WorldWideScience

Sample records for circulating human erythroid

  1. Effect of inflammation induced by prolonged exercise on circulating erythroid progenitors and markers of erythropoiesis

    OpenAIRE

    Premetis, Evangelos; Skenderi, Katerina; Graphakos, Stelios; Baltopoulos, Panayiotis; Tsironi, Maria; Papassotiriou, Ioannis

    2009-01-01

    Background: Exercise in humans augments the mobilization of circulating hematopoietic progenitor cells (CD34+) from the bone marrow. We investigated the effect of inflammation on erythroid marrow activity by mobilization of erythroid progenitor cells (EPs) along with soluble markers of erythropoiesis. Methods: Ten healthy athletes who participated in an ultradistance foot race participated in the study. Peripheral blood mononuclear cells were isolated, before (phase I), at the end (phase II)...

  2. Isolation and in vitro differentiation of human erythroid precursor cells.

    Science.gov (United States)

    Kim, H C; Marks, P A; Rifking, R A; Maniatis, G M; Bank, A

    1976-05-01

    There is decreased beta-globin production in beta-thalassemic reticulocytes and nucleated erythroid cells. In this study, we have examined whether unbalanced globin synthesis is expressed at all stages of human erythroid cell maturation. In order to determine the pattern of globin synthesis in early erythroid cells during erythroid cell maturation, an in vitro culture system using human bone marrow erythroid precursor cells has been developed. Early erythroid precursor cells (proerythroblasts and basophilic erythroblasts) have been isolated from nonthalassemic and thalassemic human bone marrows by lysing more mature erythroid cells, using complement and a rabbit antiserum prepared against normal human red cells. In the presence of erythropoietin, differentiation and proliferation of erythroid cells in demonstrable in liquid suspension culture for 24-48 hr, as determined by morphological criteria and by an increase in globin synthesis. The ratio of alpha- to beta-globin chain synthesis in nonthalassemic cells in approximately 1 at all stages of erythroid cell differentiation during culture. In cells from four patients with homozygous beta- thalassemia there is decreased beta-globin synthesis compared to alpha-globin synthesis, both in early erythroid precursor cells and during their maturation in culture. These findings indicate that unbalanced globin chain synthesis is expressed at all stages of red cell maturation in homozygous beta-thalassemia. PMID:1260133

  3. Proliferation and maturation of human erythroid progenitors in liquid culture.

    Science.gov (United States)

    Fibach, E; Manor, D; Oppenheim, A; Rachmilewitz, E A

    1989-01-01

    Hemopoiesis is studied in vitro mainly in semisolid culture, where hemopoietic progenitors develop into discrete colonies. We describe a liquid culture system that supports the proliferation and maturation of human erythroid progenitors. We seeded mononuclear cells from the peripheral blood (PB) of patients with beta-thalassemia in liquid medium in the presence of conditioned medium from human bladder carcinoma cells. Seven days later, RBCs, normoblasts, granulocytes, and monocytes disappeared, and the number of lymphocytes dropped considerably. In contrast, erythroid colony-forming cells increased fourfold to tenfold. The next step entailed the removal of colony-stimulating factor (CSF) and CSF-secreting cells, the exclusion of macrophages by harvesting nonadherent cells, and the lysis of T lymphocytes by treatment with monoclonal rat antihuman lymphocyte antibodies (CAMPATH-1) and complement. Reculture of the remaining cells in liquid medium supplemented with recombinant erythropoietin (EPO) resulted in the exclusive development of erythroid cells, with myeloid cells reduced to less than 2%. Stainable hemoglobin (Hb) appeared on day 3, with over 85% of the population containing hemoglobin by day 11 and the cell number increasing from 0.2 X 10(6) to 3 X 10(6) mL. By permitting the manipulation of culture conditions and components and increasing the cell yield, the liquid system may facilitate quantitative analysis of growth kinetics as well as biochemical and immunologic characterization of the developing erythroid cell. PMID:2910352

  4. Identification of human erythroid lineage-committed progenitors.

    Science.gov (United States)

    Mori, Yasuo; Akashi, Koichi; Weissman, Irving L

    2016-05-01

    Elucidating the developmental pathway leading to erythrocytes and being able to isolate their progenitors is crucial to understanding and treating disorders of red cell imbalance such as anemia, myelodysplastic syndrome, and polycythemia vera. Endoglin (CD105) is a key marker for purifying mouse erythroid lineage-committed progenitors (EPs) from bone marrow. Herein, we show that human EPs can also be isolated from adult bone marrow. We identified three subfractions that possessed different expression patterns of CD105 and CD71 within the previously defined human megakaryocyte/erythrocyte progenitor (hMEP; Lineage-CD34(+)CD38(+)IL-3Rα(-)CD45RA(-)) population. Both CD71(-)CD105(-) and CD71(+)CD105(-) MEPs, at least in vitro, retained bipotency for the megakaryocyte (MegK) and erythrocyte (E) lineages, although the latter sub-population had a differentiation potential skewed toward the E-lineage. Notably, the differentiation output of the CD71(+)CD105(+) subset of cells within the MEP population was completely restricted to the E-lineage with the loss of MegK potential; thus, we termed CD71(+)CD105(-) MEPs and CD71(+)CD105(+) cells as E-biased MEPs (E-MEPs) and EPs, respectively. These previously unclassified populations may facilitate understanding of the molecular mechanisms governing human erythroid development and serve as potential therapeutic targets in disorders of the erythroid lineage. PMID:27263782

  5. Erythropoietin stimulates a rise in intracellular free calcium concentration in single early human erythroid precursors.

    OpenAIRE

    Miller, B A; Scaduto, R C; Tillotson, D L; Botti, J J; Cheung, J Y

    1988-01-01

    Erythropoietin and granulocyte-macrophage colony-stimulating factor (GM-CSF) stimulate the differentiation and proliferation of erythroid cells. To determine the cellular mechanism of action of these growth factors, we measured changes in intracellular free calcium concentration [( Cac]) in single human erythroid precursors in response to recombinant erythropoietin and GM-CSF. [Cac] in immature erythroblasts derived from cultured human cord blood erythroid progenitors was measured with fluore...

  6. Selective toxicity of dihydroartemisinin on human CD34+ erythroid cell differentiation

    International Nuclear Information System (INIS)

    Artemisinins are safely used in the combination therapy for uncomplicated malaria, but their employment during pregnancy is still controversial. In fact, animal studies reported that the active metabolite, dihydroartemisinin (DHA), causes embryonic erythrocytes depletion, when the treatment is performed during a critical period of time. The present study investigates the effect of DHA on human developmental erythropoiesis in order to characterize the target erythroid stage and to predict the window of susceptibility in human pregnancy. As a model for human developmental erythropoiesis, peripheral blood purified, CD34+ cells were committed towards erythrocytes and DHA (0.5 or 2 μM) was added to different erythroid stages during 14 days culture. Erythroid differentiation was investigated by cytofluorimetric analysis of Glycophorin A expression, by morphological analysis and erythroid globin gene expression analysis with real-time PCR. It was found that the effect of DHA was dependent on the maturation stage of erythroid cells. In fact when DHA was added to the pro- and basophilic erythroblasts caused a significant dose-dependent inhibition of cell proliferation and a significant delay of erythroid differentiation, as measured by morphological analysis, expression of Glycophorin A by immunofluorescence and of erythroid globin genes by real-time PCR. In contrast, the inhibition of stem cells and of early progenitors was transient and masked by the subsequent exponential cell growth. No effect was observed on mature erythroid stages. This is the first demonstration that DHA affects human erythropoiesis in vitro, in a dose- and time-dependent manner; the target population seems to be the pro-erythroblast and basophilic erythroblast stage, suggesting that DHA toxicity is limited to primitive human erythropoiesis. These findings outline the relevance of DHA dosage and timing to prevent embryotoxicity and support current WHO recommendations of avoiding malaria treatment

  7. Propagation of human parvovirus B19 in primary culture of erythroid lineage cells derived from fetal liver.

    OpenAIRE

    Yaegashi, N; Shiraishi, H; Takeshita, T.; Nakamura, M.; Yajima, A; Sugamura, K

    1989-01-01

    Erythroid lineage cells derived from fetal liver were demonstrated to be target cells for human parvovirus B19 infection. B19 virus antigen-positive serum was inoculated into primary cultures containing erythroid lineage cells enriched from fetal liver. The B19 virus antigen was detected on about 5% of cells in the culture by immunofluorescence staining, and the stained cells were identified as erythroid lineage cells by double staining with anti-B19 virus-positive serum and anti-erythroid li...

  8. Insight into GATA1 transcriptional activity through interrogation of cis elements disrupted in human erythroid disorders.

    Science.gov (United States)

    Wakabayashi, Aoi; Ulirsch, Jacob C; Ludwig, Leif S; Fiorini, Claudia; Yasuda, Makiko; Choudhuri, Avik; McDonel, Patrick; Zon, Leonard I; Sankaran, Vijay G

    2016-04-19

    Whole-exome sequencing has been incredibly successful in identifying causal genetic variants and has revealed a number of novel genes associated with blood and other diseases. One limitation of this approach is that it overlooks mutations in noncoding regulatory elements. Furthermore, the mechanisms by which mutations in transcriptionalcis-regulatory elements result in disease remain poorly understood. Here we used CRISPR/Cas9 genome editing to interrogate three such elements harboring mutations in human erythroid disorders, which in all cases are predicted to disrupt a canonical binding motif for the hematopoietic transcription factor GATA1. Deletions of as few as two to four nucleotides resulted in a substantial decrease (>80%) in target gene expression. Isolated deletions of the canonical GATA1 binding motif completely abrogated binding of the cofactor TAL1, which binds to a separate motif. Having verified the functionality of these three GATA1 motifs, we demonstrate strong evolutionary conservation of GATA1 motifs in regulatory elements proximal to other genes implicated in erythroid disorders, and show that targeted disruption of such elements results in altered gene expression. By modeling transcription factor binding patterns, we show that multiple transcription factors are associated with erythroid gene expression, and have created predictive maps modeling putative disruptions of their binding sites at key regulatory elements. Our study provides insight into GATA1 transcriptional activity and may prove a useful resource for investigating the pathogenicity of noncoding variants in human erythroid disorders. PMID:27044088

  9. Binding and internalization of recombinant human erythropoietin in murine erythroid precursor cells

    International Nuclear Information System (INIS)

    Erythropoietin (EPO) biosynthetically labelled with [35S]cysteine was produced from Chinese hamster ovary (CHO) cells containing amplified copies of human EPO cDNA. The glycosylated recombinant [35S]EPO, purified to virtual radiochemical homogeneity, was biologically active. We studied the interaction of this labeled recombinant EPO with erythroid precursor cells from mice made anemic with phenylhydrazine. The [35S]-labeled molecule bound to erythroid precursors in a time- and temperature-dependent manner. The binding was specific for EPO, and neither insulin, transferrin, epidermal growth factor, nor multiplication stimulating activity could compete for EPO binding sites. In the presence of 0.2% sodium azide, which blocks 80% to 90% of internalization, the recombinant molecule bound with an apparent Kd of 750 pmol/L and 100 to 200 binding sites per cell at 37 degrees C. Asialo-EPO was a more effective competitor than sialated EPO for the available binding sites. Thus, the enhanced biological specific activity of asialo-EPO could result from its enhanced binding affinity. We also studied recombinant human EPO labeled with 125I and found that it also bound to the erythroid cells in a saturable and specific manner. After 90 minutes of incubation at 37 degrees C, most of the bound [35S]EPO was internalized, whereas most of the [125I]EPO remained on the cell surface. The reduced internalization of the iodinated molecule could account for the previously reported functional deficit associated with iodination

  10. Binding and internalization of recombinant human erythropoietin in murine erythroid precursor cells

    Energy Technology Data Exchange (ETDEWEB)

    Mufson, R.A.; Gesner, T.G.

    1987-05-01

    Erythropoietin (EPO) biosynthetically labelled with (/sup 35/S)cysteine was produced from Chinese hamster ovary (CHO) cells containing amplified copies of human EPO cDNA. The glycosylated recombinant (/sup 35/S)EPO, purified to virtual radiochemical homogeneity, was biologically active. We studied the interaction of this labeled recombinant EPO with erythroid precursor cells from mice made anemic with phenylhydrazine. The (/sup 35/S)-labeled molecule bound to erythroid precursors in a time- and temperature-dependent manner. The binding was specific for EPO, and neither insulin, transferrin, epidermal growth factor, nor multiplication stimulating activity could compete for EPO binding sites. In the presence of 0.2% sodium azide, which blocks 80% to 90% of internalization, the recombinant molecule bound with an apparent Kd of 750 pmol/L and 100 to 200 binding sites per cell at 37 degrees C. Asialo-EPO was a more effective competitor than sialated EPO for the available binding sites. Thus, the enhanced biological specific activity of asialo-EPO could result from its enhanced binding affinity. We also studied recombinant human EPO labeled with /sup 125/I and found that it also bound to the erythroid cells in a saturable and specific manner. After 90 minutes of incubation at 37 degrees C, most of the bound (/sup 35/S)EPO was internalized, whereas most of the (/sup 125/I)EPO remained on the cell surface. The reduced internalization of the iodinated molecule could account for the previously reported functional deficit associated with iodination.

  11. Eos negatively regulates human γ-globin gene transcription during erythroid differentiation.

    Directory of Open Access Journals (Sweden)

    Hai-Chuan Yu

    Full Text Available BACKGROUND: Human globin gene expression is precisely regulated by a complicated network of transcription factors and chromatin modifying activities during development and erythropoiesis. Eos (Ikaros family zinc finger 4, IKZF4, a member of the zinc finger transcription factor Ikaros family, plays a pivotal role as a repressor of gene expression. The aim of this study was to examine the role of Eos in globin gene regulation. METHODOLOGY/PRINCIPAL FINDINGS: Western blot and quantitative real-time PCR detected a gradual decrease in Eos expression during erythroid differentiation of hemin-induced K562 cells and Epo-induced CD34+ hematopoietic stem/progenitor cells (HPCs. DNA transfection and lentivirus-mediated gene transfer demonstrated that the enforced expression of Eos significantly represses the expression of γ-globin, but not other globin genes, in K562 cells and CD34+ HPCs. Consistent with a direct role of Eos in globin gene regulation, chromatin immunoprecipitaion and dual-luciferase reporter assays identified three discrete sites located in the DNase I hypersensitivity site 3 (HS3 of the β-globin locus control region (LCR, the promoter regions of the Gγ- and Aγ- globin genes, as functional binding sites of Eos protein. A chromosome conformation capture (3C assay indicated that Eos may repress the interaction between the LCR and the γ-globin gene promoter. In addition, erythroid differentiation was inhibited by enforced expression of Eos in K562 cells and CD34+ HPCs. CONCLUSIONS/SIGNIFICANCE: Our results demonstrate that Eos plays an important role in the transcriptional regulation of the γ-globin gene during erythroid differentiation.

  12. Dihydroartemisinin inhibits the human erythroid cell differentiation by altering the cell cycle

    International Nuclear Information System (INIS)

    Artemisinin derivatives such as dihydroartemisinin (DHA) induce significant depletion of early embryonic erythroblasts in animal models. We have reported previously that DHA specifically targets pro-erythroblasts and basophilic erythroblasts, when human CD34+ stem cells are differentiated toward the erythroid lineage, indicating that a window of susceptibility to artemisinins may exist also in human developmental erythropoiesis during pregnancy. To better investigate the toxicity of artemisinin derivatives, the structure–activity relationship was evaluated against the K562 leukaemia cell line, used as a model for differentiating early human erythroblasts. All artemisinins derivatives, except deoxyartemisinin, inhibited both spontaneous and induced erythroid differentiation, confirming that the peroxide bridge is responsible for the erythro-toxicity. On the contrary, cell growth was markedly reduced by DHA, artemisone and artesunate but not by artemisinin, 10-deoxoartemisinin or deoxy-artemisinin. The substituent at position C-10 is responsible only for the anti-proliferative effect, since 10-deoxoartemisinin did not reduce cell growth but arrested the differentiation of K562 cells. In particular, the results showed that DHA resulted the most potent and rapidly acting compound of the drug family, causing (i) the decreased expression of GpA surface receptors and the down regulation the γ-globin gene; (ii) the alteration of S phase of cell cycle and (iii) the induction of programmed cell death of early erythroblasts in a dose dependent manner within 24 h. In conclusion, these findings confirm that the active metabolite DHA is responsible for the erythro-toxicity of most of artemisinins used in therapy. Thus, as long as no further clinical data are available, current WHO recommendations of avoiding malaria treatment with artemisinins during the first trimester of pregnancy remain valid.

  13. Embryonic----Fetal Hb switch in humans: studies on erythroid bursts generated by embryonic progenitors from yolk sac and liver.

    Science.gov (United States)

    Peschle, C; Migliaccio, A R; Migliaccio, G; Petrini, M; Calandrini, M; Russo, G; Mastroberardino, G; Presta, M; Gianni, A M; Comi, P

    1984-04-01

    The synthesis of embryonic (zeta, epsilon), fetal (alpha, gamma), and adult (beta) globin was evaluated in human yolk sacs (YS) and livers at different ontogenic stages (i.e., from 6 through 10-12 wk of age) by means of analytical isoelectric focusing. Globin production was comparatively evaluated in vivo (i.e., in directly labeled erythroblasts from YS and liver) and in vitro [i.e., in erythroid bursts generated in culture by erythroid burst-forming units (BFU-E) from the same erythropoietic tissues]. Erythroid bursts generated in vitro by BFU-E from 6-wk livers and YS show essentially a "fetal" globin synthetic pattern: this is in sharp contrast to the "embryonic" pattern in corresponding liver and YS erythroblasts directly labeled in vivo. The invitro phenomenon suggests that (i) 6-wk BFU-E constitute a new generation of progenitors, which have already switched from an embryonic to a fetal program, and/or (ii) expression of their fetal program is induced by unknown in vitro factor(s), which may underlie the in vivo switch at later ontogenic stages. It is emphasized that 6- to 7-wk BFU-E are endowed with the potential for in vitro synthesis of not only epsilon- and gamma-chains but also some beta-globin. In general, we observed an inverse correlation between the levels of epsilon- and beta-chain synthesis. These results, together with previous studies on fetal, perinatal, and adult BFU-E, are compatible with models suggesting that in ontogeny the chromatin configuration is gradually modified at the level of the non-alpha gene cluster, thus leading to a 5'----3' activation of globin genes in a balanced fashion. PMID:6201856

  14. Parvovirus B19 promoter at map unit 6 confers autonomous replication competence and erythroid specificity to adeno-associated virus 2 in primary human hematopoietic progenitor cells.

    OpenAIRE

    Wang, X S; Yoder, M C; Zhou, S. Z.; A Srivastava

    1995-01-01

    The pathogenic human parvovirus B19 is an autonomously replicating virus with a remarkable tropism for human erythroid progenitor cells. Although the target cell specificity for B19 infection has been suggested to be mediated by the erythrocyte P-antigen receptor (globoside), a number of nonerythroid cells that express this receptor are nonpermissive for B19 replication. To directly test the role of expression from the B19 promoter at map unit 6 (B19p6) in the erythroid cell specificity of B1...

  15. Differentiation Potential of O Bombay Human-Induced Pluripotent Stem Cells and Human Embryonic Stem Cells into Fetal Erythroid-Like Cells

    Directory of Open Access Journals (Sweden)

    Fatemeh Ganji,

    2015-01-01

    Full Text Available Objective: There is constant difficulty in obtaining adequate supplies of blood components, as well as disappointing performance of "universal" red blood cells. Advances in somatic cell reprogramming of human-induced pluripotent stem cells (hiPSCs have provided a valuable alternative source to differentiate into any desired cell type as a therapeutic promise to cure many human disease. Materials and Methods: In this experimental study, we examined the erythroid differentiation potential of normal Bombay hiPSCs (B-hiPSCs and compared results to human embryonic stem cell (hESC lines. Because of lacking ABO blood group expression in B-hiPSCs, it has been highlighted as a valuable source to produce any cell type in vitro. Results: Similar to hESC lines, hemangioblasts derived from B-hiPSCs expressed approximately 9% KDR+CD31+ and approximately 5% CD31+CD34+. In semisolid media, iPSC and hESC-derived hemangioblast formed mixed type of hematopoietic colony. In mixed colonies, erythroid progenitors were capable to express CD71+GPA+HbF+ and accompanied by endothelial cells differentiation. Conclusion: Finally, iPS and ES cells have been directly induced to erythropoiesis without hemangioblast formation that produced CD71+HbF+erythroid cells. Although we observed some variations in the efficiency of hematopoietic differentiation between iPSC and ES cells, the pattern of differentiation was similar among all three tested lines.

  16. Isolation, growth and identification of colony-forming cells with erythroid, myeloid, dendritic cell and NK-cell potential from human fetal liver

    Directory of Open Access Journals (Sweden)

    Muench Marcus

    2002-01-01

    Full Text Available The study of hematopoietic stem cells (HSCs and the process by which they differentiate into committed progenitors has been hampered by the lack of in vitro clonal assays that can support erythroid, myeloid and lymphoid differentiation. We describe a method for the isolation from human fetal liver of highly purified candidate HSCs and progenitors based on the phenotypes CD38-CD34++ and CD38+CD34++, respectively. We also describe a method for the growth of colony-forming cells (CFCs from these cell populations, under defined culture conditions, that supports the differentiation of erythroid, CD14/CD15+ myeloid, CD1a+ dendritic cell and CD56+ NK cell lineages. Flow cytometric analyses of individual colonies demonstrate that CFCs with erythroid, myeloid and lymphoid potential are distributed among both the CD38- and CD38+ populations of CD34++ progenitors.

  17. H-Ferritin Is Preferentially Incorporated by Human Erythroid Cells through Transferrin Receptor 1 in a Threshold-Dependent Manner.

    Directory of Open Access Journals (Sweden)

    Soichiro Sakamoto

    Full Text Available Ferritin is an iron-storage protein composed of different ratios of 24 light (L and heavy (H subunits. The serum level of ferritin is a clinical marker of the body's iron level. Transferrin receptor (TFR1 is the receptor not only for transferrin but also for H-ferritin, but how it binds two different ligands and the blood cell types that preferentially incorporate H-ferritin remain unknown. To address these questions, we investigated hematopoietic cell-specific ferritin uptake by flow cytometry. Alexa Fluor 488-labeled H-ferritin was preferentially incorporated by erythroid cells among various hematopoietic cell lines examined, and was almost exclusively incorporated by bone marrow erythroblasts among human primary hematopoietic cells of various lineages. H-ferritin uptake by erythroid cells was strongly inhibited by unlabeled H-ferritin but was only partially inhibited by a large excess of holo-transferrin. On the other hand, internalization of labeled holo-transferrin by these cells was not inhibited by H-ferritin. Chinese hamster ovary cells lacking functional endogenous TFR1 but expressing human TFR1 with a mutated RGD sequence, which is required for transferrin binding, efficiently incorporated H-ferritin, indicating that TFR1 has distinct binding sites for H-ferritin and holo-transferrin. H-ferritin uptake by these cells required a threshold level of cell surface TFR1 expression, whereas there was no threshold for holo-transferrin uptake. The requirement for a threshold level of TFR1 expression can explain why among primary human hematopoietic cells, only erythroblasts efficiently take up H-ferritin.

  18. Erythroid activator NF-E2, TAL1 and KLF1 play roles in forming the LCR HSs in the human adult β-globin locus.

    Science.gov (United States)

    Kim, Yea Woon; Yun, Won Ju; Kim, AeRi

    2016-06-01

    The β-like globin genes are developmental stage specifically transcribed in erythroid cells. The transcription of the β-like globin genes requires erythroid specific activators such as GATA-1, NF-E2, TAL1 and KLF1. However, the roles of these activators have not fully elucidated in transcription of the human adult β-globin gene. Here we employed hybrid MEL cells (MEL/ch11) where a human chromosome containing the β-globin locus is present and the adult β-globin gene is highly transcribed by induction. The roles of erythroid specific activators were analyzed by inhibiting the expression of NF-E2, TAL1 or KLF1 in MEL/ch11 cells. The loss of each activator decreased the transcription of human β-globin gene, locus wide histone hyperacetylation and the binding of other erythroid specific activators including GATA-1, even though not affecting the expression of other activators. Notably, sensitivity to DNase I was reduced in the locus control region (LCR) hypersensitive sites (HSs) with the depletion of activators. These results indicate that NF-E2, TAL1 and KLF1, all activators play a primary role in HSs formation in the LCR. It might contribute to the transcription of human adult β-globin gene by allowing the access of activators and cofactors. The roles of activators in the adult β-globin locus appear to be different from the roles in the early fetal locus. PMID:27026582

  19. Antibodies to human fetal erythroid cells from a nonimmune phage antibody library

    OpenAIRE

    Huie, Michael A.; Cheung, Mei-Chi; Muench, Marcus O.; Becerril, Baltazar; Kan, Yuet W.; Marks, James D.

    2001-01-01

    The ability to isolate fetal nucleated red blood cells (NRBCs) from the maternal circulation makes possible prenatal genetic analysis without the need for diagnostic procedures that are invasive for the fetus. Such isolation requires antibodies specific to fetal NRBCs. To generate a panel of antibodies to antigens present on fetal NRBCs, a new type of nonimmune phage antibody library was generated in which multiple copies of antibody fragments are displayed on each pha...

  20. The first trimester human placenta is a site for terminal maturation of primitive erythroid cells

    OpenAIRE

    Van Handel, Ben; Sacha L Prashad; Hassanzadeh-Kiabi, Nargess; Huang, Andy; Magnusson, Mattias; Atanassova, Boriana; Chen, Angela; Hamalainen, Eija I.; Mikkola, Hanna K. A.

    2010-01-01

    Embryonic hematopoiesis starts via the generation of primitive red blood cells (RBCs) that satisfy the embryo's immediate oxygen needs. Although primitive RBCs were thought to retain their nuclei, recent studies have shown that primitive RBCs in mice enucleate in the fetal liver. It has been unknown whether human primitive RBCs enucleate, and what hematopoietic site might support this process. Our data indicate that the terminal maturation and enucleation of human primitive RBCs occurs in fir...

  1. All of the human β-type globin genes compete for LCR enhancer activity in embryonic erythroid cells of yeast artificial chromosome transgenic mice

    OpenAIRE

    Okamura, Eiichi; Matsuzaki, Hitomi; Campbell, Andrew D.; Engel, James Douglas; Fukamizu, Akiyoshi; Tanimoto, Keiji

    2009-01-01

    In primitive erythroid cells of human β-globin locus transgenic mice (TgM), the locus control region (LCR)-proximal ε- and γ-globin genes are transcribed, whereas the distal δ- and β-globin genes are silent. It is generally accepted that the β-globin gene is competitively suppressed by γ-globin gene expression at this developmental stage. Previously, however, we observed that ε-globin gene expression was severely attenuated when its distance from the LCR was extended, implying that β-globin g...

  2. Human cerebral circulation. Positron emission tomography studies

    International Nuclear Information System (INIS)

    We reviewed the literature on human cerebral circulation and oxygen metabolism, as measured by positron emission tomography (PET), with respect to normal values and of regulation of cerebral circulation. A multicenter study in Japan showed that between-center variations in cerebral blood flow (CBF), cerebral blood volume (CBV), cerebral oxygen extraction fraction (OEF) and cerebral metabolic rate of oxygen (CMRO2) values were not considerably larger than the corresponding within-center variations. Overall mean±SD values in cerebral cortical regions of normal human subjects were as follows: CBF=44.4±6.5 ml/100 ml/min; CBV=3.8±0.7 ml/100 ml; OEF=0.44±0.06; CMRO2=3.3±0.5 ml/100 ml/min (11 PET centers, 70 subjects). Intrinsic regulation of cerebral circulation involves several factors. Autoregulation maintains CBF in response to changes in cerebral perfusion pressure; chemical factors such as PaCO2 affect cerebral vascular tone and alter CBF; changes in neural activity cause changes in cerebral energy metabolism and CBF; neurogenic control of CBF occurs by sympathetic innervation. Regional differences in vascular response to changes in PaCO2 have been reported, indicating regional differences in cerebral vascular tone. Relations between CBF and CBV during changes in PaCO2 and during changes in neural activity were in good agreement with Poiseuille's law. The mechanisms of vascular response to neural activation and deactivation were independent on those of responses to PaCO2 changes. CBV in a brain region is the sum of three components: arterial, capillary and venous blood volumes. It has been reported that the arterial blood volume fraction is approximately 30% in humans and that changes in human CBV during changes in PaCO2 are caused by changes in arterial blood volume without changes in venous blood volume. These findings should be considered in future studies of the pathophysiology of cerebrovascular diseases. (author) 136 refs

  3. A high concentration of triiodothyronine attenuates the stimulatory effect on hemin-induced erythroid differentiation of human erythroleukemia K562 cells.

    Science.gov (United States)

    Shiraishi, Mieno; Yamamoto, Yoritsuna; Hirooka, Nobutaka; Obuchi, Yasuhiro; Tachibana, Shoichi; Makishima, Makoto; Tanaka, Yuji

    2015-01-01

    Although thyroid hormone is a known stimulator of erythropoietic differentiation, severe anemia is sometimes observed in patients with hyperthyroidism and this mechanism is not fully understood. The aim of this study was to investigate the effect of triiodothyronine (T3) on hemin-induced erythropoiesis. Human erythroleukemia K562 cells were used as an erythroid differentiation model. Cell differentiation was induced by hemin and the effect of pre-incubation with T3 (0.1 to 100 nM) was analyzed by measuring the benzidine-positive rate, hemoglobin content, CD71 expression (transferrin receptor), and mRNA expression for transcription factors related to erythropoiesis and thyroid hormone receptors (TRs). Hemin, a promoter of erythroid differentiation, increased the levels of mRNAs for TRα, TRβ, and retinoid X receptor α (RXRα), as well as those for nuclear factor-erythroid 2 (NFE2), GATA-binding protein 1 (GATA1) and GATA-binding protein 2 (GATA2). Lower concentrations of T3 had a stimulatory effect on hemin-induced hemoglobin production (1 and 10 nM), CD71 expression (0.1 nM), and α-globin mRNA expression (1 nM), while a higher concentration of T3 (100 nM) abrogated the stimulatory effect on these parameters. T3 at 100 nM did not affect cell viability and proliferation, suggesting that the abrogation of erythropoiesis enhancement was not due to toxicity. T3 at 100 nM also significantly inhibited expression of GATA2 and RXRα mRNA, compared to 1 nM T3. We conclude that a high concentration of T3 attenuates the classical stimulatory effect on erythropoiesis exerted by a low concentration of T3 in hemin-induced K562 cells. PMID:25787723

  4. Retroviral-mediated transfer and expression of human β-globin genes in cultured murine and human erythroid cells

    International Nuclear Information System (INIS)

    The authors cloned human β-globin DNA sequences from a genomic library prepared from DNA isolated from the human leukemia cell line K562 and have used the retroviral vector pZip-NeoSV(X)1 to introduce a 3.0-kilobase segment encompassing the globin gene into mouse erythroleukemia cells. Whereas the endogenous K562 β-globin gene is repressed in K562 cells, when introduced into mouse erythroleukemia cells by retroviral-mediated gene transfer, the β-globin gene from K562 cells was transcribed and induced 5-20-fold after treatment of the cells with dimethyl sulfoxide. The transcripts were correctly initiated, and expression and regulation of the K562 gene were identical to the expression of a normal human β-globin gene transferred into mouse erythroleukemia cells in the same way. They have also introduced the normal human β-globin gene into K562 cells using the same retrovirus vector. SP6 analysis of the RNA isolated from the transduced cells showed that the normal β-globin gene was transcribed at a moderately high level, before or after treatment with hemin. Based on these data, they suggest that the lack of expression of the endogenous β-globin gene in K562 cells does not result from an alteration in the gene itself and may not result from a lack of factor(s) necessary for β-lobin gene transcription. Retroviral-mediated transfer of the human β-globin gene may, however, uniquely influence expression of the gene K562 cells

  5. RECOMBINANT HUMAN MAST-CELL GROWTH-FACTOR SUPPORTS ERYTHROID COLONY FORMATION IN POLYCYTHEMIA-VERA IN THE PRESENCE AND ABSENCE OF ERYTHROPOIETIN AND SERUM

    NARCIS (Netherlands)

    MULLER, EW; DEWOLF, JTM; HENDRIKS, DW; ESSELINK, MT; HALIE, MR; VELLENGA, E

    1993-01-01

    The effect of mast cell growth factor (MGF) was studied on erythropoietin (Epo)-dependent and Epo-independent (''spontaneous'') erythroid colony formation in patients with polycythemia vera (PV). MGF stimulated both Epo-dependent and Epo-independent erythroid colony formation from PV peripheral bloo

  6. Neither DNA hypomethylation nor changes in the kinetics of erythroid differentiation explain 5-azacytidine's ability to induce human fetal hemoglobin

    OpenAIRE

    Mabaera, Rodwell; Greene, Michael R.; Richardson, Christine A.; Conine, Sarah J; Kozul, Courtney D.; Lowrey, Christopher H.

    2008-01-01

    5-azacytidine (5-Aza) is a potent inducer of fetal hemoglobin (HbF) in people with β-thalassemia and sickle cell disease. Two models have been proposed to explain this activity. The first is based on the drug's ability to inhibit global DNA methylation, including the fetal globin genes, resulting in their activation. The second is based on 5-Aza's cytotoxicity and observations that HbF production is enhanced during marrow recovery. We tested these models using human primary cells in an in vit...

  7. Dexamethasone targeted directly to macrophages induces macrophage niches that promote erythroid expansion

    DEFF Research Database (Denmark)

    Falchi, Mario; Varricchio, Lilian; Martelli, Fabrizio;

    2015-01-01

    Cultures of human CD34(pos) cells stimulated with erythroid growth factors plus dexamethasone, a model for stress erythropoiesis, generate numerous erythroid cells plus a few macrophages (approx. 3%; 3:1 positive and negative for CD169). Interactions occurring between erythroblasts and macrophages...

  8. Nonrandom distribution of iron in circulating human transferrin.

    Science.gov (United States)

    Zak, O; Aisen, P

    1986-07-01

    By combining the urea gel electrophoresis technique of Makey and Seal with Western immunoblotting, a method has been developed for analyzing the distribution of iron between the two sites of circulating human transferrin. The new method avoids exposure of samples to a nonphysiologic pH that may promote removal or redistribution of iron from the protein; this facilitates examination of multiple samples at one time. Analysis of 21 freshly drawn specimens from normal human subjects confirms previous reports that iron is not randomly distributed in the specific sites of transferrin. Rather, there is a considerable range in the ratio of occupancies of N-terminal and C-terminal sites (N:C ratio), from 0.31 to 6.87 in the present study, with the N-terminal site predominantly occupied in most subjects. The N:C ratio correlates modestly with serum iron concentration (r = .54). Possible flaws in studies indicating a random occupancy of the specific sites of circulating transferrin may lie in the low pH to which samples may be exposed during procedures based on isoelectric focusing or in drawing inferences from data considering only total monoferric transferrin rather than the two distinguishable monoferric species. PMID:3719094

  9. Flow Cytometric Identification of Fibrocytes in the Human Circulation.

    Science.gov (United States)

    Hu, Xinyuan; DeBiasi, Erin M; Herzog, Erica L

    2015-01-01

    Because the incidence of organ fibrosis increases with age, various fibrosing disorders are projected to account for significant increases in morbidity, mortality, and healthcare costs in the years to come. Treatments for these diseases are scarce and better understanding of the immunopathogenesis of fibrosis and its relationship to aging are sorely needed. One area of interest in this field is the role that fibrocytes might play in the development of tissue remodeling and fibrosis. Fibrocytes are mesenchymal progenitor cells presumed to be of monocyte origin that possess the tissue remodeling properties of tissue resident fibroblasts such as extracellular matrix production and α-SMA-related contractile properties, as well as the immunologic functions typically attributed to macrophages including production of cytokines and chemokines, antigen presentation, regulation of leukocyte trafficking, and modulation of angiogenesis. Fibrocytes could participate in the development of age-related fibrosing disorders through any or all of these functions. This chapter presents methods that have been developed for the study of circulating human fibrocytes. Protocols for the quantification of fibrocytes in the human circulation will be presented along with discussion of the technical challenges that are frequently encountered in this field. It is hoped that this information will facilitate further investigation of the relationship between fibrocytes, aging, and fibrosis, and perhaps uncover new areas of study in these difficult-to-treat and deadly diseases. PMID:26420706

  10. RUNX1 represses the erythroid gene expression program during megakaryocytic differentiation.

    Science.gov (United States)

    Kuvardina, Olga N; Herglotz, Julia; Kolodziej, Stephan; Kohrs, Nicole; Herkt, Stefanie; Wojcik, Bartosch; Oellerich, Thomas; Corso, Jasmin; Behrens, Kira; Kumar, Ashok; Hussong, Helge; Urlaub, Henning; Koch, Joachim; Serve, Hubert; Bonig, Halvard; Stocking, Carol; Rieger, Michael A; Lausen, Jörn

    2015-06-01

    The activity of antagonizing transcription factors represents a mechanistic paradigm of bidirectional lineage-fate control during hematopoiesis. At the megakaryocytic/erythroid bifurcation, the cross-antagonism of krueppel-like factor 1 (KLF1) and friend leukemia integration 1 (FLI1) has such a decisive role. However, how this antagonism is resolved during lineage specification is poorly understood. We found that runt-related transcription factor 1 (RUNX1) inhibits erythroid differentiation of murine megakaryocytic/erythroid progenitors and primary human CD34(+) progenitor cells. We show that RUNX1 represses the erythroid gene expression program during megakaryocytic differentiation by epigenetic repression of the erythroid master regulator KLF1. RUNX1 binding to the KLF1 locus is increased during megakaryocytic differentiation and counterbalances the activating role of T-cell acute lymphocytic leukemia 1 (TAL1). We found that corepressor recruitment by RUNX1 contributes to a block of the KLF1-dependent erythroid gene expression program. Our data indicate that the repressive function of RUNX1 influences the balance between erythroid and megakaryocytic differentiation by shifting the balance between KLF1 and FLI1 in the direction of FLI1. Taken together, we show that RUNX1 is a key player within a network of transcription factors that represses the erythroid gene expression program. PMID:25911237

  11. Exogenous delta⁹-tetrahydrocannabinol influences circulating endogenous cannabinoids in humans.

    Science.gov (United States)

    Walter, Carmen; Ferreirós, Nerea; Bishay, Philipp; Geisslinger, Gerd; Tegeder, Irmgard; Lötsch, Jörn

    2013-10-01

    Delta⁹-tetrahydrocannabinol (THC) competes with the endogenous cannabinoids arachidonoyl ethanolamide (anandamide) and 2-arachidonoyl glycerol (2-AG) at cannabinoid receptors. This may cause adaptive changes in the endocannabinoid signaling cascade with possible consequences for the biological functions of the endocannabinoid system. We show that administration of a single oral dose of 20 mg THC to 30 healthy volunteers resulted in higher circulating concentrations of anandamide, 2-AG, palmitoyl ethanolamide, and oleoylethanolamide at 2 and 3 hours after administration as compared with placebo. At 2 hours after THC administration, changes in oleoylethanolamide plasma concentrations from baseline were linearly related to the THC plasma concentrations. In rats, treatment with the CB₁/CB₂ agonist WIN 55,212 also increased plasma endocannabinoid concentrations. However, this was associated with a decrease of ethanolamide endocannabinoids in specific brain regions including spinal cord, cortex, and hypothalamus; whereas 2-arachidonoyl glycerol increased in the cortex. Thus, administration of THC to human volunteers influenced the concentrations of circulating endocannabinoids, which was mimicked by WIN-55,212 in rats, suggesting that exogenous cannabinoids may lead to changes in the endocannabinoid system that can be detected in plasma. PMID:23899642

  12. Individual neurophysin concentrations in the pituitary and circulation of humans

    International Nuclear Information System (INIS)

    Specific, homologous human neurophysin I and II radioimmunoassays were established and used to measure the individual, immunoreactive neurophysin concentrations in human plasma. Circulating levels of human neurophysin I in normal individuals were less than 1 ng/ml and neurophysin II levels were 1-2 ng/ml. During dehydration, there was a significant rise in plasma neurophysin I, together with an increase in neurophysin II. Haemorrhage also was associated with a rise in plasma neurophysin I and II, but the percent increase was greater for I than II. In two subjects in whom nicotine inhalation caused a rise in plasma neurophysin I, there was no detectable increase in plasma neurophysin II. These stimuli which have been reported to release vasopressin from the posterior pituitary also are associated with the differential release of neurophysin I. Plasma neurophysin II levels could more clearly be shown to rise independently of plasma neurophysin I during events thought to be related to oxytocin release. Plasma neurophysin II levels were significantly elevated in women taking oral contraceptives. Similarly during pregnancy there was a progressive rise in plasma neurophysin II concentration which was proportional to the period of gestation. Plasma neurophysin II concentrations in seven of fifteen nursing women rose significantly during suckling. There was no detectable change in plasma neurophysin I during any of these events. Plasma neurophysin I and II levels were both significantly elevated in fourteen patients with chronic renal failure and rose over haemodialysis, suggesting that the kidney may be the major route of clearance of the neurophysins. In humans the independent release of neurophysin II was associated with stimuli thought to release oxytocin, but neurophysin I showed only a differential release compared to neurophysin II in vasopressin stimulated events. (author)

  13. High-level, erythroid specific, expression of the human α-globin gene in transgenic mice and the production of human haemoglobin in murine erythrocytes.

    NARCIS (Netherlands)

    O. Hanscombe; M. Vidal; J. Kaeda; L. Luzzatto; D.R. Greaves; F.G. Grosveld (Frank)

    1989-01-01

    textabstractUsing the dominant control region (DCR) sequences that flank the beta-globin gene locus, we have been able to achieve high-level expression of the human alpha-globin gene in transgenic mice. Expression in fetal liver and blood is copy number dependent and at levels comparable to that of

  14. THE EFFECTS OF IL-1 AND IL-4 ON THE EPO-INDEPENDENT ERYTHROID PROGENITOR IN POLYCYTHEMIA-VERA

    NARCIS (Netherlands)

    DEWOLF, JTM; HENDRIKS, DW; ESSELINK, MT; HALIE, MR; VELLENGA, E

    1994-01-01

    Human recombinant interleukin-1 (IL-1) was studied for its effects on the erythroid progenitors from normal subjects and from patients with polycythaemia vera (PV). No supportive effect of IL-1 was noticed on the normal, erythropoietin (Epo) dependent, erythroid burst-forming unit (BFU-E) using peri

  15. Dexamethasone targeted directly to macrophages induces macrophage niches that promote erythroid expansion

    OpenAIRE

    Falchi, Mario; Varricchio, Lilian; Martelli, Fabrizio; Masiello, Francesca; Federici, Giulia; Zingariello, Maria; Girelli, Gabriella; Whitsett, Carolyn; Petricoin, Emanuel F.; Moestrup, Søren Kragh; Zeuner, Ann; Migliaccio, Anna Rita

    2015-01-01

    Cultures of human CD34pos cells stimulated with erythroid growth factors plus dexamethasone, a model for stress erythropoiesis, generate numerous erythroid cells plus a few macrophages (approx. 3%; 3:1 positive and negative for CD169). Interactions occurring between erythroblasts and macrophages in these cultures and the biological effects associated with these interactions were documented by live phase-contrast videomicroscopy. Macrophages expressed high motility interacting with hundreds/th...

  16. High Frequency of Human Enterovirus Species C Circulation in Madagascar

    OpenAIRE

    Rakoto-Andrianarivelo, Mala; Rousset, Dominique; Razafindratsimandresy, Richter; Chevaliez, Stéphane; Guillot, Sophie; Balanant, Jean; Delpeyroux, Francis

    2005-01-01

    Four poliomyelitis outbreaks caused by vaccine-derived polioviruses have been reported recently, including one in Madagascar in 2002. In all cases, the viral strains involved were recombinant between poliovirus vaccine strains and nonpoliovirus strains, probably enterovirus species C. Nevertheless, little is known about the circulation and epidemiology of enteroviruses in the regions where these outbreaks occurred. To assess the circulation of enteroviruses (particularly enterovirus species C...

  17. Hepcidin Expression in Iron Overload Diseases Is Variably Modulated by Circulating Factors

    OpenAIRE

    Ravasi, Giulia; Pelucchi, Sara; Trombini, Paola; Mariani, Raffaella; Tomosugi, Naohisa; Modignani, Giulia Litta; Pozzi, Matteo; Nemeth, Elizabeth; Ganz, Tomas; Hayashi, Hisao; Barisani, Donatella; Piperno, Alberto

    2012-01-01

    Hepcidin is a regulatory hormone that plays a major role in controlling body iron homeostasis. Circulating factors (holotransferrin, cytokines, erythroid regulators) might variably contribute to hepcidin modulation in different pathological conditions. There are few studies analysing the relationship between hepcidin transcript and related protein expression profiles in humans. Our aims were: a. to measure hepcidin expression at either hepatic, serum and urinary level in three paradigmatic ir...

  18. Activated T lymphocytes disappear from circulation during endotoxemia in humans

    DEFF Research Database (Denmark)

    Suarez Krabbe, Karen; Kemp, Helle Bruunsgaard; Qvist, Jesper;

    2002-01-01

    disappearance were characterized by an activated phenotype (CD45RA(-) CD45RO(+)) as well as a phenotype linked to apoptosis (CD95(+) CD28(-)). In conclusion, endotoxin-induced lymphopenia reflects the disappearance from the circulation of activated lymphocytes prone to undergo apoptosis....

  19. Role of HO/CO in the Control of Peripheral Circulation in Humans

    OpenAIRE

    David Sacerdoti; Despina Mania; Paola Pesce; Silvia Gaiani; Angelo Gatta; Massimo Bolognesi

    2012-01-01

    Experimental studies show that the heme oxygenase/carbon monoxide system (HO/CO) plays an important role in the homeostasis of circulation and in the pathophysiology of hypertension. No data are available on its role in the control of peripheral circulation in humans. We evaluated the effects of inhibition of HO with stannous mesoporphyrin IX (SnMP) (200  M) locally administered by iontophoresis, on human skin blood flow, evaluated by laser-Doppler flowmetry, in the presence and absence of ...

  20. Circulating human basophils lack the features of professional antigen presenting cells

    OpenAIRE

    Sharma, Meenu; Hegde, Pushpa; Aimanianda, Vishukumar; Beau, Remi; Sénéchal, Helene; Poncet, Pascal; Latgé, Jean-Paul; Kaveri, Srini V; Bayry, Jagadeesh

    2013-01-01

    Recent reports in mice demonstrate that basophils function as antigen presenting cells (APC). They express MHC class II and co-stimulatory molecules CD80 and CD86, capture and present soluble antigens or IgE-antigen complexes and polarize Th2 responses. Therefore, we explored whether human circulating basophils possess the features of professional APC. We found that unlike dendritic cells (DC) and monocytes, steady-state circulating human basophils did not express HLA-DR and co-stimulatory mo...

  1. Ethanol Extract of Cirsium japonicum var. ussuriense Kitamura Exhibits the Activation of Nuclear Factor Erythroid 2-Related Factor 2-dependent Antioxidant Response Element and Protects Human Keratinocyte HaCaT Cells Against Oxidative DNA Damage

    Science.gov (United States)

    Yoo, Ok-Kyung; Choi, Bu Young; Park, Jin-Oh; Lee, Ji-Won; Park, Byoung-Kwon; Joo, Chul Gue; Heo, Hyo-Jung; Keum, Young-Sam

    2016-01-01

    Keratinocytes are constantly exposed to extracellular insults, such as ultraviolet B, toxic chemicals and mechanical stress, all of which can facilitate the aging of keratinocytes via the generation of intracellular reactive oxygen species (ROS). Nuclear factor erythroid 2-related factor 2 (Nrf2) is a transcription factor that plays a critical role in protecting keratinocytes against oxidants and xenobiotics by binding to the antioxidant response element (ARE), a cis-acting element existing in the promoter of most phase II cytoprotective genes. In the present study, we have attempted to find novel ethanol extract(s) of indigenous plants of Jeju island, Korea that can activate the Nrf2/ARE-dependent gene expression in human keratinocyte HaCaT cells. As a result, we identified that ethanol extract of Cirsium japonicum var. ussuriense Kitamura (ECJUK) elicited strong stimulatory effect on the ARE-dependent gene expression. Supporting this observation, we found that ECJUK induced the expression of Nrf2, hemoxygenase-1, and NAD(P)H:quinone oxidoreductase-1 and this event was correlated with Akt1 phosphorylation. We also found that ECJUK increased the intracellular reduced glutathione level and suppressed 12-O-tetradecanoylphorbol acetate-induced 8-hydroxyguanosine formation without affecting the overall viability. Collectively, our results provide evidence that ECJUK can protect against oxidative stress-mediated damages through the activation of Nrf2/ARE-dependent phase II cytoprotective gene expression. PMID:27051652

  2. Tracking erythroid progenitor cells in times of need and times of plenty.

    Science.gov (United States)

    Koury, Mark J

    2016-08-01

    Red blood cell production rates increase rapidly following blood loss or hemolysis, but the expansion of erythropoiesis in these anemic states is tightly regulated such that rebound polycythemia does not occur. The erythroid cells that respond to erythropoietic stimulation or suppression are the progenitor stages of burst-forming units-erythroid (BFU-Es) and colony-forming units-erythroid (CFU-Es). Results from an early study of the changes in the size, location, and cell cycling status of BFU-E and CFU-E populations in mice under normal conditions, erythropoietic stimulation, and erythropoietic suppression are used as reference points to review subsequent developments related to erythroid progenitor populations and regulation of their size. The review concerns development of erythroid progenitor populations mainly in mice and humans, with a focus on the mechanisms related to the rapid but highly regulated expansion of erythropoiesis in spleens of erythropoietically stimulated mice. Current knowledge is used as a model of erythroid progenitor populations in mice under normal, erythropoietically suppressed, and erythropoietically stimulated conditions. Clinical applications of information learned from studies of erythropoietic expansion, in terms of current therapies for anemia, are reviewed. PMID:26646992

  3. Long-term follow-up of myelodysplastic syndrome patients with moderate/severe anaemia receiving human recombinant erythropoietin + 13-cis-retinoic acid and dihydroxylated vitamin D3: independent positive impact of erythroid response on survival.

    Science.gov (United States)

    Crisà, Elena; Foli, Cristina; Passera, Roberto; Darbesio, Antonella; Garvey, Kimberly B; Boccadoro, Mario; Ferrero, Dario

    2012-07-01

    We previously reported a 60% erythroid response rate with recombinant erythropoietin + 13-cis retinoic acid + dihydroxylated vitamin D3 in 63 elderly myelodysplastic patients (median age 75 years) with unfavourable features for response to erythropoietin alone [70% transfusion-dependent, 35% refractory anaemia with ring sideroblasts/refractory anaemia with excess of blasts type 1 (RAEB1), 70% with International Prognostic Scoring System (IPSS) Intermediate-1 or -2]. This report updates that case study at a 7-year follow-up, and compared the impact on overall survival of erythroid response to known prognostic factors. The erythroid response duration (median 17 months; 22 in non-RAEB patients, with 20% patients in response after 6 years of therapy) was longer than in most studies with erythropoietin alone. Overall survival (median 55 months in non-RAEB, 15 in RAEB1 patients) was negatively affected by RAEB1 diagnosis, IPSS and WPSS intermediate scores and transfusion-dependence. In the multivariate analysis, erythroid response maintained an independent positive impact on survival, particularly in non-RAEB patients in the first 3 years from diagnosis (90% survival compared to 50% of non-responders). In conclusion, the long-term follow-up confirmed the achievement, by our combined treatment, of fairly long-lasting erythroid response in the majority of MDS patients with unfavourable prognostic features for response to erythropoietin: this translated in a survival benefit that was independent from other prognostic features. PMID:22571649

  4. In vitro apoptotic cell death during erythroid differentiation.

    Science.gov (United States)

    Zamai, L; Burattini, S; Luchetti, F; Canonico, B; Ferri, P; Melloni, E; Gonelli, A; Guidotti, L; Papa, S; Falcieri, E

    2004-03-01

    Erythropoiesis occurs in bone marrow and it has been shown that during in vivo erythroid differentiation some immature erythroblasts undergo apoptosis. In this regard, it is known that immature erythroblasts are FasL- and TRAIL-sensitive and can be killed by cells expressing these ligand molecules. In the present study, we have investigated the cell death phenomenon that occurs during a common unilineage model of erythroid development. Purified CD34+ human haemopoietic progenitors were cultured in vitro in the presence of SCF, IL-3 and erythropoietin. Their differentiation stages and apoptosis were followed by multiple technical approaches. Flow cytometric evaluation of surface and intracellular molecules revealed that glycophorin A appeared at day 3-4 of incubation and about 75% of viable cells co-expressed high density glycophorin A (Gly(bright)) and adult haemoglobin at day 14 of culture, indicating that this system reasonably recapitulates in vivo normal erythropoiesis. Interestingly, when mature (Gly(bright)) erythroid cells reached their higher percentages (day 14) almost half of cultured cells were apoptotic. Morphological studies indicated that the majority of dead cells contained cytoplasmic granular material typical of basophilic stage, and DNA analysis by flow cytometry and TUNEL reaction revealed nuclear fragmentation. These observations indicate that in vitro unilineage erythroid differentiation, as in vivo, is associated with apoptotic cell death of cells with characteristics of basophilic erythroblasts. We suggest that the interactions between different death receptors on immature basophilic erythroblasts with their ligands on more mature erythroblasts may contribute to induce apoptosis in vitro. PMID:15004520

  5. Quantitative proteome profiling of normal human circulating microparticles

    DEFF Research Database (Denmark)

    Østergaard, Ole; Nielsen, Christoffer T; Iversen, Line V;

    2012-01-01

    Circulating microparticles (MPs) are produced as part of normal physiology. Their numbers, origin, and composition change in pathology. Despite this, the normal MP proteome has not yet been characterized with standardized high-resolution methods. We here quantitatively profile the normal MP...... proteome using nano-LC-MS/MS on an LTQ-Orbitrap with optimized sample collection, preparation, and analysis of 12 different normal samples. Analytical and procedural variation were estimated in triply processed samples analyzed in triplicate from two different donors. Label-free quantitation was validated...... quantitated. Of these, 334 (63%) were present in all samples and represent an MP core proteome. Technical triplicates showed...

  6. Quantitative proteome profiling of normal human circulating microparticles

    DEFF Research Database (Denmark)

    Østergaard, Ole; Nielsen, Christoffer T; Iversen, Line V; Jacobsen, Søren; Tanassi, Julia T; Heegaard, Niels H H

    2012-01-01

    Circulating microparticles (MPs) are produced as part of normal physiology. Their numbers, origin, and composition change in pathology. Despite this, the normal MP proteome has not yet been characterized with standardized high-resolution methods. We here quantitatively profile the normal MP...... proteome using nano-LC-MS/MS on an LTQ-Orbitrap with optimized sample collection, preparation, and analysis of 12 different normal samples. Analytical and procedural variation were estimated in triply processed samples analyzed in triplicate from two different donors. Label-free quantitation was validated...... by the correlation of cytoskeletal protein intensities with MP numbers obtained by flow cytometry. Finally, the validity of using pooled samples was evaluated using overlap protein identification numbers and multivariate data analysis. Using conservative parameters, 536 different unique proteins were...

  7. Human Factors of Queuing: A Library Circulation Model.

    Science.gov (United States)

    Mansfield, Jerry W.

    1981-01-01

    Classical queuing theories and their accompanying service facilities totally disregard the human factors in the name of efficiency. As library managers we need to be more responsive to human needs in the design of service points and make every effort to minimize queuing and queue frustration. Five references are listed. (Author/RAA)

  8. A long term model of circulation. [human body

    Science.gov (United States)

    White, R. J.

    1974-01-01

    A quantitative approach to modeling human physiological function, with a view toward ultimate application to long duration space flight experiments, was undertaken. Data was obtained on the effect of weightlessness on certain aspects of human physiological function during 1-3 month periods. Modifications in the Guyton model are reviewed. Design considerations for bilateral interface models are discussed. Construction of a functioning whole body model was studied, as well as the testing of the model versus available data.

  9. Detection and Quantitation of Circulating Human Irisin by Tandem Mass Spectrometry.

    Science.gov (United States)

    Jedrychowski, Mark P; Wrann, Christiane D; Paulo, Joao A; Gerber, Kaitlyn K; Szpyt, John; Robinson, Matthew M; Nair, K Sreekumaran; Gygi, Steven P; Spiegelman, Bruce M

    2015-10-01

    Exercise provides many health benefits, including improved metabolism, cardiovascular health, and cognition. We have shown previously that FNDC5, a type I transmembrane protein, and its circulating form, irisin, convey some of these benefits in mice. However, recent reports questioned the existence of circulating human irisin both because human FNDC5 has a non-canonical ATA translation start and because of claims that many human irisin antibodies used in commercial ELISA kits lack required specificity. In this paper we have identified and quantitated human irisin in plasma using mass spectrometry with control peptides enriched with heavy stable isotopes as internal standards. This precise state-of-the-art method shows that human irisin is mainly translated from its non-canonical start codon and circulates at ∼ 3.6 ng/ml in sedentary individuals; this level is increased to ∼ 4.3 ng/ml in individuals undergoing aerobic interval training. These data unequivocally demonstrate that human irisin exists, circulates, and is regulated by exercise. PMID:26278051

  10. A continuum model for pressure-flow relationship in human pulmonary circulation.

    Science.gov (United States)

    Huang, Wei; Zhou, Qinlian; Gao, Jian; Yen, R T

    2011-06-01

    A continuum model was introduced to analyze the pressure-flow relationship for steady flow in human pulmonary circulation. The continuum approach was based on the principles of continuum mechanics in conjunction with detailed measurement of vascular geometry, vascular elasticity and blood rheology. The pulmonary arteries and veins were considered as elastic tubes and the "fifth-power law" was used to describe the pressure-flow relationship. For pulmonary capillaries, the "sheet-flow" theory was employed and the pressure-flow relationship was represented by the "fourth-power law". In this paper, the pressure-flow relationship for the whole pulmonary circulation and the longitudinal pressure distribution along the streamlines were studied. Our computed data showed general agreement with the experimental data for the normal subjects and the patients with mitral stenosis and chronic bronchitis in the literature. In conclusion, our continuum model can be used to predict the changes of steady flow in human pulmonary circulation. PMID:21608412

  11. Transport of circulating serum cholesterol by human renal cell carcinoma

    International Nuclear Information System (INIS)

    Clear cell renal cancer contains a large quantity of cholesterol ester (300-mg./gm. protein). To determine whether abnormalities in cholesterol transport could account for this sterol accumulation, the uptake, release, and imaging capabilities of intravenously injected 131I-6-iodomethyl-29-norcholesterol, a cholesterol analogue, were studied preoperatively in five patients with clear cell renal cancer. At surgery, samples of the liver, tumor, adrenal, and non-tumor kidney were obtained for analysis. 131I-sterol uptake by the tumor, when normalized for cholesterol content, was less than for adrenal, liver or kidney. In contrast, release of preloaded 131I-sterol from the human tumors was consistently slower than for normal kidney. The reduced release of free cholesterol from renal cancer cells may, in part, be responsible for the accumulation of cholesterol in human renal cancer

  12. Intracellular and circulating neuronal antinuclear antibodies in human epilepsy

    OpenAIRE

    Iffland, Philip H.; Carvalho-Tavares, Juliana; Trigunaite, Abhishek; Man, Shumei; Rasmussen, Peter; Alexopoulos, Andreas; Ghosh, Chaitali; Jørgensen, Trine N.; Janigro, Damir

    2013-01-01

    There are overwhelming data supporting the inflammatory origin of some epilepsies (e.g., Rasmussen's encephalitis and limbic encephalitis). Inflammatory epilepsies with an autoimmune component are characterized by autoantibodies against membrane-bound, intracellular or secreted proteins (e.g., voltage gated potassium channels). Comparably, little is known regarding autoantibodies targeting nuclear antigen. We tested the hypothesis that in addition to known epilepsy-related autoantigens, human...

  13. Cytotoxicity of quantum dots and graphene oxide to erythroid cells and macrophages

    Science.gov (United States)

    Qu, Guangbo; Wang, Xiaoyan; Wang, Zhe; Liu, Sijin; Jiang, Guibing

    2013-04-01

    Great concerns have been raised about the exposure and possible adverse influence of nanomaterials due to their wide applications in a variety of fields, such as biomedicine and daily lives. The blood circulation system and blood cells form an important barrier against invaders, including nanomaterials. However, studies of the biological effects of nanomaterials on blood cells have been limited and without clear conclusions thus far. In the current study, the biological influence of quantum dots (QDs) with various surface coating on erythroid cells and graphene oxide (GO) on macrophages was closely investigated. We found that QDs posed great damage to macrophages through intracellular accumulation of QDs coupled with reactive oxygen species generation, particularly for QDs coated with PEG-NH2. QD modified with polyethylene glycol-conjugated amine particles exerted robust inhibition on cell proliferation of J744A.1 macrophages, irrespective of apoptosis. Additionally, to the best of our knowledge, our study is the first to have demonstrated that GO could provoke apoptosis of erythroid cells through oxidative stress in E14.5 fetal liver erythroid cells and in vivo administration of GO-diminished erythroid population in spleen, associated with disordered erythropoiesis in mice.

  14. Concurrent expression of erythroid and renal aquaporin CHIP and appearance of water channel activity in perinatal rats.

    OpenAIRE

    Smith, B L; Baumgarten, R; Nielsen, S; D. Raben; Zeidel, M L; Agre, P

    1993-01-01

    Major phenotypic changes occur in red cell membranes during the perinatal period, but the underlying molecular explanations remain poorly defined. Aquaporin CHIP, the major erythroid and renal water channel, was studied in perinatal rats using affinity-purified anti-CHIP IgG for immunoblotting, flow cytometry, and immunofluorescence microscopy. CHIP was not detected in prenatal red cells but was first identified in circulating red cells on the third postnatal day. Most circulating red cells w...

  15. Does Every Cell Get Blood? Young Students' Discussions about Illustrations of Human Blood Circulation

    Science.gov (United States)

    Westman, Anna-Karin; Karlsson, Karl-Goran

    2016-01-01

    This article presents a study of how groups of young students discuss illustrations of human blood circulation. Transparency is not an innate quality of illustrations, visual information is always coded and interpretations are always related to culture and context. Results of this study are discussed with reference to Kress and van Leeuwens'…

  16. Rethinking International Migration of Human Capital and Brain Circulation: The Case of Chinese-Canadian Academics

    Science.gov (United States)

    Blachford, Dongyan Ru; Zhang, Bailing

    2014-01-01

    This article examines the dynamics of brain circulation through a historical review of the debates over international migration of human capital and a case study on Chinese-Canadian academics. Interviews with 22 Chinese-Canadian professors who originally came from China provide rich data regarding the possibilities and problems of the contemporary…

  17. OPTIMAL ERYTHROID CELL PRODUCTION DURING ERYTHROPOIETIN TREATMENT OF MICE OCCURS BY EXPLOITING THE SPLENIC MICROENVIRONMENT

    NARCIS (Netherlands)

    NIJHOF, W; GORIS, H; DONTJE, B; DRESZ, J; LOEFFLER, M

    1993-01-01

    In this study, quantitative effects on erythroid cell production by a prolonged recombinant human erythropoietin (rhEpo) treatment of mice are presented. Epo treatments, given subcutaneously (s.c.) twice per day in doses of 0.5 to 500 U per day, were performed under steady-state production condition

  18. Computational Characterization of Exogenous MicroRNAs that Can Be Transferred into Human Circulation.

    Directory of Open Access Journals (Sweden)

    Jiang Shu

    Full Text Available MicroRNAs have been long considered synthesized endogenously until very recent discoveries showing that human can absorb dietary microRNAs from animal and plant origins while the mechanism remains unknown. Compelling evidences of microRNAs from rice, milk, and honeysuckle transported to human blood and tissues have created a high volume of interests in the fundamental questions that which and how exogenous microRNAs can be transferred into human circulation and possibly exert functions in humans. Here we present an integrated genomics and computational analysis to study the potential deciding features of transportable microRNAs. Specifically, we analyzed all publicly available microRNAs, a total of 34,612 from 194 species, with 1,102 features derived from the microRNA sequence and structure. Through in-depth bioinformatics analysis, 8 groups of discriminative features have been used to characterize human circulating microRNAs and infer the likelihood that a microRNA will get transferred into human circulation. For example, 345 dietary microRNAs have been predicted as highly transportable candidates where 117 of them have identical sequences with their homologs in human and 73 are known to be associated with exosomes. Through a milk feeding experiment, we have validated 9 cow-milk microRNAs in human plasma using microRNA-sequencing analysis, including the top ranked microRNAs such as bta-miR-487b, miR-181b, and miR-421. The implications in health-related processes have been illustrated in the functional analysis. This work demonstrates the data-driven computational analysis is highly promising to study novel molecular characteristics of transportable microRNAs while bypassing the complex mechanistic details.

  19. Erythropoietin guides multipotent hematopoietic progenitor cells toward an erythroid fate

    Science.gov (United States)

    Grover, Amit; Mancini, Elena; Moore, Susan; Mead, Adam J.; Atkinson, Deborah; Rasmussen, Kasper D.; O’Carroll, Donal; Jacobsen, Sten Eirik W.

    2014-01-01

    The erythroid stress cytokine erythropoietin (Epo) supports the development of committed erythroid progenitors, but its ability to act on upstream, multipotent cells remains to be established. We observe that high systemic levels of Epo reprogram the transcriptomes of multi- and bipotent hematopoietic stem/progenitor cells in vivo. This induces erythroid lineage bias at all lineage bifurcations known to exist between hematopoietic stem cells (HSCs) and committed erythroid progenitors, leading to increased erythroid and decreased myeloid HSC output. Epo, therefore, has a lineage instructive role in vivo, through suppression of non-erythroid fate options, demonstrating the ability of a cytokine to systematically bias successive lineage choices in favor of the generation of a specific cell type. PMID:24493804

  20. Role of HO/CO in the Control of Peripheral Circulation in Humans.

    Science.gov (United States)

    Sacerdoti, David; Mania, Despina; Pesce, Paola; Gaiani, Silvia; Gatta, Angelo; Bolognesi, Massimo

    2012-01-01

    Experimental studies show that the heme oxygenase/carbon monoxide system (HO/CO) plays an important role in the homeostasis of circulation and in the pathophysiology of hypertension. No data are available on its role in the control of peripheral circulation in humans. We evaluated the effects of inhibition of HO with stannous mesoporphyrin IX (SnMP) (200 μM) locally administered by iontophoresis, on human skin blood flow, evaluated by laser-Doppler flowmetry, in the presence and absence of nitric oxide synthase (NOS) inhibition with L-NG-Nitroarginine methyl ester (L-NAME) (100 μM). We also evaluated the effect of HO inhibition on vasodilatation induced by acetylcholine (ACh) and vasoconstriction caused by noradrenaline (NA). SnMP and L-NAME caused a similar 20-25% decrease in skin flow. After nitric oxide (NO) inhibition with L-NAME, HO inhibition with SnMP caused a further 20% decrease in skin perfusion. SnMP decreased vasodilatation induced by ACh by about 70%, while it did not affect vasoconstriction to NA. In conclusion, HO/CO participates in the control of peripheral circulation, independently from NO, and is involved in vasodilatation to ACh. PMID:22500215

  1. Circulating Blood Monocyte Subclasses and Lipid-Laden Adipose Tissue Macrophages in Human Obesity.

    Directory of Open Access Journals (Sweden)

    Tal Pecht

    Full Text Available Visceral adipose tissue foam cells are increased in human obesity, and were implicated in adipose dysfunction and increased cardio-metabolic risk. In the circulation, non-classical monocytes (NCM are elevated in obesity and associate with atherosclerosis and type 2 diabetes. We hypothesized that circulating NCM correlate and/or are functionally linked to visceral adipose tissue foam cells in obesity, potentially providing an approach to estimate visceral adipose tissue status in the non-surgical obese patient.We preformed ex-vivo functional studies utilizing sorted monocyte subclasses from healthy donors. Moreover, we assessed circulating blood monocyte subclasses and visceral fat adipose tissue macrophage (ATM lipid content by flow-cytometry in paired blood and omental-fat samples collected from patients (n = 65 undergoing elective abdominal surgery.Ex-vivo, NCM and NCM-derived macrophages exhibited lower lipid accumulation capacity compared to classical or intermediate monocytes/-derived macrophages. Moreover, of the three subclasses, NCM exhibited the lowest migration towards adipose tissue conditioned-media. In a cohort of n = 65, increased %NCM associated with higher BMI (r = 0.250,p<0.05 and ATM lipid content (r = 0.303,p<0.05. Among patients with BMI≥25Kg/m2, linear regression models adjusted for age, sex or BMI revealed that NCM independently associate with ATM lipid content, particularly in men.Collectively, although circulating blood NCM are unlikely direct functional precursor cells for adipose tissue foam cells, their increased percentage in the circulation may clinically reflect higher lipid content in visceral ATMs.

  2. Molecular pathways of early CD105-positive erythroid cells as compared with CD34-positive common precursor cells by flow cytometric cell-sorting and gene expression profiling

    International Nuclear Information System (INIS)

    Special attention has recently been drawn to the molecular network of different genes that are responsible for the development of erythroid cells. The aim of the present study was to establish in detail the immunophenotype of early erythroid cells and to compare the gene expression profile of freshly isolated early erythroid precursors with that of the CD34-positive (CD34+) compartment. Multiparameter flow cytometric analyses of human bone marrow mononuclear cell fractions (n=20) defined three distinct early erythroid stages. The gene expression profile of sorted early erythroid cells was analyzed by Affymetrix array technology. For 4524 genes, a differential regulation was found in CD105-positive erythroid cells as compared with the CD34+ progenitor compartment (2362 upregulated genes). A highly significant difference was observed in the expression level of genes involved in transcription, heme synthesis, iron and mitochondrial metabolism and transforming growth factor-β signaling. A comparison with recently published data showed over 1000 genes that as yet have not been reported to be upregulated in the early erythroid lineage. The gene expression level within distinct pathways could be illustrated directly by applying the Ingenuity software program. The results of gene expression analyses can be seen at the Gene Expression Omnibus repository

  3. Use of Human Plasma Samples to Identify Circulating Drug Metabolites that Inhibit Cytochrome P450 Enzymes.

    Science.gov (United States)

    Eng, Heather; Obach, R Scott

    2016-08-01

    Drug interactions elicited through inhibition of cytochrome P450 (P450) enzymes are important in pharmacotherapy. Recently, greater attention has been focused on not only parent drugs inhibiting P450 enzymes but also on possible inhibition of these enzymes by circulating metabolites. In this report, an ex vivo method whereby the potential for circulating metabolites to be inhibitors of P450 enzymes is described. To test this method, seven drugs and their known plasma metabolites were added to control human plasma at concentrations previously reported to occur in humans after administration of the parent drug. A volume of plasma for each drug based on the known inhibitory potency and time-averaged concentration of the parent drug was extracted and fractionated by high-pressure liquid chromatography-mass spectrometry, and the fractions were tested for inhibition of six human P450 enzyme activities (CYP1A2, CYP2C8, CYP2C9, CYP2C19, CYP2D6, and CYP3A4). Observation of inhibition in fractions that correspond to the retention times of metabolites indicates that the metabolite has the potential to contribute to P450 inhibition in vivo. Using this approach, norfluoxetine, hydroxyitraconazole, desmethyldiltiazem, desacetyldiltiazem, desethylamiodarone, hydroxybupropion, erythro-dihydrobupropion, and threo-dihydrobupropion were identified as circulating metabolites that inhibit P450 activities at a similar or greater extent as the parent drug. A decision tree is presented outlining how this method can be used to determine when a deeper investigation of the P450 inhibition properties of a drug metabolite is warranted. PMID:27271369

  4. Circulating Plasma microRNAs can differentiate Human Sepsis and Systemic Inflammatory Response Syndrome (SIRS)

    OpenAIRE

    Stefano Caserta; Florian Kern; Jonathan Cohen; Stephen Drage; Newbury, Sarah F; Llewelyn, Martin J

    2016-01-01

    Systemic inflammation in humans may be triggered by infection, termed sepsis, or non-infective processes, termed non-infective systemic inflammatory response syndrome (SIRS). MicroRNAs regulate cellular processes including inflammation and may be detected in blood. We aimed to establish definitive proof-of-principle that circulating microRNAs are differentially affected during sepsis and non-infective SIRS. Critically ill patients with severe (n = 21) or non-severe (n = 8) intra-abdominal sep...

  5. Effects of angiotensin blockade on the splanchnic circulation in normotensive humans

    DEFF Research Database (Denmark)

    Stadeager, C; Hesse, B; Henriksen, O; Christensen, N J; Bonde-Petersen, F; Mehlsen, J; Giese, Jacob

    1989-01-01

    The effects of angiotensin-converting enzyme inhibition (ACE-I) by enalapril on splanchnic (n = 10) and central hemodynamics (n = 9) were examined in moderately salt-depleted healthy volunteers, at rest and during 15-20 min of lower body negative pressure (LBNP), reducing mean arterial pressure by...... levels during ACE-I. We conclude that, in normal sodium-depleted humans, acute ACE-I decreases splanchnic vascular resistance at rest and abolishes splanchnic vasoconstriction during LBNP. Furthermore, it may interfere with autonomic nervous system control of the circulation....

  6. Self-reactivities to the non-erythroid alpha spectrin correlate with cerebral malaria in Gabonese children.

    Directory of Open Access Journals (Sweden)

    Vincent Guiyedi

    Full Text Available BACKGROUND: Hypergammaglobulinemia and polyclonal B-cell activation commonly occur in Plasmodium sp. infections. Some of the antibodies produced recognize self-components and are correlated with disease severity in P. falciparum malaria. However, it is not known whether some self-reactive antibodies produced during P. falciparum infection contribute to the events leading to cerebral malaria (CM. We show here a correlation between self-antibody responses to a human brain protein and high levels of circulating TNF alpha (TNFalpha, with the manifestation of CM in Gabonese children. METHODOLOGY: To study the role of self-reactive antibodies associated to the development of P. falciparum cerebral malaria, we used a combination of quantitative immunoblotting and multivariate analysis to analyse correlation between the reactivity of circulating IgG with a human brain protein extract and TNFalpha concentrations in cohorts of uninfected controls (UI and P. falciparum-infected Gabonese children developing uncomplicated malaria (UM, severe non-cerebral malaria (SNCM, or CM. RESULTS/CONCLUSION: The repertoire of brain antigens recognized by plasma IgGs was more diverse in infected than in UI individuals. Anti-brain reactivity was significantly higher in the CM group than in the UM and SNCM groups. IgG self-reactivity to brain antigens was also correlated with plasma IgG levels and age. We found that 90% of CM patients displayed reactivity to a high-molecular mass band containing the spectrin non-erythroid alpha chain. Reactivity with this band was correlated with high TNFalpha concentrations in CM patients. These results strongly suggest that an antibody response to brain antigens induced by P. falciparum infection may be associated with pathogenic mechanisms in patients developing CM.

  7. A SARS-like cluster of circulating bat coronaviruses shows potential for human emergence.

    Science.gov (United States)

    Menachery, Vineet D; Yount, Boyd L; Debbink, Kari; Agnihothram, Sudhakar; Gralinski, Lisa E; Plante, Jessica A; Graham, Rachel L; Scobey, Trevor; Ge, Xing-Yi; Donaldson, Eric F; Randell, Scott H; Lanzavecchia, Antonio; Marasco, Wayne A; Shi, Zhengli-Li; Baric, Ralph S

    2015-12-01

    The emergence of severe acute respiratory syndrome coronavirus (SARS-CoV) and Middle East respiratory syndrome (MERS)-CoV underscores the threat of cross-species transmission events leading to outbreaks in humans. Here we examine the disease potential of a SARS-like virus, SHC014-CoV, which is currently circulating in Chinese horseshoe bat populations. Using the SARS-CoV reverse genetics system, we generated and characterized a chimeric virus expressing the spike of bat coronavirus SHC014 in a mouse-adapted SARS-CoV backbone. The results indicate that group 2b viruses encoding the SHC014 spike in a wild-type backbone can efficiently use multiple orthologs of the SARS receptor human angiotensin converting enzyme II (ACE2), replicate efficiently in primary human airway cells and achieve in vitro titers equivalent to epidemic strains of SARS-CoV. Additionally, in vivo experiments demonstrate replication of the chimeric virus in mouse lung with notable pathogenesis. Evaluation of available SARS-based immune-therapeutic and prophylactic modalities revealed poor efficacy; both monoclonal antibody and vaccine approaches failed to neutralize and protect from infection with CoVs using the novel spike protein. On the basis of these findings, we synthetically re-derived an infectious full-length SHC014 recombinant virus and demonstrate robust viral replication both in vitro and in vivo. Our work suggests a potential risk of SARS-CoV re-emergence from viruses currently circulating in bat populations. PMID:26552008

  8. Circulating Human Eosinophils Share a Similar Transcriptional Profile in Asthma and Other Hypereosinophilic Disorders.

    Directory of Open Access Journals (Sweden)

    Cindy Barnig

    Full Text Available Eosinophils are leukocytes that are released into the peripheral blood in a phenotypically mature state and are capable of being recruited into tissues in response to appropriate stimuli. Eosinophils, traditionally considered cytotoxic effector cells, are leukocytes recruited into the airways of asthma patients where they are believed to contribute to the development of many features of the disease. This perception, however, has been challenged by recent findings suggesting that eosinophils have also immunomodulatory functions and may be involved in tissue homeostasis and wound healing. Here we describe a transcriptome-based approach-in a limited number of patients and controls-to investigate the activation state of circulating human eosinophils isolated by flow cytometry. We provide an overview of the global expression pattern in eosinophils in various relevant conditions, e.g., eosinophilic asthma, hypereosinophilic dermatological diseases, parasitosis and pulmonary aspergillosis. Compared to healthy subjects, circulating eosinophils isolated from asthma patients differed in their gene expression profile which is marked by downregulation of transcripts involved in antigen presentation, pathogen recognition and mucosal innate immunity, whereas up-regulated genes were involved in response to non-specific stimulation, wounding and maintenance of homeostasis. Eosinophils from other hypereosinophilic disorders displayed a very similar transcriptional profile. Taken together, these observations seem to indicate that eosinophils exhibit non-specific immunomodulatory functions important for tissue repair and homeostasis and suggest new roles for these cells in asthma immunobiology.

  9. Circulating Plasma microRNAs can differentiate Human Sepsis and Systemic Inflammatory Response Syndrome (SIRS).

    Science.gov (United States)

    Caserta, Stefano; Kern, Florian; Cohen, Jonathan; Drage, Stephen; Newbury, Sarah F; Llewelyn, Martin J

    2016-01-01

    Systemic inflammation in humans may be triggered by infection, termed sepsis, or non-infective processes, termed non-infective systemic inflammatory response syndrome (SIRS). MicroRNAs regulate cellular processes including inflammation and may be detected in blood. We aimed to establish definitive proof-of-principle that circulating microRNAs are differentially affected during sepsis and non-infective SIRS. Critically ill patients with severe (n = 21) or non-severe (n = 8) intra-abdominal sepsis; severe (n = 23) or non-severe (n = 21) non-infective SIRS; or no SIRS (n = 16) were studied. Next-generation sequencing and qRT-PCR were used to measure plasma microRNAs. Detectable blood miRNAs (n = 116) were generally up-regulated in SIRS compared to no-SIRS patients. Levels of these 'circulating inflammation-related microRNAs' (CIR-miRNAs) were 2.64 (IQR: 2.10-3.29) and 1.52 (IQR: 1.15-1.92) fold higher for non-infective SIRS and sepsis respectively (p inflammatory cytokines (IL-1, IL-6 and others). Thus, among critically ill patients, sepsis and non-infective SIRS are associated with substantial, differential changes in CIR-miRNAs. CIR-miRNAs may be regulators of inflammation and warrant thorough evaluation as diagnostic and therapeutic targets. PMID:27320175

  10. Chasing a ghost? - Issues with the determination of circulating levels of endotoxin in human blood.

    Science.gov (United States)

    Gnauck, Anne; Lentle, Roger Graham; Kruger, Marlena Cathorina

    2016-06-01

    Reliable quantification of bacterial products such as endotoxin is important for the diagnosis of Gram-negative infection and for the monitoring of its treatment. Further, it is important to identify patients with persistent subclinical level of bacterial products in their systemic circulation as data from animal studies also suggest this may be correlated with the onset of metabolic syndrome. In this review, we first aim to describe the principles of the Limulus amoebocyte lysate (LAL) test, an assay that is used to quantify endotoxin, and the various shortcomings that must be addressed before it can become a reliable means of quantifying endotoxin in samples derived from blood. We then review published data regarding endotoxin levels in healthy subjects and those with sepsis, inflammatory bowel disease, liver disorders and metabolic disorders such as obesity and diabetes. We also review the evidence regarding influence of macronutrients in augmenting the levels of systemic endotoxin. The results of this review show that reported mean levels of endotoxin in the systemic circulation of healthy humans and of those with various clinical disorders vary over a wide range. Further, this review shows that a significant proportion of this variation can be related to the method that was used to prepare plasma and serum samples prior to assay and its ability to reduce the effect of various blood borne factors that interfere with the LAL assay. PMID:26732012

  11. Structural Insights into the Stability and Flexibility of Unusual Erythroid Spectrin Repeats

    Energy Technology Data Exchange (ETDEWEB)

    Kusunoki, H.; Macdonald, R.I.; Mondragon, A. (NWU)

    2010-03-08

    Erythroid spectrin, a major component of the cytoskeletal network of the red cell which contributes to both the stability and the elasticity of the red cell membrane, is composed of two subunits, {alpha} and {beta}, each formed by 16-20 tandem repeats. The properties of the repeats and their relative arrangement are thought to be key determinants of spectrin flexibility. Here we report a 2.4 {angstrom} resolution crystal structure of human erythroid {beta}-spectrin repeats 8 and 9. This two-repeat fragment is unusual as it exhibits low stability of folding and one of its repeats lacks two tryptophans highly conserved among spectrin repeats. Two key factors responsible for the lower stability and, possibly, its flexibility, are revealed by the structure. A third novel feature of the structure is the relative orientation of the two repeats, which increases the range of possible conformations and provides new insights into atomic models of spectrin flexibility.

  12. Persistent circulating human insulin in sheep transplanted in utero with human mesenchymal stem cells

    Science.gov (United States)

    Ersek, Adel; Pixley, John S.; Goodrich, A. Daisy; Porada, Christopher D.; Almeida-Porada, Graca; Thain, David S.; Zanjani, Esmail D.

    2010-01-01

    Objective To determine if mesenchymal stem cells (MSC) derived from human fetal pancreatic tissue (pMSC) would engraft and differentiate in sheep pancreas following transplantation in utero. Methods A three-step culture system was established for generating human fetal pMSC. Sheep fetuses were transplanted during the fetal transplant receptivity period with human pMSC and evaluated for in situ and functional engraftment in their pancreas, liver and bone marrow. Results Isolation and expansion of adherent cells from the human fetal pancreas yielded a cell population with morphologic and phenotypic characteristics similar to MSC derived from bone marrow. This putative stem cell population could undergo multilineage differentiation in vitro. Three to 27 months after fetal transplantation, the pancreatic engraftment frequency (chimeric index) was 79% while functional engraftment was noted in 50% of transplanted sheep. Hepatic and marrow engraftment and expression was noted as well. Conclusion We have established a procedure for isolation of human fetal pMSC that display characteristics similar to bone marrow derived MSC. In vivo results suggest the pMSC engraft, differentiate and secrete human insulin from the sheep pancreas. PMID:20170708

  13. Exercise-induced changes in circulating levels of transforming growth factor-beta-1 in humans

    DEFF Research Database (Denmark)

    Heinemeier, Katja; Langberg, Henning; Kjaer, Michael

    resting subjects (reported values range from 500 to 18,300 pg ml(-1)) and also the extent of intra-individual variation is unknown. As a basis for detecting exercise-induced changes in transforming growth factor-beta-1, we measured its concentration, by enzyme-linked immunosorbent assay, in plasma from...... eight healthy resting subjects. Plasma was sampled from each subject on five successive days according to a procedure designed to minimize activation of platelets, as platelet alpha-granules contain large amounts of transforming growth factor-beta-1. The mean plasma level was relatively low [1155 (30......Mechanical loading of cells induces the expression of transforming growth factor-beta-1, and acute exercise, which involves mechanical loading of several tissues, could thus increase its circulating level in humans. However, no consensus exists regarding the plasma concentration of this cytokine in...

  14. TRAIL regulates normal erythroid maturation through an ERK-dependent pathway.

    Science.gov (United States)

    Secchiero, Paola; Melloni, Elisabetta; Heikinheimo, Markku; Mannisto, Susanna; Di Pietro, Roberta; Iacone, Antonio; Zauli, Giorgio

    2004-01-15

    In order to investigate the biologic activity of tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) on human erythropoiesis, glycophorin A (GPA)+ erythroid cells were generated in serum-free liquid phase from human cord blood (CB) CD34+ progenitor cells. The surface expression of TRAIL-R1 was weakly detectable in the early-intermediate phase of erythroid differentiation (days 4-6; dim-intermediate GPA expression), whereas a clear-cut expression of TRAIL-R2 was observed through the entire course of erythroid differentiation (up to days 12-14; bright GPA expression). On the other hand, surface TRAIL-R3 and -R4 were not detected at any culture time. Besides inducing a rapid but small increase of apoptotic cell death, which was abrogated by the pan-caspase inhibitor z-VAD-fmk, the addition of recombinant TRAIL at day 6 of culture inhibited the generation of morphologically mature erythroblasts. Among the intracellular pathways investigated, TRAIL significantly stimulated the extracellular signal-regulated kinase 1/2 (ERK1/2) but not the p38/mitogen-activated protein kinase (MAPK) or the c-Jun NH2-terminal kinase (JNK) pathway. Consistently with a key role of ERK1/2 in mediating the negative effects of TRAIL on erythroid maturation, PD98059, a pharmacologic inhibitor of the ERK pathway, but not z-VAD-fmk or SB203580, a pharmacologic inhibitor of p38/MAPK, reverted the antidifferentiative effect of TRAIL on CB-derived erythroblasts. PMID:12969966

  15. Radioimmunoassay of erythropoietin: circulating levels in normal and polycythemic human beings

    International Nuclear Information System (INIS)

    Techniques are described in detail for the RIA of human Ep in unextracted plasma or serum. With 100 μl of sample, the assay is sensitive at an Ep concentration of approximately 4 mU/ml, and when required, the sensitivity can be increased to 0.4 mU/ml, a range considerably less than the concentration observed in normal human beings. This is approximately 100 times more sensitive than existing in vivo bioassays for this hormone. Studies concerned with the validation of the Ep RIA show a high degree of correlation with the polycythemic mouse bioassay. Dilutions of a variety of human serum samples show a parallel relationship with the standard reference preparation for Ep. Validation of the RIA is further confirmed by observations of appropriate increases or decreases of circulating Ep levels in physiological and clinical conditions known to be associated with stimulation or suppression of Ep secretion. Significantly different mean serum concentrations of 17.2 mU/ml for normal male subjects and 18.8 mU/ml for normal female subjects were observed. Mean plasma Ep concentrations in patients with polycythemia vera are significantly decreased, and those of patients with secondary polycythemia are significantly increased as compared to plasma levels in normal subjects. These results demonstrate an initial practical value of the Ep RA in the hematology clinic, which will most certainly be expanded with its more extensive use

  16. Radioimmunoassay of erythropoietin: circulating levels in normal and polycythemic human beings

    Energy Technology Data Exchange (ETDEWEB)

    Garcia, J.F. (Lawrence Berkeley Lab., CA); Ebbe, S.N.; Hollander, L.; Cutting, H.O.; Miller, M.E.; Cronkite, E.P.

    1982-05-01

    Techniques are described in detail for the RIA of human Ep in unextracted plasma or serum. With 100 ..mu..l of sample, the assay is sensitive at an Ep concentration of approximately 4 mU/ml, and when required, the sensitivity can be increased to 0.4 mU/ml, a range considerably less than the concentration observed in normal human beings. This is approximately 100 times more sensitive than existing in vivo bioassays for this hormone. Studies concerned with the validation of the Ep RIA show a high degree of correlation with the polycythemic mouse bioassay. Dilutions of a variety of human serum samples show a parallel relationship with the standard reference preparation for Ep. Validation of the RIA is further confirmed by observations of appropriate increases or decreases of circulating Ep levels in physiological and clinical conditions known to be associated with stimulation or suppression of Ep secretion. Significantly different mean serum concentrations of 17.2 mU/ml for normal male subjects and 18.8 mU/ml for normal female subjects were observed. Mean plasma Ep concentrations in patients with polycythemia vera are significantly decreased, and those of patients with secondary polycythemia are significantly increased as compared to plasma levels in normal subjects. These results demonstrate an initial practical value of the Ep RA in the hematology clinic, which will most certainly be expanded with its more extensive use.

  17. Radioimmunoassay of erythropoietin: circulating levels in normal and polycythemic human beings.

    Science.gov (United States)

    Garcia, J F; Ebbe, S N; Hollander, L; Cutting, H O; Miller, M E; Cronkite, E P

    1982-05-01

    Techniques are described in detail for the RIA of human Ep in unextracted plasma or serum. With 100 microliters of sample, the essay is sensitive at an Ep concentration of approximately 4 mU/ml, and when required, the sensitivity can be increased to 0.4 mU/ml, a range considerably less than the concentration observed in normal human beings. This is approximately 100 times more sensitive than existing in vivo bioassays for this hormone. Studies concerned with the validation of the Ep RIA show a high degree of correlation with the polycythemic mouse bioassay. Dilutions of a variety of human serum samples show a parallel relationship with the standard reference preparation for Ep. Validation of the RIA is further confirmed by observations of appropriate increases or decreases in circulating Ep levels in physiological and clinical conditions known to be associated with stimulation of suppression of Ep secretion. Significantly different mean serum concentrations of 17.2 mU/ml for normal male subjects and 18.8 mU/ml for normal female subjects were observed. Mean plasma Ep concentrations in patients with polycythemia vera are significantly decreased, and those of patients with secondary polycythemia are significantly increased as compared to plasma levels in normal subjects. These results demonstrate an initial practical value of the Ep RIA inthe hematology clinic, which will most certainly be expanded with its more extensive use. PMID:7069267

  18. Quantification of erythroid and granulocytic precursor cells in plateletpheresis residues

    Energy Technology Data Exchange (ETDEWEB)

    Abboud, C.N.; Brennan, J.K.; Lichtman, M.A.; Nusbacher, J.

    1978-01-01

    Mononuclear cell fractions of human blood and plateletpheresis residues were compared for their content of hemopoietic precursor cells. Erythroid burst-forming units (BFU-E) averaged 560 +- 130 per ml of blood and granulocyte--monocyte colony forming units (CFU-C) averaged 240 +- 90 per ml blood. Estimates based on a blood volume of 7% of body weight indicate that the total blood pools of BFU-E and CFU-C are about 3.5 x 10/sup 6/ and 1.5 x 10/sup 6/ cells respectively. Sequential studies were performed over 3 days following one plateletpheresis in 4 donors. CFU-C and BFU-E approximately doubled between 48 and 72 hours after a plateletpheresis. During this time there was no significant alteration in the percent of null, T or B lymphocytes in blood. Thus, plateletpheresis appears to lead to a mobilization of precursor cells, which results in a transient increase in their concentration in blood. Therefore, pheresis 48 to 72 hours after an initial short-term procedure could harvest much larger numbers of precursor cells. Moreover, such techniques would put blood precursor cell content of plateletpheresis residues within reach of the precursor cell content in the volume of human marrow used for transplantation.

  19. Immunoradiometric assay for the detection of circulating antibodies to murine monoclonal antibodies in humans (HAMA)

    International Nuclear Information System (INIS)

    The increasing clinical use of monoclonal antibodies (MAb) has focussed attention on the importance of the generation of human anti-mouse antibodies (HAMA). HAMA can not only be life threatening but can also be associated with reduced image quality and accelerated MAb clearance in vivo as well as interfere with in vitro MAb based assays. The development of a two step immunoradiometric assay (IRMA) for detecting circulating HAMA is reported. Preliminary results have been generated with specific MAb coated polystyrene wells. The appropriately diluted serum sample is first incubated with the MAb coated wells followed by a wash step and a second incubation with 125I labeled goat anti-human IgG. After a final wash, the wells are assayed for 125I and the results expressed as percent of the input bound. The prototype assay is compared with an existing commercially available ELISA kit using patient sera obtained at various time periods up to 7 months after IV MAb injection for radioimmunoscintigraphy. 18 refs., 2 tabs., 1 fig

  20. Recombinant human granulocyte colony-stimulating factor increases circulating CD34-postive cells in patients with AIDS

    DEFF Research Database (Denmark)

    Nielsen, S D; Dam-Larsen, S; Nielsen, C;

    1997-01-01

    circulating hematopoietic progenitor cells (CD34 cells) in patients with AIDS, using the recombinant human granulocyte colony-stimulating factor (G-CSF). Eight patients with AIDS were treated with G-CSF for neutropenia (< 1.0 x 10(9)/l). Treatment consisted of daily subcutaneous injections with 300 micrograms...

  1. Chromatin looping as a target for altering erythroid gene expression.

    Science.gov (United States)

    Krivega, Ivan; Dean, Ann

    2016-03-01

    The β-hemoglobinopathies are the most common monogenic disorders in humans, with symptoms arising after birth when the fetal γ-globin genes are silenced and the adult β-globin gene is activated. There is a growing appreciation that genome organization and the folding of chromosomes are key determinants of gene transcription. Underlying this function is the activity of transcriptional enhancers that increase the transcription of target genes over long linear distances. To accomplish this, enhancers engage in close physical contact with target promoters through chromosome folding or looping that is orchestrated by protein complexes that bind to both sites and stabilize their interaction. We find that enhancer activity can be redirected with concomitant changes in gene transcription. Both targeting the β-globin locus control region (LCR) to the γ-globin gene in adult erythroid cells by tethering and epigenetic unmasking of a silenced γ-globin gene lead to increased frequency of LCR/γ-globin contacts and reduced LCR/β-globin contacts. The outcome of these manipulations is robust, pancellular γ-globin transcription activation with a concomitant reduction in β-globin transcription. These examples show that chromosome looping may be considered a therapeutic target for gene activation in β-thalassemia and sickle cell disease. PMID:26918894

  2. Numerical Models of Human Circulatory System under Altered Gravity: Brain Circulation

    Science.gov (United States)

    Kim, Chang Sung; Kiris, Cetin; Kwak, Dochan; David, Tim

    2003-01-01

    A computational fluid dynamics (CFD) approach is presented to model the blood flow through the human circulatory system under altered gravity conditions. Models required for CFD simulation relevant to major hemodynamic issues are introduced such as non-Newtonian flow models governed by red blood cells, a model for arterial wall motion due to fluid-wall interactions, a vascular bed model for outflow boundary conditions, and a model for auto-regulation mechanism. The three-dimensional unsteady incompressible Navier-Stokes equations coupled with these models are solved iteratively using the pseudocompressibility method and dual time stepping. Moving wall boundary conditions from the first-order fluid-wall interaction model are used to study the influence of arterial wall distensibility on flow patterns and wall shear stresses during the heart pulse. A vascular bed modeling utilizing the analogy with electric circuits is coupled with an auto-regulation algorithm for multiple outflow boundaries. For the treatment of complex geometry, a chimera overset grid technique is adopted to obtain connectivity between arterial branches. For code validation, computed results are compared with experimental data for steady and unsteady non-Newtonian flows. Good agreement is obtained for both cases. In sin-type Gravity Benchmark Problems, gravity source terms are added to the Navier-Stokes equations to study the effect of gravitational variation on the human circulatory system. This computational approach is then applied to localized blood flows through a realistic carotid bifurcation and two Circle of Willis models, one using an idealized geometry and the other model using an anatomical data set. A three- dimensional anatomical Circle of Willis configuration is reconstructed from human-specific magnetic resonance images using an image segmentation method. The blood flow through these Circle of Willis models is simulated to provide means for studying gravitational effects on the brain

  3. Erythroid cell growth and differentiation in vitro in the simulated microgravity environment of the NASA rotating wall vessel bioreactor

    Science.gov (United States)

    Sytkowski, A. J.; Davis, K. L.

    2001-01-01

    Prolonged exposure of humans and experimental animals to the altered gravitational conditions of space flight has adverse effects on the lymphoid and erythroid hematopoietic systems. Although some information is available regarding the cellular and molecular changes in lymphocytes exposed to microgravity, little is known about the erythroid cellular changes that may underlie the reduction in erythropoiesis and resultant anemia. We now report a reduction in erythroid growth and a profound inhibition of erythropoietin (Epo)-induced differentiation in a ground-based simulated microgravity model system. Rauscher murine erythroleukemia cells were grown either in tissue culture vessels at 1 x g or in the simulated microgravity environment of the NASA-designed rotating wall vessel (RWV) bioreactor. Logarithmic growth was observed under both conditions; however, the doubling time in simulated microgravity was only one-half of that seen at 1 x g. No difference in apoptosis was detected. Induction with Epo at the initiation of the culture resulted in differentiation of approximately 25% of the cells at 1 x g, consistent with our previous observations. In contrast, induction with Epo at the initiation of simulated microgravity resulted in only one-half of this degree of differentiation. Significantly, the growth of cells in simulated microgravity for 24 h prior to Epo induction inhibited the differentiation almost completely. The results suggest that the NASA RWV bioreactor may serve as a suitable ground-based microgravity simulator to model the cellular and molecular changes in erythroid cells observed in true microgravity.

  4. CD133 antibody conjugation to decellularized human heart valves intended for circulating cell capture.

    Science.gov (United States)

    Vossler, John D; Min Ju, Young; Williams, J Koudy; Goldstein, Steven; Hamlin, James; Lee, Sang Jin; Yoo, James J; Atala, Anthony

    2015-09-01

    The long term efficacy of tissue based heart valve grafts may be limited by progressive degeneration characterized by immune mediated inflammation and calcification. To avoid this degeneration, decellularized heart valves with functionalized surfaces capable of rapid in vivo endothelialization have been developed. The aim of this study is to examine the capacity of CD133 antibody-conjugated valve tissue to capture circulating endothelial progenitor cells (EPCs). Decellularized human pulmonary valve tissue was conjugated with CD133 antibody at varying concentrations and exposed to CD133 expressing NTERA-2 cl.D1 (NT2) cells in a microflow chamber. The amount of CD133 antibody conjugated on the valve tissue surface and the number of NT2 cells captured in the presence of shear stress was measured. Both the amount of CD133 antibody conjugated to the valve leaflet surface and the number of adherent NT2 cells increased as the concentration of CD133 antibody present in the surface immobilization procedure increased. The data presented in this study support the hypothesis that the rate of CD133(+) cell adhesion in the presence of shear stress to decellularized heart valve tissue functionalized by CD133 antibody conjugation increases as the quantity of CD133 antibody conjugated to the tissue surface increases. PMID:26333364

  5. Melatonin enhances mitochondrial ATP synthesis, reduces reactive oxygen species formation, and mediates translocation of the nuclear erythroid 2-related factor 2 resulting in activation of phase-2 antioxidant enzymes (γ-GCS, HO-1, NQO1) in ultraviolet radiation-treated normal human epidermal keratinocytes (NHEK).

    Science.gov (United States)

    Kleszczyński, Konrad; Zillikens, Detlef; Fischer, Tobias W

    2016-09-01

    Melatonin is an ubiquitous molecule with a variety of functions including potent antioxidative properties. Due to its lipophilic character, it easily crosses cellular and intracellular membranes and reaches all subcellular organelles. Because of its ability to scavenge free radicals, melatonin protects against oxidative stress, for example, induced by ultraviolet radiation (UVR). Here, we investigated, in a dose-dependent (0, 10, 25, and 50 mJ/cm(2) ) and time-dependent (0, 4, 24, 48 hr post-UVR) manner, whether melatonin prevents the UVR-mediated alterations in ATP synthesis and the generation of reactive oxygen species (ROS) in normal human epidermal keratinocytes (NHEK). Additionally, we evaluated the molecular mechanism of action of melatonin with regard to activation of phase-2 antioxidative enzymes via nuclear erythroid 2-related factor (Nrf2). We found that (i) melatonin counteracted UVR-induced alterations in the ATP synthesis and reduced free radical formation; (ii) melatonin induced the translocation of Nrf2 transcription factor from the cytosol into the nucleus resulting in, (iii) melatonin enhanced gene expression of phase-2 antioxidative enzymes including γ-glutamylcysteine synthetase (γ-GCS), heme oxygenase-1 (HO-1), and NADPH: quinone dehydrogenase-1 (NQO1) representing an elevated antioxidative response of keratinocytes. These results suggest that melatonin not only directly scavenges ROS, but also significantly induces the activation of phase-2 antioxidative enzymes via the Nrf2 pathway uncovering a new action mechanism that supports the ability of keratinocytes to protect themselves from UVR-mediated oxidative stress. PMID:27117941

  6. RUNX1 represses the erythroid gene expression program during megakaryocytic differentiation

    OpenAIRE

    Kuvardina, Olga N.; Herglotz, Julia; Kolodziej, Stephan; Kohrs, Nicole; Herkt, Stefanie; Wojcik, Bartosch; Oellerich, Thomas; Corso, Jasmin; Behrens, Kira; Kumar, Ashok; Hussong, Helge; Urlaub, Henning; Koch, Joachim; Serve, Hubert; Bonig, Halvard

    2015-01-01

    RUNX1 inhibits erythroid differentiation by downregulation of the erythroid gene expression program.RUNX1 can act as an activator and repressor during megakaryocytic differentiation and counteracts the activity of TAL1.

  7. A critical role for the co-repressor N-CoR in erythroid differentiation and heme synthesis

    Institute of Scientific and Technical Information of China (English)

    Dianzheng Zhang; Ellen Cho; Jiemin Wong

    2007-01-01

    Co-repressor N-CoR (nuclear receptor co-repressor) has important roles in different biological processes, including proliferation, differentiation and development. Mutant mice lacking N-CoR are embryonically lethal and appear to die from anemia owing to defects in definitive erythropoiesis. However, the underlying molecular mechanisms of N-CoR-mediated erythroid differentiation are largely unknown. Using the human erythroleukemic K562 cell line, which can be chemically induced to differentiate into either erythroid or megakaryocytic lineages depending on the inducers used, we have investigated the role of N-CoR in erythroid differentiation. We show that knockdown of N-CoR either transiently (siRNA) or permanently (shRNA) impairs the cytosine arabinoside (Ara-C)- but not hemin-induced erythroid differentiation of K562 cells. RT-PCR analysis reveals that N-CoR is required for induction by Ara-C of 5-aminolevulinate synthase (ALA-S2), a key enzyme involved in heme biosynthesis. Furthermore, the amount of N-CoR proteins increases significantly during Ara-C-induced K562 differentiation, apparently through a post-transcriptional mechanism. Consistent with the data from N-CoR-null mice, N-CoR is not required for the differentiation of K562 cells into megakaryocytic lineages, induced by phorbol 12-myristate 13-acetate. Thus, our in vitro study confirms a role for N-CoR in erythroid differentiation and reveals for the first time that N-CoR is required for the induction of a key enzyme involved in heme synthesis.

  8. Circulating levels of human salusin-β, a potent hemodynamic and atherogenesis regulator.

    Directory of Open Access Journals (Sweden)

    Kazumi Fujimoto

    Full Text Available Using bioinformatics analysis, we previously identified salusin-β, an endogenous bioactive peptide with diverse physiological activities. Salusin-β is abundantly expressed in the neuroendocrine system and in systemic endocrine cells/macrophages. Salusin-β acutely regulates hemodynamics and chronically induces atherosclerosis, but its unique physicochemical characteristics to tightly adhere to all types of plastic and glassware have prevented elucidation of its precise pathophysiological role. To quantitate plasma total salusin-β concentrations, we produced rabbit and chicken polyclonal antibodies against the C- and N-terminal end sequences, circumvented its sticky nature, and successfully established a sandwich enzyme-linked immunosorbent assay (ELISA. Salusin-β was abundantly present in the plasma of healthy volunteers, ranging from 1.9 to 6.6 nmol/L. Reverse phase-high performance liquid chromatography analysis showed that a single immunoreactive salusin-β peak coincided with synthetic authentic salusin-β. Plasma salusin-β concentrations were unaffected by postural changes and by potent vasopressin release stimuli, such as hypertonic saline infusion or smoking. However, salusin-β concentrations showed significant circadian variation; concentrations were high during the daytime and reached the lowest concentrations in the early morning. Plasma salusin-β levels in subjects with diabetes mellitus, coronary artery disease, and cerebrovascular disease showed distinctly higher levels than healthy controls. Patients with panhypopituitarism combined with complete central diabetes insipidus also showed significantly higher plasma salusin-β levels. Therefore, the ELISA system developed in this study will be useful for evaluating circulating total salusin-β levels and for confirming the presence of authentic salusin-β in human plasma. The obtained results suggest a limited contribution of the neuroendocrine system to peripheral total salusin

  9. Optimized Quantification of Fragmented, Free Circulating DNA in Human Blood Plasma Using a Calibrated Duplex Real-Time PCR

    OpenAIRE

    Horlitz, Martin; Lucas, Annabelle; Sprenger-Haussels, Markus

    2009-01-01

    Background Duplex real-time PCR assays have been widely used to determine amounts and concentrations of free circulating DNA in human blood plasma samples. Circulatory plasma DNA is highly fragmented and hence a PCR-based determination of DNA concentration may be affected by the limited availability of full-length targets in the DNA sample. This leads to inaccuracies when counting PCR target copy numbers as whole genome equivalents. Methodology/Principal Findings A model system was designed a...

  10. Initial function analysis of a novel erythroid differentiation related gene EDRF1

    Institute of Scientific and Technical Information of China (English)

    王敦成; 黎燕; 沈倍奋

    2001-01-01

    Erythroid differentiation depends on the establishment of specific patterns of gene expression. Hypersensitive site 2 (HS2, serving as a major enhancer of globin genes)-binding proteins may be involved in its natural open chromosomal environment formation. Previously we prepared monoclonal antibodies against HS2-binding nuclear proteins of terminal differentiated erythroid cells. By utilizing the monoclonal antibodies, we screened λ-gt11 human fetal liver cDNA expression library and obtained one cDNA clone, which was named erythroid differentiation related gene (EDRF1, Genbank accession number AF040247) , encompassing an entire open reading frame. We investigated the expression pattern of EDRF1 by RT-PCR technique. And a clue to the function of EDRF1 has been found from confirmation of high levels of EDRF1 mRNA in differentiated K562 and human fetal liver tissue. To illuminate the function of EDRF1 in K562 cells, sense and antisense EDRF1 constructs were prepared and transfected into K562 cells, α-globin mRNA was down-regulated and EpoR (erythropoietin receptor) mRNA expression was increased in antisense transfected cells. Cells transfected with sense construct grew more slowly than control cells suggested by [3H] thimidine incorporation experiments. Suppression of K562 proliferation was accompanied by increased spontaneous hemoglobin synthesis demonstrated by spectrometry.K562 cells transfected with sense construct exhibited reduced clongenicity compared with control cells in methycellulose culture. These data provided the evidence that EDRF1 can influence globin expression and hemoglobin synthesis in K562 cells and modulated self-renewal in K562 cells.

  11. Oxidative burst of circulating neutrophils following traumatic brain injury in human.

    Directory of Open Access Journals (Sweden)

    Yiliu Liao

    Full Text Available Besides secondary injury at the lesional site, Traumatic brain injury (TBI can cause a systemic inflammatory response, which may cause damage to initially unaffected organs and potentially further exacerbate the original injury. Here we investigated plasma levels of important inflammatory mediators, oxidative activity of circulating leukocytes, particularly focusing on neutrophils, from TBI subjects and control subjects with general trauma from 6 hours to 2 weeks following injury, comparing with values from uninjured subjects. We observed increased plasma level of inflammatory cytokines/molecules TNF-α, IL-6 and CRP, dramatically increased circulating leukocyte counts and elevated expression of TNF-α and iNOS in circulating leukocytes from TBI patients, which suggests a systemic inflammatory response following TBI. Our data further showed increased free radical production in leukocyte homogenates and elevated expression of key oxidative enzymes iNOS, COX-2 and NADPH oxidase (gp91(phox in circulating leukocytes, indicating an intense induction of oxidative burst following TBI, which is significantly greater than that in control subjects with general trauma. Furthermore, flow cytometry assay proved neutrophils as the largest population in circulation after TBI and showed significantly up-regulated oxidative activity and suppressed phagocytosis rate for circulating neutrophils following brain trauma. It suggests that the highly activated neutrophils might play an important role in the secondary damage, even outside the injured brain. Taken together, the potent systemic inflammatory response induced by TBI, especially the intensively increase oxidative activity of circulating leukocytes, mainly neutrophils, may lead to a systemic damage, dysfunction/damage of bystander tissues/organs and even further exacerbate secondary local damage. Controlling these pathophysiological processes may be a promising therapeutic strategy and will protect unaffected

  12. Kringle-containing fragments of apolipoprotein(a) circulate in human plasma and are excreted into the urine.

    OpenAIRE

    Mooser, V.; Marcovina, S. M.; A L White; Hobbs, H H

    1996-01-01

    Apolipoprotein(a) [apo(a)] contains multiple kringle 4 repeats and circulates as part of lipoprotein(a) [Lp(a)]. Apo(a) is synthesized by the liver but its clearance mechanism is unknown. Previously, we showed that kringle 4-containing fragments of apo(a) are present in human urine. To probe their origin, human plasma was examined and a series of apo(a) immunoreactive peptides larger in size than urinary fragments was identified. The concentration of apo(a) fragments in plasma was directly re...

  13. Erythropoietin is involved in hemoprotein syntheses in developing human decidua.

    Science.gov (United States)

    Shiota, Mitsuru; Yasuda, Yoshiko; Shimaoka, Masao; Tsuritani, Mitsuhiro; Koike, Eiji; Oiki, Masaaki; Matsubara, Junko; Taketani, Shigeru; Murakami, Hitoshi; Yamasaki, Harufumi; Okumoto, Katsumi; Hoshiai, Hiroshi

    2013-03-01

    Before establishment of feto-placental circulation, decidua can synthesize hemoproteins to maintain oxygen homeostasis in situ. Using the human decidua of induced abortions ranging from 5 to 8 weeks of gestation, we determined the expression levels of erythropoietin, erythropoietin receptor, cytoglobin, myoglobin, embryonic-, fetal- and adult hemoglobin mRNA by quantitative RT-PCR analysis and identified their proteins by Western blot and immunohistochemical analyses. Erythropoietin signaling was demonstrated in phosphatidylinositol-3-kinase/protein kinase B pathway by Western blot, and the transcriptional factors for erythroid and non-erythroid heme synthesis were examined by RT-PCR analysis. In decidua, erythropoietin and its receptor mRNAs, erythropoietin receptor protein and phosphatidylinositol-3-kinase, were expressed with a peak at 6 weeks of gestation. Moreover, the decidua during 5 to 8 weeks of gestation expressed embryonic, fetal and adult hemoglobins additionally cytoglobin and myoglobin at transcriptional and protein levels. The heme portion of these hemoproteins is considered to be synthesized by non-erythroid δ-aminolevulinate synthase. These hemoproteins were discernible especially in decidual cells concomitant with cytotrophoblast cells and macrophage in these developing decidua. Considering the different capacity for oxygen binding and dissociation among hemoglobins with the oxygen storage capacity for cytoglobin and myoglobin, these hemoproteins appear to play a role in oxygen demand in decidua in situ before development of feto-placental circulation under the control of erythropoietin signaling. PMID:23480354

  14. Isolation of circulating microRNAs from microvesicles found in human plasma.

    Science.gov (United States)

    Quackenbush, John F; Cassidy, Pamela B; Pfeffer, Lawrence M; Boucher, Kenneth M; Hawkes, Jason E; Pfeffer, Susan R; Kopelovich, Levy; Leachman, Sancy A

    2014-01-01

    Intact miRNAs can be isolated from the circulation in significant quantities despite the presence of extremely high levels of RNase activity. The remarkable stability of circulating miRNAs makes them excellent candidates for biomarkers in diagnostic applications as well as therapeutic targets in a variety of disease states including melanoma. Circulating RNA molecules are resistant to degradation by RNases because they are encapsulated in membrane-bound microvesicles. We describe a convenient method for the use of ExoQuick, a proprietary resin developed by Systems Biosciences (Mountain View, CA), whereby microvesicles can be purified under gentle conditions using readily available laboratory equipment. This protocol allows for isolation all microvesicles, regardless of their origin, and provides a convenient method for identifying potential cancer-specific biomarkers from biological fluids including serum and plasma. PMID:24259003

  15. Studies of globin gene expression in differentiating erythroid cells

    International Nuclear Information System (INIS)

    The author has addressed questions concerning globin gene expression and the loss of protein synthesis in the terminal stages of erythroid development. (1) The hypothesis that the rate of cell division affects the relative synthesis of γ and β globin in erythroid cells was investigated. The effect of hydroxyurea, aminopterin, or low culture temperature on the in vitro growth of erythroid progenitor cells and on the relative synthesis of γ and β globin was measured. No consistent change in γ globin synthesis was detected. (2) The hypothesis that the ratio of γ and β globin synthesis decreases during erythroid maturation because of differential mRNA stability was investigated. The half-lives of γ and β globin mRNAs and γ and β globin protein synthesis were measured in cultured reticulocytes. γ and β globin mRNAs were assayed by solution hybridization and by in vitro translation. Globin synthesis was determined by 3H-leucine incorporation into the γ and β globin chains. γ and β globin mRNAs decay with similar half-lives in cultured reticulocytes. Therefore, the change in the ratio of γ and β globin synthesis during erythroid maturation cannot be explained by differences in mRNA stability and is likely to result from asynchronous transcription of the genes. These data suggest that protein synthesis in maturing reticulocytes is not limited by the quantity of mRNA but by the availability of translation factors. (3) The hypothesis was tested that the initiation factor GEF becomes limiting for protein synthesis during reticulocyte maturation

  16. Altered chromatin occupancy of master regulators underlies evolutionary divergence in the transcriptional landscape of erythroid differentiation.

    Science.gov (United States)

    Ulirsch, Jacob C; Lacy, Jessica N; An, Xiuli; Mohandas, Narla; Mikkelsen, Tarjei S; Sankaran, Vijay G

    2014-12-01

    Erythropoiesis is one of the best understood examples of cellular differentiation. Morphologically, erythroid differentiation proceeds in a nearly identical fashion between humans and mice, but recent evidence has shown that networks of gene expression governing this process are divergent between species. We undertook a systematic comparative analysis of six histone modifications and four transcriptional master regulators in primary proerythroblasts and erythroid cell lines to better understand the underlying basis of these transcriptional differences. Our analyses suggest that while chromatin structure across orthologous promoters is strongly conserved, subtle differences are associated with transcriptional divergence between species. Many transcription factor (TF) occupancy sites were poorly conserved across species (∼25% for GATA1, TAL1, and NFE2) but were more conserved between proerythroblasts and cell lines derived from the same species. We found that certain cis-regulatory modules co-occupied by GATA1, TAL1, and KLF1 are under strict evolutionary constraint and localize to genes necessary for erythroid cell identity. More generally, we show that conserved TF occupancy sites are indicative of active regulatory regions and strong gene expression that is sustained during maturation. Our results suggest that evolutionary turnover of TF binding sites associates with changes in the underlying chromatin structure, driving transcriptional divergence. We provide examples of how this framework can be applied to understand epigenomic variation in specific regulatory regions, such as the β-globin gene locus. Our findings have important implications for understanding epigenomic changes that mediate variation in cellular differentiation across species, while also providing a valuable resource for studies of hematopoiesis. PMID:25521328

  17. Enhanced inhibition of parvovirus B19 replication by cidofovir in extendedly exposed erythroid progenitor cells.

    Science.gov (United States)

    Bonvicini, Francesca; Bua, Gloria; Manaresi, Elisabetta; Gallinella, Giorgio

    2016-07-15

    Human parvovirus B19 (B19V) commonly induces self-limiting infections but can also cause severe clinical manifestations in patients with underlying haematological disorders or with immune system deficits. Currently, therapeutic options for B19V entirely rely on symptomatic and supportive treatments since a specific antiviral therapy is not yet available. Recently a first step in the research for active compounds inhibiting B19V replication has allowed identifying the acyclic nucleoside phosphonate cidofovir (CDV). Herein, the effect of CDV against B19V replication was characterized in human erythroid progenitor cells (EPCs) cultured and infected following different experimental approaches to replicate in vitro the infection of an expanding erythroid cell population in the bone marrow. B19V replication was selectively inhibited both in infected EPCs extendedly exposed to CDV 500μM (viral inhibition 82%) and in serially infected EPCs cultures with passage of the virus progeny, constantly under drug exposure (viral inhibition 99%). In addition, a potent inhibitory effect against B19V (viral inhibition 92%) was assessed in a short-term infection of EPCs treated with CDV 500μM 1day before viral infection. In the evaluated experimental conditions, the enhanced effect of CDV against B19V might be ascribed both to the increased intracellular drug concentration achieved by extended exposure, and to a progressive reduction in efficiency of the replicative process within treated EPCs population. PMID:27071853

  18. Identification of cardiac-related circulating microRNA profile in human chronic heart failure

    Science.gov (United States)

    Li, Huaping; Fan, Jiahui; Yin, Zhongwei; Wang, Feng; Chen, Chen; Wang, Dao Wen

    2016-01-01

    Background During chronic heart failure, levels of circulating miRNAs endued with characteristics of diseased cells could be identified as biomarkers. In this study, we sought to identify cardiac-related circulating miRNAs as biomarkers of failing heart. Methods Total RNA of plasma and heart samples was extracted from 10 normal controls and 14 patients with chronic heart failure. Microarray was applied for miRNA profiles. Validation and organ/tissue distribution analysis was performed by qRT-PCR. In addition, bioinformatics analysis was performed to understand the critical roles of these cardiac-related circulating miRNAs in heart failure. Results Results showed that levels of more than half of the miRNAs dysregulated in heart failed to show any differences in plasma. Meanwhile, more than 90% of the miRNAs dysregulated in plasma remained stable in heart. Four cardiac fibroblast-derived miRNAs (miR-660-3p, miR-665, miR-1285-3p and miR-4491) were found significantly upregulated in heart and plasma during heart failure. These 4 miRNAs strongly discriminated patients from controls, and 3 of them showed significant correlations with LVEF. Conclusions This study provides global profiles of miRNAs changes in plasma and failing heart, and using a circulation-tissue miRNA profiling comparison model, we successfully identify 3 cardiac-related circulating miRNAs as potential biomarkers for diagnosis of heart failure. PMID:26683101

  19. The role of DNA methylation in catechol-enhanced erythroid differentiation of K562 cells

    Energy Technology Data Exchange (ETDEWEB)

    Li, Xiao-Fei; Wu, Xiao-Rong; Xue, Ming; Wang, Yan; Wang, Jie; Li, Yang; Suriguga,; Zhang, Guang-Yao; Yi, Zong-Chun, E-mail: yizc@buaa.edu.cn

    2012-11-15

    Catechol is one of phenolic metabolites of benzene in vivo. Catechol is also widely used in pharmaceutical and chemical industries. In addition, fruits, vegetables and cigarette smoke also contain catechol. Our precious study showed that several benzene metabolites (phenol, hydroquinone, and 1,2,4-benzenetriol) inhibited erythroid differentiation of K562 cells. In present study, the effect of catechol on erythroid differentiation of K562 cells was investigated. Moreover, to address the role of DNA methylation in catechol-induced effect on erythroid differentiation in K562 cells, methylation levels of erythroid-specific genes were analyzed by Quantitative MassARRAY methylation analysis platform. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation in K562 cells in concentration- and time-dependent manners. The mRNA expression of erythroid specific genes, including α-globin, β-globin, γ-globin, erythroid 5-aminolevulinate synthase, erythroid porphobilinogen deaminase, and transcription factor GATA-1 genes, showed a significant concentration-dependent increase in catechol-treated K562 cells. The exposure to catechol caused a decrease in DNA methylation levels at a few CpG sites in some erythroid specific genes including α-globin, β-globin and erythroid porphobilinogen deaminase genes. These results indicated that catechol improved erythroid differentiation potency of K562 cells at least partly via up-regulating transcription of some erythroid related genes, and suggested that inhibition of DNA methylation might be involved in up-regulated expression of some erythroid related genes. -- Highlights: ► Catechol enhanced hemin-induced hemoglobin accumulation. ► Exposure to catechol resulted in up-regulated expression of erythroid genes. ► Catechol reduced methylation levels at some CpG sites in erythroid genes.

  20. The role of DNA methylation in catechol-enhanced erythroid differentiation of K562 cells

    International Nuclear Information System (INIS)

    Catechol is one of phenolic metabolites of benzene in vivo. Catechol is also widely used in pharmaceutical and chemical industries. In addition, fruits, vegetables and cigarette smoke also contain catechol. Our precious study showed that several benzene metabolites (phenol, hydroquinone, and 1,2,4-benzenetriol) inhibited erythroid differentiation of K562 cells. In present study, the effect of catechol on erythroid differentiation of K562 cells was investigated. Moreover, to address the role of DNA methylation in catechol-induced effect on erythroid differentiation in K562 cells, methylation levels of erythroid-specific genes were analyzed by Quantitative MassARRAY methylation analysis platform. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation in K562 cells in concentration- and time-dependent manners. The mRNA expression of erythroid specific genes, including α-globin, β-globin, γ-globin, erythroid 5-aminolevulinate synthase, erythroid porphobilinogen deaminase, and transcription factor GATA-1 genes, showed a significant concentration-dependent increase in catechol-treated K562 cells. The exposure to catechol caused a decrease in DNA methylation levels at a few CpG sites in some erythroid specific genes including α-globin, β-globin and erythroid porphobilinogen deaminase genes. These results indicated that catechol improved erythroid differentiation potency of K562 cells at least partly via up-regulating transcription of some erythroid related genes, and suggested that inhibition of DNA methylation might be involved in up-regulated expression of some erythroid related genes. -- Highlights: ► Catechol enhanced hemin-induced hemoglobin accumulation. ► Exposure to catechol resulted in up-regulated expression of erythroid genes. ► Catechol reduced methylation levels at some CpG sites in erythroid genes.

  1. Physiological, Pharmacological, and Nutritional Regulation of Circulating Adiponectin Concentrations in Humans

    OpenAIRE

    Swarbrick, Michael M.; Peter J Havel

    2008-01-01

    Adiponectin is an adipocyte hormone that links visceral adiposity with insulin resistance and atherosclerosis. It is unique among adipocyte-derived hormones in that its circulating concentrations are inversely proportional to adiposity, and low adiponectin concentrations predict the development of type 2 diabetes and cardiovascular disease. Consequently, in the decade since its discovery, adiponectin has generated immense interest as a potential therapeutic target for the metabolic syndrome a...

  2. Maternal and Fetoplacental Hypoxia Do Not Alter Circulating Angiogenic Growth Effectors During Human Pregnancy1

    OpenAIRE

    Zamudio, Stacy; Borges, Marcus; Echalar, Lourdes; Kovalenko, Olga; Vargas, Enrique; Torricos, Tatiana; Khan, Abdulla Al; Alvarez, Manuel; Illsley, Nicholas P

    2013-01-01

    One causal model of preeclampsia (PE) postulates that placental hypoxia alters the production of angiogenic growth effectors (AGEs), causing an imbalance leading to maternal endothelial cell dysfunction. We tested this model using the natural experiment of high-altitude (HA) residence. We hypothesized that in HA pregnancies 1) circulating soluble fms-like tyrosine kinase 1 (sFlt-1) is increased and placental growth factor (PlGF) decreased, and 2) AGE concentrations correlate with measures of ...

  3. Fibronectin Binding Is Required for Acquisition of Mesenchymal/Endothelial Differentiation Potential in Human Circulating Monocytes

    Directory of Open Access Journals (Sweden)

    Noriyuki Seta

    2012-01-01

    Full Text Available We previously reported monocyte-derived multipotential cells (MOMCs, which include progenitors capable of differentiating into a variety of mesenchymal cells and endothelial cells. In vitro generation of MOMCs from circulating CD14+ monocytes requires their binding to extracellular matrix (ECM protein and exposure to soluble factor(s derived from circulating CD14- cells. Here, we investigated the molecular factors involved in MOMC generation by examining the binding of monocytes to ECM proteins. We found that MOMCs were obtained on the fibronectin, but not on type I collagen, laminin, or poly-L-lysine. MOMC generation was followed by changes in the expression profiles of transcription factors and was completely inhibited by either anti-α5 integrin antibody or a synthetic peptide that competed with the RGD domain for the β1-integrin binding site. These results indicate that acquisition of the multidifferentiation potential by circulating monocytes depends on their binding to the RGD domain of fibronectin via cell-surface α5β1 integrin.

  4. Immunocytochemical mapping of the hemoglobin biosynthesis site in amphibian erythroid cells.

    Science.gov (United States)

    Cianciarullo, A M; Beçak, W; Soares, M J

    1999-06-01

    During the past 25 years, several studies have attempted to determine the site of integration of the heme and the four globin chains in vertebrate erythroid cells that is important in the formation of the hemoglobin molecule. Mitochondrion-like organelles or hemosomes were pointed out as responsible for this task. We performed several experiments to investigate this hypothesis. The intracellular distribution of hemoglobin in amphibian erythroid cells was detected by post-embedding immuno-electron microscopy, using a polyclonal anti-human hemoglobin-proteinA-gold complex. Hemoglobin mapping showed an intense labeling in the cell cytoplasm, but none in cytoplasmic structures such as endoplasmic reticulum, mitochondria, mitochondrion-like organelles, Golgi complex, ribosomes or ferruginous inclusions. The mitochondrial fraction obtained according to the protocol described for some authors, showed by ultrastructural examination that this fraction has a heterogeneous content, also composed by microvesicles rich in cytoplasmic hemoglobin, an artifact generated by mechanical action during cell fractionation. Thus, when this fraction is lysed and its content submitted to electrophoresis, hemoglobin bands would be found inevitably, causing false-positive results, erroneously attributed to hemoglobin content of mitochondrion-like organelles. Our data do not confirm the hypothesis that the final hemoglobin biosynthesis occurs inside mitochondrion-like organelles. They suggest that the hemoglobin molecule be assembled in the erythrocyte cytoplasm outside of mitochondria or hemosomes. PMID:10481306

  5. Cpeb4-mediated translational regulatory circuitry controls terminal erythroid differentiation.

    Science.gov (United States)

    Hu, Wenqian; Yuan, Bingbing; Lodish, Harvey F

    2014-09-29

    While we have considerable understanding of the transcriptional networks controlling mammalian cell differentiation, our knowledge of posttranscriptional regulatory events is very limited. Using differentiation of primary erythroid cells as a model, we show that the sequence-specific mRNA-binding protein Cpeb4 is strongly induced by the erythroid-important transcription factors Gata1 and Tal1 and is essential for terminal erythropoiesis. By interacting with the translation initiation factor eIF3, Cpeb4 represses the translation of a large set of mRNAs, including its own mRNA. Thus, transcriptional induction and translational repression combine to form a negative feedback loop to control Cpeb4 protein levels within a specific range that is required for terminal erythropoiesis. Our study provides an example of how translational control is integrated with transcriptional regulation to precisely control gene expression during mammalian cell differentiation. PMID:25220394

  6. TMEM14C is required for erythroid mitochondrial heme metabolism

    OpenAIRE

    Yien, Yvette Yee; Robledo, Raymond F.; Schultz, Iman J.; Takahashi-Makise, Naoko; Gwynn, Babette; Bauer, Daniel Evan; Dass, Abhishek; Yi, Gloria; Li, Liangtao; Hildick-Smith, Gordon J.; Cooney, Jeffrey D.; Pierce, Eric Adam; Mohler, Kyla; Dailey, Tamara A.; Miyata, Non

    2014-01-01

    The transport and intracellular trafficking of heme biosynthesis intermediates are crucial for hemoglobin production, which is a critical process in developing red cells. Here, we profiled gene expression in terminally differentiating murine fetal liver-derived erythroid cells to identify regulators of heme metabolism. We determined that TMEM14C, an inner mitochondrial membrane protein that is enriched in vertebrate hematopoietic tissues, is essential for erythropoiesis and heme synthesis in ...

  7. Bmi-1 Regulates Extensive Erythroid Self-Renewal

    OpenAIRE

    Ah Ram Kim; Jayme L. Olsen; Samantha J. England; Yu-Shan Huang; Katherine H. Fegan; Luis F. Delgadillo; Kathleen E. McGrath; Paul D. Kingsley; Richard E. Waugh; James Palis

    2015-01-01

    Summary Red blood cells (RBCs), responsible for oxygen delivery and carbon dioxide exchange, are essential for our well-being. Alternative RBC sources are needed to meet the increased demand for RBC transfusions projected to occur as our population ages. We previously have discovered that erythroblasts derived from the early mouse embryo can self-renew extensively ex vivo for many months. To better understand the mechanisms regulating extensive erythroid self-renewal, global gene expression d...

  8. Circulating follicular T helper cells and cytokine profile in humans following vaccination with the rVSV-ZEBOV Ebola vaccine.

    Science.gov (United States)

    Farooq, Fouzia; Beck, Kevin; Paolino, Kristopher M; Phillips, Revell; Waters, Norman C; Regules, Jason A; Bergmann-Leitner, Elke S

    2016-01-01

    The most recent Zaire Ebolavirus (ZEBOV) outbreak was the largest and most widespread in recorded history, emphasizing the need for an effective vaccine. Here, we analyzed human cellular immune responses induced by a single dose of the rVSV-ZEBOV vaccine candidate, which showed significant protective efficacy in endemic populations in Guinea. This is the first in-depth characterization of ZEBOV-GP specific, circulating follicular T cells (cTfh). Since antibody titers correlated with protection in preclinical models of ZEBOV infection, Tfh were predicted to correlate with protection. Indeed, the ZEBOV-specific cTfh data correlated with antibody titers in human vaccines and unexpectedly with the Tfh17 subset. The combination of two cutting edge technologies allowed the immuno-profiling of rare cell populations and may help elucidate correlates of protection for a variety of vaccines. PMID:27323685

  9. Role of Helix-Loop-Helix Proteins during Differentiation of Erythroid Cells ▿

    OpenAIRE

    Anantharaman, Archana; Lin, I-Ju; Barrow, Joeva; Liang, Shermi Y; Masannat, Jude; Strouboulis, John; Huang, Suming; Bungert, Jörg

    2011-01-01

    Helix-loop-helix (HLH) proteins play a profound role in the process of development and cellular differentiation. Among the HLH proteins expressed in differentiating erythroid cells are the ubiquitous proteins Myc, USF1, USF2, and TFII-I, as well as the hematopoiesis-specific transcription factor Tal1/SCL. All of these HLH proteins exhibit distinct functions during the differentiation of erythroid cells. For example, Myc stimulates the proliferation of erythroid progenitor cells, while the USF...

  10. Long-acting lipidated analogue of human pancreatic polypeptide is slowly released into circulation

    DEFF Research Database (Denmark)

    Bellmann-Sickert, Kathrin; Elling, Christian E; Madsen, Andreas N;

    2011-01-01

    human pancreatic polypeptide analogue specific for the human (h)Y(2) and hY(4) receptor with PEGs of different size and palmitic acid. Receptor specificity was demonstrated by competitive binding studies. Modifications had only a small influence on binding affinities and no influence on secondary...

  11. Effect of AGM and fetal liver-derived stromal cell lines on globin expression in adult baboon (P. anubis bone marrow-derived erythroid progenitors.

    Directory of Open Access Journals (Sweden)

    Donald Lavelle

    Full Text Available This study was performed to investigate the hypothesis that the erythroid micro-environment plays a role in regulation of globin gene expression during adult erythroid differentiation. Adult baboon bone marrow and human cord blood CD34+ progenitors were grown in methylcellulose, liquid media, and in co-culture with stromal cell lines derived from different developmental stages in identical media supporting erythroid differentiation to examine the effect of the micro-environment on globin gene expression. Adult progenitors express high levels of γ-globin in liquid and methylcellulose media but low, physiological levels in stromal cell co-cultures. In contrast, γ-globin expression remained high in cord blood progenitors in stromal cell line co-cultures. Differences in γ-globin gene expression between adult progenitors in stromal cell line co-cultures and liquid media required cell-cell contact and were associated with differences in rate of differentiation and γ-globin promoter DNA methylation. We conclude that γ-globin expression in adult-derived erythroid cells can be influenced by the micro-environment, suggesting new potential targets for HbF induction.

  12. WEATHER AND CIRCULATION TYPES ACCOMPANYING THERMAL AND HUMIDITY CONDITIONS UNFAVOURABLE TO THE HUMAN HEALTH IN SUMMER IN KRAKOW (POLAND

    Directory of Open Access Journals (Sweden)

    D. CIARANEK

    2013-03-01

    Full Text Available The paper presents the results of a study analysing the frequency of occurrence and patterns of change in the human perception of temperature in relation to types of weather and circulation in Krakow. The Humidex index used for the purpose was determined at three measurement times (6, 12, 18 UTC with data spanning the period 1961-2012. The frequency of occurrence of all types of discomfort situation was found to be on the increase. Days with some discomfort occurred most frequently during non-advection situations, (especially in the centre of a meteorological high or anticyclonic wedge, accompanied by transformed polar maritime air or continental polar air. The weather varied greatly on such days, from cloudy to sunny and with or without precipitation. Days with high discomfort levels were associated with the advection of tropical air accompanied typically by very hot, sweltering weather, and by dry, very sunny weather.

  13. The role of the erythroid-specific delta-aminolevulinate synthase gene expression in erythroid heme synthesis.

    Science.gov (United States)

    Meguro, K; Igarashi, K; Yamamoto, M; Fujita, H; Sassa, S

    1995-08-01

    Using antisense technology, the effects of suppressed gene expression of the erythroid-specific delta-aminolevulinate (ALA) synthase (ALAS-E) on heme synthesis, expression of mRNAs encoding an erythroid-specific transcription factor NF-E2, other heme pathway enzymes, and beta-globin were examined in murine erythroleukemia (MEL) cells. In MEL cells in which an antisense ALAS-E RNA was expressed (AS clone), sense ALAS-E mRNA levels in both untreated and dimethylsulfoxide (DMSO)-treated cells were decreased compared with their respective controls. Heme synthesis in AS clones was decreased in proportion to the suppressed levels of ALAS-E mRNA. In addition, mRNAs for ALA dehydratase, porphobilinogen deaminase, ferrochelatase (FeC), and beta-globin were also decreased in AS clones. There was a strong correlation between the level of ALAS-E mRNA and most of the mRNAs of the heme pathway enzymes and beta-globin. There was a decrease in the mRNA level of p45, but not of mafK, which are the large and the small subunits of NF-E2, respectively, in AS clones. Treatment of AS cells with hemin and ALA in the presence of DMSO partially restored the suppressed mRNA levels for beta-globin and FeC and heme content, respectively. These findings thus indicate that heme formation, which is determined by the level of ALAS-E, plays an essential role on gene expression of many proteins necessary for erythroid development. PMID:7620186

  14. Acute Myeloid Leukemia (AML) with Erythroid Predominance Exhibits Clinical and Molecular Characteristics that Differ from Other Types of AML

    OpenAIRE

    Zuo, Zhuang; Medeiros, L. Jeffrey; Chen, Zhao; Liu, Dingsheng; Bueso-Ramos, Carlos E.; Luthra, Rajyalakshmi; A.Wang, Sa

    2012-01-01

    The clinical importance of erythroid predominance in bone marrow of patients with acute myeloid leukemia (AML) is controversial. These cases represent a heterogeneous group of diseases that historically have been classified into different categories. We studied 313 AML patients and specifically compared the clinical, cytogenetic, and molecular features of cases of AML with erythroid predominance, arbitrarily defined as ≥50% erythroid precursors, to AML cases without erythroid predominance. We...

  15. Bmi-1 Regulates Extensive Erythroid Self-Renewal

    Directory of Open Access Journals (Sweden)

    Ah Ram Kim

    2015-06-01

    Full Text Available Red blood cells (RBCs, responsible for oxygen delivery and carbon dioxide exchange, are essential for our well-being. Alternative RBC sources are needed to meet the increased demand for RBC transfusions projected to occur as our population ages. We previously have discovered that erythroblasts derived from the early mouse embryo can self-renew extensively ex vivo for many months. To better understand the mechanisms regulating extensive erythroid self-renewal, global gene expression data sets from self-renewing and differentiating erythroblasts were analyzed and revealed the differential expression of Bmi-1. Bmi-1 overexpression conferred extensive self-renewal capacity upon adult bone-marrow-derived self-renewing erythroblasts, which normally have limited proliferative potential. Importantly, Bmi-1 transduction did not interfere with the ability of extensively self-renewing erythroblasts (ESREs to terminally mature either in vitro or in vivo. Bmi-1-induced ESREs can serve to generate in vitro models of erythroid-intrinsic disorders and ultimately may serve as a source of cultured RBCs for transfusion therapy.

  16. Beyond the VAD: Human Factors Engineering for Mechanically Assisted Circulation in the 21st Century.

    Science.gov (United States)

    Throckmorton, Amy L; Patel-Raman, Sonna M; Fox, Carson S; Bass, Ellen J

    2016-06-01

    Thousands of ventricular assist devices (VADs) currently provide circulatory support to patients worldwide, and dozens of heart pump designs for adults and pediatric patients are under various stages of development in preparation for translation to clinical use. The successful bench-to-bedside development of a VAD involves a structured evaluation of possible system states, including human interaction with the device and auxiliary component usage in the hospital or home environment. In this study, we review the literature and present the current landscape of preclinical design and assessment, decision support tools and procedures, and patient-centered therapy. Gaps of knowledge are identified. The study findings support the need for more attention to user-centered design approaches for medical devices, such as mechanical circulatory assist systems, that specifically involve detailed qualitative and quantitative assessments of human-device interaction to mitigate risk and failure. PMID:26511100

  17. Circulating plant miRNAs can regulate human gene expression in vitro

    Science.gov (United States)

    Pastrello, Chiara; Tsay, Mike; McQuaid, Rosanne; Abovsky, Mark; Pasini, Elisa; Shirdel, Elize; Angeli, Marc; Tokar, Tomas; Jamnik, Joseph; Kotlyar, Max; Jurisicova, Andrea; Kotsopoulos, Joanne; El-Sohemy, Ahmed; Jurisica, Igor

    2016-01-01

    While Brassica oleracea vegetables have been linked to cancer prevention, the exact mechanism remains unknown. Regulation of gene expression by cross-species microRNAs has been previously reported; however, its link to cancer suppression remains unexplored. In this study we address both issues. We confirm plant microRNAs in human blood in a large nutrigenomics study cohort and in a randomized dose-controlled trial, finding a significant positive correlation between the daily amount of broccoli consumed and the amount of microRNA in the blood. We also demonstrate that Brassica microRNAs regulate expression of human genes and proteins in vitro, and that microRNAs cooperate with other Brassica-specific compounds in a possible cancer-preventive mechanism. Combined, we provide strong evidence and a possible multimodal mechanism for broccoli in cancer prevention. PMID:27604570

  18. Influenza A Virus with a Human-Like N2 Gene Is Circulating in Pigs

    DEFF Research Database (Denmark)

    Breum, Solvej Østergaard; Hjulsager, Charlotte Kristiane; Trebbien, Ramona; Larsen, Lars Erik

    2013-01-01

    A novel reassortant influenza A virus, H1avN2hu, has been found in Danish swine. The virus contains an H1 gene similar to the hemagglutinin (HA) gene of H1N1 avian-like swine viruses and an N2 gene most closely related to the neuraminidase (NA) gene of human H3N2 viruses from the mid-1990s....

  19. Fifty cases of human immunodeficiency virus (HIV) infection: immunoultrastructural study of circulating lymphocytes.

    OpenAIRE

    Feremans, W W; Huygen, K.; Menu, R; Farber, C M; de Caluwe, J P; van Vooren, J P; Marcelis, L; Andre, L; Brasseur, M; Bondue, H

    1988-01-01

    The peripheral lymphocytes of 50 cases of human immunodeficiency virus (HIV) infection (13 of acquired immune deficiency syndrome (AIDS), 17 of AIDS related complex (ARC), and 20 healthy carriers) were studied immunoultrastructurally. The prevalence of "tubuloreticular structures" and "tubular confronting cisternae" increased with the progression of the disease. Numerous tubular confronting cisternae were noted in patients presenting with a high serum acid labile alpha-interferon values. The ...

  20. Regulation of circulating endocannabinoids associated with cancer and metastases in mice and humans

    OpenAIRE

    Sailler, Sebastian; Schmitz, Katja; Jäger, Elke; Ferreiros, Nerea; Wicker, Sabine; Zschiebsch, Katja; Pickert, Geethanjali; Geisslinger, Gerd; Walter, Carmen; Tegeder, Irmgard; Lötsch, Jörn

    2014-01-01

    Background and aims Endocannabinoids may modify cancer development, progression and associated pain. We determined whether cancer-evoked dysregulations in this system become manifest in altered tissue and plasma endocannabinoids. Methods Endocannabinoid changes due to cancer were explored in a local and metastatic syngeneic mouse melanoma model. Endocannabinoid stratification in human cancer was cross-sectionally assessed in the plasma of 304 patients (147 men, 157 women, aged 32 - 87 years) ...

  1. Neural control of the circulation: how sex and age differences interact in humans.

    Science.gov (United States)

    Joyner, Michael J; Barnes, Jill N; Hart, Emma C; Wallin, B Gunnar; Charkoudian, Nisha

    2015-01-01

    The autonomic nervous system is a key regulator of the cardiovascular system. In this review, we focus on how sex and aging influence autonomic regulation of blood pressure in humans in an effort to understand general issues related to the cardiovascular system as a whole. Younger women generally have lower blood pressure and sympathetic activity than younger men. However, both sexes show marked interindividual variability across age groups with significant overlap seen. Additionally, while men across the lifespan show a clear relationship between markers of whole body sympathetic activity and vascular resistance, such a relationship is not seen in young women. In this context, the ability of the sympathetic nerves to evoke vasoconstriction is lower in young women likely as a result of concurrent β2-mediated vasodilation that offsets α-adrenergic vasoconstriction. These differences reflect both central sympatho-inhibitory effects of estrogen and also its influence on peripheral vasodilation at the level of the vascular smooth muscle and endothelium. By contrast postmenopausal women show a clear relationship between markers of whole body sympathetic traffic and vascular resistance, and sympathetic activity rises progressively in both sexes with aging. These major findings in humans are discussed in the context of differences in population-based trends in blood pressure and orthostatic intolerance. The many areas where there is little sex-specific data on how the autonomic nervous system participates in the regulation of the human cardiovascular system are highlighted. PMID:25589269

  2. Fetal Circulation

    Science.gov (United States)

    ... Pressure High Blood Pressure Tools & Resources Stroke More Fetal Circulation Updated:Jul 8,2016 click to enlarge The ... fetal heart. These two bypass pathways in the fetal circulation make it possible for most fetuses to survive ...

  3. Reductions in circulating endocannabinoid 2-arachidonoylglycerol levels in healthy human subjects exposed to chronic stressors.

    Science.gov (United States)

    Yi, Buqing; Nichiporuk, Igor; Nicolas, Michel; Schneider, Stefan; Feuerecker, Matthias; Vassilieva, Galina; Thieme, Detlef; Schelling, Gustav; Choukèr, Alexander

    2016-06-01

    Increasing evidence indicates that chronic stress, such as social isolation, plays an important role in the development of a variety of psychiatric and somatic disorders. Meanwhile, chronic stress imposed by prolonged isolation and confinement in the spacecraft is also one of the major concerns for the health of future interplanetary space travelers. Preclinical studies suggest that the peripheral endocannabinoid (eCB) system is involved in the regulation of the stress response and eCB signaling is implicated in the pathogenesis of stress-related diseases. However, there are only few human studies addressing this topic, of which most focusing on patients who have already developed a certain type of disorder. It remains unknown whether chronic stress may affect eCB signaling in healthy humans. A 520-d isolation and confinement study simulating a flight to Mars provided an extraordinary chance to study the effects of prolonged stress in healthy humans. During the study period, the participants lived in confinement and could not meet their families, friends, or strangers for more than 500 days. We examined the impact of chronic exposure to isolation and confinement through monitoring their psychological state, brain cortical activity, sympathetic adrenal-medullary system response and eCB signaling response. We observed reduced positive emotion ratings, decreased brain cortical activities and high levels of catecholamine release, indicating that prolonged exposure to isolation and confinement stressors may bring about changes both psychologically and physiologically. Importantly, for eCB signaling response, blood concentrations of eCB 2-arachidonoylglycerol (2-AG), but not anandamide (AEA), were significantly reduced (p<0.001), suggesting that dysregulation of 2-AG signaling might be specifically implicated in the response to chronic stressors. PMID:26780604

  4. Occurring of In Vitro Functional Vasculogenic Pericytes from Human Circulating Early Endothelial Precursor Cell Culture

    Directory of Open Access Journals (Sweden)

    Silvia Cantoni

    2015-01-01

    Full Text Available Pericytes are periendothelial cells of the microcirculation which contribute to tissue homeostasis and hemostasis by regulating microvascular morphogenesis and stability. Because of their multipotential ex vivo differentiation capabilities, pericytes are becoming very interesting in regenerative medicine field. Several studies address this issue by attempting to isolate pericyte/mesenchymal-like cells from peripheral blood; however the origin of these cells and their culture conditions are still debated. Here we showed that early Endothelial Progenitor Cells (EPCs expressing CD45+/CD146+/CD31+ can be a source of cells with pericyte/mesenchymal phenotype and function, identified as human Progenitor Perivascular Cells (hPPCs. We provided evidence that hPPCs have an immunophenotype consistent with Mesenchymal Stem Cells (MSCs from human adipose tissue (hASCs and fetal membranes of term placenta (FM-hMSCs. In addition, hPPCs can be subcultured and exhibit expression of pluripotent genes (OCT-4, KLF-4, and NANOG as well as a remarkable vasculogenic potential. Our findings could be helpful to develop innovative cell-based therapies for future clinical applications with distinct therapeutic purposes.

  5. Circulating Vitamin D3 and 25-hydroxyvitamin D in Humans: An Important Tool to Define Adequate Nutritional Vitamin D Status

    OpenAIRE

    Bruce W Hollis; Wagner, Carol L.; Drezner, Mark K.; Binkley, Neil C

    2007-01-01

    Circulating 25-hydroxyvitamin D [25(OH)D] is generally considered the means by which we define nutritional vitamin D status. There is much debate, however, with respect to what a healthy minimum level of circulation 25(OH)D should be. Recent data using various biomarkers such as intact parathyroid hormone (PTH), intestinal calcium absorption, and skeletal density measurements suggest this minimum level to be 80 nmol (32 ng/mL). Surprisingly, the relationship between circulating vitamin D3 and...

  6. Insulin stimulates endothelin-1 secretion from human endothelial cells and modulates its circulating levels in vivo.

    Science.gov (United States)

    Ferri, C; Pittoni, V; Piccoli, A; Laurenti, O; Cassone, M R; Bellini, C; Properzi, G; Valesini, G; De Mattia, G; Santucci, A

    1995-03-01

    Endothelin-1 (ET-1) is a potent vasoactive and mitogenic peptide produced by the vascular endothelium. In this study, we evaluated whether insulin stimulates ET-1 secretion by human endothelial cells derived from umbilical cord veins and by human permanent endothelial hybrid cells Ea.hy 926. Moreover, to provide evidence that insulin may stimulate ET-1 secretion in vivo, plasma ET-1 levels were evaluated in 7 type II diabetic normotensive males (mean age, 54.3 +/- 4.0 yr) during 2-h hyperinsulinemic euglycemic clamps (287 pmol insulin/m2.min-1) as well as in 12 obese hypertensive males (mean age, 44.2 +/- 4.6 yr) before and after a 12-week period of caloric restriction. Our results showed that insulin stimulated ET-1 release from cultured endothelial cells in a dose-dependent fashion. ET-1 release persisted for 24 h and was also observed at physiological insulin concentrations (10(-9) mol/L). The insulin-induced ET-1 secretion was inhibited by genistein, a tyrosine kinase inhibitor, and by cycloheximide, a protein synthesis inhibitor, suggesting that it requires de novo protein synthesis rather than ET-1 release from intracellular stores. In the in vivo experiments, plasma ET-1 levels rapidly increased during euglycemic hyperinsulinemic clamps (from 0.76 +/- 0.18 pg/mL at time zero to 1.65 +/- 0.21 pg/mL at 60 min; P < 0.05) and persisted elevated until the end of insulin infusion (1.37 +/- 0.37 pg/mL at 120 min; P < 0.05 vs. time zero). In obese hypertensives, plasma ET-1 levels significantly decreased after 12 weeks of caloric restriction (from 0.85 +/- 0.51 to 0.48 +/- 0.28 pg/mL; P < 0.04). The decrease in body weight induced by caloric restriction was accompanied by a significant reduction in fasting insulin levels (from 167.2 +/- 94.0 to 98.9 +/- 44.9 pmol/L; P < 0.05) which correlated with the reduction in plasma ET-1 levels (r = 0.78; P < 0.003). In conclusion, our data show that insulin stimulates both in vitro and in vivo ET-1 secretion. Such interaction

  7. Recombinant erythropoietin in humans has a prolonged effect on circulating erythropoietin isoform distribution

    DEFF Research Database (Denmark)

    Aachmann-Andersen, Niels Jacob; Just Christensen, Søren; Lisbjerg, Kristian;

    2014-01-01

    The membrane-assisted isoform immunoassay (MAIIA) quantitates erythropoietin (EPO) isoforms as percentages of migrated isoforms (PMI). We evaluated the effect of recombinant human EPO (rhEPO) on the distribution of EPO isoforms in plasma in a randomized, placebo-controlled, double-blinded, cross......-over study. 16 healthy subjects received either low-dose Epoetin beta (5000 IU on days 1, 3, 5, 7, 9, 11 and 13); high-dose Epoetin beta (30.000 IU on days 1, 2 and 3 and placebo on days 5, 7, 9, 11 and 13); or placebo on all days. PMI on days 4, 11 and 25 was determined by interaction of N......-acetyl glucosamine with the glycosylation dependent desorption of EPO isoforms. At day 25, plasma-EPO in both rhEPO groups had returned to values not different from the placebo group. PMI with placebo, reflecting the endogenous EPO isoforms, averaged 82.5 (10.3) % (mean (SD)). High-dose Epoetin beta decreased PMI on...

  8. Phenotypic Features of Circulating Leukocytes from Non-human Primates Naturally Infected with Trypanosoma cruzi Resemble the Major Immunological Findings Observed in Human Chagas Disease.

    Directory of Open Access Journals (Sweden)

    Renato Sathler-Avelar

    2016-01-01

    Full Text Available Cynomolgus macaques (Macaca fascicularis represent a feasible model for research on Chagas disease since natural T. cruzi infection in these primates leads to clinical outcomes similar to those observed in humans. However, it is still unknown whether these clinical similarities are accompanied by equivalent immunological characteristics in the two species. We have performed a detailed immunophenotypic analysis of circulating leukocytes together with systems biology approaches from 15 cynomolgus macaques naturally infected with T. cruzi (CH presenting the chronic phase of Chagas disease to identify biomarkers that might be useful for clinical investigations.Our data established that CH displayed increased expression of CD32+ and CD56+ in monocytes and enhanced frequency of NK Granzyme A+ cells as compared to non-infected controls (NI. Moreover, higher expression of CD54 and HLA-DR by T-cells, especially within the CD8+ subset, was the hallmark of CH. A high level of expression of Granzyme A and Perforin underscored the enhanced cytotoxicity-linked pattern of CD8+ T-lymphocytes from CH. Increased frequency of B-cells with up-regulated expression of Fc-γRII was also observed in CH. Complex and imbricate biomarker networks demonstrated that CH showed a shift towards cross-talk among cells of the adaptive immune system. Systems biology analysis further established monocytes and NK-cell phenotypes and the T-cell activation status, along with the Granzyme A expression by CD8+ T-cells, as the most reliable biomarkers of potential use for clinical applications.Altogether, these findings demonstrated that the similarities in phenotypic features of circulating leukocytes observed in cynomolgus macaques and humans infected with T. cruzi further supports the use of these monkeys in preclinical toxicology and pharmacology studies applied to development and testing of new drugs for Chagas disease.

  9. Biophysical Properties of Scaffolds Modulate Human Blood Vessel Formation from Circulating Endothelial Colony-Forming Cells

    Science.gov (United States)

    Critser, Paul J.; Yoder, Mervin C.

    A functional vascular system forms early in development and is continually remodeled throughout the life of the organism. Impairment to the regeneration or repair of this system leads to tissue ischemia, dysfunction, and disease. The process of vascular formation and remodeling is complex, relying on local microenvironmental cues, cytokine signaling, and multiple cell types to function properly. Tissue engineering strategies have attempted to exploit these mechanisms to develop functional vascular networks for the generation of artificial tissues and therapeutic strategies to restore tissue homeostasis. The success of these strategies requires the isolation of appropriate progenitor cell sources which are straightforward to obtain, display high proliferative potential, and demonstrate an ability to form functional vessels. Several populations are of interest including endothelial colony-forming cells, a subpopulation of endothelial progenitor cells. Additionally, the development of scaffolds to deliver and support progenitor cell survival and function is crucial for the formation of functional vascular networks. The composition and biophysical properties of these scaffolds have been shown to modulate endothelial cell behavior and vessel formation. However, further investigation is needed to better understand how these mechanical properties and biophysical properties impact vessel formation. Additionally, several other cell populations are involved in neoangiogenesis and formation of tissue parenchyma and an understanding of the potential impact of these cell populations on the biophysical properties of scaffolds will also be needed to advance these strategies. This chapter examines how the biophysical properties of matrix scaffolds can influence vessel formation and remodeling and, in particular, the impact on in vivo human endothelial progenitor cell vessel formation.

  10. Recombinant erythropoietin in humans has a prolonged effect on circulating erythropoietin isoform distribution.

    Directory of Open Access Journals (Sweden)

    Niels Jacob Aachmann-Andersen

    Full Text Available The membrane-assisted isoform immunoassay (MAIIA quantitates erythropoietin (EPO isoforms as percentages of migrated isoforms (PMI. We evaluated the effect of recombinant human EPO (rhEPO on the distribution of EPO isoforms in plasma in a randomized, placebo-controlled, double-blinded, cross-over study. 16 healthy subjects received either low-dose Epoetin beta (5000 IU on days 1, 3, 5, 7, 9, 11 and 13; high-dose Epoetin beta (30.000 IU on days 1, 2 and 3 and placebo on days 5, 7, 9, 11 and 13; or placebo on all days. PMI on days 4, 11 and 25 was determined by interaction of N-acetyl glucosamine with the glycosylation dependent desorption of EPO isoforms. At day 25, plasma-EPO in both rhEPO groups had returned to values not different from the placebo group. PMI with placebo, reflecting the endogenous EPO isoforms, averaged 82.5 (10.3 % (mean (SD. High-dose Epoetin beta decreased PMI on days 4 and 11 to 31.0 (4.2% (p<0.00001 and 45.2 (7.3% (p<0.00001. Low-dose Epoetin beta decreased PMI on days 4 and 11 to 46.0 (12.8% (p<0.00001 and 46.1 (10.4% (p<0.00001. In both rhEPO groups, PMI on day 25 was still decreased (high-dose Epoetin beta: 72.9 (19.4% (p=0.029; low-dose Epoetin beta: 73.1 (17.8% (p=0.039. In conclusion, Epoetin beta leaves a footprint in the plasma-EPO isoform pattern. MAIIA can detect changes in EPO isoform distribution up til at least three weeks after administration of Epoetin beta even though the total EPO concentration has returned to normal.

  11. Human circulating monocytes internalize 125I-insulin in a similar fashion to rat hepatocytes: relevance to receptor regulation in target and nontarget tissues

    International Nuclear Information System (INIS)

    Circulating monocytes bind 125I-insulin in a specific fashion and have been used to analyze the ambient receptor status in humans. When freshly isolated circulating monocytes are incubated with 125I-insulin and examined by electron microscopic autoradiography, approximately 18% of the labeled material is internalized after 15 minutes at 37 degrees C. By 2 hours at 37 degrees C, approximately one half of the 125I-insulin is internalized. Internalization occurs also at 15 degrees C but at a slower rate. Furthermore, the monocytes bind and internalize 125I-insulin in a manner that mirrors that of major target tissues, such as rat hepatocytes. These data suggest that the insulin receptor of the circulating monocyte might be regulated by adsorptive endocytosis in a manner analogous to that of target tissue, such as the liver

  12. Circulating Tumor Necrosis Factor α Receptors Predict the Outcomes of Human IgA Nephropathy: A Prospective Cohort Study.

    Directory of Open Access Journals (Sweden)

    Yun Jung Oh

    Full Text Available The circulating tumor necrosis factor receptors (TNFRs could predict the long-term renal outcome in diabetes, but the role of circulating TNFRs in other chronic kidney disease has not been reported. Here, we investigated the correlation between circulating TNFRs and renal histologic findings on kidney biopsy in IgA nephropathy (IgAN and assessed the notion that the circulating TNFRs could predict the clinical outcome. 347 consecutive biopsy-proven IgAN patients between 2006 and 2012 were prospectively enrolled. Concentrations of circulating TNFRs were measured using serum samples stored at the time of biopsy. The primary clinical endpoint was the decline of estimated glomerular filtration rate (eGFR; ≥ 30% decline compared to baseline. Mean eGFR decreased and proteinuria worsened proportionally as circulating TNFR1 and TNFR2 increased (P < 0.001. Tubulointerstitial lesions such as interstitial fibrosis and tubular atrophy were significantly more severe as concentrations of circulating TNFRs increased, regardless of eGFR levels. The risks of reaching the primary endpoint were significantly higher in the highest quartile of TNFRs compared with other quartiles by the Cox proportional hazards model (TNFR1; hazard ratio 7.48, P < 0.001, TNFR2; hazard ratio 2.51, P = 0.021. In stratified analysis according to initial renal function classified by the eGFR levels of 60 mL/min/1.73 m2, TNFR1 and TNFR2 were significant predictors of renal progression in both subgroups. In conclusion, circulating TNFRs reflect the histology and clinical severity of IgAN. Moreover, elevated concentrations of circulating TNFRs at baseline are early biomarkers for subsequent renal progression in IgAN patients.

  13. Lung Circulation.

    Science.gov (United States)

    Suresh, Karthik; Shimoda, Larissa A

    2016-01-01

    The circulation of the lung is unique both in volume and function. For example, it is the only organ with two circulations: the pulmonary circulation, the main function of which is gas exchange, and the bronchial circulation, a systemic vascular supply that provides oxygenated blood to the walls of the conducting airways, pulmonary arteries and veins. The pulmonary circulation accommodates the entire cardiac output, maintaining high blood flow at low intravascular arterial pressure. As compared with the systemic circulation, pulmonary arteries have thinner walls with much less vascular smooth muscle and a relative lack of basal tone. Factors controlling pulmonary blood flow include vascular structure, gravity, mechanical effects of breathing, and the influence of neural and humoral factors. Pulmonary vascular tone is also altered by hypoxia, which causes pulmonary vasoconstriction. If the hypoxic stimulus persists for a prolonged period, contraction is accompanied by remodeling of the vasculature, resulting in pulmonary hypertension. In addition, genetic and environmental factors can also confer susceptibility to development of pulmonary hypertension. Under normal conditions, the endothelium forms a tight barrier, actively regulating interstitial fluid homeostasis. Infection and inflammation compromise normal barrier homeostasis, resulting in increased permeability and edema formation. This article focuses on reviewing the basics of the lung circulation (pulmonary and bronchial), normal development and transition at birth and vasoregulation. Mechanisms contributing to pathological conditions in the pulmonary circulation, in particular when barrier function is disrupted and during development of pulmonary hypertension, will also be discussed. © 2016 American Physiological Society. Compr Physiol 6:897-943, 2016. PMID:27065170

  14. Calcium regulates the commitment of murine erythroleukemia cells to terminal erythroid differentiation

    OpenAIRE

    1981-01-01

    An alteration in the rate of calcium transport appears to be the rate- limiting event for the commitment of murine erythroleukemia (MEL) cells to initiate a program of terminal erythroid differentiation. The dimethyl sulfoxide (DMSO)-induced commitment of MEL cells to erythroid differentiation can be inhibited by treatment of cells with the calcium- chelating agent EGTA. Upon removal of EGTA, cells initiate commitment without the 12-h lag normally observed after treatment with DMSO alone. Tre...

  15. Globin gene expression in correlation with G protein-related genes during erythroid differentiation

    OpenAIRE

    Vladan P Čokić; Smith, Reginald D.; Biancotto, Angélique; Noguchi, Constance T.; Puri, Raj K.; Schechter, Alan N.

    2013-01-01

    Background The guanine nucleotide binding protein (G protein)-coupled receptors (GPCRs) regulate cell growth, proliferation and differentiation. G proteins are also implicated in erythroid differentiation, and some of them are expressed principally in hematopoietic cells. GPCRs-linked NO/cGMP and p38 MAPK signaling pathways already demonstrated potency for globin gene stimulation. By analyzing erythroid progenitors, derived from hematopoietic cells through in vitro ontogeny, our study intends...

  16. Nuclear factor, erythroid 2-like 2-associated molecular signature predicts lung cancer survival.

    Science.gov (United States)

    Qian, Zhongqing; Zhou, Tong; Gurguis, Christopher I; Xu, Xiaoyan; Wen, Qing; Lv, Jingzhu; Fang, Fang; Hecker, Louise; Cress, Anne E; Natarajan, Viswanathan; Jacobson, Jeffrey R; Zhang, Donna D; Garcia, Joe G N; Wang, Ting

    2015-01-01

    Nuclear factor, erythroid 2-like 2 (NFE2L2), a transcription factor also known as NF-E2-related factor 2 (Nrf2), is a key cytoprotective gene that regulates critical antioxidant and stress-responsive genes. Nrf2 has been demonstrated to be a promising therapeutic target and useful biomarker in malignant disease. We hypothesized that NFE2L2-mediated gene expression would reflect cancer severity and progression. We conducted a meta-analysis of microarray data for 240 NFE2L2-mediated genes that were enriched in tumor tissues. We then developed a risk scoring system based on NFE2L2 gene expression profiling and designated 50 tumor-associated genes as the NFE2L2-associated molecular signature (NAMS). We tested the relationship between this gene expression signature and both recurrence-free survival and overall survival in lung cancer patients. We find that NAMS predicts clinical outcome in the training cohort and in 12 out of 20 validation cohorts. Cox proportional hazard regressions indicate that NAMS is a robust prognostic gene signature, independent of other clinical and pathological factors including patient age, gender, smoking, gene alteration, MYC level, and cancer stage. NAMS is an excellent predictor of recurrence-free survival and overall survival in human lung cancer. This gene signature represents a promising prognostic biomarker in human lung cancer. PMID:26596768

  17. Evolving insights into the synergy between erythropoietin and thrombopoietin and the bipotent erythroid/megakaryocytic progenitor cell.

    Science.gov (United States)

    Papayannopoulou, Thalia; Kaushansky, Kenneth

    2016-08-01

    Although the synergy between erythropoietin and thrombopoietin has previously been pointed out, the clonal demonstration of a human bipotent erythroid/megakaryocytic progenitor (MEP) was first published in Experimental Hematology (Papayannopoulou T, Brice M, Farrer D, Kaushansky K. Exp Hematol. 1996;24:660-669) and later in the same year in Blood (Debili N, Coulombel L, Croisille L, et al. Blood. 1996;88:1284-1296). This demonstration, and the fact that both bipotent and monopotent erythroid or megakaryocytic progenitors co-express markers of both lineages and respond to both lineage-specific transcription factors, has provided a background for the extensive use of MEP assessment by fluorescence-activated cell sorting in many subsequent studies. Beyond this, the demonstration of shared regulatory elements and the presence of single mutations affecting both lineages have inspired further studies to decipher how the shift in transcription factor networks occurs from one lineage to the other. Furthermore, in addition to shared effects, erythropoietin and thrombopoietin have additional independent effects. Most notable for thrombopoietin is its effect on hematopoietic stem cells illustrated by in vitro and in vivo approaches. PMID:26773569

  18. Characterization of a Distinct Population of Circulating Human Non-Adherent Endothelial Forming Cells and Their Recruitment via Intercellular Adhesion Molecule-3

    OpenAIRE

    Appleby, Sarah L.; Cockshell, Michaelia P.; Pippal, Jyotsna B.; Thompson, Emma J.; Barrett, Jeffrey M.; Katie Tooley; Shaundeep Sen; Wai Yan Sun; Randall Grose; Ian Nicholson; Vitalina Levina; Ira Cooke; Gert Talbo; Lopez, Angel F.; Bonder, Claudine S.

    2012-01-01

    Circulating vascular progenitor cells contribute to the pathological vasculogenesis of cancer whilst on the other hand offer much promise in therapeutic revascularization in post-occlusion intervention in cardiovascular disease. However, their characterization has been hampered by the many variables to produce them as well as their described phenotypic and functional heterogeneity. Herein we have isolated, enriched for and then characterized a human umbilical cord blood derived CD133(+) popul...

  19. Repression by RB1 characterizes genes involved in the penultimate stage of erythroid development.

    Science.gov (United States)

    Zhang, Ji; Loyd, Melanie R; Randall, Mindy S; Morris, John J; Shah, Jayesh G; Ney, Paul A

    2015-01-01

    Retinoblastoma-1 (RB1), and the RB1-related proteins p107 and p130, are key regulators of the cell cycle. Although RB1 is required for normal erythroid development in vitro, it is largely dispensable for erythropoiesis in vivo. The modest phenotype caused by RB1 deficiency in mice raises questions about redundancy within the RB1 family, and the role of RB1 in erythroid differentiation. Here we show that RB1 is the major pocket protein that regulates terminal erythroid differentiation. Erythroid cells lacking all pocket proteins exhibit the same cell cycle defects as those deficient for RB1 alone. RB1 has broad repressive effects on gene transcription in erythroid cells. As a group, RB1-repressed genes are generally well expressed but downregulated at the final stage of erythroid development. Repression correlates with E2F binding, implicating E2Fs in the recruitment of RB1 to repressed genes. Merging differential and time-dependent changes in expression, we define a group of approximately 800 RB1-repressed genes. Bioinformatics analysis shows that this list is enriched for terms related to the cell cycle, but also for terms related to terminal differentiation. Some of these have not been previously linked to RB1. These results expand the range of processes potentially regulated by RB1, and suggest that a principal role of RB1 in development is coordinating the events required for terminal differentiation. PMID:26397180

  20. The estrogen receptor cooperates with the TGF alpha receptor (c-erbB) in regulation of chicken erythroid progenitor self-renewal.

    Science.gov (United States)

    Schroeder, C; Gibson, L; Nordström, C; Beug, H

    1993-03-01

    A unique combination of growth promoting factors is described that allows growth of large amounts (10(10)-10(11)) of normal erythroid progenitors from chick bone marrow. These erythroid progenitors express the estrogen receptor (ER) as well as the receptor tyrosine kinase TGF alpha R/c-erbB. They require both TGF alpha and estradiol for sustained self-renewal in vitro, but terminally differentiate upon withdrawal of TGF alpha and inactivation of the ER by an antagonist (ICI 164.384). Overexpression of the human ER in erythroblasts devoid of endogenous ER revealed that the hormone-activated ER alone arrested erythroid differentiation and repressed a large group of erythrocyte genes. When similarly overexpressed, TGF alpha R/c-erbB inhibited the expression of a distinct, but overlapping, set of genes. The endogenous ER and TGF alpha R/c-erbB affect erythrocyte gene expression in a similar, but less pronounced fashion. Surprisingly, suppression of ER function by antagonist efficiently inhibited erythroblast transformation by tyrosine kinase oncogenes, suggesting a role of the endogenous ER in leukemogenesis. We speculate that the oncogenes v-erbB and v-erbA cooperate in erythroleukemia induction by a mechanism that is employed by TGF alpha R/c-erbB and ER to regulate normal progenitor self-renewal in response to external signals. PMID:8458346

  1. Nuclear RNA sequencing of the mouse erythroid cell transcriptome.

    Directory of Open Access Journals (Sweden)

    Jennifer A Mitchell

    Full Text Available In addition to protein coding genes a substantial proportion of mammalian genomes are transcribed. However, most transcriptome studies investigate steady-state mRNA levels, ignoring a considerable fraction of the transcribed genome. In addition, steady-state mRNA levels are influenced by both transcriptional and posttranscriptional mechanisms, and thus do not provide a clear picture of transcriptional output. Here, using deep sequencing of nuclear RNAs (nucRNA-Seq in parallel with chromatin immunoprecipitation sequencing (ChIP-Seq of active RNA polymerase II, we compared the nuclear transcriptome of mouse anemic spleen erythroid cells with polymerase occupancy on a genome-wide scale. We demonstrate that unspliced transcripts quantified by nucRNA-seq correlate with primary transcript frequencies measured by RNA FISH, but differ from steady-state mRNA levels measured by poly(A-enriched RNA-seq. Highly expressed protein coding genes showed good correlation between RNAPII occupancy and transcriptional output; however, genome-wide we observed a poor correlation between transcriptional output and RNAPII association. This poor correlation is due to intergenic regions associated with RNAPII which correspond with transcription factor bound regulatory regions and a group of stable, nuclear-retained long non-coding transcripts. In conclusion, sequencing the nuclear transcriptome provides an opportunity to investigate the transcriptional landscape in a given cell type through quantification of unspliced primary transcripts and the identification of nuclear-retained long non-coding RNAs.

  2. Human circulating monocytes can express receptor activator of nuclear factor-kappaB ligand and differentiate into functional osteoclasts without exogenous stimulation.

    Science.gov (United States)

    Seta, Noriyuki; Okazaki, Yuka; Kuwana, Masataka

    2008-07-01

    Osteoclast formation from mononuclear precursors is believed to require accessory cells expressing receptor activator of nuclear factor-kappaB ligand (RANKL). We recently identified a human cell population originated from circulating CD14(+) monocytes, called monocyte-derived multipotential cells (MOMCs), which can differentiate into several distinct mesenchymal cells, neuron and endothelial cells. This study was undertaken to examine whether MOMCs can differentiate into functional osteoclasts. MOMCs prepared from peripheral blood of healthy volunteers cultured on fibronectin for 7 days at high density (8 x 10(5) cells cm(-2)), but not at regular density (2 x 10(4) cells cm(-2)), resulted in the appearance of tartrate-resistant acid phosphatase-positive giant multi-nucleated cells forming actin ring without exogenous osteoclastogenic factors. A subset of these cells showed bone resorption capacity on dentine slices and expression of genes for cathepsin K and calcitonin receptor, characteristic of functional osteoclasts. Such osteoclast differentiation was not observed in high-density culture of circulating monocytes, macrophages or dendritic cells, or the high-density culture of MOMCs on type I collagen. Among cells of the monocyte lineage, untreated MOMCs exclusively showed gene and protein expression of RANKL. When osteoprotegerin/IgG1 Fc chimera was added to high-density MOMC cultures, osteoclast formation was completely inhibited by neutralizing the endogenous RANKL. These results indicate that human MOMCs derived from circulating monocytes can express RANKL and differentiate into functional osteoclasts without RANKL-expressing accessory cells. PMID:18301383

  3. Iron as the Key Modulator of Hepcidin Expression in Erythroid Antibody-Mediated Hypoplasia

    Directory of Open Access Journals (Sweden)

    J. C. Fernandes

    2014-01-01

    Full Text Available Erythroid hypoplasia (EH is a rare complication associated with recombinant human erythropoietin (rHuEPO therapies, due to development of anti-rHuEPO antibodies; however, the underlying mechanisms remain poorly clarified. Our aim was to manage a rat model of antibody-mediated EH induced by rHuEPO and study the impact on iron metabolism and erythropoiesis. Wistar rats treated during 9 weeks with a high rHuEPO dose (200 IU developed EH, as shown by anemia, reduced erythroblasts, reticulocytopenia, and plasmatic anti-rHuEPO antibodies. Serum iron was increased and associated with mRNA overexpression of hepatic hepcidin and other iron regulatory mediators and downregulation of matriptase-2; overexpression of divalent metal transporter 1 and ferroportin was observed in duodenum and liver. Decreased EPO expression was observed in kidney and liver, while EPO receptor was overexpressed in liver. Endogenous EPO levels were normal, suggesting that anti-rHuEPO antibodies blunted EPO function. Our results suggest that anti-rHuEPO antibodies inhibit erythropoiesis causing anemia. This leads to a serum iron increase, which seems to stimulate hepcidin expression despite no evidence of inflammation, thus suggesting iron as the key modulator of hepcidin synthesis. These findings might contribute to improving new therapeutic strategies against rHuEPO resistance and/or development of antibody-mediated EH in patients under rHuEPO therapy.

  4. Comparative RNA-sequencing analysis of myocardial and circulating small RNAs in human heart failure and their utility as biomarkers

    Science.gov (United States)

    Akat, Kemal Marc; Moore-McGriff, D’Vesharronne; Morozov, Pavel; Brown, Miguel; Gogakos, Tasos; Correa Da Rosa, Joel; Mihailovic, Aleksandra; Sauer, Markus; Ji, Ruiping; Ramarathnam, Aarthi; Totary-Jain, Hana; Williams, Zev; Tuschl, Thomas; Schulze, P. Christian

    2014-01-01

    Heart failure (HF) is associated with high morbidity and mortality and its incidence is increasing worldwide. MicroRNAs (miRNAs) are potential markers and targets for diagnostic and therapeutic applications, respectively. We determined myocardial and circulating miRNA abundance and its changes in patients with stable and end-stage HF before and at different time points after mechanical unloading by a left ventricular assist device (LVAD) by small RNA sequencing. miRNA changes in failing heart tissues partially resembled that of fetal myocardium. Consistent with prototypical miRNA–target-mRNA interactions, target mRNA levels were negatively correlated with changes in abundance for highly expressed miRNAs in HF and fetal hearts. The circulating small RNA profile was dominated by miRNAs, and fragments of tRNAs and small cytoplasmic RNAs. Heart- and muscle-specific circulating miRNAs (myomirs) increased up to 140-fold in advanced HF, which coincided with a similar increase in cardiac troponin I (cTnI) protein, the established marker for heart injury. These extracellular changes nearly completely reversed 3 mo following initiation of LVAD support. In stable HF, circulating miRNAs showed less than fivefold differences compared with normal, and myomir and cTnI levels were only captured near the detection limit. These findings provide the underpinning for miRNA-based therapies and emphasize the usefulness of circulating miRNAs as biomarkers for heart injury performing similar to established diagnostic protein biomarkers. PMID:25012294

  5. Induction of erythroid differentiation by cytoplast fusion in mouse erythroleukemia (Friend) cells

    International Nuclear Information System (INIS)

    An intracellular activity, which is induced by dimethyl sulfoxide (DMSO) or hexamethylenebisacetamide (HMBA) and leads to erythroid differentiation in mouse Friend cells, was characterized by cell fusion between genetically marked intact cells and cytoplasts. For this, a procedure for rapid selection of cybrids was devised by sensitizing non-fused cells with oligomycin. The authors were able to demonstrate that cytoplasts derived from DMSO- (or HMBA)-treated cells trigger erythroid differentiation upon fusion with UV-irradiated cells. The activity in the cytoplasts remained only transiently and its induction was inhibited by biologically active phorbol esters or cycloheximide. The activity, however, was not induced in cytoplasts by directly treating them with DMSO (or HMBA). These results indicate that (1) the intracellular erythroid-inducing activity is located in cytoplasts, (2) it acts in trans and induces erythroid differentiation as a dominant factor and (3) its production requires de novo nuclear protein synthesis. The mechanisms of the induction of the intracellular activity and of how it triggers erythroid differentiation are discussed

  6. The circulation physiology of agroecosystems

    Institute of Scientific and Technical Information of China (English)

    Cao Zhiping; Richard Dawson

    2007-01-01

    This paper represents an effort to enlarge the understanding of the biophysical foundation of agroecosystems by using an analogy with the circulation of the blood in the human body. The circulation function in the human body can be represented as arterial pressure. The factors affecting arterial pressure in the human body have direct counterparts in the cultivation-husbandry system. The relationship between circulation pressure and the factors affecting that pressure in the cultivation-husbandry system are similar to the relationship between the arterial pressure and factors affecting arterial pressure in the human body. Furthermore, circulation resistance in the cultivation-husbandry system can be shown to be analogous to the calculation of peripheral resistance in the human body by Poiseuille's formula.

  7. Antigenic and genomic characterization of human influenza A and B viruses circulating in Argentina after the introduction of influenza A(H1N1)pdm09.

    Science.gov (United States)

    Russo, Mara L; Pontoriero, Andrea V; Benedetti, Estefania; Czech, Andrea; Avaro, Martin; Periolo, Natalia; Campos, Ana M; Savy, Vilma L; Baumeister, Elsa G

    2014-12-01

    This study was conducted as part of the Argentinean Influenza and other Respiratory Viruses Surveillance Network, in the context of the Global Influenza Surveillance carried out by the World Health Organization (WHO). The objective was to study the activity and the antigenic and genomic characteristics of circulating viruses for three consecutive seasons (2010, 2011 and 2012) in order to investigate the emergence of influenza viral variants. During the study period, influenza virus circulation was detected from January to December. Influenza A and B, and all current subtypes of human influenza viruses, were present each year. Throughout the 2010 post-pandemic season, influenza A(H1N1)pdm09, unexpectedly, almost disappeared. The haemagglutinin (HA) of the A(H1N1)pdm09 viruses studied were segregated in a different genetic group to those identified during the 2009 pandemic, although they were still antigenically closely related to the vaccine strain A/California/07/2009. Influenza A(H3N2) viruses were the predominant strains circulating during the 2011 season, accounting for nearly 76 % of influenza viruses identified. That year, all HA sequences of the A(H3N2) viruses tested fell into the A/Victoria/208/2009 genetic clade, but remained antigenically related to A/Perth/16/2009 (reference vaccine recommended for this three-year period). A(H3N2) viruses isolated in 2012 were antigenically closely related to A/Victoria/361/2011, recommended by the WHO as the H3 component for the 2013 Southern Hemisphere formulation. B viruses belonging to the B/Victoria lineage circulated in 2010. A mixed circulation of viral variants of both B/Victoria and B/Yamagata lineages was detected in 2012, with the former being predominant. A(H1N1)pdm09 viruses remained antigenically closely related to the vaccine virus A/California/7/2009; A(H3N2) viruses continually evolved into new antigenic clusters and both B lineages, B/Victoria/2/87-like and B/Yamagata/16/88-like viruses, were observed

  8. The effect of circulating antigen on the biodistribution of the engineered human antibody hCTM01 in a nude mice model

    International Nuclear Information System (INIS)

    Clinical studies are currently underway to assess the biodistribution and therapeutic potential of the genetically engineered human antibody hCTM01 directed against polymorphic epithelial mucin (PEM) in patients with ovarian carcinoma. The present study was undertaken to assess the effect of circulating PEM antigen on the biodistribution of the anti-PEM antibody in mice bearing MUC-1 transfected adenocarcinoma cell lines. Tumour xenografts were established from three cell lines: 413-BCR, which expressed antigen on the cell surface and also shed antigen into the circulation, E3P23, which expressed the antigen but did not shed into the circulation, and a negative control (410.4 MUCI). Groups of five mice were injected with 1.0 mg/kg antibody, imaged after 72 h and then sacrificed, followed by assay of tissue uptake. The results showed a clear difference in the tumour and liver uptake, with the non-secreting cell line showing almost twice the tumour uptake and approximately 20% of the liver uptake of the secreting cell line. (orig.). With 4 figs., 1 tab

  9. The SOD1 transgene expressed in erythroid cells alleviates fatal phenotype in congenic NZB/NZW-F1 mice.

    Science.gov (United States)

    Otsuki, Noriyuki; Konno, Tasuku; Kurahashi, Toshihiro; Suzuki, Saori; Lee, Jaeyong; Okada, Futoshi; Iuchi, Yoshihito; Homma, Takujiro; Fujii, Junichi

    2016-07-01

    Oxidative stress due to a superoxide dismutase 1 (SOD1) deficiency causes anemia and autoimmune responses, which are phenotypically similar to autoimmune hemolytic anemia (AIHA) and systemic lupus erythematosus (SLE) in C57BL/6 mice and aggravates AIHA pathogenesis in New Zealand black (NZB) mice. We report herein on an evaluation of the role of reactive oxygen species (ROS) in a model mouse with inherited SLE, that is, F1 mice of the NZB × New Zealand white (NZW) strain. The ROS levels within red blood cells (RBCs) of the F1 mice were similar to the NZW mice but lower compared to the NZB mice throughout adult period. Regarding SLE pathogenesis, we examined the effects of an SOD1 deficiency or the overexpression of human SOD1 in erythroid cells by establishing corresponding congenic F1 mice. A SOD1 deficiency caused an elevation in ROS production, methemoglobin content, and hyperoxidation of peroxiredoxin in RBC of the F1 mice, which were all consistent with elevated oxidative stress. However, while the overexpression of human SOD1 in erythroid cells extended the life span of the congenic F1 mice, the SOD1 deficiency had no effect on life span compared to wild-type F1 mice. It is generally recognized that NZW mice possess a larval defect in the immune system and that NZB mice trigger an autoimmune reaction in the F1 mice. Our results suggest that the oxidative insult originated from the NZB mouse background has a functional role in triggering an aberrant immune reaction, leading to fatal responses in F1 mice. PMID:27080108

  10. Affinity isolation of antigen-specific circulating B cells for generation of phage display-derived human monoclonal antibodies

    DEFF Research Database (Denmark)

    Ditzel, Henrik

    2009-01-01

    A method is described for affinity isolation of antigen-specific circulating B cells of interest for subsequent generation of immune antibody phage display libraries. This approach should overcome the problem of low yields of monoclonal antibodies of interest in the libraries generated from...... the frequency of antibody phage particles of interest in the library and allow for efficient isolation monoclonal antibodies with the predefined specificity....

  11. Comparative RNA-sequencing analysis of myocardial and circulating small RNAs in human heart failure and their utility as biomarkers

    OpenAIRE

    Akat, Kemal Marc; Moore-McGriff, D’Vesharronne; Morozov, Pavel; Brown, Miguel; Gogakos, Tasos; Correa da Rosa, Joel; Mihailovic, Aleksandra; Sauer, Markus; Ji, Ruiping; Ramarathnam, Aarthi; Totary-Jain, Hana; Williams, Zev; Tuschl, Thomas; Schulze, P. Christian

    2014-01-01

    Heart failure (HF) has a high morbidity and mortality and its incidence is increasing worldwide. While protein biomarkers have been established for diagnostic and prognostic evaluation of patients with HF, there is currently no systematic assessment of RNA biomarkers. We determined the composition of myocardial tissue and circulating microRNAs (miRNAs) in a large cohort of patients with stable and advanced HF and compared it to the composition of normal adult and fetal samples. The advanced H...

  12. Relative levels of the proprotein and cleavage‐activated form of circulating human anti‐Müllerian hormone are sexually dimorphic and variable during the life cycle

    OpenAIRE

    Pankhurst, Michael W.; Chong, Yih Harng; McLennan, Ian S.

    2016-01-01

    Abstract Anti‐Müllerian hormone (AMH) is a gonadal hormone, which induces aspects of the male phenotype, and influences ovarian follicular recruitment. AMH is synthesized as a proprotein (proAMH), which is incompletely cleaved to the receptor‐competent AMHN ,C. AMH ELISAs have not distinguished between proAMH and AMHN ,C; consequently, the physiological ranges of circulating proAMH and AMHN ,C are unknown. A novel proAMH ELISA has been used to assay serum proAMH in humans. Total AMH was also ...

  13. Identification of Cell Type-Specific Differences in Erythropoietin Receptor Signaling in Primary Erythroid and Lung Cancer Cells

    Science.gov (United States)

    Salopiata, Florian; Depner, Sofia; Wäsch, Marvin; Böhm, Martin E.; Mücke, Oliver; Plass, Christoph; Lehmann, Wolf D.; Kreutz, Clemens; Timmer, Jens; Klingmüller, Ursula

    2016-01-01

    Lung cancer, with its most prevalent form non-small-cell lung carcinoma (NSCLC), is one of the leading causes of cancer-related deaths worldwide, and is commonly treated with chemotherapeutic drugs such as cisplatin. Lung cancer patients frequently suffer from chemotherapy-induced anemia, which can be treated with erythropoietin (EPO). However, studies have indicated that EPO not only promotes erythropoiesis in hematopoietic cells, but may also enhance survival of NSCLC cells. Here, we verified that the NSCLC cell line H838 expresses functional erythropoietin receptors (EPOR) and that treatment with EPO reduces cisplatin-induced apoptosis. To pinpoint differences in EPO-induced survival signaling in erythroid progenitor cells (CFU-E, colony forming unit-erythroid) and H838 cells, we combined mathematical modeling with a method for feature selection, the L1 regularization. Utilizing an example model and simulated data, we demonstrated that this approach enables the accurate identification and quantification of cell type-specific parameters. We applied our strategy to quantitative time-resolved data of EPO-induced JAK/STAT signaling generated by quantitative immunoblotting, mass spectrometry and quantitative real-time PCR (qRT-PCR) in CFU-E and H838 cells as well as H838 cells overexpressing human EPOR (H838-HA-hEPOR). The established parsimonious mathematical model was able to simultaneously describe the data sets of CFU-E, H838 and H838-HA-hEPOR cells. Seven cell type-specific parameters were identified that included for example parameters for nuclear translocation of STAT5 and target gene induction. Cell type-specific differences in target gene induction were experimentally validated by qRT-PCR experiments. The systematic identification of pathway differences and sensitivities of EPOR signaling in CFU-E and H838 cells revealed potential targets for intervention to selectively inhibit EPO-induced signaling in the tumor cells but leave the responses in erythroid

  14. Identification of Cell Type-Specific Differences in Erythropoietin Receptor Signaling in Primary Erythroid and Lung Cancer Cells.

    Science.gov (United States)

    Merkle, Ruth; Steiert, Bernhard; Salopiata, Florian; Depner, Sofia; Raue, Andreas; Iwamoto, Nao; Schelker, Max; Hass, Helge; Wäsch, Marvin; Böhm, Martin E; Mücke, Oliver; Lipka, Daniel B; Plass, Christoph; Lehmann, Wolf D; Kreutz, Clemens; Timmer, Jens; Schilling, Marcel; Klingmüller, Ursula

    2016-08-01

    Lung cancer, with its most prevalent form non-small-cell lung carcinoma (NSCLC), is one of the leading causes of cancer-related deaths worldwide, and is commonly treated with chemotherapeutic drugs such as cisplatin. Lung cancer patients frequently suffer from chemotherapy-induced anemia, which can be treated with erythropoietin (EPO). However, studies have indicated that EPO not only promotes erythropoiesis in hematopoietic cells, but may also enhance survival of NSCLC cells. Here, we verified that the NSCLC cell line H838 expresses functional erythropoietin receptors (EPOR) and that treatment with EPO reduces cisplatin-induced apoptosis. To pinpoint differences in EPO-induced survival signaling in erythroid progenitor cells (CFU-E, colony forming unit-erythroid) and H838 cells, we combined mathematical modeling with a method for feature selection, the L1 regularization. Utilizing an example model and simulated data, we demonstrated that this approach enables the accurate identification and quantification of cell type-specific parameters. We applied our strategy to quantitative time-resolved data of EPO-induced JAK/STAT signaling generated by quantitative immunoblotting, mass spectrometry and quantitative real-time PCR (qRT-PCR) in CFU-E and H838 cells as well as H838 cells overexpressing human EPOR (H838-HA-hEPOR). The established parsimonious mathematical model was able to simultaneously describe the data sets of CFU-E, H838 and H838-HA-hEPOR cells. Seven cell type-specific parameters were identified that included for example parameters for nuclear translocation of STAT5 and target gene induction. Cell type-specific differences in target gene induction were experimentally validated by qRT-PCR experiments. The systematic identification of pathway differences and sensitivities of EPOR signaling in CFU-E and H838 cells revealed potential targets for intervention to selectively inhibit EPO-induced signaling in the tumor cells but leave the responses in erythroid

  15. Induction of erythroid differentiation and increased globin mRNA production with furocoumarins and their photoproducts.

    Science.gov (United States)

    Salvador, Alessia; Brognara, Eleonora; Vedaldi, Daniela; Castagliuolo, Ignazio; Brun, Paola; Zuccato, Cristina; Lampronti, Ilaria; Gambari, Roberto

    2013-04-01

    Differentiation-therapy is an important approach in the treatment of cancer, as in the case of erythroid induction in chronic myelogenous leukemia. Moreover, an important therapeutic strategy for treating beta-thalassemia and sickle-cell anemia could be the use of drugs able to induce erythroid differentiation and fetal hemoglobin (HbF) accumulation: in fact, the increased production of this type of hemoglobin can reduce the clinical symptoms and the frequency of transfusions. An important class of erythroid differentiating compounds and HbF inducers is composed by DNA-binding chemotherapeutics: however, they are not used in most instances considering their possible devastating side effects. In this contest, we approached the study of erythrodifferentiating properties of furocoumarins. In fact, upon UV-A irradiation, they are able to covalently bind DNA. Thus, the erythrodifferentiation activity of some linear and angular furocoumarins was evaluated in the experimental K562 cellular model system. Quantitative real-time reverse transcription polymerase-chain reaction assay was employed to evaluate the accumulation of different globin mRNAs. The results demonstrated that both linear and angular furocoumarins are strong inducers of erythroid differentiation of K562 cells. From a preliminary screening, we selected the most active compounds and investigated the role of DNA photodamage in their erythroid inducing activity and mechanism of action. Moreover, some cytofluorimetric experiments were carried out to better study cell cycle modifications and the mitochondrial involvement. A further development of the work was carried out studying the erythroid differentiation of photolysis products of these molecules. 5,5'-Dimethylpsoralen photoproducts induced an important increase in γ-globin gene transcription in K562 cells. PMID:23518160

  16. DMPD: A role for caspases in the differentiation of erythroid cells and macrophages. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available 17905508 A role for caspases in the differentiation of erythroid cells and macropha...;90(2):416-22. Epub 2007 Sep 2. (.png) (.svg) (.html) (.csml) Show A role for caspases in the differentiatio...n of erythroid cells and macrophages. PubmedID 17905508 Title A role for caspases

  17. Heterogeneity in the properties of burst-forming units of erythroid lineage in sickle cell anemia: DNA synthesis and burst-promoting activity production is related to peripheral hemoglobin F levels

    International Nuclear Information System (INIS)

    Circulating 14-day erythroid progenitors (BFU-E) from 28 sickle cell anemia (SS) patients with hemoglobin F (HbF) levels ranging from 2% to 16% were studied to determine their sensitivity to [3H] thymidine kill and burst-promoting activity (BPA)-like factor production. We find that the proportion of BFU-E sensitive to 3H-dT kill, and hence active in DNA synthesis, was inversely correlated with the percent of peripheral HbF when light density (LD) mononuclear cells were used for plating. Regression analysis showed that the correlation between HbF level and BFU-E kill was highly significant (r = .88; P less than .00003). We confirmed the BPA-like factor(s) production by LD mononuclear cells of SS patients, and found, in addition, that this phenomenon is restricted to the population of SS patients with HbF levels lower than 9%. Circulating BFU-E of patients with high HbF levels are not sensitive to 3H-dT, and their mononuclear cells do not release BPA-like factor. In summary, SS patients exhibit differences in the capacity of their mononuclear cells to produce BPA activity according to their peripheral HbF level, as well as to the DNA synthesis-state of their circulating BFU-E. We conclude that erythroid progenitors differ among SS patients in relation to their peripheral HbF level

  18. Is erythroferrone finally the long sought-after systemic erythroid regulator of iron?

    Institute of Scientific and Technical Information of China (English)

    Alfons; Lawen

    2015-01-01

    Iron metabolism is regulated on the cellular and the systemic level. Over the last decade, the liver peptide "hepcidin" has emerged as the body’s key irons store regulator. The long postulated "erythroid regulator of iron", however, remained elusive. Last year, evidence was provided, that a previously described myokine "myonectin" may also function as the long sought erythroid regulator of iron. Myonectin was therefore renamed "erythroferrone". This editorial provides a brief discussion on the two functions of erythroferrone and also briefly considers the emerging potential role of transferrin receptor 2 in erythropoiesis.

  19. Human circulating plasma DNA significantly decreases while lymphocyte DNA damage increases under chronic occupational exposure to low-dose gamma-neutron and tritium β-radiation

    Energy Technology Data Exchange (ETDEWEB)

    Korzeneva, Inna B., E-mail: inna.korzeneva@molgen.vniief.ru [Russian Federal Nuclear Center – All-Russian Research Institute of Experimental Physics (RFNC-VNIIEF) 607190, Sarov, 37 Mira ave., Nizhniy Novgorod Region (Russian Federation); Kostuyk, Svetlana V.; Ershova, Liza S. [Research Centre for Medical Genetics, Russian Academy of Medical Sciences, 115478 Moscow, 1 Moskvorechye str. (Russian Federation); Osipov, Andrian N. [Federal Medial and Biological Center named after Burnazyan of the Federal Medical and Biological Agency (FMBTz named after Burnazyan of FMBA), Moscow (Russian Federation); State Research Center - Burnasyan Federal Medical Biophysical Center of Federal Medical Biological Agency, Zhivopisnaya, 46, Moscow, 123098 (Russian Federation); Zhuravleva, Veronika F.; Pankratova, Galina V. [Russian Federal Nuclear Center – All-Russian Research Institute of Experimental Physics (RFNC-VNIIEF) 607190, Sarov, 37 Mira ave., Nizhniy Novgorod Region (Russian Federation); Porokhovnik, Lev N.; Veiko, Natalia N. [Research Centre for Medical Genetics, Russian Academy of Medical Sciences, 115478 Moscow, 1 Moskvorechye str. (Russian Federation)

    2015-09-15

    Highlights: • The chronic exposure to low-dose IR induces DSBs in human lymphocytes (TM index). • Exposure to IR decreases the level of human circulating DNA (cfDNA index). • IR induces an increase of DNase1 activity (DNase1 index) in plasma. • IR induces an increase of the level of antibodies to DNA (Ab DNA index) in plasma. • The ratio cfDNA/(DNase 1 × Ab DNA × TM) is a potential marker of human exposure to IR. - Abstract: The blood plasma of healthy people contains cell-fee (circulating) DNA (cfDNA). Apoptotic cells are the main source of the cfDNA. The cfDNA concentration increases in case of the organism’s cell death rate increase, for example in case of exposure to high-dose ionizing radiation (IR). The objects of the present research are the blood plasma and blood lymphocytes of people, who contacted occupationally with the sources of external gamma/neutron radiation or internal β-radiation of tritium N = 176). As the controls (references), blood samples of people, who had never been occupationally subjected to the IR sources, were used (N = 109). With respect to the plasma samples of each donor there were defined: the cfDNA concentration (the cfDNA index), DNase1 activity (the DNase1 index) and titre of antibodies to DNA (the Ab DNA index). The general DNA damage in the cells was defined (using the Comet assay, the tail moment (TM) index). A chronic effect of the low-dose ionizing radiation on a human being is accompanied by the enhancement of the DNA damage in lymphocytes along with a considerable cfDNA content reduction, while the DNase1 content and concentration of antibodies to DNA (Ab DNA) increase. All the aforementioned changes were also observed in people, who had not worked with the IR sources for more than a year. The ratio cfDNA/(DNase1 × Ab DNA × TM) is proposed to be used as a marker of the chronic exposure of a person to the external low-dose IR. It was formulated the assumption that the joint analysis of the cfDNA, DNase1, Ab

  20. Human circulating plasma DNA significantly decreases while lymphocyte DNA damage increases under chronic occupational exposure to low-dose gamma-neutron and tritium β-radiation

    International Nuclear Information System (INIS)

    Highlights: • The chronic exposure to low-dose IR induces DSBs in human lymphocytes (TM index). • Exposure to IR decreases the level of human circulating DNA (cfDNA index). • IR induces an increase of DNase1 activity (DNase1 index) in plasma. • IR induces an increase of the level of antibodies to DNA (Ab DNA index) in plasma. • The ratio cfDNA/(DNase 1 × Ab DNA × TM) is a potential marker of human exposure to IR. - Abstract: The blood plasma of healthy people contains cell-fee (circulating) DNA (cfDNA). Apoptotic cells are the main source of the cfDNA. The cfDNA concentration increases in case of the organism’s cell death rate increase, for example in case of exposure to high-dose ionizing radiation (IR). The objects of the present research are the blood plasma and blood lymphocytes of people, who contacted occupationally with the sources of external gamma/neutron radiation or internal β-radiation of tritium N = 176). As the controls (references), blood samples of people, who had never been occupationally subjected to the IR sources, were used (N = 109). With respect to the plasma samples of each donor there were defined: the cfDNA concentration (the cfDNA index), DNase1 activity (the DNase1 index) and titre of antibodies to DNA (the Ab DNA index). The general DNA damage in the cells was defined (using the Comet assay, the tail moment (TM) index). A chronic effect of the low-dose ionizing radiation on a human being is accompanied by the enhancement of the DNA damage in lymphocytes along with a considerable cfDNA content reduction, while the DNase1 content and concentration of antibodies to DNA (Ab DNA) increase. All the aforementioned changes were also observed in people, who had not worked with the IR sources for more than a year. The ratio cfDNA/(DNase1 × Ab DNA × TM) is proposed to be used as a marker of the chronic exposure of a person to the external low-dose IR. It was formulated the assumption that the joint analysis of the cfDNA, DNase1, Ab

  1. Immunosuppressive CD71+ erythroid cells compromise neonatal host defence against infection

    Science.gov (United States)

    Elahi, Shokrollah; Ertelt, James M.; Kinder, Jeremy M.; Jiang, Tony T.; Zhang, Xuzhe; Xin, Lijun; Chaturvedi, Vandana; Strong, Beverly S.; Qualls, Joseph E.; Steinbrecher, Kris A.; Kalfa, Theodosia A.; Shaaban, Aimen F.; Way, Sing Sing

    2013-12-01

    Newborn infants are highly susceptible to infection. This defect in host defence has generally been ascribed to the immaturity of neonatal immune cells; however, the degree of hyporesponsiveness is highly variable and depends on the stimulation conditions. These discordant responses illustrate the need for a more unified explanation for why immunity is compromised in neonates. Here we show that physiologically enriched CD71+ erythroid cells in neonatal mice and human cord blood have distinctive immunosuppressive properties. The production of innate immune protective cytokines by adult cells is diminished after transfer to neonatal mice or after co-culture with neonatal splenocytes. Neonatal CD71+ cells express the enzyme arginase-2, and arginase activity is essential for the immunosuppressive properties of these cells because molecular inhibition of this enzyme or supplementation with L-arginine overrides immunosuppression. In addition, the ablation of CD71+ cells in neonatal mice, or the decline in number of these cells as postnatal development progresses parallels the loss of suppression, and restored resistance to the perinatal pathogens Listeria monocytogenes and Escherichia coli. However, CD71+ cell-mediated susceptibility to infection is counterbalanced by CD71+ cell-mediated protection against aberrant immune cell activation in the intestine, where colonization with commensal microorganisms occurs swiftly after parturition. Conversely, circumventing such colonization by using antimicrobials or gnotobiotic germ-free mice overrides these protective benefits. Thus, CD71+ cells quench the excessive inflammation induced by abrupt colonization with commensal microorganisms after parturition. This finding challenges the idea that the susceptibility of neonates to infection reflects immune-cell-intrinsic defects and instead highlights processes that are developmentally more essential and inadvertently mitigate innate immune protection. We anticipate that these

  2. Cytoplasmic poly(A) binding protein C4 serves a critical role in erythroid differentiation.

    Science.gov (United States)

    Kini, Hemant K; Kong, Jian; Liebhaber, Stephen A

    2014-04-01

    The expression of an mRNA is strongly impacted by its 3' poly(A) tail and associated poly(A)-binding proteins (PABPs). Vertebrates encode six PABP isoforms that vary in abundance, distribution, developmental control, and subcellular localization. Here we demonstrate that the minor PABP isoform PABPC4 is expressed in erythroid cells and impacts the steady-state expression of a subset of erythroid mRNAs. Motif analyses reveal a high-value AU-rich motif in the 3' untranslated regions (UTRs) of PABPC4-impacted mRNAs. This motif enhances the association of PABPC4 with mRNAs containing critically shortened poly(A) tails. This association may serve to protect a subset of mRNAs from accelerated decay. Finally, we demonstrate that selective depletion of PABPC4 in an erythroblast cell line inhibits terminal erythroid maturation with corresponding alterations in the erythroid gene expression. These observations lead us to conclude that PABPC4 plays an essential role in posttranscriptional control of a major developmental pathway. PMID:24469397

  3. Global discovery of erythroid long noncoding RNAs reveals novel regulators of red cell maturation

    OpenAIRE

    Alvarez-Dominguez, Juan R.; Hu, Wenqian; Yuan, Bingbing; Shi, Jiahai; Park, Staphany S.; Gromatzky, Austin A.; van Oudenaarden, Alexander; Lodish, Harvey F.

    2014-01-01

    Global lncRNA discovery reveals novel erythroid-specific lncRNAs that are dynamically expressed and targeted by GATA1, TAL1, and KLF1.Multiple types of lncRNAs promote red cell maturation by regulating neighboring loci, including DLEU2 and a novel Band 3 enhancer lncRNA.

  4. Histones to the cytosol: exportin 7 is essential for normal terminal erythroid nuclear maturation

    Science.gov (United States)

    Martinez-Morilla, Sandra; Patterson, Heide Christine; Shi, Jiahai; Burke, Karly; Avila-Figueroa, Amalia; Venkatesan, Srividhya; Wang, Junxia; Paulsen, Katharina; Görlich, Dirk; Murata-Hori, Maki; Lodish, Harvey F.

    2014-01-01

    Global nuclear condensation, culminating in enucleation during terminal erythropoiesis, is poorly understood. Proteomic examination of extruded erythroid nuclei from fetal liver revealed a striking depletion of most nuclear proteins, suggesting that nuclear protein export had occurred. Expression of the nuclear export protein, Exportin 7 (Xpo7), is highly erythroid-specific, induced during erythropoiesis, and abundant in very late erythroblasts. Knockdown of Xpo7 in primary mouse fetal liver erythroblasts resulted in severe inhibition of chromatin condensation and enucleation but otherwise had little effect on erythroid differentiation, including hemoglobin accumulation. Nuclei in Xpo7-knockdown cells were larger and less dense than normal and accumulated most nuclear proteins as measured by mass spectrometry. Strikingly, many DNA binding proteins such as histones H2A and H3 were found to have migrated into the cytoplasm of normal late erythroblasts prior to and during enucleation, but not in Xpo7-knockdown cells. Thus, terminal erythroid maturation involves migration of histones into the cytoplasm via a process likely facilitated by Xpo7. PMID:25092175

  5. Probing conformational stability and dynamics of erythroid and nonerythroid spectrin: effects of urea and guanidine hydrochloride.

    Science.gov (United States)

    Patra, Malay; Mukhopadhyay, Chaitali; Chakrabarti, Abhijit

    2015-01-01

    We have studied the conformational stability of the two homologous membrane skeletal proteins, the erythroid and non-erythroid spectrins, in their dimeric and tetrameric forms respectively during unfolding in the presence of urea and guanidine hydrochloride (GuHCl). Fluorescence and circular dichroism (CD) spectroscopy have been used to study the changes of intrinsic tryptophan fluorescence, anisotropy, far UV-CD and extrinsic fluorescence of bound 1-anilinonapthalene-8-sulfonic acid (ANS). Chemical unfolding of both proteins were reversible and could be described as a two state transition. The folded erythroid spectrin and non-erythroid spectrin were directly converted to unfolded monomer without formation of any intermediate. Fluorescence quenching, anisotropy, ANS binding and dynamic light scattering data suggest that in presence of low concentrations of the denaturants (up-to 1M) hydrogen bonding network and van der Waals interaction play a role inducing changes in quaternary as well as tertiary structures without complete dissociation of the subunits. This is the first report of two large worm like, multi-domain proteins obeying twofold rule which is commonly found in small globular proteins. The free energy of stabilization (ΔGuH20) for the dimeric spectrin has been 20 kcal/mol lesser than the tetrameric from. PMID:25617632

  6. Probing conformational stability and dynamics of erythroid and nonerythroid spectrin: effects of urea and guanidine hydrochloride.

    Directory of Open Access Journals (Sweden)

    Malay Patra

    Full Text Available We have studied the conformational stability of the two homologous membrane skeletal proteins, the erythroid and non-erythroid spectrins, in their dimeric and tetrameric forms respectively during unfolding in the presence of urea and guanidine hydrochloride (GuHCl. Fluorescence and circular dichroism (CD spectroscopy have been used to study the changes of intrinsic tryptophan fluorescence, anisotropy, far UV-CD and extrinsic fluorescence of bound 1-anilinonapthalene-8-sulfonic acid (ANS. Chemical unfolding of both proteins were reversible and could be described as a two state transition. The folded erythroid spectrin and non-erythroid spectrin were directly converted to unfolded monomer without formation of any intermediate. Fluorescence quenching, anisotropy, ANS binding and dynamic light scattering data suggest that in presence of low concentrations of the denaturants (up-to 1M hydrogen bonding network and van der Waals interaction play a role inducing changes in quaternary as well as tertiary structures without complete dissociation of the subunits. This is the first report of two large worm like, multi-domain proteins obeying twofold rule which is commonly found in small globular proteins. The free energy of stabilization (ΔGuH20 for the dimeric spectrin has been 20 kcal/mol lesser than the tetrameric from.

  7. The role of catechol-O-methyltransferase in catechol-enhanced erythroid differentiation of K562 cells

    Energy Technology Data Exchange (ETDEWEB)

    Suriguga,; Li, Xiao-Fei; Li, Yang; Yu, Chun-Hong; Li, Yi-Ran; Yi, Zong-Chun, E-mail: yizc@buaa.edu.cn

    2013-12-15

    Catechol is widely used in pharmaceutical and chemical industries. Catechol is also one of phenolic metabolites of benzene in vivo. Our previous study showed that catechol improved erythroid differentiation potency of K562 cells, which was associated with decreased DNA methylation in erythroid specific genes. Catechol is a substrate for the catechol-O-methyltransferase (COMT)-mediated methylation. In the present study, the role of COMT in catechol-enhanced erythroid differentiation of K562 cells was investigated. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation and induced mRNA expression of erythroid specific genes in K562 cells. Treatment with catechol caused a time- and concentration-dependent increase in guaiacol concentration in the medium of cultured K562 cells. When COMT expression was knocked down by COMT shRNA expression in K562 cells, the production of guaiacol significantly reduced, and the sensitivity of K562 cells to cytotoxicity of catechol significantly increased. Knockdown of COMT expression by COMT shRNA expression also eliminated catechol-enhanced erythroid differentiation of K562 cells. In addition, the pre-treatment with methyl donor S-adenosyl-L-methionine or its demethylated product S-adenosyl-L-homocysteine induced a significant increase in hemin-induced Hb synthesis in K562 cells and the mRNA expression of erythroid specific genes. These findings indicated that O-methylation catalyzed by COMT acted as detoxication of catechol and involved in catechol-enhanced erythroid differentiation of K562 cells, and the production of S-adenosyl-L-homocysteine partly explained catechol-enhanced erythroid differentiation. - Highlights: • Catechol enhanced hemin-induced hemoglobin accumulation. • COMT-catalyzed methylation acted as detoxication of catechol. • COMT involved in catechol-enhanced erythroid differentiation.

  8. The role of catechol-O-methyltransferase in catechol-enhanced erythroid differentiation of K562 cells

    International Nuclear Information System (INIS)

    Catechol is widely used in pharmaceutical and chemical industries. Catechol is also one of phenolic metabolites of benzene in vivo. Our previous study showed that catechol improved erythroid differentiation potency of K562 cells, which was associated with decreased DNA methylation in erythroid specific genes. Catechol is a substrate for the catechol-O-methyltransferase (COMT)-mediated methylation. In the present study, the role of COMT in catechol-enhanced erythroid differentiation of K562 cells was investigated. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation and induced mRNA expression of erythroid specific genes in K562 cells. Treatment with catechol caused a time- and concentration-dependent increase in guaiacol concentration in the medium of cultured K562 cells. When COMT expression was knocked down by COMT shRNA expression in K562 cells, the production of guaiacol significantly reduced, and the sensitivity of K562 cells to cytotoxicity of catechol significantly increased. Knockdown of COMT expression by COMT shRNA expression also eliminated catechol-enhanced erythroid differentiation of K562 cells. In addition, the pre-treatment with methyl donor S-adenosyl-L-methionine or its demethylated product S-adenosyl-L-homocysteine induced a significant increase in hemin-induced Hb synthesis in K562 cells and the mRNA expression of erythroid specific genes. These findings indicated that O-methylation catalyzed by COMT acted as detoxication of catechol and involved in catechol-enhanced erythroid differentiation of K562 cells, and the production of S-adenosyl-L-homocysteine partly explained catechol-enhanced erythroid differentiation. - Highlights: • Catechol enhanced hemin-induced hemoglobin accumulation. • COMT-catalyzed methylation acted as detoxication of catechol. • COMT involved in catechol-enhanced erythroid differentiation

  9. Control of thermal balance by a liquid circulating garment based on a mathematical representation of the human thermoregulatory system. Ph.D. Thesis - California Univ., Berkeley

    Science.gov (United States)

    Kuznetz, L. H.

    1976-01-01

    Test data and a mathematical model of the human thermoregulatory system were used to investigate control of thermal balance by means of a liquid circulating garment (LCG). The test data were derived from five series of experiments in which environmental and metabolic conditions were varied parametrically as a function of several independent variables, including LCG flowrate, LCG inlet temperature, net environmental heat exchange, surrounding gas ventilation rate, ambient pressure, metabolic rate, and subjective/obligatory cooling control. The resultant data were used to relate skin temperature to LCG water temperature and flowrate, to assess a thermal comfort band, to demonstrate the relationship between metabolic rate and LCG heat dissipation, and so forth. The usefulness of the mathematical model as a tool for data interpretation and for generation of trends and relationships among the various physiological parameters was also investigated and verified.

  10. Multiple forms of human intestinal alkaline phosphatase: chemical and enzymatic properties, and circulating clearances of the fast- and slow-moving enzymes

    International Nuclear Information System (INIS)

    Two forms of alkaline phosphatase orthophosphoric monoester phosphohydrolase (alkaline optimum, EC 3.1.3.1) have been purified from human small intestine by column chromatography on DEAE-cellulose and tyraminyl derivative affinity gel, and by preparative disc gel electrophoresis. Intestinal phosphatases were electrophoretically separated into two components, fast- and slow-moving enzymes, with apparent molecular weights of 140000 and 168000 and with subunit weights of 68000 and 80000, respectively. Organ distribution of injected 125I-labelled enzymes indicates that the desialylated hepatic enzyme was selectively distributed in liver, while the degalactosylated intestinal enzyme was incorporated into liver, lymph fluid, and small intestine. These results suggest that the pathway of circulating clearance of alkaline phosphatase has several routes. (Auth.)

  11. Circulating chromatin-anti-chromatin antibody complexes bind with high affinity to dermo-epidermal structures in murine and human lupus nephritis

    DEFF Research Database (Denmark)

    Fismen, S; Hedberg, A; Fenton, K A;

    2009-01-01

    Murine and human lupus nephritis are characterized by glomerular deposits of electron-dense structures (EDS). Dominant components of EDS are chromatin fragments and IgG antibodies. Whether glomerular EDS predispose for similar deposits in skin is unknown. We analysed (i) whether dermo...... (NZBxNZW)F1 and MRL-lpr/lpr mice and from five patients with lupus nephritis were analysed by immunofluorescence, immune electron microscopy (IEM) and co-localization TUNEL IEM. Affinity of chromatin fragments for membrane structures was determined by surface plasmon resonance. Results demonstrated (i...... were present in capillary lumina in glomeruli and skin of all nephritic individuals. Thus, chromatin-IgG complexes accounting for lupus nephritis seem to reach skin through circulation, but other undetermined factors are required for these complexes to deposit within skin membranes....

  12. Circulating CD14brightCD16+ 'intermediate' monocytes exhibit enhanced parasite pattern recognition in human helminth infection.

    Directory of Open Access Journals (Sweden)

    Joseph D Turner

    2014-04-01

    Full Text Available Circulating monocyte sub-sets have recently emerged as mediators of divergent immune functions during infectious disease but their role in helminth infection has not been investigated. In this study we evaluated whether 'classical' (CD14brightCD16-, 'intermediate' (CD14brightCD16+, and 'non-classical' (CD14dimCD16+ monocyte sub-sets from peripheral blood mononuclear cells varied in both abundance and ability to bind antigenic material amongst individuals living in a region of Northern Senegal which is co-endemic for Schistosoma mansoni and S. haematobium. Monocyte recognition of excretory/secretory (E/S products released by skin-invasive cercariae, or eggs, of S. mansoni was assessed by flow cytometry and compared between S. mansoni mono-infected, S. mansoni and S. haematobium co-infected, and uninfected participants. Each of the three monocyte sub-sets in the different infection groups bound schistosome E/S material. However, 'intermediate' CD14brightCD16+ monocytes had a significantly enhanced ability to bind cercarial and egg E/S. Moreover, this elevation of ligand binding was particularly evident in co-infected participants. This is the first demonstration of modulated parasite pattern recognition in CD14brightCD16+ intermediate monocytes during helminth infection, which may have functional consequences for the ability of infected individuals to respond immunologically to infection.

  13. Circulation economics

    DEFF Research Database (Denmark)

    Ingebrigtsen, Stig; Jakobsen, Ove

    2006-01-01

    Purpose - This paper is an attempt to advance the critical discussion regarding environmental and societal responsibility in economics and business. Design/methodology/approach - The paper presents and discusses as a holistic, organic perspective enabling innovative solutions to challenges...... concerning the responsible and efficient use of natural resources and the constructive interplay with culture. To reach the goal of sustainable development, the paper argues that it is necessary to make changes in several dimensions in mainstream economics. This change of perspective is called a turn towards...... presupposes a perspective integrating economic, natural and cultural values. Third, to organize the interplay between all stakeholders we introduce an arena for communicative cooperation. Originality/value - The paper concludes that circulation economics presupposes a change in paradigm, from a mechanistic...

  14. Circulating intestine-derived exosomal miR-328 in plasma, a possible biomarker for estimating BCRP function in the human intestines

    Science.gov (United States)

    Gotanda, Keisuke; Hirota, Takeshi; Saito, Jumpei; Fukae, Masato; Egashira, Yu; Izumi, Noritomo; Deguchi, Mariko; Kimura, Miyuki; Matsuki, Shunji; Irie, Shin; Ieiri, Ichiro

    2016-01-01

    A variant in the breast cancer resistance protein (BCRP) gene, 421C> A is a useful biomarker for describing large inter-individual differences in the pharmacokinetics of sulfasalazine (SASP), a BCRP substrate. However, large intra-genotypic variability still exists in spite of the incorporation of this variant into the pharmacokinetics of SASP. Since miR-328 negatively regulates BCRP expression in human tissues, we hypothesized that exosomal miR-328 in plasma, which leaks from the intestines, is a possible biomarker for estimating BCRP activity in the human intestines. We established an immunoprecipitation-based quantitative method for circulating intestine-derived miR-328 in plasma using an anti-glycoprotein A33 antibody. A clinical study was conducted with an open-label, non-randomized, and single-arm design involving 33 healthy participants. Intestine-derived exosomal miR-328 levels positively correlated (P exosomal miR-328 in plasma has potential as a possible biomarker for estimating BCRP function in the human intestines. PMID:27571936

  15. Immunophenotyping of circulating T helper cells argues for multiple functions and plasticity of T cells in vivo in humans--possible role in asthma.

    Directory of Open Access Journals (Sweden)

    Carina Malmhäll

    Full Text Available BACKGROUND: The immune process driving eosinophilic and non-eosinophilic asthma is likely driven by different subsets of T helper (Th cells. Recently, in vitro studies and animal studies suggest that Th cell subsets displays plasticity by changing their transcription factor or by expressing multiple transcription factors. Our aim was to determine whether individuals with asthma and elevated circulating eosinophils express signs of different regulatory immune mechanisms compared with asthmatics with low blood eosinophils and non-asthmatic control subjects. In addition, determine the relationship between eosinophilia and circulating Th cell subsets. METHODOLOGY/PRINCIPAL FINDINGS: Participants were selected from a random epidemiological cohort, the West Sweden Asthma Study. Immunophenotypes of fresh peripheral blood cells obtained from stable asthmatics, with and without elevated eosinophilic inflammation (EOS high and EOS low respectively and control subjects, were determined by flow cytometry. No differences in the number of Th1 (T-bet, Th2 (GATA-3, Th17 (RORγt or Treg (FOXP3 cells were observed between the groups when analysing each subset separately. However, in all groups, each of the Th subsets showed expression of additional canonical transcription factors T-bet, GATA-3, RORγt and FOXP3. Furthermore, by in vitro stimulation with anti-CD3/anti-CD28 there was a significant increase of single expressing GATA-3(+ and co-expressing T-bet(+GATA-3(+ cells in the EOS high asthmatics in comparison with control subjects. In addition, T-bet(-GATA-3(+RORγt(+FOXP3(+ were decreased in comparison to the EOS low asthmatics. Finally, in a group of control subjects we found that the majority of proliferating Th cells (CD4(+CD25(+Ki67(+ expressed three or four transcription factors. CONCLUSIONS: The ability of human Th cells to express several regulatory transcription factors suggests that these cells may display plasticity in vivo.

  16. Measurement of Circulating Filarial Antigen Levels in Human Blood with a Point-of-Care Test Strip and a Portable Spectrodensitometer.

    Science.gov (United States)

    Chesnais, Cédric B; Vlaminck, Johnny; Kunyu-Shako, Billy; Pion, Sébastien D; Awaca-Uvon, Naomi-Pitchouna; Weil, Gary J; Mumba, Dieudonné; Boussinesq, Michel

    2016-06-01

    The Alere Filariasis Test Strip (FTS) is a qualitative, point-of-care diagnostic tool that detects Wuchereria bancrofti circulating filarial antigen (CFA) in human blood, serum, or plasma. The Global Program to Eliminate Lymphatic Filariasis employs the FTS for mapping filariasis-endemic areas and assessing the success of elimination efforts. The objective of this study was to explore the relationship between the intensity of positive test lines obtained by FTS with CFA levels as determined by enzyme-linked immunosorbent assay (ELISA) with blood and plasma samples from 188 individuals who live in a filariasis-endemic area. The intensity of the FTS test line was assessed visually to provide a semiquantitative score (visual Filariasis Test Strip [vFTS]), and line intensity was measured with a portable spectrodensitometer (quantitative Filariasis Test Strip [qFTS]). These results were compared with antigen levels measured by ELISA in plasma from the same subjects. qFTS measurements were highly correlated with vFTS scores (ρ = 0.94; P bancrofti CFA levels in human blood, which are correlated with adult worm burdens. This tool may be useful for assessing the impact of treatment on adult filarial worms in individuals and communities. PMID:27114288

  17. Differential Contribution of the Gata1 Gene Hematopoietic Enhancer to Erythroid Differentiation▿ †

    OpenAIRE

    Suzuki, Mikiko; Moriguchi, Takashi; Ohneda, Kinuko; Yamamoto, Masayuki

    2008-01-01

    GATA1 is a key regulator of erythroid cell differentiation. To examine how Gata1 gene expression is regulated in a stage-specific manner, transgenic mouse lines expressing green fluorescent protein (GFP) reporter from the Gata1 locus in a bacterial artificial chromosome (G1BAC-GFP) were prepared. We found that the GFP reporter expression faithfully recapitulated Gata1 gene expression. Using GFP fluorescence in combination with hematopoietic surface markers, we established a purification proto...

  18. Ldb1 complexes: The new master-regulators of erythroid gene transcription

    OpenAIRE

    Love, Paul E.; Warzecha, Claude; Li, Liqi

    2013-01-01

    Elucidation of the genetic pathways that control red blood cell development has been a central goal of erythropoiesis research over the past decade. Notably, data from several recent studies have provided new insights into the regulation of erythroid gene transcription. Transcription profiling demonstrates that erythopoiesis is mainly controlled by a small group of lineage-restricted transcription factors (Gata1, Tal1, and Klf1). Binding site mapping using ChIP-Seq indicates that most DNA bou...

  19. Effects of tumour mass and circulating antigen on the biodistribution of 111In-labelled F(ab')2 fragments of human prostatic acid phosphatase monoclonal antibody in nude mice bearing PC-82 human prostatic tumor xenografts

    International Nuclear Information System (INIS)

    We have evaluated the effects of tumour mass and circulating antigen (prostatic acid phosphatase, PAP) on the biodistribution and the incorporation of 111In-labelled F(ab')2 monoclonal antibody (MoAb) fragments directed against human PAP into human prostatic tumours (PC-82; 0.1-8.9 g) growing in nude mice. The radioactivities in the blood, liver, spleen, kidney and tumour were compared at 1, 3, 4 and 6 days after the intravenous administration of the antibody fragments. There was a significant correlation between the tumour size and the serum PAP concentration in the model employed. Even tissue of a small tumour (111In-labelled F(ab')2 fragments. This relationship had levelled off by 72 h and most likely reflected a better vascularisation of the smaller tumours. Our results show that the increase in tumour size and in the concentration of circulating antigen in the blood led to decreased tumour-to-blood ratios, since there was a tendency for higher blood activities in mice with larger tumours and higher serum PAP concentrations. There was no correlation between tumour size and label uptake by the liver during the follow-up over 144 h, although serum PAP concentrations ranged from 3.1 μg/l to 352 μg/l. On the other hand, when compared with our previous data obtained with non-tumour-bearing mice, there was a significant increase in the uptake by the liver and spleen. These results indicate that even a small concentration of circulating antigen was able to trigger an abnormal change in the biodistribution of MoAbs. (orig.)

  20. Reduced DOCK4 expression leads to erythroid dysplasia in myelodysplastic syndromes.

    Science.gov (United States)

    Sundaravel, Sriram; Duggan, Ryan; Bhagat, Tushar; Ebenezer, David L; Liu, Hui; Yu, Yiting; Bartenstein, Matthias; Unnikrishnan, Madhu; Karmakar, Subhradip; Liu, Ting-Chun; Torregroza, Ingrid; Quenon, Thomas; Anastasi, John; McGraw, Kathy L; Pellagatti, Andrea; Boultwood, Jacqueline; Yajnik, Vijay; Artz, Andrew; Le Beau, Michelle M; Steidl, Ulrich; List, Alan F; Evans, Todd; Verma, Amit; Wickrema, Amittha

    2015-11-17

    Anemia is the predominant clinical manifestation of myelodysplastic syndromes (MDS). Loss or deletion of chromosome 7 is commonly seen in MDS and leads to a poor prognosis. However, the identity of functionally relevant, dysplasia-causing, genes on 7q remains unclear. Dedicator of cytokinesis 4 (DOCK4) is a GTPase exchange factor, and its gene maps to the commonly deleted 7q region. We demonstrate that DOCK4 is underexpressed in MDS bone marrow samples and that the reduced expression is associated with decreased overall survival in patients. We show that depletion of DOCK4 levels leads to erythroid cells with dysplastic morphology both in vivo and in vitro. We established a novel single-cell assay to quantify disrupted F-actin filament network in erythroblasts and demonstrate that reduced expression of DOCK4 leads to disruption of the actin filaments, resulting in erythroid dysplasia that phenocopies the red blood cell (RBC) defects seen in samples from MDS patients. Reexpression of DOCK4 in -7q MDS patient erythroblasts resulted in significant erythropoietic improvements. Mechanisms underlying F-actin disruption revealed that DOCK4 knockdown reduces ras-related C3 botulinum toxin substrate 1 (RAC1) GTPase activation, leading to increased phosphorylation of the actin-stabilizing protein ADDUCIN in MDS samples. These data identify DOCK4 as a putative 7q gene whose reduced expression can lead to erythroid dysplasia. PMID:26578796

  1. Detection and characterization of human pathogenic viruses circulating in community wastewater using multi target microarrays and polymerase chain reaction.

    Science.gov (United States)

    Wong, Mark V M; Hashsham, Syed A; Gulari, Erdogan; Rouillard, Jean-Marie; Aw, Tiong Gim; Rose, Joan B

    2013-12-01

    Sewage pollution remains the most significant source of human waterborne pathogens. This study describes the detection and characterization of human enteric viruses in community wastewaters using cell culture coupled with multiple target microarrays (with a total of 780 unique probes targeting 27 different groups of both DNA and RNA viruses) and polymerase chain reaction (PCR) assays. Over a 13-month sampling period, RNA viruses (astroviruses and enteroviruses) were more frequently detected compared to DNA viruses (adenoviruses, particularly type 41 and BK polyomavirus). Overall, many more viruses were shed during the winter months (December-February) compared to the summer months. Exploration of the multiple types of enteric viruses particularly in winter months identified much more significant prevalence of key viral pathogens associated with sewage pollution of the water environment than previously realized and seasonal disinfection used in some parts of the world may lead to a seeding of ambient waters. Molecular characterization of pathogenic viruses in community wastewater will improve the understanding of the potential risk of waterborne disease transmission of viral pathogens. PMID:24334840

  2. One-week habitation of two humans in an airtight facility with two goats and 23 crops Analysis of carbon, oxygen, and water circulation

    Science.gov (United States)

    Tako, Y.; Tsuga, S.; Tani, T.; Arai, R.; Komatsubara, O.; Shinohara, M.

    Human habitation and animal holding experiments in a closed environment, the Closed Ecology Experiment Facilities (CEEF), were carried out. The CEEF were established for collecting experimental data to estimate carbon transfer in the ecosystem around Rokkasho nuclear fuel reprocessing plant. Circulation of O2 and CO2, and supply of food from crops cultivated in the CEEF were conducted for the first time in the habitation experiments. Two humans known as eco-nauts inhabited the CEEF, living and working in the Plant Module (PM) and the Animal and Habitation Module (AHM), for a week three times in 2005. On a fresh weight basis, 82% of their food was supplied from 23 crops including rice and soybean, cultivated and harvested in the PM, in the 2nd and 3rd experiments. For the goats, the animals held in the experiments, all of their feed, consisting of rice straw, soybean plant leaves, and peanut shells and peanut plant leaves, was produced in the PM in the 2nd and 3rd experiments. The O2 produced in the PM by photosynthesis of the crops was separated by the O2 separator using molecular sheaves, then accumulated, transferred, and supplied to the AHM atmosphere. The CO2 produced in the AHM by respiration of the humans and animals was separated by the CO2 separator using solid amine, then accumulated, transferred, and supplied to the PM atmosphere. The amount of O2 consumed in the AHM was 46 51% of that produced in the PM, and the amount of CO2 produced in the AHM was 43 56% of that consumed in the PM. The surplus of O2 and the shortage of CO2 was a result of the fact that waste of the goats and the crops and part of the human waste were not processed in these habitation experiments. The estimated amount of carbon ingested by the eco-nauts was 64 92% of that in the harvested edible part of the crops. The estimated amount of carbon ingested by the goats was 36 53% of that in the harvested inedible part of the crops. One week was not enough time for determination of gas

  3. Unusual subcellular confinement of the fragile X mental retardation protein (FMRP) in circulating human platelets: complete polyribosome dissociation.

    Science.gov (United States)

    Lauzière, Véronique; Lessard, Mandy; Meunier, Alexandre J; McCoy, Marie; Bergeron, Lucien Junior; Corbin, Francois

    2012-04-01

    FMRP, a RNA-binding protein, was shown in association with polyribosomes in every cell types studied so far, suggesting a ubiquitous role as a translational regulator. Platelets are known for their limited protein synthesis potential. However, current investigations put forward that RNA metabolism is more developed than previously thought. Unexpectedly, our results provide evidence that FMRP, in platelets, is not constitutively associated with heavy particles, such as polyribosomes, and possesses a sedimentation coefficient of less than 10S contrasting with values of 150 to 500S as reported in other cell types. In summary, this report brings to light platelets as a simple human biological system to delineate novel FMRP functions as well as strengthening our comprehension of the pathophysiology of the fragile X syndrome which results from the absence of FMRP. PMID:22210492

  4. Use of fractional factorial design to study the compatibility of viral ribonucleoprotein gene segments of human H7N9 virus and circulating human influenza subtypes

    OpenAIRE

    Chin, Alex W.H.; Mok, Chris K.P.; Zhu, Huachen; Guan, Yi; Peiris, Joseph S. M.; Poon, Leo L. M.

    2014-01-01

    Avian H7N9 influenza viruses may pose a further threat to humans by reassortment with human viruses, which could lead to generation of novel reassortants with enhanced polymerase activity. We previously established a novel statistical approach to study the polymerase activity of reassorted vRNPs (Influenza Other Respir Viruses. 2013;7:969-78). Here, we report the use of this method to study recombinant vRNPs with subunits derived from human H1N1, H3N2, and H7N9 viruses. Our results demonstrat...

  5. Nitrogen. Too much of a good thing? An effective reduction of the overload of the nitrogen circulation on the benefit of environment and humans; Stickstoff. Zuviel des Guten? Ueberlastung des Stickstoffkreislaufs zum Nutzen von Umwelt und Mensch wirksam reduzieren

    Energy Technology Data Exchange (ETDEWEB)

    Schuetze, Gudrun; Geupel, Markus (comps.)

    2011-03-14

    The contribution under consideration reports on the influence of human activities on the circulation of nitrogen as well as on the resulting consequences for humans and environment. Thus the entry of nitrogen compounds is a main reason for the reduction of the biodiversity. The focus of this contribution is on the situation in Germany and the European bordering countries. Possibilities are pointed out, how harmful emissions of nitrogen can be reduced.

  6. Human circulating plasma DNA significantly decreases while lymphocyte DNA damage increases under chronic occupational exposure to low-dose gamma-neutron and tritium β-radiation.

    Science.gov (United States)

    Korzeneva, Inna B; Kostuyk, Svetlana V; Ershova, Liza S; Osipov, Andrian N; Zhuravleva, Veronika F; Pankratova, Galina V; Porokhovnik, Lev N; Veiko, Natalia N

    2015-09-01

    The blood plasma of healthy people contains cell-fee (circulating) DNA (cfDNA). Apoptotic cells are the main source of the cfDNA. The cfDNA concentration increases in case of the organism's cell death rate increase, for example in case of exposure to high-dose ionizing radiation (IR). The objects of the present research are the blood plasma and blood lymphocytes of people, who contacted occupationally with the sources of external gamma/neutron radiation or internal β-radiation of tritium N = 176). As the controls (references), blood samples of people, who had never been occupationally subjected to the IR sources, were used (N = 109). With respect to the plasma samples of each donor there were defined: the cfDNA concentration (the cfDNA index), DNase1 activity (the DNase1 index) and titre of antibodies to DNA (the Ab DNA index). The general DNA damage in the cells was defined (using the Comet assay, the tail moment (TM) index). A chronic effect of the low-dose ionizing radiation on a human being is accompanied by the enhancement of the DNA damage in lymphocytes along with a considerable cfDNA content reduction, while the DNase1 content and concentration of antibodies to DNA (Ab DNA) increase. All the aforementioned changes were also observed in people, who had not worked with the IR sources for more than a year. The ratio cfDNA/(DNase1×Ab DNA × TM) is proposed to be used as a marker of the chronic exposure of a person to the external low-dose IR. It was formulated the assumption that the joint analysis of the cfDNA, DNase1, Ab DNA and TM values may provide the information about the human organism's cell resistivity to chronic exposure to the low-dose IR and about the development of the adaptive response in the organism that is aimed, firstly, at the effective cfDNA elimination from the blood circulation, and, secondly - at survival of the cells, including the cells with the damaged DNA. PMID:26113293

  7. Circulating follistatin in relation to energy metabolism.

    Science.gov (United States)

    Hansen, Jakob Schiøler; Plomgaard, Peter

    2016-09-15

    Recently, substantial evidence has emerged that the liver contributes significantly to the circulating levels of follistatin and that circulating follistatin is tightly regulated by the glucagon-to-insulin ratio. Both observations are based on investigations of healthy subjects. These novel findings challenge the present view of circulating follistatin in human physiology, being that circulating follistatin is a result of spill-over from para/autocrine actions in various tissues and cells. Follistatin as a liver-derived protein under the regulation of glucagon-to-insulin ratio suggests a relation to energy metabolism. In this narrative review, we attempt to reconcile the existing findings on circulating follistatin with the novel concept that circulating follistatin is a liver-derived molecule regulated by the glucagon-to-insulin ratio. The picture emerging is that conditions associated with elevated levels of circulating follistatin have a metabolic denominator with decreased insulin sensitivity and/or hyperglucagoneimia. PMID:27264073

  8. Temporal and spatial dynamics of human immunodeficiency virus type 1 circulating recombinant forms 08_BC and 07_BC in Asia.

    Science.gov (United States)

    Tee, Kok Keng; Pybus, Oliver G; Li, Xiao-Jie; Han, Xiaoxu; Shang, Hong; Kamarulzaman, Adeeba; Takebe, Yutaka

    2008-09-01

    Human immunodeficiency virus type 1 (HIV-1) CRF08_BC and CRF07_BC are two major recombinants descended from subtypes B' and C. Despite their massive epidemic impact in China, their migration patterns and divergence times remain unknown. Phylogenetic and population genetic analyses were performed on 228 HIV-1 sequences representing CRF08_BC, CRF07_BC, and subtype C strains from different locations across China, India, and Myanmar. Genome-specific rates of evolution and divergence times were estimated using a Bayesian Markov chain Monte Carlo framework under various evolutionary models. CRF08_BC originated in 1990.3 (95% credible region [CR], 1988.6 to 1991.9) in Yunnan province before spreading to Guangxi (south) and Liaoning (northeast) around 1995. Inside Guangxi region, the eastward expansion of CRF08_BC continued from Baise city (west) to Binyang (central) between 1997 and 1998 and later spread into Pingxiang around 1999 in the south, mainly through injecting drug users. Additionally, CRF07_BC diverged from its common ancestor in 1993.3 (95% CR, 1991.2 to 1995.2) before crossing the border into southern Taiwan in late 1990s. Phylogenetic analysis indicates that both CRF08_BC and CRF07_BC can trace their origins to Yunnan. The parental Indian subtype C lineage likely entered China around 1981.2 (95% CR, 1976.7 to 1985.9). Using a multiple unlinked locus model, we also showed that the dates of divergence calculated in this study may not be significantly affected by intrasubtype recombination among different lineages. This is the first phylodynamic study depicting the spatiotemporal dynamics of HIV/AIDS in East Asia. PMID:18596096

  9. Inhibitory effect of the substance P and its derivative on erythropoietin-independent growth of erythroid progenitors in polycythemia vera.

    Science.gov (United States)

    Le Gall, Christelle; Ianotto, Jean-Christophe; Hardy, Elisabeth; Ugo, Valérie; Eveillard, Jean-Richard; Ngo-Sack, Françoise; Bourquard, Pascal; Morice, Patrick; Berthou, Christian

    2008-05-01

    Regulation of normal hematopoiesis by neuropeptide substance P (SP) and its amino terminal fragment, SP(1-4), has been reported. Endogenous erythroid colony (EEC) formation without erythropoietin is characteristic of polycythemia vera (PV), a chronic myeloproliferative disorder. We investigated the effect(s) of SP and SP(1-4) on EEC formation from PV BM mononuclear cells (BMMCs) and purified CD36+ erythroid progenitors. We found a potent in vitro inhibitory effect of SP and SP(1-4) on PV EEC formation for both BMMCs and CD36+ erythroid progenitors. The influence of SP and SP(1-4) on PV progenitor erythroid differentiation and cell viability was also investigated, and the impact of neurokinin receptors and G proteins in the inhibition were analyzed by quantitative PCR and with specific inhibitors. This progenitor inhibition was: (1) not mediated by accessory cells; (2) characterized by an increase in cell death and inhibition of the EPOindependent terminal erythroid differentiation; and (3) not mediated by the same neurokinin receptor. NK-1R and NK-2R antagonists completely abrogated the SP inhibitory effect but not SP(1-4)-induced inhibition. Furthermore, the truncated form of the NK-1R was predominant over the full-length mRNA and could mediated the SP inhibitory effect on PV CD36+ erythroid progenitors. Different G proteins were also implicated according to the erythroid differentiation stage of the PV cells. The observation of an inhibitory effect of SP and its related peptide, SP(1-4), on PV EEC formation at physiological concentrations (10-8M) suggests that neuropeptides represent a way to downregulate pathologic expansion of PV progenitors. PMID:17980427

  10. The leukemia associated ETO nuclear repressor gene is regulated by the GATA-1 transcription factor in erythroid/megakaryocytic cells

    Directory of Open Access Journals (Sweden)

    Gullberg Urban

    2010-05-01

    Full Text Available Abstract Background The Eight-Twenty-One (ETO nuclear co-repressor gene belongs to the ETO homologue family also containing Myeloid Translocation Gene on chromosome 16 (MTG16 and myeloid translocation Gene-Related protein 1 (MTGR1. By chromosomal translocations ETO and MTG16 become parts of fusion proteins characteristic of morphological variants of acute myeloid leukemia. Normal functions of ETO homologues have as yet not been examined. The goal of this work was to identify structural and functional promoter elements upstream of the coding sequence of the ETO gene in order to explore lineage-specific hematopoietic expression and get hints to function. Results A putative proximal ETO promoter was identified within 411 bp upstream of the transcription start site. Strong ETO promoter activity was specifically observed upon transfection of a promoter reporter construct into erythroid/megakaryocytic cells, which have endogeneous ETO gene activity. An evolutionary conserved region of 228 bp revealed potential cis-elements involved in transcription of ETO. Disruption of the evolutionary conserved GATA -636 consensus binding site repressed transactivation and disruption of the ETS1 -705 consensus binding site enhanced activity of the ETO promoter. The promoter was stimulated by overexpression of GATA-1 into erythroid/megakaryocytic cells. Electrophoretic mobility shift assay with erythroid/megakaryocytic cells showed specific binding of GATA-1 to the GATA -636 site. Furthermore, results from chromatin immunoprecipitation showed GATA-1 binding in vivo to the conserved region of the ETO promoter containing the -636 site. The results suggest that the GATA -636 site may have a role in activation of the ETO gene activity in cells with erythroid/megakaryocytic potential. Leukemia associated AML1-ETO strongly suppressed an ETO promoter reporter in erythroid/megakaryocytic cells. Conclusions We demonstrate that the GATA-1 transcription factor binds and

  11. Characterization of a distinct population of circulating human non-adherent endothelial forming cells and their recruitment via intercellular adhesion molecule-3.

    Directory of Open Access Journals (Sweden)

    Sarah L Appleby

    Full Text Available Circulating vascular progenitor cells contribute to the pathological vasculogenesis of cancer whilst on the other hand offer much promise in therapeutic revascularization in post-occlusion intervention in cardiovascular disease. However, their characterization has been hampered by the many variables to produce them as well as their described phenotypic and functional heterogeneity. Herein we have isolated, enriched for and then characterized a human umbilical cord blood derived CD133(+ population of non-adherent endothelial forming cells (naEFCs which expressed the hematopoietic progenitor cell markers (CD133, CD34, CD117, CD90 and CD38 together with mature endothelial cell markers (VEGFR2, CD144 and CD31. These cells also expressed low levels of CD45 but did not express the lymphoid markers (CD3, CD4, CD8 or myeloid markers (CD11b and CD14 which distinguishes them from 'early' endothelial progenitor cells (EPCs. Functional studies demonstrated that these naEFCs (i bound Ulex europaeus lectin, (ii demonstrated acetylated-low density lipoprotein uptake, (iii increased vascular cell adhesion molecule (VCAM-1 surface expression in response to tumor necrosis factor and (iv in co-culture with mature endothelial cells increased the number of tubes, tubule branching and loops in a 3-dimensional in vitro matrix. More importantly, naEFCs placed in vivo generated new lumen containing vasculature lined by CD144 expressing human endothelial cells (ECs. Extensive genomic and proteomic analyses of the naEFCs showed that intercellular adhesion molecule (ICAM-3 is expressed on their cell surface but not on mature endothelial cells. Furthermore, functional analysis demonstrated that ICAM-3 mediated the rolling and adhesive events of the naEFCs under shear stress. We suggest that the distinct population of naEFCs identified and characterized here represents a new valuable therapeutic target to control aberrant vasculogenesis.

  12. Feasibility of quantification of the distribution of blood flow in the normal human fetal circulation using CMR: a cross-sectional study

    Directory of Open Access Journals (Sweden)

    Seed Mike

    2012-11-01

    Full Text Available Abstract Background We present the first phase contrast (PC cardiovascular magnetic resonance (CMR measurements of the distribution of blood flow in twelve late gestation human fetuses. These were obtained using a retrospective gating technique known as metric optimised gating (MOG. Methods A validation experiment was performed in five adult volunteers where conventional cardiac gating was compared with MOG. Linear regression and Bland Altman plots were used to compare MOG with the gold standard of conventional gating. Measurements using MOG were then made in twelve normal fetuses at a median gestational age of 37 weeks (range 30–39 weeks. Flow was measured in the major fetal vessels and indexed to the fetal weight. Results There was good correlation between the conventional gated and MOG measurements in the adult validation experiment (R=0.96. Mean flows in ml/min/kg with standard deviations in the major fetal vessels were as follows: combined ventricular output (CVO 540±101, main pulmonary artery (MPA 327±68, ascending aorta (AAo 198±38, superior vena cava (SVC 147±46, ductus arteriosus (DA 220±39,pulmonary blood flow (PBF 106±59,descending aorta (DAo 273±85, umbilical vein (UV 160±62, foramen ovale (FO107±54. Results expressed as mean percentages of the CVO with standard deviations were as follows: MPA 60±4, AAo37±4, SVC 28±7, DA 41±8, PBF 19±10, DAo50±12, UV 30±9, FO 21±12. Conclusion This study demonstrates how PC CMR with MOG is a feasible technique for measuring the distribution of the normal human fetal circulation in late pregnancy. Our preliminary results are in keeping with findings from previous experimental work in fetal lambs.

  13. Extended flow cytometry characterization of normal bone marrow progenitor cells by simultaneous detection of aldehyde dehydrogenase and early hematopoietic antigens: implication for erythroid differentiation studies

    Directory of Open Access Journals (Sweden)

    Pascariello Caterina

    2008-05-01

    Full Text Available Abstract Background Aldehyde dehydrogenase (ALDH is a cytosolic enzyme highly expressed in hematopoietic precursors from cord blood and granulocyte-colony stimulating factor mobilized peripheral blood, as well as in bone marrow from patients with acute myeloblastic leukemia. As regards human normal bone marrow, detailed characterization of ALDH+ cells has been addressed by one single study (Gentry et al, 2007. The goal of our work was to provide new information about the dissection of normal bone marrow progenitor cells based upon the simultaneous detection by flow cytometry of ALDH and early hematopoietic antigens, with particular attention to the expression of ALDH on erythroid precursors. To this aim, we used three kinds of approach: i multidimensional analytical flow cytometry, detecting ALDH and early hematopoietic antigens in normal bone marrow; ii fluorescence activated cell sorting of distinct subpopulations of progenitor cells, followed by in vitro induction of erythroid differentiation; iii detection of ALDH+ cellular subsets in bone marrow from pure red cell aplasia patients. Results In normal bone marrow, we identified three populations of cells, namely ALDH+CD34+, ALDH-CD34+ and ALDH+CD34- (median percentages were 0.52, 0.53 and 0.57, respectively. As compared to ALDH-CD34+ cells, ALDH+CD34+ cells expressed the phenotypic profile of primitive hematopoietic progenitor cells, with brighter expression of CD117 and CD133, accompanied by lower display of CD38 and CD45RA. Of interest, ALDH+CD34- population disclosed a straightforward erythroid commitment, on the basis of three orders of evidences. First of all, ALDH+CD34- cells showed a CD71bright, CD105+, CD45- phenotype. Secondly, induction of differentiation experiments evidenced a clear-cut expression of glycophorin A (CD235a. Finally, ALDH+CD34- precursors were not detectable in patients with pure red cell aplasia (PRCA. Conclusion Our study, comparing surface antigen expression of

  14. Neural Control of the Circulation

    Science.gov (United States)

    Thomas, Gail D.

    2011-01-01

    The purpose of this brief review is to highlight key concepts about the neural control of the circulation that graduate and medical students should be expected to incorporate into their general knowledge of human physiology. The focus is largely on the sympathetic nerves, which have a dominant role in cardiovascular control due to their effects to…

  15. Plants and Photosynthesis: Level III, Unit 3, Lesson 1; The Human Digestive System: Lesson 2; Functions of the Blood: Lesson 3; Human Circulation and Respiration: Lesson 4; Reproduction of a Single Cell: Lesson 5; Reproduction by Male and Female Cells: Lesson 6; The Human Reproductive System: Lesson 7; Genetics and Heredity: Lesson 8; The Nervous System: Lesson 9; The Glandular System: Lesson 10. Advanced General Education Program. A High School Self-Study Program.

    Science.gov (United States)

    Manpower Administration (DOL), Washington, DC. Job Corps.

    This self-study program for the high-school level contains lessons in the following subjects: Plants and Photosynthesis; The Human Digestive System; Functions of the Blood; Human Circulation and Respiration; Reproduction of a Single Cell; Reproduction by Male and Female Cells; The Human Reproductive System; Genetics and Heredity; The Nervous…

  16. Gamma-interferon alters globin gene expression in neonatal and adult erythroid cells

    Energy Technology Data Exchange (ETDEWEB)

    Miller, B.A.; Perrine, S.P.; Antognetti, G.; Perlmutter, D.H.; Emerson, S.G.; Sieff, C.; Faller, D.V.

    1987-06-01

    The effect of gamma-interferon on fetal hemoglobin synthesis by purified cord blood, fetal liver, and adult bone marrow erythroid progenitors was studied with a radioligand assay to measure hemoglobin production by BFU-E-derived erythroblasts. Coculture with recombinant gamma-interferon resulted in a significant and dose-dependent decrease in fetal hemoglobin production by neonatal and adult, but not fetal, BFU-E-derived erythroblasts. Accumulation of fetal hemoglobin by cord blood BFU-E-derived erythroblasts decreased up to 38.1% of control cultures (erythropoietin only). Synthesis of both G gamma/A gamma globin was decreased, since the G gamma/A gamma ratio was unchanged. Picograms fetal hemoglobin per cell was decreased by gamma-interferon addition, but picograms total hemoglobin was unchanged, demonstrating that a reciprocal increase in beta-globin production occurred in cultures treated with gamma-interferon. No toxic effect of gamma-interferon on colony growth was noted. The addition of gamma-interferon to cultures resulted in a decrease in the percentage of HbF produced by adult BFU-E-derived cells to 45.6% of control. Fetal hemoglobin production by cord blood, fetal liver, and adult bone marrow erythroid progenitors, was not significantly affected by the addition of recombinant GM-CSF, recombinant interleukin 1 (IL-1), recombinant IL-2, or recombinant alpha-interferon. Although fetal progenitor cells appear unable to alter their fetal hemoglobin program in response to any of the growth factors added here, the interaction of neonatal and adult erythroid progenitors with gamma-interferon results in an altered expression of globin genes.

  17. Canonical Wnt signaling promotes early hematopoietic progenitor formation and erythroid specification during embryonic stem cell differentiation.

    Directory of Open Access Journals (Sweden)

    Anuradha Tarafdar

    Full Text Available The generation of hematopoietic stem cells (HSCs during development is a complex process linked to morphogenic signals. Understanding this process is important for regenerative medicine applications that require in vitro production of HSC. In this study we investigated the effects of canonical Wnt/β-catenin signaling during early embryonic differentiation and hematopoietic specification using an embryonic stem cell system. Our data clearly demonstrates that following early differentiation induction, canonical Wnt signaling induces a strong mesodermal program whilst maintaining a degree of stemness potential. This involved a complex interplay between β-catenin/TCF/LEF/Brachyury/Nanog. β-catenin mediated up-regulation of TCF/LEF resulted in enhanced brachyury levels, which in-turn lead to Nanog up-regulation. During differentiation, active canonical Wnt signaling also up-regulated key transcription factors and cell specific markers essential for hematopoietic specification, in particular genes involved in establishing primitive erythropoiesis. This led to a significant increase in primitive erythroid colony formation. β-catenin signaling also augmented early hematopoietic and multipotent progenitor (MPP formation. Following culture in a MPP specific cytokine cocktail, activation of β-catenin suppressed differentiation of the early hematopoietic progenitor population, with cells displaying a higher replating capacity and a propensity to form megakaryocytic erythroid progenitors. This bias towards erythroid lineage commitment was also observed when hematopoietic progenitors were directed to undergo myeloid colony formation. Overall this study underscores the importance of canonical Wnt/β-catenin signaling in mesodermal specification, primitive erythropoiesis and early hematopietic progenitor formation during hematopoietic induction.

  18. PRV-1, erythroid colonies and platelet Mpl are unrelated to thrombosis in essential thrombocythaemia

    DEFF Research Database (Denmark)

    Vannucchi, Alessandro M; Pancrazzi, Alessandro; Antonioli, Elisabetta;

    2004-01-01

    markers of ET, namely PRV-1 overexpression, endogenous erythroid colony (EEC) formation, and reduced platelet Mpl content. Fifty-three (60%) of 88 subjects studied had monoclonal myelopoiesis and presented a 32% incidence of major thrombosis compared with 6% of polyclonal subjects (P = 0.......009). The frequency of abnormalities of PRV-1, EEC, or Mpl was similar in monoclonal and polyclonal subjects (respectively, 28%, 48%, 75%, and 37%, 27%, 63%), and none of them correlated with thrombosis. We conclude that the exploited epigenetic markers constitute independent phenotypic variations...

  19. 5-Azacytidine acts directly on both erythroid precursors and progenitors to increase production of fetal hemoglobin.

    OpenAIRE

    Humphries, R K; Dover, G; Young, N S; Moore, J G; Charache, S.; Ley, T; Nienhuis, A W

    1985-01-01

    The effect of 5-azacytidine on erythroid precursors and progenitors was studied in nine patients with sickle cell anemia or severe thalassemia. Each patient received the drug intravenously for 5 or 7 d. 5-Azacytidine caused a four- to sixfold increase in gamma-messenger RNA concentration in bone marrow cells of eight of the nine patients and decreased the methylation frequency of a specific cytosine residue in the gamma-globin gene promoter in all nine patients. Within 2 d of the start of dru...

  20. S-1 induced secondary acute erythroid leukemia with a chromosome inv(12)(p13;q13)

    Institute of Scientific and Technical Information of China (English)

    Kensuke Matsumoto; Akira Kitanaka; Makiko Uemura; Fusako Waki; Tetsuya Fukumoto; Hiroaki Ohnishi; Yoshitsugu Kubota; Toshihiko Ishida

    2011-01-01

    Adjuvant chemotherapy by S-1 following gastrectomy is considered standard treatment in Japan. Analysis of follow-up data have proved the efficacy of S-1 administration,and that hematological adverse events were relatively rare. PPyrimidine anti-metabolites, including S-1, have shown relatively lower risks for secondary hematological malignancies in comparison to alkylating agents and topoisomerase-Ⅱ inhibitors. We here report a case of therapy-related leukemia after S-1 administration. A patient who had received S-1as the sole adjuvant chemotherapy was diagnosed with acute erythroid leukemia. To the best of our knowledge, our patient represents the first report of S-1 induced acute leukemia.

  1. Histone demethylase LSD1-mediated repression of GATA-2 is critical for erythroid differentiation

    Directory of Open Access Journals (Sweden)

    Guo Y

    2015-06-01

    Full Text Available Yidi Guo,1 Xueqi Fu,1,2 Yue Jin,1 Jing Sun,1 Ye Liu,1 Bo Huo,1 Xiang Li,1 Xin Hu1–31School of Life Sciences, Jilin University, 2Key Laboratory for Molecular Enzymology and Engineering of Ministry of Education, Jilin University, 3National Engineering Laboratory of AIDS Vaccine, School of Life Sciences, Jilin University, Changchun, People’s Republic of ChinaBackground: The transcription factor GATA-2 is predominantly expressed in hematopoietic stem and progenitor cells and counteracts the erythroid-specific transcription factor GATA-1, to modulate the proliferation and differentiation of hematopoietic cells. During hematopoietic cell differentiation, GATA-2 exhibits dynamic expression patterns, which are regulated by multiple transcription factors.Methods: Stable LSD1-knockdown cell lines were established by growing murine erythroleukemia (MEL or mouse embryonic stem cells together with virus particles, in the presence of Polybrene® at 4 µg/mL, for 24–48 hours followed by puromycin selection (1 µg/mL for 2 weeks. Real-time polymerase chain reaction (PCR-based quantitative chromatin immunoprecipitation (ChIP analysis was used to test whether the TAL1 transcription factor is bound to 1S promoter in the GATA-2 locus or whether LSD1 colocalizes with TAL1 at the 1S promoter. The sequential ChIP assay was utilized to confirm the role of LSD1 in the regulation of H3K4me2 at the GATA-2 locus during erythroid differentiation. Western blot analysis was employed to detect the protein expression. The alamarBlue® assay was used to examine the proliferation of the cells, and the absorbance was monitored at optical density (OD 570 nm and OD 600 nm.Results: In this study, we showed that LSD1 regulates the expression of GATA-2 during erythroid differentiation. Knockdown of LSD1 results in increased GATA-2 expression and inhibits the differentiation of MEL and embryonic stem cells. Furthermore, we demonstrated that LSD1 binds to the 1S promoter of the

  2. Erythroid-specific gene chromatin has an altered association with linker histones.

    OpenAIRE

    Ridsdale, J A; Rattner, J.B.; Davie, J R

    1988-01-01

    The chromatin of several genes was assayed for sensitivity to DNAase I and for solubility as polynucleosomes in 0.15 M NaCl. The degree of solubility of chromatin fragments as polynucleosomes in 0.15 M NaCl correlates well with the sensitivity to DNAase I for several genes. Chromatin of repressed, housekeeping and erythroid-specific genes can be distinguished as distinct groups by the degree to which they display these properties. NaCl precipitation of chromatin fragments stripped and then re...

  3. Fusion of ZMYND8 and RELA genes in acute erythroid leukemia

    DEFF Research Database (Denmark)

    Panagopoulos, Ioannis; Micci, Francesca; Thorsen, Jim;

    2013-01-01

    Acute erythroid leukemia was diagnosed in a 4-month-old boy. Cytogenetic analysis of bone marrow (BM) cells showed a t(11;20)(p11;q11) translocation. RNA extracted from the BM was sequenced and analyzed for fusion transcripts using the software FusionMap. A ZMYND8-RELA fusion was ranked first. RT...... the translocation. The putative ZMYND8-RELA fusion protein contains the Zinc-PHD finger domain, a bromodomain, a PWWP domain, a MYND type of zinc finger of ZMYND8, and the entire RELA protein, indicating that it might act leukemogenically by influencing several cellular processes including the NF-kappa-B pathway....

  4. A blood circulation model for reference man

    International Nuclear Information System (INIS)

    A dynamic blood circulation model that predicts the movement and gradual dispersion of a bolus of material in the circulation after its intravenous injection into an adult human. The main purpose of the model is improve the dosimetry of internally deposited radionuclides that decay in the circulation to a significant extent. The model partitions the blood volume into 24 separate organs or tissues, right heart chamber, left heart chamber, pulmonary circulation, arterial outflow to the aorta and large arteries, and venous return via the large veins. Model results were compared to data obtained from injection of carbon 11 labeled carbon monoxide or rubidium 86

  5. Nitrogen-doped multiple graphene aerogel/gold nanostar as the electrochemical sensing platform for ultrasensitive detection of circulating free DNA in human serum.

    Science.gov (United States)

    Ruiyi, Li; Ling, Liu; Hongxia, Bei; Zaijun, Li

    2016-05-15

    Graphene aerogel has attracted increasing attention due to its large specific surface area, high-conductivity and electronic interaction. The paper reported a facile synthesis of nitrogen-doped multiple graphene aerogel/gold nanostar (termed as N-doped MGA/GNS) and its use as the electrochemical sensing platform for detection of double stranded (dsDNA). On the one hand, the N-doped MGA offers a much better electrochemical performance compared with classical graphene aerogel. Interestingly, the performance can be enhanced by only increasing the cycle number of graphene oxide gelation. On the other hand, the hybridization with GNS further enhances the electrocatalytic activity towards Fe(CN)6(3-/4-). In addition, the N-doped MGA/GNS provides a well-defined three-dimensional architecture. The unique structure make it is easy to combine with dsDNA to form the electroactive bioconjugate. The integration not only triggers an ultrafast DNA electron and charge transfer, but also realizes a significant synergy between N-doped MGA, GNS and dsDNA. As a result, the electrochemical sensor based on the hybrid exhibits highly sensitive differential pulse voltammetric response (DPV) towards dsDNA. The DPV signal linearly increases with the increase of dsDNA concentration in the range from 1.0×10(-)(21) g ml(-)(1) to 1.0×10(-16) g ml(-1) with the detection limit of 3.9×10(-22) g ml(-1) (S/N=3). The sensitivity is much more than that of all reported DNA sensors. The analytical method was successfully applied in the electrochemical detection of circulating free DNA in human serum. The study also opens a window on the electrical properties of multiple graphene aerogel and DNA as well their hybrids to meet the needs of further applications as special nanoelectronics in molecule diagnosis, bioanalysis and catalysis. PMID:26745792

  6. A blood circulation model for reference man

    Energy Technology Data Exchange (ETDEWEB)

    Leggett, R.W.; Eckerman, K.F. [Oak Ridge National Lab., TN (United States). Health Sciences Research Div.; Williams, L.R. [Indiana Univ., South Bend, IN (United States). Div. of Liberal Arts and Sciences

    1999-01-01

    This paper describes a dynamic blood circulation model that predicts the movement and gradual dispersal of a bolus of material in the circulation after its intravascular injection into an adult human. The main purpose of the model is to improve the dosimetry of internally deposited radionuclides that decay in the circulation to a significant extent. The total blood volume is partitioned into the blood contents of 24 separate organs or tissues, right heart chambers, left heart chambers, pulmonary circulation, arterial outflow to the systemic tissues (aorta and large arteries), and venous return from the systemic tissues (large veins). As a compromise between physical reality and computational simplicity, the circulation of blood is viewed as a system of first-order transfers between blood pools, with the delay time depending on the mean transit time across the pool. The model allows consideration of incomplete, tissue-dependent extraction of material during passage through the circulation and return of material from tissues to plasma.

  7. Circulation of Stars

    Science.gov (United States)

    Boitani, P.

    2016-01-01

    Since the dawn of man, contemplation of the stars has been a primary impulse in human beings, who proliferated their knowledge of the stars all over the world. Aristotle sees this as the product of primeval and perennial “wonder” which gives rise to what we call science, philosophy, and poetry. Astronomy, astrology, and star art (painting, architecture, literature, and music) go hand in hand through millennia in all cultures of the planet (and all use catasterisms to explain certain phenomena). Some of these developments are independent of each other, i.e., they take place in one culture independently of others. Some, on the other hand, are the product of the “circulation of stars.” There are two ways of looking at this. One seeks out forms, the other concentrates on the passing of specific lore from one area to another through time. The former relies on archetypes (for instance, with catasterism), the latter constitutes a historical process. In this paper I present some of the surprising ways in which the circulation of stars has occurred—from East to West, from East to the Far East, and from West to East, at times simultaneously.

  8. Epigenetic Determinants of Erythropoiesis: Role of the Histone Methyltransferase SetD8 in Promoting Erythroid Cell Maturation and Survival.

    Science.gov (United States)

    DeVilbiss, Andrew W; Sanalkumar, Rajendran; Hall, Bryan D R; Katsumura, Koichi R; de Andrade, Isabela Fraga; Bresnick, Emery H

    2015-06-01

    Erythropoiesis, in which committed progenitor cells generate millions of erythrocytes daily, involves dramatic changes in the chromatin structure and transcriptome of erythroblasts, prior to their enucleation. While the involvement of the master-regulatory transcription factors GATA binding protein 1 (GATA-1) and GATA-2 in this process is established, the mechanistic contributions of many chromatin-modifying/remodeling enzymes in red cell biology remain enigmatic. We demonstrated that SetD8, a histone methyltransferase that catalyzes monomethylation of histone H4 at lysine 20 (H4K20me1), is a context-dependent GATA-1 corepressor in erythroid cells. To determine whether SetD8 controls erythroid maturation and/or function, we used a small hairpin RNA (shRNA)-based loss-of-function strategy in a primary murine erythroblast culture system. In this system, SetD8 promoted erythroblast maturation and survival, and this did not involve upregulation of the established regulator of erythroblast survival Bcl-x(L). SetD8 catalyzed H4K20me1 at a critical Gata2 cis element and restricted occupancy by an enhancer of Gata2 transcription, Scl/TAL1, thereby repressing Gata2 transcription. Elevating GATA-2 levels in erythroid precursors yielded a maturation block comparable to that induced by SetD8 downregulation. As lowering GATA-2 expression in the context of SetD8 knockdown did not rescue erythroid maturation, we propose that SetD8 regulation of erythroid maturation involves multiple target genes. These results establish SetD8 as a determinant of erythroid cell maturation and provide a framework for understanding how a broadly expressed histone-modifying enzyme mediates cell-type-specific GATA factor function. PMID:25855754

  9. Structural and functional characterization of an atypical activation domain in erythroid Krüppel-like factor (EKLF)

    OpenAIRE

    Mas, Caroline; Lussier-Price, Mathieu; Soni, Shefali; Morse, Thomas; Arseneault, Geneviève; Di Lello, Paola; Lafrance-Vanasse, Julien; Bieker, James J.; Omichinski, James G.

    2011-01-01

    Erythroid Krüppel-like factor (EKLF) plays an important role in erythroid development by stimulating β-globin gene expression. We have examined the details by which the minimal transactivation domain (TAD) of EKLF (EKLFTAD) interacts with several transcriptional regulatory factors. We report that EKLFTAD displays homology to the p53TAD and, like the p53TAD, can be divided into two functional subdomains (EKLFTAD1 and EKLFTAD2). Based on sequence analysis, we found that EKLFTAD2 is conserved in...

  10. LRF is an essential downstream target of GATA1 in erythroid development and regulates BIM-dependent apoptosis

    OpenAIRE

    Maeda, Takahiro; Ito, Keisuke; Merghoub, Taha; Poliseno, Laura; Hobbs, Robin M.; Wang, Guocan; Dong, Lin; Maeda, Manami; Dore, Louis C.; Zelent, Arthur; Luzzatto, Lucio; Teruya-Feldstein, Julie; Weiss, Mitchell J.; Pandolfi, Pier Paolo

    2009-01-01

    GATA-1-dependent transcription is essential for erythroid differentiation and maturation. Suppression of programmed cell death is also thought to be critical for this process; however, the link between these two features of erythropoiesis has remained elusive. Here, we show that the POZ-Krüppel family transcription factor, LRF (also known as Zbtb7a/Pokemon), is a direct target of GATA1 and plays an essential anti-apoptotic role during terminal erythroid differentiation. We find that loss of L...

  11. Restricted expression of the erythroid/brain glucose transporter isoform to perivenous hepatocytes in rats. Modulation by glucose.

    OpenAIRE

    Tal, M.; Schneider, D L; Thorens, B.; Lodish, H F

    1990-01-01

    The "erythroid/brain" glucose transporter (GT) isoform is expressed only in a subset of hepatocytes, those forming the first row around the terminal hepatic venules, while the "liver" GT is expressed in all hepatocytes. After 3 d of starvation, a three- to fourfold elevation of expression of the erythroid/brain GT mRNA and protein is detected in the liver as a whole; this correlates with the expression of this GT in more hepatocytes, those forming the first three to four rows around the hepat...

  12. Early events leading to erythroid differentiation in mouse Friend cells revealed by cell fusion experiments

    International Nuclear Information System (INIS)

    Cell fusion with two genetically marked Friend (murine erythroleukemia) cells has made it possible to characterize the very early events leading to erythroid differentiation, particularly the nature of reactions initiated by inducers such as dimethyl sulfoxide. We have found that brief exposure of Friend cells to dimethyl sulfoxide (as well as butyric acid or hexamethylene-bisacetamide) induces an early cellular activity required for erythroid differentiation which is detected only by fusion with ultraviolet-irradiated cells. The induction process of this activity consists of at least two distinct stages. In the first stage, the reaction proceeds without supply of metabolites from the medium and exhibits sensitivity to tumor promoters. The second stage is tightly coupled to cellular metabolic activity, notably protein synthesis. Under normal conditions, the induced activity is short-lived, suggesting turnover of the molecules responsible for this activity. There appears to be a signal produced following dimethyl sulfoxide pulse which acts as an inducer for this activity. The signal remains active for as long as 40 hr when protein synthesis is blocked

  13. Effect of HS2 and HS3 elements on erythroid-specific expression in transgenic mice

    Institute of Scientific and Technical Information of China (English)

    JIA Chunping; YAN Jingbin; XIAO Yanping; FANG Yudan; HUANG Shuzheng; ZENG Yitao

    2003-01-01

    The expression plasmids CMV/GFP, HS2ALL, HS3ALL and HS23ALL were selected to investigate the effect of HS2 and HS3 element on erythroid-specific expression in transgenic mice. These plasmids were digested with restriction enzymes and purified. And five DNA fragments, CMV/GFP, HS2/GFP, CMV/HS2/GFP, HS23/GFP and HS3/GFP were obtained. After purification, the above DNA fragments were microinjected into the pre-nuclei of the mice fertilized eggs and transgenic mice were generated, with an integration rate of 10.89%. The green fluorescence protein(GFP) expression in many transgenic mouse tissues was determined by FACS analysis. The results showed that the HS2 and 1.7 kb of β-globin gene promoter were sufficient for the erythroid-specific expression of β-globin gene. The GFP expression of different recombinant constructs was also analyzed in blood of all the transgenic mice with FACS. The results indicated that HS2 and HS3 had the same enhancement activity on the regulation of β-globin gene expression. Moreover, these two elements showed a significant synergistic effect on gene expression at the transgenic mouse level, although the GFP expression varied largely among different transgenic mouse litters.

  14. Interleukin 3 promotes erythroid burst formation in serum-free cultures without detectable erythropoietin

    International Nuclear Information System (INIS)

    Erythroid burst-forming units (BFU-E) from mouse bone marrow were grown for 7 days in agar or serum-free methylcellulose cultures in the presence or absence of erythropoietin (Ep) and/or interleukin 3 (IL-3). It was found that IL-3, even in the absence of serum and detectable Ep, was able to stimulate the full development of many erythroid bursts. This IL-3 effect was cell-dose dependent and did not appear to correlate with Ep dose. Spontaneous bursts and those stimulated by Ep only were rare and when seen were very small relative to those produced by IL-3 or IL-3 plus Ep. When addition of IL-3 or Ep to 7-day cultures was delayed, IL-3 but not Ep was shown to maintain BFU-E. No evidence was found by radioimmunoassay that Ep was produced or released in 7-day, serum-free cultures of bone marrow nor was Ep activity detected in culture media except those to which it had been added deliberately

  15. Involvement of Phosphatases in Proliferation, Maturation, and Hemoglobinization of Developing Erythroid Cells

    Directory of Open Access Journals (Sweden)

    Eitan Fibach

    2011-01-01

    Full Text Available Production of RBCs is triggered by the action of erythropoietin (Epo through its binding to surface receptors (Epo-R on erythroid precursors in the bone marrow. The intensity and the duration of the Epo signal are regulated by several factors, including the balance between the activities of kinesase and phosphatases. The Epo signal determines the proliferation and maturation of the precursors into hemoglobin (Hb-containing RBCs. The activity of various protein tyrosine phosphatases, including those involved in the Epo pathway, can be inhibited by sodium orthovanadate (Na3VO4, vanadate. Adding vanadate to cultured erythroid precursors of normal donors and patients with β-thalassemia enhanced cell proliferation and arrested maturation. This was associated with an increased production of fetal hemoglobin (HbF. Increased HbF in patients with β-hemoglobinopathies (β-thalassemia and sickle cell disease ameliorates the clinical symptoms of the disease. These results raise the possibility that specific and nontoxic inhibitors of phosphatases may be considered as a therapeutic modality for elevating HbF in patients with β-hemoglobinopathies as well as for intensifying the Epo response in other forms of anemia.

  16. Efficacy of Rapamycin as Inducer of Hb F in Primary Erythroid Cultures from Sickle Cell Disease and β-Thalassemia Patients.

    Science.gov (United States)

    Pecoraro, Alice; Troia, Antonio; Calzolari, Roberta; Scazzone, Concetta; Rigano, Paolo; Martorana, Adriana; Sacco, Massimiliano; Maggio, Aurelio; Di Marzo, Rosalba

    2015-01-01

    Phenotypic improvement of hemoglobinopathies such as sickle cell disease and β-thalassemia (β-thal) has been shown in patients with high levels of Hb F. Among the drugs proposed to increase Hb F production, hydroxyurea (HU) is currently the only one proven to improve the clinical course of these diseases. However, Hb F increase and patient's response are highly variable, indicating that new pharmacological agents could be useful for patients not responding to HU or showing a reduction of response during long-term therapy. In this study we evaluated the efficacy of rapamycin, a lypophilic macrolide used for the prevention of acute rejection in renal transplant recipients, as an inducer of Hb F production. The analyses were performed in cultured erythroid progenitors from 25 sickle cell disease and 25 β-thal intermedia (β-TI) patients. The use of a quantitative Real-Time-polymerase chain reaction ReTi-PCR technique and high performance liquid chromatography (HPLC) allowed us to determine the increase in γ-globin mRNA expression and Hb F production in human erythroid cells treated with rapamycin. The results of our study demonstrated an increase in vitro of γ-globin mRNA expression in 15 sickle cell disease and 14 β-TI patients and a corresponding Hb F increase. The induction by rapamycin, even if lower or similar in most of samples analyzed, in some cases was higher than HU. These data suggest that rapamycin could be a good candidate to be used in vivo for the treatment of hemoglobinopathies. PMID:26016899

  17. Circulating levels of chromatin fragments are inversely correlated with anti-dsDNA antibody levels in human and murine systemic lupus erythematosus

    DEFF Research Database (Denmark)

    Jørgensen, Mariann H; Rekvig, Ole Petter; Jacobsen, Rasmus S;

    2011-01-01

    Anti-dsDNA antibodies represent a central pathogenic factor in Lupus nephritis. Together with nucleosomes they deposit as immune complexes in the mesangial matrix and along basement membranes within the glomeruli. The origin of the nucleosomes and when they appear e.g. in circulation is not known...... inverse correlation between DNA concentration and anti-dsDNA antibodies may reflect antibody-dependent deposition of immune complexes during the development of lupus nephritis in autoimmune lupus prone mice. The measurement of circulating DNA in SLE sera by using qPCR may indicate and detect the...... development of lupus nephritis at an early stage....

  18. Identification of the receptor for erythropoietin by cross-linking to Friend virus-infected erythroid cells

    International Nuclear Information System (INIS)

    Erythropoietin (Epo) is a glycoprotein hormone that regulates erythroid development and interacts with surface receptors on developing erythroid cells. In this laboratory, a cell system with a relatively pure population of erythroid cells that respond to Epo has been developed. Immature erythroid cells are obtained from the spleens of mice infected with the anemia strain of Friend virus. The binding of 125I-labeled Epo (125-Epo) to plasma membranes from these cells was studied in this investigation. 125I-Epo binding reached equilibrium within 20 min at 370C. Twenty percent of the receptors bound 125I-Epo with a K/sub d/ of 0.08 x 10-9 M, while the remaining receptors bound the hormone with a k/sub d/ of 0.6 x 10-9 M. In this study, a receptor for Epo was identified by cross-linking 125I-Epo to the receptor in intact cells and plasma membrane preparations using disuccinimidyl suberate. Polyacrylamide gel electrophoresis revealed two labeled bands of 100 and 85 kDa. The 85-kDa band was more heavily labeled (65%) than the 100-kDa band. Both bands were equally decreased when increasing amounts of unlabeled Epo were included in the binding mixture, indicating a specific interaction of 175I-Epo with the receptor

  19. miR-214 protects erythroid cells against oxidative stress by targeting ATF4 and EZH2.

    Science.gov (United States)

    Gao, Ming; Liu, Yun; Chen, Yue; Yin, Chunyang; Chen, Jane-Jane; Liu, Sijin

    2016-03-01

    Nuclear factor (erythroid-derived 2) like 2 (Nrf2) is a key regulator in protecting cells against stress by targeting many anti-stress response genes. Recent evidence also reveals that Nrf2 functions partially by targeting mircroRNAs (miRNAs). However, the understanding of Nrf2-mediated cytoprotection through miRNA-dependent mechanisms is largely unknown. In the current study, we identified a direct Nrf2 targeting miRNA, miR-214, and demonstrated a protective role of miR-214 in erythroid cells against oxidative stresses generated by radiation, excess iron and arsenic (As) exposure. miR-214 expression was transcriptionally repressed by Nrf2 through a canonical antioxidant response element (ARE) within its promoter region, and this repression is ROS-dependence. The suppression of miR-214 by Nrf2 could antagonize oxidative stress-induced cell death in erythroid cells by two ways. First, miR-214 directly targeted ATF4, a crucial transcriptional factor involved in anti-stress responses, down regulation of miR-214 releases the repression of ATF4 translation and leads to increased ATF4 protein content. Second, miR-214 was able to prevent cell death by targeting EZH2, the catalytic core component of PRC2 complex that is responsible for tri-methylation reaction at lysine 27 (K27) of histone 3 (H3) (H3K27me3), by which As-induced miR-214 reduction resulted in an increased global H3K27me3 level and a compromised overexpression of a pro-apoptotic gene Bim. These two pathways downstream of miR-214 synergistically cooperated to antagonize erythroid cell death upon oxidative stress. Our combined data revealed a protective role of miR-214 signaling in erythroid cells against oxidative stress, and also shed new light on Nrf2-mediated cytoprotective machinery. PMID:26791102

  20. Carbon monoxide induced erythroid differentiation of K562 cells mimics the central macrophage milieu in erythroblastic islands.

    Directory of Open Access Journals (Sweden)

    Shlomi Toobiak

    Full Text Available Growing evidence supports the role of erythroblastic islands (EI as microenvironmental niches within bone marrow (BM, where cell-cell attachments are suggested as crucial for erythroid maturation. The inducible form of the enzyme heme oxygenase, HO-1, which conducts heme degradation, is absent in erythroblasts where hemoglobin (Hb is synthesized. Yet, the central macrophage, which retains high HO-1 activity, might be suitable to take over degradation of extra, harmful, Hb heme. Of these enzymatic products, only the hydrophobic gas molecule--CO can transfer from the macrophage to surrounding erythroblasts directly via their tightly attached membranes in the terminal differentiation stage.Based on the above, the study hypothesized CO to have a role in erythroid maturation. Thus, the effect of CO gas as a potential erythroid differentiation inducer on the common model for erythroid progenitors, K562 cells, was explored. Cells were kept under oxygen lacking environment to mimic BM conditions. Nitrogen anaerobic atmosphere (N₂A served as control for CO atmosphere (COA. Under both atmospheres cells proliferation ceased: in N₂A due to cell death, while in COA as a result of erythroid differentiation. Maturation was evaluated by increased glycophorin A expression and Hb concentration. Addition of 1%CO only to N₂A, was adequate for maintaining cell viability. Yet, the average Hb concentration was low as compared to COA. This was validated to be the outcome of diversified maturation stages of the progenitor's population.In fact, the above scenario mimics the in vivo EI conditions, where at any given moment only a minute portion of the progenitors proceeds into terminal differentiation. Hence, this model might provide a basis for further molecular investigations of the EI structure/function relationship.

  1. Parvovirus B19 Replication and Expression in Differentiating Erythroid Progenitor Cells.

    Directory of Open Access Journals (Sweden)

    Gloria Bua

    Full Text Available The pathogenic Parvovirus B19 (B19V is characterized by a strict adaptation to erythroid progenitor cells (EPCs, a heterogeneous population of differentiating cells with diverse phenotypic and functional properties. In our work, we studied the dynamics of B19V infection in EPCs in dependence on the cell differentiation stage, in terms of distribution of infected cells, synthesis of viral nucleic acids and production of infectious virus. EPCs at early differentiation stage led to an abortive infection, without viral genome replication and a very low transcriptional activity. EPCs at later stages were permissive, with highest levels of viral replicative activity at day 9 (+3.0 Log from 2 to 48 hpi and lower levels at day 18 (+1.5 Log from 2 to 48 hpi. B19V DNA increment was in accordance with the percentage of cells positive to flow-FISH assay (41.4% at day 9, 1.1% at day 18. Quantitation of total RNA indicated a close association of genome replication and transcription with viral RNA accumulation within infected cells related to viral DNA increase during the course of infection. Analysis of the different classes of mRNAs revealed two distinct pattern of genome expression profile with a fine regulation in the frequency utilization of RNA processing signals: an early phase, when cleavage at the proximal site leading to a higher relative production of mRNA for NS protein, and a late phase, when cleavage at the distal site was more frequent leading to higher relative abundance of mRNA for VP and 11 kDA proteins. Infectious virus was released from cells at day 6-15, but not at day 18. Our results, providing a detailed description of B19V replication and expression profile in differentiating EPCs, highlight the very tight adaptation of B19V to a specific cellular target defined both by its erythroid lineage and its differentiation stage.

  2. Parvovirus B19 Replication and Expression in Differentiating Erythroid Progenitor Cells.

    Science.gov (United States)

    Bua, Gloria; Manaresi, Elisabetta; Bonvicini, Francesca; Gallinella, Giorgio

    2016-01-01

    The pathogenic Parvovirus B19 (B19V) is characterized by a strict adaptation to erythroid progenitor cells (EPCs), a heterogeneous population of differentiating cells with diverse phenotypic and functional properties. In our work, we studied the dynamics of B19V infection in EPCs in dependence on the cell differentiation stage, in terms of distribution of infected cells, synthesis of viral nucleic acids and production of infectious virus. EPCs at early differentiation stage led to an abortive infection, without viral genome replication and a very low transcriptional activity. EPCs at later stages were permissive, with highest levels of viral replicative activity at day 9 (+3.0 Log from 2 to 48 hpi) and lower levels at day 18 (+1.5 Log from 2 to 48 hpi). B19V DNA increment was in accordance with the percentage of cells positive to flow-FISH assay (41.4% at day 9, 1.1% at day 18). Quantitation of total RNA indicated a close association of genome replication and transcription with viral RNA accumulation within infected cells related to viral DNA increase during the course of infection. Analysis of the different classes of mRNAs revealed two distinct pattern of genome expression profile with a fine regulation in the frequency utilization of RNA processing signals: an early phase, when cleavage at the proximal site leading to a higher relative production of mRNA for NS protein, and a late phase, when cleavage at the distal site was more frequent leading to higher relative abundance of mRNA for VP and 11 kDA proteins. Infectious virus was released from cells at day 6-15, but not at day 18. Our results, providing a detailed description of B19V replication and expression profile in differentiating EPCs, highlight the very tight adaptation of B19V to a specific cellular target defined both by its erythroid lineage and its differentiation stage. PMID:26845771

  3. The GATA1s isoform is normally down-regulated during terminal haematopoietic differentiation and over-expression leads to failure to repress MYB, CCND2 and SKI during erythroid differentiation of K562 cells

    Directory of Open Access Journals (Sweden)

    Halsey Christina

    2012-08-01

    Full Text Available Abstract Background Although GATA1 is one of the most extensively studied haematopoietic transcription factors little is currently known about the physiological functions of its naturally occurring isoforms GATA1s and GATA1FL in humans—particularly whether the isoforms have distinct roles in different lineages and whether they have non-redundant roles in haematopoietic differentiation. As well as being of general interest to understanding of haematopoiesis, GATA1 isoform biology is important for children with Down syndrome associated acute megakaryoblastic leukaemia (DS-AMKL where GATA1FL mutations are an essential driver for disease pathogenesis. Methods Human primary cells and cell lines were analyzed using GATA1 isoform specific PCR. K562 cells expressing GATA1s or GATA1FL transgenes were used to model the effects of the two isoforms on in vitro haematopoietic differentiation. Results We found no evidence for lineage specific use of GATA1 isoforms; however GATA1s transcripts, but not GATA1FL transcripts, are down-regulated during in vitro induction of terminal megakaryocytic and erythroid differentiation in the cell line K562. In addition, transgenic K562-GATA1s and K562-GATA1FL cells have distinct gene expression profiles both in steady state and during terminal erythroid differentiation, with GATA1s expression characterised by lack of repression of MYB, CCND2 and SKI. Conclusions These findings support the theory that the GATA1s isoform plays a role in the maintenance of proliferative multipotent megakaryocyte-erythroid precursor cells and must be down-regulated prior to terminal differentiation. In addition our data suggest that SKI may be a potential therapeutic target for the treatment of children with DS-AMKL.

  4. Lipid peroxidation and total cholesterol in HAART-naive patients infected with circulating recombinant forms of human immunodeficiency virus type-1 in Cameroon.

    Directory of Open Access Journals (Sweden)

    Georges Teto

    Full Text Available BACKGROUND: HIV infection has commonly been found to affect lipid profile and antioxidant defense. OBJECTIVES: To determine the effects of Human Immunodeficiency Virus (HIV infection and viral subtype on patient's cholesterol and oxidative stress markers, and determine whether in the absence of Highly Active Antiretroviral Therapy (HAART, these biochemical parameters could be useful in patient's management and monitoring disease progression in Cameroon. For this purpose, we measured total cholesterol (TC, LDL cholesterol (LDLC, HDL cholesterol (HDLC, total antioxidant ability (TAA, lipid peroxidation indices (LPI, and malondialdehyde (MDA in HIV negative persons and HIV positive HAART-naïve patients infected with HIV-1 group M subtypes. METHODS: We measured serum TC, LDLC, HDLC, plasma MDA, and TAA concentrations, and calculated LPI indices in 151 HIV-positive HAART-naïve patients and 134 seronegative controls. We also performed gene sequence analysis on samples from 30 patients to determine the effect of viral genotypes on these biochemical parameters. We also determined the correlation between CD4 cell count and the above biochemical parameters. RESULTS: We obtained the following controls/patients values for TC (1.96±0.54/1. 12±0. 48 g/l, LDLC (0. 67±0. 46/0. 43±0. 36 g/l, HDLC (105. 51±28. 10/46. 54±23. 36 mg/dl TAA (0. 63±0. 17/0. 16±0. 16 mM, MDA (0. 20±0. 07/0. 41±0. 10 µM and LPI (0. 34±0. 14/26. 02±74. 40. In each case, the difference between the controls and patients was statistically significant (p<0.05. There was a positive and statistically significant Pearson correlation between CD4 cell count and HDLC (r = +0.272; p<0.01, TAA (r = +0.199; p<0.05 and a negative and statistically significant Pearson correlation between CD4 cell count and LPI (r = -0.166; p<0.05. Pearson correlation between CD4 cell count and TC, CD4cell count and LDLC was positive but not statistically significant while it was negative but

  5. Microwave circulator design

    CERN Document Server

    Linkhart, Douglas K

    2014-01-01

    Circulator design has advanced significantly since the first edition of this book was published 25 years ago. The objective of this second edition is to present theory, information, and design procedures that will enable microwave engineers and technicians to design and build circulators successfully. This resource contains a discussion of the various units used in the circulator design computations, as well as covers the theory of operation. This book presents numerous applications, giving microwave engineers new ideas about how to solve problems using circulators. Design examples are provided, which demonstrate how to apply the information to real-world design tasks.

  6. Immunophenotyping of Circulating T Helper Cells Argues for Multiple Functions and Plasticity of T Cells In Vivo in Humans - Possible Role in Asthma

    OpenAIRE

    Carina Malmhäll; Apostolos Bossios; Madeleine Rådinger; Margareta Sjöstrand; You Lu; Bo Lundbäck; Jan Lötvall

    2012-01-01

    BACKGROUND: The immune process driving eosinophilic and non-eosinophilic asthma is likely driven by different subsets of T helper (Th) cells. Recently, in vitro studies and animal studies suggest that Th cell subsets displays plasticity by changing their transcription factor or by expressing multiple transcription factors. Our aim was to determine whether individuals with asthma and elevated circulating eosinophils express signs of different regulatory immune mechanisms compared with asthmati...

  7. Heavy and moderate interval exercise training alters low-flow-mediated constriction but does not increase circulating progenitor cells in healthy humans

    OpenAIRE

    Rakobowchuk, M; E. Harris; Taylor, A.; Baliga, V; Cubbon, RM; Rossiter, HB; Birch, KM

    2011-01-01

    Moderate-intensity endurance exercise training improves vascular endothelial vasomotor function; however, the impact of high-intensity exercise training has been equivocal. Thus, the effect of the physiological stress of the exercise remains poorly understood. Furthermore, enhanced vascular repair mediated by circulating progenitor cells may also be improved. To address whether the physiological stress of exercise training is an important factor contributing to these adaptations, 20 healthy p...

  8. Treatment with depleting CD4 monoclonal antibody results in a preferential loss of circulating naive T cells but does not affect IFN-gamma secreting TH1 cells in humans

    OpenAIRE

    Rep, M.H.G.; Oosten, van, J.M.F.; Roos, M T; Adér, H.J.; Polman, C H; Lier, van, R.

    1997-01-01

    CD4(pos) TH1 T cells are considered to play a central role in a number of human autoimmune diseases such as rheumatoid arthritis (RA) and multiple sclerosis. Experimental treatment protocols aimed at selectively eliminating CD4(pos) T cells thus far have yielded disappointing clinical results. Here we analyzed phenotype and function of circulating T cells in multiple sclerosis patients treated with the chimeric CD4 mAb cM-T412 in a randomized, double-blind, placebo-controlled, magnetic resona...

  9. Field Evaluation of the gag-Based Heteroduplex Mobility Assay for Genetic Subtyping of Circulating Recombinant Forms of Human Immunodeficiency Virus Type 1 in Abidjan, Côte d'Ivoire

    OpenAIRE

    Sawadogo, Souleymane; Adjé-Touré, Christiane; Bilé, Celestin E.; Ekpini, Rene E. A.; Chorba, Terence; John N. Nkengasong

    2003-01-01

    The gag-based heteroduplex mobility assay (gag-HMA) was evaluated for its ease and reliability in subtyping circulating recombinant forms (CRFs) of human immunodeficiency virus type 1 (HIV-1) in Côte d'Ivoire. One hundred thirty-two plasma samples were analyzed blindly for HIV-1 subtypes by sequencing the pol gene and by gag-HMA. DNA sequencing was used as the “gold standard.” Of the 132 samples sequenced, 108 (82%) were CRF02_AG, 14 (11%) were pure subtype A, 5 (4%) were subtype G, 3 (2%) we...

  10. NF-Y recruits both transcription activator and repressor to modulate tissue- and developmental stage-specific expression of human γ-globin gene.

    Directory of Open Access Journals (Sweden)

    Xingguo Zhu

    Full Text Available The human embryonic, fetal and adult β-like globin genes provide a paradigm for tissue- and developmental stage-specific gene regulation. The fetal γ-globin gene is expressed in fetal erythroid cells but is repressed in adult erythroid cells. The molecular mechanism underlying this transcriptional switch during erythroid development is not completely understood. Here, we used a combination of in vitro and in vivo assays to dissect the molecular assemblies of the active and the repressed proximal γ-globin promoter complexes in K562 human erythroleukemia cell line and primary human fetal and adult erythroid cells. We found that the proximal γ-globin promoter complex is assembled by a developmentally regulated, general transcription activator NF-Y bound strongly at the tandem CCAAT motifs near the TATA box. NF-Y recruits to neighboring DNA motifs the developmentally regulated, erythroid transcription activator GATA-2 and general repressor BCL11A, which in turn recruit erythroid repressor GATA-1 and general repressor COUP-TFII to form respectively the NF-Y/GATA-2 transcription activator hub and the BCL11A/COUP-TFII/GATA-1 transcription repressor hub. Both the activator and the repressor hubs are present in both the active and the repressed γ-globin promoter complexes in fetal and adult erythroid cells. Through changes in their levels and respective interactions with the co-activators and co-repressors during erythroid development, the activator and the repressor hubs modulate erythroid- and developmental stage-specific transcription of γ-globin gene.

  11. The glucocorticoid receptor cooperates with the erythropoietin receptor and c-Kit to enhance and sustain proliferation of erythroid progenitors in vitro

    NARCIS (Netherlands)

    W. Zauner; G. Mellitzer; P. Steinlein (Peter); G. Fritsch; K. Huber; H. Beug (Hartmut); B. Löwenberg (Bob); M.M. von Lindern (Marieke)

    1999-01-01

    textabstractAlthough erythropoietin (Epo) is essential for the production of mature red blood cells, the cooperation with other factors is required for a proper balance between progenitor proliferation and differentiation. In avian erythroid progenitors, steroid hormone

  12. Intense circulation of A/H5N1 and other avian influenza viruses in Cambodian live-bird markets with serological evidence of sub-clinical human infections.

    Science.gov (United States)

    Horm, Srey Viseth; Tarantola, Arnaud; Rith, Sareth; Ly, Sowath; Gambaretti, Juliette; Duong, Veasna; Y, Phalla; Sorn, San; Holl, Davun; Allal, Lotfi; Kalpravidh, Wantanee; Dussart, Philippe; Horwood, Paul F; Buchy, Philippe

    2016-01-01

    Surveillance for avian influenza viruses (AIVs) in poultry and environmental samples was conducted in four live-bird markets in Cambodia from January through November 2013. Through real-time RT-PCR testing, AIVs were detected in 45% of 1048 samples collected throughout the year. Detection rates ranged from 32% and 18% in duck and chicken swabs, respectively, to 75% in carcass wash water samples. Influenza A/H5N1 virus was detected in 79% of samples positive for influenza A virus and 35% of all samples collected. Sequence analysis of full-length haemagglutinin (HA) and neuraminidase (NA) genes from A/H5N1 viruses, and full-genome analysis of six representative isolates, revealed that the clade 1.1.2 reassortant virus associated with Cambodian human cases during 2013 was the only A/H5N1 virus detected during the year. However, multiplex reverse transcriptase-polymerase chain reaction (RT-PCR) analysis of HA and NA genes revealed co-circulation of at least nine low pathogenic AIVs from HA1, HA2, HA3, HA4, HA6, HA7, HA9, HA10 and HA11 subtypes. Four repeated serological surveys were conducted throughout the year in a cohort of 125 poultry workers. Serological testing found an overall prevalence of 4.5% and 1.8% for antibodies to A/H5N1 and A/H9N2, respectively. Seroconversion rates of 3.7 and 0.9 cases per 1000 person-months participation were detected for A/H5N1 and A/H9N2, respectively. Peak AIV circulation was associated with the Lunar New Year festival. Knowledge of periods of increased circulation of avian influenza in markets should inform intervention measures such as market cleaning and closures to reduce risk of human infections and emergence of novel AIVs. PMID:27436362

  13. Acute myeloid leukemia and transcription factors: role of erythroid Krüppel-like factor (EKLF

    Directory of Open Access Journals (Sweden)

    Ayala Rosa

    2012-06-01

    Full Text Available Abstract We have investigated the role of erythroid transcription factors mRNA expression in patients with acute myeloid leukemia (AML in the context of cytogenetic and other prognostic molecular markers, such as FMS-like Tyrosine Kinase 3 (FLT3, Nucleophosmin 1 (NPM1, and CCAAT/enhance-binding protein α (CEBPA mutations. Further validation of Erythroid Krüppel-like Factor (EKLF mRNA expression as a prognostic factor was assessed. We evaluated GATA binding protein 1 (GATA1, GATA binding protein 2 (GATA2, EKLF and Myeloproliferative Leukemia virus oncogen homology (cMPL gene mRNA expression in the bone marrow of 65 AML patients at diagnosis, and assessed any correlation with NPM1, FLT3 and CEBPA mutations. EKLF-positive AML was associated with lower WBC in peripheral blood (P = 0.049, a higher percentage of erythroblasts in bone marrow (p = 0.057, and secondary AMLs (P = 0.036. High expression levels of EKLF showed a trend to association with T-cell antigen expression, such as CD7 (P = 0.057. Patients expressing EKLF had longer Overall Survival (OS and Event Free Survival (EFS than those patients not expressing EKLF (median OS was 35.61 months and 19.31 months, respectively, P = 0.0241; median EFS was 19.80 months and 8.03 months, respectively, P = 0.0140. No correlation of GATA1, GATA2, EKLF and cMPL levels was observed with FLT-3 or NPM1 mutation status. Four of four CEBPA mutated AMLs were EKLF positive versus 10 of 29 CEBPA wild-type AMLs; three of the CEBPA mutated, EKLF-positive AMLs were also GATA2 positive. There were no cases of CEBPA mutations in the EKLF-negative AML group. In conclusion, we have validated EKLF mRNA expression as an independent predictor of outcome in AML, and its expression is not associated with FLT3-ITD and NPM1 mutations. EKLF mRNA expression in AML patients may correlate with dysregulated CEBPA.

  14. Endogenous erythroid colony assay in patients with polycythemia vera and its clinical significance

    Institute of Scientific and Technical Information of China (English)

    白洁; 邵宗鸿; 刘鸿; 施均; 何广胜; 曹燕然; 崔振珠; 吴玉红; 孙娟; 田征; 贾海蓉; 钱林生; 杨天楹; 杨崇礼

    2004-01-01

    Background Polycythemia vera (PV) is a malignant disorder of hemaopoietic stem cells which is characterized by clonal hyperproliferation and a low rate of apoptosis. This study was to assess endogenous erythroid colony (EEC) formation in the bone marrow of PV patients and determine its clinical significance.Methods The bone marrow mononuclear cells of 26 patients with PV, 2 patients with secondary erythrocytosis (SE), and 19 normal controls were cultured by Marsh's method for EEC evaluation, and the clinical significance was evaluated.Results EECs appeared in 25 patients with PV but not in 2 patients with SE and 19 normal controls. The number of EECs and the EEC ratio [EEC/erythropoietin (EPO)-dependent colony forming unit-erythroid (CFU-E)] in PV patients positively correlated with hemoglobin (Hb) levels. Their EEC number did not correlate with white blood cell (WBC) counts, platelet (PLT) counts, or leukocyte alkaline phosphatase (LAP) scores. Their EEC did not correlate with serum EPO levels. Fifteen patients with PV were treated with hydroxyurea (Hu) and/or interferon-alpha (IFN-α). Their EEC ratio before treatment positively correlated with the treatment time required for complete remission (CR) and negatively correlated with the time before relapse. The EEC numbers of 7 PV patients treated with Hu/IFN-α decreased after the blood cell counts dropped to normal levels. There was a positive correlation between the EEC ratio and the incidence of attacks of vascular thrombosis in PV patients. The numbers of apoptosised bone marrow mononuclear cells in PV patients were lower than those in normal controls. The EEC numbers of PV patients negatively correlated with the rate of apoptosis of bone marrow mononuclear cells.Conclusions EEC formation is characteristic in PV patients. EEC number in PV patients positively correlates with Hb levels, the time required for CR, and the incidence of attacks of vascular thrombosis. EEC number negatively correlates with the time

  15. Genome-wide identification of TAL1's functional targets: Insights into its mechanisms of action in primary erythroid cells

    OpenAIRE

    Kassouf, Mira T.; Hughes, Jim R.; Taylor, Stephen; McGowan, Simon J; Soneji, Shamit; Green, Angela L.; Vyas, Paresh; Porcher, Catherine

    2010-01-01

    Coordination of cellular processes through the establishment of tissue-specific gene expression programs is essential for lineage maturation. The basic helix-loop-helix hemopoietic transcriptional regulator TAL1 (formerly SCL) is required for terminal differentiation of red blood cells. To gain insight into TAL1 function and mechanisms of action in erythropoiesis, we performed ChIP-sequencing and gene expression analyses from primary fetal liver erythroid cells. We show that TAL1 coordinates ...

  16. Murine erythroid 5-aminolevulinate synthase: Truncation of a disordered N-terminal extension is not detrimental for catalysis.

    Science.gov (United States)

    Stojanovski, Bosko M; Breydo, Leonid; Uversky, Vladimir N; Ferreira, Gloria C

    2016-05-01

    5-Aminolevulinate synthase (ALAS), a pyridoxal 5'-phosphate (PLP)-dependent homodimeric enzyme, catalyzes the initial step of heme biosynthesis in non-plant eukaryotes. The precursor form of the enzyme is translated in the cytosol, and upon mitochondrial import, the N-terminal targeting presequence is proteolytically cleaved to generate mature ALAS. In bone marrow-derived erythroid cells, a mitochondrial- and site-specific endoprotease of yet unknown primary structure, produces a protein shorter than mature erythroid ALAS (ALAS2) found in peripheral blood erythroid cells. This truncated ALAS2 lacks the presequence and the N-terminal sequence (corresponding to ~7 KDa molecular mass) present in ALAS2 from peripheral blood erythroid cells. How the truncation affects the structural topology and catalytic properties of ALAS2 is presently not known. To address this question, we created a recombinant, truncated, murine ALAS2 (ΔmALAS2) devoid of the cleavable N-terminal region and examined its catalytic and biophysical properties. The N-terminal truncation of mALAS2 did not significantly affect the organization of the secondary structure, but a subtle reduction in the rigidity of the tertiary structure was noted. Furthermore, thermal denaturation studies revealed a decrease of 4.3°C in the Tm value of ΔmALAS2, implicating lower thermal stability. While the kcat of ΔmALAS2 is slightly increased over that of the wild-type enzyme, the slowest step in the ΔmALAS2-catalyzed reaction remains dominated by ALA release. Importantly, intrinsic disorder algorithms imply that the N-terminal region of mALAS2 is highly disordered, and thus susceptible to proteolysis. We propose that the N-terminal truncation offers a cell-specific ALAS2 regulatory mechanism without hindering heme synthesis. PMID:26854603

  17. Transferrin receptor number, synthesis, and endocytosis during erythropoietin-induced maturation of Friend virus-infected erythroid cells

    International Nuclear Information System (INIS)

    Erythropoietin (EP) responsive Friend virus-infected erythroid cells had 200,000 steady-state binding sites for transferrin at 370C when isolated from the spleens of Friend virus-infected mice. Upon culture of these cells with EP, the synthesis of transferrin receptors increased 4- to 7-fold and the number of transferrin-binding sites per cell doubled after 24 h. However, the rate of uptake of 59Fe from transferrin remained constant at approximately 35,000 atoms of 59Fe per minute per cell during this period in culture. The amount of 125I-transferrin internalized during the steady-state binding did not change during this culture period while the transferrin bound to the surface increased 3-fold. At all stages of erythroid maturation, the maximum rate of endocytosis was determined to be 18,000 molecules of transferrin per minute per cell, and the interval that 125I-transferrin remains in the interior of the cell was calculated to be 6.9 min. After 48 h of culture with EP, the number of steady-state transferrin-binding sites was reduced in part due to the sequestration of surface receptors within the cell. The uptake of iron from transferrin was limited by the level of endocytosis of transferrin during the initial phase of culture and the number of transferrin receptors at the cell surface during the latter stages of erythroid maturation of these cells

  18. Acute megakaryoblastic leukemia, unlike acute erythroid leukemia, predicts an unfavorable outcome after allogeneic HSCT.

    Science.gov (United States)

    Ishiyama, Ken; Yamaguchi, Takuhiro; Eto, Tetsuya; Ohashi, Kazuteru; Uchida, Naoyuki; Kanamori, Heiwa; Fukuda, Takahiro; Miyamura, Koichi; Inoue, Yoshiko; Taguchi, Jun; Mori, Takehiko; Iwato, Koji; Morishima, Yasuo; Nagamura-Inoue, Tokiko; Atsuta, Yoshiko; Sakamaki, Hisashi; Takami, Akiyoshi

    2016-08-01

    Acute erythroid leukemia (FAB-M6) and acute megakaryoblastic leukemia (FAB-M7) exhibit closely related properties in cells regarding morphology and the gene expression profile. Although allogeneic hematopoietic stem cell transplantation (allo-HSCT) is considered the mainstay of the treatment for both subtypes of leukemia due to their refractoriness to chemotherapy and high rates of relapse, it remains unclear whether allo-HSCT is curative in such cases due to their scarcity. We retrospectively examined the impact of allo-HSCT in 382 patients with M6 and 108 patients with M7 using nationwide HSCT data and found the overall survival (OS) and relapse rates of the M6 patients to be significantly better than those of the M7 patients after adjusting for confounding factors and statistically comparable with those of the patients with M0/M1/M2/M4/M5 disease. Consequently, the factors of age, gender, performance status, karyotype, disease status at HSCT and development of graft-vs.-host disease predicted the OS for the M6 patients, while the performance status and disease status at HSCT were predictive of the OS for the M7 patients. These findings substantiate the importance of distinguishing between M6 and M7 in the HSCT setting and suggest that unknown mechanisms influence the HSCT outcomes of these closely related subtypes of leukemia. PMID:27244257

  19. Chelation efficacy and erythroid response during deferasirox treatment in patients with myeloproliferative neoplasms in fibrotic phase.

    Science.gov (United States)

    Latagliata, Roberto; Montagna, Chiara; Porrini, Raffaele; Di Veroli, Ambra; Leonetti, Sabrina Crescenzi; Niscola, Pasquale; Ciccone, Fabrizio; Spadea, Antonio; Breccia, Massimo; Maurillo, Luca; Rago, Angela; Spirito, Francesca; Cedrone, Michele; De Muro, Marianna; Montanaro, Marco; Andriani, Alessandro; Bagnato, Antonino; Montefusco, Enrico; Alimena, Giuliana

    2016-06-01

    At present, very few data are available on deferasirox (DFX) in the treatment of patients with Philadelphia-negative myeloproliferative neoplasms in fibrotic phase (FP-MPN) and transfusion dependence. To address this issue, a retrospective analysis of 28 patients (22 male and 6 female) with FP-MPN and iron overload secondary to transfusion dependence was performed, based on patients enrolled in the database of our regional cooperative group who received treatment with DFX. DFX was started after a median interval from diagnosis of 12.8 months (IR 7.1-43.1) with median ferritin values of 1415 ng/mL (IR 1168-1768). Extra-hematological toxicity was reported in 16 of 28 patients (57.1%), but only two patients discontinued treatment due to toxicity. Among 26 patients evaluable for response (≥6 months of treatment), after a median treatment period of 15.4 months (IR 8.1-22.3), 11 patients (42.3%) achieved a stable and consistent reduction in ferritin levels 3 months) rise of Hb levels >1.5 g/dL, with disappearance of transfusion dependence in four cases. Treatment with DFX is feasible and effective in FP-MPN with iron overload. Moreover, in this setting, an erythroid response can occur in a significant proportion of patients. PMID:26277477

  20. FHL2 interacts with CALM and is highly expressed in acute erythroid leukemia

    International Nuclear Information System (INIS)

    The t(10;11)(p13;q14) translocation results in the fusion of the CALM (clathrin assembly lymphoid myeloid leukemia protein) and AF10 genes. This translocation is observed in acute myeloblastic leukemia (AML M6), acute lymphoblastic leukemia (ALL) and malignant lymphoma. Using a yeast two-hybrid screen, the four and a half LIM domain protein 2 (FHL2) was identified as a CALM interacting protein. Recently, high expression of FHL2 in breast, gastric, colon, lung as well as in prostate cancer was shown to be associated with an adverse prognosis. The interaction between CALM and FHL2 was confirmed by glutathione S-transferase-pulldown assay and co-immunoprecipitation experiments. The FHL2 interaction domain of CALM was mapped to amino acids 294–335 of CALM. The transcriptional activation capacity of FHL2 was reduced by CALM, but not by CALM/AF10, which suggests that regulation of FHL2 by CALM might be disturbed in CALM/AF10-positive leukemia. Extremely high expression of FHL2 was seen in acute erythroid leukemia (AML M6). FHL2 was also highly expressed in chronic myeloid leukemia and in AML with complex aberrant karyotype. These results suggest that FHL2 may play an important role in leukemogenesis, especially in the case of AML M6

  1. Therapeutic Effects of Erythroid Differentiation Regulator 1 on Imiquimod-Induced Psoriasis-Like Skin Inflammation

    Directory of Open Access Journals (Sweden)

    Kyung Eun Kim

    2016-02-01

    Full Text Available Psoriasis is a common skin disease accompanied by chronic inflammation. In previous studies, erythroid differentiation regulator 1 (ERDR1 was shown to have a negative correlation with proinflammatory cytokine IL-18. However, the role of ERDR1 in the inflammatory skin disease psoriasis has not been evaluated. In this study, to investigate the role of ERDR1 in psoriasis, recombinant ERDR1 was injected intraperitoneally into a psoriasis mouse model. Recombinant ERDR1 (rERDR1 significantly alleviated the symptoms of psoriasis-like skin inflammation and reduced the mRNA of various psoriasis-related markers, including keratin 14, S100A8, and Th17-related cytokines IL-17 and IL-22, suggesting that rERDR1 exerts therapeutic effects on psoriasis via the regulation of Th17 functions. Additionally, the expression of CCL20, a well-known Th17 attracting chemokine, was determined. CCL20 expression significantly decreased in the rERDR1-injected group compared with the vehicle (PBS-injected group. CCR6 expression in the psoriatic lesional skin was also decreased by rERDR1 administration, implying the inhibition of CCR6-expressing Th17 cell chemotaxis via the downregulation of CCL20. Taken together, this study provides the first evidence that ERDR1 may be a potential therapeutic target for psoriasis.

  2. FOXP1 Expression in Normal and Neoplastic Erythroid and Myeloid Cells.

    Science.gov (United States)

    Lovrić, Eva; Pavlov, Katarina Horvat; Korać, Petra; Dominis, Mara

    2015-09-01

    FOXP1 protein was firstly analyzed in normal tissues, and afterwards in different tumor tissues, mainly carcinoma and lymphoma. In B-cell malignancies, its role was well explored; its expression was shown to be connected with disease prognosis in certain B-non Hodgkin lymphomas. In this study, 16 bone marrow trephine samples from patients with no hematopoietic malignancies and 10 samples from peripheral blood of healthy individuals were immunostained with anti-FOXP1 antibody. Positive cells in bone marrows were not only lymphocytes, but also cells that are immunohistochemically positive for glycophorin C or myeloperoxidase. Peripheral blood samples showed no other positive cells, but small round lymphocytes. Additionally 60 samples from patients with myeloid lineage neoplasms were analyzed. 25 samples from patients with myelodysplastic syndrome (MDS) and 35 patients with myeloproliferative disease (MPD) were double immunostained with anti-FOXP1/anti-glycophorin C and anti-FOXP1/anti-myeloperoxidase antibodies. FOXP1 was found to be expressed in 22 cases of MDS and in none of MPD cases. Its expression in MDS was observed mostly in myeloperoxidase positive cells in contrast to gylcophorin C positive cells. Only two cases revealed both myeloperoxidase positive cells and gylcophorin C positive cells expressing FOXP1 transcription factor. Our results show that FOXP1 is present in normal cells of erythroid and myeloid linages and thus suggest its possible role in development of all hematopoetic cells as well as possible involvement in neoplasm development of myeloid disorders. PMID:26898077

  3. Developmental stage-related expression and identification of murine erythroid differentiation-denucleation factor (MEDDF)

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    Using MEDDF cDNA fragment in plasmid pBS-SK-MEDDF as template the coding sequence was cloned into pGEM-T-Easy plasmid by PCR method to delete non-coding sequence. After DNA sequencing it was confirmed that the clone sequence was correct, the coding region then was inserted into the vector pET-30a between BamH I and Hind III to construct eukaryotic expression vector. It was found that the specific protein was up to 40% of total bactorial proteins in certain high-expression E. coli. High titer of anti-sera was detected by inoculating New Zealand rabbits with purified MEDDF protein as an antigen. By using immunocytochemical staining it was demonstrated that the expression of MEDDF was exhibited in a developmental stage-specific manner, suggesting that MEDDF may play a certain role in the initiation of murine erythroid terminal differentiation and nuclear condensation. As for the expression of MEDDF appearing in granulocytes and megakaryocyter in murine bone marrow, it may indicate that there is an original relationship between the proteins and differentiation of murine myelogenous lineage.

  4. Therapeutic fetal-globin inducers reduce transcriptional repression in hemoglobinopathy erythroid progenitors through distinct mechanisms.

    Science.gov (United States)

    Dai, Yan; Sangerman, Jose; Luo, Hong Yuan; Fucharoen, Suthat; Chui, David H K; Faller, Douglas V; Perrine, Susan P

    2016-01-01

    Pharmacologic augmentation of γ-globin expression sufficient to reduce anemia and clinical severity in patients with diverse hemoglobinopathies has been challenging. In studies here, representative molecules from four chemical classes, representing several distinct primary mechanisms of action, were investigated for effects on γ-globin transcriptional repressors, including components of the NuRD complex (LSD1 and HDACs 2-3), and the downstream repressor BCL11A, in erythroid progenitors from hemoglobinopathy patients. Two HDAC inhibitors (MS-275 and SB939), a short-chain fatty acid derivative (sodium dimethylbutyrate [SDMB]), and an agent identified in high-throughput screening, Benserazide, were studied. These therapeutics induced γ-globin mRNA in progenitors above same subject controls up to 20-fold, and increased F-reticulocytes up to 20%. Cellular protein levels of BCL11A, LSD-1, and KLF1 were suppressed by the compounds. Chromatin immunoprecipitation assays demonstrated a 3.6-fold reduction in LSD1 and HDAC3 occupancy in the γ-globin gene promoter with Benserazide exposure, 3-fold reduction in LSD-1 and HDAC2 occupancy in the γ-globin gene promoter with SDMB exposure, while markers of gene activation (histone H3K9 acetylation and H3K4 demethylation), were enriched 5.7-fold. These findings identify clinical-stage oral therapeutics which inhibit or displace major co-repressors of γ-globin gene transcription and may suggest a rationale for combination therapy to produce enhanced efficacy. PMID:26603726

  5. Implication of enterohepatic re-circulation on single dose bioequivalence evaluation of two brands of clonidine hydrochloride tablets in healthy human volunteers

    Directory of Open Access Journals (Sweden)

    Mehta H

    2009-01-01

    Full Text Available A single dose, crossover bioequivalence study of two different brands of clonidine hydrochloride 25 μg tablets was conducted in 24 (+2 stand by healthy, adult, male, Indian subjects under fasting conditions to check the implication of enterohepatic re-circulation on assessment of bioequivalence. After an overnight fasting of at least 10 h, the subjects received single oral dose of test or reference product with either of the product as per randomization schedule in each period with a washout period of 10 days. The pre-dose blood sample was collected within a period of one h before dosing. The post-dose blood samples were collected at specified time intervals up to 96 h. The plasma concentrations of clonidine were quantified by validated LCMS/MS method and pharmacokinetic parameters were computed. The 90% confidence intervals of test/reference ratios for C max and area under the plasma-concentration- time-curve AUC under 0-t were found to be between 0.80 and 1.25 for log-transformed data. Analysis of variance did not show significant difference to these parameters. No meaningful values of K el and therefore AUC under 0-infinity could be calculated for significant number of subjects due to enterohepatic re-circulation. Based on the results obtained, two different brands of clonidine 25 μg tablets have comparable rate and extent of absorption after oral administration but failed to show bioequivalence as per regulatory requirement of Food and Drugs Administration-united states.

  6. Defining origins of malignant B cells: a new circulating normal human IgM(+)D(+) B-cell subset lacking CD27 expression and displaying somatically mutated IGHV genes as a relevant memory population.

    Science.gov (United States)

    Weston-Bell, N; Townsend, M; Di Genova, G; Forconi, F; Sahota, S S

    2009-11-01

    In probing the cell of origin in malignant B cells, an imprint of somatic hypermutation (SHM) in immunoglobulin (Ig) variable (V) region genes delineates antigen encounter, and identifying the precise pathway generating SHM in the normal B-cell counterpart becomes relevant. SHM remains the definitive memory imprint in normal human B cells, but CD27 expression also delineates memory. Recently, dye extrusion adenosine triphosphate-binding transporter assays identified circulating isotype-switched memory B cells that lacked CD27, yet exhibited low levels of SHM. To extend findings, we report a pre-switched CD27(-ve) circulating memory B-cell population in normal blood using comparable assays, and isolated CD19(+)IgM(+)D(+)CD27(-ve) cells (>99% purity) for the analysis of IGHV5/IGHV3-IGHM transcripts. Of these (n=334), approximately 78% were germ line and naive B cell derived. Strikingly, 21.9% of the transcripts were mutated. They showed 3-5 mutations (13.5% of sequences) and >5 mutations (8.4% of sequences) per transcript. Accrual of mutations in a subset of CD19(+)IgM(+)D(+)CD27(-ve) cells define a new circulating pre-switched memory B-cell pool, present in substantial numbers in the population harboring naive B cells. These CD19(+)IgM(+)D(+)CD27(-ve) memory B cells may have a distinct lineage and function, and seem relevant to understanding origins of malignant B cells, in particular those of hairy cell leukemia cells, which display mutated V genes yet lack CD27 expression. PMID:19776762

  7. Concepts in Assisted Circulation

    OpenAIRE

    Lefemine, Armand A.; Dunbar, Jacob; DeLucia, Anthony

    1986-01-01

    Assisted circulation by extracorporeal and extracardiac bypass techniques must be based on the requirements of the heart and of the total body, though these may differ. The cardiac problem in cardiogenic shock is more likely to be a biventricular problem demanding decompression of both sides. Extra pulmonary oxygenation should be avoided because of complexity in long-term use. Principles of assisted circulation may be applied in an extra-thoracic temporary manner or as an intracorporeal long-...

  8. Gaussian Fibonacci Circulant Type Matrices

    Directory of Open Access Journals (Sweden)

    Zhaolin Jiang

    2014-01-01

    Full Text Available Circulant matrices have become important tools in solving integrable system, Hamiltonian structure, and integral equations. In this paper, we prove that Gaussian Fibonacci circulant type matrices are invertible matrices for n>2 and give the explicit determinants and the inverse matrices. Furthermore, the upper bounds for the spread on Gaussian Fibonacci circulant and left circulant matrices are presented, respectively.

  9. The predominance of Human Immunodeficiency Virus type 1 (HIV-1 circulating recombinant form 02 (CRF02_AG in West Central Africa may be related to its replicative fitness

    Directory of Open Access Journals (Sweden)

    Butel Christelle

    2006-07-01

    Full Text Available Abstract Background CRF02_AG is the predominant HIV strain circulating in West and West Central Africa. The aim of this study was to test whether this predominance is associated with a higher in vitro replicative fitness relative to parental subtype A and G viruses. Primary HIV-1 isolates (10 CRF02_AG, 5 subtype A and 5 subtype G were obtained from a well-described Cameroonian cohort. Growth competition experiments were carried out at equal multiplicity of infection in activated T cells and monocyte-derived dendritic cells (MO-DC in parallel. Results Dual infection/competition experiments in activated T cells clearly indicated that CRF02_AG isolates had a significant replication advantage over the subtype A and subtype G viruses. The higher fitness of CRF02_AG was evident for isolates from patients with CD4+ T cell counts >200 cells/μL (non-AIDS or CD4+ T cell counts Conclusion We observed a higher ex vivo replicative fitness of CRF02_AG isolates compared to subtype A and G viruses from the same geographic region and showed that this was independent of the co-receptor tropism and irrespective of high or low CD4+ T cell count. This advantage in replicative fitness may contribute to the dominant spread of CRF02_AG over A and G subtypes in West and West Central Africa.

  10. Dynamic transcription factor activity profiles reveal key regulatory interactions during megakaryocytic and erythroid differentiation.

    Science.gov (United States)

    Duncan, Mark T; Shin, Seungjin; Wu, Jia J; Mays, Zachary; Weng, Stanley; Bagheri, Neda; Miller, William M; Shea, Lonnie D

    2014-10-01

    The directed differentiation toward erythroid (E) or megakaryocytic (MK) lineages by the MK-E progenitor (MEP) could enhance the ex vivo generation of red blood cells and platelets for therapeutic transfusions. The lineage choice at the MEP bifurcation is controlled in large part by activity within the intracellular signal transduction network, the output of which determines the activity of transcription factors (TFs) and ultimately gene expression. Although many TFs have been implicated, E or MK differentiation is a complex process requiring multiple days, and the dynamics of TF activities during commitment and terminal maturation are relatively unexplored. Herein, we applied a living cell array for the large-scale, dynamic quantification of TF activities during MEP bifurcation. A panel of hematopoietic TFs (GATA-1, GATA-2, SCL/TAL1, FLI-1, NF-E2, PU.1, c-Myb) was characterized during E and MK differentiation of bipotent K562 cells. Dynamic TF activity profiles associated with differentiation towards each lineage were identified, and validated with previous reports. From these activity profiles, we show that GATA-1 is an important hub during early hemin- and PMA-induced differentiation, and reveal several characteristic TF interactions for E and MK differentiation that confirm regulatory mechanisms documented in the literature. Additionally, we highlight several novel TF interactions at various stages of E and MK differentiation. Furthermore, we investigated the mechanism by which nicotinamide (NIC) promoted terminal MK maturation using an MK-committed cell line, CHRF-288-11 (CHRF). Concomitant with its enhancement of ploidy, NIC strongly enhanced the activity of three TFs with known involvement in terminal MK maturation: FLI-1, NF-E2, and p53. Dynamic profiling of TF activity represents a novel tool to complement traditional assays focused on mRNA and protein expression levels to understand progenitor cell differentiation. PMID:24853077

  11. The radiation response of murine erythroid progenitors (CFU/sub E/)

    International Nuclear Information System (INIS)

    The radiation response of murine erythroid progenitors (CFU/sub E/) to irradiation followed by in situ holding and to split dose irradiations was investigated. LAF/sub 1//JAX female mice were whole body irradiated with 150 kVp X rays. The femoral bone marrow was extracted to assay for CFU survival by the plasma clot culture method. In situ holding experiments were performed in which 2.0 Gy was delivered, and the CFU/sub E/ were allowed to remain in situ for various time intervals between irradiation and culturing. The surviving fraction sharply declined from 0.21 for CFU/sub E/ cultured immediately after irradiation to a minimum value of 0.04 for irradiated CFU/sub E/ held in situ for 1.5 hours prior to culturing. Subsequently, the surviving fraction increased rapidly approaching immediate plating values within 6 hours of in situ holding. In split dose experiments a conditioning dose of 0.8 Gy was administered at ''time zero,'' and at various time intervals after the first dose, a second dose of 0.8 Gy was delivered. The CFU/sub E/ were cultured immediately after the delivery of the second dose. A pattern similar to that for in situ holding experiments was observed. The surviving fraction decreased from 0.24 for 1.6 Gy delivered in one dose to 0.06 for split doses separated by 45 minutes. The surviving fraction then rose to 0.2 for split doses separated by 6 hours. The possible roles of repair, division and intercompartmental transitions in the above phenomena are discussed

  12. On Pareto theory of circulation of elites

    OpenAIRE

    Ricardo P\\'erez-Marco

    2014-01-01

    We prove that Pareto theory of circulation of elites results from our wealth evolution model, Kelly criterion for optimal betting and Keynes' observation of "animal spirits" that drive the economy and cause that human financial decisions are prone to excess risk-taking.

  13. Method and cell lines for the production of monoclonal antibodies to human glycophorin A

    Science.gov (United States)

    Bigbee, W.L.; Fong, S.S.N.; Jensen, R.H.; Vanderlaan, M.

    Cloned mouse hybridoma cell lines have been established which continuously produce antibodies that differentiate between the M and N forms of human glycophorin A. These antibodies have potential application as human blood group reagents, as markers for terminally differentiated erythroid cells and as immunofluorescent labels of somatically variant human erythrocytes.

  14. PULMONARY CIRCULATION AT EXERCISE

    OpenAIRE

    R. Naeije; CHESLER, N

    2012-01-01

    The pulmonary circulation is a high flow and low pressure circuit, with an average resistance of 1 mmHg.min.L−1 in young adults, increasing to 2.5 mmHg.min.L−1 over 4–6 decades of life. Pulmonary vascular mechanics at exercise are best described by distensible models. Exercise does not appear to affect the time constant of the pulmonary circulation or the longitudinal distribution of resistances. Very high flows are associated with high capillary pressures, up to a 20–25 mmHg threshold associ...

  15. Hematopoietic deletion of transferrin receptor 2 in mice leads to a block in erythroid differentiation during iron-deficient anemia.

    Science.gov (United States)

    Rishi, Gautam; Secondes, Eriza S; Wallace, Daniel F; Subramaniam, V Nathan

    2016-08-01

    Iron metabolism and erythropoiesis are inherently interlinked physiological processes. Regulation of iron metabolism is mediated by the iron-regulatory hormone hepcidin. Hepcidin limits the amount of iron released into the blood by binding to and causing the internalization of the iron exporter, ferroportin. A number of molecules and physiological stimuli, including erythropoiesis, are known to regulate hepcidin. An increase in erythropoietic demand decreases hepcidin, resulting in increased bioavailable iron in the blood. Transferrin receptor 2 (TFR2) is involved in the systemic regulation of iron metabolism. Patients and mice with mutations in TFR2 develop hemochromatosis due to inappropriate hepcidin levels relative to body iron. Recent studies from our laboratory and others have suggested an additional role for TFR2 in response to iron-restricted erythropoiesis. These studies used mouse models with perturbed systemic iron metabolism: anemic mice lacking matriptase-2 and Tfr2, or bone marrow transplants from iron-loaded Tfr2 null mice. We developed a novel transgenic mouse model which lacks Tfr2 in the hematopoietic compartment, enabling the delineation of the role of Tfr2 in erythroid development without interfering with its role in systemic iron metabolism. We show that in the absence of hematopoietic Tfr2 immature polychromatic erythroblasts accumulate with a concordant reduction in the percentage of mature erythroid cells in the spleen and bone marrow of anemic mice. These results demonstrate that erythroid Tfr2 is essential for an appropriate erythropoietic response in iron-deficient anemia. These findings may be of relevance in clinical situations in which an immediate and efficient erythropoietic response is required. Am. J. Hematol. 91:812-818, 2016. © 2016 Wiley Periodicals, Inc. PMID:27169626

  16. Genomewide analysis of reassortment and evolution of human influenza A(H3N2) viruses circulating between 1968 and 2011

    NARCIS (Netherlands)

    K.B. Westgeest (Kim); C.A. Russell (Colin); X. Lin (Xudong); M.I. Spronken (Monique); T.M. Bestebroer (Theo); J. Bahl (Justin); R. van Beek (Ruud); E. Skepner (Eugene); R.A. Halpin (Rebecca); J.C. de Jong (Jan); G.F. Rimmelzwaan (Guus); A.D.M.E. Osterhaus (Albert); D.R. Smith (Derek Richard); C.E. Wentworth (Charles); R.A.M. Fouchier (Ron); M.T. de Graaf (Marieke)

    2014-01-01

    textabstractInfluenza A(H3N2) viruses became widespread in humans during the 1968 H3N2 virus pandemic and have been a major cause of influenza epidemics ever since. These viruses evolve continuously by reassortment and genomic evolution. Antigenic drift is the cause for the need to update influenza

  17. Erythroid overexpression of C/EBPgamma in transgenic mice affects gamma-globin expression and fetal liver erythropoiesis.

    OpenAIRE

    Zafarana, Gaetano; Rottier, Robbert; Grosveld, Frank; Philipsen, Sjaak

    2000-01-01

    textabstractThe CCAAT boxes of the beta-like globin genes interact with three proteins: NF-Y, GATA-1 and NFE-6. We demonstrate that NFE-6 contains C/EBPgamma, and address its role in globin gene regulation by erythroid overexpression of C/EBPgamma, and a dominant-negative form C/EBPgammaDeltaB, in mice. Elevated levels of C/EBPgamma, but not C/EBPgammaDeltaB, increase expression of the (fetal) gamma-globin relative to the (adult) beta-globin gene. Interestingly, fetal liver erythropoiesis is ...

  18. Body fat mass and macronutrient intake in relation to circulating soluble leptin receptor, free leptin index, adiponectin, and resistin concentrations in healthy humans.

    Science.gov (United States)

    Yannakoulia, Mary; Yiannakouris, Nikos; Blüher, Susann; Matalas, Antonia-Leda; Klimis-Zacas, Dorothy; Mantzoros, Christos S

    2003-04-01

    The adipocyte-derived hormones leptin [which circulates in a free form and bound to a soluble leptin receptor (sOB-R)], adiponectin, and resistin play a key role in regulating energy homeostasis and metabolism. We assessed the association between body composition, total energy, and macronutrient intake and serum leptin, sOB-R, free leptin index, adiponectin, and resistin concentrations in 61 female and 53 male consecutively enrolled healthy Greek students. In this cross-sectional study, total energy and macronutrient intake were determined using 3-d food records. Body composition was assessed by bioelectrical impedance analysis; fasting blood samples were taken for the measurement of total leptin, sOB-R, adiponectin, and resistin; and the ratio leptin/sOB-R was used as an index of free leptin. Serum sOB-R concentrations were lower in the female subjects compared with the males (27.24 +/- 29.06 vs. 50.14 +/- 39.74 ng/ml, P < 0.001), whereas leptin, adiponectin, and resistin concentrations were significantly higher in females (leptin: 9.93 +/- 6.01 vs. 3.27 +/- 2.54 ng/ml, P < 0.001; adiponectin: 11.40 +/- 6.73 micro g/ml vs. 4.90 +/- 2.79 micro g/ml; P < 0.001; resistin: 16.86 +/- 5.39 ng/ml in females vs. 14.00 +/- 7.16 ng/ml in males, P < 0.02). Simple regression analysis showed that, in both genders, leptin, free leptin index, adiponectin, and resistin correlated positively with body fat mass and negatively with waist to hip ratio. sOB-R correlated negatively with body fat mass and positively with waist to hip ratio. Multiple regression analysis models controlling for gender, body fat, and total energy intake demonstrated that sOB-R is positively associated with energy intake from carbohydrates and negatively with energy intake from dietary fat, whereas free leptin index is negatively associated with energy intake from carbohydrates and positively with energy intake from dietary fat. No statistically significant correlations were observed between serum

  19. Partial characterization and clinical correlation of circulating human immunoglobulins directed against thyrotrophin binding sites in guinea pig fat cell membranes. Development of a direct enzyme immunoassay.

    OpenAIRE

    Baker, J. R.; Lukes, Y G; Smallridge, R.C.; Berger, M.; Burman, K. D.

    1983-01-01

    To obviate several problems inherent in indirect thyroid-stimulating hormone (TSH) receptor antibody assays, we developed an enzyme-linked immunosorbent assay (ELISA) that measures antibodies binding to guinea pig fat cell membrane, which contain high concentrations of TSH receptors. Solubilized guinea pig fat cell membranes were adsorbed to plastic microtiter plates and served as the solid-phase antigen. Test sera and affinity-purified alkaline phosphatase-conjugated anti-human IgG were co-i...

  20. Feasibility of quantification of the distribution of blood flow in the normal human fetal circulation using CMR: a cross-sectional study

    OpenAIRE

    Seed Mike; F P van Amerom Joshua; Yoo Shi-Joon; Al Nafisi Bahiyah; Grosse-Wortmann Lars; Jaeggi Edgar; Jansz Michael S; Macgowan Christopher K

    2012-01-01

    Abstract Background We present the first phase contrast (PC) cardiovascular magnetic resonance (CMR) measurements of the distribution of blood flow in twelve late gestation human fetuses. These were obtained using a retrospective gating technique known as metric optimised gating (MOG). Methods A validation experiment was performed in five adult volunteers where conventional cardiac gating was compared with MOG. Linear regression and Bland Altman plots were used to compare MOG with the gold st...

  1. Risk group characteristics and viral transmission clusters in South-East Asian patients infected with human immunodeficiency virus-1 (HIV-1) circulating recombinant form (CRF) 01_AE and subtype B.

    Science.gov (United States)

    Oyomopito, Rebecca A; Chen, Yen-Ju; Sungkanuparph, Somnuek; Kantor, Rami; Merati, Tuti; Yam, Wing-Cheong; Sirisanthana, Thira; Li, Patrick C K; Kantipong, Pacharee; Phanuphak, Praphan; Lee, Chris K C; Kamarulzaman, Adeeba; Ditangco, Rossana; Huang, Szu-Wei; Sohn, Annette H; Law, Matthew; Chen, Yi Ming A

    2015-09-01

    Human immunodeficiency virus (HIV)-1 epidemics in Asian countries are driven by varying exposures. The epidemiology of the regional pandemic has been changing with the spread of HIV-1 to lower-risk populations through sexual transmission. Common HIV-1 genotypes include subtype B and circulating recombinant form (CRF) 01_AE. Our objective was to use HIV-1 genotypic data to better quantify local epidemics. TASER-M is a multicenter prospective cohort of HIV-infected patients. Associations between HIV exposure, patient sex, country of sample origin and HIV-1 genotype were evaluated by multivariate logistic regression. Phylogenetic methods were used on genotypic data to investigate transmission relationships. A total of 1086 patients from Thailand, Hong Kong, Malaysia and the Philippines were included in analyses. Proportions of male patients within countries varied (Thailand: 55.6%, Hong Kong: 86.1%, Malaysia: 81.4%, Philippines: 93.8%; p < 0.001) as did HIV exposures (heterosexual contact: Thailand: 85.7%, Hong Kong, 46.2%, Malaysia: 47.8%, Philippines: 25.0%; p < 0.001). After adjustment, we found increased subtype B infection among men who have sex with men, relative to heterosexual-reported exposures (odds ratio = 2.4, p < 0.001). We further describe four transmission clusters of eight to 15 treatment naïve, predominantly symptomatic patients (two each for subtype B and CRF01_AE). Risk-group subpopulations differed with respect to the infecting HIV-1 genotype. Homosexual exposure patients had higher odds of being infected with subtype B. Where HIV-1 genotypes circulate within countries or patient risk-groups, local monitoring of genotype-specific transmissions may play a role in focusing public health prevention strategies. Phylogenetic evaluations provide complementary information for surveillance and monitoring of viruses with high mutation rates such as HIV-1 and Ebola. PMID:26362956

  2. The LIM protein RBTN2 and the basic helix-loop-helix protein TAL1 are present in a complex in erythroid cells.

    OpenAIRE

    Valge-Archer, V E; Osada, H; Warren, A.J.; Forster, A.; Li, J.; Baer, R; Rabbitts, T H

    1994-01-01

    Chromosomal translocations in T-cell acute leukemias can activate genes encoding putative transcription factors such as the LIM proteins RBTN1 and RBTN2 and the DNA-binding basic helix-loop-helix transcription factor TAL1 associated with T-cell acute lymphocytic leukemia. While not expressed in normal T cells, RBTN2 and TAL1 are coexpressed in erythroid cells and are both important for erythroid differentiation. We demonstrate, using anti-RBTN2 and anti-TAL1 antisera, that the LIM protein RBT...

  3. Identification of a novel agrin-dependent pathway in cell signaling and adhesion within the erythroid niche.

    Science.gov (United States)

    Anselmo, A; Lauranzano, E; Soldani, C; Ploia, C; Angioni, R; D'amico, G; Sarukhan, A; Mazzon, C; Viola, A

    2016-08-01

    Establishment of cell-cell adhesion is crucial in embryonic development as well as within the stem cell niches of an adult. Adhesion between macrophages and erythroblasts is required for the formation of erythroblastic islands, specialized niches where erythroblasts proliferate and differentiate to produce red blood cells throughout life. The Eph family is the largest known family of receptor tyrosine kinases (RTKs) and controls cell adhesion, migration, invasion and morphology by modulating integrin and adhesion molecule activity and by modifying the actin cytoskeleton. Here, we identify the proteoglycan agrin as a novel regulator of Eph receptor signaling and characterize a novel mechanism controlling cell-cell adhesion and red cell development within the erythroid niche. We demonstrate that agrin induces clustering and activation of EphB1 receptors on developing erythroblasts, leading to the activation of α5β1 integrins. In agreement, agrin knockout mice display severe anemia owing to defective adhesion to macrophages and impaired maturation of erythroid cells. These results position agrin-EphB1 as a novel key signaling couple regulating cell adhesion and erythropoiesis. PMID:26990660

  4. [Peculiarities of antioxidant defense system in erythroid cells and tissues of pigs under action of chromium chloride].

    Science.gov (United States)

    Iskra, R Ia; Vlizlo, V V

    2013-01-01

    The influence of CrCI3 in the amount of 400 mg Cr/kg of feed on antioxidant defense in populations of erythrocytes, erythroid bone marrow cells and tissues of pigs was studied. The increasing of the antioxidant defense of swine organism, as evidenced by the increase in superoxide dismutase and glutathione peroxidase activity in the fractions of "young" erythrocytes, was shown. Superoxide dismutase activity decreases, while glutathione and catalase activity increases in the erythroid cells of the bone marrow after of CrCl3 action. Oxidative processes are intensified in the liver of pigs of the experimental group, in contrast to other tissues, leading to the increase of content of TBARS-products, growth of superoxide dismutase activity and reduction of glutathione peroxidase activity. At the same time, the action of CrCl3 in other tissues activates antioxidant system, including the kidneys, lungs and myocardium, increases superoxide dismutase activity, and catalase activity in the spleen and kidneys. A decrease of content of TBARS-products and reduction of superoxide dismutase activity, as well as the increase of katalase activity and reduction of glutathione content were discovered in the skeletal muscles of pigs of the experimental group. As a result of research it is suggested to add CrCl3 to the diet of pigs to enhance antioxidant defense during their intensive growth. PMID:23940874

  5. LRF is an essential downstream target of GATA1 in erythroid development and regulates BIM-dependent apoptosis.

    Science.gov (United States)

    Maeda, Takahiro; Ito, Keisuke; Merghoub, Taha; Poliseno, Laura; Hobbs, Robin M; Wang, Guocan; Dong, Lin; Maeda, Manami; Dore, Louis C; Zelent, Arthur; Luzzatto, Lucio; Teruya-Feldstein, Julie; Weiss, Mitchell J; Pandolfi, Pier Paolo

    2009-10-01

    GATA-1-dependent transcription is essential for erythroid differentiation and maturation. Suppression of programmed cell death is also thought to be critical for this process; however, the link between these two features of erythropoiesis has remained elusive. Here, we show that the POZ-Krüppel family transcription factor, LRF (also known as Zbtb7a/Pokemon), is a direct target of GATA1 and plays an essential antiapoptotic role during terminal erythroid differentiation. We find that loss of Lrf leads to lethal anemia in embryos, due to increased apoptosis of late-stage erythroblasts. This programmed cell death is Arf and p53 independent and is instead mediated by upregulation of the proapoptotic factor Bim. We identify Lrf as a direct repressor of Bim transcription. In strong support of this mechanism, genetic Bim loss delays the lethality of Lrf-deficient embryos and rescues their anemia phenotype. Thus, our data define a key transcriptional cascade for effective erythropoiesis, whereby GATA-1 suppresses BIM-mediated apoptosis via LRF. PMID:19853566

  6. Induction of gamma-globin gene transcription by hydroxycarbamide in primary erythroid cell cultures from Lepore patients.

    Science.gov (United States)

    Calzolari, Roberta; Pecoraro, Alice; Borruso, Vito; Troia, Antonio; Acuto, Santina; Maggio, Aurelio; Di Marzo, Rosalba

    2008-05-01

    Increased expression of fetal haemoglobin (HbF) may ameliorate the clinical course of beta-thalassemia and sickle cell disease. Some pharmacological agents, such as hydroxycarbamide (HC), can increase fetal haemoglobin synthesis during adult life. Cellular selection and/or molecular mechanisms have been proposed to account for this increase. To explore the mechanism of action of HC we focused on homozygous Hb-Lepore patients that presented with high fetal haemoglobin levels and were good responders to HC treatment "in vivo". We performed primary erythroid cultures from peripheral blood of four homozygous Lepore patients. The increase in HBG (gamma-globin) transcription levels and HbF content in these cultures, after HC treatment, were detected by quantitative real time polymerase chain reaction analysis and flow cytometric analysis. Primary transcript "in-situ" hybridization analysis showed a 2-fold increase in the number of cells expressing both HBG alleles in HC-treated erythroid cultures. These studies, demonstrating the larger number of biallelic HBG expressing cells, suggest that HC is able to stimulate the activation of HBG transcription. These observations provide evidences that the molecular mechanism of action is involved in the increase of fetal haemoglobin production by HC. PMID:18422777

  7. Haem is necessary for a continued increase in ferrochelatase mRNA in murine erythroleukaemia cells during erythroid differentiation.

    Science.gov (United States)

    Fukuda, Y; Fujita, H; Taketani, S; Sassa, S

    1993-12-01

    The level of mRNA encoding ferrochelatase (FeC) was examined in two murine erythroleukaemia (MEL) clones, DS and DR, a DMSO-sensitive, and a DMSO-resistant clone, respectively. DS cells undergo erythroid differentiation by DMSO treatment with a marked increase in haem synthesis, while DR cells fail to do so due to the lack of the erythroid-specific delta-aminolaevulinate synthase (ALAS-E). Both DS and DR cells showed an increase in the level of FeC mRNA within 18 h of DMSO treatment. The level of FeC mRNA in DR cells was then decreased, while that in DS cells continued to increase for 72 h. Treatment with haemin significantly increased FeC mRNA in DR cells. When cells were treated with both DMSO and haemin, the level of FeC mRNA in DR cells increased to a level comparable to that in DS cells. These findings suggest that the failure to maintain increased FeC mRNA DR cells after DMSO treatment may be due to a deficiency of haem in these cells. PMID:7918029

  8. INTERNAL CIRCULATION ENVELOPES

    CERN Multimedia

    Mail Office

    2001-01-01

    Internal mail envelopes often finish up in large piles in certain offices, thus creating a shortage for other users of the mail service, who would be grateful if everyone with an unused stock could deposit them in their mail box, after attaching them together with an elastic band or a piece of string. The messengers will then collect them so that the Mail Office can put them back in circulation. Thank you for your understanding and collaboration.

  9. RECOMBINANT-HUMAN-ERYTHROPOIETIN IN PATIENTS WITH MYELODYSPLASTIC SYNDROMES

    NARCIS (Netherlands)

    SCHOUTEN, HC; VELLENGA, E; VANRHENEN, DJ; DEWOLF, JTM; COPPENS, PJW; BLIJHAM, GH

    1991-01-01

    As anemia is frequently the main problem in myelodysplastic syndromes (MDS), we studied the efficacy of human erythropoietin (rhEpo) in stimulating the erythroid lineage in 14 patients, starting with 40 U/kg three times a week and doubling the dose every 6 weeks until a response was observed. The hi

  10. Competition of nuclear factor-erythroid 2 factors related transcription factor isoforms, Nrf1 and Nrf2, in antioxidant enzyme induction

    Directory of Open Access Journals (Sweden)

    Nikolai L. Chepelev

    2013-01-01

    Full Text Available Although the Nrf2 (nuclear factor-erythroid 2 p45 subunit-related factor 2 regulated expression of multiple antioxidant and cytoprotective genes through the electrophile responsive element (EpRE is well established, interaction of Nrf2/EpRE with Nrf1, a closely-related transcription factor, is less well understood. Due to either proteolysis or alternative translation, Nrf1 has been found as proteins of varying size, p120, p95, and p65, which have been described as either activators of EpRE or competitive inhibitors of Nrf2. We investigated the effect of Nrf1 on EpRE-regulated gene expression using the catalytic and modifier subunits of glutamate cysteine ligase (GCLC and GCLM as models and explored the potential role of Nrf1 in altering their expression in aging and upon chronic exposure to airborne nano-sized particulate matter (nPM. Nrf1 knockout resulted in the increased expression of GCLC and GCLM in human bronchial epithelial (HBE1 cells. Overexpression Nrf2 in combination with either p120 or p65 diminished or failed to further increase the GCLC- and GLCM-EpRE luciferase activity. All known forms of Nrf1 protein, remained unchanged in the lungs of mice with age or in response to nPM. Our study shows that Nrf1 could inhibit EpRE activity in vitro, whereas the precise role of Nrf1 in vivo requires further investigations. We conclude that Nrf1 may not be directly responsible for the loss of Nrf2-dependent inducibility of antioxidant and cytoprotective genes observed in aged animals.

  11. Antioxidative effects of the spice cardamom against non-melanoma skin cancer by modulating nuclear factor erythroid-2-related factor 2 and NF-κB signalling pathways.

    Science.gov (United States)

    Das, Ila; Acharya, Asha; Berry, Deborah L; Sen, Supti; Williams, Elizabeth; Permaul, Eva; Sengupta, Archana; Bhattacharya, Sudin; Saha, Tapas

    2012-09-28

    The role of dietary factors in inhibiting or delaying the development of non-melanoma skin cancer (NMSC) has been investigated for many years. Cardamom, which is a dietary phytoproduct, has been commonly used in cuisines for flavour and has numerous health benefits, such as improving digestion and stimulating metabolism and having antitumorigenic effects. We have investigated the efficacy of dietary cardamom against 7,12-dimethylbenz[a]anthracene (DMBA)-induced skin papillomatogenesis in Swiss albino mice that closely resembles human NMSC. Mice were grouped into normal wild type (untreated), vehicle-treated (acetone), carcinogen-treated (DMBA), and DMBA and cardamom-treated (DMBA+CARD) to delineate the role of cardamom against DMBA-induced papillomatogenesis. Oral administration of cardamom to DMBA-treated mice up-regulated the phase II detoxification enzymes, such as glutathione-S-transferase and glutathione peroxidase, probably via activation of nuclear factor erythroid-2-related factor 2 transcription factor in 'DMBA+CARD' mice. Furthermore, reduced glutathione, glutathione reductase, superoxide dismutase and catalase were also up-regulated by cardamom in the same 'DMBA+CARD' group of mice compared with DMBA-treated mice. Cardamom ingestion in DMBA-treated mice blocked NF-κB activation and down-regulated cyclo-oxygenase-2 expression. As a consequence, both the size and the number of skin papillomas generated on the skin due to the DMBA treatment were reduced in the 'DMBA+CARD' group. Thus, the results from the present study suggest that cardamom has a potential to become a pivotal chemopreventive agent to prevent papillomagenesis on the skin. PMID:22182368

  12. Human parvovirus B19 can infect cynomolgus monkey marrow cells in tissue culture.

    OpenAIRE

    Gallinella, G.; Anderson, S M; Young, N S; Brown, K E

    1995-01-01

    The human pathogenic parvovirus B19 cannot be grown in standard tissue culture but propagates in human bone marrow, where it is cytotoxic to erythroid progenitor cells. We now show that parvovirus B19 can replicate in cynomolgus bone marrow. Cynomolgus monkeys may be a suitable animal model for pathogenesis studies of parvovirus B19.

  13. Pharmacokinetics and extracorporeal adsorption treatment (ECAT) to reduce circulating blood radioactivity after i.v. administration of humanized biotinylated MAB 111In-MN14 in rats

    International Nuclear Information System (INIS)

    The results of radioimmunotherapy of disseminated solid tumors are still disappointing and hence new strategies are needed. ECAT is a new method for tumor radioimmunotargeting to reduce activity in radiosensitive organs by removing excess of radiolabeled MAb from blood. It was previously developed and experimentally evaluated by us using mouse MAb L6 and HMFG1as well as chimeric BR96. The aim of the study was not only to estimate the influence of biotinylation on pharmacokinetics and biodistribution of humanized MAb 111In-MN14, but also to validate the capacity of subsequent ECAT in terms of reduction of activity in whole body, blood and in various organs after i.v. administration of 111In-hMN14-DOTA-biotin in rats. These results could also be transferred to the pre-targeting strategy based on the biotin-avidin reaction. Methods: hMN14 recognizes the carcinoembryonic antigen expressed on most tumor cells from human colorectal, pancreatic, lung, breast, and ovarian carcinomas. 93 rats were used in the study. After radiolabeling, 111In-hMN14-DOTA was biotinylated in order to enable antibodies to be absorbed on the MITRA-avidin-agarose column (Mitra Medical Technology Ltd, Lund, Sweden). NHS-biotin or Sulfo-NHS-biotin were used for the biotinylation of hMN14. ECAT was explored from un-separated blood in 8 rats. Blood volumes were passed through an adsorption column close to theoretical clearance during 2.5h. WB counts and blood activity were monitored. At dissections, performed immediately after ECAT completion, organs and tissues of interest were removed and measured for activity content. Results: TLC analysis of 111In-hMN14-DOTA-biotin showed a radiochemical purity of > 87% for NHS-biotin and >95% for the sulfo-NHS-biotin reagent. HPLC size exclusion analysis showed no aggregation or fragmentation of the radioimmunoconjugate irrespective of the amount of sulfo-NHS-biotin ratio/mg MAb. Increasing or extensive signs of aggregation were registered already at a low

  14. BIM-enabled Conceptual Modelling and Representation of Building Circulation

    Directory of Open Access Journals (Sweden)

    Jin Kook Lee

    2014-08-01

    Full Text Available This paper describes how a building information modelling (BIM-based approach for building circulation enables us to change the process of building design in terms of its computational representation and processes, focusing on the conceptual modelling and representation of circulation within buildings. BIM has been designed for use by several BIM authoring tools, in particular with the widely known interoperable industry foundation classes (IFCs, which follow an object-oriented data modelling methodology. Advances in BIM authoring tools, using space objects and their relations defined in an IFC’s schema, have made it possible to model, visualize and analyse circulation within buildings prior to their construction. Agent-based circulation has long been an interdisciplinary topic of research across several areas, including design computing, computer science, architectural morphology, human behaviour and environmental psychology. Such conventional approaches to building circulation are centred on navigational knowledge about built environments, and represent specific circulation paths and regulations. This paper, however, places emphasis on the use of ‘space objects’ in BIM-enabled design processes rather than on circulation agents, the latter of which are not defined in the IFCs’ schemas. By introducing and reviewing some associated research and projects, this paper also surveys how such a circulation representation is applicable to the analysis of building circulation-related rules.

  15. Multiple circulating infections can mimic the early stages of viral hemorrhagic fevers and possible human exposure to filoviruses in Sierra Leone prior to the 2014 outbreak.

    Science.gov (United States)

    Boisen, Matthew L; Schieffelin, John S; Goba, Augustine; Oottamasathien, Darin; Jones, Abigail B; Shaffer, Jeffrey G; Hastie, Kathryn M; Hartnett, Jessica N; Momoh, Mambu; Fullah, Mohammed; Gabiki, Michael; Safa, Sidiki; Zandonatti, Michelle; Fusco, Marnie; Bornholdt, Zach; Abelson, Dafna; Gire, Stephen K; Andersen, Kristian G; Tariyal, Ridhi; Stremlau, Mathew; Cross, Robert W; Geisbert, Joan B; Pitts, Kelly R; Geisbert, Thomas W; Kulakoski, Peter; Wilson, Russell B; Henderson, Lee; Sabeti, Pardis C; Grant, Donald S; Garry, Robert F; Saphire, Erica O; Branco, Luis M; Khan, Sheik Humarr

    2015-02-01

    Lassa fever (LF) is a severe viral hemorrhagic fever caused by Lassa virus (LASV). The LF program at the Kenema Government Hospital (KGH) in Eastern Sierra Leone currently provides diagnostic services and clinical care for more than 500 suspected LF cases per year. Nearly two-thirds of suspected LF patients presenting to the LF Ward test negative for either LASV antigen or anti-LASV immunoglobulin M (IgM), and therefore are considered to have a non-Lassa febrile illness (NLFI). The NLFI patients in this study were generally severely ill, which accounts for their high case fatality rate of 36%. The current studies were aimed at determining possible causes of severe febrile illnesses in non-LF cases presenting to the KGH, including possible involvement of filoviruses. A seroprevalence survey employing commercial enzyme-linked immunosorbent assay tests revealed significant IgM and IgG reactivity against dengue virus, chikungunya virus, West Nile virus (WNV), Leptospira, and typhus. A polymerase chain reaction-based survey using sera from subjects with acute LF, evidence of prior LASV exposure, or NLFI revealed widespread infection with Plasmodium falciparum malaria in febrile patients. WNV RNA was detected in a subset of patients, and a 419 nt amplicon specific to filoviral L segment RNA was detected at low levels in a single patient. However, 22% of the patients presenting at the KGH between 2011 and 2014 who were included in this survey registered anti-Ebola virus (EBOV) IgG or IgM, suggesting prior exposure to this agent. The 2014 Ebola virus disease (EVD) outbreak is already the deadliest and most widely dispersed outbreak of its kind on record. Serological evidence reported here for possible human exposure to filoviruses in Sierra Leone prior to the current EVD outbreak supports genetic analysis that EBOV may have been present in West Africa for some time prior to the 2014 outbreak. PMID:25531344

  16. Oral immunization with a Salmonella enterica serovar typhi vaccine induces specific circulating mucosa-homing CD4(+) and CD8(+) T cells in humans.

    Science.gov (United States)

    Lundin, B Samuel; Johansson, Camilla; Svennerholm, Ann-Mari

    2002-10-01

    The kinetics and homing characteristics of T-cell responses in humans after mucosal immunizations have not been well characterized. Therefore, we have investigated the magnitude and duration of such responses as well as the homing receptor expression of antigen-specific peripheral blood T cells by using an oral model vaccine, i.e., the live, attenuated Salmonella enterica serovar Typhi vaccine (Ty21a). Eight volunteers were each given three doses of the vaccine 2 days apart, and blood samples, from which CD4(+) and CD8(+) T cells were selected by the use of magnetic beads, were collected before vaccination and at regular intervals thereafter. To purify the potentially antigen-specific gut-homing T cells, CD45RA(-) integrin beta(7)(+) cells were further sorted by flow cytometry. The sorted cells were then stimulated in vitro with the serovar Typhi vaccine strain, and the proliferation of cells and the cytokine production were measured. Following vaccination, there was a large increase in both the proliferation of and the gamma interferon (IFN-gamma) production by blood T cells stimulated with the vaccine strain. The responses were seen among both CD4(+) and CD8(+) T cells, although the CD8(+) cells produced the largest amounts of IFN-gamma. Peak responses were seen 7 to 14 days after the onset of vaccination. Furthermore, most of the IFN-gamma produced by both CD4(+) and CD8(+) cells emanated from cells with the potential to home to mucosal tissues, as the integrin beta(7)-expressing memory T cells produced around 10-fold more IFN-gamma than the remaining populations. In conclusion, we demonstrate that oral vaccination with a live oral bacterial vaccine induces antigen-specific CD4(+) and CD8(+) memory T cells, almost all of which express the gut-homing integrin beta(7). PMID:12228290

  17. A short Gfi-1B isoform controls erythroid differentiation by recruiting the LSD1-corest complex through the dimethylation of its SNAG domain

    NARCIS (Netherlands)

    B. Laurent (Benoît); V. Randrianarison-Huetz (Voahangy); E. Frisan (Emilie); C. Andrieu-Soler (Charlotte); E. Soler (Eric); M. Fontenay (Michaela); I. Dusanter-Fourt (Isabelle); D. Dumenil (Dominique)

    2012-01-01

    textabstractGfi-1B is a transcriptional repressor essential for the regulation of erythropoiesis and megakaryopoiesis. Here we identify Gfi-1B p32, a Gfi-1B isoform, as essential for erythroid differentiation. Gfi-1B p32 is generated by alternative splicing and lacks the two first zinc finger domain

  18. Protein structure of fetal antigen 1 (FA1). A novel circulating human epidermal-growth-factor-like protein expressed in neuroendocrine tumors and its relation to the gene products of dlk and pG2

    DEFF Research Database (Denmark)

    Jensen, Charlotte Harken; Krogh, Thomas N; Højrup, Peter;

    1994-01-01

    vascular structure. In the pancreas, FA1 co-localized with insulin in the insulin secretory granules of the beta cells within the islets of Langerhans. Our findings suggest that FA1 is synthesized as a membrane anchored protein and released into the circulation after enzymic cleavage, and that circulating...

  19. Resolvability in Circulant Graphs

    Institute of Scientific and Technical Information of China (English)

    Muhammad SALMAN; Imran JAVAID; Muhammad Anwar CHAUDHRY

    2012-01-01

    A set W of the vertices of a connected graph G is called a resolving set for G if for every two distinct vertices u,v ∈ V(G) there is a vertex w ∈ W such that d(u,w) ≠ d(v,w).A resolving set of minimum cardinality is called a metric basis for G and the number of vertices in a metric basis is called the metric dimension of G,denoted by dim(G).For a vertex u of G and a subset S of V(G),the distance between u and S is the number mins∈s d(u,s).A k-partition H ={S1,S2,...,Sk} of V(G) is called a resolving partition if for every two distinct vertices u,v ∈ V(G) there is a set Si in Π such that d(u,Si) ≠ d(v,Si).The minimum k for which there is a resolving k-partition of V(G) is called the partition dimension of G,denoted by pd(G).The circulant graph is a graph with vertex set Zn,an additive group ofintegers modulo n,and two vertices labeled i and j adjacent if and only if i - j (mod n) ∈ C,where C C Zn has the property that C =-C and 0(∈) C.The circulant graph is denoted by Xn,△ where A =|C|.In this paper,we study the metric dimension of a family of circulant graphs Xn,3 with connection set C ={1,-n/2,n - 1} and prove that dim(Xn,3) is independent of choice of n by showing that 3 for all n =0 (mod 4),dim(X,n,3) ={ 4 for all n =2 (mod 4).We also study the partition dimension of a family of circulant graphs Xn,4 with connection set C ={±1,±2} and prove that pd(Xn,4) is independent of choice of n and show that pd(X5,4) =5 and 3 forall odd n≥9,pd(Xn,4) ={ 4 for all even n ≥ 6 and n =7.

  20. Circulatory shear flow alters the viability and proliferation of circulating colon cancer cells

    OpenAIRE

    Rong Fan; Travis Emery; Yongguo Zhang; Yuxuan Xia; Jun Sun; Jiandi Wan

    2016-01-01

    During cancer metastasis, circulating tumor cells constantly experience hemodynamic shear stress in the circulation. Cellular responses to shear stress including cell viability and proliferation thus play critical roles in cancer metastasis. Here, we developed a microfluidic approach to establish a circulatory microenvironment and studied circulating human colon cancer HCT116 cells in response to a variety of magnitude of shear stress and circulating time. Our results showed that cell viabili...

  1. Growth factor independence 1b (gfi1b is important for the maturation of erythroid cells and the regulation of embryonic globin expression.

    Directory of Open Access Journals (Sweden)

    Lothar Vassen

    Full Text Available Growth factor independence 1b (GFI1B is a DNA binding repressor of transcription with vital functions in hematopoiesis. Gfi1b-null embryos die at midgestation very likely due to defects in erythro- and megakaryopoiesis. To analyze the full functionality of Gfi1b, we used conditionally deficient mice that harbor floxed Gfi1b alleles and inducible (Mx-Cre, Cre-ERT or erythroid specific (EpoR-Cre Cre expressing transgenes. In contrast to the germline knockout, EpoR-Cre mediated erythroid specific ablation of Gfi1b allows full gestation, but causes perinatal lethality with very few mice surviving to adulthood. Both the embryonic deletion of Gfi1b by EpoR-Cre and the deletion in adult mice by Mx-Cre or Cre-ERT leads to reduced numbers of erythroid precursors, perturbed and delayed erythroid maturation, anemia and extramedullary erythropoiesis. Global expression analyses showed that the Hba-x, Hbb-bh1 and Hbb-y embryonic globin genes were upregulated in Gfi1b deficient TER119+ fetal liver cells over the gestation period from day 12.5-17.5 p.c. and an increased level of Hbb-bh1 and Hbb-y embryonic globin gene expression was even maintained in adult Gfi1b deficient mice. While the expression of Bcl11a, a regulator of embryonic globin expression was not affected by Gfi1b deficiency, the expression of Gata1 was reduced and the expression of Sox6, also involved in globin switch, was almost entirely lost when Gfi1b was absent. These findings establish Gfi1b as a regulator of embryonic globin expression and embryonic and adult erythroid maturation.

  2. BET bromodomain inhibition rescues erythropoietin differentiation of human erythroleukemia cell line UT7

    International Nuclear Information System (INIS)

    Highlights: ► UT7 erythroleukemia cells are known to be refractory to differentiate. ► Brief JQ1 treatment initiates the first steps of erythroid differentiation program. ► Engaged UT7 cells then maturate in the presence of erythropoietin. ► Sustained JQ1 treatment inhibits both proliferation and erythroid differentiation. -- Abstract: Malignant transformation is a multistep process requiring oncogenic activation, promoting cellular proliferation, frequently coupled to inhibition of terminal differentiation. Consequently, forcing the reengagement of terminal differentiation of transformed cells coupled or not with an inhibition of their proliferation is a putative therapeutic approach to counteracting tumorigenicity. UT7 is a human leukemic cell line able to grow in the presence of IL3, GM-CSF and Epo. This cell line has been widely used to study Epo-R/Epo signaling pathways but is a poor model for erythroid differentiation. We used the BET bromodomain inhibition drug JQ1 to target gene expression, including that of c-Myc. We have shown that only 2 days of JQ1 treatment was required to transitory inhibit Epo-induced UT7 proliferation and to restore terminal erythroid differentiation. This study highlights the importance of a cellular erythroid cycle break mediated by c-Myc inhibition before initiation of the erythropoiesis program and describes a new model for BET bromodomain inhibitor drug application.

  3. BET bromodomain inhibition rescues erythropoietin differentiation of human erythroleukemia cell line UT7

    Energy Technology Data Exchange (ETDEWEB)

    Goupille, Olivier [CEA, Institute of Emerging Diseases and Innovative Therapies, Fontenay-aux-Roses (France); UMR INSERM U.962, University Paris XI, CEA, Fontenay-aux-Roses (France); Penglong, Tipparat [CEA, Institute of Emerging Diseases and Innovative Therapies, Fontenay-aux-Roses (France); UMR INSERM U.962, University Paris XI, CEA, Fontenay-aux-Roses (France); Thalassemia Research Center and Department of Clinical Pathology, Faculty of Medicine, Ramathibodi Hospital, Mahidol University (Thailand); Lefevre, Carine; Granger, Marine; Kadri, Zahra [CEA, Institute of Emerging Diseases and Innovative Therapies, Fontenay-aux-Roses (France); UMR INSERM U.962, University Paris XI, CEA, Fontenay-aux-Roses (France); Fucharoen, Suthat [Thalassemia Research Center and Department of Clinical Pathology, Faculty of Medicine, Ramathibodi Hospital, Mahidol University (Thailand); Maouche-Chretien, Leila [CEA, Institute of Emerging Diseases and Innovative Therapies, Fontenay-aux-Roses (France); UMR INSERM U.962, University Paris XI, CEA, Fontenay-aux-Roses (France); Leboulch, Philippe [CEA, Institute of Emerging Diseases and Innovative Therapies, Fontenay-aux-Roses (France); UMR INSERM U.962, University Paris XI, CEA, Fontenay-aux-Roses (France); Genetics Division, Department of Medicine, Brigham and Women' s Hospital and Harvard Medical School, Boston, MA (United States); Chretien, Stany, E-mail: stany.chretien@cea.fr [CEA, Institute of Emerging Diseases and Innovative Therapies, Fontenay-aux-Roses (France); UMR INSERM U.962, University Paris XI, CEA, Fontenay-aux-Roses (France)

    2012-12-07

    Highlights: Black-Right-Pointing-Pointer UT7 erythroleukemia cells are known to be refractory to differentiate. Black-Right-Pointing-Pointer Brief JQ1 treatment initiates the first steps of erythroid differentiation program. Black-Right-Pointing-Pointer Engaged UT7 cells then maturate in the presence of erythropoietin. Black-Right-Pointing-Pointer Sustained JQ1 treatment inhibits both proliferation and erythroid differentiation. -- Abstract: Malignant transformation is a multistep process requiring oncogenic activation, promoting cellular proliferation, frequently coupled to inhibition of terminal differentiation. Consequently, forcing the reengagement of terminal differentiation of transformed cells coupled or not with an inhibition of their proliferation is a putative therapeutic approach to counteracting tumorigenicity. UT7 is a human leukemic cell line able to grow in the presence of IL3, GM-CSF and Epo. This cell line has been widely used to study Epo-R/Epo signaling pathways but is a poor model for erythroid differentiation. We used the BET bromodomain inhibition drug JQ1 to target gene expression, including that of c-Myc. We have shown that only 2 days of JQ1 treatment was required to transitory inhibit Epo-induced UT7 proliferation and to restore terminal erythroid differentiation. This study highlights the importance of a cellular erythroid cycle break mediated by c-Myc inhibition before initiation of the erythropoiesis program and describes a new model for BET bromodomain inhibitor drug application.

  4. KLF1 stabilizes GATA-1 and TAL1 occupancy in the human β-globin locus.

    Science.gov (United States)

    Kang, Yujin; Kim, Yea Woon; Yun, Jangmi; Shin, Jongo; Kim, AeRi

    2015-03-01

    KLF1 is an erythroid specific transcription factor that binds to regulatory regions of erythroid genes. Binding sites of KLF1 are often found near binding sites of GATA-1 and TAL1. In the β-globin locus, KLF1 is required for forming active chromatin structure, although its role is unclear. To explore the role of KLF1 in transcribing the human γ-globin genes, we stably reduced the expression of KLF1 in erythroid K562 cells, compromising its association in the β-globin locus. The γ-globin transcription was reduced with disappearance of active chromatin structure of the locus in the KLF1 knockdown cells. Interestingly, GATA-1 and TAL1 binding was reduced in the β-globin locus, even though their expressions were not affected by KLF1 knockdown. The KLF1-dependent GATA-1 and TAL1 binding was observed in the adult locus transcribing the β-globin gene and in several erythroid genes, where GATA-1 occupancy is independent from TAL1. These results indicate that KLF1 plays a role in facilitating and/or stabilizing GATA-1 and TAL1 occupancy in the erythroid genes, contributing to the generation of active chromatin structure such as histone acetylation and chromatin looping. PMID:25528728

  5. Ocean General Circulation Models

    Energy Technology Data Exchange (ETDEWEB)

    Yoon, Jin-Ho; Ma, Po-Lun

    2012-09-30

    1. Definition of Subject The purpose of this text is to provide an introduction to aspects of oceanic general circulation models (OGCMs), an important component of Climate System or Earth System Model (ESM). The role of the ocean in ESMs is described in Chapter XX (EDITOR: PLEASE FIND THE COUPLED CLIMATE or EARTH SYSTEM MODELING CHAPTERS). The emerging need for understanding the Earth’s climate system and especially projecting its future evolution has encouraged scientists to explore the dynamical, physical, and biogeochemical processes in the ocean. Understanding the role of these processes in the climate system is an interesting and challenging scientific subject. For example, a research question how much extra heat or CO2 generated by anthropogenic activities can be stored in the deep ocean is not only scientifically interesting but also important in projecting future climate of the earth. Thus, OGCMs have been developed and applied to investigate the various oceanic processes and their role in the climate system.

  6. Neuronal messengers in the human cerebral circulation

    DEFF Research Database (Denmark)

    Gulbenkian, S; Uddman, R; Edvinsson, L

    2001-01-01

    neuronal regulation of cerebral blood flow. Although little is known about the physiological actions and inter-relationships among all these putative neurotransmitters, their presence within cerebrovascular nerve fibers will make it necessary to revise our view on the mechanisms of cerebrovascular...

  7. In Vivo Biomechanics of Human Pulmonary Circulation /

    OpenAIRE

    Arai, Tatsuya J.

    2013-01-01

    Gas exchange between inhaled alveolar air and pulmonary capillary blood occurs in the lung. The relationship between ventilation and perfusion determines the global efficiency of gas exchange in the lung. The normal healthy lung maintains a regional ventilation-perfusion ratio close to unity, whereas in disease, the regional ventilation-perfusion mismatch results in inefficient gas exchange, leading to arterial hypoxemia. The original research presented in this dissertation focused on factors...

  8. Trypanosoma cruzi: circulating antigens

    Directory of Open Access Journals (Sweden)

    V. Bongertz

    1981-03-01

    Full Text Available Circulating antigens were detected in sera of mice experimentally infected with a high close of Trypanosoma cruzi by reaction with sera from chronically infected mice. The immunodiffusion reaction between homologous acute and chronic sera produced four precipitation lines. By reaction with chronic mouse serum, circulating antingens were detected in sera from heavily infected hamsters, dogs, rabbits and in sera from chagasic patients. A reaction was also found in urine from acutely infected mice and dogs. Trypanosoma cruzi exoantigen was detected in trypanosome culture medium and in the supernatant of infected cell cultures. Attempts to isolate the antigens are described.Antígenos circulantes foram detectados em soros de camundongos infectados experimentalmente com elevadas doses de Trypanosoma cruzi pela reação com soros obtidos de camundongos em fase crônica de infecção. A reação de imunodifusão entre soros homólogos agudo e crônico produziu quatro linhas de precipitação. Por reação com soro crônico de camundongo antígenos circulantes foram detectados em soros de crícetos, cães e coelhos infectados com doses elevadas de Trypanosoma cruzi e em soros de pacientes chagásicos. Uma reação foi também observada com urina de camundongos e cães infectados de forma aguda. Exoantígeno de Trypanosoma cruzi foi detectado em meio de cultura de tripanosomas e em sobrenadantes de culturas de células infectadas. Tentativas de isolamento dos antigenos são descritas.

  9. TROPICAL METEOROLOGY & Climate: Hadley Circulation

    Energy Technology Data Exchange (ETDEWEB)

    Lu, Jian; Vecchi, Gabriel A.

    2015-01-30

    The Hadley circulation, a prominent circulation feature characterized by rising air near the Equator and sinking air in the subtropics, defines the position of dry subtropical areas and is a fundamental regulator of the earth’s energy and momentum budgets. The character of the Hadley circulation, and its related precipitation regimes, exhibits variation and change in response to both climate variability and radiative forcing changes. The strength and position of the Hadley circulation change from year to year paced by El Niño and La Niña events. Over the last few decades of the twentieth century, the Hadley cell has expanded poleward in both hemispheres, with changes in atmospheric composition (including stratospheric ozone depletion and greenhouse gas increases) thought to have contributed to its expansion. This article introduces the basic phenomenology and driving mechanism of the Hadley circulation and discusses its variations under both natural and anthropogenic climate forcings.

  10. Sino-Danish Brain Circulation

    DEFF Research Database (Denmark)

    Bertelsen, Rasmus Gjedssø; Du, Xiangyun; Søndergaard, Morten Karnøe

    2014-01-01

    China is faced with urgent needs to develop an economically and environmentally sustainable economy based on innovation and knowledge. Brain circulation and research and business investments from the outside are central for this development. Sino-American brain circulation and research...... and investment by overseas researchers and entrepreneurs are well described. In that case, the US is the center of global R&D and S&T. However, the brain circulation and research and investments between a small open Scandinavian economy, such as Denmark, and the huge developing economy of China are not well...... understood. In this case, Denmark is very highly developed, but a satellite in the global R&D and S&T system. With time and the growth of China as a R&D and S&T power house, both Denmark and China will benefit from brain circulation between them. Such brain circulation is likely to play a key role in flows...

  11. GAR22: A novel target gene of thyroid hormone receptor causes growth inhibition in human erythroid cells

    Czech Academy of Sciences Publication Activity Database

    Gamper, I.; Koh, K.-R.; Ruau, D.; Ullrich, K.; Bartůňková, Jana; Piroth, D.; Hacker, C.; Bartůněk, Petr; Zenke, M.

    2009-01-01

    Roč. 37, č. 5 (2009), s. 539-548. ISSN 0301-472X R&D Projects: GA MŠk(CZ) LC06077 Institutional research plan: CEZ:AV0Z50520514 Keywords : Thyroid hormone receptor * GAR22 * erythropoiesis Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.106, year: 2009

  12. A common signaling pathway is activated in erythroid cells expressing high levels of fetal hemoglobin: a potential role for cAMP-elevating agents in β-globin disorders

    Directory of Open Access Journals (Sweden)

    Ikuta T

    2013-12-01

    Full Text Available Tohru Ikuta,1 Yuichi Kuroyanagi,1 Nadine Odo,1 Siyang Liu21Department of Anesthesiology and Perioperative Medicine, 2Department of Physiology, Medical College of Georgia, Georgia Regents University, Augusta, GA, USABackground: Although erythroid cells prepared from fetal liver, cord blood, or blood from β-thalassemia patients are known to express fetal hemoglobin at high levels, the underlying mechanisms remain elusive. We previously showed that cyclic nucleotides such as cAMP and cGMP induce fetal hemoglobin expression in primary erythroid cells. Here we report that cAMP signaling contributes to high-level fetal hemoglobin expression in erythroid cells prepared from cord blood and β-thalassemia.Methods: The status of the cAMP signaling pathway was investigated using primary erythroid cells prepared from cord blood and the mononuclear cells of patients with β-thalassemia; erythroid cells from adult bone marrow mononuclear cells served as the control.Results: We found that intracellular cAMP levels were higher in erythroid cells from cord blood and β-thalassemia than from adult bone marrow. Protein kinase A activity levels and cAMP-response element binding protein phosphorylation were higher in erythroid cells from cord blood or β-thalassemia than in adult bone marrow progenitors. Mitogen-activated protein kinase pathways, which play a role in fetal hemoglobin expression, were not consistently activated in cord blood or β-thalassemia erythroid cells. When cAMP signaling was activated in adult erythroid cells, fetal hemoglobin was induced at high levels and associated with reduced expression of BCL11A, a silencer of the β-globin gene.Conclusion: These results suggest that activated cAMP signaling may be a common mechanism among erythroid cells with high fetal hemoglobin levels, in part because of downregulation of BCL11A. Activation of the cAMP signaling pathway with cAMP-elevating agents may prove to be an important signaling mechanism to

  13. Natural Circulation with Boiling

    International Nuclear Information System (INIS)

    A number of parameters with dominant influence on the power level at hydrodynamic instability in natural circulation, two-phase flow, have been studied experimentally. The geometrical dependent quantities were: the system driving head, the boiling channel and riser dimensions, the single-phase as well as the two phase flow restrictions. The parameters influencing the liquid properties were the system pressure and the test section inlet subcooling. The threshold of instability was determined by plotting the noise characteristics in the mass flow records against power. The flow responses to artificially obtained power disturbances at instability conditions were also measured in order to study the nature of hydrodynamic instability. The results presented give a review over relatively wide ranges of the main parameters, mainly concerning the coolant performance in both single and parallel boiling channel flow. With regard to the power limits the experimental results verified that the single boiling channel performance was intimately related to that of the parallel channels. In the latter case the additional inter-channel factors with attenuating effects were studied. Some optimum values of the parameters were observed

  14. Desensitization to hydroxycarbamide following long-term treatment of thalassaemia intermedia as observed in vivo and in primary erythroid cultures from treated patients.

    Science.gov (United States)

    Rigano, Paolo; Pecoraro, Alice; Calzolari, Roberta; Troia, Antonio; Acuto, Santina; Renda, Disma; Pantalone, Gaetano Restivo; Maggio, Aurelio; Di Marzo, Rosalba

    2010-12-01

    Hydroxycarbamide (HC) is a pharmacological agent capable of stimulating fetal haemoglobin (HbF) production during adult life. High levels of HbF may ameliorate the clinical course of β-thalassaemia and sickle cell disease. The efficacy of HC for the treatment of thalassaemia major and thalassaemia intermedia is variable. Although an increase of HbF has been observed in most patients, only some patients experience significant improvement in total haemoglobin levels. This study aimed to determine the effectiveness and safety of short- (1 year) and long-term (mean follow-up 68 months) HC treatment in 24 thalassaemia intermedia patients. Additionally, we evaluated if primary erythroid progenitor cells cultured from treated patients responded to HC treatment in a manner similar to that observed in vivo. Our results confirm a good response to HC after a short-term follow-up in 70% of thalassaemia intermedia patients and a reduction of clinical response in patients with a long follow-up. Erythroid cultures obtained from patients during treatment reproduced the observed in vivo response. Interestingly, haematopoietic stem cells from long-term treated patients showed reduced ability to develop into primary erythroid cultures some months before the reduction of the 'in vivo' response. The mechanism of this loss of response to HC remains to be determined. PMID:20955403

  15. β-globin gene promoter generates 5' truncated transcripts in the embryonic foetal erythroid environment.

    NARCIS (Netherlands)

    K. Khazaie; F. Gounari; M. Antoniou (Michael); E. de Boer (Ernie); F.G. Grosveld (Frank)

    1987-01-01

    textabstractWe report here the localisation of sequences responsible for the faulty expression of human beta-globin gene in Putko and K562 cells. Complete beta-globin gene introduced into these cells produces transcripts with abnormal 5' ends, while cotransfected mouse H2 gene is expressed correctly

  16. The effects of erythropoietin signaling on telomerase regulation in non-erythroid malignant and non-malignant cells

    International Nuclear Information System (INIS)

    Highlights: • We assumed that some of erythropoietin adverse effects may be mediated by telomerase activity. • EPO administration increased telomerase activity, cells proliferation and migration. • The inhibition of telomerase modestly repressed the proliferative effect of erythropoietin. • Telomere shortening caused by long term inhibition of the enzyme totally abolished that effect. • This effect was mediated via the Lyn–AKT axis and not by the canonical JAK2–STAT pathway. - Abstract: Treatment with erythropoietin (EPO) in several cancers is associated with decreased survival due to cancer progression. Due to the major importance of telomerase in cancer biology we hypothesized that some of these effects may be mediated through EPO effect on telomerase. For this aim we explored the possible effects of EPO on telomerase regulation, cell migration and chemosensitivity in non-erythroid malignant and non-malignant cells. Cell proliferation, telomerase activity (TA) and cell migration increased in response to EPO. EPO had no effect on cancer cells sensitivity to cisplatinum and on the cell cycle status. The inhibition of telomerase modestly repressed the proliferative effect of EPO. Telomere shortening caused by long term inhibition of the enzyme abolished the effect of EPO, suggesting that EPO effects on cancer cells are related to telomere dynamics. TA was correlated with the levels of Epo-R. The increase in TA was mediated post-translationally through the Lyn-Src and not the canonical JAK2 pathway

  17. A protective role of nuclear factor-erythroid 2-related factor-2 (Nrf2) in inflammatory disorders

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Jiyoung [National Research Laboratory, College of Pharmacy, Graduate School of Convergence Science and Technology, Seoul National University, Seoul 151-742 (Korea, Republic of); Cha, Young-Nam [Inha University College of Medicine, Incheon 382-751 (Korea, Republic of); Surh, Young-Joon, E-mail: surh@plaza.snu.ac.kr [National Research Laboratory, College of Pharmacy, Graduate School of Convergence Science and Technology, Seoul National University, Seoul 151-742 (Korea, Republic of); Department of Molecular Medicine and Biopharmaceutical Sciences, Graduate School of Convergence Science and Technology, Seoul National University, Seoul 151-742 (Korea, Republic of); Cancer Research Institute, Seoul National University, Seoul 110-799 (Korea, Republic of)

    2010-08-07

    Nuclear factor-erythroid 2-related factor-2 (Nrf2) is a key transcription factor that plays a central role in cellular defense against oxidative and electrophilic insults by timely induction of antioxidative and phase-2 detoxifying enzymes and related stress-response proteins. The 5'-flanking regions of genes encoding these cytoprotective proteins contain a specific consensus sequence termed antioxidant response element (ARE) to which Nrf2 binds. Recent studies have demonstrated that Nrf2-ARE signaling is also involved in attenuating inflammation-associated pathogenesis, such as autoimmune diseases, rheumatoid arthritis, asthma, emphysema, gastritis, colitis and atherosclerosis. Thus, disruption or loss of Nrf2 signaling causes enhanced susceptibility not only to oxidative and electrophilic stresses but also to inflammatory tissue injuries. During the early-phase of inflammation-mediated tissue damage, activation of Nrf2-ARE might inhibit the production or expression of pro-inflammatory mediators including cytokines, chemokines, cell adhesion molecules, matrix metalloproteinases, cyclooxygenase-2 and inducible nitric oxide synthase. It is likely that the cytoprotective function of genes targeted by Nrf2 may cooperatively regulate the innate immune response and also repress the induction of pro-inflammatory genes. This review highlights the protective role of Nrf2 in inflammation-mediated disorders with special focus on the inflammatory signaling modulated by this redox-regulated transcription factor.

  18. Neuroprotective effects of salidroside on focal cerebral ischemia/reperfusion injury involves the nuclear erythroid 2-related factor 2 pathway

    Directory of Open Access Journals (Sweden)

    Jing Han

    2015-01-01

    Full Text Available Salidroside, the main active ingredient extracted from Rhodiola crenulata, has been shown to be neuroprotective in ischemic cerebral injury, but the underlying mechanism for this neuroprotection is poorly understood. In the current study, the neuroprotective effect of salidroside on cerebral ischemia-induced oxidative stress and the role of the nuclear factor erythroid 2-related factor 2 (Nrf2 pathway was investigated in a rat model of middle cerebral artery occlusion. Salidroside (30 mg/kg reduced infarct size, improved neurological function and histological changes, increased activity of superoxide dismutase and glutathione-S-transferase, and reduced malon-dialdehyde levels after cerebral ischemia and reperfusion. Furthermore, salidroside apparently increased Nrf2 and heme oxygenase-1 expression. These results suggest that salidroside exerts its neuroprotective effect against cerebral ischemia through anti-oxidant mechanisms and that activation of the Nrf2 pathway is involved. The Nrf2/antioxidant response element pathway may become a new therapeutic target for the treatment of ischemic stroke.

  19. The effects of erythropoietin signaling on telomerase regulation in non-erythroid malignant and non-malignant cells

    Energy Technology Data Exchange (ETDEWEB)

    Uziel, Orit, E-mail: Oritu@clalit.org.il [Felsenstein Medical Research Center, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Kanfer, Gil [Felsenstein Medical Research Center, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Dep. of Human Molecular Genetics and Biochemistry, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Beery, Einat [Felsenstein Medical Research Center, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Yelin, Dana; Shepshelovich, Daniel [Medicine A, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Bakhanashvili, Mary [Unit of Infectious Diseases, Sheba Medical Center, Tel-Hashomer (Israel); Nordenberg, Jardena [Felsenstein Medical Research Center, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Dep. of Human Molecular Genetics and Biochemistry, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Endocrinology Laboratory, Beilinson Medical Center, Petah-Tikva (Israel); Lahav, Meir [Felsenstein Medical Research Center, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Medicine A, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel)

    2014-07-18

    Highlights: • We assumed that some of erythropoietin adverse effects may be mediated by telomerase activity. • EPO administration increased telomerase activity, cells proliferation and migration. • The inhibition of telomerase modestly repressed the proliferative effect of erythropoietin. • Telomere shortening caused by long term inhibition of the enzyme totally abolished that effect. • This effect was mediated via the Lyn–AKT axis and not by the canonical JAK2–STAT pathway. - Abstract: Treatment with erythropoietin (EPO) in several cancers is associated with decreased survival due to cancer progression. Due to the major importance of telomerase in cancer biology we hypothesized that some of these effects may be mediated through EPO effect on telomerase. For this aim we explored the possible effects of EPO on telomerase regulation, cell migration and chemosensitivity in non-erythroid malignant and non-malignant cells. Cell proliferation, telomerase activity (TA) and cell migration increased in response to EPO. EPO had no effect on cancer cells sensitivity to cisplatinum and on the cell cycle status. The inhibition of telomerase modestly repressed the proliferative effect of EPO. Telomere shortening caused by long term inhibition of the enzyme abolished the effect of EPO, suggesting that EPO effects on cancer cells are related to telomere dynamics. TA was correlated with the levels of Epo-R. The increase in TA was mediated post-translationally through the Lyn-Src and not the canonical JAK2 pathway.

  20. A protective role of nuclear factor-erythroid 2-related factor-2 (Nrf2) in inflammatory disorders

    International Nuclear Information System (INIS)

    Nuclear factor-erythroid 2-related factor-2 (Nrf2) is a key transcription factor that plays a central role in cellular defense against oxidative and electrophilic insults by timely induction of antioxidative and phase-2 detoxifying enzymes and related stress-response proteins. The 5'-flanking regions of genes encoding these cytoprotective proteins contain a specific consensus sequence termed antioxidant response element (ARE) to which Nrf2 binds. Recent studies have demonstrated that Nrf2-ARE signaling is also involved in attenuating inflammation-associated pathogenesis, such as autoimmune diseases, rheumatoid arthritis, asthma, emphysema, gastritis, colitis and atherosclerosis. Thus, disruption or loss of Nrf2 signaling causes enhanced susceptibility not only to oxidative and electrophilic stresses but also to inflammatory tissue injuries. During the early-phase of inflammation-mediated tissue damage, activation of Nrf2-ARE might inhibit the production or expression of pro-inflammatory mediators including cytokines, chemokines, cell adhesion molecules, matrix metalloproteinases, cyclooxygenase-2 and inducible nitric oxide synthase. It is likely that the cytoprotective function of genes targeted by Nrf2 may cooperatively regulate the innate immune response and also repress the induction of pro-inflammatory genes. This review highlights the protective role of Nrf2 in inflammation-mediated disorders with special focus on the inflammatory signaling modulated by this redox-regulated transcription factor.

  1. Atmospheric Circulation of Terrestrial Exoplanets

    OpenAIRE

    Showman, Adam P.; Wordsworth, Robin D.; Merlis, Timothy M.; Kaspi, Yohai

    2013-01-01

    The investigation of planets around other stars began with the study of gas giants, but is now extending to the discovery and characterization of super-Earths and terrestrial planets. Motivated by this observational tide, we survey the basic dynamical principles governing the atmospheric circulation of terrestrial exoplanets, and discuss the interaction of their circulation with the hydrological cycle and global-scale climate feedbacks. Terrestrial exoplanets occupy a wide range of physical a...

  2. 西藏藏族人群中细小病毒B19基因与内地汉族人群的差异%Different human parvovirus B19 subgroup circulation in Tibet and Han population in China

    Institute of Scientific and Technical Information of China (English)

    朱娜; 佟瑞; 周为民; 谭心怡; 楼永良; 谭文杰

    2015-01-01

    目的 分析人细小病毒B19及人细小病毒4(PARV4)在西藏藏族人群中与内地汉族人群中的基因特点.方法 采用建立的B19与PARV4 PCR筛查方法,分别从西藏藏族人群中与内地汉族人群血液标本中获得人细小病毒B19及PARV4的部分基因片段,经纯化、测序后,进行基因进化树分析.结果 共获得10个B19 VP1基因片段序列(西藏,2个;四川,3个;浙江,5个);10个PAV4ORF1基因片段序列(西藏,2个;四川,2个;云南,1个;浙江,5个);西藏藏族人群中细小病毒B19基因与内地汉族人群同属基因1A亚型,但为不同进化分支;而西藏藏族与内地汉族人群PAV4基因属同一分支.结论 细小病毒B19基因在西藏藏族与内地汉族人群中的差异分析为该病的检测与控制提供了参考.%Objective To investigate the genetic diversity differences of human parvoviruse B19 and parvovirus 4 (PRVA4) in Tibet and Han population in China.Methods Phylogenetic analysis was performed on genome fragments of B19 or PARV4 obtained from the blood samples of Tibet and Han population in China by using a PCR followed by sequencing.Results Ten partial VP1 fragments of B19 (2 from Tibet,3 from Sichuan,5 from Zhejiang) and 10 partial ORF1 fragments of PAV4 (2 from Tibet,2 from Sichuan,1 Yunnan,5 from Zhejiang) were obtained.Phylogenetic analysis indicated that different B19 subgroup circulates in Tibet and Han population although they belong to the same 1A subtype.While the gene evolution of PAV4 is very conserved between the Tibet and Han population in China.Conclusion These studies on genetic diversity of B19 in different Chinese population provide a way for detection and prevention of B19 human parvovirus infection.

  3. Global genetic architecture of an erythroid quantitative trait locus, HMIP-2.

    Science.gov (United States)

    Menzel, Stephan; Rooks, Helen; Zelenika, Diana; Mtatiro, Siana N; Gnanakulasekaran, Akshala; Drasar, Emma; Cox, Sharon; Liu, Li; Masood, Mariam; Silver, Nicholas; Garner, Chad; Vasavda, Nisha; Howard, Jo; Makani, Julie; Adekile, Adekunle; Pace, Betty; Spector, Tim; Farrall, Martin; Lathrop, Mark; Thein, Swee Lay

    2014-11-01

    HMIP-2 is a human quantitative trait locus affecting peripheral numbers, size and hemoglobin composition of red blood cells, with a marked effect on the persistence of the fetal form of hemoglobin, HbF, in adults. The locus consists of multiple common variants in an enhancer region for MYB (chr 6q23.3), which encodes the hematopoietic transcription factor cMYB. Studying a European population cohort and four African-descended groups of patients with sickle cell anemia, we found that all share a set of two spatially separate HbF-promoting alleles at HMIP-2, termed "A" and "B." These typically occurred together ("A-B") on European chromosomes, but existed on separate homologous chromosomes in Africans. Using haplotype signatures for "A" and "B," we interrogated public population datasets. Haplotypes carrying only "A" or "B" were typical for populations in Sub-Saharan Africa. The "A-B" combination was frequent in European, Asian, and Amerindian populations. Both alleles were infrequent in tropical regions, possibly undergoing negative selection by geographical factors, as has been reported for malaria with other hematological traits. We propose that the ascertainment of worldwide distribution patterns for common, HbF-promoting alleles can aid their further genetic characterization, including the investigation of gene-environment interaction during human migration and adaptation. PMID:25069958

  4. Tumor-Related Methylated Cell-Free DNA and Circulating Tumor Cells in Melanoma

    OpenAIRE

    Salvianti, Francesca; Orlando, Claudio; Massi, Daniela; DE GIORGI, VINCENZO; Grazzini, Marta; Pazzagli, Mario; Pinzani, Pamela

    2016-01-01

    Solid tumor release into the circulation cell-free DNA (cfDNA) and circulating tumor cells (CTCs) which represent promising biomarkers for cancer diagnosis. Circulating tumor DNA may be studied in plasma from cancer patients by detecting tumor specific alterations, such as genetic or epigenetic modifications. Ras association domain family 1 isoform A (RASSF1A) is a tumor suppressor gene silenced by promoter hypermethylation in a variety of human cancers including melanoma. The aim of the pres...

  5. Human parvovirus B19: a mechanistic overview of infection and DNA replication

    OpenAIRE

    Luo, Yong; Qiu, Jianming

    2015-01-01

    Human parvovirus B19 (B19V) is a human pathogen that belongs to genus Erythroparvovirus of the Parvoviridae family, which is composed of a group of small DNA viruses with a linear single-stranded DNA genome. B19V mainly infects human erythroid progenitor cells and causes mild to severe hematological disorders in patients. However, recent clinical studies indicate that B19V also infects nonerythroid lineage cells, such as myocardial endothelial cells, and may be associated with other disease o...

  6. Seasonal overturning circulation in the Red Sea: 2. Winter circulation

    KAUST Repository

    Yao, Fengchao

    2014-04-01

    The shallow winter overturning circulation in the Red Sea is studied using a 50 year high-resolution MITgcm (MIT general circulation model) simulation with realistic atmospheric forcing. The overturning circulation for a typical year, represented by 1980, and the climatological mean are analyzed using model output to delineate the three-dimensional structure and to investigate the underlying dynamical mechanisms. The horizontal model circulation in the winter of 1980 is dominated by energetic eddies. The climatological model mean results suggest that the surface inflow intensifies in a western boundary current in the southern Red Sea that switches to an eastern boundary current north of 24N. The overturning is accomplished through a cyclonic recirculation and a cross-basin overturning circulation in the northern Red Sea, with major sinking occurring along a narrow band of width about 20 km along the eastern boundary and weaker upwelling along the western boundary. The northward pressure gradient force, strong vertical mixing, and horizontal mixing near the boundary are the essential dynamical components in the model\\'s winter overturning circulation. The simulated water exchange is not hydraulically controlled in the Strait of Bab el Mandeb; instead, the exchange is limited by bottom and lateral boundary friction and, to a lesser extent, by interfacial friction due to the vertical viscosity at the interface between the inflow and the outflow. Key Points Sinking occurs in a narrow boundary layer along the eastern boundary Surface western boundary current switches into an eastern boundary current Water exchange in the Strait of Bab el Mandeb is not hydraulically controlled © 2014. American Geophysical Union. All Rights Reserved.

  7. The Invertibility, Explicit Determinants, and Inverses of Circulant and Left Circulant and g-Circulant Matrices Involving Any Continuous Fibonacci and Lucas Numbers

    Directory of Open Access Journals (Sweden)

    Zhaolin Jiang

    2014-01-01

    Full Text Available Circulant matrices play an important role in solving delay differential equations. In this paper, circulant type matrices including the circulant and left circulant and g-circulant matrices with any continuous Fibonacci and Lucas numbers are considered. Firstly, the invertibility of the circulant matrix is discussed and the explicit determinant and the inverse matrices by constructing the transformation matrices are presented. Furthermore, the invertibility of the left circulant and g-circulant matrices is also studied. We obtain the explicit determinants and the inverse matrices of the left circulant and g-circulant matrices by utilizing the relationship between left circulant, g-circulant matrices and circulant matrix, respectively.

  8. Circulating Fibronectin Controls Tumor Growth

    Directory of Open Access Journals (Sweden)

    Anja von Au

    2013-08-01

    Full Text Available Fibronectin is ubiquitously expressed in the extracellular matrix, and experimental evidence has shown that it modulates blood vessel formation. The relative contribution of local and circulating fibronectin to blood vessel formation in vivo remains unknown despite evidence for unexpected roles of circulating fibronectin in various diseases. Using transgenic mouse models, we established that circulating fibronectin facilitates the growth of bone metastases by enhancing blood vessel formation and maturation. This effect is more relevant than that of fibronectin produced by endothelial cells and pericytes, which only exert a small additive effect on vessel maturation. Circulating fibronectin enhances its local production in tumors through a positive feedback loop and increases the amount of vascular endothelial growth factor (VEGF retained in the matrix. Both fibronectin and VEGF then cooperate to stimulate blood vessel formation. Fibronectin content in the tumor correlates with the number of blood vessels and tumor growth in the mouse models. Consistent with these results, examination of three separate arrays from patients with breast and prostate cancers revealed that a high staining intensity for fibronectin in tumors is associated with increased mortality. These results establish that circulating fibronectin modulates blood vessel formation and tumor growth by modifying the amount of and the response to VEGF. Furthermore, determination of the fibronectin content can serve as a prognostic biomarker for breast and prostate cancers and possibly other cancers.

  9. Protective role of nuclear factor erythroid 2-related factor 2 in the hemorrhagic shock-induced inflammatory response.

    Science.gov (United States)

    Zhao, Haige; Hao, Sijing; Xu, Hongfei; Ma, Liang; Zhang, Zheng; Ni, Yiming; Yu, Luyang

    2016-04-01

    Hemorrhagic shock (HS) following trauma or major surgery significantly contributes to mortality. However, the mechanisms through which HS activates the inflammatory response are not yet fully understood. Nuclear factor-erythroid 2 (NF-E2) p45-related factor-2 (Nrf2), a bZIP transcription factor, is a master regulator of robust cytoprotective defenses. The present study investigated the role of Nrf2 in the pathophysiology of HS. Nrf2 expression in peripheral leukocytes obtained from patients with surgery-associated hemorrhage subjected to resuscitation treatment (termed HS patients) or healthy donors was examined by RT-qPCR. A marked increase in Nrf2 expression was detected in the leukocytes obtained from the HS patients, which indicates a correlation between Nrf2 expression and the development of HS. Wild-type (WT; Nrf2+/+) and Nrf2-deficient [Nrf2-/- or Nrf2‑knockout (KO)] mice were subjected to surgery to induce HS. Systemic inflammation was significantly elevated in the Nrf2-KO mice compared with the WT mice following HS, as assessed by an increase in serum cytokine levels [interleukin (IL)-6, tumor necrosis factor (TNF)-α and IL-1β], as well as high-mobility group box 1 protein (HMGB1) expression. The Nrf2-KO mice exhibited more severe lung and liver injury following HS as evidenced by increased tissue damage, increased myeloperoxidase (MPO) activity and the increased production of pro-inflammatory cytokines. Additionally, Nrf2 deficiency augmented cytokine production induced by the exposure of peritoneal mouse macrophages to lipopolysaccharide (LPS) following HS. Taken together, these results suggest that Nrf2 is a critical host factor which limits immune dysregulation and organ injury following HS. PMID:26935388

  10. Crystal Structure of the Nonerythroid [alpha]-Spectrin Tetramerization Site Reveals Differences between Erythroid and Nonerythroid Spectrin Tetramer Formation

    Energy Technology Data Exchange (ETDEWEB)

    Mehboob, Shahila; Song, Yuanli; Witek, Marta; Long, Fei; Santarsiero, Bernard D.; Johnson, Michael E.; Fung, Leslie W.-M. (UIC)

    2010-06-21

    We have solved the crystal structure of a segment of nonerythroid {alpha}-spectrin ({alpha}II) consisting of the first 147 residues to a resolution of 2.3 {angstrom}. We find that the structure of this segment is generally similar to a corresponding segment from erythroid {alpha}-spectrin ({alpha}I) but exhibits unique differences with functional significance. Specific features include the following: (i) an irregular and frayed first helix (Helix C{prime}); (ii) a helical conformation in the junction region connecting Helix C{prime} with the first structural domain (D1); (iii) a long A1B1 loop in D1; and (iv) specific inter-helix hydrogen bonds/salt bridges that stabilize D1. Our findings suggest that the hydrogen bond networks contribute to structural domain stability, and thus rigidity, in {alpha}II, and the lack of such hydrogen bond networks in {alpha}I leads to flexibility in {alpha}I. We have previously shown the junction region connecting Helix C{prime} to D1 to be unstructured in {alpha}I (Park, S., Caffrey, M. S., Johnson, M. E., and Fung, L. W. (2003) J. Biol. Chem. 278, 21837-21844) and now find it to be helical in {alpha}II, an important difference for {alpha}-spectrin association with {beta}-spectrin in forming tetramers. Homology modeling and molecular dynamics simulation studies of the structure of the tetramerization site, a triple helical bundle of partial domain helices, show that mutations in {alpha}-spectrin will affect Helix C{prime} structural flexibility and/or the junction region conformation and may alter the equilibrium between spectrin dimers and tetramers in cells. Mutations leading to reduced levels of functional tetramers in cells may potentially lead to abnormal neuronal functions.

  11. The Donders model of the circulation in normo- and pathophysiology

    DEFF Research Database (Denmark)

    Noordergraaf, Gerrit J.; Ottesen, Johnny T.; Kortsmit, Wil J.P.M.;

    2006-01-01

    A model of the closed human cardiovascular loop is developed. This model, using one set of 88 equations, allows variations from normal resting conditions to exercise, as well as to the extreme condition of a circulation following cardiac arrest. The principal purpose of the model is to evaluate t...

  12. A radioimmunoprecipitation polyethylene glycol assay for circulating Entamoeba histolytica antigens

    International Nuclear Information System (INIS)

    An assay capable of detecting circulating Entamoeba histolytica antigens in amoebiasis is described. This assay utilised a radiolabelled affinity purified rabbit anti-E. histolytica antibody that had been depleted of antibodies that cross-react with human serum proteins, and a polyethylene glycol precipitation step. (Auth.)

  13. Radioimmunoprecipitation polyethylene glycol assay for circulating Entamoeba histolytica antigens

    Energy Technology Data Exchange (ETDEWEB)

    Pillai, S.; Mohimen, A.; Mehra, S. (Calcutta Medical Research Inst., Calcutta (India). Kothari Centre of Gastroenterology)

    1982-12-17

    An assay capable of detecting circulating Entamoeba histolytica antigens in amoebiasis is described. This assay utilised a radiolabelled affinity purified rabbit anti-E. histolytica antibody that had been depleted of antibodies that cross-react with human serum proteins, and a polyethylene glycol precipitation step.

  14. Atmospheric Circulation of Terrestrial Exoplanets

    CERN Document Server

    Showman, Adam P; Merlis, Timothy M; Kaspi, Yohai

    2013-01-01

    The investigation of planets around other stars began with the study of gas giants, but is now extending to the discovery and characterization of super-Earths and terrestrial planets. Motivated by this observational tide, we survey the basic dynamical principles governing the atmospheric circulation of terrestrial exoplanets, and discuss the interaction of their circulation with the hydrological cycle and global-scale climate feedbacks. Terrestrial exoplanets occupy a wide range of physical and dynamical conditions, only a small fraction of which have yet been explored in detail. Our approach is to lay out the fundamental dynamical principles governing the atmospheric circulation on terrestrial planets--broadly defined--and show how they can provide a foundation for understanding the atmospheric behavior of these worlds. We first survey basic atmospheric dynamics, including the role of geostrophy, baroclinic instabilities, and jets in the strongly rotating regime (the "extratropics") and the role of the Hadle...

  15. Doppler velocimetry with emphasis on the fetal cerebral circulation

    OpenAIRE

    Noordam, Marja

    1996-01-01

    textabstractIn this thesis the following questions were addressed: 1. Are changes in placental vascular resistance associated with alterations in arterial down stream impedance at fetal level? To this purpose placental embolization was carried-out in the fetal lamb with subsequent Doppler velocimetry in the fetal descending aorta (chapter 2). 2. What happens to the human fetal cerebral circulation relative to normal and raised umbilical placental resistance? To answer this question, the human...

  16. Impaired ferritin mRNA translation in primary erythroid progenitors: shift to iron-dependent regulation by the v-ErbA oncoprotein.

    Science.gov (United States)

    Mikulits, W; Schranzhofer, M; Bauer, A; Dolznig, H; Lobmayr, L; Infante, A A; Beug, H; Müllner, E W

    1999-12-15

    In immortalized cells of the erythroid lineage, the iron-regulatory protein (IRP) has been suggested to coregulate biosynthesis of the iron storage protein ferritin and the erythroid delta-aminolevulinate synthase (eALAS), a key enzyme in heme production. Under iron scarcity, IRP binds to an iron-responsive element (IRE) located in ferritin and eALAS mRNA leaders, causing a block of translation. In contrast, IRP-IRE interaction is reduced under high iron conditions, allowing efficient translation. We show here that primary chicken erythroblasts (ebls) proliferating or differentiating in culture use a drastically different regulation of iron metabolism. Independently of iron administration, ferritin H (ferH) chain mRNA translation was massively decreased, whereas eALAS transcripts remained constitutively associated with polyribosomes, indicating efficient translation. Variations in iron supply had minor but significant effects on eALAS mRNA polysome recruitment but failed to modulate IRP-affinity to the ferH-IRE in vitro. However, leukemic ebls transformed by the v-ErbA/v-ErbB-expressing avian erythroblastosis virus showed an iron-dependent reduction of IRP mRNA-binding activity, resulting in mobilization of ferH mRNA into polysomes. Hence, we analyzed a panel of ebls overexpressing v-ErbA and/or v-ErbB oncoproteins as well as the respective normal cellular homologues (c-ErbA/TRalpha, c-ErbB/EGFR). It turned out that v-ErbA, a mutated class II nuclear hormone receptor that arrests erythroid differentiation, caused the change in ferH mRNA translation. Accordingly, inhibition of v-ErbA function in these leukemic ebls led to a switch from iron-responsive to iron-independent ferH expression. PMID:10590077

  17. CDK2 accelerates early erythroid differentiation of K562 cells%CDK2促进K562细胞早期红系分化

    Institute of Scientific and Technical Information of China (English)

    李均; 岳瑞华; 沈钧乐; 肖俊

    2011-01-01

    目的 探讨细胞周期调节蛋白CDK2对K562细胞红系分化的影响.方法 分别用CDK2表达质粒和干扰RNA分子转染K562细胞,用Western blot法检测过表达或干扰效率,使用real-time PCR和联苯胺染色法检测K562细胞分化.结果 CDK2在K562细胞红系分化早期呈现表达上升趋势;在K562细胞中过表达CDK2可促进hemin诱导的红系分化;反之,干扰K562内源的CDK2表达会对K562红系分化产生抑制作用.结论 CDK2在K562细胞早期红系分化过程中发挥促进作用.%Objective To study the roles of a cell cycle regulator cyclin-dependent kinase 2 (CDK2) in erythroid differentiation of K562 cells. Methods K562 cells were transfected with the construct expressing CDK2 and siRNAs specifically targeting at CDK2. The effects of over-expression or knocking-down of CDK2 were examined by Western blot. Quantitative RT-PCR was performed to detect the level of γ-globin mRNA expression. The benzidine staining assay was used to identify the differentiation state of K562 cells. Results CDK2 was up-regulated at the early stage of K562 erythroid differentiation. Over-expression of CDK2 in K562 cells accelerated erythroid differentiation. Inhibition of CDK2 attenuates globin accumulation in K562 cells. Conclusion CDK2 is necessary for early erythroid differentiation of K562 cells.

  18. Dual role for the methyltransferase G9a in the maintenance of β-globin gene transcription in adult erythroid cells

    OpenAIRE

    Chaturvedi, Chandra-Prakash; Hosey, Alison M.; Palii, Carmen; Perez-Iratxeta, Carolina; Nakatani, Yoshihiro; Ranish, Jeffrey A.; Dilworth, F. Jeffrey; Brand, Marjorie

    2009-01-01

    Using a proteomics screen, we have identified the methyltransferase G9a as an interacting partner of the hematopoietic activator NF-E2. We show that G9a is recruited to the β-globin locus in a NF-E2-dependent manner and spreads over the entire locus. While G9a is often regarded as a corepressor, knocking down this protein in differentiating adult erythroid cells leads to repression of the adult βmaj globin gene and aberrant reactivation of the embryonic β-like globin gene Ey. While in adult c...

  19. Antisense myb inhibition of purified erythroid progenitors in development and differentiation is linked to cycling activity and expression of DNA polymerase alpha

    International Nuclear Information System (INIS)

    These studies aimed to determine the expression and functional role of c-myb in erythroid progenitors with different cycling activities. In the first series of experiments the erythroid burst-forming unit (BFU-E) and colony-forming unit (CFU-E) populations from adult peripheral blood (PB), bone marrow (BM), and embryonic-fetal liver (FL) were treated with either c-myb antisense oligomers or 3H-thymidine (3H-TdR). A direct correlation was always observed between the inhibitory effect of anti-myb oligomers and the level of cycling activity. Thus, the inhibitory effect of antisense c-myb on the number of BFU-E colonies was 28.3% +/- 15.8% in PB, 53.4% +/- 9.3% in BM, and 68.2% +/- 24.5% in FL. Both adult and embryonic CFU-E were markedly inhibited. Using purified PB progenitors, we observed a similar pattern, although with slightly lower inhibitory effects. In the 3H-TdR suicide assay the killing index of BFU-E was 8.9% +/- 4.2% in PB, 29.4% +/- 6.5% in BM, and 40.1% +/- 9.6% in FL. The values for adult and embryonic CFU-E were 55.7% +/- 7.9% and 60.98% +/- 6.6%, respectively. We then investigated the kinetics of c-myb mRNA level during the erythroid differentiation of purified adult PB and FL BFU-E, as evaluated in liquid-phase culture by reverse transcription-polymerase chain reaction. Adult erythroid precursors showed a gradual increase of c-myb mRNA from day 4 through day 8 of culture and a sharp decrease at later times, whereas the expression of c-myb mRNA and protein in differentiation embryonic precursors peaked 2 days earlier. In both cases, c-myb mRNA level peaked at the CFU-E stage of differentiation. Finally, highly purified adult PB BFU-E were stimulated into cycling by a 3-day treatment with interleukin-3 in liquid phase: both the sensitivity to c-myb antisense oligomers and the 3H-TdR suicide index showed a gradual, strictly parallel increase

  20. Factors affecting the enterohepatic circulation of oral contraceptive steroids.

    Science.gov (United States)

    Orme, M L; Back, D J

    1990-12-01

    Oral contraceptive steroids may undergo enterohepatic circulation, but it is relevant for only estrogens, because these compounds can be directly conjugated in the liver. Animal studies show convincing evidence of the importance of the enterohepatic circulation, but studies in humans are much less convincing. The importance of the route and the rate of metabolism of ethinyl estradiol are reviewed. Some antibiotics have been reported anecdotally to reduce the efficacy of oral contraceptive steroids, but controlled studies have not confirmed this observation. Although gut flora are altered by oral antibiotics, the blood levels of ethinyl estradiol are not reduced, and one antibiotic at least (cotrimoxazole) enhances the activity of ethinyl estradiol. PMID:2256523

  1. VanderLaan Circulant Type Matrices

    Directory of Open Access Journals (Sweden)

    Hongyan Pan

    2015-01-01

    Full Text Available Circulant matrices have become a satisfactory tools in control methods for modern complex systems. In the paper, VanderLaan circulant type matrices are presented, which include VanderLaan circulant, left circulant, and g-circulant matrices. The nonsingularity of these special matrices is discussed by the surprising properties of VanderLaan numbers. The exact determinants of VanderLaan circulant type matrices are given by structuring transformation matrices, determinants of well-known tridiagonal matrices, and tridiagonal-like matrices. The explicit inverse matrices of these special matrices are obtained by structuring transformation matrices, inverses of known tridiagonal matrices, and quasi-tridiagonal matrices. Three kinds of norms and lower bound for the spread of VanderLaan circulant and left circulant matrix are given separately. And we gain the spectral norm of VanderLaan g-circulant matrix.

  2. Conservation of Circulation in Magnetohydrodynamics

    CERN Document Server

    Bekenstein, J D; Bekenstein, Jacob D.; Oron, Asaf

    2000-01-01

    We demonstrate, both at the Newtonian and (general) relativistic levels, theexistence of a generalization of Kelvin's circulation theorem (for pure fluids)which is applicable to perfect magnetohydrodynamics. The argument is based onthe least action principle for magnetohydrodynamic flow. Examples of the newconservation law are furnished. The new theorem should be helpful inidentifying new kinds of vortex phenomena distinct from magnetic ropes or fluidvortices.

  3. Human Parvovirus B19 VP2 Empty Capsids Bind to Human Villous Trophoblast Cells in vitro Via the Globoside Receptor

    OpenAIRE

    Wegner, Carole C.; Jordan, Jeanne A.

    2004-01-01

    BACKGROUND: Pregnant women acutely infected with human parvovirus B19 (B19) may transmit the virus to the developing fetus. The mechanism whereby the virus interacts with the placenta is unknown. It is known that globoside receptor is required for successful infection of the target cells, which are the highly undifferentiated, actively dividing colony and burst-form units of the erythroid series. Globoside is present on trophoblast cells which have intimate contact with maternal blood, and ma...

  4. Model for large scale circulation of nuclides in nature, 1

    Energy Technology Data Exchange (ETDEWEB)

    Ohnishi, Teruaki

    1988-12-01

    A model for large scale circulation of nuclides was developed, and a computer code named COCAIN was made which simulates this circulation system-dynamically. The natural environment considered in the present paper consists of 2 atmospheres, 8 geospheres and 2 lithospheres. The biosphere is composed of 4 types of edible plants, 5 cattles and their products, 4 water biota and 16 human organs. The biosphere is assumed to be given nuclides from the natural environment mentioned above. With the use of COCAIN, two numerical case studies were carried out; the one is the study on nuclear pollution in nature by the radioactive nuclides originating from the past nuclear bomb tests, and the other is the study on the response of environment and biota to the pulse injection of nuclides into one compartment. From the former case study it was verified that this model can well explain the observation and properly simulate the large scale circulation of nuclides in nature.

  5. In vivo acoustic and photoacoustic focusing of circulating cells

    Science.gov (United States)

    Galanzha, Ekaterina I.; Viegas, Mark G.; Malinsky, Taras I.; Melerzanov, Alexander V.; Juratli, Mazen A.; Sarimollaoglu, Mustafa; Nedosekin, Dmitry A.; Zharov, Vladimir P.

    2016-03-01

    In vivo flow cytometry using vessels as natural tubes with native cell flows has revolutionized the study of rare circulating tumor cells in a complex blood background. However, the presence of many blood cells in the detection volume makes it difficult to count each cell in this volume. We introduce method for manipulation of circulating cells in vivo with the use of gradient acoustic forces induced by ultrasound and photoacoustic waves. In a murine model, we demonstrated cell trapping, redirecting and focusing in blood and lymph flow into a tight stream, noninvasive wall-free transportation of blood, and the potential for photoacoustic detection of sickle cells without labeling and of leukocytes targeted by functionalized nanoparticles. Integration of cell focusing with intravital imaging methods may provide a versatile biological tool for single-cell analysis in circulation, with a focus on in vivo needleless blood tests, and preclinical studies of human diseases in animal models.

  6. Model for large scale circulation of nuclides in nature, 1

    International Nuclear Information System (INIS)

    A model for large scale circulation of nuclides was developed, and a computer code named COCAIN was made which simulates this circulation system-dynamically. The natural environment considered in the present paper consists of 2 atmospheres, 8 geospheres and 2 lithospheres. The biosphere is composed of 4 types of edible plants, 5 cattles and their products, 4 water biota and 16 human organs. The biosphere is assumed to be given nuclides from the natural environment mentioned above. With the use of COCAIN, two numerical case studies were carried out; the one is the study on nuclear pollution in nature by the radioactive nuclides originating from the past nuclear bomb tests, and the other is the study on the response of environment and biota to the pulse injection of nuclides into one compartment. From the former case study it was verified that this model can well explain the observation and properly simulate the large scale circulation of nuclides in nature. (author)

  7. In vivo acoustic and photoacoustic focusing of circulating cells

    Science.gov (United States)

    Galanzha, Ekaterina I.; Viegas, Mark G.; Malinsky, Taras I.; Melerzanov, Alexander V.; Juratli, Mazen A.; Sarimollaoglu, Mustafa; Nedosekin, Dmitry A.; Zharov, Vladimir P.

    2016-01-01

    In vivo flow cytometry using vessels as natural tubes with native cell flows has revolutionized the study of rare circulating tumor cells in a complex blood background. However, the presence of many blood cells in the detection volume makes it difficult to count each cell in this volume. We introduce method for manipulation of circulating cells in vivo with the use of gradient acoustic forces induced by ultrasound and photoacoustic waves. In a murine model, we demonstrated cell trapping, redirecting and focusing in blood and lymph flow into a tight stream, noninvasive wall-free transportation of blood, and the potential for photoacoustic detection of sickle cells without labeling and of leukocytes targeted by functionalized nanoparticles. Integration of cell focusing with intravital imaging methods may provide a versatile biological tool for single-cell analysis in circulation, with a focus on in vivo needleless blood tests, and preclinical studies of human diseases in animal models. PMID:26979811

  8. Acetylcholinesterase in the human erythron. III. Regulation of differentiation.

    Science.gov (United States)

    Barr, R D; Koekebakker, M

    1990-08-01

    Acetylcholinesterase (AChE) is present in both primitive and mature erythroid cells, but a role for the enzyme in human hematopoiesis has not been defined. This prospect represented the primary objective of the following study. In clonal culture of normal human bone marrow cells, a "wave" of AChE activity was demonstrated, rising from undetectable levels to a peak (of 1.48 femto-moles per min per cell) at 10 days in the course of progressive erythroid clonogenesis. At concentrations of enzyme inhibitor that clearly reduced AChE activity in a dose-dependent fashion, there was no overall effect on erythropoiesis in vitro, but the clones were generally smaller and significantly more often multi-focal than in control cultures. Furthermore, in the presence of AChE inhibitors, a concentration-dependent increase in the myeloid-erythroid ratios of the culture harvests was observed. Likewise, a clear reduction in hemoglobination was revealed, in cells of 10 day cultures, from a mean hemoglobin concentration of 35.0 pg per cell in controls to 20.1 pg per cell in the presence of the maximal concentration of the inhibitor (10(-6) M eserine). These data point to a role for AChE in the regulation of differentiation in the human erythron. PMID:2368693

  9. High-level β-globin expression after retroviral transfer of locus activation region-containing human β-globin gene derivatives into murine erythroleukemia cells

    International Nuclear Information System (INIS)

    The locus activation region (LAR) of the human β-globin-like gene cluster is characterized by a group of four DNase I hypersensitive sites, which arise specifically in erythroid tissues and are required for a normal pattern of β-globin-like expression. The hypersensitive sites are found at positions 6.1, 10.9, 14.7, and 18 kilobase pairs (kbp) 5' of the ε-globin gene. Recently functional assays of the LAR that tested determinants for all four hypersensitive sites showed that expression of the human β-globin gene was increased to normal or near-normal levels in both transgenic mice and erythroid cells. The authors constructed retroviral vectors with a human β-globin gene and the determinant for a single hypersensitive site and measured β-globin gene expression after retroviral infection of murine erythroleukemia cells. In the context of gene-transfer experiments ultimately aimed at gene therapy, the results show that LAR determinants lead to an increased level of human β-globin RNA expression after retroviral transfer into erythroid cells. But inclusion of LAR determinants in retroviral vectors also entails the potential risk of activating the expression of nonglobin genes in erythroid cells

  10. Cis-vaccenic acid induces differentiation and up-regulates gamma globin synthesis in K562, JK1 and transgenic mice erythroid progenitor stem cells.

    Science.gov (United States)

    Aimola, Idowu A; Inuwa, Hajiya M; Nok, Andrew J; Mamman, Aisha I; Bieker, James J

    2016-04-01

    Gamma globin induction remains a promising pharmacological therapeutic treatment mode for sickle cell anemia and beta thalassemia, however Hydroxyurea remains the only FDA approved drug which works via this mechanism. In this regard, we assayed the γ-globin inducing capacity of Cis-vaccenic acid (CVA). CVA induced differentiation of K562, JK1 and transgenic mice primary bone marrow hematopoietic progenitor stem cells. CVA also significantly up-regulated γ-globin gene expression in JK-1 and transgenic mice bone marrow erythroid progenitor stem cells (TMbmEPSCs) but not K562 cells without altering cell viability. Increased γ-globin expression was accompanied by KLF1 suppression in CVA induced JK-1 cells. Erythropoietin induced differentiation of JK-1 cells 24h before CVA induction did not significantly alter CVA induced differentiation and γ-globin expression in JK-1 cells. Inhibition of JK-1 and Transgenic mice bone marrow erythroid progenitor stem cells Fatty acid elongase 5 (Elovl5) and Δ(9) desaturase suppressed the γ-globin inductive effects of CVA. CVA treatment failed to rescue γ-globin expression in Elovl5 and Δ(9)-desaturase inhibited cells 48h post inhibition in JK-1 cells. The data suggests that CVA directly modulates differentiation of JK-1 and TMbmEPSCs, and indirectly modulates γ-globin gene expression in these cells. Our findings provide important clues for further evaluations of CVA as a potential fetal hemoglobin therapeutic inducer. PMID:26879870

  11. Intrinsic defects in erythroid cells from familial hemophagocytic lymphohistiocytosis type 5 patients identify a role for STXBP2/Munc18-2 in erythropoiesis and phospholipid scrambling.

    Science.gov (United States)

    Kostova, Elena B; Beuger, Boukje M; Veldthuis, Martijn; van der Werff Ten Bosch, Jutte; Kühnle, Ingrid; van den Akker, Emile; van den Berg, Timo K; van Zwieten, Rob; van Bruggen, Robin

    2015-12-01

    Familial hemophagocytic lymphohistiocytosis type 5 (FHL-5) is a rare genetic disorder caused by mutations in STXBP2/Munc18-2. Munc18-2 plays a role in the degranulation machinery of natural killer cells and cytotoxic T lymphocytes. Mutations in STXBP2/Munc18-2 lead to impaired killing of target cells by natural killer cells and cytotoxic T lymphocytes, which in turn results in elevated levels of the inflammatory cytokine interferon γ, macrophage activation, and hemophagocytosis. Even though patients with FHL-5 present with anemia and hemolysis, no link between the disease and the erythroid lineage has been established. Here we report that red blood cells express Munc18-2 and that erythroid cells from patients with FHL-5 exhibit intrinsic defects caused by STXBP2/Munc18-2 mutations. Red blood cells from patients with FHL-5 expose less phosphatidylserine on their surface upon Ca(2+) ionophore ionomycin treatment. Furthermore, cultured erythroblasts from patients with FHL-5 display defective erythropoiesis characterized by decreased CD235a expression and aberrant cell morphology. PMID:26320718

  12. Epidermal Growth Factor Increases LRF/Pokemon Expression in Human Prostate Cancer Cells

    OpenAIRE

    Aggarwal, Himanshu; Aggarwal, Anshu; Devendra K Agrawal

    2011-01-01

    Leukemia/lymphoma related factor/POK erythroid myeloid ontogenic factor (LRF/Pokemon) is a member of the POK family of proteins that promotes oncogenesis in several forms of cancer. Recently, we found higher LRF expression in human breast and prostate carcinomas compared to the corresponding normal tissues. The aim of this study was to examine the regulation of LRF expression in human prostate cells. Epidermal growth factor (EGF) and its receptors mediate several tumorigenic cascades that reg...

  13. Journalism as Cultures of Circulation

    DEFF Research Database (Denmark)

    Bødker, Henrik

    2013-01-01

    The universe of journalism has always consisted of interspersed texts, meanings and practices. Yet, much journalism research has often isolated either texts and/or contexts and as such assumed relations between professional practices, informed (rational) readers and (conceived) core texts...... of journalism. It is, however, more important than ever to shift attention away from texts to the processes through which they are circulated. This is partly because the many cultural forms of journalism (textual, institutional, technological, material, behavioural and imagined) are undergoing significant......, likes, comments, searches, journalist roles, writing and reading positions and identities etc. Such forms will be traced within the mediation of a specific event with the overall aim of beginning a theorization of the landscape of journalism as highly interrelated cultures of circulation....

  14. Proper Sizing of Circulation Pumps

    DEFF Research Database (Denmark)

    Tommerup, Henrik M.; Nørgaard, Jørgen

    2007-01-01

    The paper describes the preliminary results from field tests of replacing various types of old pumps used for circulating water in heating systems in single- and double-family houses with new types of pumps. The tests were carried out in Denmark for the Danish Electricity Savings Trust, but the...... results can be applied to Europe in general. Despite the small sample of houses involved in the test, 15 houses, some rather safe conclusions can be drawn from the results, which showed that newly developed pumps with power consumption around 5-8 W, can perform the task of circulating the water...... sufficiently to keep the houses satisfactorily warm during the heating season of the test. The old replaced pumps used 5-10 times more power. In Europe alone, a gradual replacement of the present vastly oversized pumps with such small but sufficient pumps can save the construction of 17 large power plants as...

  15. Radioisotopic evaluation of portal circulation

    International Nuclear Information System (INIS)

    The use of a radio-tracer of portal circulation through the intestine, should prevent cruel punctures in the portal-vein or spleen as it is usually the case with traditional methods in the study of portal-system. The absorption of I-131 and Tc-99m, previously cheked in rabbits presented similar results in dogs. The time of circulation between terminal large-intestine and the liver (t-RF) was determined by external counting at hepatic level by recording radioactivity variation-time. In healthy animals the t-RF was from 20to 60 seconds, with average time of 42 seconds. In 2 animals with partial binding of portal-vein the t-RF went up to 110 and 120 seconds. (Author)

  16. Ocean circulation generated magnetic signals

    DEFF Research Database (Denmark)

    Manoj, C.; Kuvshinov, A.; Maus, S.;

    2006-01-01

    Conducting ocean water, as it flows through the Earth's magnetic field, generates secondary electric and magnetic fields. An assessment of the ocean-generated magnetic fields and their detectability may be of importance for geomagnetism and oceanography. Motivated by the clear identification of...... ocean tidal signatures in the CHAMP magnetic field data we estimate the ocean magnetic signals of steady flow using a global 3-D EM numerical solution. The required velocity data are from the ECCO ocean circulation experiment and alternatively from the OCCAM model for higher resolution. We assume an...... magnetic field, as compared to the ECCO simulation. Besides the expected signatures of the global circulation patterns, we find significant seasonal variability of ocean magnetic signals in the Indian and Western Pacific Oceans. Compared to seasonal variation, interannual variations produce weaker signals....

  17. The Sun's Shallow Meridional Circulation

    CERN Document Server

    Hathaway, David H

    2011-01-01

    The Sun's global meridional circulation is evident as a slow poleward flow at its surface. This flow is observed to carry magnetic elements poleward - producing the Sun's polar magnetic fields as a key part of the 11-year sunspot cycle. Current theories for the sunspot cycle assume that this surface flow is part of a circulation which sinks inward at the poles and turns equatorward at depths below 100 Mm. Here we use the advection of the Sun's convection cells by the meridional flow to map the flow velocity in latitude and depth. Our measurements show the largest cells clearly moving equatorward at depths below 35 Mm - the base of the Sun's surface shear layer. This surprisingly shallow return flow indicates the need for substantial revisions to solar/stellar dynamo theory.

  18. Natural circulation systems: advantages and challenges

    International Nuclear Information System (INIS)

    This lecture briefly explains the principle of working of a natural circulation system, its various advantages and applications in nuclear and other industries. The major challenges to be overcome before the wide acceptance of natural circulation as the normal mode of coolant circulation in nuclear power reactors are briefly described. Classification of NCSs and the terminologies commonly encountered in natural circulation literature are also briefly explained. (author)

  19. The general circulation of the atmosphere

    OpenAIRE

    Schneider, Tapio

    2006-01-01

    Theories of how Earth's surface climate may change in the future, of how it may have been in the past, and of how it is related to climates of other planets must build upon a theory of the general circulation of the atmosphere. The view of the atmospheric general circulation presented here focuses not on Earth's general circulation as such but on a continuum of idealized circulations with axisymmetric flow statistics. Analyses of observational data for Earth's atmosphere, simulations with ide...

  20. Conservation of circulation in magnetohydrodynamics

    Science.gov (United States)

    Bekenstein; Oron

    2000-10-01

    We demonstrate at both the Newtonian and (general) relativistic levels the existence of a generalization of Kelvin's circulation theorem (for pure fluids) that is applicable to perfect magnetohydrodynamics. The argument is based on the least action principle for magnetohydrodynamic flow. Examples of the new conservation law are furnished. The new theorem should be helpful in identifying new kinds of vortex phenomena distinct from magnetic ropes or fluid vortices. PMID:11089118

  1. Electronic circulation of accounting documents

    OpenAIRE

    Kremláčková, Kateřina

    2014-01-01

    This thesis describes a circulation of accounting documents in an accounting entity, deals with legal requirements of the entire process and discusses it as a part of an internal control system of the entity. In connection with the theme of the work there are also defined legislative conditions for using information and communication technologies and introduced possibilities of involving these technologies in the process of processing of the accounting documents. Above all the electronic data...

  2. Purchase, circulation and fuel taxation

    OpenAIRE

    Potter, Stephen

    2008-01-01

    During the last decade, the UK and many other developed nations have reformed existing forms of road transport taxation to address a number of transport policy goals. This has involved modifying the design of purchase, circulation and fuel taxation to promote: • More fuel efficient vehicles • Alternative fuel vehicles • Cleaner fuels (lower emissions and/or low carbon) • Modal shift and traffic volume • Congestion reduction This chapter particularly explores the use of...

  3. Serological evaluation of Crimean-Congo hemorrhagic fever in humans with high-risk professions living in enzootic regions of Isfahan province of Iran and genetic analysis of circulating strains

    DEFF Research Database (Denmark)

    Chinikar, Sadegh; Ghiasi, Seyed Mojtaba; Naddaf, Saeed;

    2012-01-01

    Crimean-Congo hemorrhagic fever (CCHF) is a zoonotic viral disease that is asymptomatic in infected livestock, but causes a serious threat to humans with a mortality rate up to 50%. Although the CCHF virus (CCHFV) is often transmitted by ticks, livestock-to-human and human-to-human transmission...... also occurs. In the current study, we focused on CCHF in the province of Isfahan, located in the center of Iran and deemed to be the second most infected province. Human and livestock sera and resident ticks in the livestock are collected from different regions of the province and analyzed with...... specific IgG ELISA and RT-PCR tests. Overall, 12% and 12.7% of studied human and livestock populations were IgG positive, respectively. The genome of CCHFV was detected in 9% of ticks resident in livestock involved in this survey. The CCHFV isolates from infected ticks were genetically examined. Nucleotide...

  4. Examples of natural circulation in PHWR

    International Nuclear Information System (INIS)

    The main objective of this lecture is to provide deep insight into the complex natural circulation phenomena in the core of a Pressurised Heavy Water Reactor. A detailed account of natural circulation tests conducted in an Indian PHWR is given in this lecture. This will enable the participants to appreciate the importance of natural circulation in a nuclear reactor to a greater extent. (author)

  5. Nucleic acids in circulation: Are they harmful to the host?

    Indian Academy of Sciences (India)

    Indraneel Mittra; Naveen Kumar Nair; Pradyumna Kumar Mishra

    2012-06-01

    It has been estimated that 1011–1012 cells, primarily of haematogenous origin, die in the adult human body daily, and a similar number is regenerated to maintain homeostasis. Despite the presence of an efficient scavenging system for dead cells, considerable amounts of fragmented genetic material enter the circulation in healthy individuals. Elevated blood levels of extracellular nucleic acids have been reported in various disease conditions; such as ageing and age-related degenerative disorders, cancer; acute and chronic inflammatory conditions, severe trauma and autoimmune disorders. In addition to genomic DNA and nucleosomes, mitochondrial DNA is also found in circulation, as are RNA and microRNA. There is extensive literature that suggests that extraneously added nucleic acids have biological actions. They can enter into cells in vitro and in vivo and induce genetic transformation and cellular and chromosomal damage; and experimentally added nucleic acids are capable of activating both innate and adaptive immune systems and inducing a sterile inflammatory response. The possibility as to whether circulating nucleic acids may, likewise, have biological activities has not been explored. In this review we raise the question as to whether circulating nucleic acids may have damaging effects on the host and be implicated in ageing and diverse acute and chronic human pathologies.

  6. Alternative transcription and splicing of the human porphobilinogen deaminase gene

    International Nuclear Information System (INIS)

    Porphobilinogen deaminase is a cytosolic enzyme involved in the heme biosynthetic pathway. Two isoforms of PBGD, encoded by two mRNAs differing solely in their 5' end, are known: one is found in all cells and the other is present only in erythroid cells. The authors have previously shown that the human PBGD is encoded by a single gene and have now cloned and characterized this gene, which is split into 15 exons spread over 10 kilobases of DNA. They demonstrate that the two mRNAs arise from two overlapping transcription units. The first one (upstream) is active in all tissues and its promoter has some of the structural features of a housekeeping promoter; the second, located 3 kilobases downstream, is active only in erythroid cells and its promoter displays structural homologies with the β-globin gene promoters

  7. Early concepts and charts of ocean circulation

    Science.gov (United States)

    Peterson, R. G.; Stramma, L.; Kortum, G.

    Charts of ocean currents from the late nineteenth century show that already by then the patterns of surface circulation in regions away from polar latitudes were well understood. This fundamental knowledge accumulated gradually through centuries of sea travel and had reached a state of near correctness by the time dedicated research cruises, full-depth measurements and the practical application of the dynamical method were being instituted. Perhaps because of the foregoing, many of the pioneering works, critical to establishing what the upper-level circulation is like, the majority of the charts accompanying them, and several of the groundbreaking theoretical treatments on the physics of currents, are only poorly known to present-day oceanographers. In this paper we trace Western developments in knowledge and understanding of ocean circulation from the earliest times to the late-1800s transition into the modern era. We also discuss certain peripheral advances that proved critical to the subject. The earliest known ideas, dating from the Bronze Age and described by Homer, necessarily reflect severe limitations to geographical knowledge, as well as basic human predilections toward conjecture and exaggeration in the face of inadequate information. People considered the earth to be flat and circular, with the ocean flowing like a river around it. They also believed in horrific whirlpools, a concept that persisted into the Renaissance and which would later provide subject material for modern literature. From the Greek Classical Age, we find hydrologic theories of Earth's interior being laced with subterranean channels (Socrates) and all motion deriving from a divine force forever propelling the heavens toward the west, the primum mobile (Aristotle). These ideas, particularly the latter, dominated opinions about ocean circulation into the late Renaissance. By late Antiquity mariners had very likely acquired intimate knowledge of coastal currents in the Mediterranean, but

  8. The trypanocidal benznidazole promotes adaptive response to oxidative injury: Involvement of the nuclear factor-erythroid 2-related factor-2 (Nrf2) and multidrug resistance associated protein 2 (MRP2).

    Science.gov (United States)

    Rigalli, Juan Pablo; Perdomo, Virginia Gabriela; Ciriaci, Nadia; Francés, Daniel Eleazar Antonio; Ronco, María Teresa; Bataille, Amy Michele; Ghanem, Carolina Inés; Ruiz, María Laura; Manautou, José Enrique; Catania, Viviana Alicia

    2016-08-01

    Oxidative stress is a frequent cause underlying drug-induced hepatotoxicity. Benznidazole (BZL) is the only trypanocidal agent available for treatment of Chagas disease in endemic areas. Its use is associated with side effects, including increases in biomarkers of hepatotoxicity. However, BZL potential to cause oxidative stress has been poorly investigated. Here, we evaluated the effect of a pharmacologically relevant BZL concentration (200μM) at different time points on redox status and the counteracting mechanisms in the human hepatic cell line HepG2. BZL increased reactive oxygen species (ROS) after 1 and 3h of exposure, returning to normality at 24h. Additionally, BZL increased glutathione peroxidase activity at 12h and the oxidized glutathione/total glutathione (GSSG/GSSG+GSH) ratio that reached a peak at 24h. Thus, an enhanced detoxification of peroxide and GSSG formation could account for ROS normalization. GSSG/GSSG+GSH returned to control values at 48h. Expression of the multidrug resistance-associated protein 2 (MRP2) and GSSG efflux via MRP2 were induced by BZL at 24 and 48h, explaining normalization of GSSG/GSSG+GSH. BZL activated the nuclear erythroid 2-related factor 2 (Nrf2), already shown to modulate MRP2 expression in response to oxidative stress. Nrf2 participation was confirmed using Nrf2-knockout mice in which MRP2 mRNA expression was not affected by BZL. In summary, we demonstrated a ROS increase by BZL in HepG2 cells and a glutathione peroxidase- and MRP2 driven counteracting mechanism, being Nrf2 a key modulator of this response. Our results could explain hepatic alterations associated with BZL therapy. PMID:27180241

  9. Large scale atmospheric tropical circulation changes and consequences during global warming

    International Nuclear Information System (INIS)

    The changes of the tropical large scale circulation during climate change can have large impacts on human activities. In a first part, the meridional atmospheric tropical circulation was studied in the different coupled models. During climate change, we find, on the one hand, that the Hadley meridional circulation and the subtropical jet are significantly shifted poleward, and on the other hand, that the intensity of the tropical circulation weakens. The slow down of the atmospheric circulation results from the dry static stability changes affecting the tropical troposphere. Secondly, idealized simulations are used to explain the tropical circulation changes. Ensemble simulation using the model LMDZ4 are set up to study the results from the coupled model IPSLCM4. The weakening of the large scale tropical circulation and the poleward shift of the Hadley cells are explained by both the uniform change and the meridional gradient change of the sea surface temperature. Then, we used the atmospheric model LMDZ4 in an aqua-planet configuration. The Hadley circulation changes are explained in a simple framework by the required poleward energy transport. In a last part, we focus on the water vapor distribution and feedback in the climate models. The Hadley circulation changes were shown to have a significant impact on the water vapour feedback during climate change. (author)

  10. Regulated expression of genes inserted at the human chromosomal β-globin locus by homologous recombination

    International Nuclear Information System (INIS)

    The authors have examined the effect of the site of integration on the expression of cloned genes introduced into cultured erythroid cells. Smithies et al. reported the targeted integration of DNA into the human β-globin locus on chromosome 11 in a mouse erythroleukemia-human cell hybrid. These hybrid cells can undergo erythroid differentiation leading to greatly increased mouse and human β-globin synthesis. By transfection of these hybrid cells with a plasmid carrying a modified human β-globin gene and a foreign gene composed of the coding sequence of the bacterial neomycin-resistance gene linked to simian virus 40 transcription signals (SVneo), cells were obtained in which the two genes are integrated at the β-globin locus on human chromosome 11 or at random sites. When they examined the response of the integrated genes to cell differentation, they found that the genes inserted at the β-globin locus were induced during differentiation, whereas randomly positioned copies were not induced. Even the foreign SVneo gene was inducible when it had been integrated at the β-globin locus. The results show that genes introduced at the β-globin locus acquire some of the regulatory properties of globin genes during erythroid differentiation

  11. Cardiovascular studies in the rhesus monkey. [brain circulation during stress

    Science.gov (United States)

    Stone, H. L.; Sandler, H.

    1977-01-01

    Criteria are given for selecting the macaca mulatta as the analogue of the human in the study of cerebral circulation, particularly the control of the cerebral vascular bed during normal and stressful conditions. Topics discussed include surgical preparation of subject; responses to changes in arterial pressure, oxygen, and carbon dioxide; innervation of cerebral vessels; cerebral flow response to acceleration; and cerebral blood flow and cerebellar stimulation.

  12. Replication of parvovirus B19 in hematopoietic progenitor cells generated in vitro from normal human peripheral blood.

    OpenAIRE

    Schwarz, T F; Serke, S; Hottenträger, B; von Brunn, A; Baurmann, H; Kirsch, A.; Stolz, W.; Huhn, D; Deinhardt, F.; Roggendorf, M

    1992-01-01

    Erythroid progenitor cells generated in vitro from peripheral human blood in the presence of interleukin-3 and erythropoietin were infected with human parvovirus B19. B19 virus DNA replication was highest 48 to 72 h after infection, and maximum levels of B19 virus proteins were detected in culture supernatants at 72 to 96 h after infection. B19 virus propagated in vitro was infectious. This cell culture system with peripheral blood cells facilitates studies in vitro of B19 virus replication.

  13. Intestinal circulation during inhalation anesthesia

    International Nuclear Information System (INIS)

    This study was designed to evaluate the influence of inhalational agents on the intestinal circulation in an isolated loop preparation. Sixty dogs were studied, using three intestinal segments from each dog. Selected intestinal segments were pumped with aortic blood at a constant pressure of 100 mmHg. A mixture of 86Rb and 9-microns spheres labeled with 141Ce was injected into the arterial cannula supplying the intestinal loop, while mesenteric venous blood was collected for activity counting. A very strong and significant correlation was found between rubidium clearance and microsphere entrapment (r = 0.97, P less than 0.0001). Nitrous oxide anesthesia was accompanied by a higher vascular resistance (VR), lower flow (F), rubidium clearance (Cl-Rb), and microspheres entrapment (Cl-Sph) than pentobarbital anesthesia, indicating that the vascular bed in the intestinal segment was constricted and flow (total and nutritive) decreased. Halothane, enflurane, and isoflurane anesthesia were accompanied by a much lower arteriovenous oxygen content difference (AVDO2) and oxygen uptake than pentobarbital or nitrous oxide. Compared with pentobarbital, enflurane anesthesia was not accompanied by marked differences in VR, F, Cl-Rb, and Cl-Sph; halothane at 2 MAC decreased VR and increased F and Cl-Rb while isoflurane increased VR and decreased F. alpha-Adrenoceptor blockade with phentolamine (1 mg . kg-1) abolished isoflurane-induced vasoconstriction, suggesting that the increase in VR was mediated via circulating catecholamines

  14. v-erbA overexpression is required to extinguish c-erbA function in erythroid cell differentiation and regulation of the erbA target gene CAII

    DEFF Research Database (Denmark)

    Disela, C; Glineur, C; Bugge, T; Sap, J; Stengl, G; Dodgson, J; Stunnenberg, H; Beug, H; Zenke, M

    1991-01-01

    The v-erbA oncoprotein represents a retrovirus-transduced oncogenic version of the thyroid hormone (T3/T4) receptor c-erbA (type alpha). It contributes to virus-induced erythroleukemia by efficiently arresting differentiation of red cell progenitors and by suppressing transcription of erythrocyte...... transient expression experiments and is a target for efficient down-regulation of CAII transcription by the v-erbA oncoprotein. In stably transformed erythroblasts coexpressing the v-erbA oncoprotein and the c-erbA/T3 receptor at an approximately equimolar ratio, c-erbA activity is dominant over v-erbA. T3...... efficiently induced erythroid differentiation in these cells, thus overcoming the v-erbA-mediated differentiation arrest. Likewise, T3 activated CAII transcription as well as transient expression of a T3-responsive reporter gene containing the CAII-specific erbA-binding site. The c-erbA-dependent activation...

  15. Hemopoietic regeneration in murine spleen following transfusion of normal and irradiated marrow: different response of granulocyte/macrophage and erythroid precursors

    International Nuclear Information System (INIS)

    To investigate cell proliferation in regenerating spleen, bone marrow of normal and gamma-irradiated donor mice (3 weeks after 5 Gy) was transfused into lethally irradiated recipients. In the donors and in the recipient spleens numbers of CFU-S and progenitor cells were determined. In the irradiated donors the progenitors were at control level after 3 weeks of recovery although CFU-S were still at 50% of control. Recipients of the irradiated marrow received therefore an increased proportion of progenitors. CFU-C appeared to be self-renewing and/or increased in number due to enhanced CFU-S differentiation, but not the erythroid progenitors. CFU-S self-renewal was reduced after 5 Gy. The data suggest that cell differentiation and maturation proceed during early splenic regeneration. The quantity of CFU-C does not necessarily mirror the situation in the stem cell compartment. (author)

  16. Growth of erythroid burst-forming units (BFU-E) in cultures of canine bone marrow and peripheral blood cells: effect of serum from irradiated dogs

    International Nuclear Information System (INIS)

    Erythroid burst-forming units (BFU-E) from canine bone marrow and peripheral blood could be grown in methylcellulose in the presence of an appropriate batch of fetal calf serum (FCS), transferrin, and erythropoietin (Epo). However, improved colony formation (size and number of bursts) was obtained when serum from total body irradiated dogs was present in the culture. This serum, obtained from dogs at day 9 after total body irradiation with a dose of 3.9 Gy, reduced markedly the Epo requirement of BFU-E. Furthermore, it allowed the omission of FCS from the culture medium if cholesterol and bovine serum albumin (BSA) were used as FCS substitutes. BFU-E concentrations were found to be rather different in the peripheral blood and in bone marrow samples from different sites (i.e., iliac crest, sternum, and humerus) of normal beagles. The studies further show that canine bone marrow BFU-E can be cryopreserved in liquid nitrogen

  17. Kit transduced signals counteract erythroid maturation by MAPK-dependent modulation of erythropoietin signaling and apoptosis induction in mouse fetal liver.

    Science.gov (United States)

    Haas, N; Riedt, T; Labbaf, Z; Baßler, K; Gergis, D; Fröhlich, H; Gütgemann, I; Janzen, V; Schorle, H

    2015-05-01

    Signaling by the stem cell factor receptor Kit in hematopoietic stem and progenitor cells is functionally associated with the regulation of cellular proliferation, differentiation and survival. Expression of the receptor is downregulated upon terminal differentiation in most lineages, including red blood cell terminal maturation, suggesting that omission of Kit transduced signals is a prerequisite for the differentiation process to occur. However, the molecular mechanisms by which Kit signaling preserves the undifferentiated state of progenitor cells are not yet characterized in detail. In this study, we generated a mouse model for inducible expression of a Kit receptor carrying an activating mutation and studied its effects on fetal liver hematopoiesis. We found that sustained Kit signaling leads to expansion of erythroid precursors and interferes with terminal maturation beyond the erythroblast stage. Primary KIT(D816V) erythroblasts stimulated to differentiate fail to exit cell cycle and show elevated rates of apoptosis because of insufficient induction of survival factors. They further retain expression of progenitor cell associated factors c-Myc, c-Myb and GATA-2 and inefficiently upregulate erythroid transcription factors GATA-1, Klf1 and Tal1. In KIT(D816V) erythroblasts we found constitutive activation of the mitogen-activated protein kinase (MAPK) pathway, elevated expression of the src kinase family member Lyn and impaired Akt activation in response to erythropoietin. We demonstrate that the block in differentiation is partially rescued by MAPK inhibition, and completely rescued by the multikinase inhibitor Dasatinib. These results show that a crosstalk between Kit and erythropoietin receptor signaling cascades exists and that continuous Kit signaling, partly mediated by the MAPK pathway, interferes with this crosstalk. PMID:25323585

  18. Eto2/MTG16 and MTGR1 are heteromeric corepressors of the TAL1/SCL transcription factor in murine erythroid progenitors

    Energy Technology Data Exchange (ETDEWEB)

    Cai, Ying; Xu, Zhixiong; Xie, Jingping [Department of Medicine, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Ham, Amy-Joan L. [Department of Biochemistry, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Koury, Mark J. [Department of Medicine, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Tennessee Valley VA Healthcare System, Nashville, TN 37212 (United States); Hiebert, Scott W. [Department of Biochemistry, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Vanderbilt-Ingram Cancer Center, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Brandt, Stephen J., E-mail: stephen.brandt@vanderbilt.edu [Department of Medicine, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Department of Cell and Developmental Biology, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Department of Cancer Biology, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Vanderbilt-Ingram Cancer Center, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Tennessee Valley VA Healthcare System, Nashville, TN 37212 (United States)

    2009-12-11

    The TAL1 (or SCL) gene, originally discovered through its involvement by a chromosomal translocation in T-cell acute lymphoblastic leukemia, encodes a basic helix-loop-helix (bHLH) transcription factor essential for hematopoietic and vascular development. To identify its interaction partners, we expressed a tandem epitope-tagged protein in murine erythroleukemia (MEL) cells and characterized affinity-purified Tal1-containing complexes by liquid chromatography-tandem mass spectrometry analysis. In addition to known interacting proteins, two proteins related to the Eight-Twenty-One (ETO) corepressor, Eto2/Mtg16 and Mtgr1, were identified from the peptide fragments analyzed. Tal1 interaction with Eto2 and Mtgr1 was verified by coimmunoprecipitation analysis in Tal1, Eto2-, and Mtgr1-transfected COS-7 cells, MEL cells expressing V5 epitope-tagged Tal1 protein, and non-transfected MEL cells. Mapping analysis with Gal4 fusion proteins demonstrated a requirement for the bHLH domain of Tal1 and TAF110 domain of Eto2 for their interaction, and transient transfection and glutathione S-transferase pull-down analysis showed that Mtgr1 and Eto2 enhanced the other's association with Tal1. Enforced expression of Eto2 in differentiating MEL cells inhibited the promoter of the Protein 4.2 (P4.2) gene, a direct target of TAL1 in erythroid progenitors, and transduction of Eto2 and Mtgr1 augmented Tal1-mediated gene repression. Finally, chromatin immunoprecipitation analysis revealed that Eto2 occupancy of the P4.2 promoter in MEL cells decreased with differentiation, in parallel with a decline in Eto2 protein abundance. These results identify Eto2 and Mtgr1 as authentic interaction partners of Tal1 and suggest they act as heteromeric corepressors of this bHLH transcription factor during erythroid differentiation.

  19. Eto2/MTG16 and MTGR1 are heteromeric corepressors of the TAL1/SCL transcription factor in murine erythroid progenitors

    International Nuclear Information System (INIS)

    The TAL1 (or SCL) gene, originally discovered through its involvement by a chromosomal translocation in T-cell acute lymphoblastic leukemia, encodes a basic helix-loop-helix (bHLH) transcription factor essential for hematopoietic and vascular development. To identify its interaction partners, we expressed a tandem epitope-tagged protein in murine erythroleukemia (MEL) cells and characterized affinity-purified Tal1-containing complexes by liquid chromatography-tandem mass spectrometry analysis. In addition to known interacting proteins, two proteins related to the Eight-Twenty-One (ETO) corepressor, Eto2/Mtg16 and Mtgr1, were identified from the peptide fragments analyzed. Tal1 interaction with Eto2 and Mtgr1 was verified by coimmunoprecipitation analysis in Tal1, Eto2-, and Mtgr1-transfected COS-7 cells, MEL cells expressing V5 epitope-tagged Tal1 protein, and non-transfected MEL cells. Mapping analysis with Gal4 fusion proteins demonstrated a requirement for the bHLH domain of Tal1 and TAF110 domain of Eto2 for their interaction, and transient transfection and glutathione S-transferase pull-down analysis showed that Mtgr1 and Eto2 enhanced the other's association with Tal1. Enforced expression of Eto2 in differentiating MEL cells inhibited the promoter of the Protein 4.2 (P4.2) gene, a direct target of TAL1 in erythroid progenitors, and transduction of Eto2 and Mtgr1 augmented Tal1-mediated gene repression. Finally, chromatin immunoprecipitation analysis revealed that Eto2 occupancy of the P4.2 promoter in MEL cells decreased with differentiation, in parallel with a decline in Eto2 protein abundance. These results identify Eto2 and Mtgr1 as authentic interaction partners of Tal1 and suggest they act as heteromeric corepressors of this bHLH transcription factor during erythroid differentiation.

  20. Disruption of nuclear factor (erythroid-derived-2)-like 2 antioxidant signaling: a mechanism for impaired activation of stem cells and delayed regeneration of skeletal muscle.

    Science.gov (United States)

    Shelar, Sandeep Balu; Narasimhan, Madhusudhanan; Shanmugam, Gobinath; Litovsky, Silvio Hector; Gounder, Sellamuthu S; Karan, Goutam; Arulvasu, Cinnasamy; Kensler, Thomas W; Hoidal, John R; Darley-Usmar, Victor M; Rajasekaran, Namakkal S

    2016-05-01

    Recently we have reported that age-dependent decline in antioxidant levels accelerated apoptosis and skeletal muscle degeneration. Here, we demonstrate genetic ablation of the master cytoprotective transcription factor, nuclear factor (erythroid-derived-2)-like 2 (Nrf2), aggravates cardiotoxin (CTX)-induced tibialis anterior (TA) muscle damage. Disruption of Nrf2 signaling sustained the CTX-induced burden of reactive oxygen species together with compromised expression of antioxidant genes and proteins. Transcript/protein expression of phenotypic markers of muscle differentiation, namely paired box 7 (satellite cell) and early myogenic differentiation and terminal differentiation (myogenin and myosin heavy chain 2) were increased on d 2 and 4 postinjury but later returned to baseline levels on d 8 and 15 in wild-type (WT) mice. In contrast, these responses were persistently augmented in Nrf2-null mice suggesting that regulation of the regeneration-related signaling mechanisms require Nrf2 for normal functioning. Furthermore, Nrf2-null mice displayed slower regeneration marked by dysregulation of embryonic myosin heavy chain temporal expression. Histologic observations illustrated that Nrf2-null mice displayed smaller, immature TA muscle fibers compared with WT counterparts on d 15 after CTX injury. Improvement in TA muscle morphology and gain in muscle mass evident in the WT mice was not noticeable in the Nrf2-null animals. Taken together these data show that the satellite cell activation, proliferation, and differentiation requires a functional Nrf2 system for effective healing following injury.-Shelar, S. B., Narasimhan, M., Shanmugam, G., Litovsky, S. H., Gounder, S. S., Karan, G., Arulvasu, C., Kensler, T. W., Hoidal, J. R., Darley-Usmar, V. M., Rajasekaran, N. S. Disruption of nuclear factor (erythroid-derived-2)-like 2 antioxidant signaling: a mechanism for impaired activation of stem cells and delayed regeneration of skeletal muscle. PMID:26839378

  1. Erythroid progenitor cells (CFU-E*) from Friend virus-infected mice undergo 55Fe suicide in vitro in the absence of added erythropoietin

    International Nuclear Information System (INIS)

    The authors have investigated the effect of 55Fe on the survival in suspension of erythropoietin (epo)-independent erythroid progenitor cells (CFU-E*) induced by Friend polycythemia virus (FV). Spleen cells from C3Hf/Bi mice previously infected with FV were exposed to carrier-free 55Fe, and the survival of CFU-E* as a function of time in liquid medium was determined from the number of erythroid colonies that developed from these cells seeded in plasma cultures without added epo. The results showed that spleen CFU-E* were highly vulnerable to 55Fe. Marrow CFU-E* behaved in a similar manner. The 55Fe responsible for their suicide had been presented to the progenitor cells only during the 4-h period of incubation, after which they were washed and plated in excess nonradioactive iron. They therefore conclude that CFU-E* themselves, and not only their progeny, are capable of actively incorporating iron. Under the same conditions in the absence of added epo, the effect of 55Fe on the survival of normal spleen or marrow CFU-E could not be assessed because two few normal CFU-E survived the incubation period. Normal bone marrow cells incubated in complete medium containing epo retained their capacity for erythrocytic colony formation, and CFU-E could then be shown to be vulnerable to 55Fe. Thus, either the iron-incorporating system of normal CFU-E was inducible by epo, or else epo permitted survival of the CFU-E so that the activity of a constitutive iron-incorporating system could be recognized

  2. Downregulation of the Spi-1/PU.1 oncogene induces the expression of TRIM10/HERF1, a key factor required for terminal erythroid cell differentiation and survival

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    Sustained expression of the Spi-1/PU.1 and Fli-1 oncoproteins blocks globin gene activation in mouse erythroleukemia cells; however, only Spi-1/PU.1 expression inhibits the inclusion of exon 16 in the mature 4.1R mRNA. This splicing event is crucial for a functional 4.1R protein and, therefore, for red blood cell membrane integrity. This report demonstrates that Spi-I/PU.1 downregulation induces the activation of TRiMl0/hematopoietic RING finger 1 (HERFI), a member of the tripartite motif (TRIM)/RBCC protein family needed for globin gene transcription. Additionally, we demonstrate that TRIM10/HERFI is required for the regulated splicing of exon 16 during late erythroid differentiation. Using inducible overexpression and silencing approaches, we found that: (1) TRIM10/HERF1 knockdown inhibits hemoglobin production and exon splicing and triggers cell apoptosis in dimethylsulfoxide (DMSO)-induced cells; (2) TRIMI0/HERF1 upregulation is required but is insufficient on its own to activate exon retention; (3) Fli-1 has no effect on TRIMI0/HERFI expression, whereas either DMSO-induced downregulation or shRNA-knockdown of Spi-1/PU.1 expression is sufficient to activate TRIM10/HERFI expression; and (4) Spi-1/PU.1 knockdown triggers both the transcription and the splicing events independently of the chemical induction. Altogether, these data indicate that primary Spi-1/PU.1 downregulation acts on late erythroid differentiation through at least two pathways, one of which requires TRIM10/HERF1 upregulation and parallels the Spi-1/PU.1-induced Fli-1 shutoff regulatory cascade.

  3. Semiquantitative determination of circulating islet cell surface antibodies in diabetes

    International Nuclear Information System (INIS)

    Circulating pancreatic islet cell antibodies have been demonstrated in patients with insulin-dependent diabetes (IDD). The islet cell surface antibodies (ICSA) were determined by an indirect immunofluorescence test using a suspension of viable islet cells, and similar cytoplasmic antibodies which require the use of group O human pancreas were also found in the serum of some patients. A strong association exists between the presence of islet cell antibodies and the onset of insulin-dependent diabetes. The quantitative determination of circulating ICSA using 125I-protein A, which binds to IgG attached to the islet cell surface, was essentially as described by Lernmark et al. In the present study, we determined the circulating ICSA in diabetes, especially in IDD. The ICSA were estimated in various sera from both indirect immunofluorescence and 125I-protein A. Controls bound 125I-protein A. Sera from 4 IDD patients with circulating ICSA demonstrated by immunofluorescence showed >3,000 cpm 125I-protein A binding activity, and that from 5 patients without ICSA bound <2,000 cpm. Sera from newly-diagnosed diabetics who had severe hyperglycemia showed <2,000 cpm, with or without ICSA. (author)

  4. Circulation of Venus upper mesosphere.

    Science.gov (United States)

    Zasova, Ludmila; Gorinov, Dmitry; Shakun, Alexey; Altieri, Francesca; Migliorini, Alessandra; Piccioni, Giuseppe; Drossart, Pierre

    2014-05-01

    Observation of the O2 1.27 μm airglow intensity distribution on the night side of Venus is one of the methods of study of the circulation in upper mesosphere 90-100 km. VIRTIS-M on board Venus Express made these observations in nadir and limb modes in Southern and Northern hemispheres respectively. Global map of the O2 night glow is published (Piccioni et al. 2009). In this work we use for analysis only data, obtained with exposure > 3 s to avoid high noisy data. It was found that intensity of emission decreases to poles and to terminators (similar to Piccioni et al.2009) in both hemispheres, which gives evidence for existence of SS-AS circulation with transport of the air masses through poles and terminators with ascending/descending flows at SS/AS areas. However, asymmetry of distribution of intensity of airglow is observed in both hemispheres. Global map for southern hemisphere (from nadir data) has good statistics at φ > 10-20° S and pretty poor at low latitude. Maximum emission is shifted from midnight by 1 - 2 hours to the evening (22-23h) and deep minimum of emission is found at LT=2-4 h at φ > 20° S. This asymmetry is extended up to equatorial region, however statistic is poor there. No evident indication for existence of the Retrograde Zonal Superrotation (RZS) is found: maximum emission in this case, which is resulting from downwards flow, should be shifted to the morning. The thermal tides, gravity waves are evidently influence on the night airglow distribution. VIRTIS limb observations cover the low northern latitudes and they are more sparse at higher latitudes. Intensity of airglow at φ = 0 - 20° N shows wide maximum, which is shifted by 1- 2 h from midnight to morning terminator. This obviously indicates that observed O2 night glow distribution in low North latitudes is explained by a superposition of SS-AS flow and RZS circulation at 95-100 km. This behavior is similar to the NO intensity distribution, obtained by SPICAV.

  5. The discovery of pulmonary circulation: From Imhotep to William Harvey

    OpenAIRE

    Elmaghawry, Mohamed; Zanatta, Alberto; Zampieri, Fabio

    2014-01-01

    In his quest to comprehend his existence, Man has long been exploring his outer world (macro-cosmos), as well as his inner world (micro-cosmos). In modern times, monmental advances in the fields of physics, chemistry, and other natural sciences have reflected on how we understand the anatomy and physiology of the human body and circulation. Yet, humanity took a long and winding road to reach what we acknowledge today as solid facts of cardiovascular physiology. In this article, we will review...

  6. A reliable method to concentrate circulating DNA.

    Science.gov (United States)

    Bryzgunova, Olga; Bondar, Anna; Morozkin, Evgeniy; Mileyko, Vladislav; Vlassov, Valentin; Laktionov, Pavel

    2011-01-15

    Concentration of circulating DNA probes is required to increase the amount of DNA involved in subsequent study (by polymerase chain reaction, sequencing, and microarray). This work was dedicated to the comparison of five different methods used for concentration of DNA circulating in blood. Precipitation of circulating DNA with acetone in the presence of triethylamine provides minimal DNA loss, high reproducibility, and at least three times higher DNA yield in comparison with the standard ethanol protocol. PMID:20828533

  7. Space-Time Radar Waveforms: Circulating Codes

    OpenAIRE

    Babur, G.; Aubry, P.; Le Chevalier, F.

    2013-01-01

    This paper describes a concept of the circulating codes covering the whole class of the space-time codes. The circulating codes do not narrow the radiated pattern of the antenna array, thus providing a wide angular coverage, possibly tunable. In turn, the beam-forming on transmit is achievable by means of the signal processing in one (or each) receiver channel. The modelling results demonstrate the efficiency of the circulating codes based on their multidimensional ambiguity functions.

  8. Linear thermal circulator based on Coriolis forces.

    Science.gov (United States)

    Li, Huanan; Kottos, Tsampikos

    2015-02-01

    We show that the presence of a Coriolis force in a rotating linear lattice imposes a nonreciprocal propagation of the phononic heat carriers. Using this effect we propose the concept of Coriolis linear thermal circulator which can control the circulation of a heat current. A simple model of three coupled harmonic masses on a rotating platform permits us to demonstrate giant circulating rectification effects for moderate values of the angular velocities of the platform. PMID:25768443

  9. The Ten Relationships in Rural Land Circulation

    OpenAIRE

    Cai, Zhirong; Ren, Shuo; Zhang, Zhigang

    2009-01-01

    The ten relationships during land circulation are discussed. Among them, the relationship between peasant household and government indicates that government should only carry out its service and regulatory functions and farmers should be the main body of land circulation, because peasants usually have no discourse power during land circulation. In the relationship between land ownership and contracting management right, we mainly discuss the transfer of land contracting management right and p...

  10. Circulatory shear flow alters the viability and proliferation of circulating colon cancer cells

    Science.gov (United States)

    Fan, Rong; Emery, Travis; Zhang, Yongguo; Xia, Yuxuan; Sun, Jun; Wan, Jiandi

    2016-06-01

    During cancer metastasis, circulating tumor cells constantly experience hemodynamic shear stress in the circulation. Cellular responses to shear stress including cell viability and proliferation thus play critical roles in cancer metastasis. Here, we developed a microfluidic approach to establish a circulatory microenvironment and studied circulating human colon cancer HCT116 cells in response to a variety of magnitude of shear stress and circulating time. Our results showed that cell viability decreased with the increase of circulating time, but increased with the magnitude of wall shear stress. Proliferation of cells survived from circulation could be maintained when physiologically relevant wall shear stresses were applied. High wall shear stress (60.5 dyne/cm2), however, led to decreased cell proliferation at long circulating time (1 h). We further showed that the expression levels of β-catenin and c-myc, proliferation regulators, were significantly enhanced by increasing wall shear stress. The presented study provides a new insight to the roles of circulatory shear stress in cellular responses of circulating tumor cells in a physiologically relevant model, and thus will be of interest for the study of cancer cell mechanosensing and cancer metastasis.

  11. Circulatory shear flow alters the viability and proliferation of circulating colon cancer cells

    Science.gov (United States)

    Fan, Rong; Emery, Travis; Zhang, Yongguo; Xia, Yuxuan; Sun, Jun; Wan, Jiandi

    2016-01-01

    During cancer metastasis, circulating tumor cells constantly experience hemodynamic shear stress in the circulation. Cellular responses to shear stress including cell viability and proliferation thus play critical roles in cancer metastasis. Here, we developed a microfluidic approach to establish a circulatory microenvironment and studied circulating human colon cancer HCT116 cells in response to a variety of magnitude of shear stress and circulating time. Our results showed that cell viability decreased with the increase of circulating time, but increased with the magnitude of wall shear stress. Proliferation of cells survived from circulation could be maintained when physiologically relevant wall shear stresses were applied. High wall shear stress (60.5 dyne/cm2), however, led to decreased cell proliferation at long circulating time (1 h). We further showed that the expression levels of β-catenin and c-myc, proliferation regulators, were significantly enhanced by increasing wall shear stress. The presented study provides a new insight to the roles of circulatory shear stress in cellular responses of circulating tumor cells in a physiologically relevant model, and thus will be of interest for the study of cancer cell mechanosensing and cancer metastasis. PMID:27255403

  12. Role of Circulating Fibrocytes in Cardiac Fibrosis

    Science.gov (United States)

    Lin, Rong-Jie; Su, Zi-Zhuo; Liang, Shu-Min; Chen, Yu-Yang; Shu, Xiao-Rong; Nie, Ru-Qiong; Wang, Jing-Feng; Xie, Shuang-Lun

    2016-01-01

    Objective: It is revealed that circulating fibrocytes are elevated in patients/animals with cardiac fibrosis, and this review aims to provide an introduction to circulating fibrocytes and their role in cardiac fibrosis. Data Sources: This review is based on the data from 1994 to present obtained from PubMed. The search terms were “circulating fibrocytes” and “cardiac fibrosis”. Study Selection: Articles and critical reviews, which are related to circulating fibrocytes and cardiac fibrosis, were selected. Results: Circulating fibrocytes, which are derived from hematopoietic stem cells, represent a subset of peripheral blood mononuclear cells exhibiting mixed morphological and molecular characteristics of hematopoietic and mesenchymal cells (CD34+/CD45+/collagen I+). They can produce extracellular matrix and many cytokines. It is shown that circulating fibrocytes participate in many fibrotic diseases, including cardiac fibrosis. Evidence accumulated in recent years shows that aging individuals and patients with hypertension, heart failure, coronary heart disease, and atrial fibrillation have more circulating fibrocytes in peripheral blood and/or heart tissue, and this elevation of circulating fibrocytes is correlated with the degree of fibrosis in the hearts. Conclusions: Circulating fibrocytes are effector cells in cardiac fibrosis. PMID:26831236

  13. Improvement of Classification of Enterprise Circulating Funds

    Directory of Open Access Journals (Sweden)

    Rohanova Hanna O.

    2014-02-01

    Full Text Available The goal of the article lies in revelation of possibilities of increase of efficiency of managing enterprise circulating funds by means of improvement of their classification features. Having analysed approaches of many economists to classification of enterprise circulating funds, systemised and supplementing them, the article offers grouping classification features of enterprise circulating funds. In the result of the study the article offers an expanded classification of circulating funds, which clearly shows the role of circulating funds in managing enterprise finance and economy in general. The article supplements and groups classification features of enterprise circulating funds by: the organisation level, functioning character, sources of formation and their cost, and level of management efficiency. The article shows that the provided grouping of classification features of circulating funds allows exerting all-sided and purposeful influence upon indicators of efficiency of circulating funds functioning and facilitates their rational management in general. The prospect of further studies in this direction is identification of the level of attraction of loan resources by production enterprises for financing circulating funds.

  14. Irregular Labellings of Circulant Graphs

    OpenAIRE

    Anholcer, Marcin

    2011-01-01

    We investigate the \\textit{irregularity strength} ($s(G)$) and \\textit{total vertex irregularity strength} ($tvs(G)$) of circulant graphs $Ci_n(1,2,...,k)$ and prove that $tvs(Ci_n(1,2,...,k))=\\lceil\\frac{n+2k}{2k+1}\\rceil$, while $s(Ci_n(1,2,...,k))=\\lceil\\frac{n+2k-1}{2k}\\rceil$ except the case when $(n \\bmod 4k = 2k+1 \\wedge k\\bmod 2=1) \\vee n=2k+1$ and $s(Ci_n(1,2,...,k))=\\lceil\\frac{n+2k-1}{2k}\\rceil+1$.

  15. Inflammatory response and extracorporeal circulation.

    Science.gov (United States)

    Kraft, Florian; Schmidt, Christoph; Van Aken, Hugo; Zarbock, Alexander

    2015-06-01

    Patients undergoing cardiac surgery with extracorporeal circulation (EC) frequently develop a systemic inflammatory response syndrome. Surgical trauma, ischaemia-reperfusion injury, endotoxaemia and blood contact to nonendothelial circuit compounds promote the activation of coagulation pathways, complement factors and a cellular immune response. This review discusses the multiple pathways leading to endothelial cell activation, neutrophil recruitment and production of reactive oxygen species and nitric oxide. All these factors may induce cellular damage and subsequent organ injury. Multiple organ dysfunction after cardiac surgery with EC is associated with an increased morbidity and mortality. In addition to the pathogenesis of organ dysfunction after EC, this review deals with different therapeutic interventions aiming to alleviate the inflammatory response and consequently multiple organ dysfunction after cardiac surgery. PMID:26060024

  16. The aerodynamics of circulation control

    Science.gov (United States)

    Wood, N. J.

    1981-01-01

    Two dimensional subsonic wind tunnel tests were conducted on a 20% thickness: chord ratio circulation controlled elliptic aerofoil section equipped with forward and reverse blowing slots. Overall performance measurements were made over a range of trailing edge blowing momentum coefficients from 0 to 0.04; some included the effect of leading edge blowing. A detailed investigation of the trailing edge wall jet, using split film probes, hot wire probes and total head tubes, provided measurements of mean velocity components, Reynolds normal and shear stresses, and radial static pressure. The closure of the two dimensional angular momentum and continuity equations was examined using the measured data, with and without correction, and the difficulty of obtaining a satisfactory solution illustrated. Suggestions regarding the nature of the flow field which should aid the understanding of Coanda effect and the theoretical solution of highly curved wall jet flows are presented.

  17. Genome-wide circulating microRNA expression profiling indicates biomarkers for epilepsy

    OpenAIRE

    Wang, Jun; Yu, Jin-Tai; Tan, Lin; Tian, Yan; Ma, Jing; Tan, Chen-Chen; Wang, Hui-Fu; Liu, Ying; Tan, Meng-Shan; Jiang, Teng; Tan, Lan

    2015-01-01

    MicroRNAs (miRNAs) have been proposed as biomarkers for cancer and other diseases due to their stability in serum. In epilepsy, miRNAs have almost been studied in brain tissues and in animals' circulation, but not in circulation of human. To date, a major challenge is to develop biomarkers to improve the current diagnosis of epilepsy. The aim of this study was to evaluate whether circulating miRNAs can be used as biomarkers for epilepsy. We measured the differences in serum miRNA levels betwe...

  18. Construction of a Sequencing Library from Circulating Cell-Free DNA.

    Science.gov (United States)

    Fang, Nan; Löffert, Dirk; Akinci-Tolun, Rumeysa; Heitz, Katja; Wolf, Alexander

    2016-01-01

    Circulating DNA is cell-free DNA (cfDNA) in serum or plasma that can be used for non-invasive prenatal testing, as well as cancer diagnosis, prognosis, and stratification. High-throughput sequence analysis of the cfDNA with next-generation sequencing technologies has proven to be a highly sensitive and specific method in detecting and characterizing mutations in cancer and other diseases, as well as aneuploidy during pregnancy. This unit describes detailed procedures to extract circulating cfDNA from human serum and plasma and generate sequencing libraries from a wide concentration range of circulating DNA. © 2016 by John Wiley & Sons, Inc. PMID:27038390

  19. Human parvovirus B19 infection in a renal transplant recipient: a case report

    OpenAIRE

    Alves Michelle Teodoro; Vilaça Sandra Simone; Carvalho Maria das Graças; Fernandes Ana Paula; Dusse Luci Maria Sant’ Ana; Gomes Karina Braga

    2013-01-01

    Abstract Background Parvovirus B19 presents tropism for human erythroid progenitor cells, causing chronic anemia in organ transplant recipients, due to their suppressed humoral and cellular responses. Diagnosis may be achieved through serological tests for detection of anti-B19 antibodies. However, renal transplant recipients are not routinely tested for parvovirus B19 infection, since there is scanty data or consensus on screening for B19 infection, as well as for treatment or preventive man...

  20. High Circulating Frequencies of Tumor Necrosis Factor Alpha- and Interleukin-2-Secreting Human T-Lymphotropic Virus Type 1 (HTLV-1)-Specific CD4+ T Cells in Patients with HTLV-1-Associated Neurological Disease

    OpenAIRE

    Goon, Peter K. C.; Igakura, Tadahiko; Hanon, Emmanuel; Angelina J Mosley; Asquith, Becca; Gould, Keith G.; Taylor, Graham P.; Weber, Jonathan N.; Bangham, Charles R M

    2003-01-01

    Significantly higher frequencies of tumor necrosis factor alpha- and interleukin-2-secreting human T-lymphotropic virus type 1 (HTLV-1)-specific CD4+ T cells were present in the peripheral blood mononuclear cells of HTLV-1-associated myelopathy/tropical spastic paraparesis (HAM/TSP) patients than in those of asymptomatic carriers with similar provirus loads. The data suggest that HTLV-1-specific CD4+ T cells play a role in the pathogenesis of HAM/TSP.

  1. Effects of Elevated Circulating Cortisol Concentrations on Maternal Behavior in Common Marmoset Monkeys (Callithrix jacchus)

    OpenAIRE

    Saltzman, Wendy; Abbott, David H.

    2009-01-01

    Both acute and chronic stress can impair maternal behavior and increase rates of infant abuse in several species. The mechanisms inducing these effects are unknown, but experimental manipulation of circulating corticosterone levels alters maternal behavior in rats, and circulating or excreted cortisol concentrations have been found to correlate either positively or negatively with maternal behavior in humans and nonhuman primates. In this study, therefore, we experimentally tested the hypothe...

  2. Circulating Irisin Levels Are Positively Associated with Metabolic Risk Factors in Sedentary Subjects

    OpenAIRE

    Moreno, María; Moreno-Navarrete, José María; Serrano, Marta; Ortega, Francisco; Delgado, Elías; Sanchez-Ragnarsson, Cecilia; Valdés, Sergio; Botas, Patricia; Ricart, Wifredo; Fernández-Real, José Manuel

    2015-01-01

    Introduction A physically active life-style plays an independent role in the protection against type 2 diabetes and cardiovascular diseases. Irisin, a novel exercise-induced myokine, activates thermogenesis in rodents through increasing beige fat cells abundance within white fat. We aimed to investigate circulating irisin levels in association with the degree of physical activity and various metabolic parameters in humans. Methods Circulating irisin levels (ELISA) and metabolic parameters wer...

  3. Endogenous circulating sympatholytic factor in orthostatic intolerance

    Science.gov (United States)

    Shapiro, R. E.; Winters, B.; Hales, M.; Barnett, T.; Schwinn, D. A.; Flavahan, N.; Berkowitz, D. E.

    2000-01-01

    Sympathotonic orthostatic hypotension (SOH) is an idiopathic syndrome characterized by tachycardia, hypotension, elevated plasma norepinephrine, and symptoms of orthostatic intolerance provoked by assumption of an upright posture. We studied a woman with severe progressive SOH with blood pressure unresponsive to the pressor effects of alpha(1)-adrenergic receptor (AR) agonists. We tested the hypothesis that a circulating factor in this patient interferes with vascular adrenergic neurotransmission. Preincubation of porcine pulmonary artery vessel rings with patient plasma produced a dose-dependent inhibition of vasoconstriction to phenylephrine in vitro, abolished vasoconstriction to direct electrical stimulation, and had no effect on nonadrenergic vasoconstrictive stimuli (endothelin-1), PGF-2alpha (or KCl). Preincubation of vessels with control plasma was devoid of these effects. SOH plasma inhibited the binding of an alpha(1)-selective antagonist radioligand ([(125)I]HEAT) to membrane fractions derived from porcine pulmonary artery vessel rings, rat liver, and cell lines selectively overexpressing human ARs of the alpha(1B) subtype but not other AR subtypes (alpha(1A) and alpha(1D)). We conclude that a factor in SOH plasma can selectively and irreversibly inhibit adrenergic ligand binding to alpha(1B) ARs. We propose that this factor contributes to a novel pathogenesis for SOH in this patient. This patient's syndrome represents a new disease entity, and her plasma may provide a unique tool for probing the selective functions of alpha(1)-ARs.

  4. Unit group of algebra of circulant matrices

    Directory of Open Access Journals (Sweden)

    Rajendra Sharma

    2013-12-01

    Full Text Available Let Crn(Fp denote the algebra of nXn circulant matrices over Fp, finite field of order p of prime characteristic p. The order of the unit groups U(Cr3(Fp, U(Cr4(Fp and U(Cr5(Fp of algebras of circulant matrices over Fp are characterized.

  5. Introduction to instabilities in natural circulation systems

    International Nuclear Information System (INIS)

    This lecture reviews the various natural circulation instabilities and their classification instabilities observed during various stages of natural circulation such as single-phase, boiling inception and fully developed two-phase flow are described. The mechanisms causing the instabilities are also briefly described. (author)

  6. Kelvin's Canonical Circulation Theorem in Hall Magnetohydrodynamics

    CERN Document Server

    Shivamoggi, B K

    2016-01-01

    The purpose of this paper is to show that, thanks to the restoration of the legitimate connection between the current density and the plasma flow velocity in Hall magnetohydrodynamics (MHD), Kelvin's Circulation Theorem becomes valid in Hall MHD. The ion-flow velocity in the usual circulation integral is now replaced by the canonical ion-flow velocity.

  7. Numerical Modeling of Ocean Circulation

    Science.gov (United States)

    Miller, Robert N.

    2007-01-01

    The modelling of ocean circulation is important not only for its own sake, but also in terms of the prediction of weather patterns and the effects of climate change. This book introduces the basic computational techniques necessary for all models of the ocean and atmosphere, and the conditions they must satisfy. It describes the workings of ocean models, the problems that must be solved in their construction, and how to evaluate computational results. Major emphasis is placed on examining ocean models critically, and determining what they do well and what they do poorly. Numerical analysis is introduced as needed, and exercises are included to illustrate major points. Developed from notes for a course taught in physical oceanography at the College of Oceanic and Atmospheric Sciences at Oregon State University, this book is ideal for graduate students of oceanography, geophysics, climatology and atmospheric science, and researchers in oceanography and atmospheric science. Features examples and critical examination of ocean modelling and results Demonstrates the strengths and weaknesses of different approaches Includes exercises to illustrate major points and supplement mathematical and physical details

  8. Circulating Hematopoietic Stem and Progenitor Cells in Aging Atomic Bomb Survivors.

    Science.gov (United States)

    Kyoizumi, Seishi; Kubo, Yoshiko; Misumi, Munechika; Kajimura, Junko; Yoshida, Kengo; Hayashi, Tomonori; Imai, Kazue; Ohishi, Waka; Nakachi, Kei; Young, Lauren F; Shieh, Jae-Hung; Moore, Malcolm A; van den Brink, Marcel R M; Kusunoki, Yoichiro

    2016-01-01

    It is not yet known whether hematopoietic stem and progenitor cells (HSPCs) are compromised in the aging population of atomic bomb (A-bomb) survivors after their exposure nearly 70 years ago. To address this, we evaluated age- and radiation-related changes in different subtypes of circulating HSPCs among the CD34-positive/lineage marker-negative (CD34(+)Lin(-)) cell population in 231 Hiroshima A-bomb survivors. We enumerated functional HSPC subtypes, including: cobblestone area-forming cells; long-term culture-initiating cells; erythroid burst-forming units; granulocyte and macrophage colony-forming units; and T-cell and natural killer cell progenitors using cell culture. We obtained the count of each HSPC subtype per unit volume of blood and the proportion of each HSPC subtype in CD34(+)Lin(-) cells to represent the lineage commitment trend. Multivariate analyses, using sex, age and radiation dose as variables, showed significantly decreased counts with age in the total CD34(+)Lin(-) cell population and all HSPC subtypes. As for the proportion, only T-cell progenitors decreased significantly with age, suggesting that the commitment to the T-cell lineage in HSPCs continuously declines with age throughout the lifetime. However, neither the CD34(+)Lin(-) cell population, nor HSPC subtypes showed significant radiation-induced dose-dependent changes in counts or proportions. Moreover, the correlations of the proportions among HSPC subtypes in the survivors properly revealed the hierarchy of lineage commitments. Taken together, our findings suggest that many years after exposure to radiation and with advancing age, the number and function of HSPCs in living survivors as a whole may have recovered to normal levels. PMID:26720799

  9. Interannual variability of the Adriatic Sea circulation

    Science.gov (United States)

    Beg Paklar, Gordana; Sepic, Jadranka; Grbec, Branka; Dzoic, Tomislav; Kovac, Zarko; Ivatek-Sahdan, Stjepan

    2016-04-01

    The Regional Ocean Modeling System (ROMS) was implemented in order to reproduce interannual variability of the Adriatic Sea circulation. Simulations and model result analysis were performed for a three-year period from 1st January 2011 to 31st December 2013. ROMS model run was forced with realistic atmospheric fields obtained from meteorological model Aladin, climatological river discharges, tides and Mediterranean circulation imposed at the southern open boundary. Atmospheric forcing included momentum, heat and water fluxes calculated interactively from the Aladin surface fields during ROMS model simulations. Model results were compared with available CTD and ADCP measurements and discussed in the light of the climatological circulation and thermohaline properties of the Adriatic Sea and its coastal areas. Interannual variability in the Adriatic circulation is related to the prevailing atmospheric conditions, changes in the hydrological conditions and water mass exchange at the Otranto Strait. Basic features of the Adriatic circulation - basin-wide cyclonic circulation with several embedded smaller cyclonic gyres around main pits - are well reproduced by ROMS model. Modelled temperatures and salinities are within corresponding seasonal intervals, although measured profiles generally indicate stronger stratification than modelled ones. Summer circulation in 2011 with current reversal obtained along the eastern Adriatic coast was related to the sampling results of the early fish stages as well as to ARGO drifter movements. Simulated fields from the Adriatic scale model were used to prescribe the initial and open boundary conditions for the interannual simulation in the middle Adriatic coastal domain.

  10. Circulating Zinc-α2-glycoprotein levels and Insulin Resistance in Polycystic Ovary Syndrome.

    Science.gov (United States)

    Lai, Yerui; Chen, Jinhua; Li, Ling; Yin, Jingxia; He, Junying; Yang, Mengliu; Jia, Yanjun; Liu, Dongfang; Liu, Hua; Liao, Yong; Yang, Gangyi

    2016-01-01

    The aim of study was to assess the relationship between zinc-α2-glycoprotein (ZAG) and androgen excess with insulin resistance in polycystic ovary syndrome (PCOS) women. 99 PCOS women and 100 healthy controls were recruited. Euglycemic-hyperinsulinemic clamp (EHC) was preformed to assess their insulin sensitivity. Circulating ZAG was determined with an ELISA kit. In healthy subjects, circulating ZAG levels exhibited a characteristic diurnal rhythm in humans, with a major nocturnal rise occurring between midnight and early morning. Circulating ZAG and M-value were much lower in PCOS women than in the controls. In all population, overweight/obese subjects had significantly lower circulating ZAG levels than lean individuals. Multiple linear regression analysis revealed that only M-value and the area under the curve for glucose were independently related factors to circulating ZAG in PCOS women. Multivariate logistic regression analysis showed that circulating ZAG was significantly associated with PCOS even after controlling for anthropometric variables, blood pressure, lipid profile and hormone levels. The PCOS women with high ZAG had fewer MetS, IGT and polycystic ovaries as compared with the low ZAG PCOS women. Taken together, circulating ZAG levels are reduced in women with PCOS and ZAG may be a cytokine associated with insulin resistance in PCOS women. PMID:27180914

  11. Circulating Zinc-α2-glycoprotein levels and Insulin Resistance in Polycystic Ovary Syndrome

    Science.gov (United States)

    Lai, Yerui; Chen, Jinhua; Li, Ling; Yin, Jingxia; He, Junying; Yang, Mengliu; Jia, Yanjun; Liu, Dongfang; Liu, Hua; Liao, Yong; Yang, Gangyi

    2016-01-01

    The aim of study was to assess the relationship between zinc-α2-glycoprotein (ZAG) and androgen excess with insulin resistance in polycystic ovary syndrome (PCOS) women. 99 PCOS women and 100 healthy controls were recruited. Euglycemic-hyperinsulinemic clamp (EHC) was preformed to assess their insulin sensitivity. Circulating ZAG was determined with an ELISA kit. In healthy subjects, circulating ZAG levels exhibited a characteristic diurnal rhythm in humans, with a major nocturnal rise occurring between midnight and early morning. Circulating ZAG and M-value were much lower in PCOS women than in the controls. In all population, overweight/obese subjects had significantly lower circulating ZAG levels than lean individuals. Multiple linear regression analysis revealed that only M-value and the area under the curve for glucose were independently related factors to circulating ZAG in PCOS women. Multivariate logistic regression analysis showed that circulating ZAG was significantly associated with PCOS even after controlling for anthropometric variables, blood pressure, lipid profile and hormone levels. The PCOS women with high ZAG had fewer MetS, IGT and polycystic ovaries as compared with the low ZAG PCOS women. Taken together, circulating ZAG levels are reduced in women with PCOS and ZAG may be a cytokine associated with insulin resistance in PCOS women. PMID:27180914

  12. Development of CO2 circulators

    International Nuclear Information System (INIS)

    The development of the basic machine types we have supplied has not been without problems. The Windscale AGR (the prototype AGR) was a small 1.2 MW vertically up circulator with an inlet temperature of 237 deg. C (459 deg. F). Oil leakage problems occurred and were cured in the works test facility and the machine went into service with no other problems. The Horizontal 5 MW machines for Hinkley/Hunterston were not so fortunate with vibration problems, interface corrosion problems (effecting the whole reactor) and material dimensional stability problems. Oil ingress problems did not show up in test work but were later reported from site. These reports were initially exagerated due to the measuring techniques which took the operators some time to resolve. In the vertical 5 MW machines for Hartlepool and Heysham 1 there are two interesting factors, firstly a spar failure and secondly shaft axial stability. Many of the problems were due to modifications at site or our inability to model all aspects of site installation from which lessons for the future can be learned. The latest stations Torness and Heysham II incorporate these lessons. The machines have been designed with so much margin that during the resolution of the reactor control rod gag problems the machines were run continuously at 20% overload (6.3 MW). From an initial accident case of 350 deg. C inlet temperature, this increased to 458 deg. C and now stands at 585 deg. C. No modifications to the impeller were required. The site experience to date is good with no operational problems reported. (author). 4 figs

  13. Natural Circulation Performance in Nuclear Power Plants

    International Nuclear Information System (INIS)

    The present paper deals with a study of natural circulation in PWR systems, The study consists of two parts: in the first one, natural circulation in experimental facilities simulating PWR plants was analyzed. This made it possible to gather a broad data base which was assumed as a reference for the subsequent part of the research. Seven Nuclear Power Plants nodalizations and additional experimental data from ''non-PWR'' facilities have been considered in the second part of the paper. Conclusions are drawn about natural circulation capabilities derived for the seven Nuclear Power Plants nodalizations and from data base pertinent to three ''non-PWR'' facilities. (author)

  14. Natural circulation performance in nuclear power plants

    International Nuclear Information System (INIS)

    The present paper deals with a study of natural circulation in PWR systems. The study consists of two parts: in the first one, natural circulation in experimental facilities simulating PWR plants was analysed. This made it possible to gather a broad data base which was assumed as a reference for the subsequent part of the research. Seven Nuclear Power Plants nodalization and additional experimental data from 'non-PWR' facilities have been considered in the second part of the paper. Conclusions are drawn about natural circulation capabilities derived for the seven Nuclear Power Plants nodalization and from data base pertinent to three 'non-PWR' facilities. (author)

  15. General Circulation Modeling of the Jovian stratosphere

    Science.gov (United States)

    Sethunadh, J.; Medvedev, A. S.; Hartogh, P.

    2014-04-01

    The middle atmosphere of Jupiter (1 bar to 1 μ bar) is primarily driven by the heat generated in the interior and by radiative heating and cooling. The stratosphere of Jupiter is less studied, and the mechanisms behind many observed phenomena (e.g.,QQO) in the middle atmosphere as well as the stratospheric circulation patterns remain unknown. We have developed a new General Circulation Model (GCM) to simulate the middle atmospheres of gas giants, which can give important insights to the stratospheric circulation and to the physical and dynamical processes underlying the observed middle atmospheric phenomena.

  16. Circulating miRNA and cancer diagnosis

    Institute of Scientific and Technical Information of China (English)

    2009-01-01

    miRNAs are a class of small RNA molecules with regulatory function, and play an important role in tumor development and progression. It has been demonstrated that tumor-derived miRNAs exist in the circulating nucleic acids of cancer patients. This phenomenon implies that detection of the circulating miRNA may be an effective method for non-invasive diagnosis of cancer. In this review, we summarize the applications of the circulating miRNA as biomarkers in cancer diagnosis, as well as the latest research progress in this area.

  17. A novel interface for hybrid mock circulations to evaluate ventricular assist devices.

    Science.gov (United States)

    Ochsner, Gregor; Amacher, Raffael; Amstutz, Alois; Plass, André; Schmid Daners, Marianne; Tevaearai, Hendrik; Vandenberghe, Stijn; Wilhelm, Markus J; Guzzella, Lino

    2013-02-01

    This paper presents a novel mock circulation for the evaluation of ventricular assist devices (VADs), which is based on a hardware-in-the-loop concept. A numerical model of the human blood circulation runs in real time and computes instantaneous pressure, volume, and flow rate values. The VAD to be tested is connected to a numerical-hydraulic interface, which allows the interaction between the VAD and the numerical model of the circulation. The numerical-hydraulic interface consists of two pressure-controlled reservoirs, which apply the computed pressure values from the model to the VAD, and a flow probe to feed the resulting VAD flow rate back to the model. Experimental results are provided to show the proper interaction between a numerical model of the circulation and a mixed-flow blood pump. PMID:23204266

  18. A mock circulation model for cardiovascular device evaluation

    International Nuclear Information System (INIS)

    The aim of this study was to develop an integrated mock circulation system that functions in a physiological manner for testing cardiovascular devices under well-controlled circumstances. In contrast to previously reported mock loops, the model includes a systemic, pulmonary, and coronary circulation, an elaborate heart contraction model, and a realistic heart rate control model. The behavior of the presented system was tested in response to changes in left ventricular contractile states, loading conditions, and heart rate. For validation purposes, generated hemodynamic parameters and responses were compared to literature. The model was implemented in a servo-motor driven mock loop, together with a relatively simple lead-lag controller. The pressure and flow signals measured closely mimicked human pressure under both physiological and pathological conditions. In addition, the system's response to changes in preload, afterload, and heart rate indicate a proper implementation of the incorporated feedback mechanisms (frequency and cardiac function control). Therefore, the presented mock circulation allows for generic in vitro testing of cardiovascular devices under well-controlled circumstances. (paper)

  19. Functional mapping of the genome of the B19 (human) parvovirus by in vitro translation after negative hybrid selection.

    OpenAIRE

    Ozawa, K; Ayub, J; Young, N.

    1988-01-01

    We have analyzed the coding capacity of B19 parvovirus transcripts by in vitro translation using the negative hybrid selection technique. Five different antisense oligonucleotides (18-mers) corresponding to different portions of the B19 genome were hybridized to RNA samples extracted from human erythroid bone marrow cells infected with B19 parvovirus in vitro, and RNase H was added to cleave specific B19 RNA molecules at selected sites. B19-specific translation products of these RNA samples w...

  20. Platelet Function During Hypothermia in Experimental Mock Circulation.

    Science.gov (United States)

    Van Poucke, Sven; Stevens, Kris; Kicken, Cécile; Simons, Antoine; Marcus, Abraham; Lancé, Marcus

    2016-03-01

    Alterations in platelet function are a common finding in surgical procedures involving cardiopulmonary bypass and hypothermia. Although the combined impact of hypothermia and artificial circulation on platelets has been studied before, the ultimate strategy to safely minimize the risk for bleeding and thrombosis is yet unknown. The aim of this study was to evaluate the use of a mock circulation loop to study the impact of hypothermia for platelet-related hemostatic changes. Venous blood was collected from healthy adult humans (n = 3). Closed mock circulation loops were assembled, each consisting of a centrifugal pump, an oxygenator with integrated heat exchanger, and a hardshell venous reservoir. The experiment started with the mock circulation temperature set at 37°C (T0 [0 h]). Cooling was then initiated at T1 (+2 h), where temperature was adjusted from 37°C to 32°C. Hypothermia was maintained from T2 (+4 h) to T3 (+28 h). From that point in time, rewarming from 32°C to 37°C was initiated with similar speed as cooling. From time point T4 (+30 h), normothermia (37°C) was maintained until the experiment ended at T5 (+32 h). Blood samples were analyzed in standard hematological tests: light transmission aggregometry (LTA) (arachidonic acid [AA], adenosine diphosphate [ADP], collagen [COL], thrombin-receptor-activating-peptide-14 [TRAP]), multiple electrode aggregometry (MEA) (AA, ADP, COL, TRAP), and rotational thromboelastometry (ROTEM) (EXTEM, FIBTEM, PLTEM). Hemoglobin, hematocrit, and platelet count decrease more substantially during temperature drop (37-32°C) than during hypothermia maintenance. Hb and Hct continue to follow this trend during active rewarming (32-37°C). PC increase from the moment active rewarming was initiated. None of the values return to the initial values. LTA values demonstrate a similar decrease in aggregation after stimulation with the platelet agonists between the start of the mock circulation and the start of

  1. Association of Nuclear Factor-Erythroid 2-Related Factor 2, Thioredoxin Interacting Protein, and Heme Oxygenase-1 Gene Polymorphisms with Diabetes and Obesity in Mexican Patients

    Science.gov (United States)

    Jiménez-Osorio, Angélica Saraí; González-Reyes, Susana; García-Niño, Wylly Ramsés; Moreno-Macías, Hortensia; Rodríguez-Arellano, Martha Eunice; Vargas-Alarcón, Gilberto; Zúñiga, Joaquín; Barquera, Rodrigo; Pedraza-Chaverri, José

    2016-01-01

    The nuclear factor-erythroid 2- (NF-E2-) related factor 2 (Nrf2) is abated and its ability to reduce oxidative stress is impaired in type 2 diabetes and obesity. Thus, the aim of this study was to explore if polymorphisms in Nrf2 and target genes are associated with diabetes and obesity in Mexican mestizo subjects. The rs1800566 of NAD(P)H:quinone oxidoreductase 1 (NQO1) gene, rs7211 of thioredoxin interacting protein (TXNIP) gene, rs2071749 of heme oxygenase-1 (HMOX1) gene, and the rs6721961 and the rs2364723 from Nrf2 gene were genotyped in 627 diabetic subjects and 1020 controls. The results showed that the rs7211 polymorphism is a protective factor against obesity in nondiabetic subjects (CC + CT versus TT, OR = 0.40, P = 0.005) and in women (CC versus CT + TT, OR = 0.7, P = 0.016). TT carriers had lower high-density lipoprotein cholesterol levels and lower body mass index. The rs2071749 was positively associated with obesity (AA versus AG + GG, OR = 1.25, P = 0.026). Finally, the rs6721961 was negatively associated with diabetes in men (CC versus CA + AA, OR = 0.62, P = 0.003). AA carriers showed lower glucose concentrations. No association was found for rs1800566 and rs2364723 polymorphisms. In conclusion, the presence of Nrf2 and related genes polymorphisms are associated with diabetes and obesity in Mexican patients.

  2. Lack of Association between Nuclear Factor Erythroid-Derived 2-Like 2 Promoter Gene Polymorphisms and Oxidative Stress Biomarkers in Amyotrophic Lateral Sclerosis Patients

    Directory of Open Access Journals (Sweden)

    Annalisa LoGerfo

    2014-01-01

    Full Text Available Oxidative stress involvement has been strongly hypothesized among the possible pathogenic mechanisms of motor neuron degeneration in amyotrophic lateral sclerosis (ALS. The intracellular redox balance is finely modulated by numerous complex mechanisms critical for cellular functions, among which the nuclear factor erythroid-derived 2-like 2 (NFE2L2/Nrf2 pathways. We genotyped, in a cohort of ALS patients (n=145 and healthy controls (n=168, three SNPs in Nrf2 gene promoter: −653 A/G, −651 G/A, and −617 C/A and evaluated, in a subset (n=73 of patients, advanced oxidation protein products (AOPP, iron-reducing ability of plasma (FRAP, and plasma thiols (-SH as oxidative damage peripheral biomarkers. Nrf2 polymorphisms were not different among patients and controls. Increased levels of AOPP (P<0.05 and decreased levels of FRAP (P<0.001 have been observed in ALS patients compared with controls, but no difference in -SH values was found. Furthermore, no association was found between biochemical markers of redox balance and Nrf2 polymorphisms. These data confirm an altered redox balance in ALS and indicate that, while being abnormally modified compared to controls, the oxidative stress biomarkers assessed in this study are independent from the −653 A/G, −651 G/A, and −617 C/A Nrf2 SNPs in ALS patients.

  3. Lack of association between nuclear factor erythroid-derived 2-like 2 promoter gene polymorphisms and oxidative stress biomarkers in amyotrophic lateral sclerosis patients.

    Science.gov (United States)

    LoGerfo, Annalisa; Chico, Lucia; Borgia, Loredana; Petrozzi, Lucia; Rocchi, Anna; D'Amelio, Antonia; Carlesi, Cecilia; Caldarazzo Ienco, Elena; Mancuso, Michelangelo; Siciliano, Gabriele

    2014-01-01

    Oxidative stress involvement has been strongly hypothesized among the possible pathogenic mechanisms of motor neuron degeneration in amyotrophic lateral sclerosis (ALS). The intracellular redox balance is finely modulated by numerous complex mechanisms critical for cellular functions, among which the nuclear factor erythroid-derived 2-like 2 (NFE2L2/Nrf2) pathways. We genotyped, in a cohort of ALS patients (n = 145) and healthy controls (n = 168), three SNPs in Nrf2 gene promoter: -653 A/G, -651 G/A, and -617 C/A and evaluated, in a subset (n = 73) of patients, advanced oxidation protein products (AOPP), iron-reducing ability of plasma (FRAP), and plasma thiols (-SH) as oxidative damage peripheral biomarkers. Nrf2 polymorphisms were not different among patients and controls. Increased levels of AOPP (P < 0.05) and decreased levels of FRAP (P < 0.001) have been observed in ALS patients compared with controls, but no difference in -SH values was found. Furthermore, no association was found between biochemical markers of redox balance and Nrf2 polymorphisms. These data confirm an altered redox balance in ALS and indicate that, while being abnormally modified compared to controls, the oxidative stress biomarkers assessed in this study are independent from the -653 A/G, -651 G/A, and -617 C/A Nrf2 SNPs in ALS patients. PMID:24672634

  4. Nine known and five novel mutations in the erythroid transcription factor KLF1 gene and phenotypic expression of fetal hemoglobin in hemoglobin E disorder.

    Science.gov (United States)

    Tepakhan, Wanicha; Yamsri, Supawadee; Sanchaisuriya, Kanokwan; Fucharoen, Goonnapa; Xu, Xiangmin; Fucharoen, Supan

    2016-07-01

    Hemoglobin E is the most common Hb variant found in South East Asia. Variation of Hb F expression in Hb E syndrome is associated with several genetic modifiers. We report several single nucleotide polymorphisms (SNPs), including nine known and five novel mutations of the Krüppel-like factor 1 (KLF1; an erythroid specific transcription factor) gene and determine their associations with phenotypic expression of Hb F in Hb E disorders. KLF1 mutations were examined using high resolution melting (HRM) assay and DNA sequencing in 575 homozygous Hb E, 278 heterozygous Hb E and 100 normal subjects. Fourteen mutations were mostly observed in subjects with elevated Hb F, including nine known mutations (G176AfsX179, T334R, R238H, -154 (C>T), A298P, S270W, R301H, -148 (G>A) and G335R and five novel mutations (Q217X, Q223X, Y290_S293del, K307N, and M358I). None of them, but the -148 (G>A), were observed in normal controls to have Hb F <1%. Combined KLF1 mutations with other SNPs including (G)γ-XmnI, BCL11A and HBS1L-MYB were associated with higher Hb F levels. KLF1 is therefore an important genetic factor associated with increased Hb F and in combination with other modifying factors could explain the phenotypic variation of Hb F expression in this common hemoglobinopathy. PMID:27282573

  5. Anti-fibrotic effects of L-2-oxothiazolidine-4-carboxylic acid via modulation of nuclear factor erythroid 2-related factor 2 in rats

    Directory of Open Access Journals (Sweden)

    In Hee Kim1,2, Dae-Ghon Kim1,2*, Peipei Hao2, Yunpeng Wang2, Seong Hun Kim1,2, Sang Wook Kim1,2, Seung Ok Lee1,2 & Soo Teik Lee1,2

    2012-06-01

    Full Text Available L-2-Oxothiazolidine-4-carboxylic acid (OTC is a cysteine prodrugthat maintains glutathione in tissues. The present studywas designed to investigate anti-fibrotic and anti-oxidative effectsof OTC via modulation of nuclear factor erythroid 2-relatedfactor 2 (Nrf2 in an in vivo thioacetamide (TAA-inducedhepatic fibrosis model. Treatment with OTC (80 or 160 mg/kgimproved serum liver function parameters and significantlyameliorated liver fibrosis. The OTC treatment groups exhibitedsignificantly lower expression of α-smooth muscle actin, transforminggrowth factor-β1, and collagen α1 mRNA than that inthe TAA model group. Furthermore, the OTC treatment groupsshowed a significant decrease in hepatic malondialdehyde levelcompared to that in the TAA model group. Nrf2 and hemeoxygenase-1 expression increased significantly in the OTCtreatment groups compared with that in the TAA model group.Taken together, these results suggest that OTC restores the anti-oxidative system by upregulating Nrf2; thus, ameliorating liverinjury and a fibrotic reaction.

  6. Nuclear Factor Erythroid 2-Related Factor 2 Down-Regulation in Oral Neutrophils Is Associated with Periodontal Oxidative Damage and Severe Chronic Periodontitis.

    Science.gov (United States)

    Sima, Corneliu; Aboodi, Guy M; Lakschevitz, Flavia S; Sun, Chunxiang; Goldberg, Michael B; Glogauer, Michael

    2016-06-01

    The balance between reactive oxygen species and antioxidants plays an important role in periodontal health. We previously demonstrated that high reactive oxygen species production by oral polymorphonuclear neutrophils (oPMNs) in chronic periodontitis (CP) refractory to conventional therapy is associated with severe destruction of periodontium. Herein, we show that inhibition of antioxidant production through down-regulation of nuclear factor erythroid 2-related factor 2 (Nrf2) pathway in oPMN, despite enhanced recruitment in the oral cavity, is associated with severe CP. Twenty-four genes in the Nrf2-mediated oxidative stress response pathway were down-regulated in PMNs of diseased patients. Downstream of Nrf2, levels of oPMN superoxide dismutase 1 and catalase were decreased in severe CP, despite increased recruitment. Nrf2(-/-) mice had more severe loss of periodontium in response to periodontitis-inducing subgingival ligatures compared with wild-types. Levels of 8-hydroxy-deoxyguanosine were increased in periodontal lesions of Nrf2(-/-) mice, indicating high oxidative damage. We report, for the first time, Nrf2 pathway down-regulation in oPMNs of patients with severe CP. PMNs of CP patients may be primed for low antioxidant response in the context of high recruitment in the oral cavity, resulting in increased oxidative tissue damage. PMID:27070823

  7. Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

    Energy Technology Data Exchange (ETDEWEB)

    Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk

    2014-04-25

    Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

  8. Genetic variability of VP7, VP4, VP6 and NSP4 genes of common human G1P[8] rotavirus strains circulating in Italy between 2010 and 2014.

    Science.gov (United States)

    Ianiro, Giovanni; Delogu, Roberto; Fiore, Lucia; Ruggeri, Franco M

    2016-07-15

    Group A rotaviruses (RVA) are the leading cause of acute gastroenteritis (AGE) in young children worldwide. The RVA outer capsid layer is composed of the VP7 and VP4 proteins. The VP7 (G-type) and VP4 (P-type) genotypes are the basis for the binary RVA nomenclature. At least 27 G-types and 37 P-types of RVA are currently known, but most of human infections are related to the five major genotypes G1P[8], G2P[4], G3P[8], G4P[8], and G9P[8]. Every year G1P[8] strains cause approximately 50% of all symptomatic RVA infections reported in children in Italy. Fifteen G1P[8] RVA strains identified in different areas of Italy between 2010 and 2014 were selected. Strains were subjected to nucleotide sequencing of the VP7, VP4, VP6 and NSP4 genes to investigate their genetic variability with respect to geographic area and date of detection. Phylogenetic analyses showed that the 15 G1P[8] RVA strains belonged to two different lineages for both the VP7 and NSP4 genes, and showed some intra-lineage diversity in VP4 and VP6 genes. Similarities between strains correlated by either area or date of detection were also evaluated. The results obtained by phylogenetic analyses were confirmed analyzing the deduced amino acid sequences of the VP7, VP4, VP6 and NSP4 proteins of the G1P[8] RVA strains, detecting several substitutions in all proteins. The genetic variability observed between common G1P[8] RVAs highlights the constant evolution of the RVA genome through random point mutations (genetic drift) and intra-genotype reassortment (genetic shift). The evolution and diversity of the G1 RVA strains observed in this study can be related to the naturally acquired herd immunity, which represents the main mechanism of selective pressure in Italy, where mass anti-rotavirus vaccination was missing during the years of the study. PMID:27130628

  9. EOP MIT General Circulation Model (MITgcm)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This data contains a regional implementation of the Massachusetts Institute of Technology general circulation model (MITgcm) at a 1-km spatial resolution for the...

  10. Global warming and changes in ocean circulation

    Energy Technology Data Exchange (ETDEWEB)

    Duffy, P.B.; Caldeira, K.C.

    1998-02-01

    This final report provides an overview of the goals and accomplishments of this project. Modeling and observational work has raised the possibility that global warming may cause changes in the circulation of the ocean. If such changes would occur they could have important climatic consequences. The first technical goal of this project was to investigate some of these possible changes in ocean circulation in a quantitative way, using a state-of -the-art numerical model of the ocean. Another goal was to develop our ocean model, a detailed three-dimensional numerical model of the ocean circulation and ocean carbon cycles. A major non-technical goal was to establish LLNL as a center of excellence in modelling the ocean circulation and carbon cycle.

  11. Sedimentary response to ocean gateway circulation changes

    Science.gov (United States)

    Heinze, Christoph; Crowley, Thomas J.

    1997-12-01

    Previous modeling studies suggested that changes in ocean gateways may have exerted a dramatic influence on the ocean circulation. In this pilot study we extend those results to examining the potential ramifications of circulation changes on the sedimentary record. A version of the Hamburg carbon cycle/sediment model is used in these sensitivity experiments. Results indicate that internal reorganization of the ocean circulation can potentially cause very large regional changes in lysocline depth (1500-3000 m) and opal deposition. These shifts are sometimes comparable in magnitude to those imposed by changes in external forcing (e.g., climate, sea level, and weathering). Comparisons of the model response with the geologic record indicate some significant levels of first-order agreement. This exercise suggests that opportunities now exist for physically based modeling of past sediment responses to circulation and climate changes.

  12. GCFR main helium circulator and electric drive

    International Nuclear Information System (INIS)

    One of the major objectives of the helium circulators for the gas-cooled fast breeder reactor (GCFR) is to achieve the highest possible operational reliability. This is no simple task considering the plant system integration requirements, auxiliary support systems, all possible transient requirements, and resulting complexity in supplying the driving power, primary coolant flow control, and lubrication and sealing. Therefore, the design of the circulator itself is highly dependent on the type of prime mover selected to drive the circulator, e.g., series turbine, parallel turbine, or electric motor. The circulator main drive has evolved from the series steam turbine drive into the variable-speed, synchronous electric motor drive mounted externally to the reactor and controlled by thyristor variable frequency controller. This design is a result of 18 months of joint effort by General Atomic Company and Westinghouse Electric Corporation

  13. STRUCTURES OF CIRCULANT INVERSE M-MATRICES

    Institute of Scientific and Technical Information of China (English)

    Yurui Lin; Linzhang Lu

    2007-01-01

    In this paper,we present a useful result on the structures of circulant inverse Mis not a positive matrix and not equal to c0I,then A is an inverse M-matrix if and only if there exists a positive integer k,which is a proper factor of n,such that cjk>0 for The result is then extended to the so-called generalized circulant inverse M-matrices.

  14. Dynamic Transition Theory for Thermohaline Circulation

    OpenAIRE

    Ma, Tian; Wang, Shouhong

    2009-01-01

    The main objective of this and its accompanying articles is to derive a mathematical theory associated with the thermohaline circulations (THC). This article provides a general transition and stability theory for the Boussinesq system, governing the motion and states of the large-scale ocean circulation. First, it is shown that the first transition is either to multiple steady states or to oscillations (periodic solutions), determined by the sign of a nondimensional parameter $K$, depending o...

  15. Efficient Circulation of Railway Rolling Stock

    OpenAIRE

    Alfieri, Arianna; Groot, Rutger; Kroon, Leo; Schrijver, Lex

    2002-01-01

    textabstractRailway rolling stock (locomotives, carriages, and train units) is one of the most significant cost sources for operatorsof passenger trains, both public and private. Rolling stock costsare due to material acquisition, power supply, and material maintenance. The efficient circulation of rolling stock material is therefore one of the objectives pursued. In this paper we focus on the circulation of train units on a single line. In order to utilize the train units on this line in an ...

  16. The Nordic Seas circulation and exchanges.

    OpenAIRE

    Hawker, E.J.

    2005-01-01

    The Nordic Seas provide the main oceanic connection between the Arctic and the deep global oceans via dense overflows between Greenland and Scotland, into the North Atlantic. An understanding of the circulation and exchanges of this region is vital for any consideration of the implications of high latitude climate change to variability in the Atlantic thermohaline circulation and consequences for regional (European) climate. This thesis makes use of a unique data set of near synoptic hyd...

  17. Local phenomena associated with natural circulation

    International Nuclear Information System (INIS)

    The objective of this lecture is to impart to the participants an adequate knowledge of various phenomena encountered in the natural circulation systems of a nuclear reactor. All the components of the primary system of a nuclear reactor are described and phenomena occurring in each of them are explained. A comprehensive coverage of related thermohydraulic relationships is provided which will enable the participants to carryout the process design of a natural circulation system. (author)

  18. 北京地区人Boca病毒全基因组序列及生物信息学分析%Genomic sequence analysis for human Bocavirus circulating in Beijing by bioinformatics

    Institute of Scientific and Technical Information of China (English)

    赵林清; 钱渊; 朱汝南; 邓洁; 王芳; Li Yan

    2007-01-01

    目的 了解北京地区人Boca病毒(human Bocavirus,HBoV)的基因组编码特征,并对其基因组编码的非结构蛋白NS1、核蛋白NP-1以及病毒外壳蛋白VP1及VP2的二级结构等特性进行预测分析.方法 从已证明为HBoV阳性的2份临床标本BJ3064、BJ3722中应用针对NS1、NP-1、VP1、VP2基因组3'末端的引物对经PCR扩增得到预期片段,将扩增产物直接测序后得到基因组序列;运用生物信息学的方法,对HBoV BJ3064基因组编码的各蛋白的二级结构及其他生物学特性进行了预测分析.结果 测序结果显示HBoV BJ3064及BJ3722基因组序列全长均为5299 bp,有4个主要的CDS(coding domain sequences),分别编码NS1、NP-1、VP1和VP2蛋白.序列同源性比较结果显示BJ3064与BJ3722间基因组序列的同源性达99.9%;与ST1比较,同源性为99.4%~99.5%;与ST2比较,同源性为99.8%;与BPV及MVC比较,同源性低于45%;与细小病毒B19的同源性仅为5%左右;基因组系统进化树分析显示BJ3064、BJ3722与ST2在一簇中,ST1属另一簇.NS1、NP-1、VP1及VP2蛋白二级结构中主要为无规卷曲,其他结构如α螺旋、β片层、β转角在不同蛋白中占有不同比例;各蛋白均无明显的跨膜结构域;NS1、NP-1属不稳定蛋白,VP1、VP2属稳定蛋白.结论 全基因组序列的确定进一步证明北京地区发现的BJ3064、BJ3722是典型的人Boca病毒,相对于ST1,BJ3064、BJ3722与ST2之间进化关系更密切;蛋白二级结构等生物信息学分析将有益于对此新发现病毒的进一步深入研究,如蛋白的表达、分离纯化以及蛋白检测条件的选择等.

  19. Southern Meridional Atmospheric Circulation Associated with IOD

    Institute of Scientific and Technical Information of China (English)

    LIU Na; CHEN Hongxia

    2006-01-01

    Using the monthly wind and sea surface temperature (SST) data, southern meridional atmospheric circulation cells associated with the Indian Ocean Dipole Mode (IOD) events in the Indian Ocean are for the first time described and examined. The divergent wind and pressure vertical velocity are employed for the identification of atmospheric circulation cells. During the four different phases of the positive IOD events, the anomalous meridional Hadley circulation over the western Indian Ocean shows that the air rises in the tropics, flows poleward in the upper troposphere, sinks in the subtropics, and returns back to the tropics in the lower troposphere. The anomalous Hadley circulation over the eastern Indian Ocean is opposite to that over the western Indian Ocean. During positive IOD events, the meridional Hadley circulation over the eastern Indian Ocean is weakened while it is strengthened over the western Indian Ocean. Correlation analysis between the IOD index and the indices of the Hadley cells also proves that, the atmospheric circulation patterns are evident in every IOD event over the period of record.

  20. Global climate and ocean circulation on an aquaplanet ocean-atmosphere general circulation model

    OpenAIRE

    Smith, R.; Dubois, C.; Marotzke, J.

    2006-01-01

    A low-resolution coupled ocean–atmosphere general circulation model (OAGCM) is used to study the characteristics of the large-scale ocean circulation and its climatic impacts in a series of global coupled aquaplanet experiments. Three configurations, designed to produce fundamentally different ocean circulation regimes, are considered. The first has no obstruction to zonal flow, the second contains a low barrier that blocks zonal flow in the ocean at all latitudes, creating a single enclosed ...

  1. Circulation model for water circulation and purification in a water Cerenkov detector

    Institute of Scientific and Technical Information of China (English)

    LU Hao-Qi; YANG Chang-Gen; WANG Ling-Yu; XU Ji-Lei; WANG aui-Guang; WANG Zhi-Min; WANG Yi-Fang

    2009-01-01

    Owing to its low cost and good transparency, highly purified water is widely used as a medium in large water Cerenkov detector experiments. The water circulation and purification system is usually needed to keep the water in good quality. In this work, a practical circulation model is built to describe the variation of the water resistivity in the circulation process and compared with the data obtained from a prototype experiment. The successful test of the model makes it useful in the future design and optimization of the circulation/purification system.

  2. Experimental and numerical investigation of natural circulation phenomena in a rectangular natural circulation loop

    International Nuclear Information System (INIS)

    Natural circulation is the key phenomena in the passive cooling systems. Thus, it is important to study the flow characteristics and heat transfer behavior in natural circulation. The natural circulation phenomena in steady state and transient form is investigated using 3D CFD simulations, carried out using OpenFoam 2.2.0. The first part consists of a steady-state study, in which the results are validated by data available from a set of experiments conducted over a range of heater power (130W-360W). The second part consists of a transient study of flow development and establishment of natural circulation within this loop. (author)

  3. Association of erythroid transcription factors: complexes involving the LIM protein RBTN2 and the zinc-finger protein GATA1.

    OpenAIRE

    Osada, H; Grutz, G.; Axelson, H; Forster, A.; Rabbitts, T H

    1995-01-01

    The RBTN2 LIM-domain protein, originally identified as an oncogenic protein in human T-cell leukemia, is essential for erythropoiesis. A possible role for RBTN2 in transcription during erythropoiesis has been investigated. Direct interaction of the RBTN2 protein was observed in vivo and in vitro with the GATA1 or -2 zinc-finger transcription factors, as well as with the basic helix-loop-helix protein TAL1. By using mammalian two-hybrid analysis, complexes involving RBTN2, TAL1, and GATA1, tog...

  4. Gemfibrozil disrupts the metabolism of circulating lipids in bobwhite quails.

    Science.gov (United States)

    Bussière-Côté, Sophie; Omlin, Teye; de Càssia Pinheiro, Eliana; Weber, Jean-Michel

    2016-01-01

    The circulating lipids of birds play essential roles for egg production and as an energy source for flight and thermogenesis. How lipid-lowering pharmaceuticals geared to prevent heart disease in humans and that are routinely released in the environment affect their metabolism is unknown. This study assesses the impact of the popular drug gemfibrozil (GEM) on the plasma phospholipids (PL), neutral lipids (NL), and nonesterified fatty acids (NEFA) of bobwhite quails (Colinus virginianus). Results show that bird lipoproteins are rapidly altered by GEM, even at environmentally-relevant doses. After 4 days of exposure, pharmacological amounts cause an 83% increase in circulating PL levels, a major decrease in average lipoprotein size measured as a 56% drop in the NL/PL ratio, and important changes in the fatty acid composition of PL and NEFA (increases in fatty acid unsaturation). The levels of PL carrying all individual fatty acids except arachidonate are strongly stimulated. The large decrease in bird lipoprotein size may reflect the effects seen in humans: lowering of LDL that can cause atherosclerosis and stimulation of HDL that promote cholesterol disposal. Lower (environmental) doses of GEM cause a reduction of %palmitate in all the plasma lipid fractions of quails, but particularly in the core triacylglycerol of lipoproteins (NL). No changes in mRNA levels of bird peroxisome proliferator-activated receptor (PPAR) could be demonstrated. The disrupting effects of GEM on circulating lipids reported here suggest that the pervasive presence of this drug in the environment could jeopardize reproduction and migratory behaviours in wild birds. PMID:26432161

  5. Grsf1-induced translation of the SNARE protein Use1 is required for expansion of the erythroid compartment.

    Directory of Open Access Journals (Sweden)

    Andrzej Nieradka

    Full Text Available Induction of cell proliferation requires a concomitant increase in the synthesis of glycosylated lipids and membrane proteins, which is dependent on ER-Golgi protein transport by CopII-coated vesicles. In this process, retrograde transport of ER resident proteins from the Golgi is crucial to maintain ER integrity, and allows for anterograde transport to continue. We previously showed that expression of the CopI specific SNARE protein Use1 (Unusual SNARE in the ER 1 is tightly regulated by eIF4E-dependent translation initiation of Use1 mRNA. Here we investigate the mechanism that controls Use1 mRNA translation. The 5'UTR of mouse Use1 contains a 156 nt alternatively spliced intron. The non-spliced form is the predominantly translated mRNA. The alternatively spliced sequence contains G-repeats that bind the RNA-binding protein G-rich sequence binding factor 1 (Grsf1 in RNA band shift assays. The presence of these G-repeats rendered translation of reporter constructs dependent on the Grsf1 concentration. Down regulation of either Grsf1 or Use1 abrogated expansion of erythroblasts. The 5'UTR of human Use1 lacks the splice donor site, but contains an additional upstream open reading frame in close proximity of the translation start site. Similar to mouse Use1, also the human 5'UTR contains G-repeats in front of the start codon. In conclusion, Grsf1 controls translation of the SNARE protein Use1, possibly by positioning the 40S ribosomal subunit and associated translation factors in front of the translation start site.

  6. Novel reassortant swine influenza viruses are circulating in Danish pigs

    DEFF Research Database (Denmark)

    Breum, Solvej Østergaard; Hjulsager, Charlotte Kristiane; Trebbien, Ramona;

    The Danish surveillance program for influenza A virus in pigs has revealed that two novel reassortant swine influenza viruses may now be circulating in the Danish swine population, since they each have been detected in at least two submissions from different herds in 2011 as well as in 2012. One of...... the reassortant viruses comprised a HA gene similar to H1 of H1N1 avian-like swine influenza virus (SIV) and a NA gene most closely related to N2 gene of human H3N2 influenza virus that circulated in humans in the mid 1990s. The internal genes of this reassortant virus with the subtype H1avN2hu all...... pandemic H1N1pdm09 influenza virus lineage. Swine influenza virus with a similar subtype to H1pdm09N2sw has previously been found in pigs in Italy and Germany. Detailed analyses of viral genes will further elucidate the relationship between these new swine influenza viruses found in the different countries...

  7. Postural reactions of circulation and its regulation during simulated weightlessness

    Science.gov (United States)

    Sokolov, V. I.; Valyev, V. A.; Kirillov, M. V.; Gornago, V. A.

    The extention and intensification of space exploration the influence of weightlessness on human organism and the formation of a new level of adaptation. The studies of blood circulation is very important because of freguent occurance of cardiovascular disorders in the middle age sudjects. In connection with extention and intensification of space exploration the influence of weightlessness on human organism and the formation of a new level of adaptation mechanisms acguires a special significance (5, 9, 10). The data obtained in recently undertaken model experiments (1, 5, 10), and also during space flights (5, 9) indicate that weightlessness in many ways affects various physiological systems of organism, and first of all cardiovascular system with the development of reflex, humoral and metabolic reactions. It also indicates, that the changes in functioning of cardiovascular system brings about the discruption of its regular responses, which is foremost expressed in decreased antigravitational response, which manifests itself in lowered orthostatic stability (2, 4, 6). It is worth mentioning, that the changes during previous investigations of haemodynamics were mainly carried out with the subjects under forty, therefore agerelated specific features of blood circulation system response are described in a few articles (5, 8). The studies of the kind are especially important because of frequent occurence of cardiovascular disorders such as heart and brain vessels atherosclerosis, hypertension in the middle age, which can to a great extent complicate and affect the "acute" period of adaptation to weightlessness and readaptation process.

  8. Role of circulation in climate changes over Australia

    International Nuclear Information System (INIS)

    Full text: Significant changes in Australian temperatures and rainfall have been observed over recent decades. Both nighttime and daytime temperatures have been increasing steadily since the 1950s or before. This warming has occurred Australia-wide, except for small localised regions in the north-west and south-west, and is consistent with warming seen in most other locations of the globe. Rainfall has increased in the north-west and centre, with decreases found in most other regions, with significant declines in the south-west and along the east coast. Previous studies have shown that the recent warming is very likely due to human-induced changes in external forcing. What proportion of these climate changes can be ascribed to changes in variability such as the El Nino -Southern Oscillation (ENSO) and other modes of circulation? ENSO has a strong influence on Australian climate which, while improving predictability on seasonal timescales, also makes attribution of human-induced changes on climate scales more difficult than elsewhere. For example, the current 2006/2007 El Nino-related drought has exacerbated temperature and rainfall trends, but would warming have occurred anyway? By quantifying the contribution of circulation-related variability to recent climate trends, we determine the residual patterns of climate change over Australia. This increased understanding of recent observed changes will enable better informed decisions about the future

  9. Molecular Evolution of the Nuclear Factor (Erythroid-Derived 2)-Like 2 Gene Nrf2 in Old World Fruit Bats (Chiroptera: Pteropodidae).

    Science.gov (United States)

    Yin, Qiuyuan; Zhu, Lei; Liu, Di; Irwin, David M; Zhang, Shuyi; Pan, Yi-Hsuan

    2016-01-01

    Mammals developed antioxidant systems to defend against oxidative damage in their daily life. Enzymatic antioxidants and low molecular weight antioxidants (LMWAs) constitute major parts of the antioxidant systems. Nuclear factor (erythroid-derived 2)-like 2 (Nrf2, encoded by the Nrf2 gene) is a central transcriptional regulator, regulating transcription, of many antioxidant enzymes. Frugivorous bats eat large amounts of fruits that contain high levels of LMWAs such as vitamin C, thus, a reliance on LMWAs might greatly reduce the need for antioxidant enzymes in comparison to insectivorous bats. Therefore, it is possible that frugivorous bats have a reduced need for Nrf2 function due to their substantial intake of diet-antioxidants. To test whether the Nrf2 gene has undergone relaxed evolution in fruit-eating bats, we obtained Nrf2 sequences from 16 species of bats, including four Old World fruit bats (Pteropodidae) and one New World fruit bat (Phyllostomidae). Our molecular evolutionary analyses revealed changes in the selection pressure acting on Nrf2 gene and identified seven specific amino acid substitutions that occurred on the ancestral lineage leading to Old World fruit bats. Biochemical experiments were conducted to examine Nrf2 in Old World fruit bats and showed that the amount of catalase, which is regulated by Nrf2, was significantly lower in the brain, heart and liver of Old World fruit bats despite higher levels of Nrf2 protein in Old World fruit bats. Computational predictions suggest that three of these seven amino acid replacements might be deleterious to Nrf2 function. Therefore, the results suggest that Nrf2 gene might have experienced relaxed constraint in Old World fruit bats, however, we cannot rule out the possibility of positive selection. Our study provides the first data on the molecular adaptation of Nrf2 gene in frugivorous bats in compensation to the increased levels of LWMAs from their fruit-diet. PMID:26735303

  10. A novel nuclear factor erythroid 2-related factor 2 (Nrf2) activator RS9 attenuates brain injury after ischemia reperfusion in mice.

    Science.gov (United States)

    Yamauchi, Keita; Nakano, Yusuke; Imai, Takahiko; Takagi, Toshinori; Tsuruma, Kazuhiro; Shimazawa, Masamitsu; Iwama, Toru; Hara, Hideaki

    2016-10-01

    Recanalization of occluded vessels leads to ischemia-reperfusion injury (IRI), with oxidative stress as one of the main causes of injury, despite the fact that recanalization therapy is the most effective treatment for ischemic stroke. The nuclear factor erythroid 2-related factor 2 (Nrf2) is one of the transcription factors which has an essential role in protection against oxidative stress. RS9 is a novel Nrf2 activator obtained from bardoxolone methyl (BARD), an Nrf2 activator that has already been tested in a clinical trial, using a biotransformation technique. RS9 has been reported to lead to higher Nrf2 activation and less cytotoxicity than BARD. In this study, we investigated the effects of RS9 on IRI. Mice were intraperitoneally treated immediately after 2h of transient middle cerebral artery occlusion (MCAO) with a vehicle solution or 0.2mg/kg of RS9. Post-onset treatment of RS9 attenuated the infarct volume and improved neurological deficits 22h after reperfusion. RS9 activated Nrf2 2 and 6h after reperfusion and activated heme oxygenase-1 at 6 and 22h after reperfusion. RS9 also attenuated the phosphorylation of NF-κB p65 2 and 6h after reperfusion. Finally, RS9 improved the survival rate and neurological deficits 7days after MCAO. Our results suggest that the activation of Nrf2 by RS9 has a neuroprotective effect, mediated by attenuating both oxidative stress and neuroinflammation, and that RS9 is an effective therapeutic candidate for the treatment of IRI. PMID:27474227

  11. Sulphur antioxidants inhibit oxidative stress induced retinal ganglion cell death by scavenging reactive oxygen species but influence nuclear factor (erythroid-derived 2)-like 2 signalling pathway differently.

    Science.gov (United States)

    Majid, Aman Shah Abdul; Yin, Zheng Qin; Ji, Dan

    2013-01-01

    This study aimed to show if two different sulphur containing drugs sulbutiamine and acetylcysteine (NAC) could attenuate the effects of two different insults being serum deprivation and glutamate/buthionine sulfoximine (GB)-induced death to transformed retinal ganglion cell line (RGC-5) in culture. Cells were exposed to either 5 mM of GB for 24 h or serum deprivation for 48 h with inclusion of either NAC or sulbutiamine. Cell viability, microscopic evidence for apoptosis, caspase 3 activity, reactive oxygen species (ROS), glutathione (GSH), catalase and gluthathione-S-transferase (GST) were determined. The effects of NAC and sulbutiamine on the oxidative stress related transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf-2) levels and its dependent phase II enzyme haemeoxygenase-1 (HO-1) were carried out using Western blot and quantitative-polymerase chain reaction (PCR). NAC and sulbutiamine dose-dependently attenuated serum deprivation-induced cell death. However NAC but not sulbutiamine attenuated GB-induced cell death. NAC and sulbutiamine both independently stimulated the GSH and GST production but scavenged different types of ROS with different efficacy. Moreover only sulbutiamine stimulated catalase and significantly increased Nrf-2 and HO-1 levels. In addition, the pan caspase inhibitor, benzoylcarbonyl-Val-Ala-Asp-fluoromethyl ketone (z-VAD-fmk) attenuated the negative effect of serum deprivation while the necroptosis inhibitor (necrostatin-1) counteracted solely an insult of GB. The neuroprotective actions of NAC and sulbutiamine in GB or serum-deprivation insult are therefore different. PMID:23811559

  12. Local thermal control of the human cutaneous circulation

    OpenAIRE

    Johnson, John M.; Kellogg, Dean L.

    2010-01-01

    The level of skin blood flow is subject to both reflex thermoregulatory control and influences from the direct effects of warming and cooling the skin. The effects of local changes in temperature are capable of maximally vasoconstricting or vasodilating the skin. They are brought about by a combination of mechanisms involving endothelial, adrenergic, and sensory systems. Local warming initiates a transient vasodilation through an axon reflex, succeeded by a plateau phase due largely to nitric...

  13. Higher circulating levels of IGF-1 are associated with longer leukocyte telomere length in healthy subjects

    DEFF Research Database (Denmark)

    Barbieri, Michelangela; Paolisso, Giuseppe; Kimura, Masayuki;

    2009-01-01

    Mutations that inhibit the insulin-like growth factor-1 (IGF-1) extend the lifespan of worms, flies and mice. However, it appears that relatively low circulating levels of IGF-1 in humans are associated with aging-related diseases and diminished longevity. As leukocyte telomere length (LTL...

  14. Experimental study of the natural circulation phenomena

    International Nuclear Information System (INIS)

    The objective of this paper is to study the natural circulation in experimental loops and extend the results to nuclear facilities. New generation of compact nuclear power plants use the natural circulation as cooling and residual heat removal systems in case of accidents or shutdown. Lately the interest in this phenomenon, by scientific community, has increased. The experimental loop, described in this paper, was assembled at Escola Politecnica - USP at the Chemical Engineering Department. It is the goal to generate information to help with the understanding of the one and two phase natural circulation phenomena. Some experiments were performed with different levels of heat power and different flow of the cooling water at the secondary circuit. The data generated from these experiments are going to be used to validate some computational thermal hydraulic codes. Experimental results for one and two phase regimes are presented as well as the proposed model to simulate the flow regimes with the RELAP5 code. (author)

  15. MAGNETICALLY CONTROLLED CIRCULATION ON HOT EXTRASOLAR PLANETS

    International Nuclear Information System (INIS)

    Through the process of thermal ionization, intense stellar irradiation renders hot Jupiter atmospheres electrically conductive. Simultaneously, lateral variability in the irradiation drives the global circulation with peak wind speeds of the order of ∼km s–1. In turn, the interactions between the atmospheric flows and the background magnetic field give rise to Lorentz forces that can act to perturb the flow away from its purely hydrodynamical counterpart. Using analytical theory and numerical simulations, we show here that significant deviations away from axisymmetric circulation are unstable in presence of a non-negligible axisymmetric magnetic field. Specifically, our results suggest that dayside-to-nightside flows, often obtained within the context of three-dimensional circulation models, only exist on objects with anomalously low magnetic fields, while the majority of highly irradiated exoplanetary atmospheres are entirely dominated by zonal jets

  16. Tropical convective transport and the Walker circulation

    Directory of Open Access Journals (Sweden)

    J. S. Hosking

    2012-05-01

    Full Text Available We introduce a methodology to visualise rapid vertical and zonal tropical transport pathways. Using prescribed sea-surface temperatures in four monthly model integrations for 2005, preferred transport routes from the troposphere to the stratosphere are found in the model over the Maritime Continent (MC in November and February, i.e., boreal winter. In these months, the ascending branch of the Walker Circulation over the MC is formed in conjunction with strong deep convection, allowing fast transport into the stratosphere. At the same time, the downwelling branch of the Walker Circulation is enhanced over the East Pacific, compared to other months in 2005, reducing locally the upward transport from emissions below. We conclude that the Walker circulation plays an important role in the seasonality of fast tropical transport from the troposphere to the stratosphere and so impacts at the same time the potential supply of surface emissions.

  17. Use of natural circulation flow map

    International Nuclear Information System (INIS)

    Natural circulation in complex systems, considering the experimental simulators of PWR and the experience gained in analyzing natural circulation experiments performed in those systems are referred to. In particular, the NC scenarios occurring at different values of the primary system mass inventory are studied. Data have been gathered and analyzed coming from the experimental facilities (PWR simulators, or Integral Test Facilities, ITF) named Semiscale, Spes, Lobi, Bethsy, Pkl and Lstf. The case of PWR design, the NC should be seen as the fundamental mechanism for removing core following accidents or events that cause unavailability of primary circulation pumps. The NC phenomenon constitutes the basis for the layout of the primary system with core located in the bottom of vessel and steam generators a few meters above the top of the active fuel

  18. Cryogenic hydrogen circulation system of neutron source

    International Nuclear Information System (INIS)

    Cold neutron sources of reactors and spallation neutron sources are classic high flux neutron sources in operation all over the world. Cryogenic fluids such as supercritical or supercooled hydrogen are commonly selected as a moderator to absorb the nuclear heating from proton beams. By comparing supercritical hydrogen circulation systems and supercooled hydrogen circulation systems, the merits and drawbacks in both systems are summarized. When supercritical hydrogen circulates as the moderator, severe pressure fluctuations caused by temperature changes will occur. The pressure control system used to balance the system pressure, which consists of a heater as an active controller for thermal compensation and an accumulator as a passive volume controller, is preliminarily studied. The results may provide guidelines for design and operation of other cryogenic hydrogen system for neutron sources under construction

  19. Quantification of bronchial circulation perfusion in rats

    Science.gov (United States)

    Wietholt, Christian; Molthen, Robert C.; Haworth, Steven T.; Roerig, David L.; Dawson, Christopher A.; Clough, Anne V.

    2004-04-01

    The bronchial circulation is thought to be the primary blood supply for pulmonary carcinomas. Thus, we have developed a method for imaging and quantifying changes in perfusion in the rat lung due to development of the bronchial circulation. A dual-modality micro-CT/SPECT system was used to detect change in perfusion in two groups of rats: controls and those with a surgically occluded left pulmonary artery. Both groups were imaged following injections on separate days i) 2mCi of Tc99m labeled macroaggregated albumin (MAA) into the left carotid artery (IA) and ii) a similar injection into the femoral vein (IV). The IA injection resulted in Tc99m accumulation in capillaries of the systemic circulation including the bronchial circulation, whereas the IV resulted in Tc99m accumulation in the pulmonary capillaries. Ordered subset expectation maximization (OSEM) was used to reconstruct the SPECT image volumes and a Feldkamp algorithm was used to reconstruct the micro-CT image volumes. The micro-CT and SPECT volumes were registered, the SPECT image volume was segmented using the right and left lung boundaries defined from the micro-CT volume, and the ratio of IA radioactivity accumulation in the left lung to IV radioactivity accumulation in both lungs was used as a measure of left lung flow via the bronchial circulation. This ratio was ~0.02 for the untreated rats compared to the treated animals that had an increased flow ratio of ~0.21 40 days after left pulmonary artery occlusion. This increase in flow to the occluded left lung via the bronchial circulation suggests this will be a useful model for further investigating antiangiogenic treatments.

  20. Experimental study of natural circulation circuit

    Energy Technology Data Exchange (ETDEWEB)

    Lemos, Wanderley F.; Su, Jian, E-mail: wlemos@lasme.coppe.ufrj.br, E-mail: sujian@lasme.coppe.ufrj.br [Coordenacao dos Programas de Pos-Graduacao de Engenharia (LASME/COPPE/UFRJ), Rio de Janeiro, RJ (Brazil). Lab. de Simulacao e Metodos Numericos; Faccini, Jose L.H., E-mail: faccini@ien.gov.br [Instituto de Engenharia Nuclear (LTE/IEN/CNEN-RJ), Rio de Janeiro, RJ (Brazil). Lab. de Termo-Hidraulica Experimental

    2011-07-01

    This work presents an experimental study about fluid flows behavior in natural circulation, under conditions of single-phase flow. The experiment was performed through experimental thermal-hydraulic circuit built at IEN. This test equipment has performance similar to passive system of residual heat removal present in Advanced Pressurized Water Reactors (APWR). This experimental study aims to observing and analyzing the natural circulation phenomenon, using this experimental circuit that was dimensioned and built based on concepts of similarity and scale. This philosophy allows the analysis of natural circulation behavior in single-phase flow conditions proportionally to the functioning real conditions of a nuclear reactor. The experiment was performed through procedures to initialization of hydraulic feeding of primary and secondary circuits and electrical energizing of resistors installed inside heater. Power controller has availability to adjust values of electrical power to feeding resistors, in order to portray several conditions of energy decay of nuclear reactor in a steady state. Data acquisition system allows the measurement and monitoring of the evolution of the temperature in various points through thermocouples installed in strategic points along hydraulic circuit. The behavior of the natural circulation phenomenon was monitored by graphical interface on computer screen, showing the temperature evolutions of measuring points and results stored in digital spreadsheets. The results stored in digital spreadsheets allowed the getting of data to graphic construction and discussion about natural circulation phenomenon. Finally, the calculus of Reynolds number allowed the establishment for a correlation of friction in function of geometric scales of length, heights and cross section of tubing, considering a natural circulation flow throughout in the region of hot leg. (author)

  1. Fort St. Vrain circulator operating experience

    International Nuclear Information System (INIS)

    Fort St. Vrain, on the system of Public Service Company of Colorado, is the only high-temperature gas-cooled power reactor in the United States. Four helium circulators are utilized in this plant to transfer heat from the reactor to the steam generators. These unique machines have a single stage axial flow helium compressor driven by a single stage steam turbine. A single stage water driven (pelton wheel) turbine is the back-up drive utilizing either feed water, condensate, or fire water as the driving fluid. Developmental testing of the circulators was accomplished prior to installation into Fort St. Vrain. A combined machine operating history of approximately 250,000 hours has shown these machines to be of conservative design and proven mechanical integrity. However, many problems have been encountered in operating the complex auxiliaries which are necessary for successful circulator and plant operation. It has been 15 years since initial installation of the circulators occurred at Fort St. Vrain. During this time, a number of significant issues had to be resolved dealing specifically with machine performance. These events include cavitation damage of the pelton wheels during the initial plant hot functional testing, cracks in the water turbine buckets and cervic coupling, static shutdown seal bellows failure, and, most recently, degradation of components within the steam drive assembly. Unreliable operation particularly with the circulator auxiliaries has been a focus of attention by Public Service Company of Colorado. Actions to replace or significantly modify the existing circulators and their auxiliaries are currently awaiting decisions concerning the long-term future of the Fort St. Vrain plant. (author). 10 refs, 7 figs, 2 tabs

  2. The stripline circulator theory and practice

    CERN Document Server

    Helszajn, J

    2008-01-01

    Stripline circulator theory and applications from the world's foremost authority. The stripline junction circulator is a unique three-port non-reciprocal microwave junction used to connect a single antenna to both a transmitter and a receiver. Its operation relies on the interaction between an electron spin in a suitably magnetized insulator with an alternating radio frequency magnetic field. In its simplest form, it consists of a microwave planar gyromagnetic resonator symmetrically coupled by three transmission lines. This book explores the magnetic interaction involved in the stripline circ.

  3. Quenching phenomena in natural circulation loop

    Energy Technology Data Exchange (ETDEWEB)

    Umekawa, Hisashi; Ozawa, Mamoru [Kansai Univ., Osaka (Japan); Ishida, Naoki [Daihatsu Motor Company, Osaka (Japan)

    1995-09-01

    Quenching phenomena has been investigated experimentally using circulation loop of liquid nitrogen. During the quenching under natural circulation, the heat transfer mode changes from film boiling to nucleate boiling, and at the same time flux changes with time depending on the vapor generation rate and related two-phase flow characteristics. Moreover, density wave oscillations occur under a certain operating condition, which is closely related to the dynamic behavior of the cooling curve. The experimental results indicates that the occurrence of the density wave oscillation induces the deterioration of effective cooling of the heat surface in the film and the transition boiling regions, which results in the decrease in the quenching velocity.

  4. The circulation of the Mozambique channel

    Science.gov (United States)

    Sætre, Roald; Da Silva, António Jorge

    1984-05-01

    Based on hydrographic data from 1977 to 1980 off the coast of Mozambique and historical data from the Mozambique Channel, the general circulation pattern of the area is described. The circulation pattern is characterized by the influence of three anticyclonic gyres covering the northern, the central, and the southern parts of the channel. Additionally, smaller cyclonic eddies are observed, of which some probably are topographically induced. The results strongly indicate that in the upper 1000 m the role of the Mozambique Current as one of the tributaries to the Agulhas Current is of minor significance and draw into question the concept of the Mozambique Current as a continuous one.

  5. Blowing Circulation Control on a Seaplane Airfoil

    Science.gov (United States)

    Guo, B. D.; Liu, P. Q.; Qu, Q. L.

    2011-09-01

    RANS simulations are presented for blowing circulation control on a seaplane airfoil. Realizable k-epsilon turbulent model and pressure-based coupled algorithm with second-order discretization were adopted to simulate the compressible flow. Both clear and simple flap configuration were simulated with blowing momentum coefficient Cμ = 0, 0.15 and 0.30. The results show that blowing near the airfoil trailing edge could enhance the Coanda effect, delay the flow separation, and increase the lift coefficient dramatically. The blowing circulation control is promising to apply to taking off and landing of an amphibious aircraft or seaplane.

  6. Scaling Analysis of Natural Circulation Flow Loop

    International Nuclear Information System (INIS)

    To improve the thermal margin for the severe accident measures in high-power reactors, engineered corium cooling systems involving boiling-induced two-phase natural circulation have been proposed for decay heat removal. The boiling-induced natural circulation flow is generated in a coolant path between a hot vessel wall and cold coolant reservoir. In general, an increase in the natural circulation mass flow rate of the coolant leads to an increase in the critical heat flux (CHF) on the hot wall, thus enhancing the thermal margin. An ex-vessel core catcher under consideration, which is one of the engineered corium cooling system, is a passive system consisting of an inclined engineered cooling channel made of a single channel between the body of the core catcher and the inside wall of the reactor cavity. Under severe accident conditions, water is supplied from the IRWST to the engineered cooling channel. The water in the inclined channel absorbs the decay heat transferred from the corium through the carbon steel structure of the core catcher body and boils off as steam. The latter is subsequently released into the free volume of the containment above the corium spreading compartment. Water continues to flow from the IRWST to the cooling channel as a result of buoyancy-driven natural circulation. The engineered cooling channel is designed to provide effective long-term cooling and stabilization of the corium mixture in the core catcher body while facilitating steam venting. In this study, the scaling analysis was performed by solving the natural circulation flow loop equation for the cooling channel in the ex-vessel core catcher. The scaling analysis was performed by solving the natural circulation flow loop equation for the cooling channel in the ex-vessel core catcher. The boiling-induced natural circulation flow in the cooling channel of the core catcher has been modeled by considering the conservation of mass, momentum and energy in the two-phase mixture, along

  7. Applications of Circulation Control, Yesterday and Today

    OpenAIRE

    Jonathan Kweder; Chad C. Panthe; James E. Smit

    2010-01-01

    Circulation control, an aerodynamic method of changing the properties of an airfoil, such as lift, camber and angle of attack, has been used in several unique ways since its inception, as an enhancement to fixed wing aircraft, in the 1960’s. Early in the research venture, this technology was used on the main wing of an aircraft in conjunction with a Coandă surface, such as a rounded trailing edge or a deployable flap. Research during this time proved to be the foundation of the circulation co...

  8. Applications of Circulation Control, Yesterday and Today

    Directory of Open Access Journals (Sweden)

    Jonathan Kweder

    2010-12-01

    Full Text Available Circulation control, an aerodynamic method of changing the properties of an airfoil, such as lift, camber and angle of attack, has been used in several unique ways since its inception, as an enhancement to fixed wing aircraft, in the 1960’s. Early in the research venture, this technology was used on the main wing of an aircraft in conjunction with a Coandă surface, such as a rounded trailing edge or a deployable flap. Research during this time proved to be the foundation of the circulation control technology and showed that small amounts of exit jet velocity could have a large impact on the aerodynamics of an airfoil. In the 1970’s the inspirations that drove circulation control research changed from design work to optimization of the parameters which were found to have the most effect on circulation control. These studies included slot placement, favorable momentum coefficient, and pressurization benefits and determents. This research period also allowed for expansion of the uses of circulation control to submarine/hydrodynamic and rotary wing applications. Newest research has brought on several propeller driven applications and the recent push for efficient renewable research has allowed circulation control research technologies to evolve into use in wind turbine and water turbine applications. The idea being that with circulation control the turbine can adapt easier to the changing wind velocity and direction and ultimately capture more power than an un-augmented turbine. As with most new and novel technologies there is a process and time delay associated with their development and ultimate application. For some technologies the market, or the supporting hardware, are lacking and sometimes the technology has strong advocacies for yet to be fulfilled expectations. In most of these cases a strong idea will re-surface repeatedly until the art has matured, or the better solution is found. This paper will focus on the previously developed

  9. Evaluation of coronary blood flow velocity during cardiac arrest with circulation maintained through mechanical chest compressions in a porcine model

    OpenAIRE

    Wagner Henrik; Madsen Hardig Bjarne; Steen Stig; Sjoberg Trygve; Harnek Jan; Olivecrona Goran K

    2011-01-01

    Abstract Background Mechanical chest compressions (CCs) have been shown capable of maintaining circulation in humans suffering cardiac arrest for extensive periods of time. Reports have documented a visually normalized coronary blood flow during angiography in such cases (TIMI III flow), but it has never been actually measured. Only indirect measurements of the coronary circulation during cardiac arrest with on-going mechanical CCs have been performed previously through measurement of the cor...

  10. Combined intermittent hypobaric hypoxia and muscle electro-stimulation: a method to increase circulating progenitor cell concentration?

    OpenAIRE

    Corral, Luisa; Javierre, Casimiro; Blasi, Juan; Viscor, Ginés; Ricart, Antoni; Ventura, Josep Lluis

    2014-01-01

    Background Our goal was to test whether short-term intermittent hypobaric hypoxia (IHH) at a level well tolerated by healthy humans could, in combination with muscle electro-stimulation (ME), mobilize circulating progenitor cells (CPC) and increase their concentration in peripheral circulation. Methods Nine healthy male subjects were subjected, as the active group (HME), to a protocol involving IHH plus ME. IHH exposure consisted of four, three-hour sessions at a barometric pressure of 540 hP...

  11. The LIM-only protein Lmo2 is a bridging molecule assembling an erythroid, DNA-binding complex which includes the TAL1, E47, GATA-1 and Ldb1/NLI proteins.

    OpenAIRE

    Wadman, I A; Osada, H; Grütz, G G; Agulnick, A D; Westphal, H; Forster, A.; Rabbitts, T H

    1997-01-01

    The LIM-only protein Lmo2, activated by chromosomal translocations in T-cell leukaemias, is normally expressed in haematopoiesis. It interacts with TAL1 and GATA-1 proteins, but the function of the interaction is unexplained. We now show that in erythroid cells Lmo2 forms a novel DNA-binding complex, with GATA-1, TAL1 and E2A, and the recently identified LIM-binding protein Ldb1/NLI. This oligomeric complex binds to a unique, bipartite DNA motif comprising an E-box, CAGGTG, followed approxima...

  12. cDNA sequence for human erythrocyte ankyrin

    International Nuclear Information System (INIS)

    The cDNA for human erythrocyte ankyrin has been isolated from a series of overlapping clones obtained from a reticulocyte cDNA library. The composite cDNA sequence has a large open reading frame of 5636 base pairs (bp) with the complete coding sequence for a polypeptide of 1879 amino acids with a predicted molecular mass of 206 kDa. The derived amino acid sequence contained 194 residues that were identical to those obtained by direct amino acid sequencing of 11 ankyrin proteolytic peptides. The primary sequence contained 23 highly homologous repeat units of 33 amino acids within the 90-kDa band 3 binding domain. Two cDNA clones showed evidence of apparent mRNA processing, resulting in the deletions of 486 bp and 135 bp, respectively. The 486-bp deletion resulted in the removal of a 16-kDa highly acidic peptide, and the smaller deletion had the effect of altering the COOH terminus of the molecule. Radiolabeled ankyrin cDNAs recognized two erythroid message sizes by RNA blot analysis, one of which was predominantly associated with early erythroid cell types. An ankyrin message was also observed in RNA from the human cerebellum by the same method. The ankyrin gene is assigned to chromosome 8 using genomic DNA from a panel of sorted human chromosomes

  13. RELATIONSHIP BETWEEN CIRCULATING CORTISOL AND TESTOSTERONE: INFLUENCE OF PHYSICAL EXERCISE

    Directory of Open Access Journals (Sweden)

    Anthony C. Hackney

    2005-03-01

    Full Text Available Human research has shown the administration of cortisol into the circulation at rest will result in reduced blood testosterone levels. Many researchers have used these results to imply that physical exercise induced cortisol increases would perhaps result in subsequent reductions in circulating testosterone levels. Our purpose was to examine this concept and determine what, if any, relationship exists between circulating cortisol (C and testosterone (T in men (n = 45, 26.3 3.8 yr at rest and after exercise. Blood samples were collect at rest (10 hour post-prandial; denoted as 'Resting'; n = 45 and again on the same day at 1.0 hr into recovery from intensive exercise (denoted as 'Exercise Recovery'; n = 45. Approximately 48-96 hr after this initial (Trial # 1 blood collection protocol the subjects replicated the exact procedures again and provided a second Resting and Exercise Recovery set of blood samples (Trial # 2. Blood samples from Trial # 1and Trial # 2 were pooled (Resting, n = 90; Exercise Recovery, n = 90. The blood samples were analyzed by radioimmunoassay for C, total T (TT, and free T (fT. Pearson correlation coefficients for the Resting samples ([TT vs. C] r 0.05. For the Exercise Recovery samples ([TT vs. C] r = -0.53; [fT vs. C] r = +0.21 correlation coefficients were significant (p < 0.05. The findings indicate that exercise does allow the development of a significant negative relationship between C and TT. Interestingly, a significant positive relationship developed between C and fT following exercise; possibly due to an adrenal cortex contribution of fT or disassociation of fT from sex hormone binding globulin. The detected in vivo relationships between C and T, however, were associative and not causal in nature and were small to moderate at best in strength.

  14. Circulating angiogenic factors in patients with thromboangiitis obliterans.

    Directory of Open Access Journals (Sweden)

    Bernd Hewing

    Full Text Available BACKGROUND: Thromboangiitis obliterans (TAO, also known as Buerger's disease is a non-atherosclerotic inflammatory vascular disease that primarily affects arteries in the extremities of young adult smokers. Since the etiology of TAO is still unknown, therapeutic options are limited. Recent attempts in therapeutic angiogenesis have been promising. Therefore, the aim of our study was to evaluate angiogenic processes and factors including circulating progenitor cells in TAO. METHODOLOGY/PRINCIPAL FINDINGS: TAO patients with critical limb ischemia and age- and gender-matched nonsmokers and smokers without cardiovascular disease (n = 12 in each group were enrolled in the study. Flow cytometric analysis of peripheral blood showed significantly decreased levels of circulating CD45(dimCD34(+ progenitor cells in TAO patients and in smokers compared to nonsmokers. In contrast to both control groups, the proportion of CD45(dimCD34(+ progenitor cells co-expressing VEGF receptor-2 (VEGFR2 was significantly elevated in TAO patients. Enzyme-linked immunosorbent assay (ELISA of common angiogenic factors (such as VEGF did not clearly point to pro- or antiangiogenic conditions in serum or plasma of TAO patients. Serum of TAO patients and controls was evaluated in proliferation, migration (scratch assay and spheroid sprouting assays using human umbilical vein endothelial cells (HUVECs. Serum of TAO patients exhibited a diminished sprouting capacity of HUVECs compared to both control groups. Proliferation and migration of endothelial cells were impaired after treatment with serum of TAO patients. CONCLUSION: Levels of circulating progenitor cells were altered in TAO patients compared to healthy nonsmokers and smokers. Furthermore, serum of TAO patients exhibited an antiangiogenic activity (impaired endothelial cell sprouting, migration and proliferation on endothelial cells, which may contribute to vascular pathology in this patient population.

  15. Transient characteristic analysis of integral pressurized water reactor from forced circulation to natural circulation

    International Nuclear Information System (INIS)

    Natural circulation of nuclear reactor has heat dumpling capacity, which can improve the inherent safety of reactor. In this paper, the conceptional design of integrated pressurized water reactor was studied and RELAP5/MOD3.4 was used to analyze transient characteristic in the process from forced circulation to natural circulation. What's more, the influence of reactor power, resistance, moment of inertia of main pump, and various operation strategies on transient characteristic in this conversion process were also studied. (authors)

  16. General circulation modeling of the Jupiter stratosphere

    Science.gov (United States)

    Sethunadh, J.; Medvedev, A. S.; Hartogh, P.

    2012-09-01

    The stratosphere of Jupiter extends for more than 350 km above the cloud top. It is driven almost equally by the radiative heating and cooling within the atmosphere, and by heat from below. We present first results of simulations with the newly developed general circulation model (GCM).

  17. General circulation of the Jovian stratosphere

    Science.gov (United States)

    Medvedev, Alexander S.; Sethunadh, Jisesh; Hartogh, Paul

    The stratosphere of Jupiter is a convectively stable and coldest layer that extends for about 350 km above the tropopause. The dynamics of stratospheres of fast rotating gas giants differ from that of terrestrial-like planets, their modeling is more challenging, and is still little known despite a growing number of observations. We present results of simulations with a newly developed Jovian general circulation model, which covers the altitudes between one bar and one microbar. The results demonstrate a high sensitivity of the circulation to variations of eddy diffusion, which, in turn, depends on the model resolution and assumed background viscosity. In the lower stratosphere, the multiple circulation cells associated with the tropospheric alternating jets dominate. Higher, a weak two-cell equator-to-pole transport forms due to the influence of smaller-scale eddies. The strength and extent of this circulation are defined by the momentum supplied by shallow and vertically propagating waves, and are consistent with observations of the Shoemaker-Levi 9 comet traces. We will also discuss the dynamical implications of our recent finding that radiative forcing exponentially increases with height, rather than approximately constant throughout the Jovian stratosphere, as was thought before (see presentation of T. Kuroda at B0.3 session).

  18. Detecting Holocene changes in thermohaline circulation

    OpenAIRE

    L. D. Keigwin; Boyle, E. A.

    2000-01-01

    Throughout the last glacial cycle, reorganizations of deep ocean water masses were coincident with rapid millennial-scale changes in climate. Climate changes have been less severe during the present interglacial, but evidence for concurrent deep ocean circulation change is ambiguous.

  19. A Circulation Model for Busy Public Libraries.

    Science.gov (United States)

    Bagust, A.

    1983-01-01

    Develops stochastic model of library borrowing using Negative Binomial distribution applied to circulation data obtained from Huddersfield Public Library. Evidence concerning process of popularity decay is presented and method is given by which relegation tests can be constructed to maintain optimum turnover. Eight references and statistical…

  20. Circulating amounts of osteoprotegerin and RANK ligand

    DEFF Research Database (Denmark)

    Abrahamsen, Bo; Hjelmborg, Jacob Vb; Kostenuik, Paul;

    2005-01-01

    UNLABELLED: Osteoprotegerin (OPG) is a circulating receptor that inhibits osteoclastogenesis by binding to RANK ligand (RANKL). OPG knock-out animals develop severe osteoporosis. Treatment with OPG lowers bone resorption and increases BMD. OPG production is influenced by a wide range of hormones ...

  1. Global circulation patterns of seasonal influenza viruses vary with antigenic drift

    Science.gov (United States)

    Bedford, Trevor; Riley, Steven; Barr, Ian G.; Broor, Shobha; Chadha, Mandeep; Cox, Nancy J.; Daniels, Rodney S.; Gunasekaran, C. Palani; Hurt, Aeron C.; Kelso, Anne; Klimov, Alexander; Lewis, Nicola S.; Li, Xiyan; McCauley, John W.; Odagiri, Takato; Potdar, Varsha; Rambaut, Andrew; Shu, Yuelong; Skepner, Eugene; Smith, Derek J.; Suchard, Marc A.; Tashiro, Masato; Wang, Dayan; Xu, Xiyan; Lemey, Philippe; Russell, Colin A.

    2015-07-01

    Understanding the spatiotemporal patterns of emergence and circulation of new human seasonal influenza virus variants is a key scientific and public health challenge. The global circulation patterns of influenza A/H3N2 viruses are well characterized, but the patterns of A/H1N1 and B viruses have remained largely unexplored. Here we show that the global circulation patterns of A/H1N1 (up to 2009), B/Victoria, and B/Yamagata viruses differ substantially from those of A/H3N2 viruses, on the basis of analyses of 9,604 haemagglutinin sequences of human seasonal influenza viruses from 2000 to 2012. Whereas genetic variants of A/H3N2 viruses did not persist locally between epidemics and were reseeded from East and Southeast Asia, genetic variants of A/H1N1 and B viruses persisted across several seasons and exhibited complex global dynamics with East and Southeast Asia playing a limited role in disseminating new variants. The less frequent global movement of influenza A/H1N1 and B viruses coincided with slower rates of antigenic evolution, lower ages of infection, and smaller, less frequent epidemics compared to A/H3N2 viruses. Detailed epidemic models support differences in age of infection, combined with the less frequent travel of children, as probable drivers of the differences in the patterns of global circulation, suggesting a complex interaction between virus evolution, epidemiology, and human behaviour.

  2. Observations of the summer Red Sea circulation

    Science.gov (United States)

    Sofianos, Sarantis S.; Johns, William E.

    2007-06-01

    Aiming at exploring and understanding the summer circulation in the Red Sea, a cruise was conducted in the basin during the summer of 2001 involving hydrographic, meteorological, and direct current observations. The most prominent feature, characteristic of the summer circulation and exchange with the Indian Ocean, is a temperature, salinity, and oxygen minimum located around a depth of 75 m at the southern end of the basin, associated with Gulf of Aden Intermediate Water inflowing from the Gulf of Aden during the summer season as an intruding subsurface layer. Stirring and mixing with ambient waters lead to marked increases in temperature (from 16.5 to almost 33°C) and salinity (from 35.7 to more than 38 psu) in this layer by the time it reaches midbasin. The observed circulation presents a very vigorous pattern with strong variability and intense features that extend the width of the basin. A permanent cyclone, detected in the northern Red Sea, verifies previous observations and modeling studies, while in the central sector of the basin a series of very strong anticyclones were observed with maximum velocities exceeding 1 m/s. The three-layer flow pattern, representative of the summer exchange between the Red Sea and the Gulf of Aden, is observed in the strait of Bab el Mandeb. In the southern part of the basin the layer flow is characterized by strong banking of the inflows and outflows against the coasts. Both surface and intermediate water masses involved in the summer Red Sea circulation present prominent spatial variability in their characteristics, indicating that the eddy field and mixing processes play an important role in the summer Red Sea circulation.

  3. Decontamination of CAGR gas circulator components

    International Nuclear Information System (INIS)

    This paper describes the development and full-scale trial of two methods for removal of radioactive contamination on the surfaces of CAGR gas circulator components. The two methods described are a particle impact cleaning (PIC) decontamination technique and an electrochemical technique, 'electro-swabbing', which is based on the principle of decontamination by electro-polishing. In developing these techniques it was necessary to take account of the physical and chemical nature of the surface deposits on the gas circulator components; these were shown to consist of magnetite-type oxide and carbonaceous material. In order to follow the progress of the decontamination it was also necessary to develop a surface sampling technique which was effective and precise under these conditions; an electrochemical technique, employing similar principles to the electro-swabbing process, was developed for this purpose. The full-scale trial of the PIC decontamination technique was carried out on an inlet guide vane (IGV) assembly, this having been identified as the component from the gas circulator which contributes most to the radiation dose accumulated during routine circulator maintenance. The technique was shown to be practically viable and some 99% of the radioactive contamination was readily removed from the treated surfaces with only negligible surface damage being caused. The full-scale trial of the electro-swabbing decontamination technique was carried out on a gas circulator impeller. High decontamination factors were again achieved with ≥ 99% of the radioactive contamination being removed from the treated surfaces. The technique has practical limitations in terms of handling and treatment of waste-arisings. However, the use of specially-designed swabbing electrodes may allow the treatment of constricted geometries inaccessible to techniques such as PIC. The technique is also highly suitable for the treatment of soft-finish materials and of components fabricated from a

  4. Effects of Microtopography on Overmarsh Circulation

    Science.gov (United States)

    Sullivan, J. C.; Torres, R.; Garrett, A.

    2013-12-01

    Authors: J.C. Sullivan, R. Torres, A.J. Garrett In this study we systematically degrade a high-resolution, high precision salt marsh DEM and characterize the effects of DEM smoothing on overmarsh circulation. The question driving this effort is: How much topographic detail is needed to accurately simulate salt marsh circulation? The hydrodynamic model Delft3D was applied to data from a previous dye-tracer study in a 2 km2 semi-enclosed salt marsh basin at Skidaway Institute of Oceanography near Savannah, Georgia, USA. Overmarsh circulation was simulated for each smoothed DEM over a 5 day period corresponding to spring tide conditions. Results show that flood and ebb pathways differ significantly, but this effect is less apparent as the DEM is smoothed. Also, the flushing time (Tf) decreases with smoothing leading to greater dilution of a dye tracer with each tidal cycle. Observations at the macro, meso and micro scale show that flood and ebb flows become stronger through a consistent set of flow paths, including intertidal creeks, and differences in overmarsh circulation are more apparent in low marsh and channel head areas. This work shows that accurate representation of overmarsh circulation requires that the DEM resolve creek and low lying marsh structures at a spatial scale of 2-4m, but not necessarily the smallest tidal creeks (< 1m in width and depth). The next phase of this work will be to incorporate spatial variations in vegetation cover using RULLI (Remote Ultra Low-Light Imaging) remote sensing technology developed by the Department of Energy.

  5. Circulation factors affecting precipitation over Bulgaria

    Science.gov (United States)

    Nojarov, Peter

    2015-09-01

    The objective of this paper is to determine the influence of circulation factors on precipitation in Bulgaria. The study succeeds investigation on the influence of circulation factors on air temperatures in Bulgaria, as the focus here is directed toward precipitation amounts. Circulation factors are represented through two circulation indices, showing west-east or south-north transport of air masses over Bulgaria and four teleconnection indices (patterns)—North Atlantic Oscillation, East Atlantic, East Atlantic/Western Russia, and Scandinavian. Omega values at 700-hPa level show vertical motions in the atmosphere. Annual precipitation trends are mixed and not statistically significant. A significant decrease of precipitation in Bulgaria is observed in November due to the strengthening of the eastward transport of air masses (strengthening of EA teleconnection pattern) and anticyclonal weather (increase of descending motions in the atmosphere). There is also a precipitation decrease in May and June due to the growing influence of the Azores High. An increase of precipitation happens in September. All this leads to a redistribution of annual precipitation course, but annual precipitation amounts remain the same. However, this redistribution has a negative impact on agriculture and winter ski tourism. Zonal circulation has a larger influence on precipitation in Bulgaria compared to meridional. Eastward transport throughout the year leads to lower than the normal precipitation, and vice versa. With regard to the four teleconnection patterns, winter precipitation in Bulgaria is determined mainly by EA/WR teleconnection pattern, spring and autumn by EA teleconnection pattern, and summer by SCAND teleconnection pattern.

  6. Development Strategies for Rural Key Circulation Service Network

    Institute of Scientific and Technical Information of China (English)

    2012-01-01

    The rural key circulation service network is an important channel for ensuring agricultural products’entry to market and urban industrial products’entry to rural areas.Through in-depth survey and research,we took a look at development changes and current situations of three circulation service networks,namely,circulation of nondurable consumer goods,circulation of agricultural means of production,and circulation of agricultural products.Based on several key problems in rural circulation service network,such as logistics problem,delivery problem,backward transaction mode,and the last kilometer information,we put forward corresponding development countermeasures.

  7. Circulating microRNA profiles of Ebola virus infection

    Science.gov (United States)

    Duy, Janice; Koehler, Jeffrey W.; Honko, Anna N.; Schoepp, Randal J.; Wauquier, Nadia; Gonzalez, Jean-Paul; Pitt, M. Louise; Mucker, Eric M.; Johnson, Joshua C.; O’Hearn, Aileen; Bangura, James; Coomber, Moinya; Minogue, Timothy D.

    2016-01-01

    Early detection of Ebola virus (EBOV) infection is essential to halting transmission and adjudicating appropriate treatment. However, current methods rely on viral identification, and this approach can misdiagnose presymptomatic and asymptomatic individuals. In contrast, disease-driven alterations in the host transcriptome can be exploited for pathogen-specific diagnostic biomarkers. Here, we present for the first time EBOV-induced changes in circulating miRNA populations of nonhuman primates (NHPs) and humans. We retrospectively profiled longitudinally-collected plasma samples from rhesus macaques challenged via intramuscular and aerosol routes and found 36 miRNAs differentially present in both groups. Comparison of miRNA abundances to viral loads uncovered 15 highly correlated miRNAs common to EBOV-infected NHPs and humans. As proof of principle, we developed an eight-miRNA classifier that correctly categorized infection status in 64/74 (86%) human and NHP samples. The classifier identified acute infections in 27/29 (93.1%) samples and in 6/12 (50%) presymptomatic NHPs. These findings showed applicability of NHP-derived miRNAs to a human cohort, and with additional research the resulting classifiers could impact the current capability to diagnose presymptomatic and asymptomatic EBOV infections. PMID:27098369

  8. Circulating microRNA profiles of Ebola virus infection.

    Science.gov (United States)

    Duy, Janice; Koehler, Jeffrey W; Honko, Anna N; Schoepp, Randal J; Wauquier, Nadia; Gonzalez, Jean-Paul; Pitt, M Louise; Mucker, Eric M; Johnson, Joshua C; O'Hearn, Aileen; Bangura, James; Coomber, Moinya; Minogue, Timothy D

    2016-01-01

    Early detection of Ebola virus (EBOV) infection is essential to halting transmission and adjudicating appropriate treatment. However, current methods rely on viral identification, and this approach can misdiagnose presymptomatic and asymptomatic individuals. In contrast, disease-driven alterations in the host transcriptome can be exploited for pathogen-specific diagnostic biomarkers. Here, we present for the first time EBOV-induced changes in circulating miRNA populations of nonhuman primates (NHPs) and humans. We retrospectively profiled longitudinally-collected plasma samples from rhesus macaques challenged via intramuscular and aerosol routes and found 36 miRNAs differentially present in both groups. Comparison of miRNA abundances to viral loads uncovered 15 highly correlated miRNAs common to EBOV-infected NHPs and humans. As proof of principle, we developed an eight-miRNA classifier that correctly categorized infection status in 64/74 (86%) human and NHP samples. The classifier identified acute infections in 27/29 (93.1%) samples and in 6/12 (50%) presymptomatic NHPs. These findings showed applicability of NHP-derived miRNAs to a human cohort, and with additional research the resulting classifiers could impact the current capability to diagnose presymptomatic and asymptomatic EBOV infections. PMID:27098369

  9. Circulating protein synthesis rates reveal skeletal muscle proteome dynamics.

    Science.gov (United States)

    Shankaran, Mahalakshmi; King, Chelsea L; Angel, Thomas E; Holmes, William E; Li, Kelvin W; Colangelo, Marc; Price, John C; Turner, Scott M; Bell, Christopher; Hamilton, Karyn L; Miller, Benjamin F; Hellerstein, Marc K

    2016-01-01

    Here, we have described and validated a strategy for monitoring skeletal muscle protein synthesis rates in rodents and humans over days or weeks from blood samples. We based this approach on label incorporation into proteins that are synthesized specifically in skeletal muscle and escape into the circulation. Heavy water labeling combined with sensitive tandem mass spectrometric analysis allowed integrated synthesis rates of proteins in muscle tissue across the proteome to be measured over several weeks. Fractional synthesis rate (FSR) of plasma creatine kinase M-type (CK-M) and carbonic anhydrase 3 (CA-3) in the blood, more than 90% of which is derived from skeletal muscle, correlated closely with FSR of CK-M, CA-3, and other proteins of various ontologies in skeletal muscle tissue in both rodents and humans. Protein synthesis rates across the muscle proteome generally changed in a coordinate manner in response to a sprint interval exercise training regimen in humans and to denervation or clenbuterol treatment in rodents. FSR of plasma CK-M and CA-3 revealed changes and interindividual differences in muscle tissue proteome dynamics. In human subjects, sprint interval training primarily stimulated synthesis of structural and glycolytic proteins. Together, our results indicate that this approach provides a virtual biopsy, sensitively revealing individualized changes in proteome-wide synthesis rates in skeletal muscle without a muscle biopsy. Accordingly, this approach has potential applications for the diagnosis, management, and treatment of muscle disorders. PMID:26657858

  10. Extracellular circulating viral microRNAs: current knowledge and perspectives

    Directory of Open Access Journals (Sweden)

    Alessandro eLagana'

    2013-06-01

    Full Text Available MicroRNAs (miRNAs are small non coding RNAs responsible of post-transcriptional regulation of gene expression through interaction with messenger RNAs (mRNAs. They are involved in important biological processes and are often dysregulated in a variety of diseases, including cancer and infections. Viruses also encode their own sets of miRNAs, which they use to control the expression of either the host's genes and/or their own. In the past few years evidence of the presence of cellular miRNAs in extracellular human body fluids such as serum, plasma, saliva, and urine has accumulated. They have been found either cofractionate with the Argonaute2 (Ago2 protein or in membrane-bound vesicles such as exosomes. Although little is known about the role of circulating miRNAs, it has been demonstrated that miRNAs secreted by virus infected cells are transferred to and act in uninfected recipient cells. In this mini review we summarize the current knowledge on viral circulating miRNAs and provide a few examples of computational prediction of their function.

  11. Study in rabbits of portal circulation by a radioisotopic method

    International Nuclear Information System (INIS)

    The development of a precocius - and noninvasive method for the detection of portal circulation alterations by means of time interval measurements between the rectal administration of radiotracers and their detection in liver and head is aimed at. The pertecnetate (99sup(m)Tc)- and iodate (131I) absorption by the terminal large intestine was tested in 22 rabbits. The time iinterval between rectal administration of the radiotracer and its appearance in liver and head was determined in 12 rabbits, by external detection with a scintillation camera. The same parameters were studied in 9 animals submitted to the ligature of the portal vein. Iodate and pertecnetate are absorbed by the terminal large intestine, the pertecnetate absorption being significantly smaller than that of iodate. The pertecnetate distribution volume is smaller than that of iodate; the rectum - liver - and rectum - head time intervals is increased in animals with the ligature of portal vein. Application of the method to larger animals will permit the necessary improvements for its utilization as a precocius - noninvasive - and inocuous test in the evaluation of alteration of the human portal circulation. (Author)

  12. Impact of fatty acids on brain circulation, structure and function.

    Science.gov (United States)

    Haast, Roy A M; Kiliaan, Amanda J

    2015-01-01

    The use of dietary intervention has evolved into a promising approach to prevent the onset and progression of brain diseases. The positive relationship between intake of omega-3 long chain polyunsaturated fatty acids (ω3-LCPUFAs) and decreased onset of disease- and aging-related deterioration of brain health is increasingly endorsed across epidemiological and diet-interventional studies. Promising results are found regarding to the protection of proper brain circulation, structure and functionality in healthy and diseased humans and animal models. These include enhanced cerebral blood flow (CBF), white and gray matter integrity, and improved cognitive functioning, and are possibly mediated through increased neurovascular coupling, neuroprotection and neuronal plasticity, respectively. Contrary, studies investigating diets high in saturated fats provide opposite results, which may eventually lead to irreversible damage. Studies like these are of great importance given the high incidence of obesity caused by the increased and decreased consumption of respectively saturated fats and ω3-LCPUFAs in the Western civilization. This paper will review in vivo research conducted on the effects of ω3-LCPUFAs and saturated fatty acids on integrity (circulation, structure and function) of the young, aging and diseased brain. PMID:24485516

  13. Introduction and prolonged circulation of G12 rotaviruses in Sicily.

    Science.gov (United States)

    Giammanco, G M; Bonura, F; DI Bernardo, F; Cascio, A; Ferrera, G; Dones, P; Saporito, L; Collura, A; Terranova, D M; Valenzise, M; Allù, M T; Casuccio, N; Palermo, M; Bányai, K; Martella, V; DE Grazia, S

    2016-07-01

    Genotype G12 strains are now considered to be the sixth most prevalent human rotaviruses worldwide. In two Sicilian cities, Palermo and Messina, surveillance of rotavirus circulation performed since 1985 and 2009, respectively, did not detect G12 strains until 2012. From 2012 to 2014 rotavirus infection was detected in 29·7% of 1647 stool samples collected from children admitted for acute gastroenteritis to three Sicilian hospitals in Palermo, Messina and Ragusa. In 2012, G12P[8] was first detected in Palermo and then in Messina where it represented the second most frequent genotype (20% prevalence) after G1P[8]. Thereafter, G12 strains continued to circulate in Sicily, showing a marked prevalence in Ragusa (27·8%) in 2013 and in Palermo (21%) and Messina (16·6%) in 2014. All but one of the Sicilian G12 strains carried a P[8] VP4 genotype, whereas the single non-P[8] rotavirus strain was genotyped as G12P[9]. Phylogenetic analysis of the VP7 and VP4 sequences allowed distinction of several genetic lineages and separation of the G12P[8] strains into three cluster combinations. These findings indicate independent introductions of G12 rotavirus strains in Sicily in recent years. PMID:26743189

  14. Genetic engineering of platelets to neutralize circulating tumor cells.

    Science.gov (United States)

    Li, Jiahe; Sharkey, Charles C; Wun, Brittany; Liesveld, Jane L; King, Michael R

    2016-04-28

    Mounting experimental evidence demonstrates that platelets support cancer metastasis. Within the circulatory system, platelets guard circulating tumor cells (CTCs) from immune elimination and promote their arrest at the endothelium, supporting CTC extravasation into secondary sites. Neutralization of CTCs in blood circulation can potentially attenuate metastases to distant organs. Therefore, extensive studies have explored the blockade of platelet-CTC interactions as an anti-metastatic strategy. Such an intervention approach, however, may cause bleeding disorders since the platelet-CTC interactions inherently rely on the blood coagulation cascade including platelet activation. On the other hand, platelets have been genetically engineered to correct inherited bleeding disorders in both animal models and human clinical trials. In this study, inspired by the physical association between platelets and CTCs, platelets were genetically modified to express surface-bound tumor necrosis factor-related apoptosis-inducing ligand (TRAIL), a cytokine known to induce apoptosis specifically in tumor cells. The TRAIL-expressing platelets were demonstrated to kill cancer cells in vitro and significantly reduce metastases in a mouse model of prostate cancer metastasis. Our results suggest that using platelets to produce and deliver cancer-specific therapeutics can provide a Trojan-horse strategy of neutralizing CTCs to attenuate metastasis. PMID:26921521

  15. The aryl hydrocarbon receptor and estrogen receptor alpha differentially modulate nuclear factor erythroid-2-related factor 2 transactivation in MCF-7 breast cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Lo, Raymond; Matthews, Jason, E-mail: jason.matthews@utoronto.ca

    2013-07-15

    Nuclear factor erythroid-2-related factor 2 (NRF2; NFE2L2) plays an important role in mediating cellular protection against reactive oxygen species. NRF2 signaling is positively modulated by the aryl hydrocarbon receptor (AHR) but inhibited by estrogen receptor alpha (ERα). In this study we investigated the crosstalk among NRF2, AHR and ERα in MCF-7 breast cancer cells treated with the NRF2 activator sulforaphane (SFN), a dual AHR and ERα activator, 3,3′-diindolylmethane (DIM), 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) or 17β-estradiol (E2). SFN-dependent increases in NADPH-dependent oxidoreductase 1 (NQO1) and heme oxygenase I (HMOX1) mRNA levels were significantly reduced after co-treatment with E2. E2-dependent repression of NQO1 and HMOX1 was associated with increased ERα but reduced p300 recruitment and reduced histone H3 acetylation at both genes. In contrast, DIM + SFN or TCDD + SFN induced NQO1 and HMOX1 mRNA expression to levels higher than SFN alone, which was prevented by RNAi-mediated knockdown of AHR. DIM + SFN but not TCDD + SFN also induced recruitment of ERα to NQO1 and HMOX1. However, the presence of AHR at NQO1 and HMOX1 restored p300 recruitment and histone H3 acetylation, thereby reversing the ERα-dependent repression of NRF2. Taken together, our study provides further evidence of functional interplay among NRF2, AHR and ERα signaling pathways through altered p300 recruitment to NRF2-regulated target genes. - Highlights: • We examined crosstalk among ERα, AHR, and NRF2 in MCF-7 breast cancer cells. • AHR enhanced the mRNA expression levels of two NRF2 target genes – HMOX1 and NQO1. • ERα repressed HMOX1 and NQO1 expression via decreased histone acetylation. • AHR prevented ERα-dependent repression of HMOX1 and NQO1.

  16. Quantitative measurement of blood circulation in tests of rats using nuclear medical methods

    International Nuclear Information System (INIS)

    The experiments show that is it is possible to quantitatively assess the blood circulation and, within limits, the germinative function of tests by measuring the impulses of an incorporated radionuclide (99-Tc-pertechnetate) using an uptake measuring instrument. This is a rapid and unbloody method to be adopted in human medicine. 'Acute tests' or pre-damaged tests can thus be exactly diagnosed. In the former case the circulation modification and in the latter the evaluation of the germinative function ability is of main interest. The most important measuring criterion is the 15-minute-uptake U; it represents the blood circulation in the tests measured. The germinative function ability is evaluated on the basis of the accumulation activity Nsub(max). (orig./MG)

  17. A modified Phenol-chloroform extraction method for isolating circulating cell free DNA of tumor patients

    Directory of Open Access Journals (Sweden)

    Clemens Hufnagl

    2013-03-01

    Full Text Available Searching for new cancer biomarkers, circulating cell-free DNA (cfDNA has become an appealing target of interest as an elevated level of cfDNA has been detected in the circulation of cancer patients in comparison with healthy controls. Since cfDNA can be isolated from the circulation and other body fluids of patients without harming their physical condition, cfDNA is becoming a promising candidate as a novel non-invasive biomarker for cancer. The challenge in the diagnostic analysis of cfDNA is its very low presence in human plasma/serum and its partially strong fragmentation. Here we evaluated a modified phenol/chloroform extraction method for the isolation of cfDNA and compared it with published standard methods for cfDNA isolation.

  18. Circulating follistatin is liver-derived and regulated by the glucagon-to-insulin ratio

    DEFF Research Database (Denmark)

    Hansen, Jakob S; Rutti, Sabine; Arous, Caroline; Clemmesen, Jens O; Secher, Niels H; Drescher, Andrea; Gonelle-Gispert, Carmen; Halban, Philippe A; Pedersen, Bente K; Weigert, Cora; Bouzakri, Karim; Plomgaard, Peter

    2016-01-01

    CONTEXT: Follistatin is a plasma protein recently reported to increase under conditions with negative energy balance such as exercise and fasting in humans. Currently, the perception is that circulating follistatin is a result of para/autocrine actions from various tissues. The large and acute...... that in humans the liver is a major contributor to circulating follistatin both at rest and during exercise. Glucagon increases and insulin inhibits follistatin secretion both in vivo and in vitro mediated via the secondary messenger cAMP in the hepatocyte. Short-term follistatin treatment reduced...... glucagon secretion from islets of Langerhans, whereas long-term follistatin treatment prevented apoptosis and induced proliferation of rat β-cells. CONCLUSIONS: In conclusion, in humans, the liver secretes follistatin at rest and during exercise and the glucagon-to-insulin ratio is a key determinant of...

  19. Circulation patterns in active lava lakes

    Science.gov (United States)

    Redmond, T. C.; Lev, E.

    2014-12-01

    Active lava lakes provide a unique window into magmatic conduit processes. We investigated circulation patterns of 4 active lava lakes: Kilauea's Halemaumau crater, Mount Erebus, Erta Ale and Nyiragongo, and in an artificial "lava lake" constructed at the Syracuse University Lava Lab. We employed visual and thermal video recordings collected at these volcanoes and use computer vision techniques to extract time-dependent, two-dimensional surface velocity maps. The large amount of data available from Halemaumau enabled us to identify several characteristic circulation patterns. One such pattern is a rapid acceleration followed by rapid deceleration, often to a level lower than the pre-acceleration level, and then a slow recovery. Another pattern is periodic asymmetric peaks of gradual acceleration and rapid deceleration, or vice versa, previously explained by gas pistoning. Using spectral analysis, we find that the dominant period of circulation cycles at approximately 30 minutes, 3 times longer than the dominant period identified previously for Mount Erebus. Measuring a complete surface velocity field allowed us to map and follow locations of divergence and convergence, therefore upwelling and downwelling, thus connecting the surface flow with that at depth. At Nyiragongo, the location of main upwelling shifts gradually, yet is usually at the interior of the lake, for Erebus it is usually along the perimeter yet often there is catastrophic downwelling at the interior; For Halemaumau upwelling/downwelling position is almost always on the perimeter. In addition to velocity fields, we developed an automated tool for counting crustal plates at the surface of the lava lakes, and found a correlation, and a lag time, between changes if circulation vigor and the average size of crustal plates. Circulation in the artificial basaltic lava "lake" was limited by its size and degree of foaming, yet we measured surface velocities and identify patterns. Maximum surface velocity

  20. Isolation and Molecular Characterization of Circulating Melanoma Cells

    Directory of Open Access Journals (Sweden)

    Xi Luo

    2014-05-01

    Full Text Available Melanoma is an invasive malignancy with a high frequency of blood-borne metastases, but circulating tumor cells (CTCs have not been readily isolated. We adapted microfluidic CTC capture to a tamoxifen-driven B-RAF/PTEN mouse melanoma model. CTCs were detected in all tumor-bearing mice and rapidly declined after B-RAF inhibitor treatment. CTCs were shed early from localized tumors, and a short course of B-RAF inhibition following surgical resection was sufficient to dramatically suppress distant metastases. The large number of CTCs in melanoma-bearing mice enabled a comparison of RNA-sequencing profiles with matched primary tumors. A mouse melanoma CTC-derived signature correlated with invasiveness and cellular motility in human melanoma. CTCs were detected in smaller numbers in patients with metastatic melanoma and declined with successful B-RAF-targeted therapy. Together, the capture and molecular characterization of CTCs provide insight into the hematogenous spread of melanoma.

  1. EVALUATION OF AERATION/CIRCULATION AS A LAKE RESTORATION TECHNIQUE

    Science.gov (United States)

    Artificial circulation and hypolimnetic aeration are management techniques for oxygenating eutrophic lakes subject to water quality problems, algal blooms, and fishkills. Artificial circulation is achieved by injecting diffused air into lower waters, by mechanial pumping of water...

  2. Silent Circulation of Ross River Virus in French Polynesia

    Directory of Open Access Journals (Sweden)

    Maite Aubry

    2015-08-01

    Discussion: Our results support the existence of autochthonous RRV transmission and suggest that this pathogen has silently circulated in French Polynesia. These findings raise the question of possible undetected circulation of RRV in other Pacific Island Countries and Territories.

  3. Anti-cyclonic circulation driven by the estuarine circulation in a gulf type ROFI

    Science.gov (United States)

    Fujiwara, T.; Sanford, L. P.; Nakatsuji, K.; Sugiyama, Y.

    1997-08-01

    Baroclinic residual circulation processes are examined in gulf type Regions Of Freshwater Influence (ROFIs), which have large rivers discharging into a rounded head wider than the Rossby internal deformation radius. Theoretical and observational investigations concentrate on Ise Bay, Japan, with supporting data from Osaka Bay and Tokyo Bay. Simplified analytical solutions are derived to describe the primary features of the circulation. Three dimensional residual current data collected using moored current meters and shipboard acoustic doppler current profilers (ADCPs), satellite imagery and density structure data observed using STDs, are presented for comparison to the theoretical predictions. There are three key points to understanding the resulting circulation in gulf type ROFIs. First, there are likely to be three distinct water masses: the river plume, a brackish upper layer, and a higher salinity lower layer. Second, baroclinic processes in gulf type ROFIs are influenced by the Earth's rotation at first order. Residual currents are quasi-geostrophic and potential vorticity is approximately conserved. Third, the combined effects of a classical longitudinal estuarine circulation and the Earth's rotation are both necessary to produce the resulting circulation. Anti-cyclonic vorticity is generated in the upper layer by the horizontal divergence associated with upward entrainment, which is part of the estuarine circulation. The interaction between anti-cyclonic vorticity and horizontal divergence results in two regions of qualitatively different circulation, with gyre-like circulation near the bay head and uniformly seaward anti-cyclonicly sheared flow further towards the mouth. The stagnation point separating the two regions is closer to (further away from) the bay head for stronger (weaker) horizontal divergence, respectively. The vorticity and spin-up time of this circulation are-(ƒ-ω 1)/2 and h/2w 0, respectively, where ƒ is the Coriolis parameter, ω 1 is

  4. Cognitive problems related to vertebrobasilar circulation.

    Science.gov (United States)

    Koçer, Abdulkadir

    2015-01-01

    Neurodegenerative disorders are characterized by decreased regional cerebral blood flow. Supporting this concept, both cognitive training exercises and physical activity promote blood flow increase and correlate with healthy cognitive aging. The terminal branches of the posterior circulation supply blood to areas of the brain, such as the thalamus, hippocampus, occipital lobe, and cerebellum, involved with important intellectual functions, particularly recent memory, visual-spatial functioning, and visuomotor adaptations. Amnesia and visual agnosia may be a complication of not only posterior circulation infarctions but also vertebrobasilar insufficiency (VBI) without accompanying structural infarcts. The cognitive impairment maybe a manifestation of transient attacks and may persist beyond resolution of symptoms related to ischemia. Early recognition of cognitive deficits in the VBI patient is important because several recent reports show stent placements or medical treatment may improve cognition. PMID:26738337

  5. The circulation of care in transnational families

    Directory of Open Access Journals (Sweden)

    Laura Merla

    2014-09-01

    Full Text Available This article presents an approach to transnational family solidarity in terms of the “circulation of care”. This approach is based on a multidimensional vision of care-giving that goes beyond the personal care given to a dependent person. It takes the whole family network as its unit of analysis, and uses it to show the multiplicity of actors and the roles they play in the maintenance of transnational family solidarity in the long term. The article provides an analysis model of the institutional contexts that partially constitute the resources necessary for the circulation of care, recognising that other factors, such as the history of intra-family relationships, influence the dynamics at play.

  6. Natural circulation in pressurized water reactors

    International Nuclear Information System (INIS)

    Several analytical modelling have been done for steady-state and slow transients conditions, besides more sophisticated studies considering two and three dimensional effects in a very simple geometry. Under severe accident conditions for PWR a code to analyse natural circulation has been developed by Westinghouse. This paper discusses the problem of natural circulation in a complex geometry similar to that of nuclear power plants. A first experiment has been done at the integral test facility of 'Co-ordination of Special Projects-Ministry of Naval Affairs' (Coordenadoria para Projetos Especiais -Ministerio da Marinha, COPESP) for several flux conditions. The results obtained were compared with numerical simulations for the steady-state regime. 09 refs, 05 figs, 01 tab. (B.C.A.)

  7. Meridional circulation in turbulent protoplanetary disks

    CERN Document Server

    Fromang, Sebastien; Masset, Frederic

    2011-01-01

    Based on viscous disk theory, a number of recent studies have suggested the existence of a large scale meridional circulation in protoplanetary disks. Such a flow could account for the presence of crystalline silicates, among which Calcium and Aluminium-rich Inclusions (CAIs), at large distances from the sun. This paper aims at examining whether such large scale flows exist in turbulent protoplanetary disks. High resolution global hydrodynamical and magnetohydrodynamical numerical simulations of turbulent protoplanetary disks are used to infer the properties of the flow in such disks. By performing hydrodynamic simulations using explicit viscosity, we demonstrate that our numerical setup does not suffer from any numerical artifact. The aforementioned meridional circulation is readily recovered in viscous and laminar disks. In MHD simulations, the magneto-rotational instability drives turbulence in the disks. Averaging out the turbulent fluctuations over long timescale, the results fail to show any large scale...

  8. The design of large natural circulation BWR's

    International Nuclear Information System (INIS)

    Boiling water reactors (BWR) with natural circulation are applied for capacities up to 60 MWe. Based on scale studies, however, it appears that larger production units are more efficient. It is recommended to investigate the bottlenecks in realizing larger reactors (>1000 MWe). The aim of the study on the title subject is to study to what extent the production capacity of BWRs with natural circulation can be increased. Based on data from the literature a simple analytic method has been chosen and existing BWR designs were compared. Capacities of 1300 MWe appear to be possible. These reactors will have a smaller pin diameter and a lower water supply temperature. Also steam separators with a minor pressure reduction must be available. The reliability of the stability measurement must be increased. Based on the results of this investigation the priorities for research on the design of future BWRs have been determined

  9. Formation and plasma circulation of solar prominences

    CERN Document Server

    Xia, Chun

    2016-01-01

    Solar prominences are long-lived cool and dense plasma curtains in the hot and rarefied outer solar atmosphere or corona. The physical mechanism responsible for their formation and especially for their internal plasma circulation has been uncertain for decades. The observed ubiquitous down flows in quiescent prominences are difficult to interpret as plasma with high conductivity seems to move across horizontal magnetic field lines. Here we present three-dimensional numerical simulations of prominence formation and evolution in an elongated magnetic flux rope as a result of in-situ plasma condensations fueled by continuous plasma evaporation from the solar chromosphere. The prominence is born and maintained in a fragmented, highly dynamic state with continuous reappearance of multiple blobs and thread structures that move mainly downward dragging along mass-loaded field lines. The prominence plasma circulation is characterized by the dynamic balance between the drainage of prominence plasma back to the chromos...

  10. Blood flow in the human fetal descending aorta : a pulsed Doppler study

    OpenAIRE

    Pijpers, Leendert

    1985-01-01

    textabstractIn 1628 William Harvey introduced his concept ofthe human circulation. Although a lot of studies concerning the fetal circulation were done before it was not until the 1930s that Barcroft (1934, 1939) and associates performed radiograpbic studies on the feta! goal and lamb to establish the feta! circulation. Later in 1964 Lind, Stern and Wegelius used cine-angiographic studies to describe the human fetal circulation. Volume flow measurements were already carried out in 1884 by Coh...

  11. The global ocean circulation on a retrograde rotating earth

    OpenAIRE

    Kamphuis, V.; Huisman, S.E.; Dijkstra, H. A.

    2011-01-01

    To understand the three-dimensional ocean circulation patterns that have occurred in past continental geometries, it is crucial to study the role of the present-day continental geometry and surface (wind stress and buoyancy) forcing on the present-day global ocean circulation. This circulation, often referred to as the Conveyor state, is characterised by an Atlantic Meridional Overturning Circulation (MOC) with a deep water formation at northern latitudes and the absence of ...

  12. Meridional circulation in turbulent protoplanetary disks

    OpenAIRE

    Fromang, Sebastien; Lyra, Wladimir; Masset, Frederic

    2011-01-01

    Based on the viscous disk theory, a number of recent studies have suggested there is large scale meridional circulation in protoplanetary disks. Such a flow could account for the presence of crystalline silicates, including calcium- and aluminum-rich inclusions (CAIs), at large distances from the sun. This paper aims at examining whether such large-scale flows exist in turbulent protoplanetary disks. High-resolution global hydrodynamical and magnetohydrodynamical (MHD) numerical simulations o...

  13. Isolation of Circulating Tumor Cells by Dielectrophoresis

    OpenAIRE

    Gascoyne, Peter R.C.; Sangjo Shim

    2014-01-01

    Dielectrophoresis (DEP) is an electrokinetic method that allows intrinsic dielectric properties of suspended cells to be exploited for discrimination and separation. It has emerged as a promising method for isolating circulation tumor cells (CTCs) from blood. DEP-isolation of CTCs is independent of cell surface markers. Furthermore, isolated CTCs are viable and can be maintained in culture, suggesting that DEP methods should be more generally applicable than antibody-based approaches. The aim...

  14. Water circulation forecasting in Spanish harbours

    OpenAIRE

    Grifoll, Manel; Jordá, Gabriel; Sotillo, Marcos G.; Ferrer, Luis; Espino, Manuel; Sánchez-Arcilla, Agustín; Álvarez-Fanjul, Enrique

    2012-01-01

    This paper describes the first harbour circulation forecasting system implemented in Spain. The configuration design was based on previous analyses of the morphologic and hydrodynamic behaviour of three harbours: Barcelona, Tarragona and Bilbao. A nested system of oceanic models was implemented, with a scope ranging from the regional scale (with a mean horizontal resolution of 5 km) to the harbour scale (with a mean horizontal resolution of 40 m). A set of sensitivity tests was carried out in...

  15. Parallel Computing of Ocean General Circulation Model

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    This paper discusses the parallel computing of the thirdgeneration Ocea n General Circulation Model (OGCM) from the State Key Laboratory of Numerical Mo deling for Atmospheric Science and Geophysical Fluid Dynamics(LASG),Institute of Atmosphere Physics(IAP). Meanwhile, several optimization strategies for paralle l computing of OGCM (POGCM) on Scalable Shared Memory Multiprocessor (S2MP) are presented. Using Message Passing Interface (MPI), we obtain super linear speedup on SGI Origin 2000 for parallel OGCM(POGCM) after optimization.

  16. Transients in a circulating fluidized bed boiler

    OpenAIRE

    Baskakov, A. P.; Munts, V. A.; Pavlyuk, E. Yu.

    2013-01-01

    Transients in a circulating fluidized bed boiler firing biomass are considered. An attempt is made to describe transients with the use of concepts applied in the automatic control theory. The parameters calculated from an analysis of unsteady heat balance equations are compared with the experimental data obtained in the 12-MW boiler of the Chalmers University of Technology. It is demonstrated that these equations describe the transient modes of operation with good accuracy. Dependences for ca...

  17. Circulating fluidized bed boilers design and operations

    CERN Document Server

    Basu, Prabir

    1991-01-01

    This book provides practicing engineers and students with insight into the design and operation of circulating fluidized bed (CFB) boilers. Through a combination of theoretical concepts and practical experience, this book gives the reader a basic understanding of the many aspects of this subject.Important environmental considerations, including solid waste disposal and predicted emissions, are addressed individually in separate chapters. This book places an emphasis on combustion, hydrodynamics, heat transfer, and material issues, and illustrates these concepts with numerous examples of pres

  18. Fluctuation Theorem in an Atmospheric Circulation Model

    CERN Document Server

    Schalge, Bernd; Wouters, Jeroen; Fraedrich, Klaus; Lunkeit, Frank

    2012-01-01

    Evidence for the validity of the Fluctuation Theorem (FT) in an atmospheric Global Circulation Model is found. The model is hydrostatic with variable numbers of vertical levels and different horizontal resolutions. For finite time intervals the largest local Lyapunov exponent (LLLE) is found to be negative consistent with predictions of the FT. The effect is present for resolutions up to wave numbers l=42 (~ 250km) and 10 levels.

  19. The creation and circulation of public geographies

    OpenAIRE

    Kitchin, Rob; Linehan, Denis; O'Callaghan, Cian; Lawton, Philip

    2013-01-01

    In response to the commentaries, we discuss further how social media disrupts and remakes the creation and circulation of geographical knowledges and potentially reconfigures the moral economy of the social sciences. In particular, we examine questions of what is meant by public geography, the publics which such geographies serve, alternative and complementary approaches to social media, the politics of authorship within collective blogs, the politics and mechanisms of knowledge c...

  20. Circulating somatostatin. Physiological regulator of pancreatic function?

    OpenAIRE

    Gyr, K; Beglinger, C; Köhler, E; Trautzl, U; Keller, U.; Bloom, S R

    1987-01-01

    The present study was designed to determine whether somatostatin is released into the circulation in sufficient amounts to regulate exocrine and endocrine pancreatic function and to evaluate the possible role of somatostatin as a hormonal regulator of the pancreas. Mean plasma somatostatin levels (SLI) increased from 11 +/- 2 pmol liter-1 to peak concentrations of 18 +/- 2 in six healthy male volunteers after a steak meal (P less than 0.05). Infusion of somatostatin inhibited hormone-induced ...