binding was due to a subfraction of immunoglobulins

  15. Recombinant erythropoietin in humans has a prolonged effect on circulating erythropoietin isoform distribution

    DEFF Research Database (Denmark)

    Aachmann-Andersen, Niels Jacob; Just Christensen, Søren; Lisbjerg, Kristian

    2014-01-01

    The membrane-assisted isoform immunoassay (MAIIA) quantitates erythropoietin (EPO) isoforms as percentages of migrated isoforms (PMI). We evaluated the effect of recombinant human EPO (rhEPO) on the distribution of EPO isoforms in plasma in a randomized, placebo-controlled, double-blinded, cross......-over study. 16 healthy subjects received either low-dose Epoetin beta (5000 IU on days 1, 3, 5, 7, 9, 11 and 13); high-dose Epoetin beta (30.000 IU on days 1, 2 and 3 and placebo on days 5, 7, 9, 11 and 13); or placebo on all days. PMI on days 4, 11 and 25 was determined by interaction of N......-acetyl glucosamine with the glycosylation dependent desorption of EPO isoforms. At day 25, plasma-EPO in both rhEPO groups had returned to values not different from the placebo group. PMI with placebo, reflecting the endogenous EPO isoforms, averaged 82.5 (10.3) % (mean (SD)). High-dose Epoetin beta decreased PMI...

  16. Circulating ApoJ is closely associated with insulin resistance in human subjects.

    Science.gov (United States)

    Seo, Ji A; Kang, Min-Cheol; Ciaraldi, Theodore P; Kim, Sang Soo; Park, Kyong Soo; Choe, Charles; Hwang, Won Min; Lim, Dong Mee; Farr, Olivia; Mantzoros, Christos; Henry, Robert R; Kim, Young-Bum

    2018-01-01

    Insulin resistance is a major risk factor for type 2 diabetes. ApolipoproteinJ (ApoJ) has been implicated in altered pathophysiologic states including cardiovascular and Alzheimer's disease. However, the function of ApoJ in regulation of glucose homeostasis remains unclear. This study sought to determine whether serum ApoJ levels are associated with insulin resistance in human subjects and if they change after interventions that improve insulin sensitivity. Serum ApoJ levels and insulin resistance status were assessed in nondiabetic (ND) and type 2 diabetic (T2D) subjects. The impacts of rosiglitazone or metformin therapy on serum ApoJ levels and glucose disposal rate (GDR) during a hyperinsulinemic/euglycemic clamp were evaluated in a separate cohort of T2D subjects. Total ApoJ protein or that associated with the HDL and LDL fractions was measured by immunoblotting or ELISA. Fasting serum ApoJ levels were greatly elevated in T2D subjects (ND vs T2D; 100±8.3 vs. 150.6±8.5AU, Pinsulin, HOMA-IR, and BMI. ApoJ levels were significantly and independently associated with HOMA-IR, even after adjustment for age, sex, and BMI. Rosiglitazone treatment in T2D subjects resulted in a reduction in serum ApoJ levels (before vs. after treatment; 100±13.9 vs. 77±15.2AU, P=0.015), whereas metformin had no effect on ApoJ levels. The change in ApoJ levels during treatment was inversely associated with the change in GDR. Interestingly, ApoJ content in the LDL fraction was inversely associated with HOMA-IR. Serum ApoJ levels are closely correlated with the magnitude of insulin resistance regardless of obesity, and decrease along with improvement of insulin resistance in response only to rosiglitazone in type 2 diabetes. Copyright © 2017 Elsevier Inc. All rights reserved.

  17. Recombinant erythropoietin in humans has a prolonged effect on circulating erythropoietin isoform distribution.

    Directory of Open Access Journals (Sweden)

    Niels Jacob Aachmann-Andersen

    Full Text Available The membrane-assisted isoform immunoassay (MAIIA quantitates erythropoietin (EPO isoforms as percentages of migrated isoforms (PMI. We evaluated the effect of recombinant human EPO (rhEPO on the distribution of EPO isoforms in plasma in a randomized, placebo-controlled, double-blinded, cross-over study. 16 healthy subjects received either low-dose Epoetin beta (5000 IU on days 1, 3, 5, 7, 9, 11 and 13; high-dose Epoetin beta (30.000 IU on days 1, 2 and 3 and placebo on days 5, 7, 9, 11 and 13; or placebo on all days. PMI on days 4, 11 and 25 was determined by interaction of N-acetyl glucosamine with the glycosylation dependent desorption of EPO isoforms. At day 25, plasma-EPO in both rhEPO groups had returned to values not different from the placebo group. PMI with placebo, reflecting the endogenous EPO isoforms, averaged 82.5 (10.3 % (mean (SD. High-dose Epoetin beta decreased PMI on days 4 and 11 to 31.0 (4.2% (p<0.00001 and 45.2 (7.3% (p<0.00001. Low-dose Epoetin beta decreased PMI on days 4 and 11 to 46.0 (12.8% (p<0.00001 and 46.1 (10.4% (p<0.00001. In both rhEPO groups, PMI on day 25 was still decreased (high-dose Epoetin beta: 72.9 (19.4% (p=0.029; low-dose Epoetin beta: 73.1 (17.8% (p=0.039. In conclusion, Epoetin beta leaves a footprint in the plasma-EPO isoform pattern. MAIIA can detect changes in EPO isoform distribution up til at least three weeks after administration of Epoetin beta even though the total EPO concentration has returned to normal.

  18. Acute erythroid neoplastic proliferations. A biological study based on 62 patients.

    Science.gov (United States)

    Domingo-Claros, Alicia; Larriba, Itziar; Rozman, Maruja; Irriguible, Dolors; Vallespí, Teresa; Aventin, Anna; Ayats, Ramon; Millá, Fuensanta; Solé, Francesc; Florensa, Lourdes; Gallart, Miquel; Tuset, Esperanza; Lopez, Carmen; Woessner, Soledad

    2002-02-01

    The terms acute erythroleukemia and AML-M6 are defined in the FAB classification as proliferations of dysplastic erythroid elements mixed with blasts of myeloid origin, but pure erythroid leukemias are not included. The recent WHO classification has a category of acute myeloid leukemia not otherwise categorized, which includes acute erythroid leukemia (M6) of two subtypes: M6a-erythroleukemia (erythroid/myeloid) and M6b-pure erythroid leukemia. The aims of this co-operative study were to discover the incidences of these different subtypes, and pay special attention to the morphology of these entities. We reviewed a series of 62 patients with erythroid neoplastic proliferations. Previous medical history, age, sex, peripheral blood and bone marrow cell counts, cytochemical stains, immunophenotype, and cytogenetics were evaluated at presentation. We analyzed the incidence of erythrocyte, leukocyte and platelet abnormalities in the peripheral blood. In bone marrow we analyzed dysplastic features of erythroblasts, granulocytic elements and the megakaryocytic lineage. Fifty-three patients met the criteria of M6a subtype of the WHO classification, and 2 were classified as having pure erythremia (M6b); 7 cases could not be classified according to the WHO criteria. Fifty-five patients presented with de novo acute leukemia, and seven patients had secondary acute leukemia. The most frequent dysplastic features in blood smears were: schistocytes, tear-drop and pincered cells in erythrocytes; hypogranulation and hyposegmentation in leukocytes; gigantism and hypogranulation in platelets. In bone marrow, megaloblastic changes, multinuclearity, karyorrhexis and basophilic stippling in erythroblasts; hypogranulation and gigantism in granulocytic series, and micromegakaryocytes and unconnected nuclei in megakarocytes were the most dysplastic features. A positive PAS reaction and increase of bone marrow iron with ring sideroblasts were common features. Trilineage dysplasia was

  19. Human circulating monocytes internalize 125I-insulin in a similar fashion to rat hepatocytes: relevance to receptor regulation in target and nontarget tissues

    International Nuclear Information System (INIS)

    Grunberger, G.; Robert, A.; Carpentier, J.L.; Dayer, J.M.; Roth, A.; Stevenson, H.C.; Orci, L.; Gorden, P.

    1985-01-01

    Circulating monocytes bind 125 I-insulin in a specific fashion and have been used to analyze the ambient receptor status in humans. When freshly isolated circulating monocytes are incubated with 125 I-insulin and examined by electron microscopic autoradiography, approximately 18% of the labeled material is internalized after 15 minutes at 37 degrees C. By 2 hours at 37 degrees C, approximately one half of the 125 I-insulin is internalized. Internalization occurs also at 15 degrees C but at a slower rate. Furthermore, the monocytes bind and internalize 125 I-insulin in a manner that mirrors that of major target tissues, such as rat hepatocytes. These data suggest that the insulin receptor of the circulating monocyte might be regulated by adsorptive endocytosis in a manner analogous to that of target tissue, such as the liver

  20. Inner-ear circulation in humans is disrupted by extracranial venous outflow strictures: Implications for Ménière’s disease

    Directory of Open Access Journals (Sweden)

    Eleuterio F. Toro

    2018-02-01

    Full Text Available Ménière’s disease (MD is a pathology of the inner ear, the symptoms of which include tinnitus, vertigo attacks, fluctuating hearing loss, and nausea. Neither cause nor cure are currently known, though animal experiments suggest that disruption of the inner ear circulation, including venous hypertension and endolymphatic hydrops, to be hallmarks of the disease. Recent evidence for humans suggests a potential link to strictures in the extracranial venous outflow routes. The purpose of the present work is to demonstrate that the inner-ear circulation in humans is disrupted by extracranial venous outflow stricture and to discuss the implications of this finding for MD. The hypothesis linking extracranial venous outflow strictures to the altered dynamics of central nervous system (CNS fluid compartments is investigated theoretically via a global, closed-loop, multiscale mathematical model for the entire human circulation, interacting with the brain parenchyma and cerebrospinal fluid (CSF. The fluid dynamics model for the full human body includes submodels for the heart, pulmonary circulation, arterial system, microvasculature, venous system and the CSF, with a specially refined description of the inner ear vasculature. We demonstrate that extracranial venous outflow strictures disrupt inner ear circulation, and more generally, alter the dynamics of fluid compartments in the whole CNS. Specifically, as compared to a healthy control, the computational results from our model show that subjects with extracranial outflow venous strictures exhibit: altered inner ear circulation, redirection of flow to collaterals, increased intracranial venous pressure and increased intracranial pressure. Our findings are consistent with recent clinical evidence in humans that links extracranial outflow venous strictures to MD, aid the mechanistic understanding of the underlying features of the disease and lend support to recently proposed biophysically motivated

  1. Elevated Serum PSA is Associated With Human Herpesvirus 8 Infection and Increased Circulating Cytokine Levels in Men From Tobago.

    Science.gov (United States)

    Henning, Jill D; Karamchandani, Jaideep M; Bonachea, Luis A; Bunker, Clareann H; Patrick, Alan L; Jenkins, Frank J

    2017-05-01

    Serum-prostate specific antigen (PSA) levels have been used for many years as a biomarker for prostate cancer. This usage is under scrutiny due to the fact that elevated PSA levels can be caused by other conditions such as benign prostatic hyperplasia and infections of or injury to the prostate. As a result, the identification of specific pathogens capable of increasing serum levels of PSA is important. A potential candidate responsible for elevated PSA is human herpesvirus 8 (HHV-8). We have reported previously that HHV-8 is capable of infecting and establishing a latent infection in the prostate. In this current study we test the hypothesis that HHV-8 infection is associated with elevated PSA levels. Circulating cytokine levels between men with elevated PSA and controls are also compared. HHV-8 serostatus was determined among men with elevated serum PSA (≥4 ng/ml; n = 168, no prostate cancer on biopsy) and age-matched controls (PSA PSA and 85 controls). Men with an elevated serum PSA were significantly more likely to be HHV-8 seropositive (42.9%) than the age-matched cancer-free men (22.2%; OR 2.51; 95%CI 1.48-4.29, P = 00001). Comparison of circulating cytokine levels between men with elevated serum PSA and controls indicated that elevated serum PSA is associated with a pro-inflammatory response with a mixed Th1/Th2 response while HHV-8 infection was associated with significantly higher levels of IL12p70, IL-10, and IL-13 indicating a Th2 immune response. We found a significant association between HHV-8 infection and increased levels of serum PSA. In an age of patient-centered medicine, men with an elevated serum PSA should be considered for HHV-8 serology testing to determine if HHV-8 is responsible for the elevated PSA. Prostate 77: 617-624, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  2. Role of ISM circulations in Western Kachchh, India during Mid-Late Holocene in disarticulation of Human Settlements

    Science.gov (United States)

    Dabhi, M.

    2017-12-01

    Paleoclimatic record indicates that one of the major factors for change in Indian Summer Monsoon (ISM) is North Atlantic Oceanic Circulation (NAO). Climatic changes have often been an influential factor in culture developments and dislocation of human settlements. The climatic transformations in Western India are affected by variation in the Indian Summer Monsoon (ISM). During last millennial scale, Indian sub-continent has observed varied climatic oscillations due to temperature variations in ocean and continent. People and society are the most affected lot due to this climate and monsoonal changes, which finally leads towards migration or colonization of people. Therefore, a high resolution data is required to delineate the complexity of monsoonal variation. This study focuses on the Mid-Late Holocene monsoonal changes from the sediment record of Western Kachchh. The field of study is at the mount of Kali River, a 45 km long river originating from the hills of Western Mainland Kachchh and debouching into Kori Creek. The exposed cross-section along the river bank has a fluvial unit (Unit-1) at the base followed by human settlement marked as Unit-2 culminating with eolian deposits (Unit-3) at the top. Multiproxy analysis (sedimentologically, optically and geochemically) were carried out to ascertain the climatic perturbations in the region. The lower Unit 1 which range in age from 6-5 Ka shows declining monsoon. The above exposed sediments with anthropogenic activity (Unit 2) cover a time span of 3-2.5 ka indicates monsoonal stability with declining trends. The general weakening of monsoon may be a major factor towards the ending or migration of the human settlement leading to the absence of archeological activity above 2.5ka in the area. The eolian sediments resting above the Unit 2 fall between 450 to 230 yrs represent the trends of Little Ice Age. Sediment record from the opposite bank of the river reveals an age of 1100 yrs supports wet condition which is co

  3. Polymorphic Human Sulfotransferase 2A1 Mediates the Formation of 25-Hydroxyvitamin D3-3-O-Sulfate, a Major Circulating Vitamin D Metabolite in Humans.

    Science.gov (United States)

    Wong, Timothy; Wang, Zhican; Chapron, Brian D; Suzuki, Mizuki; Claw, Katrina G; Gao, Chunying; Foti, Robert S; Prasad, Bhagwat; Chapron, Alenka; Calamia, Justina; Chaudhry, Amarjit; Schuetz, Erin G; Horst, Ronald L; Mao, Qingcheng; de Boer, Ian H; Thornton, Timothy A; Thummel, Kenneth E

    2018-04-01

    Metabolism of 25-hydroxyvitamin D 3 (25OHD 3 ) plays a central role in regulating the biologic effects of vitamin D in the body. Although cytochrome P450-dependent hydroxylation of 25OHD 3 has been extensively investigated, limited information is available on the conjugation of 25OHD 3 In this study, we report that 25OHD 3 is selectively conjugated to 25OHD 3 -3- O -sulfate by human sulfotransferase 2A1 (SULT2A1) and that the liver is a primary site of metabolite formation. At a low (50 nM) concentration of 25OHD 3 , 25OHD 3 -3- O -sulfate was the most abundant metabolite, with an intrinsic clearance approximately 8-fold higher than the next most efficient metabolic route. In addition, 25OHD 3 sulfonation was not inducible by the potent human pregnane X receptor agonist, rifampicin. The 25OHD 3 sulfonation rates in a bank of 258 different human liver cytosols were highly variable but correlated with the rates of dehydroepiandrosterone sulfonation. Further analysis revealed a significant association between a common single nucleotide variant within intron 1 of SULT2A1 (rs296361; minor allele frequency = 15% in whites) and liver cytosolic SULT2A1 content as well as 25OHD 3 -3- O -sulfate formation rate, suggesting that variation in the SULT2A1 gene contributes importantly to interindividual differences in vitamin D homeostasis. Finally, 25OHD 3 -3- O -sulfate exhibited high affinity for the vitamin D binding protein and was detectable in human plasma and bile but not in urine samples. Thus, circulating concentrations of 25OHD 3 -3- O -sulfate appear to be protected from rapid renal elimination, raising the possibility that the sulfate metabolite may serve as a reservoir of 25OHD 3 in vivo, and contribute indirectly to the biologic effects of vitamin D. Copyright © 2018 by The American Society for Pharmacology and Experimental Therapeutics.

  4. A Rare Case of Pure Erythroid Sarcoma in a Pediatric Patient: Case Report and Literature Review

    Directory of Open Access Journals (Sweden)

    Pablo Manresa

    2017-12-01

    Full Text Available We describe an exceptional case of erythroid sarcoma in a pediatric patient as a growing orbital mass with no evidence of morphologic bone marrow involvement, who was finally diagnosed of pure erythroid sarcoma based on histopathology and flow cytometry criteria. We discuss the contribution of standardized eight-color flow cytometry as a rapid and reliable diagnostic method. The use of normal bone marrow databases allowed us to identify small aberrant populations in bone marrow and later confirm the diagnosis in the neoplastic tissue.

  5. Identification of Cell Type-Specific Differences in Erythropoietin Receptor Signaling in Primary Erythroid and Lung Cancer Cells.

    Directory of Open Access Journals (Sweden)

    Ruth Merkle

    2016-08-01

    Full Text Available Lung cancer, with its most prevalent form non-small-cell lung carcinoma (NSCLC, is one of the leading causes of cancer-related deaths worldwide, and is commonly treated with chemotherapeutic drugs such as cisplatin. Lung cancer patients frequently suffer from chemotherapy-induced anemia, which can be treated with erythropoietin (EPO. However, studies have indicated that EPO not only promotes erythropoiesis in hematopoietic cells, but may also enhance survival of NSCLC cells. Here, we verified that the NSCLC cell line H838 expresses functional erythropoietin receptors (EPOR and that treatment with EPO reduces cisplatin-induced apoptosis. To pinpoint differences in EPO-induced survival signaling in erythroid progenitor cells (CFU-E, colony forming unit-erythroid and H838 cells, we combined mathematical modeling with a method for feature selection, the L1 regularization. Utilizing an example model and simulated data, we demonstrated that this approach enables the accurate identification and quantification of cell type-specific parameters. We applied our strategy to quantitative time-resolved data of EPO-induced JAK/STAT signaling generated by quantitative immunoblotting, mass spectrometry and quantitative real-time PCR (qRT-PCR in CFU-E and H838 cells as well as H838 cells overexpressing human EPOR (H838-HA-hEPOR. The established parsimonious mathematical model was able to simultaneously describe the data sets of CFU-E, H838 and H838-HA-hEPOR cells. Seven cell type-specific parameters were identified that included for example parameters for nuclear translocation of STAT5 and target gene induction. Cell type-specific differences in target gene induction were experimentally validated by qRT-PCR experiments. The systematic identification of pathway differences and sensitivities of EPOR signaling in CFU-E and H838 cells revealed potential targets for intervention to selectively inhibit EPO-induced signaling in the tumor cells but leave the responses in

  6. Circulating species of Leishmania at microclimate area of Boulemane Province, Morocco: impact of environmental and human factors.

    Science.gov (United States)

    Hmamouch, Asmae; El Alem, Mahmoud Mohamed; Hakkour, Maryam; Amarir, Fatima; Daghbach, Hassan; Habbari, Khalid; Fellah, Hajiba; Bekhti, Khadija; Sebti, Faiza

    2017-02-22

    Cutaneous leishmaniasis (CL) is widely distributed in Morocco where its geographical range and incidence are related to environmental factors. This study aimed to examine the impact of several factors on the distribution of CL in Boulemane Province, which is characterized by several microclimates, and to identify the Leishmania species circulating in these areas. Ordinary least squares regression (OLSR) analysis was performed to study the impact of poverty, vulnerability, population density, urbanization and bioclimatic factors on the distribution of CL in this province. Molecular characterization of parasites was performed using a previously described PCR-RFLP method targeting the ITS1 of ribosomal DNA of Leishmania. A total of 1009 cases were declared in Boulemane Province between the years 2000 and 2015 with incidences fluctuating over the years (P = 0.007). Analyzing geographical maps of the study region identified four unique microclimate areas; sub-humid, semi-arid, arid and Saharan. The geographical distribution and molecular identification of species shows that the Saharan microclimate, characterized by the presence of Leishmania major was the most affected (47.78%) followed by semi-arid area where Leishmania tropica was identified in three districts. Among several environmental factors included in the study, poverty had the greatest influence on the spatial extension of the disease in this province. The incidence of CL in Boulemane Province varies between microclimate areas, and environmental factors partly explain this variation. However, the existence of CL in the most affected districts is mainly related to poverty, population movement and human behavior. To our knowledge, this the first study utilizing molecular techniques to confirm L. tropica and L. major as the causative agents of CL in Boulemane Province. Our findings indicate that the spatial and temporal distribution of CL in Boulemane Province is strongly related to poverty and population

  7. Human circulating ribosomal DNA content significantly increases while circulating satellite III (1q12) content decreases under chronic occupational exposure to low-dose gamma- neutron and tritium beta-radiation

    International Nuclear Information System (INIS)

    Korzeneva, Inna B.; Kostuyk, Svetlana V.; Ershova, Elizaveta S.; Skorodumova, Elena N.; Zhuravleva, Veronika F.; Pankratova, Galina V.; Volkova, Irina V.; Stepanova, Elena V.; Porokhovnik, Lev N.; Veiko, Natalia N.

    2016-01-01

    Highlights: • A transcribed region of human ribosomal repeat is resistant to double-strand breaks in the environment of a raised endonuclease activity. • Hybridization-based techniques are preferable for the analysis of damaged and/or oxidized genomic fragments, rather than the qRT-PCR method. • A chronic exposure to the low-dose IR induces an elevation of the rDNA content in the human circulating cfDNA as compared to cellular DNA. • An exposure to IR entails a decrease of the level of the human circulating satellite III (1q12) as compared to cellular DNA (RsatIII index). • The RrDNA/RsatIII ratio is a potential marker of a chronic IR individual exposure. - Abstract: A single exposure to ionizing radiation (IR) results in an elevated cell-free DNA (cfDNA) content in the blood plasma. In this case, the cfDNA concentration can be a marker of the cell death in the organism. However, a chronic exposure to a low-dose IR enhances both the endonuclease activity and titer of antibodies to DNA in blood plasma, resulting in a decrease of the total concentration of circulating cfDNA in exposed people. In this case, the total cfDNA concentration should not be considered as a marker of the cell death in an exposed body. We assumed that a pool of the cfDNA circulating in the exposed people contains DNA fragments, which are resistant to a double-strand break formation in the environment of the elevated plasma endonuclease activity, and can be accumulated in the blood plasma. In order to test this hypothesis, we studied the content of GC-rich sequences (69%GC) of the transcribed region of human ribosomal repeat (rDNA), as well as the content of AT-rich repeat (63%AT) of satellite III (1q12) in the cfDNA samples obtained from 285 individuals. We have found that a chronic exposure to gamma-neutron radiation (N = 88) and tritium β-radiation (N = 88) evokes an increase of the rDNA content (RrDNA index) and a decrease of the satellite III content (RsatIII index) in the

  8. Human circulating ribosomal DNA content significantly increases while circulating satellite III (1q12) content decreases under chronic occupational exposure to low-dose gamma- neutron and tritium beta-radiation

    Energy Technology Data Exchange (ETDEWEB)

    Korzeneva, Inna B., E-mail: inna.korzeneva@molgen.vniief.ru [Russian Federal Nuclear Center – All-Russian Research Institute of Experimental Physics (RFNC-VNIIEF) 607190 Sarov, 37 Mira ave., Nizhniy Novgorod Region (Russian Federation); Kostuyk, Svetlana V. [Research Centre for Medical Genetics, 115478 Moscow, 1 Moskvorechye str. (Russian Federation); Ershova, Elizaveta S. [Research Centre for Medical Genetics, 115478 Moscow, 1 Moskvorechye str. (Russian Federation); V. A. Negovsky Research Institute of General Reanimatology, Moscow, 107031 (Russian Federation); Skorodumova, Elena N.; Zhuravleva, Veronika F.; Pankratova, Galina V.; Volkova, Irina V.; Stepanova, Elena V. [Russian Federal Nuclear Center – All-Russian Research Institute of Experimental Physics (RFNC-VNIIEF) 607190 Sarov, 37 Mira ave., Nizhniy Novgorod Region (Russian Federation); Porokhovnik, Lev N. [Research Centre for Medical Genetics, 115478 Moscow, 1 Moskvorechye str. (Russian Federation); Veiko, Natalia N. [Research Centre for Medical Genetics, 115478 Moscow, 1 Moskvorechye str. (Russian Federation); V. A. Negovsky Research Institute of General Reanimatology, Moscow, 107031 (Russian Federation)

    2016-09-15

    Highlights: • A transcribed region of human ribosomal repeat is resistant to double-strand breaks in the environment of a raised endonuclease activity. • Hybridization-based techniques are preferable for the analysis of damaged and/or oxidized genomic fragments, rather than the qRT-PCR method. • A chronic exposure to the low-dose IR induces an elevation of the rDNA content in the human circulating cfDNA as compared to cellular DNA. • An exposure to IR entails a decrease of the level of the human circulating satellite III (1q12) as compared to cellular DNA (RsatIII index). • The RrDNA/RsatIII ratio is a potential marker of a chronic IR individual exposure. - Abstract: A single exposure to ionizing radiation (IR) results in an elevated cell-free DNA (cfDNA) content in the blood plasma. In this case, the cfDNA concentration can be a marker of the cell death in the organism. However, a chronic exposure to a low-dose IR enhances both the endonuclease activity and titer of antibodies to DNA in blood plasma, resulting in a decrease of the total concentration of circulating cfDNA in exposed people. In this case, the total cfDNA concentration should not be considered as a marker of the cell death in an exposed body. We assumed that a pool of the cfDNA circulating in the exposed people contains DNA fragments, which are resistant to a double-strand break formation in the environment of the elevated plasma endonuclease activity, and can be accumulated in the blood plasma. In order to test this hypothesis, we studied the content of GC-rich sequences (69%GC) of the transcribed region of human ribosomal repeat (rDNA), as well as the content of AT-rich repeat (63%AT) of satellite III (1q12) in the cfDNA samples obtained from 285 individuals. We have found that a chronic exposure to gamma-neutron radiation (N = 88) and tritium β-radiation (N = 88) evokes an increase of the rDNA content (RrDNA index) and a decrease of the satellite III content (RsatIII index) in the

  9. Chimaeric Virus-Like Particles Derived from Consensus Genome Sequences of Human Rotavirus Strains Co-Circulating in Africa

    Science.gov (United States)

    Jere, Khuzwayo C.; O'Neill, Hester G.; Potgieter, A. Christiaan; van Dijk, Alberdina A.

    2014-01-01

    Rotavirus virus-like particles (RV-VLPs) are potential alternative non-live vaccine candidates due to their high immunogenicity. They mimic the natural conformation of native viral proteins but cannot replicate because they do not contain genomic material which makes them safe. To date, most RV-VLPs have been derived from cell culture adapted strains or common G1 and G3 rotaviruses that have been circulating in communities for some time. In this study, chimaeric RV-VLPs were generated from the consensus sequences of African rotaviruses (G2, G8, G9 or G12 strains associated with either P[4], P[6] or P[8] genotypes) characterised directly from human stool samples without prior adaptation of the wild type strains to cell culture. Codon-optimised sequences for insect cell expression of genome segments 2 (VP2), 4 (VP4), 6 (VP6) and 9 (VP7) were cloned into a modified pFASTBAC vector, which allowed simultaneous expression of up to four genes using the Bac-to-Bac Baculovirus Expression System (BEVS; Invitrogen). Several combinations of the genome segments originating from different field strains were cloned to produce double-layered RV-VLPs (dRV-VLP; VP2/6), triple-layered RV-VLPs (tRV-VLP; VP2/6/7 or VP2/6/7/4) and chimaeric tRV-VLPs. The RV-VLPs were produced by infecting Spodoptera frugiperda 9 and Trichoplusia ni cells with recombinant baculoviruses using multi-cistronic, dual co-infection and stepwise-infection expression strategies. The size and morphology of the RV-VLPs, as determined by transmission electron microscopy, revealed successful production of RV-VLPs. The novel approach of producing tRV-VLPs, by using the consensus insect cell codon-optimised nucleotide sequence derived from dsRNA extracted directly from clinical specimens, should speed-up vaccine research and development by by-passing the need to adapt rotaviruses to cell culture. Other problems associated with cell culture adaptation, such as possible changes in epitopes, can also be circumvented

  10. Fusion of ZMYND8 and RELA genes in acute erythroid leukemia

    DEFF Research Database (Denmark)

    Panagopoulos, Ioannis; Micci, Francesca; Thorsen, Jim

    2013-01-01

    Acute erythroid leukemia was diagnosed in a 4-month-old boy. Cytogenetic analysis of bone marrow (BM) cells showed a t(11;20)(p11;q11) translocation. RNA extracted from the BM was sequenced and analyzed for fusion transcripts using the software FusionMap. A ZMYND8-RELA fusion was ranked first. RT...

  11. Probing Conformational Stability and Dynamics of Erythroid and Nonerythroid Spectrin: Effects of Urea and Guanidine Hydrochloride

    Science.gov (United States)

    Patra, Malay; Mukhopadhyay, Chaitali; Chakrabarti, Abhijit

    2015-01-01

    We have studied the conformational stability of the two homologous membrane skeletal proteins, the erythroid and non-erythroid spectrins, in their dimeric and tetrameric forms respectively during unfolding in the presence of urea and guanidine hydrochloride (GuHCl). Fluorescence and circular dichroism (CD) spectroscopy have been used to study the changes of intrinsic tryptophan fluorescence, anisotropy, far UV-CD and extrinsic fluorescence of bound 1-anilinonapthalene-8-sulfonic acid (ANS). Chemical unfolding of both proteins were reversible and could be described as a two state transition. The folded erythroid spectrin and non-erythroid spectrin were directly converted to unfolded monomer without formation of any intermediate. Fluorescence quenching, anisotropy, ANS binding and dynamic light scattering data suggest that in presence of low concentrations of the denaturants (up-to 1M) hydrogen bonding network and van der Waals interaction play a role inducing changes in quaternary as well as tertiary structures without complete dissociation of the subunits. This is the first report of two large worm like, multi-domain proteins obeying twofold rule which is commonly found in small globular proteins. The free energy of stabilization (ΔGu H 2 0) for the dimeric spectrin has been 20 kcal/mol lesser than the tetrameric from. PMID:25617632

  12. Dimethyl sulfoxide-inducible cytoplasmic factor involved in erythroid differentiation in mouse erythroleukemia (Friend) cells

    International Nuclear Information System (INIS)

    Watanabe, T.; Oishi, M.

    1987-01-01

    A previous report described an intracellular factor (differentiation-inducing factor I, or DIF-I) that seem to play a role in erythroid differentiation in mouse erythroleukemia (MEL) cells. The authors have detected another erythroid-inducing factor in cell-free extracts from dimethyl sulfoxide- or hexamethylenebis(acetamide)-treated MEL cells, which acts synergistically with DIF-I. The partially purified factor (termed DIF-II) triggered erythroid differentiation when introduced into undifferentiated MEL cells that had been potentiated by the induction of DIF-I. The activity in the extracts appeared in an inducible manner after addition of dimethyl sulfoxide or hexamethylenebis(acetamide), reached a maximum at 6 hr, and then rapidly decreased. The induction was inhibited by phorbol 12-myristate 13-acetate and also by cycloheximide. No induction was observed in a mutant MEL cell line defective in erythroid differentiation. These characteristics are consistent with the supposition that DIF-II is one of the putative dimethyl sulfoxide-inducible factors detected in previously reported cell-fusion and cytoplast-fusion experiments. The role of DIF-II in MEL-cell differentiation and in vitro differentiation in general is discussed

  13. PCBP1 and NCOA4 regulate erythroid iron storage and heme biosynthesis.

    Science.gov (United States)

    Ryu, Moon-Suhn; Zhang, Deliang; Protchenko, Olga; Shakoury-Elizeh, Minoo; Philpott, Caroline C

    2017-05-01

    Developing erythrocytes take up exceptionally large amounts of iron, which must be transferred to mitochondria for incorporation into heme. This massive iron flux must be precisely controlled to permit the coordinated synthesis of heme and hemoglobin while avoiding the toxic effects of chemically reactive iron. In cultured animal cells, iron chaperones poly rC-binding protein 1 (PCBP1) and PCBP2 deliver iron to ferritin, the sole cytosolic iron storage protein, and nuclear receptor coactivator 4 (NCOA4) mediates the autophagic turnover of ferritin. The roles of PCBP, ferritin, and NCOA4 in erythroid development remain unclear. Here, we show that PCBP1, NCOA4, and ferritin are critical for murine red cell development. Using a cultured cell model of erythroid differentiation, depletion of PCBP1 or NCOA4 impaired iron trafficking through ferritin, which resulted in reduced heme synthesis, reduced hemoglobin formation, and perturbation of erythroid regulatory systems. Mice lacking Pcbp1 exhibited microcytic anemia and activation of compensatory erythropoiesis via the regulators erythropoietin and erythroferrone. Ex vivo differentiation of erythroid precursors from Pcbp1-deficient mice confirmed defects in ferritin iron flux and heme synthesis. These studies demonstrate the importance of ferritin for the vectorial transfer of imported iron to mitochondria in developing red cells and of PCBP1 and NCOA4 in mediating iron flux through ferritin.

  14. Impact of methods used to express levels of circulating fatty acids on the degree and direction of associations with blood lipids in humans.

    Science.gov (United States)

    Sergeant, Susan; Ruczinski, Ingo; Ivester, Priscilla; Lee, Tammy C; Morgan, Timothy M; Nicklas, Barbara J; Mathias, Rasika A; Chilton, Floyd H

    2016-01-28

    Numerous studies have examined relationships between disease biomarkers (such as blood lipids) and levels of circulating or cellular fatty acids. In such association studies, fatty acids have typically been expressed as the percentage of a particular fatty acid relative to the total fatty acids in a sample. Using two human cohorts, this study examined relationships between blood lipids (TAG, and LDL, HDL or total cholesterol) and circulating fatty acids expressed either as a percentage of total or as concentration in serum. The direction of the correlation between stearic acid, linoleic acid, dihomo-γ-linolenic acid, arachidonic acid and DHA and circulating TAG reversed when fatty acids were expressed as concentrations v. a percentage of total. Similar reversals were observed for these fatty acids when examining their associations with the ratio of total cholesterol:HDL-cholesterol. This reversal pattern was replicated in serum samples from both human cohorts. The correlations between blood lipids and fatty acids expressed as a percentage of total could be mathematically modelled from the concentration data. These data reveal that the different methods of expressing fatty acids lead to dissimilar correlations between blood lipids and certain fatty acids. This study raises important questions about how such reversals in association patterns impact the interpretation of numerous association studies evaluating fatty acids and their relationships with disease biomarkers or risk.

  15. Modern embalming, circulation of fluids, and the voyage through the human arterial system: Carl L. Barnes and the culture of immortality in America.

    Science.gov (United States)

    Podgorny, Irina

    2011-01-01

    By considering the work of American embalmer, lawyer, and physician Carl Lewis Barnes (1872-1927), this paper analyzes the emergence of modern embalming in America. Barnes experimented with and exhibited the techniques by which embalming fluids travelled into the most remote cavities of the human body. In this sense, modem embalmers based their skills and methods on experimental medicine, turning the anatomy of blood vessels, physiology of circulation, and composition of blood into a circuit that allowed embalming fluids to move throughout the corpse. Embalmers in the late 19th century took ownership of the laws of hydrodynamics and the physiology of blood circulation to market their fluids and equipment, thus playing the role of physiologists of death, performing and demonstrating physiological experiments with dead bodies.

  16. The role of catechol-O-methyltransferase in catechol-enhanced erythroid differentiation of K562 cells

    International Nuclear Information System (INIS)

    Suriguga,; Li, Xiao-Fei; Li, Yang; Yu, Chun-Hong; Li, Yi-Ran; Yi, Zong-Chun

    2013-01-01

    Catechol is widely used in pharmaceutical and chemical industries. Catechol is also one of phenolic metabolites of benzene in vivo. Our previous study showed that catechol improved erythroid differentiation potency of K562 cells, which was associated with decreased DNA methylation in erythroid specific genes. Catechol is a substrate for the catechol-O-methyltransferase (COMT)-mediated methylation. In the present study, the role of COMT in catechol-enhanced erythroid differentiation of K562 cells was investigated. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation and induced mRNA expression of erythroid specific genes in K562 cells. Treatment with catechol caused a time- and concentration-dependent increase in guaiacol concentration in the medium of cultured K562 cells. When COMT expression was knocked down by COMT shRNA expression in K562 cells, the production of guaiacol significantly reduced, and the sensitivity of K562 cells to cytotoxicity of catechol significantly increased. Knockdown of COMT expression by COMT shRNA expression also eliminated catechol-enhanced erythroid differentiation of K562 cells. In addition, the pre-treatment with methyl donor S-adenosyl-L-methionine or its demethylated product S-adenosyl-L-homocysteine induced a significant increase in hemin-induced Hb synthesis in K562 cells and the mRNA expression of erythroid specific genes. These findings indicated that O-methylation catalyzed by COMT acted as detoxication of catechol and involved in catechol-enhanced erythroid differentiation of K562 cells, and the production of S-adenosyl-L-homocysteine partly explained catechol-enhanced erythroid differentiation. - Highlights: • Catechol enhanced hemin-induced hemoglobin accumulation. • COMT-catalyzed methylation acted as detoxication of catechol. • COMT involved in catechol-enhanced erythroid differentiation

  17. The role of catechol-O-methyltransferase in catechol-enhanced erythroid differentiation of K562 cells

    Energy Technology Data Exchange (ETDEWEB)

    Suriguga,; Li, Xiao-Fei; Li, Yang; Yu, Chun-Hong; Li, Yi-Ran; Yi, Zong-Chun, E-mail: yizc@buaa.edu.cn

    2013-12-15

    Catechol is widely used in pharmaceutical and chemical industries. Catechol is also one of phenolic metabolites of benzene in vivo. Our previous study showed that catechol improved erythroid differentiation potency of K562 cells, which was associated with decreased DNA methylation in erythroid specific genes. Catechol is a substrate for the catechol-O-methyltransferase (COMT)-mediated methylation. In the present study, the role of COMT in catechol-enhanced erythroid differentiation of K562 cells was investigated. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation and induced mRNA expression of erythroid specific genes in K562 cells. Treatment with catechol caused a time- and concentration-dependent increase in guaiacol concentration in the medium of cultured K562 cells. When COMT expression was knocked down by COMT shRNA expression in K562 cells, the production of guaiacol significantly reduced, and the sensitivity of K562 cells to cytotoxicity of catechol significantly increased. Knockdown of COMT expression by COMT shRNA expression also eliminated catechol-enhanced erythroid differentiation of K562 cells. In addition, the pre-treatment with methyl donor S-adenosyl-L-methionine or its demethylated product S-adenosyl-L-homocysteine induced a significant increase in hemin-induced Hb synthesis in K562 cells and the mRNA expression of erythroid specific genes. These findings indicated that O-methylation catalyzed by COMT acted as detoxication of catechol and involved in catechol-enhanced erythroid differentiation of K562 cells, and the production of S-adenosyl-L-homocysteine partly explained catechol-enhanced erythroid differentiation. - Highlights: • Catechol enhanced hemin-induced hemoglobin accumulation. • COMT-catalyzed methylation acted as detoxication of catechol. • COMT involved in catechol-enhanced erythroid differentiation.

  18. Human circulating ribosomal DNA content significantly increases while circulating satellite III (1q12) content decreases under chronic occupational exposure to low-dose gamma- neutron and tritium beta-radiation.

    Science.gov (United States)

    Korzeneva, Inna B; Kostuyk, Svetlana V; Ershova, Elizaveta S; Skorodumova, Elena N; Zhuravleva, Veronika F; Pankratova, Galina V; Volkova, Irina V; Stepanova, Elena V; Porokhovnik, Lev N; Veiko, Natalia N

    A single exposure to ionizing radiation (IR) results in an elevated cell-free DNA (cfDNA) content in the blood plasma. In this case, the cfDNA concentration can be a marker of the cell death in the organism. However, a chronic exposure to a low-dose IR enhances both the endonuclease activity and titer of antibodies to DNA in blood plasma, resulting in a decrease of the total concentration of circulating cfDNA in exposed people. In this case, the total cfDNA concentration should not be considered as a marker of the cell death in an exposed body. We assumed that a pool of the cfDNA circulating in the exposed people contains DNA fragments, which are resistant to a double-strand break formation in the environment of the elevated plasma endonuclease activity, and can be accumulated in the blood plasma. In order to test this hypothesis, we studied the content of GC-rich sequences (69%GC) of the transcribed region of human ribosomal repeat (rDNA), as well as the content of AT-rich repeat (63%AT) of satellite III (1q12) in the cfDNA samples obtained from 285 individuals. We have found that a chronic exposure to gamma-neutron radiation (N=88) and tritium β-radiation (N=88) evokes an increase of the rDNA content (RrDNA index) and a decrease of the satellite III content (RsatIII index) in the circulating cfDNA as compared with the cfDNA of non-exposed people (N=109). Such index that simultaneously displays both the increase of rDNA content and decrease of satellite III content in the cfDNA (RrDNA/RsatIII) can be recommended as a marker of chronic processes in the body that involve the elevated cell death rate and/or increased blood plasma endonuclease activity. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. Affinity isolation of antigen-specific circulating B cells for generation of phage display-derived human monoclonal antibodies

    DEFF Research Database (Denmark)

    Ditzel, Henrik

    2009-01-01

    A method is described for affinity isolation of antigen-specific circulating B cells of interest for subsequent generation of immune antibody phage display libraries. This approach should overcome the problem of low yields of monoclonal antibodies of interest in the libraries generated from...... peripheral blood lymphocytes caused by the low abundance of antigen-specific B cells in the circulation. The preselection of B cells is based on the specificity of the surface Ig receptor and is accomplished using the antigen of interest conjugated to magnetic beads. This method should significantly increase...... the frequency of antibody phage particles of interest in the library and allow for efficient isolation monoclonal antibodies with the predefined specificity....

  20. Antigenic and genomic characterization of human influenza A and B viruses circulating in Argentina after the introduction of influenza A(H1N1)pdm09.

    Science.gov (United States)

    Russo, Mara L; Pontoriero, Andrea V; Benedetti, Estefania; Czech, Andrea; Avaro, Martin; Periolo, Natalia; Campos, Ana M; Savy, Vilma L; Baumeister, Elsa G

    2014-12-01

    This study was conducted as part of the Argentinean Influenza and other Respiratory Viruses Surveillance Network, in the context of the Global Influenza Surveillance carried out by the World Health Organization (WHO). The objective was to study the activity and the antigenic and genomic characteristics of circulating viruses for three consecutive seasons (2010, 2011 and 2012) in order to investigate the emergence of influenza viral variants. During the study period, influenza virus circulation was detected from January to December. Influenza A and B, and all current subtypes of human influenza viruses, were present each year. Throughout the 2010 post-pandemic season, influenza A(H1N1)pdm09, unexpectedly, almost disappeared. The haemagglutinin (HA) of the A(H1N1)pdm09 viruses studied were segregated in a different genetic group to those identified during the 2009 pandemic, although they were still antigenically closely related to the vaccine strain A/California/07/2009. Influenza A(H3N2) viruses were the predominant strains circulating during the 2011 season, accounting for nearly 76 % of influenza viruses identified. That year, all HA sequences of the A(H3N2) viruses tested fell into the A/Victoria/208/2009 genetic clade, but remained antigenically related to A/Perth/16/2009 (reference vaccine recommended for this three-year period). A(H3N2) viruses isolated in 2012 were antigenically closely related to A/Victoria/361/2011, recommended by the WHO as the H3 component for the 2013 Southern Hemisphere formulation. B viruses belonging to the B/Victoria lineage circulated in 2010. A mixed circulation of viral variants of both B/Victoria and B/Yamagata lineages was detected in 2012, with the former being predominant. A(H1N1)pdm09 viruses remained antigenically closely related to the vaccine virus A/California/7/2009; A(H3N2) viruses continually evolved into new antigenic clusters and both B lineages, B/Victoria/2/87-like and B/Yamagata/16/88-like viruses, were observed

  1. Role of Nuclear Factor (Erythroid-Derived 2-Like 2 Signaling for Effects of Fumaric Acid Esters on Dendritic Cells

    Directory of Open Access Journals (Sweden)

    Anna Hammer

    2017-12-01

    Full Text Available To date, the intracellular signaling pathways involved in dendritic cell (DC function are poorly understood. The antioxidative transcription factor nuclear factor (erythroid-derived 2-like 2 (Nrf2 has been shown to affect maturation, function, and subsequent DC-mediated T cell responses of murine and human DCs. In experimental autoimmune encephalomyelitis (EAE, as prototype animal model for a T helper cell-mediated autoimmune disease, antigen presentation, cytokine production, and costimulation by DCs play a major role. We explore the role of Nrf2 in DC function, and DC-mediated T cell responses during T cell-mediated autoimmunity of the central nervous system using genetic ablation and pharmacological activation in mice and men to corroborate our data in a translational setting. In murine and human DCs, monomethyl fumarate induced Nrf2 signaling inhibits DC maturation and DC-mediated T cell proliferation by reducing inflammatory cytokine production and expression of costimulatory molecules. In contrast, Nrf2-deficient DCs generate more activated T helper cells (Th1/Th17 but fewer regulatory T cells and foster T cell proliferation. Transfer of DCs with Nrf2 activation during active EAE reduces disease severity and T cell infiltration. Our data demonstrate that Nrf2 signaling modulates autoimmunity in murine and human systems via inhibiting DC maturation and function thus shedding further light on the mechanism of action of antioxidative stress pathways in antigen-presenting cells.

  2. Red wine consumption increases antioxidant status and decreases oxidative stress in the circulation of both young and old humans

    Science.gov (United States)

    Micallef, Michelle; Lexis, Louise; Lewandowski, Paul

    2007-01-01

    Background Red wine contains a naturally rich source of antioxidants, which may protect the body from oxidative stress, a determinant of age-related disease. The current study set out to determine the in vivo effects of moderate red wine consumption on antioxidant status and oxidative stress in the circulation. Methods 20 young (18–30 yrs) and 20 older (≥ 50 yrs) volunteers were recruited. Each age group was randomly divided into treatment subjects who consumed 400 mL/day of red wine for two weeks, or control subjects who abstained from alcohol for two weeks, after which they crossed over into the other group. Blood samples were collected before and after red wine consumption and were used for analysis of whole blood glutathione (GSH), plasma malondialdehyde (MDA) and serum total antioxidant status. Results Results from this study show consumption of red wine induced significant increases in plasma total antioxidant status (P < 0.03), and significant decreases in plasma MDA (P < 0.001) and GSH (P < 0.004) in young and old subjects. The results show that the consumption of 400 mL/day of red wine for two weeks, significantly increases antioxidant status and decreases oxidative stress in the circulation Conclusion It may be implied from this data that red wine provides general oxidative protection and to lipid systems in circulation via the increase in antioxidant status. PMID:17888186

  3. The effect of circulating antigen on the biodistribution of the engineered human antibody hCTM01 in a nude mice model

    International Nuclear Information System (INIS)

    Davies, Q.; Perkins, A.C.; Frier, M.; Watson, S.; Lalani, E.N.; Symonds, E.M.

    1997-01-01

    Clinical studies are currently underway to assess the biodistribution and therapeutic potential of the genetically engineered human antibody hCTM01 directed against polymorphic epithelial mucin (PEM) in patients with ovarian carcinoma. The present study was undertaken to assess the effect of circulating PEM antigen on the biodistribution of the anti-PEM antibody in mice bearing MUC-1 transfected adenocarcinoma cell lines. Tumour xenografts were established from three cell lines: 413-BCR, which expressed antigen on the cell surface and also shed antigen into the circulation, E3P23, which expressed the antigen but did not shed into the circulation, and a negative control (410.4 MUCI). Groups of five mice were injected with 1.0 mg/kg antibody, imaged after 72 h and then sacrificed, followed by assay of tissue uptake. The results showed a clear difference in the tumour and liver uptake, with the non-secreting cell line showing almost twice the tumour uptake and approximately 20% of the liver uptake of the secreting cell line. (orig.). With 4 figs., 1 tab

  4. Nutrigenomics in human peripheral blood mononuclear cells : the effects of fatty acids on gene expression profiles of human circulating cells as assessed in human intervention studies

    NARCIS (Netherlands)

    Bouwens, M.

    2009-01-01

    Research on the effects of nutrition on the function and health of organs in the human body, such as liver and intestine, is difficult, because for this research organ tissue is needed. Since nutrition research is usually performed in healthy volunteers, this tissue is difficult to obtain. However,

  5. Erythroid precursors from patients with low-risk myelodysplasia demonstrate ultrastructural features of enhanced autophagy of mitochondria

    NARCIS (Netherlands)

    Houwerzijl, E. J.; Pol, H-W D.; Blom, N. R.; van der Want, J. J. L.; de Wolf, J. Thm; Vellenga, E.

    Recent studies in erythroid cells have shown that autophagy is an important process for the physiological clearance of mitochondria during terminal differentiation. However, autophagy also plays an important role in removing damaged and dysfunctional mitochondria. Defective mitochondria and impaired

  6. Non-erythroid alpha spectrin prevents telomere dysfunction after DNA interstrand cross-link damage

    OpenAIRE

    Zhang, Pan; Herbig, Utz; Coffman, Frederick; Lambert, Muriel W.

    2013-01-01

    Telomere integrity is critical for telomere function and genomic stability. We previously demonstrated that non-erythroid ?-spectrin (?IISp) is present in mammalian cell nuclei where it is important in repair of DNA interstrand cross-links (ICLs) and chromosome stability. We now demonstrate that ?IISp is also important for telomere maintenance after ICL damage. It localizes to telomeres in S phase after ICL damage where it has enhanced association with TRF1 and TRF2 and is required for recrui...

  7. Erythroid differentiation and commitment in rat erythroleukemia cells with hypertonic culture conditions.

    OpenAIRE

    Yamaguchi, Y; Kluge, N; Ostertag, W; Furusawa, M

    1981-01-01

    Cell cultures of 7,12-dimethylbenz[a]anthracene-induced rat erythroleukemia can be stimulated to synthesize hemoglobin when cultured in hypertonic media. During hypertonic treatment the intracellular osmotic conditions immediately readjust to those of the extracellular medium. None of the Friend virus-induced mouse erythroleukemia cell lines was inducible for differentiation with the same hypertonic culture conditions used for rat cells. Earliest commitment to erythroid terminal differentiati...

  8. The role of catechol-O-methyltransferase in catechol-enhanced erythroid differentiation of K562 cells.

    Science.gov (United States)

    Suriguga; Li, Xiao-Fei; Li, Yang; Yu, Chun-Hong; Li, Yi-Ran; Yi, Zong-Chun

    2013-12-15

    Catechol is widely used in pharmaceutical and chemical industries. Catechol is also one of phenolic metabolites of benzene in vivo. Our previous study showed that catechol improved erythroid differentiation potency of K562 cells, which was associated with decreased DNA methylation in erythroid specific genes. Catechol is a substrate for the catechol-O-methyltransferase (COMT)-mediated methylation. In the present study, the role of COMT in catechol-enhanced erythroid differentiation of K562 cells was investigated. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation and induced mRNA expression of erythroid specific genes in K562 cells. Treatment with catechol caused a time- and concentration-dependent increase in guaiacol concentration in the medium of cultured K562 cells. When COMT expression was knocked down by COMT shRNA expression in K562 cells, the production of guaiacol significantly reduced, and the sensitivity of K562 cells to cytotoxicity of catechol significantly increased. Knockdown of COMT expression by COMT shRNA expression also eliminated catechol-enhanced erythroid differentiation of K562 cells. In addition, the pre-treatment with methyl donor S-adenosyl-L-methionine or its demethylated product S-adenosyl-L-homocysteine induced a significant increase in hemin-induced Hb synthesis in K562 cells and the mRNA expression of erythroid specific genes. These findings indicated that O-methylation catalyzed by COMT acted as detoxication of catechol and involved in catechol-enhanced erythroid differentiation of K562 cells, and the production of S-adenosyl-L-homocysteine partly explained catechol-enhanced erythroid differentiation. © 2013.

  9. Polyherbal EMSA ERITIN Promotes Erythroid Lineages and Lymphocyte Migration in Irradiated Mice

    Directory of Open Access Journals (Sweden)

    Ibrahim Mansur

    2016-01-01

    Full Text Available Radiotherapy is commonly used to kill malignant cells, but it can significantly deplete hematopoietic and splenic erythroblasts. Radioprotective agents are therefore very important in clinical radiotherapy. We examined the effect of poly-herbal EMSA ERITIN on immunological responses when administered to sublethally irradiated mice with the aim of highlighting promotes erythroid lineages and lymphocytes migration in irradiated mice with the parameter are TER119+CD123+in bone marrow and SDF-1 in bone marrow and spleen organ. Normal BALB/c mice were sublethally irradiated with 600 rad. EMSA ERITIN was administered orally at different doses:(1.04, 3.125 and 9.375 mg/g body weight for 15 days. On day 16 erythroid lineages (TER-119+CD123+ were observed in bone marrow and lymphocytes migration by the production of SDF-1 in spleen and bone marrow. Lymphocytes migration was indicated by the production of SDF-1 in spleen and bone marrow using flow cytometry analysis. EMSA ERITIN increased the generation of erythroid lineage cells marked by TER119+CD123+ and promoted lymphocyte migration by increasing SDF-1 production in bone marrow and spleen. EMSA ERITIN appears to be a powerful medicinal herb with potential as a food supplement to normalize homeostasis and erythropoiesis after radiation.

  10. Genetic regulation of the variation of circulating insulin-like growth factors and leptin in human pedigrees.

    Science.gov (United States)

    Pantsulaia, Ia; Pantsulaia, I; Trofimov, Svetlana; Kobyliansky, Eugene; Livshits, Gregory

    2005-07-01

    Recent literature has shown that circulating levels of insulin-like growth factor I (IGF-I) and/or IGF binding proteins (IGF-BPs) may be of importance in the risk assessment of several chronic diseases including cancer, cardiovascular disease, diabetes mellitus and so on. The present study examined the extent of genetic and environmental influences on the populational variation of circulating IGF-I and IGF-BP-1 in apparently healthy and ethnically homogeneous white families. The plasma levels of each of the studied biochemical indices were determined by enzyme-linked immunoassay in 563 individuals aged 18 to 80 years. Quantitative genetic analysis showed that the IGF-I variation was appreciably attributable to genetic effects (47.1% +/- 9.0%), whereas for IGF-BP-1, only 23.3% +/- 7.8% of the interindividual variation was explained by genetic determinants. Common familial environment factors contributed significantly only to IGF-BP-1 variation (23.3% +/- 7.8%). In addition, we examined the covariations between these molecules and between them and IGF-BP-3 and leptin that were previously studied in the same sample. The analysis revealed that the pleiotropic genetic effects were significant for 2 pairs of traits, namely for IGF-I and IGF-BP-3, and for IGF-BP-1 and leptin. The bivariate heritability estimates were 0.21 +/- 0.04 and 0.15 +/- 0.05. The common environmental factors were consistently a significant source of correlation between all pairs (barring IGF-I and leptin) of the studied molecules; they were the sole predictors of correlation between IGF-I and IGF-BP-1, and between IGF-BP-1 and IGF-BP-3. Our results affirm the existence of specific and common genetic pathways that in combination determine a substantial proportion of the circulating variation of these molecules.

  11. Human rotavirus vaccine Rotarix™ provides protection against diverse circulating rotavirus strains in African infants: a randomized controlled trial

    Directory of Open Access Journals (Sweden)

    Steele Andrew

    2012-09-01

    Full Text Available Abstract Background Rotaviruses are the most important cause of severe acute gastroenteritis worldwide in children Rotarix™ significantly reduced severe rotavirus gastroenteritis episodes in a Phase III clinical trial conducted in infants in South Africa and Malawi. This paper examines rotavirus vaccine efficacy in preventing severe rotavirus gastroenteritis, during infancy, caused by the various G and P rotavirus types encountered during the first rotavirus-season. Methods Healthy infants aged 5–10 weeks were enrolled and randomized into three groups to receive either two (10 and 14 weeks or three doses of Rotarix™ (together forming the pooled Rotarix™ group or three doses of placebo at a 6,10,14-week schedule. Weekly home visits were conducted to identify gastroenteritis episodes. Rotaviruses were detected by ELISA and genotyped by RT-PCR and nucleotide sequencing. The percentage of infants with severe rotavirus gastroenteritis caused by the circulating G and P types from 2 weeks post-last dose until one year of age and the corresponding vaccine efficacy was calculated with 95% CI. Results Overall, 4939 infants were vaccinated and 4417 (pooled Rotarix™ = 2974; placebo = 1443 were included in the per protocol efficacy cohort. G1 wild-type was detected in 23 (1.6% severe rotavirus gastroenteritis episodes from the placebo group. This was followed in order of detection by G12 (15 [1%] in placebo and G8 types (15 [1%] in placebo. Vaccine efficacy against G1 wild-type, G12 and G8 types were 64.1% (95% CI: 29.9%; 82%, 51.5% (95% CI:-6.5%; 77.9% and 64.4% (95% CI: 17.1%; 85.2%, respectively. Genotype P[8] was the predominant circulating P type and was detected in 38 (2.6% severe rotavirus gastroenteritis cases in placebo group. The remaining circulating P types comprised of P[4] (20 [1.4%] in placebo and P[6] (13 [0.9%] in placebo. Vaccine efficacy against P[8] was 59.1% (95% CI: 32.8%; 75.3%, P[4] was 70.9% (95% CI: 37.5%; 87

  12. Human rotavirus vaccine Rotarix™ provides protection against diverse circulating rotavirus strains in African infants: a randomized controlled trial.

    Science.gov (United States)

    Steele, Andrew Duncan; Neuzil, Kathleen M; Cunliffe, Nigel A; Madhi, Shabir A; Bos, Pieter; Ngwira, Bagrey; Witte, Desiree; Todd, Stacy; Louw, Cheryl; Kirsten, Mari; Aspinall, Sanet; Van Doorn, Leen Jan; Bouckenooghe, Alain; Suryakiran, Pemmaraju V; Han, Htay Htay

    2012-09-13

    Rotaviruses are the most important cause of severe acute gastroenteritis worldwide in children rotavirus vaccine Rotarix™ significantly reduced severe rotavirus gastroenteritis episodes in a Phase III clinical trial conducted in infants in South Africa and Malawi. This paper examines rotavirus vaccine efficacy in preventing severe rotavirus gastroenteritis, during infancy, caused by the various G and P rotavirus types encountered during the first rotavirus-season. Healthy infants aged 5-10 weeks were enrolled and randomized into three groups to receive either two (10 and 14 weeks) or three doses of Rotarix™ (together forming the pooled Rotarix™ group) or three doses of placebo at a 6,10,14-week schedule. Weekly home visits were conducted to identify gastroenteritis episodes. Rotaviruses were detected by ELISA and genotyped by RT-PCR and nucleotide sequencing. The percentage of infants with severe rotavirus gastroenteritis caused by the circulating G and P types from 2 weeks post-last dose until one year of age and the corresponding vaccine efficacy was calculated with 95% CI. Overall, 4939 infants were vaccinated and 4417 (pooled Rotarix™ = 2974; placebo = 1443) were included in the per protocol efficacy cohort. G1 wild-type was detected in 23 (1.6%) severe rotavirus gastroenteritis episodes from the placebo group. This was followed in order of detection by G12 (15 [1%] in placebo) and G8 types (15 [1%] in placebo). Vaccine efficacy against G1 wild-type, G12 and G8 types were 64.1% (95% CI: 29.9%; 82%), 51.5% (95% CI:-6.5%; 77.9%) and 64.4% (95% CI: 17.1%; 85.2%), respectively. Genotype P[8] was the predominant circulating P type and was detected in 38 (2.6%) severe rotavirus gastroenteritis cases in placebo group. The remaining circulating P types comprised of P[4] (20 [1.4%] in placebo) and P[6] (13 [0.9%] in placebo). Vaccine efficacy against P[8] was 59.1% (95% CI: 32.8%; 75.3%), P[4] was 70.9% (95% CI: 37.5%; 87.0%) and P[6] was 55.2% (95% CI: -6

  13. Nuclear factor erythroid 2-related factor 2 deletion impairs glucose tolerance and exacerbates hyperglycemia in type 1 diabetic mice.

    Science.gov (United States)

    Aleksunes, Lauren M; Reisman, Scott A; Yeager, Ronnie L; Goedken, Michael J; Klaassen, Curtis D

    2010-04-01

    The transcription factor nuclear factor erythroid 2-related factor 2 (Nrf2) induces a battery of cytoprotective genes after oxidative stress. Nrf2 aids in liver regeneration by altering insulin signaling; however, whether Nrf2 participates in hepatic glucose homeostasis is unknown. Compared with wild-type mice, mice lacking Nrf2 (Nrf2-null) have lower basal serum insulin and prolonged hyperglycemia in response to an intraperitoneal glucose challenge. In the present study, blood glucose, serum insulin, urine flow rate, and hepatic expression of glucose-related genes were quantified in male diabetic wild-type and Nrf2-null mice. Type 1 diabetes was induced with a single intraperitoneal dose (200 mg/kg) of streptozotocin (STZ). Histopathology and serum insulin levels confirmed depleted pancreatic beta-cells in STZ-treated mice of both genotypes. Five days after STZ, Nrf2-null mice had higher blood glucose levels than wild-type mice. Nine days after STZ, polyuria occurred in both genotypes with more urine output from Nrf2-null mice (11-fold) than wild-type mice (7-fold). Moreover, STZ-treated Nrf2-null mice had higher levels of serum beta-hydroxybutyrate, triglycerides, and fatty acids 10 days after STZ compared with wild-type mice. STZ reduced hepatic glycogen in both genotypes, with less observed in Nrf2-null mice. Increased urine output and blood glucose in STZ-treated Nrf2-null mice corresponded with enhanced gluconeogenesis (glucose-6-phosphatase and phosphoenolpyruvate carboxykinase)- and reduced glycolysis (pyruvate kinase)-related mRNA expression in their livers. Furthermore, the Nrf2 activator oltipraz lowered blood glucose in wild-type but not Nrf2-null mice administered STZ. Collectively, these data indicate that the absence of Nrf2 worsens hyperglycemia in type I diabetic mice and Nrf2 may represent a therapeutic target for reducing circulating glucose levels.

  14. Red wine consumption increases antioxidant status and decreases oxidative stress in the circulation of both young and old humans

    Directory of Open Access Journals (Sweden)

    Lexis Louise

    2007-09-01

    Full Text Available Abstract Background Red wine contains a naturally rich source of antioxidants, which may protect the body from oxidative stress, a determinant of age-related disease. The current study set out to determine the in vivo effects of moderate red wine consumption on antioxidant status and oxidative stress in the circulation. Methods 20 young (18–30 yrs and 20 older (≥ 50 yrs volunteers were recruited. Each age group was randomly divided into treatment subjects who consumed 400 mL/day of red wine for two weeks, or control subjects who abstained from alcohol for two weeks, after which they crossed over into the other group. Blood samples were collected before and after red wine consumption and were used for analysis of whole blood glutathione (GSH, plasma malondialdehyde (MDA and serum total antioxidant status. Results Results from this study show consumption of red wine induced significant increases in plasma total antioxidant status (P Conclusion It may be implied from this data that red wine provides general oxidative protection and to lipid systems in circulation via the increase in antioxidant status.

  15. Characterization of the neuraminidase genes from human influenza A viruses circulating in Iran from 2010 to 2015.

    Science.gov (United States)

    Moasser, Elham; Behzadian, Farida; Moattari, Afagh; Fotouhi, Fatemeh; Zaraket, Hassan

    2018-02-01

    Characterization of influenza viruses is critical for detection of new emerging variants. Herein, we analyzed the genetic diversity and drug susceptibility of the neuraminidase gene (NAs) expressed by influenza A/H1N1pdm09 and A/H3N2 viruses circulating in Iran from 2010 to 2015. We genetically analyzed the NAs of 38 influenza A/H1N1pdm09 and 35 A/H3N2 isolates. The Iranian A/H1N1pdm09 viruses belonged to seven genogroups/subgenogroups, with the dominant groups being genogroups 6B and 6C. The A/H3N2 isolates fell into six gneogroups/subgenogroups, with the dominant genogroups being 3C and 3C.2a. The most common mutations detected among the A/H1N1pdm09 viruses included N44S, V106I, N200S, and N248D. All H1N1pdm09 viruses were genetically susceptible to the NAIs. However, one A/H1N1pdm09 virus from the 2013-2014 season possessed an NA-S247N mutation, which reduces the susceptibility to oseltamivir. In case of H3N2, none of the analyzed Iranian strains carried a substitution that might affect its susceptibility to NAIs. The ongoing evolution of influenza viruses and the detect of influenza viruses with reduced susceptibility to NAIs warrants continuous monitoring of the circulating strains.

  16. Circulating IGF-I and IGFBP3 levels control human colonic stem cell function and are disrupted in diabetic enteropathy

    Science.gov (United States)

    Maestroni, Anna; Jung, Peter; Orsenigo, Elena; Nasr, Moufida Ben; Tezza, Sara; Bassi, Roberto; Finzi, Giovanna; Marando, Alessandro; Vergani, Andrea; Frego, Roberto; Albarello, Luca; Andolfo, Annapaola; Manuguerra, Roberta; Viale, Edi; Staudacher, Carlo; Corradi, Domenico; Batlle, Eduard; Breault, David; Secchi, Antonio; Folli, Franco; Fiorina, Paolo

    2016-01-01

    Summary The role of circulating factors in regulating colonic stem cells (CoSCs) and colonic epithelial homeostasis is unclear. Individuals with long-standing type 1 diabetes (T1D) frequently have intestinal symptoms, termed diabetic enteropathy (DE), though its etiology is unknown. Here, we report T1D patients with DE exhibit abnormalities in their intestinal mucosa and CoSCs, which fail to generate in vitro mini-guts. Proteomic profiling of T1D+DE patient serum revealed altered levels of insulin-like growth factor 1 (IGF-1) and its binding protein-3 (IGFBP3). IGFBP3 prevented in vitro growth of patient-derived organoids via binding its receptor TMEM219, in an IGF-1-independent manner, and disrupted in vivo CoSC function in a preclinical DE model. Restoration of normoglycemia in patients with long-standing T1D via kidney-pancreas transplantation or in diabetic mice by treatment with an ecto-TMEM219 recombinant protein normalized circulating IGF-1/IGFBP3 levels and reestablished CoSC homeostasis. These findings demonstrate that peripheral IGF-1/IGFBP3 control CoSCs and their dysfunction in DE. PMID:26431183

  17. Human circulating plasma DNA significantly decreases while lymphocyte DNA damage increases under chronic occupational exposure to low-dose gamma-neutron and tritium β-radiation

    Energy Technology Data Exchange (ETDEWEB)

    Korzeneva, Inna B., E-mail: inna.korzeneva@molgen.vniief.ru [Russian Federal Nuclear Center – All-Russian Research Institute of Experimental Physics (RFNC-VNIIEF) 607190, Sarov, 37 Mira ave., Nizhniy Novgorod Region (Russian Federation); Kostuyk, Svetlana V.; Ershova, Liza S. [Research Centre for Medical Genetics, Russian Academy of Medical Sciences, 115478 Moscow, 1 Moskvorechye str. (Russian Federation); Osipov, Andrian N. [Federal Medial and Biological Center named after Burnazyan of the Federal Medical and Biological Agency (FMBTz named after Burnazyan of FMBA), Moscow (Russian Federation); State Research Center - Burnasyan Federal Medical Biophysical Center of Federal Medical Biological Agency, Zhivopisnaya, 46, Moscow, 123098 (Russian Federation); Zhuravleva, Veronika F.; Pankratova, Galina V. [Russian Federal Nuclear Center – All-Russian Research Institute of Experimental Physics (RFNC-VNIIEF) 607190, Sarov, 37 Mira ave., Nizhniy Novgorod Region (Russian Federation); Porokhovnik, Lev N.; Veiko, Natalia N. [Research Centre for Medical Genetics, Russian Academy of Medical Sciences, 115478 Moscow, 1 Moskvorechye str. (Russian Federation)

    2015-09-15

    Highlights: • The chronic exposure to low-dose IR induces DSBs in human lymphocytes (TM index). • Exposure to IR decreases the level of human circulating DNA (cfDNA index). • IR induces an increase of DNase1 activity (DNase1 index) in plasma. • IR induces an increase of the level of antibodies to DNA (Ab DNA index) in plasma. • The ratio cfDNA/(DNase 1 × Ab DNA × TM) is a potential marker of human exposure to IR. - Abstract: The blood plasma of healthy people contains cell-fee (circulating) DNA (cfDNA). Apoptotic cells are the main source of the cfDNA. The cfDNA concentration increases in case of the organism’s cell death rate increase, for example in case of exposure to high-dose ionizing radiation (IR). The objects of the present research are the blood plasma and blood lymphocytes of people, who contacted occupationally with the sources of external gamma/neutron radiation or internal β-radiation of tritium N = 176). As the controls (references), blood samples of people, who had never been occupationally subjected to the IR sources, were used (N = 109). With respect to the plasma samples of each donor there were defined: the cfDNA concentration (the cfDNA index), DNase1 activity (the DNase1 index) and titre of antibodies to DNA (the Ab DNA index). The general DNA damage in the cells was defined (using the Comet assay, the tail moment (TM) index). A chronic effect of the low-dose ionizing radiation on a human being is accompanied by the enhancement of the DNA damage in lymphocytes along with a considerable cfDNA content reduction, while the DNase1 content and concentration of antibodies to DNA (Ab DNA) increase. All the aforementioned changes were also observed in people, who had not worked with the IR sources for more than a year. The ratio cfDNA/(DNase1 × Ab DNA × TM) is proposed to be used as a marker of the chronic exposure of a person to the external low-dose IR. It was formulated the assumption that the joint analysis of the cfDNA, DNase1, Ab

  18. Natural killer cells recognize friend retrovirus-infected erythroid progenitor cells through NKG2D-RAE-1 interactions In Vivo.

    Science.gov (United States)

    Ogawa, Tatsuya; Tsuji-Kawahara, Sachiyo; Yuasa, Takae; Kinoshita, Saori; Chikaishi, Tomomi; Takamura, Shiki; Matsumura, Haruo; Seya, Tsukasa; Saga, Toshihiko; Miyazawa, Masaaki

    2011-06-01

    Natural killer (NK) cells function as early effector cells in the innate immune defense against viral infections and also participate in the regulation of normal and malignant hematopoiesis. NK cell activities have been associated with early clearance of viremia in experimental simian immunodeficiency virus and clinical human immunodeficiency virus type 1 (HIV-1) infections. We have previously shown that NK cells function as major cytotoxic effector cells in vaccine-induced immune protection against Friend virus (FV)-induced leukemia, and NK cell depletion totally abrogates the above protective immunity. However, how NK cells recognize retrovirus-infected cells remains largely unclear. The present study demonstrates a correlation between the expression of the products of retinoic acid early transcript-1 (RAE-1) genes in target cells and their susceptibility to killing by NK cells isolated from FV-infected animals. This killing was abrogated by antibodies blocking the NKG2D receptor in vitro. Further, the expression of RAE-1 proteins on erythroblast surfaces increased early after FV inoculation, and administration of an RAE-1-blocking antibody resulted in increased spleen infectious centers and exaggerated pathology, indicating that FV-infected erythroid cells are recognized by NK cells mainly through the NKG2D-RAE-1 interactions in vivo. Enhanced retroviral replication due to host gene-targeting resulted in markedly increased RAE-1 expression in the absence of massive erythroid cell proliferation, indicating a direct role of retroviral replication in RAE-1 upregulation.

  19. Thrombopoietin has a differentiative effect on late-stage human erythropoiesis.

    Science.gov (United States)

    Liu, W; Wang, M; Tang, D C; Ding, I; Rodgers, G P

    1999-05-01

    To further explore the mechanism of the effect of thrombopoietin (TPO) on erythropoiesis, we used a two-phase culture system to investigate the effect of TPO on late-stage human erythroid lineage differentiation. In serum-free suspension and semisolid cultures of human peripheral blood derived erythroid progenitors, TPO alone did not produce benzidine-positive cells. However, in serum-containing culture, TPO alone stimulated erythroid cell proliferation and differentiation, demonstrated by erythroid colony formation, production of benzidine-positive cells and haemoglobin (Hb) synthesis. Monoclonal anti-human erythropoietin antibody and anti-human erythropoietin receptor antibody completely abrogated the erythroid differentiative ability of TPO in the serum-containing systems. This implied that binding of EPO and EPO-R was essential for erythropoiesis and the resultant signal transduction may be augmented by the signals emanating from TPO-c-Mpl interaction. Experiment of withdrawal of TPO further demonstrated the involvement of TPO in late-stage erythropoiesis. RT-PCR results showed that there was EPO-R but not c-Mpl expression on developing erythroblasts induced by TPO in serum-containing system. Our results establish that TPO affects not only the proliferation of erythroid progenitors but also the differentiation of erythroid progenitors to mature erythroid cells.

  20. Functional contribution of elevated circulating and hepatic non-classical CD14CD16 monocytes to inflammation and human liver fibrosis.

    Directory of Open Access Journals (Sweden)

    Henning W Zimmermann

    Full Text Available BACKGROUND: Monocyte-derived macrophages critically perpetuate inflammatory responses after liver injury as a prerequisite for organ fibrosis. Experimental murine models identified an essential role for the CCR2-dependent infiltration of classical Gr1/Ly6C(+ monocytes in hepatic fibrosis. Moreover, the monocyte-related chemokine receptors CCR1 and CCR5 were recently recognized as important fibrosis modulators in mice. In humans, monocytes consist of classical CD14(+CD16(- and non-classical CD14(+CD16(+ cells. We aimed at investigating the relevance of monocyte subpopulations for human liver fibrosis, and hypothesized that 'non-classical' monocytes critically exert inflammatory as well as profibrogenic functions in patients during liver disease progression. METHODOLOGY/PRINCIPAL FINDINGS: We analyzed circulating monocyte subsets from freshly drawn blood samples of 226 patients with chronic liver disease (CLD and 184 healthy controls by FACS analysis. Circulating monocytes were significantly expanded in CLD-patients compared to controls with a marked increase of the non-classical CD14(+CD16(+ subset that showed an activated phenotype in patients and correlated with proinflammatory cytokines and clinical progression. Correspondingly, CD14(+CD16(+ macrophages massively accumulated in fibrotic/cirrhotic livers, as evidenced by immunofluorescence and FACS. Ligands of monocyte-related chemokine receptors CCR2, CCR1 and CCR5 were expressed at higher levels in fibrotic and cirrhotic livers, while CCL3 and CCL4 were also systemically elevated in CLD-patients. Isolated monocyte/macrophage subpopulations were functionally characterized regarding cytokine/chemokine expression and interactions with primary human hepatic stellate cells (HSC in vitro. CD14(+CD16(+ monocytes released abundant proinflammatory cytokines. Furthermore, CD14(+CD16(+, but not CD14(+CD16(- monocytes could directly activate collagen-producing HSC. CONCLUSIONS/SIGNIFICANCE: Our data

  1. Lower numbers of circulating natural killer T (NK T) cells in individuals with human T lymphotropic virus type 1 (HTLV-1) associated neurological disease

    Science.gov (United States)

    Ndhlovu, L C; Snyder-Cappione, J E; Carvalho, K I; Leal, F E; Loo, C P; bruno, F R; Jha, A R; Devita, D; Hasenkrug, A M; Barbosa, H M R; Segurado, A C; Nixon, D F; Murphy, E L; Kallas, E G

    2009-01-01

    Human T lymphotropic virus type 1 (HTLV-1) infects 10–20 million people worldwide. The majority of infected individuals are asymptomatic; however, approximately 3% develop the debilitating neurological disease HTLV-1-associated myelopathy/tropical spastic paraparesis (HAM/TSP). There is also currently no cure, vaccine or effective therapy for HTLV-1 infection, and the mechanisms for progression to HAM/TSP remain unclear. NK T cells are an immunoregulatory T cell subset whose frequencies and effector functions are associated critically with immunity against infectious diseases. We hypothesized that NK T cells are associated with HAM/TSP progression. We measured NK T cell frequencies and absolute numbers in individuals with HAM/TSP infection from two cohorts on two continents: São Paulo, Brazil and San Francisco, CA, USA, and found significantly lower levels when compared with healthy subjects and/or asymptomatic carriers. Also, the circulating NK T cell compartment in HAM/TSP subjects is comprised of significantly more CD4+ and fewer CD8+ cells than healthy controls. These findings suggest that lower numbers of circulating NK T cells and enrichment of the CD4+ NK T subset are associated with HTLV-1 disease progression. PMID:19778295

  2. In Vitro Large Scale Production of Human Mature Red Blood Cells from Hematopoietic Stem Cells by Coculturing with Human Fetal Liver Stromal Cells

    Directory of Open Access Journals (Sweden)

    Jiafei Xi

    2013-01-01

    Full Text Available In vitro models of human erythropoiesis are useful in studying the mechanisms of erythroid differentiation in normal and pathological conditions. Here we describe an erythroid liquid culture system starting from cord blood derived hematopoietic stem cells (HSCs. HSCs were cultured for more than 50 days in erythroid differentiation conditions and resulted in a more than 109-fold expansion within 50 days under optimal conditions. Homogeneous erythroid cells were characterized by cell morphology, flow cytometry, and hematopoietic colony assays. Furthermore, terminal erythroid maturation was improved by cosculturing with human fetal liver stromal cells. Cocultured erythroid cells underwent multiple maturation events, including decrease in size, increase in glycophorin A expression, and nuclear condensation. This process resulted in extrusion of the pycnotic nuclei in up to 80% of the cells. Importantly, they possessed the capacity to express the adult definitive β-globin chain upon further maturation. We also show that the oxygen equilibrium curves of the cord blood-differentiated red blood cells (RBCs are comparable to normal RBCs. The large number and purity of erythroid cells and RBCs produced from cord blood make this method useful for fundamental research in erythroid development, and they also provide a basis for future production of available RBCs for transfusion.

  3. Circulating CD14brightCD16+ 'intermediate' monocytes exhibit enhanced parasite pattern recognition in human helminth infection.

    Directory of Open Access Journals (Sweden)

    Joseph D Turner

    2014-04-01

    Full Text Available Circulating monocyte sub-sets have recently emerged as mediators of divergent immune functions during infectious disease but their role in helminth infection has not been investigated. In this study we evaluated whether 'classical' (CD14brightCD16-, 'intermediate' (CD14brightCD16+, and 'non-classical' (CD14dimCD16+ monocyte sub-sets from peripheral blood mononuclear cells varied in both abundance and ability to bind antigenic material amongst individuals living in a region of Northern Senegal which is co-endemic for Schistosoma mansoni and S. haematobium. Monocyte recognition of excretory/secretory (E/S products released by skin-invasive cercariae, or eggs, of S. mansoni was assessed by flow cytometry and compared between S. mansoni mono-infected, S. mansoni and S. haematobium co-infected, and uninfected participants. Each of the three monocyte sub-sets in the different infection groups bound schistosome E/S material. However, 'intermediate' CD14brightCD16+ monocytes had a significantly enhanced ability to bind cercarial and egg E/S. Moreover, this elevation of ligand binding was particularly evident in co-infected participants. This is the first demonstration of modulated parasite pattern recognition in CD14brightCD16+ intermediate monocytes during helminth infection, which may have functional consequences for the ability of infected individuals to respond immunologically to infection.

  4. Diversity and Adaptation of Human Respiratory Syncytial Virus Genotypes Circulating in Two Distinct Communities: Public Hospital and Day Care Center

    Directory of Open Access Journals (Sweden)

    Gustavo Rocha Garcia

    2012-10-01

    Full Text Available HRSV is one of the most important pathogens causing acute respiratory tract diseases as bronchiolitis and pneumonia among infants. HRSV was isolated from two distinct communities, a public day care center and a public hospital in São José do Rio Preto – SP, Brazil. We obtained partial sequences from G gene that were used on phylogenetic and selection pressure analysis. HRSV accounted for 29% of respiratory infections in hospitalized children and 7.7% in day care center children. On phylogenetic analysis of 60 HRSV strains, 48 (80% clustered within or adjacent to the GA1 genotype; GA5, NA1, NA2, BA-IV and SAB1 were also observed. SJRP GA1 strains presented variations among deduced amino acids composition and lost the potential O-glycosilation site at amino acid position 295, nevertheless this resulted in an insertion of two potential O-glycosilation sites at positions 296 and 297. Furthermore, a potential O-glycosilation site insertion, at position 293, was only observed for hospital strains. Using SLAC and MEME methods, only amino acid 274 was identified to be under positive selection. This is the first report on HRSV circulation and genotypes classification derived from a day care center community in Brazil.

  5. Generation of erythroid cells from polyploid giant cancer cells: re-thinking about tumor blood supply.

    Science.gov (United States)

    Yang, Zhigang; Yao, Hong; Fei, Fei; Li, Yuwei; Qu, Jie; Li, Chunyuan; Zhang, Shiwu

    2018-04-01

    During development and tumor progression, cells need a sufficient blood supply to maintain development and rapid growth. It is reported that there are three patterns of blood supply for tumor growth: endothelium-dependent vessels, mosaic vessels, and vasculogenic mimicry (VM). VM was first reported in highly aggressive uveal melanomas, with tumor cells mimicking the presence and function of endothelial cells forming the walls of VM vessels. The walls of mosaic vessels are randomly lined with both endothelial cells and tumor cells. We previously proposed a three-stage process, beginning with VM, progressing to mosaic vessels, and eventually leading to endothelium-dependent vessels. However, many phenomena unique to VM channel formation remain to be elucidated, such as the origin of erythrocytes before VM vessels connect with endothelium-dependent vessels. In adults, erythroid cells are generally believed to be generated from hematopoietic stem cells in the bone marrow. In contrast, embryonic tissue obtains oxygen through formation of blood islands, which are largely composed of embryonic hemoglobin with a higher affinity with oxygen, in the absence of mature erythrocytes. Recent data from our laboratory suggest that embryonic blood-forming mechanisms also exist in cancer tissue, particularly when these tissues are under environmental stress such as hypoxia. We review the evidence from induced pluripotent stem cells in vitro and in vivo to support this previously underappreciated cell functionality in normal and cancer cells, including the ability to generate erythroid cells. We will also summarize the current understanding of tumor angiogenesis, VM, and our recent work on polyploid giant cancer cells, with emphasis on their ability to generate erythroid cells and their association with tumor growth under hypoxia. An alternative embryonic pathway to obtain oxygen in cancer cells exists, particularly when they are under hypoxic conditions.

  6. Gamma-interferon alters globin gene expression in neonatal and adult erythroid cells

    International Nuclear Information System (INIS)

    Miller, B.A.; Perrine, S.P.; Antognetti, G.; Perlmutter, D.H.; Emerson, S.G.; Sieff, C.; Faller, D.V.

    1987-01-01

    The effect of gamma-interferon on fetal hemoglobin synthesis by purified cord blood, fetal liver, and adult bone marrow erythroid progenitors was studied with a radioligand assay to measure hemoglobin production by BFU-E-derived erythroblasts. Coculture with recombinant gamma-interferon resulted in a significant and dose-dependent decrease in fetal hemoglobin production by neonatal and adult, but not fetal, BFU-E-derived erythroblasts. Accumulation of fetal hemoglobin by cord blood BFU-E-derived erythroblasts decreased up to 38.1% of control cultures (erythropoietin only). Synthesis of both G gamma/A gamma globin was decreased, since the G gamma/A gamma ratio was unchanged. Picograms fetal hemoglobin per cell was decreased by gamma-interferon addition, but picograms total hemoglobin was unchanged, demonstrating that a reciprocal increase in beta-globin production occurred in cultures treated with gamma-interferon. No toxic effect of gamma-interferon on colony growth was noted. The addition of gamma-interferon to cultures resulted in a decrease in the percentage of HbF produced by adult BFU-E-derived cells to 45.6% of control. Fetal hemoglobin production by cord blood, fetal liver, and adult bone marrow erythroid progenitors, was not significantly affected by the addition of recombinant GM-CSF, recombinant interleukin 1 (IL-1), recombinant IL-2, or recombinant alpha-interferon. Although fetal progenitor cells appear unable to alter their fetal hemoglobin program in response to any of the growth factors added here, the interaction of neonatal and adult erythroid progenitors with gamma-interferon results in an altered expression of globin genes

  7. In vitro culture and characterization of human lung cancer circulating tumor cells isolated by size exclusion from an orthotopic nude-mouse model expressing fluorescent protein.

    Science.gov (United States)

    Kolostova, Katarina; Zhang, Yong; Hoffman, Robert M; Bobek, Vladimir

    2014-09-01

    In the present study, we demonstrate an animal model and recently introduced size-based exclusion method for circulating tumor cells (CTCs) isolation. The methodology enables subsequent in vitro CTC-culture and characterization. Human lung cancer cell line H460, expressing red fluorescent protein (H460-RFP), was orthotopically implanted in nude mice. CTCs were isolated by a size-based filtration method and successfully cultured in vitro on the separating membrane (MetaCell®), analyzed by means of time-lapse imaging. The cultured CTCs were heterogeneous in size and morphology even though they originated from a single tumor. The outer CTC-membranes were blebbing in general. Abnormal mitosis resulting in three daughter cells was frequently observed. The expression of RFP ensured that the CTCs originated from lung tumor. These readily isolatable, identifiable and cultivable CTCs can be used to characterize individual patient cancers and for screening of more effective treatment.

  8. Iron overload promotes erythroid apoptosis through regulating HIF-1a/ROS signaling pathway in patients with myelodysplastic syndrome.

    Science.gov (United States)

    Zheng, Qing-Qing; Zhao, You-Shan; Guo, Juan; Zhao, Si-da; Song, Lu-Xi; Fei, Cheng-Ming; Zhang, Zheng; Li, Xiao; Chang, Chun-Kang

    2017-07-01

    Erythroid apoptosis increases significantly in myelodysplastic syndrome (MDS) patients with iron overload, but the underlying mechanism is not fully clear. In this study, we aim to explore the effect of HIF-1a/ROS on erythroid apoptosis in MDS patients with iron overload. We found that iron overload injured cellular functions through up-regulating ROS levels in MDS/AML cells, including inhibited cell viability, increased cell apoptosis and blocked cell cycle at G0/G1 phase. Interestingly, overexpression of hypoxia inducible factor-1a (HIF-1a), which was under-expressed in iron overload models, reduced ROS levels and attenuated cell damage caused by iron overload in MDS/AML cells. And gene knockdown of HIF-1a got the similar results as iron overload in MDS/AML cells. Furthermore, iron overload caused high erythroid apoptosis was closely related with ROS in MDS patients. Importantly, the HIF-1a protein levels of erythrocytes elevated obviously after incubation with desferrioxamine (DFO) from MDS patients with iron overload, accompanied by ROS levels inhibited and erythroid apoptosis reduced. Taken together, our findings determine that the HIF-1a/ROS signaling pathway plays a key role in promoting erythroid apoptosis in MDS patients with iron overload. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. Proteomic analysis of erythroid differentiation induced by hexamethylene bisacetamide in murine erythroleukemia cells

    Czech Academy of Sciences Publication Activity Database

    Petrák, J.; Myslivcová, D.; Man, Petr; Čmejlová, J.; Čmejla, R.; Vyoral, D.

    2007-01-01

    Roč. 35, - (2007), s. 193-202 ISSN 0301-472X R&D Projects: GA MŠk LC545 Grant - others:CZ(CZ) 023736; GA ČR(CZ) GA303/04/0003; GA MŠk(CZ) LC06044 Institutional research plan: CEZ:AV0Z50200510 Source of funding: V - iné verejné zdroje ; V - iné verejné zdroje ; V - iné verejné zdroje Keywords : murine erythroleukemia cells * erythroid differentiation * hexamethylene bisacetamide Subject RIV: EE - Microbiology, Virology Impact factor: 3.147, year: 2007

  10. PRV-1, erythroid colonies and platelet Mpl are unrelated to thrombosis in essential thrombocythaemia

    DEFF Research Database (Denmark)

    Vannucchi, Alessandro M; Pancrazzi, Alessandro; Antonioli, Elisabetta

    2004-01-01

    markers of ET, namely PRV-1 overexpression, endogenous erythroid colony (EEC) formation, and reduced platelet Mpl content. Fifty-three (60%) of 88 subjects studied had monoclonal myelopoiesis and presented a 32% incidence of major thrombosis compared with 6% of polyclonal subjects (P = 0.......009). The frequency of abnormalities of PRV-1, EEC, or Mpl was similar in monoclonal and polyclonal subjects (respectively, 28%, 48%, 75%, and 37%, 27%, 63%), and none of them correlated with thrombosis. We conclude that the exploited epigenetic markers constitute independent phenotypic variations...

  11. Extended flow cytometry characterization of normal bone marrow progenitor cells by simultaneous detection of aldehyde dehydrogenase and early hematopoietic antigens: implication for erythroid differentiation studies

    Directory of Open Access Journals (Sweden)

    Pascariello Caterina

    2008-05-01

    Full Text Available Abstract Background Aldehyde dehydrogenase (ALDH is a cytosolic enzyme highly expressed in hematopoietic precursors from cord blood and granulocyte-colony stimulating factor mobilized peripheral blood, as well as in bone marrow from patients with acute myeloblastic leukemia. As regards human normal bone marrow, detailed characterization of ALDH+ cells has been addressed by one single study (Gentry et al, 2007. The goal of our work was to provide new information about the dissection of normal bone marrow progenitor cells based upon the simultaneous detection by flow cytometry of ALDH and early hematopoietic antigens, with particular attention to the expression of ALDH on erythroid precursors. To this aim, we used three kinds of approach: i multidimensional analytical flow cytometry, detecting ALDH and early hematopoietic antigens in normal bone marrow; ii fluorescence activated cell sorting of distinct subpopulations of progenitor cells, followed by in vitro induction of erythroid differentiation; iii detection of ALDH+ cellular subsets in bone marrow from pure red cell aplasia patients. Results In normal bone marrow, we identified three populations of cells, namely ALDH+CD34+, ALDH-CD34+ and ALDH+CD34- (median percentages were 0.52, 0.53 and 0.57, respectively. As compared to ALDH-CD34+ cells, ALDH+CD34+ cells expressed the phenotypic profile of primitive hematopoietic progenitor cells, with brighter expression of CD117 and CD133, accompanied by lower display of CD38 and CD45RA. Of interest, ALDH+CD34- population disclosed a straightforward erythroid commitment, on the basis of three orders of evidences. First of all, ALDH+CD34- cells showed a CD71bright, CD105+, CD45- phenotype. Secondly, induction of differentiation experiments evidenced a clear-cut expression of glycophorin A (CD235a. Finally, ALDH+CD34- precursors were not detectable in patients with pure red cell aplasia (PRCA. Conclusion Our study, comparing surface antigen expression of

  12. A novel dendritic cell-based direct ex vivo assay for detection and enumeration of circulating antigen-specific human T cells.

    Science.gov (United States)

    Carrio, Roberto; Zhang, Ge; Drake, Donald R; Schanen, Brian C

    2018-05-07

    Although a variety of assays have been used to examine T cell responses in vitro, standardized ex vivo detection of antigen-specific CD4 + T cells from human circulatory PBMCs remains constrained by low-dimensional characterization outputs and the need for polyclonal, mitogen-induced expansion methods to generate detectable response signals. To overcome these limitations, we developed a novel methodology utilizing antigen-pulsed autologous human dendritic target cells in a rapid and sensitive assay to accurately enumerate antigen-specific CD4 + T cell precursor frequency by multiparametric flow cytometry. With this approach, we demonstrate the ability to reproducibly quantitate poly-functional T cell responses following both primary and recall antigenic stimulation. Furthermore, this approach enables more comprehensive phenotypic profiling of circulating antigen-specific CD4 + T cells, providing valuable insights into the pre-existing polarization of antigen-specific T cells in humans. Combined, this approach permits sensitive and detailed ex vivo detection of antigen-specific CD4 + T cells delivering an important tool for advancing vaccine, immune-oncology and other therapeutic studies.

  13. Human eosinophils express, relative to other circulating leukocytes, large amounts of secretory 14-kD phospholipase A2

    NARCIS (Netherlands)

    Blom, M.; Tool, A. T.; Wever, P. C.; Wolbink, G. J.; Brouwer, M. C. [=Maria Clara; Calafat, J.; Egesten, A.; Knol, E. F.; Hack, C. E.; Roos, D.; Verhoeven, A. J.

    1998-01-01

    Human eosinophils perform several functions dependent on phospholipase A2 (PLA2) activity, most notably the synthesis of platelet-activating factor (PAF) and leukotriene C4 (LTC4). Several forms of PLA2 have been identified in mammalian cells. In the present study, the 14-kD, secretory form of PLA2

  14. Erythroid cells in vitro: from developmental biology to blood transfusion products.

    Science.gov (United States)

    Migliaccio, Anna Rita; Whitsett, Carolyn; Migliaccio, Giovanni

    2009-07-01

    Red blood cells (RBCs) transfusion plays a critical role in numerous therapies. Disruption of blood collection by political unrest, natural disasters and emerging infections and implementation of restrictions on the use of erythropoiesis-stimulating agents in cancer may impact blood availability in the near future. These considerations highlight the importance of developing alternative blood products. Knowledge about the processes that control RBC production has been applied to the establishment of culture conditions allowing ex-vivo generation of RBCs in numbers close to those (2.5 x 10 cells/ml) present in a transfusion, from cord blood, donated blood units or embryonic stem cells. In addition, experimental studies demonstrate that such cells protect mice from lethal bleeding. Therefore, erythroid cells generated ex vivo may be suitable for transfusion provided they can be produced safely in adequate numbers. However, much remains to be done to translate a theoretical production of approximately 2.5 x 10 RBCs in the laboratory into a 'clinical grade production process'. This review summarizes the state-of-the-art in establishing ex-vivo culture conditions for erythroid cells and discusses the most compelling issues to be addressed to translate this progress into a clinical grade transfusion product.

  15. Circulating CXCR5⁺CD4⁺ T Follicular-Like Helper Cell and Memory B Cell Responses to Human Papillomavirus Vaccines.

    Directory of Open Access Journals (Sweden)

    Ken Matsui

    Full Text Available Through the interaction of T follicular helper (Tfh cells and B cells, efficacious vaccines can generate high-affinity, pathogen-neutralizing antibodies, and memory B cells. Using CXCR5, CXCR3, CCR6, CCR7, PD1, and ICOS as markers, Tfh-like cells can be identified in the circulation and be classified into three functionally distinct subsets that are PD1+ICOS+, PD1+ ICOS-, or PD1-ICOS-. We used these markers to identify different subsets of CXCR5+CD4+ Tfh-like cells in response to highly immunogenic and efficacious vaccines for human papillomaviruses (HPV: Cervarix and Gardasil. In this small study, we used PBMC samples from 11 Gardasil recipients, and 8 Cervarix recipients from the Vaccine Research Center 902 Study to examine the induction of circulating Tfh-like cells and IgD-CD38HiCD27+ memory B cells by flow cytometry. PD1+ICOS+ CXCR3+CCR6-CXCR5+CD4+ (Tfh1-like cells were induced and peaked on Day (D 7 post-first vaccination, but not as much on D7 post-third vaccination. We also observed a trend toward increase in PD1+ICOS+ CXCR3-CCR6-CXCR5+CD4+ (Tfh2-like cells for both vaccines, and PD1+ICOS+ CXCR3-CCR6+CXCR5+CD4+ (Tfh17-like subset was induced by Cervarix post-first vaccination. There were also minimal changes in the other cellular subsets. In addition, Cervarix recipients had more memory B cells post-first vaccination than did Gardasil recipients at D14 and D30. We found frequencies of memory B cells at D30 correlated with anti-HPV16 and 18 antibody titers from D30, and the induction levels of memory B cells at D30 and PD1+ICOS+Tfh1-like cells at D7 post-first vaccination correlated for Cervarix. Our study showed that induction of circulating CXCR5+CD4+ Tfh-like subsets can be detected following immunization with HPV vaccines, and potentially be useful as a marker of immunogenicity of vaccines. However, further investigations should be extended to different cohorts with larger sample size to better understand the functions of these T

  16. Genetic variability of human respiratory syncytial virus A strains circulating in Ontario: a novel genotype with a 72 nucleotide G gene duplication.

    Directory of Open Access Journals (Sweden)

    Alireza Eshaghi

    Full Text Available Human respiratory syncytial virus (HRSV is the main cause of acute lower respiratory infections in children under 2 years of age and causes repeated infections throughout life. We investigated the genetic variability of RSV-A circulating in Ontario during 2010-2011 winter season by sequencing and phylogenetic analysis of the G glycoprotein gene.Among the 201 consecutive RSV isolates studied, RSV-A (55.7% was more commonly observed than RSV-B (42.3%. 59.8% and 90.1% of RSV-A infections were among children ≤12 months and ≤5 years old, respectively. On phylogenetic analysis of the second hypervariable region of the 112 RSV-A strains, 110 (98.2% clustered within or adjacent to the NA1 genotype; two isolates were GA5 genotype. Eleven (10% NA1-related isolates clustered together phylogenetically as a novel RSV-A genotype, named ON1, containing a 72 nucleotide duplication in the C-terminal region of the attachment (G glycoprotein. The predicted polypeptide is lengthened by 24 amino acids and includes a23 amino acid duplication. Using RNA secondary structural software, a possible mechanism of duplication occurrence was derived. The 23 amino acid ON1 G gene duplication results in a repeat of 7 potential O-glycosylation sites including three O-linked sugar acceptors at residues 270, 275, and 283. Using Phylogenetic Analysis by Maximum Likelihood analysis, a total of 19 positively selected sites were observed among Ontario NA1 isolates; six were found to be codons which reverted to the previous state observed in the prototype RSV-A2 strain. The tendency of codon regression in the G-ectodomain may infer a decreased avidity of antibody to the current circulating strains. Further work is needed to document and further understand the emergence, virulence, pathogenicity and transmissibility of this novel RSV-A genotype with a72 nucleotide G gene duplication.

  17. Human leptospirosis in Tanzania: sequencing and phylogenetic analysis confirm that pathogenic Leptospira species circulate among agro-pastoralists living in Katavi-Rukwa ecosystem.

    Science.gov (United States)

    Muller, Shabani K; Assenga, Justine A; Matemba, Lucas E; Misinzo, Gerald; Kazwala, Rudovick R

    2016-06-10

    Leptospirosis is a neglected zoonotic disease of worldwide public health importance. The disease affects humans, domestic animals and wildlife. However, leptospirosis is challenging in its diagnosis in humans. Culture technique, which is time consuming, is not recommended for clinical diagnosis. For these reasons, serological and molecular techniques remain the test of choice. The major objective of this study was to explore the genetic characteristic of Leptospira species which are prevalent among agro-pastoralists living in Katavi-Rukwa Ecosystem, Tanzania. A cross-sectional epidemiological study was carried out in the Katavi-Region South-west, Tanzania between August, 2013 and November, 2014. A total of 267 participants were randomly recruited for the study. Microscopic agglutination test (MAT) was used to detect antibody against six Leptospira antigens including local serogroups Icterohaemorrhagiae, Ballum, Grippotyphosa, Sejroe and reference serogroups Hebdomadis, and Australis. Samples with MAT titers ≥ 1:160 were scored as positive, samples with MAT titers ranging from 1:20 to 1:80 were scored as exposed to Leptospira, and absence of agglutination titers was scored as negative. All MAT positive samples, including the low titre samples were subjected to PCR using the respective 16S rRNA primers for the pathogenic and non-pathogenic species. Out of 267 samples tested, 80 (29.9 %) were positive with MAT. The major circulating leptospiral serogroups were Sejroe (15.7 %,), Icterohaemorrhagiae (8.9 %), Grippotyphosa (4.8 %), Hebdomadis (3.37 %), Australis (1.49 %) and Ballum (1.19 %). By using PCR, 33 (15.7 %) out of 210 samples were pathogenic Leptospira while no saprophytic Leptospira spp. was detected. Partial 16S rRNA gene sequences of Leptospira species which were obtained from this study were submitted to GenBank and acquired accession numbers KP313246 and KP313247. Phylogenetic analysis of the nucleotide sequences revealed that species

  18. Human exposure to Bisphenol A and liver health status: Quantification of urinary and circulating levels by LC-MS/MS.

    Science.gov (United States)

    Nicolucci, Carla; Errico, Sonia; Federico, Alessandro; Dallio, Marcello; Loguercio, Carmelina; Diano, Nadia

    2017-06-05

    A selective and highly sensitive analytical methodology for determination of Bisphenol A in human plasma was developed and validated. The method was based on selective liquid/solid extraction, combined with liquid chromatography-electrospray ionization tandem mass spectrometry in the multiple reaction monitoring mode and negative ionization. The linearity of the detector response was verified in human plasma over the concentration range 0.100-200ngmL -1 . The detection limit was 0.03ngmL -1 and the quantification limit was 0.100ngmL -1 . The analytical features of the proposed in-house validated method were satisfactory: precision was Bisphenol A was detected above the detection limit in all samples. The data show a persistence of unconjugated Bisphenol A levels in plasma and indicate a chronic Bisphenol A exposure of the target organ, suggesting an association between liver health status and Bisphenol A exposure. The results from our study are valuable for further investigation with large sample size and longitudinal study designs, necessary to confirm the observed association. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Aging and cytomegalovirus (CMV) infection differentially and jointly affect distinct circulating T cell subsets in humans1

    Science.gov (United States)

    Wertheimer, Anne M.; Bennett, Michael S.; Park, Byung; Uhrlaub, Jennifer L.; Martinez, Carmine; Pulko, Vesna; Currier, Noreen L.; Nikolich-Zugich, Dragana; Kaye, Jeffrey; Nikolich-Zugich, Janko

    2014-01-01

    The impact of intrinsic aging upon human peripheral blood T-cell subsets remains incompletely quantified and understood. This impact must be distinguished from the influence of latent persistent microorganisms, particularly cytomegalovirus (CMV), which has been associated with age-related changes in the T cell pool. In a cross-sectional cohort of 152 CMV-negative individuals, aged 21–101 years, we found that aging correlated strictly to an absolute loss of naïve CD8, but not CD4, T cells, but, contrary to many reports, did not lead to an increase in memory T cell numbers. The loss of naïve CD8 T cells was not altered by CMV in 239 subjects (range 21–96 years) but the decline in CD4+ naïve cells showed significance in CMV+ individuals. These individuals also exhibited an absolute increase in the effector/effector memory CD4+ and CD8+ cells with age. That increase was seen mainly, if not exclusively, in older subjects with elevated anti-CMV Ab titers, suggesting that efficacy of viral control over time may determine the magnitude of CMV impact upon T cell memory, and perhaps upon immune defense. These findings provide important new insights into the age-related changes in the peripheral blood pool of older adults, demonstrating that aging and CMV exert both distinct and joint influence upon blood T cell homeostasis in humans. PMID:24501199

  20. Human circulating plasma DNA significantly decreases while lymphocyte DNA damage increases under chronic occupational exposure to low-dose gamma-neutron and tritium β-radiation.

    Science.gov (United States)

    Korzeneva, Inna B; Kostuyk, Svetlana V; Ershova, Liza S; Osipov, Andrian N; Zhuravleva, Veronika F; Pankratova, Galina V; Porokhovnik, Lev N; Veiko, Natalia N

    2015-09-01

    The blood plasma of healthy people contains cell-fee (circulating) DNA (cfDNA). Apoptotic cells are the main source of the cfDNA. The cfDNA concentration increases in case of the organism's cell death rate increase, for example in case of exposure to high-dose ionizing radiation (IR). The objects of the present research are the blood plasma and blood lymphocytes of people, who contacted occupationally with the sources of external gamma/neutron radiation or internal β-radiation of tritium N = 176). As the controls (references), blood samples of people, who had never been occupationally subjected to the IR sources, were used (N = 109). With respect to the plasma samples of each donor there were defined: the cfDNA concentration (the cfDNA index), DNase1 activity (the DNase1 index) and titre of antibodies to DNA (the Ab DNA index). The general DNA damage in the cells was defined (using the Comet assay, the tail moment (TM) index). A chronic effect of the low-dose ionizing radiation on a human being is accompanied by the enhancement of the DNA damage in lymphocytes along with a considerable cfDNA content reduction, while the DNase1 content and concentration of antibodies to DNA (Ab DNA) increase. All the aforementioned changes were also observed in people, who had not worked with the IR sources for more than a year. The ratio cfDNA/(DNase1×Ab DNA × TM) is proposed to be used as a marker of the chronic exposure of a person to the external low-dose IR. It was formulated the assumption that the joint analysis of the cfDNA, DNase1, Ab DNA and TM values may provide the information about the human organism's cell resistivity to chronic exposure to the low-dose IR and about the development of the adaptive response in the organism that is aimed, firstly, at the effective cfDNA elimination from the blood circulation, and, secondly - at survival of the cells, including the cells with the damaged DNA. Copyright © 2015. Published by Elsevier B.V.

  1. Nitrogen. Too much of a good thing? An effective reduction of the overload of the nitrogen circulation on the benefit of environment and humans; Stickstoff. Zuviel des Guten? Ueberlastung des Stickstoffkreislaufs zum Nutzen von Umwelt und Mensch wirksam reduzieren

    Energy Technology Data Exchange (ETDEWEB)

    Schuetze, Gudrun; Geupel, Markus (comps.)

    2011-03-14

    The contribution under consideration reports on the influence of human activities on the circulation of nitrogen as well as on the resulting consequences for humans and environment. Thus the entry of nitrogen compounds is a main reason for the reduction of the biodiversity. The focus of this contribution is on the situation in Germany and the European bordering countries. Possibilities are pointed out, how harmful emissions of nitrogen can be reduced.

  2. Roles of circulating WNT-signaling proteins and WNT-inhibitors in human adiposity, insulin resistance, insulin secretion, and inflammation.

    Science.gov (United States)

    Almario, R U; Karakas, S E

    2015-02-01

    Wingless-type MMTV integration site family member (WNT) signaling and WNT-inhibitors have been implicated in regulation of adipogenesis, insulin resistance, pancreatic function, and inflammation. Our goal was to determine serum proteins involved in WNT signaling (WNT5 and WISP2) and WNT inhibition (SFRP4 and SFRP5) as they relate to obesity, serum adipokines, insulin resistance, insulin secretion, and inflammation in humans. Study population comprised 57 insulin resistant women with polycystic ovary syndrome (PCOS) and 27 reference women. In a cross-sectional study, blood samples were obtained at fasting, during oral, and frequently sampled intravenous glucose tolerance tests. Serum WNT5, WISP2, and SFRP4 concentrations did not differ between PCOS vs. reference women. Serum WNT5 correlated inversely with weight both in PCOS and reference women, and correlated directly with insulin response during oral glucose tolerance test in PCOS women. Serum WISP2 correlated directly with fatty acid binding protein 4. Serum SFRP5 did not differ between obese (n=32) vs. nonobese (n=25) PCOS women, but reference women had lower SFRP5 (pPCOS groups). Serum SFRP5 correlated inversely with IL-1β, TNF-α, cholesterol, and apoprotein B. These findings demonstrated that WNT5 correlated inversely with adiposity and directly with insulin response, and the WNT-inhibitor SFRP5 may be anti-inflammatory. Better understanding of the role of WNT signaling in obesity, insulin resistance, insulin secretion, lipoprotein metabolism, and inflammation is important for prevention and treatment of metabolic syndrome, diabetes and cardiovascular disease. © Georg Thieme Verlag KG Stuttgart · New York.

  3. Erythroid Differentiation Regulator 1 as a Novel Biomarker for Hair Loss Disorders.

    Science.gov (United States)

    Woo, Yu Ri; Hwang, Sewon; Jeong, Seo Won; Cho, Dae Ho; Park, Hyun Jeong

    2017-02-03

    Erythroid differentiation regulator 1 (Erdr1) is known to be involved in the inflammatory process via regulating the immune system in many cutaneous disorders, such as psoriasis and rosacea. However, the role of Erdr1 in various hair loss disorders remains unclear. The aim of this study was to investigate the putative role of Erdr1 in alopecias. Skin samples from 21 patients with hair loss disorders and five control subjects were retrieved, in order to assess their expression levels of Erdr1. Results revealed that expression of Erdr1 was significantly downregulated in the epidermis and hair follicles of patients with hair loss disorders, when compared to that in the control group. In particular, the expression of Erdr1 was significantly decreased in patients with alopecia areata. We propose that Erdr1 downregulation might be involved in the pathogenesis of hair loss, and could be considered as a novel biomarker for hair loss disorders.

  4. Comparison of different methods for erythroid differentiation in the K562 cell line.

    Science.gov (United States)

    Shariati, Laleh; Modaress, Mehran; Khanahmad, Hossein; Hejazi, Zahra; Tabatabaiefar, Mohammad Amin; Salehi, Mansoor; Modarressi, Mohammad Hossein

    2016-08-01

    To compare methods for erythroid differentiation of K562 cells that will be promising in the treatment of beta-thalassemia by inducing γ-globin synthesis. Cells were treated separately with: RPMI 1640 medium without glutamine, RPMI 1640 medium without glutamine supplemented with 1 mM sodium butyrate, RPMI 1640 medium supplemented with 1 mM sodium butyrate, 25 µg cisplatin/ml, 0.1 µg cytosine arabinoside/ml. The highest differentiation (84 %) with minimum toxicity was obtained with cisplatin at 15 µg /ml. Real-time RT-PCR showed that expression of the γ-globin gene was significantly higher in the cells differentiated with cisplatin compared to undifferentiated cells (P < 0.001). Cisplatin is useful in the experimental therapy of ß-globin gene defects and can be considered for examining the basic mechanism of γ-reactivation.

  5. CIRCULATING CD11B EXPRESSION CORRELATES WITH THE NEUTROPHIL RESPONSE AND AIRWAY MCD-14 EXPRESSION IS ENHANCED FOLLOWING OZONE EXPOSURE IN HUMANS

    Science.gov (United States)

    We recently reported that baseline expression of circulating CD11b is associated with the magnitude of the neutrophil response following inhaled endotoxin. In this study, we examined whether circulating CD11b plays a similar role in the inflammatory response following inhaled ozo...

  6. Oligonol supplementation attenuates body temperature and the circulating levels of prostaglandin E2 and cyclooxygenase-2 after heat stress in humans.

    Science.gov (United States)

    Shin, Young Oh; Lee, Jeong Beom; Song, Young Ju; Min, Young Ki; Yang, Hun Mo

    2013-04-01

    Oligonol, a phenolic production from lychee, has been reported to exhibit anti-oxidative and anti-inflammatory effects. This study investigated the effect of Oligonol supplementation on circulating levels of prostaglandin E2 (PGE2) and cyclooxygenase (COX)-2, as well as body temperature, after heat stress in 17 healthy human male volunteers (age, 21.6±2.1 years). All experiments were performed in an automated climate chamber (26.0°C±0.5°C, relative humidity 60%±3.0%, air velocity less than 1 m/sec) between 2 and 5 p.m. Subjects ingested an Oligonol (100 mg)-containing beverage or placebo beverage before half-body immersion into hot water (42°C±0.5°C for 30 min). Tympanic and skin temperatures were measured and mean body temperatures were calculated. Serum concentrations of PGE2 and COX-2 were analyzed before, immediately after, and 60 min after immersion. Oligonol intake significantly prevented elevation of tympanic (temperature difference: 0.17°C at Post, Pbody temperatures (temperature difference: 0.18°C at Post, Pbody temperature under heat stress, and this is associated with decreases in serum levels of PGE2 and COX-2.

  7. Cholesterol delivery to the adrenal glands estimated by adrenal venous sampling: An in vivo model to determine the contribution of circulating lipoproteins to steroidogenesis in humans.

    Science.gov (United States)

    Buitenwerf, Edward; Dullaart, Robin P F; Muller Kobold, Anneke C; Links, Thera P; Sluiter, Wim J; Connelly, Margery A; Kerstens, Michiel N

    Cholesterol, required for adrenal steroid hormone synthesis, is at least in part derived from circulating lipoproteins. The contribution of high-density lipoproteins (HDL) and low-density lipoproteins (LDL) to adrenal steroidogenesis in humans is unclear. The aim of the study was to determine the extent to which HDL and LDL are taken up by the adrenal glands using samples obtained during adrenal venous sampling (AVS). AVS was successfully performed in 23 patients with primary aldosteronism. Samples were drawn from both adrenal veins and inferior vena cava (IVC). HDL cholesterol (HDL-C) and lipoprotein particle profiles were determined by nuclear magnetic resonance spectroscopy. Apolipoprotein (apo) A-I and apoB were assayed by immunoturbidimetry. Plasma HDL-C and HDL and LDL particle concentrations (HDL-P and LDL-P) were not lower in samples obtained from the adrenal veins compared with the IVC (HDL-C, P = .59; HDL-P, P = .06; LDL-P, P = .93). ApoB was lower in adrenal venous plasma than in IVC (P = .026; P lipoproteins and steroidogenesis. Copyright © 2017 National Lipid Association. Published by Elsevier Inc. All rights reserved.

  8. Erythroid cell mitochondria receive endosomal iron by a "kiss-and-run" mechanism.

    Science.gov (United States)

    Hamdi, Amel; Roshan, Tariq M; Kahawita, Tanya M; Mason, Anne B; Sheftel, Alex D; Ponka, Prem

    2016-12-01

    In erythroid cells, more than 90% of transferrin-derived iron enters mitochondria where ferrochelatase inserts Fe 2+ into protoporphyrin IX. However, the path of iron from endosomes to mitochondrial ferrochelatase remains elusive. The prevailing opinion is that, after its export from endosomes, the redox-active metal spreads into the cytosol and mysteriously finds its way into mitochondria through passive diffusion. In contrast, this study supports the hypothesis that the highly efficient transport of iron toward ferrochelatase in erythroid cells requires a direct interaction between transferrin-endosomes and mitochondria (the "kiss-and-run" hypothesis). Using a novel method (flow sub-cytometry), we analyze lysates of reticulocytes after labeling these organelles with different fluorophores. We have identified a double-labeled population definitively representing endosomes interacting with mitochondria, as demonstrated by confocal microscopy. Moreover, we conclude that this endosome-mitochondrion association is reversible, since a "chase" with unlabeled holotransferrin causes a time-dependent decrease in the size of the double-labeled population. Importantly, the dissociation of endosomes from mitochondria does not occur in the absence of holotransferrin. Additionally, mutated recombinant holotransferrin, that cannot release iron, significantly decreases the uptake of 59 Fe by reticulocytes and diminishes 59 Fe incorporation into heme. This suggests that endosomes, which are unable to provide iron to mitochondria, cause a "traffic jam" leading to decreased endocytosis of holotransferrin. Altogether, our results suggest that a molecular mechanism exists to coordinate the iron status of endosomal transferrin with its trafficking. Besides its contribution to the field of iron metabolism, this study provides evidence for a new intracellular trafficking pathway of organelles. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. Parvovirus B19 Replication and Expression in Differentiating Erythroid Progenitor Cells.

    Directory of Open Access Journals (Sweden)

    Gloria Bua

    Full Text Available The pathogenic Parvovirus B19 (B19V is characterized by a strict adaptation to erythroid progenitor cells (EPCs, a heterogeneous population of differentiating cells with diverse phenotypic and functional properties. In our work, we studied the dynamics of B19V infection in EPCs in dependence on the cell differentiation stage, in terms of distribution of infected cells, synthesis of viral nucleic acids and production of infectious virus. EPCs at early differentiation stage led to an abortive infection, without viral genome replication and a very low transcriptional activity. EPCs at later stages were permissive, with highest levels of viral replicative activity at day 9 (+3.0 Log from 2 to 48 hpi and lower levels at day 18 (+1.5 Log from 2 to 48 hpi. B19V DNA increment was in accordance with the percentage of cells positive to flow-FISH assay (41.4% at day 9, 1.1% at day 18. Quantitation of total RNA indicated a close association of genome replication and transcription with viral RNA accumulation within infected cells related to viral DNA increase during the course of infection. Analysis of the different classes of mRNAs revealed two distinct pattern of genome expression profile with a fine regulation in the frequency utilization of RNA processing signals: an early phase, when cleavage at the proximal site leading to a higher relative production of mRNA for NS protein, and a late phase, when cleavage at the distal site was more frequent leading to higher relative abundance of mRNA for VP and 11 kDA proteins. Infectious virus was released from cells at day 6-15, but not at day 18. Our results, providing a detailed description of B19V replication and expression profile in differentiating EPCs, highlight the very tight adaptation of B19V to a specific cellular target defined both by its erythroid lineage and its differentiation stage.

  10. Parvovirus B19 Replication and Expression in Differentiating Erythroid Progenitor Cells

    Science.gov (United States)

    Bua, Gloria; Manaresi, Elisabetta; Bonvicini, Francesca; Gallinella, Giorgio

    2016-01-01

    The pathogenic Parvovirus B19 (B19V) is characterized by a strict adaptation to erythroid progenitor cells (EPCs), a heterogeneous population of differentiating cells with diverse phenotypic and functional properties. In our work, we studied the dynamics of B19V infection in EPCs in dependence on the cell differentiation stage, in terms of distribution of infected cells, synthesis of viral nucleic acids and production of infectious virus. EPCs at early differentiation stage led to an abortive infection, without viral genome replication and a very low transcriptional activity. EPCs at later stages were permissive, with highest levels of viral replicative activity at day 9 (+3.0 Log from 2 to 48 hpi) and lower levels at day 18 (+1.5 Log from 2 to 48 hpi). B19V DNA increment was in accordance with the percentage of cells positive to flow-FISH assay (41.4% at day 9, 1.1% at day 18). Quantitation of total RNA indicated a close association of genome replication and transcription with viral RNA accumulation within infected cells related to viral DNA increase during the course of infection. Analysis of the different classes of mRNAs revealed two distinct pattern of genome expression profile with a fine regulation in the frequency utilization of RNA processing signals: an early phase, when cleavage at the proximal site leading to a higher relative production of mRNA for NS protein, and a late phase, when cleavage at the distal site was more frequent leading to higher relative abundance of mRNA for VP and 11 kDA proteins. Infectious virus was released from cells at day 6–15, but not at day 18. Our results, providing a detailed description of B19V replication and expression profile in differentiating EPCs, highlight the very tight adaptation of B19V to a specific cellular target defined both by its erythroid lineage and its differentiation stage. PMID:26845771

  11. Carbon monoxide induced erythroid differentiation of K562 cells mimics the central macrophage milieu in erythroblastic islands.

    Directory of Open Access Journals (Sweden)

    Shlomi Toobiak

    Full Text Available Growing evidence supports the role of erythroblastic islands (EI as microenvironmental niches within bone marrow (BM, where cell-cell attachments are suggested as crucial for erythroid maturation. The inducible form of the enzyme heme oxygenase, HO-1, which conducts heme degradation, is absent in erythroblasts where hemoglobin (Hb is synthesized. Yet, the central macrophage, which retains high HO-1 activity, might be suitable to take over degradation of extra, harmful, Hb heme. Of these enzymatic products, only the hydrophobic gas molecule--CO can transfer from the macrophage to surrounding erythroblasts directly via their tightly attached membranes in the terminal differentiation stage.Based on the above, the study hypothesized CO to have a role in erythroid maturation. Thus, the effect of CO gas as a potential erythroid differentiation inducer on the common model for erythroid progenitors, K562 cells, was explored. Cells were kept under oxygen lacking environment to mimic BM conditions. Nitrogen anaerobic atmosphere (N₂A served as control for CO atmosphere (COA. Under both atmospheres cells proliferation ceased: in N₂A due to cell death, while in COA as a result of erythroid differentiation. Maturation was evaluated by increased glycophorin A expression and Hb concentration. Addition of 1%CO only to N₂A, was adequate for maintaining cell viability. Yet, the average Hb concentration was low as compared to COA. This was validated to be the outcome of diversified maturation stages of the progenitor's population.In fact, the above scenario mimics the in vivo EI conditions, where at any given moment only a minute portion of the progenitors proceeds into terminal differentiation. Hence, this model might provide a basis for further molecular investigations of the EI structure/function relationship.

  12. Feasibility of quantification of the distribution of blood flow in the normal human fetal circulation using CMR: a cross-sectional study

    Directory of Open Access Journals (Sweden)

    Seed Mike

    2012-11-01

    Full Text Available Abstract Background We present the first phase contrast (PC cardiovascular magnetic resonance (CMR measurements of the distribution of blood flow in twelve late gestation human fetuses. These were obtained using a retrospective gating technique known as metric optimised gating (MOG. Methods A validation experiment was performed in five adult volunteers where conventional cardiac gating was compared with MOG. Linear regression and Bland Altman plots were used to compare MOG with the gold standard of conventional gating. Measurements using MOG were then made in twelve normal fetuses at a median gestational age of 37 weeks (range 30–39 weeks. Flow was measured in the major fetal vessels and indexed to the fetal weight. Results There was good correlation between the conventional gated and MOG measurements in the adult validation experiment (R=0.96. Mean flows in ml/min/kg with standard deviations in the major fetal vessels were as follows: combined ventricular output (CVO 540±101, main pulmonary artery (MPA 327±68, ascending aorta (AAo 198±38, superior vena cava (SVC 147±46, ductus arteriosus (DA 220±39,pulmonary blood flow (PBF 106±59,descending aorta (DAo 273±85, umbilical vein (UV 160±62, foramen ovale (FO107±54. Results expressed as mean percentages of the CVO with standard deviations were as follows: MPA 60±4, AAo37±4, SVC 28±7, DA 41±8, PBF 19±10, DAo50±12, UV 30±9, FO 21±12. Conclusion This study demonstrates how PC CMR with MOG is a feasible technique for measuring the distribution of the normal human fetal circulation in late pregnancy. Our preliminary results are in keeping with findings from previous experimental work in fetal lambs.

  13. Genetic variability of attachment (G and Fusion (F protein genes of human metapneumovirus strains circulating during 2006-2009 in Kolkata, Eastern India

    Directory of Open Access Journals (Sweden)

    Chawla-Sarkar Mamta

    2011-02-01

    Full Text Available Abstract Background Human metapneumovirus (hMPV is associated with the acute respiratory tract infection (ARTI in all the age groups. However, there is limited information on prevalence and genetic diversity of human metapneumovirus (hMPV strains circulating in India. Objective To study prevalence and genomic diversity of hMPV strains among ARTI patients reporting in outpatient departments of hospitals in Kolkata, Eastern India. Methods Nasal and/or throat swabs from 2309 patients during January 2006 to December 2009, were screened for the presence of hMPV by RT-PCR of nucleocapsid (N gene. The G and F genes of representative hMPV positive samples were sequenced. Results 118 of 2309 (5.11% clinical samples were positive for hMPV. The majority (≈80% of the positive cases were detected during July−November all through the study period. Genetic analysis revealed that 77% strains belong to A2 subgroup whereas rest clustered in B1 subgroup. G sequences showed higher diversity at the nucleotide and amino acid level. In contrast, less than 10% variation was observed in F gene of representative strains of all four years. Sequence analysis also revealed changes in the position of stop codon in G protein, which resulted in variable length (217-231 aa polypeptides. Conclusion The study suggests that approximately 5% of ARTI in the region were caused by hMPV. This is the first report on the genetic variability of G and F gene of hMPV strains from India which clearly shows that the G protein of hMPV is continuously evolving. Though the study partially fulfills lacunae of information, further studies from other regions are necessary for better understanding of prevalence, epidemiology and virus evolution in Indian subcontinent.

  14. Characterization of a distinct population of circulating human non-adherent endothelial forming cells and their recruitment via intercellular adhesion molecule-3.

    Directory of Open Access Journals (Sweden)

    Sarah L Appleby

    Full Text Available Circulating vascular progenitor cells contribute to the pathological vasculogenesis of cancer whilst on the other hand offer much promise in therapeutic revascularization in post-occlusion intervention in cardiovascular disease. However, their characterization has been hampered by the many variables to produce them as well as their described phenotypic and functional heterogeneity. Herein we have isolated, enriched for and then characterized a human umbilical cord blood derived CD133(+ population of non-adherent endothelial forming cells (naEFCs which expressed the hematopoietic progenitor cell markers (CD133, CD34, CD117, CD90 and CD38 together with mature endothelial cell markers (VEGFR2, CD144 and CD31. These cells also expressed low levels of CD45 but did not express the lymphoid markers (CD3, CD4, CD8 or myeloid markers (CD11b and CD14 which distinguishes them from 'early' endothelial progenitor cells (EPCs. Functional studies demonstrated that these naEFCs (i bound Ulex europaeus lectin, (ii demonstrated acetylated-low density lipoprotein uptake, (iii increased vascular cell adhesion molecule (VCAM-1 surface expression in response to tumor necrosis factor and (iv in co-culture with mature endothelial cells increased the number of tubes, tubule branching and loops in a 3-dimensional in vitro matrix. More importantly, naEFCs placed in vivo generated new lumen containing vasculature lined by CD144 expressing human endothelial cells (ECs. Extensive genomic and proteomic analyses of the naEFCs showed that intercellular adhesion molecule (ICAM-3 is expressed on their cell surface but not on mature endothelial cells. Furthermore, functional analysis demonstrated that ICAM-3 mediated the rolling and adhesive events of the naEFCs under shear stress. We suggest that the distinct population of naEFCs identified and characterized here represents a new valuable therapeutic target to control aberrant vasculogenesis.

  15. Feasibility of quantification of the distribution of blood flow in the normal human fetal circulation using CMR: a cross-sectional study.

    Science.gov (United States)

    Seed, Mike; van Amerom, Joshua F P; Yoo, Shi-Joon; Al Nafisi, Bahiyah; Grosse-Wortmann, Lars; Jaeggi, Edgar; Jansz, Michael S; Macgowan, Christopher K

    2012-11-26

    We present the first phase contrast (PC) cardiovascular magnetic resonance (CMR) measurements of the distribution of blood flow in twelve late gestation human fetuses. These were obtained using a retrospective gating technique known as metric optimised gating (MOG). A validation experiment was performed in five adult volunteers where conventional cardiac gating was compared with MOG. Linear regression and Bland Altman plots were used to compare MOG with the gold standard of conventional gating. Measurements using MOG were then made in twelve normal fetuses at a median gestational age of 37 weeks (range 30-39 weeks). Flow was measured in the major fetal vessels and indexed to the fetal weight. There was good correlation between the conventional gated and MOG measurements in the adult validation experiment (R=0.96). Mean flows in ml/min/kg with standard deviations in the major fetal vessels were as follows: combined ventricular output (CVO) 540 ± 101, main pulmonary artery (MPA) 327 ± 68, ascending aorta (AAo) 198 ± 38, superior vena cava (SVC) 147 ± 46, ductus arteriosus (DA) 220 ± 39,pulmonary blood flow (PBF) 106 ± 59,descending aorta (DAo) 273 ± 85, umbilical vein (UV) 160 ± 62, foramen ovale (FO)107 ± 54. Results expressed as mean percentages of the CVO with standard deviations were as follows: MPA 60 ± 4, AAo37 ± 4, SVC 28 ± 7, DA 41 ± 8, PBF 19 ± 10, DAo50 ± 12, UV 30 ± 9, FO 21 ± 12. This study demonstrates how PC CMR with MOG is a feasible technique for measuring the distribution of the normal human fetal circulation in late pregnancy. Our preliminary results are in keeping with findings from previous experimental work in fetal lambs.

  16. Characterization of a Distinct Population of Circulating Human Non-Adherent Endothelial Forming Cells and Their Recruitment via Intercellular Adhesion Molecule-3

    Science.gov (United States)

    Thompson, Emma J.; Barrett, Jeffrey M.; Tooley, Katie; Sen, Shaundeep; Sun, Wai Yan; Grose, Randall; Nicholson, Ian; Levina, Vitalina; Cooke, Ira; Talbo, Gert; Lopez, Angel F.; Bonder, Claudine S.

    2012-01-01

    Circulating vascular progenitor cells contribute to the pathological vasculogenesis of cancer whilst on the other hand offer much promise in therapeutic revascularization in post-occlusion intervention in cardiovascular disease. However, their characterization has been hampered by the many variables to produce them as well as their described phenotypic and functional heterogeneity. Herein we have isolated, enriched for and then characterized a human umbilical cord blood derived CD133+ population of non-adherent endothelial forming cells (naEFCs) which expressed the hematopoietic progenitor cell markers (CD133, CD34, CD117, CD90 and CD38) together with mature endothelial cell markers (VEGFR2, CD144 and CD31). These cells also expressed low levels of CD45 but did not express the lymphoid markers (CD3, CD4, CD8) or myeloid markers (CD11b and CD14) which distinguishes them from ‘early’ endothelial progenitor cells (EPCs). Functional studies demonstrated that these naEFCs (i) bound Ulex europaeus lectin, (ii) demonstrated acetylated-low density lipoprotein uptake, (iii) increased vascular cell adhesion molecule (VCAM-1) surface expression in response to tumor necrosis factor and (iv) in co-culture with mature endothelial cells increased the number of tubes, tubule branching and loops in a 3-dimensional in vitro matrix. More importantly, naEFCs placed in vivo generated new lumen containing vasculature lined by CD144 expressing human endothelial cells (ECs). Extensive genomic and proteomic analyses of the naEFCs showed that intercellular adhesion molecule (ICAM)-3 is expressed on their cell surface but not on mature endothelial cells. Furthermore, functional analysis demonstrated that ICAM-3 mediated the rolling and adhesive events of the naEFCs under shear stress. We suggest that the distinct population of naEFCs identified and characterized here represents a new valuable therapeutic target to control aberrant vasculogenesis. PMID:23144795

  17. Changes in the composition of circulating CD8+ T cell subsets during acute epstein-barr and human immunodeficiency virus infections in humans

    NARCIS (Netherlands)

    Roos, M. T.; van Lier, R. A.; Hamann, D.; Knol, G. J.; Verhoofstad, I.; van Baarle, D.; Miedema, F.; Schellekens, P. T.

    2000-01-01

    In response to viral infection, unprimed naive CD8(+), major histocompatibility complex class I-restricted, virus-specific T cells clonally expand and differentiate into memory- and effector-type cells. Changes in CD8(+) subset distribution were studied in 17 subjects with acute human

  18. A blood circulation model for reference man

    Energy Technology Data Exchange (ETDEWEB)

    Leggett, R.W.; Eckerman, K.F. [Oak Ridge National Lab., TN (United States); Williams, L.R. [Indiana Univ., South Bend, IN (United States). Div. of Liberal Arts and Sciences

    1996-12-31

    A dynamic blood circulation model that predicts the movement and gradual dispersion of a bolus of material in the circulation after its intravenous injection into an adult human. The main purpose of the model is improve the dosimetry of internally deposited radionuclides that decay in the circulation to a significant extent. The model partitions the blood volume into 24 separate organs or tissues, right heart chamber, left heart chamber, pulmonary circulation, arterial outflow to the aorta and large arteries, and venous return via the large veins. Model results were compared to data obtained from injection of carbon 11 labeled carbon monoxide or rubidium 86.

  19. A blood circulation model for reference man

    International Nuclear Information System (INIS)

    Leggett, R.W.; Eckerman, K.F.; Williams, L.R.

    1996-01-01

    A dynamic blood circulation model that predicts the movement and gradual dispersion of a bolus of material in the circulation after its intravenous injection into an adult human. The main purpose of the model is improve the dosimetry of internally deposited radionuclides that decay in the circulation to a significant extent. The model partitions the blood volume into 24 separate organs or tissues, right heart chamber, left heart chamber, pulmonary circulation, arterial outflow to the aorta and large arteries, and venous return via the large veins. Model results were compared to data obtained from injection of carbon 11 labeled carbon monoxide or rubidium 86

  20. Circulation of Stars

    Science.gov (United States)

    Boitani, P.

    2016-01-01

    Since the dawn of man, contemplation of the stars has been a primary impulse in human beings, who proliferated their knowledge of the stars all over the world. Aristotle sees this as the product of primeval and perennial “wonder” which gives rise to what we call science, philosophy, and poetry. Astronomy, astrology, and star art (painting, architecture, literature, and music) go hand in hand through millennia in all cultures of the planet (and all use catasterisms to explain certain phenomena). Some of these developments are independent of each other, i.e., they take place in one culture independently of others. Some, on the other hand, are the product of the “circulation of stars.” There are two ways of looking at this. One seeks out forms, the other concentrates on the passing of specific lore from one area to another through time. The former relies on archetypes (for instance, with catasterism), the latter constitutes a historical process. In this paper I present some of the surprising ways in which the circulation of stars has occurred—from East to West, from East to the Far East, and from West to East, at times simultaneously.

  1. Efficient detection of human circulating tumor cells without significant production of false-positive cells by a novel conditionally replicating adenovirus

    Directory of Open Access Journals (Sweden)

    Fuminori Sakurai

    2016-01-01

    Full Text Available Circulating tumor cells (CTCs are promising biomarkers in several cancers, and thus methods and apparatuses for their detection and quantification in the blood have been actively pursued. A novel CTC detection system using a green fluorescence protein (GFP–expressing conditionally replicating adenovirus (Ad (rAd-GFP was recently developed; however, there is concern about the production of false-positive cells (GFP-positive normal blood cells when using rAd-GFP, particularly at high titers. In addition, CTCs lacking or expressing low levels of coxsackievirus–adenovirus receptor (CAR cannot be detected by rAd-GFP, because rAd-GFP is constructed based on Ad serotype 5, which recognizes CAR. In order to suppress the production of false-positive cells, sequences perfectly complementary to blood cell–specific microRNA, miR-142-3p, were incorporated into the 3′-untranslated region of the E1B and GFP genes. In addition, the fiber protein was replaced with that of Ad serotype 35, which recognizes human CD46, creating rAdF35-142T-GFP. rAdF35-142T-GFP efficiently labeled not only CAR-positive tumor cells but also CAR-negative tumor cells with GFP. The numbers of false-positive cells were dramatically lower for rAdF35-142T-GFP than for rAd-GFP. CTCs in the blood of cancer patients were detected by rAdF35-142T-GFP with a large reduction in false-positive cells.

  2. Nitrogen-doped multiple graphene aerogel/gold nanostar as the electrochemical sensing platform for ultrasensitive detection of circulating free DNA in human serum.

    Science.gov (United States)

    Ruiyi, Li; Ling, Liu; Hongxia, Bei; Zaijun, Li

    2016-05-15

    Graphene aerogel has attracted increasing attention due to its large specific surface area, high-conductivity and electronic interaction. The paper reported a facile synthesis of nitrogen-doped multiple graphene aerogel/gold nanostar (termed as N-doped MGA/GNS) and its use as the electrochemical sensing platform for detection of double stranded (dsDNA). On the one hand, the N-doped MGA offers a much better electrochemical performance compared with classical graphene aerogel. Interestingly, the performance can be enhanced by only increasing the cycle number of graphene oxide gelation. On the other hand, the hybridization with GNS further enhances the electrocatalytic activity towards Fe(CN)6(3-/4-). In addition, the N-doped MGA/GNS provides a well-defined three-dimensional architecture. The unique structure make it is easy to combine with dsDNA to form the electroactive bioconjugate. The integration not only triggers an ultrafast DNA electron and charge transfer, but also realizes a significant synergy between N-doped MGA, GNS and dsDNA. As a result, the electrochemical sensor based on the hybrid exhibits highly sensitive differential pulse voltammetric response (DPV) towards dsDNA. The DPV signal linearly increases with the increase of dsDNA concentration in the range from 1.0×10(-)(21) g ml(-)(1) to 1.0×10(-16) g ml(-1) with the detection limit of 3.9×10(-22) g ml(-1) (S/N=3). The sensitivity is much more than that of all reported DNA sensors. The analytical method was successfully applied in the electrochemical detection of circulating free DNA in human serum. The study also opens a window on the electrical properties of multiple graphene aerogel and DNA as well their hybrids to meet the needs of further applications as special nanoelectronics in molecule diagnosis, bioanalysis and catalysis. Copyright © 2015 Elsevier B.V. All rights reserved.

  3. Nitrite and S-Nitrosohemoglobin Exchange Across the Human Cerebral and Femoral Circulation: Relationship to Basal and Exercise Blood Flow Responses to Hypoxia.

    Science.gov (United States)

    Bailey, Damian M; Rasmussen, Peter; Overgaard, Morten; Evans, Kevin A; Bohm, Aske M; Seifert, Thomas; Brassard, Patrice; Zaar, Morten; Nielsen, Henning B; Raven, Peter B; Secher, Niels H

    2017-01-10

    The mechanisms underlying red blood cell (RBC)-mediated hypoxic vasodilation remain controversial, with separate roles for nitrite () and S-nitrosohemoglobin (SNO-Hb) widely contested given their ability to transduce nitric oxide bioactivity within the microcirculation. To establish their relative contribution in vivo, we quantified arterial-venous concentration gradients across the human cerebral and femoral circulation at rest and during exercise, an ideal model system characterized by physiological extremes of O 2 tension and blood flow. Ten healthy participants (5 men, 5 women) aged 24±4 (mean±SD) years old were randomly assigned to a normoxic (21% O 2 ) and hypoxic (10% O 2 ) trial with measurements performed at rest and after 30 minutes of cycling at 70% of maximal power output in hypoxia and equivalent relative and absolute intensities in normoxia. Blood was sampled simultaneously from the brachial artery and internal jugular and femoral veins with plasma and RBC nitric oxide metabolites measured by tri-iodide reductive chemiluminescence. Blood flow was determined by transcranial Doppler ultrasound (cerebral blood flow) and constant infusion thermodilution (femoral blood flow) with net exchange calculated via the Fick principle. Hypoxia was associated with a mild increase in both cerebral blood flow and femoral blood flow (Pflow during exercise (Pvenous; Parterial; P0.05). These findings suggest that hypoxia and, to a far greater extent, exercise independently promote arterial-venous delivery gradients of intravascular nitric oxide, with deoxyhemoglobin-mediated reduction identified as the dominant mechanism underlying hypoxic vasodilation. © 2016 American Heart Association, Inc.

  4. Plants and Photosynthesis: Level III, Unit 3, Lesson 1; The Human Digestive System: Lesson 2; Functions of the Blood: Lesson 3; Human Circulation and Respiration: Lesson 4; Reproduction of a Single Cell: Lesson 5; Reproduction by Male and Female Cells: Lesson 6; The Human Reproductive System: Lesson 7; Genetics and Heredity: Lesson 8; The Nervous System: Lesson 9; The Glandular System: Lesson 10. Advanced General Education Program. A High School Self-Study Program.

    Science.gov (United States)

    Manpower Administration (DOL), Washington, DC. Job Corps.

    This self-study program for the high-school level contains lessons in the following subjects: Plants and Photosynthesis; The Human Digestive System; Functions of the Blood; Human Circulation and Respiration; Reproduction of a Single Cell; Reproduction by Male and Female Cells; The Human Reproductive System; Genetics and Heredity; The Nervous…

  5. Co-circulation of genetically distinct human metapneumovirus and human bocavirus strains in young children with respiratory tract infections in Italy.

    Science.gov (United States)

    Zappa, Alessandra; Canuti, Marta; Frati, Elena; Pariani, Elena; Perin, Silvana; Ruzza, Maria Lorena; Farina, Claudio; Podestà, Alberto; Zanetti, Alessandro; Amendola, Antonella; Tanzi, Elisabetta

    2011-01-01

    The discovery of human Metapneumovirus (hMPV) and human Bocavirus (hBoV) identified the etiological causes of several cases of acute respiratory tract infections in children. This report describes the molecular epidemiology of hMPV and hBoV infections observed following viral surveillance of children hospitalized for acute respiratory tract infections in Milan, Italy. Pharyngeal swabs were collected from 240 children ≤3 years of age (130 males, 110 females; median age, 5.0 months; IQR, 2.0-12.5 months) and tested for respiratory viruses, including hMPV and hBoV, by molecular methods. hMPV-RNA and hBoV-DNA positive samples were characterized molecularly and a phylogenetical analysis was performed. PCR analysis identified 131/240 (54.6%) samples positive for at least one virus. The frequency of hMPV and hBoV infections was similar (8.3% and 12.1%, respectively). Both infections were associated with lower respiratory tract infections: hMPV was present as a single infectious agent in 7.2% of children with bronchiolitis, hBoV was associated with 18.5% of pediatric pneumonias and identified frequently as a single etiological agent. Genetically distinct hMPV and hBoV strains were identified in children examined with respiratory tract infections. Phylogenetic analysis showed an increased prevalence of hMPV genotype A (A2b sublineage) compared to genotype B (80% vs. 20%, respectively) and of the hBoV genotype St2 compared to genotype St1 (71.4% vs. 28.6%, respectively). Interestingly, a shift in hMPV infections resulting from A2 strains has been observed in recent years. In addition, the occurrence of recombination events between two hBoV strains with a breakpoint located in the VP1/VP2 region was identified. © 2010 Wiley-Liss, Inc.

  6. Protein structure of fetal antigen 1 (FA1). A novel circulating human epidermal-growth-factor-like protein expressed in neuroendocrine tumors and its relation to the gene products of dlk and pG2

    DEFF Research Database (Denmark)

    Jensen, Charlotte Harken; Krogh, Thomas N; Højrup, Peter

    1994-01-01

    The present paper describes the primary structure, glycosylation and tissue localization of fetal antigen 1 (FA1) isolated from second-trimester human amniotic fluid. FA1 is a single-chained, heterogeneous glycoprotein of 225-262 amino acid residues. FA1 has six well conserved epidermal...... extends with minor corrections to the human adrenal-specific mRNA, pG2 as well. Immunohistochemical analysis demonstrated the presence of FA1 in 10 out of 14 lung tumors containing neuroendocrine elements, and in the placental villi where FA1 was exclusively seen in stromal cells in close contact...... to the vascular structure. In the pancreas, FA1 co-localized with insulin in the insulin secretory granules of the beta cells within the islets of Langerhans. Our findings suggest that FA1 is synthesized as a membrane anchored protein and released into the circulation after enzymic cleavage, and that circulating...

  7. Circulating Autoantibodies in Age-Related Macular Degeneration Recognize Human Macular Tissue Antigens Implicated in Autophagy, Immunomodulation, and Protection from Oxidative Stress and Apoptosis.

    Directory of Open Access Journals (Sweden)

    Alessandro Iannaccone

    Full Text Available We investigated sera from elderly subjects with and without age-related macular degeneration (AMD for presence of autoantibodies (AAbs against human macular antigens and characterized their identity.Sera were collected from participants in the Age-Related Maculopathy Ancillary (ARMA Study, a cross-sectional investigation ancillary to the Health ABC Study, enriched with participants from the general population. The resulting sample (mean age: 79.2±3.9 years old included subjects with early to advanced AMD (n = 131 and controls (n = 231. Sera were tested by Western blots for immunoreactive bands against human donor macular tissue homogenates. Immunoreactive bands were identified and graded, and odds ratios (OR calculated. Based on these findings, sera were immunoprecipitated, and subjected to 2D gel electrophoresis (GE. Liquid chromatography-tandem mass spectrometry (LC-MS/MS was used to identify the targets recognized by circulating AAbs seen on 2D-GE, followed by ELISAs with recombinant proteins to confirm LC-MS/MS results, and quantify autoreactivities.In AMD, 11 immunoreactive bands were significantly more frequent and 13 were significantly stronger than in controls. Nine of the more frequent bands also showed stronger reactivity. OR estimates ranged between 4.06 and 1.93, and all clearly excluded the null value. Following immunoprecipitation, 2D-GE and LC-MS/MS, five of the possible autoreactivity targets were conclusively identified: two members of the heat shock protein 70 (HSP70 family, HSPA8 and HSPA9; another member of the HSP family, HSPB4, also known as alpha-crystallin A chain (CRYAA; Annexin A5 (ANXA5; and Protein S100-A9, also known as calgranulin B that, when complexed with S100A8, forms calprotectin. ELISA testing with recombinant proteins confirmed, on average, significantly higher reactivities against all targets in AMD samples compared to controls.Consistent with other evidence supporting the role of inflammation and the

  8. Association of cardiovascular complications with circulating levels of tribbles 3 human homolog and matrix metalloproteinases in Indian type 2 diabetic patients, with or without hypertension

    Directory of Open Access Journals (Sweden)

    Prashant Shirish Ratnaparkhi

    2018-01-01

    Full Text Available Aim and Objective: Matrix metalloproteinases (MMPs and Tribbles 3 (Trb3 human homologue have been reported to induce atherosclerosis. We wanted to evaluate the association of circulating levels of Trb3 human homologue and MMPs (MMP2 and MMP9, with possible cardiovascular complications in Indian type 2 diabetic patients (type 2 diabetes mellitus [T2DM], with or without hypertension (HT. Materials and Methods: Serum from 144 individuals, classified as follows: Group A1= (DM + HT; T2DM> 5 years + HT (n = 55; Group A2 = DM; T2DM <2 years, (n = 28; Group B1 = HT; (n = 31 and Group B2 = HC; (n = 30 age- and sex-matched healthy controls. Anthropometric measurements, biochemical profiles of sugar and lipids were established using auto analyser. MMP2, MMP9, Trb3, oxidised low-density lipoprotein cholesterol, and proinsulin were measured in the serum using ELISA. Results: Using Bonferroni correction, we found that MMP2 levels were increased in (DM + HT, when compared to individuals with DM and HT (P = 0.006 and 0.000. HT group had reduced levels of MMP2, as compared to HC, (P = 0.000. The Mann–Whitney U-test for MMP9 revealed that DM group had elevated levels of MMP9 compared to (DM + HT, HT and HC group, (P = 0.011, 0.000, and 0.001. (DM + HT had elevated levels of MMP9 when compared to HT group, (P = 0.012.. Levels of MMP9 in HT were lower than the HC group, although not significant. Levels of Trb3 were found to be elevated in (DM + HT when compared to DM, (P = 0.032. The levels of Trb3 were higher in the HT, when compared to HC group, although not statistically significant. Multiple linear regression model for Framingham Risk Score, weighted with post prandial blood sugar yielded R2 = 0.338; F = 7.602 (df = 9, P = 0.000. Trb3 (β = −0.179, P = 0.019; MMP2 (β =0.021, P = 0.787 and MMP9 (β = −0.03, P = 0.684. Conclusion: Trb3 is a useful marker for evaluating the association of cardiovascular risk in diabetic patients.

  9. Postprandial triglyceride-rich lipoproteins promote lipid accumulation and apolipoprotein B-48 receptor transcriptional activity in human circulating and murine bone marrow neutrophils in a fatty acid-dependent manner.

    Science.gov (United States)

    Ortega-Gómez, Almudena; Varela, Lourdes M; López, Sergio; Montserrat de la Paz, Sergio; Sánchez, Rosario; Muriana, Francisco J G; Bermúdez, Beatriz; Abia, Rocío

    2017-09-01

    Postprandial triglyceride-rich lipoproteins (TRLs) promote atherosclerosis. Recent research points the bone marrow (BM) as a primary site in atherosclerosis. We elucidated how the acute administration of monounsaturated fatty acids (MUFAs) MUFAs, omega-3 polyunsaturated fatty acids (PUFAs) PUFAs and saturated fatty acids (SFAs) affects human circulating and murine BM neutrophil lipid accumulation and functionality. Postprandial hypertriglyceridemia was induced in healthy subjects and Apoe -/- mice by the acute administration of dietary fats enriched in MUFAs, PUFAs, or SFAs. Postprandial hypertriglyceridemia increased apolipoprotein-B48 receptor (ApoB48R) transcriptional activity that was linearly correlated with intracellular triglycerides (TGs) TGs accumulation in human circulating and murine BM neutrophils. MUFA and omega-3 PUFAs attenuated ApoB48R gene expression and intracellular TG accumulation compared to SFAs. TRLs induced apoB48R-dependent TG accumulation in human neutrophils ex vivo. Murine BM neutrophils showed a decrease in surface L-selectin and an increase in TNF-α and IL-1β mRNA expressions only after SFAs administration. TRLs enriched in SFAs induced BM neutrophil degranulation ex vivo suggesting cell priming/activation. Postprandial TRLs disrupts the normal biology and function of circulating and BM neutrophils. MUFA- and omega-3 PUFA-rich dietary fats such as virgin olive oil or fish oil has the potential to prevent excessive neutrophil lipid accumulation and activation by targeting the fatty acid composition of TRLs. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. The glucocorticoid receptor cooperates with the erythropoietin receptor and c-Kit to enhance and sustain proliferation of erythroid progenitors in vitro

    NARCIS (Netherlands)

    von Lindern, M.; Zauner, W.; Mellitzer, G.; Steinlein, P.; Fritsch, G.; Huber, K.; Löwenberg, B.; Beug, H.

    1999-01-01

    Although erythropoietin (Epo) is essential for the production of mature red blood cells, the cooperation with other factors is required for a proper balance between progenitor proliferation and differentiation. In avian erythroid progenitors, steroid hormones cooperate with tyrosine kinase receptors

  11. Sustained enhancement of OCTN1 transporter expression in association with hydroxyurea induced gamma-globin expression in erythroid progenitors

    OpenAIRE

    Walker, Aisha L.; Ofori-Acquah, Solomon

    2016-01-01

    The clinical benefits of hydroxyurea treatment in patients with sickle cell disease (SCD) are due largely to increased gamma-globin expression. However, mechanisms that control gamma-globin expression by hydroxyurea in erythroid progenitors are incompletely understood. Here, we investigated the role of two hydroxyurea transporters, urea transporter B (UTB) and organic cation/carnitine transporter 1 (OCTN1), in this process. Endogenous expression of both transporters peaked towards the end of ...

  12. Myelo-erythroid commitment after burn injury is under β-adrenergic control via MafB regulation.

    Science.gov (United States)

    Hasan, Shirin; Johnson, Nicholas B; Mosier, Michael J; Shankar, Ravi; Conrad, Peggie; Szilagyi, Andrea; Gamelli, Richard L; Muthumalaiappan, Kuzhali

    2017-03-01

    Severely injured burn patients receive multiple blood transfusions for anemia of critical illness despite the adverse consequences. One limiting factor to consider alternate treatment strategies is the lack of a reliable test platform to study molecular mechanisms of impaired erythropoiesis. This study illustrates how conditions resulting in a high catecholamine microenvironment such as burns can instigate myelo-erythroid reprioritization influenced by β-adrenergic stimulation leading to anemia. In a mouse model of scald burn injury, we observed, along with a threefold increase in bone marrow LSK cells (lin neg Sca1 + cKit + ), that the myeloid shift is accompanied with a significant reduction in megakaryocyte erythrocyte progenitors (MEPs). β-Blocker administration (propranolol) for 6 days after burn, not only reduced the number of LSKs and MafB + cells in multipotent progenitors, but also influenced myelo-erythroid bifurcation by increasing the MEPs and reducing the granulocyte monocyte progenitors in the bone marrow of burn mice. Furthermore, similar results were observed in burn patients' peripheral blood mononuclear cell-derived ex vivo culture system, demonstrating that commitment stage of erythropoiesis is impaired in burn patients and intervention with propranolol (nonselective β1,2-adrenergic blocker) increases MEPs. Also, MafB + cells that were significantly increased following standard burn care could be mitigated when propranolol was administered to burn patients, establishing the mechanistic regulation of erythroid commitment by myeloid regulatory transcription factor MafB. Overall, results demonstrate that β-adrenergic blockers following burn injury can redirect the hematopoietic commitment toward erythroid lineage by lowering MafB expression in multipotent progenitors and be of potential therapeutic value to increase erythropoietin responsiveness in burn patients. Copyright © 2017 the American Physiological Society.

  13. Disruption of the 5S RNP-Mdm2 interaction significantly improves the erythroid defect in a mouse model for Diamond-Blackfan anemia.

    OpenAIRE

    Jaako, Pekka; Debnath, Shubhranshu; Olsson, Karin; Zhang, Y; Flygare, Johan; Lindström, M S; Bryder, David; Karlsson, Stefan

    2015-01-01

    Diamond-Blackfan anemia (DBA) is a congenital erythroid hypoplasia caused by haploinsufficiency of genes encoding ribosomal proteins (RPs). Perturbed ribosome biogenesis in DBA has been shown to induce a p53-mediated ribosomal stress response. However, the mechanisms of p53 activation and its relevance for the erythroid defect remain elusive. Previous studies have indicated that activation of p53 is caused by the inhibition of Mdm2, the main negative regulator of p53, by the 5S ribonucleoprot...

  14. Therapeutic γ-globin inducers reduce transcriptional repression in hemoglobinopathy erythroid progenitors through distinct mechanisms

    Science.gov (United States)

    Dai, Yan; Sangerman, Jose; Hong, Yuan Luo; Fuchareon, Suthat; Chui, David H.K.; Faller, Douglas V.; Perrine, Susan P.

    2015-01-01

    Pharmacologic augmentation of γ-globin expression sufficient to reduce anemia and clinical severity in patients with diverse hemoglobinopathies has been challenging. In studies here, representative molecules from four chemical classes, representing several distinct primary mechanisms of action, were investigated for effects on γ-globin transcriptional repressors, including components of the NuRD complex (LSD1 and HDACs 2-3), and the downstream repressor BCL11A, in erythroid progenitors from hemoglobinopathy patients. Two HDAC inhibitors (MS-275 and SB939), a short-chain fatty acid derivative (sodium dimethylbutyrate [SDMB]), and an agent identified in high-throughput screening, Benserazide, were studied. These therapeutics induced γ globin mRNA in progenitors above same subject controls up to 20-fold, and increased F-reticulocytes up to 20%. Cellular protein levels of BCL11A, LSD-1, and KLF1 were suppressed by the compounds. Chromatin immunoprecipitation assays demonstrated a 3.6-fold reduction in LSD1 and HDAC3 occupancy in the γ-globin gene promoter with Benserazide exposure, 3-fold reduction in LSD-1 and HDAC2 occupancy in the γ-globin gene promoter with SDMB exposure, while markers of gene activation (histone H3K9 acetylation and H3K4 demethylation), were enriched 5.7-fold. These findings identify clinical-stage oral therapeutics which inhibit or displace major co-repressors of γ-globin gene transcription and may suggest a rationale for combination therapy to produce enhanced efficacy. PMID:26603726

  15. FHL2 interacts with CALM and is highly expressed in acute erythroid leukemia

    International Nuclear Information System (INIS)

    Pašaliç, Z; Greif, P A; Jurinoviç, V; Mulaw, M; Kakadia, P M; Tizazu, B; Fröhlich-Archangelo, L; Krause, A; Bohlander, S K

    2011-01-01

    The t(10;11)(p13;q14) translocation results in the fusion of the CALM (clathrin assembly lymphoid myeloid leukemia protein) and AF10 genes. This translocation is observed in acute myeloblastic leukemia (AML M6), acute lymphoblastic leukemia (ALL) and malignant lymphoma. Using a yeast two-hybrid screen, the four and a half LIM domain protein 2 (FHL2) was identified as a CALM interacting protein. Recently, high expression of FHL2 in breast, gastric, colon, lung as well as in prostate cancer was shown to be associated with an adverse prognosis. The interaction between CALM and FHL2 was confirmed by glutathione S-transferase-pulldown assay and co-immunoprecipitation experiments. The FHL2 interaction domain of CALM was mapped to amino acids 294–335 of CALM. The transcriptional activation capacity of FHL2 was reduced by CALM, but not by CALM/AF10, which suggests that regulation of FHL2 by CALM might be disturbed in CALM/AF10-positive leukemia. Extremely high expression of FHL2 was seen in acute erythroid leukemia (AML M6). FHL2 was also highly expressed in chronic myeloid leukemia and in AML with complex aberrant karyotype. These results suggest that FHL2 may play an important role in leukemogenesis, especially in the case of AML M6

  16. Differential Relationships among Circulating Inflammatory and Immune Activation Biomediators and Impact of Aging and Human Immunodeficiency Virus Infection in a Cohort of Injection Drug Users

    Directory of Open Access Journals (Sweden)

    Gregory D. Kirk

    2017-10-01

    Full Text Available As individuals with human immunodeficiency virus (HIV infection live longer, aging and age-related chronic conditions have become major health concerns for this vulnerable population. Substantial evidence suggests that chronic inflammation and immune activation contribute significantly to chronic conditions in people aging with or without HIV infection. As a result, increasing numbers of inflammation and immune activation biomediators have been measured. While very few studies describe their in vivo relationships, such studies can serve as an important and necessary initial step toward delineating the complex network of chronic inflammation and immune activation. In this study, we evaluated in vivo relationships between serum levels of neopterin, a biomediator of immune activation, and four commonly described inflammatory biomediators: soluble tumor necrosis factor (TNF-α receptor (sTNFR-1, sTNFR-2, interleukin (IL-6, and C-reactive protein (CRP, as well as the impact of HIV infection and aging in the AIDS Linked to the Intravenous Experience (ALIVE study, a community-recruited observational study of former and current injection drug users (IDUs with or at high risk for HIV infection in Baltimore, MD, USA. The study included 1,178 participants in total with 316 HIV-infected (HV+ and 862 HIV-uninfected (HIV− IDUs. Multivariate regression analyses were employed, adjusting for age, sex, body mass index, smoking, hepatitis C virus co-infection, injection drug use, comorbidities, and HIV status (for all participants, and HIV viral load, CD4+ T-cell counts, and antiretroviral therapy (for HIV+ participants. The results showed significant impact of aging on all five biomediators and that of HIV infection on all but sTNFR-1. In the adjusted model, neopterin had positive associations with sTNFR-1 and sTNFR-2 (partial correlation coefficients: 0.269 and 0.422, respectively, for all participants; 0.292 and 0.354 for HIV+; and 0.262 and 0.435 for HIV

  17. Circulating levels of chromatin fragments are inversely correlated with anti-dsDNA antibody levels in human and murine systemic lupus erythematosus

    DEFF Research Database (Denmark)

    Jørgensen, Mariann H; Rekvig, Ole Petter; Jacobsen, Rasmus S

    2011-01-01

    Anti-dsDNA antibodies represent a central pathogenic factor in Lupus nephritis. Together with nucleosomes they deposit as immune complexes in the mesangial matrix and along basement membranes within the glomeruli. The origin of the nucleosomes and when they appear e.g. in circulation is not known...

  18. Antioxidant mechanism of black garlic extract involving nuclear factor erythroid 2-like factor 2 pathway.

    Science.gov (United States)

    Ha, Ae Wha; Kim, Woo Kyoung

    2017-06-01

    Although studies have revealed that black garlic is a potent antioxidant, its antioxidant mechanism remains unclear. The objective of this study was to determine black garlic's antioxidant activities and possible antioxidant mechanisms related to nuclear factor erythroid 2-like factor 2 (Nrf2)-Keap1 complex. After four weeks of feeding rats with a normal fat diet (NF), a high-fat diet (HF), a high-fat diet with 0.5% black garlic extract (HF+BGE 0.5), a high-fat diet with 1.0% black garlic extract (HF+BGE 1.0), or a high-fat diet with 1.5% black garlic extract (HF+BGE 1.5), plasma concentrations of glucose, insulin,homeostatic model assessment of insulin resistance (HOMA-IR) were determined. As oxidative stress indices, plasma concentrations of thiobarbituric acid reactive substances (TBARS) and 8-isoprostaglandin F2α (8-iso-PGF) were determined. To measure antioxidant capacities, plasma total antioxidant capacity (TAC) and activities of antioxidant enzymes in plasma and liver were determined. The mRNA expression levels of antioxidant related proteins such as Nrf2, NAD(P)H: quinone-oxidoreductase-1 (NQO1), heme oxygenase-1 (HO-1), glutathione reductase (GR), and glutathione S-transferase alpha 2 (GSTA2) were examined. Plasma glucose level, plasma insulin level, and HOMA-IR in black garlic supplemented groups were significantly ( P concentration and TAC in the HF+BGE 1.5 group were significantly decreased compared to those of the HF group. The activities of catalase and glutathione peroxidase were significantly ( P antioxidant systems in rats fed with black garlic extract were related to mRNA expression levels of Nrf2 related genes.

  19. Microwave circulator design

    CERN Document Server

    Linkhart, Douglas K

    2014-01-01

    Circulator design has advanced significantly since the first edition of this book was published 25 years ago. The objective of this second edition is to present theory, information, and design procedures that will enable microwave engineers and technicians to design and build circulators successfully. This resource contains a discussion of the various units used in the circulator design computations, as well as covers the theory of operation. This book presents numerous applications, giving microwave engineers new ideas about how to solve problems using circulators. Design examples are provided, which demonstrate how to apply the information to real-world design tasks.

  20. Lipid peroxidation and total cholesterol in HAART-naïve patients infected with circulating recombinant forms of human immunodeficiency virus type-1 in Cameroon.

    Directory of Open Access Journals (Sweden)

    Georges Teto

    Full Text Available HIV infection has commonly been found to affect lipid profile and antioxidant defense.To determine the effects of Human Immunodeficiency Virus (HIV infection and viral subtype on patient's cholesterol and oxidative stress markers, and determine whether in the absence of Highly Active Antiretroviral Therapy (HAART, these biochemical parameters could be useful in patient's management and monitoring disease progression in Cameroon. For this purpose, we measured total cholesterol (TC, LDL cholesterol (LDLC, HDL cholesterol (HDLC, total antioxidant ability (TAA, lipid peroxidation indices (LPI, and malondialdehyde (MDA in HIV negative persons and HIV positive HAART-naïve patients infected with HIV-1 group M subtypes.We measured serum TC, LDLC, HDLC, plasma MDA, and TAA concentrations, and calculated LPI indices in 151 HIV-positive HAART-naïve patients and 134 seronegative controls. We also performed gene sequence analysis on samples from 30 patients to determine the effect of viral genotypes on these biochemical parameters. We also determined the correlation between CD4 cell count and the above biochemical parameters.We obtained the following controls/patients values for TC (1.96±0.54/1. 12±0. 48 g/l, LDLC (0. 67±0. 46/0. 43±0. 36 g/l, HDLC (105. 51±28. 10/46. 54±23. 36 mg/dl TAA (0. 63±0. 17/0. 16±0. 16 mM, MDA (0. 20±0. 07/0. 41±0. 10 µM and LPI (0. 34±0. 14/26. 02±74. 40. In each case, the difference between the controls and patients was statistically significant (p<0.05. There was a positive and statistically significant Pearson correlation between CD4 cell count and HDLC (r = +0.272; p<0.01, TAA (r = +0.199; p<0.05 and a negative and statistically significant Pearson correlation between CD4 cell count and LPI (r = -0.166; p<0.05. Pearson correlation between CD4 cell count and TC, CD4cell count and LDLC was positive but not statistically significant while it was negative but not statistically significant with MDA. The

  1. NF-Y recruits both transcription activator and repressor to modulate tissue- and developmental stage-specific expression of human γ-globin gene.

    Directory of Open Access Journals (Sweden)

    Xingguo Zhu

    Full Text Available The human embryonic, fetal and adult β-like globin genes provide a paradigm for tissue- and developmental stage-specific gene regulation. The fetal γ-globin gene is expressed in fetal erythroid cells but is repressed in adult erythroid cells. The molecular mechanism underlying this transcriptional switch during erythroid development is not completely understood. Here, we used a combination of in vitro and in vivo assays to dissect the molecular assemblies of the active and the repressed proximal γ-globin promoter complexes in K562 human erythroleukemia cell line and primary human fetal and adult erythroid cells. We found that the proximal γ-globin promoter complex is assembled by a developmentally regulated, general transcription activator NF-Y bound strongly at the tandem CCAAT motifs near the TATA box. NF-Y recruits to neighboring DNA motifs the developmentally regulated, erythroid transcription activator GATA-2 and general repressor BCL11A, which in turn recruit erythroid repressor GATA-1 and general repressor COUP-TFII to form respectively the NF-Y/GATA-2 transcription activator hub and the BCL11A/COUP-TFII/GATA-1 transcription repressor hub. Both the activator and the repressor hubs are present in both the active and the repressed γ-globin promoter complexes in fetal and adult erythroid cells. Through changes in their levels and respective interactions with the co-activators and co-repressors during erythroid development, the activator and the repressor hubs modulate erythroid- and developmental stage-specific transcription of γ-globin gene.

  2. Circulation pump mounting

    International Nuclear Information System (INIS)

    Skalicky, A.

    1976-01-01

    The suspension is described of nuclear reactor circulating pumps enabling their dilatation with a minimum reverse force consisting of spacing rods supported with one end in the anchor joints and provided with springs and screw joints engaging the circulating pump shoes. The spacing rods are equipped with side vibration dampers anchored in the shaft side wall and on the body of the circulating pump drive body. The negative reverse force F of the spacing rods is given by the relation F=Q/l.y, where Q is the weight of the circulating pump, l is the spatial distance between the shoe joints and anchor joints, and y is the deflection of the circulating pump vertical axis from the mean equilibrium position. The described suspension is advantageous in that that the reverse force for the deflection from the mean equilibrium position is minimal, dynamic behaviour is better, and construction costs are lower compared to suspension design used so far. (J.B.)

  3. Seasonal overturning circulation in the Red Sea: 2. Winter circulation

    KAUST Repository

    Yao, Fengchao; Hoteit, Ibrahim; Pratt, Lawrence J.; Bower, Amy S.; Kö hl, Armin; Gopalakrishnan, Ganesh; Rivas, David

    2014-01-01

    The shallow winter overturning circulation in the Red Sea is studied using a 50 year high-resolution MITgcm (MIT general circulation model) simulation with realistic atmospheric forcing. The overturning circulation for a typical year, represented

  4. The 78 kDa glucose-regulated protein (GRP78/BIP) is expressed on the cell membrane, is released into cell culture medium and is also present in human peripheral circulation.

    Science.gov (United States)

    Delpino, Andrea; Castelli, Mauro

    2002-01-01

    In human rabdomiosarcoma cells (TE671/RD) chronic exposure to 500 nM thapsigargin (a powerful inhibitor of the endoplasmic reticulum Ca2+-ATPases) resulted in the induction of the stress protein GRP78/BIP. Making use of the surface biotinylation method, followed by the isolation of the GRP78 using ATP-agarose affinity chromatography, it was found that a fraction of the thapsigargin-induced GRP78 is expressed on the cell surface. The presence of GRP78 on the membrane of thapsigargin-treated cells was confirmed by fractionation of cell lysates into a soluble and a membrane fraction, followed by Western blot analysis with an anti-GRP78 antibody. It was also found that conspicuous amounts of GRP78 are present in the culture medium collected from thapsigargin-treated cultures. This extracellular GRP78 originates mostly by an active release from intact cells and does not result solely from the leakage of proteins from dead cells. Moreover, small amounts of circulating, free GRP78 and naturally-occurring anti-GRP78 autoantibodies were detected in the peripheral circulation of healthy human individuals.

  5. Role of the mitochondrial amino acid pool in the differential sensitivity of erythroid and myeloid cells to chloramphenicol

    International Nuclear Information System (INIS)

    Abou-Khalil, S.; Abou-Khalil, W.H.; Whitney, P.L.; Yunis, A.A.

    1986-01-01

    Previous studies in the authors laboratory have suggested that mitochondrial amino acid (AA) pool is involved in the differential sensitivity of erythroid and myeloid cells to chloramphenicol (CAP). The present study examines the role of AA pool by analysis of its composition and testing the effects of its major components. The endogenous AA composition of isolated mitochondria protein was determined using a JEOL 5AH AA analyzer. L-( 14 C) leucine incorporation into mitochondrial protein was used to measure the rate of protein synthesis. Analysis of the endogenous pool in erythroleukemia (EM) and chloroleukemia (CM) mitochrondria showed similar total amount of AAs. However, some AAs were present in significantly higher or lower quantity within EM and CM (i.e. EM had about 2-fold higher glycine content). When compensating for each low AA addition of that particular acid to the reaction medium, only glycine and serine had significant effect. Thus, the addition of increasing concentrations of glycine or serine enhanced the sensitivity to CAP from 14% to 49-51% in CM but not in EM. Other AAs gave little or no effect. Since glycine is one of the first reactants in heme biosynthesis within mitochondria and is interconvertible with serine, it would appear that erythroid cells sensitivity to CAP is determined by the mitochondrial glycine-serine pool and may be somehow related of the pathway to heme biosynthesis in these cells

  6. Delayed Mesoderm and Erythroid Differentiation of Murine Embryonic Stem Cells in the Absence of the Transcriptional Regulator FUBP1

    Directory of Open Access Journals (Sweden)

    Josephine Wesely

    2017-01-01

    Full Text Available The transcriptional regulator far upstream binding protein 1 (FUBP1 is essential for fetal and adult hematopoietic stem cell (HSC self-renewal, and the constitutive absence of FUBP1 activity during early development leads to embryonic lethality in homozygous mutant mice. To investigate the role of FUBP1 in murine embryonic stem cells (ESCs and in particular during differentiation into hematopoietic lineages, we generated Fubp1 knockout (KO ESC clones using CRISPR/Cas9 technology. Although FUBP1 is expressed in undifferentiated ESCs and during spontaneous differentiation following aggregation into embryoid bodies (EBs, absence of FUBP1 did not affect ESC maintenance. Interestingly, we observed a delayed differentiation of FUBP1-deficient ESCs into the mesoderm germ layer, as indicated by impaired expression of several mesoderm markers including Brachyury at an early time point of ESC differentiation upon aggregation to EBs. Coculture experiments with OP9 cells in the presence of erythropoietin revealed a diminished differentiation capacity of Fubp1 KO ESCs into the erythroid lineage. Our data showed that FUBP1 is important for the onset of mesoderm differentiation and maturation of hematopoietic progenitor cells into the erythroid lineage, a finding that is supported by the phenotype of FUBP1-deficient mice.

  7. Heme-dependent up-regulation of the α-globin gene expression by transcriptional repressor Bach1 in erythroid cells

    International Nuclear Information System (INIS)

    Tahara, Tsuyoshi; Sun Jiying; Igarashi, Kazuhiko; Taketani, Shigeru

    2004-01-01

    The transcriptional factor Bach1 forms a heterodimer with small Maf family, and functions as a repressor of the Maf recognition element (MARE) in vivo. To investigate the involvement of Bach1 in the heme-dependent regulation of the expression of the α-globin gene, human erythroleukemia K562 cells were cultured with succinylacetone (SA), a heme biosynthetic inhibitor, and the level of α-globin mRNA was examined. A decrease of α-globin mRNA was observed in SA-treated cells, which was restored by the addition of hemin. The heme-dependent expression of α-globin occurred at the transcriptional level since the expression of human α-globin gene promoter-reporter gene containing hypersensitive site-40 (HS-40) was decreased when K562 cells were cultured with SA. Hemin treatment restored the decrease of the promoter activity by SA. The regulation of the HS-40 activity by heme was dependent on the NF-E2/AP-1 (NA) site, which is similar to MARE. The NA site-binding activity of Bach1 in K562 increased upon SA-treatment, and the increase was diminished by the addition of hemin. The transient expression of Bach1 and mutated Bach1 lacking CP motifs suppressed the HS-40 activity, and cancellation of the repressor activity by hemin was observed when wild-type Bach1 was expressed. The expression of NF-E2 strengthened the restoration of the Bach1-effect by hemin. Interestingly, nuclear localization of Bach1 increased when cells were treated with SA, while hemin induced the nuclear export of Bach1. These results indicated that heme plays an important role in the induction of α-globin gene expression through disrupting the interaction of Bach1 and the NA site in HS-40 enhancer in erythroid cells

  8. Circulating mitochondrial DNA as biomarker linking environmental chemical exposure to early preclinical lesions elevation of mtDNA in human serum after exposure to carcinogenic halo-alkane-based pesticides.

    Directory of Open Access Journals (Sweden)

    Lygia T Budnik

    Full Text Available There is a need for a panel of suitable biomarkers for detection of environmental chemical exposure leading to the initiation or progression of degenerative diseases or potentially, to cancer. As the peripheral blood may contain increased levels of circulating cell-free DNA in diseased individuals, we aimed to evaluate this DNA as effect biomarker recognizing vulnerability after exposure to environmental chemicals. We recruited 164 individuals presumably exposed to halo-alkane-based pesticides. Exposure evaluation was based on human biomonitoring analysis; as biomarker of exposure parent halo-methanes, -ethanes and their metabolites, as well as the hemoglobin-adducts methyl valine and hydroxyl ethyl valine in blood were used, complemented by expert evaluation of exposure and clinical intoxication symptoms as well as a questionnaire. Assessment showed exposures to halo alkanes in the concentration range being higher than non-cancer reference doses (RfD but (mostly lower than the occupational exposure limits. We quantified circulating DNA in serum from 86 individuals with confirmed exposure to off-gassing halo-alkane pesticides (in storage facilities or in home environment and 30 non-exposed controls, and found that exposure was significantly associated with elevated serum levels of circulating mitochondrial DNA (in size of 79 bp, mtDNA-79, p = 0.0001. The decreased integrity of mtDNA (mtDNA-230/mtDNA-79 in exposed individuals implicates apoptotic processes (p = 0.015. The relative amounts of mtDNA-79 in serum were positively associated with the lag-time after intoxication to these chemicals (r = 0.99, p<0.0001. Several months of post-exposure the specificity of this biomarker increased from 30% to 97% in patients with intoxication symptoms. Our findings indicate that mitochondrial DNA has a potential to serve as a biomarker recognizing vulnerable risk groups after exposure to toxic/carcinogenic chemicals.

  9. Tracing How Arts and Humanities Research Translates, Circulates and Consolidates in Society.. How Have Scholars Been Reacting to Diverse Impact and Public Value Agendas?

    Science.gov (United States)

    Benneworth, Paul

    2015-01-01

    Arts and humanities research appears to have a problem when it comes to making an argument that it matters to society. Despite widespread efforts within and beyond the field to document how arts and humanities research creates social value, these arguments have had little traction within public policy debates. The paper argues that other…

  10. Tracing how arts and humanities research translates, circulates and consolidates in society.. How have scholars been reacting to diverse impact and public value agendas?

    NARCIS (Netherlands)

    Benneworth, Paul Stephen

    2014-01-01

    Arts and humanities research appears to have a problem when it comes to making an argument that it matters to society. Despite widespread efforts within and beyond the field to document how arts and humanities research creates social value, these arguments have had little traction within public

  11. Circulating interleukin-10 levels and human papilloma virus and Epstein-Barr virus-associated cancers: evidence from a Mendelian randomization meta-analysis based on 11,170 subjects.

    Science.gov (United States)

    Qu, Kai; Pang, Qing; Lin, Ting; Zhang, Li; Gu, Mingliang; Niu, Wenquan; Liu, Chang; Zhang, Ming

    2016-01-01

    Recent studies have showed interleukin 10 (IL-10) is a critical cytokine that determines antiviral immune response and is related to virus-associated cancers. However, whether genetically elevated circulating IL-10 levels are associated with the risk of human papilloma virus and Epstein-Barr virus-associated cancers (HEACs) is still unclear. Mendelian randomization method was implemented to meta-analyze available observational studies by employing IL-10 three variants (-592C>A, -819C>T, and -1082A>G) as instruments. A total of 24 articles encompassing 11,170 subjects were ultimately eligible for the meta-analysis. Overall, there was a significant association between IL-10 promoter variant -1082A>G and HEACs under allelic and dominant models (both PG was significant for nasopharyngeal cancer under allelic, homozygous genotypic and dominant models (all P<0.001). Moreover by ethnicity, carriers of -1082G allele had a 74% increased risk for nasopharyngeal cancer in Asians under dominant model (odds ratio [OR] =1.737; 95% confidence interval [CI]: 1.280-2.358; P<0.001). In further Mendelian randomization analysis, the predicted OR for 10 pg/mL increment in IL-10 levels was 1.14 (95% CI: 1.01-16.99) in HEACs. Our findings provided strong evidence for a critical role of genetically elevated circulating IL-10 levels in the development of HEACs, especially in Asian population and for nasopharyngeal cancer.

  12. Generation of a High Number of Healthy Erythroid Cells from Gene-Edited Pyruvate Kinase Deficiency Patient-Specific Induced Pluripotent Stem Cells

    Directory of Open Access Journals (Sweden)

    Zita Garate

    2015-12-01

    Full Text Available Pyruvate kinase deficiency (PKD is a rare erythroid metabolic disease caused by mutations in the PKLR gene. Erythrocytes from PKD patients show an energetic imbalance causing chronic non-spherocytic hemolytic anemia, as pyruvate kinase defects impair ATP production in erythrocytes. We generated PKD induced pluripotent stem cells (PKDiPSCs from peripheral blood mononuclear cells (PB-MNCs of PKD patients by non-integrative Sendai viral vectors. PKDiPSCs were gene edited to integrate a partial codon-optimized R-type pyruvate kinase cDNA in the second intron of the PKLR gene by TALEN-mediated homologous recombination (HR. Notably, we found allele specificity of HR led by the presence of a single-nucleotide polymorphism. High numbers of erythroid cells derived from gene-edited PKDiPSCs showed correction of the energetic imbalance, providing an approach to correct metabolic erythroid diseases and demonstrating the practicality of this approach to generate the large cell numbers required for comprehensive biochemical and metabolic erythroid analyses.

  13. Circulating brain derived neurotrophic factor (BDNF) and frequency of BDNF positive T cells in peripheral blood in human ischemic stroke: Effect on outcome.

    Science.gov (United States)

    Chan, Adeline; Yan, Jun; Csurhes, Peter; Greer, Judith; McCombe, Pamela

    2015-09-15

    The aim of this study was to measure the levels of circulating BDNF and the frequency of BDNF-producing T cells after acute ischaemic stroke. Serum BDNF levels were measured by ELISA. Flow cytometry was used to enumerate peripheral blood leukocytes that were labelled with antibodies against markers of T cells, T regulatory cells (Tregs), and intracellular BDNF. There was a slight increase in serum BDNF levels after stroke. There was no overall difference between stroke patients and controls in the frequency of CD4(+) and CD8(+) BDNF(+) cells, although a subgroup of stroke patients showed high frequencies of these cells. However, there was an increase in the percentage of BDNF(+) Treg cells in the CD4(+) population in stroke patients compared to controls. Patients with high percentages of CD4(+) BDNF(+) Treg cells had a better outcome at 6months than those with lower levels. These groups did not differ in age, gender or initial stroke severity. Enhancement of BDNF production after stroke could be a useful means of improving neuroprotection and recovery after stroke. Copyright © 2015 Elsevier B.V. All rights reserved.

  14. Acute oral intake of a higenamine-based dietary supplement increases circulating free fatty acids and energy expenditure in human subjects.

    Science.gov (United States)

    Lee, Sang-Rok; Schriefer, Johnhenry M; Gunnels, Trint A; Harvey, Innocence C; Bloomer, Richard J

    2013-10-21

    Higenamine, also known as norcoclaurine, is an herbal constituent thought to act as a beta-2 adrenergic receptor agonist-possibly stimulating lipolysis. It was the purpose of this study to determine the impact of a higenamine-based dietary supplement on plasma free fatty acids and energy expenditure following acute oral ingestion. Sixteen healthy subjects (8 men; 26.1 ± 2.5 yrs; 8 women 22.4 ± 3.1 yrs) ingested a dietary supplement containing a combination of higenamine, caffeine (270 mg), and yohimbe bark extract or a placebo, on two separate occasions in a double-blind, randomized, cross-over design, separated by 6-8 days. Blood samples were collected immediately before ingestion, and at 30, 60, 120, and 180 minutes post ingestion, and analyzed for plasma free fatty acids (FFA) and glycerol. Breath samples were collected at the same times for a measure of kilocalorie expenditure and respiratory exchange ratio (RER) using indirect calorimetry. Heart rate and blood pressure were recorded at all times. Data collection occurred in the morning following a 10 hour overnight fast. A condition effect was noted for both FFA (p 0.05). A condition effect was noted for heart rate (p = 0.03) and systolic blood pressure (p < 0.0001), with values higher for supplement compared to placebo. Ingestion of a higenamine-based dietary supplement stimulates lipolysis and energy expenditure, as evidenced by a significant increase in circulating FFA and kilocalorie expenditure. The same supplement results in a moderate increase in heart rate (~3 bpm) and systolic blood pressure (~12 mmHg), which is consistent with previous studies evaluating moderate doses of caffeine and yohimbine, suggesting that higenamine contributes little to the increase in these hemodynamic variables. These findings are in reference to young, healthy and active men and women.

  15. FGF21, a liver hormone that inhibits alcohol intake in mice, increases in human circulation after acute alcohol ingestion and sustained binge drinking at Oktoberfest

    DEFF Research Database (Denmark)

    Søberg, Susanna; Andersen, Emilie S; Dalgaard, Niels B

    2018-01-01

    . KLB encodes β-klotho, co-receptor for the liver-derived hormone fibroblast growth factor 21 (FGF21). In mice, FGF21 reduces alcohol intake, and human Fgf21 variants are enriched among heavy drinkers. Thus, the liver may limit alcohol consumption by secreting FGF21. However, whether full-length, active...... plasma FGF21 (FGF21 (1-181)) levels in humans increase acutely or sub-chronically in response to alcohol ingestion is uncertain. METHODS: We recruited 10 healthy, fasted male subjects to receive an oral water or alcohol bolus with concurrent blood sampling for FGF21 (1-181) measurement in plasma...... correlated fasting FGF21 (1-181) levels in 49 healthy, non-alcoholic subjects of mixed sex with self-reports of alcohol-related behaviors, emotional responses, and problems. Finally, we characterized the effect of recombinant human FGF21 injection on ad libitum alcohol intake in mice. RESULTS: We show...

  16. Method and cell lines for the production of monoclonal antibodies to human glycophorin A

    Science.gov (United States)

    Bigbee, W.L.; Fong, S.S.N.; Jensen, R.H.; Vanderlaan, M.

    Cloned mouse hybridoma cell lines have been established which continuously produce antibodies that differentiate between the M and N forms of human glycophorin A. These antibodies have potential application as human blood group reagents, as markers for terminally differentiated erythroid cells and as immunofluorescent labels of somatically variant human erythrocytes.

  17. Arctic circulation regimes.

    Science.gov (United States)

    Proshutinsky, Andrey; Dukhovskoy, Dmitry; Timmermans, Mary-Louise; Krishfield, Richard; Bamber, Jonathan L

    2015-10-13

    Between 1948 and 1996, mean annual environmental parameters in the Arctic experienced a well-pronounced decadal variability with two basic circulation patterns: cyclonic and anticyclonic alternating at 5 to 7 year intervals. During cyclonic regimes, low sea-level atmospheric pressure (SLP) dominated over the Arctic Ocean driving sea ice and the upper ocean counterclockwise; the Arctic atmosphere was relatively warm and humid, and freshwater flux from the Arctic Ocean towards the subarctic seas was intensified. By contrast, during anticylonic circulation regimes, high SLP dominated driving sea ice and the upper ocean clockwise. Meanwhile, the atmosphere was cold and dry and the freshwater flux from the Arctic to the subarctic seas was reduced. Since 1997, however, the Arctic system has been under the influence of an anticyclonic circulation regime (17 years) with a set of environmental parameters that are atypical for this regime. We discuss a hypothesis explaining the causes and mechanisms regulating the intensity and duration of Arctic circulation regimes, and speculate how changes in freshwater fluxes from the Arctic Ocean and Greenland impact environmental conditions and interrupt their decadal variability. © 2015 The Authors.

  18. Impact of interocean exchange on the Atlantic overturning circulation

    NARCIS (Netherlands)

    Weijer, W.

    2000-01-01

    The awareness that human activity could change climate has greatly raised public and scientific interest in climate. One issue of present-day climate research is the stability of the thermohaline circulation. This overturning circulation, popularly known as the `conveyor belt', redistributes

  19. Detection of circulating immune complexes of human IgA and beta 2 glycoprotein I in patients with antiphospholipid syndrome symptomatology.

    Science.gov (United States)

    Martínez-Flores, José A; Serrano, Manuel; Pérez, Dolores; Lora, David; Paz-Artal, Estela; Morales, José M; Serrano, Antonio

    2015-07-01

    Patients with antiphospholipid syndrome (APS) have a hypercoagulable condition associated with the presence of antiphospholipid autoantibodies (aPL). Consensus antibodies for diagnosis are lupus anticoagulant, anti-beta2 glycoprotein I (B2GPI) and anticardiolipin (IgG or IgM). Circulating immunocomplexes (CIC) of B2GPI associated with IgM or IgG were reported. Isolated IgA aB2GPI antibodies have achieved high diagnostic value although specific CIC of B2GPI bounded to IgA (B2A-CIC) has still not been described. CIC detection assays are mainly based on interaction with complement and are not appropriate to detect B2A-CIC because IgA does not fix complement using the classical pathway. Sera from healthy blood donors (N= 247) and from patients with thrombosis background and isolate positive for IgA aB2GPI (N = 68) were studied in a case-control study. Two methods were applied, these being a capture ELISA to quantify specific B2A-CIC and quantification of total IgA anti-B2GPI after dissociating CIC. B2A-CIC values in APS-patients were 19.27 ± 2.6 AU vs 6.1 ± 0.4 AU in blood donors (p < 0.001). There were 36.4% B2A-CIC positive patients (cutoff 21 AU) versus 5.5% in blood donors (p < 0.001). Dissociated IgA aB2GPI levels (total IgA aB2GPI) were 146.8 ± 10.8 IU/mL in patients vs. 22.4 IU/mL in controls (p < 0.001). B2A-CIC was independent of B2GPI and autoantibodies IgA aB2GPI serum levels. B2A-CIC can be identified and quantified in an easy and reproducible manner using two complement-independent methods. The use of these tests in prospective studies will allow better understanding of the prognosis and outcome of patients. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. Systems engineering requirements impacting MHTGR circulator design

    International Nuclear Information System (INIS)

    Chi, H.W.; Baccaglini, G.M.; Potter, R.C.; Shenoy, A.S.

    1988-01-01

    At the initiation of the MHTGR program, an important task involved translating the plant users' requirements into design conditions. This was particularly true in the case of the heat transport and shutdown cooling systems since these embody many components. This paper addresses the two helium circulators in these systems. An integrated approach is being used in the development of design and design documentation for the MHTGR plant. It is an organized and systematic development of plant functions and requirements, determined by top-down design, performance, and cost trade-off studies and analyses, to define the overall plant systems, subsystems, components, and human actions. These studies, that led to the identification of the major design parameters for the two circulators, are discussed in this paper. This includes the performance information, steady state and transient data, and the various interface requirements. The design of the circulators used in the MHTGR is presented. (author). 1 ref., 17 figs

  1. Genomic Analysis of 15 Human Coronaviruses OC43 (HCoV-OC43s Circulating in France from 2001 to 2013 Reveals a High Intra-Specific Diversity with New Recombinant Genotypes

    Directory of Open Access Journals (Sweden)

    Nathalie Kin

    2015-05-01

    Full Text Available Human coronavirus OC43 (HCoV-OC43 is one of five currently circulating human coronaviruses responsible for respiratory infections. Like all coronaviruses, it is characterized by its genome’s high plasticity. The objectives of the current study were to detect genetically distinct genotypes and eventually recombinant genotypes in samples collected in Lower Normandy between 2001 and 2013. To this end, we sequenced complete nsp12, S, and N genes of 15 molecular isolates of HCoV-OC43 from clinical samples and compared them to available data from the USA, Belgium, and Hong-Kong. A new cluster E was invariably detected from nsp12, S, and N data while the analysis of nsp12 and N genes revealed the existence of new F and G clusters respectively. The association of these different clusters of genes in our specimens led to the description of thirteen genetically distinct genotypes, among which eight recombinant viruses were discovered. Identification of these recombinant viruses, together with temporal analysis and tMRCA estimation, provides important information for understanding the dynamics of the evolution of these epidemic coronaviruses.

  2. Controlled humidity gas circulators

    International Nuclear Information System (INIS)

    Gruner, S.M.

    1981-01-01

    A programmable circulator capable of regulating the humidity of a gas stream over a wide range of humidity is described. An optical dew-point hygrometer is used as a feedback element to control the addition or removal of water vapor. Typical regulation of the gas is to a dew-point temperature of +- 0.2 0 C and to an accuracy limited by the dew-point hygrometer

  3. Fluid circulation control device

    International Nuclear Information System (INIS)

    Benard, Henri; Henocque, Jean.

    1982-01-01

    Horizontal fluid circulation control device, of the type having a pivoting flap. This device is intended for being fitted in the pipes of hydraulic installation, particularly in a bleed and venting system of a nuclear power station shifting radioactive or contaminated liquids. The characteristic of this device is the cut-out at the top of the flap to allow the air contained in the pipes to flow freely [fr

  4. Molecular characterization of canine distemper vi- rus circulating in ...

    African Journals Online (AJOL)

    2OIE Collaborating Centre for Diseases at Animal and Human Interface, FAO Reference Centre for Rabies, Viale ... Asia-1 lineage canine distemper virus is circulating in outbreak. .... jected to cell culture on Vero cell lines for virus isolation.

  5. Circulating chromatin-anti-chromatin antibody complexes bind with high affinity to dermo-epidermal structures in murine and human lupus nephritis

    DEFF Research Database (Denmark)

    Fismen, S; Hedberg, A; Fenton, K A

    2009-01-01

    Murine and human lupus nephritis are characterized by glomerular deposits of electron-dense structures (EDS). Dominant components of EDS are chromatin fragments and IgG antibodies. Whether glomerular EDS predispose for similar deposits in skin is unknown. We analysed (i) whether dermo-epidermal i......Murine and human lupus nephritis are characterized by glomerular deposits of electron-dense structures (EDS). Dominant components of EDS are chromatin fragments and IgG antibodies. Whether glomerular EDS predispose for similar deposits in skin is unknown. We analysed (i) whether dermo......-epidermal immune complex deposits have similar molecular composition as glomerular deposits, (ii) whether chromatin fragments bind dermo-epidermal structures, and (iii) whether deposits in nephritic glomeruli predispose for accumulation of similar deposits in skin. Paired skin and kidney biopsies from nephritic...... (NZBxNZW)F1 and MRL-lpr/lpr mice and from five patients with lupus nephritis were analysed by immunofluorescence, immune electron microscopy (IEM) and co-localization TUNEL IEM. Affinity of chromatin fragments for membrane structures was determined by surface plasmon resonance. Results demonstrated (i...

  6. GAR22: A novel target gene of thyroid hormone receptor causes growth inhibition in human erythroid cells

    Czech Academy of Sciences Publication Activity Database

    Gamper, I.; Koh, K.-R.; Ruau, D.; Ullrich, K.; Bartůňková, Jana; Piroth, D.; Hacker, C.; Bartůněk, Petr; Zenke, M.

    2009-01-01

    Roč. 37, č. 5 (2009), s. 539-548 ISSN 0301-472X R&D Projects: GA MŠk(CZ) LC06077 Institutional research plan: CEZ:AV0Z50520514 Keywords : Thyroid hormone receptor * GAR22 * erythropoiesis Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.106, year: 2009

  7. HS5 of the human β-globin Locus Control Region: a developmental stage-specific border in erythroid cells.

    NARCIS (Netherlands)

    A. Wai (Albert); N. Gillemans (Nynke); S. Raguz-Bolognesi (Selina); S. Pruzina (Sara); G. Zafarana (Gaetano); D.N. Meijer (Dies); F.G. Grosveld (Frank); J.N.J. Philipsen (Sjaak)

    2003-01-01

    textabstractElements with insulator/border activity have been characterized most extensively in Drosophila melanogaster. In vertebrates, the first example of such an element was provided by a hypersensitive site of the chicken beta-globin locus, cHS4. It has been proposed that the homologous site in

  8. Involvement of the major histocompatibility complex region in the genetic regulation of circulating CD8 T-cell numbers in humans.

    Science.gov (United States)

    Cruz, E; Vieira, J; Gonçalves, R; Alves, H; Almeida, S; Rodrigues, P; Lacerda, R; Porto, G

    2004-07-01

    Variability in T-lymphocyte numbers is partially explained by a genetic regulation. From studies in animal models, it is known that the Major Histocompatibility Complex (MHC) is involved in this regulation. In humans, this has not been shown yet. The objective of the present study was to test the hypothesis that genes in the MHC region influence the regulation of T-lymphocyte numbers. Two approaches were used. Association studies between T-cell counts (CD4(+) and CD8(+)) or total lymphocyte counts and HLA class I alleles (A and B) or mutations in the HFE (C282Y and H63D), the hemochromatosis gene, in an unrelated population (n = 264). A second approach was a sibpair correlation analysis of the same T-cell counts in relation to HLA-HFE haplotypes in subjects belonging to 48 hemochromatosis families (n = 456 sibpairs). In the normal population, results showed a strong statistically significant association of the HLA-A*01 with high numbers of CD8(+) T cells and a less powerful association with the HLA-A*24 with low numbers of CD8(+) T cells. Sibpair correlations revealed the most significant correlation for CD8(+) T-cell numbers for sibpairs with HLA-HFE-identical haplotypes. This was not observed for CD4(+) T cells. These results show that the MHC region is involved in the genetic regulation of CD8(+) T-cell numbers in humans. Identification of genes responsible for this control may have important biological and clinical implications.

  9. A common signaling pathway is activated in erythroid cells expressing high levels of fetal hemoglobin: a potential role for cAMP-elevating agents in β-globin disorders

    Directory of Open Access Journals (Sweden)

    Ikuta T

    2013-12-01

    Full Text Available Tohru Ikuta,1 Yuichi Kuroyanagi,1 Nadine Odo,1 Siyang Liu21Department of Anesthesiology and Perioperative Medicine, 2Department of Physiology, Medical College of Georgia, Georgia Regents University, Augusta, GA, USABackground: Although erythroid cells prepared from fetal liver, cord blood, or blood from β-thalassemia patients are known to express fetal hemoglobin at high levels, the underlying mechanisms remain elusive. We previously showed that cyclic nucleotides such as cAMP and cGMP induce fetal hemoglobin expression in primary erythroid cells. Here we report that cAMP signaling contributes to high-level fetal hemoglobin expression in erythroid cells prepared from cord blood and β-thalassemia.Methods: The status of the cAMP signaling pathway was investigated using primary erythroid cells prepared from cord blood and the mononuclear cells of patients with β-thalassemia; erythroid cells from adult bone marrow mononuclear cells served as the control.Results: We found that intracellular cAMP levels were higher in erythroid cells from cord blood and β-thalassemia than from adult bone marrow. Protein kinase A activity levels and cAMP-response element binding protein phosphorylation were higher in erythroid cells from cord blood or β-thalassemia than in adult bone marrow progenitors. Mitogen-activated protein kinase pathways, which play a role in fetal hemoglobin expression, were not consistently activated in cord blood or β-thalassemia erythroid cells. When cAMP signaling was activated in adult erythroid cells, fetal hemoglobin was induced at high levels and associated with reduced expression of BCL11A, a silencer of the β-globin gene.Conclusion: These results suggest that activated cAMP signaling may be a common mechanism among erythroid cells with high fetal hemoglobin levels, in part because of downregulation of BCL11A. Activation of the cAMP signaling pathway with cAMP-elevating agents may prove to be an important signaling mechanism to

  10. Genetic manipulation of RPS5 gene expression modulates the initiation of commitment of MEL cells to erythroid maturation: Implications in understanding ribosomopathies.

    Science.gov (United States)

    Vizirianakis, Ioannis S; Papachristou, Eleni T; Andreadis, Panagiotis; Zopounidou, Elena; Matragkou, Christina N; Tsiftsoglou, Asterios S

    2015-07-01

    Impairment of ribosome biogenesis contributes to the molecular pathophysiology of ribosomopathies by deregulating cell-lineage specific proliferation, differentiation and apoptosis decisions of haematopoietic progenitor cells. Here, using pro-erythroblast-like murine erythroleukemia (MEL) cells, a model system of erythroid maturation, we aimed to investigate whether genetic manipulation of RPS5 expression affects the capacity of cells to grow and differentiate in culture. Parental MEL cells stably transfected with full length RPS5 cDNA in sense (MEL-C14 culture) or antisense (MEL-antisenseRPS5 culture) orientation, as well as MEL cells transiently transfected with siRNAs specific for RPS5 gene silencing (MEL-RPS5siRNA culture) were assessed for their ability to fully execute their erythroid maturation program in culture. The data obtained thus far indicate that: a) MEL-antisenseRPS5 exhibit a pronounced delay in the initiation of differentiation, as well as an impairment of commitment, since the continuous presence of the inducer in culture is required for the cells to fully execute their erythroid maturation program. b) RNAi-mediating silencing of RPS5 gene expression resulted in the inability of MEL cells to differentiate; however, when these cells were allowed to recapitulate normal RPS5 gene expression levels they regained their differentiation capacity by accumulating high proportion of erythroid mature cells. c) Interestingly the latter, is accompanied by morphological changes of cells and an impairment of their proliferation and apoptosis potential. Such data for the first time correlate the RPS5 gene expression levels with the differentiation capacity of MEL cells in vitro, a fact that might also have implications in understanding ribosomopathies.

  11. BIM-Enabled Conceptual Modelling and Representation of Building Circulation

    Directory of Open Access Journals (Sweden)

    Jin Kook Lee

    2014-08-01

    Full Text Available This paper describes how a building information modelling (BIM-based approach for building circulation enables us to change the process of building design in terms of its computational representation and processes, focusing on the conceptual modelling and representation of circulation within buildings. BIM has been designed for use by several BIM authoring tools, in particular with the widely known interoperable industry foundation classes (IFCs, which follow an object-oriented data modelling methodology. Advances in BIM authoring tools, using space objects and their relations defined in an IFC's schema, have made it possible to model, visualize and analyse circulation within buildings prior to their construction. Agent-based circulation has long been an interdisciplinary topic of research across several areas, including design computing, computer science, architectural morphology, human behaviour and environmental psychology. Such conventional approaches to building circulation are centred on navigational knowledge about built environments, and represent specific circulation paths and regulations. This paper, however, places emphasis on the use of ‘space objects’ in BIM-enabled design processes rather than on circulation agents, the latter of which are not defined in the IFCs' schemas. By introducing and reviewing some associated research and projects, this paper also surveys how such a circulation representation is applicable to the analysis of building circulation-related rules.

  12. Method validation for preparing serum and plasma samples from human blood for downstream proteomic, metabolomic, and circulating nucleic acid-based applications.

    Science.gov (United States)

    Ammerlaan, Wim; Trezzi, Jean-Pierre; Lescuyer, Pierre; Mathay, Conny; Hiller, Karsten; Betsou, Fay

    2014-08-01

    Formal method validation for biospecimen processing in the context of accreditation in laboratories and biobanks is lacking. Serum and plasma processing protocols were validated for fitness-for-purpose in terms of key downstream endpoints, and this article demonstrates methodology for biospecimen processing method validation. Serum and plasma preparation from human blood was optimized for centrifugation conditions with respect to microparticle counts. Optimal protocols were validated for methodology and reproducibility in terms of acceptance criteria based on microparticle counts, DNA and hemoglobin concentration, and metabolomic and proteomic profiles. These parameters were also used to evaluate robustness for centrifugation temperature (4°C versus room temperature [RT]), deceleration (low, medium, high) and blood stability (after a 2-hour delay). Optimal protocols were 10-min centrifugation for serum and 20-min for plasma at 2000 g, medium brake, RT. Methodology and reproducibility acceptance criteria were met for both protocols except for reproducibility of plasma metabolomics. Overall, neither protocol was robust for centrifugation at 4°C versus RT. RT gave higher microparticles and free DNA yields in serum, and fewer microparticles with less hemolysis in plasma. Overall, both protocols were robust for fast, medium, and low deceleration, with a medium brake considered optimal. Pre-centrifugation stability after a 2-hour delay was seen at both temperatures for hemoglobin concentration and proteomics, but not for microparticle counts. We validated serum and plasma collection methods suitable for downstream protein, metabolite, or free nucleic acid-based applications. Temperature and pre-centrifugation delay can influence analytic results, and laboratories and biobanks should systematically record these conditions in the scope of accreditation.

  13. Human immunodeficiency virus type 1 subtype B ancestral envelope protein is functional and elicits neutralizing antibodies in rabbits similar to those elicited by a circulating subtype B envelope.

    Science.gov (United States)

    Doria-Rose, N A; Learn, G H; Rodrigo, A G; Nickle, D C; Li, F; Mahalanabis, M; Hensel, M T; McLaughlin, S; Edmonson, P F; Montefiori, D; Barnett, S W; Haigwood, N L; Mullins, J I

    2005-09-01

    Human immunodeficiency virus type 1 (HIV-1) is a difficult target for vaccine development, in part because of its ever-expanding genetic diversity and attendant capacity to escape immunologic recognition. Vaccine efficacy might be improved by maximizing immunogen antigenic similarity to viruses likely to be encountered by vaccinees. To this end, we designed a prototype HIV-1 envelope vaccine using a deduced ancestral state for the env gene. The ancestral state reconstruction method was shown to be >95% accurate by computer simulation and 99.8% accurate when estimating the known inoculum used in an experimental infection study in rhesus macaques. Furthermore, the deduced ancestor gene differed from the set of sequences used to derive the ancestor by an average of 12.3%, while these latter sequences were an average of 17.3% different from each other. A full-length ancestral subtype B HIV-1 env gene was constructed and shown to produce a glycoprotein of 160 kDa that bound and fused with cells expressing the HIV-1 coreceptor CCR5. This Env was also functional in a virus pseudotype assay. When either gp160- or gp140-expressing plasmids and recombinant gp120 were used to immunize rabbits in a DNA prime-protein boost regimen, the artificial gene induced immunoglobulin G antibodies capable of weakly neutralizing heterologous primary HIV-1 strains. The results were similar for rabbits immunized in parallel with a natural isolate, HIV-1 SF162. Further design efforts to better present conserved neutralization determinants are warranted.

  14. Disruption of the 5S RNP-Mdm2 interaction significantly improves the erythroid defect in a mouse model for Diamond-Blackfan anemia.

    Science.gov (United States)

    Jaako, P; Debnath, S; Olsson, K; Zhang, Y; Flygare, J; Lindström, M S; Bryder, D; Karlsson, S

    2015-11-01

    Diamond-Blackfan anemia (DBA) is a congenital erythroid hypoplasia caused by haploinsufficiency of genes encoding ribosomal proteins (RPs). Perturbed ribosome biogenesis in DBA has been shown to induce a p53-mediated ribosomal stress response. However, the mechanisms of p53 activation and its relevance for the erythroid defect remain elusive. Previous studies have indicated that activation of p53 is caused by the inhibition of mouse double minute 2 (Mdm2), the main negative regulator of p53, by the 5S ribonucleoprotein particle (RNP). Meanwhile, it is not clear whether this mechanism solely mediates the p53-dependent component found in DBA. To approach this question, we crossed our mouse model for RPS19-deficient DBA with Mdm2(C305F) knock-in mice that have a disrupted 5S RNP-Mdm2 interaction. Upon induction of the Rps19 deficiency, Mdm2(C305F) reversed the p53 response and improved expansion of hematopoietic progenitors in vitro, and ameliorated the anemia in vivo. Unexpectedly, disruption of the 5S RNP-Mdm2 interaction also led to selective defect in erythropoiesis. Our findings highlight the sensitivity of erythroid progenitor cells to aberrations in p53 homeostasis mediated by the 5S RNP-Mdm2 interaction. Finally, we provide evidence indicating that physiological activation of the 5S RNP-Mdm2-p53 pathway may contribute to functional decline of the hematopoietic system in a cell-autonomous manner over time.

  15. Synergistic Effect of Sodium Butyrate and Thalidomide in the Induction of Fetal Hemoglobin Expression in Erythroid Progenitors Derived from Cord Blood CD133 + Cells

    Directory of Open Access Journals (Sweden)

    Ali Dehghanifard

    2012-07-01

    Full Text Available Background: The use of drugs with the ability to induce production of fetal hemoglobin as a novel therapeutic approach in treating β-Hemoglobinopathies is considered. γ-globin gene expression inducer drugs including sodium butyrate and thalidomide can reduce additional α-globin chains accumulation in erythroid precursors. Materials and Methods: In this experimental study, MACS kit was used to isolate CD133+ cells of umbilical cord blood. Further, the effect of two drugs of thalidomide and sodium butyrate were separately and combined studied on the induction of quantitative expression of β-globin and γ-globin genes in erythroid precursor cells derived from CD133+ stem cells in-vitro. For this purpose, the technique SYBR green Real-time PCR was used.Results: Flow cytometry results showed that approximately 95% of purified cells were CD133+. Real-time PCR results also showed the increased levels of γ-globin mRNA in the cell groups treated with thalidomide, sodium butyrate and combination of drugs as 2.6 and 1.2 and 3.5 times respectively, and for β-globin gene, it is respectively 1.4 and 1.3 and 1.6 times compared with the control group (p<0.05.Conclusion: The study results showed that the mentioned drug combination can act as a pharmaceutical composition affecting the induction of fetal hemoglobin expression in erythroid precursor cells derived from CD133 + cells.

  16. The effects of erythropoietin signaling on telomerase regulation in non-erythroid malignant and non-malignant cells

    International Nuclear Information System (INIS)

    Uziel, Orit; Kanfer, Gil; Beery, Einat; Yelin, Dana; Shepshelovich, Daniel; Bakhanashvili, Mary; Nordenberg, Jardena; Lahav, Meir

    2014-01-01

    Highlights: • We assumed that some of erythropoietin adverse effects may be mediated by telomerase activity. • EPO administration increased telomerase activity, cells proliferation and migration. • The inhibition of telomerase modestly repressed the proliferative effect of erythropoietin. • Telomere shortening caused by long term inhibition of the enzyme totally abolished that effect. • This effect was mediated via the Lyn–AKT axis and not by the canonical JAK2–STAT pathway. - Abstract: Treatment with erythropoietin (EPO) in several cancers is associated with decreased survival due to cancer progression. Due to the major importance of telomerase in cancer biology we hypothesized that some of these effects may be mediated through EPO effect on telomerase. For this aim we explored the possible effects of EPO on telomerase regulation, cell migration and chemosensitivity in non-erythroid malignant and non-malignant cells. Cell proliferation, telomerase activity (TA) and cell migration increased in response to EPO. EPO had no effect on cancer cells sensitivity to cisplatinum and on the cell cycle status. The inhibition of telomerase modestly repressed the proliferative effect of EPO. Telomere shortening caused by long term inhibition of the enzyme abolished the effect of EPO, suggesting that EPO effects on cancer cells are related to telomere dynamics. TA was correlated with the levels of Epo-R. The increase in TA was mediated post-translationally through the Lyn-Src and not the canonical JAK2 pathway

  17. A protective role of nuclear factor-erythroid 2-related factor-2 (Nrf2) in inflammatory disorders

    International Nuclear Information System (INIS)

    Kim, Jiyoung; Cha, Young-Nam; Surh, Young-Joon

    2010-01-01

    Nuclear factor-erythroid 2-related factor-2 (Nrf2) is a key transcription factor that plays a central role in cellular defense against oxidative and electrophilic insults by timely induction of antioxidative and phase-2 detoxifying enzymes and related stress-response proteins. The 5'-flanking regions of genes encoding these cytoprotective proteins contain a specific consensus sequence termed antioxidant response element (ARE) to which Nrf2 binds. Recent studies have demonstrated that Nrf2-ARE signaling is also involved in attenuating inflammation-associated pathogenesis, such as autoimmune diseases, rheumatoid arthritis, asthma, emphysema, gastritis, colitis and atherosclerosis. Thus, disruption or loss of Nrf2 signaling causes enhanced susceptibility not only to oxidative and electrophilic stresses but also to inflammatory tissue injuries. During the early-phase of inflammation-mediated tissue damage, activation of Nrf2-ARE might inhibit the production or expression of pro-inflammatory mediators including cytokines, chemokines, cell adhesion molecules, matrix metalloproteinases, cyclooxygenase-2 and inducible nitric oxide synthase. It is likely that the cytoprotective function of genes targeted by Nrf2 may cooperatively regulate the innate immune response and also repress the induction of pro-inflammatory genes. This review highlights the protective role of Nrf2 in inflammation-mediated disorders with special focus on the inflammatory signaling modulated by this redox-regulated transcription factor.

  18. A protective role of nuclear factor-erythroid 2-related factor-2 (Nrf2) in inflammatory disorders

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Jiyoung [National Research Laboratory, College of Pharmacy, Graduate School of Convergence Science and Technology, Seoul National University, Seoul 151-742 (Korea, Republic of); Cha, Young-Nam [Inha University College of Medicine, Incheon 382-751 (Korea, Republic of); Surh, Young-Joon, E-mail: surh@plaza.snu.ac.kr [National Research Laboratory, College of Pharmacy, Graduate School of Convergence Science and Technology, Seoul National University, Seoul 151-742 (Korea, Republic of); Department of Molecular Medicine and Biopharmaceutical Sciences, Graduate School of Convergence Science and Technology, Seoul National University, Seoul 151-742 (Korea, Republic of); Cancer Research Institute, Seoul National University, Seoul 110-799 (Korea, Republic of)

    2010-08-07

    Nuclear factor-erythroid 2-related factor-2 (Nrf2) is a key transcription factor that plays a central role in cellular defense against oxidative and electrophilic insults by timely induction of antioxidative and phase-2 detoxifying enzymes and related stress-response proteins. The 5'-flanking regions of genes encoding these cytoprotective proteins contain a specific consensus sequence termed antioxidant response element (ARE) to which Nrf2 binds. Recent studies have demonstrated that Nrf2-ARE signaling is also involved in attenuating inflammation-associated pathogenesis, such as autoimmune diseases, rheumatoid arthritis, asthma, emphysema, gastritis, colitis and atherosclerosis. Thus, disruption or loss of Nrf2 signaling causes enhanced susceptibility not only to oxidative and electrophilic stresses but also to inflammatory tissue injuries. During the early-phase of inflammation-mediated tissue damage, activation of Nrf2-ARE might inhibit the production or expression of pro-inflammatory mediators including cytokines, chemokines, cell adhesion molecules, matrix metalloproteinases, cyclooxygenase-2 and inducible nitric oxide synthase. It is likely that the cytoprotective function of genes targeted by Nrf2 may cooperatively regulate the innate immune response and also repress the induction of pro-inflammatory genes. This review highlights the protective role of Nrf2 in inflammation-mediated disorders with special focus on the inflammatory signaling modulated by this redox-regulated transcription factor.

  19. Nuclear factor erythroid 2-related factor-2 activity controls 4-hydroxynonenal metabolism and activity in prostate cancer cells.

    Science.gov (United States)

    Pettazzoni, Piergiorgio; Ciamporcero, Eric; Medana, Claudio; Pizzimenti, Stefania; Dal Bello, Federica; Minero, Valerio Giacomo; Toaldo, Cristina; Minelli, Rosalba; Uchida, Koji; Dianzani, Mario Umberto; Pili, Roberto; Barrera, Giuseppina

    2011-10-15

    4-Hydroxynonenal (HNE) is an end product of lipoperoxidation with antiproliferative and proapoptotic properties in various tumors. Here we report a greater sensitivity to HNE in PC3 and LNCaP cells compared to DU145 cells. In contrast to PC3 and LNCaP cells, HNE-treated DU145 cells showed a smaller reduction in growth and did not undergo apoptosis. In DU145 cells, HNE did not induce ROS production and DNA damage and generated a lower amount of HNE-protein adducts. DU145 cells had a greater GSH and GST A4 content and GSH/GST-mediated HNE detoxification. Nuclear factor erythroid 2-related factor-2 (Nrf2) is a regulator of the antioxidant response. Nrf2 protein content and nuclear accumulation were higher in DU145 cells compared to PC3 and LNCaP cells, whereas the expression of KEAP1, the main negative regulator of Nrf2 activity, was lower. Inhibition of Nrf2 expression with specific siRNA resulted in a reduction in GST A4 expression and GS-HNE formation, indicating that Nrf2 controls HNE metabolism. In addition, Nrf2 knockdown sensitized DU145 cells to HNE-mediated antiproliferative and proapoptotic activity. In conclusion, we demonstrated that increased Nrf2 activity resulted in a reduction in HNE sensitivity in prostate cancer cells, suggesting a potential mechanism of resistance to pro-oxidant therapy. Copyright © 2011 Elsevier Inc. All rights reserved.

  20. The effects of erythropoietin signaling on telomerase regulation in non-erythroid malignant and non-malignant cells

    Energy Technology Data Exchange (ETDEWEB)

    Uziel, Orit, E-mail: Oritu@clalit.org.il [Felsenstein Medical Research Center, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Kanfer, Gil [Felsenstein Medical Research Center, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Dep. of Human Molecular Genetics and Biochemistry, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Beery, Einat [Felsenstein Medical Research Center, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Yelin, Dana; Shepshelovich, Daniel [Medicine A, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Bakhanashvili, Mary [Unit of Infectious Diseases, Sheba Medical Center, Tel-Hashomer (Israel); Nordenberg, Jardena [Felsenstein Medical Research Center, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Dep. of Human Molecular Genetics and Biochemistry, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Endocrinology Laboratory, Beilinson Medical Center, Petah-Tikva (Israel); Lahav, Meir [Felsenstein Medical Research Center, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Medicine A, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel)

    2014-07-18

    Highlights: • We assumed that some of erythropoietin adverse effects may be mediated by telomerase activity. • EPO administration increased telomerase activity, cells proliferation and migration. • The inhibition of telomerase modestly repressed the proliferative effect of erythropoietin. • Telomere shortening caused by long term inhibition of the enzyme totally abolished that effect. • This effect was mediated via the Lyn–AKT axis and not by the canonical JAK2–STAT pathway. - Abstract: Treatment with erythropoietin (EPO) in several cancers is associated with decreased survival due to cancer progression. Due to the major importance of telomerase in cancer biology we hypothesized that some of these effects may be mediated through EPO effect on telomerase. For this aim we explored the possible effects of EPO on telomerase regulation, cell migration and chemosensitivity in non-erythroid malignant and non-malignant cells. Cell proliferation, telomerase activity (TA) and cell migration increased in response to EPO. EPO had no effect on cancer cells sensitivity to cisplatinum and on the cell cycle status. The inhibition of telomerase modestly repressed the proliferative effect of EPO. Telomere shortening caused by long term inhibition of the enzyme abolished the effect of EPO, suggesting that EPO effects on cancer cells are related to telomere dynamics. TA was correlated with the levels of Epo-R. The increase in TA was mediated post-translationally through the Lyn-Src and not the canonical JAK2 pathway.

  1. Radiology of liver circulation

    International Nuclear Information System (INIS)

    Hermine, C.L.

    1985-01-01

    This book proposes that careful evaluation of the arterioportogram is the cornerstone in assessing portal flow obstruction, being the most consistent of all observations including liver histology, portal venous pressure, size and number of portosystemic collaterals, and wedged hepatic venous pressure. Very brief chapters cover normal hepatic circulation and angiographic methods. Contrast volumes and flow rates for celiac, hepatic, and superior mesenteric injection are given, with the timing for venous phase radiographs. In the main body of the text, portal obstruction is divided very simply into presinusoidal (all proximal causes) and postsinusoidal (all distal causes, including Budd-Chiari). Changes are discussed regarding the splenic artery and spleen; hepatic artery and its branches; portal flow rate and direction; and arterioportal shunting and portosystemic collateral circulation in minimal, moderate, severe, and very severe portal obstruction and in recognizable entities such as prehepatic portal and hepatic venous obstructions. The major emphasis in this section is the recognition and understanding of flow changes by which level and severity of obstruction are assessed (not simply the anatomy of portosystemic collateral venous flow). Excellent final chapters discuss the question of portal hypertension without obstruction, and the contribution of arterioportography to the treatment of portal hypertension, again with an emphasis on hemodynamics before and after shunt surgery. There is a fascinating final chapter on segmental intrahepatic obstruction without portal hypertension that explains much of the unusual contrast enhancement sometimes seen in CT scanning of hepatic mass lesions

  2. Circulation Systems Past and Present

    Directory of Open Access Journals (Sweden)

    Maurice J. Freedman

    1981-01-01

    Full Text Available A review of the development of circulation systems shows two areas of change. The librarian's perception of circulation control has shifted from a broad service orientation to a narrow record-keeping approach and recently back again. The technological development of circulation sys-tems has evolved from manual systems to the online systems of today. The trade-offs and deficiencies of earlier systems in relation to the comprehensive services made possible by the online computer are detailed.

  3. The ocean circulation inverse problem

    National Research Council Canada - National Science Library

    Wunsch, C

    1996-01-01

    .... This book addresses the problem of inferring the state of the ocean circulation, understanding it dynamically, and even forecasting it through a quantitative combination of theory and observation...

  4. BET bromodomain inhibition rescues erythropoietin differentiation of human erythroleukemia cell line UT7

    International Nuclear Information System (INIS)

    Goupille, Olivier; Penglong, Tipparat; Lefèvre, Carine; Granger, Marine; Kadri, Zahra; Fucharoen, Suthat; Maouche-Chrétien, Leila; Leboulch, Philippe; Chrétien, Stany

    2012-01-01

    Highlights: ► UT7 erythroleukemia cells are known to be refractory to differentiate. ► Brief JQ1 treatment initiates the first steps of erythroid differentiation program. ► Engaged UT7 cells then maturate in the presence of erythropoietin. ► Sustained JQ1 treatment inhibits both proliferation and erythroid differentiation. -- Abstract: Malignant transformation is a multistep process requiring oncogenic activation, promoting cellular proliferation, frequently coupled to inhibition of terminal differentiation. Consequently, forcing the reengagement of terminal differentiation of transformed cells coupled or not with an inhibition of their proliferation is a putative therapeutic approach to counteracting tumorigenicity. UT7 is a human leukemic cell line able to grow in the presence of IL3, GM-CSF and Epo. This cell line has been widely used to study Epo-R/Epo signaling pathways but is a poor model for erythroid differentiation. We used the BET bromodomain inhibition drug JQ1 to target gene expression, including that of c-Myc. We have shown that only 2 days of JQ1 treatment was required to transitory inhibit Epo-induced UT7 proliferation and to restore terminal erythroid differentiation. This study highlights the importance of a cellular erythroid cycle break mediated by c-Myc inhibition before initiation of the erythropoiesis program and describes a new model for BET bromodomain inhibitor drug application.

  5. BET bromodomain inhibition rescues erythropoietin differentiation of human erythroleukemia cell line UT7

    Energy Technology Data Exchange (ETDEWEB)

    Goupille, Olivier [CEA, Institute of Emerging Diseases and Innovative Therapies, Fontenay-aux-Roses (France); UMR INSERM U.962, University Paris XI, CEA, Fontenay-aux-Roses (France); Penglong, Tipparat [CEA, Institute of Emerging Diseases and Innovative Therapies, Fontenay-aux-Roses (France); UMR INSERM U.962, University Paris XI, CEA, Fontenay-aux-Roses (France); Thalassemia Research Center and Department of Clinical Pathology, Faculty of Medicine, Ramathibodi Hospital, Mahidol University (Thailand); Lefevre, Carine; Granger, Marine; Kadri, Zahra [CEA, Institute of Emerging Diseases and Innovative Therapies, Fontenay-aux-Roses (France); UMR INSERM U.962, University Paris XI, CEA, Fontenay-aux-Roses (France); Fucharoen, Suthat [Thalassemia Research Center and Department of Clinical Pathology, Faculty of Medicine, Ramathibodi Hospital, Mahidol University (Thailand); Maouche-Chretien, Leila [CEA, Institute of Emerging Diseases and Innovative Therapies, Fontenay-aux-Roses (France); UMR INSERM U.962, University Paris XI, CEA, Fontenay-aux-Roses (France); Leboulch, Philippe [CEA, Institute of Emerging Diseases and Innovative Therapies, Fontenay-aux-Roses (France); UMR INSERM U.962, University Paris XI, CEA, Fontenay-aux-Roses (France); Genetics Division, Department of Medicine, Brigham and Women' s Hospital and Harvard Medical School, Boston, MA (United States); Chretien, Stany, E-mail: stany.chretien@cea.fr [CEA, Institute of Emerging Diseases and Innovative Therapies, Fontenay-aux-Roses (France); UMR INSERM U.962, University Paris XI, CEA, Fontenay-aux-Roses (France)

    2012-12-07

    Highlights: Black-Right-Pointing-Pointer UT7 erythroleukemia cells are known to be refractory to differentiate. Black-Right-Pointing-Pointer Brief JQ1 treatment initiates the first steps of erythroid differentiation program. Black-Right-Pointing-Pointer Engaged UT7 cells then maturate in the presence of erythropoietin. Black-Right-Pointing-Pointer Sustained JQ1 treatment inhibits both proliferation and erythroid differentiation. -- Abstract: Malignant transformation is a multistep process requiring oncogenic activation, promoting cellular proliferation, frequently coupled to inhibition of terminal differentiation. Consequently, forcing the reengagement of terminal differentiation of transformed cells coupled or not with an inhibition of their proliferation is a putative therapeutic approach to counteracting tumorigenicity. UT7 is a human leukemic cell line able to grow in the presence of IL3, GM-CSF and Epo. This cell line has been widely used to study Epo-R/Epo signaling pathways but is a poor model for erythroid differentiation. We used the BET bromodomain inhibition drug JQ1 to target gene expression, including that of c-Myc. We have shown that only 2 days of JQ1 treatment was required to transitory inhibit Epo-induced UT7 proliferation and to restore terminal erythroid differentiation. This study highlights the importance of a cellular erythroid cycle break mediated by c-Myc inhibition before initiation of the erythropoiesis program and describes a new model for BET bromodomain inhibitor drug application.

  6. Inhibition of erythroid cell growth by allogeneic murine lymphocytes. Evidence for a synergism between lymph node cells and thymocytes

    International Nuclear Information System (INIS)

    Blomgren, H.; Jacobsson, H.

    1974-01-01

    Murine lymphoid cells from thymus and lymph nodes were tested for synergistic response in a graft-vs-host test. The test is based on the principle that allogeneic lymphocytes inhibit erythroid cell proliferation in the spleens of irradiated mice infused with syngeneic bone marrow cells. Mixtures of thymocytes and lymph node cells from the same parental strain yielded graft-vs-host responses in irradiated F 1 -hybrids higher than expected by summing the responses of the two cell populations tested separately. A similar synergistic response was obtained using mixtures of thymocytes and lymph node cells obtained from the two parental strains of the hybrid, whereas such an effect was not detected using mixtures of lymph node cells or mixtures of thymocytes from the two parental strains. Nor could synergy be demonstrated between parental strain lymph node cells and thymocytes syngeneic with the bone marrow target cells. Thymocytes obtained from one parental strain which was injected into its irradiated F 1 -hybrid transformed into a population of sensitized cells in the spleens of the recipients. This transformation was suppressed by the simultaneous injection of lymph node cells from the second parental strain. Since there is a synergistic immune response by such cell mixtures it is concluded that thymocytes may enhance the graft-vs-host response of lymph node cells. Parental strain thymocytes and lymph node cells, the latter being specifically immunologically tolerant to the bone marrow target cells, failed to give a synergistic response indicating that thymocytes do not transform unresponsive lymphocytes into responsive, but rather enhance the reactivity of existing, specifically responsive cells. The results thus show that thymocytes may enhance the response of lymph node cells in this specific graft-vs-host assay

  7. Persistent sample circulation microextraction combined with graphite furnace atomic absorption spectroscopy for trace determination of heavy metals in fish species marketed in Kermanshah, Iran, and human health risk assessment.

    Science.gov (United States)

    Safari, Yahya; Karimaei, Mostafa; Sharafi, Kiomars; Arfaeinia, Hossein; Moradi, Masoud; Fattahi, Nazir

    2018-06-01

    Persistent sample circulation microextraction (PSCME) combined with graphite furnace atomic absorption spectrometry (GFAAS) was developed as a high pre-concentration technique for the determination of heavy metals in fish species. In this method, a few microliters of organic solvent (40.0 µL carbon tetrachloride) was transferred to the bottom of a conical sample cup. Then 10.0 mL of aqueous solution was transformed to fine droplets while passing through the organic solvent. At this stage, metal-ligand hydrophobic complex was extracted into the organic solvent. After extraction, 20 µL of extraction solvent was injected into the graphite tube using an auto-sampler. Under optimal conditions, enrichment factors and enhancement factor were in the range of 180-240 and 155-214, respectively. The calibration curves were linear in the range of 0.03-200 µg kg -1 and the limits of detection (LODs) were in the range of 0.01-0.05 µg kg -1 . Repeatability (intra-day) and reproducibility (inter-day) for 0.50 µg L -1 Hg and 0.10 µg L -1 Cd and Pb were in the range of 3.1-4.2% (n = 7) and 4.3-6.1% (n = 7), respectively. Potential human health risk assessment was conducted by calculating estimated weekly intake (EWI) of the metals from eating fish and comparison of these values with provisional tolerable weekly intake (PTWI) values. EWI data for the studied metals through fish consumption were lower than the PTWI values. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  8. Sino-Danish Brain Circulation

    DEFF Research Database (Denmark)

    Bertelsen, Rasmus Gjedssø; Du, Xiangyun; Søndergaard, Morten Karnøe

    2014-01-01

    China is faced with urgent needs to develop an economically and environmentally sustainable economy based on innovation and knowledge. Brain circulation and research and business investments from the outside are central for this development. Sino-American brain circulation and research...... and investment by overseas researchers and entrepreneurs are well described. In that case, the US is the center of global R&D and S&T. However, the brain circulation and research and investments between a small open Scandinavian economy, such as Denmark, and the huge developing economy of China are not well...... understood. In this case, Denmark is very highly developed, but a satellite in the global R&D and S&T system. With time and the growth of China as a R&D and S&T power house, both Denmark and China will benefit from brain circulation between them. Such brain circulation is likely to play a key role in flows...

  9. Circulating elastin peptides, role in vascular pathology.

    Science.gov (United States)

    Robert, L; Labat-Robert, J

    2014-12-01

    The atherosclerotic process starts with the degradation of elastic fibers. Their presence was demonstrated in the circulation as well as several of their biological properties elucidated. We described years ago a procedure to obtain large elastin peptides by organo-alkaline hydrolysis, κ-elastin. This method enabled also the preparation of specific antibodies used to determine elastin peptides, as well as anti-elastin antibodies in body fluids and tissue extracts. Elastin peptides were determined in a large number of human blood samples. Studies were carried out to explore their pharmacological properties. Similar recent studies by other laboratories confirmed our findings and arose new interest in circulating elastin peptides for their biological activities. This recent trend justified the publication of a review of the biological and pathological activities of elastin peptides demonstrated during our previous studies, subject of this article. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  10. Natural Circulation with Boiling

    Energy Technology Data Exchange (ETDEWEB)

    Mathisen, R P

    1967-09-15

    A number of parameters with dominant influence on the power level at hydrodynamic instability in natural circulation, two-phase flow, have been studied experimentally. The geometrical dependent quantities were: the system driving head, the boiling channel and riser dimensions, the single-phase as well as the two phase flow restrictions. The parameters influencing the liquid properties were the system pressure and the test section inlet subcooling. The threshold of instability was determined by plotting the noise characteristics in the mass flow records against power. The flow responses to artificially obtained power disturbances at instability conditions were also measured in order to study the nature of hydrodynamic instability. The results presented give a review over relatively wide ranges of the main parameters, mainly concerning the coolant performance in both single and parallel boiling channel flow. With regard to the power limits the experimental results verified that the single boiling channel performance was intimately related to that of the parallel channels. In the latter case the additional inter-channel factors with attenuating effects were studied. Some optimum values of the parameters were observed.

  11. Antisense myb inhibition of purified erythroid progenitors in development and differentiation is linked to cycling activity and expression of DNA polymerase alpha

    International Nuclear Information System (INIS)

    Valtieri, M.; Venturelli, D.; Care, A.; Fossati, C.; Pelosi, E.; Labbaye, C.; Mattia, G.; Gewirtz, A.M.; Calabretta, B.; Peschle, C.

    1991-01-01

    These studies aimed to determine the expression and functional role of c-myb in erythroid progenitors with different cycling activities. In the first series of experiments the erythroid burst-forming unit (BFU-E) and colony-forming unit (CFU-E) populations from adult peripheral blood (PB), bone marrow (BM), and embryonic-fetal liver (FL) were treated with either c-myb antisense oligomers or 3H-thymidine (3H-TdR). A direct correlation was always observed between the inhibitory effect of anti-myb oligomers and the level of cycling activity. Thus, the inhibitory effect of antisense c-myb on the number of BFU-E colonies was 28.3% +/- 15.8% in PB, 53.4% +/- 9.3% in BM, and 68.2% +/- 24.5% in FL. Both adult and embryonic CFU-E were markedly inhibited. Using purified PB progenitors, we observed a similar pattern, although with slightly lower inhibitory effects. In the 3H-TdR suicide assay the killing index of BFU-E was 8.9% +/- 4.2% in PB, 29.4% +/- 6.5% in BM, and 40.1% +/- 9.6% in FL. The values for adult and embryonic CFU-E were 55.7% +/- 7.9% and 60.98% +/- 6.6%, respectively. We then investigated the kinetics of c-myb mRNA level during the erythroid differentiation of purified adult PB and FL BFU-E, as evaluated in liquid-phase culture by reverse transcription-polymerase chain reaction. Adult erythroid precursors showed a gradual increase of c-myb mRNA from day 4 through day 8 of culture and a sharp decrease at later times, whereas the expression of c-myb mRNA and protein in differentiation embryonic precursors peaked 2 days earlier. In both cases, c-myb mRNA level peaked at the CFU-E stage of differentiation. Finally, highly purified adult PB BFU-E were stimulated into cycling by a 3-day treatment with interleukin-3 in liquid phase: both the sensitivity to c-myb antisense oligomers and the 3H-TdR suicide index showed a gradual, strictly parallel increase

  12. ABO alleles are linked with haplotypes of an erythroid cell-specific regulatory element in intron 1 with a few exceptions attributable to genetic recombination.

    Science.gov (United States)

    Nakajima, T; Sano, R; Takahashi, Y; Watanabe, K; Kubo, R; Kobayashi, M; Takahashi, K; Takeshita, H; Kominato, Y

    2016-01-01

    Recent investigation of transcriptional regulation of the ABO genes has identified a candidate erythroid cell-specific regulatory element, named the +5·8-kb site, in the first intron of ABO. Six haplotypes of the site have been reported previously. The present genetic population study demonstrated that each haplotype was mostly linked with specific ABO alleles with a few exceptions, possibly as a result of hybrid formation between common ABO alleles. Thus, investigation of these haplotypes could provide a clue to further elucidation of ABO alleles. © 2015 International Society of Blood Transfusion.

  13. Position-independent high level expression of the human β-globin gene in transgenic mice.

    NARCIS (Netherlands)

    F.G. Grosveld (Frank); G. Blom van Assendelft (Greet); D.R. Greaves (David); G. Kollias (George)

    1987-01-01

    textabstractWe have constructed a "minilocus" that contains the 5' and 3' flanking regions of the human beta-globin locus and the beta-globin gene. These regions are characterized by erythroid-specific DNAase I-superhypersensitive sites and are normally located approximately 50 kb 5' and 20 kb 3' of

  14. Seasonal overturning circulation in the Red Sea: 2. Winter circulation

    Science.gov (United States)

    Yao, Fengchao; Hoteit, Ibrahim; Pratt, Larry J.; Bower, Amy S.; Köhl, Armin; Gopalakrishnan, Ganesh; Rivas, David

    2014-04-01

    The shallow winter overturning circulation in the Red Sea is studied using a 50 year high-resolution MITgcm (MIT general circulation model) simulation with realistic atmospheric forcing. The overturning circulation for a typical year, represented by 1980, and the climatological mean are analyzed using model output to delineate the three-dimensional structure and to investigate the underlying dynamical mechanisms. The horizontal model circulation in the winter of 1980 is dominated by energetic eddies. The climatological model mean results suggest that the surface inflow intensifies in a western boundary current in the southern Red Sea that switches to an eastern boundary current north of 24°N. The overturning is accomplished through a cyclonic recirculation and a cross-basin overturning circulation in the northern Red Sea, with major sinking occurring along a narrow band of width about 20 km along the eastern boundary and weaker upwelling along the western boundary. The northward pressure gradient force, strong vertical mixing, and horizontal mixing near the boundary are the essential dynamical components in the model's winter overturning circulation. The simulated water exchange is not hydraulically controlled in the Strait of Bab el Mandeb; instead, the exchange is limited by bottom and lateral boundary friction and, to a lesser extent, by interfacial friction due to the vertical viscosity at the interface between the inflow and the outflow.

  15. Effects of low-level (1.0 R) x-irradiation on the erythroid response of the rat bone marrow

    International Nuclear Information System (INIS)

    Gong, J.K.; Glomski, C.A.; Frederiksen, N.L.; Lawson, A.J.; Daley, J.P.

    1976-01-01

    The levels of normoblasts in the bone marrow of six groups of female Sprague--Dawley rats previously exposed to a 1.0 R dose of x rays were compared with those in sham-exposed animals at intervals from 14 hr to 10 weeks postirradiation. Four parameters were analyzed, the percentage of normoblasts in Wright's Giemsa stained marrow smears, and the number of erythroid precursors per milligram of isolated marrow sample, per whole femur, and per entire skeleton. The studies were based on marrow examinations and on 59 Fe tracer data. At all intervals except the earliest, [14 hr], significant elevations in the percentage of normoblasts were found in the bone marrow. In addition, at 6 and 10 weeks postirradiation increases were found in the number of normoblasts in the isolated marrow samples, whole femurs, and total skeletons. When compared 81 hr after phlebotomy, subnormal increases in normoblast levels were found in all four parameters of the irradiated subjects. The results suggest that x irradiation at this dose level can induce an abnormal marrow function manifested by an elevated number of normoblasts and, after phlebotomy, by a subnormal proliferation of the erythroid precursors

  16. The trypanocidal benznidazole promotes adaptive response to oxidative injury: Involvement of the nuclear factor-erythroid 2-related factor-2 (Nrf2) and multidrug resistance associated protein 2 (MRP2)

    International Nuclear Information System (INIS)

    Rigalli, Juan Pablo; Perdomo, Virginia Gabriela; Ciriaci, Nadia; Francés, Daniel Eleazar Antonio; Ronco, María Teresa; Bataille, Amy Michele; Ghanem, Carolina Inés; Ruiz, María Laura; Manautou, José Enrique; Catania, Viviana Alicia

    2016-01-01

    Oxidative stress is a frequent cause underlying drug-induced hepatotoxicity. Benznidazole (BZL) is the only trypanocidal agent available for treatment of Chagas disease in endemic areas. Its use is associated with side effects, including increases in biomarkers of hepatotoxicity. However, BZL potential to cause oxidative stress has been poorly investigated. Here, we evaluated the effect of a pharmacologically relevant BZL concentration (200 μM) at different time points on redox status and the counteracting mechanisms in the human hepatic cell line HepG2. BZL increased reactive oxygen species (ROS) after 1 and 3 h of exposure, returning to normality at 24 h. Additionally, BZL increased glutathione peroxidase activity at 12 h and the oxidized glutathione/total glutathione (GSSG/GSSG + GSH) ratio that reached a peak at 24 h. Thus, an enhanced detoxification of peroxide and GSSG formation could account for ROS normalization. GSSG/GSSG + GSH returned to control values at 48 h. Expression of the multidrug resistance-associated protein 2 (MRP2) and GSSG efflux via MRP2 were induced by BZL at 24 and 48 h, explaining normalization of GSSG/GSSG + GSH. BZL activated the nuclear erythroid 2-related factor 2 (Nrf2), already shown to modulate MRP2 expression in response to oxidative stress. Nrf2 participation was confirmed using Nrf2-knockout mice in which MRP2 mRNA expression was not affected by BZL. In summary, we demonstrated a ROS increase by BZL in HepG2 cells and a glutathione peroxidase- and MRP2 driven counteracting mechanism, being Nrf2 a key modulator of this response. Our results could explain hepatic alterations associated with BZL therapy. - Highlights: • BZL triggers a redox imbalance in the human hepatic cell line HepG2. • Concomitantly BZL triggers compensatory mechanisms to alleviate the redox injury. • Response mechanisms comprise an enhanced glutathione peroxidase and MRP2 activity. • Transcription factor Nrf2 plays a key role orchestrating

  17. The trypanocidal benznidazole promotes adaptive response to oxidative injury: Involvement of the nuclear factor-erythroid 2-related factor-2 (Nrf2) and multidrug resistance associated protein 2 (MRP2)

    Energy Technology Data Exchange (ETDEWEB)

    Rigalli, Juan Pablo [Institute of Experimental Physiology (IFISE-CONICET), Suipacha 570, 2000 Rosario (Argentina); Department of Clinical Pharmacology and Pharmacoepidemiology, University of Heidelberg, Heidelberg (Germany); Perdomo, Virginia Gabriela; Ciriaci, Nadia; Francés, Daniel Eleazar Antonio; Ronco, María Teresa [Institute of Experimental Physiology (IFISE-CONICET), Suipacha 570, 2000 Rosario (Argentina); Bataille, Amy Michele [University of Connecticut, School of Pharmacy, Department of Pharmaceutical Sciences, Storrs, CT (United States); Ghanem, Carolina Inés [Institute of Pharmacological Investigations (ININFA-CONICET), University of Buenos Aires, Buenos Aires (Argentina); Ruiz, María Laura [Institute of Experimental Physiology (IFISE-CONICET), Suipacha 570, 2000 Rosario (Argentina); Manautou, José Enrique [University of Connecticut, School of Pharmacy, Department of Pharmaceutical Sciences, Storrs, CT (United States); Catania, Viviana Alicia, E-mail: vcatania@fbioyf.unr.edu.ar [Institute of Experimental Physiology (IFISE-CONICET), Suipacha 570, 2000 Rosario (Argentina)

    2016-08-01

    Oxidative stress is a frequent cause underlying drug-induced hepatotoxicity. Benznidazole (BZL) is the only trypanocidal agent available for treatment of Chagas disease in endemic areas. Its use is associated with side effects, including increases in biomarkers of hepatotoxicity. However, BZL potential to cause oxidative stress has been poorly investigated. Here, we evaluated the effect of a pharmacologically relevant BZL concentration (200 μM) at different time points on redox status and the counteracting mechanisms in the human hepatic cell line HepG2. BZL increased reactive oxygen species (ROS) after 1 and 3 h of exposure, returning to normality at 24 h. Additionally, BZL increased glutathione peroxidase activity at 12 h and the oxidized glutathione/total glutathione (GSSG/GSSG + GSH) ratio that reached a peak at 24 h. Thus, an enhanced detoxification of peroxide and GSSG formation could account for ROS normalization. GSSG/GSSG + GSH returned to control values at 48 h. Expression of the multidrug resistance-associated protein 2 (MRP2) and GSSG efflux via MRP2 were induced by BZL at 24 and 48 h, explaining normalization of GSSG/GSSG + GSH. BZL activated the nuclear erythroid 2-related factor 2 (Nrf2), already shown to modulate MRP2 expression in response to oxidative stress. Nrf2 participation was confirmed using Nrf2-knockout mice in which MRP2 mRNA expression was not affected by BZL. In summary, we demonstrated a ROS increase by BZL in HepG2 cells and a glutathione peroxidase- and MRP2 driven counteracting mechanism, being Nrf2 a key modulator of this response. Our results could explain hepatic alterations associated with BZL therapy. - Highlights: • BZL triggers a redox imbalance in the human hepatic cell line HepG2. • Concomitantly BZL triggers compensatory mechanisms to alleviate the redox injury. • Response mechanisms comprise an enhanced glutathione peroxidase and MRP2 activity. • Transcription factor Nrf2 plays a key role orchestrating

  18. Two different pathways for the transport of primitive and definitive blood cells from the yolk sac to the embryo in humans.

    Science.gov (United States)

    Pereda, Jaime; Monge, Juan I; Niimi, Gen

    2010-08-01

    During the early human embryonic period nutrients and blood cells are temporarily provided by the extraembryonic yolk sac (YS). The YS before week six is involved not only in primitive but also in definitive erythropoiesis. While the destiny of primitive erythroid cells that fill the blood vessels of the YS is well known, the final destination of erythrocytes present in the endodermal vesicular system is unknown. In the present study we have investigated, step by step, the destiny of the erythrocytes present in the endodermal vesicles during the embryonic period. Twelve human YSs and their corresponding yolk stalks were analyzed between weeks 4 and 7 of embryonic age by light and scanning electron microscopy. It is shown that erythrocytes (according to their size and morphological features) located within the endodermal vesicles of the YS wall are pulled out through endodermal pits into the YS cavity, from where they reach the lumen of the primitive gut of the embryo through the vitelline duct, a temporary pathway communicating both compartments. During the study period no erythrocytes were seen within the embryo's vascular network where only primitive erythroblasts were identified. Our results indicate that the vitelline duct plays an important transient role as a pathway for the transport of nutrients and blood cells between the YS and the embryo before week five of embryonic development that ends just at the time when YS-embryo circulation becomes established. (c) 2010 Wiley-Liss, Inc.

  19. Fragment Length of Circulating Tumor DNA.

    Science.gov (United States)

    Underhill, Hunter R; Kitzman, Jacob O; Hellwig, Sabine; Welker, Noah C; Daza, Riza; Baker, Daniel N; Gligorich, Keith M; Rostomily, Robert C; Bronner, Mary P; Shendure, Jay

    2016-07-01

    Malignant tumors shed DNA into the circulation. The transient half-life of circulating tumor DNA (ctDNA) may afford the opportunity to diagnose, monitor recurrence, and evaluate response to therapy solely through a non-invasive blood draw. However, detecting ctDNA against the normally occurring background of cell-free DNA derived from healthy cells has proven challenging, particularly in non-metastatic solid tumors. In this study, distinct differences in fragment length size between ctDNAs and normal cell-free DNA are defined. Human ctDNA in rat plasma derived from human glioblastoma multiforme stem-like cells in the rat brain and human hepatocellular carcinoma in the rat flank were found to have a shorter principal fragment length than the background rat cell-free DNA (134-144 bp vs. 167 bp, respectively). Subsequently, a similar shift in the fragment length of ctDNA in humans with melanoma and lung cancer was identified compared to healthy controls. Comparison of fragment lengths from cell-free DNA between a melanoma patient and healthy controls found that the BRAF V600E mutant allele occurred more commonly at a shorter fragment length than the fragment length of the wild-type allele (132-145 bp vs. 165 bp, respectively). Moreover, size-selecting for shorter cell-free DNA fragment lengths substantially increased the EGFR T790M mutant allele frequency in human lung cancer. These findings provide compelling evidence that experimental or bioinformatic isolation of a specific subset of fragment lengths from cell-free DNA may improve detection of ctDNA.

  20. Seasonal overturning circulation in the Red Sea: 2. Winter circulation

    KAUST Repository

    Yao, Fengchao

    2014-04-01

    The shallow winter overturning circulation in the Red Sea is studied using a 50 year high-resolution MITgcm (MIT general circulation model) simulation with realistic atmospheric forcing. The overturning circulation for a typical year, represented by 1980, and the climatological mean are analyzed using model output to delineate the three-dimensional structure and to investigate the underlying dynamical mechanisms. The horizontal model circulation in the winter of 1980 is dominated by energetic eddies. The climatological model mean results suggest that the surface inflow intensifies in a western boundary current in the southern Red Sea that switches to an eastern boundary current north of 24N. The overturning is accomplished through a cyclonic recirculation and a cross-basin overturning circulation in the northern Red Sea, with major sinking occurring along a narrow band of width about 20 km along the eastern boundary and weaker upwelling along the western boundary. The northward pressure gradient force, strong vertical mixing, and horizontal mixing near the boundary are the essential dynamical components in the model\\'s winter overturning circulation. The simulated water exchange is not hydraulically controlled in the Strait of Bab el Mandeb; instead, the exchange is limited by bottom and lateral boundary friction and, to a lesser extent, by interfacial friction due to the vertical viscosity at the interface between the inflow and the outflow. Key Points Sinking occurs in a narrow boundary layer along the eastern boundary Surface western boundary current switches into an eastern boundary current Water exchange in the Strait of Bab el Mandeb is not hydraulically controlled © 2014. American Geophysical Union. All Rights Reserved.

  1. The Invertibility, Explicit Determinants, and Inverses of Circulant and Left Circulant and g-Circulant Matrices Involving Any Continuous Fibonacci and Lucas Numbers

    Directory of Open Access Journals (Sweden)

    Zhaolin Jiang

    2014-01-01

    Full Text Available Circulant matrices play an important role in solving delay differential equations. In this paper, circulant type matrices including the circulant and left circulant and g-circulant matrices with any continuous Fibonacci and Lucas numbers are considered. Firstly, the invertibility of the circulant matrix is discussed and the explicit determinant and the inverse matrices by constructing the transformation matrices are presented. Furthermore, the invertibility of the left circulant and g-circulant matrices is also studied. We obtain the explicit determinants and the inverse matrices of the left circulant and g-circulant matrices by utilizing the relationship between left circulant, g-circulant matrices and circulant matrix, respectively.

  2. Proper Sizing of Circulation Pumps

    DEFF Research Database (Denmark)

    Tommerup, Henrik M.; Nørgaard, Jørgen

    2007-01-01

    The paper describes the preliminary results from field tests of replacing various types of old pumps used for circulating water in heating systems in single- and double-family houses with new types of pumps. The tests were carried out in Denmark for the Danish Electricity Savings Trust, but the r......The paper describes the preliminary results from field tests of replacing various types of old pumps used for circulating water in heating systems in single- and double-family houses with new types of pumps. The tests were carried out in Denmark for the Danish Electricity Savings Trust...

  3. Expression of the transcription factor Evi-1 in human erythroleukemia cell lines and in leukemias.

    Science.gov (United States)

    Fontenay-Roupie, M; Bouscary, D; Melle, J; Viguié, F; Picard, F; Guesnu, M; Dreyfus, F

    1997-02-01

    The Evi-1 proto-oncogene is a zinc finger DNA binding protein. Although activation of the Evi-1 gene has been associated with chromosomal rearrangements of the 3q25-q28 region, ectopic expression of Evi-1 could also be observed in acute myelogenous leukemias and myelodysplastic syndromes without cytogenetic abnormalities of the 3q26 locus. In this study, human erythroleukemic cell lines were screened for the expression of Evi-1 mRNA by northern blotting. Evi-1 was expressed in all the erythroid cell lines, whether undifferentiated (K 562, HEL, LAMA 84) or exhibiting spontaneous terminal erythroid differentiation (KU 812, JK-1). Evi-1 mRNA levels were constant or elevated in hemoglobin-synthesizing KU 812 or K 562 cells in response to erythropoietin or hemin treatment, respectively. In human acute myeloblastic leukemias (AML), 11/30 expressed Evi-1 by RT-PCR. Among these cases, 4/6 erythroleukemias without abnormalities of the 3q25-q28 region were found positive. The presence of acidophilic erythroblasts (15-47% of bone marrow cells) accounted for the existence of a terminal erythroid differentiation in all Evi-1-positive AML M6, whereas one negative case was poorly differentiated and referred to as AML M6 variant. These results suggest that Evi-1 mRNA expression can coexist with erythroid differentiation.

  4. Circulating immune complexes – reviewing the biological roles in ...

    African Journals Online (AJOL)

    Circulating immune complexes – reviewing the biological roles in human immune function and exercise. ... studies that have investigated CIC's following exercise and proposes that a comprehensive understanding and interpretation of immune system responses to exercise should take these complexes into consideration.

  5. [Entomologic situation regarding arbovirus circulation in the Guajaibon area].

    Science.gov (United States)

    Fuentes González, O; Fernández Martínez, A; Castex Rodríguez, M; Pelegrino Martínez, J L

    1989-01-01

    The collections of culicidae made in the Guajaibón area, North coast of Havana province, are analyzed with arbovirologic purposes. The predominance of Aedes scapularis in the human bait collections is confirmed. The possibility of arbovirus circulation in the area is suggested.

  6. Leukemic transformation of normal murine erythroid progenitors: v- and c-ErbB act through signaling pathways activated by the EpoR and c-Kit in stress erythropoiesis

    NARCIS (Netherlands)

    von Lindern, M.; Deiner, E. M.; Dolznig, H.; Parren-van Amelsvoort, M.; Hayman, M. J.; Mullner, E. W.; Beug, H.

    2001-01-01

    Primary erythroid progenitors can be expanded by the synergistic action of erythropoietin (Epo), stem cell factor (SCF) and glucocorticoids. While Epo is required for erythropoiesis in general, glucocorticoids and SCF mainly contribute to stress erythropoiesis in hypoxic mice. This ability of normal

  7. Hemolytic disease of the fetus and newborn due to anti-Ge3: combined antibody-dependent hemolysis and erythroid precursor cell growth inhibition.

    Science.gov (United States)

    Blackall, Douglas P; Pesek, Gina D; Montgomery, Matthew M; Oza, Krishna K; Arndt, Patricia A; Garratty, George; Shahcheraghi, Ali; Denomme, Gregory A

    2008-10-01

    The Gerbich (Ge) antigens are a collection of high-incidence antigens carried on the red blood cell membrane glycoproteins, glycophorins C and D. Antibodies against these antigens are uncommon, and there have been only rare case reports of hemolytic disease of the fetus and newborn due to anti-Ge. In this case report, we present a neonate with severe anemia and hyperbilirubinemia due to anti-Ge3. Routine and special laboratory studies undertaken in this case suggested two mechanisms for the patient's hemolysis and persistent anemia. Antibody-dependent hemolysis was associated with early-onset hyperbilirubinemia, anemia, and a mild reticulocytosis, and inhibition of erythroid progenitor cell growth was associated with late anemia and normal bilirubin and reticulocyte values. Though rare, anti-Ge3 can be a dangerous antibody in pregnancy. Affected neonates may require intensive initial therapy and close follow-up for at least several weeks after delivery.

  8. Hemopoietic regeneration in murine spleen following transfusion of normal and irradiated marrow: different response of granulocyte/macrophage and erythroid precursors

    International Nuclear Information System (INIS)

    Wangenheim, K.-H. von; Peterson, H.-P.; Huebner, G.E.; Feinendegen, L.E.

    1987-01-01

    To investigate cell proliferation in regenerating spleen, bone marrow of normal and gamma-irradiated donor mice (3 weeks after 5 Gy) was transfused into lethally irradiated recipients. In the donors and in the recipient spleens numbers of CFU-S and progenitor cells were determined. In the irradiated donors the progenitors were at control level after 3 weeks of recovery although CFU-S were still at 50% of control. Recipients of the irradiated marrow received therefore an increased proportion of progenitors. CFU-C appeared to be self-renewing and/or increased in number due to enhanced CFU-S differentiation, but not the erythroid progenitors. CFU-S self-renewal was reduced after 5 Gy. The data suggest that cell differentiation and maturation proceed during early splenic regeneration. The quantity of CFU-C does not necessarily mirror the situation in the stem cell compartment. (author)

  9. VanderLaan Circulant Type Matrices

    Directory of Open Access Journals (Sweden)

    Hongyan Pan

    2015-01-01

    Full Text Available Circulant matrices have become a satisfactory tools in control methods for modern complex systems. In the paper, VanderLaan circulant type matrices are presented, which include VanderLaan circulant, left circulant, and g-circulant matrices. The nonsingularity of these special matrices is discussed by the surprising properties of VanderLaan numbers. The exact determinants of VanderLaan circulant type matrices are given by structuring transformation matrices, determinants of well-known tridiagonal matrices, and tridiagonal-like matrices. The explicit inverse matrices of these special matrices are obtained by structuring transformation matrices, inverses of known tridiagonal matrices, and quasi-tridiagonal matrices. Three kinds of norms and lower bound for the spread of VanderLaan circulant and left circulant matrix are given separately. And we gain the spectral norm of VanderLaan g-circulant matrix.

  10. Eto2/MTG16 and MTGR1 are heteromeric corepressors of the TAL1/SCL transcription factor in murine erythroid progenitors

    Energy Technology Data Exchange (ETDEWEB)

    Cai, Ying; Xu, Zhixiong; Xie, Jingping [Department of Medicine, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Ham, Amy-Joan L. [Department of Biochemistry, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Koury, Mark J. [Department of Medicine, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Tennessee Valley VA Healthcare System, Nashville, TN 37212 (United States); Hiebert, Scott W. [Department of Biochemistry, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Vanderbilt-Ingram Cancer Center, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Brandt, Stephen J., E-mail: stephen.brandt@vanderbilt.edu [Department of Medicine, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Department of Cell and Developmental Biology, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Department of Cancer Biology, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Vanderbilt-Ingram Cancer Center, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Tennessee Valley VA Healthcare System, Nashville, TN 37212 (United States)

    2009-12-11

    The TAL1 (or SCL) gene, originally discovered through its involvement by a chromosomal translocation in T-cell acute lymphoblastic leukemia, encodes a basic helix-loop-helix (bHLH) transcription factor essential for hematopoietic and vascular development. To identify its interaction partners, we expressed a tandem epitope-tagged protein in murine erythroleukemia (MEL) cells and characterized affinity-purified Tal1-containing complexes by liquid chromatography-tandem mass spectrometry analysis. In addition to known interacting proteins, two proteins related to the Eight-Twenty-One (ETO) corepressor, Eto2/Mtg16 and Mtgr1, were identified from the peptide fragments analyzed. Tal1 interaction with Eto2 and Mtgr1 was verified by coimmunoprecipitation analysis in Tal1, Eto2-, and Mtgr1-transfected COS-7 cells, MEL cells expressing V5 epitope-tagged Tal1 protein, and non-transfected MEL cells. Mapping analysis with Gal4 fusion proteins demonstrated a requirement for the bHLH domain of Tal1 and TAF110 domain of Eto2 for their interaction, and transient transfection and glutathione S-transferase pull-down analysis showed that Mtgr1 and Eto2 enhanced the other's association with Tal1. Enforced expression of Eto2 in differentiating MEL cells inhibited the promoter of the Protein 4.2 (P4.2) gene, a direct target of TAL1 in erythroid progenitors, and transduction of Eto2 and Mtgr1 augmented Tal1-mediated gene repression. Finally, chromatin immunoprecipitation analysis revealed that Eto2 occupancy of the P4.2 promoter in MEL cells decreased with differentiation, in parallel with a decline in Eto2 protein abundance. These results identify Eto2 and Mtgr1 as authentic interaction partners of Tal1 and suggest they act as heteromeric corepressors of this bHLH transcription factor during erythroid differentiation.

  11. Eto2/MTG16 and MTGR1 are heteromeric corepressors of the TAL1/SCL transcription factor in murine erythroid progenitors

    International Nuclear Information System (INIS)

    Cai, Ying; Xu, Zhixiong; Xie, Jingping; Ham, Amy-Joan L.; Koury, Mark J.; Hiebert, Scott W.; Brandt, Stephen J.

    2009-01-01

    The TAL1 (or SCL) gene, originally discovered through its involvement by a chromosomal translocation in T-cell acute lymphoblastic leukemia, encodes a basic helix-loop-helix (bHLH) transcription factor essential for hematopoietic and vascular development. To identify its interaction partners, we expressed a tandem epitope-tagged protein in murine erythroleukemia (MEL) cells and characterized affinity-purified Tal1-containing complexes by liquid chromatography-tandem mass spectrometry analysis. In addition to known interacting proteins, two proteins related to the Eight-Twenty-One (ETO) corepressor, Eto2/Mtg16 and Mtgr1, were identified from the peptide fragments analyzed. Tal1 interaction with Eto2 and Mtgr1 was verified by coimmunoprecipitation analysis in Tal1, Eto2-, and Mtgr1-transfected COS-7 cells, MEL cells expressing V5 epitope-tagged Tal1 protein, and non-transfected MEL cells. Mapping analysis with Gal4 fusion proteins demonstrated a requirement for the bHLH domain of Tal1 and TAF110 domain of Eto2 for their interaction, and transient transfection and glutathione S-transferase pull-down analysis showed that Mtgr1 and Eto2 enhanced the other's association with Tal1. Enforced expression of Eto2 in differentiating MEL cells inhibited the promoter of the Protein 4.2 (P4.2) gene, a direct target of TAL1 in erythroid progenitors, and transduction of Eto2 and Mtgr1 augmented Tal1-mediated gene repression. Finally, chromatin immunoprecipitation analysis revealed that Eto2 occupancy of the P4.2 promoter in MEL cells decreased with differentiation, in parallel with a decline in Eto2 protein abundance. These results identify Eto2 and Mtgr1 as authentic interaction partners of Tal1 and suggest they act as heteromeric corepressors of this bHLH transcription factor during erythroid differentiation.

  12. Serological evaluation of Crimean-Congo hemorrhagic fever in humans with high-risk professions living in enzootic regions of Isfahan province of Iran and genetic analysis of circulating strains

    DEFF Research Database (Denmark)

    Chinikar, Sadegh; Ghiasi, Seyed Mojtaba; Naddaf, Saeed

    2012-01-01

    Crimean-Congo hemorrhagic fever (CCHF) is a zoonotic viral disease that is asymptomatic in infected livestock, but causes a serious threat to humans with a mortality rate up to 50%. Although the CCHF virus (CCHFV) is often transmitted by ticks, livestock-to-human and human-to-human transmission a...

  13. Adult, embryonic and fetal hemoglobin are expressed in human glioblastoma cells.

    Science.gov (United States)

    Emara, Marwan; Turner, A Robert; Allalunis-Turner, Joan

    2014-02-01

    Hemoglobin is a hemoprotein, produced mainly in erythrocytes circulating in the blood. However, non-erythroid hemoglobins have been previously reported in other cell types including human and rodent neurons of embryonic and adult brain, but not astrocytes and oligodendrocytes. Human glioblastoma multiforme (GBM) is the most aggressive tumor among gliomas. However, despite extensive basic and clinical research studies on GBM cells, little is known about glial defence mechanisms that allow these cells to survive and resist various types of treatment. We have shown previously that the newest members of vertebrate globin family, neuroglobin (Ngb) and cytoglobin (Cygb), are expressed in human GBM cells. In this study, we sought to determine whether hemoglobin is also expressed in GBM cells. Conventional RT-PCR, DNA sequencing, western blot analysis, mass spectrometry and fluorescence microscopy were used to investigate globin expression in GBM cell lines (M006x, M059J, M059K, M010b, U87R and U87T) that have unique characteristics in terms of tumor invasion and response to radiotherapy and hypoxia. The data showed that α, β, γ, δ, ζ and ε globins are expressed in all tested GBM cell lines. To our knowledge, we are the first to report expression of fetal, embryonic and adult hemoglobin in GBM cells under normal physiological conditions that may suggest an undefined function of those expressed hemoglobins. Together with our previous reports on globins (Ngb and Cygb) expression in GBM cells, the expression of different hemoglobins may constitute a part of series of active defence mechanisms supporting these cells to resist various types of treatments including chemotherapy and radiotherapy.

  14. Circulating cell-free DNA and circulating tumor cells, the "liquid biopsies" in ovarian cancer.

    Science.gov (United States)

    Cheng, Xianliang; Zhang, Lei; Chen, Yajuan; Qing, Chen

    2017-11-13

    Limited understanding of ovarian cancer (OC) genome portrait has hindered the therapeutic advances. The serial monitoring of tumor genotypes is becoming increasingly attainable with circulating cell-free DNA (cf-DNA) and circulating tumor cells (CTCs) emerging as "liquid biopsies". They represent non-invasive biomarkers and are viable, as they can be isolated from human plasma, serum and other body fluids. Molecular characterization of circulating tumor DNA (ct-DNA) and CTCs offer unique potentials to better understand the biology of metastasis and resistance to therapies. The liquid biopsies may also give innovative insights into the process of rapid and accurate identification, resistant genetic alterations and a real time monitoring of treatment responses. In addition, liquid biopsies are shedding light on elucidating signal pathways involved in invasiveness and metastasis competence; but the detection and molecular characterization of ct-DNA and CTCs are still challenging, since they are rare, and the amount of available samples are very limited. This review will focus on the clinical potential of ct-DNA and CTCs in both the early and advanced diagnosis, prognosis, and in the identification of resistance mutations in OC.

  15. LCR/MEL: A versatile system for high-level expression of heterologous proteins in erythroid cells.

    NARCIS (Netherlands)

    M. Needham; C. Gooding; K. Hudson; M. Antoniou (Michael); F.G. Grosveld (Frank); M. Hollis

    1992-01-01

    textabstractWe have used the human globin locus control region (LCR) to assemble an expression system capable of high-level, integration position-independent expression of heterologous genes and cDNAs in murine erythroleukaemia (MEL) cells. The cDNAs are inserted between the human beta-globin

  16. Atmospheric circulation classification comparison based on wildfires in Portugal

    Science.gov (United States)

    Pereira, M. G.; Trigo, R. M.

    2009-04-01

    Atmospheric circulation classifications are not a simple description of atmospheric states but a tool to understand and interpret the atmospheric processes and to model the relation between atmospheric circulation and surface climate and other related variables (Radan Huth et al., 2008). Classifications were initially developed with weather forecasting purposes, however with the progress in computer processing capability, new and more robust objective methods were developed and applied to large datasets prompting atmospheric circulation classification methods to one of the most important fields in synoptic and statistical climatology. Classification studies have been extensively used in climate change studies (e.g. reconstructed past climates, recent observed changes and future climates), in bioclimatological research (e.g. relating human mortality to climatic factors) and in a wide variety of synoptic climatological applications (e.g. comparison between datasets, air pollution, snow avalanches, wine quality, fish captures and forest fires). Likewise, atmospheric circulation classifications are important for the study of the role of weather in wildfire occurrence in Portugal because the daily synoptic variability is the most important driver of local weather conditions (Pereira et al., 2005). In particular, the objective classification scheme developed by Trigo and DaCamara (2000) to classify the atmospheric circulation affecting Portugal have proved to be quite useful in discriminating the occurrence and development of wildfires as well as the distribution over Portugal of surface climatic variables with impact in wildfire activity such as maximum and minimum temperature and precipitation. This work aims to present: (i) an overview the existing circulation classification for the Iberian Peninsula, and (ii) the results of a comparison study between these atmospheric circulation classifications based on its relation with wildfires and relevant meteorological

  17. The Donders model of the circulation in normo- and pathophysiology

    DEFF Research Database (Denmark)

    Noordergraaf, Gerrit J.; Ottesen, Johnny T.; Kortsmit, Wil J.P.M.

    2006-01-01

    the continuum of physiological conditions to cardiopulmonary resuscitation effects within the circulation.   Within the model, Harvey's view of the circulation has been broadened to include impedance-defined flow as a unifying concept. The cardiac function curve, the relation between ventricular filling...... and output, changes during exercise. First, it rotates counterclockwise and stretches along the output axis, second, it shifts along the filling axis. The first is induced by sympathetic control, the second by respiratory control. The model shows that depth of respiration, sympathetic stimulation of cardiac......A model of the closed human cardiovascular loop is developed. This model, using one set of 88 equations, allows variations from normal resting conditions to exercise, as well as to the extreme condition of a circulation following cardiac arrest. The principal purpose of the model is to evaluate...

  18. Journalism as Cultures of Circulation

    DEFF Research Database (Denmark)

    Bødker, Henrik

    2013-01-01

    The universe of journalism has always consisted of interspersed texts, meanings and practices. Yet, much journalism research has often isolated either texts and/or contexts and as such assumed relations between professional practices, informed (rational) readers and (conceived) core texts...... of journalism. It is, however, more important than ever to shift attention away from texts to the processes through which they are circulated. This is partly because the many cultural forms of journalism (textual, institutional, technological, material, behavioural and imagined) are undergoing significant......, likes, comments, searches, journalist roles, writing and reading positions and identities etc. Such forms will be traced within the mediation of a specific event with the overall aim of beginning a theorization of the landscape of journalism as highly interrelated cultures of circulation....

  19. Radioisotopic evaluation of portal circulation

    International Nuclear Information System (INIS)

    Maliska, C.; Rosenthal, D.

    1986-01-01

    The use of a radio-tracer of portal circulation through the intestine, should prevent cruel punctures in the portal-vein or spleen as it is usually the case with traditional methods in the study of portal-system. The absorption of I-131 and Tc-99m, previously cheked in rabbits presented similar results in dogs. The time of circulation between terminal large-intestine and the liver (t-RF) was determined by external counting at hepatic level by recording radioactivity variation-time. In healthy animals the t-RF was from 20to 60 seconds, with average time of 42 seconds. In 2 animals with partial binding of portal-vein the t-RF went up to 110 and 120 seconds. (Author) [pt

  20. Ocean circulation generated magnetic signals

    DEFF Research Database (Denmark)

    Manoj, C.; Kuvshinov, A.; Maus, S.

    2006-01-01

    Conducting ocean water, as it flows through the Earth's magnetic field, generates secondary electric and magnetic fields. An assessment of the ocean-generated magnetic fields and their detectability may be of importance for geomagnetism and oceanography. Motivated by the clear identification...... of ocean tidal signatures in the CHAMP magnetic field data we estimate the ocean magnetic signals of steady flow using a global 3-D EM numerical solution. The required velocity data are from the ECCO ocean circulation experiment and alternatively from the OCCAM model for higher resolution. We assume...... of the magnetic field, as compared to the ECCO simulation. Besides the expected signatures of the global circulation patterns, we find significant seasonal variability of ocean magnetic signals in the Indian and Western Pacific Oceans. Compared to seasonal variation, interannual variations produce weaker signals....

  1. Observations of Local Seychelles Circulation

    Science.gov (United States)

    2015-09-30

    1 DISTRIBUTION STATEMENT A. Approved for public release; distribution is unlimited. Observations of Local Seychelles Circulation Geno...goal for the proposed work is to develop predictive capabilities for physical oceanography for the Seychelles region in support of locally relevant...observations in the Seychelles region that will lead to long-term data collection efforts. In collaboration with local partnerships, we will carry out

  2. Circulating nucleic acids and evolution.

    Science.gov (United States)

    Anker, Philippe; Stroun, Maurice

    2012-06-01

    J.B. Lamarck in 1809 was the first to present a theory of evolution. He proposed it was due to the adaptation of species to environmental changes, this adaptation being acquired by the offspring. In 1868, Darwin suggested that cells excrete gemmules, which circulate through the body and reach the gonads where they are transmitted to the next generation. His main argument came from graft hybrids. In the fifties and sixties, Russian geneticists, rejecting neo-Darwinism, said that acquired characteristics were the basis of evolution. The main experiments on which they based their theory were the transmission of hereditary characteristics by a special technique of grafting between two varieties of plants. We repeated this kind of experiment and also succeeded in obtaining hereditary modifications of the pupil plants that acquired some characteristics of the mentor variety. Rather than adopting the views of the Russian scientists, we suggested that DNA was circulating between the mentor and pupil plants. Hirata's group have shown recently, by using molecular techniques such as cloning, RFLP PCR and sequencing some genes of their graft hybrids of pepper plants, that transfer of informative molecules from the mentor to the pupil plant does exist. Nucleic acids are actively released by cells; they circulate in the body. They can transform oncogenically or trigger antibody response but the only genetic transformation showing that DNA can go from the soma to the germen comes from graft hybrids. This suggests that circulating nucleic acids, in this case DNA, like Darwin's gemmules, play a role in the mechanism of evolution.

  3. Improvement of Classification of Enterprise Circulating Funds

    OpenAIRE

    Rohanova Hanna O.

    2014-01-01

    The goal of the article lies in revelation of possibilities of increase of efficiency of managing enterprise circulating funds by means of improvement of their classification features. Having analysed approaches of many economists to classification of enterprise circulating funds, systemised and supplementing them, the article offers grouping classification features of enterprise circulating funds. In the result of the study the article offers an expanded classification of circulating funds, ...

  4. Hall Effect Gyrators and Circulators

    Science.gov (United States)

    Viola, Giovanni; DiVincenzo, David P.

    2014-04-01

    The electronic circulator and its close relative the gyrator are invaluable tools for noise management and signal routing in the current generation of low-temperature microwave systems for the implementation of new quantum technologies. The current implementation of these devices using the Faraday effect is satisfactory but requires a bulky structure whose physical dimension is close to the microwave wavelength employed. The Hall effect is an alternative nonreciprocal effect that can also be used to produce desired device functionality. We review earlier efforts to use an Ohmically contacted four-terminal Hall bar, explaining why this approach leads to unacceptably high device loss. We find that capacitive coupling to such a Hall conductor has much greater promise for achieving good circulator and gyrator functionality. We formulate a classical Ohm-Hall analysis for calculating the properties of such a device, and show how this classical theory simplifies remarkably in the limiting case of the Hall angle approaching 90°. In this limit, we find that either a four-terminal or a three-terminal capacitive device can give excellent circulator behavior, with device dimensions far smaller than the ac wavelength. An experiment is proposed to achieve GHz-band gyration in millimeter (and smaller) scale structures employing either semiconductor heterostructure or graphene Hall conductors. An inductively coupled scheme for realizing a Hall gyrator is also analyzed.

  5. Encoders for block-circulant LDPC codes

    Science.gov (United States)

    Divsalar, Dariush (Inventor); Abbasfar, Aliazam (Inventor); Jones, Christopher R. (Inventor); Dolinar, Samuel J. (Inventor); Thorpe, Jeremy C. (Inventor); Andrews, Kenneth S. (Inventor); Yao, Kung (Inventor)

    2009-01-01

    Methods and apparatus to encode message input symbols in accordance with an accumulate-repeat-accumulate code with repetition three or four are disclosed. Block circulant matrices are used. A first method and apparatus make use of the block-circulant structure of the parity check matrix. A second method and apparatus use block-circulant generator matrices.

  6. Early concepts and charts of ocean circulation

    Science.gov (United States)

    Peterson, R. G.; Stramma, L.; Kortum, G.

    Charts of ocean currents from the late nineteenth century show that already by then the patterns of surface circulation in regions away from polar latitudes were well understood. This fundamental knowledge accumulated gradually through centuries of sea travel and had reached a state of near correctness by the time dedicated research cruises, full-depth measurements and the practical application of the dynamical method were being instituted. Perhaps because of the foregoing, many of the pioneering works, critical to establishing what the upper-level circulation is like, the majority of the charts accompanying them, and several of the groundbreaking theoretical treatments on the physics of currents, are only poorly known to present-day oceanographers. In this paper we trace Western developments in knowledge and understanding of ocean circulation from the earliest times to the late-1800s transition into the modern era. We also discuss certain peripheral advances that proved critical to the subject. The earliest known ideas, dating from the Bronze Age and described by Homer, necessarily reflect severe limitations to geographical knowledge, as well as basic human predilections toward conjecture and exaggeration in the face of inadequate information. People considered the earth to be flat and circular, with the ocean flowing like a river around it. They also believed in horrific whirlpools, a concept that persisted into the Renaissance and which would later provide subject material for modern literature. From the Greek Classical Age, we find hydrologic theories of Earth's interior being laced with subterranean channels (Socrates) and all motion deriving from a divine force forever propelling the heavens toward the west, the primum mobile (Aristotle). These ideas, particularly the latter, dominated opinions about ocean circulation into the late Renaissance. By late Antiquity mariners had very likely acquired intimate knowledge of coastal currents in the Mediterranean, but

  7. Large scale atmospheric tropical circulation changes and consequences during global warming

    International Nuclear Information System (INIS)

    Gastineau, G.

    2008-01-01

    The changes of the tropical large scale circulation during climate change can have large impacts on human activities. In a first part, the meridional atmospheric tropical circulation was studied in the different coupled models. During climate change, we find, on the one hand, that the Hadley meridional circulation and the subtropical jet are significantly shifted poleward, and on the other hand, that the intensity of the tropical circulation weakens. The slow down of the atmospheric circulation results from the dry static stability changes affecting the tropical troposphere. Secondly, idealized simulations are used to explain the tropical circulation changes. Ensemble simulation using the model LMDZ4 are set up to study the results from the coupled model IPSLCM4. The weakening of the large scale tropical circulation and the poleward shift of the Hadley cells are explained by both the uniform change and the meridional gradient change of the sea surface temperature. Then, we used the atmospheric model LMDZ4 in an aqua-planet configuration. The Hadley circulation changes are explained in a simple framework by the required poleward energy transport. In a last part, we focus on the water vapor distribution and feedback in the climate models. The Hadley circulation changes were shown to have a significant impact on the water vapour feedback during climate change. (author)

  8. Diarrhea caused by circulating agents.

    Science.gov (United States)

    Fabian, Elisabeth; Kump, Patrizia; Krejs, Guenter J

    2012-09-01

    Circulating agents cause intestinal secretion or changes in motility with decreased intestinal transit time, resulting in secretory-type diarrhea. Secretory diarrhea as opposed to osmotic diarrhea is characterized by large-volume, watery stools, often more than 1 L per day; by persistence of diarrhea when patients fast; and by the fact that on analysis of stool-water, measured osmolarity is identical to that calculated from the electrolytes present. Although sodium plays the main role in water and electrolyte absorption, chloride is the major ion involved in secretion. Copyright © 2012 Elsevier Inc. All rights reserved.

  9. Vasculitis of the mesenteric circulation.

    Science.gov (United States)

    Koster, Matthew J; Warrington, Kenneth J

    2017-02-01

    Vasculitis of the mesenteric circulation is an uncommon but life-threatening manifestation of systemic vasculitis. Initial symptoms are frequently non-specific and therefore patients often present to primary care physicians and gastroenterologists with abdominal pain or gastrointestinal bleeding. Given the severity of the conditions associated with mesenteric vasculitis, it is imperative to appropriately diagnose and initiate treatment of suspected cases. This review will focus on diseases commonly associated with vasculitis of the mesenteric vessels. Imaging characteristics and clinical features assisting in diagnosis as well as initial approaches to treatment are emphasized. Copyright © 2016 Elsevier Ltd. All rights reserved.

  10. Autonomic Regulation of Splanchnic Circulation

    Directory of Open Access Journals (Sweden)

    Kathleen A Fraser

    1991-01-01

    Full Text Available The role of the autonomic nervous system in circulatory regulation of the splanchnic organs (stomach, small intestine, colon, liver, pancreas and spleen is reviewed. In general, the sympathetic nervous system is primarily involved in vasoconstriction, while the parasympathetic contributes to vasodilation. Vasoconstriction in the splanchnic circulation appears to be mediated by alpha-2 receptors and vasodilation by activation of primary afferent nerves with subsequent release of vasodilatory peptides, or by stimulation of beta-adrenergic receptors. As well, an important function of the autonomic nervous system is to provide a mechanism by which splanchnic vascular reserve can be mobilized during stress to maintain overall cardiovascular homeostasis.

  11. Novel reassortant swine influenza viruses are circulating in Danish pigs

    DEFF Research Database (Denmark)

    Breum, Solvej Østergaard; Hjulsager, Charlotte Kristiane; Trebbien, Ramona

    of the reassortant viruses comprised a HA gene similar to H1 of H1N1 avian-like swine influenza virus (SIV) and a NA gene most closely related to N2 gene of human H3N2 influenza virus that circulated in humans in the mid 1990s. The internal genes of this reassortant virus with the subtype H1avN2hu all belonged...... to the H1N1 avian-like SIV lineages. Until now this novel virus H1avN2hu has only been detected in Danish swine. The other novel reassortant virus contained the HA gene from H1N1pdm09 virus and a NA gene similar to the N2 gene of H3N2 SIV that have been circulating in European swine since the mid 1980s...

  12. Intestinal circulation during inhalation anesthesia

    International Nuclear Information System (INIS)

    Tverskoy, M.; Gelman, S.; Fowler, K.C.; Bradley, E.L.

    1985-01-01

    This study was designed to evaluate the influence of inhalational agents on the intestinal circulation in an isolated loop preparation. Sixty dogs were studied, using three intestinal segments from each dog. Selected intestinal segments were pumped with aortic blood at a constant pressure of 100 mmHg. A mixture of 86 Rb and 9-microns spheres labeled with 141 Ce was injected into the arterial cannula supplying the intestinal loop, while mesenteric venous blood was collected for activity counting. A very strong and significant correlation was found between rubidium clearance and microsphere entrapment (r = 0.97, P less than 0.0001). Nitrous oxide anesthesia was accompanied by a higher vascular resistance (VR), lower flow (F), rubidium clearance (Cl-Rb), and microspheres entrapment (Cl-Sph) than pentobarbital anesthesia, indicating that the vascular bed in the intestinal segment was constricted and flow (total and nutritive) decreased. Halothane, enflurane, and isoflurane anesthesia were accompanied by a much lower arteriovenous oxygen content difference (AVDO 2 ) and oxygen uptake than pentobarbital or nitrous oxide. Compared with pentobarbital, enflurane anesthesia was not accompanied by marked differences in VR, F, Cl-Rb, and Cl-Sph; halothane at 2 MAC decreased VR and increased F and Cl-Rb while isoflurane increased VR and decreased F. alpha-Adrenoceptor blockade with phentolamine (1 mg . kg-1) abolished isoflurane-induced vasoconstriction, suggesting that the increase in VR was mediated via circulating catecholamines

  13. Roadmap for cardiovascular circulation model

    Science.gov (United States)

    Bradley, Christopher P.; Suresh, Vinod; Mithraratne, Kumar; Muller, Alexandre; Ho, Harvey; Ladd, David; Hellevik, Leif R.; Omholt, Stig W.; Chase, J. Geoffrey; Müller, Lucas O.; Watanabe, Sansuke M.; Blanco, Pablo J.; de Bono, Bernard; Hunter, Peter J.

    2016-01-01

    Abstract Computational models of many aspects of the mammalian cardiovascular circulation have been developed. Indeed, along with orthopaedics, this area of physiology is one that has attracted much interest from engineers, presumably because the equations governing blood flow in the vascular system are well understood and can be solved with well‐established numerical techniques. Unfortunately, there have been only a few attempts to create a comprehensive public domain resource for cardiovascular researchers. In this paper we propose a roadmap for developing an open source cardiovascular circulation model. The model should be registered to the musculo‐skeletal system. The computational infrastructure for the cardiovascular model should provide for near real‐time computation of blood flow and pressure in all parts of the body. The model should deal with vascular beds in all tissues, and the computational infrastructure for the model should provide links into CellML models of cell function and tissue function. In this work we review the literature associated with 1D blood flow modelling in the cardiovascular system, discuss model encoding standards, software and a model repository. We then describe the coordinate systems used to define the vascular geometry, derive the equations and discuss the implementation of these coupled equations in the open source computational software OpenCMISS. Finally, some preliminary results are presented and plans outlined for the next steps in the development of the model, the computational software and the graphical user interface for accessing the model. PMID:27506597

  14. Regulated expression of genes inserted at the human chromosomal β-globin locus by homologous recombination

    International Nuclear Information System (INIS)

    Nandi, A.K.; Roginski, R.S.; Gregg, R.G.; Smithies, O.; Skoultchi, A.I.

    1988-01-01

    The authors have examined the effect of the site of integration on the expression of cloned genes introduced into cultured erythroid cells. Smithies et al. reported the targeted integration of DNA into the human β-globin locus on chromosome 11 in a mouse erythroleukemia-human cell hybrid. These hybrid cells can undergo erythroid differentiation leading to greatly increased mouse and human β-globin synthesis. By transfection of these hybrid cells with a plasmid carrying a modified human β-globin gene and a foreign gene composed of the coding sequence of the bacterial neomycin-resistance gene linked to simian virus 40 transcription signals (SVneo), cells were obtained in which the two genes are integrated at the β-globin locus on human chromosome 11 or at random sites. When they examined the response of the integrated genes to cell differentation, they found that the genes inserted at the β-globin locus were induced during differentiation, whereas randomly positioned copies were not induced. Even the foreign SVneo gene was inducible when it had been integrated at the β-globin locus. The results show that genes introduced at the β-globin locus acquire some of the regulatory properties of globin genes during erythroid differentiation

  15. Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

    Energy Technology Data Exchange (ETDEWEB)

    Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk

    2014-04-25

    Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

  16. Lack of association between nuclear factor erythroid-derived 2-like 2 promoter gene polymorphisms and oxidative stress biomarkers in amyotrophic lateral sclerosis patients.

    Science.gov (United States)

    LoGerfo, Annalisa; Chico, Lucia; Borgia, Loredana; Petrozzi, Lucia; Rocchi, Anna; D'Amelio, Antonia; Carlesi, Cecilia; Caldarazzo Ienco, Elena; Mancuso, Michelangelo; Siciliano, Gabriele

    2014-01-01

    Oxidative stress involvement has been strongly hypothesized among the possible pathogenic mechanisms of motor neuron degeneration in amyotrophic lateral sclerosis (ALS). The intracellular redox balance is finely modulated by numerous complex mechanisms critical for cellular functions, among which the nuclear factor erythroid-derived 2-like 2 (NFE2L2/Nrf2) pathways. We genotyped, in a cohort of ALS patients (n = 145) and healthy controls (n = 168), three SNPs in Nrf2 gene promoter: -653 A/G, -651 G/A, and -617 C/A and evaluated, in a subset (n = 73) of patients, advanced oxidation protein products (AOPP), iron-reducing ability of plasma (FRAP), and plasma thiols (-SH) as oxidative damage peripheral biomarkers. Nrf2 polymorphisms were not different among patients and controls. Increased levels of AOPP (P < 0.05) and decreased levels of FRAP (P < 0.001) have been observed in ALS patients compared with controls, but no difference in -SH values was found. Furthermore, no association was found between biochemical markers of redox balance and Nrf2 polymorphisms. These data confirm an altered redox balance in ALS and indicate that, while being abnormally modified compared to controls, the oxidative stress biomarkers assessed in this study are independent from the -653 A/G, -651 G/A, and -617 C/A Nrf2 SNPs in ALS patients.

  17. Lack of Association between Nuclear Factor Erythroid-Derived 2-Like 2 Promoter Gene Polymorphisms and Oxidative Stress Biomarkers in Amyotrophic Lateral Sclerosis Patients

    Directory of Open Access Journals (Sweden)

    Annalisa LoGerfo

    2014-01-01

    Full Text Available Oxidative stress involvement has been strongly hypothesized among the possible pathogenic mechanisms of motor neuron degeneration in amyotrophic lateral sclerosis (ALS. The intracellular redox balance is finely modulated by numerous complex mechanisms critical for cellular functions, among which the nuclear factor erythroid-derived 2-like 2 (NFE2L2/Nrf2 pathways. We genotyped, in a cohort of ALS patients (n=145 and healthy controls (n=168, three SNPs in Nrf2 gene promoter: −653 A/G, −651 G/A, and −617 C/A and evaluated, in a subset (n=73 of patients, advanced oxidation protein products (AOPP, iron-reducing ability of plasma (FRAP, and plasma thiols (-SH as oxidative damage peripheral biomarkers. Nrf2 polymorphisms were not different among patients and controls. Increased levels of AOPP (P<0.05 and decreased levels of FRAP (P<0.001 have been observed in ALS patients compared with controls, but no difference in -SH values was found. Furthermore, no association was found between biochemical markers of redox balance and Nrf2 polymorphisms. These data confirm an altered redox balance in ALS and indicate that, while being abnormally modified compared to controls, the oxidative stress biomarkers assessed in this study are independent from the −653 A/G, −651 G/A, and −617 C/A Nrf2 SNPs in ALS patients.

  18. Production of β-globin and adult hemoglobin following G418 treatment of erythroid precursor cells from homozygous β039 thalassemia patients

    Science.gov (United States)

    Salvatori, Francesca; Breveglieri, Giulia; Zuccato, Cristina; Finotti, Alessia; Bianchi, Nicoletta; Borgatti, Monica; Feriotto, Giordana; Destro, Federica; Canella, Alessandro; Brognara, Eleonora; Lampronti, Ilaria; Breda, Laura; Rivella, Stefano; Gambari, Roberto

    2013-01-01

    In several types of thalassemia (including β039-thalassemia), stop codon mutations lead to premature translation termination and to mRNA destabilization through nonsense-mediated decay. Drugs (for instance aminoglycosides) can be designed to suppress premature termination, inducing a ribosomal readthrough. These findings have introduced new hopes for the development of a pharmacologic approach to the cure of this disease. However, the effects of aminoglycosides on globin mRNA carrying β-thalassemia stop mutations have not yet been investigated. In this study, we have used a lentiviral construct containing the β039- thalassemia globin gene under control of the β-globin promoter and a LCR cassette. We demonstrated by fluorescence-activated cell sorting (FACS) analysis the production of β-globin by K562 cell clones expressing the β039-thalassemia globin gene and treated with G418. More importantly, after FACS and high-performance liquid chromatography (HPLC) analyses, erythroid precursor cells from β039-thalassemia patients were demonstrated to be able to produce β-globin and adult hemoglobin after treatment with G418. This study strongly suggests that ribosomal readthrough should be considered a strategy for developing experimental strategies for the treatment of β0-thalassemia caused by stop codon mutations. PMID:19810011

  19. Serological evaluation of Crimean-Congo hemorrhagic fever in humans with high-risk professions living in enzootic regions of Isfahan province of Iran and genetic analysis of circulating strains.

    Science.gov (United States)

    Chinikar, Sadegh; Ghiasi, Seyed M; Naddaf, Saeed; Piazak, Norair; Moradi, Maryam; Razavi, Mohammad R; Afzali, Neda; Haeri, Ali; Mostafavizadeh, Kamyar; Ataei, Behrouz; Khalilifard-Brojeni, Mohammad; Husseini, Sayed M; Bouloy, Michele

    2012-09-01

    Crimean-Congo hemorrhagic fever (CCHF) is a zoonotic viral disease that is asymptomatic in infected livestock, but causes a serious threat to humans with a mortality rate up to 50%. Although the CCHF virus (CCHFV) is often transmitted by ticks, livestock-to-human and human-to-human transmission also occurs. In the current study, we focused on CCHF in the province of Isfahan, located in the center of Iran and deemed to be the second most infected province. Human and livestock sera and resident ticks in the livestock are collected from different regions of the province and analyzed with specific IgG ELISA and RT-PCR tests. Overall, 12% and 12.7% of studied human and livestock populations were IgG positive, respectively. The genome of CCHFV was detected in 9% of ticks resident in livestock involved in this survey. The CCHFV isolates from infected ticks were genetically examined. Nucleotide sequence of the S-segment revealed that the different isolates were closely related to each other, with nucleotide sequence identities higher than 98%. Phylogenetic analysis demonstrated that a variant isolate clustered with the Iraq strain. This high proportion of IgG-positive sera and nearly high proportion of infected ticks increases the risk of CCHF outbreaks in the province and probably posits a great danger to other provinces.

  20. Stressed lungs: unveiling the role of circulating stress ...

    Science.gov (United States)

    Ozone, a major component of smog generated through the interaction of light and anthropogenic emissions, induces adverse pulmonary, cardiovascular, and systemic health effects upon inhalation. It is generally accepted that ozone-induced lung injury is mediated by its interaction with lung lining components causing local oxidative changes, which then leads to cell damage and recruitment of inflammatory cells. It is postulated that the spillover of reactive intermediates and pro-inflammatory molecules from lung to systemic circulation mediates extra-pulmonary effects. However, recent work from our laboratory supports an alternative hypothesis that circulating stress hormones, such as epinephrine and corticosterone/cortisol, are involved in mediating ozone pulmonary effects. We have shown in rats and humans that ozone increases the levels of circulating stress hormones through activation of the hypothalamus- pituitary-adrenal (HPA) axis before any measurable effects are observed in the lung. The surgical removal of adrenals diminishes circulating stress hormones and at the same time, the pulmonary effects of ozone suggesting a significant contribution of these hormones in ozone-induced lung injury and inflammation. While ozone effects in the lung have been extensively studied, the contribution of central nervous system -mediated hormonal stress response has not been examined. In order to understand the signaling pathways that might be involved in ozone-induced lun

  1. Uranus atmospheric dynamics and circulation

    Science.gov (United States)

    Allison, Michael; Beebe, Reta F.; Conrath, Barney J.; Hinson, David P.; Ingersoll, Andrew P.

    1991-01-01

    The observations, models, and theories relevant to the atmospheric dynamics and meteorology of Uranus are discussed. The available models for the large-scale heat transport and atmospheric dynamics as well as diagnostic interpretations of the Voyager data are reviewed. Some pertinent ideas and questions regarding the global circulation balance are considered, partly in comparison with other planetary atmospheres. The available data indicate atmospheric rotation at midlatitudes nearly 200 m/s faster than that of the planetary magnetic field. Analysis of the dynamical deformation of the shape and size of isobaric surfaces measured by the Voyager radio-occultation experiment suggests a subrotating equator at comparable altitudes. Infrared temperature retrievals above the cloud deck indicate a smaller equator-to-pole contrast than expected for purely radiative-convective equilibrium, but show local variations implying a latitudinally correlated decrease with altitude in the cloud-tracked wind.

  2. Improvement of Classification of Enterprise Circulating Funds

    Directory of Open Access Journals (Sweden)

    Rohanova Hanna O.

    2014-02-01

    Full Text Available The goal of the article lies in revelation of possibilities of increase of efficiency of managing enterprise circulating funds by means of improvement of their classification features. Having analysed approaches of many economists to classification of enterprise circulating funds, systemised and supplementing them, the article offers grouping classification features of enterprise circulating funds. In the result of the study the article offers an expanded classification of circulating funds, which clearly shows the role of circulating funds in managing enterprise finance and economy in general. The article supplements and groups classification features of enterprise circulating funds by: the organisation level, functioning character, sources of formation and their cost, and level of management efficiency. The article shows that the provided grouping of classification features of circulating funds allows exerting all-sided and purposeful influence upon indicators of efficiency of circulating funds functioning and facilitates their rational management in general. The prospect of further studies in this direction is identification of the level of attraction of loan resources by production enterprises for financing circulating funds.

  3. NPP Krsko natural circulation performance evaluation

    International Nuclear Information System (INIS)

    Segon, Velimir; Bajs, Tomislav; Frogheri, Monica

    1999-01-01

    The present document deals with an evaluation of the natural circulation performance of the Krsko nuclear power plant. Two calculation have been performed using the NPP Krsko nodalization (both similar to the LOBI A2-77 natural circulation experiment) - the first with the present steam generators at NPP Krsko (Westinghouse, 18% plugged), the second with the future steam generators (Siemens, 0% plugged). The results were evaluated using the natural circulation flow map derived in /1/, and were compared to evaluate the influence of the new steam generators on the natural circulation performance. (author)

  4. Basic natural circulation characteristics of SBWR

    International Nuclear Information System (INIS)

    Kuran, S.; Soekmen, C. N.

    2001-01-01

    Natural circulation is an important passive heat removal mechanism for both existing and next generation light water reactors. Simplified Boiling Water Reactor (SBWR) is one of the advanced light water reactors that rely on natural circulation for normal as well as emergency core cooling. In this study, basic natural circulation characteristics of this reactor are examined on a flow loop that simulates the operation of SBWR. On this model, effect of system operating parameters on the steady state natural circulation characteristics inside the loop is studied via solving the transcendental equation for loop flow rate

  5. Circulatory shear flow alters the viability and proliferation of circulating colon cancer cells

    Science.gov (United States)

    Fan, Rong; Emery, Travis; Zhang, Yongguo; Xia, Yuxuan; Sun, Jun; Wan, Jiandi

    2016-06-01

    During cancer metastasis, circulating tumor cells constantly experience hemodynamic shear stress in the circulation. Cellular responses to shear stress including cell viability and proliferation thus play critical roles in cancer metastasis. Here, we developed a microfluidic approach to establish a circulatory microenvironment and studied circulating human colon cancer HCT116 cells in response to a variety of magnitude of shear stress and circulating time. Our results showed that cell viability decreased with the increase of circulating time, but increased with the magnitude of wall shear stress. Proliferation of cells survived from circulation could be maintained when physiologically relevant wall shear stresses were applied. High wall shear stress (60.5 dyne/cm2), however, led to decreased cell proliferation at long circulating time (1 h). We further showed that the expression levels of β-catenin and c-myc, proliferation regulators, were significantly enhanced by increasing wall shear stress. The presented study provides a new insight to the roles of circulatory shear stress in cellular responses of circulating tumor cells in a physiologically relevant model, and thus will be of interest for the study of cancer cell mechanosensing and cancer metastasis.

  6. Functional analysis of human hematopoietic stem cell gene expression using zebrafish.

    Directory of Open Access Journals (Sweden)

    2005-08-01

    Full Text Available Although several reports have characterized the hematopoietic stem cell (HSC transcriptome, the roles of HSC-specific genes in hematopoiesis remain elusive. To identify candidate regulators of HSC fate decisions, we compared the transcriptome of human umbilical cord blood and bone marrow (CD34+(CD33-(CD38-Rho(lo(c-kit+ cells, enriched for hematopoietic stem/progenitor cells with (CD34+(CD33-(CD38-Rho(hi cells, enriched in committed progenitors. We identified 277 differentially expressed transcripts conserved in these ontogenically distinct cell sources. We next performed a morpholino antisense oligonucleotide (MO-based functional screen in zebrafish to determine the hematopoietic function of 61 genes that had no previously known function in HSC biology and for which a likely zebrafish ortholog could be identified. MO knock down of 14/61 (23% of the differentially expressed transcripts resulted in hematopoietic defects in developing zebrafish embryos, as demonstrated by altered levels of circulating blood cells at 30 and 48 h postfertilization and subsequently confirmed by quantitative RT-PCR for erythroid-specific hbae1 and myeloid-specific lcp1 transcripts. Recapitulating the knockdown phenotype using a second MO of independent sequence, absence of the phenotype using a mismatched MO sequence, and rescue of the phenotype by cDNA-based overexpression of the targeted transcript for zebrafish spry4 confirmed the specificity of MO targeting in this system. Further characterization of the spry4-deficient zebrafish embryos demonstrated that hematopoietic defects were not due to more widespread defects in the mesodermal development, and therefore represented primary defects in HSC specification, proliferation, and/or differentiation. Overall, this high-throughput screen for the functional validation of differentially expressed genes using a zebrafish model of hematopoiesis represents a major step toward obtaining meaningful information from global

  7. Natural circulation in reactor coolant system

    International Nuclear Information System (INIS)

    Han, J.T.

    1987-01-01

    Reactor coolant system (RCS) natural circulation in a PWR is the buoyancy-driven coolant circulation between the core and the upper-plenum region (in-vessel circulation) with or without a countercurrent flow in the hot leg piping between the vessel and steam generators (ex-vessel circulation). This kind of multidimensional bouyancy-driven flow circulation serves as a means of transferring the heat from the core to the structures in the upper plenum, hot legs, and possibly steam generators. As a result, the RCS piping and other pressure boundaries may be heated to high temperatures at which the structural integrity is challenged. RCS natural circulation is likely to occur during the core uncovery period of the TMLB' accident in a PWR when the vessel upper plenum and hot leg are already drained and filled with steam and possibly other gaseous species. RCS natural circulation is being studied for the Surry plant during the TMLB' accident in which station blackout coincides with the loss of auxiliary feedwater and no operator actions. The effects of the multidimensional RCS natural circulation during the TMLB' accident are discussed

  8. Circulating follistatin in relation to energy metabolism

    DEFF Research Database (Denmark)

    Hansen, Jakob Schiøler; Plomgaard, Peter

    2016-01-01

    a relation to energy metabolism. In this narrative review, we attempt to reconcile the existing findings on circulating follistatin with the novel concept that circulating follistatin is a liver-derived molecule regulated by the glucagon-to-insulin ratio. The picture emerging is that conditions associated...

  9. Molecular Evolution of the Nuclear Factor (Erythroid-Derived 2)-Like 2 Gene Nrf2 in Old World Fruit Bats (Chiroptera: Pteropodidae).

    Science.gov (United States)

    Yin, Qiuyuan; Zhu, Lei; Liu, Di; Irwin, David M; Zhang, Shuyi; Pan, Yi-Hsuan

    2016-01-01

    Mammals developed antioxidant systems to defend against oxidative damage in their daily life. Enzymatic antioxidants and low molecular weight antioxidants (LMWAs) constitute major parts of the antioxidant systems. Nuclear factor (erythroid-derived 2)-like 2 (Nrf2, encoded by the Nrf2 gene) is a central transcriptional regulator, regulating transcription, of many antioxidant enzymes. Frugivorous bats eat large amounts of fruits that contain high levels of LMWAs such as vitamin C, thus, a reliance on LMWAs might greatly reduce the need for antioxidant enzymes in comparison to insectivorous bats. Therefore, it is possible that frugivorous bats have a reduced need for Nrf2 function due to their substantial intake of diet-antioxidants. To test whether the Nrf2 gene has undergone relaxed evolution in fruit-eating bats, we obtained Nrf2 sequences from 16 species of bats, including four Old World fruit bats (Pteropodidae) and one New World fruit bat (Phyllostomidae). Our molecular evolutionary analyses revealed changes in the selection pressure acting on Nrf2 gene and identified seven specific amino acid substitutions that occurred on the ancestral lineage leading to Old World fruit bats. Biochemical experiments were conducted to examine Nrf2 in Old World fruit bats and showed that the amount of catalase, which is regulated by Nrf2, was significantly lower in the brain, heart and liver of Old World fruit bats despite higher levels of Nrf2 protein in Old World fruit bats. Computational predictions suggest that three of these seven amino acid replacements might be deleterious to Nrf2 function. Therefore, the results suggest that Nrf2 gene might have experienced relaxed constraint in Old World fruit bats, however, we cannot rule out the possibility of positive selection. Our study provides the first data on the molecular adaptation of Nrf2 gene in frugivorous bats in compensation to the increased levels of LWMAs from their fruit-diet.

  10. Catalase overexpression prevents nuclear factor erythroid 2-related factor 2 stimulation of renal angiotensinogen gene expression, hypertension, and kidney injury in diabetic mice.

    Science.gov (United States)

    Abdo, Shaaban; Shi, Yixuan; Otoukesh, Abouzar; Ghosh, Anindya; Lo, Chao-Sheng; Chenier, Isabelle; Filep, Janos G; Ingelfinger, Julie R; Zhang, Shao Ling; Chan, John S D

    2014-10-01

    This study investigated the impact of catalase (Cat) overexpression in renal proximal tubule cells (RPTCs) on nuclear factor erythroid 2-related factor 2 (Nrf2) stimulation of angiotensinogen (Agt) gene expression and the development of hypertension and renal injury in diabetic Akita transgenic mice. Additionally, adult male mice were treated with the Nrf2 activator oltipraz with or without the inhibitor trigonelline. Rat RPTCs, stably transfected with plasmid containing either rat Agt or Nrf2 gene promoter, were also studied. Cat overexpression normalized systolic BP, attenuated renal injury, and inhibited RPTC Nrf2, Agt, and heme oxygenase-1 (HO-1) gene expression in Akita Cat transgenic mice compared with Akita mice. In vitro, high glucose level, hydrogen peroxide, and oltipraz stimulated Nrf2 and Agt gene expression; these changes were blocked by trigonelline, small interfering RNAs of Nrf2, antioxidants, or pharmacological inhibitors of nuclear factor-κB and p38 mitogen-activated protein kinase. The deletion of Nrf2-responsive elements in the rat Agt gene promoter abolished the stimulatory effect of oltipraz. Oltipraz administration also augmented Agt, HO-1, and Nrf2 gene expression in mouse RPTCs and was reversed by trigonelline. These data identify a novel mechanism, Nrf2-mediated stimulation of intrarenal Agt gene expression and activation of the renin-angiotensin system, by which hyperglycemia induces hypertension and renal injury in diabetic mice. © 2014 by the American Diabetes Association. Readers may use this article as long as the work is properly cited, the use is educational and not for profit, and the work is not altered.

  11. Hemistepsin A ameliorates acute inflammation in macrophages via inhibition of nuclear factor-κB and activation of nuclear factor erythroid 2-related factor 2.

    Science.gov (United States)

    Kim, Jae Kwang; Lee, Ji Eun; Jung, Eun Hye; Jung, Ji Yun; Jung, Dae Hwa; Ku, Sae Kwang; Cho, Il Je; Kim, Sang Chan

    2018-01-01

    Hemistepsin A (HsA) is a sesquiterpene lactone isolated from Hemistepta lyrata (Bunge) Bunge. We investigated the anti-inflammatory effects of HsA and sought to determine its mechanisms of action in macrophages. HsA pretreatment inhibited nitric oxide production, and reduced the expression of iNOS and COX-2 in Toll-like receptor ligand-stimulated RAW 264.7 cells. Additionally, HsA decreased the secretion of proinflammatory cytokines in lipopolysaccharide (LPS)-stimulated Kupffer cells as well as in RAW 264.7 cells. HsA inhibited phosphorylation of IKKα/β and degradation of IκBα, resulting in decreased nuclear translocation of nuclear factor-κB (NF-κB) and its transcriptional activity. Moreover, HsA phosphorylated nuclear factor erythroid 2-related factor 2 (Nrf2), increased expression levels of antioxidant genes, and attenuated LPS-stimulated H 2 O 2 production. Phosphorylation of p38 and c-Jun N-terminal kinase was required for HsA-mediated Nrf2 phosphorylation. In a D-galactosamine/LPS-induced liver injury model, HsA ameliorated D-galactosamine/LPS-induced hepatocyte degeneration and inflammatory cells infiltration. Moreover, immunohistochemical analyses using nitrotyrosine, 4-hydroxynonenal, and cleaved poly (ADP-ribose) polymerase antibodies revealed that HsA protected the liver from oxidative stress. Furthermore, HsA reduced the numbers of proinflammatory cytokine-positive cells in hepatic tissues. Thus, these results suggest HsA may be a promising natural product to manage inflammation-mediated tissue injuries through inhibition of NF-κB and activation of Nrf2. Copyright © 2017 Elsevier Ltd. All rights reserved.

  12. Extraembryonic origin of circulating endothelial cells.

    Directory of Open Access Journals (Sweden)

    Luc Pardanaud

    Full Text Available Circulating endothelial cells (CEC are contained in the bone marrow and peripheral blood of adult humans and participate to the revascularization of ischemic tissues. These cells represent attractive targets for cell or gene therapy aimed at improving ischemic revascularization or inhibition of tumor angiogenesis. The embryonic origin of CEC has not been addressed previously. Here we use quail-chick chimeras to study CEC origin and participation to the developing vasculature. CEC are traced with different markers, in particular the QH1 antibody recognizing only quail endothelial cells. Using yolk-sac chimeras, where quail embryos are grafted onto chick yolk sacs and vice-versa, we show that CEC are generated in the yolk sac. These cells are mobilized during wound healing, demonstrating their participation to angiogenic repair processes. Furthermore, we found that the allantois is also able to give rise to CEC in situ. In contrast to the yolk sac and allantois, the embryo proper does not produce CEC. Our results show that CEC exclusively originate from extra-embryonic territories made with splanchnopleural mesoderm and endoderm, while definitive hematopoietic stem cells and endothelial cells are of intra-embryonic origin.

  13. Extraembryonic origin of circulating endothelial cells.

    Science.gov (United States)

    Pardanaud, Luc; Eichmann, Anne

    2011-01-01

    Circulating endothelial cells (CEC) are contained in the bone marrow and peripheral blood of adult humans and participate to the revascularization of ischemic tissues. These cells represent attractive targets for cell or gene therapy aimed at improving ischemic revascularization or inhibition of tumor angiogenesis. The embryonic origin of CEC has not been addressed previously. Here we use quail-chick chimeras to study CEC origin and participation to the developing vasculature. CEC are traced with different markers, in particular the QH1 antibody recognizing only quail endothelial cells. Using yolk-sac chimeras, where quail embryos are grafted onto chick yolk sacs and vice-versa, we show that CEC are generated in the yolk sac. These cells are mobilized during wound healing, demonstrating their participation to angiogenic repair processes. Furthermore, we found that the allantois is also able to give rise to CEC in situ. In contrast to the yolk sac and allantois, the embryo proper does not produce CEC. Our results show that CEC exclusively originate from extra-embryonic territories made with splanchnopleural mesoderm and endoderm, while definitive hematopoietic stem cells and endothelial cells are of intra-embryonic origin.

  14. Collateral Circulation in Chronic Total Occlusions - An Interventional Perspective

    Science.gov (United States)

    Choo, Gim-Hooi

    2015-01-01

    Human coronary collaterals are inter-coronary communications that are believed to be present from birth. In the presence of chronic total occlusions, recruitment of flow via these collateral anastomoses to the arterial segment distal to occlusion provide an alternative source of blood flow to the myocardial segment at risk. This mitigates the ischemic injury. Clinical outcome of coronary occlusion ie. severity of myocardial infarction/ischemia, impairment of cardiac function and possibly survival depends not only on the acuity of the occlusion, extent of jeopardized myocardium, duration of ischemia but also to the adequacy of collateral circulation. Adequacy of collateral circulation can be assessed by various methods. These coronary collateral channels have been used successfully as a retrograde access route for percutaneous recanalization of chronic total occlusions. Factors that promote angiogenesis and further collateral remodeling ie. arteriogenesis have been identified. Promotion of collateral growth as a therapeutic target in patients with no suitable revascularization option is an exciting proposal.

  15. Collateral Circulation in Chronic Total Occlusions - an interventional perspective.

    Science.gov (United States)

    Choo, Gim-Hooi

    2015-09-09

    Human coronary collaterals are inter-coronary communications that are believed to be present from birth. In the presence of chronic total occlusions, recruitment of flow via these collateral anastomoses to the arterial segment distal to occlusion provide an alternative source of blood flow to the myocardial segment at risk. This mitigates the ischemic injury. Clinical outcome of coronary occlusion ie. severity of myocardial infarction/ischemia, impairment of cardiac function and possibly survival depends not only on the acuity of the occlusion, extent of jeopardized myocardium, duration of ischemia but also to the adequacy of collateral circulation. Adequacy of collateral circulation can be assessed by various methods. These coronary collateral channels have been used successfully as a retrograde access route for percutaneous recanalization of chronic total occlusions. Factors that promote angiogenesis and further collateral remodeling ie. arteriogenesis have been identified. Promotion of collateral growth as a therapeutic target in patients with no suitable revascularization option is an exciting proposal.

  16. Moderator circulation in CANDU reactors

    International Nuclear Information System (INIS)

    Fath, H.E.S.; Hussein, M.A.

    1989-01-01

    A two-dimensional computer code that is capable of predicting the moderator flow and temperature distribution inside CANDU calandria is presented. The code uses a new approach to simulate the calandria tube matrix by blocking the cells containing the tubes in the finite difference mesh. A jet momentum-dominant flow pattern is predicted in the nonisothermal case, and the effect of the buoyancy force, resulting from nuclear heating, is found to enhance the speed of circulation. Hot spots are located in low-velocity areas at the top of the calandria and below the inlet jet level between the fuel channels. A parametric study is carried out to investigate the effect of moderator inlet velocity,moderator inlet nozzle location, and geometric scaling. The results indicate that decreasing the moderator inlet velocity has no significant influence on the general features of the flow pattern (i.e., momentum dominant); however, too many high-temperature hot spots appear within the fuel channels

  17. Numerical Modeling of Ocean Circulation

    Science.gov (United States)

    Miller, Robert N.

    2007-01-01

    The modelling of ocean circulation is important not only for its own sake, but also in terms of the prediction of weather patterns and the effects of climate change. This book introduces the basic computational techniques necessary for all models of the ocean and atmosphere, and the conditions they must satisfy. It describes the workings of ocean models, the problems that must be solved in their construction, and how to evaluate computational results. Major emphasis is placed on examining ocean models critically, and determining what they do well and what they do poorly. Numerical analysis is introduced as needed, and exercises are included to illustrate major points. Developed from notes for a course taught in physical oceanography at the College of Oceanic and Atmospheric Sciences at Oregon State University, this book is ideal for graduate students of oceanography, geophysics, climatology and atmospheric science, and researchers in oceanography and atmospheric science. Features examples and critical examination of ocean modelling and results Demonstrates the strengths and weaknesses of different approaches Includes exercises to illustrate major points and supplement mathematical and physical details

  18. Circulating microparticles: square the circle

    Science.gov (United States)

    2013-01-01

    Background The present review summarizes current knowledge about microparticles (MPs) and provides a systematic overview of last 20 years of research on circulating MPs, with particular focus on their clinical relevance. Results MPs are a heterogeneous population of cell-derived vesicles, with sizes ranging between 50 and 1000 nm. MPs are capable of transferring peptides, proteins, lipid components, microRNA, mRNA, and DNA from one cell to another without direct cell-to-cell contact. Growing evidence suggests that MPs present in peripheral blood and body fluids contribute to the development and progression of cancer, and are of pathophysiological relevance for autoimmune, inflammatory, infectious, cardiovascular, hematological, and other diseases. MPs have large diagnostic potential as biomarkers; however, due to current technological limitations in purification of MPs and an absence of standardized methods of MP detection, challenges remain in validating the potential of MPs as a non-invasive and early diagnostic platform. Conclusions Improvements in the effective deciphering of MP molecular signatures will be critical not only for diagnostics, but also for the evaluation of treatment regimens and predicting disease outcomes. PMID:23607880

  19. Vertical mixing by Langmuir circulations

    International Nuclear Information System (INIS)

    McWilliams, James C.; Sullivan, Peter P.

    2001-01-01

    Wind and surface wave frequently induce Langmuir circulations (LC) in the upper ocean, and the LC contribute to mixing materials down from the surface. In this paper we analyze large-eddy simulation (LES) cases based on surface-wave-averaged, dynamical equations and show that the effect of the LC is a great increase in the vertical mixing efficiency for both material properties and momentum. We provide new confirmation that the previously proposed K-profile parameterization (KPP) model accurately characterizes the turbulent transport in a weakly convective, wind-driven boundary layer with stable interior stratification. We also propose a modest generalization of KPP for the regime of weakly convective Langmuir turbulence. This makes the KPP turbulent flux profiles match those in the LES case with LC present fairly well, especially so for material properties being transported downwards from the ocean surface. However, some open issues remain about how well the present LES and KPP formulations represent Langmuir turbulence, in part because wave-breaking effects are not yet included. (Author)

  20. 46 CFR 56.50-45 - Circulating pumps.

    Science.gov (United States)

    2010-10-01

    ... APPURTENANCES Design Requirements Pertaining to Specific Systems § 56.50-45 Circulating pumps. (a) A main circulating pump and emergency means for circulating water through the main condenser shall be provided. The... circulating pump and the condenser. (b) Independent sea suctions shall be provided for the main circulating...

  1. Development of CO2 circulators

    International Nuclear Information System (INIS)

    Donaldson, J.

    1988-01-01

    The development of the basic machine types we have supplied has not been without problems. The Windscale AGR (the prototype AGR) was a small 1.2 MW vertically up circulator with an inlet temperature of 237 deg. C (459 deg. F). Oil leakage problems occurred and were cured in the works test facility and the machine went into service with no other problems. The Horizontal 5 MW machines for Hinkley/Hunterston were not so fortunate with vibration problems, interface corrosion problems (effecting the whole reactor) and material dimensional stability problems. Oil ingress problems did not show up in test work but were later reported from site. These reports were initially exagerated due to the measuring techniques which took the operators some time to resolve. In the vertical 5 MW machines for Hartlepool and Heysham 1 there are two interesting factors, firstly a spar failure and secondly shaft axial stability. Many of the problems were due to modifications at site or our inability to model all aspects of site installation from which lessons for the future can be learned. The latest stations Torness and Heysham II incorporate these lessons. The machines have been designed with so much margin that during the resolution of the reactor control rod gag problems the machines were run continuously at 20% overload (6.3 MW). From an initial accident case of 350 deg. C inlet temperature, this increased to 458 deg. C and now stands at 585 deg. C. No modifications to the impeller were required. The site experience to date is good with no operational problems reported. (author). 4 figs

  2. SpaceX Dragon Air Circulation System

    Science.gov (United States)

    Hernandez, Brenda; Piatrovich, Siarhei; Prina, Mauro

    2011-01-01

    The Dragon capsule is a reusable vehicle being developed by Space Exploration Technologies (SpaceX) that will provide commercial cargo transportation to the International Space Station (ISS). Dragon is designed to be a habitable module while it is berthed to ISS. As such, the Dragon Environmental Control System (ECS) consists of pressure control and pressure equalization, air sampling, fire detection, illumination, and an air circulation system. The air circulation system prevents pockets of stagnant air in Dragon that can be hazardous to the ISS crew. In addition, through the inter-module duct, the air circulation system provides fresh air from ISS into Dragon. To utilize the maximum volume of Dragon for cargo packaging, the Dragon ECS air circulation system is designed around cargo rack optimization. At the same time, the air circulation system is designed to meet the National Aeronautics Space Administration (NASA) inter-module and intra-module ventilation requirements and acoustic requirements. A flight like configuration of the Dragon capsule including the air circulation system was recently assembled for testing to assess the design for inter-module and intra-module ventilation and acoustics. The testing included the Dragon capsule, and flight configuration in the pressure section with cargo racks, lockers, all of the air circulation components, and acoustic treatment. The air circulation test was also used to verify the Computational Fluid Dynamics (CFD) model of the Dragon capsule. The CFD model included the same Dragon internal geometry that was assembled for the test. This paper will describe the Dragon air circulation system design which has been verified by testing the system and with CFD analysis.

  3. Circulating microRNAs in breast cancer

    DEFF Research Database (Denmark)

    Hamam, Rimi; Hamam, Dana; Alsaleh, Khalid A.

    2017-01-01

    Effective management of breast cancer depends on early diagnosis and proper monitoring of patients' response to therapy. However, these goals are difficult to achieve because of the lack of sensitive and specific biomarkers for early detection and for disease monitoring. Accumulating evidence...... in the past several years has highlighted the potential use of peripheral blood circulating nucleic acids such as DNA, mRNA and micro (mi)RNA in breast cancer diagnosis, prognosis and for monitoring response to anticancer therapy. Among these, circulating miRNA is increasingly recognized as a promising...... circulating miRNAs as diagnostic, prognostic or predictive biomarkers in breast cancer management....

  4. Circulating Zinc-α2-glycoprotein levels and Insulin Resistance in Polycystic Ovary Syndrome

    Science.gov (United States)

    Lai, Yerui; Chen, Jinhua; Li, Ling; Yin, Jingxia; He, Junying; Yang, Mengliu; Jia, Yanjun; Liu, Dongfang; Liu, Hua; Liao, Yong; Yang, Gangyi

    2016-01-01

    The aim of study was to assess the relationship between zinc-α2-glycoprotein (ZAG) and androgen excess with insulin resistance in polycystic ovary syndrome (PCOS) women. 99 PCOS women and 100 healthy controls were recruited. Euglycemic-hyperinsulinemic clamp (EHC) was preformed to assess their insulin sensitivity. Circulating ZAG was determined with an ELISA kit. In healthy subjects, circulating ZAG levels exhibited a characteristic diurnal rhythm in humans, with a major nocturnal rise occurring between midnight and early morning. Circulating ZAG and M-value were much lower in PCOS women than in the controls. In all population, overweight/obese subjects had significantly lower circulating ZAG levels than lean individuals. Multiple linear regression analysis revealed that only M-value and the area under the curve for glucose were independently related factors to circulating ZAG in PCOS women. Multivariate logistic regression analysis showed that circulating ZAG was significantly associated with PCOS even after controlling for anthropometric variables, blood pressure, lipid profile and hormone levels. The PCOS women with high ZAG had fewer MetS, IGT and polycystic ovaries as compared with the low ZAG PCOS women. Taken together, circulating ZAG levels are reduced in women with PCOS and ZAG may be a cytokine associated with insulin resistance in PCOS women. PMID:27180914

  5. Circulating irisin levels are positively associated with metabolic risk factors in sedentary subjects.

    Directory of Open Access Journals (Sweden)

    María Moreno

    Full Text Available A physically active life-style plays an independent role in the protection against type 2 diabetes and cardiovascular diseases. Irisin, a novel exercise-induced myokine, activates thermogenesis in rodents through increasing beige fat cells abundance within white fat. We aimed to investigate circulating irisin levels in association with the degree of physical activity and various metabolic parameters in humans.Circulating irisin levels (ELISA and metabolic parameters were analyzed in 428 subjects (195 men/233 women. Participants were classified according to their self-reported physical activity and to their area of residence.Circulating irisin levels were higher in active than in sedentary subjects (p = 0.006. Rural inhabitants showed higher circulating irisin levels than urban subjects (p < 0.0001. The increase in irisin levels related to an active lifestyle was only observed in rural citizens (p = 0.014. Among sedentary participants, irisin levels were positively associated with metabolic risk factors (BMI, fasting insulin, HOMA and fasting triglycerides. The area of residence (β = - 0.592, p = < 0.0001 contributed independently to circulating irisin levels variance after controlling for age, gender, BMI, HOMAIR, triglycerides and physical activity.In sedentary participants, circulating irisin levels were positively associated with parameters related to an increased cardiometabolic risk. The present study confirmed that an active lifestyle increases circulating irisin levels, but only among subjects living in a rural environment. Area of residence might be a determinant of irisin levels.

  6. Circulating leptin and thyroid dysfunction

    DEFF Research Database (Denmark)

    Zimmermann-Belsing, Tina; Brabant, Georg; Holst, Jens Juul

    2003-01-01

    and triiodothyronine are involved in the starvation-induced decrease in thermogenesis. Both rodent and human studies of leptin have failed to show any consistent relationship between thyroid function and serum leptin concentrations. However, leptin might have an important role in thyroid pathophysiology due to thyroid...

  7. The aryl hydrocarbon receptor and estrogen receptor alpha differentially modulate nuclear factor erythroid-2-related factor 2 transactivation in MCF-7 breast cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Lo, Raymond; Matthews, Jason, E-mail: jason.matthews@utoronto.ca

    2013-07-15

    Nuclear factor erythroid-2-related factor 2 (NRF2; NFE2L2) plays an important role in mediating cellular protection against reactive oxygen species. NRF2 signaling is positively modulated by the aryl hydrocarbon receptor (AHR) but inhibited by estrogen receptor alpha (ERα). In this study we investigated the crosstalk among NRF2, AHR and ERα in MCF-7 breast cancer cells treated with the NRF2 activator sulforaphane (SFN), a dual AHR and ERα activator, 3,3′-diindolylmethane (DIM), 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) or 17β-estradiol (E2). SFN-dependent increases in NADPH-dependent oxidoreductase 1 (NQO1) and heme oxygenase I (HMOX1) mRNA levels were significantly reduced after co-treatment with E2. E2-dependent repression of NQO1 and HMOX1 was associated with increased ERα but reduced p300 recruitment and reduced histone H3 acetylation at both genes. In contrast, DIM + SFN or TCDD + SFN induced NQO1 and HMOX1 mRNA expression to levels higher than SFN alone, which was prevented by RNAi-mediated knockdown of AHR. DIM + SFN but not TCDD + SFN also induced recruitment of ERα to NQO1 and HMOX1. However, the presence of AHR at NQO1 and HMOX1 restored p300 recruitment and histone H3 acetylation, thereby reversing the ERα-dependent repression of NRF2. Taken together, our study provides further evidence of functional interplay among NRF2, AHR and ERα signaling pathways through altered p300 recruitment to NRF2-regulated target genes. - Highlights: • We examined crosstalk among ERα, AHR, and NRF2 in MCF-7 breast cancer cells. • AHR enhanced the mRNA expression levels of two NRF2 target genes – HMOX1 and NQO1. • ERα repressed HMOX1 and NQO1 expression via decreased histone acetylation. • AHR prevented ERα-dependent repression of HMOX1 and NQO1.

  8. The nuclear factor-erythroid 2-related factor/heme oxygenase-1 axis is critical for the inflammatory features of type 2 diabetes-associated osteoarthritis.

    Science.gov (United States)

    Vaamonde-Garcia, Carlos; Courties, Alice; Pigenet, Audrey; Laiguillon, Marie-Charlotte; Sautet, Alain; Houard, Xavier; Kerdine-Römer, Saadia; Meijide, Rosa; Berenbaum, Francis; Sellam, Jérémie

    2017-09-01

    Epidemiological findings support the hypothesis that type 2 diabetes mellitus (T2DM) is a risk factor for osteoarthritis (OA). Moreover, OA cartilage from patients with T2DM exhibits a greater response to inflammatory stress, but the molecular mechanism is unclear. To investigate whether the antioxidant defense system participates in this response, we examined here the expression of nuclear factor-erythroid 2-related factor (Nrf-2), a master antioxidant transcription factor, and of heme oxygenase-1 (HO-1), one of its main target genes, in OA cartilage from T2DM and non-T2DM patients as well as in murine chondrocytes exposed to high glucose (HG). Ex vivo experiments indicated that Nrf-2 and HO-1 expression is reduced in T2DM versus non-T2DM OA cartilage (0.57-fold Nrf-2 and 0.34-fold HO-1), and prostaglandin E 2 (PGE 2 ) release was increased in samples with low HO-1 expression. HG-exposed, IL-1β-stimulated chondrocytes had lower Nrf-2 levels in vitro , particularly in the nuclear fraction, than chondrocytes exposed to normal glucose (NG). Accordingly, HO-1 levels were also decreased (0.49-fold) in these cells. The HO-1 inducer cobalt protoporphyrin IX more efficiently attenuated PGE 2 and IL-6 release in HG+IL-1β-treated cells than in NG+IL-1β-treated cells. Greater reductions in HO-1 expression and increase in PGE 2 /IL-6 production were observed in HG+IL-1β-stimulated chondrocytes from Nrf-2 -/- mice than in chondrocytes from wild-type mice. We conclude that the Nrf-2/HO-1 axis is a critical pathway in the hyperglucidic-mediated dysregulation of chondrocytes. Impairments in this antioxidant system may explain the greater inflammatory responsiveness of OA cartilage from T2DM patients and may inform treatments of such patients. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  9. The aryl hydrocarbon receptor and estrogen receptor alpha differentially modulate nuclear factor erythroid-2-related factor 2 transactivation in MCF-7 breast cancer cells

    International Nuclear Information System (INIS)

    Lo, Raymond; Matthews, Jason

    2013-01-01

    Nuclear factor erythroid-2-related factor 2 (NRF2; NFE2L2) plays an important role in mediating cellular protection against reactive oxygen species. NRF2 signaling is positively modulated by the aryl hydrocarbon receptor (AHR) but inhibited by estrogen receptor alpha (ERα). In this study we investigated the crosstalk among NRF2, AHR and ERα in MCF-7 breast cancer cells treated with the NRF2 activator sulforaphane (SFN), a dual AHR and ERα activator, 3,3′-diindolylmethane (DIM), 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) or 17β-estradiol (E2). SFN-dependent increases in NADPH-dependent oxidoreductase 1 (NQO1) and heme oxygenase I (HMOX1) mRNA levels were significantly reduced after co-treatment with E2. E2-dependent repression of NQO1 and HMOX1 was associated with increased ERα but reduced p300 recruitment and reduced histone H3 acetylation at both genes. In contrast, DIM + SFN or TCDD + SFN induced NQO1 and HMOX1 mRNA expression to levels higher than SFN alone, which was prevented by RNAi-mediated knockdown of AHR. DIM + SFN but not TCDD + SFN also induced recruitment of ERα to NQO1 and HMOX1. However, the presence of AHR at NQO1 and HMOX1 restored p300 recruitment and histone H3 acetylation, thereby reversing the ERα-dependent repression of NRF2. Taken together, our study provides further evidence of functional interplay among NRF2, AHR and ERα signaling pathways through altered p300 recruitment to NRF2-regulated target genes. - Highlights: • We examined crosstalk among ERα, AHR, and NRF2 in MCF-7 breast cancer cells. • AHR enhanced the mRNA expression levels of two NRF2 target genes – HMOX1 and NQO1. • ERα repressed HMOX1 and NQO1 expression via decreased histone acetylation. • AHR prevented ERα-dependent repression of HMOX1 and NQO1.

  10. Pleiotrophin levels are associated with improved coronary collateral circulation.

    Science.gov (United States)

    Türker Duyuler, Pinar; Duyuler, Serkan; Gök, Murat; Kundi, Harun; Topçuoğlu, Canan; Güray, Ümit

    2018-01-01

    Elucidation of the underlying mechanisms of angiogenesis and arteriogenesis in coronary collateral formation is necessary for new therapies. Pleiotrophin is a secreted multifunctional cytokine and associated with the formation of functional cardiovascular neovascularization in a series of experimental animal models. We aimed to evaluate the serum levels of pleiotrophin in patients with chronic total coronary artery occlusion and poor or good collateral development. We included 88 consecutive patients (mean age of the entire population: 63.7±12.1 years, 68 male patients) with stable angina pectoris who underwent coronary angiography and had chronic total occlusion in at least one major coronary artery. Collateral grading was performed according to the Rentrop classification. After grading, patients were divided into poor collateral circulation (Rentrop grade 0 and 1) and good collateral circulation (Rentrop grades 2 and 3) groups. Serum pleiotrophin levels were measured using a commercial human ELISA kit. Fifty-eight patients had good and 30 patients had poor coronary collaterals. The good collateral group had higher serum pleiotrophin levels than the poor collateral group (690.1±187.9 vs. 415.3±165.9 ng/ml, Pcollateral development (odds ratio: 1.007; confidence interval: 1.003-1.012; P=0.002). This study showed that increased serum pleiotrophin levels are associated with better developed coronary collateral circulation. Further studies are needed to better understand the relationship.

  11. Circulating microRNAs as Potential Biomarkers of Infectious Disease

    Science.gov (United States)

    Correia, Carolina N.; Nalpas, Nicolas C.; McLoughlin, Kirsten E.; Browne, John A.; Gordon, Stephen V.; MacHugh, David E.; Shaughnessy, Ronan G.

    2017-01-01

    microRNAs (miRNAs) are a class of small non-coding endogenous RNA molecules that regulate a wide range of biological processes by post-transcriptionally regulating gene expression. Thousands of these molecules have been discovered to date, and multiple miRNAs have been shown to coordinately fine-tune cellular processes key to organismal development, homeostasis, neurobiology, immunobiology, and control of infection. The fundamental regulatory role of miRNAs in a variety of biological processes suggests that differential expression of these transcripts may be exploited as a novel source of molecular biomarkers for many different disease pathologies or abnormalities. This has been emphasized by the recent discovery of remarkably stable miRNAs in mammalian biofluids, which may originate from intracellular processes elsewhere in the body. The potential of circulating miRNAs as biomarkers of disease has mainly been demonstrated for various types of cancer. More recently, however, attention has focused on the use of circulating miRNAs as diagnostic/prognostic biomarkers of infectious disease; for example, human tuberculosis caused by infection with Mycobacterium tuberculosis, sepsis caused by multiple infectious agents, and viral hepatitis. Here, we review these developments and discuss prospects and challenges for translating circulating miRNA into novel diagnostics for infectious disease. PMID:28261201

  12. [Circulating endothelial cells: biomarkers for monitoring activity of antiangiogenic therapy].

    Science.gov (United States)

    Farace, Françoise; Bidart, Jean-Michel

    2007-07-01

    Tumor vessel formation is largely dependent on the recruitment of endothelial cells. Rare in healthy individuals, circulating endothelial cells (CEC) are shed from vessel walls and enter the circulation reflecting endothelial damage or dysfunction. Increased numbers of CEC have been documented in different types of cancer. Recent studies have suggested the role for CEC in tumor angiogenesis, but whose presence could also reflect normal endothelium perturbation in cancer. Originating from the bone marrow rather than from vessel walls, endothelial progenitor cells (EPC) are mobilized following tissue ischemia and may be recruited to complement local angiogenesis supplied by existing endothelium. Recently, studies in mouse models suggest that the circulating fraction of endothelial progenitors (CEP) is involved in tumor angiogenesis but their contribution is less clear in humans. The detection of CEC and CEP is difficult and impeded by the rarity of these cells. They may have important clinical implication as novel biomarkers susceptible to predict more efficiently and rapidly the therapeutic response to anti-angiogenic treatments. However, a methodological consensus would be necessary in order to correctly evaluate the clinical interest of CEC and CEP in patients.

  13. Seawater circulating system in an aquaculture laboratory

    Digital Repository Service at National Institute of Oceanography (India)

    Chatterji, A.; Ingole, B.S.; Parulekar, A.H.

    The note gives an account, for the first time in India, of an Aquaculture Laboratory with open type seawater circulating system developed at the National Institute of Oceanography, Goa, India. Besides describing the details of the system...

  14. EOP MIT General Circulation Model (MITgcm)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This data contains a regional implementation of the Massachusetts Institute of Technology general circulation model (MITgcm) at a 1-km spatial resolution for the...

  15. Seasonal Overturning Circulation in the Red Sea

    Science.gov (United States)

    Yao, F.; Hoteit, I.; Koehl, A.

    2010-12-01

    The Red Sea exhibits a distinct seasonal overturning circulation. In winter, a typical two-layer exchange structure, with a fresher inflow from the Gulf of Aden on top of an outflow from the Red Sea, is established. In summer months (June to September) this circulation pattern is changed to a three-layer structure: a surface outflow from the Red Sea on top of a subsurface intrusion of the Gulf of Aden Intermediate Water and a weakened deep outflow. This seasonal variability is studied using a general circulation model, MITgcm, with 6 hourly NCEP atmospheric forcing. The model is able to reproduce the observed seasonal variability very well. The forcing mechanisms of the seasonal variability related to seasonal surface wind stress and buoyancy flux, and water mass transformation processes associated with the seasonal overturning circulation are analyzed and presented.

  16. Blocking device especially for circulating pumps

    International Nuclear Information System (INIS)

    Susil, J.; Vychodil, V.; Lorenc, P.

    1976-01-01

    The claim of the invention is a blocking device which blocks reverse flow occurring after the shutdown of circulating pumps, namely in the operation of nuclear power plants or in pumps with a high delivery head. (F.M.)

  17. Estuarine turbidity, flushing, salinity, and circulation

    Science.gov (United States)

    Pritchard, D. W.

    1972-01-01

    The effects of estuarine turbidity, flushing, salinity, and circulation on the ecology of the Chesapeake Bay are discussed. The sources of fresh water, the variations in salinity, and the circulation patterns created by temperature and salinity changes are analyzed. The application of remote sensors for long term observation of water temperatures is described. The sources of sediment and the biological effects resulting from increased sediments and siltation are identified.

  18. [Circulating tumor cells: cornerstone of personalized medicine].

    Science.gov (United States)

    Rafii, A; Vidal, F; Rathat, G; Alix-Panabières, C

    2014-11-01

    Cancer treatment has evolved toward personalized medicine. It is mandatory for clinicians to ascertain tumor biological features in order to optimize patients' treatment. Identification and characterization of circulating tumor cells demonstrated a prognostic value in many solid tumors. Here, we describe the main technologies for identification and characterization of circulating tumor cells and their clinical application in gynecologic and breast cancers. Copyright © 2014. Published by Elsevier Masson SAS.

  19. Themes on circulation in the third world.

    Science.gov (United States)

    Chapman, M; Prothero, R M

    1983-01-01

    "This article focuses upon circulation, or reciprocal flows of people, with specific reference to Third World societies." Aspects considered include attempts to standardize terminology and to formulate typologies of population movement; the development of explanatory models of circulation and modernization, social networks, family welfare, and capitalism; and "the transfer of methods and concepts to societies and populations different from those from which they initially evolved and in which they were first tested." excerpt

  20. Surgical myocardial revascularization without extracorporeal circulation

    Directory of Open Access Journals (Sweden)

    Salomón Soriano Ordinola Rojas

    2003-05-01

    Full Text Available OBJECTIVE: To assess the immediate postoperative period of patients undergoing myocardial revascularization without extracorporeal circulation with different types of grafts. METHODS: One hundred and twelve patients, 89 (79.5% of whom were males, were revascularized without extracorporeal circulation. Their ages ranged from 39 to 85 years. The criteria for indicating myocardial revascularization without extracorporeal circulation were as follows: revascularized coronary artery caliber > 1.5 mm, lack of intramyocardial trajectory on coronary angiography, noncalcified coronary arteries, and tolerance of the heart to the different rotation maneuvers. RESULTS: Myocardial revascularization without extracorporeal circulation was performed in 112 patients. Three were converted to extracorporeal circulation, which required a longer hospital stay but did not impact mortality. During the procedure, the following events were observed: atrial fibrillation in 10 patients, ventricular fibrillation in 4, total transient atrioventricular block in 2, ventricular extrasystoles in 58, use of a device to retrieve red blood cells in 53, blood transfusion in 8, and arterial hypotension in 89 patients. Coronary angiography was performed in 20 patients on the seventh postoperative day when the grafts were patent. CONCLUSION: Myocardial revascularization without extracorporeal circulation is a reproducible technique that is an alternative for treating ischemic heart disease.

  1. Circulating microRNA Profile throughout the menstrual cycle.

    Directory of Open Access Journals (Sweden)

    Kadri Rekker

    Full Text Available Normal physiological variables, such as age and gender, contribute to alterations in circulating microRNA (miRNA expression levels. The changes in the female body during the menstrual cycle can also be reflected in plasma miRNA expression levels. Therefore, this study aimed to determine the plasma miRNA profile of healthy women during the menstrual cycle and to assess which circulating miRNAs are derived from blood cells. The plasma miRNA expression profiles in nine healthy women were determined by quantitative real time PCR using Exiqon Human Panel I assays from four time-points of the menstrual cycle. This platform was also used for studying miRNAs from pooled whole blood RNA samples at the same four time-points. Our results indicated that circulating miRNA expression levels in healthy women were not significantly altered by the processes occurring during the menstrual cycle. No significant differences in plasma miRNA expression levels were observed between the menstrual cycle time-points, but the number of detected miRNAs showed considerable variation among the studied individuals. miRNA analysis from whole blood samples revealed that majority of miRNAs in plasma are derived from blood cells. The most abundant miRNA in plasma and blood was hsa-miR-451a, but a number of miRNAs were only detected in one or the other sample type. In conclusion, our data suggest that the changes in the female body during the menstrual cycle do not affect the expression of circulating miRNAs at measurable levels.

  2. Hypoxia, leukocytes, and the pulmonary circulation.

    Science.gov (United States)

    Stenmark, Kurt R; Davie, Neil J; Reeves, John T; Frid, Maria G

    2005-02-01

    Data are rapidly accumulating in support of the idea that circulating monocytes and/or mononuclear fibrocytes are recruited to the pulmonary circulation of chronically hypoxic animals and that these cells play an important role in the pulmonary hypertensive process. Hypoxic induction of monocyte chemoattractant protein-1, stromal cell-derived factor-1, vascular endothelial growth factor-A, endothelin-1, and tumor growth factor-beta(1) in pulmonary vessel wall cells, either directly or indirectly via signals from hypoxic lung epithelial cells, may be a critical first step in the recruitment of circulating leukocytes to the pulmonary circulation. In addition, hypoxic stress appears to induce release of increased numbers of monocytic progenitor cells from the bone marrow, and these cells may have upregulated expression of receptors for the chemokines produced by the lung circulation, which thus facilitates their specific recruitment to the pulmonary site. Once present, macrophages/fibrocytes may exert paracrine effects on resident pulmonary vessel wall cells stimulating proliferation, phenotypic modulation, and migration of resident fibroblasts and smooth muscle cells. They may also contribute directly to the remodeling process through increased production of collagen and/or differentiation into myofibroblasts. In addition, they could play a critical role in initiating and/or supporting neovascularization of the pulmonary artery vasa vasorum. The expanded vasa network may then act as a conduit for further delivery of circulating mononuclear cells to the pulmonary arterial wall, creating a feedforward loop of pathological remodeling. Future studies will need to determine the mechanisms that selectively induce leukocyte/fibrocyte recruitment to the lung circulation under hypoxic conditions, their direct role in the remodeling process via production of extracellular matrix and/or differentiation into myofibroblasts, their impact on the phenotype of resident smooth muscle

  3. Gemfibrozil disrupts the metabolism of circulating lipids in bobwhite quails.

    Science.gov (United States)

    Bussière-Côté, Sophie; Omlin, Teye; de Càssia Pinheiro, Eliana; Weber, Jean-Michel

    2016-01-01

    The circulating lipids of birds play essential roles for egg production and as an energy source for flight and thermogenesis. How lipid-lowering pharmaceuticals geared to prevent heart disease in humans and that are routinely released in the environment affect their metabolism is unknown. This study assesses the impact of the popular drug gemfibrozil (GEM) on the plasma phospholipids (PL), neutral lipids (NL), and nonesterified fatty acids (NEFA) of bobwhite quails (Colinus virginianus). Results show that bird lipoproteins are rapidly altered by GEM, even at environmentally-relevant doses. After 4 days of exposure, pharmacological amounts cause an 83% increase in circulating PL levels, a major decrease in average lipoprotein size measured as a 56% drop in the NL/PL ratio, and important changes in the fatty acid composition of PL and NEFA (increases in fatty acid unsaturation). The levels of PL carrying all individual fatty acids except arachidonate are strongly stimulated. The large decrease in bird lipoprotein size may reflect the effects seen in humans: lowering of LDL that can cause atherosclerosis and stimulation of HDL that promote cholesterol disposal. Lower (environmental) doses of GEM cause a reduction of %palmitate in all the plasma lipid fractions of quails, but particularly in the core triacylglycerol of lipoproteins (NL). No changes in mRNA levels of bird peroxisome proliferator-activated receptor (PPAR) could be demonstrated. The disrupting effects of GEM on circulating lipids reported here suggest that the pervasive presence of this drug in the environment could jeopardize reproduction and migratory behaviours in wild birds. Copyright © 2015 Elsevier Inc. All rights reserved.

  4. Circulating water pumps for nuclear power stations

    International Nuclear Information System (INIS)

    Satoh, Hiroshi; Ohmori, Tsuneaki

    1979-01-01

    Shortly, the nuclear power station with unit power output of 1100 MW will begin the operation, and the circulating water pumps manufactured recently are those of 2.4 to 4 m bore, 840 to 2170 m 3 /min discharge and 2100 to 5100 kW driving power. The circulating water pumps are one of important auxiliary machines, because if they fail, power generation capacity lowers immediately. Enormous quantity of cooling water is required to cool condensers, therefore in Japan, sea water is usually used. As siphon is formed in circulating water pipes, the total head of the pumps is not very high. The discharge of the pumps is determined so as to keep the temperature rise of discharged water lower than 7 deg. C. The quantity of cooling water for nuclear power generation is about 50% more as compared with thermal power generation because of the difference in steam conditions. The total head of the pumps is normally from 8 to 15 m. The circulating water pumps rarely stop after they started the operation, therefore it is economical to determine the motor power so that it can withstand 10% overload for a short period, instead of large power. At present, vertical shaft, oblique flow circulating water pumps are usually employed. Recently, movable blade pumps are adopted. The installation, construction and materials of the pumps and the problems are described. (Kako, I.)

  5. Cascade of circulations in fluid turbulence.

    Science.gov (United States)

    Eyink, Gregory L

    2006-12-01

    Kelvin's theorem on conservation of circulations is an essential ingredient of Taylor's theory of turbulent energy dissipation by the process of vortex-line stretching. In previous work, we have proposed a nonlinear mechanism for the breakdown of Kelvin's theorem in ideal turbulence at infinite Reynolds number. We develop here a detailed physical theory of this cascade of circulations. Our analysis is based upon an effective equation for large-scale coarse-grained velocity, which contains a turbulent-induced vortex force that can violate Kelvin's theorem. We show that singularities of sufficient strength, which are observed to exist in turbulent flow, can lead to nonvanishing dissipation of circulation for an arbitrarily small coarse-graining length in the effective equations. This result is an analog for circulation of Onsager's theorem on energy dissipation for singular Euler solutions. The physical mechanism of the breakdown of Kelvin's theorem is diffusion of lines of large-scale vorticity out of the advected loop. This phenomenon can be viewed as a classical analog of the Josephson-Anderson phase-slip phenomenon in superfluids due to quantized vortex lines. We show that the circulation cascade is local in scale and use this locality to develop concrete expressions for the turbulent vortex force by a multiscale gradient expansion. We discuss implications for Taylor's theory of turbulent dissipation and we point out some related cascade phenomena, in particular for magnetic flux in magnetohydrodynamic turbulence.

  6. Circulation as Assessment: Collection Development Policies Evaluated in Terms of Circulation at a Small Academic Library.

    Science.gov (United States)

    Dinkins, Debbi

    2003-01-01

    Discusses the use of academic library circulation statistics to assess whether user needs are being met and describes a study at Stetson University that investigated collection development practices by comparing circulation statistics for books selected by faculty in support of departmental curricula with those of librarian selections. (Author/LRW)

  7. Lower peripheral circulation in eumenorrheic young women with premenstrual symptoms

    Directory of Open Access Journals (Sweden)

    Tatsumi Noriyuki

    2007-03-01

    Full Text Available Abstract Background A majority of women from all cultures and socioeconomic levels experience diverse psychosomatic and behavioral symptoms premenstrually, a phenomenon commonly termed premenstrual syndrome, although symptoms and discomfort levels vary from woman to woman. The underlying pathological mechanisms of premenstrual syndrome remain unknown; however, altered function or even slight disorder of the blood circulation system, which contributes to the orchestrations of the human internal environment, could cause bio-psychological changes leading to complaints and ultimately compromising a woman's overall health. The present study, therefore, investigates to what extent and how the menstrual cyclicity of peripheral circulation is associated with premenstrual symptomatology. Methods Twenty-one eumenorrheic young women participated in this study. All subjects were investigated during the follicular and late luteal phases. Cycle phase was determined by the onset of menstruation and oral temperature and was verified by concentrations of ovarian hormones, estrone, and pregnanediol in a urine sample taken early in the morning. Peripheral circulation was evaluated with the Astrim (Sysmex, Kobe, a portable non-invasive monitoring device using the principle of near-infrared spectroscopy, which calculates the venous oxygenation index (VOI based on the ratio of light absorption of oxyhemoglobin and deoxyhemoglobin, a proven reliable indicator of peripheral blood circulation. The Menstrual Distress Questionnaire was applied to measure physical, emotional, and behavioral symptoms accompanying the menstrual cycle of the subjects. Results The oral temperature and urinary ovarian hormones adjusted for creatinine significantly increased in the late luteal phase in all subjects. While 10 subjects experienced no symptoms during the menstrual cycle, 11 subjects had apparent physical and psychological discomfort in the late luteal phase. We found that VOI

  8. Nuclear factor erythroid 2-related factor 2 antioxidant response element pathways protect bovine mammary epithelial cells against H2O2-induced oxidative damage in vitro.

    Science.gov (United States)

    Ma, Y F; Wu, Z H; Gao, M; Loor, J J

    2018-03-21

    The experiment was conducted to determine the role of nuclear factor (erythroid-derived 2)-like factor 2 (NFE2L2, formerly Nrf2) antioxidant response element (ARE) pathway in protecting bovine mammary epithelial cells (BMEC) against H 2 O 2 -induced oxidative stress injury. An NFE2L2 small interfering RNA (siRNA) interference or a pCMV6-XL5-NFE2L2 plasmid fragment was transfected to independently downregulate or upregulate expression of NFE2L2. Isolated BMEC in triplicate were exposed to H 2 O 2 (600 μM) for 6 h to induce oxidative stress before transient transfection with scrambled siRNA, NFE2L2-siRNA, pCMV6-XL5, and pCMV6-XL5-NFE2L2. Cell proliferation, apoptosis and necrosis rates, antioxidant enzyme activities, reactive oxygen species (ROS) and malondialdehyde (MDA) production, protein and mRNA expression of NFE2L2 and downstream target genes, and fluorescence activity of ARE were measured. The results revealed that compared with the control, BMEC transfected with NFE2L2-siRNA3 had proliferation rates that were 9 or 65% lower without or with H 2 O 2 , respectively. These cells also had apoptosis and necrosis rates that were 27 and 3.5 times greater with H 2 O 2 compared with the control group, respectively. In contrast, transfected pCMV6-XL5-NFE2L2 had proliferation rates that were 64.3% greater or 17% lower without or with H 2 O 2 compared with the control group, respectively. Apoptosis rates were 1.8 times lower with H 2 O 2 compared with the control. In addition, compared with the control, production of ROS and MDA and activities of superoxide dismutase (SOD), glutathione peroxidase (GSH-Px), catalase (CAT), and glutathione-S-transferase (GST) increased markedly in cells transfected with pCMV6-XL5-NFE2L2 and without H 2 O 2 . However, compared with the control, production of ROS and MDA and activity of CAT and GSH-Px increased markedly, whereas activities of SOD and GST decreased in cells transfected with pCMV6-XL5-NFE2L2 and incubated with H 2 O 2

  9. Circulating DNA and its methylation level in inflammatory bowel disease and related colon cancer.

    Science.gov (United States)

    Bai, Xuming; Zhu, Yaqun; Pu, Wangyang; Xiao, Li; Li, Kai; Xing, Chungen; Jin, Yong

    2015-01-01

    Both of chronic inflammation and abnormal immune in inflammatory bowel disease can induce colon cancer. Previous research showed that cell apoptosis and necrosis become the main source of circulating DNA in the peripheral blood during tumorigenesis that reduced along with methylation degree. However, its role in the process of colitis transforming to colon cancer is not clarified. Drinking 3% DSS was used to establish colitis model, while 3% dextran sodium sulfate (DSS) combined with azo oxidation methane (AOM) intraperitoneal injection was applied to establish colitis related colon cancer model. Circulating DNA and its methylation level in peripheral blood were tested. Morphology observation, HE staining, and p53 and β-catenin expression detection confirmed that drinking 3% DSS and 3% DSS combined with AOM intraperitoneal injection can successfully establish colitis and colitis associated colorectal cancer models. Circulating DNA level in colitis and colon cancer mice increased by gradient compared with control, while significant difference was observed between each other. Circulating DNA methylation level decreased obviously in colitis and colon cancer, and significant difference was observed between each other. Abnormal protein expression, circulating DNA and its methylation level in ulcerative colitis associated colorectal tissues change in gradient, suggesting that circulating DNA and its methylation level can be treated as new markers for colitis cancer transformation that has certain significance to explore the mechanism of human ulcerative colitis canceration.

  10. Circulating irisin levels are positively associated with metabolic risk factors in sedentary subjects.

    Science.gov (United States)

    Moreno, María; Moreno-Navarrete, José María; Serrano, Marta; Ortega, Francisco; Delgado, Elías; Sanchez-Ragnarsson, Cecilia; Valdés, Sergio; Botas, Patricia; Ricart, Wifredo; Fernández-Real, José Manuel

    2015-01-01

    A physically active life-style plays an independent role in the protection against type 2 diabetes and cardiovascular diseases. Irisin, a novel exercise-induced myokine, activates thermogenesis in rodents through increasing beige fat cells abundance within white fat. We aimed to investigate circulating irisin levels in association with the degree of physical activity and various metabolic parameters in humans. Circulating irisin levels (ELISA) and metabolic parameters were analyzed in 428 subjects (195 men/233 women). Participants were classified according to their self-reported physical activity and to their area of residence. Circulating irisin levels were higher in active than in sedentary subjects (p = 0.006). Rural inhabitants showed higher circulating irisin levels than urban subjects (p sedentary participants, irisin levels were positively associated with metabolic risk factors (BMI, fasting insulin, HOMA and fasting triglycerides). The area of residence (β = - 0.592, p = sedentary participants, circulating irisin levels were positively associated with parameters related to an increased cardiometabolic risk. The present study confirmed that an active lifestyle increases circulating irisin levels, but only among subjects living in a rural environment. Area of residence might be a determinant of irisin levels.

  11. Subarachnoid Hemorrhage Severely Impairs Brain Parenchymal Cerebrospinal Fluid Circulation in Nonhuman Primate.

    Science.gov (United States)

    Goulay, Romain; Flament, Julien; Gauberti, Maxime; Naveau, Michael; Pasquet, Nolwenn; Gakuba, Clement; Emery, Evelyne; Hantraye, Philippe; Vivien, Denis; Aron-Badin, Romina; Gaberel, Thomas

    2017-08-01

    Subarachnoid hemorrhage (SAH) is a devastating form of stroke with neurological outcomes dependent on the occurrence of delayed cerebral ischemia. It has been shown in rodents that some of the mechanisms leading to delayed cerebral ischemia are related to a decreased circulation of the cerebrospinal fluid (CSF) within the brain parenchyma. Here, we evaluated the cerebral circulation of the CSF in a nonhuman primate in physiological condition and after SAH. We first evaluated in physiological condition the circulation of the brain CSF in Macaca facicularis , using magnetic resonance imaging of the temporal DOTA-Gd distribution after its injection into the CSF. Then, animals were subjected to a minimally invasive SAH before an MRI evaluation of the impact of SAH on the brain parenchymal CSF circulation. We first demonstrate that the CSF actively penetrates the brain parenchyma. Two hours after injection, almost the entire brain is labeled by DOTA-Gd. We also show that our model of SAH in nonhuman primate displays the characteristics of SAH in humans and leads to a dramatic impairment of the brain parenchymal circulation of the CSF. The CSF actively penetrates within the brain parenchyma in the gyrencephalic brain, as described for the glymphatic system in rodent. This parenchymal CSF circulation is severely impaired by SAH. © 2017 American Heart Association, Inc.

  12. Experimental study of the natural circulation phenomena

    International Nuclear Information System (INIS)

    Sabundjian, Gaiane; Andrade, Delvonei Alves de; Umbehaun, Pedro E.; Torres, Walmir M.; Castro, Alfredo Jose Alvim de; Belchior Junior, Antonio; Rocha, Ricardo Takeshi Vieira da; Damy, Osvaldo Luiz de Almeida; Torres, Eduardo

    2006-01-01

    The objective of this paper is to study the natural circulation in experimental loops and extend the results to nuclear facilities. New generation of compact nuclear power plants use the natural circulation as cooling and residual heat removal systems in case of accidents or shutdown. Lately the interest in this phenomenon, by scientific community, has increased. The experimental loop, described in this paper, was assembled at Escola Politecnica - USP at the Chemical Engineering Department. It is the goal to generate information to help with the understanding of the one and two phase natural circulation phenomena. Some experiments were performed with different levels of heat power and different flow of the cooling water at the secondary circuit. The data generated from these experiments are going to be used to validate some computational thermal hydraulic codes. Experimental results for one and two phase regimes are presented as well as the proposed model to simulate the flow regimes with the RELAP5 code. (author)

  13. Circulating microRNAs in breast cancer

    DEFF Research Database (Denmark)

    Hamam, Rimi; Hamam, Dana; Alsaleh, Khalid A

    2017-01-01

    Effective management of breast cancer depends on early diagnosis and proper monitoring of patients' response to therapy. However, these goals are difficult to achieve because of the lack of sensitive and specific biomarkers for early detection and for disease monitoring. Accumulating evidence in ...... circulating miRNAs as diagnostic, prognostic or predictive biomarkers in breast cancer management.......Effective management of breast cancer depends on early diagnosis and proper monitoring of patients' response to therapy. However, these goals are difficult to achieve because of the lack of sensitive and specific biomarkers for early detection and for disease monitoring. Accumulating evidence...... in the past several years has highlighted the potential use of peripheral blood circulating nucleic acids such as DNA, mRNA and micro (mi)RNA in breast cancer diagnosis, prognosis and for monitoring response to anticancer therapy. Among these, circulating miRNA is increasingly recognized as a promising...

  14. Adjustable speed drives improve circulating water system

    International Nuclear Information System (INIS)

    Dent, R.A.; Dicic, Z.

    1994-01-01

    This paper illustrates the integration of electrical and mechanical engineering requirements to produce a solution to past problems and future operating demands. The application of adjustable speed drives in the modifications of the circulating water system at Indian Point No. 3 Nuclear Power Plant provided increased operating flexibility, efficiency and avoided otherwise costly renovations to the plant electrical systems. Rectification of the original inadequate design of the circulating water system, in addition to maximizing plant efficiency consistent with environmental considerations, formed the basis for this modification. This entailed replacement of all six circulating water pumps and motors and physical modifications to the intake system. This paper details the methodology used in this engineering task. The new system was installed successfully and has been operating reliably and economically for the past eight years

  15. Natural circulation in a scaled PWR integral test facility

    International Nuclear Information System (INIS)

    Kiang, R.L.; Jeuck, P.R. III

    1987-01-01

    Natural circulation is an important mechanism for cooling a nuclear power plant under abnormal operating conditions. To study natural circulation, we modeled a type of pressurized water reactor (PWR) that incorporates once-through steam generators. We conducted tests of single-phase natural circulations, two-phase natural circulations, and a boiler condenser mode. Because of complex geometry, the natural circulations observed in this facility exhibit some phenomena not commonly seen in a simple thermosyphon loop

  16. Experimental study of natural circulation circuit

    Energy Technology Data Exchange (ETDEWEB)

    Lemos, Wanderley F.; Su, Jian, E-mail: wlemos@lasme.coppe.ufrj.br, E-mail: sujian@lasme.coppe.ufrj.br [Coordenacao dos Programas de Pos-Graduacao de Engenharia (LASME/COPPE/UFRJ), Rio de Janeiro, RJ (Brazil). Lab. de Simulacao e Metodos Numericos; Faccini, Jose L.H., E-mail: faccini@ien.gov.br [Instituto de Engenharia Nuclear (LTE/IEN/CNEN-RJ), Rio de Janeiro, RJ (Brazil). Lab. de Termo-Hidraulica Experimental

    2011-07-01

    This work presents an experimental study about fluid flows behavior in natural circulation, under conditions of single-phase flow. The experiment was performed through experimental thermal-hydraulic circuit built at IEN. This test equipment has performance similar to passive system of residual heat removal present in Advanced Pressurized Water Reactors (APWR). This experimental study aims to observing and analyzing the natural circulation phenomenon, using this experimental circuit that was dimensioned and built based on concepts of similarity and scale. This philosophy allows the analysis of natural circulation behavior in single-phase flow conditions proportionally to the functioning real conditions of a nuclear reactor. The experiment was performed through procedures to initialization of hydraulic feeding of primary and secondary circuits and electrical energizing of resistors installed inside heater. Power controller has availability to adjust values of electrical power to feeding resistors, in order to portray several conditions of energy decay of nuclear reactor in a steady state. Data acquisition system allows the measurement and monitoring of the evolution of the temperature in various points through thermocouples installed in strategic points along hydraulic circuit. The behavior of the natural circulation phenomenon was monitored by graphical interface on computer screen, showing the temperature evolutions of measuring points and results stored in digital spreadsheets. The results stored in digital spreadsheets allowed the getting of data to graphic construction and discussion about natural circulation phenomenon. Finally, the calculus of Reynolds number allowed the establishment for a correlation of friction in function of geometric scales of length, heights and cross section of tubing, considering a natural circulation flow throughout in the region of hot leg. (author)

  17. Fort St. Vrain circulator operating experience

    Energy Technology Data Exchange (ETDEWEB)

    Brey, H. L.

    1988-08-15

    Fort St. Vrain, on the system of Public Service Company of Colorado, is the only high-temperature gas-cooled power reactor in the United States. Four helium circulators are utilized in this plant to transfer heat from the reactor to the steam generators. These unique machines have a single stage axial flow helium compressor driven by a single stage steam turbine. A single stage water driven (pelton wheel) turbine is the back-up drive utilizing either feed water, condensate, or fire water as the driving fluid. Developmental testing of the circulators was accomplished prior to installation into Fort St. Vrain. A combined machine operating history of approximately 250,000 hours has shown these machines to be of conservative design and proven mechanical integrity. However, many problems have been encountered in operating the complex auxiliaries which are necessary for successful circulator and plant operation. It has been 15 years since initial installation of the circulators occurred at Fort St. Vrain. During this time, a number of significant issues had to be resolved dealing specifically with machine performance. These events include cavitation damage of the pelton wheels during the initial plant hot functional testing, cracks in the water turbine buckets and cervic coupling, static shutdown seal bellows failure, and, most recently, degradation of components within the steam drive assembly. Unreliable operation particularly with the circulator auxiliaries has been a focus of attention by Public Service Company of Colorado. Actions to replace or significantly modify the existing circulators and their auxiliaries are currently awaiting decisions concerning the long-term future of the Fort St. Vrain plant. (author). 10 refs, 7 figs, 2 tabs.

  18. Experimental study of natural circulation circuit

    International Nuclear Information System (INIS)

    Lemos, Wanderley F.; Su, Jian; Faccini, Jose L.H.

    2011-01-01

    This work presents an experimental study about fluid flows behavior in natural circulation, under conditions of single-phase flow. The experiment was performed through experimental thermal-hydraulic circuit built at IEN. This test equipment has performance similar to passive system of residual heat removal present in Advanced Pressurized Water Reactors (APWR). This experimental study aims to observing and analyzing the natural circulation phenomenon, using this experimental circuit that was dimensioned and built based on concepts of similarity and scale. This philosophy allows the analysis of natural circulation behavior in single-phase flow conditions proportionally to the functioning real conditions of a nuclear reactor. The experiment was performed through procedures to initialization of hydraulic feeding of primary and secondary circuits and electrical energizing of resistors installed inside heater. Power controller has availability to adjust values of electrical power to feeding resistors, in order to portray several conditions of energy decay of nuclear reactor in a steady state. Data acquisition system allows the measurement and monitoring of the evolution of the temperature in various points through thermocouples installed in strategic points along hydraulic circuit. The behavior of the natural circulation phenomenon was monitored by graphical interface on computer screen, showing the temperature evolutions of measuring points and results stored in digital spreadsheets. The results stored in digital spreadsheets allowed the getting of data to graphic construction and discussion about natural circulation phenomenon. Finally, the calculus of Reynolds number allowed the establishment for a correlation of friction in function of geometric scales of length, heights and cross section of tubing, considering a natural circulation flow throughout in the region of hot leg. (author)

  19. Fort St. Vrain circulator operating experience

    International Nuclear Information System (INIS)

    Brey, H.L.

    1988-01-01

    Fort St. Vrain, on the system of Public Service Company of Colorado, is the only high-temperature gas-cooled power reactor in the United States. Four helium circulators are utilized in this plant to transfer heat from the reactor to the steam generators. These unique machines have a single stage axial flow helium compressor driven by a single stage steam turbine. A single stage water driven (pelton wheel) turbine is the back-up drive utilizing either feed water, condensate, or fire water as the driving fluid. Developmental testing of the circulators was accomplished prior to installation into Fort St. Vrain. A combined machine operating history of approximately 250,000 hours has shown these machines to be of conservative design and proven mechanical integrity. However, many problems have been encountered in operating the complex auxiliaries which are necessary for successful circulator and plant operation. It has been 15 years since initial installation of the circulators occurred at Fort St. Vrain. During this time, a number of significant issues had to be resolved dealing specifically with machine performance. These events include cavitation damage of the pelton wheels during the initial plant hot functional testing, cracks in the water turbine buckets and cervic coupling, static shutdown seal bellows failure, and, most recently, degradation of components within the steam drive assembly. Unreliable operation particularly with the circulator auxiliaries has been a focus of attention by Public Service Company of Colorado. Actions to replace or significantly modify the existing circulators and their auxiliaries are currently awaiting decisions concerning the long-term future of the Fort St. Vrain plant. (author). 10 refs, 7 figs, 2 tabs

  20. Doppler ultrasonography of the human fetal pulmonary circulation

    NARCIS (Netherlands)

    J.A.M. Laudij (Jacqueline)

    2000-01-01

    textabstractPulmonary hypoplasia is a condition characterized by a decrease in the number of lung cells, airways and alveoli with a resulting decrease in organ size and weight. The reported incidence of pulmonary hypoplasia in the general population is about 1 per 1000 live births and it is one of

  1. Light microscope observation of circulating human lymphocytes cultured in vitro

    Directory of Open Access Journals (Sweden)

    Naila Francis Paulo de Oliveira

    2010-10-01

    Full Text Available The purpose of this work was to study the isolation and a light microscopy technique for cultured lymphocytes. Blood samples were obtained by venipuncture with an anticoagulant added and centrifuged in a Percoll density gradient to separate the leukocytes. Lymphocytes were placed in 25 cm ³ tissue culture flasks at 37ºC. After culturing, they were fixed and stained with the methods used for blood smears. Results showed that not all fixing solutions and stains were an equally good choice for cultured lymphocytes.Os linfócitos são células importantes do sistema imune e têm sido largamente utilizados em estudos morfológicos. Entretanto, a literatura sobre técnicas de preparação dessas células é escassa e antiga, especialmente para linfócitos cultivados in vitro. Portanto, o objetivo desse estudo foi relatar com detalhes as técnicas de isolamento e microscopia de luz de linfócitos mantidos em cultura. Amostras de sangue foram obtidas por punção venosa e centrifugadas em gradiente de densidade de Percoll, para separar os leucócitos. Os linfócitos foram mantidos em frascos de cultura de 25 cm³ a 37ºC. Após a cultura, as células foram fixadas e coradas de acordo com a metodologia utilizada para esfregaços sanguíneos. Nossos resultados mostraram que nem todos os fixadores e corantes utilizados para esfregaços sanguíneos são uma boa escolha para linfócitos cultivados in vitro.

  2. Circulating Red Cell–derived Microparticles in Human Malaria

    Science.gov (United States)

    Nantakomol, Duangdao; Dondorp, Arjen M.; Krudsood, Srivicha; Udomsangpetch, Rachanee; Pattanapanyasat, Kovit; Combes, Valery; Grau, Georges E.; White, Nicholas J.; Viriyavejakul, Parnpen; Day, Nicholas P.J.

    2011-01-01

    In patients with falciparum malaria, plasma concentrations of cell-derived microparticles correlate with disease severity. Using flow cytometry, we quantified red blood cell–derived microparticles (RMPs) in patients with malaria and identified the source and the factors associated with production. RMP concentrations were increased in patients with Plasmodium falciparum (n = 29; median, 457 RMPs/μL [range, 13–4,342 RMPs/μL]), Plasmodium vivax (n = 5; median, 409 RMPs/μL [range, 281–503/μL]), and Plasmodium malariae (n = 2; median, 163 RMPs/μL [range, 127–200 RMPs/μL]) compared with those in healthy subjects (n = 11; median, 8 RMPs/μL [range, 3–166 RMPs/μL]; P = .01). RMP concentrations were highest in patients with severe falciparum malaria (P = .01). Parasitized red cells produced >10 times more RMPs than did unparasitized cells, but the overall majority of RMPs still derived from uninfected red blood cells (URBCs). In cultures, RMP production increased as the parasites matured. Hemin and parasite products induced RMP production in URBCs, which was inhibited by N-acetylcysteine, suggesting heme-mediated oxidative stress as a pathway for the generation of RMPs. PMID:21282195

  3. Circulating red cell-derived microparticles in human malaria.

    Science.gov (United States)

    Nantakomol, Duangdao; Dondorp, Arjen M; Krudsood, Srivicha; Udomsangpetch, Rachanee; Pattanapanyasat, Kovit; Combes, Valery; Grau, Georges E; White, Nicholas J; Viriyavejakul, Parnpen; Day, Nicholas P J; Chotivanich, Kesinee

    2011-03-01

    In patients with falciparum malaria, plasma concentrations of cell-derived microparticles correlate with disease severity. Using flow cytometry, we quantified red blood cell-derived microparticles (RMPs) in patients with malaria and identified the source and the factors associated with production. RMP concentrations were increased in patients with Plasmodium falciparum (n = 29; median, 457 RMPs/μL [range, 13-4,342 RMPs/μL]), Plasmodium vivax (n = 5; median, 409 RMPs/μL [range, 281-503/μL]), and Plasmodium malariae (n = 2; median, 163 RMPs/μL [range, 127-200 RMPs/μL]) compared with those in healthy subjects (n = 11; median, 8 RMPs/μL [range, 3-166 RMPs/μL]; P = .01). RMP concentrations were highest in patients with severe falciparum malaria (P = .01). Parasitized red cells produced >10 times more RMPs than did unparasitized cells, but the overall majority of RMPs still derived from uninfected red blood cells (URBCs). In cultures, RMP production increased as the parasites matured. Hemin and parasite products induced RMP production in URBCs, which was inhibited by N-acetylcysteine, suggesting heme-mediated oxidative stress as a pathway for the generation of RMPs.

  4. Quenching phenomena in natural circulation loop

    International Nuclear Information System (INIS)

    Umekawa, Hisashi; Ozawa, Mamoru; Ishida, Naoki

    1995-01-01

    Quenching phenomena has been investigated experimentally using circulation loop of liquid nitrogen. During the quenching under natural circulation, the heat transfer mode changes from film boiling to nucleate boiling, and at the same time flux changes with time depending on the vapor generation rate and related two-phase flow characteristics. Moreover, density wave oscillations occur under a certain operating condition, which is closely related to the dynamic behavior of the cooling curve. The experimental results indicates that the occurrence of the density wave oscillation induces the deterioration of effective cooling of the heat surface in the film and the transition boiling regions, which results in the decrease in the quenching velocity

  5. Labour circulation and the urban labour process.

    Science.gov (United States)

    Standing, G

    1986-01-01

    The author investigates aspects of labor circulation, which he defines as "temporary movement between geographical areas for work or in search of work....[He attempts to determine] what roles have been played by labour circulation in the development of urban-industrial labour forces in the transition to industrial capitalism." Factors considered include the exploitation and oppression of labor migrants; the industrial-urban labor reserve; urban socioeconomic stratification and discrimination by age, sex, or race; the division of labor; and policy options. excerpt

  6. An elementary model of money circulation

    Science.gov (United States)

    Pokrovskii, Vladimir N.; Schinckus, Christophe

    2016-12-01

    This paper investigates money circulation for a system, consisting of a production system, the government, a central bank, commercial banks and many customers of the commercial banks. A set of equations for the system is written; the theory determines the main features of interaction between production and money circulation. Investigation of the equations in a steady-state situation reveals some relationship among output of the production system and monetary variables. The relation of quantity theory of money is confirmed, whereas a new concept of the efficiency of the system is introduced.

  7. Engineering Judgment and Natural Circulation Calculations

    International Nuclear Information System (INIS)

    Ferreri, J.C.; Ferreri, J.C.

    2011-01-01

    The analysis performed to establish the validity of computer code results in the particular field of natural circulation flow stability calculations is presented in the light of usual engineering practice. The effects of discretization and closure correlations are discussed and some hints to avoid undesired mistakes in the evaluations performed are given. Additionally, the results are presented for an experiment relevant to the way in which a (small) number of skilled, nuclear safety analysts and researchers react when facing the solution of a natural circulation problem. These results may be also framed in the concept of Engineering Judgment and are potentially useful for Knowledge Management activities.

  8. First circulating beam in the AA

    CERN Multimedia

    CERN PhotoLab

    1980-01-01

    On 3 July 1980, two years after project authorization, beam circulated for the first time in the AA. It was a 3.56 GeV/c proton test beam. We see an expecting crowd, minutes before the happy event. The persons are too numerous to name them all, but the 3 most prominent ones are at the centre (left to right): Roy Billinge (Joint AA Project Leader, with his hand on the control box), Eifionydd Jones (white shirt), Simon van der Meer (spiritus rector and Joint AA Project Leader). The first antiprotons were injected, made to circulate and cooled soon after, on 14 July 1980.

  9. Quenching phenomena in natural circulation loop

    Energy Technology Data Exchange (ETDEWEB)

    Umekawa, Hisashi; Ozawa, Mamoru [Kansai Univ., Osaka (Japan); Ishida, Naoki [Daihatsu Motor Company, Osaka (Japan)

    1995-09-01

    Quenching phenomena has been investigated experimentally using circulation loop of liquid nitrogen. During the quenching under natural circulation, the heat transfer mode changes from film boiling to nucleate boiling, and at the same time flux changes with time depending on the vapor generation rate and related two-phase flow characteristics. Moreover, density wave oscillations occur under a certain operating condition, which is closely related to the dynamic behavior of the cooling curve. The experimental results indicates that the occurrence of the density wave oscillation induces the deterioration of effective cooling of the heat surface in the film and the transition boiling regions, which results in the decrease in the quenching velocity.

  10. Stabilization and augmentation of circulating AIM in mice by synthesized IgM-Fc.

    Directory of Open Access Journals (Sweden)

    Toshihiro Kai

    Full Text Available Owing to rapid and drastic changes in lifestyle and eating habits in modern society, obesity and obesity-associated diseases are among the most important public health problems. Hence, the development of therapeutic approaches to regulate obesity is strongly desired. In view of previous work showing that apoptosis inhibitor of macrophage (AIM blocks lipid storage in adipocytes, thereby preventing obesity caused by a high-fat diet, we here explored a strategy to augment circulating AIM levels. We synthesized the Fc portion of the soluble human immunoglobulin (IgM heavy chain and found that it formed a pentamer containing IgJ as natural IgM does, and effectively associated with AIM in vitro. When we injected the synthesized Fc intravenously into mice lacking circulating IgM, it associated with endogenous mouse AIM, protecting AIM from renal excretion and preserving the circulating AIM levels. As the synthesized Fc lacked the antigen-recognizing variable region, it provoked no undesired immune response. In addition, a challenge with the Fc-human AIM complex in wild-type mice, which exhibited normal levels of circulating IgM and AIM, successfully maintained the levels of the human AIM in mouse blood. We also observed that the human AIM was effectively incorporated into adipocytes in visceral fat tissue, suggesting its functionality against obesity. Thus, our findings reveal potent strategies to safely increase AIM levels, which could form the basis for developing novel therapies for obesity.

  11. Higher circulating levels of IGF-1 are associated with longer leukocyte telomere length in healthy subjects

    DEFF Research Database (Denmark)

    Barbieri, Michelangela; Paolisso, Giuseppe; Kimura, Masayuki

    2009-01-01

    Mutations that inhibit the insulin-like growth factor-1 (IGF-1) extend the lifespan of worms, flies and mice. However, it appears that relatively low circulating levels of IGF-1 in humans are associated with aging-related diseases and diminished longevity. As leukocyte telomere length (LTL) is os...

  12. Circulating Follistatin Is Liver-Derived and Regulated by the Glucagon-to-Insulin Ratio

    DEFF Research Database (Denmark)

    Hansen, Jakob S; Rutti, Sabine; Arous, Caroline

    2016-01-01

    CONTEXT: Follistatin is a plasma protein recently reported to increase under conditions with negative energy balance, such as exercise and fasting in humans. Currently, the perception is that circulating follistatin is a result of para/autocrine actions from various tissues. The large and acute i...

  13. Circulating zonulin, a marker of intestinal permeability, is increased in association with obesity-associated insulin resistance.

    Directory of Open Access Journals (Sweden)

    José María Moreno-Navarrete

    Full Text Available Zonulin is the only physiological mediator known to regulate intestinal permeability reversibly by modulating intercellular tight junctions. To investigate the relationship between intestinal permeability and obesity-associated metabolic disturbances in humans, we aimed to study circulating zonulin according to obesity and insulin resistance. Circulating zonulin (ELISA was measured in 123 caucasian men in association with inflammatory and metabolic parameters (including minimal model-measured insulin sensitivity. Circulating zonulin increased with body mass index (BMI, waist to hip ratio (WHR, fasting insulin, fasting triglycerides, uric acid and IL-6, and negatively correlated with HDL-cholesterol and insulin sensitivity. In multiple regression analysis, insulin sensitivity (p = 0.002 contributed independently to circulating zonulin variance, after controlling for the effects of BMI, fasting triglycerides and age. When circulating IL-6 was added to this model, only BMI (p = 0.01 contributed independently to circulating zonulin variance. In conclusion, the relationship between insulin sensitivity and circulating zonulin might be mediated through the obesity-related circulating IL-6 increase.

  14. Circulating zonulin, a marker of intestinal permeability, is increased in association with obesity-associated insulin resistance.

    Science.gov (United States)

    Moreno-Navarrete, José María; Sabater, Mònica; Ortega, Francisco; Ricart, Wifredo; Fernández-Real, José Manuel

    2012-01-01

    Zonulin is the only physiological mediator known to regulate intestinal permeability reversibly by modulating intercellular tight junctions. To investigate the relationship between intestinal permeability and obesity-associated metabolic disturbances in humans, we aimed to study circulating zonulin according to obesity and insulin resistance. Circulating zonulin (ELISA) was measured in 123 caucasian men in association with inflammatory and metabolic parameters (including minimal model-measured insulin sensitivity). Circulating zonulin increased with body mass index (BMI), waist to hip ratio (WHR), fasting insulin, fasting triglycerides, uric acid and IL-6, and negatively correlated with HDL-cholesterol and insulin sensitivity. In multiple regression analysis, insulin sensitivity (p = 0.002) contributed independently to circulating zonulin variance, after controlling for the effects of BMI, fasting triglycerides and age. When circulating IL-6 was added to this model, only BMI (p = 0.01) contributed independently to circulating zonulin variance. In conclusion, the relationship between insulin sensitivity and circulating zonulin might be mediated through the obesity-related circulating IL-6 increase.

  15. Bed system performance in helium circulation mode

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Yean Jin; Jung, Kwang Jin; Ahn, Do Hee; Chung, Hong Suk [UST, Daejeon (Korea, Republic of); Kang, Hee Suk [KAERI, Daejeon (Korea, Republic of); Yun, Sei Hun [NFRI, Deajeon (Korea, Republic of)

    2016-05-15

    As a part of the International Thermonuclear Experimental Reactor (ITER) Project, We have conducted an experiment for storing hydrogen to depleted uranium and zirconium cobalt. The helium blanket effect has been observed in experiments using metal hydrides. The collapse of the hydrogen isotopes are accompanied by the decay heat and helium-3. Helium-3 dramatically reduces the hydrogen isotope storage capacity by surrounding the metal. This phenomenon is called a helium blanket effect. In addition the authors are working on the recovery and removal techniques of helium-3. In this paper, we discuss the equipment used to test the helium blanket effect and the results of a helium circulation experiment. The helium-3 produced surrounds the storage material surface and thus disturbs the reaction of the storage material and the hydrogen isotope. Even if the amount of helium-3 is small, the storage capacity of the SDS bed significantly drops. This phenomenon is the helium blanket effect. To resolve this phenomenon, a circulating loop was introduced. Using a circulating system, helium can be separated from the storage material. We made a helium loop that includes a ZrCo bed. Then using a metal bellows pump, we tested the helium circulation.

  16. Periodontitis and increase in circulating oxidative stress

    Directory of Open Access Journals (Sweden)

    Takaaki Tomofuji

    2009-05-01

    Full Text Available Reactive oxygen species (ROS are products of normal cellular metabolism. However, excessive production of ROS oxidizes DNA, lipids and proteins, inducing tissue damage. Studies have shown that periodontitis induces excessive ROS production in periodontal tissue. When periodontitis develops, ROS produced in the periodontal lesion diffuse into the blood stream, resulting in the oxidation of blood molecules (circulating oxidative stress. Such oxidation may be detrimental to systemic health. For instance, previous animal studies suggested that experimental periodontitis induces oxidative damage of the liver and descending aorta by increasing circulating oxidative stress. In addition, it has been revealed that clinical parameters in chronic periodontitis patients showed a significant improvement 2 months after periodontal treatment, which was accompanied by a significant reduction of reactive oxygen metabolites in plasma. Improvement of periodontitis by periodontal treatment could reduce the occurrence of circulating oxidative stress. Furthermore, recent studies indicate that the increase in circulating oxidative stress following diabetes mellitus and inappropriate nutrition damages periodontal tissues. In such cases, therapeutic approaches to systemic oxidative stress might be necessary to improve periodontal health.

  17. Natural circulation under severe accident conditions

    International Nuclear Information System (INIS)

    Pafford, D.J.; Hanson, D.J.; Tung, V.X.; Chmielewski, S.V.

    1992-01-01

    Research is being conducted to better understand natural circulation phenomena in mixtures of steam and noncondensibles and its influence on the temperature of the vessel internals and the hot leg, pressurizer surge line, and steam generator tubes. The temperature of these structures is important because their failure prior to reactor vessel lower head failure could reduce the likelihood of containment failure as a result of direct containment heating. Computer code calculations (MELPROG, SCDAP/RELAP5/MOD3) predict high fluid temperatures in the upper plenum resulting from in-vessel natural circulation. Using a simple model for the guide tube phenomena, high upper plenum temperatures are shown to be consistent with the relatively low temperatures that were deduced metallurgically from leadscrews removed from the TMI-2 upper plenum. Evaluation of the capabilities of the RELAP5/MOD3 computer code to predict natural circulation behavior was also performed. The code was used to model the Westinghouse natural circulation experimental facility. Comparisons between code calculations and results from experiments show good agreement

  18. Detecting Holocene changes in thermohaline circulation

    OpenAIRE

    Keigwin, L. D.; Boyle, E. A.

    2000-01-01

    Throughout the last glacial cycle, reorganizations of deep ocean water masses were coincident with rapid millennial-scale changes in climate. Climate changes have been less severe during the present interglacial, but evidence for concurrent deep ocean circulation change is ambiguous.

  19. Opportunities in CARICOM Migration : Brain Circulation, Diasporic ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Opportunities in CARICOM Migration : Brain Circulation, Diasporic Tourism, and Investment. Between 1965 and 2000, about 12% of the Caribbean labour force moved to Canada and other developed countries, making the Caribbean the largest per capita source of emigrants in the world. Remittances from these emigrants ...

  20. Oceanic Circulation. A Programmed Unit of Instruction.

    Science.gov (United States)

    Marine Maritime Academy, Castine.

    This booklet contains a programmed lesson on oceanic circulation. It is designed to allow students to progress through the subject at their own speed. Since it is written in linear format, it is suggested that students proceed through the program from "frame" to succeeding "frame." Instructions for students on how to use the booklet are included.…

  1. 3D Visualization of Global Ocean Circulation

    Science.gov (United States)

    Nelson, V. G.; Sharma, R.; Zhang, E.; Schmittner, A.; Jenny, B.

    2015-12-01

    Advanced 3D visualization techniques are seldom used to explore the dynamic behavior of ocean circulation. Streamlines are an effective method for visualization of flow, and they can be designed to clearly show the dynamic behavior of a fluidic system. We employ vector field editing and extraction software to examine the topology of velocity vector fields generated by a 3D global circulation model coupled to a one-layer atmosphere model simulating preindustrial and last glacial maximum (LGM) conditions. This results in a streamline-based visualization along multiple density isosurfaces on which we visualize points of vertical exchange and the distribution of properties such as temperature and biogeochemical tracers. Previous work involving this model examined the change in the energetics driving overturning circulation and mixing between simulations of LGM and preindustrial conditions. This visualization elucidates the relationship between locations of vertical exchange and mixing, as well as demonstrates the effects of circulation and mixing on the distribution of tracers such as carbon isotopes.

  2. Efficient Circulation of Railway Rolling Stock

    NARCIS (Netherlands)

    Alfieri, A.; Groot, R.; Kroon, L.G.; Schrijver, A.

    2006-01-01

    Railway rolling stock (locomotives, carriages, and train units) is one of the most significant cost sources for operatorsof passenger trains, both public and private. Rolling stock costsare due to material acquisition, power supply, and material maintenance. The efficient circulation of rolling

  3. Efficient Circulation of Railway Rolling Stock

    NARCIS (Netherlands)

    A. Alfieri (Arianna); R. Groot (Rutger); L.G. Kroon (Leo); A. Schrijver (Lex)

    2002-01-01

    textabstractRailway rolling stock (locomotives, carriages, and train units) is one of the most significant cost sources for operatorsof passenger trains, both public and private. Rolling stock costsare due to material acquisition, power supply, and material maintenance. The efficient circulation of

  4. Circulation of Coxiella burnetii in a Naturally Infected Flock of Dairy Sheep: Shedding Dynamics, Environmental Contamination, and Genotype Diversity

    OpenAIRE

    Joulié, A.; Laroucau, K.; Bailly, X.; Prigent, M.; Gasqui, P.; Lepetitcolin, E.; Blanchard, B.; Rousset, E.; Sidi-Boumedine, K.; Jourdain, E.

    2015-01-01

    Q fever is a worldwide zoonosis caused by Coxiella burnetii. Domestic ruminants are considered to be the main reservoir. Sheep, in particular, may frequently cause outbreaks in humans. Because within-flock circulation data are essential to implementing optimal management strategies, we performed a follow-up study of a naturally infected flock of dairy sheep. We aimed to (i) describe C. burnetii shedding dynamics by sampling vaginal mucus, feces, and milk, (ii) assess circulating strain divers...

  5. Dynamic Regulation of Circulating microRNAs During Acute Exercise and Long-Term Exercise Training in Basketball Athletes

    OpenAIRE

    Yongqin Li; Mengchao Yao; Qiulian Zhou; Yan Cheng; Lin Che; Jiahong Xu; Junjie Xiao; Zhongming Shen; Yihua Bei

    2018-01-01

    Emerging evidence indicates the beneficial effects of physical exercise on human health, which depends on the intensity, training time, exercise type, environmental factors, and the personal health status. Conventional biomarkers provide limited insight into the exercise-induced adaptive processes. Circulating microRNAs (miRNAs, miRs) are dynamically regulated in response to acute exhaustive exercise and sustained rowing, running and cycling exercises. However, circulating miRNAs in response ...

  6. Circulating Zonulin, a Marker of Intestinal Permeability, Is Increased in Association with Obesity-Associated Insulin Resistance

    OpenAIRE

    Moreno-Navarrete, José María; Sabater, Mònica; Ortega, Francisco; Ricart, Wifredo; Fernández-Real, José Manuel

    2012-01-01

    Zonulin is the only physiological mediator known to regulate intestinal permeability reversibly by modulating intercellular tight junctions. To investigate the relationship between intestinal permeability and obesity-associated metabolic disturbances in humans, we aimed to study circulating zonulin according to obesity and insulin resistance. Circulating zonulin (ELISA) was measured in 123 caucasian men in association with inflammatory and metabolic parameters (including minimal model-measure...

  7. Observations of the summer Red Sea circulation

    Science.gov (United States)

    Sofianos, Sarantis S.; Johns, William E.

    2007-06-01

    Aiming at exploring and understanding the summer circulation in the Red Sea, a cruise was conducted in the basin during the summer of 2001 involving hydrographic, meteorological, and direct current observations. The most prominent feature, characteristic of the summer circulation and exchange with the Indian Ocean, is a temperature, salinity, and oxygen minimum located around a depth of 75 m at the southern end of the basin, associated with Gulf of Aden Intermediate Water inflowing from the Gulf of Aden during the summer season as an intruding subsurface layer. Stirring and mixing with ambient waters lead to marked increases in temperature (from 16.5 to almost 33°C) and salinity (from 35.7 to more than 38 psu) in this layer by the time it reaches midbasin. The observed circulation presents a very vigorous pattern with strong variability and intense features that extend the width of the basin. A permanent cyclone, detected in the northern Red Sea, verifies previous observations and modeling studies, while in the central sector of the basin a series of very strong anticyclones were observed with maximum velocities exceeding 1 m/s. The three-layer flow pattern, representative of the summer exchange between the Red Sea and the Gulf of Aden, is observed in the strait of Bab el Mandeb. In the southern part of the basin the layer flow is characterized by strong banking of the inflows and outflows against the coasts. Both surface and intermediate water masses involved in the summer Red Sea circulation present prominent spatial variability in their characteristics, indicating that the eddy field and mixing processes play an important role in the summer Red Sea circulation.

  8. Decontamination of CAGR gas circulator components

    International Nuclear Information System (INIS)

    Rogers, L.N.; Hooper, A.J.

    1985-01-01

    This paper describes the development and full-scale trial of two methods for removal of radioactive contamination on the surfaces of CAGR gas circulator components. The two methods described are a particle impact cleaning (PIC) decontamination technique and an electrochemical technique, 'electro-swabbing', which is based on the principle of decontamination by electro-polishing. In developing these techniques it was necessary to take account of the physical and chemical nature of the surface deposits on the gas circulator components; these were shown to consist of magnetite-type oxide and carbonaceous material. In order to follow the progress of the decontamination it was also necessary to develop a surface sampling technique which was effective and precise under these conditions; an electrochemical technique, employing similar principles to the electro-swabbing process, was developed for this purpose. The full-scale trial of the PIC decontamination technique was carried out on an inlet guide vane (IGV) assembly, this having been identified as the component from the gas circulator which contributes most to the radiation dose accumulated during routine circulator maintenance. The technique was shown to be practically viable and some 99% of the radioactive contamination was readily removed from the treated surfaces with only negligible surface damage being caused. The full-scale trial of the electro-swabbing decontamination technique was carried out on a gas circulator impeller. High decontamination factors were again achieved with ≥ 99% of the radioactive contamination being removed from the treated surfaces. The technique has practical limitations in terms of handling and treatment of waste-arisings. However, the use of specially-designed swabbing electrodes may allow the treatment of constricted geometries inaccessible to techniques such as PIC. The technique is also highly suitable for the treatment of soft-finish materials and of components fabricated from a

  9. Serological Evidence of Orthopoxvirus Circulation Among Equids, Southeast Brazil

    Directory of Open Access Journals (Sweden)

    Iara A. Borges

    2018-03-01

    Full Text Available Since 1999 Vaccinia virus (VACV outbreaks involving bovines and humans have been reported in Brazil; this zoonosis is known as Bovine Vaccinia (BV and is mainly an occupational disease of milkers. It was only in 2008 (and then again in 2011 and 2014 however, that VACV was found causing natural infections in Brazilian equids. These reports involved only equids, no infected humans or bovines were identified, and the sources of infections remain unknown up to date. The peculiarities of Equine Vaccinia outbreaks (e.g., absence of human infection, the frequently shared environments, and fomites by equids and bovines in Brazilian farms and the remaining gaps in BV epidemiology incited a question over OPV serological status of equids in Brazil. For this report, sera from 621 equids - representing different species, ages, sexes and locations of origin within Minas Gerais State, southeast Brazil – were examined for the presence of anti-Orthopoxvirus (OPV antibodies. Only 74 of these were sampled during an Equine Vaccinia outbreak, meaning some of these specific animals presented typical lesions of OPV infections. The majority of sera, however, were sampled from animals without typical signs of OPV infection and during the absence of reported Bovine or Equine Vaccinia outbreaks. Results suggest the circulation of VACV among equids of southeast Brazil even prior to the time of the first VACV outbreak in 2008. There is a correlation of OPVs outbreaks among bovines and equids although many gaps remain to our understanding of its nature. The data obtained may even be carefully associated to recent discussion over OPVs history. Moreover, data is available to improve the knowledge and instigate new researches regarding OPVs circulation in Brazil and worldwide.

  10. A 3.0-kb deletion including an erythroid cell-specific regulatory element in intron 1 of the ABO blood group gene in an individual with the Bm phenotype.

    Science.gov (United States)

    Sano, R; Kuboya, E; Nakajima, T; Takahashi, Y; Takahashi, K; Kubo, R; Kominato, Y; Takeshita, H; Yamao, H; Kishida, T; Isa, K; Ogasawara, K; Uchikawa, M

    2015-04-01

    We developed a sequence-specific primer PCR (SSP-PCR) for detection of a 5.8-kb deletion (B(m) 5.8) involving an erythroid cell-specific regulatory element in intron 1 of the ABO blood group gene. Using this SSP-PCR, we performed genetic analysis of 382 individuals with Bm or ABm. The 5.8-kb deletion was found in 380 individuals, and disruption of the GATA motif in the regulatory element was found in one individual. Furthermore, a novel 3.0-kb deletion involving the element (B(m) 3.0) was demonstrated in the remaining individual. Comparisons of single-nucleotide polymorphisms and microsatellites in intron 1 between B(m) 5.8 and B(m) 3.0 suggested that these deletions occurred independently. © 2014 International Society of Blood Transfusion.

  11. Experimental investigation on natural circulation and air-injection enhanced circulation in a simple loop

    International Nuclear Information System (INIS)

    Walter Ambrosini; Nicola Forgione; Francesco Oriolo; Filippo Pellacani; Mariano Tarantino; Claudio Struckmann

    2005-01-01

    Full text of publication follows: Natural circulation represents an interesting phenomenon because of both the complex aspects characterising it and for the widespread application in industry. On the other hand, injection of a gas into a rising branch of a loop represents a means to establish or to enhance a circulation flow, as it occurs in the so-called 'air-lift' loops. Both natural circulation and gas-injection enhanced circulation are presently considered for cooling Accelerator Driven System (ADS) reactors. These are subcritical reactors in which the fission reaction chain is maintained by the injection of neutrons obtained by spallation reactions in a target through a high energy proton beam generated in an external accelerator. The capability of such reactors to be used as incinerators of long lived fission products makes them particularly interesting in the light of the closure of the nuclear fuel cycle. Some of the fluids proposed as coolants for these reactors are liquid metals, with main interest for lead and lead-bismuth eutectic (LBE). Experimental activities are being performed in support to the design of the reactor prototype by different organisations. The university of Pisa, in addition to provide cooperation in these large scale activities performed with LBE has set up a specific experimental program aimed at studying the fundamental mechanisms involved in natural circulation and gas-injection enhanced circulation. The adopted experimental facility consists in a simple loop, having a rectangular lay-out (roughly, 4 m tall and 1 m wide), equipped with a 5 kW, 1 m tall heater, a 2 m long pipe-in-pipe heat exchanger, an air injection device and a separator. The fluid adopted in the tests performed up to now is water, though studies for evaluating the feasibility of the adoption of different fluids have been undertaken. Experimental data reported in previous publications concerning this research were related to a relatively high range of gas

  12. Study in rabbits of portal circulation by a radioisotopic method

    International Nuclear Information System (INIS)

    Maliska, C.

    1980-01-01

    The development of a precocius - and noninvasive method for the detection of portal circulation alterations by means of time interval measurements between the rectal administration of radiotracers and their detection in liver and head is aimed at. The pertecnetate ( 99 sup(m)Tc)- and iodate ( 131 I) absorption by the terminal large intestine was tested in 22 rabbits. The time iinterval between rectal administration of the radiotracer and its appearance in liver and head was determined in 12 rabbits, by external detection with a scintillation camera. The same parameters were studied in 9 animals submitted to the ligature of the portal vein. Iodate and pertecnetate are absorbed by the terminal large intestine, the pertecnetate absorption being significantly smaller than that of iodate. The pertecnetate distribution volume is smaller than that of iodate; the rectum - liver - and rectum - head time intervals is increased in animals with the ligature of portal vein. Application of the method to larger animals will permit the necessary improvements for its utilization as a precocius - noninvasive - and inocuous test in the evaluation of alteration of the human portal circulation. (Author) [pt

  13. Money circulation and debt circulation: A restatement of quantity theory of money

    OpenAIRE

    Xing, Xiaoyun; Xiong, Wanting; Chen, Liujun; Chen, Jiawei; Wang, Yougui; Stanley, H. Eugene

    2018-01-01

    Both money and debt are products of credit creation of banks. Money is always circulating among traders by facilitating commodity transactions. In contrast, debt is created by borrowing and annihilated by repayment as it is matured. However, when this creation- annihilation process is mediated by banks which are constrained by a credit capacity, there exists continuous transfer of debt among debtors, which can be defined as debt circulation. This paper presents a multi-agent model in which in...

  14. Grazing Affects Exosomal Circulating MicroRNAs in Cattle

    Science.gov (United States)

    Muroya, Susumu; Ogasawara, Hideki; Hojito, Masayuki

    2015-01-01

    Circulating microRNAs (c-miRNAs) are associated with physiological adaptation to acute and chronic aerobic exercise in humans. To investigate the potential effect of grazing movement on miRNA circulation in cattle, here we profiled miRNA expression in centrifugally prepared exosomes from the plasma of both grazing and housed Japanese Shorthorn cattle. Microarray analysis of the c-miRNAs resulted in detection of a total of 231 bovine exosomal miRNAs in the plasma, with a constant expression level of let-7g across the duration and cattle groups. Expression of muscle-specific miRNAs such as miR-1, miR-133a, miR-206, miR-208a/b, and miR-499 were undetectable, suggesting the mildness of grazing movement as exercise. According to validation by quantitative RT-PCR, the circulating miR-150 level in the grazing cattle normalized by the endogenous let-7g level was down-regulated after 2 and 4 months of grazing (P cattle equalized when the grazing cattle were returned to a housed situation. Likewise, the levels of miR-19b, miR-148a, miR-221, miR-223, miR-320a, miR-361, and miR-486 were temporarily lowered in the cattle at 1 and/or 2 month of grazing compared to those of the housed cattle (P cattle at 2 months of grazing (P = 0.044). The elevation of miR-451 level in the plasma was coincident with that in the biceps femoris muscle of the grazing cattle (P = 0.008), which suggests the secretion or intake of miR-451 between skeletal muscle cells and circulation during grazing. These results revealed that exosomal c-miRNAs in cattle were affected by grazing, suggesting their usefulness as molecular grazing markers and functions in physiological adaptation of grazing cattle associated with endocytosis, focal adhesion, axon guidance, and a variety of intracellular signaling, as predicted by bioinformatic analysis. PMID:26308447

  15. Comparison of Print Monograph Acquisitions Strategies Finds Circulation Advantage to Firm Orders

    Directory of Open Access Journals (Sweden)

    Laura Costello

    2017-12-01

    Full Text Available A Review of: Ke, I., Gao, W., & Bronicki, J. (2017. Does title-by-title selection make a difference? A usage title analysis on print monograph purchasing. Collection Management, 42(1, 34-47. http://dx.doi.org/10.1080/01462679.2016.1249040 Abstract Objective – To compare usage of print monographs acquired through firm order to those acquired through approval plans. Design – Quantitative study. Setting – A public research university serving an annual enrollment of over 43,500 students and employing more than 2,600 faculty members in the South Central United States. Subjects – Circulation and call number data from 21,356 print books acquired through approval plans, and 23,920 print books acquired through firm orders. Methods – Item records for print materials purchased between January 1, 2011 and December 31, 2014 were extracted from the catalog and separated by acquisitions strategy into firm order and approval plan lists. Items without call numbers and materials that had been placed on course reserves were removed from the lists. The authors examined accumulated circulation counts and conducted trend analyses to examine year-to-year usage. The authors also measured circulation performance in each Library of Congress call number class; they grouped these classes into science, social science, and humanities titles. Main Results – The authors found that 31% of approval plan books and 39% of firm order books had circulated at least once. The firm order books that had circulated were used an average of 1.87 times, compared to approval plan books which were used an average of 1.47 times. The year-to-year analysis showed that the initial circulation rate for approval plan books decreased from 42% in 2011 to 14% in 2014, and from 46% to 24% for firm order books. Subject area analysis showed that medicine and military science had the highest circulation rates at over 45%, and that agriculture and bibliography titles had the lowest circulation

  16. Immunogenicity of mumps virus vaccine candidates matching circulating genotypes in the United States and China.

    Science.gov (United States)

    Zengel, James; Phan, Shannon I; Pickar, Adrian; Xu, Pei; He, Biao

    2017-07-13

    Mumps virus (MuV) causes acute infection in humans with characteristic swelling of the parotid gland. While vaccination has greatly reduced the incidence of MuV infection, there have been multiple large outbreaks of mumps virus (MuV) in highly vaccinated populations. The most common vaccine strain, Jeryl Lynn, belongs to genotype A, which is no longer a circulating genotype. We have developed two vaccine candidates that match the circulating genotypes in the United States (genotype G) and China (genotype F). We found that there was a significant decrease in the ability of the Jeryl Lynn vaccine to produce neutralizing antibody responses to non-matched viruses, when compared to either of our vaccine candidates. Our data suggests that an updated vaccine may allow for better immunity against the circulating MuV genotypes G and F. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. Bond Graph Model of Cerebral Circulation: Toward Clinically Feasible Systemic Blood Flow Simulations

    Science.gov (United States)

    Safaei, Soroush; Blanco, Pablo J.; Müller, Lucas O.; Hellevik, Leif R.; Hunter, Peter J.

    2018-01-01

    We propose a detailed CellML model of the human cerebral circulation that runs faster than real time on a desktop computer and is designed for use in clinical settings when the speed of response is important. A lumped parameter mathematical model, which is based on a one-dimensional formulation of the flow of an incompressible fluid in distensible vessels, is constructed using a bond graph formulation to ensure mass conservation and energy conservation. The model includes arterial vessels with geometric and anatomical data based on the ADAN circulation model. The peripheral beds are represented by lumped parameter compartments. We compare the hemodynamics predicted by the bond graph formulation of the cerebral circulation with that given by a classical one-dimensional Navier-Stokes model working on top of the whole-body ADAN model. Outputs from the bond graph model, including the pressure and flow signatures and blood volumes, are compared with physiological data. PMID:29551979

  18. Quantitative measurement of blood circulation in tests of rats using nuclear medical methods

    International Nuclear Information System (INIS)

    Ripke, R.

    1980-01-01

    The experiments show that is it is possible to quantitatively assess the blood circulation and, within limits, the germinative function of tests by measuring the impulses of an incorporated radionuclide (99-Tc-pertechnetate) using an uptake measuring instrument. This is a rapid and unbloody method to be adopted in human medicine. 'Acute tests' or pre-damaged tests can thus be exactly diagnosed. In the former case the circulation modification and in the latter the evaluation of the germinative function ability is of main interest. The most important measuring criterion is the 15-minute-uptake U; it represents the blood circulation in the tests measured. The germinative function ability is evaluated on the basis of the accumulation activity Nsub(max). (orig./MG) [de

  19. [Applications of platelets in studies on traditional Chinese medicines promoting blood circulation to remove blood stasis].

    Science.gov (United States)

    Wang, Feng-Qin; Chen, Cen; Xia, Zhi-Ning; Yang, Feng-Qing

    2014-08-01

    Thrombotic diseases in different forms become a great threat to human health. Such anti-platelet aggregation drugs as aspirin and clopidogrel are common drugs in clinic. However, along with the appearance of resistance and side effects of western anti-platelet aggregation drugs, anti-platelet aggregation traditional Chinese medicines promoting blood circulation to remove blood stasis have gradually become an important study orientation. Platelet is one of major participant in thrombosis, and plays an important role as a bioactive material in studies on traditional Chinese medicines promoting blood circulation to remove blood stasis, mainly involving two aspects--the evaluation for the anti-platelet aggregation activity of traditional Chinese medicines and the screening of their active components. This paper summarized the applications of platelets in studies on traditional Chinese medicines promoting blood circulation to remove blood stasis, so as to provide basis for further studies.

  20. Implications for the offspring of circulating factors involved in beta cell adaptation in pregnancy

    DEFF Research Database (Denmark)

    Nalla, Amarnadh; Ringholm, Lene; Søstrup, Birgitte

    2014-01-01

    is able to stimulate proliferation of rat beta cells. We have identified several circulating factors that may contribute to beta cell adaptation to pregnancy. Further studies are needed to elucidate their possible role in glucose homeostasis in the mother and her offspring.......OBJECTIVE: Several studies have shown an increase in beta cell mass during pregnancy. Somatolactogenic hormones are known to stimulate the proliferation of existing beta cells in rodents whereas the mechanism in humans is still unclear. We hypothesize that in addition to somatolactogenic hormones...... there are other circulating factors involved in beta cell adaptation to pregnancy. This study aimed at screening for potential pregnancy-associated circulating beta cell growth factors. SAMPLES: Serum samples from nonpregnant and pregnant women. METHODS: The effect of serum from pregnant women...

  1. Modelling the Seasonal Overturning Circulation in the Red Sea

    KAUST Repository

    Yao, Fengchao; Hoteit, Ibrahim; Pratt, Larry; Bower, Amy; Koehl, Armin; Gopalakrishnan, Ganesh

    2015-01-01

    The overturning circulation in the Red Sea exhibits a distinct seasonally reversing pattern and is studied using 50-year, high-resolution MIT general circulation model simulations. The seasonal water exchange in the Strait of Bab el Mandeb

  2. Silent Circulation of Ross River Virus in French Polynesia

    Directory of Open Access Journals (Sweden)

    Maite Aubry

    2015-08-01

    Discussion: Our results support the existence of autochthonous RRV transmission and suggest that this pathogen has silently circulated in French Polynesia. These findings raise the question of possible undetected circulation of RRV in other Pacific Island Countries and Territories.

  3. Circulating dendritic cells in pediatric patients with nephrotic syndrome

    African Journals Online (AJOL)

    EL-HAKIM

    nephrotic syndrome, circulating DCs were measured by flowcytometry. Results: Circulating DC count ... parents or caregivers of each child before enrollment in the study. ..... role in initiating the primary immune response. On the basis of the ...

  4. Distinct proteome pathology of circulating microparticles in systemic lupus erythematosus

    DEFF Research Database (Denmark)

    Østergaard, Ole; Nielsen, Christoffer Tandrup; Tanassi, Julia T

    2017-01-01

    BACKGROUND: The pathogenesis of systemic lupus erythematosus (SLE) is poorly understood but has been linked to defective clearance of subcellular particulate material from the circulation. This study investigates the origin, formation, and specificity of circulating microparticles (MPs) in patients...

  5. Circulation induced by diffused aeration in a shallow lake

    African Journals Online (AJOL)

    2017-01-01

    Jan 1, 2017 ... Lastly, a simple returning flow model was proposed to describe the circulation flow patterns ... method to describe the circulation patterns induced by the bub- ... 160 holes of 1 mm, which was designed to promote high mix-.

  6. Uptake and degradation of circulating proteins by the liver.

    NARCIS (Netherlands)

    Buys, Carolus Henricus Cornelis Maria

    1976-01-01

    Circulating proteins, like all proteins in a living animal, are subject to continual replacement or turnover. This process implies both synthesis and degradation, This thesis deals with the degradative part of turnover of circulating proteins. ... Summary

  7. Anti-cyclonic circulation driven by the estuarine circulation in a gulf type ROFI

    Science.gov (United States)

    Fujiwara, T.; Sanford, L. P.; Nakatsuji, K.; Sugiyama, Y.

    1997-08-01

    Baroclinic residual circulation processes are examined in gulf type Regions Of Freshwater Influence (ROFIs), which have large rivers discharging into a rounded head wider than the Rossby internal deformation radius. Theoretical and observational investigations concentrate on Ise Bay, Japan, with supporting data from Osaka Bay and Tokyo Bay. Simplified analytical solutions are derived to describe the primary features of the circulation. Three dimensional residual current data collected using moored current meters and shipboard acoustic doppler current profilers (ADCPs), satellite imagery and density structure data observed using STDs, are presented for comparison to the theoretical predictions. There are three key points to understanding the resulting circulation in gulf type ROFIs. First, there are likely to be three distinct water masses: the river plume, a brackish upper layer, and a higher salinity lower layer. Second, baroclinic processes in gulf type ROFIs are influenced by the Earth's rotation at first order. Residual currents are quasi-geostrophic and potential vorticity is approximately conserved. Third, the combined effects of a classical longitudinal estuarine circulation and the Earth's rotation are both necessary to produce the resulting circulation. Anti-cyclonic vorticity is generated in the upper layer by the horizontal divergence associated with upward entrainment, which is part of the estuarine circulation. The interaction between anti-cyclonic vorticity and horizontal divergence results in two regions of qualitatively different circulation, with gyre-like circulation near the bay head and uniformly seaward anti-cyclonicly sheared flow further towards the mouth. The stagnation point separating the two regions is closer to (further away from) the bay head for stronger (weaker) horizontal divergence, respectively. The vorticity and spin-up time of this circulation are-(ƒ-ω 1)/2 and h/2w 0, respectively, where ƒ is the Coriolis parameter, ω 1 is

  8. Producing superfluid circulation states using phase imprinting

    Science.gov (United States)

    Kumar, Avinash; Dubessy, Romain; Badr, Thomas; De Rossi, Camilla; de Goër de Herve, Mathieu; Longchambon, Laurent; Perrin, Hélène

    2018-04-01

    We propose a method to prepare states of given quantized circulation in annular Bose-Einstein condensates (BEC) confined in a ring trap using the method of phase imprinting without relying on a two-photon angular momentum transfer. The desired phase profile is imprinted on the atomic wave function using a short light pulse with a tailored intensity pattern generated with a spatial light modulator. We demonstrate the realization of "helicoidal" intensity profiles suitable for this purpose. Due to the diffraction limit, the theoretical steplike intensity profile is not achievable in practice. We investigate the effect of imprinting an intensity profile smoothed by a finite optical resolution onto the annular BEC with a numerical simulation of the time-dependent Gross-Pitaevskii equation. This allows us to optimize the intensity pattern for a given target circulation to compensate for the limited resolution.

  9. Natural circulation in pressurized water reactors

    International Nuclear Information System (INIS)

    Bastos, J.L.F.; Loureiro, L.V.; Rocha, R.T.V. da; Umbehaun, P.E.

    1992-01-01

    Several analytical modelling have been done for steady-state and slow transients conditions, besides more sophisticated studies considering two and three dimensional effects in a very simple geometry. Under severe accident conditions for PWR a code to analyse natural circulation has been developed by Westinghouse. This paper discusses the problem of natural circulation in a complex geometry similar to that of nuclear power plants. A first experiment has been done at the integral test facility of 'Co-ordination of Special Projects-Ministry of Naval Affairs' (Coordenadoria para Projetos Especiais -Ministerio da Marinha, COPESP) for several flux conditions. The results obtained were compared with numerical simulations for the steady-state regime. 09 refs, 05 figs, 01 tab. (B.C.A.)

  10. Circulation policies in health science libraries.

    Science.gov (United States)

    Watkins, C; Coker, N C

    1970-10-01

    There is general agreement that library policies have considerable influence on the use of libraries. Medical school (health science) libraries of this country were surveyed as to their policies in respect to whether faculty and student use were regulated by a single policy, circulation regulations, hours library was accessible to users, accessibility of reserve material, interlibrary loan, policy on overdue material, and exit control. THE LIBRARIES WERE THEN DIVIDED INTO THREE GROUPS, HIGH, MIDDLE, AND LOW ACCORDING TO THE FOLLOWING CHARACTERISTICS: size of student body, size of faculty, size of holdings, size of library staff, annual budget, and annual circulation. Our findings would indicate that schools falling in a high category based upon these criteria tend to be more restrictive in their policies and to have different regulations for faculty and students than do schools in the low category.These findings warrant further study.

  11. Natural circulation in simulated LMFBR fuel assemblies

    International Nuclear Information System (INIS)

    Levin, A.E.; Carbajo, J.J.; Lloyd, D.B.; Montgomery, B.H.; Rose, S.D.; Wantland, J.L.

    1985-01-01

    Natural circulation experiments have been performed using simulated liquid metal fast breeder reactor fuel assemblies in the Thermal-Hydraulic Out-of-Reactor Safety (THORS) facility, an engineering-scale sodium loop. Objective of these tests has been to provide experimental data under conditions that might be encountered during a partial or total loss of the shutdown heat removal system (SHRS) in a reactor. The experiments have included single- and two-phase tests under quasi-steady and transient conditions, at both nominal and non-nominal system conditions. Results from these test indicate that the potential for reactor damage during degraded SHRS operation is extremely slight, and that natural circulation can be a major contributor to safe operation of the system in both single- and two-phase flow during such operation

  12. Genetic architecture of circulating lipid levels

    DEFF Research Database (Denmark)

    Demirkan, Ayşe; Amin, Najaf; Isaacs, Aaron

    2011-01-01

    Serum concentrations of low-density lipoprotein cholesterol (LDL-C), high-density lipoprotein cholesterol (HDL-C), triglycerides (TGs) and total cholesterol (TC) are important heritable risk factors for cardiovascular disease. Although genome-wide association studies (GWASs) of circulating lipid...... the ENGAGE Consortium GWAS on serum lipids, were applied to predict lipid levels in an independent population-based study, the Rotterdam Study-II (RS-II). We additionally tested for evidence of a shared genetic basis for different lipid phenotypes. Finally, the polygenic score approach was used to identify...... an alternative genome-wide significance threshold before pathway analysis and those results were compared with those based on the classical genome-wide significance threshold. Our study provides evidence suggesting that many loci influencing circulating lipid levels remain undiscovered. Cross-prediction models...

  13. On-Chip Microwave Quantum Hall Circulator

    Directory of Open Access Journals (Sweden)

    A. C. Mahoney

    2017-01-01

    Full Text Available Circulators are nonreciprocal circuit elements that are integral to technologies including radar systems, microwave communication transceivers, and the readout of quantum information devices. Their nonreciprocity arises from the interference of microwaves over the centimeter scale of the signal wavelength, in the presence of bulky magnetic media that breaks time-reversal symmetry. Here, we realize a completely passive on-chip microwave circulator with size 1/1000th the wavelength by exploiting the chiral, “slow-light” response of a two-dimensional electron gas in the quantum Hall regime. For an integrated GaAs device with 330  μm diameter and about 1-GHz center frequency, a nonreciprocity of 25 dB is observed over a 50-MHz bandwidth. Furthermore, the nonreciprocity can be dynamically tuned by varying the voltage at the port, an aspect that may enable reconfigurable passive routing of microwave signals on chip.

  14. Correlates of Circulating 25-Hydroxyvitamin D

    OpenAIRE

    McCullough, Marjorie L.; Weinstein, Stephanie J.; Freedman, D. Michal; Helzlsouer, Kathy; Flanders, W. Dana; Koenig, Karen; Kolonel, Laurence; Laden, Francine; Le Marchand, Loic; Purdue, Mark; Snyder, Kirk; Stevens, Victoria L.; Stolzenberg-Solomon, Rachael; Virtamo, Jarmo; Yang, Gong

    2010-01-01

    Low vitamin D status is common globally and is associated with multiple disease outcomes. Understanding the correlates of vitamin D status will help guide clinical practice, research, and interpretation of studies. Correlates of circulating 25-hydroxyvitamin D (25(OH)D) concentrations measured in a single laboratory were examined in 4,723 cancer-free men and women from 10 cohorts participating in the Cohort Consortium Vitamin D Pooling Project of Rarer Cancers, which covers a worldwide geogra...

  15. Circulating fluidized bed boilers design and operations

    CERN Document Server

    Basu, Prabir

    1991-01-01

    This book provides practicing engineers and students with insight into the design and operation of circulating fluidized bed (CFB) boilers. Through a combination of theoretical concepts and practical experience, this book gives the reader a basic understanding of the many aspects of this subject.Important environmental considerations, including solid waste disposal and predicted emissions, are addressed individually in separate chapters. This book places an emphasis on combustion, hydrodynamics, heat transfer, and material issues, and illustrates these concepts with numerous examples of pres

  16. Music Circulation and Transmission in Tbilisi, Georgia

    OpenAIRE

    Sebald, Brigita

    2013-01-01

    This dissertation, based upon two years research in Tbilisi, Georgia, questions how popular music travels from the performer to the audience and how it circulates among audience members. After the disintegration of the Soviet Union in the early 1990s, the state-run music industry collapsed, taking the infrastructure for music distribution with it. In the years since, a music industry has not been rebuilt due to uncertain economic realities and a shaky political situation. Because of this, per...

  17. Periodontitis and increase in circulating oxidative stress

    OpenAIRE

    Takaaki Tomofuji; Koichiro Irie; Toshihiro Sanbe; Tetsuji Azuma; Daisuke Ekuni; Naofumi Tamaki; Tatsuo Yamamoto; Manabu Morita

    2009-01-01

    Reactive oxygen species (ROS) are products of normal cellular metabolism. However, excessive production of ROS oxidizes DNA, lipids and proteins, inducing tissue damage. Studies have shown that periodontitis induces excessive ROS production in periodontal tissue. When periodontitis develops, ROS produced in the periodontal lesion diffuse into the blood stream, resulting in the oxidation of blood molecules (circulating oxidative stress). Such oxidation may be detrimental to systemic health. Fo...

  18. Engineering Judgment and Natural Circulation Calculations

    OpenAIRE

    Ferreri, J. C.

    2011-01-01

    The analysis performed to establish the validity of computer code results in the particular field of natural circulation flow stability calculations is presented in the light of usual engineering practice. The effects of discretization and closure correlations are discussed and some hints to avoid undesired mistakes in the evaluations performed are given. Additionally, the results are presented for an experiment relevant to the way in which a (small) number of skilled, nuclear safety analysts...

  19. Nitric oxide : An ally in extracorporeal circulation?

    OpenAIRE

    Melki, Vilyam

    2016-01-01

    Many complications associated with heart surgery are due to the negative effects of extracorporeal circulation (ECC). Some of these complications may be attributed to ECC-induced activation of inflammation and coagulation pathways. The inflammatory reaction may be caused by the interaction of blood components with air and the artificial surfaces of the ECC, from substances produced due to ischaemia-reperfusion injury of the heart and lungs, and from increased release of endotoxin from ischemi...

  20. The creation and circulation of public geographies

    OpenAIRE

    Kitchin, Rob; Linehan, Denis; O'Callaghan, Cian; Lawton, Philip

    2013-01-01

    In response to the commentaries, we discuss further how social media disrupts and remakes the creation and circulation of geographical knowledges and potentially reconfigures the moral economy of the social sciences. In particular, we examine questions of what is meant by public geography, the publics which such geographies serve, alternative and complementary approaches to social media, the politics of authorship within collective blogs, the politics and mechanisms of knowledge c...

  1. NUCLA Circulating Atmospheric Fluidized Bed Demonstration Project

    Energy Technology Data Exchange (ETDEWEB)

    1992-02-01

    The objective of this DOE Cooperative Agreement is to conduct a cost-shared clean coal technology project to demonstrate the feasibility of circulating fluidized bed combustion technology and to evaluate economic, environmental, and operational benefits of CFB steam generators on a utility scale. At the conclusion of the Phase 2 program, testing related to satisfying these objectives was completed. Data analysis and reporting are scheduled for completion by October 1991. (VC)

  2. First circulating beam in the AA

    CERN Multimedia

    CERN PhotoLab

    1980-01-01

    On 3 July 1980, two years after project authorization, beam circulated for the first time in the AA. It was a 3.5 GeV/c proton test beam. We see an expecting crowd, minutes before the happy event. The persons are to numerous to name them all. Heribert Koziol, apparently asleep, is answering the call from an impatient director. See also 8007094.

  3. Circulating procoagulant microparticles in cancer patients

    OpenAIRE

    Thaler, Johannes; Ay, Cihan; Weinstabl, Harald; Dunkler, Daniela; Simanek, Ralph; Vormittag, Rainer; Freyssinet, Jean-Marie; Zielinski, Christoph; Pabinger, Ingrid

    2010-01-01

    Abstract Accumulating evidence indicates that microparticles (MPs) are important mediators of the interaction between cancer and the hemostatic system. We conducted a large prospective cohort study to determine whether the number of circulating procoagulant MPs is elevated in cancer patients and whether the elevated MP levels are predictive of occurrence of venous thrombembolism (VTE). We analyzed plasma samples of 728 cancer patients from the ongoing prospective observational Vien...

  4. Circulation in a Short Cylindrical Couette System

    Energy Technology Data Exchange (ETDEWEB)

    Akira Kageyama; Hantao Ji; Jeremy Goodman

    2003-07-08

    In preparation for an experimental study of magnetorotational instability (MRI) in liquid metal, we explore Couette flows having height comparable to the gap between cylinders, centrifugally stable rotation, and high Reynolds number. Experiments in water are compared with numerical simulations. The flow is very different from that of an ideal, infinitely long Couette system. Simulations show that endcaps co-rotating with the outer cylinder drive a strong poloidal circulation that redistributes angular momentum. Predicted toroidal flow profiles agree well with experimental measurements. Spin-down times scale with Reynolds number as expected for laminar Ekman circulation; extrapolation from two-dimensional simulations at Re less than or equal to 3200 agrees remarkably well with experiment at Re approximately equal to 106. This suggests that turbulence does not dominate the effective viscosity. Further detailed numerical studies reveal a strong radially inward flow near both endcaps. After turning vertically along the inner cylinder, these flows converge at the midplane and depart the boundary in a radial jet. To minimize this circulation in the MRI experiment, endcaps consisting of multiple, differentially rotating rings are proposed. Simulations predict that an adequate approximation to the ideal Couette profile can be obtained with a few rings.

  5. Circulation in a Short Cylindrical Couette System

    International Nuclear Information System (INIS)

    Akira Kageyama; Hantao Ji; Jeremy Goodman

    2003-01-01

    In preparation for an experimental study of magnetorotational instability (MRI) in liquid metal, we explore Couette flows having height comparable to the gap between cylinders, centrifugally stable rotation, and high Reynolds number. Experiments in water are compared with numerical simulations. The flow is very different from that of an ideal, infinitely long Couette system. Simulations show that endcaps co-rotating with the outer cylinder drive a strong poloidal circulation that redistributes angular momentum. Predicted toroidal flow profiles agree well with experimental measurements. Spin-down times scale with Reynolds number as expected for laminar Ekman circulation; extrapolation from two-dimensional simulations at Re less than or equal to 3200 agrees remarkably well with experiment at Re approximately equal to 106. This suggests that turbulence does not dominate the effective viscosity. Further detailed numerical studies reveal a strong radially inward flow near both endcaps. After turning vertically along the inner cylinder, these flows converge at the midplane and depart the boundary in a radial jet. To minimize this circulation in the MRI experiment, endcaps consisting of multiple, differentially rotating rings are proposed. Simulations predict that an adequate approximation to the ideal Couette profile can be obtained with a few rings

  6. When Prostate Cancer Circulates in the Bloodstream

    Directory of Open Access Journals (Sweden)

    Virginie Vlaeminck-Guillem

    2015-10-01

    Full Text Available Management of patients with prostate cancer is currently based on imperfect clinical, biological, radiological and pathological evaluation. Prostate cancer aggressiveness, including metastatic potential, remains difficult to accurately estimate. In an attempt to better adapt therapeutics to an individual (personalized medicine, reliable evaluation of the intrinsic molecular biology of the tumor is warranted, and particularly for all tumor sites (primary tumors and secondary sites at any time of the disease progression. As a consequence of their natural tendency to grow (passive invasion or as a consequence of an active blood vessel invasion by metastase-initiating cells, tumors shed various materials into the bloodstream. Major efforts have been recently made to develop powerful and accurate methods able to detect, quantify and/or analyze all these circulating tumor materials: circulating tumors cells, disseminating tumor cells, extracellular vesicles (including exosomes, nucleic acids, etc. The aim of this review is to summarize current knowledge about these circulating tumor materials and their applications in translational research.

  7. Diagnosis of boundary-layer circulations.

    Science.gov (United States)

    Beare, Robert J; Cullen, Michael J P

    2013-05-28

    Diagnoses of circulations in the vertical plane provide valuable insights into aspects of the dynamics of the climate system. Dynamical theories based on geostrophic balance have proved useful in deriving diagnostic equations for these circulations. For example, semi-geostrophic theory gives rise to the Sawyer-Eliassen equation (SEE) that predicts, among other things, circulations around mid-latitude fronts. A limitation of the SEE is the absence of a realistic boundary layer. However, the coupling provided by the boundary layer between the atmosphere and the surface is fundamental to the climate system. Here, we use a theory based on Ekman momentum balance to derive an SEE that includes a boundary layer (SEEBL). We consider a case study of a baroclinic low-level jet. The SEEBL solution shows significant benefits over Ekman pumping, including accommodating a boundary-layer depth that varies in space and structure, which accounts for buoyancy and momentum advection. The diagnosed low-level jet is stronger than that determined by Ekman balance. This is due to the inclusion of momentum advection. Momentum advection provides an additional mechanism for enhancement of the low-level jet that is distinct from inertial oscillations.

  8. The dynamics of the coronary collateral circulation.

    Science.gov (United States)

    Zimarino, Marco; D'Andreamatteo, Mariangela; Waksman, Ron; Epstein, Stephen E; De Caterina, Raffaele

    2014-04-01

    Coronary collaterals are present at birth, with wide interindividual variation in their functional capacity. These vessels protect jeopardized myocardium, and the number of collaterals and the extent of their coverage are associated with improved survival in patients with coronary heart disease. The collateral circulation is not a permanent set of structures, but undergoes dynamic changes with important consequences for cardioprotection. If a severe atherosclerotic lesion develops in an artery supplying tissue downstream of a total occlusion through collateral blood flow, pressure gradients across the collateral bed change. The result is that some of the collateral flow previously supplying the perfusion territory of the totally occluded artery is redirected to the perfusion territory of the donor artery, thus producing a 'collateral steal'. The collateral circulation can regress once antegrade flow in the main dependent artery is re-established, as occurs following the recanalization of a chronic total occlusion. The clinical benefits of coronary revascularization must be cautiously weighed against the risk of reducing the protective support derived from coronary collaterals. Consequently, pharmacological, gene-based, and cell-based therapeutic attempts have been made to enhance collateral function. Although such approaches have so far yielded no, or modest, beneficial results, the rapidly accruing data on coronary collateral circulation will hopefully lead to new effective therapeutic strategies.

  9. Circulation of a triaxial, charged ellipsoidal droplet

    International Nuclear Information System (INIS)

    Graber, J.L.; Rosensteel, G.

    2002-01-01

    The Kelvin circulation, which is the Casimir invariant of the general collective motion gcm(3) Lie algebra, is determined for a rapidly rotating triaxial nucleus in the classical domain. The potential energy is approximated by the sum of Coulomb repulsion and attractive surface energy terms, and the kinetic energy is adopted from the Riemann ellipsoidal model. An accurate approximation valid for both small and large deformations is reported for the potential energy. The Riemann ellipsoid theory allows for collective rotation in the continuum from rigid body motion to irrotational flow; the rigidity parametrizes this kinematical continuum. Analytic formulas are derived for the circulation, angular momentum, and energy as functions of the axis lengths, fissility, and rigidity. In particular, the bifurcation point to Jacobi triaxial shapes from noncollective oblate spheroids is given by a simple analytic formula. For a given fissility, the bifurcation point depends sensitive- ly on the rigidity. The Kelvin circulation remains approximately constant for triaxial ellipsoids as the angular momentum increases. This implies that gcm(3) is an approximate partial dynamical symmetry for rapidly rotating triaxial nuclei

  10. Formation of germline chimera Gaok chicken used circulation primordial germ cells (circulation PGCs fresh and thawed

    Directory of Open Access Journals (Sweden)

    Kostaman T

    2014-03-01

    Full Text Available Formation of germline chimeras by transfer of chicken primordial germ cells (PGCs is one of the effective techniques for preservation and regeneration of genetic resources in chickens. This study attempted to form germline chimeras of Gaok chicken buy purifying circulated PGCs of donor embryo before it is transferred to the recipient (White Leghorn chickens=WL and studied the ability of recipient embryo on survival in incubators, and hatchability. This study used 200 fertile eggs of Gaok and 90 fertile WL breed all of the eggs was incubated at 380C and 60% humidity in a portable incubator. PGCs-circulation of the blood collected Gaok embryos at stage 14-16 were taken from the dorsal aorta, and then purified by centrifugation method using nycodenz. PGCs-circulation results further purification frozen in liquid nitrogen before being transferred to the recipient embryo. The results showed that for the development of embryos transferred to the fresh circulation of PGCs-circulation as many as 25 cells can survive up to day 14, while one of the transferred of 50 and 100 cells into recipient embryos was hatched (10%. On the contrari recipient embryos that are transferred to the frozen PGCs-circulation the embryos development was shorter, and only survived until day 10th (treatment 25 cells, day 14th (treatment of 50 cells and day 17th (treatment of 100 cells. It is concluded that the amount of PGCs-circulation embryos transferred to the recipient is one factor that influence the success of the development germline chimeras.

  11. 19 CFR 207.63 - Circulation of draft questionnaires.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 3 2010-04-01 2010-04-01 false Circulation of draft questionnaires. 207.63... SUBSIDIZED EXPORTS TO THE UNITED STATES Five-Year Reviews § 207.63 Circulation of draft questionnaires. (a) The Director shall circulate draft questionnaires to the parties for comment in each full review. (b...

  12. Characteristics of the Current Sales and Circulation System in China

    Institute of Scientific and Technical Information of China (English)

    our reporter

    2001-01-01

    <正> 5 Former circulation enterprises finding new market position Those large-sized auto circulation enterprises, which used to lead the circulation system, have been suffering the twist and turns from the new system oriented by automakers. Their market shares shapely fell down and have emerged into chaos. Parts of them that are powerful enough have established new sales companies controlled by the jointly

  13. Exact Inverse Matrices of Fermat and Mersenne Circulant Matrix

    Directory of Open Access Journals (Sweden)

    Yanpeng Zheng

    2015-01-01

    Full Text Available The well known circulant matrices are applied to solve networked systems. In this paper, circulant and left circulant matrices with the Fermat and Mersenne numbers are considered. The nonsingularity of these special matrices is discussed. Meanwhile, the exact determinants and inverse matrices of these special matrices are presented.

  14. Appraisal of circulation routine duties in academic libraries | Hassan ...

    African Journals Online (AJOL)

    ... of brown charging system, book reservation, keeping of reserved collection, circulation of reserved books, treatment of overdue, lost of books on loan and library statistics among other as duties perform in circulation department of libraries. Keywords: Library Service, Circulation Duties, Challenges, Academic Libraries ...

  15. The stability of the thermohaline circulation in a coupled ocean-atmosphere general circulation model

    Energy Technology Data Exchange (ETDEWEB)

    Schiller, A. [Max-Planck-Institut fuer Meteorologie, Hamburg (Germany); Mikolajewicz, U. [Max-Planck-Institut fuer Meteorologie, Hamburg (Germany); Voss, R. [Deutsches Klimarechenzentrum (DKRZ), Hamburg (Germany)

    1996-02-01

    The stability of the Atlantic thermohaline circulation against meltwater input is investigated in a coupled ocean-atmosphere general circulation model. The meltwater input to the Labrador Sea is increased linearly for 250 years to a maximum input of 0.625 Sv and then reduced again to 0 (both instantaneously and slowly decreasing over 250 years). The resulting freshening forces a shutdown of the formation of North Atlantic deepwater and a subsequent reversal of the thermohaline circulation of the Atlantic, filling the deep Atlantic with Antarctic bottom water. The change in the overturning pattern causes a drastic reduction of the Atlantic northward heat transport, resulting in a strong cooling with maximum amplitude over the northern North Atlantic and a southward shift of the sea-ice margin in the Atlantic. Due to the increased meridional temperature gradient, the Atlantic intertropical convergence zone is displaced southward and the westerlies in the northern hemisphere gain strength. We identify four main feedbacks affecting the stability of the thermohaline circulation: the change in the overturning circulation of the Atlantic leads to longer residence times of the surface waters in high northern latitudes, which allows them to accumulate more precipitation and runoff from the continents, which results in an increased stability in the North Atlantic.

  16. Seasonal overturning circulation in the Red Sea: 1. Model validation and summer circulation

    KAUST Repository

    Yao, Fengchao

    2014-04-01

    The overturning circulation in the Red Sea exhibits a distinct seasonally reversing pattern and is studied using high-resolution MIT general circulation model simulations. In the first part of this study, the vertical and horizontal structure of the summer overturning circulation and its dynamical mechanisms are presented from the model results. The seasonal water exchange in the Strait of Bab el Mandeb is successfully simulated, and the structures of the intruding subsurface Gulf of Aden intermediate water are in good agreement with summer observations in 2011. The model results suggest that the summer overturning circulation is driven by the combined effect of the shoaling of the thermocline in the Gulf of Aden resulting from remote winds in the Arabian Sea and an upward surface slope from the Red Sea to the Gulf of Aden set up by local surface winds in the Red Sea. In addition, during late summer two processes associated, respectively, with latitudinally differential heating and increased salinity in the southern Red Sea act together to cause the reversal of the contrast of the vertical density structure and the cessation of the summer overturning circulation. Dynamically, the subsurface northward pressure gradient force is mainly balanced by vertical viscosity resulting from the vertical shear and boundary friction in the Strait of Bab el Mandeb. Unlike some previous studies, the three-layer summer exchange flows in the Strait of Bab el Mandeb do not appear to be hydraulically controlled.

  17. Seasonal overturning circulation in the Red Sea: 1. Model validation and summer circulation

    KAUST Repository

    Yao, Fengchao; Hoteit, Ibrahim; Pratt, Larry J.; Bower, Amy S.; Zhai, Ping; Kö hl, Armin; Gopalakrishnan, Ganesh

    2014-01-01

    The overturning circulation in the Red Sea exhibits a distinct seasonally reversing pattern and is studied using high-resolution MIT general circulation model simulations. In the first part of this study, the vertical and horizontal structure of the summer overturning circulation and its dynamical mechanisms are presented from the model results. The seasonal water exchange in the Strait of Bab el Mandeb is successfully simulated, and the structures of the intruding subsurface Gulf of Aden intermediate water are in good agreement with summer observations in 2011. The model results suggest that the summer overturning circulation is driven by the combined effect of the shoaling of the thermocline in the Gulf of Aden resulting from remote winds in the Arabian Sea and an upward surface slope from the Red Sea to the Gulf of Aden set up by local surface winds in the Red Sea. In addition, during late summer two processes associated, respectively, with latitudinally differential heating and increased salinity in the southern Red Sea act together to cause the reversal of the contrast of the vertical density structure and the cessation of the summer overturning circulation. Dynamically, the subsurface northward pressure gradient force is mainly balanced by vertical viscosity resulting from the vertical shear and boundary friction in the Strait of Bab el Mandeb. Unlike some previous studies, the three-layer summer exchange flows in the Strait of Bab el Mandeb do not appear to be hydraulically controlled.

  18. Bioimpedance harmonic analysis as a tool to simultaneously assess circulation and nervous control.

    Science.gov (United States)

    Mudraya, I S; Revenko, S V; Nesterov, A V; Gavrilov, I Yu; Kirpatovsky, V I

    2011-07-01

    Multicycle harmonic (Fourier) analysis of bioimpedance was employed to simultaneously assess circulation and neural activity in visceral (rat urinary bladder) and somatic (human finger) organs. The informative value of the first cardiac harmonic of the bladder impedance as an index of bladder circulation is demonstrated. The individual reactions of normal and obstructive bladders in response to infusion cystometry were recorded. The potency of multicycle harmonic analysis of bioimpedance to assess sympathetic and parasympathetic neural control in urinary bladder is discussed. In the human finger, bioimpedance harmonic analysis revealed three periodic components at the rate of the heart beat, respiration and Mayer wave (0.1 Hz), which were observed under normal conditions and during blood flow arrest in the hand. The revealed spectrum peaks were explained by the changes in systemic blood pressure and in regional vascular tone resulting from neural vasomotor control. During normal respiration and circulation, two side cardiac peaks were revealed in a bioimpedance amplitude spectrum, whose amplitude reflected the depth of amplitude respiratory modulation of the cardiac output. During normal breathing, the peaks corresponding to the second and third cardiac harmonics were split, reflecting frequency respiratory modulation of the heart rate. Multicycle harmonic analysis of bioimpedance is a novel potent tool to examine the interaction between the respiratory and cardiovascular system and to simultaneously assess regional circulation and neural influences in visceral and somatic organs.

  19. Gas Cooled Fast Breeder Reactor cost estimate for a circulator test facility (modified HTGR circulator test facility)

    International Nuclear Information System (INIS)

    1979-10-01

    This is a conceptual design cost estimate for a Helium Circulator Test Facility to be located at the General Atomic Company, San Diego, California. The circulator, drive motors, controllers, thermal barrier, and circulator service module installation costs are part of the construction cost included

  20. Explicit Determinants of the RFPrLrR Circulant and RLPrFrL Circulant Matrices Involving Some Famous Numbers

    Directory of Open Access Journals (Sweden)

    Tingting Xu

    2014-01-01

    Full Text Available Circulant matrices may play a crucial role in solving various differential equations. In this paper, the techniques used herein are based on the inverse factorization of polynomial. We give the explicit determinants of the RFPrLrR circulant matrices and RLPrFrL circulant matrices involving Fibonacci, Lucas, Pell, and Pell-Lucas number, respectively.

  1. Gas cooled fast breeder reactor design for a circulator test facility (modified HTGR circulator test facility)

    Energy Technology Data Exchange (ETDEWEB)

    1979-10-01

    A GCFR helium circulator test facility sized for full design conditions is proposed for meeting the above requirements. The circulator will be mounted in a large vessel containing high pressure helium which will permit testing at the same power, speed, pressure, temperature and flow conditions intended in the demonstration plant. The electric drive motor for the circulator will obtain its power from an electric supply and distribution system in which electric power will be taken from a local utility. The conceptual design decribed in this report is the result of close interaction between the General Atomic Company (GA), designer of the GCFR, and The Ralph M. Parson Company, architect/engineer for the test facility. A realistic estimate of total project cost is presented, together with a schedule for design, procurement, construction, and inspection.

  2. Power limit and quality limit of natural circulation reactor

    International Nuclear Information System (INIS)

    Zhao Guochang; Ma Changwen

    1997-01-01

    The circulation characteristics of natural circulation reactor in boiling regime are researched. It is found that, the circulation mass flow rate and the power have a peak value at a mass quality respectively. Therefore, the natural circulation reactor has a power limit under certain technological condition. It can not be increased steadily by continually increasing the mass quality. Corresponding to this, the mass quality of natural circulation reactor has a reasonable limit. The relations between the maximum power and the reactor parameters, such as the resistance coefficient, the working pressure and so on, are analyzed. It is pointed out that the power limit of natural circulation reactor is about 1000 MW at present technological condition. Taking the above result and low quality stability experimental result into account, the authors recommend that the reasonable mass quality of natural circulation reactor working in boiling regime is from 2% to 3% under the researched working pressure

  3. Liquid Biopsy for Cancer: Circulating Tumor Cells, Circulating Free DNA or Exosomes?

    Directory of Open Access Journals (Sweden)

    Wei Zhang

    2017-02-01

    Full Text Available Precision medicine and personalized medicine are based on the development of biomarkers, and liquid biopsy has been reported to be able to detect biomarkers that carry information on tumor development and progression. Compared with traditional ‘solid biopsy’, which cannot always be performed to determine tumor dynamics, liquid biopsy has notable advantages in that it is a noninvasive modality that can provide diagnostic and prognostic information prior to treatment, during treatment and during progression. In this review, we describe the source, characteristics, technology for detection and current situation of circulating tumor cells, circulating free DNA and exosomes used for diagnosis, recurrence monitoring, prognosis assessment and medication planning.

  4. Seawater bicarbonate removal during hydrothermal circulation

    Science.gov (United States)

    Proskurowski, G. K.; Seewald, J.; Sylva, S. P.; Reeves, E.; Lilley, M. D.

    2013-12-01

    High temperature fluids sampled at hydrothermal vents represent a complex alteration product of water-rock reactions on a multi-component mixture of source fluids. Sources to high-temperature hydrothermal samples include the 'original' seawater present in the recharge limb of circulation, magmatically influenced fluids added at depth as well as any seawater entrained during sampling. High-temperature hydrothermal fluids are typically enriched in magmatic volatiles, with CO2 the dominant species, characterized by concentrations of 10's-100's of mmol/kg (1, 2). Typically, the high concentration of CO2 relative to background seawater bicarbonate concentrations (~2.3 mmol/kg) obscures a full analysis of the fate of seawater bicarbonate during high-temperature hydrothermal circulation. Here we present data from a suite of samples collected over the past 15 years from high-temperature hydrothermal vents at 9N, Endeavour, Lau Basin, and the MAR that have endmember CO2 concentrations less than 10 mmol/kg. Using stable and radiocarbon isotope measurements these samples provide a unique opportunity to examine the balance between 'original' seawater bicarbonate and CO2 added from magmatic sources. Multiple lines of evidence from multiple hydrothermal settings consistently points to the removal of ~80% of the 'original' 2.3 mmol/kg seawater bicarbonate. Assuming that this removal occurs in the low-temperature, 'recharge' limb of hydrothermal circulation, this removal process is widely occurring and has important contributions to the global carbon cycle over geologic time. 1. Lilley MD, Butterfield DA, Lupton JE, & Olson EJ (2003) Magmatic events can produce rapid changes in hydrothermal vent chemistry. Nature 422(6934):878-881. 2. Seewald J, Cruse A, & Saccocia P (2003) Aqueous volatiles in hydrothermal fluids from the Main Endeavour Field, northern Juan de Fuca Ridge: temporal variability following earthquake activity. Earth and Planetary Science Letters 216(4):575-590.

  5. Bottom water circulation in Cascadia Basin

    Science.gov (United States)

    Hautala, Susan L.; Paul Johnson, H.; Hammond, Douglas E.

    2009-10-01

    A combination of beta spiral and minimum length inverse methods, along with a compilation of historical and recent high-resolution CTD data, are used to produce a quantitative estimate of the subthermocline circulation in Cascadia Basin. Flow in the North Pacific Deep Water, from 900-1900 m, is characterized by a basin-scale anticyclonic gyre. Below 2000 m, two water masses are present within the basin interior, distinguished by different potential temperature-salinity lines. These water masses, referred to as Cascadia Basin Bottom Water (CBBW) and Cascadia Basin Deep Water (CBDW), are separated by a transition zone at about 2400 m depth. Below the depth where it freely communicates with the broader North Pacific, Cascadia Basin is renewed by northward flow through deep gaps in the Blanco Fracture Zone that feeds the lower limb of a vertical circulation cell within the CBBW. Lower CBBW gradually warms and returns to the south at lighter density. Isopycnal layer renewal times, based on combined lateral and diapycnal advective fluxes, increase upwards from the bottom. The densest layer, existing in the southeast quadrant of the basin below ˜2850 m, has an advective flushing time of 0.6 years. The total volume flushing time for the entire CBBW is 2.4 years, corresponding to an average water parcel residence time of 4.7 years. Geothermal heating at the Cascadia Basin seafloor produces a characteristic bottom-intensified temperature anomaly and plays an important role in the conversion of cold bottom water to lighter density within the CBBW. Although covering only about 0.05% of the global seafloor, the combined effects of bottom heat flux and diapycnal mixing within Cascadia Basin provide about 2-3% of the total required global input to the upward branch of the global thermohaline circulation.

  6. Containment air circulation for optimal hydrogen recombination

    International Nuclear Information System (INIS)

    Spinks, N.; Krause, M.

    1997-01-01

    An accepted first-line defense for hydrogen mitigation is to design for the hydrogen to be rapidly mixed with the containment atmosphere and diluted to below flammability concentrations. Then, as hydrogen continues to be produced in the longer term, recombiners can be used to remove hydrogen: recombiners can be located in forced-air ducts or passive recombiners can be distributed within containment and the heat of recombination used to promote local air circulation. However, this principle does not eliminate the possibility of high hydrogen concentrations at locations removed from the recombiners. An improvement on this strategy is to arrange for a specific, buoyancy-driven, overall circulation of the containment atmosphere s