WorldWideScience

Sample records for circulating human erythroid

  1. Transcriptome dynamics during human erythroid differentiation and development.

    Science.gov (United States)

    Yang, Yadong; Wang, Hai; Chang, Kai-Hsin; Qu, Hongzhu; Zhang, Zhaojun; Xiong, Qian; Qi, Heyuan; Cui, Peng; Lin, Qiang; Ruan, Xiuyan; Yang, Yaran; Li, Yajuan; Shu, Chang; Li, Quanzhen; Wakeland, Edward K; Yan, Jiangwei; Hu, Songnian; Fang, Xiangdong

    2013-01-01

    To explore the mechanisms controlling erythroid differentiation and development, we analyzed the genome-wide transcription dynamics occurring during the differentiation of human embryonic stem cells (HESCs) into the erythroid lineage and development of embryonic to adult erythropoiesis using high throughput sequencing technology. HESCs and erythroid cells at three developmental stages: ESER (embryonic), FLER (fetal), and PBER (adult) were analyzed. Our findings revealed that the number of expressed genes decreased during differentiation, whereas the total expression intensity increased. At each of the three transitions (HESCs-ESERs, ESERs-FLERs, and FLERs-PBERs), many differentially expressed genes were observed, which were involved in maintaining pluripotency, early erythroid specification, rapid cell growth, and cell-cell adhesion and interaction. We also discovered dynamic networks and their central nodes in each transition. Our study provides a fundamental basis for further investigation of erythroid differentiation and development, and has implications in using ESERs for transfusion product in clinical settings.

  2. Identification of human erythroid lineage-committed progenitors.

    Science.gov (United States)

    Mori, Yasuo; Akashi, Koichi; Weissman, Irving L

    2016-05-01

    Elucidating the developmental pathway leading to erythrocytes and being able to isolate their progenitors is crucial to understanding and treating disorders of red cell imbalance such as anemia, myelodysplastic syndrome, and polycythemia vera. Endoglin (CD105) is a key marker for purifying mouse erythroid lineage-committed progenitors (EPs) from bone marrow. Herein, we show that human EPs can also be isolated from adult bone marrow. We identified three subfractions that possessed different expression patterns of CD105 and CD71 within the previously defined human megakaryocyte/erythrocyte progenitor (hMEP; Lineage-CD34(+)CD38(+)IL-3Rα(-)CD45RA(-)) population. Both CD71(-)CD105(-) and CD71(+)CD105(-) MEPs, at least in vitro, retained bipotency for the megakaryocyte (MegK) and erythrocyte (E) lineages, although the latter sub-population had a differentiation potential skewed toward the E-lineage. Notably, the differentiation output of the CD71(+)CD105(+) subset of cells within the MEP population was completely restricted to the E-lineage with the loss of MegK potential; thus, we termed CD71(+)CD105(-) MEPs and CD71(+)CD105(+) cells as E-biased MEPs (E-MEPs) and EPs, respectively. These previously unclassified populations may facilitate understanding of the molecular mechanisms governing human erythroid development and serve as potential therapeutic targets in disorders of the erythroid lineage. PMID:27263782

  3. Erythropoietin stimulates a rise in intracellular free calcium concentration in single early human erythroid precursors.

    OpenAIRE

    Miller, B A; Scaduto, R C; Tillotson, D L; Botti, J J; Cheung, J Y

    1988-01-01

    Erythropoietin and granulocyte-macrophage colony-stimulating factor (GM-CSF) stimulate the differentiation and proliferation of erythroid cells. To determine the cellular mechanism of action of these growth factors, we measured changes in intracellular free calcium concentration [( Cac]) in single human erythroid precursors in response to recombinant erythropoietin and GM-CSF. [Cac] in immature erythroblasts derived from cultured human cord blood erythroid progenitors was measured with fluore...

  4. Gene expression profiling of human erythroid progenitors by micro-serial analysis of gene expression.

    Science.gov (United States)

    Fujishima, Naohito; Hirokawa, Makoto; Aiba, Namiko; Ichikawa, Yoshikazu; Fujishima, Masumi; Komatsuda, Atsushi; Suzuki, Yoshiko; Kawabata, Yoshinari; Miura, Ikuo; Sawada, Ken-ichi

    2004-10-01

    We compared the expression profiles of highly purified human CD34+ cells and erythroid progenitor cells by micro-serial analysis of gene expression (microSAGE). Human CD34+ cells were purified from granulocyte colony-stimulating factor-mobilized blood stem cells, and erythroid progenitors were obtained by cultivating these cells in the presence of stem cell factor, interleukin 3, and erythropoietin. Our 10,202 SAGE tags allowed us to identify 1354 different transcripts appearing more than once. Erythroid progenitor cells showed increased expression of LRBA, EEF1A1, HSPCA, PILRB, RANBP1, NACA, and SMURF. Overexpression of HSPCA was confirmed by real-time polymerase chain reaction analysis. MicroSAGE revealed an unexpected preferential expression of several genes in erythroid progenitor cells in addition to the known functional genes, including hemoglobins. Our results provide reference data for future studies of gene expression in various hematopoietic disorders, including myelodysplastic syndrome and leukemia.

  5. Propagation of human parvovirus B19 in primary culture of erythroid lineage cells derived from fetal liver.

    OpenAIRE

    Yaegashi, N; Shiraishi, H; Takeshita, T.; Nakamura, M.; Yajima, A; Sugamura, K

    1989-01-01

    Erythroid lineage cells derived from fetal liver were demonstrated to be target cells for human parvovirus B19 infection. B19 virus antigen-positive serum was inoculated into primary cultures containing erythroid lineage cells enriched from fetal liver. The B19 virus antigen was detected on about 5% of cells in the culture by immunofluorescence staining, and the stained cells were identified as erythroid lineage cells by double staining with anti-B19 virus-positive serum and anti-erythroid li...

  6. Binding and internalization of recombinant human erythropoietin in murine erythroid precursor cells

    International Nuclear Information System (INIS)

    Erythropoietin (EPO) biosynthetically labelled with [35S]cysteine was produced from Chinese hamster ovary (CHO) cells containing amplified copies of human EPO cDNA. The glycosylated recombinant [35S]EPO, purified to virtual radiochemical homogeneity, was biologically active. We studied the interaction of this labeled recombinant EPO with erythroid precursor cells from mice made anemic with phenylhydrazine. The [35S]-labeled molecule bound to erythroid precursors in a time- and temperature-dependent manner. The binding was specific for EPO, and neither insulin, transferrin, epidermal growth factor, nor multiplication stimulating activity could compete for EPO binding sites. In the presence of 0.2% sodium azide, which blocks 80% to 90% of internalization, the recombinant molecule bound with an apparent Kd of 750 pmol/L and 100 to 200 binding sites per cell at 37 degrees C. Asialo-EPO was a more effective competitor than sialated EPO for the available binding sites. Thus, the enhanced biological specific activity of asialo-EPO could result from its enhanced binding affinity. We also studied recombinant human EPO labeled with 125I and found that it also bound to the erythroid cells in a saturable and specific manner. After 90 minutes of incubation at 37 degrees C, most of the bound [35S]EPO was internalized, whereas most of the [125I]EPO remained on the cell surface. The reduced internalization of the iodinated molecule could account for the previously reported functional deficit associated with iodination

  7. Binding and internalization of recombinant human erythropoietin in murine erythroid precursor cells

    Energy Technology Data Exchange (ETDEWEB)

    Mufson, R.A.; Gesner, T.G.

    1987-05-01

    Erythropoietin (EPO) biosynthetically labelled with (/sup 35/S)cysteine was produced from Chinese hamster ovary (CHO) cells containing amplified copies of human EPO cDNA. The glycosylated recombinant (/sup 35/S)EPO, purified to virtual radiochemical homogeneity, was biologically active. We studied the interaction of this labeled recombinant EPO with erythroid precursor cells from mice made anemic with phenylhydrazine. The (/sup 35/S)-labeled molecule bound to erythroid precursors in a time- and temperature-dependent manner. The binding was specific for EPO, and neither insulin, transferrin, epidermal growth factor, nor multiplication stimulating activity could compete for EPO binding sites. In the presence of 0.2% sodium azide, which blocks 80% to 90% of internalization, the recombinant molecule bound with an apparent Kd of 750 pmol/L and 100 to 200 binding sites per cell at 37 degrees C. Asialo-EPO was a more effective competitor than sialated EPO for the available binding sites. Thus, the enhanced biological specific activity of asialo-EPO could result from its enhanced binding affinity. We also studied recombinant human EPO labeled with /sup 125/I and found that it also bound to the erythroid cells in a saturable and specific manner. After 90 minutes of incubation at 37 degrees C, most of the bound (/sup 35/S)EPO was internalized, whereas most of the (/sup 125/I)EPO remained on the cell surface. The reduced internalization of the iodinated molecule could account for the previously reported functional deficit associated with iodination.

  8. Eos negatively regulates human γ-globin gene transcription during erythroid differentiation.

    Directory of Open Access Journals (Sweden)

    Hai-Chuan Yu

    Full Text Available BACKGROUND: Human globin gene expression is precisely regulated by a complicated network of transcription factors and chromatin modifying activities during development and erythropoiesis. Eos (Ikaros family zinc finger 4, IKZF4, a member of the zinc finger transcription factor Ikaros family, plays a pivotal role as a repressor of gene expression. The aim of this study was to examine the role of Eos in globin gene regulation. METHODOLOGY/PRINCIPAL FINDINGS: Western blot and quantitative real-time PCR detected a gradual decrease in Eos expression during erythroid differentiation of hemin-induced K562 cells and Epo-induced CD34+ hematopoietic stem/progenitor cells (HPCs. DNA transfection and lentivirus-mediated gene transfer demonstrated that the enforced expression of Eos significantly represses the expression of γ-globin, but not other globin genes, in K562 cells and CD34+ HPCs. Consistent with a direct role of Eos in globin gene regulation, chromatin immunoprecipitaion and dual-luciferase reporter assays identified three discrete sites located in the DNase I hypersensitivity site 3 (HS3 of the β-globin locus control region (LCR, the promoter regions of the Gγ- and Aγ- globin genes, as functional binding sites of Eos protein. A chromosome conformation capture (3C assay indicated that Eos may repress the interaction between the LCR and the γ-globin gene promoter. In addition, erythroid differentiation was inhibited by enforced expression of Eos in K562 cells and CD34+ HPCs. CONCLUSIONS/SIGNIFICANCE: Our results demonstrate that Eos plays an important role in the transcriptional regulation of the γ-globin gene during erythroid differentiation.

  9. Identification and purification of human erythroid progenitor cells by monoclonal antibody to the transferrin receptor (TU 67).

    Science.gov (United States)

    Herrmann, F; Griffin, J D; Sabbath, K D; Oster, W; Wernet, P; Mertelsmann, R

    1988-04-01

    Anti-TU 67 is a murine monoclonal antibody that recognizes the transferrin receptor. With respect to hematopoietic cells TU 67 is expressed by human multipotent colony-forming cells (CFU-Mix), erythroid progenitor cells (BFU-E and CFU-E) and a fraction of granulocyte/monocyte colony forming cells, but is not expressed by mature hematopoietic cells including erythrocytes, platelets, lymphocytes, and peripheral blood myeloid cells. The TU 67-positive fraction of normal bone marrow, separated by fluorescence-activated cell sorting (FACS) or immune rosettes, contained 87% of the erythroid progenitor cells. Erythroid progenitor cells were enriched up to 50-fold by using a combination of monoclonal antibodies to deplete mature hematopoietic cells, followed by positive selection of BFU-E and CFU-E by TU 67 antibody.

  10. Embryonic----Fetal Hb switch in humans: studies on erythroid bursts generated by embryonic progenitors from yolk sac and liver.

    Science.gov (United States)

    Peschle, C; Migliaccio, A R; Migliaccio, G; Petrini, M; Calandrini, M; Russo, G; Mastroberardino, G; Presta, M; Gianni, A M; Comi, P

    1984-04-01

    The synthesis of embryonic (zeta, epsilon), fetal (alpha, gamma), and adult (beta) globin was evaluated in human yolk sacs (YS) and livers at different ontogenic stages (i.e., from 6 through 10-12 wk of age) by means of analytical isoelectric focusing. Globin production was comparatively evaluated in vivo (i.e., in directly labeled erythroblasts from YS and liver) and in vitro [i.e., in erythroid bursts generated in culture by erythroid burst-forming units (BFU-E) from the same erythropoietic tissues]. Erythroid bursts generated in vitro by BFU-E from 6-wk livers and YS show essentially a "fetal" globin synthetic pattern: this is in sharp contrast to the "embryonic" pattern in corresponding liver and YS erythroblasts directly labeled in vivo. The invitro phenomenon suggests that (i) 6-wk BFU-E constitute a new generation of progenitors, which have already switched from an embryonic to a fetal program, and/or (ii) expression of their fetal program is induced by unknown in vitro factor(s), which may underlie the in vivo switch at later ontogenic stages. It is emphasized that 6- to 7-wk BFU-E are endowed with the potential for in vitro synthesis of not only epsilon- and gamma-chains but also some beta-globin. In general, we observed an inverse correlation between the levels of epsilon- and beta-chain synthesis. These results, together with previous studies on fetal, perinatal, and adult BFU-E, are compatible with models suggesting that in ontogeny the chromatin configuration is gradually modified at the level of the non-alpha gene cluster, thus leading to a 5'----3' activation of globin genes in a balanced fashion. PMID:6201856

  11. Parvovirus B19 promoter at map unit 6 confers autonomous replication competence and erythroid specificity to adeno-associated virus 2 in primary human hematopoietic progenitor cells.

    OpenAIRE

    Wang, X S; Yoder, M C; Zhou, S. Z.; A Srivastava

    1995-01-01

    The pathogenic human parvovirus B19 is an autonomously replicating virus with a remarkable tropism for human erythroid progenitor cells. Although the target cell specificity for B19 infection has been suggested to be mediated by the erythrocyte P-antigen receptor (globoside), a number of nonerythroid cells that express this receptor are nonpermissive for B19 replication. To directly test the role of expression from the B19 promoter at map unit 6 (B19p6) in the erythroid cell specificity of B1...

  12. Differentiation Potential of O Bombay Human-Induced Pluripotent Stem Cells and Human Embryonic Stem Cells into Fetal Erythroid-Like Cells

    Directory of Open Access Journals (Sweden)

    Fatemeh Ganji,

    2015-01-01

    Full Text Available Objective: There is constant difficulty in obtaining adequate supplies of blood components, as well as disappointing performance of "universal" red blood cells. Advances in somatic cell reprogramming of human-induced pluripotent stem cells (hiPSCs have provided a valuable alternative source to differentiate into any desired cell type as a therapeutic promise to cure many human disease. Materials and Methods: In this experimental study, we examined the erythroid differentiation potential of normal Bombay hiPSCs (B-hiPSCs and compared results to human embryonic stem cell (hESC lines. Because of lacking ABO blood group expression in B-hiPSCs, it has been highlighted as a valuable source to produce any cell type in vitro. Results: Similar to hESC lines, hemangioblasts derived from B-hiPSCs expressed approximately 9% KDR+CD31+ and approximately 5% CD31+CD34+. In semisolid media, iPSC and hESC-derived hemangioblast formed mixed type of hematopoietic colony. In mixed colonies, erythroid progenitors were capable to express CD71+GPA+HbF+ and accompanied by endothelial cells differentiation. Conclusion: Finally, iPS and ES cells have been directly induced to erythropoiesis without hemangioblast formation that produced CD71+HbF+erythroid cells. Although we observed some variations in the efficiency of hematopoietic differentiation between iPSC and ES cells, the pattern of differentiation was similar among all three tested lines.

  13. H-Ferritin Is Preferentially Incorporated by Human Erythroid Cells through Transferrin Receptor 1 in a Threshold-Dependent Manner.

    Directory of Open Access Journals (Sweden)

    Soichiro Sakamoto

    Full Text Available Ferritin is an iron-storage protein composed of different ratios of 24 light (L and heavy (H subunits. The serum level of ferritin is a clinical marker of the body's iron level. Transferrin receptor (TFR1 is the receptor not only for transferrin but also for H-ferritin, but how it binds two different ligands and the blood cell types that preferentially incorporate H-ferritin remain unknown. To address these questions, we investigated hematopoietic cell-specific ferritin uptake by flow cytometry. Alexa Fluor 488-labeled H-ferritin was preferentially incorporated by erythroid cells among various hematopoietic cell lines examined, and was almost exclusively incorporated by bone marrow erythroblasts among human primary hematopoietic cells of various lineages. H-ferritin uptake by erythroid cells was strongly inhibited by unlabeled H-ferritin but was only partially inhibited by a large excess of holo-transferrin. On the other hand, internalization of labeled holo-transferrin by these cells was not inhibited by H-ferritin. Chinese hamster ovary cells lacking functional endogenous TFR1 but expressing human TFR1 with a mutated RGD sequence, which is required for transferrin binding, efficiently incorporated H-ferritin, indicating that TFR1 has distinct binding sites for H-ferritin and holo-transferrin. H-ferritin uptake by these cells required a threshold level of cell surface TFR1 expression, whereas there was no threshold for holo-transferrin uptake. The requirement for a threshold level of TFR1 expression can explain why among primary human hematopoietic cells, only erythroblasts efficiently take up H-ferritin.

  14. Generation and Characterization of Erythroid Cells from Human Embryonic Stem Cells and Induced Pluripotent Stem Cells: An Overview

    Directory of Open Access Journals (Sweden)

    Kai-Hsin Chang

    2011-01-01

    Full Text Available Because of the imbalance in the supply and demand of red blood cells (RBCs, especially for alloimmunized patients or patients with rare blood phenotypes, extensive research has been done to generate therapeutic quantities of mature RBCs from hematopoietic stem cells of various sources, such as bone marrow, peripheral blood, and cord blood. Since human embryonic stem cells (hESCs and induced pluripotent stem cells (iPSCs can be maintained indefinitely in vitro, they represent potentially inexhaustible sources of donor-free RBCs. In contrast to other ex vivo stem-cell-derived cellular therapeutics, tumorigenesis is not a concern, as RBCs can be irradiated without marked adverse effects on in vivo function. Here, we provide a comprehensive review of the recent publications relevant to the generation and characterization of hESC- and iPSC-derived erythroid cells and discuss challenges to be met before the eventual realization of clinical usage of these cells.

  15. Reprogramming of human peripheral blood monocytes to erythroid lineage by blocking of the PU-1 gene expression.

    Science.gov (United States)

    Nouri, Masoumeh; Deezagi, Abdolkhalegh; Ebrahimi, Marzieh

    2016-03-01

    In hematopoietic system development, PU.1 and GATA-1 as lineage-specific transcription factors (TF) are expressed in common myeloid progenitors. The cross antagonism between them ascertains gene expression programs of monocytic and erythroid cells, respectively. This concept in transdifferentiation approaches has not been well considered yet, especially in intralineage conversion systems. To demonstrate whether PU.1 suppression induces monocyte lineage conversion into red blood cells, a combination of three PU.1-specific siRNAs was implemented to knock down PU.1 gene expression and generate the balance in favor of GATA-1 expression to induce erythroid differentiation. For this purpose, monocytes were isolated from human peripheral blood and transfected by PU.1 siRNAs. In transfected monocytes, the rate of PU.1 expression in mRNA level was significantly decreased until 0.38 ± 0.118 when compared to untreated monocytes at 72 h (p value ≤0.05) which resulted in significant overexpression of GATA1 of 16.1 ± 0.343-fold compared to the untreated group (p value ≤0.01). Subsequently, overexpression of hemoglobin (α 13.26 ± 1.34-fold; p value≤0.0001) and β-globin (37.55 ± 16.56-fold; p value≤0.0001) was observed when compared to control groups. The results of western immunoblotting confirm those findings too. While, reduced expression of monocyte, CD14 gene, was observed in qRT-PCR and flow cytometry results. Our results suggest that manipulating the ratio of the two TFs in bifurcation differentiation pathways via applying siRNA technology can possibly change the cells' fate as a safe way for therapeutics application.

  16. A novel role for nuclear factor-erythroid 2 in erythroid maturation by modulation of mitochondrial autophagy.

    Science.gov (United States)

    Gothwal, Monika; Wehrle, Julius; Aumann, Konrad; Zimmermann, Vanessa; Gründer, Albert; Pahl, Heike L

    2016-09-01

    We have recently demonstrated that the transcription factor nuclear factor-erythroid 2, which is critical for erythroid maturation and globin gene expression, plays an important role in the pathophysiology of myeloproliferative neoplasms. Myeloproliferative neoplasm patients display elevated levels of nuclear factor-erythroid 2 and transgenic mice overexpressing the transcription factor develop myeloproliferative neoplasm, albeit, surprisingly without erythrocytosis. Nuclear factor-erythroid 2 transgenic mice show both a reticulocytosis and a concomitant increase in iron deposits in the spleen, suggesting both enhanced erythrocyte production and increased red blood cell destruction. We therefore hypothesized that elevated nuclear factor-erythroid 2 levels may lead to increased erythrocyte destruction by interfering with organelle clearance during erythroid maturation. We have previously shown that nuclear factor-erythroid 2 overexpression delays erythroid maturation of human hematopoietic stem cells. Here we report that increased nuclear factor-erythroid 2 levels also impede murine maturation by retarding mitochondrial depolarization and delaying mitochondrial elimination. In addition, ribosome autophagy is delayed in transgenics. We demonstrate that the autophagy genes NIX and ULK1 are direct novel nuclear factor-erythroid 2 target genes, as these loci are bound by nuclear factor-erythroid 2 in chromatin immunoprecipitation assays. Moreover, Nix and Ulk1 expression is increased in transgenic mice and in granulocytes from polycythemia vera patients. This is the first report implying a role for nuclear factor-erythroid 2 in erythroid maturation by affecting autophagy. PMID:27479815

  17. Antibodies to human fetal erythroid cells from a nonimmune phage antibody library

    OpenAIRE

    Huie, Michael A.; Cheung, Mei-Chi; Muench, Marcus O.; Becerril, Baltazar; Kan, Yuet W.; Marks, James D.

    2001-01-01

    The ability to isolate fetal nucleated red blood cells (NRBCs) from the maternal circulation makes possible prenatal genetic analysis without the need for diagnostic procedures that are invasive for the fetus. Such isolation requires antibodies specific to fetal NRBCs. To generate a panel of antibodies to antigens present on fetal NRBCs, a new type of nonimmune phage antibody library was generated in which multiple copies of antibody fragments are displayed on each pha...

  18. Action of antithymocyte globulin on normal human erythroid progenitor cell proliferation in vitro: erythropoietic growth-enhancing factors are released from marrow accessory cells.

    Science.gov (United States)

    Mangan, K F; D'Alessandro, L; Mullaney, M T

    1986-04-01

    Studies were undertaken to determine the mechanism of action of a horse antithymocyte globulin preparation (ATGAM) (HATG) and its control preparation of horse gamma globulin (HIgG) on the proliferation of normal human marrow and blood erythroid progenitor cells (CFU-E, BFU-E) in vitro. In preincubation studies with marrow mononuclear cells and complement, HATG did not significantly augment CFU-E or BFU-E growth greater than that expected because of removal of marrow T cells by this agent. However, direct addition of HATG but not HIgG to marrow cultures significantly stimulated CFU-E and BFU-E up to two to four times that of media or HIgG controls (P less than 0.05). The peak effect was observed at 10 to 100 micrograms/ml HATG; HATG was toxic at 1000 micrograms/ml. By contrast, the OKT3 monoclonal antibody was less stimulatory than HATG. The in vitro erythropoietic stimulatory effect of HATG was dependent on the presence of accessory cells because removal of T cells or monocytes (less than 2% to 5%) or adsorptions of HATG with T cells or monocytes reduced its stimulatory effect, highly purified BFU-E nearly devoid of accessory cells required irradiated accessory cells for demonstration of the HATG stimulatory effect, and an erythroid burst-promoting activity was released from T cells or unseparated mononuclear cells in the presence of HATG but not HIgG. The HATG enhancing effect was optimal in the first 96 hours of cultures in the presence of erythropoietin, and was reproducible with three separate lots of HATG. Up to 16% of HATG-stimulated erythroid colonies expressed nonerythroid lineage cells. Iron 59 incorporation into heme of CFU-E- or BFU-E-derived colonies was augmented equally by HATG or HIgG at 10 micrograms/ml. Erythropoietin dose-response curves and studies with antierythropoietin sera suggested that HATG also increased the sensitivity of erythroid progenitor cells to very low concentrations of erythropoietin. We conclude that HATG but not HIgG control

  19. The first trimester human placenta is a site for terminal maturation of primitive erythroid cells

    OpenAIRE

    Van Handel, Ben; Sacha L Prashad; Hassanzadeh-Kiabi, Nargess; Huang, Andy; Magnusson, Mattias; Atanassova, Boriana; Chen, Angela; Hamalainen, Eija I.; Mikkola, Hanna K. A.

    2010-01-01

    Embryonic hematopoiesis starts via the generation of primitive red blood cells (RBCs) that satisfy the embryo's immediate oxygen needs. Although primitive RBCs were thought to retain their nuclei, recent studies have shown that primitive RBCs in mice enucleate in the fetal liver. It has been unknown whether human primitive RBCs enucleate, and what hematopoietic site might support this process. Our data indicate that the terminal maturation and enucleation of human primitive RBCs occurs in fir...

  20. Endogenous K-ras signaling in erythroid differentiation.

    Science.gov (United States)

    Zhang, Jing; Lodish, Harvey F

    2007-08-15

    K-ras is one of the most frequently mutated genes in virtually all types of human cancers. Using mouse fetal liver erythroid progenitors as a model system, we studied the role of endogenous K-ras signaling in erythroid differentiation. When oncogenic K-ras is expressed from its endogenous promoter, it hyperactivates cytokine-dependent signaling pathways and results in a partial block in erythroid differentiation. In erythroid progenitors deficient in K-ras, cytokine-dependent Akt activation is greatly reduced, leading to delays in erythroid differentiation. Thus, both loss- and gain-of-Kras functions affect erythroid differentiation through modulation of cytokine signaling. These results support the notion that in human cancer patients oncogenic Ras signaling might be controlled by antagonizing essential cytokines.

  1. A high concentration of triiodothyronine attenuates the stimulatory effect on hemin-induced erythroid differentiation of human erythroleukemia K562 cells.

    Science.gov (United States)

    Shiraishi, Mieno; Yamamoto, Yoritsuna; Hirooka, Nobutaka; Obuchi, Yasuhiro; Tachibana, Shoichi; Makishima, Makoto; Tanaka, Yuji

    2015-01-01

    Although thyroid hormone is a known stimulator of erythropoietic differentiation, severe anemia is sometimes observed in patients with hyperthyroidism and this mechanism is not fully understood. The aim of this study was to investigate the effect of triiodothyronine (T3) on hemin-induced erythropoiesis. Human erythroleukemia K562 cells were used as an erythroid differentiation model. Cell differentiation was induced by hemin and the effect of pre-incubation with T3 (0.1 to 100 nM) was analyzed by measuring the benzidine-positive rate, hemoglobin content, CD71 expression (transferrin receptor), and mRNA expression for transcription factors related to erythropoiesis and thyroid hormone receptors (TRs). Hemin, a promoter of erythroid differentiation, increased the levels of mRNAs for TRα, TRβ, and retinoid X receptor α (RXRα), as well as those for nuclear factor-erythroid 2 (NFE2), GATA-binding protein 1 (GATA1) and GATA-binding protein 2 (GATA2). Lower concentrations of T3 had a stimulatory effect on hemin-induced hemoglobin production (1 and 10 nM), CD71 expression (0.1 nM), and α-globin mRNA expression (1 nM), while a higher concentration of T3 (100 nM) abrogated the stimulatory effect on these parameters. T3 at 100 nM did not affect cell viability and proliferation, suggesting that the abrogation of erythropoiesis enhancement was not due to toxicity. T3 at 100 nM also significantly inhibited expression of GATA2 and RXRα mRNA, compared to 1 nM T3. We conclude that a high concentration of T3 attenuates the classical stimulatory effect on erythropoiesis exerted by a low concentration of T3 in hemin-induced K562 cells. PMID:25787723

  2. Human cerebral circulation. Positron emission tomography studies

    International Nuclear Information System (INIS)

    We reviewed the literature on human cerebral circulation and oxygen metabolism, as measured by positron emission tomography (PET), with respect to normal values and of regulation of cerebral circulation. A multicenter study in Japan showed that between-center variations in cerebral blood flow (CBF), cerebral blood volume (CBV), cerebral oxygen extraction fraction (OEF) and cerebral metabolic rate of oxygen (CMRO2) values were not considerably larger than the corresponding within-center variations. Overall mean±SD values in cerebral cortical regions of normal human subjects were as follows: CBF=44.4±6.5 ml/100 ml/min; CBV=3.8±0.7 ml/100 ml; OEF=0.44±0.06; CMRO2=3.3±0.5 ml/100 ml/min (11 PET centers, 70 subjects). Intrinsic regulation of cerebral circulation involves several factors. Autoregulation maintains CBF in response to changes in cerebral perfusion pressure; chemical factors such as PaCO2 affect cerebral vascular tone and alter CBF; changes in neural activity cause changes in cerebral energy metabolism and CBF; neurogenic control of CBF occurs by sympathetic innervation. Regional differences in vascular response to changes in PaCO2 have been reported, indicating regional differences in cerebral vascular tone. Relations between CBF and CBV during changes in PaCO2 and during changes in neural activity were in good agreement with Poiseuille's law. The mechanisms of vascular response to neural activation and deactivation were independent on those of responses to PaCO2 changes. CBV in a brain region is the sum of three components: arterial, capillary and venous blood volumes. It has been reported that the arterial blood volume fraction is approximately 30% in humans and that changes in human CBV during changes in PaCO2 are caused by changes in arterial blood volume without changes in venous blood volume. These findings should be considered in future studies of the pathophysiology of cerebrovascular diseases. (author) 136 refs

  3. RECOMBINANT HUMAN MAST-CELL GROWTH-FACTOR SUPPORTS ERYTHROID COLONY FORMATION IN POLYCYTHEMIA-VERA IN THE PRESENCE AND ABSENCE OF ERYTHROPOIETIN AND SERUM

    NARCIS (Netherlands)

    MULLER, EW; DEWOLF, JTM; HENDRIKS, DW; ESSELINK, MT; HALIE, MR; VELLENGA, E

    1993-01-01

    The effect of mast cell growth factor (MGF) was studied on erythropoietin (Epo)-dependent and Epo-independent (''spontaneous'') erythroid colony formation in patients with polycythemia vera (PV). MGF stimulated both Epo-dependent and Epo-independent erythroid colony formation from PV peripheral bloo

  4. Expression of P190 and P210 BCR/ABL1 in normal human CD34(+) cells induces similar gene expression profiles and results in a STAT5-dependent expansion of the erythroid lineage

    DEFF Research Database (Denmark)

    Järås, Marcus; Johnels, Petra; Agerstam, Helena;

    2009-01-01

    and systematically compared the effects of retroviral P190 BCR/ABL1 and P210 BCR/ABL1 expression on cell proliferation, differentiation, and global gene expression in human CD34(+) cells from cord blood. RESULTS: Expression of either P190 BCR/ABL1 or P210 BCR/ABL1 resulted in expansion of erythroid cells...... and stimulated erythropoietin-independent burst-forming unit-erythroid colony formation. By using a lentiviral anti-signal transducer and activator of transcription 5 (STAT5) short-hairpin RNA, we found that both P190 BCR/ABL1- and P210 BCR/ABL1-induced erythroid cell expansion were STAT5-dependent. Under...... that the early cellular and transcriptional effects of P190 BCR/ABL1 and P210 BCR/ABL1 expression are very similar when they are expressed in the same human progenitor cell population, and that STAT5 is an important regulator of BCR/ABL1-induced erythroid cell expansion....

  5. Neither DNA hypomethylation nor changes in the kinetics of erythroid differentiation explain 5-azacytidine's ability to induce human fetal hemoglobin

    OpenAIRE

    Mabaera, Rodwell; Greene, Michael R.; Richardson, Christine A.; Conine, Sarah J; Kozul, Courtney D.; Lowrey, Christopher H.

    2008-01-01

    5-azacytidine (5-Aza) is a potent inducer of fetal hemoglobin (HbF) in people with β-thalassemia and sickle cell disease. Two models have been proposed to explain this activity. The first is based on the drug's ability to inhibit global DNA methylation, including the fetal globin genes, resulting in their activation. The second is based on 5-Aza's cytotoxicity and observations that HbF production is enhanced during marrow recovery. We tested these models using human primary cells in an in vit...

  6. Development of a hydraulic model of the human systemic circulation

    Science.gov (United States)

    Sharp, M. K.; Dharmalingham, R. K.

    1999-01-01

    Physical and numeric models of the human circulation are constructed for a number of objectives, including studies and training in physiologic control, interpretation of clinical observations, and testing of prosthetic cardiovascular devices. For many of these purposes it is important to quantitatively validate the dynamic response of the models in terms of the input impedance (Z = oscillatory pressure/oscillatory flow). To address this need, the authors developed an improved physical model. Using a computer study, the authors first identified the configuration of lumped parameter elements in a model of the systemic circulation; the result was a good match with human aortic input impedance with a minimum number of elements. Design, construction, and testing of a hydraulic model analogous to the computer model followed. Numeric results showed that a three element model with two resistors and one compliance produced reasonable matching without undue complication. The subsequent analogous hydraulic model included adjustable resistors incorporating a sliding plate to vary the flow area through a porous material and an adjustable compliance consisting of a variable-volume air chamber. The response of the hydraulic model compared favorably with other circulation models.

  7. Flow Cytometric Identification of Fibrocytes in the Human Circulation.

    Science.gov (United States)

    Hu, Xinyuan; DeBiasi, Erin M; Herzog, Erica L

    2015-01-01

    Because the incidence of organ fibrosis increases with age, various fibrosing disorders are projected to account for significant increases in morbidity, mortality, and healthcare costs in the years to come. Treatments for these diseases are scarce and better understanding of the immunopathogenesis of fibrosis and its relationship to aging are sorely needed. One area of interest in this field is the role that fibrocytes might play in the development of tissue remodeling and fibrosis. Fibrocytes are mesenchymal progenitor cells presumed to be of monocyte origin that possess the tissue remodeling properties of tissue resident fibroblasts such as extracellular matrix production and α-SMA-related contractile properties, as well as the immunologic functions typically attributed to macrophages including production of cytokines and chemokines, antigen presentation, regulation of leukocyte trafficking, and modulation of angiogenesis. Fibrocytes could participate in the development of age-related fibrosing disorders through any or all of these functions. This chapter presents methods that have been developed for the study of circulating human fibrocytes. Protocols for the quantification of fibrocytes in the human circulation will be presented along with discussion of the technical challenges that are frequently encountered in this field. It is hoped that this information will facilitate further investigation of the relationship between fibrocytes, aging, and fibrosis, and perhaps uncover new areas of study in these difficult-to-treat and deadly diseases. PMID:26420706

  8. Nonrandom distribution of iron in circulating human transferrin.

    Science.gov (United States)

    Zak, O; Aisen, P

    1986-07-01

    By combining the urea gel electrophoresis technique of Makey and Seal with Western immunoblotting, a method has been developed for analyzing the distribution of iron between the two sites of circulating human transferrin. The new method avoids exposure of samples to a nonphysiologic pH that may promote removal or redistribution of iron from the protein; this facilitates examination of multiple samples at one time. Analysis of 21 freshly drawn specimens from normal human subjects confirms previous reports that iron is not randomly distributed in the specific sites of transferrin. Rather, there is a considerable range in the ratio of occupancies of N-terminal and C-terminal sites (N:C ratio), from 0.31 to 6.87 in the present study, with the N-terminal site predominantly occupied in most subjects. The N:C ratio correlates modestly with serum iron concentration (r = .54). Possible flaws in studies indicating a random occupancy of the specific sites of circulating transferrin may lie in the low pH to which samples may be exposed during procedures based on isoelectric focusing or in drawing inferences from data considering only total monoferric transferrin rather than the two distinguishable monoferric species.

  9. High-level, erythroid specific, expression of the human α-globin gene in transgenic mice and the production of human haemoglobin in murine erythrocytes.

    NARCIS (Netherlands)

    O. Hanscombe; M. Vidal; J. Kaeda; L. Luzzatto; D.R. Greaves; F.G. Grosveld (Frank)

    1989-01-01

    textabstractUsing the dominant control region (DCR) sequences that flank the beta-globin gene locus, we have been able to achieve high-level expression of the human alpha-globin gene in transgenic mice. Expression in fetal liver and blood is copy number dependent and at levels comparable to that of

  10. THE EFFECTS OF IL-1 AND IL-4 ON THE EPO-INDEPENDENT ERYTHROID PROGENITOR IN POLYCYTHEMIA-VERA

    NARCIS (Netherlands)

    DEWOLF, JTM; HENDRIKS, DW; ESSELINK, MT; HALIE, MR; VELLENGA, E

    1994-01-01

    Human recombinant interleukin-1 (IL-1) was studied for its effects on the erythroid progenitors from normal subjects and from patients with polycythaemia vera (PV). No supportive effect of IL-1 was noticed on the normal, erythropoietin (Epo) dependent, erythroid burst-forming unit (BFU-E) using peri

  11. Hepcidin Expression in Iron Overload Diseases Is Variably Modulated by Circulating Factors

    OpenAIRE

    Ravasi, Giulia; Pelucchi, Sara; Trombini, Paola; Mariani, Raffaella; Tomosugi, Naohisa; Modignani, Giulia Litta; Pozzi, Matteo; Nemeth, Elizabeth; Ganz, Tomas; Hayashi, Hisao; Barisani, Donatella; Piperno, Alberto

    2012-01-01

    Hepcidin is a regulatory hormone that plays a major role in controlling body iron homeostasis. Circulating factors (holotransferrin, cytokines, erythroid regulators) might variably contribute to hepcidin modulation in different pathological conditions. There are few studies analysing the relationship between hepcidin transcript and related protein expression profiles in humans. Our aims were: a. to measure hepcidin expression at either hepatic, serum and urinary level in three paradigmatic ir...

  12. Separation of haemopoietic cells for biochemical investigation. Preparation of erythroid and myeloid cells from human and laboratory-animal bone marrow and the separation of erythroblasts according to their state of maturation.

    Science.gov (United States)

    Harrison, F L; Beswick, T M; Chesterton, C J

    1981-03-15

    The separation of haemopoietic bone-marrow cells by centrifugation through discontinuous density gradients of Percoll is described. This method was used to prepare fractions enriched in erythroblasts, myeloid blast cells or reticulocytes from bone marrow of anaemic and non-anaemic rabbits, from the marrow of other anaemic laboratory animals and from human samples. It is a simple, rapid, reproducible and inexpensive technique that can be readily adapted to suit individual requirements. Secondly, a convenient method is presented for the separation of large quantities of bone-marrow cells into fractions enriched in erythroblasts at different stages of maturation, by velocity sedimentation through a linear gradient of 1-2% sucrose at unit gravity. In vitro, erythroblasts adhere together strongly via a mechanism almost certainly involving a beta-galactoside-specific surface lectin termed erythroid developmental agglutinin. Since the efficiency of cell-separation techniques depends heavily on the maintenance of a single cell suspension in which each unit can move independently, the presence of an adhesive molecule at the cell surface is of considerable significance. The effect of washing the marrow with a lactose-containing medium, which has been shown to remove the agglutinin, was therefore investigated in relation to both methods. The separation on Percoll gradients is considerably enhanced by this treatment. In addition, the unit-gravity sedimentation gradient can be loaded with 5-10 times more cells after lactose extraction in comparison with intact marrow. Although enrichment is less, a useful fractionation according to maturation is still obtained.

  13. Tracking erythroid progenitor cells in times of need and times of plenty.

    Science.gov (United States)

    Koury, Mark J

    2016-08-01

    Red blood cell production rates increase rapidly following blood loss or hemolysis, but the expansion of erythropoiesis in these anemic states is tightly regulated such that rebound polycythemia does not occur. The erythroid cells that respond to erythropoietic stimulation or suppression are the progenitor stages of burst-forming units-erythroid (BFU-Es) and colony-forming units-erythroid (CFU-Es). Results from an early study of the changes in the size, location, and cell cycling status of BFU-E and CFU-E populations in mice under normal conditions, erythropoietic stimulation, and erythropoietic suppression are used as reference points to review subsequent developments related to erythroid progenitor populations and regulation of their size. The review concerns development of erythroid progenitor populations mainly in mice and humans, with a focus on the mechanisms related to the rapid but highly regulated expansion of erythropoiesis in spleens of erythropoietically stimulated mice. Current knowledge is used as a model of erythroid progenitor populations in mice under normal, erythropoietically suppressed, and erythropoietically stimulated conditions. Clinical applications of information learned from studies of erythropoietic expansion, in terms of current therapies for anemia, are reviewed. PMID:26646992

  14. Erythroid pyrimidine 5'-nucleotidase: cloning, developmental expression, and regulation by cAMP and in vivo hypoxia.

    Science.gov (United States)

    Mass, Markus; Simo, Erika; Dragon, Stefanie

    2003-12-01

    A characteristic process of terminal erythroid differentiation is the degradation of ribosomal RNA into mononucleotides. The pyrimidine mononucleotides can be dephosphorylated by pyrimidine 5'-nucleotidase (P5N-I). In humans, a lack of this enzyme causes hemolytic anemia with ribosomal structures and trinucleotides retained in the red blood cells (RBCs). Although the protein/nucleotide sequence of P5N-I is known in mammals, the onset and regulation of P5N-I during erythroid maturation is unknown. However, in circulating chicken embryonic RBCs, the enzyme is induced together with carbonic anhydrase (CAII) and 2,3-bisphosphoglycerate (2,3-BPG) by norepinephrine (NE) and adenosine, which are released by the embryo under hypoxic conditions. Here, we present the chicken P5N-I sequence and the gene expression of P5N-I during RBC maturation; the profile of gene expression follows the enzyme activity with a rise between days 13 and 16 of embryonic development. The p5n-I expression is induced (1) in definitive but not primitive RBCs by stimulation of beta-adrenergic/adenosine receptors, and (2) in definitive RBCs by hypoxic incubation of the chicken embryo. Since embryonic RBCs increase their hemoglobin-oxygen affinity by degradation of nucleotides such as uridine triphosphate (UTP) and cytidine triphosphate (CTP), the induction of p5n-I expression can be seen as an adaptive response to hypoxia.

  15. Activated T lymphocytes disappear from circulation during endotoxemia in humans

    DEFF Research Database (Denmark)

    Suarez Krabbe, Karen; Kemp, Helle Bruunsgaard; Qvist, Jesper;

    2002-01-01

    disappearance were characterized by an activated phenotype (CD45RA(-) CD45RO(+)) as well as a phenotype linked to apoptosis (CD95(+) CD28(-)). In conclusion, endotoxin-induced lymphopenia reflects the disappearance from the circulation of activated lymphocytes prone to undergo apoptosis....

  16. In vitro apoptotic cell death during erythroid differentiation.

    Science.gov (United States)

    Zamai, L; Burattini, S; Luchetti, F; Canonico, B; Ferri, P; Melloni, E; Gonelli, A; Guidotti, L; Papa, S; Falcieri, E

    2004-03-01

    Erythropoiesis occurs in bone marrow and it has been shown that during in vivo erythroid differentiation some immature erythroblasts undergo apoptosis. In this regard, it is known that immature erythroblasts are FasL- and TRAIL-sensitive and can be killed by cells expressing these ligand molecules. In the present study, we have investigated the cell death phenomenon that occurs during a common unilineage model of erythroid development. Purified CD34+ human haemopoietic progenitors were cultured in vitro in the presence of SCF, IL-3 and erythropoietin. Their differentiation stages and apoptosis were followed by multiple technical approaches. Flow cytometric evaluation of surface and intracellular molecules revealed that glycophorin A appeared at day 3-4 of incubation and about 75% of viable cells co-expressed high density glycophorin A (Gly(bright)) and adult haemoglobin at day 14 of culture, indicating that this system reasonably recapitulates in vivo normal erythropoiesis. Interestingly, when mature (Gly(bright)) erythroid cells reached their higher percentages (day 14) almost half of cultured cells were apoptotic. Morphological studies indicated that the majority of dead cells contained cytoplasmic granular material typical of basophilic stage, and DNA analysis by flow cytometry and TUNEL reaction revealed nuclear fragmentation. These observations indicate that in vitro unilineage erythroid differentiation, as in vivo, is associated with apoptotic cell death of cells with characteristics of basophilic erythroblasts. We suggest that the interactions between different death receptors on immature basophilic erythroblasts with their ligands on more mature erythroblasts may contribute to induce apoptosis in vitro. PMID:15004520

  17. Long-term follow-up of myelodysplastic syndrome patients with moderate/severe anaemia receiving human recombinant erythropoietin + 13-cis-retinoic acid and dihydroxylated vitamin D3: independent positive impact of erythroid response on survival.

    Science.gov (United States)

    Crisà, Elena; Foli, Cristina; Passera, Roberto; Darbesio, Antonella; Garvey, Kimberly B; Boccadoro, Mario; Ferrero, Dario

    2012-07-01

    We previously reported a 60% erythroid response rate with recombinant erythropoietin + 13-cis retinoic acid + dihydroxylated vitamin D3 in 63 elderly myelodysplastic patients (median age 75 years) with unfavourable features for response to erythropoietin alone [70% transfusion-dependent, 35% refractory anaemia with ring sideroblasts/refractory anaemia with excess of blasts type 1 (RAEB1), 70% with International Prognostic Scoring System (IPSS) Intermediate-1 or -2]. This report updates that case study at a 7-year follow-up, and compared the impact on overall survival of erythroid response to known prognostic factors. The erythroid response duration (median 17 months; 22 in non-RAEB patients, with 20% patients in response after 6 years of therapy) was longer than in most studies with erythropoietin alone. Overall survival (median 55 months in non-RAEB, 15 in RAEB1 patients) was negatively affected by RAEB1 diagnosis, IPSS and WPSS intermediate scores and transfusion-dependence. In the multivariate analysis, erythroid response maintained an independent positive impact on survival, particularly in non-RAEB patients in the first 3 years from diagnosis (90% survival compared to 50% of non-responders). In conclusion, the long-term follow-up confirmed the achievement, by our combined treatment, of fairly long-lasting erythroid response in the majority of MDS patients with unfavourable prognostic features for response to erythropoietin: this translated in a survival benefit that was independent from other prognostic features. PMID:22571649

  18. Circulating human basophils lack the features of professional antigen presenting cells

    OpenAIRE

    Sharma, Meenu; Hegde, Pushpa; Aimanianda, Vishukumar; Beau, Remi; Sénéchal, Helene; Poncet, Pascal; Latgé, Jean-Paul; Kaveri, Srini V; Bayry, Jagadeesh

    2013-01-01

    Recent reports in mice demonstrate that basophils function as antigen presenting cells (APC). They express MHC class II and co-stimulatory molecules CD80 and CD86, capture and present soluble antigens or IgE-antigen complexes and polarize Th2 responses. Therefore, we explored whether human circulating basophils possess the features of professional APC. We found that unlike dendritic cells (DC) and monocytes, steady-state circulating human basophils did not express HLA-DR and co-stimulatory mo...

  19. Calcium Signaling Is Required for Erythroid Enucleation.

    Science.gov (United States)

    Wölwer, Christina B; Pase, Luke B; Russell, Sarah M; Humbert, Patrick O

    2016-01-01

    Although erythroid enucleation, the property of erythroblasts to expel their nucleus, has been known for 7ore than a century, surprisingly little is known regarding the molecular mechanisms governing this unique developmental process. Here we show that similar to cytokinesis, nuclear extrusion requires intracellular calcium signaling and signal transduction through the calmodulin (CaM) pathway. However, in contrast to cytokinesis we found that orthochromatic erythroblasts require uptake of extracellular calcium to enucleate. Together these functional studies highlight a critical role for calcium signaling in the regulation of erythroid enucleation.

  20. Calcium Signaling Is Required for Erythroid Enucleation.

    Directory of Open Access Journals (Sweden)

    Christina B Wölwer

    Full Text Available Although erythroid enucleation, the property of erythroblasts to expel their nucleus, has been known for 7ore than a century, surprisingly little is known regarding the molecular mechanisms governing this unique developmental process. Here we show that similar to cytokinesis, nuclear extrusion requires intracellular calcium signaling and signal transduction through the calmodulin (CaM pathway. However, in contrast to cytokinesis we found that orthochromatic erythroblasts require uptake of extracellular calcium to enucleate. Together these functional studies highlight a critical role for calcium signaling in the regulation of erythroid enucleation.

  1. Calcium Signaling Is Required for Erythroid Enucleation

    Science.gov (United States)

    Russell, Sarah M.; Humbert, Patrick O.

    2016-01-01

    Although erythroid enucleation, the property of erythroblasts to expel their nucleus, has been known for 7ore than a century, surprisingly little is known regarding the molecular mechanisms governing this unique developmental process. Here we show that similar to cytokinesis, nuclear extrusion requires intracellular calcium signaling and signal transduction through the calmodulin (CaM) pathway. However, in contrast to cytokinesis we found that orthochromatic erythroblasts require uptake of extracellular calcium to enucleate. Together these functional studies highlight a critical role for calcium signaling in the regulation of erythroid enucleation. PMID:26731108

  2. Quantitative proteome profiling of normal human circulating microparticles

    DEFF Research Database (Denmark)

    Østergaard, Ole; Nielsen, Christoffer T; Iversen, Line V;

    2012-01-01

    Circulating microparticles (MPs) are produced as part of normal physiology. Their numbers, origin, and composition change in pathology. Despite this, the normal MP proteome has not yet been characterized with standardized high-resolution methods. We here quantitatively profile the normal MP...... proteome using nano-LC-MS/MS on an LTQ-Orbitrap with optimized sample collection, preparation, and analysis of 12 different normal samples. Analytical and procedural variation were estimated in triply processed samples analyzed in triplicate from two different donors. Label-free quantitation was validated...... by the correlation of cytoskeletal protein intensities with MP numbers obtained by flow cytometry. Finally, the validity of using pooled samples was evaluated using overlap protein identification numbers and multivariate data analysis. Using conservative parameters, 536 different unique proteins were quantitated...

  3. Human Factors of Queuing: A Library Circulation Model.

    Science.gov (United States)

    Mansfield, Jerry W.

    1981-01-01

    Classical queuing theories and their accompanying service facilities totally disregard the human factors in the name of efficiency. As library managers we need to be more responsive to human needs in the design of service points and make every effort to minimize queuing and queue frustration. Five references are listed. (Author/RAA)

  4. A long term model of circulation. [human body

    Science.gov (United States)

    White, R. J.

    1974-01-01

    A quantitative approach to modeling human physiological function, with a view toward ultimate application to long duration space flight experiments, was undertaken. Data was obtained on the effect of weightlessness on certain aspects of human physiological function during 1-3 month periods. Modifications in the Guyton model are reviewed. Design considerations for bilateral interface models are discussed. Construction of a functioning whole body model was studied, as well as the testing of the model versus available data.

  5. Multiple erythroid isoforms of human long-chain acyl-CoA synthetases are produced by switch of the fatty acid gate domains

    Directory of Open Access Journals (Sweden)

    Kuypers Frans A

    2006-07-01

    Full Text Available Abstract Background The formation of acyl-CoA by the action of acyl-CoA synthetases plays a crucial role in membrane lipid turnover, including the plasma membrane of erythrocytes. In human, five Acyl-CoA Synthetase Long-chain (ACSL genes have been identified with as many as 3 different transcript variants for each. Results Acyl-CoA Synthetase Long-chain member 6 (ACSL6 is responsible for activation of long-chain fatty acids in erythrocytes. Two additional transcript variants were also isolated from brain and testis. We report the expression in reticulocytes of two new variants and of the one isolated from brain. All three represented different spliced variants of a mutually exclusive exon pair. They encode a slightly different short motif which contains a conserved structural domain, the fatty acid Gate domain. The motifs differ in the presence of either the aromatic residue phenylalanine (Phe or tyrosine (Tyr. Based on homology, two new isoforms for the closely related ACSL1 were predicted and characterized. One represented a switch of the Phe- to the Tyr-Gate domain motif, the other resulted from the exclusion of both. Swapping of this motif also appears to be common in all mammalian ACSL member 1 and 6 homologs. Conclusion We propose that a Phe to Tyr substitution or deletion of the Gate domain, is the structural reason for the conserved alternative splicing that affects these motifs. Our findings support our hypothesis that this region is structurally important to define the activity of these enzymes.

  6. Head movement, an important contributor to human cerebrospinal fluid circulation

    Science.gov (United States)

    Xu, Qiang; Yu, Sheng-Bo; Zheng, Nan; Yuan, Xiao-Ying; Chi, Yan-Yan; Liu, Cong; Wang, Xue-Mei; Lin, Xiang-Tao; Sui, Hong-Jin

    2016-01-01

    The suboccipital muscles are connected to the upper cervical spinal dura mater via the myodural bridges (MDBs). Recently, it was suggested that they might work as a pump to provide power for cerebrospinal fluid (CSF) circulation. The purpose of this study was to investigate effects of the suboccipital muscles contractions on the CSF flow. Forty healthy adult volunteers were subjected to cine phase-contrast MR imaging. Each volunteer was scanned twice, once before and once after one-minute-head-rotation period. CSF flow waveform parameters at craniocervical junction were analyzed. The results showed that, after the head rotations, the maximum and average CSF flow rates during ventricular diastole were significantly increased, and the CSF stroke volumes during diastole and during entire cardiac cycle were significantly increased. This suggested that the CSF flow was significantly promoted by head movements. Among the muscles related with head movements, only three suboccipital muscles are connected to the upper cervical spinal dura mater via MDBs. It was believed that MDBs might transform powers of the muscles to CSF. The present results suggested that the head movements served as an important contributor to CSF dynamics and the MDBs might be involved in this mechanism. PMID:27538827

  7. Translational control mediated by hnRNP K links NMHC IIA to erythroid enucleation.

    Science.gov (United States)

    Naarmann-de Vries, Isabel S; Brendle, Annika; Bähr-Ivacevic, Tomi; Benes, Vladimir; Ostareck, Dirk H; Ostareck-Lederer, Antje

    2016-03-15

    Post-transcriptional regulation is crucial for structural and functional alterations in erythropoiesis. Enucleation of erythroid progenitors precedes reticulocyte release into circulation. In enucleated cells, reticulocyte 15-lipoxygenase (r15-LOX, also known as ALOX15) initiates mitochondria degradation. Regulation of r15-LOX mRNA translation by hnRNP K determines timely r15-LOX synthesis in terminal maturation. K562 cells induced for erythroid maturation recapitulate enucleation and mitochondria degradation. HnRNP K depletion from maturing K562 cells results in enhanced enucleation, which even occurs independently of maturation. We performed RIP-Chip analysis to identify hnRNP K-interacting RNAs comprehensively. Non-muscle myosin heavy chain (NMHC) IIA (also known as MYH9) mRNA co-purified with hnRNP K from non-induced K562 cells, but not from mature cells. NMHC IIA protein increase in erythroid maturation at constant NMHC IIA mRNA levels indicates post-transcriptional regulation. We demonstrate that binding of hnRNP K KH domain 3 to a specific sequence element in the NMHC IIA mRNA 3'UTR mediates translation regulation in vitro Importantly, elevated NMHC IIA expression results in erythroid-maturation-independent enucleation as shown for hnRNP K depletion. Our data provide evidence that hnRNP-K-mediated regulation of NMHC IIA mRNA translation contributes to the control of enucleation in erythropoiesis. PMID:26823606

  8. Cytotoxicity of quantum dots and graphene oxide to erythroid cells and macrophages

    Science.gov (United States)

    Qu, Guangbo; Wang, Xiaoyan; Wang, Zhe; Liu, Sijin; Jiang, Guibing

    2013-04-01

    Great concerns have been raised about the exposure and possible adverse influence of nanomaterials due to their wide applications in a variety of fields, such as biomedicine and daily lives. The blood circulation system and blood cells form an important barrier against invaders, including nanomaterials. However, studies of the biological effects of nanomaterials on blood cells have been limited and without clear conclusions thus far. In the current study, the biological influence of quantum dots (QDs) with various surface coating on erythroid cells and graphene oxide (GO) on macrophages was closely investigated. We found that QDs posed great damage to macrophages through intracellular accumulation of QDs coupled with reactive oxygen species generation, particularly for QDs coated with PEG-NH2. QD modified with polyethylene glycol-conjugated amine particles exerted robust inhibition on cell proliferation of J744A.1 macrophages, irrespective of apoptosis. Additionally, to the best of our knowledge, our study is the first to have demonstrated that GO could provoke apoptosis of erythroid cells through oxidative stress in E14.5 fetal liver erythroid cells and in vivo administration of GO-diminished erythroid population in spleen, associated with disordered erythropoiesis in mice.

  9. Regulation of erythroid differentiation by miR-376a and its targets

    Institute of Scientific and Technical Information of China (English)

    Fang Wang; Jia Yu; Gui-Hua Yang; Xiao-Shuang Wang; Jun-Wu Zhang

    2011-01-01

    Lineage differentiation is a continuous process during which fated progenitor cells execute specific programs to produce mature counterparts. This lineage-restricted pathway can be controlled by particular regulators, which are usually exclusively expressed in certain cell types or at specific differentiation stages. Here we report that miR376a participates in the regulation of the early stages of human erythropoiesis by targeting cyclin-dependent kinase 2 (CDK2) and Argonaute 2 (Ago2). Among various human leukemia cell lines, miR-376a was only detected in K562 cells which originated from a progenitor common to the erythroid and megakaryotic lineages. Enforced expression of miR-376a or silencing of CDK2 and Ago2 by RNAi inhibits erythroid differentiation of K562 cells. Hematopoietic progenitor cells transduced with miR-376a showed a significant reduction of their erythroid clonogenic capacity. MiR-376a is relatively abundant in erythroid progenitor cells, where it reduces expression of CDK2 and maintains a low level of differentiation due to cell cycle arrest and decreased cell growth. Following erythroid induction, miR376a is significantly down-regulated and CDK2 is released from miR-376a inhibition, thereby facilitating the escape of progenitor cells from the quiescent state into erythroid differentiation. Moreover, our results establish a functional link between miR-376a and Ago2, a key factor in miRNA biogenesis and silencing pathways with novel roles in human hematopoiesis.

  10. Concurrent expression of erythroid and renal aquaporin CHIP and appearance of water channel activity in perinatal rats.

    OpenAIRE

    Smith, B L; Baumgarten, R; Nielsen, S; D. Raben; Zeidel, M L; Agre, P

    1993-01-01

    Major phenotypic changes occur in red cell membranes during the perinatal period, but the underlying molecular explanations remain poorly defined. Aquaporin CHIP, the major erythroid and renal water channel, was studied in perinatal rats using affinity-purified anti-CHIP IgG for immunoblotting, flow cytometry, and immunofluorescence microscopy. CHIP was not detected in prenatal red cells but was first identified in circulating red cells on the third postnatal day. Most circulating red cells w...

  11. Intracellular and circulating neuronal antinuclear antibodies in human epilepsy

    OpenAIRE

    Iffland, Philip H.; Carvalho-Tavares, Juliana; Trigunaite, Abhishek; Man, Shumei; Rasmussen, Peter; Alexopoulos, Andreas; Ghosh, Chaitali; Jørgensen, Trine N.; Janigro, Damir

    2013-01-01

    There are overwhelming data supporting the inflammatory origin of some epilepsies (e.g., Rasmussen's encephalitis and limbic encephalitis). Inflammatory epilepsies with an autoimmune component are characterized by autoantibodies against membrane-bound, intracellular or secreted proteins (e.g., voltage gated potassium channels). Comparably, little is known regarding autoantibodies targeting nuclear antigen. We tested the hypothesis that in addition to known epilepsy-related autoantigens, human...

  12. OPTIMAL ERYTHROID CELL PRODUCTION DURING ERYTHROPOIETIN TREATMENT OF MICE OCCURS BY EXPLOITING THE SPLENIC MICROENVIRONMENT

    NARCIS (Netherlands)

    NIJHOF, W; GORIS, H; DONTJE, B; DRESZ, J; LOEFFLER, M

    1993-01-01

    In this study, quantitative effects on erythroid cell production by a prolonged recombinant human erythropoietin (rhEpo) treatment of mice are presented. Epo treatments, given subcutaneously (s.c.) twice per day in doses of 0.5 to 500 U per day, were performed under steady-state production condition

  13. Rethinking International Migration of Human Capital and Brain Circulation: The Case of Chinese-Canadian Academics

    Science.gov (United States)

    Blachford, Dongyan Ru; Zhang, Bailing

    2014-01-01

    This article examines the dynamics of brain circulation through a historical review of the debates over international migration of human capital and a case study on Chinese-Canadian academics. Interviews with 22 Chinese-Canadian professors who originally came from China provide rich data regarding the possibilities and problems of the contemporary…

  14. Does Every Cell Get Blood? Young Students' Discussions about Illustrations of Human Blood Circulation

    Science.gov (United States)

    Westman, Anna-Karin; Karlsson, Karl-Goran

    2016-01-01

    This article presents a study of how groups of young students discuss illustrations of human blood circulation. Transparency is not an innate quality of illustrations, visual information is always coded and interpretations are always related to culture and context. Results of this study are discussed with reference to Kress and van Leeuwens'…

  15. Initial function analysis of a novel erythroid differentiation related gene EDRF1

    Institute of Scientific and Technical Information of China (English)

    WANG; Duncheng(

    2001-01-01

    [1]Migliaccio, A. R, Vannucchi, A. M., Migliaccio, G., Molecular control of erythroid differentiation, International Journal of Hematology, 1996, 64(1): 1-29.[2]Migliaccio, A. R., Migliaccio, G., The making of an erythroid cell, Biotherapy, 1998, 10(2): 251-268.[3]Higgs, D. R., Sharpe, J. A., Wood, W. G., Understanding α-globin gene expression a step towards effective gene therapy,Seminars in Hematology, 1998, 35(1): 93-104.[4]Crosstey, M., Merika, M., Orkin, S. H., Self-association of the erythroid transcription factor GATA-1 mediated by its zinc finger domains, Mol. Cell Biol., 1992, 15: 2448-2456.[5]Wang. X., Chen, S. P., Xue, S. R, Preparation and determination of monoclonal antibodies against the proteins related to erythroid differentiation, Acta Anatomica Sinica, 1997, 28(2): 187-191.[6]Wang. X., Liu, P. X., Zhang, J. B. et al., Appearance of some novel proteins binding enhancer element of globin genes (HS2) during erythroid terminal differentiation, Acta Anatomica Sinica, 1994, 25(4): 379-384.[7]Wang. X.. Wang, D. C., Chen, X. et al., cDNA cloning and function analysis of two novel erythroid differentiation related genes. Science in China, Ser. C, 2001, 44(1): 99-105.[8]Wu, H., Liu, X.. Jaenisch, R. et al., Generation of committed erythroid BFU-E and CFR-E progenitors does not require erythropoietin or the erythropoietin receptor, Cell, 1995, 83 (1): 59-64.[9]Partington, G. A., Patient, R. K., Phosphorylation of GATA-1 increases its DNA-binding affinity and is correlated with induction of human K562 erythroleukaemia cells, Nucleic Acids Res., 1999, 27(4): 1168-1175.[10].Canelles, M., Delgado, M. D., Hyland, K. M. et al., Max and inhibitory c-Myc mutants induce erythroid differentiation and resistance to apoptosis in human myeloid leukemia cells, Oncogene, 1997, 14(11): 1315- 1127.Acknowledgements This work was supported by National High Technology Programs of China (Grant No.102-08-01-03) and Natural Science Fund

  16. Erythropoietin guides multipotent hematopoietic progenitor cells toward an erythroid fate

    Science.gov (United States)

    Grover, Amit; Mancini, Elena; Moore, Susan; Mead, Adam J.; Atkinson, Deborah; Rasmussen, Kasper D.; O’Carroll, Donal; Jacobsen, Sten Eirik W.

    2014-01-01

    The erythroid stress cytokine erythropoietin (Epo) supports the development of committed erythroid progenitors, but its ability to act on upstream, multipotent cells remains to be established. We observe that high systemic levels of Epo reprogram the transcriptomes of multi- and bipotent hematopoietic stem/progenitor cells in vivo. This induces erythroid lineage bias at all lineage bifurcations known to exist between hematopoietic stem cells (HSCs) and committed erythroid progenitors, leading to increased erythroid and decreased myeloid HSC output. Epo, therefore, has a lineage instructive role in vivo, through suppression of non-erythroid fate options, demonstrating the ability of a cytokine to systematically bias successive lineage choices in favor of the generation of a specific cell type. PMID:24493804

  17. Computational Characterization of Exogenous MicroRNAs that Can Be Transferred into Human Circulation.

    Directory of Open Access Journals (Sweden)

    Jiang Shu

    Full Text Available MicroRNAs have been long considered synthesized endogenously until very recent discoveries showing that human can absorb dietary microRNAs from animal and plant origins while the mechanism remains unknown. Compelling evidences of microRNAs from rice, milk, and honeysuckle transported to human blood and tissues have created a high volume of interests in the fundamental questions that which and how exogenous microRNAs can be transferred into human circulation and possibly exert functions in humans. Here we present an integrated genomics and computational analysis to study the potential deciding features of transportable microRNAs. Specifically, we analyzed all publicly available microRNAs, a total of 34,612 from 194 species, with 1,102 features derived from the microRNA sequence and structure. Through in-depth bioinformatics analysis, 8 groups of discriminative features have been used to characterize human circulating microRNAs and infer the likelihood that a microRNA will get transferred into human circulation. For example, 345 dietary microRNAs have been predicted as highly transportable candidates where 117 of them have identical sequences with their homologs in human and 73 are known to be associated with exosomes. Through a milk feeding experiment, we have validated 9 cow-milk microRNAs in human plasma using microRNA-sequencing analysis, including the top ranked microRNAs such as bta-miR-487b, miR-181b, and miR-421. The implications in health-related processes have been illustrated in the functional analysis. This work demonstrates the data-driven computational analysis is highly promising to study novel molecular characteristics of transportable microRNAs while bypassing the complex mechanistic details.

  18. Circulating Blood Monocyte Subclasses and Lipid-Laden Adipose Tissue Macrophages in Human Obesity.

    Directory of Open Access Journals (Sweden)

    Tal Pecht

    Full Text Available Visceral adipose tissue foam cells are increased in human obesity, and were implicated in adipose dysfunction and increased cardio-metabolic risk. In the circulation, non-classical monocytes (NCM are elevated in obesity and associate with atherosclerosis and type 2 diabetes. We hypothesized that circulating NCM correlate and/or are functionally linked to visceral adipose tissue foam cells in obesity, potentially providing an approach to estimate visceral adipose tissue status in the non-surgical obese patient.We preformed ex-vivo functional studies utilizing sorted monocyte subclasses from healthy donors. Moreover, we assessed circulating blood monocyte subclasses and visceral fat adipose tissue macrophage (ATM lipid content by flow-cytometry in paired blood and omental-fat samples collected from patients (n = 65 undergoing elective abdominal surgery.Ex-vivo, NCM and NCM-derived macrophages exhibited lower lipid accumulation capacity compared to classical or intermediate monocytes/-derived macrophages. Moreover, of the three subclasses, NCM exhibited the lowest migration towards adipose tissue conditioned-media. In a cohort of n = 65, increased %NCM associated with higher BMI (r = 0.250,p<0.05 and ATM lipid content (r = 0.303,p<0.05. Among patients with BMI≥25Kg/m2, linear regression models adjusted for age, sex or BMI revealed that NCM independently associate with ATM lipid content, particularly in men.Collectively, although circulating blood NCM are unlikely direct functional precursor cells for adipose tissue foam cells, their increased percentage in the circulation may clinically reflect higher lipid content in visceral ATMs.

  19. Role of HO/CO in the Control of Peripheral Circulation in Humans

    Directory of Open Access Journals (Sweden)

    David Sacerdoti

    2012-01-01

    Full Text Available Experimental studies show that the heme oxygenase/carbon monoxide system (HO/CO plays an important role in the homeostasis of circulation and in the pathophysiology of hypertension. No data are available on its role in the control of peripheral circulation in humans. We evaluated the effects of inhibition of HO with stannous mesoporphyrin IX (SnMP (200 M locally administered by iontophoresis, on human skin blood flow, evaluated by laser-Doppler flowmetry, in the presence and absence of nitric oxide synthase (NOS inhibition with L-NG-Nitroarginine methyl ester (L-NAME (100 M. We also evaluated the effect of HO inhibition on vasodilatation induced by acetylcholine (ACh and vasoconstriction caused by noradrenaline (NA. SnMP and L-NAME caused a similar 20–25% decrease in skin flow. After nitric oxide (NO inhibition with L-NAME, HO inhibition with SnMP caused a further 20% decrease in skin perfusion. SnMP decreased vasodilatation induced by ACh by about 70%, while it did not affect vasoconstriction to NA. In conclusion, HO/CO participates in the control of peripheral circulation, independently from NO, and is involved in vasodilatation to ACh.

  20. Hemodynamic changes in the hepatic circulation after the modulation of the splenic circulation in an in vivo human experimental model.

    Science.gov (United States)

    Akamatsu, Nobuhisa; Sugawara, Yasuhiko; Satou, Shouichi; Mitsui, Tetsuya; Ninomiya, Riki; Komagome, Masahiko; Ozawa, Fumiaki; Beck, Yoshifumi

    2014-01-01

    Recent advances in liver surgery have highlighted the effects of the splenic circulation on the hepatic circulation with respect to the hepatic arterial buffer response (HABR). The aim of the present study was to investigate the actual hemodynamic effects of splenic artery embolization/ligation and splenectomy on the hepatic circulation in patients who underwent pancreaticoduodenectomy through in vivo experimental models. In vivo models of splenic artery embolization/ligation (only splenic artery clamping) and splenectomy (simultaneous clamping of both the splenic artery and the splenic vein) were created in 40 patients who underwent pancreaticoduodenectomy for various reasons. The portal venous flow velocity, the portal venous flow volume, the hepatic arterial flow velocity, and the hepatic arterial resistance index were measured with color Doppler ultrasonography. Clamping of the splenic artery induced an immediate and significant increase (16%) in the hepatic artery velocity (P splenic artery, the hepatic artery velocity remained significantly increased at the level of the initial clamping, and the portal venous flow significantly decreased (16%, P splenic vein, which was performed after the clamping of the splenic artery, resulted in an immediate and significant decrease (30%) in the portal venous flow (P splenic vein, there was no change in the portal flow, which remained significantly lower (28%) than the flow in controls, whereas the hepatic arterial flow further significantly increased (31%, P splenic artery embolization/ligation and splenectomy are effective for increasing hepatic arterial flow and decreasing portal flow, with splenectomy providing a greater advantage. The HABR underlies these hemodynamic changes.

  1. Use of Human Plasma Samples to Identify Circulating Drug Metabolites that Inhibit Cytochrome P450 Enzymes.

    Science.gov (United States)

    Eng, Heather; Obach, R Scott

    2016-08-01

    Drug interactions elicited through inhibition of cytochrome P450 (P450) enzymes are important in pharmacotherapy. Recently, greater attention has been focused on not only parent drugs inhibiting P450 enzymes but also on possible inhibition of these enzymes by circulating metabolites. In this report, an ex vivo method whereby the potential for circulating metabolites to be inhibitors of P450 enzymes is described. To test this method, seven drugs and their known plasma metabolites were added to control human plasma at concentrations previously reported to occur in humans after administration of the parent drug. A volume of plasma for each drug based on the known inhibitory potency and time-averaged concentration of the parent drug was extracted and fractionated by high-pressure liquid chromatography-mass spectrometry, and the fractions were tested for inhibition of six human P450 enzyme activities (CYP1A2, CYP2C8, CYP2C9, CYP2C19, CYP2D6, and CYP3A4). Observation of inhibition in fractions that correspond to the retention times of metabolites indicates that the metabolite has the potential to contribute to P450 inhibition in vivo. Using this approach, norfluoxetine, hydroxyitraconazole, desmethyldiltiazem, desacetyldiltiazem, desethylamiodarone, hydroxybupropion, erythro-dihydrobupropion, and threo-dihydrobupropion were identified as circulating metabolites that inhibit P450 activities at a similar or greater extent as the parent drug. A decision tree is presented outlining how this method can be used to determine when a deeper investigation of the P450 inhibition properties of a drug metabolite is warranted. PMID:27271369

  2. Circulating Plasma microRNAs can differentiate Human Sepsis and Systemic Inflammatory Response Syndrome (SIRS)

    OpenAIRE

    Stefano Caserta; Florian Kern; Jonathan Cohen; Stephen Drage; Newbury, Sarah F; Llewelyn, Martin J

    2016-01-01

    Systemic inflammation in humans may be triggered by infection, termed sepsis, or non-infective processes, termed non-infective systemic inflammatory response syndrome (SIRS). MicroRNAs regulate cellular processes including inflammation and may be detected in blood. We aimed to establish definitive proof-of-principle that circulating microRNAs are differentially affected during sepsis and non-infective SIRS. Critically ill patients with severe (n = 21) or non-severe (n = 8) intra-abdominal sep...

  3. Self-reactivities to the non-erythroid alpha spectrin correlate with cerebral malaria in Gabonese children.

    Directory of Open Access Journals (Sweden)

    Vincent Guiyedi

    Full Text Available BACKGROUND: Hypergammaglobulinemia and polyclonal B-cell activation commonly occur in Plasmodium sp. infections. Some of the antibodies produced recognize self-components and are correlated with disease severity in P. falciparum malaria. However, it is not known whether some self-reactive antibodies produced during P. falciparum infection contribute to the events leading to cerebral malaria (CM. We show here a correlation between self-antibody responses to a human brain protein and high levels of circulating TNF alpha (TNFalpha, with the manifestation of CM in Gabonese children. METHODOLOGY: To study the role of self-reactive antibodies associated to the development of P. falciparum cerebral malaria, we used a combination of quantitative immunoblotting and multivariate analysis to analyse correlation between the reactivity of circulating IgG with a human brain protein extract and TNFalpha concentrations in cohorts of uninfected controls (UI and P. falciparum-infected Gabonese children developing uncomplicated malaria (UM, severe non-cerebral malaria (SNCM, or CM. RESULTS/CONCLUSION: The repertoire of brain antigens recognized by plasma IgGs was more diverse in infected than in UI individuals. Anti-brain reactivity was significantly higher in the CM group than in the UM and SNCM groups. IgG self-reactivity to brain antigens was also correlated with plasma IgG levels and age. We found that 90% of CM patients displayed reactivity to a high-molecular mass band containing the spectrin non-erythroid alpha chain. Reactivity with this band was correlated with high TNFalpha concentrations in CM patients. These results strongly suggest that an antibody response to brain antigens induced by P. falciparum infection may be associated with pathogenic mechanisms in patients developing CM.

  4. SARS-like cluster of circulating bat coronavirus pose threat for human emergence

    Science.gov (United States)

    Menachery, Vineet D.; Yount, Boyd L.; Debbink, Kari; Agnihothram, Sudhakar; Gralinski, Lisa E.; Plante, Jessica A.; Graham, Rachel L.; Scobey, Trevor; Ge, Xing-Yi; Donaldson, Eric F.; Randell, Scott H.; Lanzavecchia, Antonio; Marasco, Wayne A.; Shi, Zhengli-Li; Baric, Ralph S.

    2016-01-01

    The emergence of Severe Acute Respiratory Syndrome Coronavirus (SARS-CoV) and Middle East Respiratory Syndrome (MERS)-CoV underscores the threat of cross-species transmission events leading to outbreaks in humans. In this study, we examine the disease potential for SARS-like CoVs currently circulating in Chinese horseshoe bat populations. Utilizing the SARS-CoV infectious clone, we generated and characterized a chimeric virus expressing the spike of bat coronavirus SHC014 in a mouse adapted SARS-CoV backbone. The results indicate that group 2b viruses encoding the SHC014 spike in a wild type backbone can efficiently utilize multiple ACE2 receptor orthologs, replicate efficiently in primary human airway cells, and achieve in vitro titers equivalent to epidemic strains of SARS-CoV. Additionally, in vivo experiments demonstrate replication of the chimeric virus in mouse lung with notable pathogenesis. Evaluation of available SARS-based immune-therapeutic and prophylactic modalities revealed poor efficacy; both monoclonal antibody and vaccine approaches failed to neutralize and protect from CoVs utilizing the novel spike protein. Importantly, based on these findings, we synthetically rederived an infectious full length SHC014 recombinant virus and demonstrate robust viral replication both in vitro and in vivo. Together, the work highlights a continued risk of SARS-CoV reemergence from viruses currently circulating in bat populations. PMID:26552008

  5. Structural Insights into the Stability and Flexibility of Unusual Erythroid Spectrin Repeats

    Energy Technology Data Exchange (ETDEWEB)

    Kusunoki, H.; Macdonald, R.I.; Mondragon, A. (NWU)

    2010-03-08

    Erythroid spectrin, a major component of the cytoskeletal network of the red cell which contributes to both the stability and the elasticity of the red cell membrane, is composed of two subunits, {alpha} and {beta}, each formed by 16-20 tandem repeats. The properties of the repeats and their relative arrangement are thought to be key determinants of spectrin flexibility. Here we report a 2.4 {angstrom} resolution crystal structure of human erythroid {beta}-spectrin repeats 8 and 9. This two-repeat fragment is unusual as it exhibits low stability of folding and one of its repeats lacks two tryptophans highly conserved among spectrin repeats. Two key factors responsible for the lower stability and, possibly, its flexibility, are revealed by the structure. A third novel feature of the structure is the relative orientation of the two repeats, which increases the range of possible conformations and provides new insights into atomic models of spectrin flexibility.

  6. Dexamethasone targeted directly to macrophages induces macrophage niches that promote erythroid expansion

    DEFF Research Database (Denmark)

    Falchi, Mario; Varricchio, Lilian; Martelli, Fabrizio;

    2015-01-01

    Cultures of human CD34(pos) cells stimulated with erythroid growth factors plus dexamethasone, a model for stress erythropoiesis, generate numerous erythroid cells plus a few macrophages (approx. 3%; 3:1 positive and negative for CD169). Interactions occurring between erythroblasts and macrophages...... in these cultures and the biological effects associated with these interactions were documented by live phase-contrast videomicroscopy. Macrophages expressed high motility interacting with hundreds/thousands of erythroblasts per hour. CD169(pos) macrophages established multiple rapid 'loose' interactions...... with proerythroblasts leading to formation of transient erythroblastic island-like structures. By contrast, CD169(neg) macrophages established 'tight' interactions with mature erythroblasts and phagocytosed these cells. 'Loose' interactions of CD169(pos) macrophages were associated with proerythroblast cytokinesis (the...

  7. TRAIL regulates normal erythroid maturation through an ERK-dependent pathway.

    Science.gov (United States)

    Secchiero, Paola; Melloni, Elisabetta; Heikinheimo, Markku; Mannisto, Susanna; Di Pietro, Roberta; Iacone, Antonio; Zauli, Giorgio

    2004-01-15

    In order to investigate the biologic activity of tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) on human erythropoiesis, glycophorin A (GPA)+ erythroid cells were generated in serum-free liquid phase from human cord blood (CB) CD34+ progenitor cells. The surface expression of TRAIL-R1 was weakly detectable in the early-intermediate phase of erythroid differentiation (days 4-6; dim-intermediate GPA expression), whereas a clear-cut expression of TRAIL-R2 was observed through the entire course of erythroid differentiation (up to days 12-14; bright GPA expression). On the other hand, surface TRAIL-R3 and -R4 were not detected at any culture time. Besides inducing a rapid but small increase of apoptotic cell death, which was abrogated by the pan-caspase inhibitor z-VAD-fmk, the addition of recombinant TRAIL at day 6 of culture inhibited the generation of morphologically mature erythroblasts. Among the intracellular pathways investigated, TRAIL significantly stimulated the extracellular signal-regulated kinase 1/2 (ERK1/2) but not the p38/mitogen-activated protein kinase (MAPK) or the c-Jun NH2-terminal kinase (JNK) pathway. Consistently with a key role of ERK1/2 in mediating the negative effects of TRAIL on erythroid maturation, PD98059, a pharmacologic inhibitor of the ERK pathway, but not z-VAD-fmk or SB203580, a pharmacologic inhibitor of p38/MAPK, reverted the antidifferentiative effect of TRAIL on CB-derived erythroblasts. PMID:12969966

  8. Rift Valley Fever Virus Circulating among Ruminants, Mosquitoes and Humans in the Central African Republic

    Science.gov (United States)

    Nakouné, Emmanuel; Kamgang, Basile; Berthet, Nicolas; Manirakiza, Alexandre; Kazanji, Mirdad

    2016-01-01

    Background Rift Valley fever virus (RVFV) causes a viral zoonosis, with discontinuous epizootics and sporadic epidemics, essentially in East Africa. Infection with this virus causes severe illness and abortion in sheep, goats, and cattle as well as other domestic animals. Humans can also be exposed through close contact with infectious tissues or by bites from infected mosquitoes, primarily of the Aedes and Culex genuses. Although the cycle of RVFV infection in savannah regions is well documented, its distribution in forest areas in central Africa has been poorly investigated. Methodology/Principal Findings To evaluate current circulation of RVFV among livestock and humans living in the Central African Republic (CAR), blood samples were collected from sheep, cattle, and goats and from people at risk, such as stock breeders and workers in slaughterhouses and livestock markets. The samples were tested for anti-RVFV immunoglobulin M (IgM) and immunoglobulin G (IgG) antibodies. We also sequenced the complete genomes of two local strains, one isolated in 1969 from mosquitoes and one isolated in 1985 from humans living in forested areas. The 1271 animals sampled comprised 727 cattle, 325 sheep, and 219 goats at three sites. The overall seroprevalence of anti-RVFV IgM antibodies was 1.9% and that of IgG antibodies was 8.6%. IgM antibodies were found only during the rainy season, but the frequency of IgG antibodies did not differ significantly by season. No evidence of recent RVFV infection was found in 335 people considered at risk; however, 16.7% had evidence of past infection. Comparison of the nucleotide sequences of the strains isolated in the CAR with those isolated in other African countries showed that they belonged to the East/Central African cluster. Conclusion and significance This study confirms current circulation of RVFV in CAR. Further studies are needed to determine the potential vectors involved and the virus reservoirs. PMID:27760144

  9. Circulating Human Eosinophils Share a Similar Transcriptional Profile in Asthma and Other Hypereosinophilic Disorders.

    Directory of Open Access Journals (Sweden)

    Cindy Barnig

    Full Text Available Eosinophils are leukocytes that are released into the peripheral blood in a phenotypically mature state and are capable of being recruited into tissues in response to appropriate stimuli. Eosinophils, traditionally considered cytotoxic effector cells, are leukocytes recruited into the airways of asthma patients where they are believed to contribute to the development of many features of the disease. This perception, however, has been challenged by recent findings suggesting that eosinophils have also immunomodulatory functions and may be involved in tissue homeostasis and wound healing. Here we describe a transcriptome-based approach-in a limited number of patients and controls-to investigate the activation state of circulating human eosinophils isolated by flow cytometry. We provide an overview of the global expression pattern in eosinophils in various relevant conditions, e.g., eosinophilic asthma, hypereosinophilic dermatological diseases, parasitosis and pulmonary aspergillosis. Compared to healthy subjects, circulating eosinophils isolated from asthma patients differed in their gene expression profile which is marked by downregulation of transcripts involved in antigen presentation, pathogen recognition and mucosal innate immunity, whereas up-regulated genes were involved in response to non-specific stimulation, wounding and maintenance of homeostasis. Eosinophils from other hypereosinophilic disorders displayed a very similar transcriptional profile. Taken together, these observations seem to indicate that eosinophils exhibit non-specific immunomodulatory functions important for tissue repair and homeostasis and suggest new roles for these cells in asthma immunobiology.

  10. Circulating Human Eosinophils Share a Similar Transcriptional Profile in Asthma and Other Hypereosinophilic Disorders

    Science.gov (United States)

    Barnig, Cindy; Dembélé, Doulaye; Paul, Nicodème; Poirot, Anh; Uring-Lambert, Béatrice; Georgel, Philippe; de Blay, Fréderic; Bahram, Seiamak

    2015-01-01

    Eosinophils are leukocytes that are released into the peripheral blood in a phenotypically mature state and are capable of being recruited into tissues in response to appropriate stimuli. Eosinophils, traditionally considered cytotoxic effector cells, are leukocytes recruited into the airways of asthma patients where they are believed to contribute to the development of many features of the disease. This perception, however, has been challenged by recent findings suggesting that eosinophils have also immunomodulatory functions and may be involved in tissue homeostasis and wound healing. Here we describe a transcriptome-based approach–in a limited number of patients and controls—to investigate the activation state of circulating human eosinophils isolated by flow cytometry. We provide an overview of the global expression pattern in eosinophils in various relevant conditions, e.g., eosinophilic asthma, hypereosinophilic dermatological diseases, parasitosis and pulmonary aspergillosis. Compared to healthy subjects, circulating eosinophils isolated from asthma patients differed in their gene expression profile which is marked by downregulation of transcripts involved in antigen presentation, pathogen recognition and mucosal innate immunity, whereas up-regulated genes were involved in response to non-specific stimulation, wounding and maintenance of homeostasis. Eosinophils from other hypereosinophilic disorders displayed a very similar transcriptional profile. Taken together, these observations seem to indicate that eosinophils exhibit non-specific immunomodulatory functions important for tissue repair and homeostasis and suggest new roles for these cells in asthma immunobiology. PMID:26524763

  11. Chasing a ghost?--Issues with the determination of circulating levels of endotoxin in human blood.

    Science.gov (United States)

    Gnauck, Anne; Lentle, Roger Graham; Kruger, Marlena Cathorina

    2016-01-01

    Reliable quantification of bacterial products such as endotoxin is important for the diagnosis of Gram-negative infection and for the monitoring of its treatment. Further, it is important to identify patients with persistent subclinical level of bacterial products in their systemic circulation as data from animal studies also suggest this may be correlated with the onset of metabolic syndrome. In this review, we first aim to describe the principles of the Limulus amoebocyte lysate (LAL) test, an assay that is used to quantify endotoxin, and the various shortcomings that must be addressed before it can become a reliable means of quantifying endotoxin in samples derived from blood. We then review published data regarding endotoxin levels in healthy subjects and those with sepsis, inflammatory bowel disease, liver disorders and metabolic disorders such as obesity and diabetes. We also review the evidence regarding influence of macronutrients in augmenting the levels of systemic endotoxin. The results of this review show that reported mean levels of endotoxin in the systemic circulation of healthy humans and of those with various clinical disorders vary over a wide range. Further, this review shows that a significant proportion of this variation can be related to the method that was used to prepare plasma and serum samples prior to assay and its ability to reduce the effect of various blood borne factors that interfere with the LAL assay. PMID:26732012

  12. Circulating Plasma microRNAs can differentiate Human Sepsis and Systemic Inflammatory Response Syndrome (SIRS).

    Science.gov (United States)

    Caserta, Stefano; Kern, Florian; Cohen, Jonathan; Drage, Stephen; Newbury, Sarah F; Llewelyn, Martin J

    2016-01-01

    Systemic inflammation in humans may be triggered by infection, termed sepsis, or non-infective processes, termed non-infective systemic inflammatory response syndrome (SIRS). MicroRNAs regulate cellular processes including inflammation and may be detected in blood. We aimed to establish definitive proof-of-principle that circulating microRNAs are differentially affected during sepsis and non-infective SIRS. Critically ill patients with severe (n = 21) or non-severe (n = 8) intra-abdominal sepsis; severe (n = 23) or non-severe (n = 21) non-infective SIRS; or no SIRS (n = 16) were studied. Next-generation sequencing and qRT-PCR were used to measure plasma microRNAs. Detectable blood miRNAs (n = 116) were generally up-regulated in SIRS compared to no-SIRS patients. Levels of these 'circulating inflammation-related microRNAs' (CIR-miRNAs) were 2.64 (IQR: 2.10-3.29) and 1.52 (IQR: 1.15-1.92) fold higher for non-infective SIRS and sepsis respectively (p inflammatory cytokines (IL-1, IL-6 and others). Thus, among critically ill patients, sepsis and non-infective SIRS are associated with substantial, differential changes in CIR-miRNAs. CIR-miRNAs may be regulators of inflammation and warrant thorough evaluation as diagnostic and therapeutic targets. PMID:27320175

  13. Persistent circulating human insulin in sheep transplanted in utero with human mesenchymal stem cells

    Science.gov (United States)

    Ersek, Adel; Pixley, John S.; Goodrich, A. Daisy; Porada, Christopher D.; Almeida-Porada, Graca; Thain, David S.; Zanjani, Esmail D.

    2010-01-01

    Objective To determine if mesenchymal stem cells (MSC) derived from human fetal pancreatic tissue (pMSC) would engraft and differentiate in sheep pancreas following transplantation in utero. Methods A three-step culture system was established for generating human fetal pMSC. Sheep fetuses were transplanted during the fetal transplant receptivity period with human pMSC and evaluated for in situ and functional engraftment in their pancreas, liver and bone marrow. Results Isolation and expansion of adherent cells from the human fetal pancreas yielded a cell population with morphologic and phenotypic characteristics similar to MSC derived from bone marrow. This putative stem cell population could undergo multilineage differentiation in vitro. Three to 27 months after fetal transplantation, the pancreatic engraftment frequency (chimeric index) was 79% while functional engraftment was noted in 50% of transplanted sheep. Hepatic and marrow engraftment and expression was noted as well. Conclusion We have established a procedure for isolation of human fetal pMSC that display characteristics similar to bone marrow derived MSC. In vivo results suggest the pMSC engraft, differentiate and secrete human insulin from the sheep pancreas. PMID:20170708

  14. Radioimmunoassay of erythropoietin: circulating levels in normal and polycythemic human beings.

    Science.gov (United States)

    Garcia, J F; Ebbe, S N; Hollander, L; Cutting, H O; Miller, M E; Cronkite, E P

    1982-05-01

    Techniques are described in detail for the RIA of human Ep in unextracted plasma or serum. With 100 microliters of sample, the essay is sensitive at an Ep concentration of approximately 4 mU/ml, and when required, the sensitivity can be increased to 0.4 mU/ml, a range considerably less than the concentration observed in normal human beings. This is approximately 100 times more sensitive than existing in vivo bioassays for this hormone. Studies concerned with the validation of the Ep RIA show a high degree of correlation with the polycythemic mouse bioassay. Dilutions of a variety of human serum samples show a parallel relationship with the standard reference preparation for Ep. Validation of the RIA is further confirmed by observations of appropriate increases or decreases in circulating Ep levels in physiological and clinical conditions known to be associated with stimulation of suppression of Ep secretion. Significantly different mean serum concentrations of 17.2 mU/ml for normal male subjects and 18.8 mU/ml for normal female subjects were observed. Mean plasma Ep concentrations in patients with polycythemia vera are significantly decreased, and those of patients with secondary polycythemia are significantly increased as compared to plasma levels in normal subjects. These results demonstrate an initial practical value of the Ep RIA inthe hematology clinic, which will most certainly be expanded with its more extensive use. PMID:7069267

  15. Radioimmunoassay of erythropoietin: circulating levels in normal and polycythemic human beings

    Energy Technology Data Exchange (ETDEWEB)

    Garcia, J.F. (Lawrence Berkeley Lab., CA); Ebbe, S.N.; Hollander, L.; Cutting, H.O.; Miller, M.E.; Cronkite, E.P.

    1982-05-01

    Techniques are described in detail for the RIA of human Ep in unextracted plasma or serum. With 100 ..mu..l of sample, the assay is sensitive at an Ep concentration of approximately 4 mU/ml, and when required, the sensitivity can be increased to 0.4 mU/ml, a range considerably less than the concentration observed in normal human beings. This is approximately 100 times more sensitive than existing in vivo bioassays for this hormone. Studies concerned with the validation of the Ep RIA show a high degree of correlation with the polycythemic mouse bioassay. Dilutions of a variety of human serum samples show a parallel relationship with the standard reference preparation for Ep. Validation of the RIA is further confirmed by observations of appropriate increases or decreases of circulating Ep levels in physiological and clinical conditions known to be associated with stimulation or suppression of Ep secretion. Significantly different mean serum concentrations of 17.2 mU/ml for normal male subjects and 18.8 mU/ml for normal female subjects were observed. Mean plasma Ep concentrations in patients with polycythemia vera are significantly decreased, and those of patients with secondary polycythemia are significantly increased as compared to plasma levels in normal subjects. These results demonstrate an initial practical value of the Ep RA in the hematology clinic, which will most certainly be expanded with its more extensive use.

  16. PPAR-α and glucocorticoid receptor synergize to promote erythroid progenitor self-renewal.

    Science.gov (United States)

    Lee, Hsiang-Ying; Gao, Xiaofei; Barrasa, M Inmaculada; Li, Hu; Elmes, Russell R; Peters, Luanne L; Lodish, Harvey F

    2015-06-25

    Many acute and chronic anaemias, including haemolysis, sepsis and genetic bone marrow failure diseases such as Diamond-Blackfan anaemia, are not treatable with erythropoietin (Epo), because the colony-forming unit erythroid progenitors (CFU-Es) that respond to Epo are either too few in number or are not sensitive enough to Epo to maintain sufficient red blood cell production. Treatment of these anaemias requires a drug that acts at an earlier stage of red cell formation and enhances the formation of Epo-sensitive CFU-E progenitors. Recently, we showed that glucocorticoids specifically stimulate self-renewal of an early erythroid progenitor, burst-forming unit erythroid (BFU-E), and increase the production of terminally differentiated erythroid cells. Here we show that activation of the peroxisome proliferator-activated receptor α (PPAR-α) by the PPAR-α agonists GW7647 and fenofibrate synergizes with the glucocorticoid receptor (GR) to promote BFU-E self-renewal. Over time these agonists greatly increase production of mature red blood cells in cultures of both mouse fetal liver BFU-Es and mobilized human adult CD34(+) peripheral blood progenitors, with a new and effective culture system being used for the human cells that generates normal enucleated reticulocytes. Although Ppara(-/-) mice show no haematological difference from wild-type mice in both normal and phenylhydrazine (PHZ)-induced stress erythropoiesis, PPAR-α agonists facilitate recovery of wild-type but not Ppara(-/-) mice from PHZ-induced acute haemolytic anaemia. We also show that PPAR-α alleviates anaemia in a mouse model of chronic anaemia. Finally, both in control and corticosteroid-treated BFU-E cells, PPAR-α co-occupies many chromatin sites with GR; when activated by PPAR-α agonists, additional PPAR-α is recruited to GR-adjacent sites and presumably facilitates GR-dependent BFU-E self-renewal. Our discovery of the role of PPAR-α agonists in stimulating self-renewal of early erythroid

  17. Predominant leptospiral serogroups circulating among humans, livestock and wildlife in Katavi-Rukwa ecosystem, Tanzania.

    Directory of Open Access Journals (Sweden)

    Justine A Assenga

    2015-03-01

    Full Text Available Leptospirosis is a worldwide zoonotic disease and a serious, under-reported public health problem, particularly in rural areas of Tanzania. In the Katavi-Rukwa ecosystem, humans, livestock and wildlife live in close proximity, which exposes them to the risk of a number of zoonotic infectious diseases, including leptospirosis.A cross-sectional epidemiological study was carried out in the Katavi region, South-west Tanzania, to determine the seroprevalence of Leptospira spp in humans, domestic ruminants and wildlife. Blood samples were collected from humans (n = 267, cattle (n = 1,103, goats (n = 248, buffaloes (n = 38, zebra (n = 2, lions (n = 2, rodents (n = 207 and shrews (n = 11. Decanted sera were tested using the Microscopic Agglutination Test (MAT for antibodies against six live serogroups belonging to the Leptospira spp, with a cutoff point of ≥ 1:160. The prevalence of leptospiral antibodies was 29.96% in humans, 30.37% in cattle, 8.47% in goats, 28.95% in buffaloes, 20.29% in rodents and 9.09% in shrews. Additionally, one of the two samples in lions was seropositive. A significant difference in the prevalence P<0.05 was observed between cattle and goats. No significant difference in prevalence was observed with respect to age and sex in humans or any of the sampled animal species. The most prevalent serogroups with antibodies of Leptospira spp were Sejroe, Hebdomadis, Grippotyphosa, Icterohaemorrhagie and Australis, which were detected in humans, cattle, goats and buffaloes; Sejroe and Grippotyphosa, which were detected in a lion; Australis, Icterohaemorrhagie and Grippotyphosa, which were detected in rodents; and Australis, which was detected in shrews. Antibodies to serogroup Ballum were detected only in humans.The results of this study demonstrate that leptospiral antibodies are widely prevalent in humans, livestock and wildlife from the Katavi-Rukwa ecosystem. The disease poses a serious economic and public health threat in the

  18. Inflammatory environment and oxidized LDL convert circulating human proangiogenic cells into functional antigen-presenting cells.

    Science.gov (United States)

    Vinci, Maria Cristina; Piacentini, Luca; Chiesa, Mattia; Saporiti, Federica; Colombo, Gualtiero I; Pesce, Maurizio

    2015-09-01

    The function of human circulating PACs has been described extensively. However, little focus has been placed on understanding how these cells differ in their functions in the presence of microenvironments mimicking vascular inflammation. We hypothesized that exposure to proinflammatory cytokines or the oxLDL, an autoantigen abundant in advanced atherosclerotic plaques, converts PACs into immune-modulating/proinflammatory cells. Hence, we examined the effect of oxLDL and inflammatory stimuli on their phenotype by use of a functional genomics model based on secretome and whole genome transcriptome profiling. PACs obtained from culturing a PBMC fraction in angiogenic medium were primed with DC differentiation cytokines and then exposed to proinflammatory cytokines or oxLDL. Under these conditions, PACs converted into APCs, expressed maturation markers CD80 and CD83, and showed an increased up-regulation of CD86. APCcy and APCox induced a robust T cell BrdU incorporation. Despite a similar ability to induce lymphocyte proliferation, APCcy and APCox differed for the secretory pathway and mRNA expression. Analysis of the differentially expressed genes identified 4 gene "clusters," showing reciprocal modulation in APCcy vs. APCox, justifying, according to functional genomics analyses, a different putative function of the cells in antigen processing. Together, these data show that treatment with inflammatory cytokines or oxLDL converts human PAC phenotypes and functions into that of APCs with similar lymphocyte-activating ability but distinct maturation degree and paracrine functions.

  19. The hemodynamics of human septic shock relate to circulating innate immunity factors.

    Science.gov (United States)

    Hartemink, Koen J; Groeneveld, A B Johan

    2010-01-01

    The role of innate immunity, e.g., complement activation and cytokine release in the hemodynamic alterations in the course of human septic shock is largely unknown. We prospectively studied 14 consecutive septic shock patients with a pulmonary artery catheter in place. For 3 days after admission, hemodynamic variables and plasma levels of C3a, a product of complement activation, and interleukin (IL)-6 and tumor necrosis factor alpha (TNF-α) were measured 6-hourly. Doses of vasoactive drugs were recorded. Of the 14 patients, 8 died in the ICU. Patients had a hyperdynamic circulation with tachycardia, mild hypotension, increased cardiac index, peripheral vasodilation and myocardial depression. C3a, IL-6 and TNF-α plasma levels were supranormal in 123 of 138 (89%), 132 of 138 (96%) and 83 of 111 (75%) measurements, respectively. Independently of blood culture results, treatment with vasoactive drugs and outcome, mean arterial blood pressure and systemic vascular resistance index were lower when IL-6 levels were higher and left ventricular function was less depressed when C3a levels were higher in the course of septic shock. The TNF-α levels did not invariably relate to peripheral vascular and myocardial function parameters. Our serial observations suggest that, in human septic shock, peripheral vasodilation is most strongly and independently, of all inflammatory factors, associated with IL-6 release, whereas complement activation partly offsets the myocardial depression of the syndrome. Innate immunity factors may thus differ in their contribution to the course of hemodynamic abnormalities of septic shock.

  20. Immunoradiometric assay for the detection of circulating antibodies to murine monoclonal antibodies in humans (HAMA)

    International Nuclear Information System (INIS)

    The increasing clinical use of monoclonal antibodies (MAb) has focussed attention on the importance of the generation of human anti-mouse antibodies (HAMA). HAMA can not only be life threatening but can also be associated with reduced image quality and accelerated MAb clearance in vivo as well as interfere with in vitro MAb based assays. The development of a two step immunoradiometric assay (IRMA) for detecting circulating HAMA is reported. Preliminary results have been generated with specific MAb coated polystyrene wells. The appropriately diluted serum sample is first incubated with the MAb coated wells followed by a wash step and a second incubation with 125I labeled goat anti-human IgG. After a final wash, the wells are assayed for 125I and the results expressed as percent of the input bound. The prototype assay is compared with an existing commercially available ELISA kit using patient sera obtained at various time periods up to 7 months after IV MAb injection for radioimmunoscintigraphy. 18 refs., 2 tabs., 1 fig

  1. Pathogenesis of the erythroid failure in Diamond Blackfan anaemia.

    Science.gov (United States)

    Sieff, Colin A; Yang, Jing; Merida-Long, Lilia B; Lodish, Harvey F

    2010-02-01

    Diamond Blackfan anaemia (DBA) is a severe congenital failure of erythropoiesis. Despite mutations in one of several ribosome protein genes, including RPS19, the cause of the erythroid specificity is still a mystery. We hypothesized that, because the chromatin of late erythroid cells becomes condensed and transcriptionally inactive prior to enucleation, the rapidly proliferating immature cells require very high ribosome synthetic rates. RNA biogenesis was measured in primary mouse fetal liver erythroid progenitor cells; during the first 24 h, cell number increased three to fourfold while, remarkably, RNA content increased sixfold, suggesting an accumulation of an excess of ribosomes during early erythropoiesis. Retrovirus infected siRNA RPS19 knockdown cells showed reduced proliferation but normal differentiation, and cell cycle analysis showed a G1/S phase delay. p53 protein was increased in the knockdown cells, and the mRNA level for p21, a transcriptional target of p53, was increased. Furthermore, we show that RPS19 knockdown decreased MYB protein, and Kit mRNA was reduced, as was the amount of cell surface KIT protein. Thus, in this small hairpin RNA murine model of DBA, RPS19 insufficient erythroid cells may proliferate poorly because of p53-mediated cell cycle arrest, and also because of decreased expression of the key erythroid signalling protein KIT.

  2. Recombinant human granulocyte colony-stimulating factor increases circulating CD34-postive cells in patients with AIDS

    DEFF Research Database (Denmark)

    Nielsen, S D; Dam-Larsen, S; Nielsen, C;

    1997-01-01

    circulating hematopoietic progenitor cells (CD34 cells) in patients with AIDS, using the recombinant human granulocyte colony-stimulating factor (G-CSF). Eight patients with AIDS were treated with G-CSF for neutropenia (< 1.0 x 10(9)/l). Treatment consisted of daily subcutaneous injections with 300 micrograms...

  3. Circulating N-terminal brain natriuretic peptide and cardiac function in response to acute systemic hypoxia in healthy humans

    NARCIS (Netherlands)

    I. Heinonen (Ilkka); M. Luotolahti (Matti); O. Vuolteenaho (Olli); M. Nikinmaa (Mikko); A. Saraste (Antti); J. Hartiala (Jaakko); J. Koskenvuo (Juha); J. Knuuti (Juhani); O. Arjamaa (Olli)

    2014-01-01

    textabstractBackground: As it remains unclear whether hypoxia of cardiomyocytes could trigger the release of brain natriuretic peptide (BNP) in humans, we investigated whether breathing normobaric hypoxic gas mixture increases the circulating NT-proBNP in healthy male subjects.Methods: Ten healthy y

  4. Erythroid cell growth and differentiation in vitro in the simulated microgravity environment of the NASA rotating wall vessel bioreactor

    Science.gov (United States)

    Sytkowski, A. J.; Davis, K. L.

    2001-01-01

    Prolonged exposure of humans and experimental animals to the altered gravitational conditions of space flight has adverse effects on the lymphoid and erythroid hematopoietic systems. Although some information is available regarding the cellular and molecular changes in lymphocytes exposed to microgravity, little is known about the erythroid cellular changes that may underlie the reduction in erythropoiesis and resultant anemia. We now report a reduction in erythroid growth and a profound inhibition of erythropoietin (Epo)-induced differentiation in a ground-based simulated microgravity model system. Rauscher murine erythroleukemia cells were grown either in tissue culture vessels at 1 x g or in the simulated microgravity environment of the NASA-designed rotating wall vessel (RWV) bioreactor. Logarithmic growth was observed under both conditions; however, the doubling time in simulated microgravity was only one-half of that seen at 1 x g. No difference in apoptosis was detected. Induction with Epo at the initiation of the culture resulted in differentiation of approximately 25% of the cells at 1 x g, consistent with our previous observations. In contrast, induction with Epo at the initiation of simulated microgravity resulted in only one-half of this degree of differentiation. Significantly, the growth of cells in simulated microgravity for 24 h prior to Epo induction inhibited the differentiation almost completely. The results suggest that the NASA RWV bioreactor may serve as a suitable ground-based microgravity simulator to model the cellular and molecular changes in erythroid cells observed in true microgravity.

  5. PPARα and glucocorticoid receptor synergize to promote erythroid progenitor self-renewal

    Science.gov (United States)

    Lee, Hsiang-Ying; Gao, Xiaofei; Barrasa, M. Inmaculada; Li, Hu; Elmes, Russell R.; Peters, Luanne L.; Lodish, Harvey F.

    2015-01-01

    Summary Many acute and chronic anemias, including hemolysis, sepsis, and genetic bone marrow failure diseases such as Diamond-Blackfan Anemia (DBA), are not treatable with erythropoietin (Epo), because the colony-forming unit erythroid progenitors (CFU-Es) that respond to Epo are either too few in number or are not sensitive enough to Epo to maintain sufficient red blood cell production 1,2,3–5,6,7,8,9. Treatment of these anemias requires a drug that acts at an earlier stage of red cell formation and enhances the formation of Epo-sensitive CFU-E progenitors. Recently we showed that glucocorticoids specifically stimulate self-renewal of the early erythroid progenitor, the burst-forming unit erythroid (BFU-E), and increase the production of terminally differentiated erythroid cells 10,11. Here we demonstrate that activation of the peroxisome proliferator-activated receptor alpha (PPARα) by PPARα agonists, GW7647 and fenofibrate, synergizes with glucocorticoid receptor (GR) to promote BFU-E self-renewal. Over time these agonists greatly increase production of mature red blood cells in cultures both of mouse fetal liver BFU-Es and of mobilized human adult CD34+ peripheral blood progenitors, the latter employing a new and effective culture system that generates normal enucleated reticulocytes. While PPARα−/− mice show no hematological difference from wild-type mice in both normal and phenylhydrazine (PHZ)-induced stress erythropoiesis, PPARα agonists facilitate recovery of wild-type mice, but not PPARα−/− mice, from PHZ-induced acute hemolytic anemia. We also showed that PPARα alleviates anemia in a mouse model of chronic anemia. Finally, both in control and corticosteroid-treated BFU-E cells PPARα co-occupies many chromatin sites with GR; when activated by PPARα agonists, additional PPARα is recruited to GR-adjacent sites and presumably facilitates GR-dependent BFU-E self-renewal. Our discovery of the role of PPARα agonists in stimulating self

  6. Numerical Models of Human Circulatory System under Altered Gravity: Brain Circulation

    Science.gov (United States)

    Kim, Chang Sung; Kiris, Cetin; Kwak, Dochan; David, Tim

    2003-01-01

    A computational fluid dynamics (CFD) approach is presented to model the blood flow through the human circulatory system under altered gravity conditions. Models required for CFD simulation relevant to major hemodynamic issues are introduced such as non-Newtonian flow models governed by red blood cells, a model for arterial wall motion due to fluid-wall interactions, a vascular bed model for outflow boundary conditions, and a model for auto-regulation mechanism. The three-dimensional unsteady incompressible Navier-Stokes equations coupled with these models are solved iteratively using the pseudocompressibility method and dual time stepping. Moving wall boundary conditions from the first-order fluid-wall interaction model are used to study the influence of arterial wall distensibility on flow patterns and wall shear stresses during the heart pulse. A vascular bed modeling utilizing the analogy with electric circuits is coupled with an auto-regulation algorithm for multiple outflow boundaries. For the treatment of complex geometry, a chimera overset grid technique is adopted to obtain connectivity between arterial branches. For code validation, computed results are compared with experimental data for steady and unsteady non-Newtonian flows. Good agreement is obtained for both cases. In sin-type Gravity Benchmark Problems, gravity source terms are added to the Navier-Stokes equations to study the effect of gravitational variation on the human circulatory system. This computational approach is then applied to localized blood flows through a realistic carotid bifurcation and two Circle of Willis models, one using an idealized geometry and the other model using an anatomical data set. A three- dimensional anatomical Circle of Willis configuration is reconstructed from human-specific magnetic resonance images using an image segmentation method. The blood flow through these Circle of Willis models is simulated to provide means for studying gravitational effects on the brain

  7. Melatonin enhances mitochondrial ATP synthesis, reduces reactive oxygen species formation, and mediates translocation of the nuclear erythroid 2-related factor 2 resulting in activation of phase-2 antioxidant enzymes (γ-GCS, HO-1, NQO1) in ultraviolet radiation-treated normal human epidermal keratinocytes (NHEK).

    Science.gov (United States)

    Kleszczyński, Konrad; Zillikens, Detlef; Fischer, Tobias W

    2016-09-01

    Melatonin is an ubiquitous molecule with a variety of functions including potent antioxidative properties. Due to its lipophilic character, it easily crosses cellular and intracellular membranes and reaches all subcellular organelles. Because of its ability to scavenge free radicals, melatonin protects against oxidative stress, for example, induced by ultraviolet radiation (UVR). Here, we investigated, in a dose-dependent (0, 10, 25, and 50 mJ/cm(2) ) and time-dependent (0, 4, 24, 48 hr post-UVR) manner, whether melatonin prevents the UVR-mediated alterations in ATP synthesis and the generation of reactive oxygen species (ROS) in normal human epidermal keratinocytes (NHEK). Additionally, we evaluated the molecular mechanism of action of melatonin with regard to activation of phase-2 antioxidative enzymes via nuclear erythroid 2-related factor (Nrf2). We found that (i) melatonin counteracted UVR-induced alterations in the ATP synthesis and reduced free radical formation; (ii) melatonin induced the translocation of Nrf2 transcription factor from the cytosol into the nucleus resulting in, (iii) melatonin enhanced gene expression of phase-2 antioxidative enzymes including γ-glutamylcysteine synthetase (γ-GCS), heme oxygenase-1 (HO-1), and NADPH: quinone dehydrogenase-1 (NQO1) representing an elevated antioxidative response of keratinocytes. These results suggest that melatonin not only directly scavenges ROS, but also significantly induces the activation of phase-2 antioxidative enzymes via the Nrf2 pathway uncovering a new action mechanism that supports the ability of keratinocytes to protect themselves from UVR-mediated oxidative stress. PMID:27117941

  8. A critical role for the co-repressor N-CoR in erythroid differentiation and heme synthesis

    Institute of Scientific and Technical Information of China (English)

    Dianzheng Zhang; Ellen Cho; Jiemin Wong

    2007-01-01

    Co-repressor N-CoR (nuclear receptor co-repressor) has important roles in different biological processes, including proliferation, differentiation and development. Mutant mice lacking N-CoR are embryonically lethal and appear to die from anemia owing to defects in definitive erythropoiesis. However, the underlying molecular mechanisms of N-CoR-mediated erythroid differentiation are largely unknown. Using the human erythroleukemic K562 cell line, which can be chemically induced to differentiate into either erythroid or megakaryocytic lineages depending on the inducers used, we have investigated the role of N-CoR in erythroid differentiation. We show that knockdown of N-CoR either transiently (siRNA) or permanently (shRNA) impairs the cytosine arabinoside (Ara-C)- but not hemin-induced erythroid differentiation of K562 cells. RT-PCR analysis reveals that N-CoR is required for induction by Ara-C of 5-aminolevulinate synthase (ALA-S2), a key enzyme involved in heme biosynthesis. Furthermore, the amount of N-CoR proteins increases significantly during Ara-C-induced K562 differentiation, apparently through a post-transcriptional mechanism. Consistent with the data from N-CoR-null mice, N-CoR is not required for the differentiation of K562 cells into megakaryocytic lineages, induced by phorbol 12-myristate 13-acetate. Thus, our in vitro study confirms a role for N-CoR in erythroid differentiation and reveals for the first time that N-CoR is required for the induction of a key enzyme involved in heme synthesis.

  9. Circulating interleukin-8 levels explain breast cancer osteolysis in mice and humans.

    Science.gov (United States)

    Kamalakar, Archana; Bendre, Manali S; Washam, Charity L; Fowler, Tristan W; Carver, Adam; Dilley, Joshua D; Bracey, John W; Akel, Nisreen S; Margulies, Aaron G; Skinner, Robert A; Swain, Frances L; Hogue, William R; Montgomery, Corey O; Lahiji, Parshawn; Maher, Jacqueline J; Leitzel, Kim E; Ali, Suhail M; Lipton, Alan; Nicholas, Richard W; Gaddy, Dana; Suva, Larry J

    2014-04-01

    Skeletal metastases of breast cancer and subsequent osteolysis connote a dramatic change in the prognosis for the patient and significantly increase the morbidity associated with disease. The cytokine interleukin 8 (IL-8/CXCL8) is able to directly stimulate osteoclastogenesis and bone resorption in mouse models of breast cancer bone metastasis. In this study, we determined whether circulating levels of IL-8 were associated with increased bone resorption and breast cancer bone metastasis in patients and investigated IL-8 action in vitro and in vivo in mice. Using breast cancer patient plasma (36 patients), we identified significantly elevated IL-8 levels in bone metastasis patients compared with patients lacking bone metastasis (pIL-8 and increased bone resorption (pIL-8 expression. In vitro, human MDA-MB-231 and MDA-MET breast cancer cell lines secrete two distinct IL-8 isoforms, both of which were found to stimulate osteoclastogenesis. However, the more osteolytic MDA-MET-derived full length IL-8(1-77) had significantly higher potency than the non-osteolytic MDA-MB-231-derived IL-8(6-77), via the CXCR1 receptor. MDA-MET breast cancer cells were injected into the tibia of nude mice and 7days later treated daily with a neutralizing IL-8 monoclonal antibody. All tumor-injected mice receiving no antibody developed large osteolytic bone tumors, whereas 83% of the IL-8 antibody-treated mice had no evidence of tumor at the end of 28days and had significantly increased survival. The pro-osteoclastogenic activity of IL-8 in vivo was confirmed when transgenic mice expressing human IL-8 were examined and found to have a profound osteopenic phenotype, with elevated bone resorption and inherently low bone mass. Collectively, these data suggest that IL-8 plays an important role in breast cancer osteolysis and that anti-IL-8 therapy may be useful in the treatment of the skeletal related events associated with breast cancer.

  10. File list: His.Bld.20.AllAg.Erythroid_Cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available His.Bld.20.AllAg.Erythroid_Cells hg19 Histone Blood Erythroid Cells SRX218423,SRX21...8422 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/His.Bld.20.AllAg.Erythroid_Cells.bed ...

  11. File list: His.Bld.50.AllAg.Erythroid_Cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available His.Bld.50.AllAg.Erythroid_Cells hg19 Histone Blood Erythroid Cells SRX218422,SRX21...8423 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/His.Bld.50.AllAg.Erythroid_Cells.bed ...

  12. File list: InP.Bld.20.AllAg.Erythroid_Cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available InP.Bld.20.AllAg.Erythroid_Cells hg19 Input control Blood Erythroid Cells SRX218417... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/InP.Bld.20.AllAg.Erythroid_Cells.bed ...

  13. [Phylogenetic variability of human metapneumovirus strains circulating in Turkey during two consecutive epidemic seasons].

    Science.gov (United States)

    Bayrakdar, Fatma; Altaş, Ayşe Başak; Korukluoğlu, Gülay

    2016-01-01

    Human metapneumovirus (HMPV), classified in Paramyxoviridae family, phylogenetically consists of two major groups namely A and B, with genetic lineages of A1, A2 (comprises of sublineages A2a and A2b) and B1, B2. Although detailed evaluation on phylogenetic analysis of HMPV has been described in other countries, there are no data from Turkey on this subject. The aim of this study was to demonstrate for the first time, the phylogenetic diversity of HMPV strains circulating in Turkey during two consecutive epidemic seasons. A total of 2900 upper respiratory tract samples collected from patients with respiratory illness were evaluated between January 2011 and December 2013, without any special selection criteria. The presence of respiratory viruses in the samples were detected by real-time multiplex polymerase chain reaction (FTD® Respiratory Pathogens 21 Multiplex RT-PCR, Fast Track Diagnostics, Luxemburg), and 76 (2.6%) samples positive for HMPV were included in the study. HPMV nucleocapsid (N) (nt: 454-878) and fusion (F) (nt: 3624-4130) genes were selected for phylogenetic analysis. In sequence analysis, F and N gene sequences could only be obtained successfully from 46 out of 76 HMPV positive samples. According to sequences obtained, 54.3% belonged to B2, 17.4% to B1, 4.3% to A1, 4.3% to A2a, and 20% to A2b. In 2011, the A2b sublineage was predominant, while in 2012 and 2013, B2 lineages were predominant together with the B1 lineage. The A1 lineage was observed only in 2013. For the F gene fragment, nucleotide distance between group A and B was in the range of 0.138-0.168, however aminoacid distance amongst Turkish HMPV sequences were in the range of 0.028-0.042. For the N gene fragment, nucleotide distance between group A and B was in the range of 0.141-0.163, but aminoacid distance between group A and B was in the range of 0.037-0.050. Nucleotide diversity was higher than aminoacid diversity between and within lineages found in this study. This result

  14. Initial function analysis of a novel erythroid differentiation related gene EDRF1

    Institute of Scientific and Technical Information of China (English)

    王敦成; 黎燕; 沈倍奋

    2001-01-01

    Erythroid differentiation depends on the establishment of specific patterns of gene expression. Hypersensitive site 2 (HS2, serving as a major enhancer of globin genes)-binding proteins may be involved in its natural open chromosomal environment formation. Previously we prepared monoclonal antibodies against HS2-binding nuclear proteins of terminal differentiated erythroid cells. By utilizing the monoclonal antibodies, we screened λ-gt11 human fetal liver cDNA expression library and obtained one cDNA clone, which was named erythroid differentiation related gene (EDRF1, Genbank accession number AF040247) , encompassing an entire open reading frame. We investigated the expression pattern of EDRF1 by RT-PCR technique. And a clue to the function of EDRF1 has been found from confirmation of high levels of EDRF1 mRNA in differentiated K562 and human fetal liver tissue. To illuminate the function of EDRF1 in K562 cells, sense and antisense EDRF1 constructs were prepared and transfected into K562 cells, α-globin mRNA was down-regulated and EpoR (erythropoietin receptor) mRNA expression was increased in antisense transfected cells. Cells transfected with sense construct grew more slowly than control cells suggested by [3H] thimidine incorporation experiments. Suppression of K562 proliferation was accompanied by increased spontaneous hemoglobin synthesis demonstrated by spectrometry.K562 cells transfected with sense construct exhibited reduced clongenicity compared with control cells in methycellulose culture. These data provided the evidence that EDRF1 can influence globin expression and hemoglobin synthesis in K562 cells and modulated self-renewal in K562 cells.

  15. TMEM14C is required for erythroid mitochondrial heme metabolism.

    Science.gov (United States)

    Yien, Yvette Y; Robledo, Raymond F; Schultz, Iman J; Takahashi-Makise, Naoko; Gwynn, Babette; Bauer, Daniel E; Dass, Abhishek; Yi, Gloria; Li, Liangtao; Hildick-Smith, Gordon J; Cooney, Jeffrey D; Pierce, Eric L; Mohler, Kyla; Dailey, Tamara A; Miyata, Non; Kingsley, Paul D; Garone, Caterina; Hattangadi, Shilpa M; Huang, Hui; Chen, Wen; Keenan, Ellen M; Shah, Dhvanit I; Schlaeger, Thorsten M; DiMauro, Salvatore; Orkin, Stuart H; Cantor, Alan B; Palis, James; Koehler, Carla M; Lodish, Harvey F; Kaplan, Jerry; Ward, Diane M; Dailey, Harry A; Phillips, John D; Peters, Luanne L; Paw, Barry H

    2014-10-01

    The transport and intracellular trafficking of heme biosynthesis intermediates are crucial for hemoglobin production, which is a critical process in developing red cells. Here, we profiled gene expression in terminally differentiating murine fetal liver-derived erythroid cells to identify regulators of heme metabolism. We determined that TMEM14C, an inner mitochondrial membrane protein that is enriched in vertebrate hematopoietic tissues, is essential for erythropoiesis and heme synthesis in vivo and in cultured erythroid cells. In mice, TMEM14C deficiency resulted in porphyrin accumulation in the fetal liver, erythroid maturation arrest, and embryonic lethality due to profound anemia. Protoporphyrin IX synthesis in TMEM14C-deficient erythroid cells was blocked, leading to an accumulation of porphyrin precursors. The heme synthesis defect in TMEM14C-deficient cells was ameliorated with a protoporphyrin IX analog, indicating that TMEM14C primarily functions in the terminal steps of the heme synthesis pathway. Together, our data demonstrate that TMEM14C facilitates the import of protoporphyrinogen IX into the mitochondrial matrix for heme synthesis and subsequent hemoglobin production. Furthermore, the identification of TMEM14C as a protoporphyrinogen IX importer provides a genetic tool for further exploring erythropoiesis and congenital anemias.

  16. TMEM14C is required for erythroid mitochondrial heme metabolism

    Science.gov (United States)

    Yien, Yvette Y.; Robledo, Raymond F.; Schultz, Iman J.; Takahashi-Makise, Naoko; Gwynn, Babette; Bauer, Daniel E.; Dass, Abhishek; Yi, Gloria; Li, Liangtao; Hildick-Smith, Gordon J.; Cooney, Jeffrey D.; Pierce, Eric L.; Mohler, Kyla; Dailey, Tamara A.; Miyata, Non; Kingsley, Paul D.; Garone, Caterina; Hattangadi, Shilpa M.; Huang, Hui; Chen, Wen; Keenan, Ellen M.; Shah, Dhvanit I.; Schlaeger, Thorsten M.; DiMauro, Salvatore; Orkin, Stuart H.; Cantor, Alan B.; Palis, James; Koehler, Carla M.; Lodish, Harvey F.; Kaplan, Jerry; Ward, Diane M.; Dailey, Harry A.; Phillips, John D.; Peters, Luanne L.; Paw, Barry H.

    2014-01-01

    The transport and intracellular trafficking of heme biosynthesis intermediates are crucial for hemoglobin production, which is a critical process in developing red cells. Here, we profiled gene expression in terminally differentiating murine fetal liver-derived erythroid cells to identify regulators of heme metabolism. We determined that TMEM14C, an inner mitochondrial membrane protein that is enriched in vertebrate hematopoietic tissues, is essential for erythropoiesis and heme synthesis in vivo and in cultured erythroid cells. In mice, TMEM14C deficiency resulted in porphyrin accumulation in the fetal liver, erythroid maturation arrest, and embryonic lethality due to profound anemia. Protoporphyrin IX synthesis in TMEM14C-deficient erythroid cells was blocked, leading to an accumulation of porphyrin precursors. The heme synthesis defect in TMEM14C-deficient cells was ameliorated with a protoporphyrin IX analog, indicating that TMEM14C primarily functions in the terminal steps of the heme synthesis pathway. Together, our data demonstrate that TMEM14C facilitates the import of protoporphyrinogen IX into the mitochondrial matrix for heme synthesis and subsequent hemoglobin production. Furthermore, the identification of TMEM14C as a protoporphyrinogen IX importer provides a genetic tool for further exploring erythropoiesis and congenital anemias. PMID:25157825

  17. Acute erythroid leukemia: autopsy report of a rare disease

    Directory of Open Access Journals (Sweden)

    Cristiane Rúbia Ferreira

    2011-12-01

    Full Text Available Acute erythroid leukemia (AEL is a rare subtype of acute myeloid leukemia(AML, characterized by predominant erythroid proliferation. The 2008 WorldHealth Organization (WHO classification of AML defined two AEL subtypes:erythroleukaemia (EL, in which erythroid precursors account for 50% or moreof all nucleated bone marrow cells and myeloblasts account for 20% or more ofthe nonerythroid cell population; and pure erythroid leukemia (PEL, in whicherythroid precursors account for 80% or more of all nucleated bone marrowcells. We report the case of an elderly female patient with wasting syndromeand pancytopenia without evidence of blasts in peripheral blood. A diagnosisof PEL was established on the basis of bone marrow biopsy findings. Thepatient died on postadmission day 20, and an autopsy was performed. Wereclassified the disease as EL on the basis of the autopsy findings, whichincluded myeloblasts accounting for more than 20% of the nonerythroid cellsin the bone marrow, as well as leukemic infiltration and myeloid metaplasia insolid organs, such as the liver, spleen, kidneys, adrenal glands, and abdominallymph nodes. A rare disease, AEL accounts for less than 5% of all AMLs and ispractically a diagnosis of exclusion. Autopsy reports of AEL are extremely rarein the literature. We demonstrate that in the case reported here, leukemia cellstended to infiltrate solid organs with myeloid metaplasia. Our findings alsoshow that a larger neoplastic bone marrow sample is crucial to the correctdiagnosis of EL, which is based on morphological and quantitative criteria.

  18. Circulating levels of human salusin-β, a potent hemodynamic and atherogenesis regulator.

    Directory of Open Access Journals (Sweden)

    Kazumi Fujimoto

    Full Text Available Using bioinformatics analysis, we previously identified salusin-β, an endogenous bioactive peptide with diverse physiological activities. Salusin-β is abundantly expressed in the neuroendocrine system and in systemic endocrine cells/macrophages. Salusin-β acutely regulates hemodynamics and chronically induces atherosclerosis, but its unique physicochemical characteristics to tightly adhere to all types of plastic and glassware have prevented elucidation of its precise pathophysiological role. To quantitate plasma total salusin-β concentrations, we produced rabbit and chicken polyclonal antibodies against the C- and N-terminal end sequences, circumvented its sticky nature, and successfully established a sandwich enzyme-linked immunosorbent assay (ELISA. Salusin-β was abundantly present in the plasma of healthy volunteers, ranging from 1.9 to 6.6 nmol/L. Reverse phase-high performance liquid chromatography analysis showed that a single immunoreactive salusin-β peak coincided with synthetic authentic salusin-β. Plasma salusin-β concentrations were unaffected by postural changes and by potent vasopressin release stimuli, such as hypertonic saline infusion or smoking. However, salusin-β concentrations showed significant circadian variation; concentrations were high during the daytime and reached the lowest concentrations in the early morning. Plasma salusin-β levels in subjects with diabetes mellitus, coronary artery disease, and cerebrovascular disease showed distinctly higher levels than healthy controls. Patients with panhypopituitarism combined with complete central diabetes insipidus also showed significantly higher plasma salusin-β levels. Therefore, the ELISA system developed in this study will be useful for evaluating circulating total salusin-β levels and for confirming the presence of authentic salusin-β in human plasma. The obtained results suggest a limited contribution of the neuroendocrine system to peripheral total salusin

  19. Oxidative burst of circulating neutrophils following traumatic brain injury in human.

    Directory of Open Access Journals (Sweden)

    Yiliu Liao

    Full Text Available Besides secondary injury at the lesional site, Traumatic brain injury (TBI can cause a systemic inflammatory response, which may cause damage to initially unaffected organs and potentially further exacerbate the original injury. Here we investigated plasma levels of important inflammatory mediators, oxidative activity of circulating leukocytes, particularly focusing on neutrophils, from TBI subjects and control subjects with general trauma from 6 hours to 2 weeks following injury, comparing with values from uninjured subjects. We observed increased plasma level of inflammatory cytokines/molecules TNF-α, IL-6 and CRP, dramatically increased circulating leukocyte counts and elevated expression of TNF-α and iNOS in circulating leukocytes from TBI patients, which suggests a systemic inflammatory response following TBI. Our data further showed increased free radical production in leukocyte homogenates and elevated expression of key oxidative enzymes iNOS, COX-2 and NADPH oxidase (gp91(phox in circulating leukocytes, indicating an intense induction of oxidative burst following TBI, which is significantly greater than that in control subjects with general trauma. Furthermore, flow cytometry assay proved neutrophils as the largest population in circulation after TBI and showed significantly up-regulated oxidative activity and suppressed phagocytosis rate for circulating neutrophils following brain trauma. It suggests that the highly activated neutrophils might play an important role in the secondary damage, even outside the injured brain. Taken together, the potent systemic inflammatory response induced by TBI, especially the intensively increase oxidative activity of circulating leukocytes, mainly neutrophils, may lead to a systemic damage, dysfunction/damage of bystander tissues/organs and even further exacerbate secondary local damage. Controlling these pathophysiological processes may be a promising therapeutic strategy and will protect unaffected

  20. Erythropoietin is involved in hemoprotein syntheses in developing human decidua.

    Science.gov (United States)

    Shiota, Mitsuru; Yasuda, Yoshiko; Shimaoka, Masao; Tsuritani, Mitsuhiro; Koike, Eiji; Oiki, Masaaki; Matsubara, Junko; Taketani, Shigeru; Murakami, Hitoshi; Yamasaki, Harufumi; Okumoto, Katsumi; Hoshiai, Hiroshi

    2013-03-01

    Before establishment of feto-placental circulation, decidua can synthesize hemoproteins to maintain oxygen homeostasis in situ. Using the human decidua of induced abortions ranging from 5 to 8 weeks of gestation, we determined the expression levels of erythropoietin, erythropoietin receptor, cytoglobin, myoglobin, embryonic-, fetal- and adult hemoglobin mRNA by quantitative RT-PCR analysis and identified their proteins by Western blot and immunohistochemical analyses. Erythropoietin signaling was demonstrated in phosphatidylinositol-3-kinase/protein kinase B pathway by Western blot, and the transcriptional factors for erythroid and non-erythroid heme synthesis were examined by RT-PCR analysis. In decidua, erythropoietin and its receptor mRNAs, erythropoietin receptor protein and phosphatidylinositol-3-kinase, were expressed with a peak at 6 weeks of gestation. Moreover, the decidua during 5 to 8 weeks of gestation expressed embryonic, fetal and adult hemoglobins additionally cytoglobin and myoglobin at transcriptional and protein levels. The heme portion of these hemoproteins is considered to be synthesized by non-erythroid δ-aminolevulinate synthase. These hemoproteins were discernible especially in decidual cells concomitant with cytotrophoblast cells and macrophage in these developing decidua. Considering the different capacity for oxygen binding and dissociation among hemoglobins with the oxygen storage capacity for cytoglobin and myoglobin, these hemoproteins appear to play a role in oxygen demand in decidua in situ before development of feto-placental circulation under the control of erythropoietin signaling. PMID:23480354

  1. Enhanced inhibition of parvovirus B19 replication by cidofovir in extendedly exposed erythroid progenitor cells.

    Science.gov (United States)

    Bonvicini, Francesca; Bua, Gloria; Manaresi, Elisabetta; Gallinella, Giorgio

    2016-07-15

    Human parvovirus B19 (B19V) commonly induces self-limiting infections but can also cause severe clinical manifestations in patients with underlying haematological disorders or with immune system deficits. Currently, therapeutic options for B19V entirely rely on symptomatic and supportive treatments since a specific antiviral therapy is not yet available. Recently a first step in the research for active compounds inhibiting B19V replication has allowed identifying the acyclic nucleoside phosphonate cidofovir (CDV). Herein, the effect of CDV against B19V replication was characterized in human erythroid progenitor cells (EPCs) cultured and infected following different experimental approaches to replicate in vitro the infection of an expanding erythroid cell population in the bone marrow. B19V replication was selectively inhibited both in infected EPCs extendedly exposed to CDV 500μM (viral inhibition 82%) and in serially infected EPCs cultures with passage of the virus progeny, constantly under drug exposure (viral inhibition 99%). In addition, a potent inhibitory effect against B19V (viral inhibition 92%) was assessed in a short-term infection of EPCs treated with CDV 500μM 1day before viral infection. In the evaluated experimental conditions, the enhanced effect of CDV against B19V might be ascribed both to the increased intracellular drug concentration achieved by extended exposure, and to a progressive reduction in efficiency of the replicative process within treated EPCs population. PMID:27071853

  2. Significant Biochemical, Biophysical and Metabolic Diversity in Circulating Human Cord Blood Reticulocytes

    Science.gov (United States)

    Malleret, Benoît; Xu, Fenggao; Mohandas, Narla; Suwanarusk, Rossarin; Chu, Cindy; Leite, Juliana A.; Low, Kayen; Turner, Claudia; Sriprawat, Kanlaya; Zhang, Rou; Bertrand, Olivier; Colin, Yves; Costa, Fabio T. M.; Ong, Choon Nam; Ng, Mah Lee; Lim, Chwee Teck; Nosten, Francois; Rénia, Laurent; Russell, Bruce

    2013-01-01

    Background The transition from enucleated reticulocytes to mature normocytes is marked by substantial remodeling of the erythrocytic cytoplasm and membrane. Despite conspicuous changes, most studies describe the maturing reticulocyte as a homogenous erythropoietic cell type. While reticulocyte staging based on fluorescent RNA stains such as thiazole orange have been useful in a clinical setting; these ‘sub-vital’ stains may confound delicate studies on reticulocyte biology and may preclude their use in heamoparasite invasion studies. Design and Methods Here we use highly purified populations of reticulocytes isolated from cord blood, sorted by flow cytometry into four sequential subpopulations based on transferrin receptor (CD71) expression: CD71high, CD71medium, CD71low and CD71negative. Each of these subgroups was phenotyped in terms of their, morphology, membrane antigens, biomechanical properties and metabolomic profile. Results Superficially CD71high and CD71medium reticulocytes share a similar gross morphology (large and multilobular) when compared to the smaller, smooth and increasingly concave reticulocytes as seen in the in the CD71low and CD71negativesamples. However, between each of the four sample sets we observe significant decreases in shear modulus, cytoadhesive capacity, erythroid receptor expression (CD44, CD55, CD147, CD235R, and CD242) and metabolite concentrations. Interestingly increasing amounts of boric acid was found in the mature reticulocytes. Conclusions Reticulocyte maturation is a dynamic and continuous process, confounding efforts to rigidly classify them. Certainly this study does not offer an alternative classification strategy; instead we used a nondestructive sampling method to examine key phenotypic changes of in reticulocytes. Our study emphasizes a need to focus greater attention on reticulocyte biology. PMID:24116088

  3. The role of DNA methylation in catechol-enhanced erythroid differentiation of K562 cells

    Energy Technology Data Exchange (ETDEWEB)

    Li, Xiao-Fei; Wu, Xiao-Rong; Xue, Ming; Wang, Yan; Wang, Jie; Li, Yang; Suriguga,; Zhang, Guang-Yao; Yi, Zong-Chun, E-mail: yizc@buaa.edu.cn

    2012-11-15

    Catechol is one of phenolic metabolites of benzene in vivo. Catechol is also widely used in pharmaceutical and chemical industries. In addition, fruits, vegetables and cigarette smoke also contain catechol. Our precious study showed that several benzene metabolites (phenol, hydroquinone, and 1,2,4-benzenetriol) inhibited erythroid differentiation of K562 cells. In present study, the effect of catechol on erythroid differentiation of K562 cells was investigated. Moreover, to address the role of DNA methylation in catechol-induced effect on erythroid differentiation in K562 cells, methylation levels of erythroid-specific genes were analyzed by Quantitative MassARRAY methylation analysis platform. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation in K562 cells in concentration- and time-dependent manners. The mRNA expression of erythroid specific genes, including α-globin, β-globin, γ-globin, erythroid 5-aminolevulinate synthase, erythroid porphobilinogen deaminase, and transcription factor GATA-1 genes, showed a significant concentration-dependent increase in catechol-treated K562 cells. The exposure to catechol caused a decrease in DNA methylation levels at a few CpG sites in some erythroid specific genes including α-globin, β-globin and erythroid porphobilinogen deaminase genes. These results indicated that catechol improved erythroid differentiation potency of K562 cells at least partly via up-regulating transcription of some erythroid related genes, and suggested that inhibition of DNA methylation might be involved in up-regulated expression of some erythroid related genes. -- Highlights: ► Catechol enhanced hemin-induced hemoglobin accumulation. ► Exposure to catechol resulted in up-regulated expression of erythroid genes. ► Catechol reduced methylation levels at some CpG sites in erythroid genes.

  4. Isolation of circulating microRNAs from microvesicles found in human plasma.

    Science.gov (United States)

    Quackenbush, John F; Cassidy, Pamela B; Pfeffer, Lawrence M; Boucher, Kenneth M; Hawkes, Jason E; Pfeffer, Susan R; Kopelovich, Levy; Leachman, Sancy A

    2014-01-01

    Intact miRNAs can be isolated from the circulation in significant quantities despite the presence of extremely high levels of RNase activity. The remarkable stability of circulating miRNAs makes them excellent candidates for biomarkers in diagnostic applications as well as therapeutic targets in a variety of disease states including melanoma. Circulating RNA molecules are resistant to degradation by RNases because they are encapsulated in membrane-bound microvesicles. We describe a convenient method for the use of ExoQuick, a proprietary resin developed by Systems Biosciences (Mountain View, CA), whereby microvesicles can be purified under gentle conditions using readily available laboratory equipment. This protocol allows for isolation all microvesicles, regardless of their origin, and provides a convenient method for identifying potential cancer-specific biomarkers from biological fluids including serum and plasma. PMID:24259003

  5. Accurate measurement of circulating mitochondrial DNA content from human blood samples using real-time quantitative PCR.

    Science.gov (United States)

    Ajaz, Saima; Czajka, Anna; Malik, Afshan

    2015-01-01

    We describe a protocol to accurately measure the amount of human mitochondrial DNA (MtDNA) in peripheral blood samples which can be modified to quantify MtDNA from other body fluids, human cells, and tissues. This protocol is based on the use of real-time quantitative PCR (qPCR) to quantify the amount of MtDNA relative to nuclear DNA (designated the Mt/N ratio). In the last decade, there have been increasing numbers of studies describing altered MtDNA or Mt/N in circulation in common nongenetic diseases where mitochondrial dysfunction may play a role (for review see Malik and Czajka, Mitochondrion 13:481-492, 2013). These studies are distinct from those looking at genetic mitochondrial disease and are attempting to identify acquired changes in circulating MtDNA content as an indicator of mitochondrial function. However, the methodology being used is not always specific and reproducible. As more than 95 % of the human mitochondrial genome is duplicated in the human nuclear genome, it is important to avoid co-amplification of nuclear pseudogenes. Furthermore, template preparation protocols can also affect the results because of the size and structural differences between the mitochondrial and nuclear genomes. Here we describe how to (1) prepare DNA from blood samples; (2) pretreat the DNA to prevent dilution bias; (3) prepare dilution standards for absolute quantification using the unique primers human mitochondrial genome forward primer (hMitoF3) and human mitochondrial genome reverse primer(hMitoR3) for the mitochondrial genome, and human nuclear genome forward primer (hB2MF1) and human nuclear genome reverse primer (hB2MR1) primers for the human nuclear genome; (4) carry out qPCR for either relative or absolute quantification from test samples; (5) analyze qPCR data; and (6) calculate the sample size to adequately power studies. The protocol presented here is suitable for high-throughput use.

  6. CLINIC STUDY ON THE INFLUENCE OF RECOMBINANT HUMAN ERYTHROPOIETIN ON ERYTHROID PARAMETERS, NUTRITIONAL STATUS AND QUALITY OF LIFE IN CHRONIC RENAL FAILURE%rHuEPO对慢性肾衰竭患者红系参数、营养状态及生活质量影响的临床观察

    Institute of Scientific and Technical Information of China (English)

    李香玲; 赵学兰; 郭振涛; 李加村; 肖青

    2011-01-01

    [目的]探讨重组人促红细胞生成素(rHuEPO)对慢性肾衰竭(CRF)患者红系及营养状况与生活质量的影响.[方法]对24例CRF患者给予rHuEPO 1万IU皮下注射,每周1次,连续8周,在治疗前后分别对红系参数、营养状态和生活质量进行检测,并行自身对照.[结果]患者治疗后2、8周红系指标RBC、Hb、HCT、MCV、MCH、MCHC、Ret均明显升高(P< 0.05);IRF在2周时显著升高(P<0.01)而RDW 8周后明显升高(P<0.01);营养参数血清白蛋白(ALB)、总蛋白(TP)、转铁蛋白(Tf)治疗后明显增加,差异有统计学意义(P<0.05).生活质量中躯体功能、躯体职能、精力状况、社会功能、疼痛、总的健康状况治疗前后比较差异均有统计学意义(P<0.05).[结论]rHuEPO不仅能改善CRF患者的贫血状态,而且可改善患者的营养状况和生活质量.%[Objective] To study the recombinant human erythropoietin (rHuEPO) on erylhroid parameters and nutritional status and quality of life (QOL) in chronic renal failure (CRF) patients with anemia. [Methods] 24 patients with CRF patients received treatment of rHuEPO injection subcutaneous for 8 weeks, observed the variation of blood erythroid parameters, nutritional status and quality of life, before and after the treatment. [ Results] After 2 and 8 weeks of treatment, erythroid target RBC, Hb, HCT, MCV, MCH, MCHC and Ret were significantly increased (P<0.05), 1RF at 2 weeks was significantly higher (P < 0.01) and the RDW 8 weeks was significantly higher (P < 0.01), the nutritional status of ALB, TP and Tf were significantly increased (P < 0.05). QOL physical function, emotional function, energy status, emotional status, social function, pain and general health status were significantly different (P< 0.03). [Conclusion] rHuEPO can not only improve patients with renal anemia, but also improve the nutritional status and quality of life of the patients.

  7. Cpeb4-mediated translational regulatory circuitry controls terminal erythroid differentiation.

    Science.gov (United States)

    Hu, Wenqian; Yuan, Bingbing; Lodish, Harvey F

    2014-09-29

    While we have considerable understanding of the transcriptional networks controlling mammalian cell differentiation, our knowledge of posttranscriptional regulatory events is very limited. Using differentiation of primary erythroid cells as a model, we show that the sequence-specific mRNA-binding protein Cpeb4 is strongly induced by the erythroid-important transcription factors Gata1 and Tal1 and is essential for terminal erythropoiesis. By interacting with the translation initiation factor eIF3, Cpeb4 represses the translation of a large set of mRNAs, including its own mRNA. Thus, transcriptional induction and translational repression combine to form a negative feedback loop to control Cpeb4 protein levels within a specific range that is required for terminal erythropoiesis. Our study provides an example of how translational control is integrated with transcriptional regulation to precisely control gene expression during mammalian cell differentiation.

  8. Down-regulation of Myc is essential for terminal erythroid maturation.

    Science.gov (United States)

    Jayapal, Senthil Raja; Lee, Kian Leong; Ji, Peng; Kaldis, Philipp; Lim, Bing; Lodish, Harvey F

    2010-12-17

    Terminal differentiation of mammalian erythroid progenitors involves 4-5 cell divisions and induction of many erythroid important genes followed by chromatin and nuclear condensation and enucleation. The protein levels of c-Myc (Myc) are reduced dramatically during late stage erythroid maturation, coinciding with cell cycle arrest in G(1) phase and enucleation, suggesting possible roles for c-Myc in either or both of these processes. Here we demonstrate that ectopic Myc expression affects terminal erythroid maturation in a dose-dependent manner. Expression of Myc at physiological levels did not affect erythroid differentiation or cell cycle shutdown but specifically blocked erythroid nuclear condensation and enucleation. Continued Myc expression prevented deacetylation of several lysine residues in histones H3 and H4 that are normally deacetylated during erythroid maturation. The histone acetyltransferase Gcn5 was up-regulated by Myc, and ectopic Gcn5 expression partially blocked enucleation and inhibited the late stage erythroid nuclear condensation and histone deacetylation. When overexpressed at levels higher than the physiological range, Myc blocked erythroid differentiation, and the cells continued to proliferate in cytokine-free, serum-containing culture medium with an early erythroblast morphology. Gene expression analysis demonstrated the dysregulation of erythropoietin signaling pathway and the up-regulation of several positive regulators of G(1)-S cell cycle checkpoint by supraphysiological levels of Myc. These results reveal an important dose-dependent function of Myc in regulating terminal maturation in mammalian erythroid cells.

  9. TMEM14C is required for erythroid mitochondrial heme metabolism

    OpenAIRE

    Yien, Yvette Yee; Robledo, Raymond F.; Schultz, Iman J.; Takahashi-Makise, Naoko; Gwynn, Babette; Bauer, Daniel Evan; Dass, Abhishek; Yi, Gloria; Li, Liangtao; Hildick-Smith, Gordon J.; Cooney, Jeffrey D.; Pierce, Eric Adam; Mohler, Kyla; Dailey, Tamara A.; Miyata, Non

    2014-01-01

    The transport and intracellular trafficking of heme biosynthesis intermediates are crucial for hemoglobin production, which is a critical process in developing red cells. Here, we profiled gene expression in terminally differentiating murine fetal liver-derived erythroid cells to identify regulators of heme metabolism. We determined that TMEM14C, an inner mitochondrial membrane protein that is enriched in vertebrate hematopoietic tissues, is essential for erythropoiesis and heme synthesis in ...

  10. Bmi-1 Regulates Extensive Erythroid Self-Renewal

    OpenAIRE

    Ah Ram Kim; Jayme L. Olsen; Samantha J. England; Yu-Shan Huang; Katherine H. Fegan; Luis F. Delgadillo; Kathleen E. McGrath; Paul D. Kingsley; Richard E. Waugh; James Palis

    2015-01-01

    Summary Red blood cells (RBCs), responsible for oxygen delivery and carbon dioxide exchange, are essential for our well-being. Alternative RBC sources are needed to meet the increased demand for RBC transfusions projected to occur as our population ages. We previously have discovered that erythroblasts derived from the early mouse embryo can self-renew extensively ex vivo for many months. To better understand the mechanisms regulating extensive erythroid self-renewal, global gene expression d...

  11. cAMP and in vivo hypoxia induce tob, ifr1, and fos expression in erythroid cells of the chick embryo.

    Science.gov (United States)

    Dragon, Stefanie; Offenhäuser, Nina; Baumann, Rosemarie

    2002-04-01

    During avian embryonic development, terminal erythroid differentiation occurs in the circulation. Some of the key events, such as the induction of erythroid 2,3-bisphosphoglycerate (2,3-BPG), carbonic anhydrase (CAII), and pyrimidine 5'-nucleotidase (P5N) synthesis are oxygen dependent (Baumann R, Haller EA, Schöning U, and Weber M, Dev Biol 116: 548-551, 1986; Dragon S and Baumann R, Am J Physiol Regulatory Integrative Comp Physiol 280: R870-R878, 2001; Dragon S, Carey C, Martin K, and Baumann R, J Exp Biol 202: 2787-2795, 1999; Dragon S, Glombitza S, Götz R, and Baumann R, Am J Physiol Regulatory Integrative Comp Physiol 271: R982-R989, 1996; Dragon S, Hille R, Götz R, and Baumann R, Blood 91: 3052-3058, 1998; Million D, Zillner P, and Baumann R, Am J Physiol Regulatory Integrative Comp Physiol 261: R1188-R1196, 1991) in an indirect way: hypoxia stimulates the release of norepinephrine (NE)/adenosine into the circulation (Dragon et al., J Exp Biol 202: 2787-2795, 1999; Dragon et al., Am J Physiol Regulatory Integrative Comp Physiol 271: R982-R989, 1996). This leads via erythroid beta-adrenergic/adenosine A(2) receptor activation to a cAMP signal inducing several proteins in a transcription-dependent manner (Dragon et al., Am J Physiol Regulatory Integrative Comp Physiol 271: R982-R989, 1996; Dragon et al., Blood 91: 3052-3058, 1998; Glombitza S, Dragon S, Berghammer M, Pannermayr M, and Baumann R, Am J Physiol Regulatory Integrative Comp Physiol 271: R973-R981, 1996). To understand how the cAMP-dependent processes are initiated, we screened an erythroid cDNA library for cAMP-regulated genes. We detected three genes that were strongly upregulated (>5-fold) by cAMP in definitive and primitive red blood cells. They are homologous to the mammalian Tob, Ifr1, and Fos proteins. In addition, the genes are induced in the intact embryo during short-term hypoxia. Because the genes are regulators of proliferation and differentiation in other cell types, we suggest that c

  12. Physiological, Pharmacological, and Nutritional Regulation of Circulating Adiponectin Concentrations in Humans

    OpenAIRE

    Swarbrick, Michael M.; Peter J Havel

    2008-01-01

    Adiponectin is an adipocyte hormone that links visceral adiposity with insulin resistance and atherosclerosis. It is unique among adipocyte-derived hormones in that its circulating concentrations are inversely proportional to adiposity, and low adiponectin concentrations predict the development of type 2 diabetes and cardiovascular disease. Consequently, in the decade since its discovery, adiponectin has generated immense interest as a potential therapeutic target for the metabolic syndrome a...

  13. Maternal and Fetoplacental Hypoxia Do Not Alter Circulating Angiogenic Growth Effectors During Human Pregnancy1

    OpenAIRE

    Zamudio, Stacy; Borges, Marcus; Echalar, Lourdes; Kovalenko, Olga; Vargas, Enrique; Torricos, Tatiana; Khan, Abdulla Al; Alvarez, Manuel; Illsley, Nicholas P

    2013-01-01

    One causal model of preeclampsia (PE) postulates that placental hypoxia alters the production of angiogenic growth effectors (AGEs), causing an imbalance leading to maternal endothelial cell dysfunction. We tested this model using the natural experiment of high-altitude (HA) residence. We hypothesized that in HA pregnancies 1) circulating soluble fms-like tyrosine kinase 1 (sFlt-1) is increased and placental growth factor (PlGF) decreased, and 2) AGE concentrations correlate with measures of ...

  14. Fibronectin Binding Is Required for Acquisition of Mesenchymal/Endothelial Differentiation Potential in Human Circulating Monocytes

    Directory of Open Access Journals (Sweden)

    Noriyuki Seta

    2012-01-01

    Full Text Available We previously reported monocyte-derived multipotential cells (MOMCs, which include progenitors capable of differentiating into a variety of mesenchymal cells and endothelial cells. In vitro generation of MOMCs from circulating CD14+ monocytes requires their binding to extracellular matrix (ECM protein and exposure to soluble factor(s derived from circulating CD14- cells. Here, we investigated the molecular factors involved in MOMC generation by examining the binding of monocytes to ECM proteins. We found that MOMCs were obtained on the fibronectin, but not on type I collagen, laminin, or poly-L-lysine. MOMC generation was followed by changes in the expression profiles of transcription factors and was completely inhibited by either anti-α5 integrin antibody or a synthetic peptide that competed with the RGD domain for the β1-integrin binding site. These results indicate that acquisition of the multidifferentiation potential by circulating monocytes depends on their binding to the RGD domain of fibronectin via cell-surface α5β1 integrin.

  15. AKT induces erythroid-cell maturation of JAK2-deficient fetal liver progenitor cells and is required for Epo regulation of erythroid-cell differentiation.

    Science.gov (United States)

    Ghaffari, Saghi; Kitidis, Claire; Zhao, Wei; Marinkovic, Dragan; Fleming, Mark D; Luo, Biao; Marszalek, Joseph; Lodish, Harvey F

    2006-03-01

    AKT serine threonine kinase of the protein kinase B (PKB) family plays essential roles in cell survival, growth, metabolism, and differentiation. In the erythroid system, AKT is known to be rapidly phosphorylated and activated in response to erythropoietin (Epo) engagement of Epo receptor (EpoR) and to sustain survival signals in cultured erythroid cells. Here we demonstrate that activated AKT complements EpoR signaling and supports erythroid-cell differentiation in wild-type and JAK2-deficient fetal liver cells. We show that erythroid maturation of AKT-transduced cells is not solely dependent on AKT-induced cell survival or proliferation signals, suggesting that AKT transduces also a differentiation-specific signal downstream of EpoR in erythroid cells. Down-regulation of expression of AKT kinase by RNA interference, or AKT activity by expression of dominant negative forms, inhibits significantly fetal liver-derived erythroid-cell colony formation and gene expression, demonstrating that AKT is required for Epo regulation of erythroid-cell maturation.

  16. Circulating follicular T helper cells and cytokine profile in humans following vaccination with the rVSV-ZEBOV Ebola vaccine

    Science.gov (United States)

    Farooq, Fouzia; Beck, Kevin; Paolino, Kristopher M.; Phillips, Revell; Waters, Norman C.; Regules, Jason A.; Bergmann-Leitner, Elke S.

    2016-01-01

    The most recent Zaire Ebolavirus (ZEBOV) outbreak was the largest and most widespread in recorded history, emphasizing the need for an effective vaccine. Here, we analyzed human cellular immune responses induced by a single dose of the rVSV-ZEBOV vaccine candidate, which showed significant protective efficacy in endemic populations in Guinea. This is the first in-depth characterization of ZEBOV-GP specific, circulating follicular T cells (cTfh). Since antibody titers correlated with protection in preclinical models of ZEBOV infection, Tfh were predicted to correlate with protection. Indeed, the ZEBOV-specific cTfh data correlated with antibody titers in human vaccines and unexpectedly with the Tfh17 subset. The combination of two cutting edge technologies allowed the immuno-profiling of rare cell populations and may help elucidate correlates of protection for a variety of vaccines. PMID:27323685

  17. Circulating follicular T helper cells and cytokine profile in humans following vaccination with the rVSV-ZEBOV Ebola vaccine.

    Science.gov (United States)

    Farooq, Fouzia; Beck, Kevin; Paolino, Kristopher M; Phillips, Revell; Waters, Norman C; Regules, Jason A; Bergmann-Leitner, Elke S

    2016-01-01

    The most recent Zaire Ebolavirus (ZEBOV) outbreak was the largest and most widespread in recorded history, emphasizing the need for an effective vaccine. Here, we analyzed human cellular immune responses induced by a single dose of the rVSV-ZEBOV vaccine candidate, which showed significant protective efficacy in endemic populations in Guinea. This is the first in-depth characterization of ZEBOV-GP specific, circulating follicular T cells (cTfh). Since antibody titers correlated with protection in preclinical models of ZEBOV infection, Tfh were predicted to correlate with protection. Indeed, the ZEBOV-specific cTfh data correlated with antibody titers in human vaccines and unexpectedly with the Tfh17 subset. The combination of two cutting edge technologies allowed the immuno-profiling of rare cell populations and may help elucidate correlates of protection for a variety of vaccines. PMID:27323685

  18. Circulating levels of chromatin fragments are inversely correlated with anti-dsDNA antibody levels in human and murine systemic lupus erythematosus

    DEFF Research Database (Denmark)

    Jørgensen, Mariann H; Rekvig, Ole Petter; Jacobsen, Rasmus S;

    2011-01-01

    Anti-dsDNA antibodies represent a central pathogenic factor in Lupus nephritis. Together with nucleosomes they deposit as immune complexes in the mesangial matrix and along basement membranes within the glomeruli. The origin of the nucleosomes and when they appear e.g. in circulation is not known...... an inverse correlation between anti-dsDNA antibodies and the DNA concentration in the circulation in both murine and human serum samples. High titer of anti-DNA antibodies in human sera correlated with reduced levels of circulating chromatin, and in lupus prone mice with deposition within glomeruli....... The inverse correlation between DNA concentration and anti-dsDNA antibodies may reflect antibody-dependent deposition of immune complexes during the development of lupus nephritis in autoimmune lupus prone mice. The measurement of circulating DNA in SLE sera by using qPCR may indicate and detect...

  19. Effect of AGM and fetal liver-derived stromal cell lines on globin expression in adult baboon (P. anubis bone marrow-derived erythroid progenitors.

    Directory of Open Access Journals (Sweden)

    Donald Lavelle

    Full Text Available This study was performed to investigate the hypothesis that the erythroid micro-environment plays a role in regulation of globin gene expression during adult erythroid differentiation. Adult baboon bone marrow and human cord blood CD34+ progenitors were grown in methylcellulose, liquid media, and in co-culture with stromal cell lines derived from different developmental stages in identical media supporting erythroid differentiation to examine the effect of the micro-environment on globin gene expression. Adult progenitors express high levels of γ-globin in liquid and methylcellulose media but low, physiological levels in stromal cell co-cultures. In contrast, γ-globin expression remained high in cord blood progenitors in stromal cell line co-cultures. Differences in γ-globin gene expression between adult progenitors in stromal cell line co-cultures and liquid media required cell-cell contact and were associated with differences in rate of differentiation and γ-globin promoter DNA methylation. We conclude that γ-globin expression in adult-derived erythroid cells can be influenced by the micro-environment, suggesting new potential targets for HbF induction.

  20. Circulating human B and plasma cells. Age-associated changes in counts and detailed characterization of circulating normal CD138(-) and CD138(+) plasma cells

    NARCIS (Netherlands)

    Caraux, Anouk; Klein, Bernard; Paiva, Bruno; Bret, Caroline; Schmitz, Alexander; Fuhler, Gwenny M.; Bos, Nico A.; Johnsen, Hans E.; Orfao, Alberto; Perez-Andres, Martin

    2010-01-01

    Generation of B and plasma cells involves several organs with a necessary cell trafficking between them. A detailed phenotypic characterization of four circulating B-cell subsets (immature-, naive-, memory- B-lymphocytes and plasma cells) of 106 healthy adults was realized by multiparametric flow cy

  1. Bmi-1 Regulates Extensive Erythroid Self-Renewal

    Directory of Open Access Journals (Sweden)

    Ah Ram Kim

    2015-06-01

    Full Text Available Red blood cells (RBCs, responsible for oxygen delivery and carbon dioxide exchange, are essential for our well-being. Alternative RBC sources are needed to meet the increased demand for RBC transfusions projected to occur as our population ages. We previously have discovered that erythroblasts derived from the early mouse embryo can self-renew extensively ex vivo for many months. To better understand the mechanisms regulating extensive erythroid self-renewal, global gene expression data sets from self-renewing and differentiating erythroblasts were analyzed and revealed the differential expression of Bmi-1. Bmi-1 overexpression conferred extensive self-renewal capacity upon adult bone-marrow-derived self-renewing erythroblasts, which normally have limited proliferative potential. Importantly, Bmi-1 transduction did not interfere with the ability of extensively self-renewing erythroblasts (ESREs to terminally mature either in vitro or in vivo. Bmi-1-induced ESREs can serve to generate in vitro models of erythroid-intrinsic disorders and ultimately may serve as a source of cultured RBCs for transfusion therapy.

  2. A logistic model for the detection of circulating tumour cells in human metastatic colorectal cancer

    Science.gov (United States)

    Barbazán, Jorge; Vieito, María; Abalo, Alicia; Alonso-Alconada, Lorena; Muinelo-Romay, Laura; Alonso-Nocelo, Marta; León, Luís; Candamio, Sonia; Gallardo, Elena; Anido, Urbano; Doll, Andreas; los Ángeles Casares, María; Gómez-Tato, Antonio; Abal, Miguel; López-López, Rafael

    2012-01-01

    The accuracy in the diagnosis of metastatic colorectal cancer (mCRC) represents one of the challenges in the clinical management of patients. The detection of circulating tumour cells (CTC) is becoming a promising alternative to current detection techniques, as it focuses on one of the players of the metastatic disease and it should provide with more specific and sensitive detection rates. Here, we describe an improved method of detection of CTC from mCRC patients by combining immune-enrichment, optimal purification of RNA from very low cell numbers, and the selection of accurate PCR probes. As a result, we obtained a logistic model that combines GAPDH and VIL1 normalized to CD45 rendering powerful results in the detection of CTC from mCRC patients (AUROC value 0.8599). We further demonstrated the utility of this model at the clinical setting, as a reliable prognosis tool to determine progression-free survival in mCRC patients. Overall, we developed a strategy that ameliorates the specificity and sensitivity in the detection of CTC, resulting in a robust and promising logistic model for the clinical management of metastatic colorectal cancer patients. PMID:22304365

  3. WEATHER AND CIRCULATION TYPES ACCOMPANYING THERMAL AND HUMIDITY CONDITIONS UNFAVOURABLE TO THE HUMAN HEALTH IN SUMMER IN KRAKOW (POLAND

    Directory of Open Access Journals (Sweden)

    D. CIARANEK

    2013-03-01

    Full Text Available The paper presents the results of a study analysing the frequency of occurrence and patterns of change in the human perception of temperature in relation to types of weather and circulation in Krakow. The Humidex index used for the purpose was determined at three measurement times (6, 12, 18 UTC with data spanning the period 1961-2012. The frequency of occurrence of all types of discomfort situation was found to be on the increase. Days with some discomfort occurred most frequently during non-advection situations, (especially in the centre of a meteorological high or anticyclonic wedge, accompanied by transformed polar maritime air or continental polar air. The weather varied greatly on such days, from cloudy to sunny and with or without precipitation. Days with high discomfort levels were associated with the advection of tropical air accompanied typically by very hot, sweltering weather, and by dry, very sunny weather.

  4. Seasonal pulses of Marburg virus circulation in juvenile Rousettus aegyptiacus bats coincide with periods of increased risk of human infection.

    Science.gov (United States)

    Amman, Brian R; Carroll, Serena A; Reed, Zachary D; Sealy, Tara K; Balinandi, Stephen; Swanepoel, Robert; Kemp, Alan; Erickson, Bobbie Rae; Comer, James A; Campbell, Shelley; Cannon, Deborah L; Khristova, Marina L; Atimnedi, Patrick; Paddock, Christopher D; Crockett, Rebekah J Kent; Flietstra, Timothy D; Warfield, Kelly L; Unfer, Robert; Katongole-Mbidde, Edward; Downing, Robert; Tappero, Jordan W; Zaki, Sherif R; Rollin, Pierre E; Ksiazek, Thomas G; Nichol, Stuart T; Towner, Jonathan S

    2012-01-01

    Marburg virus (family Filoviridae) causes sporadic outbreaks of severe hemorrhagic disease in sub-Saharan Africa. Bats have been implicated as likely natural reservoir hosts based most recently on an investigation of cases among miners infected in 2007 at the Kitaka mine, Uganda, which contained a large population of Marburg virus-infected Rousettus aegyptiacus fruit bats. Described here is an ecologic investigation of Python Cave, Uganda, where an American and a Dutch tourist acquired Marburg virus infection in December 2007 and July 2008. More than 40,000 R. aegyptiacus were found in the cave and were the sole bat species present. Between August 2008 and November 2009, 1,622 bats were captured and tested for Marburg virus. Q-RT-PCR analysis of bat liver/spleen tissues indicated ~2.5% of the bats were actively infected, seven of which yielded Marburg virus isolates. Moreover, Q-RT-PCR-positive lung, kidney, colon and reproductive tissues were found, consistent with potential for oral, urine, fecal or sexual transmission. The combined data for R. aegyptiacus tested from Python Cave and Kitaka mine indicate low level horizontal transmission throughout the year. However, Q-RT-PCR data show distinct pulses of virus infection in older juvenile bats (~six months of age) that temporarily coincide with the peak twice-yearly birthing seasons. Retrospective analysis of historical human infections suspected to have been the result of discrete spillover events directly from nature found 83% (54/65) events occurred during these seasonal pulses in virus circulation, perhaps demonstrating periods of increased risk of human infection. The discovery of two tags at Python Cave from bats marked at Kitaka mine, together with the close genetic linkages evident between viruses detected in geographically distant locations, are consistent with R. aegyptiacus bats existing as a large meta-population with associated virus circulation over broad geographic ranges. These findings provide a

  5. Seasonal pulses of Marburg virus circulation in juvenile Rousettus aegyptiacus bats coincide with periods of increased risk of human infection.

    Directory of Open Access Journals (Sweden)

    Brian R Amman

    Full Text Available Marburg virus (family Filoviridae causes sporadic outbreaks of severe hemorrhagic disease in sub-Saharan Africa. Bats have been implicated as likely natural reservoir hosts based most recently on an investigation of cases among miners infected in 2007 at the Kitaka mine, Uganda, which contained a large population of Marburg virus-infected Rousettus aegyptiacus fruit bats. Described here is an ecologic investigation of Python Cave, Uganda, where an American and a Dutch tourist acquired Marburg virus infection in December 2007 and July 2008. More than 40,000 R. aegyptiacus were found in the cave and were the sole bat species present. Between August 2008 and November 2009, 1,622 bats were captured and tested for Marburg virus. Q-RT-PCR analysis of bat liver/spleen tissues indicated ~2.5% of the bats were actively infected, seven of which yielded Marburg virus isolates. Moreover, Q-RT-PCR-positive lung, kidney, colon and reproductive tissues were found, consistent with potential for oral, urine, fecal or sexual transmission. The combined data for R. aegyptiacus tested from Python Cave and Kitaka mine indicate low level horizontal transmission throughout the year. However, Q-RT-PCR data show distinct pulses of virus infection in older juvenile bats (~six months of age that temporarily coincide with the peak twice-yearly birthing seasons. Retrospective analysis of historical human infections suspected to have been the result of discrete spillover events directly from nature found 83% (54/65 events occurred during these seasonal pulses in virus circulation, perhaps demonstrating periods of increased risk of human infection. The discovery of two tags at Python Cave from bats marked at Kitaka mine, together with the close genetic linkages evident between viruses detected in geographically distant locations, are consistent with R. aegyptiacus bats existing as a large meta-population with associated virus circulation over broad geographic ranges. These

  6. Long-acting lipidated analogue of human pancreatic polypeptide is slowly released into circulation

    DEFF Research Database (Denmark)

    Bellmann-Sickert, Kathrin; Elling, Christian E; Madsen, Andreas N;

    2011-01-01

    The main disadvantages of peptide pharmaceuticals are their rapid degradation and excretion, their low hydrophilicity, and low shelf lifes. These bottlenecks can be circumvented by acylation with fatty acids (lipidation) or polyethylene glycol (PEGylation). Here, we describe the modification...... of a human pancreatic polypeptide analogue specific for the human (h)Y(2) and hY(4) receptor with PEGs of different size and palmitic acid. Receptor specificity was demonstrated by competitive binding studies. Modifications had only a small influence on binding affinities and no influence on secondary...

  7. Fetal Circulation

    Science.gov (United States)

    ... Pressure High Blood Pressure Tools & Resources Stroke More Fetal Circulation Updated:Jul 8,2016 click to enlarge The ... fetal heart. These two bypass pathways in the fetal circulation make it possible for most fetuses to survive ...

  8. Circulating plant miRNAs can regulate human gene expression in vitro

    Science.gov (United States)

    Pastrello, Chiara; Tsay, Mike; McQuaid, Rosanne; Abovsky, Mark; Pasini, Elisa; Shirdel, Elize; Angeli, Marc; Tokar, Tomas; Jamnik, Joseph; Kotlyar, Max; Jurisicova, Andrea; Kotsopoulos, Joanne; El-Sohemy, Ahmed; Jurisica, Igor

    2016-01-01

    While Brassica oleracea vegetables have been linked to cancer prevention, the exact mechanism remains unknown. Regulation of gene expression by cross-species microRNAs has been previously reported; however, its link to cancer suppression remains unexplored. In this study we address both issues. We confirm plant microRNAs in human blood in a large nutrigenomics study cohort and in a randomized dose-controlled trial, finding a significant positive correlation between the daily amount of broccoli consumed and the amount of microRNA in the blood. We also demonstrate that Brassica microRNAs regulate expression of human genes and proteins in vitro, and that microRNAs cooperate with other Brassica-specific compounds in a possible cancer-preventive mechanism. Combined, we provide strong evidence and a possible multimodal mechanism for broccoli in cancer prevention. PMID:27604570

  9. Beyond the VAD: Human Factors Engineering for Mechanically Assisted Circulation in the 21st Century.

    Science.gov (United States)

    Throckmorton, Amy L; Patel-Raman, Sonna M; Fox, Carson S; Bass, Ellen J

    2016-06-01

    Thousands of ventricular assist devices (VADs) currently provide circulatory support to patients worldwide, and dozens of heart pump designs for adults and pediatric patients are under various stages of development in preparation for translation to clinical use. The successful bench-to-bedside development of a VAD involves a structured evaluation of possible system states, including human interaction with the device and auxiliary component usage in the hospital or home environment. In this study, we review the literature and present the current landscape of preclinical design and assessment, decision support tools and procedures, and patient-centered therapy. Gaps of knowledge are identified. The study findings support the need for more attention to user-centered design approaches for medical devices, such as mechanical circulatory assist systems, that specifically involve detailed qualitative and quantitative assessments of human-device interaction to mitigate risk and failure. PMID:26511100

  10. Influenza A Virus with a Human-Like N2 Gene Is Circulating in Pigs

    DEFF Research Database (Denmark)

    Breum, Solvej Østergaard; Hjulsager, Charlotte Kristiane; Trebbien, Ramona;

    2013-01-01

    A novel reassortant influenza A virus, H1avN2hu, has been found in Danish swine. The virus contains an H1 gene similar to the hemagglutinin (HA) gene of H1N1 avian-like swine viruses and an N2 gene most closely related to the neuraminidase (NA) gene of human H3N2 viruses from the mid-1990s....

  11. Fifty cases of human immunodeficiency virus (HIV) infection: immunoultrastructural study of circulating lymphocytes.

    OpenAIRE

    Feremans, W W; Huygen, K.; Menu, R; Farber, C M; de Caluwe, J P; van Vooren, J P; Marcelis, L; Andre, L; Brasseur, M; Bondue, H

    1988-01-01

    The peripheral lymphocytes of 50 cases of human immunodeficiency virus (HIV) infection (13 of acquired immune deficiency syndrome (AIDS), 17 of AIDS related complex (ARC), and 20 healthy carriers) were studied immunoultrastructurally. The prevalence of "tubuloreticular structures" and "tubular confronting cisternae" increased with the progression of the disease. Numerous tubular confronting cisternae were noted in patients presenting with a high serum acid labile alpha-interferon values. The ...

  12. Neural control of the circulation: how sex and age differences interact in humans.

    Science.gov (United States)

    Joyner, Michael J; Barnes, Jill N; Hart, Emma C; Wallin, B Gunnar; Charkoudian, Nisha

    2015-01-01

    The autonomic nervous system is a key regulator of the cardiovascular system. In this review, we focus on how sex and aging influence autonomic regulation of blood pressure in humans in an effort to understand general issues related to the cardiovascular system as a whole. Younger women generally have lower blood pressure and sympathetic activity than younger men. However, both sexes show marked interindividual variability across age groups with significant overlap seen. Additionally, while men across the lifespan show a clear relationship between markers of whole body sympathetic activity and vascular resistance, such a relationship is not seen in young women. In this context, the ability of the sympathetic nerves to evoke vasoconstriction is lower in young women likely as a result of concurrent β2-mediated vasodilation that offsets α-adrenergic vasoconstriction. These differences reflect both central sympatho-inhibitory effects of estrogen and also its influence on peripheral vasodilation at the level of the vascular smooth muscle and endothelium. By contrast postmenopausal women show a clear relationship between markers of whole body sympathetic traffic and vascular resistance, and sympathetic activity rises progressively in both sexes with aging. These major findings in humans are discussed in the context of differences in population-based trends in blood pressure and orthostatic intolerance. The many areas where there is little sex-specific data on how the autonomic nervous system participates in the regulation of the human cardiovascular system are highlighted. PMID:25589269

  13. Reductions in circulating endocannabinoid 2-arachidonoylglycerol levels in healthy human subjects exposed to chronic stressors.

    Science.gov (United States)

    Yi, Buqing; Nichiporuk, Igor; Nicolas, Michel; Schneider, Stefan; Feuerecker, Matthias; Vassilieva, Galina; Thieme, Detlef; Schelling, Gustav; Choukèr, Alexander

    2016-06-01

    Increasing evidence indicates that chronic stress, such as social isolation, plays an important role in the development of a variety of psychiatric and somatic disorders. Meanwhile, chronic stress imposed by prolonged isolation and confinement in the spacecraft is also one of the major concerns for the health of future interplanetary space travelers. Preclinical studies suggest that the peripheral endocannabinoid (eCB) system is involved in the regulation of the stress response and eCB signaling is implicated in the pathogenesis of stress-related diseases. However, there are only few human studies addressing this topic, of which most focusing on patients who have already developed a certain type of disorder. It remains unknown whether chronic stress may affect eCB signaling in healthy humans. A 520-d isolation and confinement study simulating a flight to Mars provided an extraordinary chance to study the effects of prolonged stress in healthy humans. During the study period, the participants lived in confinement and could not meet their families, friends, or strangers for more than 500 days. We examined the impact of chronic exposure to isolation and confinement through monitoring their psychological state, brain cortical activity, sympathetic adrenal-medullary system response and eCB signaling response. We observed reduced positive emotion ratings, decreased brain cortical activities and high levels of catecholamine release, indicating that prolonged exposure to isolation and confinement stressors may bring about changes both psychologically and physiologically. Importantly, for eCB signaling response, blood concentrations of eCB 2-arachidonoylglycerol (2-AG), but not anandamide (AEA), were significantly reduced (p<0.001), suggesting that dysregulation of 2-AG signaling might be specifically implicated in the response to chronic stressors.

  14. Reductions in circulating endocannabinoid 2-arachidonoylglycerol levels in healthy human subjects exposed to chronic stressors.

    Science.gov (United States)

    Yi, Buqing; Nichiporuk, Igor; Nicolas, Michel; Schneider, Stefan; Feuerecker, Matthias; Vassilieva, Galina; Thieme, Detlef; Schelling, Gustav; Choukèr, Alexander

    2016-06-01

    Increasing evidence indicates that chronic stress, such as social isolation, plays an important role in the development of a variety of psychiatric and somatic disorders. Meanwhile, chronic stress imposed by prolonged isolation and confinement in the spacecraft is also one of the major concerns for the health of future interplanetary space travelers. Preclinical studies suggest that the peripheral endocannabinoid (eCB) system is involved in the regulation of the stress response and eCB signaling is implicated in the pathogenesis of stress-related diseases. However, there are only few human studies addressing this topic, of which most focusing on patients who have already developed a certain type of disorder. It remains unknown whether chronic stress may affect eCB signaling in healthy humans. A 520-d isolation and confinement study simulating a flight to Mars provided an extraordinary chance to study the effects of prolonged stress in healthy humans. During the study period, the participants lived in confinement and could not meet their families, friends, or strangers for more than 500 days. We examined the impact of chronic exposure to isolation and confinement through monitoring their psychological state, brain cortical activity, sympathetic adrenal-medullary system response and eCB signaling response. We observed reduced positive emotion ratings, decreased brain cortical activities and high levels of catecholamine release, indicating that prolonged exposure to isolation and confinement stressors may bring about changes both psychologically and physiologically. Importantly, for eCB signaling response, blood concentrations of eCB 2-arachidonoylglycerol (2-AG), but not anandamide (AEA), were significantly reduced (p<0.001), suggesting that dysregulation of 2-AG signaling might be specifically implicated in the response to chronic stressors. PMID:26780604

  15. Human snake bite victims: the successful detection of circulating snake venom by radiommunoassay,.

    Science.gov (United States)

    Sutherland, S K; Couter, A R; Broad, A J

    1975-01-11

    A new solid-phase radioimmunoassay has been developed which allows positive identification of the type of snake venom in human tissue and fluids and its accurate quantitation. Tiger snake venom at a level of 210 ng/ml was detected post mortem in the serum of a child, and brown snake venom was detected in two adults bitten by unidentified snakes. Apart from forensic applications, the assay will be useful in studying clinical aspects of envenomation and the use of antivenenes. PMID:1128354

  16. Occurring of In Vitro Functional Vasculogenic Pericytes from Human Circulating Early Endothelial Precursor Cell Culture

    Directory of Open Access Journals (Sweden)

    Silvia Cantoni

    2015-01-01

    Full Text Available Pericytes are periendothelial cells of the microcirculation which contribute to tissue homeostasis and hemostasis by regulating microvascular morphogenesis and stability. Because of their multipotential ex vivo differentiation capabilities, pericytes are becoming very interesting in regenerative medicine field. Several studies address this issue by attempting to isolate pericyte/mesenchymal-like cells from peripheral blood; however the origin of these cells and their culture conditions are still debated. Here we showed that early Endothelial Progenitor Cells (EPCs expressing CD45+/CD146+/CD31+ can be a source of cells with pericyte/mesenchymal phenotype and function, identified as human Progenitor Perivascular Cells (hPPCs. We provided evidence that hPPCs have an immunophenotype consistent with Mesenchymal Stem Cells (MSCs from human adipose tissue (hASCs and fetal membranes of term placenta (FM-hMSCs. In addition, hPPCs can be subcultured and exhibit expression of pluripotent genes (OCT-4, KLF-4, and NANOG as well as a remarkable vasculogenic potential. Our findings could be helpful to develop innovative cell-based therapies for future clinical applications with distinct therapeutic purposes.

  17. Long noncoding RNA-mediated anti-apoptotic activity in murine erythroid terminal differentiation.

    Science.gov (United States)

    Hu, Wenqian; Yuan, Bingbing; Flygare, Johan; Lodish, Harvey F

    2011-12-15

    Long noncoding RNAs (lncRNAs) are differentially expressed under both normal and pathological conditions, implying that they may play important biological functions. Here we examined the expression of lncRNAs during erythropoiesis and identified an erythroid-specific lncRNA with anti-apoptotic activity. Inhibition of this lncRNA blocks erythroid differentiation and promotes apoptosis. Conversely, ectopic expression of this lncRNA can inhibit apoptosis in mouse erythroid cells. This lncRNA represses expression of Pycard, a proapoptotic gene, explaining in part the inhibition of programmed cell death. These findings reveal a novel layer of regulation of cell differentiation and apoptosis by a lncRNA.

  18. Circulating Vitamin D3 and 25-hydroxyvitamin D in Humans: An Important Tool to Define Adequate Nutritional Vitamin D Status

    OpenAIRE

    Bruce W Hollis; Wagner, Carol L.; Drezner, Mark K.; Binkley, Neil C

    2007-01-01

    Circulating 25-hydroxyvitamin D [25(OH)D] is generally considered the means by which we define nutritional vitamin D status. There is much debate, however, with respect to what a healthy minimum level of circulation 25(OH)D should be. Recent data using various biomarkers such as intact parathyroid hormone (PTH), intestinal calcium absorption, and skeletal density measurements suggest this minimum level to be 80 nmol (32 ng/mL). Surprisingly, the relationship between circulating vitamin D3 and...

  19. Regulation of human cutaneous circulation evaluated by laser Doppler flowmetry, iontophoresis, and spectral analysis: importance of nitric oxide and prostaglandines.

    Science.gov (United States)

    Kvandal, Per; Stefanovska, Aneta; Veber, Mitja; Kvernmo, Hebe Désirée; Kvermmo, Hebe Désirée; Kirkebøen, Knut Arvid

    2003-05-01

    Nitric oxide (NO) and prostaglandines (PGs) are important in regulation of vascular tone and blood flow. Their contribution in human cutaneous circulation is still uncertain. We inhibited NO synthesis by infusing N(G)-monomethyl-L-arginine (L-NMMA) in the brachial artery (16 micromol/min for 5 min) and reversed it by intraarterial infusion of L-arginine (40 micromol/min for 7.5 min). PG synthesis was inhibited by the cyclooxygenase inhibitor aspirin (600 mg over 5 min intravenously). Basal cutaneous perfusion and perfusion responses during iontophoresis with the endothelium-dependent vasodilator acetylcholine (ACh) and the endothelium-independent vasodilator sodium nitroprusside (SNP) were recorded by laser Doppler flowmetry (LDF). We performed wavelet transforms of the measured signals. Mean spectral amplitude within the frequency interval from 0.0095 to 1.6 Hz and mean and normalized amplitudes of five intervals around 1, 0.3, 0.1, 0.04, and 0.01 Hz were analysed. The oscillations with frequencies around 1, 0.3, 0.1, and 0.04 Hz are influenced by the heartbeat, the respiration, the intrinsic myogenic activity of vascular smooth muscle, and the neurogenic activity of the vessel wall, respectively. We have previously shown that the oscillation with a frequency around 0.01 Hz is modulated by the vascular endothelium. L-NMMA reduced mean value of the LDF signal by approximately 20% (P = 0.0067). This reduction was reversed by L-arginine. Mean value of the LDF signals during ACh and SNP iontophoresis did not change after infusion of L-NMMA. Aspirin did not affect mean value of the LDF signal or the LDF signal during ACh or SNP iontophoresis. Before interventions the only significant difference between the effects of ACh and SNP was observed in the frequency around 0.01 Hz, where ACh increased normalized amplitude to a greater extent than SNP. L-NMMA abolished this difference, whereas it reappeared after infusion of L-arginine (P = 0.0084). Aspirin did not affect this

  20. Phenotypic Features of Circulating Leukocytes from Non-human Primates Naturally Infected with Trypanosoma cruzi Resemble the Major Immunological Findings Observed in Human Chagas Disease.

    Directory of Open Access Journals (Sweden)

    Renato Sathler-Avelar

    2016-01-01

    Full Text Available Cynomolgus macaques (Macaca fascicularis represent a feasible model for research on Chagas disease since natural T. cruzi infection in these primates leads to clinical outcomes similar to those observed in humans. However, it is still unknown whether these clinical similarities are accompanied by equivalent immunological characteristics in the two species. We have performed a detailed immunophenotypic analysis of circulating leukocytes together with systems biology approaches from 15 cynomolgus macaques naturally infected with T. cruzi (CH presenting the chronic phase of Chagas disease to identify biomarkers that might be useful for clinical investigations.Our data established that CH displayed increased expression of CD32+ and CD56+ in monocytes and enhanced frequency of NK Granzyme A+ cells as compared to non-infected controls (NI. Moreover, higher expression of CD54 and HLA-DR by T-cells, especially within the CD8+ subset, was the hallmark of CH. A high level of expression of Granzyme A and Perforin underscored the enhanced cytotoxicity-linked pattern of CD8+ T-lymphocytes from CH. Increased frequency of B-cells with up-regulated expression of Fc-γRII was also observed in CH. Complex and imbricate biomarker networks demonstrated that CH showed a shift towards cross-talk among cells of the adaptive immune system. Systems biology analysis further established monocytes and NK-cell phenotypes and the T-cell activation status, along with the Granzyme A expression by CD8+ T-cells, as the most reliable biomarkers of potential use for clinical applications.Altogether, these findings demonstrated that the similarities in phenotypic features of circulating leukocytes observed in cynomolgus macaques and humans infected with T. cruzi further supports the use of these monkeys in preclinical toxicology and pharmacology studies applied to development and testing of new drugs for Chagas disease.

  1. Biophysical Properties of Scaffolds Modulate Human Blood Vessel Formation from Circulating Endothelial Colony-Forming Cells

    Science.gov (United States)

    Critser, Paul J.; Yoder, Mervin C.

    A functional vascular system forms early in development and is continually remodeled throughout the life of the organism. Impairment to the regeneration or repair of this system leads to tissue ischemia, dysfunction, and disease. The process of vascular formation and remodeling is complex, relying on local microenvironmental cues, cytokine signaling, and multiple cell types to function properly. Tissue engineering strategies have attempted to exploit these mechanisms to develop functional vascular networks for the generation of artificial tissues and therapeutic strategies to restore tissue homeostasis. The success of these strategies requires the isolation of appropriate progenitor cell sources which are straightforward to obtain, display high proliferative potential, and demonstrate an ability to form functional vessels. Several populations are of interest including endothelial colony-forming cells, a subpopulation of endothelial progenitor cells. Additionally, the development of scaffolds to deliver and support progenitor cell survival and function is crucial for the formation of functional vascular networks. The composition and biophysical properties of these scaffolds have been shown to modulate endothelial cell behavior and vessel formation. However, further investigation is needed to better understand how these mechanical properties and biophysical properties impact vessel formation. Additionally, several other cell populations are involved in neoangiogenesis and formation of tissue parenchyma and an understanding of the potential impact of these cell populations on the biophysical properties of scaffolds will also be needed to advance these strategies. This chapter examines how the biophysical properties of matrix scaffolds can influence vessel formation and remodeling and, in particular, the impact on in vivo human endothelial progenitor cell vessel formation.

  2. Recombinant erythropoietin in humans has a prolonged effect on circulating erythropoietin isoform distribution.

    Directory of Open Access Journals (Sweden)

    Niels Jacob Aachmann-Andersen

    Full Text Available The membrane-assisted isoform immunoassay (MAIIA quantitates erythropoietin (EPO isoforms as percentages of migrated isoforms (PMI. We evaluated the effect of recombinant human EPO (rhEPO on the distribution of EPO isoforms in plasma in a randomized, placebo-controlled, double-blinded, cross-over study. 16 healthy subjects received either low-dose Epoetin beta (5000 IU on days 1, 3, 5, 7, 9, 11 and 13; high-dose Epoetin beta (30.000 IU on days 1, 2 and 3 and placebo on days 5, 7, 9, 11 and 13; or placebo on all days. PMI on days 4, 11 and 25 was determined by interaction of N-acetyl glucosamine with the glycosylation dependent desorption of EPO isoforms. At day 25, plasma-EPO in both rhEPO groups had returned to values not different from the placebo group. PMI with placebo, reflecting the endogenous EPO isoforms, averaged 82.5 (10.3 % (mean (SD. High-dose Epoetin beta decreased PMI on days 4 and 11 to 31.0 (4.2% (p<0.00001 and 45.2 (7.3% (p<0.00001. Low-dose Epoetin beta decreased PMI on days 4 and 11 to 46.0 (12.8% (p<0.00001 and 46.1 (10.4% (p<0.00001. In both rhEPO groups, PMI on day 25 was still decreased (high-dose Epoetin beta: 72.9 (19.4% (p=0.029; low-dose Epoetin beta: 73.1 (17.8% (p=0.039. In conclusion, Epoetin beta leaves a footprint in the plasma-EPO isoform pattern. MAIIA can detect changes in EPO isoform distribution up til at least three weeks after administration of Epoetin beta even though the total EPO concentration has returned to normal.

  3. Human circulating monocytes internalize 125I-insulin in a similar fashion to rat hepatocytes: relevance to receptor regulation in target and nontarget tissues

    International Nuclear Information System (INIS)

    Circulating monocytes bind 125I-insulin in a specific fashion and have been used to analyze the ambient receptor status in humans. When freshly isolated circulating monocytes are incubated with 125I-insulin and examined by electron microscopic autoradiography, approximately 18% of the labeled material is internalized after 15 minutes at 37 degrees C. By 2 hours at 37 degrees C, approximately one half of the 125I-insulin is internalized. Internalization occurs also at 15 degrees C but at a slower rate. Furthermore, the monocytes bind and internalize 125I-insulin in a manner that mirrors that of major target tissues, such as rat hepatocytes. These data suggest that the insulin receptor of the circulating monocyte might be regulated by adsorptive endocytosis in a manner analogous to that of target tissue, such as the liver

  4. How is mRNA expression predictive for protein expression? A correlation study on human circulating monocytes

    Institute of Scientific and Technical Information of China (English)

    Yanfang Guo; Yuan Chen; Hui Jiang; Lijun Tan; Jingyun Xie; Xuezhen Zhu; Songping Liang; Hongwen Deng; Peng Xiao; Shufeng Lei; Feiyan Deng; Gary Guishan Xiao; Yaozhong Liu; Xiangding Chen; Liming Li; Shan Wu

    2008-01-01

    A key assumption in studying mRNA expression is that it is informative in the prediction of protein expression. However,only limited studies have explored the mRNA-protein expression correlation in yeast or human tissues and the results have been relatively inconsistent. We carried out correlation analyses on mRNA-protein expressions in freshly isolated human circulating monocytes from 30 unrelated women. The expressed proteins for 71 genes were quantified and identified by 2-D electrophoresis coupled with mass spectrometry. The corresponding mRNA expressions were quantified by Affymetrix gene chips. Significant correlation (r=0.235, P<0.0001) was observed for the whole dataset including all studied genes and all samples. The correlations varied in different biological categories of gene ontology. For example, the highest correlation was achieved for genes of the extracellular region in terms of cellular component (r=0.643, P<0.0001) and the lowest correlation was obtained for genes of regulation (r=0.099, P=0.213) in terms of biological process. In the genome, half of the samples showed significant positive correlation for the 71 genes and significant correlation was found between the average mRNA and the average protein expression levels in all samples (r=0.296, P<0.01). However, at the study group level, only five studied genes had significant positive correlation across all the samples. Our results showed an overall positive correlation between mRNA and protein expression levels.However, the moderate and varied correlations suggest that mRNA expression might be sometimes useful, but certainly far from perfect, in predicting protein expression levels.

  5. Comprehensive microRNA profiling in acetaminophen toxicity identifies novel circulating biomarkers for human liver and kidney injury.

    Science.gov (United States)

    Vliegenthart, A D B; Shaffer, J M; Clarke, J I; Peeters, L E J; Caporali, A; Bateman, D N; Wood, D M; Dargan, P I; Craig, D G; Moore, J K; Thompson, A I; Henderson, N C; Webb, D J; Sharkey, J; Antoine, D J; Park, B K; Bailey, M A; Lader, E; Simpson, K J; Dear, J W

    2015-10-22

    Our objective was to identify microRNA (miRNA) biomarkers of drug-induced liver and kidney injury by profiling the circulating miRNome in patients with acetaminophen overdose. Plasma miRNAs were quantified in age- and sex-matched overdose patients with (N = 27) and without (N = 27) organ injury (APAP-TOX and APAP-no TOX, respectively). Classifier miRNAs were tested in a separate cohort (N = 81). miRNA specificity was determined in non-acetaminophen liver injury and murine models. Sensitivity was tested by stratification of patients at hospital presentation (N = 67). From 1809 miRNAs, 75 were 3-fold or more increased and 46 were 3-fold or more decreased with APAP-TOX. A 16 miRNA classifier model accurately diagnosed APAP-TOX in the test cohort. In humans, the miRNAs with the largest increase (miR-122-5p, miR-885-5p, miR-151a-3p) and the highest rank in the classifier model (miR-382-5p) accurately reported non-acetaminophen liver injury and were unaffected by kidney injury. miR-122-5p was more sensitive than ALT for reporting liver injury at hospital presentation, especially combined with miR-483-3p. A miRNA panel was associated with human kidney dysfunction. In mice, miR-122-5p, miR-151a-3p and miR-382-5p specifically reported APAP toxicity - being unaffected by drug-induced kidney injury. Profiling of acetaminophen toxicity identified multiple miRNAs that report acute liver injury and potential biomarkers of drug-induced kidney injury.

  6. Calcium regulates the commitment of murine erythroleukemia cells to terminal erythroid differentiation

    OpenAIRE

    1981-01-01

    An alteration in the rate of calcium transport appears to be the rate- limiting event for the commitment of murine erythroleukemia (MEL) cells to initiate a program of terminal erythroid differentiation. The dimethyl sulfoxide (DMSO)-induced commitment of MEL cells to erythroid differentiation can be inhibited by treatment of cells with the calcium- chelating agent EGTA. Upon removal of EGTA, cells initiate commitment without the 12-h lag normally observed after treatment with DMSO alone. Tre...

  7. Globin gene expression in correlation with G protein-related genes during erythroid differentiation

    OpenAIRE

    Vladan P Čokić; Smith, Reginald D.; Biancotto, Angélique; Noguchi, Constance T.; Puri, Raj K.; Schechter, Alan N.

    2013-01-01

    Background The guanine nucleotide binding protein (G protein)-coupled receptors (GPCRs) regulate cell growth, proliferation and differentiation. G proteins are also implicated in erythroid differentiation, and some of them are expressed principally in hematopoietic cells. GPCRs-linked NO/cGMP and p38 MAPK signaling pathways already demonstrated potency for globin gene stimulation. By analyzing erythroid progenitors, derived from hematopoietic cells through in vitro ontogeny, our study intends...

  8. Evolving insights into the synergy between erythropoietin and thrombopoietin and the bipotent erythroid/megakaryocytic progenitor cell.

    Science.gov (United States)

    Papayannopoulou, Thalia; Kaushansky, Kenneth

    2016-08-01

    Although the synergy between erythropoietin and thrombopoietin has previously been pointed out, the clonal demonstration of a human bipotent erythroid/megakaryocytic progenitor (MEP) was first published in Experimental Hematology (Papayannopoulou T, Brice M, Farrer D, Kaushansky K. Exp Hematol. 1996;24:660-669) and later in the same year in Blood (Debili N, Coulombel L, Croisille L, et al. Blood. 1996;88:1284-1296). This demonstration, and the fact that both bipotent and monopotent erythroid or megakaryocytic progenitors co-express markers of both lineages and respond to both lineage-specific transcription factors, has provided a background for the extensive use of MEP assessment by fluorescence-activated cell sorting in many subsequent studies. Beyond this, the demonstration of shared regulatory elements and the presence of single mutations affecting both lineages have inspired further studies to decipher how the shift in transcription factor networks occurs from one lineage to the other. Furthermore, in addition to shared effects, erythropoietin and thrombopoietin have additional independent effects. Most notable for thrombopoietin is its effect on hematopoietic stem cells illustrated by in vitro and in vivo approaches. PMID:26773569

  9. Repression by RB1 characterizes genes involved in the penultimate stage of erythroid development.

    Science.gov (United States)

    Zhang, Ji; Loyd, Melanie R; Randall, Mindy S; Morris, John J; Shah, Jayesh G; Ney, Paul A

    2015-01-01

    Retinoblastoma-1 (RB1), and the RB1-related proteins p107 and p130, are key regulators of the cell cycle. Although RB1 is required for normal erythroid development in vitro, it is largely dispensable for erythropoiesis in vivo. The modest phenotype caused by RB1 deficiency in mice raises questions about redundancy within the RB1 family, and the role of RB1 in erythroid differentiation. Here we show that RB1 is the major pocket protein that regulates terminal erythroid differentiation. Erythroid cells lacking all pocket proteins exhibit the same cell cycle defects as those deficient for RB1 alone. RB1 has broad repressive effects on gene transcription in erythroid cells. As a group, RB1-repressed genes are generally well expressed but downregulated at the final stage of erythroid development. Repression correlates with E2F binding, implicating E2Fs in the recruitment of RB1 to repressed genes. Merging differential and time-dependent changes in expression, we define a group of approximately 800 RB1-repressed genes. Bioinformatics analysis shows that this list is enriched for terms related to the cell cycle, but also for terms related to terminal differentiation. Some of these have not been previously linked to RB1. These results expand the range of processes potentially regulated by RB1, and suggest that a principal role of RB1 in development is coordinating the events required for terminal differentiation. PMID:26397180

  10. Circulating Tumor Necrosis Factor α Receptors Predict the Outcomes of Human IgA Nephropathy: A Prospective Cohort Study.

    Directory of Open Access Journals (Sweden)

    Yun Jung Oh

    Full Text Available The circulating tumor necrosis factor receptors (TNFRs could predict the long-term renal outcome in diabetes, but the role of circulating TNFRs in other chronic kidney disease has not been reported. Here, we investigated the correlation between circulating TNFRs and renal histologic findings on kidney biopsy in IgA nephropathy (IgAN and assessed the notion that the circulating TNFRs could predict the clinical outcome. 347 consecutive biopsy-proven IgAN patients between 2006 and 2012 were prospectively enrolled. Concentrations of circulating TNFRs were measured using serum samples stored at the time of biopsy. The primary clinical endpoint was the decline of estimated glomerular filtration rate (eGFR; ≥ 30% decline compared to baseline. Mean eGFR decreased and proteinuria worsened proportionally as circulating TNFR1 and TNFR2 increased (P < 0.001. Tubulointerstitial lesions such as interstitial fibrosis and tubular atrophy were significantly more severe as concentrations of circulating TNFRs increased, regardless of eGFR levels. The risks of reaching the primary endpoint were significantly higher in the highest quartile of TNFRs compared with other quartiles by the Cox proportional hazards model (TNFR1; hazard ratio 7.48, P < 0.001, TNFR2; hazard ratio 2.51, P = 0.021. In stratified analysis according to initial renal function classified by the eGFR levels of 60 mL/min/1.73 m2, TNFR1 and TNFR2 were significant predictors of renal progression in both subgroups. In conclusion, circulating TNFRs reflect the histology and clinical severity of IgAN. Moreover, elevated concentrations of circulating TNFRs at baseline are early biomarkers for subsequent renal progression in IgAN patients.

  11. Nearshore circulation

    NARCIS (Netherlands)

    Battjes, J.A.; Sobey, R.J.; Stive, M.J.F.

    1990-01-01

    Shelf circulation is driven primarily by wind- and tide-induced forces. It is laterally only weakly constrained so that the geostrophic (Coriolis) acceleration is manifest in the response. Nearshore circulation on the other hand is dominated by wave-induced forces associated with shallow-water. wave

  12. Nuclear RNA sequencing of the mouse erythroid cell transcriptome.

    Directory of Open Access Journals (Sweden)

    Jennifer A Mitchell

    Full Text Available In addition to protein coding genes a substantial proportion of mammalian genomes are transcribed. However, most transcriptome studies investigate steady-state mRNA levels, ignoring a considerable fraction of the transcribed genome. In addition, steady-state mRNA levels are influenced by both transcriptional and posttranscriptional mechanisms, and thus do not provide a clear picture of transcriptional output. Here, using deep sequencing of nuclear RNAs (nucRNA-Seq in parallel with chromatin immunoprecipitation sequencing (ChIP-Seq of active RNA polymerase II, we compared the nuclear transcriptome of mouse anemic spleen erythroid cells with polymerase occupancy on a genome-wide scale. We demonstrate that unspliced transcripts quantified by nucRNA-seq correlate with primary transcript frequencies measured by RNA FISH, but differ from steady-state mRNA levels measured by poly(A-enriched RNA-seq. Highly expressed protein coding genes showed good correlation between RNAPII occupancy and transcriptional output; however, genome-wide we observed a poor correlation between transcriptional output and RNAPII association. This poor correlation is due to intergenic regions associated with RNAPII which correspond with transcription factor bound regulatory regions and a group of stable, nuclear-retained long non-coding transcripts. In conclusion, sequencing the nuclear transcriptome provides an opportunity to investigate the transcriptional landscape in a given cell type through quantification of unspliced primary transcripts and the identification of nuclear-retained long non-coding RNAs.

  13. 重组人促红细胞生成素对急性脑缺血大鼠Nrf2及HO-1表达的影响%Effect of recombinant human erythropoietin on expressions of nuclear factor-erythroid 2-related factor 2 and heme oxygenase-1 in rats after acute cerebral ischemia

    Institute of Scientific and Technical Information of China (English)

    孟华星; 郭军红; 严澎

    2012-01-01

    Objective To study the influence of recombinant human erythropoietin (rHEPO) in expressions of nuclear factor-erythroid 2-related factor 2 (Nrf2) and heme oxygenase-1 (HO-1) in rats after acute cerebral ischemia, explore the anti-oxidant mechanism of rhEPO. Methods Thirty-six healthy male SD rats were randomly divided into sham-operated group,model group,rhEPO treatment group.The rat models of left middle cerebral artery occlusion in the later 2 groups were induced by suture method.rhEPO (5000 IU/kg) was injected intraperitoneally into the rats ofrhEPO treatment group 2 hafter the success of ischemia model making, while those of the sham-operated group and model groupwere given equal volume of saline.Rats were sacrificed 24 h after ischemia; and the levels of Nrf2 andHO-1 in the brain tissues were detected by immunohistochemistry and Western blotting. Results The immunohistochemistry showed that,as compared with those in the sham-operated group,the Nrf2- and HO-1- positive cells obviously increased in rats of the model group and rhEPO treatment group (P<0.05),and rats of the rhEPO treatment group had significantly larger numbers of Nrf2- and HO-1- positive cells than rats of the model group (P<0.05); these positive cells were mainly neurons and astrocytes located in ischemic areas.Western blotting also indicated that the expressions of Nrf2 and HO-1 were enhanced in the order of sham-operated group, model group and rhEPO treatment group; statistically significant difference was noted between each 2 groups (P<0.05). Conclusion The rhEPO may exert a neuroprotective effect by activating Keap1-Nrf2/ARE pathway after acute cerebral ischemia.%目的 研究重组人促红细胞生成素(rhEPO)对急性脑缺血大鼠脑组织中核因子E2相关性因子2(Nrf2)及血红素加氧酶1(HO-1)表达的影响,探讨rhEPO的抗氧化作用机制. 方法 将36只雄性SD大鼠按随机数字表法分为假手术组、模型组、rhEPO组,后两组采用线栓法制备大

  14. The estrogen receptor cooperates with the TGF alpha receptor (c-erbB) in regulation of chicken erythroid progenitor self-renewal.

    Science.gov (United States)

    Schroeder, C; Gibson, L; Nordström, C; Beug, H

    1993-03-01

    A unique combination of growth promoting factors is described that allows growth of large amounts (10(10)-10(11)) of normal erythroid progenitors from chick bone marrow. These erythroid progenitors express the estrogen receptor (ER) as well as the receptor tyrosine kinase TGF alpha R/c-erbB. They require both TGF alpha and estradiol for sustained self-renewal in vitro, but terminally differentiate upon withdrawal of TGF alpha and inactivation of the ER by an antagonist (ICI 164.384). Overexpression of the human ER in erythroblasts devoid of endogenous ER revealed that the hormone-activated ER alone arrested erythroid differentiation and repressed a large group of erythrocyte genes. When similarly overexpressed, TGF alpha R/c-erbB inhibited the expression of a distinct, but overlapping, set of genes. The endogenous ER and TGF alpha R/c-erbB affect erythrocyte gene expression in a similar, but less pronounced fashion. Surprisingly, suppression of ER function by antagonist efficiently inhibited erythroblast transformation by tyrosine kinase oncogenes, suggesting a role of the endogenous ER in leukemogenesis. We speculate that the oncogenes v-erbB and v-erbA cooperate in erythroleukemia induction by a mechanism that is employed by TGF alpha R/c-erbB and ER to regulate normal progenitor self-renewal in response to external signals. PMID:8458346

  15. Characterization of a Distinct Population of Circulating Human Non-Adherent Endothelial Forming Cells and Their Recruitment via Intercellular Adhesion Molecule-3

    OpenAIRE

    Appleby, Sarah L.; Cockshell, Michaelia P.; Pippal, Jyotsna B.; Thompson, Emma J.; Barrett, Jeffrey M.; Katie Tooley; Shaundeep Sen; Wai Yan Sun; Randall Grose; Ian Nicholson; Vitalina Levina; Ira Cooke; Gert Talbo; Lopez, Angel F.; Bonder, Claudine S.

    2012-01-01

    Circulating vascular progenitor cells contribute to the pathological vasculogenesis of cancer whilst on the other hand offer much promise in therapeutic revascularization in post-occlusion intervention in cardiovascular disease. However, their characterization has been hampered by the many variables to produce them as well as their described phenotypic and functional heterogeneity. Herein we have isolated, enriched for and then characterized a human umbilical cord blood derived CD133(+) popul...

  16. Iron as the Key Modulator of Hepcidin Expression in Erythroid Antibody-Mediated Hypoplasia

    Directory of Open Access Journals (Sweden)

    J. C. Fernandes

    2014-01-01

    Full Text Available Erythroid hypoplasia (EH is a rare complication associated with recombinant human erythropoietin (rHuEPO therapies, due to development of anti-rHuEPO antibodies; however, the underlying mechanisms remain poorly clarified. Our aim was to manage a rat model of antibody-mediated EH induced by rHuEPO and study the impact on iron metabolism and erythropoiesis. Wistar rats treated during 9 weeks with a high rHuEPO dose (200 IU developed EH, as shown by anemia, reduced erythroblasts, reticulocytopenia, and plasmatic anti-rHuEPO antibodies. Serum iron was increased and associated with mRNA overexpression of hepatic hepcidin and other iron regulatory mediators and downregulation of matriptase-2; overexpression of divalent metal transporter 1 and ferroportin was observed in duodenum and liver. Decreased EPO expression was observed in kidney and liver, while EPO receptor was overexpressed in liver. Endogenous EPO levels were normal, suggesting that anti-rHuEPO antibodies blunted EPO function. Our results suggest that anti-rHuEPO antibodies inhibit erythropoiesis causing anemia. This leads to a serum iron increase, which seems to stimulate hepcidin expression despite no evidence of inflammation, thus suggesting iron as the key modulator of hepcidin synthesis. These findings might contribute to improving new therapeutic strategies against rHuEPO resistance and/or development of antibody-mediated EH in patients under rHuEPO therapy.

  17. The SOD1 transgene expressed in erythroid cells alleviates fatal phenotype in congenic NZB/NZW-F1 mice.

    Science.gov (United States)

    Otsuki, Noriyuki; Konno, Tasuku; Kurahashi, Toshihiro; Suzuki, Saori; Lee, Jaeyong; Okada, Futoshi; Iuchi, Yoshihito; Homma, Takujiro; Fujii, Junichi

    2016-07-01

    Oxidative stress due to a superoxide dismutase 1 (SOD1) deficiency causes anemia and autoimmune responses, which are phenotypically similar to autoimmune hemolytic anemia (AIHA) and systemic lupus erythematosus (SLE) in C57BL/6 mice and aggravates AIHA pathogenesis in New Zealand black (NZB) mice. We report herein on an evaluation of the role of reactive oxygen species (ROS) in a model mouse with inherited SLE, that is, F1 mice of the NZB × New Zealand white (NZW) strain. The ROS levels within red blood cells (RBCs) of the F1 mice were similar to the NZW mice but lower compared to the NZB mice throughout adult period. Regarding SLE pathogenesis, we examined the effects of an SOD1 deficiency or the overexpression of human SOD1 in erythroid cells by establishing corresponding congenic F1 mice. A SOD1 deficiency caused an elevation in ROS production, methemoglobin content, and hyperoxidation of peroxiredoxin in RBC of the F1 mice, which were all consistent with elevated oxidative stress. However, while the overexpression of human SOD1 in erythroid cells extended the life span of the congenic F1 mice, the SOD1 deficiency had no effect on life span compared to wild-type F1 mice. It is generally recognized that NZW mice possess a larval defect in the immune system and that NZB mice trigger an autoimmune reaction in the F1 mice. Our results suggest that the oxidative insult originated from the NZB mouse background has a functional role in triggering an aberrant immune reaction, leading to fatal responses in F1 mice. PMID:27080108

  18. A Chemical Screening Approach to Identify Novel Key Mediators of Erythroid Enucleation

    Science.gov (United States)

    Wölwer, Christina B.; Pase, Luke B.; Pearson, Helen B.; Gödde, Nathan J.; Lackovic, Kurt; Huang, David C. S.; Russell, Sarah M.; Humbert, Patrick O.

    2015-01-01

    Erythroid enucleation is critical for terminal differentiation of red blood cells, and involves extrusion of the nucleus by orthochromatic erythroblasts to produce reticulocytes. Due to the difficulty of synchronizing erythroblasts, the molecular mechanisms underlying the enucleation process remain poorly understood. To elucidate the cellular program governing enucleation, we utilized a novel chemical screening approach whereby orthochromatic cells primed for enucleation were enriched ex vivo and subjected to a functional drug screen using a 324 compound library consisting of structurally diverse, medicinally active and cell permeable drugs. Using this approach, we have confirmed the role of HDACs, proteasomal regulators and MAPK in erythroid enucleation and introduce a new role for Cyclin-dependent kinases, in particular CDK9, in this process. Importantly, we demonstrate that when coupled with imaging analysis, this approach provides a powerful means to identify and characterize rate limiting steps involved in the erythroid enucleation process. PMID:26569102

  19. Erythropoietin retards DNA breakdown and prevents programmed death in erythroid progenitor cells

    Energy Technology Data Exchange (ETDEWEB)

    Koury, M.J.; Bondurant, M.C. (Vanderbilt Univ. Medical Center, Nashville, TN (USA) Veterans Administration Medical Center, Nashville, TN (USA))

    1990-04-20

    The mechanism by which erythropoietin controls mammalian erythrocyte production is unknown. Labeling experiments in vitro with ({sup 3}H) thymidine demonstrated DNA cleavage in erythroid progenitor cells that was accompanied by DNA repair and synthesis. Erythropoietin reduced DNA cleavage by a factor of 2.6. In the absence of erythropoietin, erythroid progenitor cells accumulated DNA cleavage fragments characteristic of those found in programmed cell death (apoptosis) by 2 to 4 hours and began dying by 16 hours. In the presence of erythropoietin, the progenitor cells survived and differentiated into reticulocytes. Thus, apoptosis is a major component of normal erythropoiesis, and erythropoietin controls erythrocyte production by retarding DNA breakdown and preventing apoptosis in erythroid progenitor cells.

  20. Comparison of the circulating metabolite profile of PF-04991532, a hepatoselective glucokinase activator, across preclinical species and humans: potential implications in metabolites in safety testing assessment.

    Science.gov (United States)

    Sharma, Raman; Litchfield, John; Bergman, Arthur; Atkinson, Karen; Kazierad, David; Gustavson, Stephanie M; Di, Li; Pfefferkorn, Jeffrey A; Kalgutkar, Amit S

    2015-02-01

    A previous report from our laboratory disclosed the identification of PF-04991532 [(S)-6-(3-cyclopentyl-2-(4-trifluoromethyl)-1H-imidazol-1-yl)propanamido)nicotinic acid] as a hepatoselective glucokinase activator for the treatment of type 2 diabetes mellitus. Lack of in vitro metabolic turnover in microsomes and hepatocytes from preclinical species and humans suggested that metabolism would be inconsequential as a clearance mechanism of PF-04991532 in vivo. Qualitative examination of human circulating metabolites using plasma samples from a 14-day multiple ascending dose clinical study, however, revealed a glucuronide (M1) and monohydroxylation products (M2a and M2b/M2c) whose abundances (based on UV integration) were greater than 10% of the total drug-related material. Based on this preliminary observation, mass balance/excretion studies were triggered in animals, which revealed that the majority of circulating radioactivity following the oral administration of [¹⁴C]PF-04991532 was attributed to an unchanged parent (>70% in rats and dogs). In contrast with the human circulatory metabolite profile, the monohydroxylated metabolites were not detected in circulation in either rats or dogs. Available mass spectral evidence suggested that M2a and M2b/M2c were diastereomers derived from cyclopentyl ring oxidation in PF-04991532. Because cyclopentyl ring hydroxylation on the C-2 and C-3 positions can generate eight possible diastereomers, it was possible that additional diastereomers may have also formed and would need to be resolved from the M2a and M2b/M2c peaks observed in the current chromatography conditions. In conclusion, the human metabolite scouting study in tandem with the animal mass balance study allowed early identification of PF-04991532 oxidative metabolites, which were not predicted by in vitro methods and may require additional scrutiny in the development phase of PF-04991532.

  1. The VP1u Receptor Restricts Parvovirus B19 Uptake to Permissive Erythroid Cells

    Science.gov (United States)

    Leisi, Remo; Von Nordheim, Marcus; Ros, Carlos; Kempf, Christoph

    2016-01-01

    Parvovirus B19 (B19V) is a small non-enveloped virus and known as the causative agent for the mild childhood disease erythema infectiosum. B19V has an extraordinary narrow tissue tropism, showing only productive infection in erythroid precursor cells in the bone marrow. We recently found that the viral protein 1 unique region (VP1u) contains an N-terminal receptor-binding domain (RBD), which mediates the uptake of the virus into cells of the erythroid lineage. To further investigate the role of the RBD in connection with a B19V-unrelated capsid, we chemically coupled the VP1u of B19V to the bacteriophage MS2 capsid and tested the internalization capacity of the bioconjugate on permissive cells. In comparison, we studied the cellular uptake and infection of B19V along the erythroid differentiation. The results showed that the MS2-VP1u bioconjugate mimicked the specific internalization of the native B19V into erythroid precursor cells, which further coincides with the restricted infection profile. The successful mimicry of B19V uptake demonstrates that the RBD in the VP1u is sufficient for the endocytosis of the viral capsid. Furthermore, the recombinant VP1u competed with B19V uptake into permissive cells, thus excluding a significant alternative uptake mechanism by other receptors. Strikingly, the VP1u receptor appeared to be expressed only on erythropoietin-dependent erythroid differentiation stages that also provide the necessary intracellular factors for a productive infection. Taken together, these findings suggest that the VP1u binds to a yet-unknown erythroid-specific cellular receptor and thus restricts the virus entry to permissive cells. PMID:27690083

  2. Identification of Cell Type-Specific Differences in Erythropoietin Receptor Signaling in Primary Erythroid and Lung Cancer Cells

    Science.gov (United States)

    Salopiata, Florian; Depner, Sofia; Wäsch, Marvin; Böhm, Martin E.; Mücke, Oliver; Plass, Christoph; Lehmann, Wolf D.; Kreutz, Clemens; Timmer, Jens; Klingmüller, Ursula

    2016-01-01

    Lung cancer, with its most prevalent form non-small-cell lung carcinoma (NSCLC), is one of the leading causes of cancer-related deaths worldwide, and is commonly treated with chemotherapeutic drugs such as cisplatin. Lung cancer patients frequently suffer from chemotherapy-induced anemia, which can be treated with erythropoietin (EPO). However, studies have indicated that EPO not only promotes erythropoiesis in hematopoietic cells, but may also enhance survival of NSCLC cells. Here, we verified that the NSCLC cell line H838 expresses functional erythropoietin receptors (EPOR) and that treatment with EPO reduces cisplatin-induced apoptosis. To pinpoint differences in EPO-induced survival signaling in erythroid progenitor cells (CFU-E, colony forming unit-erythroid) and H838 cells, we combined mathematical modeling with a method for feature selection, the L1 regularization. Utilizing an example model and simulated data, we demonstrated that this approach enables the accurate identification and quantification of cell type-specific parameters. We applied our strategy to quantitative time-resolved data of EPO-induced JAK/STAT signaling generated by quantitative immunoblotting, mass spectrometry and quantitative real-time PCR (qRT-PCR) in CFU-E and H838 cells as well as H838 cells overexpressing human EPOR (H838-HA-hEPOR). The established parsimonious mathematical model was able to simultaneously describe the data sets of CFU-E, H838 and H838-HA-hEPOR cells. Seven cell type-specific parameters were identified that included for example parameters for nuclear translocation of STAT5 and target gene induction. Cell type-specific differences in target gene induction were experimentally validated by qRT-PCR experiments. The systematic identification of pathway differences and sensitivities of EPOR signaling in CFU-E and H838 cells revealed potential targets for intervention to selectively inhibit EPO-induced signaling in the tumor cells but leave the responses in erythroid

  3. Identification of Cell Type-Specific Differences in Erythropoietin Receptor Signaling in Primary Erythroid and Lung Cancer Cells.

    Science.gov (United States)

    Merkle, Ruth; Steiert, Bernhard; Salopiata, Florian; Depner, Sofia; Raue, Andreas; Iwamoto, Nao; Schelker, Max; Hass, Helge; Wäsch, Marvin; Böhm, Martin E; Mücke, Oliver; Lipka, Daniel B; Plass, Christoph; Lehmann, Wolf D; Kreutz, Clemens; Timmer, Jens; Schilling, Marcel; Klingmüller, Ursula

    2016-08-01

    Lung cancer, with its most prevalent form non-small-cell lung carcinoma (NSCLC), is one of the leading causes of cancer-related deaths worldwide, and is commonly treated with chemotherapeutic drugs such as cisplatin. Lung cancer patients frequently suffer from chemotherapy-induced anemia, which can be treated with erythropoietin (EPO). However, studies have indicated that EPO not only promotes erythropoiesis in hematopoietic cells, but may also enhance survival of NSCLC cells. Here, we verified that the NSCLC cell line H838 expresses functional erythropoietin receptors (EPOR) and that treatment with EPO reduces cisplatin-induced apoptosis. To pinpoint differences in EPO-induced survival signaling in erythroid progenitor cells (CFU-E, colony forming unit-erythroid) and H838 cells, we combined mathematical modeling with a method for feature selection, the L1 regularization. Utilizing an example model and simulated data, we demonstrated that this approach enables the accurate identification and quantification of cell type-specific parameters. We applied our strategy to quantitative time-resolved data of EPO-induced JAK/STAT signaling generated by quantitative immunoblotting, mass spectrometry and quantitative real-time PCR (qRT-PCR) in CFU-E and H838 cells as well as H838 cells overexpressing human EPOR (H838-HA-hEPOR). The established parsimonious mathematical model was able to simultaneously describe the data sets of CFU-E, H838 and H838-HA-hEPOR cells. Seven cell type-specific parameters were identified that included for example parameters for nuclear translocation of STAT5 and target gene induction. Cell type-specific differences in target gene induction were experimentally validated by qRT-PCR experiments. The systematic identification of pathway differences and sensitivities of EPOR signaling in CFU-E and H838 cells revealed potential targets for intervention to selectively inhibit EPO-induced signaling in the tumor cells but leave the responses in erythroid

  4. DMPD: A role for caspases in the differentiation of erythroid cells and macrophages. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available 17905508 A role for caspases in the differentiation of erythroid cells and macropha...;90(2):416-22. Epub 2007 Sep 2. (.png) (.svg) (.html) (.csml) Show A role for caspases in the differentiatio...n of erythroid cells and macrophages. PubmedID 17905508 Title A role for caspases

  5. The circulation physiology of agroecosystems

    Institute of Scientific and Technical Information of China (English)

    Cao Zhiping; Richard Dawson

    2007-01-01

    This paper represents an effort to enlarge the understanding of the biophysical foundation of agroecosystems by using an analogy with the circulation of the blood in the human body. The circulation function in the human body can be represented as arterial pressure. The factors affecting arterial pressure in the human body have direct counterparts in the cultivation-husbandry system. The relationship between circulation pressure and the factors affecting that pressure in the cultivation-husbandry system are similar to the relationship between the arterial pressure and factors affecting arterial pressure in the human body. Furthermore, circulation resistance in the cultivation-husbandry system can be shown to be analogous to the calculation of peripheral resistance in the human body by Poiseuille's formula.

  6. Is erythroferrone finally the long sought-after systemic erythroid regulator of iron?

    Institute of Scientific and Technical Information of China (English)

    Alfons; Lawen

    2015-01-01

    Iron metabolism is regulated on the cellular and the systemic level. Over the last decade, the liver peptide "hepcidin" has emerged as the body’s key irons store regulator. The long postulated "erythroid regulator of iron", however, remained elusive. Last year, evidence was provided, that a previously described myokine "myonectin" may also function as the long sought erythroid regulator of iron. Myonectin was therefore renamed "erythroferrone". This editorial provides a brief discussion on the two functions of erythroferrone and also briefly considers the emerging potential role of transferrin receptor 2 in erythropoiesis.

  7. Phylogenetic analysis of human group C rotavirus circulating in Brazil reveals a potential unique NSP4 genetic variant and high similarity with Asian strains.

    Science.gov (United States)

    Luchs, Adriana; do Carmo Sampaio Tavares Timenetsky, Maria

    2015-06-01

    Group C rotaviruses (RVC) cause gastroenteritis in humans and animals worldwide, and the evidence for a possible zoonotic role has been recently provided. To gain information on the genetic diversity and relationships between human and animal RVC, we sequenced the VP4, VP7, and NSP4 genes of 12, 19, and 15 human strains, respectively, detected in São Paulo state during historical (1988 and 1993) and recent (2007 and 2008) Brazilian rotavirus surveillance. All RVC strains analyzed in the present study grouped into human genotype (G4-P[2]-E2), and did not show any evidence of animal ancestry. Phylogenetic analysis showed that RVC samples detected in 1988 and 1993 clustered together with strains from distinct continents, indicating that historical RVC strains circulating in São Paulo were closely related to those strains circulating worldwide. All three genes (VP7, VP4 and NSP4) of São Paulo RVC strains isolated in 2007-2008 exhibited close phylogenetic relationship with human RVC strains isolated in China and Japan, suggesting that they are genetically linked, and that a gene flow could be occurring between this Asian countries and Brazil. We identified two distinct clusters in the NSP4 phylogenetic tree. One cluster formed exclusively by human Brazilian strains detected in 1997 and 2003-2004 in Rio de Janeiro, Bahia, and Rio Grande do Sul states (Subgroup II) previously described in a different study, that displayed low sequence identities to other human strains formerly published, and to the Brazilian RVC strains (Subgroup I) characterized in the present study. These data suggests the circulation of two genetic profiles of the NSP4 gene in Brazil. High sequence diversity in NSP4 gene was previously reported in Asia, and additional diversity in NSP4 RVC strains spreading in the world should be expected. More in-depth molecular and epidemiological analysis of human RVC throughout the world will be needed to understand their diversity and clarify their evolution

  8. Circulation economics

    DEFF Research Database (Denmark)

    Ingebrigtsen, Stig; Jakobsen, Ove

    2006-01-01

    presupposes a perspective integrating economic, natural and cultural values. Third, to organize the interplay between all stakeholders we introduce an arena for communicative cooperation. Originality/value - The paper concludes that circulation economics presupposes a change in paradigm, from a mechanistic...

  9. Antigenic and genomic characterization of human influenza A and B viruses circulating in Argentina after the introduction of influenza A(H1N1)pdm09.

    Science.gov (United States)

    Russo, Mara L; Pontoriero, Andrea V; Benedetti, Estefania; Czech, Andrea; Avaro, Martin; Periolo, Natalia; Campos, Ana M; Savy, Vilma L; Baumeister, Elsa G

    2014-12-01

    This study was conducted as part of the Argentinean Influenza and other Respiratory Viruses Surveillance Network, in the context of the Global Influenza Surveillance carried out by the World Health Organization (WHO). The objective was to study the activity and the antigenic and genomic characteristics of circulating viruses for three consecutive seasons (2010, 2011 and 2012) in order to investigate the emergence of influenza viral variants. During the study period, influenza virus circulation was detected from January to December. Influenza A and B, and all current subtypes of human influenza viruses, were present each year. Throughout the 2010 post-pandemic season, influenza A(H1N1)pdm09, unexpectedly, almost disappeared. The haemagglutinin (HA) of the A(H1N1)pdm09 viruses studied were segregated in a different genetic group to those identified during the 2009 pandemic, although they were still antigenically closely related to the vaccine strain A/California/07/2009. Influenza A(H3N2) viruses were the predominant strains circulating during the 2011 season, accounting for nearly 76 % of influenza viruses identified. That year, all HA sequences of the A(H3N2) viruses tested fell into the A/Victoria/208/2009 genetic clade, but remained antigenically related to A/Perth/16/2009 (reference vaccine recommended for this three-year period). A(H3N2) viruses isolated in 2012 were antigenically closely related to A/Victoria/361/2011, recommended by the WHO as the H3 component for the 2013 Southern Hemisphere formulation. B viruses belonging to the B/Victoria lineage circulated in 2010. A mixed circulation of viral variants of both B/Victoria and B/Yamagata lineages was detected in 2012, with the former being predominant. A(H1N1)pdm09 viruses remained antigenically closely related to the vaccine virus A/California/7/2009; A(H3N2) viruses continually evolved into new antigenic clusters and both B lineages, B/Victoria/2/87-like and B/Yamagata/16/88-like viruses, were observed

  10. The effect of circulating antigen on the biodistribution of the engineered human antibody hCTM01 in a nude mice model

    International Nuclear Information System (INIS)

    Clinical studies are currently underway to assess the biodistribution and therapeutic potential of the genetically engineered human antibody hCTM01 directed against polymorphic epithelial mucin (PEM) in patients with ovarian carcinoma. The present study was undertaken to assess the effect of circulating PEM antigen on the biodistribution of the anti-PEM antibody in mice bearing MUC-1 transfected adenocarcinoma cell lines. Tumour xenografts were established from three cell lines: 413-BCR, which expressed antigen on the cell surface and also shed antigen into the circulation, E3P23, which expressed the antigen but did not shed into the circulation, and a negative control (410.4 MUCI). Groups of five mice were injected with 1.0 mg/kg antibody, imaged after 72 h and then sacrificed, followed by assay of tissue uptake. The results showed a clear difference in the tumour and liver uptake, with the non-secreting cell line showing almost twice the tumour uptake and approximately 20% of the liver uptake of the secreting cell line. (orig.). With 4 figs., 1 tab

  11. Circulating intestine-derived exosomal miR-328 in plasma, a possible biomarker for estimating BCRP function in the human intestines.

    Science.gov (United States)

    Gotanda, Keisuke; Hirota, Takeshi; Saito, Jumpei; Fukae, Masato; Egashira, Yu; Izumi, Noritomo; Deguchi, Mariko; Kimura, Miyuki; Matsuki, Shunji; Irie, Shin; Ieiri, Ichiro

    2016-08-30

    A variant in the breast cancer resistance protein (BCRP) gene, 421C> A is a useful biomarker for describing large inter-individual differences in the pharmacokinetics of sulfasalazine (SASP), a BCRP substrate. However, large intra-genotypic variability still exists in spite of the incorporation of this variant into the pharmacokinetics of SASP. Since miR-328 negatively regulates BCRP expression in human tissues, we hypothesized that exosomal miR-328 in plasma, which leaks from the intestines, is a possible biomarker for estimating BCRP activity in the human intestines. We established an immunoprecipitation-based quantitative method for circulating intestine-derived miR-328 in plasma using an anti-glycoprotein A33 antibody. A clinical study was conducted with an open-label, non-randomized, and single-arm design involving 33 healthy participants. Intestine-derived exosomal miR-328 levels positively correlated (P intestinal BCRP activity, resulting in the high AUC of SASP. Circulating intestine-derived exosomal miR-328 in plasma has potential as a possible biomarker for estimating BCRP function in the human intestines.

  12. Relative levels of the proprotein and cleavage‐activated form of circulating human anti‐Müllerian hormone are sexually dimorphic and variable during the life cycle

    OpenAIRE

    Pankhurst, Michael W.; Chong, Yih Harng; McLennan, Ian S.

    2016-01-01

    Abstract Anti‐Müllerian hormone (AMH) is a gonadal hormone, which induces aspects of the male phenotype, and influences ovarian follicular recruitment. AMH is synthesized as a proprotein (proAMH), which is incompletely cleaved to the receptor‐competent AMHN ,C. AMH ELISAs have not distinguished between proAMH and AMHN ,C; consequently, the physiological ranges of circulating proAMH and AMHN ,C are unknown. A novel proAMH ELISA has been used to assay serum proAMH in humans. Total AMH was also ...

  13. Immunosuppressive CD71+ erythroid cells compromise neonatal host defence against infection

    Science.gov (United States)

    Elahi, Shokrollah; Ertelt, James M.; Kinder, Jeremy M.; Jiang, Tony T.; Zhang, Xuzhe; Xin, Lijun; Chaturvedi, Vandana; Strong, Beverly S.; Qualls, Joseph E.; Steinbrecher, Kris A.; Kalfa, Theodosia A.; Shaaban, Aimen F.; Way, Sing Sing

    2013-12-01

    Newborn infants are highly susceptible to infection. This defect in host defence has generally been ascribed to the immaturity of neonatal immune cells; however, the degree of hyporesponsiveness is highly variable and depends on the stimulation conditions. These discordant responses illustrate the need for a more unified explanation for why immunity is compromised in neonates. Here we show that physiologically enriched CD71+ erythroid cells in neonatal mice and human cord blood have distinctive immunosuppressive properties. The production of innate immune protective cytokines by adult cells is diminished after transfer to neonatal mice or after co-culture with neonatal splenocytes. Neonatal CD71+ cells express the enzyme arginase-2, and arginase activity is essential for the immunosuppressive properties of these cells because molecular inhibition of this enzyme or supplementation with L-arginine overrides immunosuppression. In addition, the ablation of CD71+ cells in neonatal mice, or the decline in number of these cells as postnatal development progresses parallels the loss of suppression, and restored resistance to the perinatal pathogens Listeria monocytogenes and Escherichia coli. However, CD71+ cell-mediated susceptibility to infection is counterbalanced by CD71+ cell-mediated protection against aberrant immune cell activation in the intestine, where colonization with commensal microorganisms occurs swiftly after parturition. Conversely, circumventing such colonization by using antimicrobials or gnotobiotic germ-free mice overrides these protective benefits. Thus, CD71+ cells quench the excessive inflammation induced by abrupt colonization with commensal microorganisms after parturition. This finding challenges the idea that the susceptibility of neonates to infection reflects immune-cell-intrinsic defects and instead highlights processes that are developmentally more essential and inadvertently mitigate innate immune protection. We anticipate that these

  14. Eafs control erythroid cell fate by regulating c-myb expression through Wnt signaling.

    Directory of Open Access Journals (Sweden)

    Xufa Ma

    Full Text Available ELL associated factor 1 and ELL associated factor 2 (EAF1/2 factors are reported to play important roles in tumor suppression and embryogenesis. Our previous studies showed that eaf factors mediated effective convergence and extension (C&E movements and modulated mesoderm and neural patterning by regulating both non-canonical and canonical Wnt signaling in the early embryonic process. In this study, through knockdown of both eaf1 and eaf2 in embryos, we found that differentiation of primary erythroid cells was blocked, but hematopoietic precursor cells maintained in eafs morphants. Co-injection of c-myb-MO rescued the erythroid differentiation in eafs morphants, as indicated by the restored expression of the erythroid-specific gene, βe3 globin. In addition, low dosage of c-myb effectively blocked the βe3 globin expression in embryos, and did not affect the expression of markers of hematopoietic progenitor cells and other mesoderm, which was similar to the phenotypes we observed in eafs morphants. We also revealed that knockdown Wnt signaling by transiently inducing dn-Tcf in embryos at the bud stage down-regulated the increased c-myb to normal level and also restored βe3 globin expression in eafs morphants. Our evidence points to a novel role for eaf factors in controlling erythroid cell fate by regulating c-Myb expression through canonic Wnt signaling.

  15. Probing conformational stability and dynamics of erythroid and nonerythroid spectrin: effects of urea and guanidine hydrochloride.

    Directory of Open Access Journals (Sweden)

    Malay Patra

    Full Text Available We have studied the conformational stability of the two homologous membrane skeletal proteins, the erythroid and non-erythroid spectrins, in their dimeric and tetrameric forms respectively during unfolding in the presence of urea and guanidine hydrochloride (GuHCl. Fluorescence and circular dichroism (CD spectroscopy have been used to study the changes of intrinsic tryptophan fluorescence, anisotropy, far UV-CD and extrinsic fluorescence of bound 1-anilinonapthalene-8-sulfonic acid (ANS. Chemical unfolding of both proteins were reversible and could be described as a two state transition. The folded erythroid spectrin and non-erythroid spectrin were directly converted to unfolded monomer without formation of any intermediate. Fluorescence quenching, anisotropy, ANS binding and dynamic light scattering data suggest that in presence of low concentrations of the denaturants (up-to 1M hydrogen bonding network and van der Waals interaction play a role inducing changes in quaternary as well as tertiary structures without complete dissociation of the subunits. This is the first report of two large worm like, multi-domain proteins obeying twofold rule which is commonly found in small globular proteins. The free energy of stabilization (ΔGuH20 for the dimeric spectrin has been 20 kcal/mol lesser than the tetrameric from.

  16. Probing Conformational Stability and Dynamics of Erythroid and Nonerythroid Spectrin: Effects of Urea and Guanidine Hydrochloride

    Science.gov (United States)

    Patra, Malay; Mukhopadhyay, Chaitali; Chakrabarti, Abhijit

    2015-01-01

    We have studied the conformational stability of the two homologous membrane skeletal proteins, the erythroid and non-erythroid spectrins, in their dimeric and tetrameric forms respectively during unfolding in the presence of urea and guanidine hydrochloride (GuHCl). Fluorescence and circular dichroism (CD) spectroscopy have been used to study the changes of intrinsic tryptophan fluorescence, anisotropy, far UV-CD and extrinsic fluorescence of bound 1-anilinonapthalene-8-sulfonic acid (ANS). Chemical unfolding of both proteins were reversible and could be described as a two state transition. The folded erythroid spectrin and non-erythroid spectrin were directly converted to unfolded monomer without formation of any intermediate. Fluorescence quenching, anisotropy, ANS binding and dynamic light scattering data suggest that in presence of low concentrations of the denaturants (up-to 1M) hydrogen bonding network and van der Waals interaction play a role inducing changes in quaternary as well as tertiary structures without complete dissociation of the subunits. This is the first report of two large worm like, multi-domain proteins obeying twofold rule which is commonly found in small globular proteins. The free energy of stabilization (ΔGuH20) for the dimeric spectrin has been 20 kcal/mol lesser than the tetrameric from. PMID:25617632

  17. Probing conformational stability and dynamics of erythroid and nonerythroid spectrin: effects of urea and guanidine hydrochloride.

    Science.gov (United States)

    Patra, Malay; Mukhopadhyay, Chaitali; Chakrabarti, Abhijit

    2015-01-01

    We have studied the conformational stability of the two homologous membrane skeletal proteins, the erythroid and non-erythroid spectrins, in their dimeric and tetrameric forms respectively during unfolding in the presence of urea and guanidine hydrochloride (GuHCl). Fluorescence and circular dichroism (CD) spectroscopy have been used to study the changes of intrinsic tryptophan fluorescence, anisotropy, far UV-CD and extrinsic fluorescence of bound 1-anilinonapthalene-8-sulfonic acid (ANS). Chemical unfolding of both proteins were reversible and could be described as a two state transition. The folded erythroid spectrin and non-erythroid spectrin were directly converted to unfolded monomer without formation of any intermediate. Fluorescence quenching, anisotropy, ANS binding and dynamic light scattering data suggest that in presence of low concentrations of the denaturants (up-to 1M) hydrogen bonding network and van der Waals interaction play a role inducing changes in quaternary as well as tertiary structures without complete dissociation of the subunits. This is the first report of two large worm like, multi-domain proteins obeying twofold rule which is commonly found in small globular proteins. The free energy of stabilization (ΔGuH20) for the dimeric spectrin has been 20 kcal/mol lesser than the tetrameric from. PMID:25617632

  18. Histones to the cytosol: exportin 7 is essential for normal terminal erythroid nuclear maturation.

    Science.gov (United States)

    Hattangadi, Shilpa M; Martinez-Morilla, Sandra; Patterson, Heide Christine; Shi, Jiahai; Burke, Karly; Avila-Figueroa, Amalia; Venkatesan, Srividhya; Wang, Junxia; Paulsen, Katharina; Görlich, Dirk; Murata-Hori, Maki; Lodish, Harvey F

    2014-09-18

    Global nuclear condensation, culminating in enucleation during terminal erythropoiesis, is poorly understood. Proteomic examination of extruded erythroid nuclei from fetal liver revealed a striking depletion of most nuclear proteins, suggesting that nuclear protein export had occurred. Expression of the nuclear export protein, Exportin 7 (Xpo7), is highly erythroid-specific, induced during erythropoiesis, and abundant in very late erythroblasts. Knockdown of Xpo7 in primary mouse fetal liver erythroblasts resulted in severe inhibition of chromatin condensation and enucleation but otherwise had little effect on erythroid differentiation, including hemoglobin accumulation. Nuclei in Xpo7-knockdown cells were larger and less dense than normal and accumulated most nuclear proteins as measured by mass spectrometry. Strikingly,many DNA binding proteins such as histones H2A and H3 were found to have migrated into the cytoplasm of normal late erythroblasts prior to and during enucleation, but not in Xpo7-knockdown cells. Thus, terminal erythroid maturation involves migration of histones into the cytoplasm via a process likely facilitated by Xpo7.

  19. Homeodomain-interacting protein kinase 2 plays an important role in normal terminal erythroid differentiation.

    Science.gov (United States)

    Hattangadi, Shilpa M; Burke, Karly A; Lodish, Harvey F

    2010-06-10

    Gene-targeting experiments report that the homeodomain-interacting protein kinases 1 and 2, Hipk1 and Hipk2, are essential but redundant in hematopoietic development because Hipk1/Hipk2 double-deficient animals exhibit severe defects in hematopoiesis and vasculogenesis, whereas the single knockouts do not. These serine-threonine kinases phosphorylate and consequently modify the functions of several important hematopoietic transcription factors and cofactors. Here we show that Hipk2 knockdown alone plays a significant role in terminal fetal liver erythroid differentiation. Hipk1 and Hipk2 are highly induced during primary mouse fetal liver erythropoiesis. Specific knockdown of Hipk2 inhibits terminal erythroid cell proliferation (explained in part by impaired cell-cycle progression as well as increased apoptosis) and terminal enucleation as well as the accumulation of hemoglobin. Hipk2 knockdown also reduces the transcription of many genes involved in proliferation and apoptosis as well as important, erythroid-specific genes involved in hemoglobin biosynthesis, such as alpha-globin and mitoferrin 1, demonstrating that Hipk2 plays an important role in some but not all aspects of normal terminal erythroid differentiation.

  20. Fusion of ZMYND8 and RELA genes in acute erythroid leukemia

    DEFF Research Database (Denmark)

    Panagopoulos, Ioannis; Micci, Francesca; Thorsen, Jim;

    2013-01-01

    Acute erythroid leukemia was diagnosed in a 4-month-old boy. Cytogenetic analysis of bone marrow (BM) cells showed a t(11;20)(p11;q11) translocation. RNA extracted from the BM was sequenced and analyzed for fusion transcripts using the software FusionMap. A ZMYND8-RELA fusion was ranked first. RT...

  1. Human rotavirus vaccine Rotarix™ provides protection against diverse circulating rotavirus strains in African infants: a randomized controlled trial

    Directory of Open Access Journals (Sweden)

    Steele Andrew

    2012-09-01

    Full Text Available Abstract Background Rotaviruses are the most important cause of severe acute gastroenteritis worldwide in children Rotarix™ significantly reduced severe rotavirus gastroenteritis episodes in a Phase III clinical trial conducted in infants in South Africa and Malawi. This paper examines rotavirus vaccine efficacy in preventing severe rotavirus gastroenteritis, during infancy, caused by the various G and P rotavirus types encountered during the first rotavirus-season. Methods Healthy infants aged 5–10 weeks were enrolled and randomized into three groups to receive either two (10 and 14 weeks or three doses of Rotarix™ (together forming the pooled Rotarix™ group or three doses of placebo at a 6,10,14-week schedule. Weekly home visits were conducted to identify gastroenteritis episodes. Rotaviruses were detected by ELISA and genotyped by RT-PCR and nucleotide sequencing. The percentage of infants with severe rotavirus gastroenteritis caused by the circulating G and P types from 2 weeks post-last dose until one year of age and the corresponding vaccine efficacy was calculated with 95% CI. Results Overall, 4939 infants were vaccinated and 4417 (pooled Rotarix™ = 2974; placebo = 1443 were included in the per protocol efficacy cohort. G1 wild-type was detected in 23 (1.6% severe rotavirus gastroenteritis episodes from the placebo group. This was followed in order of detection by G12 (15 [1%] in placebo and G8 types (15 [1%] in placebo. Vaccine efficacy against G1 wild-type, G12 and G8 types were 64.1% (95% CI: 29.9%; 82%, 51.5% (95% CI:-6.5%; 77.9% and 64.4% (95% CI: 17.1%; 85.2%, respectively. Genotype P[8] was the predominant circulating P type and was detected in 38 (2.6% severe rotavirus gastroenteritis cases in placebo group. The remaining circulating P types comprised of P[4] (20 [1.4%] in placebo and P[6] (13 [0.9%] in placebo. Vaccine efficacy against P[8] was 59.1% (95% CI: 32.8%; 75.3%, P[4] was 70.9% (95% CI: 37.5%; 87

  2. Human circulating plasma DNA significantly decreases while lymphocyte DNA damage increases under chronic occupational exposure to low-dose gamma-neutron and tritium β-radiation

    International Nuclear Information System (INIS)

    Highlights: • The chronic exposure to low-dose IR induces DSBs in human lymphocytes (TM index). • Exposure to IR decreases the level of human circulating DNA (cfDNA index). • IR induces an increase of DNase1 activity (DNase1 index) in plasma. • IR induces an increase of the level of antibodies to DNA (Ab DNA index) in plasma. • The ratio cfDNA/(DNase 1 × Ab DNA × TM) is a potential marker of human exposure to IR. - Abstract: The blood plasma of healthy people contains cell-fee (circulating) DNA (cfDNA). Apoptotic cells are the main source of the cfDNA. The cfDNA concentration increases in case of the organism’s cell death rate increase, for example in case of exposure to high-dose ionizing radiation (IR). The objects of the present research are the blood plasma and blood lymphocytes of people, who contacted occupationally with the sources of external gamma/neutron radiation or internal β-radiation of tritium N = 176). As the controls (references), blood samples of people, who had never been occupationally subjected to the IR sources, were used (N = 109). With respect to the plasma samples of each donor there were defined: the cfDNA concentration (the cfDNA index), DNase1 activity (the DNase1 index) and titre of antibodies to DNA (the Ab DNA index). The general DNA damage in the cells was defined (using the Comet assay, the tail moment (TM) index). A chronic effect of the low-dose ionizing radiation on a human being is accompanied by the enhancement of the DNA damage in lymphocytes along with a considerable cfDNA content reduction, while the DNase1 content and concentration of antibodies to DNA (Ab DNA) increase. All the aforementioned changes were also observed in people, who had not worked with the IR sources for more than a year. The ratio cfDNA/(DNase1 × Ab DNA × TM) is proposed to be used as a marker of the chronic exposure of a person to the external low-dose IR. It was formulated the assumption that the joint analysis of the cfDNA, DNase1, Ab

  3. Human circulating plasma DNA significantly decreases while lymphocyte DNA damage increases under chronic occupational exposure to low-dose gamma-neutron and tritium β-radiation

    Energy Technology Data Exchange (ETDEWEB)

    Korzeneva, Inna B., E-mail: inna.korzeneva@molgen.vniief.ru [Russian Federal Nuclear Center – All-Russian Research Institute of Experimental Physics (RFNC-VNIIEF) 607190, Sarov, 37 Mira ave., Nizhniy Novgorod Region (Russian Federation); Kostuyk, Svetlana V.; Ershova, Liza S. [Research Centre for Medical Genetics, Russian Academy of Medical Sciences, 115478 Moscow, 1 Moskvorechye str. (Russian Federation); Osipov, Andrian N. [Federal Medial and Biological Center named after Burnazyan of the Federal Medical and Biological Agency (FMBTz named after Burnazyan of FMBA), Moscow (Russian Federation); State Research Center - Burnasyan Federal Medical Biophysical Center of Federal Medical Biological Agency, Zhivopisnaya, 46, Moscow, 123098 (Russian Federation); Zhuravleva, Veronika F.; Pankratova, Galina V. [Russian Federal Nuclear Center – All-Russian Research Institute of Experimental Physics (RFNC-VNIIEF) 607190, Sarov, 37 Mira ave., Nizhniy Novgorod Region (Russian Federation); Porokhovnik, Lev N.; Veiko, Natalia N. [Research Centre for Medical Genetics, Russian Academy of Medical Sciences, 115478 Moscow, 1 Moskvorechye str. (Russian Federation)

    2015-09-15

    Highlights: • The chronic exposure to low-dose IR induces DSBs in human lymphocytes (TM index). • Exposure to IR decreases the level of human circulating DNA (cfDNA index). • IR induces an increase of DNase1 activity (DNase1 index) in plasma. • IR induces an increase of the level of antibodies to DNA (Ab DNA index) in plasma. • The ratio cfDNA/(DNase 1 × Ab DNA × TM) is a potential marker of human exposure to IR. - Abstract: The blood plasma of healthy people contains cell-fee (circulating) DNA (cfDNA). Apoptotic cells are the main source of the cfDNA. The cfDNA concentration increases in case of the organism’s cell death rate increase, for example in case of exposure to high-dose ionizing radiation (IR). The objects of the present research are the blood plasma and blood lymphocytes of people, who contacted occupationally with the sources of external gamma/neutron radiation or internal β-radiation of tritium N = 176). As the controls (references), blood samples of people, who had never been occupationally subjected to the IR sources, were used (N = 109). With respect to the plasma samples of each donor there were defined: the cfDNA concentration (the cfDNA index), DNase1 activity (the DNase1 index) and titre of antibodies to DNA (the Ab DNA index). The general DNA damage in the cells was defined (using the Comet assay, the tail moment (TM) index). A chronic effect of the low-dose ionizing radiation on a human being is accompanied by the enhancement of the DNA damage in lymphocytes along with a considerable cfDNA content reduction, while the DNase1 content and concentration of antibodies to DNA (Ab DNA) increase. All the aforementioned changes were also observed in people, who had not worked with the IR sources for more than a year. The ratio cfDNA/(DNase1 × Ab DNA × TM) is proposed to be used as a marker of the chronic exposure of a person to the external low-dose IR. It was formulated the assumption that the joint analysis of the cfDNA, DNase1, Ab

  4. The role of catechol-O-methyltransferase in catechol-enhanced erythroid differentiation of K562 cells

    Energy Technology Data Exchange (ETDEWEB)

    Suriguga,; Li, Xiao-Fei; Li, Yang; Yu, Chun-Hong; Li, Yi-Ran; Yi, Zong-Chun, E-mail: yizc@buaa.edu.cn

    2013-12-15

    Catechol is widely used in pharmaceutical and chemical industries. Catechol is also one of phenolic metabolites of benzene in vivo. Our previous study showed that catechol improved erythroid differentiation potency of K562 cells, which was associated with decreased DNA methylation in erythroid specific genes. Catechol is a substrate for the catechol-O-methyltransferase (COMT)-mediated methylation. In the present study, the role of COMT in catechol-enhanced erythroid differentiation of K562 cells was investigated. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation and induced mRNA expression of erythroid specific genes in K562 cells. Treatment with catechol caused a time- and concentration-dependent increase in guaiacol concentration in the medium of cultured K562 cells. When COMT expression was knocked down by COMT shRNA expression in K562 cells, the production of guaiacol significantly reduced, and the sensitivity of K562 cells to cytotoxicity of catechol significantly increased. Knockdown of COMT expression by COMT shRNA expression also eliminated catechol-enhanced erythroid differentiation of K562 cells. In addition, the pre-treatment with methyl donor S-adenosyl-L-methionine or its demethylated product S-adenosyl-L-homocysteine induced a significant increase in hemin-induced Hb synthesis in K562 cells and the mRNA expression of erythroid specific genes. These findings indicated that O-methylation catalyzed by COMT acted as detoxication of catechol and involved in catechol-enhanced erythroid differentiation of K562 cells, and the production of S-adenosyl-L-homocysteine partly explained catechol-enhanced erythroid differentiation. - Highlights: • Catechol enhanced hemin-induced hemoglobin accumulation. • COMT-catalyzed methylation acted as detoxication of catechol. • COMT involved in catechol-enhanced erythroid differentiation.

  5. Diversity and Adaptation of Human Respiratory Syncytial Virus Genotypes Circulating in Two Distinct Communities: Public Hospital and Day Care Center

    Directory of Open Access Journals (Sweden)

    Gustavo Rocha Garcia

    2012-10-01

    Full Text Available HRSV is one of the most important pathogens causing acute respiratory tract diseases as bronchiolitis and pneumonia among infants. HRSV was isolated from two distinct communities, a public day care center and a public hospital in São José do Rio Preto – SP, Brazil. We obtained partial sequences from G gene that were used on phylogenetic and selection pressure analysis. HRSV accounted for 29% of respiratory infections in hospitalized children and 7.7% in day care center children. On phylogenetic analysis of 60 HRSV strains, 48 (80% clustered within or adjacent to the GA1 genotype; GA5, NA1, NA2, BA-IV and SAB1 were also observed. SJRP GA1 strains presented variations among deduced amino acids composition and lost the potential O-glycosilation site at amino acid position 295, nevertheless this resulted in an insertion of two potential O-glycosilation sites at positions 296 and 297. Furthermore, a potential O-glycosilation site insertion, at position 293, was only observed for hospital strains. Using SLAC and MEME methods, only amino acid 274 was identified to be under positive selection. This is the first report on HRSV circulation and genotypes classification derived from a day care center community in Brazil.

  6. Control of thermal balance by a liquid circulating garment based on a mathematical representation of the human thermoregulatory system. Ph.D. Thesis - California Univ., Berkeley

    Science.gov (United States)

    Kuznetz, L. H.

    1976-01-01

    Test data and a mathematical model of the human thermoregulatory system were used to investigate control of thermal balance by means of a liquid circulating garment (LCG). The test data were derived from five series of experiments in which environmental and metabolic conditions were varied parametrically as a function of several independent variables, including LCG flowrate, LCG inlet temperature, net environmental heat exchange, surrounding gas ventilation rate, ambient pressure, metabolic rate, and subjective/obligatory cooling control. The resultant data were used to relate skin temperature to LCG water temperature and flowrate, to assess a thermal comfort band, to demonstrate the relationship between metabolic rate and LCG heat dissipation, and so forth. The usefulness of the mathematical model as a tool for data interpretation and for generation of trends and relationships among the various physiological parameters was also investigated and verified.

  7. Circulating chromatin-anti-chromatin antibody complexes bind with high affinity to dermo-epidermal structures in murine and human lupus nephritis

    DEFF Research Database (Denmark)

    Fismen, S; Hedberg, A; Fenton, K A;

    2009-01-01

    Murine and human lupus nephritis are characterized by glomerular deposits of electron-dense structures (EDS). Dominant components of EDS are chromatin fragments and IgG antibodies. Whether glomerular EDS predispose for similar deposits in skin is unknown. We analysed (i) whether dermo...... (NZBxNZW)F1 and MRL-lpr/lpr mice and from five patients with lupus nephritis were analysed by immunofluorescence, immune electron microscopy (IEM) and co-localization TUNEL IEM. Affinity of chromatin fragments for membrane structures was determined by surface plasmon resonance. Results demonstrated (i...... were present in capillary lumina in glomeruli and skin of all nephritic individuals. Thus, chromatin-IgG complexes accounting for lupus nephritis seem to reach skin through circulation, but other undetermined factors are required for these complexes to deposit within skin membranes....

  8. The role of catechol-O-methyltransferase in catechol-enhanced erythroid differentiation of K562 cells.

    Science.gov (United States)

    Suriguga; Li, Xiao-Fei; Li, Yang; Yu, Chun-Hong; Li, Yi-Ran; Yi, Zong-Chun

    2013-12-15

    Catechol is widely used in pharmaceutical and chemical industries. Catechol is also one of phenolic metabolites of benzene in vivo. Our previous study showed that catechol improved erythroid differentiation potency of K562 cells, which was associated with decreased DNA methylation in erythroid specific genes. Catechol is a substrate for the catechol-O-methyltransferase (COMT)-mediated methylation. In the present study, the role of COMT in catechol-enhanced erythroid differentiation of K562 cells was investigated. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation and induced mRNA expression of erythroid specific genes in K562 cells. Treatment with catechol caused a time- and concentration-dependent increase in guaiacol concentration in the medium of cultured K562 cells. When COMT expression was knocked down by COMT shRNA expression in K562 cells, the production of guaiacol significantly reduced, and the sensitivity of K562 cells to cytotoxicity of catechol significantly increased. Knockdown of COMT expression by COMT shRNA expression also eliminated catechol-enhanced erythroid differentiation of K562 cells. In addition, the pre-treatment with methyl donor S-adenosyl-L-methionine or its demethylated product S-adenosyl-L-homocysteine induced a significant increase in hemin-induced Hb synthesis in K562 cells and the mRNA expression of erythroid specific genes. These findings indicated that O-methylation catalyzed by COMT acted as detoxication of catechol and involved in catechol-enhanced erythroid differentiation of K562 cells, and the production of S-adenosyl-L-homocysteine partly explained catechol-enhanced erythroid differentiation.

  9. Circulating intestine-derived exosomal miR-328 in plasma, a possible biomarker for estimating BCRP function in the human intestines

    Science.gov (United States)

    Gotanda, Keisuke; Hirota, Takeshi; Saito, Jumpei; Fukae, Masato; Egashira, Yu; Izumi, Noritomo; Deguchi, Mariko; Kimura, Miyuki; Matsuki, Shunji; Irie, Shin; Ieiri, Ichiro

    2016-01-01

    A variant in the breast cancer resistance protein (BCRP) gene, 421C> A is a useful biomarker for describing large inter-individual differences in the pharmacokinetics of sulfasalazine (SASP), a BCRP substrate. However, large intra-genotypic variability still exists in spite of the incorporation of this variant into the pharmacokinetics of SASP. Since miR-328 negatively regulates BCRP expression in human tissues, we hypothesized that exosomal miR-328 in plasma, which leaks from the intestines, is a possible biomarker for estimating BCRP activity in the human intestines. We established an immunoprecipitation-based quantitative method for circulating intestine-derived miR-328 in plasma using an anti-glycoprotein A33 antibody. A clinical study was conducted with an open-label, non-randomized, and single-arm design involving 33 healthy participants. Intestine-derived exosomal miR-328 levels positively correlated (P exosomal miR-328 in plasma has potential as a possible biomarker for estimating BCRP function in the human intestines. PMID:27571936

  10. Reduced DOCK4 expression leads to erythroid dysplasia in myelodysplastic syndromes.

    Science.gov (United States)

    Sundaravel, Sriram; Duggan, Ryan; Bhagat, Tushar; Ebenezer, David L; Liu, Hui; Yu, Yiting; Bartenstein, Matthias; Unnikrishnan, Madhu; Karmakar, Subhradip; Liu, Ting-Chun; Torregroza, Ingrid; Quenon, Thomas; Anastasi, John; McGraw, Kathy L; Pellagatti, Andrea; Boultwood, Jacqueline; Yajnik, Vijay; Artz, Andrew; Le Beau, Michelle M; Steidl, Ulrich; List, Alan F; Evans, Todd; Verma, Amit; Wickrema, Amittha

    2015-11-17

    Anemia is the predominant clinical manifestation of myelodysplastic syndromes (MDS). Loss or deletion of chromosome 7 is commonly seen in MDS and leads to a poor prognosis. However, the identity of functionally relevant, dysplasia-causing, genes on 7q remains unclear. Dedicator of cytokinesis 4 (DOCK4) is a GTPase exchange factor, and its gene maps to the commonly deleted 7q region. We demonstrate that DOCK4 is underexpressed in MDS bone marrow samples and that the reduced expression is associated with decreased overall survival in patients. We show that depletion of DOCK4 levels leads to erythroid cells with dysplastic morphology both in vivo and in vitro. We established a novel single-cell assay to quantify disrupted F-actin filament network in erythroblasts and demonstrate that reduced expression of DOCK4 leads to disruption of the actin filaments, resulting in erythroid dysplasia that phenocopies the red blood cell (RBC) defects seen in samples from MDS patients. Reexpression of DOCK4 in -7q MDS patient erythroblasts resulted in significant erythropoietic improvements. Mechanisms underlying F-actin disruption revealed that DOCK4 knockdown reduces ras-related C3 botulinum toxin substrate 1 (RAC1) GTPase activation, leading to increased phosphorylation of the actin-stabilizing protein ADDUCIN in MDS samples. These data identify DOCK4 as a putative 7q gene whose reduced expression can lead to erythroid dysplasia. PMID:26578796

  11. Global discovery of erythroid long noncoding RNAs reveals novel regulators of red cell maturation.

    Science.gov (United States)

    Alvarez-Dominguez, Juan R; Hu, Wenqian; Yuan, Bingbing; Shi, Jiahai; Park, Staphany S; Gromatzky, Austin A; van Oudenaarden, Alexander; Lodish, Harvey F

    2014-01-23

    Erythropoiesis is regulated at multiple levels to ensure the proper generation of mature red cells under multiple physiological conditions. To probe the contribution of long noncoding RNAs (lncRNAs) to this process, we examined >1 billion RNA-seq reads of polyadenylated and nonpolyadenylated RNA from differentiating mouse fetal liver red blood cells and identified 655 lncRNA genes including not only intergenic, antisense, and intronic but also pseudogene and enhancer loci. More than 100 of these genes are previously unrecognized and highly erythroid specific. By integrating genome-wide surveys of chromatin states, transcription factor occupancy, and tissue expression patterns, we identify multiple lncRNAs that are dynamically expressed during erythropoiesis, show epigenetic regulation, and are targeted by key erythroid transcription factors GATA1, TAL1, or KLF1. We focus on 12 such candidates and find that they are nuclear-localized and exhibit complex developmental expression patterns. Depleting them severely impaired erythrocyte maturation, inhibiting cell size reduction and subsequent enucleation. One of them, alncRNA-EC7, is transcribed from an enhancer and is specifically needed for activation of the neighboring gene encoding BAND 3. Our study provides an annotated catalog of erythroid lncRNAs, readily available through an online resource, and shows that diverse types of lncRNAs participate in the regulatory circuitry underlying erythropoiesis.

  12. Immunophenotyping of circulating T helper cells argues for multiple functions and plasticity of T cells in vivo in humans--possible role in asthma.

    Directory of Open Access Journals (Sweden)

    Carina Malmhäll

    Full Text Available BACKGROUND: The immune process driving eosinophilic and non-eosinophilic asthma is likely driven by different subsets of T helper (Th cells. Recently, in vitro studies and animal studies suggest that Th cell subsets displays plasticity by changing their transcription factor or by expressing multiple transcription factors. Our aim was to determine whether individuals with asthma and elevated circulating eosinophils express signs of different regulatory immune mechanisms compared with asthmatics with low blood eosinophils and non-asthmatic control subjects. In addition, determine the relationship between eosinophilia and circulating Th cell subsets. METHODOLOGY/PRINCIPAL FINDINGS: Participants were selected from a random epidemiological cohort, the West Sweden Asthma Study. Immunophenotypes of fresh peripheral blood cells obtained from stable asthmatics, with and without elevated eosinophilic inflammation (EOS high and EOS low respectively and control subjects, were determined by flow cytometry. No differences in the number of Th1 (T-bet, Th2 (GATA-3, Th17 (RORγt or Treg (FOXP3 cells were observed between the groups when analysing each subset separately. However, in all groups, each of the Th subsets showed expression of additional canonical transcription factors T-bet, GATA-3, RORγt and FOXP3. Furthermore, by in vitro stimulation with anti-CD3/anti-CD28 there was a significant increase of single expressing GATA-3(+ and co-expressing T-bet(+GATA-3(+ cells in the EOS high asthmatics in comparison with control subjects. In addition, T-bet(-GATA-3(+RORγt(+FOXP3(+ were decreased in comparison to the EOS low asthmatics. Finally, in a group of control subjects we found that the majority of proliferating Th cells (CD4(+CD25(+Ki67(+ expressed three or four transcription factors. CONCLUSIONS: The ability of human Th cells to express several regulatory transcription factors suggests that these cells may display plasticity in vivo.

  13. Measurement of Circulating Filarial Antigen Levels in Human Blood with a Point-of-Care Test Strip and a Portable Spectrodensitometer.

    Science.gov (United States)

    Chesnais, Cédric B; Vlaminck, Johnny; Kunyu-Shako, Billy; Pion, Sébastien D; Awaca-Uvon, Naomi-Pitchouna; Weil, Gary J; Mumba, Dieudonné; Boussinesq, Michel

    2016-06-01

    The Alere Filariasis Test Strip (FTS) is a qualitative, point-of-care diagnostic tool that detects Wuchereria bancrofti circulating filarial antigen (CFA) in human blood, serum, or plasma. The Global Program to Eliminate Lymphatic Filariasis employs the FTS for mapping filariasis-endemic areas and assessing the success of elimination efforts. The objective of this study was to explore the relationship between the intensity of positive test lines obtained by FTS with CFA levels as determined by enzyme-linked immunosorbent assay (ELISA) with blood and plasma samples from 188 individuals who live in a filariasis-endemic area. The intensity of the FTS test line was assessed visually to provide a semiquantitative score (visual Filariasis Test Strip [vFTS]), and line intensity was measured with a portable spectrodensitometer (quantitative Filariasis Test Strip [qFTS]). These results were compared with antigen levels measured by ELISA in plasma from the same subjects. qFTS measurements were highly correlated with vFTS scores (ρ = 0.94; P bancrofti CFA levels in human blood, which are correlated with adult worm burdens. This tool may be useful for assessing the impact of treatment on adult filarial worms in individuals and communities. PMID:27114288

  14. Turnover rates of hepatic collagen and circulating collagen-associated proteins in humans with chronic liver disease.

    Directory of Open Access Journals (Sweden)

    Martin L Decaris

    Full Text Available Accumulation and degradation of scar tissue in fibrotic liver disease occur slowly, typically over many years. Direct measurement of fibrogenesis, the rate of scar tissue deposition, may provide valuable therapeutic and prognostic information. We describe here results from a pilot study utilizing in vivo metabolic labeling to measure the turnover rate of hepatic collagen and collagen-associated proteins in plasma for the first time in human subjects. Eight subjects with chronic liver disease were labeled with daily oral doses of 2H2O for up to 8 weeks prior to diagnostic liver biopsy and plasma collection. Tandem mass spectrometry was used to measure the abundance and fractional synthesis rate (FSR of proteins in liver and blood. Relative protein abundance and FSR data in liver revealed marked differences among subjects. FSRs of hepatic type I and III collagen ranged from 0.2-0.6% per day (half-lives of 4 months to a year and correlated significantly with worsening histologic fibrosis. Analysis of plasma protein turnover revealed two collagen-associated proteins, lumican and transforming growth factor beta-induced-protein (TGFBI, exhibiting FSRs that correlated significantly with FSRs of hepatic collagen. In summary, this is the first direct measurement of liver collagen turnover in vivo in humans and suggests a high rate of collagen remodeling in advanced fibrosis. In addition, the FSRs of collagen-associated proteins in plasma are measurable and may provide a novel strategy for monitoring hepatic fibrogenesis rates.

  15. The lipocalin alpha1-microglobulin protects erythroid K562 cells against oxidative damage induced by heme and reactive oxygen species.

    Science.gov (United States)

    Olsson, Magnus G; Olofsson, Tor; Tapper, Hans; Akerstrom, Bo

    2008-08-01

    Alpha(1)-microglobulin is a 26 kDa plasma and tissue glycoprotein that belongs to the lipocalin protein superfamily. Recent reports show that it is a reductase and radical scavenger and that it binds heme and has heme-degrading properties. This study has investigated the protective effects of alpha(1)-microglobulin against oxidation by heme and reactive oxygen species in the human erythroid cell line, K562. The results show that alpha(1)-microglobulin prevents intracellular oxidation and up-regulation of heme oxygenase-1 induced by heme, hydrogen peroxide and Fenton reaction-generated hydroxyl radicals in the culture medium. It also reduces the cytosol of non-oxidized cells. Endogeneous expression of alpha(1)-microglobulin was up-regulated by these oxidants and silencing of the alpha(1)-microglobulin expression increased the cytosol oxidation. alpha(1)-microglobulin also inhibited cell death caused by heme and cleared cells from bound heme. Binding of heme to alpha(1)-microglobulin increased the radical reductase activity of the protein as compared to the apo-protein. Finally, alpha(1)-microglobulin was localized mainly at the cell surface both when administered exogeneously and in non-treated cells. The results suggest that alpha(1)-microglobulin is involved in the defence against oxidative cellular injury caused by haemoglobin and heme and that the protein may employ both heme-scavenging and one-electron reduction of radicals to achieve this.

  16. Resveratrol: Antioxidant activity and induction of fetal hemoglobin in erythroid cells from normal donors and β-thalassemia patients.

    Science.gov (United States)

    Fibach, Eitan; Prus, Eugenia; Bianchi, Nicoletta; Zuccato, Cristina; Breveglieri, Giulia; Salvatori, Francesca; Finotti, Alessia; Lipucci di Paola, Michele; Brognara, Eleonora; Lampronti, Ilaria; Borgatti, Monica; Gambari, Roberto

    2012-06-01

    Thalassemia and sickle-cell anemia (SCA) present a major public health problem in countries where the number of carriers and affected individuals is high. As a result of the abnormalities in hemoglobin production, cells of thalassemia and SCA patients exhibit oxidative stress, which ultimately is responsible for the chronic anemia observed. Therefore, identification of compounds exhibiting both antioxidant and hemoglobin-inducing activities is highly needed. Our results demonstrate resveratrol to be such a compound. This was shown both in the human K562 cell line, as well as in erythroid precursors derived from normal donors and β-thalassemia patients. Resveratrol was shown to exhibit antioxidant activity and to stimulate the expression of the γ-globin genes and the accumulation of fetal hemoglobin (HbF). To the best of our knowledge, this is the first report pointing to such a double effect of resveratrol. Since this natural product is already marketed as an antioxidant, future investigations should concentrate on demonstrating its potential to augment HbF production in experimental animal models (e.g., thalassemia and SCA mice) as well as in patients. We believe that the potential of clinical use of resveratrol as an antioxidant and HbF stimulator may offer a simple and inexpensive treatment to patients.

  17. One-week habitation of two humans in an airtight facility with two goats and 23 crops Analysis of carbon, oxygen, and water circulation

    Science.gov (United States)

    Tako, Y.; Tsuga, S.; Tani, T.; Arai, R.; Komatsubara, O.; Shinohara, M.

    Human habitation and animal holding experiments in a closed environment, the Closed Ecology Experiment Facilities (CEEF), were carried out. The CEEF were established for collecting experimental data to estimate carbon transfer in the ecosystem around Rokkasho nuclear fuel reprocessing plant. Circulation of O2 and CO2, and supply of food from crops cultivated in the CEEF were conducted for the first time in the habitation experiments. Two humans known as eco-nauts inhabited the CEEF, living and working in the Plant Module (PM) and the Animal and Habitation Module (AHM), for a week three times in 2005. On a fresh weight basis, 82% of their food was supplied from 23 crops including rice and soybean, cultivated and harvested in the PM, in the 2nd and 3rd experiments. For the goats, the animals held in the experiments, all of their feed, consisting of rice straw, soybean plant leaves, and peanut shells and peanut plant leaves, was produced in the PM in the 2nd and 3rd experiments. The O2 produced in the PM by photosynthesis of the crops was separated by the O2 separator using molecular sheaves, then accumulated, transferred, and supplied to the AHM atmosphere. The CO2 produced in the AHM by respiration of the humans and animals was separated by the CO2 separator using solid amine, then accumulated, transferred, and supplied to the PM atmosphere. The amount of O2 consumed in the AHM was 46 51% of that produced in the PM, and the amount of CO2 produced in the AHM was 43 56% of that consumed in the PM. The surplus of O2 and the shortage of CO2 was a result of the fact that waste of the goats and the crops and part of the human waste were not processed in these habitation experiments. The estimated amount of carbon ingested by the eco-nauts was 64 92% of that in the harvested edible part of the crops. The estimated amount of carbon ingested by the goats was 36 53% of that in the harvested inedible part of the crops. One week was not enough time for determination of gas

  18. Inhibitory effect of the substance P and its derivative on erythropoietin-independent growth of erythroid progenitors in polycythemia vera.

    Science.gov (United States)

    Le Gall, Christelle; Ianotto, Jean-Christophe; Hardy, Elisabeth; Ugo, Valérie; Eveillard, Jean-Richard; Ngo-Sack, Françoise; Bourquard, Pascal; Morice, Patrick; Berthou, Christian

    2008-05-01

    Regulation of normal hematopoiesis by neuropeptide substance P (SP) and its amino terminal fragment, SP(1-4), has been reported. Endogenous erythroid colony (EEC) formation without erythropoietin is characteristic of polycythemia vera (PV), a chronic myeloproliferative disorder. We investigated the effect(s) of SP and SP(1-4) on EEC formation from PV BM mononuclear cells (BMMCs) and purified CD36+ erythroid progenitors. We found a potent in vitro inhibitory effect of SP and SP(1-4) on PV EEC formation for both BMMCs and CD36+ erythroid progenitors. The influence of SP and SP(1-4) on PV progenitor erythroid differentiation and cell viability was also investigated, and the impact of neurokinin receptors and G proteins in the inhibition were analyzed by quantitative PCR and with specific inhibitors. This progenitor inhibition was: (1) not mediated by accessory cells; (2) characterized by an increase in cell death and inhibition of the EPOindependent terminal erythroid differentiation; and (3) not mediated by the same neurokinin receptor. NK-1R and NK-2R antagonists completely abrogated the SP inhibitory effect but not SP(1-4)-induced inhibition. Furthermore, the truncated form of the NK-1R was predominant over the full-length mRNA and could mediated the SP inhibitory effect on PV CD36+ erythroid progenitors. Different G proteins were also implicated according to the erythroid differentiation stage of the PV cells. The observation of an inhibitory effect of SP and its related peptide, SP(1-4), on PV EEC formation at physiological concentrations (10-8M) suggests that neuropeptides represent a way to downregulate pathologic expansion of PV progenitors. PMID:17980427

  19. ZFP36L2 is required for self-renewal of early burst-forming unit erythroid progenitors.

    Science.gov (United States)

    Zhang, Lingbo; Prak, Lina; Rayon-Estrada, Violeta; Thiru, Prathapan; Flygare, Johan; Lim, Bing; Lodish, Harvey F

    2013-07-01

    Stem cells and progenitors in many lineages undergo self-renewing divisions, but the extracellular and intracellular proteins that regulate this process are largely unknown. Glucocorticoids stimulate red blood cell formation by promoting self-renewal of early burst-forming unit-erythroid (BFU-E) progenitors. Here we show that the RNA-binding protein ZFP36L2 is a transcriptional target of the glucocorticoid receptor (GR) in BFU-Es and is required for BFU-E self-renewal. ZFP36L2 is normally downregulated during erythroid differentiation from the BFU-E stage, but its expression is maintained by all tested GR agonists that stimulate BFU-E self-renewal, and the GR binds to several potential enhancer regions of ZFP36L2. Knockdown of ZFP36L2 in cultured BFU-E cells did not affect the rate of cell division but disrupted glucocorticoid-induced BFU-E self-renewal, and knockdown of ZFP36L2 in transplanted erythroid progenitors prevented expansion of erythroid lineage progenitors normally seen following induction of anaemia by phenylhydrazine treatment. ZFP36L2 preferentially binds to messenger RNAs that are induced or maintained at high expression levels during terminal erythroid differentiation and negatively regulates their expression levels. ZFP36L2 therefore functions as part of a molecular switch promoting BFU-E self-renewal and a subsequent increase in the total numbers of colony-forming unit-erythroid (CFU-E) progenitors and erythroid cells that are generated.

  20. The leukemia associated ETO nuclear repressor gene is regulated by the GATA-1 transcription factor in erythroid/megakaryocytic cells

    Directory of Open Access Journals (Sweden)

    Gullberg Urban

    2010-05-01

    Full Text Available Abstract Background The Eight-Twenty-One (ETO nuclear co-repressor gene belongs to the ETO homologue family also containing Myeloid Translocation Gene on chromosome 16 (MTG16 and myeloid translocation Gene-Related protein 1 (MTGR1. By chromosomal translocations ETO and MTG16 become parts of fusion proteins characteristic of morphological variants of acute myeloid leukemia. Normal functions of ETO homologues have as yet not been examined. The goal of this work was to identify structural and functional promoter elements upstream of the coding sequence of the ETO gene in order to explore lineage-specific hematopoietic expression and get hints to function. Results A putative proximal ETO promoter was identified within 411 bp upstream of the transcription start site. Strong ETO promoter activity was specifically observed upon transfection of a promoter reporter construct into erythroid/megakaryocytic cells, which have endogeneous ETO gene activity. An evolutionary conserved region of 228 bp revealed potential cis-elements involved in transcription of ETO. Disruption of the evolutionary conserved GATA -636 consensus binding site repressed transactivation and disruption of the ETS1 -705 consensus binding site enhanced activity of the ETO promoter. The promoter was stimulated by overexpression of GATA-1 into erythroid/megakaryocytic cells. Electrophoretic mobility shift assay with erythroid/megakaryocytic cells showed specific binding of GATA-1 to the GATA -636 site. Furthermore, results from chromatin immunoprecipitation showed GATA-1 binding in vivo to the conserved region of the ETO promoter containing the -636 site. The results suggest that the GATA -636 site may have a role in activation of the ETO gene activity in cells with erythroid/megakaryocytic potential. Leukemia associated AML1-ETO strongly suppressed an ETO promoter reporter in erythroid/megakaryocytic cells. Conclusions We demonstrate that the GATA-1 transcription factor binds and

  1. Unusual subcellular confinement of the fragile X mental retardation protein (FMRP) in circulating human platelets: complete polyribosome dissociation.

    Science.gov (United States)

    Lauzière, Véronique; Lessard, Mandy; Meunier, Alexandre J; McCoy, Marie; Bergeron, Lucien Junior; Corbin, Francois

    2012-04-01

    FMRP, a RNA-binding protein, was shown in association with polyribosomes in every cell types studied so far, suggesting a ubiquitous role as a translational regulator. Platelets are known for their limited protein synthesis potential. However, current investigations put forward that RNA metabolism is more developed than previously thought. Unexpectedly, our results provide evidence that FMRP, in platelets, is not constitutively associated with heavy particles, such as polyribosomes, and possesses a sedimentation coefficient of less than 10S contrasting with values of 150 to 500S as reported in other cell types. In summary, this report brings to light platelets as a simple human biological system to delineate novel FMRP functions as well as strengthening our comprehension of the pathophysiology of the fragile X syndrome which results from the absence of FMRP. PMID:22210492

  2. Nitrogen. Too much of a good thing? An effective reduction of the overload of the nitrogen circulation on the benefit of environment and humans; Stickstoff. Zuviel des Guten? Ueberlastung des Stickstoffkreislaufs zum Nutzen von Umwelt und Mensch wirksam reduzieren

    Energy Technology Data Exchange (ETDEWEB)

    Schuetze, Gudrun; Geupel, Markus (comps.)

    2011-03-14

    The contribution under consideration reports on the influence of human activities on the circulation of nitrogen as well as on the resulting consequences for humans and environment. Thus the entry of nitrogen compounds is a main reason for the reduction of the biodiversity. The focus of this contribution is on the situation in Germany and the European bordering countries. Possibilities are pointed out, how harmful emissions of nitrogen can be reduced.

  3. Circulating follistatin in relation to energy metabolism.

    Science.gov (United States)

    Hansen, Jakob Schiøler; Plomgaard, Peter

    2016-09-15

    Recently, substantial evidence has emerged that the liver contributes significantly to the circulating levels of follistatin and that circulating follistatin is tightly regulated by the glucagon-to-insulin ratio. Both observations are based on investigations of healthy subjects. These novel findings challenge the present view of circulating follistatin in human physiology, being that circulating follistatin is a result of spill-over from para/autocrine actions in various tissues and cells. Follistatin as a liver-derived protein under the regulation of glucagon-to-insulin ratio suggests a relation to energy metabolism. In this narrative review, we attempt to reconcile the existing findings on circulating follistatin with the novel concept that circulating follistatin is a liver-derived molecule regulated by the glucagon-to-insulin ratio. The picture emerging is that conditions associated with elevated levels of circulating follistatin have a metabolic denominator with decreased insulin sensitivity and/or hyperglucagoneimia. PMID:27264073

  4. Interleukin-10 inhibits burst-forming unit-erythroid growth by suppression of endogenous granulocyte-macrophage colony-stimulating factor production from T cells.

    Science.gov (United States)

    Oehler, L; Kollars, M; Bohle, B; Berer, A; Reiter, E; Lechner, K; Geissler, K

    1999-02-01

    Numerous cytokines released from accessory cells have been shown to exert either stimulatory or inhibitory growth signals on burst-forming unit-erythroid (BFU-E) growth. Because of its cytokine synthesis-inhibiting effects on T cells and monocytes, interleukin-10 (IL-10) may be a potential candidate for indirectly affecting erythropoiesis. We investigated the effects of IL-10 on BFU-E growth from normal human peripheral blood mononuclear cells (PBMC) using a clonogenic progenitor cell assay. The addition of recombinant human IL-10 to cultures containing recombinant human erythropoietin suppressed BFU-E growth in a dose-dependent manner (by 55.2%, range 47.3-63.3%, p cultivating highly enriched CD34+ cells. BFU-E growth from PBMC also was markedly suppressed in the presence of a neutralizing anti-granulocyte-macrophage colony-stimulating factor (GM-CSF) antibody (by 48.7%, range 32.9-61.2% inhibition,p < 0.01), but not by neutralizing antibodies against granulocyte colony-stimulating factor and interleukin-3. This suggests a stimulatory role of endogenously released GM-CSF on BFU-E formation. Also, the addition of exogenous GM-CSF completely restored IL-10-induced suppression of BFU-E growth. To determine the cellular source of GM-CSF production, we analyzed GM-CSF levels in suspension cultures containing PBMC that were either depleted of monocytes or T cells. Monocyte-depleted PBMC showed spontaneous production of increasing amounts of GM-CSF on days 3, 5, and 7, respectively, which could be suppressed by IL-10, whereas GM-CSF levels did not increase in cultures containing T-cell-depleted PBMC. Our data indicate that IL-10 inhibits the growth of erythroid progenitor cells in vitro, most likely by suppression of endogenous GM-CSF production from T cells.

  5. Gamma-interferon alters globin gene expression in neonatal and adult erythroid cells

    Energy Technology Data Exchange (ETDEWEB)

    Miller, B.A.; Perrine, S.P.; Antognetti, G.; Perlmutter, D.H.; Emerson, S.G.; Sieff, C.; Faller, D.V.

    1987-06-01

    The effect of gamma-interferon on fetal hemoglobin synthesis by purified cord blood, fetal liver, and adult bone marrow erythroid progenitors was studied with a radioligand assay to measure hemoglobin production by BFU-E-derived erythroblasts. Coculture with recombinant gamma-interferon resulted in a significant and dose-dependent decrease in fetal hemoglobin production by neonatal and adult, but not fetal, BFU-E-derived erythroblasts. Accumulation of fetal hemoglobin by cord blood BFU-E-derived erythroblasts decreased up to 38.1% of control cultures (erythropoietin only). Synthesis of both G gamma/A gamma globin was decreased, since the G gamma/A gamma ratio was unchanged. Picograms fetal hemoglobin per cell was decreased by gamma-interferon addition, but picograms total hemoglobin was unchanged, demonstrating that a reciprocal increase in beta-globin production occurred in cultures treated with gamma-interferon. No toxic effect of gamma-interferon on colony growth was noted. The addition of gamma-interferon to cultures resulted in a decrease in the percentage of HbF produced by adult BFU-E-derived cells to 45.6% of control. Fetal hemoglobin production by cord blood, fetal liver, and adult bone marrow erythroid progenitors, was not significantly affected by the addition of recombinant GM-CSF, recombinant interleukin 1 (IL-1), recombinant IL-2, or recombinant alpha-interferon. Although fetal progenitor cells appear unable to alter their fetal hemoglobin program in response to any of the growth factors added here, the interaction of neonatal and adult erythroid progenitors with gamma-interferon results in an altered expression of globin genes.

  6. 5-Azacytidine acts directly on both erythroid precursors and progenitors to increase production of fetal hemoglobin.

    OpenAIRE

    Humphries, R K; Dover, G; Young, N S; Moore, J G; Charache, S.; Ley, T; Nienhuis, A W

    1985-01-01

    The effect of 5-azacytidine on erythroid precursors and progenitors was studied in nine patients with sickle cell anemia or severe thalassemia. Each patient received the drug intravenously for 5 or 7 d. 5-Azacytidine caused a four- to sixfold increase in gamma-messenger RNA concentration in bone marrow cells of eight of the nine patients and decreased the methylation frequency of a specific cytosine residue in the gamma-globin gene promoter in all nine patients. Within 2 d of the start of dru...

  7. S-1 induced secondary acute erythroid leukemia with a chromosome inv(12)(p13;q13)

    Institute of Scientific and Technical Information of China (English)

    Kensuke Matsumoto; Akira Kitanaka; Makiko Uemura; Fusako Waki; Tetsuya Fukumoto; Hiroaki Ohnishi; Yoshitsugu Kubota; Toshihiko Ishida

    2011-01-01

    Adjuvant chemotherapy by S-1 following gastrectomy is considered standard treatment in Japan. Analysis of follow-up data have proved the efficacy of S-1 administration,and that hematological adverse events were relatively rare. PPyrimidine anti-metabolites, including S-1, have shown relatively lower risks for secondary hematological malignancies in comparison to alkylating agents and topoisomerase-Ⅱ inhibitors. We here report a case of therapy-related leukemia after S-1 administration. A patient who had received S-1as the sole adjuvant chemotherapy was diagnosed with acute erythroid leukemia. To the best of our knowledge, our patient represents the first report of S-1 induced acute leukemia.

  8. Histone demethylase LSD1-mediated repression of GATA-2 is critical for erythroid differentiation

    Directory of Open Access Journals (Sweden)

    Guo Y

    2015-06-01

    Full Text Available Yidi Guo,1 Xueqi Fu,1,2 Yue Jin,1 Jing Sun,1 Ye Liu,1 Bo Huo,1 Xiang Li,1 Xin Hu1–31School of Life Sciences, Jilin University, 2Key Laboratory for Molecular Enzymology and Engineering of Ministry of Education, Jilin University, 3National Engineering Laboratory of AIDS Vaccine, School of Life Sciences, Jilin University, Changchun, People’s Republic of ChinaBackground: The transcription factor GATA-2 is predominantly expressed in hematopoietic stem and progenitor cells and counteracts the erythroid-specific transcription factor GATA-1, to modulate the proliferation and differentiation of hematopoietic cells. During hematopoietic cell differentiation, GATA-2 exhibits dynamic expression patterns, which are regulated by multiple transcription factors.Methods: Stable LSD1-knockdown cell lines were established by growing murine erythroleukemia (MEL or mouse embryonic stem cells together with virus particles, in the presence of Polybrene® at 4 µg/mL, for 24–48 hours followed by puromycin selection (1 µg/mL for 2 weeks. Real-time polymerase chain reaction (PCR-based quantitative chromatin immunoprecipitation (ChIP analysis was used to test whether the TAL1 transcription factor is bound to 1S promoter in the GATA-2 locus or whether LSD1 colocalizes with TAL1 at the 1S promoter. The sequential ChIP assay was utilized to confirm the role of LSD1 in the regulation of H3K4me2 at the GATA-2 locus during erythroid differentiation. Western blot analysis was employed to detect the protein expression. The alamarBlue® assay was used to examine the proliferation of the cells, and the absorbance was monitored at optical density (OD 570 nm and OD 600 nm.Results: In this study, we showed that LSD1 regulates the expression of GATA-2 during erythroid differentiation. Knockdown of LSD1 results in increased GATA-2 expression and inhibits the differentiation of MEL and embryonic stem cells. Furthermore, we demonstrated that LSD1 binds to the 1S promoter of the

  9. Characterization of a distinct population of circulating human non-adherent endothelial forming cells and their recruitment via intercellular adhesion molecule-3.

    Directory of Open Access Journals (Sweden)

    Sarah L Appleby

    Full Text Available Circulating vascular progenitor cells contribute to the pathological vasculogenesis of cancer whilst on the other hand offer much promise in therapeutic revascularization in post-occlusion intervention in cardiovascular disease. However, their characterization has been hampered by the many variables to produce them as well as their described phenotypic and functional heterogeneity. Herein we have isolated, enriched for and then characterized a human umbilical cord blood derived CD133(+ population of non-adherent endothelial forming cells (naEFCs which expressed the hematopoietic progenitor cell markers (CD133, CD34, CD117, CD90 and CD38 together with mature endothelial cell markers (VEGFR2, CD144 and CD31. These cells also expressed low levels of CD45 but did not express the lymphoid markers (CD3, CD4, CD8 or myeloid markers (CD11b and CD14 which distinguishes them from 'early' endothelial progenitor cells (EPCs. Functional studies demonstrated that these naEFCs (i bound Ulex europaeus lectin, (ii demonstrated acetylated-low density lipoprotein uptake, (iii increased vascular cell adhesion molecule (VCAM-1 surface expression in response to tumor necrosis factor and (iv in co-culture with mature endothelial cells increased the number of tubes, tubule branching and loops in a 3-dimensional in vitro matrix. More importantly, naEFCs placed in vivo generated new lumen containing vasculature lined by CD144 expressing human endothelial cells (ECs. Extensive genomic and proteomic analyses of the naEFCs showed that intercellular adhesion molecule (ICAM-3 is expressed on their cell surface but not on mature endothelial cells. Furthermore, functional analysis demonstrated that ICAM-3 mediated the rolling and adhesive events of the naEFCs under shear stress. We suggest that the distinct population of naEFCs identified and characterized here represents a new valuable therapeutic target to control aberrant vasculogenesis.

  10. Genetic variability of attachment (G and Fusion (F protein genes of human metapneumovirus strains circulating during 2006-2009 in Kolkata, Eastern India

    Directory of Open Access Journals (Sweden)

    Chawla-Sarkar Mamta

    2011-02-01

    Full Text Available Abstract Background Human metapneumovirus (hMPV is associated with the acute respiratory tract infection (ARTI in all the age groups. However, there is limited information on prevalence and genetic diversity of human metapneumovirus (hMPV strains circulating in India. Objective To study prevalence and genomic diversity of hMPV strains among ARTI patients reporting in outpatient departments of hospitals in Kolkata, Eastern India. Methods Nasal and/or throat swabs from 2309 patients during January 2006 to December 2009, were screened for the presence of hMPV by RT-PCR of nucleocapsid (N gene. The G and F genes of representative hMPV positive samples were sequenced. Results 118 of 2309 (5.11% clinical samples were positive for hMPV. The majority (≈80% of the positive cases were detected during July−November all through the study period. Genetic analysis revealed that 77% strains belong to A2 subgroup whereas rest clustered in B1 subgroup. G sequences showed higher diversity at the nucleotide and amino acid level. In contrast, less than 10% variation was observed in F gene of representative strains of all four years. Sequence analysis also revealed changes in the position of stop codon in G protein, which resulted in variable length (217-231 aa polypeptides. Conclusion The study suggests that approximately 5% of ARTI in the region were caused by hMPV. This is the first report on the genetic variability of G and F gene of hMPV strains from India which clearly shows that the G protein of hMPV is continuously evolving. Though the study partially fulfills lacunae of information, further studies from other regions are necessary for better understanding of prevalence, epidemiology and virus evolution in Indian subcontinent.

  11. Neural Control of the Circulation

    Science.gov (United States)

    Thomas, Gail D.

    2011-01-01

    The purpose of this brief review is to highlight key concepts about the neural control of the circulation that graduate and medical students should be expected to incorporate into their general knowledge of human physiology. The focus is largely on the sympathetic nerves, which have a dominant role in cardiovascular control due to their effects to…

  12. Circulating levels of chromatin fragments are inversely correlated with anti-dsDNA antibody levels in human and murine systemic lupus erythematosus

    DEFF Research Database (Denmark)

    Jørgensen, Mariann H; Rekvig, Ole Petter; Jacobsen, Rasmus S;

    2011-01-01

    Anti-dsDNA antibodies represent a central pathogenic factor in Lupus nephritis. Together with nucleosomes they deposit as immune complexes in the mesangial matrix and along basement membranes within the glomeruli. The origin of the nucleosomes and when they appear e.g. in circulation is not known....... Serum samples from autoimmune (NZBxNZW)F1 mice, healthy BALB/c mice, patients with SLE, RA and normal healthy individuals were analyzed for presence and amount of circulating anti-dsDNA antibodies and nucleosomal DNA. Here we use a quantitative PCR to measure circulating DNA in sera. We demonstrate...

  13. Structural and functional characterization of an atypical activation domain in erythroid Krüppel-like factor (EKLF)

    OpenAIRE

    Mas, Caroline; Lussier-Price, Mathieu; Soni, Shefali; Morse, Thomas; Arseneault, Geneviève; Di Lello, Paola; Lafrance-Vanasse, Julien; Bieker, James J.; Omichinski, James G.

    2011-01-01

    Erythroid Krüppel-like factor (EKLF) plays an important role in erythroid development by stimulating β-globin gene expression. We have examined the details by which the minimal transactivation domain (TAD) of EKLF (EKLFTAD) interacts with several transcriptional regulatory factors. We report that EKLFTAD displays homology to the p53TAD and, like the p53TAD, can be divided into two functional subdomains (EKLFTAD1 and EKLFTAD2). Based on sequence analysis, we found that EKLFTAD2 is conserved in...

  14. Restricted expression of the erythroid/brain glucose transporter isoform to perivenous hepatocytes in rats. Modulation by glucose.

    OpenAIRE

    Tal, M.; Schneider, D L; Thorens, B.; Lodish, H F

    1990-01-01

    The "erythroid/brain" glucose transporter (GT) isoform is expressed only in a subset of hepatocytes, those forming the first row around the terminal hepatic venules, while the "liver" GT is expressed in all hepatocytes. After 3 d of starvation, a three- to fourfold elevation of expression of the erythroid/brain GT mRNA and protein is detected in the liver as a whole; this correlates with the expression of this GT in more hepatocytes, those forming the first three to four rows around the hepat...

  15. LRF is an essential downstream target of GATA1 in erythroid development and regulates BIM-dependent apoptosis

    OpenAIRE

    Maeda, Takahiro; Ito, Keisuke; Merghoub, Taha; Poliseno, Laura; Hobbs, Robin M.; Wang, Guocan; Dong, Lin; Maeda, Manami; Dore, Louis C.; Zelent, Arthur; Luzzatto, Lucio; Teruya-Feldstein, Julie; Weiss, Mitchell J.; Pandolfi, Pier Paolo

    2009-01-01

    GATA-1-dependent transcription is essential for erythroid differentiation and maturation. Suppression of programmed cell death is also thought to be critical for this process; however, the link between these two features of erythropoiesis has remained elusive. Here, we show that the POZ-Krüppel family transcription factor, LRF (also known as Zbtb7a/Pokemon), is a direct target of GATA1 and plays an essential anti-apoptotic role during terminal erythroid differentiation. We find that loss of L...

  16. Effect of HS2 and HS3 elements on erythroid-specific expression in transgenic mice

    Institute of Scientific and Technical Information of China (English)

    JIA Chunping; YAN Jingbin; XIAO Yanping; FANG Yudan; HUANG Shuzheng; ZENG Yitao

    2003-01-01

    The expression plasmids CMV/GFP, HS2ALL, HS3ALL and HS23ALL were selected to investigate the effect of HS2 and HS3 element on erythroid-specific expression in transgenic mice. These plasmids were digested with restriction enzymes and purified. And five DNA fragments, CMV/GFP, HS2/GFP, CMV/HS2/GFP, HS23/GFP and HS3/GFP were obtained. After purification, the above DNA fragments were microinjected into the pre-nuclei of the mice fertilized eggs and transgenic mice were generated, with an integration rate of 10.89%. The green fluorescence protein(GFP) expression in many transgenic mouse tissues was determined by FACS analysis. The results showed that the HS2 and 1.7 kb of β-globin gene promoter were sufficient for the erythroid-specific expression of β-globin gene. The GFP expression of different recombinant constructs was also analyzed in blood of all the transgenic mice with FACS. The results indicated that HS2 and HS3 had the same enhancement activity on the regulation of β-globin gene expression. Moreover, these two elements showed a significant synergistic effect on gene expression at the transgenic mouse level, although the GFP expression varied largely among different transgenic mouse litters.

  17. Involvement of Phosphatases in Proliferation, Maturation, and Hemoglobinization of Developing Erythroid Cells

    Directory of Open Access Journals (Sweden)

    Eitan Fibach

    2011-01-01

    Full Text Available Production of RBCs is triggered by the action of erythropoietin (Epo through its binding to surface receptors (Epo-R on erythroid precursors in the bone marrow. The intensity and the duration of the Epo signal are regulated by several factors, including the balance between the activities of kinesase and phosphatases. The Epo signal determines the proliferation and maturation of the precursors into hemoglobin (Hb-containing RBCs. The activity of various protein tyrosine phosphatases, including those involved in the Epo pathway, can be inhibited by sodium orthovanadate (Na3VO4, vanadate. Adding vanadate to cultured erythroid precursors of normal donors and patients with β-thalassemia enhanced cell proliferation and arrested maturation. This was associated with an increased production of fetal hemoglobin (HbF. Increased HbF in patients with β-hemoglobinopathies (β-thalassemia and sickle cell disease ameliorates the clinical symptoms of the disease. These results raise the possibility that specific and nontoxic inhibitors of phosphatases may be considered as a therapeutic modality for elevating HbF in patients with β-hemoglobinopathies as well as for intensifying the Epo response in other forms of anemia.

  18. DIFFERENTIATION AND MALIGNANT SUPPRESSION INDUCED BY MOUSE ERYTHROID DIFFERENTIATION AND DENUCLEATION FACTOR ON MOUSE ERYTHROLEUKEMIA CELLS

    Institute of Scientific and Technical Information of China (English)

    韩代书; 赵青; 葛晔华; 周建平; 马静; 陈克铨; 薛社普

    2002-01-01

    Objective. To investigate the roles of mouse erythroid differentiation and denueleation factor (MEDDF), a novel factor cloned in our laboratory recently, in erythroid terminal differentiation.Methods. Mouse erythroleukemia (MEL) cells were transfected with eukaryotic expression plasmid pcD-NA-MEDDF. Then we investigated the changes on characteristics of cell growth by analyzing cells growth rate,mitotic index and colony-forming rate in semi-solid medium. The expressions of c-myc and β-globin genes were analysed by semi-quantitative RT-PCR.Results. MEL ceils transfected with pcDNA-MEDDF showed significant lower growth rate, mitotic index,and colony-forming rate in semi-solid medium ( P<0.01 ). The percentage of benzidine-positive cells was 32.8% after transfection. The expression of β-globin in cells transfected with pcDNA-MEDDF was 3.43 times higher than that of control (MEL transfected with blank vector, pcDNA3. 1 ), and the expression of c-myc decreased by 66.3%.Conclusions. MEDDF can induce differentiation of MEL cell and suppress its malignancy.

  19. Circulation of Stars

    Science.gov (United States)

    Boitani, P.

    2016-01-01

    Since the dawn of man, contemplation of the stars has been a primary impulse in human beings, who proliferated their knowledge of the stars all over the world. Aristotle sees this as the product of primeval and perennial “wonder” which gives rise to what we call science, philosophy, and poetry. Astronomy, astrology, and star art (painting, architecture, literature, and music) go hand in hand through millennia in all cultures of the planet (and all use catasterisms to explain certain phenomena). Some of these developments are independent of each other, i.e., they take place in one culture independently of others. Some, on the other hand, are the product of the “circulation of stars.” There are two ways of looking at this. One seeks out forms, the other concentrates on the passing of specific lore from one area to another through time. The former relies on archetypes (for instance, with catasterism), the latter constitutes a historical process. In this paper I present some of the surprising ways in which the circulation of stars has occurred—from East to West, from East to the Far East, and from West to East, at times simultaneously.

  20. A blood circulation model for reference man

    Energy Technology Data Exchange (ETDEWEB)

    Leggett, R.W.; Eckerman, K.F. [Oak Ridge National Lab., TN (United States). Health Sciences Research Div.; Williams, L.R. [Indiana Univ., South Bend, IN (United States). Div. of Liberal Arts and Sciences

    1999-01-01

    This paper describes a dynamic blood circulation model that predicts the movement and gradual dispersal of a bolus of material in the circulation after its intravascular injection into an adult human. The main purpose of the model is to improve the dosimetry of internally deposited radionuclides that decay in the circulation to a significant extent. The total blood volume is partitioned into the blood contents of 24 separate organs or tissues, right heart chambers, left heart chambers, pulmonary circulation, arterial outflow to the systemic tissues (aorta and large arteries), and venous return from the systemic tissues (large veins). As a compromise between physical reality and computational simplicity, the circulation of blood is viewed as a system of first-order transfers between blood pools, with the delay time depending on the mean transit time across the pool. The model allows consideration of incomplete, tissue-dependent extraction of material during passage through the circulation and return of material from tissues to plasma.

  1. Nitrogen-doped multiple graphene aerogel/gold nanostar as the electrochemical sensing platform for ultrasensitive detection of circulating free DNA in human serum.

    Science.gov (United States)

    Ruiyi, Li; Ling, Liu; Hongxia, Bei; Zaijun, Li

    2016-05-15

    Graphene aerogel has attracted increasing attention due to its large specific surface area, high-conductivity and electronic interaction. The paper reported a facile synthesis of nitrogen-doped multiple graphene aerogel/gold nanostar (termed as N-doped MGA/GNS) and its use as the electrochemical sensing platform for detection of double stranded (dsDNA). On the one hand, the N-doped MGA offers a much better electrochemical performance compared with classical graphene aerogel. Interestingly, the performance can be enhanced by only increasing the cycle number of graphene oxide gelation. On the other hand, the hybridization with GNS further enhances the electrocatalytic activity towards Fe(CN)6(3-/4-). In addition, the N-doped MGA/GNS provides a well-defined three-dimensional architecture. The unique structure make it is easy to combine with dsDNA to form the electroactive bioconjugate. The integration not only triggers an ultrafast DNA electron and charge transfer, but also realizes a significant synergy between N-doped MGA, GNS and dsDNA. As a result, the electrochemical sensor based on the hybrid exhibits highly sensitive differential pulse voltammetric response (DPV) towards dsDNA. The DPV signal linearly increases with the increase of dsDNA concentration in the range from 1.0×10(-)(21) g ml(-)(1) to 1.0×10(-16) g ml(-1) with the detection limit of 3.9×10(-22) g ml(-1) (S/N=3). The sensitivity is much more than that of all reported DNA sensors. The analytical method was successfully applied in the electrochemical detection of circulating free DNA in human serum. The study also opens a window on the electrical properties of multiple graphene aerogel and DNA as well their hybrids to meet the needs of further applications as special nanoelectronics in molecule diagnosis, bioanalysis and catalysis. PMID:26745792

  2. Nitrogen-doped multiple graphene aerogel/gold nanostar as the electrochemical sensing platform for ultrasensitive detection of circulating free DNA in human serum.

    Science.gov (United States)

    Ruiyi, Li; Ling, Liu; Hongxia, Bei; Zaijun, Li

    2016-05-15

    Graphene aerogel has attracted increasing attention due to its large specific surface area, high-conductivity and electronic interaction. The paper reported a facile synthesis of nitrogen-doped multiple graphene aerogel/gold nanostar (termed as N-doped MGA/GNS) and its use as the electrochemical sensing platform for detection of double stranded (dsDNA). On the one hand, the N-doped MGA offers a much better electrochemical performance compared with classical graphene aerogel. Interestingly, the performance can be enhanced by only increasing the cycle number of graphene oxide gelation. On the other hand, the hybridization with GNS further enhances the electrocatalytic activity towards Fe(CN)6(3-/4-). In addition, the N-doped MGA/GNS provides a well-defined three-dimensional architecture. The unique structure make it is easy to combine with dsDNA to form the electroactive bioconjugate. The integration not only triggers an ultrafast DNA electron and charge transfer, but also realizes a significant synergy between N-doped MGA, GNS and dsDNA. As a result, the electrochemical sensor based on the hybrid exhibits highly sensitive differential pulse voltammetric response (DPV) towards dsDNA. The DPV signal linearly increases with the increase of dsDNA concentration in the range from 1.0×10(-)(21) g ml(-)(1) to 1.0×10(-16) g ml(-1) with the detection limit of 3.9×10(-22) g ml(-1) (S/N=3). The sensitivity is much more than that of all reported DNA sensors. The analytical method was successfully applied in the electrochemical detection of circulating free DNA in human serum. The study also opens a window on the electrical properties of multiple graphene aerogel and DNA as well their hybrids to meet the needs of further applications as special nanoelectronics in molecule diagnosis, bioanalysis and catalysis.

  3. SOD2 deficient erythroid cells up-regulate transferrin receptor and down-regulate mitochondrial biogenesis and metabolism.

    Directory of Open Access Journals (Sweden)

    Florent M Martin

    Full Text Available BACKGROUND: Mice irradiated and reconstituted with hematopoietic cells lacking manganese superoxide dismutase (SOD2 show a persistent hemolytic anemia similar to human sideroblastic anemia (SA, including characteristic intra-mitochondrial iron deposition. SA is primarily an acquired, clonal marrow disorder occurring in individuals over 60 years of age with uncertain etiology. METHODOLOGY/PRINCIPAL FINDINGS: To define early events in the pathogenesis of this murine model of SA, we compared erythroid differentiation of Sod2⁻/⁻ and normal bone marrow cells using flow cytometry and gene expression profiling of erythroblasts. The predominant transcriptional differences observed include widespread down-regulation of mitochondrial metabolic pathways and mitochondrial biogenesis. Multiple nuclear encoded subunits of complexes I-IV of the electron transport chain, ATP synthase (complex V, TCA cycle and mitochondrial ribosomal proteins were coordinately down-regulated in Sod2⁻/⁻ erythroblasts. Despite iron accumulation within mitochondria, we found increased expression of transferrin receptor, Tfrc, at both the transcript and protein level in SOD2 deficient cells, suggesting deregulation of iron delivery. Interestingly, there was decreased expression of ABCb7, the gene responsible for X-linked hereditary SA with ataxia, a component required for iron-sulfur cluster biogenesis. CONCLUSIONS/SIGNIFICANCE: These results indicate that in erythroblasts, mitochondrial oxidative stress reduces expression of multiple nuclear genes encoding components of the respiratory chain, TCA cycle and mitochondrial protein synthesis. An additional target of particular relevance for SA is iron:sulfur cluster biosynthesis. By decreasing transcription of components of cluster synthesis machinery, both iron utilization and regulation of iron uptake are impacted, contributing to the sideroblastic phenotype.

  4. A novel erythroid differen tiation related gene EDRF2 inhibited α-globin gene expression in K562 cells

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    In previous studies, we found that EDRF2 was an erythroid differentiation related factor, whose expression was markedly upregulated during erythroid differentiation. It suggested that this factor played a role in erythropoiesis.By using rapid amplification of cDNA ends technology, we cloned EDRF2 gene 5 '- and 3 '-cDNA ends successfully.Transfection and Northern blot analysis demonstrated that EDRF2 inhibited mRNA expression of α-globin gene, while did not regulate γ-globin gene expression. Gel shift assay confirmed that DNA-binding activity of erythroid specific transcription factors GATA-1, NF-E2 and AP1 was not af fected by either forced overexpression or artificial down regulation of EDRF2 gene in K562 cells. However, we de tected that the negative regulator of expression of GATA-1 transcription factor was increased in EDRF2 overexpressed K562 cells. These results strongly suggested that EDRF2 was involved in α-globin gene expression and erythroid differen tiation and served as a negative regulator of PU.1 transcrip tion factor.

  5. Carbon monoxide induced erythroid differentiation of K562 cells mimics the central macrophage milieu in erythroblastic islands.

    Directory of Open Access Journals (Sweden)

    Shlomi Toobiak

    Full Text Available Growing evidence supports the role of erythroblastic islands (EI as microenvironmental niches within bone marrow (BM, where cell-cell attachments are suggested as crucial for erythroid maturation. The inducible form of the enzyme heme oxygenase, HO-1, which conducts heme degradation, is absent in erythroblasts where hemoglobin (Hb is synthesized. Yet, the central macrophage, which retains high HO-1 activity, might be suitable to take over degradation of extra, harmful, Hb heme. Of these enzymatic products, only the hydrophobic gas molecule--CO can transfer from the macrophage to surrounding erythroblasts directly via their tightly attached membranes in the terminal differentiation stage.Based on the above, the study hypothesized CO to have a role in erythroid maturation. Thus, the effect of CO gas as a potential erythroid differentiation inducer on the common model for erythroid progenitors, K562 cells, was explored. Cells were kept under oxygen lacking environment to mimic BM conditions. Nitrogen anaerobic atmosphere (N₂A served as control for CO atmosphere (COA. Under both atmospheres cells proliferation ceased: in N₂A due to cell death, while in COA as a result of erythroid differentiation. Maturation was evaluated by increased glycophorin A expression and Hb concentration. Addition of 1%CO only to N₂A, was adequate for maintaining cell viability. Yet, the average Hb concentration was low as compared to COA. This was validated to be the outcome of diversified maturation stages of the progenitor's population.In fact, the above scenario mimics the in vivo EI conditions, where at any given moment only a minute portion of the progenitors proceeds into terminal differentiation. Hence, this model might provide a basis for further molecular investigations of the EI structure/function relationship.

  6. PRV-1, erythroid colonies and platelet Mpl are unrelated to thrombosis in essential thrombocythaemia

    DEFF Research Database (Denmark)

    Vannucchi, Alessandro M; Pancrazzi, Alessandro; Antonioli, Elisabetta;

    2004-01-01

    Females with the monoclonal type of essential thrombocythaemia (ET), based on the X-chromosome inactivation pattern (XCIP), have previously been shown to present a higher incidence of thrombosis than polyclonal ones. We aimed to assess correlations between XCIP, thrombosis, and three epigenetic...... markers of ET, namely PRV-1 overexpression, endogenous erythroid colony (EEC) formation, and reduced platelet Mpl content. Fifty-three (60%) of 88 subjects studied had monoclonal myelopoiesis and presented a 32% incidence of major thrombosis compared with 6% of polyclonal subjects (P = 0.......009). The frequency of abnormalities of PRV-1, EEC, or Mpl was similar in monoclonal and polyclonal subjects (respectively, 28%, 48%, 75%, and 37%, 27%, 63%), and none of them correlated with thrombosis. We conclude that the exploited epigenetic markers constitute independent phenotypic variations...

  7. Parvovirus B19 Replication and Expression in Differentiating Erythroid Progenitor Cells.

    Science.gov (United States)

    Bua, Gloria; Manaresi, Elisabetta; Bonvicini, Francesca; Gallinella, Giorgio

    2016-01-01

    The pathogenic Parvovirus B19 (B19V) is characterized by a strict adaptation to erythroid progenitor cells (EPCs), a heterogeneous population of differentiating cells with diverse phenotypic and functional properties. In our work, we studied the dynamics of B19V infection in EPCs in dependence on the cell differentiation stage, in terms of distribution of infected cells, synthesis of viral nucleic acids and production of infectious virus. EPCs at early differentiation stage led to an abortive infection, without viral genome replication and a very low transcriptional activity. EPCs at later stages were permissive, with highest levels of viral replicative activity at day 9 (+3.0 Log from 2 to 48 hpi) and lower levels at day 18 (+1.5 Log from 2 to 48 hpi). B19V DNA increment was in accordance with the percentage of cells positive to flow-FISH assay (41.4% at day 9, 1.1% at day 18). Quantitation of total RNA indicated a close association of genome replication and transcription with viral RNA accumulation within infected cells related to viral DNA increase during the course of infection. Analysis of the different classes of mRNAs revealed two distinct pattern of genome expression profile with a fine regulation in the frequency utilization of RNA processing signals: an early phase, when cleavage at the proximal site leading to a higher relative production of mRNA for NS protein, and a late phase, when cleavage at the distal site was more frequent leading to higher relative abundance of mRNA for VP and 11 kDA proteins. Infectious virus was released from cells at day 6-15, but not at day 18. Our results, providing a detailed description of B19V replication and expression profile in differentiating EPCs, highlight the very tight adaptation of B19V to a specific cellular target defined both by its erythroid lineage and its differentiation stage. PMID:26845771

  8. Parvovirus B19 Replication and Expression in Differentiating Erythroid Progenitor Cells.

    Directory of Open Access Journals (Sweden)

    Gloria Bua

    Full Text Available The pathogenic Parvovirus B19 (B19V is characterized by a strict adaptation to erythroid progenitor cells (EPCs, a heterogeneous population of differentiating cells with diverse phenotypic and functional properties. In our work, we studied the dynamics of B19V infection in EPCs in dependence on the cell differentiation stage, in terms of distribution of infected cells, synthesis of viral nucleic acids and production of infectious virus. EPCs at early differentiation stage led to an abortive infection, without viral genome replication and a very low transcriptional activity. EPCs at later stages were permissive, with highest levels of viral replicative activity at day 9 (+3.0 Log from 2 to 48 hpi and lower levels at day 18 (+1.5 Log from 2 to 48 hpi. B19V DNA increment was in accordance with the percentage of cells positive to flow-FISH assay (41.4% at day 9, 1.1% at day 18. Quantitation of total RNA indicated a close association of genome replication and transcription with viral RNA accumulation within infected cells related to viral DNA increase during the course of infection. Analysis of the different classes of mRNAs revealed two distinct pattern of genome expression profile with a fine regulation in the frequency utilization of RNA processing signals: an early phase, when cleavage at the proximal site leading to a higher relative production of mRNA for NS protein, and a late phase, when cleavage at the distal site was more frequent leading to higher relative abundance of mRNA for VP and 11 kDA proteins. Infectious virus was released from cells at day 6-15, but not at day 18. Our results, providing a detailed description of B19V replication and expression profile in differentiating EPCs, highlight the very tight adaptation of B19V to a specific cellular target defined both by its erythroid lineage and its differentiation stage.

  9. Microwave circulator design

    CERN Document Server

    Linkhart, Douglas K

    2014-01-01

    Circulator design has advanced significantly since the first edition of this book was published 25 years ago. The objective of this second edition is to present theory, information, and design procedures that will enable microwave engineers and technicians to design and build circulators successfully. This resource contains a discussion of the various units used in the circulator design computations, as well as covers the theory of operation. This book presents numerous applications, giving microwave engineers new ideas about how to solve problems using circulators. Design examples are provided, which demonstrate how to apply the information to real-world design tasks.

  10. The glucocorticoid receptor cooperates with the erythropoietin receptor and c-Kit to enhance and sustain proliferation of erythroid progenitors in vitro

    NARCIS (Netherlands)

    W. Zauner; G. Mellitzer; P. Steinlein (Peter); G. Fritsch; K. Huber; H. Beug (Hartmut); B. Löwenberg (Bob); M.M. von Lindern (Marieke)

    1999-01-01

    textabstractAlthough erythropoietin (Epo) is essential for the production of mature red blood cells, the cooperation with other factors is required for a proper balance between progenitor proliferation and differentiation. In avian erythroid progenitors, steroid hormone

  11. Lipid peroxidation and total cholesterol in HAART-naive patients infected with circulating recombinant forms of human immunodeficiency virus type-1 in Cameroon.

    Directory of Open Access Journals (Sweden)

    Georges Teto

    Full Text Available BACKGROUND: HIV infection has commonly been found to affect lipid profile and antioxidant defense. OBJECTIVES: To determine the effects of Human Immunodeficiency Virus (HIV infection and viral subtype on patient's cholesterol and oxidative stress markers, and determine whether in the absence of Highly Active Antiretroviral Therapy (HAART, these biochemical parameters could be useful in patient's management and monitoring disease progression in Cameroon. For this purpose, we measured total cholesterol (TC, LDL cholesterol (LDLC, HDL cholesterol (HDLC, total antioxidant ability (TAA, lipid peroxidation indices (LPI, and malondialdehyde (MDA in HIV negative persons and HIV positive HAART-naïve patients infected with HIV-1 group M subtypes. METHODS: We measured serum TC, LDLC, HDLC, plasma MDA, and TAA concentrations, and calculated LPI indices in 151 HIV-positive HAART-naïve patients and 134 seronegative controls. We also performed gene sequence analysis on samples from 30 patients to determine the effect of viral genotypes on these biochemical parameters. We also determined the correlation between CD4 cell count and the above biochemical parameters. RESULTS: We obtained the following controls/patients values for TC (1.96±0.54/1. 12±0. 48 g/l, LDLC (0. 67±0. 46/0. 43±0. 36 g/l, HDLC (105. 51±28. 10/46. 54±23. 36 mg/dl TAA (0. 63±0. 17/0. 16±0. 16 mM, MDA (0. 20±0. 07/0. 41±0. 10 µM and LPI (0. 34±0. 14/26. 02±74. 40. In each case, the difference between the controls and patients was statistically significant (p<0.05. There was a positive and statistically significant Pearson correlation between CD4 cell count and HDLC (r = +0.272; p<0.01, TAA (r = +0.199; p<0.05 and a negative and statistically significant Pearson correlation between CD4 cell count and LPI (r = -0.166; p<0.05. Pearson correlation between CD4 cell count and TC, CD4cell count and LDLC was positive but not statistically significant while it was negative but

  12. Immunophenotyping of Circulating T Helper Cells Argues for Multiple Functions and Plasticity of T Cells In Vivo in Humans - Possible Role in Asthma

    OpenAIRE

    Carina Malmhäll; Apostolos Bossios; Madeleine Rådinger; Margareta Sjöstrand; You Lu; Bo Lundbäck; Jan Lötvall

    2012-01-01

    BACKGROUND: The immune process driving eosinophilic and non-eosinophilic asthma is likely driven by different subsets of T helper (Th) cells. Recently, in vitro studies and animal studies suggest that Th cell subsets displays plasticity by changing their transcription factor or by expressing multiple transcription factors. Our aim was to determine whether individuals with asthma and elevated circulating eosinophils express signs of different regulatory immune mechanisms compared with asthmati...

  13. Acute myeloid leukemia and transcription factors: role of erythroid Krüppel-like factor (EKLF

    Directory of Open Access Journals (Sweden)

    Ayala Rosa

    2012-06-01

    Full Text Available Abstract We have investigated the role of erythroid transcription factors mRNA expression in patients with acute myeloid leukemia (AML in the context of cytogenetic and other prognostic molecular markers, such as FMS-like Tyrosine Kinase 3 (FLT3, Nucleophosmin 1 (NPM1, and CCAAT/enhance-binding protein α (CEBPA mutations. Further validation of Erythroid Krüppel-like Factor (EKLF mRNA expression as a prognostic factor was assessed. We evaluated GATA binding protein 1 (GATA1, GATA binding protein 2 (GATA2, EKLF and Myeloproliferative Leukemia virus oncogen homology (cMPL gene mRNA expression in the bone marrow of 65 AML patients at diagnosis, and assessed any correlation with NPM1, FLT3 and CEBPA mutations. EKLF-positive AML was associated with lower WBC in peripheral blood (P = 0.049, a higher percentage of erythroblasts in bone marrow (p = 0.057, and secondary AMLs (P = 0.036. High expression levels of EKLF showed a trend to association with T-cell antigen expression, such as CD7 (P = 0.057. Patients expressing EKLF had longer Overall Survival (OS and Event Free Survival (EFS than those patients not expressing EKLF (median OS was 35.61 months and 19.31 months, respectively, P = 0.0241; median EFS was 19.80 months and 8.03 months, respectively, P = 0.0140. No correlation of GATA1, GATA2, EKLF and cMPL levels was observed with FLT-3 or NPM1 mutation status. Four of four CEBPA mutated AMLs were EKLF positive versus 10 of 29 CEBPA wild-type AMLs; three of the CEBPA mutated, EKLF-positive AMLs were also GATA2 positive. There were no cases of CEBPA mutations in the EKLF-negative AML group. In conclusion, we have validated EKLF mRNA expression as an independent predictor of outcome in AML, and its expression is not associated with FLT3-ITD and NPM1 mutations. EKLF mRNA expression in AML patients may correlate with dysregulated CEBPA.

  14. Endogenous erythroid colony assay in patients with polycythemia vera and its clinical significance

    Institute of Scientific and Technical Information of China (English)

    白洁; 邵宗鸿; 刘鸿; 施均; 何广胜; 曹燕然; 崔振珠; 吴玉红; 孙娟; 田征; 贾海蓉; 钱林生; 杨天楹; 杨崇礼

    2004-01-01

    Background Polycythemia vera (PV) is a malignant disorder of hemaopoietic stem cells which is characterized by clonal hyperproliferation and a low rate of apoptosis. This study was to assess endogenous erythroid colony (EEC) formation in the bone marrow of PV patients and determine its clinical significance.Methods The bone marrow mononuclear cells of 26 patients with PV, 2 patients with secondary erythrocytosis (SE), and 19 normal controls were cultured by Marsh's method for EEC evaluation, and the clinical significance was evaluated.Results EECs appeared in 25 patients with PV but not in 2 patients with SE and 19 normal controls. The number of EECs and the EEC ratio [EEC/erythropoietin (EPO)-dependent colony forming unit-erythroid (CFU-E)] in PV patients positively correlated with hemoglobin (Hb) levels. Their EEC number did not correlate with white blood cell (WBC) counts, platelet (PLT) counts, or leukocyte alkaline phosphatase (LAP) scores. Their EEC did not correlate with serum EPO levels. Fifteen patients with PV were treated with hydroxyurea (Hu) and/or interferon-alpha (IFN-α). Their EEC ratio before treatment positively correlated with the treatment time required for complete remission (CR) and negatively correlated with the time before relapse. The EEC numbers of 7 PV patients treated with Hu/IFN-α decreased after the blood cell counts dropped to normal levels. There was a positive correlation between the EEC ratio and the incidence of attacks of vascular thrombosis in PV patients. The numbers of apoptosised bone marrow mononuclear cells in PV patients were lower than those in normal controls. The EEC numbers of PV patients negatively correlated with the rate of apoptosis of bone marrow mononuclear cells.Conclusions EEC formation is characteristic in PV patients. EEC number in PV patients positively correlates with Hb levels, the time required for CR, and the incidence of attacks of vascular thrombosis. EEC number negatively correlates with the time

  15. NF-Y recruits both transcription activator and repressor to modulate tissue- and developmental stage-specific expression of human γ-globin gene.

    Directory of Open Access Journals (Sweden)

    Xingguo Zhu

    Full Text Available The human embryonic, fetal and adult β-like globin genes provide a paradigm for tissue- and developmental stage-specific gene regulation. The fetal γ-globin gene is expressed in fetal erythroid cells but is repressed in adult erythroid cells. The molecular mechanism underlying this transcriptional switch during erythroid development is not completely understood. Here, we used a combination of in vitro and in vivo assays to dissect the molecular assemblies of the active and the repressed proximal γ-globin promoter complexes in K562 human erythroleukemia cell line and primary human fetal and adult erythroid cells. We found that the proximal γ-globin promoter complex is assembled by a developmentally regulated, general transcription activator NF-Y bound strongly at the tandem CCAAT motifs near the TATA box. NF-Y recruits to neighboring DNA motifs the developmentally regulated, erythroid transcription activator GATA-2 and general repressor BCL11A, which in turn recruit erythroid repressor GATA-1 and general repressor COUP-TFII to form respectively the NF-Y/GATA-2 transcription activator hub and the BCL11A/COUP-TFII/GATA-1 transcription repressor hub. Both the activator and the repressor hubs are present in both the active and the repressed γ-globin promoter complexes in fetal and adult erythroid cells. Through changes in their levels and respective interactions with the co-activators and co-repressors during erythroid development, the activator and the repressor hubs modulate erythroid- and developmental stage-specific transcription of γ-globin gene.

  16. Acute megakaryoblastic leukemia, unlike acute erythroid leukemia, predicts an unfavorable outcome after allogeneic HSCT.

    Science.gov (United States)

    Ishiyama, Ken; Yamaguchi, Takuhiro; Eto, Tetsuya; Ohashi, Kazuteru; Uchida, Naoyuki; Kanamori, Heiwa; Fukuda, Takahiro; Miyamura, Koichi; Inoue, Yoshiko; Taguchi, Jun; Mori, Takehiko; Iwato, Koji; Morishima, Yasuo; Nagamura-Inoue, Tokiko; Atsuta, Yoshiko; Sakamaki, Hisashi; Takami, Akiyoshi

    2016-08-01

    Acute erythroid leukemia (FAB-M6) and acute megakaryoblastic leukemia (FAB-M7) exhibit closely related properties in cells regarding morphology and the gene expression profile. Although allogeneic hematopoietic stem cell transplantation (allo-HSCT) is considered the mainstay of the treatment for both subtypes of leukemia due to their refractoriness to chemotherapy and high rates of relapse, it remains unclear whether allo-HSCT is curative in such cases due to their scarcity. We retrospectively examined the impact of allo-HSCT in 382 patients with M6 and 108 patients with M7 using nationwide HSCT data and found the overall survival (OS) and relapse rates of the M6 patients to be significantly better than those of the M7 patients after adjusting for confounding factors and statistically comparable with those of the patients with M0/M1/M2/M4/M5 disease. Consequently, the factors of age, gender, performance status, karyotype, disease status at HSCT and development of graft-vs.-host disease predicted the OS for the M6 patients, while the performance status and disease status at HSCT were predictive of the OS for the M7 patients. These findings substantiate the importance of distinguishing between M6 and M7 in the HSCT setting and suggest that unknown mechanisms influence the HSCT outcomes of these closely related subtypes of leukemia. PMID:27244257

  17. An erythroid chaperone that facilitates folding of α-globin subunits for hemoglobin synthesis

    Science.gov (United States)

    Yu, Xiang; Kong, Yi; Dore, Louis C.; Abdulmalik, Osheiza; Katein, Anne M.; Zhou, Suiping; Choi, John K.; Gell, David; Mackay, Joel P.; Gow, Andrew J.; Weiss, Mitchell J.

    2007-01-01

    Erythrocyte precursors produce abundant α- and β-globin proteins, which assemble with each other to form hemoglobin A (HbA), the major blood oxygen carrier. αHb-stabilizing protein (AHSP) binds free α subunits reversibly to maintain their structure and limit their ability to generate reactive oxygen species. Accordingly, loss of AHSP aggravates the toxicity of excessive free α-globin caused by β-globin gene disruption in mice. Surprisingly, we found that AHSP also has important functions when free α-globin is limited. Thus, compound mutants lacking both Ahsp and 1 of 4 α-globin genes (genotype Ahsp–/–α-globin*α/αα) exhibited more severe anemia and Hb instability than mice with either mutation alone. In vitro, recombinant AHSP promoted folding of newly translated α-globin, enhanced its refolding after denaturation, and facilitated its incorporation into HbA. Moreover, in erythroid precursors, newly formed free α-globin was destabilized by loss of AHSP. Therefore, in addition to its previously defined role in detoxification of excess α-globin, AHSP also acts as a molecular chaperone to stabilize nascent α-globin for HbA assembly. Our findings illustrate what we believe to be a novel adaptive mechanism by which a specialized cell coordinates high-level production of a multisubunit protein and protects against various synthetic imbalances. PMID:17607360

  18. Developmental stage-related expression and identification of murine erythroid differentiation-denucleation factor (MEDDF)

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    Using MEDDF cDNA fragment in plasmid pBS-SK-MEDDF as template the coding sequence was cloned into pGEM-T-Easy plasmid by PCR method to delete non-coding sequence. After DNA sequencing it was confirmed that the clone sequence was correct, the coding region then was inserted into the vector pET-30a between BamH I and Hind III to construct eukaryotic expression vector. It was found that the specific protein was up to 40% of total bactorial proteins in certain high-expression E. coli. High titer of anti-sera was detected by inoculating New Zealand rabbits with purified MEDDF protein as an antigen. By using immunocytochemical staining it was demonstrated that the expression of MEDDF was exhibited in a developmental stage-specific manner, suggesting that MEDDF may play a certain role in the initiation of murine erythroid terminal differentiation and nuclear condensation. As for the expression of MEDDF appearing in granulocytes and megakaryocyter in murine bone marrow, it may indicate that there is an original relationship between the proteins and differentiation of murine myelogenous lineage.

  19. Erythropoietin, a novel versatile player regulating energy metabolism beyond the erythroid system.

    Science.gov (United States)

    Wang, Li; Di, Lijun; Noguchi, Constance Tom

    2014-01-01

    Erythropoietin (EPO), the required cytokine for promoting the proliferation and differentiation of erythroid cells to stimulate erythropoiesis, has been reported to act as a pleiotropic cytokine beyond hematopoietic system. The various activities of EPO are determined by the widespread distribution of its cell surface EPO receptor (EpoR) in multiple tissues including endothelial, neural, myoblasts, adipocytes and other cell types. EPO activity has been linked to angiogenesis, neuroprotection, cardioprotection, stress protection, anti-inflammation and especially the energy metabolism regulation that is recently revealed. The investigations of EPO activity in animals and the expression analysis of EpoR provide more insights on the potential of EPO in regulating energy metabolism and homeostasis. The findings of crosstalk between EPO and some important energy sensors and the regulation of EPO in the cellular respiration and mitochondrial function further provide molecular mechanisms for EPO activity in metabolic activity regulation. In this review, we will summarize the roles of EPO in energy metabolism regulation and the activity of EPO in tissues that are tightly associated with energy metabolism. We will also discuss the effects of EPO in regulating oxidative metabolism and mitochondrial function, the interactions between EPO and important energy regulation factors, and the protective role of EPO from stresses that are related to metabolism, providing a brief overview of previously less appreciated EPO biological function in energy metabolism and homeostasis. PMID:25170305

  20. Therapeutic fetal-globin inducers reduce transcriptional repression in hemoglobinopathy erythroid progenitors through distinct mechanisms.

    Science.gov (United States)

    Dai, Yan; Sangerman, Jose; Luo, Hong Yuan; Fucharoen, Suthat; Chui, David H K; Faller, Douglas V; Perrine, Susan P

    2016-01-01

    Pharmacologic augmentation of γ-globin expression sufficient to reduce anemia and clinical severity in patients with diverse hemoglobinopathies has been challenging. In studies here, representative molecules from four chemical classes, representing several distinct primary mechanisms of action, were investigated for effects on γ-globin transcriptional repressors, including components of the NuRD complex (LSD1 and HDACs 2-3), and the downstream repressor BCL11A, in erythroid progenitors from hemoglobinopathy patients. Two HDAC inhibitors (MS-275 and SB939), a short-chain fatty acid derivative (sodium dimethylbutyrate [SDMB]), and an agent identified in high-throughput screening, Benserazide, were studied. These therapeutics induced γ-globin mRNA in progenitors above same subject controls up to 20-fold, and increased F-reticulocytes up to 20%. Cellular protein levels of BCL11A, LSD-1, and KLF1 were suppressed by the compounds. Chromatin immunoprecipitation assays demonstrated a 3.6-fold reduction in LSD1 and HDAC3 occupancy in the γ-globin gene promoter with Benserazide exposure, 3-fold reduction in LSD-1 and HDAC2 occupancy in the γ-globin gene promoter with SDMB exposure, while markers of gene activation (histone H3K9 acetylation and H3K4 demethylation), were enriched 5.7-fold. These findings identify clinical-stage oral therapeutics which inhibit or displace major co-repressors of γ-globin gene transcription and may suggest a rationale for combination therapy to produce enhanced efficacy. PMID:26603726

  1. Intense circulation of A/H5N1 and other avian influenza viruses in Cambodian live-bird markets with serological evidence of sub-clinical human infections.

    Science.gov (United States)

    Horm, Srey Viseth; Tarantola, Arnaud; Rith, Sareth; Ly, Sowath; Gambaretti, Juliette; Duong, Veasna; Y, Phalla; Sorn, San; Holl, Davun; Allal, Lotfi; Kalpravidh, Wantanee; Dussart, Philippe; Horwood, Paul F; Buchy, Philippe

    2016-01-01

    Surveillance for avian influenza viruses (AIVs) in poultry and environmental samples was conducted in four live-bird markets in Cambodia from January through November 2013. Through real-time RT-PCR testing, AIVs were detected in 45% of 1048 samples collected throughout the year. Detection rates ranged from 32% and 18% in duck and chicken swabs, respectively, to 75% in carcass wash water samples. Influenza A/H5N1 virus was detected in 79% of samples positive for influenza A virus and 35% of all samples collected. Sequence analysis of full-length haemagglutinin (HA) and neuraminidase (NA) genes from A/H5N1 viruses, and full-genome analysis of six representative isolates, revealed that the clade 1.1.2 reassortant virus associated with Cambodian human cases during 2013 was the only A/H5N1 virus detected during the year. However, multiplex reverse transcriptase-polymerase chain reaction (RT-PCR) analysis of HA and NA genes revealed co-circulation of at least nine low pathogenic AIVs from HA1, HA2, HA3, HA4, HA6, HA7, HA9, HA10 and HA11 subtypes. Four repeated serological surveys were conducted throughout the year in a cohort of 125 poultry workers. Serological testing found an overall prevalence of 4.5% and 1.8% for antibodies to A/H5N1 and A/H9N2, respectively. Seroconversion rates of 3.7 and 0.9 cases per 1000 person-months participation were detected for A/H5N1 and A/H9N2, respectively. Peak AIV circulation was associated with the Lunar New Year festival. Knowledge of periods of increased circulation of avian influenza in markets should inform intervention measures such as market cleaning and closures to reduce risk of human infections and emergence of novel AIVs. PMID:27436362

  2. Mountains and Tropical Circulation

    Science.gov (United States)

    Naiman, Z.; Goodman, P. J.; Krasting, J. P.; Malyshev, S.; Russell, J. L.; Stouffer, R. J.

    2015-12-01

    Observed tropical convection exhibits zonal asymmetries that strongly influence spatial precipitation patterns. The drivers of changes to this zonally-asymmetric Walker circulation on decadal and longer timescales have been the focus of significant recent research. Here we use two state-of-the-art earth system models to explore the impact of earth's mountains on the Walker circulation. When all land-surface topography is removed, the Walker circulation weakens by 33-59%. There is a ~30% decrease in global, large-scale upward vertical wind velocities in the middle of the troposphere, but only minor changes in global average convective mass flux, precipitation, surface and sea-surface temperatures. The zonally symmetric Hadley circulation is also largely unchanged. Following the spatial pattern of changes to large-scale vertical wind velocities, precipitation becomes less focused over the tropics. The weakening of the Walker circulation, but not the Hadley circulation, is similar to the behavior of climate models during radiative forcing experiments: in our simulations, the weakening is associated with changes in vertical wind velocities, rather than the hydrologic cycle. These results indicate suggest that mountain heights may significantly influence the Walker circulation on geologic time scales, and observed changes in tropical precipitation over millions of years may have been forced by changes in tropical orography.

  3. Co-circulation in a single biome of the Juquitiba and Araraquara hantavirus detected in human sera in a sub-tropical region of Brazil.

    Science.gov (United States)

    de Araujo, Jansen; Duré, Ana I L; Negrão, Raquel; Ometto, Tatiana; Thomazelli, Luciano M; Durigon, Edison Luiz

    2015-05-01

    Hantaviruses is an emerging infectious disease. Although HCPS has been reported in several regions of Brazil, more cases of HCPS have recently been reported in Minas Gerais than in any other state. In 2009, we analyzed 27 samples presenting antibodies against hantaviruses. These samples originated from 688 symptomatic patients, as determined based on the Hemorrhagic Fever Protocol. A subsequent SYBR Green-based real-time RT-PCR demonstrated the presence of the virus in 22 of the samples. Among the RT-PCR-positive samples, 17 were analyzed using DNA sequencing; these sequences were compared with others deposited in GenBank and showed similarity with the Araraquara and Juquitiba virus clusters. This work describe the detection of Juquitiba virus, including three fatal cases, in Minas Gerais state, furthermore, showed that it is feasible to characterize the circulating strains using a small fragment of S segment. Finally, the results suggest the co-circulation of Araraquara and Juquitiba virus in a single biome in Minas Gerais state.

  4. Low O2 concentrations enhance the positive effect of IL-17 on the maintenance of erythroid progenitors during co-culture of CD34+ and mesenchymal stem cells.

    Science.gov (United States)

    Krstić, Aleksandra; Vlaski, Marija; Hammoud, Mohammad; Chevaleyre, Jean; Duchez, Pascale; Jovcić, Gordana; Bugarski, Diana; Milenković, Pavle; Bourin, Philippe; Boiron, Jean-Michel; Praloran, Vincent; Ivanović, Zoran

    2009-03-01

    Co-culture of haematopoietic cells with a stromal cell layer does not mimic the physiological, micro-environmental niche, whose major feature is a low oxygen (O2) concentration. Thus, in order to study the effects of IL-17 in a context which better approximates the physiological state, we investigated its effects on cell expansion, colony-forming ability, and the phenotypical profile of normal, human blood CD34+ cells co-cultured for five days with MSC layers at various O2 concentrations (20%, 12.5% and 3% O2. We demonstrated that IL-17 enhances CD34+ and total CFC production during the five days of MSC/CD34+ co-culture. This effect depends upon the O2 concentration, reaching its maximum at 3% O2, and is more pronounced on erythroid progenitors (BFU-E). In addition, the stimulation of IL-6 production by IL-17 in MSC cultures and co-cultures is enhanced by low O2 concentration. The expression of some differentiation markers (CD34, CD13 and CD41) on haematopoietic cells in co-cultures also depends upon the oxygen concentration. Our results strengthen the concept that physiological levels of O2 (mistakenly called hypoxia), should be considered as an important environmental factor that significantly influences cytokine activity.

  5. Implication of enterohepatic re-circulation on single dose bioequivalence evaluation of two brands of clonidine hydrochloride tablets in healthy human volunteers

    Directory of Open Access Journals (Sweden)

    Mehta H

    2009-01-01

    Full Text Available A single dose, crossover bioequivalence study of two different brands of clonidine hydrochloride 25 μg tablets was conducted in 24 (+2 stand by healthy, adult, male, Indian subjects under fasting conditions to check the implication of enterohepatic re-circulation on assessment of bioequivalence. After an overnight fasting of at least 10 h, the subjects received single oral dose of test or reference product with either of the product as per randomization schedule in each period with a washout period of 10 days. The pre-dose blood sample was collected within a period of one h before dosing. The post-dose blood samples were collected at specified time intervals up to 96 h. The plasma concentrations of clonidine were quantified by validated LCMS/MS method and pharmacokinetic parameters were computed. The 90% confidence intervals of test/reference ratios for C max and area under the plasma-concentration- time-curve AUC under 0-t were found to be between 0.80 and 1.25 for log-transformed data. Analysis of variance did not show significant difference to these parameters. No meaningful values of K el and therefore AUC under 0-infinity could be calculated for significant number of subjects due to enterohepatic re-circulation. Based on the results obtained, two different brands of clonidine 25 μg tablets have comparable rate and extent of absorption after oral administration but failed to show bioequivalence as per regulatory requirement of Food and Drugs Administration-united states.

  6. Defining origins of malignant B cells: a new circulating normal human IgM(+)D(+) B-cell subset lacking CD27 expression and displaying somatically mutated IGHV genes as a relevant memory population.

    Science.gov (United States)

    Weston-Bell, N; Townsend, M; Di Genova, G; Forconi, F; Sahota, S S

    2009-11-01

    In probing the cell of origin in malignant B cells, an imprint of somatic hypermutation (SHM) in immunoglobulin (Ig) variable (V) region genes delineates antigen encounter, and identifying the precise pathway generating SHM in the normal B-cell counterpart becomes relevant. SHM remains the definitive memory imprint in normal human B cells, but CD27 expression also delineates memory. Recently, dye extrusion adenosine triphosphate-binding transporter assays identified circulating isotype-switched memory B cells that lacked CD27, yet exhibited low levels of SHM. To extend findings, we report a pre-switched CD27(-ve) circulating memory B-cell population in normal blood using comparable assays, and isolated CD19(+)IgM(+)D(+)CD27(-ve) cells (>99% purity) for the analysis of IGHV5/IGHV3-IGHM transcripts. Of these (n=334), approximately 78% were germ line and naive B cell derived. Strikingly, 21.9% of the transcripts were mutated. They showed 3-5 mutations (13.5% of sequences) and >5 mutations (8.4% of sequences) per transcript. Accrual of mutations in a subset of CD19(+)IgM(+)D(+)CD27(-ve) cells define a new circulating pre-switched memory B-cell pool, present in substantial numbers in the population harboring naive B cells. These CD19(+)IgM(+)D(+)CD27(-ve) memory B cells may have a distinct lineage and function, and seem relevant to understanding origins of malignant B cells, in particular those of hairy cell leukemia cells, which display mutated V genes yet lack CD27 expression. PMID:19776762

  7. The radiation response of murine erythroid progenitors (CFU/sub E/)

    International Nuclear Information System (INIS)

    The radiation response of murine erythroid progenitors (CFU/sub E/) to irradiation followed by in situ holding and to split dose irradiations was investigated. LAF/sub 1//JAX female mice were whole body irradiated with 150 kVp X rays. The femoral bone marrow was extracted to assay for CFU survival by the plasma clot culture method. In situ holding experiments were performed in which 2.0 Gy was delivered, and the CFU/sub E/ were allowed to remain in situ for various time intervals between irradiation and culturing. The surviving fraction sharply declined from 0.21 for CFU/sub E/ cultured immediately after irradiation to a minimum value of 0.04 for irradiated CFU/sub E/ held in situ for 1.5 hours prior to culturing. Subsequently, the surviving fraction increased rapidly approaching immediate plating values within 6 hours of in situ holding. In split dose experiments a conditioning dose of 0.8 Gy was administered at ''time zero,'' and at various time intervals after the first dose, a second dose of 0.8 Gy was delivered. The CFU/sub E/ were cultured immediately after the delivery of the second dose. A pattern similar to that for in situ holding experiments was observed. The surviving fraction decreased from 0.24 for 1.6 Gy delivered in one dose to 0.06 for split doses separated by 45 minutes. The surviving fraction then rose to 0.2 for split doses separated by 6 hours. The possible roles of repair, division and intercompartmental transitions in the above phenomena are discussed

  8. Tracing How Arts and Humanities Research Translates, Circulates and Consolidates in Society.. How Have Scholars Been Reacting to Diverse Impact and Public Value Agendas?

    Science.gov (United States)

    Benneworth, Paul

    2015-01-01

    Arts and humanities research appears to have a problem when it comes to making an argument that it matters to society. Despite widespread efforts within and beyond the field to document how arts and humanities research creates social value, these arguments have had little traction within public policy debates. The paper argues that other…

  9. Expression of oncogenic K-ras from its endogenous promoter leads to a partial block of erythroid differentiation and hyperactivation of cytokine-dependent signaling pathways.

    Science.gov (United States)

    Zhang, Jing; Liu, Yangang; Beard, Caroline; Tuveson, David A; Jaenisch, Rudolf; Jacks, Tyler E; Lodish, Harvey F

    2007-06-15

    When overexpressed in primary erythroid progenitors, oncogenic Ras leads to the constitutive activation of its downstream signaling pathways, severe block of terminal erythroid differentiation, and cytokine-independent growth of primary erythroid progenitors. However, whether high-level expression of oncogenic Ras is required for these phenotypes is unknown. To address this issue, we expressed oncogenic K-ras (K-ras(G12D)) from its endogenous promoter using a tetracycline-inducible system. We show that endogenous K-ras(G12D) leads to a partial block of terminal erythroid differentiation in vivo. In contrast to results obtained when oncogenic Ras was overexpressed from retroviral vectors, endogenous levels of K-ras(G12D) fail to constitutively activate but rather hyperactivate cytokine-dependent signaling pathways, including Stat5, Akt, and p44/42 MAPK, in primary erythroid progenitors. This explains previous observations that hematopoietic progenitors expressing endogenous K-ras(G12D) display hypersensitivity to cytokine stimulation in various colony assays. Our results support efforts to modulate Ras signaling for treating hematopoietic malignancies.

  10. Gaussian Fibonacci Circulant Type Matrices

    Directory of Open Access Journals (Sweden)

    Zhaolin Jiang

    2014-01-01

    Full Text Available Circulant matrices have become important tools in solving integrable system, Hamiltonian structure, and integral equations. In this paper, we prove that Gaussian Fibonacci circulant type matrices are invertible matrices for n>2 and give the explicit determinants and the inverse matrices. Furthermore, the upper bounds for the spread on Gaussian Fibonacci circulant and left circulant matrices are presented, respectively.

  11. Hematopoietic deletion of transferrin receptor 2 in mice leads to a block in erythroid differentiation during iron-deficient anemia.

    Science.gov (United States)

    Rishi, Gautam; Secondes, Eriza S; Wallace, Daniel F; Subramaniam, V Nathan

    2016-08-01

    Iron metabolism and erythropoiesis are inherently interlinked physiological processes. Regulation of iron metabolism is mediated by the iron-regulatory hormone hepcidin. Hepcidin limits the amount of iron released into the blood by binding to and causing the internalization of the iron exporter, ferroportin. A number of molecules and physiological stimuli, including erythropoiesis, are known to regulate hepcidin. An increase in erythropoietic demand decreases hepcidin, resulting in increased bioavailable iron in the blood. Transferrin receptor 2 (TFR2) is involved in the systemic regulation of iron metabolism. Patients and mice with mutations in TFR2 develop hemochromatosis due to inappropriate hepcidin levels relative to body iron. Recent studies from our laboratory and others have suggested an additional role for TFR2 in response to iron-restricted erythropoiesis. These studies used mouse models with perturbed systemic iron metabolism: anemic mice lacking matriptase-2 and Tfr2, or bone marrow transplants from iron-loaded Tfr2 null mice. We developed a novel transgenic mouse model which lacks Tfr2 in the hematopoietic compartment, enabling the delineation of the role of Tfr2 in erythroid development without interfering with its role in systemic iron metabolism. We show that in the absence of hematopoietic Tfr2 immature polychromatic erythroblasts accumulate with a concordant reduction in the percentage of mature erythroid cells in the spleen and bone marrow of anemic mice. These results demonstrate that erythroid Tfr2 is essential for an appropriate erythropoietic response in iron-deficient anemia. These findings may be of relevance in clinical situations in which an immediate and efficient erythropoietic response is required. Am. J. Hematol. 91:812-818, 2016. © 2016 Wiley Periodicals, Inc. PMID:27169626

  12. The predominance of Human Immunodeficiency Virus type 1 (HIV-1 circulating recombinant form 02 (CRF02_AG in West Central Africa may be related to its replicative fitness

    Directory of Open Access Journals (Sweden)

    Butel Christelle

    2006-07-01

    Full Text Available Abstract Background CRF02_AG is the predominant HIV strain circulating in West and West Central Africa. The aim of this study was to test whether this predominance is associated with a higher in vitro replicative fitness relative to parental subtype A and G viruses. Primary HIV-1 isolates (10 CRF02_AG, 5 subtype A and 5 subtype G were obtained from a well-described Cameroonian cohort. Growth competition experiments were carried out at equal multiplicity of infection in activated T cells and monocyte-derived dendritic cells (MO-DC in parallel. Results Dual infection/competition experiments in activated T cells clearly indicated that CRF02_AG isolates had a significant replication advantage over the subtype A and subtype G viruses. The higher fitness of CRF02_AG was evident for isolates from patients with CD4+ T cell counts >200 cells/μL (non-AIDS or CD4+ T cell counts Conclusion We observed a higher ex vivo replicative fitness of CRF02_AG isolates compared to subtype A and G viruses from the same geographic region and showed that this was independent of the co-receptor tropism and irrespective of high or low CD4+ T cell count. This advantage in replicative fitness may contribute to the dominant spread of CRF02_AG over A and G subtypes in West and West Central Africa.

  13. Circulating brain derived neurotrophic factor (BDNF) and frequency of BDNF positive T cells in peripheral blood in human ischemic stroke: Effect on outcome.

    Science.gov (United States)

    Chan, Adeline; Yan, Jun; Csurhes, Peter; Greer, Judith; McCombe, Pamela

    2015-09-15

    The aim of this study was to measure the levels of circulating BDNF and the frequency of BDNF-producing T cells after acute ischaemic stroke. Serum BDNF levels were measured by ELISA. Flow cytometry was used to enumerate peripheral blood leukocytes that were labelled with antibodies against markers of T cells, T regulatory cells (Tregs), and intracellular BDNF. There was a slight increase in serum BDNF levels after stroke. There was no overall difference between stroke patients and controls in the frequency of CD4(+) and CD8(+) BDNF(+) cells, although a subgroup of stroke patients showed high frequencies of these cells. However, there was an increase in the percentage of BDNF(+) Treg cells in the CD4(+) population in stroke patients compared to controls. Patients with high percentages of CD4(+) BDNF(+) Treg cells had a better outcome at 6months than those with lower levels. These groups did not differ in age, gender or initial stroke severity. Enhancement of BDNF production after stroke could be a useful means of improving neuroprotection and recovery after stroke.

  14. On Pareto theory of circulation of elites

    OpenAIRE

    Ricardo P\\'erez-Marco

    2014-01-01

    We prove that Pareto theory of circulation of elites results from our wealth evolution model, Kelly criterion for optimal betting and Keynes' observation of "animal spirits" that drive the economy and cause that human financial decisions are prone to excess risk-taking.

  15. Circulant Double Coverings of a Circulant Graph of Valency Five

    Institute of Scientific and Technical Information of China (English)

    Rong Quan FENG; Jin Ho KWAK

    2007-01-01

    Enumerating the isomorphism classes of several types of graph covering projections is one of the central research topics in enumerative topological graph theory. A covering of G is called circulant if its covering graph is circulant. Recently, the authors [Discrete Math., 277, 73-85 (2004)]enumerated the isomorphism classes of circulant double coverings of a certain type, called a typicalcovering, and showed that no double covering of a circulant graph of valency three is circulant. Also, in [Graphs and Combinatorics, 21, 386-400 (2005)], the isomorphism classes of circulant double coverings of a circulant graph of valency four are enumerated. In this paper, the isomorphism classes of circulant double coverings of a circulant graph of valency five are enumerated.

  16. PULMONARY CIRCULATION AT EXERCISE

    OpenAIRE

    R. Naeije; CHESLER, N

    2012-01-01

    The pulmonary circulation is a high flow and low pressure circuit, with an average resistance of 1 mmHg.min.L−1 in young adults, increasing to 2.5 mmHg.min.L−1 over 4–6 decades of life. Pulmonary vascular mechanics at exercise are best described by distensible models. Exercise does not appear to affect the time constant of the pulmonary circulation or the longitudinal distribution of resistances. Very high flows are associated with high capillary pressures, up to a 20–25 mmHg threshold associ...

  17. Impact of interocean exchange on the Atlantic overturning circulation

    NARCIS (Netherlands)

    Weijer, W.

    2001-01-01

    The awareness that human activity could change climate has greatly raised public and scientific interest in climate. One issue of present-day climate research is the stability of the thermohaline circulation. This overturning circulation, popularly known as the `conveyor belt', redistributes w

  18. Genomewide analysis of reassortment and evolution of human influenza A(H3N2) viruses circulating between 1968 and 2011

    NARCIS (Netherlands)

    K.B. Westgeest (Kim); C.A. Russell (Colin); X. Lin (Xudong); M.I. Spronken (Monique); T.M. Bestebroer (Theo); J. Bahl (Justin); R. van Beek (Ruud); E. Skepner (Eugene); R.A. Halpin (Rebecca); J.C. de Jong (Jan); G.F. Rimmelzwaan (Guus); A.D.M.E. Osterhaus (Albert); D.R. Smith (Derek Richard); C.E. Wentworth (Charles); R.A.M. Fouchier (Ron); M.T. de Graaf (Marieke)

    2014-01-01

    textabstractInfluenza A(H3N2) viruses became widespread in humans during the 1968 H3N2 virus pandemic and have been a major cause of influenza epidemics ever since. These viruses evolve continuously by reassortment and genomic evolution. Antigenic drift is the cause for the need to update influenza

  19. LRF is an essential downstream target of GATA1 in erythroid development and regulates BIM-dependent apoptosis.

    Science.gov (United States)

    Maeda, Takahiro; Ito, Keisuke; Merghoub, Taha; Poliseno, Laura; Hobbs, Robin M; Wang, Guocan; Dong, Lin; Maeda, Manami; Dore, Louis C; Zelent, Arthur; Luzzatto, Lucio; Teruya-Feldstein, Julie; Weiss, Mitchell J; Pandolfi, Pier Paolo

    2009-10-01

    GATA-1-dependent transcription is essential for erythroid differentiation and maturation. Suppression of programmed cell death is also thought to be critical for this process; however, the link between these two features of erythropoiesis has remained elusive. Here, we show that the POZ-Krüppel family transcription factor, LRF (also known as Zbtb7a/Pokemon), is a direct target of GATA1 and plays an essential antiapoptotic role during terminal erythroid differentiation. We find that loss of Lrf leads to lethal anemia in embryos, due to increased apoptosis of late-stage erythroblasts. This programmed cell death is Arf and p53 independent and is instead mediated by upregulation of the proapoptotic factor Bim. We identify Lrf as a direct repressor of Bim transcription. In strong support of this mechanism, genetic Bim loss delays the lethality of Lrf-deficient embryos and rescues their anemia phenotype. Thus, our data define a key transcriptional cascade for effective erythropoiesis, whereby GATA-1 suppresses BIM-mediated apoptosis via LRF. PMID:19853566

  20. Identification of a novel agrin-dependent pathway in cell signaling and adhesion within the erythroid niche.

    Science.gov (United States)

    Anselmo, A; Lauranzano, E; Soldani, C; Ploia, C; Angioni, R; D'amico, G; Sarukhan, A; Mazzon, C; Viola, A

    2016-08-01

    Establishment of cell-cell adhesion is crucial in embryonic development as well as within the stem cell niches of an adult. Adhesion between macrophages and erythroblasts is required for the formation of erythroblastic islands, specialized niches where erythroblasts proliferate and differentiate to produce red blood cells throughout life. The Eph family is the largest known family of receptor tyrosine kinases (RTKs) and controls cell adhesion, migration, invasion and morphology by modulating integrin and adhesion molecule activity and by modifying the actin cytoskeleton. Here, we identify the proteoglycan agrin as a novel regulator of Eph receptor signaling and characterize a novel mechanism controlling cell-cell adhesion and red cell development within the erythroid niche. We demonstrate that agrin induces clustering and activation of EphB1 receptors on developing erythroblasts, leading to the activation of α5β1 integrins. In agreement, agrin knockout mice display severe anemia owing to defective adhesion to macrophages and impaired maturation of erythroid cells. These results position agrin-EphB1 as a novel key signaling couple regulating cell adhesion and erythropoiesis. PMID:26990660

  1. Body fat mass and macronutrient intake in relation to circulating soluble leptin receptor, free leptin index, adiponectin, and resistin concentrations in healthy humans.

    Science.gov (United States)

    Yannakoulia, Mary; Yiannakouris, Nikos; Blüher, Susann; Matalas, Antonia-Leda; Klimis-Zacas, Dorothy; Mantzoros, Christos S

    2003-04-01

    The adipocyte-derived hormones leptin [which circulates in a free form and bound to a soluble leptin receptor (sOB-R)], adiponectin, and resistin play a key role in regulating energy homeostasis and metabolism. We assessed the association between body composition, total energy, and macronutrient intake and serum leptin, sOB-R, free leptin index, adiponectin, and resistin concentrations in 61 female and 53 male consecutively enrolled healthy Greek students. In this cross-sectional study, total energy and macronutrient intake were determined using 3-d food records. Body composition was assessed by bioelectrical impedance analysis; fasting blood samples were taken for the measurement of total leptin, sOB-R, adiponectin, and resistin; and the ratio leptin/sOB-R was used as an index of free leptin. Serum sOB-R concentrations were lower in the female subjects compared with the males (27.24 +/- 29.06 vs. 50.14 +/- 39.74 ng/ml, P < 0.001), whereas leptin, adiponectin, and resistin concentrations were significantly higher in females (leptin: 9.93 +/- 6.01 vs. 3.27 +/- 2.54 ng/ml, P < 0.001; adiponectin: 11.40 +/- 6.73 micro g/ml vs. 4.90 +/- 2.79 micro g/ml; P < 0.001; resistin: 16.86 +/- 5.39 ng/ml in females vs. 14.00 +/- 7.16 ng/ml in males, P < 0.02). Simple regression analysis showed that, in both genders, leptin, free leptin index, adiponectin, and resistin correlated positively with body fat mass and negatively with waist to hip ratio. sOB-R correlated negatively with body fat mass and positively with waist to hip ratio. Multiple regression analysis models controlling for gender, body fat, and total energy intake demonstrated that sOB-R is positively associated with energy intake from carbohydrates and negatively with energy intake from dietary fat, whereas free leptin index is negatively associated with energy intake from carbohydrates and positively with energy intake from dietary fat. No statistically significant correlations were observed between serum

  2. Feasibility of quantification of the distribution of blood flow in the normal human fetal circulation using CMR: a cross-sectional study

    OpenAIRE

    Seed Mike; F P van Amerom Joshua; Yoo Shi-Joon; Al Nafisi Bahiyah; Grosse-Wortmann Lars; Jaeggi Edgar; Jansz Michael S; Macgowan Christopher K

    2012-01-01

    Abstract Background We present the first phase contrast (PC) cardiovascular magnetic resonance (CMR) measurements of the distribution of blood flow in twelve late gestation human fetuses. These were obtained using a retrospective gating technique known as metric optimised gating (MOG). Methods A validation experiment was performed in five adult volunteers where conventional cardiac gating was compared with MOG. Linear regression and Bland Altman plots were used to compare MOG with the gold st...

  3. Risk group characteristics and viral transmission clusters in South-East Asian patients infected with human immunodeficiency virus-1 (HIV-1) circulating recombinant form (CRF) 01_AE and subtype B.

    Science.gov (United States)

    Oyomopito, Rebecca A; Chen, Yen-Ju; Sungkanuparph, Somnuek; Kantor, Rami; Merati, Tuti; Yam, Wing-Cheong; Sirisanthana, Thira; Li, Patrick C K; Kantipong, Pacharee; Phanuphak, Praphan; Lee, Chris K C; Kamarulzaman, Adeeba; Ditangco, Rossana; Huang, Szu-Wei; Sohn, Annette H; Law, Matthew; Chen, Yi Ming A

    2015-09-01

    Human immunodeficiency virus (HIV)-1 epidemics in Asian countries are driven by varying exposures. The epidemiology of the regional pandemic has been changing with the spread of HIV-1 to lower-risk populations through sexual transmission. Common HIV-1 genotypes include subtype B and circulating recombinant form (CRF) 01_AE. Our objective was to use HIV-1 genotypic data to better quantify local epidemics. TASER-M is a multicenter prospective cohort of HIV-infected patients. Associations between HIV exposure, patient sex, country of sample origin and HIV-1 genotype were evaluated by multivariate logistic regression. Phylogenetic methods were used on genotypic data to investigate transmission relationships. A total of 1086 patients from Thailand, Hong Kong, Malaysia and the Philippines were included in analyses. Proportions of male patients within countries varied (Thailand: 55.6%, Hong Kong: 86.1%, Malaysia: 81.4%, Philippines: 93.8%; p < 0.001) as did HIV exposures (heterosexual contact: Thailand: 85.7%, Hong Kong, 46.2%, Malaysia: 47.8%, Philippines: 25.0%; p < 0.001). After adjustment, we found increased subtype B infection among men who have sex with men, relative to heterosexual-reported exposures (odds ratio = 2.4, p < 0.001). We further describe four transmission clusters of eight to 15 treatment naïve, predominantly symptomatic patients (two each for subtype B and CRF01_AE). Risk-group subpopulations differed with respect to the infecting HIV-1 genotype. Homosexual exposure patients had higher odds of being infected with subtype B. Where HIV-1 genotypes circulate within countries or patient risk-groups, local monitoring of genotype-specific transmissions may play a role in focusing public health prevention strategies. Phylogenetic evaluations provide complementary information for surveillance and monitoring of viruses with high mutation rates such as HIV-1 and Ebola. PMID:26362956

  4. Transcriptional divergence and conservation of human and mouse erythropoiesis.

    Science.gov (United States)

    Pishesha, Novalia; Thiru, Prathapan; Shi, Jiahai; Eng, Jennifer C; Sankaran, Vijay G; Lodish, Harvey F

    2014-03-18

    Mouse models have been used extensively for decades and have been instrumental in improving our understanding of mammalian erythropoiesis. Nonetheless, there are several examples of variation between human and mouse erythropoiesis. We performed a comparative global gene expression study using data from morphologically identical stage-matched sorted populations of human and mouse erythroid precursors from early to late erythroblasts. Induction and repression of major transcriptional regulators of erythropoiesis, as well as major erythroid-important proteins, are largely conserved between the species. In contrast, at a global level we identified a significant extent of divergence between the species, both at comparable stages and in the transitions between stages, especially for the 500 most highly expressed genes during development. This suggests that the response of multiple developmentally regulated genes to key erythroid transcriptional regulators represents an important modification that has occurred in the course of erythroid evolution. In developing a systematic framework to understand and study conservation and divergence between human and mouse erythropoiesis, we show how mouse models can fail to mimic specific human diseases and provide predictions for translating findings from mouse models to potential therapies for human disease.

  5. Competition of nuclear factor-erythroid 2 factors related transcription factor isoforms, Nrf1 and Nrf2, in antioxidant enzyme induction

    Directory of Open Access Journals (Sweden)

    Nikolai L. Chepelev

    2013-01-01

    Full Text Available Although the Nrf2 (nuclear factor-erythroid 2 p45 subunit-related factor 2 regulated expression of multiple antioxidant and cytoprotective genes through the electrophile responsive element (EpRE is well established, interaction of Nrf2/EpRE with Nrf1, a closely-related transcription factor, is less well understood. Due to either proteolysis or alternative translation, Nrf1 has been found as proteins of varying size, p120, p95, and p65, which have been described as either activators of EpRE or competitive inhibitors of Nrf2. We investigated the effect of Nrf1 on EpRE-regulated gene expression using the catalytic and modifier subunits of glutamate cysteine ligase (GCLC and GCLM as models and explored the potential role of Nrf1 in altering their expression in aging and upon chronic exposure to airborne nano-sized particulate matter (nPM. Nrf1 knockout resulted in the increased expression of GCLC and GCLM in human bronchial epithelial (HBE1 cells. Overexpression Nrf2 in combination with either p120 or p65 diminished or failed to further increase the GCLC- and GLCM-EpRE luciferase activity. All known forms of Nrf1 protein, remained unchanged in the lungs of mice with age or in response to nPM. Our study shows that Nrf1 could inhibit EpRE activity in vitro, whereas the precise role of Nrf1 in vivo requires further investigations. We conclude that Nrf1 may not be directly responsible for the loss of Nrf2-dependent inducibility of antioxidant and cytoprotective genes observed in aged animals.

  6. INTERNAL CIRCULATION ENVELOPES

    CERN Multimedia

    Mail Office

    2001-01-01

    Internal mail envelopes often finish up in large piles in certain offices, thus creating a shortage for other users of the mail service, who would be grateful if everyone with an unused stock could deposit them in their mail box, after attaching them together with an elastic band or a piece of string. The messengers will then collect them so that the Mail Office can put them back in circulation. Thank you for your understanding and collaboration.

  7. Generation of a High Number of Healthy Erythroid Cells from Gene-Edited Pyruvate Kinase Deficiency Patient-Specific Induced Pluripotent Stem Cells.

    Science.gov (United States)

    Garate, Zita; Quintana-Bustamante, Oscar; Crane, Ana M; Olivier, Emmanuel; Poirot, Laurent; Galetto, Roman; Kosinski, Penelope; Hill, Collin; Kung, Charles; Agirre, Xabi; Orman, Israel; Cerrato, Laura; Alberquilla, Omaira; Rodriguez-Fornes, Fatima; Fusaki, Noemi; Garcia-Sanchez, Felix; Maia, Tabita M; Ribeiro, Maria L; Sevilla, Julian; Prosper, Felipe; Jin, Shengfang; Mountford, Joanne; Guenechea, Guillermo; Gouble, Agnes; Bueren, Juan A; Davis, Brian R; Segovia, Jose C

    2015-12-01

    Pyruvate kinase deficiency (PKD) is a rare erythroid metabolic disease caused by mutations in the PKLR gene. Erythrocytes from PKD patients show an energetic imbalance causing chronic non-spherocytic hemolytic anemia, as pyruvate kinase defects impair ATP production in erythrocytes. We generated PKD induced pluripotent stem cells (PKDiPSCs) from peripheral blood mononuclear cells (PB-MNCs) of PKD patients by non-integrative Sendai viral vectors. PKDiPSCs were gene edited to integrate a partial codon-optimized R-type pyruvate kinase cDNA in the second intron of the PKLR gene by TALEN-mediated homologous recombination (HR). Notably, we found allele specificity of HR led by the presence of a single-nucleotide polymorphism. High numbers of erythroid cells derived from gene-edited PKDiPSCs showed correction of the energetic imbalance, providing an approach to correct metabolic erythroid diseases and demonstrating the practicality of this approach to generate the large cell numbers required for comprehensive biochemical and metabolic erythroid analyses.

  8. Generation of a High Number of Healthy Erythroid Cells from Gene-Edited Pyruvate Kinase Deficiency Patient-Specific Induced Pluripotent Stem Cells

    Science.gov (United States)

    Garate, Zita; Quintana-Bustamante, Oscar; Crane, Ana M.; Olivier, Emmanuel; Poirot, Laurent; Galetto, Roman; Kosinski, Penelope; Hill, Collin; Kung, Charles; Agirre, Xabi; Orman, Israel; Cerrato, Laura; Alberquilla, Omaira; Rodriguez-Fornes, Fatima; Fusaki, Noemi; Garcia-Sanchez, Felix; Maia, Tabita M.; Ribeiro, Maria L.; Sevilla, Julian; Prosper, Felipe; Jin, Shengfang; Mountford, Joanne; Guenechea, Guillermo; Gouble, Agnes; Bueren, Juan A.; Davis, Brian R.; Segovia, Jose C.

    2015-01-01

    Summary Pyruvate kinase deficiency (PKD) is a rare erythroid metabolic disease caused by mutations in the PKLR gene. Erythrocytes from PKD patients show an energetic imbalance causing chronic non-spherocytic hemolytic anemia, as pyruvate kinase defects impair ATP production in erythrocytes. We generated PKD induced pluripotent stem cells (PKDiPSCs) from peripheral blood mononuclear cells (PB-MNCs) of PKD patients by non-integrative Sendai viral vectors. PKDiPSCs were gene edited to integrate a partial codon-optimized R-type pyruvate kinase cDNA in the second intron of the PKLR gene by TALEN-mediated homologous recombination (HR). Notably, we found allele specificity of HR led by the presence of a single-nucleotide polymorphism. High numbers of erythroid cells derived from gene-edited PKDiPSCs showed correction of the energetic imbalance, providing an approach to correct metabolic erythroid diseases and demonstrating the practicality of this approach to generate the large cell numbers required for comprehensive biochemical and metabolic erythroid analyses. PMID:26549847

  9. Generation of a High Number of Healthy Erythroid Cells from Gene-Edited Pyruvate Kinase Deficiency Patient-Specific Induced Pluripotent Stem Cells

    Directory of Open Access Journals (Sweden)

    Zita Garate

    2015-12-01

    Full Text Available Pyruvate kinase deficiency (PKD is a rare erythroid metabolic disease caused by mutations in the PKLR gene. Erythrocytes from PKD patients show an energetic imbalance causing chronic non-spherocytic hemolytic anemia, as pyruvate kinase defects impair ATP production in erythrocytes. We generated PKD induced pluripotent stem cells (PKDiPSCs from peripheral blood mononuclear cells (PB-MNCs of PKD patients by non-integrative Sendai viral vectors. PKDiPSCs were gene edited to integrate a partial codon-optimized R-type pyruvate kinase cDNA in the second intron of the PKLR gene by TALEN-mediated homologous recombination (HR. Notably, we found allele specificity of HR led by the presence of a single-nucleotide polymorphism. High numbers of erythroid cells derived from gene-edited PKDiPSCs showed correction of the energetic imbalance, providing an approach to correct metabolic erythroid diseases and demonstrating the practicality of this approach to generate the large cell numbers required for comprehensive biochemical and metabolic erythroid analyses.

  10. A short Gfi-1B isoform controls erythroid differentiation by recruiting the LSD1-corest complex through the dimethylation of its SNAG domain

    NARCIS (Netherlands)

    B. Laurent (Benoît); V. Randrianarison-Huetz (Voahangy); E. Frisan (Emilie); C. Andrieu-Soler (Charlotte); E. Soler (Eric); M. Fontenay (Michaela); I. Dusanter-Fourt (Isabelle); D. Dumenil (Dominique)

    2012-01-01

    textabstractGfi-1B is a transcriptional repressor essential for the regulation of erythropoiesis and megakaryopoiesis. Here we identify Gfi-1B p32, a Gfi-1B isoform, as essential for erythroid differentiation. Gfi-1B p32 is generated by alternative splicing and lacks the two first zinc finger domain

  11. RECOMBINANT-HUMAN-ERYTHROPOIETIN IN PATIENTS WITH MYELODYSPLASTIC SYNDROMES

    NARCIS (Netherlands)

    SCHOUTEN, HC; VELLENGA, E; VANRHENEN, DJ; DEWOLF, JTM; COPPENS, PJW; BLIJHAM, GH

    1991-01-01

    As anemia is frequently the main problem in myelodysplastic syndromes (MDS), we studied the efficacy of human erythropoietin (rhEpo) in stimulating the erythroid lineage in 14 patients, starting with 40 U/kg three times a week and doubling the dose every 6 weeks until a response was observed. The hi

  12. Subtle distinct regulations of late erythroid molecular events by PI3K/AKT-mediated activation of Spi-1/PU.1 oncogene autoregulation loop.

    Science.gov (United States)

    Breig, O; Théoleyre, O; Douablin, A; Baklouti, F

    2010-05-13

    Spi-1/PU.1 oncogene is downregulated as proerythroblasts undergo terminal differentiation. Insertion of the Friend virus upstream of the Spi-1/PU.1 locus leads to the constitutive upregulation of Spi-1/PU.1, and a subsequent block in the differentiation of the affected erythroblasts. We have shown that sustained overexpression of Spi-1/PU.1 also inhibits the erythroid splicing of protein 4.1R exon 16, irrespective of chemical induction of differentiation. Here, we show a positive feedback loop that couples constitutive phosphatidylinositol 3-kinase (PI3K)/protein kinase B (AKT) signaling to high expression of Spi-1/PU.1 in Friend erythroleukemia cells. Inhibition of PI3K/AKT results in Spi-1/PU.1 downregulation in a stepwise manner and induces cell differentiation. Chromatin immunoprecipitation assays further supported the positive autoregulatory effect of Spi-1/PU.1. Mutational analysis indicated that Ser41, but not Ser148, is necessary for Spi-1/PU.1-mediated repression of hemoglobin expression, whereas both Ser residues are required for Spi-1/PU.1 inhibition of the erythroid splicing event. We further show that inhibition of the erythroid transcriptional and splicing events are strictly dependent on distinct Spi-1/PU.1 phosphorylation modifications rather than Spi-1/PU.1 expression level per se. Our data further support the fact that Spi-1/PU.1 inhibits 4.1R erythroid splicing through two different pathways, and bring new insights into the extracellular signal impact triggered by erythropoietin on late erythroid regulatory program, including pre-mRNA splicing.

  13. Growth factor independence 1b (gfi1b is important for the maturation of erythroid cells and the regulation of embryonic globin expression.

    Directory of Open Access Journals (Sweden)

    Lothar Vassen

    Full Text Available Growth factor independence 1b (GFI1B is a DNA binding repressor of transcription with vital functions in hematopoiesis. Gfi1b-null embryos die at midgestation very likely due to defects in erythro- and megakaryopoiesis. To analyze the full functionality of Gfi1b, we used conditionally deficient mice that harbor floxed Gfi1b alleles and inducible (Mx-Cre, Cre-ERT or erythroid specific (EpoR-Cre Cre expressing transgenes. In contrast to the germline knockout, EpoR-Cre mediated erythroid specific ablation of Gfi1b allows full gestation, but causes perinatal lethality with very few mice surviving to adulthood. Both the embryonic deletion of Gfi1b by EpoR-Cre and the deletion in adult mice by Mx-Cre or Cre-ERT leads to reduced numbers of erythroid precursors, perturbed and delayed erythroid maturation, anemia and extramedullary erythropoiesis. Global expression analyses showed that the Hba-x, Hbb-bh1 and Hbb-y embryonic globin genes were upregulated in Gfi1b deficient TER119+ fetal liver cells over the gestation period from day 12.5-17.5 p.c. and an increased level of Hbb-bh1 and Hbb-y embryonic globin gene expression was even maintained in adult Gfi1b deficient mice. While the expression of Bcl11a, a regulator of embryonic globin expression was not affected by Gfi1b deficiency, the expression of Gata1 was reduced and the expression of Sox6, also involved in globin switch, was almost entirely lost when Gfi1b was absent. These findings establish Gfi1b as a regulator of embryonic globin expression and embryonic and adult erythroid maturation.

  14. BIM-enabled Conceptual Modelling and Representation of Building Circulation

    Directory of Open Access Journals (Sweden)

    Jin Kook Lee

    2014-08-01

    Full Text Available This paper describes how a building information modelling (BIM-based approach for building circulation enables us to change the process of building design in terms of its computational representation and processes, focusing on the conceptual modelling and representation of circulation within buildings. BIM has been designed for use by several BIM authoring tools, in particular with the widely known interoperable industry foundation classes (IFCs, which follow an object-oriented data modelling methodology. Advances in BIM authoring tools, using space objects and their relations defined in an IFC’s schema, have made it possible to model, visualize and analyse circulation within buildings prior to their construction. Agent-based circulation has long been an interdisciplinary topic of research across several areas, including design computing, computer science, architectural morphology, human behaviour and environmental psychology. Such conventional approaches to building circulation are centred on navigational knowledge about built environments, and represent specific circulation paths and regulations. This paper, however, places emphasis on the use of ‘space objects’ in BIM-enabled design processes rather than on circulation agents, the latter of which are not defined in the IFCs’ schemas. By introducing and reviewing some associated research and projects, this paper also surveys how such a circulation representation is applicable to the analysis of building circulation-related rules.

  15. Human parvovirus B19 can infect cynomolgus monkey marrow cells in tissue culture.

    OpenAIRE

    Gallinella, G.; Anderson, S M; Young, N S; Brown, K E

    1995-01-01

    The human pathogenic parvovirus B19 cannot be grown in standard tissue culture but propagates in human bone marrow, where it is cytotoxic to erythroid progenitor cells. We now show that parvovirus B19 can replicate in cynomolgus bone marrow. Cynomolgus monkeys may be a suitable animal model for pathogenesis studies of parvovirus B19.

  16. Head exposure system for a human provocation study to assess the possible influence of UMTS-like electromagnetic fields on cerebral blood circulation using near-infrared imaging.

    Science.gov (United States)

    Lehmann, Hugo; Pollara, Laurent; Spichtig, Sonja; Kühn, Sven; Wolf, Martin

    2012-02-01

    A head exposure setup for efficient and precisely defined exposure of human subjects equipped with a near-infrared imaging (NIRI) sensor is presented. In a partially shielded anechoic chamber the subjects were exposed to Universal Mobile Telecommunications System (UMTS)-like electromagnetic fields (EMF) by using a patch antenna at a distance of 4 cm from the head. The non-contact design of the exposure setup enabled NIRI sensors to easily attach to the head. Moreover, different regions of the head were chosen for localised exposure and simultaneous NIRI investigation. The control software enabled the simple adaptation of the test parameters during exploratory testing as well as the performance of controlled, randomised, crossover and double-blind provocation studies. Four different signals with a carrier frequency of 1900 MHz were chosen for the exposure: a simple continuous wave signal and three different UMTS signals. Furthermore, three exposure doses were available: sham, low (spatial peak specific absorption rate (SAR) = 0.18 W/kg averaged over 10 g) and high (spatial peak SAR = 1.8 W/kg averaged over 10 g). The SAR assessment was performed by measurement and simulation. Direct comparison of measurement and numerical results showed good agreement in terms of spatial peak SAR and SAR distribution. The variability analysis of the spatial peak SAR over 10 g was assessed by numerical simulations. Maximal deviations of -22% and +32% from the nominal situation were observed. Compared to other exposure setups, the present setup allows for low exposure uncertainty, combined with high SAR efficiency, easy access for the NIRI sensor and minimal impairment of test subjects. PMID:21842517

  17. Modelled Circulation In Storfjorden

    Science.gov (United States)

    Skogseth, R.; Asplin, L.

    The model area Storfjorden is situated between the islands Spitsbergen, Barentsöya and Edgeöya at the Svalbard Archipelago. The entrance of Storfjorden is defined by a shallow bank Storfjordbanken and some small islands Tusenöyane in southeast, and by an 115m deep sill at about 76 45' N in the south. Maximum depth in Storfjorden is 190m, which is surrounded by gradually shallower shelves in the north, the east and southeast. A steep bottom slope is present on the western side of Storfjorden. He- leysundet and Freemansundet, two sounds between respectively Spitsbergen and Bar- entsöya, and Barentsöya and Edgeöya, define two narrow and shallow entrances in the north and northeast connecting Storfjorden with the northwestern Barents Sea. Strong tidal currents exist in Heleysundet (4-5ms-1) and Freemansundet (2-3ms-1), but the general circulation in Storfjorden is not well known. The coastal current in Storfjor- den is cyclonic directed into Storfjorden south of Edgeöya from the East Spitsbergen Current and out of Storfjorden south of Spitsbergen where it is called Sørkappstrøm- men. A three-dimensional sigma layered numerical ocean model called Bergen Ocean Model (BOM) was used to simulate the circulation in Storfjorden with Freemansundet opened. Two simulations were carried out, one with heat flux (100 Wm-2) and one without heat flux from the ocean to the atmosphere. The heat flux was applied only in the proper fjord area north of the sill and not outside as a crude approximation of the effects of a polynya in the sea ice cover during winter. Both simulations had a 4km horizontal resolution and 21 sigma layers. The model is forced by winds (from the NCEP reanalyzed fields) and tides. Initial fields are from the DNMI/IMR climatol- ogy. The model simulation without heat flux gave a circulation heavily dependent on tidal forcing, showing strong tidal currents up to 2ms-1 in Freemansundet, between Tusenöyane and on Storfjordbanken southwest of Edgeöya. Earlier

  18. Resolvability in Circulant Graphs

    Institute of Scientific and Technical Information of China (English)

    Muhammad SALMAN; Imran JAVAID; Muhammad Anwar CHAUDHRY

    2012-01-01

    A set W of the vertices of a connected graph G is called a resolving set for G if for every two distinct vertices u,v ∈ V(G) there is a vertex w ∈ W such that d(u,w) ≠ d(v,w).A resolving set of minimum cardinality is called a metric basis for G and the number of vertices in a metric basis is called the metric dimension of G,denoted by dim(G).For a vertex u of G and a subset S of V(G),the distance between u and S is the number mins∈s d(u,s).A k-partition H ={S1,S2,...,Sk} of V(G) is called a resolving partition if for every two distinct vertices u,v ∈ V(G) there is a set Si in Π such that d(u,Si) ≠ d(v,Si).The minimum k for which there is a resolving k-partition of V(G) is called the partition dimension of G,denoted by pd(G).The circulant graph is a graph with vertex set Zn,an additive group ofintegers modulo n,and two vertices labeled i and j adjacent if and only if i - j (mod n) ∈ C,where C C Zn has the property that C =-C and 0(∈) C.The circulant graph is denoted by Xn,△ where A =|C|.In this paper,we study the metric dimension of a family of circulant graphs Xn,3 with connection set C ={1,-n/2,n - 1} and prove that dim(Xn,3) is independent of choice of n by showing that 3 for all n =0 (mod 4),dim(X,n,3) ={ 4 for all n =2 (mod 4).We also study the partition dimension of a family of circulant graphs Xn,4 with connection set C ={±1,±2} and prove that pd(Xn,4) is independent of choice of n and show that pd(X5,4) =5 and 3 forall odd n≥9,pd(Xn,4) ={ 4 for all even n ≥ 6 and n =7.

  19. Protein structure of fetal antigen 1 (FA1). A novel circulating human epidermal-growth-factor-like protein expressed in neuroendocrine tumors and its relation to the gene products of dlk and pG2

    DEFF Research Database (Denmark)

    Jensen, Charlotte Harken; Krogh, Thomas N; Højrup, Peter;

    1994-01-01

    to the vascular structure. In the pancreas, FA1 co-localized with insulin in the insulin secretory granules of the beta cells within the islets of Langerhans. Our findings suggest that FA1 is synthesized as a membrane anchored protein and released into the circulation after enzymic cleavage, and that circulating...

  20. Circulatory shear flow alters the viability and proliferation of circulating colon cancer cells

    OpenAIRE

    Rong Fan; Travis Emery; Yongguo Zhang; Yuxuan Xia; Jun Sun; Jiandi Wan

    2016-01-01

    During cancer metastasis, circulating tumor cells constantly experience hemodynamic shear stress in the circulation. Cellular responses to shear stress including cell viability and proliferation thus play critical roles in cancer metastasis. Here, we developed a microfluidic approach to establish a circulatory microenvironment and studied circulating human colon cancer HCT116 cells in response to a variety of magnitude of shear stress and circulating time. Our results showed that cell viabili...

  1. North Atlantic Circulation

    Science.gov (United States)

    Molinari, R.; Bryan, K.; Schott, F.

    The intensity of the North Atlantic winddriven and thermohaline circulation and the close proximity of many oceanographic installations make the North Atlantic a particularly favored region of the world ocean from the standpoint of research in ocean circulation. Recent increases in available data and advances in numerical modeling techniques served as the impetus to convene a joint workshop of modelers and observers working on the North Atlantic with the Scientific Committee on Oceanic Research (SCOR) Working Group (WG) 68 (“North Atlantic Circulation”). Goals of the workshop were to provide an update on data sets and models and to discuss the poleward heat flux problem and possible monitoring strategies. The joint Workshop/SCOR WG-68 meeting was convened by F. Schott (chairman of the working group; Rosenstiel School of Marine and Atmospheric Science, Miami, Fla.), K. Bryan (National Oceanic and Atmospheric Administration/ Geophysical Fluid Dynamics Laboratory (NOAA/GFDL)), and R. Molinari (NOAA/Atlantic Oceanographic and Meteorological Laboratory (NOAA/AOML)).

  2. Ocean General Circulation Models

    Energy Technology Data Exchange (ETDEWEB)

    Yoon, Jin-Ho; Ma, Po-Lun

    2012-09-30

    1. Definition of Subject The purpose of this text is to provide an introduction to aspects of oceanic general circulation models (OGCMs), an important component of Climate System or Earth System Model (ESM). The role of the ocean in ESMs is described in Chapter XX (EDITOR: PLEASE FIND THE COUPLED CLIMATE or EARTH SYSTEM MODELING CHAPTERS). The emerging need for understanding the Earth’s climate system and especially projecting its future evolution has encouraged scientists to explore the dynamical, physical, and biogeochemical processes in the ocean. Understanding the role of these processes in the climate system is an interesting and challenging scientific subject. For example, a research question how much extra heat or CO2 generated by anthropogenic activities can be stored in the deep ocean is not only scientifically interesting but also important in projecting future climate of the earth. Thus, OGCMs have been developed and applied to investigate the various oceanic processes and their role in the climate system.

  3. Percutaneous interventions in Fontan circulation

    Directory of Open Access Journals (Sweden)

    Eduardo Franco

    2015-09-01

    Conclusions: Interventional catheterization procedures are often necessary to reach and maintain the fragile Fontan circulation, mainly in patients with right morphology systemic ventricles and fenestrated Fontan conduits.

  4. BET bromodomain inhibition rescues erythropoietin differentiation of human erythroleukemia cell line UT7

    International Nuclear Information System (INIS)

    Highlights: ► UT7 erythroleukemia cells are known to be refractory to differentiate. ► Brief JQ1 treatment initiates the first steps of erythroid differentiation program. ► Engaged UT7 cells then maturate in the presence of erythropoietin. ► Sustained JQ1 treatment inhibits both proliferation and erythroid differentiation. -- Abstract: Malignant transformation is a multistep process requiring oncogenic activation, promoting cellular proliferation, frequently coupled to inhibition of terminal differentiation. Consequently, forcing the reengagement of terminal differentiation of transformed cells coupled or not with an inhibition of their proliferation is a putative therapeutic approach to counteracting tumorigenicity. UT7 is a human leukemic cell line able to grow in the presence of IL3, GM-CSF and Epo. This cell line has been widely used to study Epo-R/Epo signaling pathways but is a poor model for erythroid differentiation. We used the BET bromodomain inhibition drug JQ1 to target gene expression, including that of c-Myc. We have shown that only 2 days of JQ1 treatment was required to transitory inhibit Epo-induced UT7 proliferation and to restore terminal erythroid differentiation. This study highlights the importance of a cellular erythroid cycle break mediated by c-Myc inhibition before initiation of the erythropoiesis program and describes a new model for BET bromodomain inhibitor drug application.

  5. Engineering a human bone marrow model: a case study on ex vivo erythropoiesis.

    Science.gov (United States)

    Mantalaris, A; Keng, P; Bourne, P; Chang, A Y; Wu, J H

    1998-01-01

    Bone marrow, with its intricate, three-dimensional tissue structure facilitating cell-cell interactions, provides a microenvironment supporting the production of hundreds of billions of multilineal blood cells everyday. We have developed a three-dimensional bone marrow culture system in which marrow cells are cultured in a reactor packed with porous microspheres. The culture supports a three-dimensional growth configuration and multilineal hemopoiesis mimicking the bone marrow in vivo. We studied ex vivo human erythropoiesis using the three-dimensional culture system. The system sustained extensive erythropoiesis at low erythropoietin concentrations (0.2 U/mL), plus stem cell factor, interleukin-3, granulocyte-macrophage colony-stimulating factor, and insulin-like growth factor-I. Erythroid cell production lasted for more than 5 weeks, and the percentage of erythroid cells in the nonadherent cell population was approximately 60%. Flow cytometric analysis using cell surface markers specific for erythroid cells (CD71 and glycophorin-A) indicated that the culture produced early, intermediate, and late erythroid cells. As the culture progressed, the erythroid cell population shifted gradually toward mature cell types. When compared to the three-dimensional culture, the traditional flask cultures failed to support extensive erythropoiesis under the same conditions. This indicates that the three-dimensional bone marrow culture system provides a microenvironment conducive to erythropoiesis under more physiological conditions and is a better bone marrow model.

  6. BET bromodomain inhibition rescues erythropoietin differentiation of human erythroleukemia cell line UT7

    Energy Technology Data Exchange (ETDEWEB)

    Goupille, Olivier [CEA, Institute of Emerging Diseases and Innovative Therapies, Fontenay-aux-Roses (France); UMR INSERM U.962, University Paris XI, CEA, Fontenay-aux-Roses (France); Penglong, Tipparat [CEA, Institute of Emerging Diseases and Innovative Therapies, Fontenay-aux-Roses (France); UMR INSERM U.962, University Paris XI, CEA, Fontenay-aux-Roses (France); Thalassemia Research Center and Department of Clinical Pathology, Faculty of Medicine, Ramathibodi Hospital, Mahidol University (Thailand); Lefevre, Carine; Granger, Marine; Kadri, Zahra [CEA, Institute of Emerging Diseases and Innovative Therapies, Fontenay-aux-Roses (France); UMR INSERM U.962, University Paris XI, CEA, Fontenay-aux-Roses (France); Fucharoen, Suthat [Thalassemia Research Center and Department of Clinical Pathology, Faculty of Medicine, Ramathibodi Hospital, Mahidol University (Thailand); Maouche-Chretien, Leila [CEA, Institute of Emerging Diseases and Innovative Therapies, Fontenay-aux-Roses (France); UMR INSERM U.962, University Paris XI, CEA, Fontenay-aux-Roses (France); Leboulch, Philippe [CEA, Institute of Emerging Diseases and Innovative Therapies, Fontenay-aux-Roses (France); UMR INSERM U.962, University Paris XI, CEA, Fontenay-aux-Roses (France); Genetics Division, Department of Medicine, Brigham and Women' s Hospital and Harvard Medical School, Boston, MA (United States); Chretien, Stany, E-mail: stany.chretien@cea.fr [CEA, Institute of Emerging Diseases and Innovative Therapies, Fontenay-aux-Roses (France); UMR INSERM U.962, University Paris XI, CEA, Fontenay-aux-Roses (France)

    2012-12-07

    Highlights: Black-Right-Pointing-Pointer UT7 erythroleukemia cells are known to be refractory to differentiate. Black-Right-Pointing-Pointer Brief JQ1 treatment initiates the first steps of erythroid differentiation program. Black-Right-Pointing-Pointer Engaged UT7 cells then maturate in the presence of erythropoietin. Black-Right-Pointing-Pointer Sustained JQ1 treatment inhibits both proliferation and erythroid differentiation. -- Abstract: Malignant transformation is a multistep process requiring oncogenic activation, promoting cellular proliferation, frequently coupled to inhibition of terminal differentiation. Consequently, forcing the reengagement of terminal differentiation of transformed cells coupled or not with an inhibition of their proliferation is a putative therapeutic approach to counteracting tumorigenicity. UT7 is a human leukemic cell line able to grow in the presence of IL3, GM-CSF and Epo. This cell line has been widely used to study Epo-R/Epo signaling pathways but is a poor model for erythroid differentiation. We used the BET bromodomain inhibition drug JQ1 to target gene expression, including that of c-Myc. We have shown that only 2 days of JQ1 treatment was required to transitory inhibit Epo-induced UT7 proliferation and to restore terminal erythroid differentiation. This study highlights the importance of a cellular erythroid cycle break mediated by c-Myc inhibition before initiation of the erythropoiesis program and describes a new model for BET bromodomain inhibitor drug application.

  7. Neuronal messengers in the human cerebral circulation

    DEFF Research Database (Denmark)

    Gulbenkian, S; Uddman, R; Edvinsson, L

    2001-01-01

    neuronal regulation of cerebral blood flow. Although little is known about the physiological actions and inter-relationships among all these putative neurotransmitters, their presence within cerebrovascular nerve fibers will make it necessary to revise our view on the mechanisms of cerebrovascular...

  8. In Vivo Biomechanics of Human Pulmonary Circulation /

    OpenAIRE

    Arai, Tatsuya J.

    2013-01-01

    Gas exchange between inhaled alveolar air and pulmonary capillary blood occurs in the lung. The relationship between ventilation and perfusion determines the global efficiency of gas exchange in the lung. The normal healthy lung maintains a regional ventilation-perfusion ratio close to unity, whereas in disease, the regional ventilation-perfusion mismatch results in inefficient gas exchange, leading to arterial hypoxemia. The original research presented in this dissertation focused on factors...

  9. The Donders model of the circulation in normo- and pathophysiology

    DEFF Research Database (Denmark)

    Noordergraaf, Gerrit J.; Ottesen, Johnny T.; Kortsmit, Wil J.P.M.;

    2006-01-01

    A model of the closed human cardiovascular loop is developed. This model, using one set of 88 equations, allows variations from normal resting conditions to exercise, as well as to the extreme condition of a circulation following cardiac arrest. The principal purpose of the model is to evaluate...... the continuum of physiological conditions to cardiopulmonary resuscitation effects within the circulation.   Within the model, Harvey's view of the circulation has been broadened to include impedance-defined flow as a unifying concept. The cardiac function curve, the relation between ventricular filling...

  10. A common signaling pathway is activated in erythroid cells expressing high levels of fetal hemoglobin: a potential role for cAMP-elevating agents in β-globin disorders

    Directory of Open Access Journals (Sweden)

    Ikuta T

    2013-12-01

    Full Text Available Tohru Ikuta,1 Yuichi Kuroyanagi,1 Nadine Odo,1 Siyang Liu21Department of Anesthesiology and Perioperative Medicine, 2Department of Physiology, Medical College of Georgia, Georgia Regents University, Augusta, GA, USABackground: Although erythroid cells prepared from fetal liver, cord blood, or blood from β-thalassemia patients are known to express fetal hemoglobin at high levels, the underlying mechanisms remain elusive. We previously showed that cyclic nucleotides such as cAMP and cGMP induce fetal hemoglobin expression in primary erythroid cells. Here we report that cAMP signaling contributes to high-level fetal hemoglobin expression in erythroid cells prepared from cord blood and β-thalassemia.Methods: The status of the cAMP signaling pathway was investigated using primary erythroid cells prepared from cord blood and the mononuclear cells of patients with β-thalassemia; erythroid cells from adult bone marrow mononuclear cells served as the control.Results: We found that intracellular cAMP levels were higher in erythroid cells from cord blood and β-thalassemia than from adult bone marrow. Protein kinase A activity levels and cAMP-response element binding protein phosphorylation were higher in erythroid cells from cord blood or β-thalassemia than in adult bone marrow progenitors. Mitogen-activated protein kinase pathways, which play a role in fetal hemoglobin expression, were not consistently activated in cord blood or β-thalassemia erythroid cells. When cAMP signaling was activated in adult erythroid cells, fetal hemoglobin was induced at high levels and associated with reduced expression of BCL11A, a silencer of the β-globin gene.Conclusion: These results suggest that activated cAMP signaling may be a common mechanism among erythroid cells with high fetal hemoglobin levels, in part because of downregulation of BCL11A. Activation of the cAMP signaling pathway with cAMP-elevating agents may prove to be an important signaling mechanism to

  11. Consumption of fructose- but not glucose-sweetened beverages for 10 weeks increases circulating concentrations of uric acid, retinol binding protein-4, and gamma-glutamyl transferase activity in overweight/obese humans

    Directory of Open Access Journals (Sweden)

    Cox Chad L

    2012-07-01

    Full Text Available Abstract Background Prospective studies in humans examining the effects of fructose consumption on biological markers associated with the development of metabolic syndrome are lacking. Therefore we investigated the relative effects of 10 wks of fructose or glucose consumption on plasma uric acid and RBP-4 concentrations, as well as liver enzyme (AST, ALT, and GGT activities in men and women. Methods As part of a parallel arm study, older (age 40–72, overweight and obese male and female subjects (BMI 25–35 kg/m2 consumed glucose- or fructose-sweetened beverages providing 25% of energy requirements for 10 wks. Fasting and 24-h blood collections were performed at baseline and following 10 wks of intervention and plasma concentrations of uric acid, RBP-4 and liver enzyme activities were measured. Results Consumption of fructose, but not glucose, led to significant increases of 24-h uric acid profiles (P P = 0.012, as well as plasma GGT activity (P = 0.04. Fasting plasma uric acid concentrations increased in both groups; however, the response was significantly greater in subjects consuming fructose (P = 0.002 for effect of sugar. Within the fructose group male subjects exhibited larger increases of RBP-4 levels than women (P = 0.024. Conclusions These findings suggest that consumption of fructose at 25% of energy requirements for 10 wks, compared with isocaloric consumption of glucose, may contribute to the development of components of the metabolic syndrome by increasing circulating uric acid, GGT activity, suggesting alteration of hepatic function, and the production of RBP-4.

  12. Sino-Danish Brain Circulation

    DEFF Research Database (Denmark)

    Bertelsen, Rasmus Gjedssø; Du, Xiangyun; Søndergaard, Morten Karnøe

    2014-01-01

    China is faced with urgent needs to develop an economically and environmentally sustainable economy based on innovation and knowledge. Brain circulation and research and business investments from the outside are central for this development. Sino-American brain circulation and research...... and investment by overseas researchers and entrepreneurs are well described. In that case, the US is the center of global R&D and S&T. However, the brain circulation and research and investments between a small open Scandinavian economy, such as Denmark, and the huge developing economy of China are not well...... understood. In this case, Denmark is very highly developed, but a satellite in the global R&D and S&T system. With time and the growth of China as a R&D and S&T power house, both Denmark and China will benefit from brain circulation between them. Such brain circulation is likely to play a key role in flows...

  13. TROPICAL METEOROLOGY & Climate: Hadley Circulation

    Energy Technology Data Exchange (ETDEWEB)

    Lu, Jian; Vecchi, Gabriel A.

    2015-01-30

    The Hadley circulation, a prominent circulation feature characterized by rising air near the Equator and sinking air in the subtropics, defines the position of dry subtropical areas and is a fundamental regulator of the earth’s energy and momentum budgets. The character of the Hadley circulation, and its related precipitation regimes, exhibits variation and change in response to both climate variability and radiative forcing changes. The strength and position of the Hadley circulation change from year to year paced by El Niño and La Niña events. Over the last few decades of the twentieth century, the Hadley cell has expanded poleward in both hemispheres, with changes in atmospheric composition (including stratospheric ozone depletion and greenhouse gas increases) thought to have contributed to its expansion. This article introduces the basic phenomenology and driving mechanism of the Hadley circulation and discusses its variations under both natural and anthropogenic climate forcings.

  14. Haem-regulated eIF2α kinase is necessary for adaptive gene expression in erythroid precursors under the stress of iron deficiency

    Science.gov (United States)

    Liu, Sijin; Bhattacharya, Sanchita; Han, Anping; Suragani, Rajasekhar N. V. S.; Zhao, Wanting; Fry, Rebecca C.; Chen, Jane-Jane

    2016-01-01

    Summary Haem-regulated eIF2α kinase (HRI) is essential for the regulation of globin gene translation and the survival of erythroid precursors in iron/haem deficiency. This study found that that in iron deficiency, fetal definitive erythropoiesis is inhibited at the basophilic erythroblast stage with increased proliferation and elevated apoptosis. This hallmark of ineffective erythropoiesis is more severe in HRI deficiency. Microarray gene profiling analysis showed that HRI was required for adaptive gene expression in erythroid precursors during chronic iron deficiency. The number of genes with expression affected more than twofold increased, from 213 in iron deficiency and 73 in HRI deficiency, to 3135 in combined iron and HRI deficiencies. Many of these genes are regulated by Gata1 and Fog1. We demonstrate for the first time that Gata1 expression in developing erythroid precursors is decreased in iron deficiency, and is decreased further in combined iron and HRI deficiencies. Additionally, Fog1 expression is decreased in combined deficiencies, but not in iron or HRI deficiency alone. Our results indicate that HRI confers adaptive gene expression in developing erythroblasts during iron deficiency through maintaining Gata1/Fog1 expression. PMID:18665838

  15. Synergistic Effect of Sodium Butyrate and Thalidomide in the Induction of Fetal Hemoglobin Expression in Erythroid Progenitors Derived from Cord Blood CD133 + Cells

    Directory of Open Access Journals (Sweden)

    Ali Dehghanifard

    2012-07-01

    Full Text Available Background: The use of drugs with the ability to induce production of fetal hemoglobin as a novel therapeutic approach in treating β-Hemoglobinopathies is considered. γ-globin gene expression inducer drugs including sodium butyrate and thalidomide can reduce additional α-globin chains accumulation in erythroid precursors. Materials and Methods: In this experimental study, MACS kit was used to isolate CD133+ cells of umbilical cord blood. Further, the effect of two drugs of thalidomide and sodium butyrate were separately and combined studied on the induction of quantitative expression of β-globin and γ-globin genes in erythroid precursor cells derived from CD133+ stem cells in-vitro. For this purpose, the technique SYBR green Real-time PCR was used.Results: Flow cytometry results showed that approximately 95% of purified cells were CD133+. Real-time PCR results also showed the increased levels of γ-globin mRNA in the cell groups treated with thalidomide, sodium butyrate and combination of drugs as 2.6 and 1.2 and 3.5 times respectively, and for β-globin gene, it is respectively 1.4 and 1.3 and 1.6 times compared with the control group (p<0.05.Conclusion: The study results showed that the mentioned drug combination can act as a pharmaceutical composition affecting the induction of fetal hemoglobin expression in erythroid precursor cells derived from CD133 + cells.

  16. β-globin gene promoter generates 5' truncated transcripts in the embryonic foetal erythroid environment.

    NARCIS (Netherlands)

    K. Khazaie; F. Gounari; M. Antoniou (Michael); E. de Boer (Ernie); F.G. Grosveld (Frank)

    1987-01-01

    textabstractWe report here the localisation of sequences responsible for the faulty expression of human beta-globin gene in Putko and K562 cells. Complete beta-globin gene introduced into these cells produces transcripts with abnormal 5' ends, while cotransfected mouse H2 gene is expressed correctly

  17. Neuroprotective effects of salidroside on focal cerebral ischemia/reperfusion injury involves the nuclear erythroid 2-related factor 2 pathway

    Directory of Open Access Journals (Sweden)

    Jing Han

    2015-01-01

    Full Text Available Salidroside, the main active ingredient extracted from Rhodiola crenulata, has been shown to be neuroprotective in ischemic cerebral injury, but the underlying mechanism for this neuroprotection is poorly understood. In the current study, the neuroprotective effect of salidroside on cerebral ischemia-induced oxidative stress and the role of the nuclear factor erythroid 2-related factor 2 (Nrf2 pathway was investigated in a rat model of middle cerebral artery occlusion. Salidroside (30 mg/kg reduced infarct size, improved neurological function and histological changes, increased activity of superoxide dismutase and glutathione-S-transferase, and reduced malon-dialdehyde levels after cerebral ischemia and reperfusion. Furthermore, salidroside apparently increased Nrf2 and heme oxygenase-1 expression. These results suggest that salidroside exerts its neuroprotective effect against cerebral ischemia through anti-oxidant mechanisms and that activation of the Nrf2 pathway is involved. The Nrf2/antioxidant response element pathway may become a new therapeutic target for the treatment of ischemic stroke.

  18. The effects of erythropoietin signaling on telomerase regulation in non-erythroid malignant and non-malignant cells

    Energy Technology Data Exchange (ETDEWEB)

    Uziel, Orit, E-mail: Oritu@clalit.org.il [Felsenstein Medical Research Center, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Kanfer, Gil [Felsenstein Medical Research Center, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Dep. of Human Molecular Genetics and Biochemistry, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Beery, Einat [Felsenstein Medical Research Center, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Yelin, Dana; Shepshelovich, Daniel [Medicine A, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Bakhanashvili, Mary [Unit of Infectious Diseases, Sheba Medical Center, Tel-Hashomer (Israel); Nordenberg, Jardena [Felsenstein Medical Research Center, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Dep. of Human Molecular Genetics and Biochemistry, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Endocrinology Laboratory, Beilinson Medical Center, Petah-Tikva (Israel); Lahav, Meir [Felsenstein Medical Research Center, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Medicine A, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel)

    2014-07-18

    Highlights: • We assumed that some of erythropoietin adverse effects may be mediated by telomerase activity. • EPO administration increased telomerase activity, cells proliferation and migration. • The inhibition of telomerase modestly repressed the proliferative effect of erythropoietin. • Telomere shortening caused by long term inhibition of the enzyme totally abolished that effect. • This effect was mediated via the Lyn–AKT axis and not by the canonical JAK2–STAT pathway. - Abstract: Treatment with erythropoietin (EPO) in several cancers is associated with decreased survival due to cancer progression. Due to the major importance of telomerase in cancer biology we hypothesized that some of these effects may be mediated through EPO effect on telomerase. For this aim we explored the possible effects of EPO on telomerase regulation, cell migration and chemosensitivity in non-erythroid malignant and non-malignant cells. Cell proliferation, telomerase activity (TA) and cell migration increased in response to EPO. EPO had no effect on cancer cells sensitivity to cisplatinum and on the cell cycle status. The inhibition of telomerase modestly repressed the proliferative effect of EPO. Telomere shortening caused by long term inhibition of the enzyme abolished the effect of EPO, suggesting that EPO effects on cancer cells are related to telomere dynamics. TA was correlated with the levels of Epo-R. The increase in TA was mediated post-translationally through the Lyn-Src and not the canonical JAK2 pathway.

  19. A protective role of nuclear factor-erythroid 2-related factor-2 (Nrf2) in inflammatory disorders

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Jiyoung [National Research Laboratory, College of Pharmacy, Graduate School of Convergence Science and Technology, Seoul National University, Seoul 151-742 (Korea, Republic of); Cha, Young-Nam [Inha University College of Medicine, Incheon 382-751 (Korea, Republic of); Surh, Young-Joon, E-mail: surh@plaza.snu.ac.kr [National Research Laboratory, College of Pharmacy, Graduate School of Convergence Science and Technology, Seoul National University, Seoul 151-742 (Korea, Republic of); Department of Molecular Medicine and Biopharmaceutical Sciences, Graduate School of Convergence Science and Technology, Seoul National University, Seoul 151-742 (Korea, Republic of); Cancer Research Institute, Seoul National University, Seoul 110-799 (Korea, Republic of)

    2010-08-07

    Nuclear factor-erythroid 2-related factor-2 (Nrf2) is a key transcription factor that plays a central role in cellular defense against oxidative and electrophilic insults by timely induction of antioxidative and phase-2 detoxifying enzymes and related stress-response proteins. The 5'-flanking regions of genes encoding these cytoprotective proteins contain a specific consensus sequence termed antioxidant response element (ARE) to which Nrf2 binds. Recent studies have demonstrated that Nrf2-ARE signaling is also involved in attenuating inflammation-associated pathogenesis, such as autoimmune diseases, rheumatoid arthritis, asthma, emphysema, gastritis, colitis and atherosclerosis. Thus, disruption or loss of Nrf2 signaling causes enhanced susceptibility not only to oxidative and electrophilic stresses but also to inflammatory tissue injuries. During the early-phase of inflammation-mediated tissue damage, activation of Nrf2-ARE might inhibit the production or expression of pro-inflammatory mediators including cytokines, chemokines, cell adhesion molecules, matrix metalloproteinases, cyclooxygenase-2 and inducible nitric oxide synthase. It is likely that the cytoprotective function of genes targeted by Nrf2 may cooperatively regulate the innate immune response and also repress the induction of pro-inflammatory genes. This review highlights the protective role of Nrf2 in inflammation-mediated disorders with special focus on the inflammatory signaling modulated by this redox-regulated transcription factor.

  20. Global genetic architecture of an erythroid quantitative trait locus, HMIP-2.

    Science.gov (United States)

    Menzel, Stephan; Rooks, Helen; Zelenika, Diana; Mtatiro, Siana N; Gnanakulasekaran, Akshala; Drasar, Emma; Cox, Sharon; Liu, Li; Masood, Mariam; Silver, Nicholas; Garner, Chad; Vasavda, Nisha; Howard, Jo; Makani, Julie; Adekile, Adekunle; Pace, Betty; Spector, Tim; Farrall, Martin; Lathrop, Mark; Thein, Swee Lay

    2014-11-01

    HMIP-2 is a human quantitative trait locus affecting peripheral numbers, size and hemoglobin composition of red blood cells, with a marked effect on the persistence of the fetal form of hemoglobin, HbF, in adults. The locus consists of multiple common variants in an enhancer region for MYB (chr 6q23.3), which encodes the hematopoietic transcription factor cMYB. Studying a European population cohort and four African-descended groups of patients with sickle cell anemia, we found that all share a set of two spatially separate HbF-promoting alleles at HMIP-2, termed "A" and "B." These typically occurred together ("A-B") on European chromosomes, but existed on separate homologous chromosomes in Africans. Using haplotype signatures for "A" and "B," we interrogated public population datasets. Haplotypes carrying only "A" or "B" were typical for populations in Sub-Saharan Africa. The "A-B" combination was frequent in European, Asian, and Amerindian populations. Both alleles were infrequent in tropical regions, possibly undergoing negative selection by geographical factors, as has been reported for malaria with other hematological traits. We propose that the ascertainment of worldwide distribution patterns for common, HbF-promoting alleles can aid their further genetic characterization, including the investigation of gene-environment interaction during human migration and adaptation. PMID:25069958

  1. Atmospheric Circulation of Terrestrial Exoplanets

    OpenAIRE

    Showman, Adam P.; Wordsworth, Robin D.; Merlis, Timothy M.; Kaspi, Yohai

    2013-01-01

    The investigation of planets around other stars began with the study of gas giants, but is now extending to the discovery and characterization of super-Earths and terrestrial planets. Motivated by this observational tide, we survey the basic dynamical principles governing the atmospheric circulation of terrestrial exoplanets, and discuss the interaction of their circulation with the hydrological cycle and global-scale climate feedbacks. Terrestrial exoplanets occupy a wide range of physical a...

  2. 西藏藏族人群中细小病毒B19基因与内地汉族人群的差异%Different human parvovirus B19 subgroup circulation in Tibet and Han population in China

    Institute of Scientific and Technical Information of China (English)

    朱娜; 佟瑞; 周为民; 谭心怡; 楼永良; 谭文杰

    2015-01-01

    目的 分析人细小病毒B19及人细小病毒4(PARV4)在西藏藏族人群中与内地汉族人群中的基因特点.方法 采用建立的B19与PARV4 PCR筛查方法,分别从西藏藏族人群中与内地汉族人群血液标本中获得人细小病毒B19及PARV4的部分基因片段,经纯化、测序后,进行基因进化树分析.结果 共获得10个B19 VP1基因片段序列(西藏,2个;四川,3个;浙江,5个);10个PAV4ORF1基因片段序列(西藏,2个;四川,2个;云南,1个;浙江,5个);西藏藏族人群中细小病毒B19基因与内地汉族人群同属基因1A亚型,但为不同进化分支;而西藏藏族与内地汉族人群PAV4基因属同一分支.结论 细小病毒B19基因在西藏藏族与内地汉族人群中的差异分析为该病的检测与控制提供了参考.%Objective To investigate the genetic diversity differences of human parvoviruse B19 and parvovirus 4 (PRVA4) in Tibet and Han population in China.Methods Phylogenetic analysis was performed on genome fragments of B19 or PARV4 obtained from the blood samples of Tibet and Han population in China by using a PCR followed by sequencing.Results Ten partial VP1 fragments of B19 (2 from Tibet,3 from Sichuan,5 from Zhejiang) and 10 partial ORF1 fragments of PAV4 (2 from Tibet,2 from Sichuan,1 Yunnan,5 from Zhejiang) were obtained.Phylogenetic analysis indicated that different B19 subgroup circulates in Tibet and Han population although they belong to the same 1A subtype.While the gene evolution of PAV4 is very conserved between the Tibet and Han population in China.Conclusion These studies on genetic diversity of B19 in different Chinese population provide a way for detection and prevention of B19 human parvovirus infection.

  3. Crystal Structure of the Nonerythroid [alpha]-Spectrin Tetramerization Site Reveals Differences between Erythroid and Nonerythroid Spectrin Tetramer Formation

    Energy Technology Data Exchange (ETDEWEB)

    Mehboob, Shahila; Song, Yuanli; Witek, Marta; Long, Fei; Santarsiero, Bernard D.; Johnson, Michael E.; Fung, Leslie W.-M. (UIC)

    2010-06-21

    We have solved the crystal structure of a segment of nonerythroid {alpha}-spectrin ({alpha}II) consisting of the first 147 residues to a resolution of 2.3 {angstrom}. We find that the structure of this segment is generally similar to a corresponding segment from erythroid {alpha}-spectrin ({alpha}I) but exhibits unique differences with functional significance. Specific features include the following: (i) an irregular and frayed first helix (Helix C{prime}); (ii) a helical conformation in the junction region connecting Helix C{prime} with the first structural domain (D1); (iii) a long A1B1 loop in D1; and (iv) specific inter-helix hydrogen bonds/salt bridges that stabilize D1. Our findings suggest that the hydrogen bond networks contribute to structural domain stability, and thus rigidity, in {alpha}II, and the lack of such hydrogen bond networks in {alpha}I leads to flexibility in {alpha}I. We have previously shown the junction region connecting Helix C{prime} to D1 to be unstructured in {alpha}I (Park, S., Caffrey, M. S., Johnson, M. E., and Fung, L. W. (2003) J. Biol. Chem. 278, 21837-21844) and now find it to be helical in {alpha}II, an important difference for {alpha}-spectrin association with {beta}-spectrin in forming tetramers. Homology modeling and molecular dynamics simulation studies of the structure of the tetramerization site, a triple helical bundle of partial domain helices, show that mutations in {alpha}-spectrin will affect Helix C{prime} structural flexibility and/or the junction region conformation and may alter the equilibrium between spectrin dimers and tetramers in cells. Mutations leading to reduced levels of functional tetramers in cells may potentially lead to abnormal neuronal functions.

  4. Protective role of nuclear factor erythroid 2-related factor 2 in the hemorrhagic shock-induced inflammatory response.

    Science.gov (United States)

    Zhao, Haige; Hao, Sijing; Xu, Hongfei; Ma, Liang; Zhang, Zheng; Ni, Yiming; Yu, Luyang

    2016-04-01

    Hemorrhagic shock (HS) following trauma or major surgery significantly contributes to mortality. However, the mechanisms through which HS activates the inflammatory response are not yet fully understood. Nuclear factor-erythroid 2 (NF-E2) p45-related factor-2 (Nrf2), a bZIP transcription factor, is a master regulator of robust cytoprotective defenses. The present study investigated the role of Nrf2 in the pathophysiology of HS. Nrf2 expression in peripheral leukocytes obtained from patients with surgery-associated hemorrhage subjected to resuscitation treatment (termed HS patients) or healthy donors was examined by RT-qPCR. A marked increase in Nrf2 expression was detected in the leukocytes obtained from the HS patients, which indicates a correlation between Nrf2 expression and the development of HS. Wild-type (WT; Nrf2+/+) and Nrf2-deficient [Nrf2-/- or Nrf2‑knockout (KO)] mice were subjected to surgery to induce HS. Systemic inflammation was significantly elevated in the Nrf2-KO mice compared with the WT mice following HS, as assessed by an increase in serum cytokine levels [interleukin (IL)-6, tumor necrosis factor (TNF)-α and IL-1β], as well as high-mobility group box 1 protein (HMGB1) expression. The Nrf2-KO mice exhibited more severe lung and liver injury following HS as evidenced by increased tissue damage, increased myeloperoxidase (MPO) activity and the increased production of pro-inflammatory cytokines. Additionally, Nrf2 deficiency augmented cytokine production induced by the exposure of peritoneal mouse macrophages to lipopolysaccharide (LPS) following HS. Taken together, these results suggest that Nrf2 is a critical host factor which limits immune dysregulation and organ injury following HS. PMID:26935388

  5. Fragment Length of Circulating Tumor DNA

    Science.gov (United States)

    Underhill, Hunter R.; Kitzman, Jacob O.; Hellwig, Sabine; Welker, Noah C.; Daza, Riza; Gligorich, Keith M.; Rostomily, Robert C.; Shendure, Jay

    2016-01-01

    Malignant tumors shed DNA into the circulation. The transient half-life of circulating tumor DNA (ctDNA) may afford the opportunity to diagnose, monitor recurrence, and evaluate response to therapy solely through a non-invasive blood draw. However, detecting ctDNA against the normally occurring background of cell-free DNA derived from healthy cells has proven challenging, particularly in non-metastatic solid tumors. In this study, distinct differences in fragment length size between ctDNAs and normal cell-free DNA are defined. Human ctDNA in rat plasma derived from human glioblastoma multiforme stem-like cells in the rat brain and human hepatocellular carcinoma in the rat flank were found to have a shorter principal fragment length than the background rat cell-free DNA (134–144 bp vs. 167 bp, respectively). Subsequently, a similar shift in the fragment length of ctDNA in humans with melanoma and lung cancer was identified compared to healthy controls. Comparison of fragment lengths from cell-free DNA between a melanoma patient and healthy controls found that the BRAF V600E mutant allele occurred more commonly at a shorter fragment length than the fragment length of the wild-type allele (132–145 bp vs. 165 bp, respectively). Moreover, size-selecting for shorter cell-free DNA fragment lengths substantially increased the EGFR T790M mutant allele frequency in human lung cancer. These findings provide compelling evidence that experimental or bioinformatic isolation of a specific subset of fragment lengths from cell-free DNA may improve detection of ctDNA. PMID:27428049

  6. Seasonal overturning circulation in the Red Sea: 2. Winter circulation

    KAUST Repository

    Yao, Fengchao

    2014-04-01

    The shallow winter overturning circulation in the Red Sea is studied using a 50 year high-resolution MITgcm (MIT general circulation model) simulation with realistic atmospheric forcing. The overturning circulation for a typical year, represented by 1980, and the climatological mean are analyzed using model output to delineate the three-dimensional structure and to investigate the underlying dynamical mechanisms. The horizontal model circulation in the winter of 1980 is dominated by energetic eddies. The climatological model mean results suggest that the surface inflow intensifies in a western boundary current in the southern Red Sea that switches to an eastern boundary current north of 24N. The overturning is accomplished through a cyclonic recirculation and a cross-basin overturning circulation in the northern Red Sea, with major sinking occurring along a narrow band of width about 20 km along the eastern boundary and weaker upwelling along the western boundary. The northward pressure gradient force, strong vertical mixing, and horizontal mixing near the boundary are the essential dynamical components in the model\\'s winter overturning circulation. The simulated water exchange is not hydraulically controlled in the Strait of Bab el Mandeb; instead, the exchange is limited by bottom and lateral boundary friction and, to a lesser extent, by interfacial friction due to the vertical viscosity at the interface between the inflow and the outflow. Key Points Sinking occurs in a narrow boundary layer along the eastern boundary Surface western boundary current switches into an eastern boundary current Water exchange in the Strait of Bab el Mandeb is not hydraulically controlled © 2014. American Geophysical Union. All Rights Reserved.

  7. The Invertibility, Explicit Determinants, and Inverses of Circulant and Left Circulant and g-Circulant Matrices Involving Any Continuous Fibonacci and Lucas Numbers

    Directory of Open Access Journals (Sweden)

    Zhaolin Jiang

    2014-01-01

    Full Text Available Circulant matrices play an important role in solving delay differential equations. In this paper, circulant type matrices including the circulant and left circulant and g-circulant matrices with any continuous Fibonacci and Lucas numbers are considered. Firstly, the invertibility of the circulant matrix is discussed and the explicit determinant and the inverse matrices by constructing the transformation matrices are presented. Furthermore, the invertibility of the left circulant and g-circulant matrices is also studied. We obtain the explicit determinants and the inverse matrices of the left circulant and g-circulant matrices by utilizing the relationship between left circulant, g-circulant matrices and circulant matrix, respectively.

  8. Tumor-Related Methylated Cell-Free DNA and Circulating Tumor Cells in Melanoma

    OpenAIRE

    Salvianti, Francesca; Orlando, Claudio; Massi, Daniela; DE GIORGI, VINCENZO; Grazzini, Marta; Pazzagli, Mario; Pinzani, Pamela

    2016-01-01

    Solid tumor release into the circulation cell-free DNA (cfDNA) and circulating tumor cells (CTCs) which represent promising biomarkers for cancer diagnosis. Circulating tumor DNA may be studied in plasma from cancer patients by detecting tumor specific alterations, such as genetic or epigenetic modifications. Ras association domain family 1 isoform A (RASSF1A) is a tumor suppressor gene silenced by promoter hypermethylation in a variety of human cancers including melanoma. The aim of the pres...

  9. Impaired ferritin mRNA translation in primary erythroid progenitors: shift to iron-dependent regulation by the v-ErbA oncoprotein.

    Science.gov (United States)

    Mikulits, W; Schranzhofer, M; Bauer, A; Dolznig, H; Lobmayr, L; Infante, A A; Beug, H; Müllner, E W

    1999-12-15

    In immortalized cells of the erythroid lineage, the iron-regulatory protein (IRP) has been suggested to coregulate biosynthesis of the iron storage protein ferritin and the erythroid delta-aminolevulinate synthase (eALAS), a key enzyme in heme production. Under iron scarcity, IRP binds to an iron-responsive element (IRE) located in ferritin and eALAS mRNA leaders, causing a block of translation. In contrast, IRP-IRE interaction is reduced under high iron conditions, allowing efficient translation. We show here that primary chicken erythroblasts (ebls) proliferating or differentiating in culture use a drastically different regulation of iron metabolism. Independently of iron administration, ferritin H (ferH) chain mRNA translation was massively decreased, whereas eALAS transcripts remained constitutively associated with polyribosomes, indicating efficient translation. Variations in iron supply had minor but significant effects on eALAS mRNA polysome recruitment but failed to modulate IRP-affinity to the ferH-IRE in vitro. However, leukemic ebls transformed by the v-ErbA/v-ErbB-expressing avian erythroblastosis virus showed an iron-dependent reduction of IRP mRNA-binding activity, resulting in mobilization of ferH mRNA into polysomes. Hence, we analyzed a panel of ebls overexpressing v-ErbA and/or v-ErbB oncoproteins as well as the respective normal cellular homologues (c-ErbA/TRalpha, c-ErbB/EGFR). It turned out that v-ErbA, a mutated class II nuclear hormone receptor that arrests erythroid differentiation, caused the change in ferH mRNA translation. Accordingly, inhibition of v-ErbA function in these leukemic ebls led to a switch from iron-responsive to iron-independent ferH expression. PMID:10590077

  10. Human parvovirus B19: a mechanistic overview of infection and DNA replication

    OpenAIRE

    Luo, Yong; Qiu, Jianming

    2015-01-01

    Human parvovirus B19 (B19V) is a human pathogen that belongs to genus Erythroparvovirus of the Parvoviridae family, which is composed of a group of small DNA viruses with a linear single-stranded DNA genome. B19V mainly infects human erythroid progenitor cells and causes mild to severe hematological disorders in patients. However, recent clinical studies indicate that B19V also infects nonerythroid lineage cells, such as myocardial endothelial cells, and may be associated with other disease o...

  11. CDK2 accelerates early erythroid differentiation of K562 cells%CDK2促进K562细胞早期红系分化

    Institute of Scientific and Technical Information of China (English)

    李均; 岳瑞华; 沈钧乐; 肖俊

    2011-01-01

    目的 探讨细胞周期调节蛋白CDK2对K562细胞红系分化的影响.方法 分别用CDK2表达质粒和干扰RNA分子转染K562细胞,用Western blot法检测过表达或干扰效率,使用real-time PCR和联苯胺染色法检测K562细胞分化.结果 CDK2在K562细胞红系分化早期呈现表达上升趋势;在K562细胞中过表达CDK2可促进hemin诱导的红系分化;反之,干扰K562内源的CDK2表达会对K562红系分化产生抑制作用.结论 CDK2在K562细胞早期红系分化过程中发挥促进作用.%Objective To study the roles of a cell cycle regulator cyclin-dependent kinase 2 (CDK2) in erythroid differentiation of K562 cells. Methods K562 cells were transfected with the construct expressing CDK2 and siRNAs specifically targeting at CDK2. The effects of over-expression or knocking-down of CDK2 were examined by Western blot. Quantitative RT-PCR was performed to detect the level of γ-globin mRNA expression. The benzidine staining assay was used to identify the differentiation state of K562 cells. Results CDK2 was up-regulated at the early stage of K562 erythroid differentiation. Over-expression of CDK2 in K562 cells accelerated erythroid differentiation. Inhibition of CDK2 attenuates globin accumulation in K562 cells. Conclusion CDK2 is necessary for early erythroid differentiation of K562 cells.

  12. [Circulating nucleic acids and infertility].

    Science.gov (United States)

    Scalici, E; Mullet, T; Ferrières Hoa, A; Gala, A; Loup, V; Anahory, T; Belloc, S; Hamamah, S

    2015-09-01

    Circulating nucleic acids (cell-free DNA and microRNAs) have for particularity to be easily detectable in the biological fluids of the body. Therefore, they constitute biomarkers of interest in female and male infertility care. Indeed, in female, they can be used to detect ovarian reserve disorders (polycystic ovary syndrome and low functional ovarian reserve) as well as to assess follicular microenvironment quality. Moreover, in men, their expression levels can vary in case of spermatogenesis abnormalities. Finally, circulating nucleic acids have also the ability to predict successfully the quality of in vitro embryo development. Their multiple contributions during assisted reproductive technology (ART) make of them biomarkers of interest, for the development of new diagnostic and/or prognostic tests, applied to our specialty. Circulating nucleic acids would so offer the possibility of personalized medical care for infertile couples in ART. PMID:26298813

  13. Atmospheric Circulation of Terrestrial Exoplanets

    CERN Document Server

    Showman, Adam P; Merlis, Timothy M; Kaspi, Yohai

    2013-01-01

    The investigation of planets around other stars began with the study of gas giants, but is now extending to the discovery and characterization of super-Earths and terrestrial planets. Motivated by this observational tide, we survey the basic dynamical principles governing the atmospheric circulation of terrestrial exoplanets, and discuss the interaction of their circulation with the hydrological cycle and global-scale climate feedbacks. Terrestrial exoplanets occupy a wide range of physical and dynamical conditions, only a small fraction of which have yet been explored in detail. Our approach is to lay out the fundamental dynamical principles governing the atmospheric circulation on terrestrial planets--broadly defined--and show how they can provide a foundation for understanding the atmospheric behavior of these worlds. We first survey basic atmospheric dynamics, including the role of geostrophy, baroclinic instabilities, and jets in the strongly rotating regime (the "extratropics") and the role of the Hadle...

  14. Radioimmunoprecipitation polyethylene glycol assay for circulating Entamoeba histolytica antigens

    Energy Technology Data Exchange (ETDEWEB)

    Pillai, S.; Mohimen, A.; Mehra, S. (Calcutta Medical Research Inst., Calcutta (India). Kothari Centre of Gastroenterology)

    1982-12-17

    An assay capable of detecting circulating Entamoeba histolytica antigens in amoebiasis is described. This assay utilised a radiolabelled affinity purified rabbit anti-E. histolytica antibody that had been depleted of antibodies that cross-react with human serum proteins, and a polyethylene glycol precipitation step.

  15. Proper Sizing of Circulation Pumps

    DEFF Research Database (Denmark)

    Tommerup, Henrik M.; Nørgaard, Jørgen

    2007-01-01

    , but the results can be applied to Europe in general. Despite the small sample of houses involved in the test, 15 houses, some rather safe conclusions can be drawn from the results, which showed that newly developed pumps with power consumption around 5-8 W, can perform the task of circulating the water...... as well as their pollution during operation. Policy measures are proposed of how to ensure that in the future only such energy saving pumps are installed. Furthermore, on the basis of the historic experiences with circulation pumps some con¬clusions are drawn on how to investigate, develop and market new...

  16. Pathophysiological processes in multiple sclerosis: focus on nuclear factor erythroid-2-related factor 2 and emerging pathways

    Directory of Open Access Journals (Sweden)

    Arnold P

    2014-02-01

    Full Text Available Philipp Arnold,1,* Deb Mojumder,2,* John DeToledo,2 Ralph Lucius,1 Henrik Wilms2 1Institute of Anatomy, Christian-Albrechts-University Kiel, Kiel, Germany; 2Department of Neurology, Texas Tech University Health Science Center, Lubbock, TX, USA *These authors contributed equally to this work Abstract: Multiple sclerosis (MS is a disease of the central nervous system that is characterized by the demyelination of neuronal axons. Four different patterns of demyelination have been described, showing the heterogeneity in the immunopathologic processes involved in the demyelination. This review will focus on reactive oxygen species (ROS-related inflammation in MS. Special emphasis will be placed on the nuclear factor erythroid-2-related factor 2 (Nrf2 as it regulates the transcription of ROS-protective genes. In the cytosol, Nrf2 binds to Keap1 (Kelch-like ECH-associated protein 1, and together they are degraded by the 26S proteasome after ubiquitination. If challenged by ROS Nrf2, binding to Keap1 is abrogated, and it translocates into the nucleus. Here it binds to the antioxidant response element and to a small protein termed Maf (musculoaponeurotic fibrosarcoma oncogene homolog. This leads to an enhanced transcription of ROS protective genes and represents the physiological answer against ROS challenge. It has been shown that dimethyl fumarate (DMF has the same effect and leads to an enhanced transcription of ROS-protective genes. This response is mediated through a reduced binding of Nrf2 to Keap1, thus resulting in a higher level of free Nrf2 in the cytosol. Consequently, more Nrf2 translocates to the nucleus, promoting transcription of its target genes. DMF has been used for the treatment of psoriasis for many years in Germany without the occurrence of major side effects. In psoriasis, DMF reduces ROS-related inflammation in skin. A DMF analog, BG-12, was recently approved for the treatment of relapsing-remitting MS by the European Union and the

  17. Serological evaluation of Crimean-Congo hemorrhagic fever in humans with high-risk professions living in enzootic regions of Isfahan province of Iran and genetic analysis of circulating strains

    DEFF Research Database (Denmark)

    Chinikar, Sadegh; Ghiasi, Seyed Mojtaba; Naddaf, Saeed;

    2012-01-01

    Crimean-Congo hemorrhagic fever (CCHF) is a zoonotic viral disease that is asymptomatic in infected livestock, but causes a serious threat to humans with a mortality rate up to 50%. Although the CCHF virus (CCHFV) is often transmitted by ticks, livestock-to-human and human-to-human transmission a...

  18. Proximal promoter elements of the human zeta-globin gene confer embryonic-specific expression on a linked reporter gene in transgenic mice.

    OpenAIRE

    Pondel, M D; Sharpe, J. A.; Clark, S.; Pearson, L; Wood, W.G.; Proudfoot, N J

    1996-01-01

    We have investigated the transcriptional regulation of the human embryonic zeta-globin gene promoter. First, we examined the effect that deletion of sequences 5' to zeta-globin's CCAAT box have on zeta-promoter activity in erythroid cell lines. Deletions of sequences between -116 and -556 (cap = 0) had little effect while further deletion to -84 reduced zeta-promoter activity by only 2-3-fold in both transiently and stably transfected erythroid cells. Constructs containing 67, 84 and 556 bp o...

  19. Doppler velocimetry with emphasis on the fetal cerebral circulation

    OpenAIRE

    Noordam, Marja

    1996-01-01

    textabstractIn this thesis the following questions were addressed: 1. Are changes in placental vascular resistance associated with alterations in arterial down stream impedance at fetal level? To this purpose placental embolization was carried-out in the fetal lamb with subsequent Doppler velocimetry in the fetal descending aorta (chapter 2). 2. What happens to the human fetal cerebral circulation relative to normal and raised umbilical placental resistance? To answer this question, the human...

  20. Conservation of Circulation in Magnetohydrodynamics

    CERN Document Server

    Bekenstein, J D; Bekenstein, Jacob D.; Oron, Asaf

    2000-01-01

    We demonstrate, both at the Newtonian and (general) relativistic levels, theexistence of a generalization of Kelvin's circulation theorem (for pure fluids)which is applicable to perfect magnetohydrodynamics. The argument is based onthe least action principle for magnetohydrodynamic flow. Examples of the newconservation law are furnished. The new theorem should be helpful inidentifying new kinds of vortex phenomena distinct from magnetic ropes or fluidvortices.

  1. VanderLaan Circulant Type Matrices

    Directory of Open Access Journals (Sweden)

    Hongyan Pan

    2015-01-01

    Full Text Available Circulant matrices have become a satisfactory tools in control methods for modern complex systems. In the paper, VanderLaan circulant type matrices are presented, which include VanderLaan circulant, left circulant, and g-circulant matrices. The nonsingularity of these special matrices is discussed by the surprising properties of VanderLaan numbers. The exact determinants of VanderLaan circulant type matrices are given by structuring transformation matrices, determinants of well-known tridiagonal matrices, and tridiagonal-like matrices. The explicit inverse matrices of these special matrices are obtained by structuring transformation matrices, inverses of known tridiagonal matrices, and quasi-tridiagonal matrices. Three kinds of norms and lower bound for the spread of VanderLaan circulant and left circulant matrix are given separately. And we gain the spectral norm of VanderLaan g-circulant matrix.

  2. Factors affecting the enterohepatic circulation of oral contraceptive steroids.

    Science.gov (United States)

    Orme, M L; Back, D J

    1990-12-01

    Oral contraceptive steroids may undergo enterohepatic circulation, but it is relevant for only estrogens, because these compounds can be directly conjugated in the liver. Animal studies show convincing evidence of the importance of the enterohepatic circulation, but studies in humans are much less convincing. The importance of the route and the rate of metabolism of ethinyl estradiol are reviewed. Some antibiotics have been reported anecdotally to reduce the efficacy of oral contraceptive steroids, but controlled studies have not confirmed this observation. Although gut flora are altered by oral antibiotics, the blood levels of ethinyl estradiol are not reduced, and one antibiotic at least (cotrimoxazole) enhances the activity of ethinyl estradiol. PMID:2256523

  3. Intrinsic defects in erythroid cells from familial hemophagocytic lymphohistiocytosis type 5 patients identify a role for STXBP2/Munc18-2 in erythropoiesis and phospholipid scrambling.

    Science.gov (United States)

    Kostova, Elena B; Beuger, Boukje M; Veldthuis, Martijn; van der Werff Ten Bosch, Jutte; Kühnle, Ingrid; van den Akker, Emile; van den Berg, Timo K; van Zwieten, Rob; van Bruggen, Robin

    2015-12-01

    Familial hemophagocytic lymphohistiocytosis type 5 (FHL-5) is a rare genetic disorder caused by mutations in STXBP2/Munc18-2. Munc18-2 plays a role in the degranulation machinery of natural killer cells and cytotoxic T lymphocytes. Mutations in STXBP2/Munc18-2 lead to impaired killing of target cells by natural killer cells and cytotoxic T lymphocytes, which in turn results in elevated levels of the inflammatory cytokine interferon γ, macrophage activation, and hemophagocytosis. Even though patients with FHL-5 present with anemia and hemolysis, no link between the disease and the erythroid lineage has been established. Here we report that red blood cells express Munc18-2 and that erythroid cells from patients with FHL-5 exhibit intrinsic defects caused by STXBP2/Munc18-2 mutations. Red blood cells from patients with FHL-5 expose less phosphatidylserine on their surface upon Ca(2+) ionophore ionomycin treatment. Furthermore, cultured erythroblasts from patients with FHL-5 display defective erythropoiesis characterized by decreased CD235a expression and aberrant cell morphology. PMID:26320718

  4. Human Parvovirus B19 VP2 Empty Capsids Bind to Human Villous Trophoblast Cells in vitro Via the Globoside Receptor

    OpenAIRE

    Wegner, Carole C.; Jordan, Jeanne A.

    2004-01-01

    BACKGROUND: Pregnant women acutely infected with human parvovirus B19 (B19) may transmit the virus to the developing fetus. The mechanism whereby the virus interacts with the placenta is unknown. It is known that globoside receptor is required for successful infection of the target cells, which are the highly undifferentiated, actively dividing colony and burst-form units of the erythroid series. Globoside is present on trophoblast cells which have intimate contact with maternal blood, and ma...

  5. In vivo acoustic and photoacoustic focusing of circulating cells

    Science.gov (United States)

    Galanzha, Ekaterina I.; Viegas, Mark G.; Malinsky, Taras I.; Melerzanov, Alexander V.; Juratli, Mazen A.; Sarimollaoglu, Mustafa; Nedosekin, Dmitry A.; Zharov, Vladimir P.

    2016-03-01

    In vivo flow cytometry using vessels as natural tubes with native cell flows has revolutionized the study of rare circulating tumor cells in a complex blood background. However, the presence of many blood cells in the detection volume makes it difficult to count each cell in this volume. We introduce method for manipulation of circulating cells in vivo with the use of gradient acoustic forces induced by ultrasound and photoacoustic waves. In a murine model, we demonstrated cell trapping, redirecting and focusing in blood and lymph flow into a tight stream, noninvasive wall-free transportation of blood, and the potential for photoacoustic detection of sickle cells without labeling and of leukocytes targeted by functionalized nanoparticles. Integration of cell focusing with intravital imaging methods may provide a versatile biological tool for single-cell analysis in circulation, with a focus on in vivo needleless blood tests, and preclinical studies of human diseases in animal models.

  6. Radioisotopic evaluation of portal circulation

    International Nuclear Information System (INIS)

    The use of a radio-tracer of portal circulation through the intestine, should prevent cruel punctures in the portal-vein or spleen as it is usually the case with traditional methods in the study of portal-system. The absorption of I-131 and Tc-99m, previously cheked in rabbits presented similar results in dogs. The time of circulation between terminal large-intestine and the liver (t-RF) was determined by external counting at hepatic level by recording radioactivity variation-time. In healthy animals the t-RF was from 20to 60 seconds, with average time of 42 seconds. In 2 animals with partial binding of portal-vein the t-RF went up to 110 and 120 seconds. (Author)

  7. Journalism as Cultures of Circulation

    DEFF Research Database (Denmark)

    Bødker, Henrik

    2013-01-01

    The universe of journalism has always consisted of interspersed texts, meanings and practices. Yet, much journalism research has often isolated either texts and/or contexts and as such assumed relations between professional practices, informed (rational) readers and (conceived) core texts...... of journalism. It is, however, more important than ever to shift attention away from texts to the processes through which they are circulated. This is partly because the many cultural forms of journalism (textual, institutional, technological, material, behavioural and imagined) are undergoing significant......, likes, comments, searches, journalist roles, writing and reading positions and identities etc. Such forms will be traced within the mediation of a specific event with the overall aim of beginning a theorization of the landscape of journalism as highly interrelated cultures of circulation....

  8. Ocean circulation generated magnetic signals

    DEFF Research Database (Denmark)

    Manoj, C.; Kuvshinov, A.; Maus, S.;

    2006-01-01

    Conducting ocean water, as it flows through the Earth's magnetic field, generates secondary electric and magnetic fields. An assessment of the ocean-generated magnetic fields and their detectability may be of importance for geomagnetism and oceanography. Motivated by the clear identification...... of ocean tidal signatures in the CHAMP magnetic field data we estimate the ocean magnetic signals of steady flow using a global 3-D EM numerical solution. The required velocity data are from the ECCO ocean circulation experiment and alternatively from the OCCAM model for higher resolution. We assume...... of the magnetic field, as compared to the ECCO simulation. Besides the expected signatures of the global circulation patterns, we find significant seasonal variability of ocean magnetic signals in the Indian and Western Pacific Oceans. Compared to seasonal variation, interannual variations produce weaker signals....

  9. Conservation of circulation in magnetohydrodynamics

    Science.gov (United States)

    Bekenstein; Oron

    2000-10-01

    We demonstrate at both the Newtonian and (general) relativistic levels the existence of a generalization of Kelvin's circulation theorem (for pure fluids) that is applicable to perfect magnetohydrodynamics. The argument is based on the least action principle for magnetohydrodynamic flow. Examples of the new conservation law are furnished. The new theorem should be helpful in identifying new kinds of vortex phenomena distinct from magnetic ropes or fluid vortices. PMID:11089118

  10. Electronic circulation of accounting documents

    OpenAIRE

    Kremláčková, Kateřina

    2014-01-01

    This thesis describes a circulation of accounting documents in an accounting entity, deals with legal requirements of the entire process and discusses it as a part of an internal control system of the entity. In connection with the theme of the work there are also defined legislative conditions for using information and communication technologies and introduced possibilities of involving these technologies in the process of processing of the accounting documents. Above all the electronic data...

  11. The trypanocidal benznidazole promotes adaptive response to oxidative injury: Involvement of the nuclear factor-erythroid 2-related factor-2 (Nrf2) and multidrug resistance associated protein 2 (MRP2).

    Science.gov (United States)

    Rigalli, Juan Pablo; Perdomo, Virginia Gabriela; Ciriaci, Nadia; Francés, Daniel Eleazar Antonio; Ronco, María Teresa; Bataille, Amy Michele; Ghanem, Carolina Inés; Ruiz, María Laura; Manautou, José Enrique; Catania, Viviana Alicia

    2016-08-01

    Oxidative stress is a frequent cause underlying drug-induced hepatotoxicity. Benznidazole (BZL) is the only trypanocidal agent available for treatment of Chagas disease in endemic areas. Its use is associated with side effects, including increases in biomarkers of hepatotoxicity. However, BZL potential to cause oxidative stress has been poorly investigated. Here, we evaluated the effect of a pharmacologically relevant BZL concentration (200μM) at different time points on redox status and the counteracting mechanisms in the human hepatic cell line HepG2. BZL increased reactive oxygen species (ROS) after 1 and 3h of exposure, returning to normality at 24h. Additionally, BZL increased glutathione peroxidase activity at 12h and the oxidized glutathione/total glutathione (GSSG/GSSG+GSH) ratio that reached a peak at 24h. Thus, an enhanced detoxification of peroxide and GSSG formation could account for ROS normalization. GSSG/GSSG+GSH returned to control values at 48h. Expression of the multidrug resistance-associated protein 2 (MRP2) and GSSG efflux via MRP2 were induced by BZL at 24 and 48h, explaining normalization of GSSG/GSSG+GSH. BZL activated the nuclear erythroid 2-related factor 2 (Nrf2), already shown to modulate MRP2 expression in response to oxidative stress. Nrf2 participation was confirmed using Nrf2-knockout mice in which MRP2 mRNA expression was not affected by BZL. In summary, we demonstrated a ROS increase by BZL in HepG2 cells and a glutathione peroxidase- and MRP2 driven counteracting mechanism, being Nrf2 a key modulator of this response. Our results could explain hepatic alterations associated with BZL therapy. PMID:27180241

  12. Natural circulation systems: advantages and challenges

    International Nuclear Information System (INIS)

    This lecture briefly explains the principle of working of a natural circulation system, its various advantages and applications in nuclear and other industries. The major challenges to be overcome before the wide acceptance of natural circulation as the normal mode of coolant circulation in nuclear power reactors are briefly described. Classification of NCSs and the terminologies commonly encountered in natural circulation literature are also briefly explained. (author)

  13. Epidermal Growth Factor Increases LRF/Pokemon Expression in Human Prostate Cancer Cells

    OpenAIRE

    Aggarwal, Himanshu; Aggarwal, Anshu; Devendra K Agrawal

    2011-01-01

    Leukemia/lymphoma related factor/POK erythroid myeloid ontogenic factor (LRF/Pokemon) is a member of the POK family of proteins that promotes oncogenesis in several forms of cancer. Recently, we found higher LRF expression in human breast and prostate carcinomas compared to the corresponding normal tissues. The aim of this study was to examine the regulation of LRF expression in human prostate cells. Epidermal growth factor (EGF) and its receptors mediate several tumorigenic cascades that reg...

  14. Internal variability of the thermohaline ocean circulation

    NARCIS (Netherlands)

    Raa, Lianke Alinda te

    2003-01-01

    Variations in the ocean circulation can strongly influence climate due to the large heat transport by the ocean currents. Variability of the thermohaline ocean circulation, the part of the ocean circulation driven by density gradients, occurs typically on (inter)decadal and longer time scales and is

  15. Nucleic acids in circulation: Are they harmful to the host?

    Indian Academy of Sciences (India)

    Indraneel Mittra; Naveen Kumar Nair; Pradyumna Kumar Mishra

    2012-06-01

    It has been estimated that 1011–1012 cells, primarily of haematogenous origin, die in the adult human body daily, and a similar number is regenerated to maintain homeostasis. Despite the presence of an efficient scavenging system for dead cells, considerable amounts of fragmented genetic material enter the circulation in healthy individuals. Elevated blood levels of extracellular nucleic acids have been reported in various disease conditions; such as ageing and age-related degenerative disorders, cancer; acute and chronic inflammatory conditions, severe trauma and autoimmune disorders. In addition to genomic DNA and nucleosomes, mitochondrial DNA is also found in circulation, as are RNA and microRNA. There is extensive literature that suggests that extraneously added nucleic acids have biological actions. They can enter into cells in vitro and in vivo and induce genetic transformation and cellular and chromosomal damage; and experimentally added nucleic acids are capable of activating both innate and adaptive immune systems and inducing a sterile inflammatory response. The possibility as to whether circulating nucleic acids may, likewise, have biological activities has not been explored. In this review we raise the question as to whether circulating nucleic acids may have damaging effects on the host and be implicated in ageing and diverse acute and chronic human pathologies.

  16. Alternative transcription and splicing of the human porphobilinogen deaminase gene

    International Nuclear Information System (INIS)

    Porphobilinogen deaminase is a cytosolic enzyme involved in the heme biosynthetic pathway. Two isoforms of PBGD, encoded by two mRNAs differing solely in their 5' end, are known: one is found in all cells and the other is present only in erythroid cells. The authors have previously shown that the human PBGD is encoded by a single gene and have now cloned and characterized this gene, which is split into 15 exons spread over 10 kilobases of DNA. They demonstrate that the two mRNAs arise from two overlapping transcription units. The first one (upstream) is active in all tissues and its promoter has some of the structural features of a housekeeping promoter; the second, located 3 kilobases downstream, is active only in erythroid cells and its promoter displays structural homologies with the β-globin gene promoters

  17. Large scale atmospheric tropical circulation changes and consequences during global warming

    International Nuclear Information System (INIS)

    The changes of the tropical large scale circulation during climate change can have large impacts on human activities. In a first part, the meridional atmospheric tropical circulation was studied in the different coupled models. During climate change, we find, on the one hand, that the Hadley meridional circulation and the subtropical jet are significantly shifted poleward, and on the other hand, that the intensity of the tropical circulation weakens. The slow down of the atmospheric circulation results from the dry static stability changes affecting the tropical troposphere. Secondly, idealized simulations are used to explain the tropical circulation changes. Ensemble simulation using the model LMDZ4 are set up to study the results from the coupled model IPSLCM4. The weakening of the large scale tropical circulation and the poleward shift of the Hadley cells are explained by both the uniform change and the meridional gradient change of the sea surface temperature. Then, we used the atmospheric model LMDZ4 in an aqua-planet configuration. The Hadley circulation changes are explained in a simple framework by the required poleward energy transport. In a last part, we focus on the water vapor distribution and feedback in the climate models. The Hadley circulation changes were shown to have a significant impact on the water vapour feedback during climate change. (author)

  18. Hemopoietic regeneration in murine spleen following transfusion of normal and irradiated marrow: different response of granulocyte/macrophage and erythroid precursors

    International Nuclear Information System (INIS)

    To investigate cell proliferation in regenerating spleen, bone marrow of normal and gamma-irradiated donor mice (3 weeks after 5 Gy) was transfused into lethally irradiated recipients. In the donors and in the recipient spleens numbers of CFU-S and progenitor cells were determined. In the irradiated donors the progenitors were at control level after 3 weeks of recovery although CFU-S were still at 50% of control. Recipients of the irradiated marrow received therefore an increased proportion of progenitors. CFU-C appeared to be self-renewing and/or increased in number due to enhanced CFU-S differentiation, but not the erythroid progenitors. CFU-S self-renewal was reduced after 5 Gy. The data suggest that cell differentiation and maturation proceed during early splenic regeneration. The quantity of CFU-C does not necessarily mirror the situation in the stem cell compartment. (author)

  19. Eto2/MTG16 and MTGR1 are heteromeric corepressors of the TAL1/SCL transcription factor in murine erythroid progenitors

    Energy Technology Data Exchange (ETDEWEB)

    Cai, Ying; Xu, Zhixiong; Xie, Jingping [Department of Medicine, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Ham, Amy-Joan L. [Department of Biochemistry, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Koury, Mark J. [Department of Medicine, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Tennessee Valley VA Healthcare System, Nashville, TN 37212 (United States); Hiebert, Scott W. [Department of Biochemistry, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Vanderbilt-Ingram Cancer Center, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Brandt, Stephen J., E-mail: stephen.brandt@vanderbilt.edu [Department of Medicine, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Department of Cell and Developmental Biology, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Department of Cancer Biology, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Vanderbilt-Ingram Cancer Center, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Tennessee Valley VA Healthcare System, Nashville, TN 37212 (United States)

    2009-12-11

    The TAL1 (or SCL) gene, originally discovered through its involvement by a chromosomal translocation in T-cell acute lymphoblastic leukemia, encodes a basic helix-loop-helix (bHLH) transcription factor essential for hematopoietic and vascular development. To identify its interaction partners, we expressed a tandem epitope-tagged protein in murine erythroleukemia (MEL) cells and characterized affinity-purified Tal1-containing complexes by liquid chromatography-tandem mass spectrometry analysis. In addition to known interacting proteins, two proteins related to the Eight-Twenty-One (ETO) corepressor, Eto2/Mtg16 and Mtgr1, were identified from the peptide fragments analyzed. Tal1 interaction with Eto2 and Mtgr1 was verified by coimmunoprecipitation analysis in Tal1, Eto2-, and Mtgr1-transfected COS-7 cells, MEL cells expressing V5 epitope-tagged Tal1 protein, and non-transfected MEL cells. Mapping analysis with Gal4 fusion proteins demonstrated a requirement for the bHLH domain of Tal1 and TAF110 domain of Eto2 for their interaction, and transient transfection and glutathione S-transferase pull-down analysis showed that Mtgr1 and Eto2 enhanced the other's association with Tal1. Enforced expression of Eto2 in differentiating MEL cells inhibited the promoter of the Protein 4.2 (P4.2) gene, a direct target of TAL1 in erythroid progenitors, and transduction of Eto2 and Mtgr1 augmented Tal1-mediated gene repression. Finally, chromatin immunoprecipitation analysis revealed that Eto2 occupancy of the P4.2 promoter in MEL cells decreased with differentiation, in parallel with a decline in Eto2 protein abundance. These results identify Eto2 and Mtgr1 as authentic interaction partners of Tal1 and suggest they act as heteromeric corepressors of this bHLH transcription factor during erythroid differentiation.

  20. Erythroid progenitor cells (CFU-E*) from Friend virus-infected mice undergo 55Fe suicide in vitro in the absence of added erythropoietin

    International Nuclear Information System (INIS)

    The authors have investigated the effect of 55Fe on the survival in suspension of erythropoietin (epo)-independent erythroid progenitor cells (CFU-E*) induced by Friend polycythemia virus (FV). Spleen cells from C3Hf/Bi mice previously infected with FV were exposed to carrier-free 55Fe, and the survival of CFU-E* as a function of time in liquid medium was determined from the number of erythroid colonies that developed from these cells seeded in plasma cultures without added epo. The results showed that spleen CFU-E* were highly vulnerable to 55Fe. Marrow CFU-E* behaved in a similar manner. The 55Fe responsible for their suicide had been presented to the progenitor cells only during the 4-h period of incubation, after which they were washed and plated in excess nonradioactive iron. They therefore conclude that CFU-E* themselves, and not only their progeny, are capable of actively incorporating iron. Under the same conditions in the absence of added epo, the effect of 55Fe on the survival of normal spleen or marrow CFU-E could not be assessed because two few normal CFU-E survived the incubation period. Normal bone marrow cells incubated in complete medium containing epo retained their capacity for erythrocytic colony formation, and CFU-E could then be shown to be vulnerable to 55Fe. Thus, either the iron-incorporating system of normal CFU-E was inducible by epo, or else epo permitted survival of the CFU-E so that the activity of a constitutive iron-incorporating system could be recognized

  1. Downregulation of the Spi-1/PU.1 oncogene induces the expression of TRIM10/HERF1, a key factor required for terminal erythroid cell differentiation and survival

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    Sustained expression of the Spi-1/PU.1 and Fli-1 oncoproteins blocks globin gene activation in mouse erythroleukemia cells; however, only Spi-1/PU.1 expression inhibits the inclusion of exon 16 in the mature 4.1R mRNA. This splicing event is crucial for a functional 4.1R protein and, therefore, for red blood cell membrane integrity. This report demonstrates that Spi-I/PU.1 downregulation induces the activation of TRiMl0/hematopoietic RING finger 1 (HERFI), a member of the tripartite motif (TRIM)/RBCC protein family needed for globin gene transcription. Additionally, we demonstrate that TRIM10/HERFI is required for the regulated splicing of exon 16 during late erythroid differentiation. Using inducible overexpression and silencing approaches, we found that: (1) TRIM10/HERF1 knockdown inhibits hemoglobin production and exon splicing and triggers cell apoptosis in dimethylsulfoxide (DMSO)-induced cells; (2) TRIMI0/HERF1 upregulation is required but is insufficient on its own to activate exon retention; (3) Fli-1 has no effect on TRIMI0/HERFI expression, whereas either DMSO-induced downregulation or shRNA-knockdown of Spi-1/PU.1 expression is sufficient to activate TRIM10/HERFI expression; and (4) Spi-1/PU.1 knockdown triggers both the transcription and the splicing events independently of the chemical induction. Altogether, these data indicate that primary Spi-1/PU.1 downregulation acts on late erythroid differentiation through at least two pathways, one of which requires TRIM10/HERF1 upregulation and parallels the Spi-1/PU.1-induced Fli-1 shutoff regulatory cascade.

  2. Regulated expression of genes inserted at the human chromosomal β-globin locus by homologous recombination

    International Nuclear Information System (INIS)

    The authors have examined the effect of the site of integration on the expression of cloned genes introduced into cultured erythroid cells. Smithies et al. reported the targeted integration of DNA into the human β-globin locus on chromosome 11 in a mouse erythroleukemia-human cell hybrid. These hybrid cells can undergo erythroid differentiation leading to greatly increased mouse and human β-globin synthesis. By transfection of these hybrid cells with a plasmid carrying a modified human β-globin gene and a foreign gene composed of the coding sequence of the bacterial neomycin-resistance gene linked to simian virus 40 transcription signals (SVneo), cells were obtained in which the two genes are integrated at the β-globin locus on human chromosome 11 or at random sites. When they examined the response of the integrated genes to cell differentation, they found that the genes inserted at the β-globin locus were induced during differentiation, whereas randomly positioned copies were not induced. Even the foreign SVneo gene was inducible when it had been integrated at the β-globin locus. The results show that genes introduced at the β-globin locus acquire some of the regulatory properties of globin genes during erythroid differentiation

  3. Cardiovascular studies in the rhesus monkey. [brain circulation during stress

    Science.gov (United States)

    Stone, H. L.; Sandler, H.

    1977-01-01

    Criteria are given for selecting the macaca mulatta as the analogue of the human in the study of cerebral circulation, particularly the control of the cerebral vascular bed during normal and stressful conditions. Topics discussed include surgical preparation of subject; responses to changes in arterial pressure, oxygen, and carbon dioxide; innervation of cerebral vessels; cerebral flow response to acceleration; and cerebral blood flow and cerebellar stimulation.

  4. Replication of parvovirus B19 in hematopoietic progenitor cells generated in vitro from normal human peripheral blood.

    OpenAIRE

    Schwarz, T F; Serke, S; Hottenträger, B; von Brunn, A; Baurmann, H; Kirsch, A.; Stolz, W.; Huhn, D; Deinhardt, F.; Roggendorf, M

    1992-01-01

    Erythroid progenitor cells generated in vitro from peripheral human blood in the presence of interleukin-3 and erythropoietin were infected with human parvovirus B19. B19 virus DNA replication was highest 48 to 72 h after infection, and maximum levels of B19 virus proteins were detected in culture supernatants at 72 to 96 h after infection. B19 virus propagated in vitro was infectious. This cell culture system with peripheral blood cells facilitates studies in vitro of B19 virus replication.

  5. LCR/MEL: A versatile system for high-level expression of heterologous proteins in erythroid cells.

    NARCIS (Netherlands)

    M. Needham; C. Gooding; K. Hudson; M. Antoniou (Michael); F.G. Grosveld (Frank); M. Hollis

    1992-01-01

    textabstractWe have used the human globin locus control region (LCR) to assemble an expression system capable of high-level, integration position-independent expression of heterologous genes and cDNAs in murine erythroleukaemia (MEL) cells. The cDNAs are inserted between the human beta-globin promot

  6. Circulation of Venus upper mesosphere.

    Science.gov (United States)

    Zasova, Ludmila; Gorinov, Dmitry; Shakun, Alexey; Altieri, Francesca; Migliorini, Alessandra; Piccioni, Giuseppe; Drossart, Pierre

    2014-05-01

    Observation of the O2 1.27 μm airglow intensity distribution on the night side of Venus is one of the methods of study of the circulation in upper mesosphere 90-100 km. VIRTIS-M on board Venus Express made these observations in nadir and limb modes in Southern and Northern hemispheres respectively. Global map of the O2 night glow is published (Piccioni et al. 2009). In this work we use for analysis only data, obtained with exposure > 3 s to avoid high noisy data. It was found that intensity of emission decreases to poles and to terminators (similar to Piccioni et al.2009) in both hemispheres, which gives evidence for existence of SS-AS circulation with transport of the air masses through poles and terminators with ascending/descending flows at SS/AS areas. However, asymmetry of distribution of intensity of airglow is observed in both hemispheres. Global map for southern hemisphere (from nadir data) has good statistics at φ > 10-20° S and pretty poor at low latitude. Maximum emission is shifted from midnight by 1 - 2 hours to the evening (22-23h) and deep minimum of emission is found at LT=2-4 h at φ > 20° S. This asymmetry is extended up to equatorial region, however statistic is poor there. No evident indication for existence of the Retrograde Zonal Superrotation (RZS) is found: maximum emission in this case, which is resulting from downwards flow, should be shifted to the morning. The thermal tides, gravity waves are evidently influence on the night airglow distribution. VIRTIS limb observations cover the low northern latitudes and they are more sparse at higher latitudes. Intensity of airglow at φ = 0 - 20° N shows wide maximum, which is shifted by 1- 2 h from midnight to morning terminator. This obviously indicates that observed O2 night glow distribution in low North latitudes is explained by a superposition of SS-AS flow and RZS circulation at 95-100 km. This behavior is similar to the NO intensity distribution, obtained by SPICAV.

  7. Linear thermal circulator based on Coriolis forces.

    Science.gov (United States)

    Li, Huanan; Kottos, Tsampikos

    2015-02-01

    We show that the presence of a Coriolis force in a rotating linear lattice imposes a nonreciprocal propagation of the phononic heat carriers. Using this effect we propose the concept of Coriolis linear thermal circulator which can control the circulation of a heat current. A simple model of three coupled harmonic masses on a rotating platform permits us to demonstrate giant circulating rectification effects for moderate values of the angular velocities of the platform.

  8. The Ten Relationships in Rural Land Circulation

    OpenAIRE

    Cai, Zhirong; Ren, Shuo; Zhang, Zhigang

    2009-01-01

    The ten relationships during land circulation are discussed. Among them, the relationship between peasant household and government indicates that government should only carry out its service and regulatory functions and farmers should be the main body of land circulation, because peasants usually have no discourse power during land circulation. In the relationship between land ownership and contracting management right, we mainly discuss the transfer of land contracting management right and p...

  9. The aerodynamics of circulation control

    Science.gov (United States)

    Wood, N. J.

    1981-01-01

    Two dimensional subsonic wind tunnel tests were conducted on a 20% thickness: chord ratio circulation controlled elliptic aerofoil section equipped with forward and reverse blowing slots. Overall performance measurements were made over a range of trailing edge blowing momentum coefficients from 0 to 0.04; some included the effect of leading edge blowing. A detailed investigation of the trailing edge wall jet, using split film probes, hot wire probes and total head tubes, provided measurements of mean velocity components, Reynolds normal and shear stresses, and radial static pressure. The closure of the two dimensional angular momentum and continuity equations was examined using the measured data, with and without correction, and the difficulty of obtaining a satisfactory solution illustrated. Suggestions regarding the nature of the flow field which should aid the understanding of Coanda effect and the theoretical solution of highly curved wall jet flows are presented.

  10. Irregular Labellings of Circulant Graphs

    OpenAIRE

    Anholcer, Marcin

    2011-01-01

    We investigate the \\textit{irregularity strength} ($s(G)$) and \\textit{total vertex irregularity strength} ($tvs(G)$) of circulant graphs $Ci_n(1,2,...,k)$ and prove that $tvs(Ci_n(1,2,...,k))=\\lceil\\frac{n+2k}{2k+1}\\rceil$, while $s(Ci_n(1,2,...,k))=\\lceil\\frac{n+2k-1}{2k}\\rceil$ except the case when $(n \\bmod 4k = 2k+1 \\wedge k\\bmod 2=1) \\vee n=2k+1$ and $s(Ci_n(1,2,...,k))=\\lceil\\frac{n+2k-1}{2k}\\rceil+1$.

  11. Inflammatory response and extracorporeal circulation.

    Science.gov (United States)

    Kraft, Florian; Schmidt, Christoph; Van Aken, Hugo; Zarbock, Alexander

    2015-06-01

    Patients undergoing cardiac surgery with extracorporeal circulation (EC) frequently develop a systemic inflammatory response syndrome. Surgical trauma, ischaemia-reperfusion injury, endotoxaemia and blood contact to nonendothelial circuit compounds promote the activation of coagulation pathways, complement factors and a cellular immune response. This review discusses the multiple pathways leading to endothelial cell activation, neutrophil recruitment and production of reactive oxygen species and nitric oxide. All these factors may induce cellular damage and subsequent organ injury. Multiple organ dysfunction after cardiac surgery with EC is associated with an increased morbidity and mortality. In addition to the pathogenesis of organ dysfunction after EC, this review deals with different therapeutic interventions aiming to alleviate the inflammatory response and consequently multiple organ dysfunction after cardiac surgery. PMID:26060024

  12. Role of Circulating Fibrocytes in Cardiac Fibrosis

    Institute of Scientific and Technical Information of China (English)

    Rong-Jie Lin; Zi-Zhuo Su; Shu-Min Liang; Yu-Yang Chen; Xiao-Rong Shu; Ru-Qiong Nie; Jing-Feng Wang

    2016-01-01

    Objective: It is revealed that circulating fibrocytes are elevated in patients/animals with cardiac fibrosis, and this review aims to provide an introduction to circulating fibrocytes and their role in cardiac fibrosis.Data Sources: This review is based on the data from 1994 to present obtained from PubMed.The search terms were "circulating fibrocytes" and "cardiac fibrosis".Study Selection: Articles and critical reviews, which are related to circulating fibrocytes and cardiac fibrosis, were selected.Results: Circulating fibrocytes, which are derived from hematopoietic stem cells, represent a subset of peripheral blood mononuclear cells exhibiting mixed morphological and molecular characteristics ofhematopoietic and mesenchymal cells (CD34+/CD45+/collagen I+).They can produce extracellular matrix and many cytokines.It is shown that circulating fibrocytes participate in many fibrotic diseases, including cardiac fibrosis.Evidence accumulated in recent years shows that aging individuals and patients with hypertension, heart failure, coronary heart disease, and atrial fibrillation have more circulating fibrocytes in peripheral blood and/or heart tissue, and this elevation of circulating fibrocytes is correlated with the degree of fibrosis in the hearts.Conclusions: Circulating fibrocytes are effector cells in cardiac fibrosis.

  13. The Rank of Integral Circulant Graphs

    Institute of Scientific and Technical Information of China (English)

    ZHOU Hou-qing

    2014-01-01

    A graph is called an integral graph if it has an integral spectrum i.e., all eigen-values are integers. A graph is called circulant graph if it is Cayley graph on the circulant group, i.e., its adjacency matrix is circulant. The rank of a graph is defined to be the rank of its adjacency matrix. This importance of the rank, due to applications in physics, chemistry and combinatorics. In this paper, using Ramanujan sums, we study the rank of integral circulant graphs and gave some simple computational formulas for the rank and provide an example which shows the formula is sharp.

  14. A brief etymology of the collateral circulation.

    Science.gov (United States)

    Faber, James E; Chilian, William M; Deindl, Elisabeth; van Royen, Niels; Simons, Michael

    2014-09-01

    It is well known that the protective capacity of the collateral circulation falls short in many individuals with ischemic disease of the heart, brain, and lower extremities. In the past 15 years, opportunities created by molecular and genetic tools, together with disappointing outcomes in many angiogenic trials, have led to a significant increase in the number of studies that focus on: understanding the basic biology of the collateral circulation; identifying the mechanisms that limit the collateral circulation's capacity in many individuals; devising methods to measure collateral extent, which has been found to vary widely among individuals; and developing treatments to increase collateral blood flow in obstructive disease. Unfortunately, accompanying this increase in reports has been a proliferation of vague terms used to describe the disposition and behavior of this unique circulation, as well as the increasing misuse of well-ensconced ones by new (and old) students of collateral circulation. With this in mind, we provide a brief glossary of readily understandable terms to denote the formation, adaptive growth, and maladaptive rarefaction of collateral circulation. We also propose terminology for several newly discovered processes that occur in the collateral circulation. Finally, we include terms used to describe vessels that are sometimes confused with collaterals, as well as terms describing processes active in the general arterial-venous circulation when ischemic conditions engage the collateral circulation. We hope this brief review will help unify the terminology used in collateral research.

  15. Improvement of Classification of Enterprise Circulating Funds

    Directory of Open Access Journals (Sweden)

    Rohanova Hanna O.

    2014-02-01

    Full Text Available The goal of the article lies in revelation of possibilities of increase of efficiency of managing enterprise circulating funds by means of improvement of their classification features. Having analysed approaches of many economists to classification of enterprise circulating funds, systemised and supplementing them, the article offers grouping classification features of enterprise circulating funds. In the result of the study the article offers an expanded classification of circulating funds, which clearly shows the role of circulating funds in managing enterprise finance and economy in general. The article supplements and groups classification features of enterprise circulating funds by: the organisation level, functioning character, sources of formation and their cost, and level of management efficiency. The article shows that the provided grouping of classification features of circulating funds allows exerting all-sided and purposeful influence upon indicators of efficiency of circulating funds functioning and facilitates their rational management in general. The prospect of further studies in this direction is identification of the level of attraction of loan resources by production enterprises for financing circulating funds.

  16. Circulating omentin concentration increases after weight loss

    Directory of Open Access Journals (Sweden)

    Ricart Wifredo

    2010-04-01

    Full Text Available Abstract Background Omentin-1 is a novel adipokine expressed in visceral adipose tissue and negatively associated with insulin resistance and obesity. We aimed to study the effects of weight loss-induced improved insulin sensitivity on circulating omentin concentrations. Methods Circulating omentin-1 (ELISA concentration in association with metabolic variables was measured in 35 obese subjects (18 men, 17 women before and after hypocaloric weight loss. Results Baseline circulating omentin-1 concentrations correlated negatively with BMI (r = -0.58, p Conclusion As previously described with adiponectin, circulating omentin-1 concentrations increase after weight loss-induced improvement of insulin sensitivity.

  17. The discovery of pulmonary circulation: From Imhotep to William Harvey.

    Science.gov (United States)

    ElMaghawry, Mohamed; Zanatta, Alberto; Zampieri, Fabio

    2014-01-01

    In his quest to comprehend his existence, Man has long been exploring his outer world (macro-cosmos), as well as his inner world (micro-cosmos). In modern times, monmental advances in the fields of physics, chemistry, and other natural sciences have reflected on how we understand the anatomy and physiology of the human body and circulation. Yet, humanity took a long and winding road to reach what we acknowledge today as solid facts of cardiovascular physiology. In this article, we will review some of the milestones along this road.

  18. The discovery of pulmonary circulation: From Imhotep to William Harvey.

    Science.gov (United States)

    ElMaghawry, Mohamed; Zanatta, Alberto; Zampieri, Fabio

    2014-01-01

    In his quest to comprehend his existence, Man has long been exploring his outer world (macro-cosmos), as well as his inner world (micro-cosmos). In modern times, monmental advances in the fields of physics, chemistry, and other natural sciences have reflected on how we understand the anatomy and physiology of the human body and circulation. Yet, humanity took a long and winding road to reach what we acknowledge today as solid facts of cardiovascular physiology. In this article, we will review some of the milestones along this road. PMID:25405183

  19. The discovery of pulmonary circulation: From Imhotep to William Harvey

    OpenAIRE

    Elmaghawry, Mohamed; Zanatta, Alberto; Zampieri, Fabio

    2014-01-01

    In his quest to comprehend his existence, Man has long been exploring his outer world (macro-cosmos), as well as his inner world (micro-cosmos). In modern times, monmental advances in the fields of physics, chemistry, and other natural sciences have reflected on how we understand the anatomy and physiology of the human body and circulation. Yet, humanity took a long and winding road to reach what we acknowledge today as solid facts of cardiovascular physiology. In this article, we will review...

  20. Circulatory shear flow alters the viability and proliferation of circulating colon cancer cells

    Science.gov (United States)

    Fan, Rong; Emery, Travis; Zhang, Yongguo; Xia, Yuxuan; Sun, Jun; Wan, Jiandi

    2016-06-01

    During cancer metastasis, circulating tumor cells constantly experience hemodynamic shear stress in the circulation. Cellular responses to shear stress including cell viability and proliferation thus play critical roles in cancer metastasis. Here, we developed a microfluidic approach to establish a circulatory microenvironment and studied circulating human colon cancer HCT116 cells in response to a variety of magnitude of shear stress and circulating time. Our results showed that cell viability decreased with the increase of circulating time, but increased with the magnitude of wall shear stress. Proliferation of cells survived from circulation could be maintained when physiologically relevant wall shear stresses were applied. High wall shear stress (60.5 dyne/cm2), however, led to decreased cell proliferation at long circulating time (1 h). We further showed that the expression levels of β-catenin and c-myc, proliferation regulators, were significantly enhanced by increasing wall shear stress. The presented study provides a new insight to the roles of circulatory shear stress in cellular responses of circulating tumor cells in a physiologically relevant model, and thus will be of interest for the study of cancer cell mechanosensing and cancer metastasis.

  1. Genome-wide circulating microRNA expression profiling indicates biomarkers for epilepsy

    OpenAIRE

    Wang, Jun; Yu, Jin-Tai; Tan, Lin; Tian, Yan; Ma, Jing; Tan, Chen-Chen; Wang, Hui-Fu; Liu, Ying; Tan, Meng-Shan; Jiang, Teng; Tan, Lan

    2015-01-01

    MicroRNAs (miRNAs) have been proposed as biomarkers for cancer and other diseases due to their stability in serum. In epilepsy, miRNAs have almost been studied in brain tissues and in animals' circulation, but not in circulation of human. To date, a major challenge is to develop biomarkers to improve the current diagnosis of epilepsy. The aim of this study was to evaluate whether circulating miRNAs can be used as biomarkers for epilepsy. We measured the differences in serum miRNA levels betwe...

  2. Construction of a Sequencing Library from Circulating Cell-Free DNA.

    Science.gov (United States)

    Fang, Nan; Löffert, Dirk; Akinci-Tolun, Rumeysa; Heitz, Katja; Wolf, Alexander

    2016-01-01

    Circulating DNA is cell-free DNA (cfDNA) in serum or plasma that can be used for non-invasive prenatal testing, as well as cancer diagnosis, prognosis, and stratification. High-throughput sequence analysis of the cfDNA with next-generation sequencing technologies has proven to be a highly sensitive and specific method in detecting and characterizing mutations in cancer and other diseases, as well as aneuploidy during pregnancy. This unit describes detailed procedures to extract circulating cfDNA from human serum and plasma and generate sequencing libraries from a wide concentration range of circulating DNA. © 2016 by John Wiley & Sons, Inc. PMID:27038390

  3. Evolution of the hemagglutinin expressed by human influenza A(H1N1)pdm09 and A(H3N2) viruses circulating between 2008-2009 and 2013-2014 in Germany.

    Science.gov (United States)

    Wedde, Marianne; Biere, Barbara; Wolff, Thorsten; Schweiger, Brunhilde

    2015-10-01

    This report describes the evolution of the influenza A(H1N1)pdm09 and A(H3N2) viruses circulating in Germany between 2008-2009 and 2013-2014. The phylogenetic analysis of the hemagglutinin (HA) genes of both subtypes revealed similar evolution of the HA variants that were also seen worldwide with minor exceptions. The analysis showed seven distinct HA clades for A(H1N1)pdm09 and six HA clades for A(H3N2) viruses. Herald strains of both subtypes appeared sporadically since 2008-2009. Regarding A(H1N1)pdm09, herald strains of HA clade 3 and 4 were detected late in the 2009-2010 season. With respect to A(H3N2), we found herald strains of HA clade 3, 4 and 7 between 2009 and 2012. Those herald strains were predominantly seen for minor and not for major HA clades. Generally, amino acid substitutions were most frequently found in the globular domain, including substitutions near the antigenic sites or the receptor binding site. Differences between both influenza A subtypes were seen with respect to the position of the indicated substitutions in the HA. For A(H1N1)pdm09 viruses, we found more substitutions in the stem region than in the antigenic sites. In contrast, in A(H3N2) viruses most changes were identified in the major antigenic sites and five changes of potential glycosylation sites were identified in the head of the HA monomer. Interestingly, we found in seasons with less influenza activity a relatively high increase of substitutions in the head of the HA in both subtypes. This might be explained by the fact that mutations under negative selection are subsequently compensated by secondary mutations to restore important functions e.g. receptor binding properties. A better knowledge of basic evolution strategies of influenza viruses will contribute to the refinement of predictive mathematical models for identifying novel antigenic drift variants.

  4. Human parvovirus B19 infection in a renal transplant recipient: a case report

    OpenAIRE

    Alves Michelle Teodoro; Vilaça Sandra Simone; Carvalho Maria das Graças; Fernandes Ana Paula; Dusse Luci Maria Sant’ Ana; Gomes Karina Braga

    2013-01-01

    Abstract Background Parvovirus B19 presents tropism for human erythroid progenitor cells, causing chronic anemia in organ transplant recipients, due to their suppressed humoral and cellular responses. Diagnosis may be achieved through serological tests for detection of anti-B19 antibodies. However, renal transplant recipients are not routinely tested for parvovirus B19 infection, since there is scanty data or consensus on screening for B19 infection, as well as for treatment or preventive man...

  5. Effects of Elevated Circulating Cortisol Concentrations on Maternal Behavior in Common Marmoset Monkeys (Callithrix jacchus)

    OpenAIRE

    Saltzman, Wendy; Abbott, David H.

    2009-01-01

    Both acute and chronic stress can impair maternal behavior and increase rates of infant abuse in several species. The mechanisms inducing these effects are unknown, but experimental manipulation of circulating corticosterone levels alters maternal behavior in rats, and circulating or excreted cortisol concentrations have been found to correlate either positively or negatively with maternal behavior in humans and nonhuman primates. In this study, therefore, we experimentally tested the hypothe...

  6. Detection of HER2 amplification in circulating free DNA in patients with breast cancer

    OpenAIRE

    Page, K; Hava, N.; Ward, B; Brown, J.; Guttery, D S; Ruangpratheep, C; Blighe, K; Sharma, A.; Walker, R. A.; Coombes, R. C.; Shaw, J. A.

    2011-01-01

    Background: Human epidermal growth factor receptor 2 (HER2) is amplified and overexpressed in 20–25% of breast cancers. This study investigated circulating free DNA (cfDNA) for detection of HER2 gene amplification in patients with breast cancer. Methods: Circulating free DNA was extracted from plasma of unselected patients with primary breast cancer (22 before surgery and 68 following treatment), 30 metastatic patients and 98 female controls using the QIAamp Blood DNA Mini Kit (Qiagen). The r...

  7. High Circulating Frequencies of Tumor Necrosis Factor Alpha- and Interleukin-2-Secreting Human T-Lymphotropic Virus Type 1 (HTLV-1)-Specific CD4+ T Cells in Patients with HTLV-1-Associated Neurological Disease

    OpenAIRE

    Goon, Peter K. C.; Igakura, Tadahiko; Hanon, Emmanuel; Angelina J Mosley; Asquith, Becca; Gould, Keith G.; Taylor, Graham P.; Weber, Jonathan N.; Bangham, Charles R M

    2003-01-01

    Significantly higher frequencies of tumor necrosis factor alpha- and interleukin-2-secreting human T-lymphotropic virus type 1 (HTLV-1)-specific CD4+ T cells were present in the peripheral blood mononuclear cells of HTLV-1-associated myelopathy/tropical spastic paraparesis (HAM/TSP) patients than in those of asymptomatic carriers with similar provirus loads. The data suggest that HTLV-1-specific CD4+ T cells play a role in the pathogenesis of HAM/TSP.

  8. Kelvin's Canonical Circulation Theorem in Hall Magnetohydrodynamics

    CERN Document Server

    Shivamoggi, B K

    2016-01-01

    The purpose of this paper is to show that, thanks to the restoration of the legitimate connection between the current density and the plasma flow velocity in Hall magnetohydrodynamics (MHD), Kelvin's Circulation Theorem becomes valid in Hall MHD. The ion-flow velocity in the usual circulation integral is now replaced by the canonical ion-flow velocity.

  9. On So's conjecture for integral circulant graphs

    Directory of Open Access Journals (Sweden)

    J.W. Sander

    2015-04-01

    According to a conjecture of {\\sc So} two integral circulant graphs are isomorphic if and only if they are isospectral, i.e. they have the same eigenvalues (counted with multiplicities. We prove a weaker form of this conjecture, namely, that two integral circulant graphs with multiplicative divisor sets are isomorphic if and only if their spectral vectors coincide.

  10. Circulating filarial antigen detection in brugian filariasis.

    Science.gov (United States)

    Tripathi, Praveen Kumar; Mahajan, Ramesh Chander; Malla, Nancy; Mewara, Abhishek; Bhattacharya, Shailja Misra; Shenoy, Ranganatha Krishna; Sehgal, Rakesh

    2016-03-01

    Human lymphatic filariasis (LF) is a major cause of disability globally. The success of global elimination programmes for LF depends upon effectiveness of tools for diagnosis and treatment. In this study on stage-specific antigen detection in brugian filariasis, L3, adult worm (AW) and microfilarial antigenaemia were detected in around 90-95% of microfilariae carriers (MF group), 50-70% of adenolymphangitis (ADL) patients, 10-25% of chronic pathology (CP) patients and 10-15% of endemic normal (EN) controls. The sensitivity of the circulating filarial antigen (CFA) detection in serum samples from MF group was up to 95%. In sera from ADL patients, unexpectedly, less antigen reactivity was observed. In CP group all the CFA positive individuals were from CP grade I and II only and none from grade III or IV, suggesting that with chronicity the AWs lose fecundity and start to disintegrate and die. Amongst EN subject, 10-15% had CFA indicating that few of them harbour filarial AWs, thus they might not be truly immune as has been conventionally believed. The specificity for antigen detection was 100% when tested with sera from various other protozoan and non-filarial helminthic infections.

  11. Numerical Modeling of Ocean Circulation

    Science.gov (United States)

    Miller, Robert N.

    2007-01-01

    The modelling of ocean circulation is important not only for its own sake, but also in terms of the prediction of weather patterns and the effects of climate change. This book introduces the basic computational techniques necessary for all models of the ocean and atmosphere, and the conditions they must satisfy. It describes the workings of ocean models, the problems that must be solved in their construction, and how to evaluate computational results. Major emphasis is placed on examining ocean models critically, and determining what they do well and what they do poorly. Numerical analysis is introduced as needed, and exercises are included to illustrate major points. Developed from notes for a course taught in physical oceanography at the College of Oceanic and Atmospheric Sciences at Oregon State University, this book is ideal for graduate students of oceanography, geophysics, climatology and atmospheric science, and researchers in oceanography and atmospheric science. Features examples and critical examination of ocean modelling and results Demonstrates the strengths and weaknesses of different approaches Includes exercises to illustrate major points and supplement mathematical and physical details

  12. Circulating Hematopoietic Stem and Progenitor Cells in Aging Atomic Bomb Survivors.

    Science.gov (United States)

    Kyoizumi, Seishi; Kubo, Yoshiko; Misumi, Munechika; Kajimura, Junko; Yoshida, Kengo; Hayashi, Tomonori; Imai, Kazue; Ohishi, Waka; Nakachi, Kei; Young, Lauren F; Shieh, Jae-Hung; Moore, Malcolm A; van den Brink, Marcel R M; Kusunoki, Yoichiro

    2016-01-01

    It is not yet known whether hematopoietic stem and progenitor cells (HSPCs) are compromised in the aging population of atomic bomb (A-bomb) survivors after their exposure nearly 70 years ago. To address this, we evaluated age- and radiation-related changes in different subtypes of circulating HSPCs among the CD34-positive/lineage marker-negative (CD34(+)Lin(-)) cell population in 231 Hiroshima A-bomb survivors. We enumerated functional HSPC subtypes, including: cobblestone area-forming cells; long-term culture-initiating cells; erythroid burst-forming units; granulocyte and macrophage colony-forming units; and T-cell and natural killer cell progenitors using cell culture. We obtained the count of each HSPC subtype per unit volume of blood and the proportion of each HSPC subtype in CD34(+)Lin(-) cells to represent the lineage commitment trend. Multivariate analyses, using sex, age and radiation dose as variables, showed significantly decreased counts with age in the total CD34(+)Lin(-) cell population and all HSPC subtypes. As for the proportion, only T-cell progenitors decreased significantly with age, suggesting that the commitment to the T-cell lineage in HSPCs continuously declines with age throughout the lifetime. However, neither the CD34(+)Lin(-) cell population, nor HSPC subtypes showed significant radiation-induced dose-dependent changes in counts or proportions. Moreover, the correlations of the proportions among HSPC subtypes in the survivors properly revealed the hierarchy of lineage commitments. Taken together, our findings suggest that many years after exposure to radiation and with advancing age, the number and function of HSPCs in living survivors as a whole may have recovered to normal levels. PMID:26720799

  13. Lack of Association between Nuclear Factor Erythroid-Derived 2-Like 2 Promoter Gene Polymorphisms and Oxidative Stress Biomarkers in Amyotrophic Lateral Sclerosis Patients

    Directory of Open Access Journals (Sweden)

    Annalisa LoGerfo

    2014-01-01

    Full Text Available Oxidative stress involvement has been strongly hypothesized among the possible pathogenic mechanisms of motor neuron degeneration in amyotrophic lateral sclerosis (ALS. The intracellular redox balance is finely modulated by numerous complex mechanisms critical for cellular functions, among which the nuclear factor erythroid-derived 2-like 2 (NFE2L2/Nrf2 pathways. We genotyped, in a cohort of ALS patients (n=145 and healthy controls (n=168, three SNPs in Nrf2 gene promoter: −653 A/G, −651 G/A, and −617 C/A and evaluated, in a subset (n=73 of patients, advanced oxidation protein products (AOPP, iron-reducing ability of plasma (FRAP, and plasma thiols (-SH as oxidative damage peripheral biomarkers. Nrf2 polymorphisms were not different among patients and controls. Increased levels of AOPP (P<0.05 and decreased levels of FRAP (P<0.001 have been observed in ALS patients compared with controls, but no difference in -SH values was found. Furthermore, no association was found between biochemical markers of redox balance and Nrf2 polymorphisms. These data confirm an altered redox balance in ALS and indicate that, while being abnormally modified compared to controls, the oxidative stress biomarkers assessed in this study are independent from the −653 A/G, −651 G/A, and −617 C/A Nrf2 SNPs in ALS patients.

  14. Lack of association between nuclear factor erythroid-derived 2-like 2 promoter gene polymorphisms and oxidative stress biomarkers in amyotrophic lateral sclerosis patients.

    Science.gov (United States)

    LoGerfo, Annalisa; Chico, Lucia; Borgia, Loredana; Petrozzi, Lucia; Rocchi, Anna; D'Amelio, Antonia; Carlesi, Cecilia; Caldarazzo Ienco, Elena; Mancuso, Michelangelo; Siciliano, Gabriele

    2014-01-01

    Oxidative stress involvement has been strongly hypothesized among the possible pathogenic mechanisms of motor neuron degeneration in amyotrophic lateral sclerosis (ALS). The intracellular redox balance is finely modulated by numerous complex mechanisms critical for cellular functions, among which the nuclear factor erythroid-derived 2-like 2 (NFE2L2/Nrf2) pathways. We genotyped, in a cohort of ALS patients (n = 145) and healthy controls (n = 168), three SNPs in Nrf2 gene promoter: -653 A/G, -651 G/A, and -617 C/A and evaluated, in a subset (n = 73) of patients, advanced oxidation protein products (AOPP), iron-reducing ability of plasma (FRAP), and plasma thiols (-SH) as oxidative damage peripheral biomarkers. Nrf2 polymorphisms were not different among patients and controls. Increased levels of AOPP (P < 0.05) and decreased levels of FRAP (P < 0.001) have been observed in ALS patients compared with controls, but no difference in -SH values was found. Furthermore, no association was found between biochemical markers of redox balance and Nrf2 polymorphisms. These data confirm an altered redox balance in ALS and indicate that, while being abnormally modified compared to controls, the oxidative stress biomarkers assessed in this study are independent from the -653 A/G, -651 G/A, and -617 C/A Nrf2 SNPs in ALS patients. PMID:24672634

  15. Nuclear factor erythroid 2-related factor 2 antibody attenuates thermal hyperalgesia in the dorsal root ganglion: Neurochemical changes and behavioral studies after sciatic nerve-pinch injury.

    Science.gov (United States)

    Xiang, Qiong; Yu, Chao; Zhu, Yao-Feng; Li, Chun-Yan; Tian, Rong-Bo; Li, Xian-Hui

    2016-08-01

    Oxidative stress is generated in several peripheral nerve injury models.Nuclear factor erythroid 2-related factor 2 (Nrf2) is activated to have a role in antioxidant effect. After nerve injury, the severely painful behavior is also performed. However, little has been explored regarding the function of Nrf2 in this painful process. Therefore, in this study, we compared the effects of Nrf2 antibody administration following sciatic nerve-pinch injury on painful behavior induced in young mice and neurochemical changes in dorsal root ganglion neurons. After pinch nerve injury, we found that the magnitude of the thermal allodynia was significantly decreased after application of Nrf2 antibody (5ul, 1mg/ml) in such injured animals and phosphorylated ERK(p-ERK) as well as the apoptotic protein (i.e., Bcl-6) in DRG neurons were also down-regulated in the anti-Nrf2-treated injured groups compared to the saline-treated groups. Taken collectively, these data suggested that the Nrf2 antibody reduced thermal hyperalgesia via ERK pathway and the down regulation of Bcl-6 protein from the apoptosis pathway might be protecting against the protein deletions caused by anti-Nrf2 effect and suggested the new therapeutic strategy with Nrf2 inhibitor following nerve injury. PMID:27316447

  16. Integrative genomic analysis in K562 chronic myelogenous leukemia cells reveals that proximal NCOR1 binding positively regulates genes that govern erythroid differentiation and Imatinib sensitivity.

    Science.gov (United States)

    Long, Mark D; van den Berg, Patrick R; Russell, James L; Singh, Prashant K; Battaglia, Sebastiano; Campbell, Moray J

    2015-09-01

    To define the functions of NCOR1 we developed an integrative analysis that combined ENCODE and NCI-60 data, followed by in vitro validation. NCOR1 and H3K9me3 ChIP-Seq, FAIRE-seq and DNA CpG methylation interactions were related to gene expression using bootstrapping approaches. Most NCOR1 combinations (24/44) were associated with significantly elevated level expression of protein coding genes and only very few combinations related to gene repression. DAVID's biological process annotation revealed that elevated gene expression was uniquely associated with acetylation and ETS binding. A matrix of gene and drug interactions built on NCI-60 data identified that Imatinib significantly targeted the NCOR1 governed transcriptome. Stable knockdown of NCOR1 in K562 cells slowed growth and significantly repressed genes associated with NCOR1 cistrome, again, with the GO terms acetylation and ETS binding, and significantly dampened sensitivity to Imatinib-induced erythroid differentiation. Mining public microarray data revealed that NCOR1-targeted genes were significantly enriched in Imatinib response gene signatures in cell lines and chronic myelogenous leukemia (CML) patients. These approaches integrated cistrome, transcriptome and drug sensitivity relationships to reveal that NCOR1 function is surprisingly most associated with elevated gene expression, and that these targets, both in CML cell lines and patients, associate with sensitivity to Imatinib.

  17. Argon protects against hypoxic-ischemic brain injury in neonatal rats through activation of nuclear factor (erythroid-derived 2)-like 2

    Science.gov (United States)

    Zhao, Hailin; Mitchell, Sian; Ciechanowicz, Sarah; Savage, Sinead; Wang, Tianlong; Ji, Xunming; Ma, Daqing

    2016-01-01

    Perinatal hypoxic ischaemic encephalopathy (HIE) has a high mortality rate with neuropsychological impairment. This study investigated the neuroprotective effects of argon against neonatal hypoxic-ischaemic brain injury. In vitro cortical neuronal cell cultures derived from rat foetuses were subjected to an oxygen and glucose deprivation (OGD) challenge for 90 minutes and then exposed to 70% argon or nitrogen with 5% carbon dioxide and balanced with oxygen for 2 hours. In vivo, seven-day-old rats were subjected to unilateral common carotid artery ligation followed by hypoxic (8% oxygen balanced with nitrogen) insult for 90 minutes. They were exposed to 70% argon or nitrogen balanced with oxygen for 2 hours. In vitro, argon treatment of cortical neuronal cultures resulted in a significant increase of p-mTOR and Nuclear factor (erythroid-derived 2)-like 2(Nrf2) and protection against OGD challenge. Inhibition of m-TOR through Rapamycin or Nrf2 through siRNA abolished argon-mediated cyto-protection. In vivo, argon exposure significantly enhanced Nrf2 and its down-stream effector NAD(P)H Dehydrogenase, Quinone 1(NQO1) and superoxide dismutase 1(SOD1). Oxidative stress, neuroinflammation and neuronal cell death were significantly decreased and brain infarction was markedly reduced. Blocking PI-3K through wortmannin or ERK1/2 through U0126 attenuated argon-mediated neuroprotection. These data provide a new molecular mechanism for the potential application of argon as a neuroprotectant in HIE. PMID:27016422

  18. Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

    Energy Technology Data Exchange (ETDEWEB)

    Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk

    2014-04-25

    Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

  19. Anti-fibrotic effects of L-2-oxothiazolidine-4-carboxylic acid via modulation of nuclear factor erythroid 2-related factor 2 in rats

    Directory of Open Access Journals (Sweden)

    In Hee Kim1,2, Dae-Ghon Kim1,2*, Peipei Hao2, Yunpeng Wang2, Seong Hun Kim1,2, Sang Wook Kim1,2, Seung Ok Lee1,2 & Soo Teik Lee1,2

    2012-06-01

    Full Text Available L-2-Oxothiazolidine-4-carboxylic acid (OTC is a cysteine prodrugthat maintains glutathione in tissues. The present studywas designed to investigate anti-fibrotic and anti-oxidative effectsof OTC via modulation of nuclear factor erythroid 2-relatedfactor 2 (Nrf2 in an in vivo thioacetamide (TAA-inducedhepatic fibrosis model. Treatment with OTC (80 or 160 mg/kgimproved serum liver function parameters and significantlyameliorated liver fibrosis. The OTC treatment groups exhibitedsignificantly lower expression of α-smooth muscle actin, transforminggrowth factor-β1, and collagen α1 mRNA than that inthe TAA model group. Furthermore, the OTC treatment groupsshowed a significant decrease in hepatic malondialdehyde levelcompared to that in the TAA model group. Nrf2 and hemeoxygenase-1 expression increased significantly in the OTCtreatment groups compared with that in the TAA model group.Taken together, these results suggest that OTC restores the anti-oxidative system by upregulating Nrf2; thus, ameliorating liverinjury and a fibrotic reaction.

  20. Interannual variability of the Adriatic Sea circulation

    Science.gov (United States)

    Beg Paklar, Gordana; Sepic, Jadranka; Grbec, Branka; Dzoic, Tomislav; Kovac, Zarko; Ivatek-Sahdan, Stjepan

    2016-04-01

    The Regional Ocean Modeling System (ROMS) was implemented in order to reproduce interannual variability of the Adriatic Sea circulation. Simulations and model result analysis were performed for a three-year period from 1st January 2011 to 31st December 2013. ROMS model run was forced with realistic atmospheric fields obtained from meteorological model Aladin, climatological river discharges, tides and Mediterranean circulation imposed at the southern open boundary. Atmospheric forcing included momentum, heat and water fluxes calculated interactively from the Aladin surface fields during ROMS model simulations. Model results were compared with available CTD and ADCP measurements and discussed in the light of the climatological circulation and thermohaline properties of the Adriatic Sea and its coastal areas. Interannual variability in the Adriatic circulation is related to the prevailing atmospheric conditions, changes in the hydrological conditions and water mass exchange at the Otranto Strait. Basic features of the Adriatic circulation - basin-wide cyclonic circulation with several embedded smaller cyclonic gyres around main pits - are well reproduced by ROMS model. Modelled temperatures and salinities are within corresponding seasonal intervals, although measured profiles generally indicate stronger stratification than modelled ones. Summer circulation in 2011 with current reversal obtained along the eastern Adriatic coast was related to the sampling results of the early fish stages as well as to ARGO drifter movements. Simulated fields from the Adriatic scale model were used to prescribe the initial and open boundary conditions for the interannual simulation in the middle Adriatic coastal domain.

  1. Development of CO2 circulators

    International Nuclear Information System (INIS)

    The development of the basic machine types we have supplied has not been without problems. The Windscale AGR (the prototype AGR) was a small 1.2 MW vertically up circulator with an inlet temperature of 237 deg. C (459 deg. F). Oil leakage problems occurred and were cured in the works test facility and the machine went into service with no other problems. The Horizontal 5 MW machines for Hinkley/Hunterston were not so fortunate with vibration problems, interface corrosion problems (effecting the whole reactor) and material dimensional stability problems. Oil ingress problems did not show up in test work but were later reported from site. These reports were initially exagerated due to the measuring techniques which took the operators some time to resolve. In the vertical 5 MW machines for Hartlepool and Heysham 1 there are two interesting factors, firstly a spar failure and secondly shaft axial stability. Many of the problems were due to modifications at site or our inability to model all aspects of site installation from which lessons for the future can be learned. The latest stations Torness and Heysham II incorporate these lessons. The machines have been designed with so much margin that during the resolution of the reactor control rod gag problems the machines were run continuously at 20% overload (6.3 MW). From an initial accident case of 350 deg. C inlet temperature, this increased to 458 deg. C and now stands at 585 deg. C. No modifications to the impeller were required. The site experience to date is good with no operational problems reported. (author). 4 figs

  2. Circulating Zinc-α2-glycoprotein levels and Insulin Resistance in Polycystic Ovary Syndrome.

    Science.gov (United States)

    Lai, Yerui; Chen, Jinhua; Li, Ling; Yin, Jingxia; He, Junying; Yang, Mengliu; Jia, Yanjun; Liu, Dongfang; Liu, Hua; Liao, Yong; Yang, Gangyi

    2016-01-01

    The aim of study was to assess the relationship between zinc-α2-glycoprotein (ZAG) and androgen excess with insulin resistance in polycystic ovary syndrome (PCOS) women. 99 PCOS women and 100 healthy controls were recruited. Euglycemic-hyperinsulinemic clamp (EHC) was preformed to assess their insulin sensitivity. Circulating ZAG was determined with an ELISA kit. In healthy subjects, circulating ZAG levels exhibited a characteristic diurnal rhythm in humans, with a major nocturnal rise occurring between midnight and early morning. Circulating ZAG and M-value were much lower in PCOS women than in the controls. In all population, overweight/obese subjects had significantly lower circulating ZAG levels than lean individuals. Multiple linear regression analysis revealed that only M-value and the area under the curve for glucose were independently related factors to circulating ZAG in PCOS women. Multivariate logistic regression analysis showed that circulating ZAG was significantly associated with PCOS even after controlling for anthropometric variables, blood pressure, lipid profile and hormone levels. The PCOS women with high ZAG had fewer MetS, IGT and polycystic ovaries as compared with the low ZAG PCOS women. Taken together, circulating ZAG levels are reduced in women with PCOS and ZAG may be a cytokine associated with insulin resistance in PCOS women. PMID:27180914

  3. Circulating Zinc-α2-glycoprotein levels and Insulin Resistance in Polycystic Ovary Syndrome

    Science.gov (United States)

    Lai, Yerui; Chen, Jinhua; Li, Ling; Yin, Jingxia; He, Junying; Yang, Mengliu; Jia, Yanjun; Liu, Dongfang; Liu, Hua; Liao, Yong; Yang, Gangyi

    2016-01-01

    The aim of study was to assess the relationship between zinc-α2-glycoprotein (ZAG) and androgen excess with insulin resistance in polycystic ovary syndrome (PCOS) women. 99 PCOS women and 100 healthy controls were recruited. Euglycemic-hyperinsulinemic clamp (EHC) was preformed to assess their insulin sensitivity. Circulating ZAG was determined with an ELISA kit. In healthy subjects, circulating ZAG levels exhibited a characteristic diurnal rhythm in humans, with a major nocturnal rise occurring between midnight and early morning. Circulating ZAG and M-value were much lower in PCOS women than in the controls. In all population, overweight/obese subjects had significantly lower circulating ZAG levels than lean individuals. Multiple linear regression analysis revealed that only M-value and the area under the curve for glucose were independently related factors to circulating ZAG in PCOS women. Multivariate logistic regression analysis showed that circulating ZAG was significantly associated with PCOS even after controlling for anthropometric variables, blood pressure, lipid profile and hormone levels. The PCOS women with high ZAG had fewer MetS, IGT and polycystic ovaries as compared with the low ZAG PCOS women. Taken together, circulating ZAG levels are reduced in women with PCOS and ZAG may be a cytokine associated with insulin resistance in PCOS women. PMID:27180914

  4. Circulating miRNA and cancer diagnosis

    Institute of Scientific and Technical Information of China (English)

    2009-01-01

    miRNAs are a class of small RNA molecules with regulatory function, and play an important role in tumor development and progression. It has been demonstrated that tumor-derived miRNAs exist in the circulating nucleic acids of cancer patients. This phenomenon implies that detection of the circulating miRNA may be an effective method for non-invasive diagnosis of cancer. In this review, we summarize the applications of the circulating miRNA as biomarkers in cancer diagnosis, as well as the latest research progress in this area.

  5. Natural Circulation Performance in Nuclear Power Plants

    International Nuclear Information System (INIS)

    The present paper deals with a study of natural circulation in PWR systems, The study consists of two parts: in the first one, natural circulation in experimental facilities simulating PWR plants was analyzed. This made it possible to gather a broad data base which was assumed as a reference for the subsequent part of the research. Seven Nuclear Power Plants nodalizations and additional experimental data from ''non-PWR'' facilities have been considered in the second part of the paper. Conclusions are drawn about natural circulation capabilities derived for the seven Nuclear Power Plants nodalizations and from data base pertinent to three ''non-PWR'' facilities. (author)

  6. Circulating MicroRNAs and Life Expectancy Among Identical Twins.

    Science.gov (United States)

    Wu, Shenghui; Kim, Taek-Kyun; Wu, Xiaogang; Scherler, Kelsey; Baxter, David; Wang, Kai; Krasnow, Ruth E; Reed, Terry; Dai, Jun

    2016-09-01

    Human life expectancy is influenced not only by longevity assurance mechanisms and disease susceptibility loci but also by the environment, gene-environment interactions, and chance. MicroRNAs (miRNAs) are a class of small noncoding RNAs closely related to genes. Circulating miRNAs have been shown as promising noninvasive biomarkers in the development of many pathophysiological conditions. However, the concentration of miRNA in the circulation may also be affected by environmental factors. We used a next-generation sequencing platform to assess the association of circulating miRNA with life expectancy, for which deaths are due to all causes independent of genes. In addition, we showed that miRNAs are present in 41-year archived plasma samples, which may be useful for both life expectancy and all-cause mortality risk assessment. Plasma miRNAs from nine identical male twins were profiled using next-generation sequencing. The average absolute difference in the minimum life expectancy was 9.68 years. Intraclass correlation coefficients were above 0.4 for 50% of miRNAs. Comparing deceased twins with their alive co-twin brothers, the concentrations were increased for 34 but decreased for 30 miRNAs. Identical twins discordant in life expectancy were dissimilar in the majority of miRNAs, suggesting that environmental factors are pivotal in miRNAs related to life expectancy.

  7. A novel interface for hybrid mock circulations to evaluate ventricular assist devices.

    Science.gov (United States)

    Ochsner, Gregor; Amacher, Raffael; Amstutz, Alois; Plass, André; Schmid Daners, Marianne; Tevaearai, Hendrik; Vandenberghe, Stijn; Wilhelm, Markus J; Guzzella, Lino

    2013-02-01

    This paper presents a novel mock circulation for the evaluation of ventricular assist devices (VADs), which is based on a hardware-in-the-loop concept. A numerical model of the human blood circulation runs in real time and computes instantaneous pressure, volume, and flow rate values. The VAD to be tested is connected to a numerical-hydraulic interface, which allows the interaction between the VAD and the numerical model of the circulation. The numerical-hydraulic interface consists of two pressure-controlled reservoirs, which apply the computed pressure values from the model to the VAD, and a flow probe to feed the resulting VAD flow rate back to the model. Experimental results are provided to show the proper interaction between a numerical model of the circulation and a mixed-flow blood pump. PMID:23204266

  8. Platelet Function During Hypothermia in Experimental Mock Circulation.

    Science.gov (United States)

    Van Poucke, Sven; Stevens, Kris; Kicken, Cécile; Simons, Antoine; Marcus, Abraham; Lancé, Marcus

    2016-03-01

    Alterations in platelet function are a common finding in surgical procedures involving cardiopulmonary bypass and hypothermia. Although the combined impact of hypothermia and artificial circulation on platelets has been studied before, the ultimate strategy to safely minimize the risk for bleeding and thrombosis is yet unknown. The aim of this study was to evaluate the use of a mock circulation loop to study the impact of hypothermia for platelet-related hemostatic changes. Venous blood was collected from healthy adult humans (n = 3). Closed mock circulation loops were assembled, each consisting of a centrifugal pump, an oxygenator with integrated heat exchanger, and a hardshell venous reservoir. The experiment started with the mock circulation temperature set at 37°C (T0 [0 h]). Cooling was then initiated at T1 (+2 h), where temperature was adjusted from 37°C to 32°C. Hypothermia was maintained from T2 (+4 h) to T3 (+28 h). From that point in time, rewarming from 32°C to 37°C was initiated with similar speed as cooling. From time point T4 (+30 h), normothermia (37°C) was maintained until the experiment ended at T5 (+32 h). Blood samples were analyzed in standard hematological tests: light transmission aggregometry (LTA) (arachidonic acid [AA], adenosine diphosphate [ADP], collagen [COL], thrombin-receptor-activating-peptide-14 [TRAP]), multiple electrode aggregometry (MEA) (AA, ADP, COL, TRAP), and rotational thromboelastometry (ROTEM) (EXTEM, FIBTEM, PLTEM). Hemoglobin, hematocrit, and platelet count decrease more substantially during temperature drop (37-32°C) than during hypothermia maintenance. Hb and Hct continue to follow this trend during active rewarming (32-37°C). PC increase from the moment active rewarming was initiated. None of the values return to the initial values. LTA values demonstrate a similar decrease in aggregation after stimulation with the platelet agonists between the start of the mock circulation and the start of cooling. Except

  9. Functional mapping of the genome of the B19 (human) parvovirus by in vitro translation after negative hybrid selection.

    OpenAIRE

    Ozawa, K; Ayub, J; Young, N.

    1988-01-01

    We have analyzed the coding capacity of B19 parvovirus transcripts by in vitro translation using the negative hybrid selection technique. Five different antisense oligonucleotides (18-mers) corresponding to different portions of the B19 genome were hybridized to RNA samples extracted from human erythroid bone marrow cells infected with B19 parvovirus in vitro, and RNase H was added to cleave specific B19 RNA molecules at selected sites. B19-specific translation products of these RNA samples w...

  10. Global warming and changes in ocean circulation

    Energy Technology Data Exchange (ETDEWEB)

    Duffy, P.B.; Caldeira, K.C.

    1998-02-01

    This final report provides an overview of the goals and accomplishments of this project. Modeling and observational work has raised the possibility that global warming may cause changes in the circulation of the ocean. If such changes would occur they could have important climatic consequences. The first technical goal of this project was to investigate some of these possible changes in ocean circulation in a quantitative way, using a state-of -the-art numerical model of the ocean. Another goal was to develop our ocean model, a detailed three-dimensional numerical model of the ocean circulation and ocean carbon cycles. A major non-technical goal was to establish LLNL as a center of excellence in modelling the ocean circulation and carbon cycle.

  11. EOP MIT General Circulation Model (MITgcm)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This data contains a regional implementation of the Massachusetts Institute of Technology general circulation model (MITgcm) at a 1-km spatial resolution for the...

  12. Sedimentary response to ocean gateway circulation changes

    Science.gov (United States)

    Heinze, Christoph; Crowley, Thomas J.

    1997-12-01

    Previous modeling studies suggested that changes in ocean gateways may have exerted a dramatic influence on the ocean circulation. In this pilot study we extend those results to examining the potential ramifications of circulation changes on the sedimentary record. A version of the Hamburg carbon cycle/sediment model is used in these sensitivity experiments. Results indicate that internal reorganization of the ocean circulation can potentially cause very large regional changes in lysocline depth (1500-3000 m) and opal deposition. These shifts are sometimes comparable in magnitude to those imposed by changes in external forcing (e.g., climate, sea level, and weathering). Comparisons of the model response with the geologic record indicate some significant levels of first-order agreement. This exercise suggests that opportunities now exist for physically based modeling of past sediment responses to circulation and climate changes.

  13. The Nordic Seas circulation and exchanges.

    OpenAIRE

    Hawker, E.J.

    2005-01-01

    The Nordic Seas provide the main oceanic connection between the Arctic and the deep global oceans via dense overflows between Greenland and Scotland, into the North Atlantic. An understanding of the circulation and exchanges of this region is vital for any consideration of the implications of high latitude climate change to variability in the Atlantic thermohaline circulation and consequences for regional (European) climate. This thesis makes use of a unique data set of near synoptic hyd...

  14. Efficient Circulation of Railway Rolling Stock

    OpenAIRE

    Alfieri, Arianna; Groot, Rutger; Kroon, Leo; Schrijver, Lex

    2002-01-01

    textabstractRailway rolling stock (locomotives, carriages, and train units) is one of the most significant cost sources for operatorsof passenger trains, both public and private. Rolling stock costsare due to material acquisition, power supply, and material maintenance. The efficient circulation of rolling stock material is therefore one of the objectives pursued. In this paper we focus on the circulation of train units on a single line. In order to utilize the train units on this line in an ...

  15. An online educational atmospheric global circulation model

    Science.gov (United States)

    Navarro, T.; Schott, C.; Forget, F.

    2015-10-01

    As part of online courses on exoplanets of Observatoire de Paris, an online tool designed to vizualise outputs of the Laboratoire de Métérologie Dynamique (LMD) Global Circulation Model (GCM) for various atmospheric circulation regimes has been developed. It includes the possibility for students to visualize 1D and 2D plots along with animations of atmospheric quantities such as temperature, winds, surface pressure, mass flux, etc... from a state-of-the-art model.

  16. STRUCTURES OF CIRCULANT INVERSE M-MATRICES

    Institute of Scientific and Technical Information of China (English)

    Yurui Lin; Linzhang Lu

    2007-01-01

    In this paper,we present a useful result on the structures of circulant inverse Mis not a positive matrix and not equal to c0I,then A is an inverse M-matrix if and only if there exists a positive integer k,which is a proper factor of n,such that cjk>0 for The result is then extended to the so-called generalized circulant inverse M-matrices.

  17. Clinical CVVH model removes endothelium-derived microparticles from circulation

    Directory of Open Access Journals (Sweden)

    Abdelhafeez H. Abdelhafeez

    2014-02-01

    Full Text Available Background: Endothelium-derived microparticles (EMPs are submicron vesicles released from the plasma membrane of endothelial cells in response to injury, apoptosis or activation. We have previously demonstrated EMP-induced acute lung injury (ALI in animal models and endothelial barrier dysfunction in vitro. Current treatment options for ALI are limited and consist of supportive therapies. We hypothesize that standard clinical continuous venovenous hemofiltration (CVVH reduces serum EMP levels and may be adapted as a potential therapeutic intervention. Materials and methods: EMPs were generated from plasminogen activation inhibitor-1 (PAI-1-stimulated human umbilical vein endothelial cells (HUVECs. Flow cytometric analysis was used to characterize EMPs as CD31- and annexin V-positive events in a submicron size gate. Enumeration was completed against a known concentration of latex beads. Ultimately, a concentration of ~650,000 EMP/mL perfusate fluid (total 470 mL was circulated through a standard CVVH filter (pore size 200 μm, flow rate 250 mL/hr for a period of 70 minutes. 0.5 mL aliquots were removed at 5- to 10-minute intervals for flow cytometric analysis. EMP concentration in the dialysate was measured at the end of 4 hours to better understand the fate of EMPs. Results: A progressive decrease in circulating EMP concentration was noted using standard CVVH at 250 mL/hr (a clinical standard rate from a 470 mL volume modelling a patient's circulation. A 50% reduction was noted within the first 30 minutes. EMPs entering the dialysate after 4 hours were 5.7% of the EMP original concentration. Conclusion: These data demonstrate that standard CVVH can remove EMPs from circulation in a circuit modelling a patient. An animal model of hemofiltration with induction of EMP release is required to test the therapeutic potential of this finding and potential of application in early treatment of ALI.

  18. Genetic variability of VP7, VP4, VP6 and NSP4 genes of common human G1P[8] rotavirus strains circulating in Italy between 2010 and 2014.

    Science.gov (United States)

    Ianiro, Giovanni; Delogu, Roberto; Fiore, Lucia; Ruggeri, Franco M

    2016-07-15

    Group A rotaviruses (RVA) are the leading cause of acute gastroenteritis (AGE) in young children worldwide. The RVA outer capsid layer is composed of the VP7 and VP4 proteins. The VP7 (G-type) and VP4 (P-type) genotypes are the basis for the binary RVA nomenclature. At least 27 G-types and 37 P-types of RVA are currently known, but most of human infections are related to the five major genotypes G1P[8], G2P[4], G3P[8], G4P[8], and G9P[8]. Every year G1P[8] strains cause approximately 50% of all symptomatic RVA infections reported in children in Italy. Fifteen G1P[8] RVA strains identified in different areas of Italy between 2010 and 2014 were selected. Strains were subjected to nucleotide sequencing of the VP7, VP4, VP6 and NSP4 genes to investigate their genetic variability with respect to geographic area and date of detection. Phylogenetic analyses showed that the 15 G1P[8] RVA strains belonged to two different lineages for both the VP7 and NSP4 genes, and showed some intra-lineage diversity in VP4 and VP6 genes. Similarities between strains correlated by either area or date of detection were also evaluated. The results obtained by phylogenetic analyses were confirmed analyzing the deduced amino acid sequences of the VP7, VP4, VP6 and NSP4 proteins of the G1P[8] RVA strains, detecting several substitutions in all proteins. The genetic variability observed between common G1P[8] RVAs highlights the constant evolution of the RVA genome through random point mutations (genetic drift) and intra-genotype reassortment (genetic shift). The evolution and diversity of the G1 RVA strains observed in this study can be related to the naturally acquired herd immunity, which represents the main mechanism of selective pressure in Italy, where mass anti-rotavirus vaccination was missing during the years of the study. PMID:27130628

  19. Surgical myocardial revascularization without extracorporeal circulation

    Directory of Open Access Journals (Sweden)

    Salomón Soriano Ordinola Rojas

    2003-05-01

    Full Text Available OBJECTIVE: To assess the immediate postoperative period of patients undergoing myocardial revascularization without extracorporeal circulation with different types of grafts. METHODS: One hundred and twelve patients, 89 (79.5% of whom were males, were revascularized without extracorporeal circulation. Their ages ranged from 39 to 85 years. The criteria for indicating myocardial revascularization without extracorporeal circulation were as follows: revascularized coronary artery caliber > 1.5 mm, lack of intramyocardial trajectory on coronary angiography, noncalcified coronary arteries, and tolerance of the heart to the different rotation maneuvers. RESULTS: Myocardial revascularization without extracorporeal circulation was performed in 112 patients. Three were converted to extracorporeal circulation, which required a longer hospital stay but did not impact mortality. During the procedure, the following events were observed: atrial fibrillation in 10 patients, ventricular fibrillation in 4, total transient atrioventricular block in 2, ventricular extrasystoles in 58, use of a device to retrieve red blood cells in 53, blood transfusion in 8, and arterial hypotension in 89 patients. Coronary angiography was performed in 20 patients on the seventh postoperative day when the grafts were patent. CONCLUSION: Myocardial revascularization without extracorporeal circulation is a reproducible technique that is an alternative for treating ischemic heart disease.

  20. Southern Meridional Atmospheric Circulation Associated with IOD

    Institute of Scientific and Technical Information of China (English)

    LIU Na; CHEN Hongxia

    2006-01-01

    Using the monthly wind and sea surface temperature (SST) data, southern meridional atmospheric circulation cells associated with the Indian Ocean Dipole Mode (IOD) events in the Indian Ocean are for the first time described and examined. The divergent wind and pressure vertical velocity are employed for the identification of atmospheric circulation cells. During the four different phases of the positive IOD events, the anomalous meridional Hadley circulation over the western Indian Ocean shows that the air rises in the tropics, flows poleward in the upper troposphere, sinks in the subtropics, and returns back to the tropics in the lower troposphere. The anomalous Hadley circulation over the eastern Indian Ocean is opposite to that over the western Indian Ocean. During positive IOD events, the meridional Hadley circulation over the eastern Indian Ocean is weakened while it is strengthened over the western Indian Ocean. Correlation analysis between the IOD index and the indices of the Hadley cells also proves that, the atmospheric circulation patterns are evident in every IOD event over the period of record.

  1. Global climate and ocean circulation on an aquaplanet ocean-atmosphere general circulation model

    OpenAIRE

    Smith, R.; Dubois, C.; Marotzke, J.

    2006-01-01

    A low-resolution coupled ocean–atmosphere general circulation model (OAGCM) is used to study the characteristics of the large-scale ocean circulation and its climatic impacts in a series of global coupled aquaplanet experiments. Three configurations, designed to produce fundamentally different ocean circulation regimes, are considered. The first has no obstruction to zonal flow, the second contains a low barrier that blocks zonal flow in the ocean at all latitudes, creating a single enclosed ...

  2. Grsf1-induced translation of the SNARE protein Use1 is required for expansion of the erythroid compartment.

    Directory of Open Access Journals (Sweden)

    Andrzej Nieradka

    Full Text Available Induction of cell proliferation requires a concomitant increase in the synthesis of glycosylated lipids and membrane proteins, which is dependent on ER-Golgi protein transport by CopII-coated vesicles. In this process, retrograde transport of ER resident proteins from the Golgi is crucial to maintain ER integrity, and allows for anterograde transport to continue. We previously showed that expression of the CopI specific SNARE protein Use1 (Unusual SNARE in the ER 1 is tightly regulated by eIF4E-dependent translation initiation of Use1 mRNA. Here we investigate the mechanism that controls Use1 mRNA translation. The 5'UTR of mouse Use1 contains a 156 nt alternatively spliced intron. The non-spliced form is the predominantly translated mRNA. The alternatively spliced sequence contains G-repeats that bind the RNA-binding protein G-rich sequence binding factor 1 (Grsf1 in RNA band shift assays. The presence of these G-repeats rendered translation of reporter constructs dependent on the Grsf1 concentration. Down regulation of either Grsf1 or Use1 abrogated expansion of erythroblasts. The 5'UTR of human Use1 lacks the splice donor site, but contains an additional upstream open reading frame in close proximity of the translation start site. Similar to mouse Use1, also the human 5'UTR contains G-repeats in front of the start codon. In conclusion, Grsf1 controls translation of the SNARE protein Use1, possibly by positioning the 40S ribosomal subunit and associated translation factors in front of the translation start site.

  3. 北京地区人Boca病毒全基因组序列及生物信息学分析%Genomic sequence analysis for human Bocavirus circulating in Beijing by bioinformatics

    Institute of Scientific and Technical Information of China (English)

    赵林清; 钱渊; 朱汝南; 邓洁; 王芳; Li Yan

    2007-01-01

    目的 了解北京地区人Boca病毒(human Bocavirus,HBoV)的基因组编码特征,并对其基因组编码的非结构蛋白NS1、核蛋白NP-1以及病毒外壳蛋白VP1及VP2的二级结构等特性进行预测分析.方法 从已证明为HBoV阳性的2份临床标本BJ3064、BJ3722中应用针对NS1、NP-1、VP1、VP2基因组3'末端的引物对经PCR扩增得到预期片段,将扩增产物直接测序后得到基因组序列;运用生物信息学的方法,对HBoV BJ3064基因组编码的各蛋白的二级结构及其他生物学特性进行了预测分析.结果 测序结果显示HBoV BJ3064及BJ3722基因组序列全长均为5299 bp,有4个主要的CDS(coding domain sequences),分别编码NS1、NP-1、VP1和VP2蛋白.序列同源性比较结果显示BJ3064与BJ3722间基因组序列的同源性达99.9%;与ST1比较,同源性为99.4%~99.5%;与ST2比较,同源性为99.8%;与BPV及MVC比较,同源性低于45%;与细小病毒B19的同源性仅为5%左右;基因组系统进化树分析显示BJ3064、BJ3722与ST2在一簇中,ST1属另一簇.NS1、NP-1、VP1及VP2蛋白二级结构中主要为无规卷曲,其他结构如α螺旋、β片层、β转角在不同蛋白中占有不同比例;各蛋白均无明显的跨膜结构域;NS1、NP-1属不稳定蛋白,VP1、VP2属稳定蛋白.结论 全基因组序列的确定进一步证明北京地区发现的BJ3064、BJ3722是典型的人Boca病毒,相对于ST1,BJ3064、BJ3722与ST2之间进化关系更密切;蛋白二级结构等生物信息学分析将有益于对此新发现病毒的进一步深入研究,如蛋白的表达、分离纯化以及蛋白检测条件的选择等.

  4. Circulation model for water circulation and purification in a water Cerenkov detector

    Institute of Scientific and Technical Information of China (English)

    LU Hao-Qi; YANG Chang-Gen; WANG Ling-Yu; XU Ji-Lei; WANG aui-Guang; WANG Zhi-Min; WANG Yi-Fang

    2009-01-01

    Owing to its low cost and good transparency, highly purified water is widely used as a medium in large water Cerenkov detector experiments. The water circulation and purification system is usually needed to keep the water in good quality. In this work, a practical circulation model is built to describe the variation of the water resistivity in the circulation process and compared with the data obtained from a prototype experiment. The successful test of the model makes it useful in the future design and optimization of the circulation/purification system.

  5. Experimental and numerical investigation of natural circulation phenomena in a rectangular natural circulation loop

    International Nuclear Information System (INIS)

    Natural circulation is the key phenomena in the passive cooling systems. Thus, it is important to study the flow characteristics and heat transfer behavior in natural circulation. The natural circulation phenomena in steady state and transient form is investigated using 3D CFD simulations, carried out using OpenFoam 2.2.0. The first part consists of a steady-state study, in which the results are validated by data available from a set of experiments conducted over a range of heater power (130W-360W). The second part consists of a transient study of flow development and establishment of natural circulation within this loop. (author)

  6. Molecular Evolution of the Nuclear Factor (Erythroid-Derived 2)-Like 2 Gene Nrf2 in Old World Fruit Bats (Chiroptera: Pteropodidae).

    Science.gov (United States)

    Yin, Qiuyuan; Zhu, Lei; Liu, Di; Irwin, David M; Zhang, Shuyi; Pan, Yi-Hsuan

    2016-01-01

    Mammals developed antioxidant systems to defend against oxidative damage in their daily life. Enzymatic antioxidants and low molecular weight antioxidants (LMWAs) constitute major parts of the antioxidant systems. Nuclear factor (erythroid-derived 2)-like 2 (Nrf2, encoded by the Nrf2 gene) is a central transcriptional regulator, regulating transcription, of many antioxidant enzymes. Frugivorous bats eat large amounts of fruits that contain high levels of LMWAs such as vitamin C, thus, a reliance on LMWAs might greatly reduce the need for antioxidant enzymes in comparison to insectivorous bats. Therefore, it is possible that frugivorous bats have a reduced need for Nrf2 function due to their substantial intake of diet-antioxidants. To test whether the Nrf2 gene has undergone relaxed evolution in fruit-eating bats, we obtained Nrf2 sequences from 16 species of bats, including four Old World fruit bats (Pteropodidae) and one New World fruit bat (Phyllostomidae). Our molecular evolutionary analyses revealed changes in the selection pressure acting on Nrf2 gene and identified seven specific amino acid substitutions that occurred on the ancestral lineage leading to Old World fruit bats. Biochemical experiments were conducted to examine Nrf2 in Old World fruit bats and showed that the amount of catalase, which is regulated by Nrf2, was significantly lower in the brain, heart and liver of Old World fruit bats despite higher levels of Nrf2 protein in Old World fruit bats. Computational predictions suggest that three of these seven amino acid replacements might be deleterious to Nrf2 function. Therefore, the results suggest that Nrf2 gene might have experienced relaxed constraint in Old World fruit bats, however, we cannot rule out the possibility of positive selection. Our study provides the first data on the molecular adaptation of Nrf2 gene in frugivorous bats in compensation to the increased levels of LWMAs from their fruit-diet. PMID:26735303

  7. Molecular Evolution of the Nuclear Factor (Erythroid-Derived 2)-Like 2 Gene Nrf2 in Old World Fruit Bats (Chiroptera: Pteropodidae).

    Science.gov (United States)

    Yin, Qiuyuan; Zhu, Lei; Liu, Di; Irwin, David M; Zhang, Shuyi; Pan, Yi-Hsuan

    2016-01-01

    Mammals developed antioxidant systems to defend against oxidative damage in their daily life. Enzymatic antioxidants and low molecular weight antioxidants (LMWAs) constitute major parts of the antioxidant systems. Nuclear factor (erythroid-derived 2)-like 2 (Nrf2, encoded by the Nrf2 gene) is a central transcriptional regulator, regulating transcription, of many antioxidant enzymes. Frugivorous bats eat large amounts of fruits that contain high levels of LMWAs such as vitamin C, thus, a reliance on LMWAs might greatly reduce the need for antioxidant enzymes in comparison to insectivorous bats. Therefore, it is possible that frugivorous bats have a reduced need for Nrf2 function due to their substantial intake of diet-antioxidants. To test whether the Nrf2 gene has undergone relaxed evolution in fruit-eating bats, we obtained Nrf2 sequences from 16 species of bats, including four Old World fruit bats (Pteropodidae) and one New World fruit bat (Phyllostomidae). Our molecular evolutionary analyses revealed changes in the selection pressure acting on Nrf2 gene and identified seven specific amino acid substitutions that occurred on the ancestral lineage leading to Old World fruit bats. Biochemical experiments were conducted to examine Nrf2 in Old World fruit bats and showed that the amount of catalase, which is regulated by Nrf2, was significantly lower in the brain, heart and liver of Old World fruit bats despite higher levels of Nrf2 protein in Old World fruit bats. Computational predictions suggest that three of these seven amino acid replacements might be deleterious to Nrf2 function. Therefore, the results suggest that Nrf2 gene might have experienced relaxed constraint in Old World fruit bats, however, we cannot rule out the possibility of positive selection. Our study provides the first data on the molecular adaptation of Nrf2 gene in frugivorous bats in compensation to the increased levels of LWMAs from their fruit-diet.

  8. Sulphur antioxidants inhibit oxidative stress induced retinal ganglion cell death by scavenging reactive oxygen species but influence nuclear factor (erythroid-derived 2)-like 2 signalling pathway differently.

    Science.gov (United States)

    Majid, Aman Shah Abdul; Yin, Zheng Qin; Ji, Dan

    2013-01-01

    This study aimed to show if two different sulphur containing drugs sulbutiamine and acetylcysteine (NAC) could attenuate the effects of two different insults being serum deprivation and glutamate/buthionine sulfoximine (GB)-induced death to transformed retinal ganglion cell line (RGC-5) in culture. Cells were exposed to either 5 mM of GB for 24 h or serum deprivation for 48 h with inclusion of either NAC or sulbutiamine. Cell viability, microscopic evidence for apoptosis, caspase 3 activity, reactive oxygen species (ROS), glutathione (GSH), catalase and gluthathione-S-transferase (GST) were determined. The effects of NAC and sulbutiamine on the oxidative stress related transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf-2) levels and its dependent phase II enzyme haemeoxygenase-1 (HO-1) were carried out using Western blot and quantitative-polymerase chain reaction (PCR). NAC and sulbutiamine dose-dependently attenuated serum deprivation-induced cell death. However NAC but not sulbutiamine attenuated GB-induced cell death. NAC and sulbutiamine both independently stimulated the GSH and GST production but scavenged different types of ROS with different efficacy. Moreover only sulbutiamine stimulated catalase and significantly increased Nrf-2 and HO-1 levels. In addition, the pan caspase inhibitor, benzoylcarbonyl-Val-Ala-Asp-fluoromethyl ketone (z-VAD-fmk) attenuated the negative effect of serum deprivation while the necroptosis inhibitor (necrostatin-1) counteracted solely an insult of GB. The neuroprotective actions of NAC and sulbutiamine in GB or serum-deprivation insult are therefore different. PMID:23811559

  9. A novel nuclear factor erythroid 2-related factor 2 (Nrf2) activator RS9 attenuates brain injury after ischemia reperfusion in mice.

    Science.gov (United States)

    Yamauchi, Keita; Nakano, Yusuke; Imai, Takahiko; Takagi, Toshinori; Tsuruma, Kazuhiro; Shimazawa, Masamitsu; Iwama, Toru; Hara, Hideaki

    2016-10-01

    Recanalization of occluded vessels leads to ischemia-reperfusion injury (IRI), with oxidative stress as one of the main causes of injury, despite the fact that recanalization therapy is the most effective treatment for ischemic stroke. The nuclear factor erythroid 2-related factor 2 (Nrf2) is one of the transcription factors which has an essential role in protection against oxidative stress. RS9 is a novel Nrf2 activator obtained from bardoxolone methyl (BARD), an Nrf2 activator that has already been tested in a clinical trial, using a biotransformation technique. RS9 has been reported to lead to higher Nrf2 activation and less cytotoxicity than BARD. In this study, we investigated the effects of RS9 on IRI. Mice were intraperitoneally treated immediately after 2h of transient middle cerebral artery occlusion (MCAO) with a vehicle solution or 0.2mg/kg of RS9. Post-onset treatment of RS9 attenuated the infarct volume and improved neurological deficits 22h after reperfusion. RS9 activated Nrf2 2 and 6h after reperfusion and activated heme oxygenase-1 at 6 and 22h after reperfusion. RS9 also attenuated the phosphorylation of NF-κB p65 2 and 6h after reperfusion. Finally, RS9 improved the survival rate and neurological deficits 7days after MCAO. Our results suggest that the activation of Nrf2 by RS9 has a neuroprotective effect, mediated by attenuating both oxidative stress and neuroinflammation, and that RS9 is an effective therapeutic candidate for the treatment of IRI. PMID:27474227

  10. Gemfibrozil disrupts the metabolism of circulating lipids in bobwhite quails.

    Science.gov (United States)

    Bussière-Côté, Sophie; Omlin, Teye; de Càssia Pinheiro, Eliana; Weber, Jean-Michel

    2016-01-01

    The circulating lipids of birds play essential roles for egg production and as an energy source for flight and thermogenesis. How lipid-lowering pharmaceuticals geared to prevent heart disease in humans and that are routinely released in the environment affect their metabolism is unknown. This study assesses the impact of the popular drug gemfibrozil (GEM) on the plasma phospholipids (PL), neutral lipids (NL), and nonesterified fatty acids (NEFA) of bobwhite quails (Colinus virginianus). Results show that bird lipoproteins are rapidly altered by GEM, even at environmentally-relevant doses. After 4 days of exposure, pharmacological amounts cause an 83% increase in circulating PL levels, a major decrease in average lipoprotein size measured as a 56% drop in the NL/PL ratio, and important changes in the fatty acid composition of PL and NEFA (increases in fatty acid unsaturation). The levels of PL carrying all individual fatty acids except arachidonate are strongly stimulated. The large decrease in bird lipoprotein size may reflect the effects seen in humans: lowering of LDL that can cause atherosclerosis and stimulation of HDL that promote cholesterol disposal. Lower (environmental) doses of GEM cause a reduction of %palmitate in all the plasma lipid fractions of quails, but particularly in the core triacylglycerol of lipoproteins (NL). No changes in mRNA levels of bird peroxisome proliferator-activated receptor (PPAR) could be demonstrated. The disrupting effects of GEM on circulating lipids reported here suggest that the pervasive presence of this drug in the environment could jeopardize reproduction and migratory behaviours in wild birds. PMID:26432161

  11. Preparation of oxaliplatin long-circulating liposomes and its effect on activity of human colorecal cancer SW480 cells%奥沙利铂长循环脂质体的制备及其对人结直肠癌SW480细胞活性的影响

    Institute of Scientific and Technical Information of China (English)

    杨闯; 刘海忠; 傅仲学

    2011-01-01

    Objective To investigate the preparation of oxaliplatin long-circulating liposomes and its effect on activity of human colorecal cancer SW480 cells. Methods The rverse-phase evaporation vesicles (REV) method was used to prepare the oxaliplatin long-circulating liposomes. The particle size, electric potential, entrapment efficiency and face shape were analyzed, and the effects of liposomes on activity of cells were also analyzed. Results The particle size and electric potential were ( 151.56 ± 15. 57 ) nmand ( - 23.68 ± 2. 35) mV resepctively. Entrapment efficiency was (42. 96 ± 6. 45 ) %. At 2 h, the uptake of liposomes by cells was observed. At 2, 12, 24 h, immunofluorescent intensity was 198,443 and642 respectively. After cells were treated with 2. 60 mmol/L blank liposomes, 28.00 mg/L free oxaliplatin and 2. 60 mmol/L liposomal oxaliplatin (containing 28 mg/L oxaliplatin), activity of cells was (84. 73 ±1.73 ) %, (70. 72 ± 2, 66 ) % and (57. 69 ± 3. 33 ) % respectively ( F = 104. 428, P < 0. 01 ). Additionally, the number of cell colonies was reduced. Conclusion Oxaliplatin long-circulating liposomes were successfully prepared, and could enhance cytotoxic effects against colorecal cancer SW480 cells.%目的 观察奥沙利铂长循环脂质体的制备以及对结直肠癌SW480细胞活性的影响.方法 通过逆向旋转蒸发法制备奥沙利铂长循环脂质体,检测脂质体的粒径、电位、包封率及外观形态;分析奥沙利铂长循环脂质体对细胞活性的影响.结果 脂质体粒径、电位分别为(151.56±15.57)nm,(-23.68±2.35)mV;包封率为(42.96±6.45)%;细胞对脂质体的摄入在2 h可观察到,平均荧光强度在2 12、24 h分别为198、443、642;2.60 mmol/L的空载脂质体、28.0 mg/L游离奥沙利铂及2.60 mmol/L的奥沙利铂脂质体(含28.00 mg/L奥沙利铂)分别与细胞作用12 h,细胞的活力分别是(84.73±1.73)%、(70.72±2.66)%和(57.69±3.33)%(F=104.428,P<0.01),同时细

  12. Novel reassortant swine influenza viruses are circulating in Danish pigs

    DEFF Research Database (Denmark)

    Breum, Solvej Østergaard; Hjulsager, Charlotte Kristiane; Trebbien, Ramona;

    The Danish surveillance program for influenza A virus in pigs has revealed that two novel reassortant swine influenza viruses may now be circulating in the Danish swine population, since they each have been detected in at least two submissions from different herds in 2011 as well as in 2012. One...... of the reassortant viruses comprised a HA gene similar to H1 of H1N1 avian-like swine influenza virus (SIV) and a NA gene most closely related to N2 gene of human H3N2 influenza virus that circulated in humans in the mid 1990s. The internal genes of this reassortant virus with the subtype H1avN2hu all belonged......1pdm09 influenza virus lineage. Swine influenza virus with a similar subtype to H1pdm09N2sw has previously been found in pigs in Italy and Germany. Detailed analyses of viral genes will further elucidate the relationship between these new swine influenza viruses found in the different countries...

  13. NAO-ocean circulation interactions in a coupled general circulation model

    Energy Technology Data Exchange (ETDEWEB)

    Bellucci, A. [Centro Euro-Mediterraneo per i Cambiamenti Climatici, Bologna (Italy); Gualdi, S.; Navarra, A. [Centro Euro-Mediterraneo per i Cambiamenti Climatici, Bologna (Italy); Istituto Nazionale di Geofisica e Vulcanologia, Bologna (Italy); Scoccimarro, E. [Istituto Nazionale di Geofisica e Vulcanologia, Bologna (Italy)

    2008-12-15

    The interplay between the North Atlantic Oscillation (NAO) and the large scale ocean circulation is inspected in a twentieth century simulation conducted with a state-of-the-art coupled general circulation model. Significant lead-lag covariance between oceanic and tropospheric variables suggests that the system supports a damped oscillatory mode involving an active ocean-atmosphere coupling, with a typical NAO-like space structure and a 5 years timescale, qualitatively consistent with a mid-latitude delayed oscillator paradigm. The two essential processes governing the oscillation are (1) a negative feedback between ocean gyre circulation and the high latitude SST meridional gradient and (2) a positive feedback between SST and the NAO. The atmospheric NAO pattern appears to have a weaker projection on the ocean meridional overturning, compared to the gyre circulation, which leads to a secondary role for the thermohaline circulation in driving the meridional heat transport, and thus the oscillatory mode. (orig.)

  14. Effects of 1-beta-D-arabinofuranosylcytosine and phorbol ester on differentiation of human K562 erythroleukemia cells.

    Science.gov (United States)

    Watanabe, T; Mitchell, T; Sariban, E; Sabbath, K; Griffin, J; Kufe, D

    1985-06-01

    We have previously demonstrated that 1-beta-D-arabinofuranosylcytosine (ara-C) induces hemoglobin synthesis in human K562 erythroleukemia cells. The present study extends these findings by demonstrating that ara-C treatment of K562 cells results in both increased heme synthesis and accumulation of alpha-, gamma-, epsilon-, and zeta-globin RNA. The results also demonstrate that ara-C enhances K562 cell surface expression of glycophorin. Furthermore, we demonstrate that phorbol ester (12-O-tetradecanoylphorbol-13-acetate; TPA) inhibits the effects of ara-C on heme production, accumulation of globin RNA, and glycophorin expression. The inhibitory effect occurs maximally when K562 cells are treated with TPA before undergoing ara-C-induced commitment to erythroid differentiation. These findings suggest that TPA inhibits an early step in the process required for ara-C to enhance expression of genes involved in the erythroid program.

  15. Circulating Endothelial Microparticles in Diabetes Mellitus

    Directory of Open Access Journals (Sweden)

    A. F. Tramontano

    2010-01-01

    Full Text Available Background. Endothelial Microparticles (EMPs are small vesicles shed from activated or apoptotic endothelial cells and involved in cellular cross-talk. Whether EMP immunophenotypes vary according to stimulus in Diabetes Mellitus (DM is not known. We studied the cellular adhesion molecule (CAM profile of circulating EMPs in patients with and without Diabetes Mellitus type 2, who were undergoing elective cardiac catheterization. Methods and Results. EMPs were analyzed by flow cytometry. The absolute median number of EMPs (EMPs/L specific for CD31, CD105, and CD106 was significantly increased in the DM population. The ratio of CD62E/CD31 EMP populations reflected an apoptotic process. Conclusion. Circulating CD31+, CD105+, and CD106+ EMPs were significantly elevated in patients with DM. EMPs were the only independent predictors of DM in our study cohort. In addition, the EMP immunophenotype reflected an apoptotic process. Circulating EMPs may provide new options for risk assessment.

  16. Walker circulation in a transient climate

    Science.gov (United States)

    Plesca, Elina; Grützun, Verena; Buehler, Stefan A.

    2016-04-01

    The tropical overturning circulations modulate the heat exchange across the tropics and between the tropics and the poles. The anthropogenic influence on the climate system will affect these circulations, impacting the dynamics of the Earth system. In this work we focus on the Walker circulation. We investigate its temporal and spatial dynamical changes and their link to other climate features, such as surface and sea-surface temperature patterns, El-Niño Southern Oscillation (ENSO), and ocean heat-uptake, both at global and regional scale. In order to determine the impact of anthropogenic climate change on the tropical circulation, we analyze the outputs of 28 general circulation models (GCMs) from the CMIP5 project. We use the experiment with 1% year-1 increase in CO2 concentration from pre-industrial levels to quadrupling of the concentration. Consistent with previous studies (ex. Ma and Xie 2013), we find that for this experiment most GCMs associate a weakening Walker circulation to a warming transient climate. Due to the role of the Walker Pacific cell in the meridional heat and moisture transport across the tropical Pacific and also the connection to ENSO, we find that a weakened Walker circulation correlates with more extreme El-Niño events, although without a change in their frequency. The spatial analysis of the Pacific Walker cell suggests an eastward displacement of the ascending branch, which is consistent with positive SST anomalies over the tropical Pacific and the link of the Pacific Walker cell to ENSO. Recent studies (ex. England et al. 2014) have linked a strengthened Walker circulation to stronger ocean heat uptake, especially in the western Pacific. The inter-model comparison of the correlation between Walker circulation intensity and ocean heat uptake does not convey a robust response for the investigated experiment. However, there is some evidence that a stronger weakening of the Walker circulation is linked to a higher transient climate

  17. Tropical convective transport and the Walker circulation

    Directory of Open Access Journals (Sweden)

    J. S. Hosking

    2012-05-01

    Full Text Available We introduce a methodology to visualise rapid vertical and zonal tropical transport pathways. Using prescribed sea-surface temperatures in four monthly model integrations for 2005, preferred transport routes from the troposphere to the stratosphere are found in the model over the Maritime Continent (MC in November and February, i.e., boreal winter. In these months, the ascending branch of the Walker Circulation over the MC is formed in conjunction with strong deep convection, allowing fast transport into the stratosphere. At the same time, the downwelling branch of the Walker Circulation is enhanced over the East Pacific, compared to other months in 2005, reducing locally the upward transport from emissions below. We conclude that the Walker circulation plays an important role in the seasonality of fast tropical transport from the troposphere to the stratosphere and so impacts at the same time the potential supply of surface emissions.

  18. Local thermal control of the human cutaneous circulation

    OpenAIRE

    Johnson, John M.; Kellogg, Dean L.

    2010-01-01

    The level of skin blood flow is subject to both reflex thermoregulatory control and influences from the direct effects of warming and cooling the skin. The effects of local changes in temperature are capable of maximally vasoconstricting or vasodilating the skin. They are brought about by a combination of mechanisms involving endothelial, adrenergic, and sensory systems. Local warming initiates a transient vasodilation through an axon reflex, succeeded by a plateau phase due largely to nitric...

  19. Circular pump support of blood circulation in the human body

    Science.gov (United States)

    Medvedev, A. E.; Fomin, V. M.; Prikhodko, Yu. M.; Cherniavskiy, A. M.; Fomichev, V. P.; Fomichev, A. V.; Chekhov, V. P.; Ruzmatov, T. M.

    2016-10-01

    The need of circulatory support systems in the treatment of chronic heart failure is increasing constantly, as 20% of patients in the waiting list die every year. Despite the great need for mechanical heart support systems, using of available systems is limited by the expensiveness. In addition, there is no one system that is 100% responsible to all medical and technical requirements, and would be completely safe for patient. Therefore, further research in the field of circu-latory support systems, considering health and technical requirements is relevant. One of the new directions in the study are disc pumps of viscous friction for liquid transporting, based on the Tesla pump principle. The operation principle of pumps based on the phenomenon of the boundary layer which is formed on the disk rotating in a fluid. There are experimental studies results of models with different variants of the rotor suspension, the various forms and the number of disks, forms the pump housing. However, none of the above samples was not brought to clinical trials. Furthermore, despite the promise of this model is still used today in some circulatory support systems are no similar type pump. Published data provide a basis for further development and testing of the pump model and allow to hope for leveling a number of significant shortcomings of modern left ventricular bypass systems.

  20. Light microscope observation of circulating human lymphocytes cultured in vitro

    Directory of Open Access Journals (Sweden)

    Naila Francis Paulo de Oliveira

    2010-10-01

    Full Text Available The purpose of this work was to study the isolation and a light microscopy technique for cultured lymphocytes. Blood samples were obtained by venipuncture with an anticoagulant added and centrifuged in a Percoll density gradient to separate the leukocytes. Lymphocytes were placed in 25 cm ³ tissue culture flasks at 37ºC. After culturing, they were fixed and stained with the methods used for blood smears. Results showed that not all fixing solutions and stains were an equally good choice for cultured lymphocytes.Os linfócitos são células importantes do sistema imune e têm sido largamente utilizados em estudos morfológicos. Entretanto, a literatura sobre técnicas de preparação dessas células é escassa e antiga, especialmente para linfócitos cultivados in vitro. Portanto, o objetivo desse estudo foi relatar com detalhes as técnicas de isolamento e microscopia de luz de linfócitos mantidos em cultura. Amostras de sangue foram obtidas por punção venosa e centrifugadas em gradiente de densidade de Percoll, para separar os leucócitos. Os linfócitos foram mantidos em frascos de cultura de 25 cm³ a 37ºC. Após a cultura, as células foram fixadas e coradas de acordo com a metodologia utilizada para esfregaços sanguíneos. Nossos resultados mostraram que nem todos os fixadores e corantes utilizados para esfregaços sanguíneos são uma boa escolha para linfócitos cultivados in vitro.

  1. Experimental study of natural circulation circuit

    Energy Technology Data Exchange (ETDEWEB)

    Lemos, Wanderley F.; Su, Jian, E-mail: wlemos@lasme.coppe.ufrj.br, E-mail: sujian@lasme.coppe.ufrj.br [Coordenacao dos Programas de Pos-Graduacao de Engenharia (LASME/COPPE/UFRJ), Rio de Janeiro, RJ (Brazil). Lab. de Simulacao e Metodos Numericos; Faccini, Jose L.H., E-mail: faccini@ien.gov.br [Instituto de Engenharia Nuclear (LTE/IEN/CNEN-RJ), Rio de Janeiro, RJ (Brazil). Lab. de Termo-Hidraulica Experimental

    2011-07-01

    This work presents an experimental study about fluid flows behavior in natural circulation, under conditions of single-phase flow. The experiment was performed through experimental thermal-hydraulic circuit built at IEN. This test equipment has performance similar to passive system of residual heat removal present in Advanced Pressurized Water Reactors (APWR). This experimental study aims to observing and analyzing the natural circulation phenomenon, using this experimental circuit that was dimensioned and built based on concepts of similarity and scale. This philosophy allows the analysis of natural circulation behavior in single-phase flow conditions proportionally to the functioning real conditions of a nuclear reactor. The experiment was performed through procedures to initialization of hydraulic feeding of primary and secondary circuits and electrical energizing of resistors installed inside heater. Power controller has availability to adjust values of electrical power to feeding resistors, in order to portray several conditions of energy decay of nuclear reactor in a steady state. Data acquisition system allows the measurement and monitoring of the evolution of the temperature in various points through thermocouples installed in strategic points along hydraulic circuit. The behavior of the natural circulation phenomenon was monitored by graphical interface on computer screen, showing the temperature evolutions of measuring points and results stored in digital spreadsheets. The results stored in digital spreadsheets allowed the getting of data to graphic construction and discussion about natural circulation phenomenon. Finally, the calculus of Reynolds number allowed the establishment for a correlation of friction in function of geometric scales of length, heights and cross section of tubing, considering a natural circulation flow throughout in the region of hot leg. (author)

  2. Higher circulating levels of IGF-1 are associated with longer leukocyte telomere length in healthy subjects

    DEFF Research Database (Denmark)

    Barbieri, Michelangela; Paolisso, Giuseppe; Kimura, Masayuki;

    2009-01-01

    Mutations that inhibit the insulin-like growth factor-1 (IGF-1) extend the lifespan of worms, flies and mice. However, it appears that relatively low circulating levels of IGF-1 in humans are associated with aging-related diseases and diminished longevity. As leukocyte telomere length (LTL...

  3. Circulating Follistatin Is Liver-Derived and Regulated by the Glucagon-to-Insulin Ratio

    DEFF Research Database (Denmark)

    Hansen, Jakob S; Rutti, Sabine; Arous, Caroline;

    2016-01-01

    CONTEXT: Follistatin is a plasma protein recently reported to increase under conditions with negative energy balance, such as exercise and fasting in humans. Currently, the perception is that circulating follistatin is a result of para/autocrine actions from various tissues. The large and acute i...

  4. First circulating beam in the AA

    CERN Multimedia

    1980-01-01

    On 3 July 1980, two years after project authorization, beam circulated for the first time in the AA. It was a 3.56 GeV/c proton test beam. We see an expecting crowd, minutes before the happy event. The persons are too numerous to name them all, but the 3 most prominent ones are at the centre (left to right): Roy Billinge (Joint AA Project Leader, with his hand on the control box), Eifionydd Jones (white shirt), Simon van der Meer (spiritus rector and Joint AA Project Leader). The first antiprotons were injected, made to circulate and cooled soon after, on 14 July 1980.

  5. Blowing Circulation Control on a Seaplane Airfoil

    Science.gov (United States)

    Guo, B. D.; Liu, P. Q.; Qu, Q. L.

    2011-09-01

    RANS simulations are presented for blowing circulation control on a seaplane airfoil. Realizable k-epsilon turbulent model and pressure-based coupled algorithm with second-order discretization were adopted to simulate the compressible flow. Both clear and simple flap configuration were simulated with blowing momentum coefficient Cμ = 0, 0.15 and 0.30. The results show that blowing near the airfoil trailing edge could enhance the Coanda effect, delay the flow separation, and increase the lift coefficient dramatically. The blowing circulation control is promising to apply to taking off and landing of an amphibious aircraft or seaplane.

  6. Quenching phenomena in natural circulation loop

    Energy Technology Data Exchange (ETDEWEB)

    Umekawa, Hisashi; Ozawa, Mamoru [Kansai Univ., Osaka (Japan); Ishida, Naoki [Daihatsu Motor Company, Osaka (Japan)

    1995-09-01

    Quenching phenomena has been investigated experimentally using circulation loop of liquid nitrogen. During the quenching under natural circulation, the heat transfer mode changes from film boiling to nucleate boiling, and at the same time flux changes with time depending on the vapor generation rate and related two-phase flow characteristics. Moreover, density wave oscillations occur under a certain operating condition, which is closely related to the dynamic behavior of the cooling curve. The experimental results indicates that the occurrence of the density wave oscillation induces the deterioration of effective cooling of the heat surface in the film and the transition boiling regions, which results in the decrease in the quenching velocity.

  7. Applications of Circulation Control, Yesterday and Today

    OpenAIRE

    Jonathan Kweder; Chad C. Panthe; James E. Smit

    2010-01-01

    Circulation control, an aerodynamic method of changing the properties of an airfoil, such as lift, camber and angle of attack, has been used in several unique ways since its inception, as an enhancement to fixed wing aircraft, in the 1960’s. Early in the research venture, this technology was used on the main wing of an aircraft in conjunction with a Coandă surface, such as a rounded trailing edge or a deployable flap. Research during this time proved to be the foundation of the circulation co...

  8. Applications of Circulation Control, Yesterday and Today

    Directory of Open Access Journals (Sweden)

    Jonathan Kweder

    2010-12-01

    Full Text Available Circulation control, an aerodynamic method of changing the properties of an airfoil, such as lift, camber and angle of attack, has been used in several unique ways since its inception, as an enhancement to fixed wing aircraft, in the 1960’s. Early in the research venture, this technology was used on the main wing of an aircraft in conjunction with a Coandă surface, such as a rounded trailing edge or a deployable flap. Research during this time proved to be the foundation of the circulation control technology and showed that small amounts of exit jet velocity could have a large impact on the aerodynamics of an airfoil. In the 1970’s the inspirations that drove circulation control research changed from design work to optimization of the parameters which were found to have the most effect on circulation control. These studies included slot placement, favorable momentum coefficient, and pressurization benefits and determents. This research period also allowed for expansion of the uses of circulation control to submarine/hydrodynamic and rotary wing applications. Newest research has brought on several propeller driven applications and the recent push for efficient renewable research has allowed circulation control research technologies to evolve into use in wind turbine and water turbine applications. The idea being that with circulation control the turbine can adapt easier to the changing wind velocity and direction and ultimately capture more power than an un-augmented turbine. As with most new and novel technologies there is a process and time delay associated with their development and ultimate application. For some technologies the market, or the supporting hardware, are lacking and sometimes the technology has strong advocacies for yet to be fulfilled expectations. In most of these cases a strong idea will re-surface repeatedly until the art has matured, or the better solution is found. This paper will focus on the previously developed

  9. Influence of external circulation on sludge characteristics during start-up of internal circulation reactor

    Institute of Scientific and Technical Information of China (English)

    DING Jian-nan; WANG Dian-zuo

    2005-01-01

    The start-up of external circulation-added internal circulation(IC) reactor was finished in 26 d, 32 d fewer than that of IC reactor. To evaluate the influence of the added external circulation on the development of granular sludge, the characteristics of the granular sludge taken from the two tested laboratory-scale reactors during start-up were studied. The results show that the added external circulation can enhance biomass granulation, accelerate granule development and improve sludge characteristics. At the end of start-up, the granular size of sludge in external circulation-added IC reactor greatly increases with a size distribution much better than that of sludge in IC reactor. The granular sludge originated from external circulation-added IC reactor contains more extracellular polymers and has a greater settling velocity than that from IC reactor. Methanogenic activity of the granular sludge from the external circulation-added IC reactor started 26 d ago reaches 358.23 mL·g-1·d-1, 1.66 and 1.20 times as great as that of the sludge from the IC reactor started 26 d and 58 d ago respectively.

  10. The aryl hydrocarbon receptor and estrogen receptor alpha differentially modulate nuclear factor erythroid-2-related factor 2 transactivation in MCF-7 breast cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Lo, Raymond; Matthews, Jason, E-mail: jason.matthews@utoronto.ca

    2013-07-15

    Nuclear factor erythroid-2-related factor 2 (NRF2; NFE2L2) plays an important role in mediating cellular protection against reactive oxygen species. NRF2 signaling is positively modulated by the aryl hydrocarbon receptor (AHR) but inhibited by estrogen receptor alpha (ERα). In this study we investigated the crosstalk among NRF2, AHR and ERα in MCF-7 breast cancer cells treated with the NRF2 activator sulforaphane (SFN), a dual AHR and ERα activator, 3,3′-diindolylmethane (DIM), 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) or 17β-estradiol (E2). SFN-dependent increases in NADPH-dependent oxidoreductase 1 (NQO1) and heme oxygenase I (HMOX1) mRNA levels were significantly reduced after co-treatment with E2. E2-dependent repression of NQO1 and HMOX1 was associated with increased ERα but reduced p300 recruitment and reduced histone H3 acetylation at both genes. In contrast, DIM + SFN or TCDD + SFN induced NQO1 and HMOX1 mRNA expression to levels higher than SFN alone, which was prevented by RNAi-mediated knockdown of AHR. DIM + SFN but not TCDD + SFN also induced recruitment of ERα to NQO1 and HMOX1. However, the presence of AHR at NQO1 and HMOX1 restored p300 recruitment and histone H3 acetylation, thereby reversing the ERα-dependent repression of NRF2. Taken together, our study provides further evidence of functional interplay among NRF2, AHR and ERα signaling pathways through altered p300 recruitment to NRF2-regulated target genes. - Highlights: • We examined crosstalk among ERα, AHR, and NRF2 in MCF-7 breast cancer cells. • AHR enhanced the mRNA expression levels of two NRF2 target genes – HMOX1 and NQO1. • ERα repressed HMOX1 and NQO1 expression via decreased histone acetylation. • AHR prevented ERα-dependent repression of HMOX1 and NQO1.

  11. Redefining circulating tumor cells by image processing

    NARCIS (Netherlands)

    Ligthart, S.T.

    2012-01-01

    Circulating tumor cells (CTC) in the blood of patients with metastatic carcinomas are associated with poor survival and can be used to guide therapy. However, CTC are very heterogeneous in size and shape, and are present at very low frequencies. Missing or misjudging a few events may have great cons

  12. A Circulation Model for Busy Public Libraries.

    Science.gov (United States)

    Bagust, A.

    1983-01-01

    Develops stochastic model of library borrowing using Negative Binomial distribution applied to circulation data obtained from Huddersfield Public Library. Evidence concerning process of popularity decay is presented and method is given by which relegation tests can be constructed to maintain optimum turnover. Eight references and statistical…

  13. [Circulating "tumor markers" in gastrointestinal tumors].

    Science.gov (United States)

    Borlinghaus, P; Lamerz, R

    1991-09-01

    Tumor markers (TM) of the neoplastic cell can be divided into non-shedded substances and antigens shedded in blood, urine or other body fluids. For clinicians circulating TM are more important. All relevant circulating TM are not useful in screening of asymptomatic patients because of insufficient sensitivity and specificity. With caution they are useful in the observation of risk groups. Circulating TM have their main significance as additional parameters in monitoring symptomatic patients with malignancies. Several follow up determinations are more important than one single measurement. During follow up of tumor patients TM should not be checked automatically if there are no diagnostic or therapeutical consequences. The clinically most important circulating TM in non-hormone secreting tumors of the gastrointestinal tract are the oncofetal antigens CEA and AFP and antigens defined by monoclonal antibodies e. g. CA 19-9 and CA 72-4. AFP is the primary TM in hepatocellular carcinoma, often elevated in hepatoblastoma and always normal in cholangiocellular carcinoma. CEA is the TM of first choice in patients with colorectal carcinomas and liver metastasis. CA 19-9 is TM of first choice in pancreatic carcinoma and additionally of diagnostic value in cholangiocellular carcinoma and tumors of the bile ducts. In cancer of the stomach CA 19-9 and CEA are secondary TM in combination with CA 72-4 as primary TM. Care should be taken that slight and moderate elevations of TM can be observed in benign diseases of liver, pancreas and bowel.

  14. Detecting Holocene changes in thermohaline circulation

    OpenAIRE

    Keigwin, L. D.; Boyle, E.A.

    2000-01-01

    Throughout the last glacial cycle, reorganizations of deep ocean water masses were coincident with rapid millennial-scale changes in climate. Climate changes have been less severe during the present interglacial, but evidence for concurrent deep ocean circulation change is ambiguous.

  15. Detecting holocene changes in thermohaline circulation.

    Science.gov (United States)

    Keigwin, L D; Boyle, E A

    2000-02-15

    Throughout the last glacial cycle, reorganizations of deep ocean water masses were coincident with rapid millennial-scale changes in climate. Climate changes have been less severe during the present interglacial, but evidence for concurrent deep ocean circulation change is ambiguous. PMID:10677463

  16. Unsteady flow about a circulation control airfoil

    Institute of Scientific and Technical Information of China (English)

    刘晶昌; 孙茂; 吴礼义

    1996-01-01

    The unsteady flow around a circulation control (CC) airfoil was investigated with Navier-Stokes method,which includes the flow around CC airfoil with pulsating jet,the flow around oscillating CC airfoil,and the flow around oscillating CC airfoil with pulsating jet.Dynamic properties of the flow and the aerodynamic forces were rewaled.

  17. Circulation factors affecting precipitation over Bulgaria

    Science.gov (United States)

    Nojarov, Peter

    2015-09-01

    The objective of this paper is to determine the influence of circulation factors on precipitation in Bulgaria. The study succeeds investigation on the influence of circulation factors on air temperatures in Bulgaria, as the focus here is directed toward precipitation amounts. Circulation factors are represented through two circulation indices, showing west-east or south-north transport of air masses over Bulgaria and four teleconnection indices (patterns)—North Atlantic Oscillation, East Atlantic, East Atlantic/Western Russia, and Scandinavian. Omega values at 700-hPa level show vertical motions in the atmosphere. Annual precipitation trends are mixed and not statistically significant. A significant decrease of precipitation in Bulgaria is observed in November due to the strengthening of the eastward transport of air masses (strengthening of EA teleconnection pattern) and anticyclonal weather (increase of descending motions in the atmosphere). There is also a precipitation decrease in May and June due to the growing influence of the Azores High. An increase of precipitation happens in September. All this leads to a redistribution of annual precipitation course, but annual precipitation amounts remain the same. However, this redistribution has a negative impact on agriculture and winter ski tourism. Zonal circulation has a larger influence on precipitation in Bulgaria compared to meridional. Eastward transport throughout the year leads to lower than the normal precipitation, and vice versa. With regard to the four teleconnection patterns, winter precipitation in Bulgaria is determined mainly by EA/WR teleconnection pattern, spring and autumn by EA teleconnection pattern, and summer by SCAND teleconnection pattern.

  18. Decontamination of CAGR gas circulator components

    International Nuclear Information System (INIS)

    This paper describes the development and full-scale trial of two methods for removal of radioactive contamination on the surfaces of CAGR gas circulator components. The two methods described are a particle impact cleaning (PIC) decontamination technique and an electrochemical technique, 'electro-swabbing', which is based on the principle of decontamination by electro-polishing. In developing these techniques it was necessary to take account of the physical and chemical nature of the surface deposits on the gas circulator components; these were shown to consist of magnetite-type oxide and carbonaceous material. In order to follow the progress of the decontamination it was also necessary to develop a surface sampling technique which was effective and precise under these conditions; an electrochemical technique, employing similar principles to the electro-swabbing process, was developed for this purpose. The full-scale trial of the PIC decontamination technique was carried out on an inlet guide vane (IGV) assembly, this having been identified as the component from the gas circulator which contributes most to the radiation dose accumulated during routine circulator maintenance. The technique was shown to be practically viable and some 99% of the radioactive contamination was readily removed from the treated surfaces with only negligible surface damage being caused. The full-scale trial of the electro-swabbing decontamination technique was carried out on a gas circulator impeller. High decontamination factors were again achieved with ≥ 99% of the radioactive contamination being removed from the treated surfaces. The technique has practical limitations in terms of handling and treatment of waste-arisings. However, the use of specially-designed swabbing electrodes may allow the treatment of constricted geometries inaccessible to techniques such as PIC. The technique is also highly suitable for the treatment of soft-finish materials and of components fabricated from a

  19. Effects of Microtopography on Overmarsh Circulation

    Science.gov (United States)

    Sullivan, J. C.; Torres, R.; Garrett, A.

    2013-12-01

    Authors: J.C. Sullivan, R. Torres, A.J. Garrett In this study we systematically degrade a high-resolution, high precision salt marsh DEM and characterize the effects of DEM smoothing on overmarsh circulation. The question driving this effort is: How much topographic detail is needed to accurately simulate salt marsh circulation? The hydrodynamic model Delft3D was applied to data from a previous dye-tracer study in a 2 km2 semi-enclosed salt marsh basin at Skidaway Institute of Oceanography near Savannah, Georgia, USA. Overmarsh circulation was simulated for each smoothed DEM over a 5 day period corresponding to spring tide conditions. Results show that flood and ebb pathways differ significantly, but this effect is less apparent as the DEM is smoothed. Also, the flushing time (Tf) decreases with smoothing leading to greater dilution of a dye tracer with each tidal cycle. Observations at the macro, meso and micro scale show that flood and ebb flows become stronger through a consistent set of flow paths, including intertidal creeks, and differences in overmarsh circulation are more apparent in low marsh and channel head areas. This work shows that accurate representation of overmarsh circulation requires that the DEM resolve creek and low lying marsh structures at a spatial scale of 2-4m, but not necessarily the smallest tidal creeks (< 1m in width and depth). The next phase of this work will be to incorporate spatial variations in vegetation cover using RULLI (Remote Ultra Low-Light Imaging) remote sensing technology developed by the Department of Energy.

  20. Observations of the summer Red Sea circulation

    Science.gov (United States)

    Sofianos, Sarantis S.; Johns, William E.

    2007-06-01

    Aiming at exploring and understanding the summer circulation in the Red Sea, a cruise was conducted in the basin during the summer of 2001 involving hydrographic, meteorological, and direct current observations. The most prominent feature, characteristic of the summer circulation and exchange with the Indian Ocean, is a temperature, salinity, and oxygen minimum located around a depth of 75 m at the southern end of the basin, associated with Gulf of Aden Intermediate Water inflowing from the Gulf of Aden during the summer season as an intruding subsurface layer. Stirring and mixing with ambient waters lead to marked increases in temperature (from 16.5 to almost 33°C) and salinity (from 35.7 to more than 38 psu) in this layer by the time it reaches midbasin. The observed circulation presents a very vigorous pattern with strong variability and intense features that extend the width of the basin. A permanent cyclone, detected in the northern Red Sea, verifies previous observations and modeling studies, while in the central sector of the basin a series of very strong anticyclones were observed with maximum velocities exceeding 1 m/s. The three-layer flow pattern, representative of the summer exchange between the Red Sea and the Gulf of Aden, is observed in the strait of Bab el Mandeb. In the southern part of the basin the layer flow is characterized by strong banking of the inflows and outflows against the coasts. Both surface and intermediate water masses involved in the summer Red Sea circulation present prominent spatial variability in their characteristics, indicating that the eddy field and mixing processes play an important role in the summer Red Sea circulation.

  1. Development Strategies for Rural Key Circulation Service Network

    Institute of Scientific and Technical Information of China (English)

    2012-01-01

    The rural key circulation service network is an important channel for ensuring agricultural products’entry to market and urban industrial products’entry to rural areas.Through in-depth survey and research,we took a look at development changes and current situations of three circulation service networks,namely,circulation of nondurable consumer goods,circulation of agricultural means of production,and circulation of agricultural products.Based on several key problems in rural circulation service network,such as logistics problem,delivery problem,backward transaction mode,and the last kilometer information,we put forward corresponding development countermeasures.

  2. Global circulation patterns of seasonal influenza viruses vary with antigenic drift

    Science.gov (United States)

    Bedford, Trevor; Riley, Steven; Barr, Ian G.; Broor, Shobha; Chadha, Mandeep; Cox, Nancy J.; Daniels, Rodney S.; Gunasekaran, C. Palani; Hurt, Aeron C.; Kelso, Anne; Klimov, Alexander; Lewis, Nicola S.; Li, Xiyan; McCauley, John W.; Odagiri, Takato; Potdar, Varsha; Rambaut, Andrew; Shu, Yuelong; Skepner, Eugene; Smith, Derek J.; Suchard, Marc A.; Tashiro, Masato; Wang, Dayan; Xu, Xiyan; Lemey, Philippe; Russell, Colin A.

    2015-07-01

    Understanding the spatiotemporal patterns of emergence and circulation of new human seasonal influenza virus variants is a key scientific and public health challenge. The global circulation patterns of influenza A/H3N2 viruses are well characterized, but the patterns of A/H1N1 and B viruses have remained largely unexplored. Here we show that the global circulation patterns of A/H1N1 (up to 2009), B/Victoria, and B/Yamagata viruses differ substantially from those of A/H3N2 viruses, on the basis of analyses of 9,604 haemagglutinin sequences of human seasonal influenza viruses from 2000 to 2012. Whereas genetic variants of A/H3N2 viruses did not persist locally between epidemics and were reseeded from East and Southeast Asia, genetic variants of A/H1N1 and B viruses persisted across several seasons and exhibited complex global dynamics with East and Southeast Asia playing a limited role in disseminating new variants. The less frequent global movement of influenza A/H1N1 and B viruses coincided with slower rates of antigenic evolution, lower ages of infection, and smaller, less frequent epidemics compared to A/H3N2 viruses. Detailed epidemic models support differences in age of infection, combined with the less frequent travel of children, as probable drivers of the differences in the patterns of global circulation, suggesting a complex interaction between virus evolution, epidemiology, and human behaviour.

  3. Extracellular circulating viral microRNAs: current knowledge and perspectives

    Directory of Open Access Journals (Sweden)

    Alessandro eLagana'

    2013-06-01

    Full Text Available MicroRNAs (miRNAs are small non coding RNAs responsible of post-transcriptional regulation of gene expression through interaction with messenger RNAs (mRNAs. They are involved in important biological processes and are often dysregulated in a variety of diseases, including cancer and infections. Viruses also encode their own sets of miRNAs, which they use to control the expression of either the host's genes and/or their own. In the past few years evidence of the presence of cellular miRNAs in extracellular human body fluids such as serum, plasma, saliva, and urine has accumulated. They have been found either cofractionate with the Argonaute2 (Ago2 protein or in membrane-bound vesicles such as exosomes. Although little is known about the role of circulating miRNAs, it has been demonstrated that miRNAs secreted by virus infected cells are transferred to and act in uninfected recipient cells. In this mini review we summarize the current knowledge on viral circulating miRNAs and provide a few examples of computational prediction of their function.

  4. Study in rabbits of portal circulation by a radioisotopic method

    International Nuclear Information System (INIS)

    The development of a precocius - and noninvasive method for the detection of portal circulation alterations by means of time interval measurements between the rectal administration of radiotracers and their detection in liver and head is aimed at. The pertecnetate (99sup(m)Tc)- and iodate (131I) absorption by the terminal large intestine was tested in 22 rabbits. The time iinterval between rectal administration of the radiotracer and its appearance in liver and head was determined in 12 rabbits, by external detection with a scintillation camera. The same parameters were studied in 9 animals submitted to the ligature of the portal vein. Iodate and pertecnetate are absorbed by the terminal large intestine, the pertecnetate absorption being significantly smaller than that of iodate. The pertecnetate distribution volume is smaller than that of iodate; the rectum - liver - and rectum - head time intervals is increased in animals with the ligature of portal vein. Application of the method to larger animals will permit the necessary improvements for its utilization as a precocius - noninvasive - and inocuous test in the evaluation of alteration of the human portal circulation. (Author)

  5. Harvey, by Hercules! The hero of the blood's circulation.

    Science.gov (United States)

    O'Rourke Boyle, Marjorie

    2013-01-01

    This article continues the analyses in Medical History 52 (2008), 73-90, 365-86 of William Harvey's self-understanding as the philosopher and discoverer of the blood's circulation. Harvey brilliantly and subversively assumed the persona of the mythological Hercules to embody his own anatomical labour in De motu cordis et sanguinis (1628). He reprised the role in self-defence against accusations in the College of Physicians, London, of his breach of faith with medical tradition. Harvey sought to usurp the medical epithet 'a second Hercules' by reforming humanist dependence on ancient texts as authoritative medicine. A knowledge of the theory and practice of Renaissance humanism discloses his identification with the Herculean labour of cleansing the Augean stable. He employed anatomical demonstration against Galen's porous cardiac septum, which admitted blood across the ventricles. Harvey's oath mehercule swore against Galen's Dia to assert the necessity of opening an alternate route for the blood flow. His Herculean labour was to dam the cardiac septum and divert the blood flow into a continuous channel through the arteries and veins. His circulation of the blood also imitated Hercules' successful dependence on the force of the water flow to flush the Augean stable. Harvey's copia did not denote a quantitative amount but a powerful supply. Harvey aspired to be, like Hercules, immortal, a term which the College belatedly acknowledged. This cultural analysis exposes Harvey's professional issues and personal ambitions, so to promote a fuller understanding of his historic role in medical discovery.

  6. Genetic engineering of platelets to neutralize circulating tumor cells.

    Science.gov (United States)

    Li, Jiahe; Sharkey, Charles C; Wun, Brittany; Liesveld, Jane L; King, Michael R

    2016-04-28

    Mounting experimental evidence demonstrates that platelets support cancer metastasis. Within the circulatory system, platelets guard circulating tumor cells (CTCs) from immune elimination and promote their arrest at the endothelium, supporting CTC extravasation into secondary sites. Neutralization of CTCs in blood circulation can potentially attenuate metastases to distant organs. Therefore, extensive studies have explored the blockade of platelet-CTC interactions as an anti-metastatic strategy. Such an intervention approach, however, may cause bleeding disorders since the platelet-CTC interactions inherently rely on the blood coagulation cascade including platelet activation. On the other hand, platelets have been genetically engineered to correct inherited bleeding disorders in both animal models and human clinical trials. In this study, inspired by the physical association between platelets and CTCs, platelets were genetically modified to express surface-bound tumor necrosis factor-related apoptosis-inducing ligand (TRAIL), a cytokine known to induce apoptosis specifically in tumor cells. The TRAIL-expressing platelets were demonstrated to kill cancer cells in vitro and significantly reduce metastases in a mouse model of prostate cancer metastasis. Our results suggest that using platelets to produce and deliver cancer-specific therapeutics can provide a Trojan-horse strategy of neutralizing CTCs to attenuate metastasis.

  7. Genetic engineering of platelets to neutralize circulating tumor cells.

    Science.gov (United States)

    Li, Jiahe; Sharkey, Charles C; Wun, Brittany; Liesveld, Jane L; King, Michael R

    2016-04-28

    Mounting experimental evidence demonstrates that platelets support cancer metastasis. Within the circulatory system, platelets guard circulating tumor cells (CTCs) from immune elimination and promote their arrest at the endothelium, supporting CTC extravasation into secondary sites. Neutralization of CTCs in blood circulation can potentially attenuate metastases to distant organs. Therefore, extensive studies have explored the blockade of platelet-CTC interactions as an anti-metastatic strategy. Such an intervention approach, however, may cause bleeding disorders since the platelet-CTC interactions inherently rely on the blood coagulation cascade including platelet activation. On the other hand, platelets have been genetically engineered to correct inherited bleeding disorders in both animal models and human clinical trials. In this study, inspired by the physical association between platelets and CTCs, platelets were genetically modified to express surface-bound tumor necrosis factor-related apoptosis-inducing ligand (TRAIL), a cytokine known to induce apoptosis specifically in tumor cells. The TRAIL-expressing platelets were demonstrated to kill cancer cells in vitro and significantly reduce metastases in a mouse model of prostate cancer metastasis. Our results suggest that using platelets to produce and deliver cancer-specific therapeutics can provide a Trojan-horse strategy of neutralizing CTCs to attenuate metastasis. PMID:26921521

  8. Circulating microRNA profiles of Ebola virus infection

    Science.gov (United States)

    Duy, Janice; Koehler, Jeffrey W.; Honko, Anna N.; Schoepp, Randal J.; Wauquier, Nadia; Gonzalez, Jean-Paul; Pitt, M. Louise; Mucker, Eric M.; Johnson, Joshua C.; O’Hearn, Aileen; Bangura, James; Coomber, Moinya; Minogue, Timothy D.

    2016-01-01

    Early detection of Ebola virus (EBOV) infection is essential to halting transmission and adjudicating appropriate treatment. However, current methods rely on viral identification, and this approach can misdiagnose presymptomatic and asymptomatic individuals. In contrast, disease-driven alterations in the host transcriptome can be exploited for pathogen-specific diagnostic biomarkers. Here, we present for the first time EBOV-induced changes in circulating miRNA populations of nonhuman primates (NHPs) and humans. We retrospectively profiled longitudinally-collected plasma samples from rhesus macaques challenged via intramuscular and aerosol routes and found 36 miRNAs differentially present in both groups. Comparison of miRNA abundances to viral loads uncovered 15 highly correlated miRNAs common to EBOV-infected NHPs and humans. As proof of principle, we developed an eight-miRNA classifier that correctly categorized infection status in 64/74 (86%) human and NHP samples. The classifier identified acute infections in 27/29 (93.1%) samples and in 6/12 (50%) presymptomatic NHPs. These findings showed applicability of NHP-derived miRNAs to a human cohort, and with additional research the resulting classifiers could impact the current capability to diagnose presymptomatic and asymptomatic EBOV infections. PMID:27098369

  9. A modified Phenol-chloroform extraction method for isolating circulating cell free DNA of tumor patients

    Directory of Open Access Journals (Sweden)

    Clemens Hufnagl

    2013-03-01

    Full Text Available Searching for new cancer biomarkers, circulating cell-free DNA (cfDNA has become an appealing target of interest as an elevated level of cfDNA has been detected in the circulation of cancer patients in comparison with healthy controls. Since cfDNA can be isolated from the circulation and other body fluids of patients without harming their physical condition, cfDNA is becoming a promising candidate as a novel non-invasive biomarker for cancer. The challenge in the diagnostic analysis of cfDNA is its very low presence in human plasma/serum and its partially strong fragmentation. Here we evaluated a modified phenol/chloroform extraction method for the isolation of cfDNA and compared it with published standard methods for cfDNA isolation.

  10. Warm World Ocean Thermohaline Circulation Model

    Science.gov (United States)

    Zimov, N.; Zimov, S. A.

    2014-12-01

    Modern day ocean circulation is dominated by thermal convection with cold waters subsiding in the Northern Atlantic, filling the ocean interior with cold and heavy water. However, ocean circulation diminished during the last glaciation and consequently the downwelling of the cold. Therefore interior ocean water temperatures must have been affected by other mechanisms which are negligible in the current state. We propose that the submergence of highly saline water from warm seas with high rates of evaporation (like the Red or Mediterranean Sea) was a major factor controlling ocean circulation during the last glaciation. Even today, waters in these poorly connected seas are the heaviest waters in the World ocean (1.029 g/cm3). The second mechanism affecting ocean temperature is the geothermal heat flux. With no heat exchange between the atmosphere and the ocean, geothermal heat flux through the ocean floor is capable of increasing ocean temperature by tens of degrees C over a 100 thousand year glacial cycle. To support these hypotheses we present an ocean box model that describes thermohaline circulation in the World Ocean. According to the model parameters, all water circulation is driven by the water density gradient. Boxes include high-latitude seas, high salinity seas, surface ocean, glaciers, and rift and lateral zones of the ocean interior. External heat sources are radiative forcing, affected by Milankovich cycles, and geothermal heat flux. Additionally this model accounts for the heat produced by organic rain decay. Taking all input parameters close to currently observed values, the model manages to recreate the glacial-interglacial cycles. During the glacial periods only haline circulation takes place, the ocean is strongly stratified, and the interior ocean accumulates heat while high-latitudes accumulate ice. 112,000 years after glaciation starts, water density on the ocean bottom becomes equal to the density of water in high-latitude seas, strong thermal

  11. Silent Circulation of Ross River Virus in French Polynesia

    Directory of Open Access Journals (Sweden)

    Maite Aubry

    2015-08-01

    Discussion: Our results support the existence of autochthonous RRV transmission and suggest that this pathogen has silently circulated in French Polynesia. These findings raise the question of possible undetected circulation of RRV in other Pacific Island Countries and Territories.

  12. [The discovery of blood circulation: revolution or revision?].

    Science.gov (United States)

    Crignon, Claire

    2011-01-01

    The discovery of the principle of blood circulation by William Harvey is generally considered as one of the major events of the "scientific revolution" of the 17th century. This paper reconsiders the question by taking in account the way Harvey's discovery was discussed by some contemporary philosophers and physicians, in particular Fontenelle, who insisted on the necessity of redefining methods and principles of medical knowledge, basing themselves on the revival of anatomy and physiology, and of its consequences on the way it permits to think about the human nature. This return allows us to consider the opportunity of substituting the kuhnian scheme of "structure of scientific revolutions" for the bachelardian concept of "refonte".

  13. Isolation and Molecular Characterization of Circulating Melanoma Cells

    Directory of Open Access Journals (Sweden)

    Xi Luo

    2014-05-01

    Full Text Available Melanoma is an invasive malignancy with a high frequency of blood-borne metastases, but circulating tumor cells (CTCs have not been readily isolated. We adapted microfluidic CTC capture to a tamoxifen-driven B-RAF/PTEN mouse melanoma model. CTCs were detected in all tumor-bearing mice and rapidly declined after B-RAF inhibitor treatment. CTCs were shed early from localized tumors, and a short course of B-RAF inhibition following surgical resection was sufficient to dramatically suppress distant metastases. The large number of CTCs in melanoma-bearing mice enabled a comparison of RNA-sequencing profiles with matched primary tumors. A mouse melanoma CTC-derived signature correlated with invasiveness and cellular motility in human melanoma. CTCs were detected in smaller numbers in patients with metastatic melanoma and declined with successful B-RAF-targeted therapy. Together, the capture and molecular characterization of CTCs provide insight into the hematogenous spread of melanoma.

  14. Anti-cyclonic circulation driven by the estuarine circulation in a gulf type ROFI

    Science.gov (United States)

    Fujiwara, T.; Sanford, L. P.; Nakatsuji, K.; Sugiyama, Y.

    1997-08-01

    Baroclinic residual circulation processes are examined in gulf type Regions Of Freshwater Influence (ROFIs), which have large rivers discharging into a rounded head wider than the Rossby internal deformation radius. Theoretical and observational investigations concentrate on Ise Bay, Japan, with supporting data from Osaka Bay and Tokyo Bay. Simplified analytical solutions are derived to describe the primary features of the circulation. Three dimensional residual current data collected using moored current meters and shipboard acoustic doppler current profilers (ADCPs), satellite imagery and density structure data observed using STDs, are presented for comparison to the theoretical predictions. There are three key points to understanding the resulting circulation in gulf type ROFIs. First, there are likely to be three distinct water masses: the river plume, a brackish upper layer, and a higher salinity lower layer. Second, baroclinic processes in gulf type ROFIs are influenced by the Earth's rotation at first order. Residual currents are quasi-geostrophic and potential vorticity is approximately conserved. Third, the combined effects of a classical longitudinal estuarine circulation and the Earth's rotation are both necessary to produce the resulting circulation. Anti-cyclonic vorticity is generated in the upper layer by the horizontal divergence associated with upward entrainment, which is part of the estuarine circulation. The interaction between anti-cyclonic vorticity and horizontal divergence results in two regions of qualitatively different circulation, with gyre-like circulation near the bay head and uniformly seaward anti-cyclonicly sheared flow further towards the mouth. The stagnation point separating the two regions is closer to (further away from) the bay head for stronger (weaker) horizontal divergence, respectively. The vorticity and spin-up time of this circulation are-(ƒ-ω 1)/2 and h/2w 0, respectively, where ƒ is the Coriolis parameter, ω 1 is

  15. Formation and plasma circulation of solar prominences

    CERN Document Server

    Xia, Chun

    2016-01-01

    Solar prominences are long-lived cool and dense plasma curtains in the hot and rarefied outer solar atmosphere or corona. The physical mechanism responsible for their formation and especially for their internal plasma circulation has been uncertain for decades. The observed ubiquitous down flows in quiescent prominences are difficult to interpret as plasma with high conductivity seems to move across horizontal magnetic field lines. Here we present three-dimensional numerical simulations of prominence formation and evolution in an elongated magnetic flux rope as a result of in-situ plasma condensations fueled by continuous plasma evaporation from the solar chromosphere. The prominence is born and maintained in a fragmented, highly dynamic state with continuous reappearance of multiple blobs and thread structures that move mainly downward dragging along mass-loaded field lines. The prominence plasma circulation is characterized by the dynamic balance between the drainage of prominence plasma back to the chromos...

  16. [William Harvey, discoverer of the blood circulation].

    Science.gov (United States)

    v Mühlendahl, K E

    2007-06-01

    William Harvey (1578-1657), living at the turn to modern times, scientifically speaking, was an eminent physician and scientist. He developed the concept of the circulation of the blood and his findings have proved to be correct in nearly all details to this day. He published his physiological findings and interpretations in a small, albeit epoch-making, volume: Exercitatio anatomica de motu cordis et sanguinis in animalibus, published in Frankfurt in 1628. On the occasion of the 350th anniversary of his death on June 3, 2007, this essay commemorates the work of this important physician, illustrating his brilliant conception of the blood circulation by quoting passages from De motu cordis et sanguinis.

  17. Modeling mesoscale circulation of the Black Sea

    Science.gov (United States)

    Korotenko, K. A.

    2015-11-01

    An eddy-resolving (1/30)° version of the DieCAST low-dissipative model, adapted to the Black Sea circulation, is presented. Under mean climatological forcing, the model realistically reproduces major dominant large-scale and mesoscale structures of seasonal sea circulation, including the Rim Current, coastal anticyclonic eddies, mushroom currents, etc. Due to its extremely low dissipation and high resolution, the model makes it possible to trace the development of the baroclinic instability along the Turkish and Caucasian coasts, reproduce mesoscale structures generated by this mechanism, and assess the scales of these structures. The model also realistically reproduces short-term effects of bora winds on the evolution of subsurface layer structures.

  18. Meridional circulation in turbulent protoplanetary disks

    CERN Document Server

    Fromang, Sebastien; Masset, Frederic

    2011-01-01

    Based on viscous disk theory, a number of recent studies have suggested the existence of a large scale meridional circulation in protoplanetary disks. Such a flow could account for the presence of crystalline silicates, among which Calcium and Aluminium-rich Inclusions (CAIs), at large distances from the sun. This paper aims at examining whether such large scale flows exist in turbulent protoplanetary disks. High resolution global hydrodynamical and magnetohydrodynamical numerical simulations of turbulent protoplanetary disks are used to infer the properties of the flow in such disks. By performing hydrodynamic simulations using explicit viscosity, we demonstrate that our numerical setup does not suffer from any numerical artifact. The aforementioned meridional circulation is readily recovered in viscous and laminar disks. In MHD simulations, the magneto-rotational instability drives turbulence in the disks. Averaging out the turbulent fluctuations over long timescale, the results fail to show any large scale...

  19. Circulation control STOL aircraft design aspects

    Science.gov (United States)

    Loth, John L.

    1987-01-01

    Since Davidson patented Circulation Control Airfoils in 1960, there have been only 2 aircraft designed and flown with circulation control (CC). Designing with CC is complex for the following reasons: the relation between lift increase and blowing momentum is nonlinear; for good cruise performance one must change the wing geometry in flight from a round to a sharp trailing edge. The bleed air from the propulsion engines or an auxiliary compressor, must be used efficiently. In designing with CC, the propulsion and control aspects are just as important as aerodynamics. These design aspects were examined and linearized equations are presented in order to facilitate a preliminary analysis of the performance potential of CC. The thrust and lift requirements for takeoff make the calculated runway length very sensitive to the bleed air ratio. Thrust vectoring improves performance and can offset nose down pitching moments. The choice of blowing jet to free stream velocity ratio determines the efficiency of applying bleed air power.

  20. The design of large natural circulation BWR's

    International Nuclear Information System (INIS)

    Boiling water reactors (BWR) with natural circulation are applied for capacities up to 60 MWe. Based on scale studies, however, it appears that larger production units are more efficient. It is recommended to investigate the bottlenecks in realizing larger reactors (>1000 MWe). The aim of the study on the title subject is to study to what extent the production capacity of BWRs with natural circulation can be increased. Based on data from the literature a simple analytic method has been chosen and existing BWR designs were compared. Capacities of 1300 MWe appear to be possible. These reactors will have a smaller pin diameter and a lower water supply temperature. Also steam separators with a minor pressure reduction must be available. The reliability of the stability measurement must be increased. Based on the results of this investigation the priorities for research on the design of future BWRs have been determined

  1. Genetically Encoded Voltage Indicators in Circulation Research.

    Science.gov (United States)

    Kaestner, Lars; Tian, Qinghai; Kaiser, Elisabeth; Xian, Wenying; Müller, Andreas; Oberhofer, Martin; Ruppenthal, Sandra; Sinnecker, Daniel; Tsutsui, Hidekazu; Miyawaki, Atsushi; Moretti, Alessandra; Lipp, Peter

    2015-09-08

    Membrane potentials display the cellular status of non-excitable cells and mediate communication between excitable cells via action potentials. The use of genetically encoded biosensors employing fluorescent proteins allows a non-invasive biocompatible way to read out the membrane potential in cardiac myocytes and other cells of the circulation system. Although the approaches to design such biosensors date back to the time when the first fluorescent-protein based Förster Resonance Energy Transfer (FRET) sensors were constructed, it took 15 years before reliable sensors became readily available. Here, we review different developments of genetically encoded membrane potential sensors. Furthermore, it is shown how such sensors can be used in pharmacological screening applications as well as in circulation related basic biomedical research. Potentials and limitations will be discussed and perspectives of possible future developments will be provided.

  2. Posterior circulation revascularization to manage vertebrobasilar occlusion

    Directory of Open Access Journals (Sweden)

    SHANG Yan-guo

    2012-06-01

    Full Text Available Objective To discuss the technique and effect of posterior circulation revascularization to manage vertebrobasilar occlusion. Methods Nine patients with vertebrobasilar occlusion were treated by using occipital artery-posterior inferior cerebellar artery bypass, superficial temporal artery-superior cerebellar artery bypass, superficial temporal artery-posterior cerebral artery bypass and occipital artery-vertebral artery bypass with radial artery graft. Results Intraoperative indocyanine green angiography showed all the bypass arteries were patent. Postoperative DSA or CTA showed bypass arteries patent in 8 patients, among whom seven patients got obvious improvement on MR or CT perfusion. One patient died of heart failure on the 15th day postoperative. During the follow-up of eight patients, no stroke reoccurred, four patients got back to nearly normal life. Conclusion Most of the patients with vertebrobasilar occlusion could benefit from the posterior circulation revascularization, which should be confirmed by randomized controlled clinical trials in the future.

  3. Cluster Dynamics in a Circulating Fluidized Bed

    Energy Technology Data Exchange (ETDEWEB)

    Guenther, C.P.; Breault, R.W.

    2006-11-01

    A common hydrodynamic feature in industrial scale circulating fluidized beds is the presence of clusters. The continuous formation and destruction of clusters strongly influences particle hold-up, pressure drop, heat transfer at the wall, and mixing. In this paper fiber optic data is analyzed using discrete wavelet analysis to characterize the dynamic behavior of clusters. Five radial positions at three different axial locations under five different operating were analyzed using discrete wavelets. Results are summarized with respect to cluster size and frequency.

  4. First circulating beam in the AA

    CERN Multimedia

    1980-01-01

    On 3 July 1980, two years after project authorization, beam circulated for the first time in the AA. It was a 3.5 GeV/c proton test beam. We see an expecting crowd, minutes before the happy event. The persons are to numerous to name them all. Heribert Koziol, apparently asleep, is answering the call from an impatient director. See also 8007094.

  5. Water circulation forecasting in Spanish harbours

    OpenAIRE

    Grifoll, Manel; Jordá, Gabriel; Sotillo, Marcos G.; Ferrer, Luis; Espino, Manuel; Sánchez-Arcilla, Agustín; Álvarez-Fanjul, Enrique

    2012-01-01

    This paper describes the first harbour circulation forecasting system implemented in Spain. The configuration design was based on previous analyses of the morphologic and hydrodynamic behaviour of three harbours: Barcelona, Tarragona and Bilbao. A nested system of oceanic models was implemented, with a scope ranging from the regional scale (with a mean horizontal resolution of 5 km) to the harbour scale (with a mean horizontal resolution of 40 m). A set of sensitivity tests was carried out in...

  6. The creation and circulation of public geographies

    OpenAIRE

    Kitchin, Rob; Linehan, Denis; O'Callaghan, Cian; Lawton, Philip

    2013-01-01

    In response to the commentaries, we discuss further how social media disrupts and remakes the creation and circulation of geographical knowledges and potentially reconfigures the moral economy of the social sciences. In particular, we examine questions of what is meant by public geography, the publics which such geographies serve, alternative and complementary approaches to social media, the politics of authorship within collective blogs, the politics and mechanisms of knowledge c...

  7. Parallel Computing of Ocean General Circulation Model

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    This paper discusses the parallel computing of the thirdgeneration Ocea n General Circulation Model (OGCM) from the State Key Laboratory of Numerical Mo deling for Atmospheric Science and Geophysical Fluid Dynamics(LASG),Institute of Atmosphere Physics(IAP). Meanwhile, several optimization strategies for paralle l computing of OGCM (POGCM) on Scalable Shared Memory Multiprocessor (S2MP) are presented. Using Message Passing Interface (MPI), we obtain super linear speedup on SGI Origin 2000 for parallel OGCM(POGCM) after optimization.

  8. Circulating fluidized bed boilers design and operations

    CERN Document Server

    Basu, Prabir

    1991-01-01

    This book provides practicing engineers and students with insight into the design and operation of circulating fluidized bed (CFB) boilers. Through a combination of theoretical concepts and practical experience, this book gives the reader a basic understanding of the many aspects of this subject.Important environmental considerations, including solid waste disposal and predicted emissions, are addressed individually in separate chapters. This book places an emphasis on combustion, hydrodynamics, heat transfer, and material issues, and illustrates these concepts with numerous examples of pres

  9. Circulating somatostatin. Physiological regulator of pancreatic function?

    OpenAIRE

    Gyr, K; Beglinger, C; Köhler, E; Trautzl, U; Keller, U.; Bloom, S R

    1987-01-01

    The present study was designed to determine whether somatostatin is released into the circulation in sufficient amounts to regulate exocrine and endocrine pancreatic function and to evaluate the possible role of somatostatin as a hormonal regulator of the pancreas. Mean plasma somatostatin levels (SLI) increased from 11 +/- 2 pmol liter-1 to peak concentrations of 18 +/- 2 in six healthy male volunteers after a steak meal (P less than 0.05). Infusion of somatostatin inhibited hormone-induced ...

  10. Circulating microRNAs in breast cancer and healthy subjects

    Directory of Open Access Journals (Sweden)

    Atasoy Ulus

    2009-05-01

    Full Text Available Abstract Background It has been demonstrated that extracellular mRNA can be detected in the circulation. Our hypothesis was that circulating miRNAs are also present and differentially expressed in the serum of breast cancer patients compared to controls. Findings We measured miRNA in the serum of samples with and without the addition of miRNA prior to analysis. To test our RNA extraction efficiency, we spiked-in serial dilutions of single-strand C elegens miR-39 (cel-miR-39 and human miR-145 (has-miR-145 into goat serum and a 10 year old human serum specimen. We next analyzed miR-16, -145, and -155 in archived serum specimens from 21 participants, 13 of whom did and 8 of whom did not have breast cancer. We were able to detect the miRNAs from all the serum samples to which the miRNAs had been added. We were also able to detect endogenous miR-16, -145, and -155 in all serum samples. While the expression of all three miRNAs was similar in samples from healthy women compared to those with breast cancer, women with progesterone receptor (PR, p = 0.016 positive tumors had higher miR-155 expression than tumors that were negative for these receptors. Conclusion 1 RNA species can be detected in archived serum; 2 miR-155 may be differentially expressed in the serum of women with hormone sensitive compared to women with hormone insensitive breast cancer. Screening serum for miRNAs that predict the presence of breast cancer is feasible, and may be useful for breast cancer detection.

  11. When Prostate Cancer Circulates in the Bloodstream

    Directory of Open Access Journals (Sweden)

    Virginie Vlaeminck-Guillem

    2015-10-01

    Full Text Available Management of patients with prostate cancer is currently based on imperfect clinical, biological, radiological and pathological evaluation. Prostate cancer aggressiveness, including metastatic potential, remains difficult to accurately estimate. In an attempt to better adapt therapeutics to an individual (personalized medicine, reliable evaluation of the intrinsic molecular biology of the tumor is warranted, and particularly for all tumor sites (primary tumors and secondary sites at any time of the disease progression. As a consequence of their natural tendency to grow (passive invasion or as a consequence of an active blood vessel invasion by metastase-initiating cells, tumors shed various materials into the bloodstream. Major efforts have been recently made to develop powerful and accurate methods able to detect, quantify and/or analyze all these circulating tumor materials: circulating tumors cells, disseminating tumor cells, extracellular vesicles (including exosomes, nucleic acids, etc. The aim of this review is to summarize current knowledge about these circulating tumor materials and their applications in translational research.

  12. Acoustic streaming and Sun's meridional circulation

    Science.gov (United States)

    Valverde, Jose Manuel

    2016-09-01

    A vast number of physical processes involving oscillations of a bounded viscous fluid are relevantly influenced by acoustic streaming. When this happens a steady circulation of fluid develops in a thin boundary adjacent to the interface. Some examples are refracted sound waves, a fluid inside a spherical cavity undergoing torsional oscillations or a pulsating liquid droplet. Steady streaming around circular interfaces consists of a hemispherically symmetric recirculation of fluid from the equatorial plane to the polar axes closely resembling the meridional circulation pattern observed in the Sun's convection zone that determines the solar cycle. In this paper, it is argued that the acoustic pulsations exhibited by the Sun would lead to acoustic streaming in the boundary of the convection zone. A simple estimation using a typical dominant frequency of 3 mHz and the observed surface oscillation amplitude yields a steady streaming velocity us ∼ 10 m s‑1, which is on the order of the meridional circulation velocity observed in the Sun's convection zone.

  13. Circulation in a Short Cylindrical Couette System

    Energy Technology Data Exchange (ETDEWEB)

    Akira Kageyama; Hantao Ji; Jeremy Goodman

    2003-07-08

    In preparation for an experimental study of magnetorotational instability (MRI) in liquid metal, we explore Couette flows having height comparable to the gap between cylinders, centrifugally stable rotation, and high Reynolds number. Experiments in water are compared with numerical simulations. The flow is very different from that of an ideal, infinitely long Couette system. Simulations show that endcaps co-rotating with the outer cylinder drive a strong poloidal circulation that redistributes angular momentum. Predicted toroidal flow profiles agree well with experimental measurements. Spin-down times scale with Reynolds number as expected for laminar Ekman circulation; extrapolation from two-dimensional simulations at Re less than or equal to 3200 agrees remarkably well with experiment at Re approximately equal to 106. This suggests that turbulence does not dominate the effective viscosity. Further detailed numerical studies reveal a strong radially inward flow near both endcaps. After turning vertically along the inner cylinder, these flows converge at the midplane and depart the boundary in a radial jet. To minimize this circulation in the MRI experiment, endcaps consisting of multiple, differentially rotating rings are proposed. Simulations predict that an adequate approximation to the ideal Couette profile can be obtained with a few rings.

  14. Elevated circulating somatostatin levels in acromegaly.

    Science.gov (United States)

    Arosio, M; Porretti, S; Epaminonda, P; Giavoli, C; Gebbia, C; Penati, C; Beck-Peccoz, P; Peracchi, M

    2003-06-01

    GH increases hypothalamic somatostatin (SS) synthesis and secretion but it is unknown if chronic GH excess, as found in acromegaly, may influence circulating SS levels, that are mainly of enteropancreatic source and affect several gastrointestinal functions, including motility. Circulating SS occurs in several post-translational forms including somatostatin-14 (SS-14), somatostatin-28 (SS-28) and other small peptides. The aim of the present study was to characterize the fasting and postprandial pattern of plasma circulating somatostatin in normal subjects and patients with acromegaly. Fasting total SS and SS-28 levels were measured in 32 subjects, 16 acromegalic patients with a new diagnosis (A) (8 F, 8 M, median age 48) and 16 matched healthy volunteers (C) (8 F, 8 M, median age 45). SS was also determined after a standard solid-liquid meal (550 kCal) in 24 of the subjects (12 C and 12 A). Fasting SS and SS-28 were significantly higher in acromegalic patients as compared to healthy subjects. In the former, a positive correlation was found between IGF-I and SS levels (r = 0.525 p acromegaly. Excess GH/IGF-I could be a causal factor in somatostatin hypersecretion. Conceivably this abnormality might play a role in some alterations of gastrointestinal function of acromegalic patients such as prolonged bowel transit.

  15. The protein corona of circulating PEGylated liposomes.

    Science.gov (United States)

    Palchetti, Sara; Colapicchioni, Valentina; Digiacomo, Luca; Caracciolo, Giulio; Pozzi, Daniela; Capriotti, Anna Laura; La Barbera, Giorgia; Laganà, Aldo

    2016-02-01

    Following systemic administration, liposomes are covered by a 'corona' of proteins, and preserving the surface functionality is challenging. Coating the liposome surface with polyethylene glycol (PEG) is the most widely used anti-opsonization strategy, but it cannot fully preclude protein adsorption. To date, protein binding has been studied following in vitro incubation to predict the fate of liposomes in vivo, while dynamic incubation mimicking in vivo conditions remains largely unexplored. The main aim of this investigation was to determine whether shear stress, produced by physiologically relevant dynamic flow, could influence the liposome-protein corona. The corona of circulating PEGylated liposome was thoroughly compared with that formed by incubation in vitro. Systematic comparison in terms of size, surface charge and quantitative composition was made by dynamic light scattering, microelectrophoresis and nano-liquid chromatography tandem mass spectrometry (nanoLC-MS/MS). Size of coronas formed under static vs. dynamic incubation did not appreciably differ from each other. On the other side, the corona of circulating liposomes was more negatively charged than its static counterpart. Of note, the variety of protein species in the corona formed in a dynamic flow was significantly wider. Collectively, these results demonstrated that the corona of circulating PEGylated liposomes can be considerably different from that formed in a static fluid. This seems to be a key factor to predict the biological activity of a liposomal formulation in a physiological environment.

  16. Tropical convective transport and the Walker circulation

    Directory of Open Access Journals (Sweden)

    J. S. Hosking

    2012-10-01

    Full Text Available We introduce a methodology to visualise rapid vertical and zonal tropical transport pathways. Using prescribed sea-surface temperatures in four monthly model integrations for 2005, we characterise preferred transport routes from the troposphere to the stratosphere in a high resolution climate model. Most efficient transport is modelled over the Maritime Continent (MC in November and February, i.e., boreal winter. In these months, the ascending branch of the Walker Circulation over the MC is formed in conjunction with strong deep convection, allowing fast transport into the stratosphere. In the model the upper tropospheric zonal winds associated with the Walker Circulation are also greatest in these months in agreement with ERA-Interim reanalysis data. We conclude that the Walker circulation plays an important role in the seasonality of fast tropical transport from the lower and middle troposphere to the upper troposphere and so impacts at the same time the potential supply of surface emissions to the tropical tropopause layer (TTL and subsequently to the stratosphere.

  17. Formation of germline chimera Gaok chicken used circulation primordial germ cells (circulation PGCs fresh and thawed

    Directory of Open Access Journals (Sweden)

    Kostaman T

    2014-03-01

    Full Text Available Formation of germline chimeras by transfer of chicken primordial germ cells (PGCs is one of the effective techniques for preservation and regeneration of genetic resources in chickens. This study attempted to form germline chimeras of Gaok chicken buy purifying circulated PGCs of donor embryo before it is transferred to the recipient (White Leghorn chickens=WL and studied the ability of recipient embryo on survival in incubators, and hatchability. This study used 200 fertile eggs of Gaok and 90 fertile WL breed all of the eggs was incubated at 380C and 60% humidity in a portable incubator. PGCs-circulation of the blood collected Gaok embryos at stage 14-16 were taken from the dorsal aorta, and then purified by centrifugation method using nycodenz. PGCs-circulation results further purification frozen in liquid nitrogen before being transferred to the recipient embryo. The results showed that for the development of embryos transferred to the fresh circulation of PGCs-circulation as many as 25 cells can survive up to day 14, while one of the transferred of 50 and 100 cells into recipient embryos was hatched (10%. On the contrari recipient embryos that are transferred to the frozen PGCs-circulation the embryos development was shorter, and only survived until day 10th (treatment 25 cells, day 14th (treatment of 50 cells and day 17th (treatment of 100 cells. It is concluded that the amount of PGCs-circulation embryos transferred to the recipient is one factor that influence the success of the development germline chimeras.

  18. 19 CFR 207.63 - Circulation of draft questionnaires.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 3 2010-04-01 2010-04-01 false Circulation of draft questionnaires. 207.63... SUBSIDIZED EXPORTS TO THE UNITED STATES Five-Year Reviews § 207.63 Circulation of draft questionnaires. (a) The Director shall circulate draft questionnaires to the parties for comment in each full review....

  19. Algorithms for Finding the Inverses of Factor Block Circulant Matrices

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    In this paper, algorithms for finding the inverse of a factor block circulant matrix,a factor block retrocirculant matrix and partitioned matrix with factor block circulant blocks over the complex field are presented respectively. In addition, two algorithms for the inverse of a factor block circulant matrix over the quaternion division algebra are proposed.

  20. The renal circulation in normal pregnancy and preeclampsia: is there a place for relaxin?

    Science.gov (United States)

    Conrad, Kirk P; Davison, John M

    2014-05-15

    During the first trimester of human pregnancy, the maternal systemic circulation undergoes remarkable vasodilation. The kidneys participate in this vasodilatory response resulting in marked increases in renal plasma flow (RPF) and glomerular filtration rate (GFR). Comparable circulatory adaptations are observed in conscious gravid rats. Administration of the corpus luteal hormone relaxin (RLN) to nonpregnant rats and humans elicits vasodilatory changes like those of pregnancy. Systemic and renal vasodilation are compromised in midterm pregnant rats by neutralization or elimination of circulating RLN and in women conceiving with donor eggs who lack a corpus luteum and circulating RLN. Although RLN exerts both rapid (minutes) and sustained (hours to days) vasodilatory actions through different molecular mechanisms, a final common pathway is endothelial nitric oxide. In preeclampsia (PE), maternal systemic and renal vasoconstriction leads to hypertension and modest reduction in GFR exceeding that of RPF. Elevated level of circulating soluble vascular endothelial growth factor receptor-1 arising from the placenta is implicated in the hypertension and disruption of glomerular fenestrae and barrier function, the former causing reduced Kf and the latter proteinuria. Additional pathogenic factors are discussed. Last, potential clinical ramifications include RLN replacement in women conceiving with donor eggs and its therapeutic use in PE. Another goal has been to apply knowledge gained from investigating circulatory adaptations in pregnancy toward identifying and developing novel therapeutic strategies for renal and cardiovascular disease in the nonpregnant population. So far, one candidate to emerge is RLN and its potential therapeutic use in heart failure. PMID:24647709

  1. Bioimpedance harmonic analysis as a tool to simultaneously assess circulation and nervous control

    International Nuclear Information System (INIS)

    Multicycle harmonic (Fourier) analysis of bioimpedance was employed to simultaneously assess circulation and neural activity in visceral (rat urinary bladder) and somatic (human finger) organs. The informative value of the first cardiac harmonic of the bladder impedance as an index of bladder circulation is demonstrated. The individual reactions of normal and obstructive bladders in response to infusion cystometry were recorded. The potency of multicycle harmonic analysis of bioimpedance to assess sympathetic and parasympathetic neural control in urinary bladder is discussed. In the human finger, bioimpedance harmonic analysis revealed three periodic components at the rate of the heart beat, respiration and Mayer wave (0.1 Hz), which were observed under normal conditions and during blood flow arrest in the hand. The revealed spectrum peaks were explained by the changes in systemic blood pressure and in regional vascular tone resulting from neural vasomotor control. During normal respiration and circulation, two side cardiac peaks were revealed in a bioimpedance amplitude spectrum, whose amplitude reflected the depth of amplitude respiratory modulation of the cardiac output. During normal breathing, the peaks corresponding to the second and third cardiac harmonics were split, reflecting frequency respiratory modulation of the heart rate. Multicycle harmonic analysis of bioimpedance is a novel potent tool to examine the interaction between the respiratory and cardiovascular system and to simultaneously assess regional circulation and neural influences in visceral and somatic organs

  2. Lightweight Magnetic Cooler With a Reversible Circulator

    Science.gov (United States)

    Chen, Weibo; McCormick, John

    2011-01-01

    A design of a highly efficient and lightweight space magnetic cooler has been developed that can continuously provide remote/distributed cooling at temperatures in the range of 2 K with a heat sink at about 15 K. The innovative design uses a cryogenic circulator that enables the cooler to operate at a high cycle frequency to achieve a large cooling capacity. The ability to provide remote/distributed cooling not only allows flexible integration with a payload and spacecraft, but also reduces the mass of the magnetic shields needed. The active magnetic regenerative refrigerator (AMRR) system is shown in the figure. This design mainly consists of two identical magnetic regenerators surrounded by their superconducting magnets and a reversible circulator. Each regenerator also has a heat exchanger at its warm end to reject the magnetization heat to the heat sink, and the two regenerators share a cold-end heat exchanger to absorb heat from a cooling target. The circulator controls the flow direction, which cycles in concert with the magnetic fields, to facilitate heat transfer. Helium enters the hot end of the demagnetized column, is cooled by the refrigerant, and passes into the cold-end heat exchanger to absorb heat. The helium then enters the cold end of the magnetized column, absorbing heat from the refrigerant, and enters the hot-end heat exchanger to reject the magnetization heat. The efficient heat transfer in the AMRR allows the system to operate at a relatively short cycle period to achieve a large cooling power. The key mechanical components in the magnetic cooler are the reversible circulator and the magnetic regenerators. The circulator uses non-contacting, self-acting gas bearings and clearance seals to achieve long life and vibration- free operation. There are no valves or mechanical wear in this circulator, so the reliability is predicted to be very high. The magnetic regenerator employs a structured bed configuration. The core consists of a stack of thin

  3. Blood flow in the human fetal descending aorta : a pulsed Doppler study

    OpenAIRE

    Pijpers, Leendert

    1985-01-01

    textabstractIn 1628 William Harvey introduced his concept ofthe human circulation. Although a lot of studies concerning the fetal circulation were done before it was not until the 1930s that Barcroft (1934, 1939) and associates performed radiograpbic studies on the feta! goal and lamb to establish the feta! circulation. Later in 1964 Lind, Stern and Wegelius used cine-angiographic studies to describe the human fetal circulation. Volume flow measurements were already carried out in 1884 by Coh...

  4. The stability of the thermohaline circulation in a coupled ocean-atmosphere general circulation model

    Energy Technology Data Exchange (ETDEWEB)

    Schiller, A. [Max-Planck-Institut fuer Meteorologie, Hamburg (Germany); Mikolajewicz, U. [Max-Planck-Institut fuer Meteorologie, Hamburg (Germany); Voss, R. [Deutsches Klimarechenzentrum (DKRZ), Hamburg (Germany)

    1996-02-01

    The stability of the Atlantic thermohaline circulation against meltwater input is investigated in a coupled ocean-atmosphere general circulation model. The meltwater input to the Labrador Sea is increased linearly for 250 years to a maximum input of 0.625 Sv and then reduced again to 0 (both instantaneously and slowly decreasing over 250 years). The resulting freshening forces a shutdown of the formation of North Atlantic deepwater and a subsequent reversal of the thermohaline circulation of the Atlantic, filling the deep Atlantic with Antarctic bottom water. The change in the overturning pattern causes a drastic reduction of the Atlantic northward heat transport, resulting in a strong cooling with maximum amplitude over the northern North Atlantic and a southward shift of the sea-ice margin in the Atlantic. Due to the increased meridional temperature gradient, the Atlantic intertropical convergence zone is displaced southward and the westerlies in the northern hemisphere gain strength. We identify four main feedbacks affecting the stability of the thermohaline circulation: the change in the overturning circulation of the Atlantic leads to longer residence times of the surface waters in high northern latitudes, which allows them to accumulate more precipitation and runoff from the continents, which results in an increased stability in the North Atlantic.

  5. Seasonal overturning circulation in the Red Sea: 1. Model validation and summer circulation

    KAUST Repository

    Yao, Fengchao

    2014-04-01

    The overturning circulation in the Red Sea exhibits a distinct seasonally reversing pattern and is studied using high-resolution MIT general circulation model simulations. In the first part of this study, the vertical and horizontal structure of the summer overturning circulation and its dynamical mechanisms are presented from the model results. The seasonal water exchange in the Strait of Bab el Mandeb is successfully simulated, and the structures of the intruding subsurface Gulf of Aden intermediate water are in good agreement with summer observations in 2011. The model results suggest that the summer overturning circulation is driven by the combined effect of the shoaling of the thermocline in the Gulf of Aden resulting from remote winds in the Arabian Sea and an upward surface slope from the Red Sea to the Gulf of Aden set up by local surface winds in the Red Sea. In addition, during late summer two processes associated, respectively, with latitudinally differential heating and increased salinity in the southern Red Sea act together to cause the reversal of the contrast of the vertical density structure and the cessation of the summer overturning circulation. Dynamically, the subsurface northward pressure gradient force is mainly balanced by vertical viscosity resulting from the vertical shear and boundary friction in the Strait of Bab el Mandeb. Unlike some previous studies, the three-layer summer exchange flows in the Strait of Bab el Mandeb do not appear to be hydraulically controlled.

  6. Explicit Determinants of the RFPrLrR Circulant and RLPrFrL Circulant Matrices Involving Some Famous Numbers

    Directory of Open Access Journals (Sweden)

    Tingting Xu

    2014-01-01

    Full Text Available Circulant matrices may play a crucial role in solving various differential equations. In this paper, the techniques used herein are based on the inverse factorization of polynomial. We give the explicit determinants of the RFPrLrR circulant matrices and RLPrFrL circulant matrices involving Fibonacci, Lucas, Pell, and Pell-Lucas number, respectively.

  7. Divergent relationship of circulating CTRP3 levels between obesity and gender: a cross-sectional study

    Science.gov (United States)

    Wagner, Roy Marshal; Sivagnanam, Kamesh; Clark, William Andrew

    2016-01-01

    C1q TNF Related Protein 3 (CTRP3) is a novel adipose tissue derived secreted factor, or adipokine, which has been linked to a number of beneficial biological effects on metabolism, inflammation, and survival signaling in a variety of tissues. However, very little is known about CTRP3 in regards to human health. The purpose of this project was to examine circulating CTRP3 levels in a clinical population, patients with symptoms requiring heart catheterization in order to identify the presence of obstructive coronary artery disease (CAD). It was hypothesized that serum CTRP3 levels would be decreased in the presence of CAD. Methods Body mass index (BMI), diabetes status, and plasma samples were collected from 100 patients who were >30 years of age and presented at the East Tennessee State University Heart Clinic with symptoms requiring heart catheterization in order to identify the presence of cardiovascular blockages (n = 52 male, n = 48 female). Circulating CTRP3 levels were quantified using commercially available ELISA. Results Circulating CTRP3 levels had no relationship to the presence of CAD regardless of gender. However, circulating concentrations of CTRP3 were significantly higher in normal weight (BMI obesity (BMI > 30) resulted in an increase in circulating CTRP3 levels in male subjects (0.74 ± 0.08 µg/ml) but showed a significant decrease in female subjects (0.58 ± 0.07 µg/ml). Additionally, there was a significant reduction in circulating CTRP3 levels in female subjects who were diagnosed with Type 2 diabetes compared with patients without (0.79 ± 0.08 vs. 0.42 ± 0.10 µg/ml). There was no relationship between diabetes status and circulating CTRP3 levels in male subjects. Conclusion Circulating CTRP3 levels had a different relationship with diabetes and obesity status between male and female patients. It is possible that circulating CTRP3 levels are controlled by hormonal status, however more research is needed to explore this relationship

  8. Effect of vegetation on the Late Miocene ocean circulation

    Directory of Open Access Journals (Sweden)

    G. Lohmann

    2006-08-01

    Full Text Available A weak and shallow thermohaline circulation in the North Atlantic Ocean is related to an open Central American gateway and exchange with fresh Pacific waters. We estimate the effect of vegetation on the ocean general circulation using the atmospheric circulation model simulations for the Late Miocene climate. Caused by an increase in net evaporation in the Miocene North Atlantic, the North Atlantic water becomes more saline which enhances the overturning circulation and thus the northward heat transport. This effect reveals a potentially important feedback between the ocean circulation, the hydrological cycle and the land surface cover for Cenozoic climate evolution.

  9. Gas cooled fast breeder reactor design for a circulator test facility (modified HTGR circulator test facility)

    Energy Technology Data Exchange (ETDEWEB)

    1979-10-01

    A GCFR helium circulator test facility sized for full design conditions is proposed for meeting the above requirements. The circulator will be mounted in a large vessel containing high pressure helium which will permit testing at the same power, speed, pressure, temperature and flow conditions intended in the demonstration plant. The electric drive motor for the circulator will obtain its power from an electric supply and distribution system in which electric power will be taken from a local utility. The conceptual design decribed in this report is the result of close interaction between the General Atomic Company (GA), designer of the GCFR, and The Ralph M. Parson Company, architect/engineer for the test facility. A realistic estimate of total project cost is presented, together with a schedule for design, procurement, construction, and inspection.

  10. Gas cooled fast breeder reactor design for a circulator test facility (modified HTGR circulator test facility)

    International Nuclear Information System (INIS)

    A GCFR helium circulator test facility sized for full design conditions is proposed for meeting the above requirements. The circulator will be mounted in a large vessel containing high pressure helium which will permit testing at the same power, speed, pressure, temperature and flow conditions intended in the demonstration plant. The electric drive motor for the circulator will obtain its power from an electric supply and distribution system in which electric power will be taken from a local utility. The conceptual design decribed in this report is the result of close interaction between the General Atomic Company (GA), designer of the GCFR, and The Ralph M. Parson Company, architect/engineer for the test facility. A realistic estimate of total project cost is presented, together with a schedule for design, procurement, construction, and inspection

  11. Codon Optimization of Human Parvovirus B19 Capsid Genes Greatly Increases Their Expression in Nonpermissive Cells▿ †

    OpenAIRE

    Zhi, Ning; Wan, Zhihong; Liu, Xiaohong; Wong, Susan; Kim, Dong Joo; Young, Neal S.; Kajigaya, Sachiko

    2010-01-01

    Parvovirus B19 (B19V) is pathogenic for humans and has an extreme tropism for human erythroid progenitors. We report cell type-specific expression of the B19V capsid genes (VP1 and VP2) and greatly increased B19V capsid protein production in nonpermissive cells by codon optimization. Codon usage limitation, rather than promoter type and the 3′ untranslated region of the capsid genes, appears to be a key factor in capsid protein production in nonpermissive cells. Moreover, B19 virus-like parti...

  12. Atmospheric General Circulation Changes under Global Warming

    Science.gov (United States)

    Palipane, Erool

    The work in this thesis is mainly two-fold. First we study the internal variability of the general circulation and focus our study on the annular modes and how important it is to simulate the subsynoptic scales in the circulation. In the next major section we will try to understand the mechanisms of the forced response and the mechanisms leading towards the jet shift from transient evolution in Atmospheric general circulation models. In the first part, in an attempt to assess the benefit of resolving the sub-synoptic to mesoscale processes, the spatial and temporal characteristics of the Annular Modes (AMs), in particular those related to the troposphere-stratosphere interaction, are evaluated for moderate- and high-horizontal resolution simulations with a global atmospheric general circulation model (AGCM), in comparison with the ERA40 re- analysis. Relative to the CMIP-type climate models, the IFS AGCM demonstrates notable improvement in capturing the key characteristics of the AMs. Notably, the performance with the high horizontal resolution version of the model is systematically superior to the moderate resolution on all metrics examined, including the variance of the AMs at different seasons of the year, the intrinsic e-folding time scales of the AMs, and the downward influence from the stratosphere to troposphere in the AMs. Moreover, the high-resolution simulation with a greater persistence in the intrinsic variability of the SAM projects an appreciably larger shift of the surface westerly wind during the Southern Hemisphere summer under climate change. In the second part, the response of the atmospheric circulation to greenhouse gas-induced SST warming is investigated using large ensemble experiments with two AGCMs, with a focus on the robust feature of the poleward shift of the eddy driven jet. In these experiments, large ensembles of simulations are conducted by abruptly switching the SST forcing on from January 1st to focus on the wintertime circulation

  13. Mapping the homodimer interface of an optimized, artificial, transmembrane protein activator of the human erythropoietin receptor.

    Directory of Open Access Journals (Sweden)

    Emily B Cohen

    Full Text Available Transmembrane proteins constitute a large fraction of cellular proteins, and specific interactions involving membrane-spanning protein segments play an important role in protein oligomerization, folding, and function. We previously isolated an artificial, dimeric, 44-amino acid transmembrane protein that activates the human erythropoietin receptor (hEPOR in trans. This artificial protein supports limited erythroid differentiation of primary human hematopoietic progenitor cells in vitro, even though it does not resemble erythropoietin, the natural ligand of this receptor. Here, we used a directed-evolution approach to explore the structural basis for the ability of transmembrane proteins to activate the hEPOR. A library that expresses thousands of mutants of the transmembrane activator was screened for variants that were more active than the original isolate at inducing growth factor independence in mouse cells expressing the hEPOR. The most active mutant, EBC5-16, supports erythroid differentiation in human cells with activity approaching that of EPO, as assessed by cell-surface expression of glycophorin A, a late-stage marker of erythroid differentiation. EBC5-16 contains a single isoleucine to serine substitution at position 25, which increases its ability to form dimers. Genetic studies confirmed the importance of dimerization for activity and identified the residues constituting the homodimer interface of EBC5-16. The interface requires a GxxxG dimer packing motif and a small amino acid at position 25 for maximal activity, implying that tight packing of the EBC5-16 dimer is a crucial determinant of activity. These experiments identified an artificial protein that causes robust activation of its target in a natural host cell, demonstrated the importance of dimerization of this protein for engagement of the hEPOR, and provided the framework for future structure-function studies of this novel mechanism of receptor activation.

  14. Estuarine circulation in the Taranto Seas.

    Science.gov (United States)

    Pascalis, Francesca De; Petrizzo, Antonio; Ghezzo, Michol; Lorenzetti, Giuliano; Manfè, Giorgia; Alabiso, Giorgio; Zaggia, Luca

    2016-07-01

    The Taranto basin is a shallow water marine system in the South of Italy characterized by the presence of a lagoon environment together with a semi-enclosed bay connected to the Ionian Sea. This marine system experienced over the last few decades strong biochemical pollution and environmental degradation, and it is considered a hotspot study site for economic, ecological and scientific reasons. The aim of this study was to examine, on an annual temporal scale and with high spatial resolution, the main hydrodynamical processes and transport scales of the system by means of a 3D finite element numerical model application, adopting the most realistic forcing available. The model allowed us to assess the role played by baroclinic terms in the basin circulation, describing its estuarine nature. In particular, the main features of water circulation, salinity and temperature distribution, water renewal time and bottom stress were investigated. Our results allowed us to equate this system dynamic to that of a weakly stratified estuary, identifying the main driving sources of this mechanism. The vertical stratification over the whole year was proved to be stable, leading to a dual circulation flowing out on the surface, mainly through Porta Napoli channel, and inflowing on the bottom mainly through Navigabile channel. This process was responsible also for the renewal time faster on the bottom of the Mar Piccolo basin than the surface. Due to the great importance of the Taranto basin for what concerns sediment pollution, also the effect of currents in terms of bottom stress was investigated, leading to the conclusion that only in the inlets area the values of bottom stress can be high enough to cause erosion. PMID:26408109

  15. Pure midbrain ischemia and hypoplastic vertebrobasilar circulation.

    Science.gov (United States)

    Gilberti, Nicola; Gamba, Massimo; Costa, Angelo; Vergani, Veronica; Spezi, Raffaella; Pezzini, Alessandro; Volonghi, Irene; Mardighian, Dikran; Gasparotti, Roberto; Padovani, Alessandro; Magoni, Mauro

    2014-02-01

    Isolated midbrain infarction is rare and little is known about etiology and patient's long-term follow up. We aimed to describe the clinical features, the causative diseases and the outcome of patients with isolated midbrain infarction who were admitted to our center, focusing on vascular abnormalities of posterior circulation. All patients with first acute ischemic stroke limited to the midbrain were included and their demographic features, neurological symptoms, neuroimaging data, and cardiovascular risk factors were recorded. Functional outcome, using modified Rankin scale, was assessed at discharge and at the 3 month follow up evaluation. We found nine patients with acute isolated midbrain infarction, representing 0.61 % of all ischemic stroke admitted to our center. The most common cause of stroke was small-vessel disease (88.8 %). At stroke onset, none of the patients had consciousness disturbances, and four patients (44.4 %) had gait impairment, five patients (55.5 %) presented with diplopia due to involvement of the third nerve or fascicular type of third-nerve palsy, seven patients (77.7 %) had vascular anomalies of vertebrobasilar circulation: the most frequent was vertebral artery hypoplasia [four patients (44.4 %)]. At follow up evaluation, seven patients (77.7 %) had a good functional outcome and no patients experienced recurrence of cerebrovascular events. As isolated midbrain infarction is uncommon, specific ocular motor signs, mainly third-nerve palsy, may help to identify and localize the mesencephalic infarct. Abnormalities in vertebrobasilar circulation, such as hypoplastic basilar or vertebral artery, are frequently associated with isolated midbrain ischemia. The hypoplastic vertebrobasilar system may predispose to posterior ischemic stroke.

  16. Seawater bicarbonate removal during hydrothermal circulation

    Science.gov (United States)

    Proskurowski, G. K.; Seewald, J.; Sylva, S. P.; Reeves, E.; Lilley, M. D.

    2013-12-01

    High temperature fluids sampled at hydrothermal vents represent a complex alteration product of water-rock reactions on a multi-component mixture of source fluids. Sources to high-temperature hydrothermal samples include the 'original' seawater present in the recharge limb of circulation, magmatically influenced fluids added at depth as well as any seawater entrained during sampling. High-temperature hydrothermal fluids are typically enriched in magmatic volatiles, with CO2 the dominant species, characterized by concentrations of 10's-100's of mmol/kg (1, 2). Typically, the high concentration of CO2 relative to background seawater bicarbonate concentrations (~2.3 mmol/kg) obscures a full analysis of the fate of seawater bicarbonate during high-temperature hydrothermal circulation. Here we present data from a suite of samples collected over the past 15 years from high-temperature hydrothermal vents at 9N, Endeavour, Lau Basin, and the MAR that have endmember CO2 concentrations less than 10 mmol/kg. Using stable and radiocarbon isotope measurements these samples provide a unique opportunity to examine the balance between 'original' seawater bicarbonate and CO2 added from magmatic sources. Multiple lines of evidence from multiple hydrothermal settings consistently points to the removal of ~80% of the 'original' 2.3 mmol/kg seawater bicarbonate. Assuming that this removal occurs in the low-temperature, 'recharge' limb of hydrothermal circulation, this removal process is widely occurring and has important contributions to the global carbon cycle over geologic time. 1. Lilley MD, Butterfield DA, Lupton JE, & Olson EJ (2003) Magmatic events can produce rapid changes in hydrothermal vent chemistry. Nature 422(6934):878-881. 2. Seewald J, Cruse A, & Saccocia P (2003) Aqueous volatiles in hydrothermal fluids from the Main Endeavour Field, northern Juan de Fuca Ridge: temporal variability following earthquake activity. Earth and Planetary Science Letters 216(4):575-590.

  17. Nucla circulating atmospheric fluidized bed demonstration project

    Energy Technology Data Exchange (ETDEWEB)

    1991-01-31

    During the fourth quarter of 1990, steady-state performance testing at the Nucla Circulating Fluidized Bed (CFB) resumed under sponsorship of the US Department of Energy. Co-sponsorship of the Demonstration Test Program by the Electric Power Research Institute (EPRI) was completed on June 15, 1990. From October through December, 1990, Colorado-Ute Electric Association (CUEA) completed a total of 23 steady-state performance tests, 4 dynamic tests, and set operating records during November and December as the result of improved unit operating reliability. Highlight events and achievements during this period of operation are presented.

  18. Biodegradable Long-Circulating Polymeric Nanospheres

    Science.gov (United States)

    Gref, Ruxandra; Minamitake, Yoshiharu; Peracchia, Maria Teresa; Trubetskoy, Vladimir; Torchilin, Vladimir; Langer, Robert

    1994-03-01

    Injectable nanoparticulate carriers have important potential applications such as site-specific drug delivery or medical imaging. Conventional carriers, however, cannot generally be used because they are eliminated by the reticulo-endothelial system within seconds or minutes after intravenous injection. To address these limitations, monodisperse biodegradable nanospheres were developed from amphiphilic copolymers composed of two biocompatible blocks. The nanospheres exhibited dramatically increased blood circulation times and reduced liver accumulation in mice. Furthermore, they entrapped up to 45 percent by weight of the drug in the dense core in a one-step procedure and could be freeze-dried and easily redispersed without additives in aqueous solutions.

  19. Effects of Buoyancy on Langmuir Circulation

    Institute of Scientific and Technical Information of China (English)

    SONG Jun; SONG Jin-Bao

    2008-01-01

    Based on the Navier-Stokes equation,an equation describing the Langmuir circulation is derived by a perturbation method when the influences of Coriolis force and buoyancy force are both considered.The approach used in the analysis is similar to the works carried out by Craik and Leibovich[J.Fluid Mech.73 (1976)401],Leibovich [J.Fluid Mech.79 (1977) 715]and Huang[J.Fluid Mech.91 (1979) 191].Potential applications of the equation proposed are discussed in the area of Antarctic circumpolar current.

  20. Tropical Atmospheric Circulations with Humidity Effects

    CERN Document Server

    Hsia, Chun-Hsiung; Ma, Tian; Wang, Shouhong

    2011-01-01

    The main objective of this article is to study the effect of the moisture on the planetary scale atmospheric circulation over the tropics. The modeling we adopt is the Boussinesq equations coupled with a diffusive equation of humidity and the humidity dependent heat source is modeled by a linear approximation of the humidity. The rigorous mathematical analysis is carried out using the dynamic transition theory. In particular, we obtain the same types of transitions and hence the scenario of the El Ni\\~no mechanism as described in \\cite{MW2,MW3}. The effect of the moisture only lowers slightly the magnitude of the critical thermal Rayleigh number.