WorldWideScience

Sample records for ciona intestinalis transcriptional

  1. Taxonomy Icon Data: Ciona intestinalis (Sea squirt) [Taxonomy Icon

    Lifescience Database Archive (English)

    Full Text Available Ciona intestinalis (Sea squirt) Ciona intestinalis Chordata/Urochordata,Cephalochordata Ciona_intest...inalis_L.png Ciona_intestinalis_NL.png Ciona_intestinalis_S.png Ciona_intestinalis_NS.png h...ttp://biosciencedbc.jp/taxonomy_icon/icon.cgi?i=Ciona+intestinalis&t=L http://biosciencedbc.jp/taxonomy_icon/icon.cgi?i=Ciona+intest...inalis&t=NL http://biosciencedbc.jp/taxonomy_icon/icon.cgi?i=Ciona+intest...inalis&t=S http://biosciencedbc.jp/taxonomy_icon/icon.cgi?i=Ciona+intestinalis&t=NS ...

  2. Genome-wide identification and characterization of transcription start sites and promoters in the tunicate Ciona intestinalis.

    Science.gov (United States)

    Yokomori, Rui; Shimai, Kotaro; Nishitsuji, Koki; Suzuki, Yutaka; Kusakabe, Takehiro G; Nakai, Kenta

    2016-01-01

    The tunicate Ciona intestinalis, an invertebrate chordate, has recently emerged as a powerful model organism for gene regulation analysis. However, few studies have been conducted to identify and characterize its transcription start sites (TSSs) and promoters at the genome-wide level. Here, using TSS-seq, we identified TSSs at the genome-wide scale and characterized promoters in C. intestinalis. Specifically, we identified TSS clusters (TSCs), high-density regions of TSS-seq tags, each of which appears to originate from an identical promoter. TSCs were found not only at known TSSs but also in other regions, suggesting the existence of many unknown transcription units in the genome. We also identified candidate promoters of 79 ribosomal protein (RP) genes, each of which had the major TSS in a polypyrimidine tract and showed a sharp TSS distribution like human RP gene promoters. Ciona RP gene promoters, however, did not appear to have typical TATA boxes, unlike human RP gene promoters. In Ciona non-RP promoters, two pyrimidine-purine dinucleotides, CA and TA, were frequently used as TSSs. Despite the absence of CpG islands, Ciona TATA-less promoters showed low expression specificity like CpG-associated human TATA-less promoters. By using TSS-seq, we also predicted trans-spliced gene TSSs and found that their downstream regions had higher G+T content than those of non-trans-spliced gene TSSs. Furthermore, we identified many putative alternative promoters, some of which were regulated in a tissue-specific manner. Our results provide valuable information about TSSs and promoter characteristics in C. intestinalis and will be helpful in future analysis of transcriptional regulation in chordates.

  3. Characterization and transcription studies of a phytochelatin synthase gene from the solitary tunicate Ciona intestinalis exposed to cadmium

    Energy Technology Data Exchange (ETDEWEB)

    Franchi, Nicola [Department of Biology, University of Padova, Padova (Italy); Department of Biological, Chemical, Pharmaceutical Science and Technology, University of Palermo, Palermo (Italy); Piccinni, Ester [Department of Biology, University of Padova, Padova (Italy); Ferro, Diana [Department of Biology, University of Padova, Padova (Italy); Institute for Evolution and Biodiversity, Westfälische Wilhelms-Universität, Münster (Germany); Basso, Giuseppe [Department of Woman and Child Health, University of Padova, Padova (Italy); Spolaore, Barbara [CRIBI Biotechnology Centre, University of Padova, Padova (Italy); Department of Pharmaceutical and Pharmacological Sciences, University of Padova, Padova (Italy); Santovito, Gianfranco, E-mail: gianfranco.santovito@unipd.it [Department of Biology, University of Padova, Padova (Italy); Ballarin, Loriano [Department of Biology, University of Padova, Padova (Italy)

    2014-07-01

    Highlights: • Ciona intestinalis have a functional phytochelatin synthase (PCS) gene (cipcs). • CiPCS amino acid sequence is phylogentically related to other metazoan PCSs. • CiPCS catalyze the synthesis of PC2. • cipcs are mostly transcribed in circulating hemocytes, in both tunic and blood lacunae. • Cadmium exposure results in a significant increase of cipcs and cipcna transcription. - Abstract: The major thiol-containing molecules involved in controlling the level of intracellular ROS in eukaryotes, acting as a nonenzymatic detoxification system, are metallothioneins (MTs), glutathione (GSH) and phytochelatins (PCs). Both MTs and GSH are well-known in the animal kingdom. PC was considered a prerogative of the plant kingdom but, in 2001, a phytochelatin synthase (PCS) gene was described in the nematode Caenorhabditis elegans; additional genes encoding this enzyme were later described in the earthworm Eisenia fetida and in the parasitic nematode Schistosoma mansoni but scanty data are available, up to now, for Deuterostomes. Here, we describe the molecular characteristics and transcription pattern, in the presence of Cd, of a PCS gene from the invertebrate chordate Ciona intestinalis, a ubiquitous solitary tunicate and demonstrate the presence of PCs in tissue extracts. We also studied mRNA localization by in situ hybridization. In addition, we analyzed the behavior of hemocytes and tunic cells consequent to Cd exposure as well as the transcription pattern of the Ciona orthologous for proliferating cell nuclear antigen (PCNA), usually considered a proliferation marker, and observed that cell proliferation occurs after 96 h of Cd treatment. This matches the hypothesis of Cd-induced cell proliferation, as already suggested by previous data on the expression of a metallothionein gene in the same animal.

  4. Characterization and metal-induced gene transcription of two new copper zinc superoxide dismutases in the solitary ascidian Ciona intestinalis

    Energy Technology Data Exchange (ETDEWEB)

    Ferro, Diana [Department of Biology, University of Padova, Padova (Italy); Institute for Evolution and Biodiversity, Westfälische Wilhelms-Universität, Münster (Germany); Franchi, Nicola [Department of Biology, University of Padova, Padova (Italy); Department of Biological, Chemical, Pharmaceutical Science and Technology, University of Palermo, Palermo (Italy); Mangano, Valentina [Department of Biological, Chemical, Pharmaceutical Science and Technology, University of Palermo, Palermo (Italy); Bakiu, Rigers [Department of Crop Production, Agricultural University of Tirana, Tirana (Albania); Cammarata, Matteo; Parrinello, Nicolò [Department of Biological, Chemical, Pharmaceutical Science and Technology, University of Palermo, Palermo (Italy); Santovito, Gianfranco, E-mail: gianfranco.santovito@unipd.it [Department of Biology, University of Padova, Padova (Italy); Ballarin, Loriano [Department of Biology, University of Padova, Padova (Italy)

    2013-09-15

    Highlights: •Ciona intestinalis express two copper-zinc superoxide dismutases (Cu,Zn SODs), one extracellular (Ci-SODa) and one intracellular isoform (Ci-SODb). •Promoters contain consensus sequences similar to mammalian MRE. •Metal exposure results in a significant increase of gene transcription: ci-soda is induced especially by copper and zinc, the increase of ci-sodb transcription is more evident after cadmium exposure. •Genes are mostly transcribed in circulating hemocytes and in ovarian follicular cells. -- Abstract: Antioxidant enzymes are known to protect living organisms against the oxidative stress risk, also induced by metals. In the present study, we describe the purification and molecular characterization of two Cu,Zn superoxide dismutases (SODs), referred to as Ci-SODa and Ci-SODb, from Ciona intestinalis, a basal chordate widely distributed in temperate shallow seawater. The putative amino acid sequences were compared with Cu,Zn SODs from other metazoans and phylogenetic analyses indicate that the two putative Ci-SODs are more related to invertebrate SODs than vertebrate ones. Both phylogenetic and preliminary homology modeling analyses suggest that Ci-SODa and Ci-SODb are extracellular and intracellular isoform, respectively. The mRNA of the two Cu,Zn SODs was localized in hemocytes and in ovarian follicular cells, as revealed by in situ hybridization. The time course of SOD mRNA levels in the presence of three different metals showed upregulation of ci-soda and inhibition of ci-sodb. Spectrophotometric analysis confirms the presence of SOD activity in Ciona tissues. Our in silico analyses of the ci-soda promoter region revealed putative consensus sequences similar to mammalian metal-responsive elements (MRE), suggesting that the transcription of these genes directly depends on metals. These data emphasize the importance of complex metal regulation of ci-soda and ci-sodb transcription, as components of an efficient detoxification pathway

  5. SNPs and Hox gene mapping in Ciona intestinalis

    Directory of Open Access Journals (Sweden)

    Biffali Elio

    2008-01-01

    Full Text Available Abstract Background The tunicate Ciona intestinalis (Enterogona, Ascidiacea, a major model system for evolutionary and developmental genetics of chordates, harbours two cryptic species. To assess the degree of intra- and inter-specific genetic variability, we report the identification and analysis of C. intestinalis SNP (Single Nucleotide Polymorphism markers. A SNP subset was used to determine the genetic distance between Hox-5 and -10 genes. Results DNA fragments were amplified from 12 regions of C. intestinalis sp. A. In total, 128 SNPs and 32 one bp indels have been identified within 8 Kb DNA. SNPs in coding regions cause 4 synonymous and 12 non-synonymous substitutions. The highest SNP frequency was detected in the Hox5 and Hox10 intragenic regions. In C. intestinalis, these two genes have lost their archetypal topology within the cluster, such that Hox10 is located between Hox4 and Hox5. A subset of the above primers was used to perform successful amplification in C. intestinalis sp. B. In this cryptic species, 62 SNPs were identified within 3614 bp: 41 in non-coding and 21 in coding regions. The genetic distance of the Hox-5 and -10 loci, computed combining a classical backcross approach with the application of SNP markers, was found to be 8.4 cM (Haldane's function. Based on the physical distance, 1 cM corresponds to 39.5 Kb. Linkage disequilibrium between the aforementioned loci was calculated in the backcross generation. Conclusion SNPs here described allow analysis and comparisons within and between C. intestinalis cryptic species. We provide the first reliable computation of genetic distance in this important model chordate. This latter result represents an important platform for future studies on Hox genes showing deviations from the archetypal topology.

  6. Refining the Ciona intestinalis model of central nervous system regeneration.

    Directory of Open Access Journals (Sweden)

    Carl Dahlberg

    Full Text Available BACKGROUND: New, practical models of central nervous system regeneration are required and should provide molecular tools and resources. We focus here on the tunicate Ciona intestinalis, which has the capacity to regenerate nerves and a complete adult central nervous system, a capacity unusual in the chordate phylum. We investigated the timing and sequence of events during nervous system regeneration in this organism. METHODOLOGY/PRINCIPAL FINDINGS: We developed techniques for reproducible ablations and for imaging live cellular events in tissue explants. Based on live observations of more than 100 regenerating animals, we subdivided the regeneration process into four stages. Regeneration was functional, as shown by the sequential recovery of reflexes that established new criteria for defining regeneration rates. We used transgenic animals and labeled nucleotide analogs to describe in detail the early cellular events at the tip of the regenerating nerves and the first appearance of the new adult ganglion anlage. CONCLUSIONS/SIGNIFICANCE: The rate of regeneration was found to be negatively correlated with adult size. New neural structures were derived from the anterior and posterior nerve endings. A blastemal structure was implicated in the formation of new neural cells. This work demonstrates that Ciona intestinalis is as a useful system for studies on regeneration of the brain, brain-associated organs and nerves.

  7. Focusing on Ciona intestinalis (Tunicata innate immune system. Evolutionary implications

    Directory of Open Access Journals (Sweden)

    N Parrinello

    2009-03-01

    Full Text Available Phylogenetic analyses based on molecular data provide compelling evidence that ascidians are of critical importance for studying chordate immune system evolution. The Ciona intestinalis draft genome sequence allows searches for phylogenetic relationships, gene cloning and expression of immunorelevant molecules. Acidians lack of the pivotal components of the vertebrate recombinatory adaptive immunity, i.e., MHC, TCRs and dimeric immunoglobulins. However, bioinformatic sequence analyses recognized genic elements indicating the essential features of the Ig superfamily and ancestor proto-MHC genes, suggesting a primitive pre-duplication and pre-recombination status. C. intestinalis genes for individuality in the absence of MHC could encode diverse molecular markers, including a wide panel of complement factors that could be responsible for self-nonself discrimination. Genome analysis reveals a number of innate immunity vertebrate-like genes which encode Toll-like and virus receptors, complement pathways components and receptors, CD94/NK-receptor-like, lectins, TNF, IL1-R, collagens. However, pure homology seeking for vertebrate-specific immunorelevant molecules is of limited value, and functional screening methods may be a more promising approach for tracing the immune system evolution. C. intestinalis, which displays acute and chronic inflammatory reactions, is a model organism for studying innate immunity genes expression and functions.

  8. Natural variation of model mutant phenotypes in Ciona intestinalis.

    Directory of Open Access Journals (Sweden)

    Paolo Sordino

    Full Text Available BACKGROUND: The study of ascidians (Chordata, Tunicata has made a considerable contribution to our understanding of the origin and evolution of basal chordates. To provide further information to support forward genetics in Ciona intestinalis, we used a combination of natural variation and neutral population genetics as an approach for the systematic identification of new mutations. In addition to the significance of developmental variation for phenotype-driven studies, this approach can encompass important implications in evolutionary and population biology. METHODOLOGY/PRINCIPAL FINDINGS: Here, we report a preliminary survey for naturally occurring mutations in three geographically interconnected populations of C. intestinalis. The influence of historical, geographical and environmental factors on the distribution of abnormal phenotypes was assessed by means of 12 microsatellites. We identified 37 possible mutant loci with stereotyped defects in embryonic development that segregate in a way typical of recessive alleles. Local populations were found to differ in genetic organization and frequency distribution of phenotypic classes. CONCLUSIONS/SIGNIFICANCE: Natural genetic polymorphism of C. intestinalis constitutes a valuable source of phenotypes for studying embryonic development in ascidians. Correlating genetic structure and the occurrence of abnormal phenotypes is a crucial focus for understanding the selective forces that shape natural finite populations, and may provide insights of great importance into the evolutionary mechanisms that generate animal diversity.

  9. A saturation screen for cis-acting regulatory DNA in the Hox genes of Ciona intestinalis

    Energy Technology Data Exchange (ETDEWEB)

    Keys, David N.; Lee, Byung-in; Di Gregorio, Anna; Harafuji, Naoe; Detter, Chris; Wang, Mei; Kahsai, Orsalem; Ahn, Sylvia; Arellano, Andre; Zhang, Quin; Trong, Stephan; Doyle, Sharon A.; Satoh, Noriyuki; Satou, Yutaka; Saiga, Hidetoshi; Christian, Allen; Rokhsar, Dan; Hawkins, Trevor L.; Levine, Mike; Richardson, Paul

    2005-01-05

    A screen for the systematic identification of cis-regulatory elements within large (>100 kb) genomic domains containing Hox genes was performed by using the basal chordate Ciona intestinalis. Randomly generated DNA fragments from bacterial artificial chromosomes containing two clusters of Hox genes were inserted into a vector upstream of a minimal promoter and lacZ reporter gene. A total of 222 resultant fusion genes were separately electroporated into fertilized eggs, and their regulatory activities were monitored in larvae. In sum, 21 separable cis-regulatory elements were found. These include eight Hox linked domains that drive expression in nested anterior-posterior domains of ectodermally derived tissues. In addition to vertebrate-like CNS regulation, the discovery of cis-regulatory domains that drive epidermal transcription suggests that C. intestinalis has arthropod-like Hox patterning in the epidermis.

  10. Arsenic (+ 3 Oxidation State) Methyltransferase and the Methylation of Arsenicals in the Invertebrate Chordate Ciona intestinalis

    OpenAIRE

    Thomas, David J; Nava, Gerardo M.; Cai, Shi-Ying; Boyer, James L.; Hernández-Zavala, Araceli; Gaskins, H. Rex

    2009-01-01

    Biotransformation of inorganic arsenic (iAs) involves methylation catalyzed by arsenic (+ 3 oxidation state) methyltransferase (As3mt) yielding mono-, di-, and trimethylated arsenicals. To investigate the evolution of molecular mechanisms that mediate arsenic biotransformation, a comparative genomic approach focusing on the invertebrate chordate Ciona intestinalis was used. Bioinformatic analyses identified an As3mt gene in the C. intestinalis genome. Constitutive As3mt RNA expression was obs...

  11. ANP (Atrial Natriuretic Peptide presence in the heart of a tunicate, Ciona intestinalis.

    Directory of Open Access Journals (Sweden)

    Aldo Gerbino

    2010-06-01

    Full Text Available Atrial natriuretic peptide was found in the heart of vertebrates, we studied the ANP presence in the heart of Ciona intestinalis. This is animal is very important because of the its evolutionary position between invertebrates and vertebrates. ANP presence was only revealed in myoepithelial cells of the myocardium. Results suggest the hypothesis that ANP is present not only in the vertebrates but also in the invertebrates and in Ciona heart ANP might play a similar role like in the heart of vertebrates.

  12. Occurrence and possible biological role of the endocannabinoid system in the sea squirt Ciona intestinalis.

    Science.gov (United States)

    Matias, Isabel; McPartland, John M; Di Marzo, Vincenzo

    2005-06-01

    A cannabinoid receptor orthologue (CiCBR) has been described in the sea squirt Ciona intestinalis. Here we report that CiCBR mRNA expression is highest in cerebral ganglion, branchial pharynx, heart and testis of C. intestinalis, and that this organism also contains cannabinoid receptor ligands and some of the enzymes for ligand biosynthesis and inactivation. Using liquid chromatography-mass spectrometry, the endocannabinoid anandamide was found in all tissues analysed (0.063-5.423 pmol/mg of lipid extract), with the highest concentrations being found in brain and heart. The endocannabinoid 2-arachidonoylglycerol (2-AG) was fivefold more abundant than anandamide, and was most abundant in stomach and intestine and least abundant in heart and ovaries (2.677-50.607 pmol/mg of lipid extract). Using phylogenomic analysis, we identified orthologues of several endocannabinoid synthesizing and degrading enzymes. In particular, we identified and partly sequenced a fatty acid amide hydrolase (FAAH) orthologue, showing 44% identity with human FAAH and containing nearly all the amino acids necessary for a functional FAAH enzyme. Ciona intestinalis also contained specific binding sites for cannabinoid receptor ligands, and an amidase enzyme with pH-dependency and subcellular/tissue distribution similar to mammalian FAAHs. Finally, a typical C. intestinalis behavioural response, siphon reopening after closure induced by mechanical stimulation, was inhibited by the cannabinoid receptor agonist HU-210, and this effect was significantly attenuated by mammalian cannabinoid receptor antagonists.

  13. Effect of colonial tunicate presence on Ciona intestinalis recruitment within a mussel farming environment

    Directory of Open Access Journals (Sweden)

    Jeff Davidson

    2012-12-01

    Full Text Available Aquatic invasive species decrease yields and increase costs in aquaculture operations worldwide. Anecdotal evidence from Prince Edward Island (PEI, Canada estuaries suggested that recruitment of the non-indigenous solitary tunicate Ciona intestinalis may be lower on aquaculture gear where colonial tunicates (Botryllus schlosseri and Botrylloides violaceus are already present. We tested this interspecific competition hypothesis by comparing C. intestinalis recruitment on un-fouled settlement plates to those pre-settled with Botryllus schlosseri or Botrylloides violaceus. C. intestinalis occurred on all plates after 2 month, but it was much more abundant (~80% coverage on unfouled plates than on pre-settled plates (<10% coverage. However, C. intestinalis showed higher individual growth on pre-settled plates than on unfouled plates. High reproductive potential for C. intestinalis appears to result in rapid recruitment to control plates, but this may be impeded on pre-settled plates due to competition for space, negative settlement cues produced by the colonial tunicates, allelopathy or overgrowth.

  14. The gut of geographically disparate Ciona intestinalis harbors a core microbiota.

    Directory of Open Access Journals (Sweden)

    Larry J Dishaw

    Full Text Available It is now widely understood that all animals engage in complex interactions with bacteria (or microbes throughout their various life stages. This ancient exchange can involve cooperation and has resulted in a wide range of evolved host-microbial interdependencies, including those observed in the gut. Ciona intestinalis, a filter-feeding basal chordate and classic developmental model that can be experimentally manipulated, is being employed to help define these relationships. Ciona larvae are first exposed internally to microbes upon the initiation of feeding in metamorphosed individuals; however, whether or not these microbes subsequently colonize the gut and whether or not Ciona forms relationships with specific bacteria in the gut remains unknown. In this report, we show that the Ciona gut not only is colonized by a complex community of bacteria, but also that samples from three geographically isolated populations reveal striking similarity in abundant operational taxonomic units (OTUs consistent with the selection of a core community by the gut ecosystem.

  15. A genomic overview of short genetic variations in a basal chordate, Ciona intestinalis

    Directory of Open Access Journals (Sweden)

    Satou Yutaka

    2012-05-01

    Full Text Available Abstract Background Although the Ciona intestinalis genome contains many allelic polymorphisms, there is only limited data analyzed systematically. Establishing a dense map of genetic variations in C. intestinalis is necessary not only for linkage analysis, but also for other experimental biology including molecular developmental and evolutionary studies, because animals from natural populations are typically used for experiments. Results Here, we identified over three million candidate short genomic variations within a 110 Mb euchromatin region among five C. intestinalis individuals. The average nucleotide diversity was approximately 1.1%. Genetic variations were found at a similar density in intergenic and gene regions. Non-synonymous and nonsense nucleotide substitutions were found in 12,493 and 1,214 genes accounting for 81.9% and 8.0% of the entire gene set, respectively, and over 60% of genes in the single animal encode non-identical proteins between maternal and paternal alleles. Conclusions Our results provide a framework for studying evolution of the animal genome, as well as a useful resource for a wide range of C. intestinalis researchers.

  16. Adverse Effect of Antifouling Compounds on the Reproductive Mechanisms of the Ascidian Ciona intestinalis

    Directory of Open Access Journals (Sweden)

    Alessandra Gallo

    2013-09-01

    Full Text Available Fertilization and embryo development that occur in sea water are sensitive to xenobiotics from anthropogenic sources. In this work, we evaluated the influence of two antifouling biocides, tributyltin (TBT and diuron, on the reproductive mechanisms of the marine invertebrate Ciona intestinalis. By using electrophysiological techniques, we examined the impact of these compounds on the electrical properties of the mature oocytes and of events occurring at fertilization. With different toxicity assays, we studied the effect of the two biocides on the gametes by evaluating fertilization rate and embryo development. Results show that sodium (Na+ currents were significantly reduced by either of the two biocides, whereas conductance was significantly increased. The fertilization current frequency and amplitude, fertilization rate and larval development were affected only by TBT. This study suggests that: (i the two biocides affect either the electrical properties of the oocyte plasma membrane and the reproductive success representing a risk factor for the survival of the species exposed to environmental pollution; (ii the ascidian Ciona intestinalis may represent a good model organism to test toxicity of marine pollutants. Possible mechanisms of action of the two biocides are discussed.

  17. Raman spectroscopic imaging of the whole Ciona intestinalis embryo during development.

    Directory of Open Access Journals (Sweden)

    Mitsuru J Nakamura

    Full Text Available Intracellular composition and the distribution of bio-molecules play central roles in the specification of cell fates and morphogenesis during embryogenesis. Consequently, investigation of changes in the expression and distribution of bio-molecules, especially mRNAs and proteins, is an important challenge in developmental biology. Raman spectroscopic imaging, a non-invasive and label-free technique, allows simultaneous imaging of the intracellular composition and distribution of multiple bio-molecules. In this study, we explored the application of Raman spectroscopic imaging in the whole Ciona intestinalis embryo during development. Analysis of Raman spectra scattered from C. intestinalis embryos revealed a number of localized patterns of high Raman intensity within the embryo. Based on the observed distribution of bio-molecules, we succeeded in identifying the location and structure of differentiated muscle and endoderm within the whole embryo, up to the tailbud stage, in a label-free manner. Furthermore, during cell differentiation, we detected significant differences in cell state between muscle/endoderm daughter cells and daughter cells with other fates that had divided from the same mother cells; this was achieved by focusing on the Raman intensity of single Raman bands at 1002 or 1526 cm(-1, respectively. This study reports the first application of Raman spectroscopic imaging to the study of identifying and characterizing differentiating tissues in a whole chordate embryo. Our results suggest that Raman spectroscopic imaging is a feasible label-free technique for investigating the developmental process of the whole embryo of C. intestinalis.

  18. The evolution of the vertebrate metzincins; insights from Ciona intestinalis and Danio rerio

    Directory of Open Access Journals (Sweden)

    Toubaris George

    2007-04-01

    Full Text Available Abstract Background The metzincins are a large gene superfamily of proteases characterized by the presence of a zinc protease domain, and include the ADAM, ADAMTS, BMP1/TLL, meprin and MMP genes. Metzincins are involved in the proteolysis of a wide variety of proteins, including those of the extracellular matrix. The metzincin gene superfamily comprises eighty proteins in the human genome and ninety-three in the mouse. When and how the level of complexity apparent in the vertebrate metzincin gene superfamily arose has not been determined in detail. Here we present a comprehensive analysis of vertebrate metzincins using genes from both Ciona intestinalis and Danio rerio to provide new insights into the complex evolution of this gene superfamily. Results We have identified 19 metzincin genes in the ciona genome and 83 in the zebrafish genome. Phylogenetic analyses reveal that the expansion of the metzincin gene superfamily in vertebrates has occurred predominantly by the simple duplication of pre-existing genes rather than by the appearance and subsequent expansion of new metzincin subtypes (the only example of which is the meprin gene family. Despite the number of zebrafish metzincin genes being relatively similar to that of tetrapods (e.g. man and mouse, the pattern of gene retention and loss within these lineages is markedly different. In addition, we have studied the evolution of the related TIMP gene family and identify a single ciona and four zebrafish TIMP genes. Conclusion The complexity seen in the vertebrate metzincin gene families was mainly acquired during vertebrate evolution. The metzincin gene repertoire in protostomes and invertebrate deuterostomes has remained relatively stable. The expanded metzincin gene repertoire of extant tetrapods, such as man, has resulted largely from duplication events associated with early vertebrate evolution, prior to the sarcopterygian-actinopterygian split. The teleost repertoire of metzincin genes

  19. Diverse ETS transcription factors mediate FGF signaling in the Ciona anterior neural plate.

    Science.gov (United States)

    Gainous, T Blair; Wagner, Eileen; Levine, Michael

    2015-03-15

    The ascidian Ciona intestinalis is a marine invertebrate belonging to the sister group of the vertebrates, the tunicates. Its compact genome and simple, experimentally tractable embryos make Ciona well-suited for the study of cell-fate specification in chordates. Tunicate larvae possess a characteristic chordate body plan, and many developmental pathways are conserved between tunicates and vertebrates. Previous studies have shown that FGF signals are essential for neural induction and patterning at sequential steps of Ciona embryogenesis. Here we show that two different ETS family transcription factors, Ets1/2 and Elk1/3/4, have partially redundant activities in the anterior neural plate of gastrulating embryos. Whereas Ets1/2 promotes pigment cell formation in lateral lineages, both Ets1/2 and Elk1/3/4 are involved in the activation of Myt1L in medial lineages and the restriction of Six3/6 expression to the anterior-most regions of the neural tube. We also provide evidence that photoreceptor cells arise from posterior regions of the presumptive sensory vesicle, and do not depend on FGF signaling. Cells previously identified as photoreceptor progenitors instead form ependymal cells and neurons of the larval brain. Our results extend recent findings on FGF-dependent patterning of anterior-posterior compartments in the Ciona central nervous system. Copyright © 2015. Published by Elsevier Inc.

  20. 玻璃海鞘的营养成分分析%Analysis of Nutritional Components in Ciona intestinalis

    Institute of Scientific and Technical Information of China (English)

    时亚南; 郑秋生; 弭宝彬; 陈朋; 许波

    2011-01-01

    [Objective] The research aimed to analyze the nutritional components in Ciona intestinalis and evaluate their nutritional value. [ Method] The contents of moisture, fat, protein, and ash amino acids, fatty acids and minerals in Ciona intestinalis were determined by conventional methods. [Result] The contents of moisture, fat, protein and ash in Ciona intestinalis were 93.08% , 2.08% , 1.99% and 2.7%, respectively. 16 kinds of common amino acids in Ciona intestinalis were determined, among which glycine content was the highest, and the ratios of total essential amino acids to total amino acids and to non-essentialamino acids were 42. 51% and 73.94% , respectively. 18 kinds of common fatty acids were measured in Ciona intestinalis, including 8 saturated fatty acids, 3 non-unsaturated fatty acids and 3 poly unsaturated fatty acids . The contents of poly unsaturated fatty acids in fatty acids were 13. 8%. Fe, Zn, Mn, Cu, Ni and other elements were rich in Ciona intestinals. The detection and analysis of heavy metal elements and other toxic substances in Ciona intestinalis indicated that they met national safety and health standards. [Conclusion] Ciona intestinalis possess high nutritional value and promising prospects for further development.%[目的]分析测定了玻璃海鞘的营养成分,并对其营养价值进行了评价.[方法]采用常规方法测定了水分、脂肪、蛋白质、灰分、氨基酸、脂肪酸和矿物质含量.[结果]玻璃海鞘水分、脂肪、蛋白质和灰分分别为:93.08%、2.08%、1.99%和2.7%.共检测了16种氨基酸,其中甘氨酸含量最高,必需氨基酸占总氨基酸的比值为42.51%,必需氨基酸和非必需氨基酸的比值为73.94%,测定了玻璃海鞘中13种脂肪酸,其中饱和脂肪酸8种,单不饱和脂肪酸2种,多不饱和脂肪酸3种,多不饱和脂肪酸含量占脂肪酸总量的13.8%.玻璃海鞘中含有丰富的Fe、Zn、Mn、Cu、Ni等微量元素,对重金属等有毒有害

  1. Identification of chondroitin/dermatan sulfotransferases in the protochordate, Ciona intestinalis.

    Science.gov (United States)

    Tetsukawa, Akira; Nakamura, Jun; Fujiwara, Shigeki

    2010-10-01

    Sulfated glycosaminoglycans are important components of connective tissues. The pattern of sulfation is important for their biological functions. Ascidians, the closest relatives of vertebrates, have a simple chordate body plan. In the present study, we identified an almost complete set of genes encoding proteins homologous to chondroitin/dermatan sulfotransferases in the genome of the ascidian Ciona intestinalis. We found eight genes encoding 4-O-sulfotransferases, eight genes encoding 6-O-sulfotransferases, and three genes encoding uronyl 2-O-sulfotransferases. The number of sulfotransferase genes was unexpectedly large, considering that ascidians do not have a well-developed endoskeleton. In addition, most of the genes within each sub-family seemed to have arisen by gene duplication events that occurred in the ascidian lineage after divergence from the main chordate lineage. This suggests that a unique pattern of sulfation independently developed during ascidian evolution. Some of the genes identified in the present study showed tissue-specific expression in the epidermis, notochord, muscle, and central nervous system. Region-specific expression in the epidermis was also observed. The present study provides useful information for further comparative and functional analyses of sulfotransferases and proteoglycans in chordate embryos.

  2. The integrins of the urochordate Ciona intestinalis provide novel insights into the molecular evolution of the vertebrate integrin family

    Directory of Open Access Journals (Sweden)

    Robertson David L

    2005-05-01

    Full Text Available Abstract Background Integrins are a functionally significant family of metazoan cell surface adhesion receptors. The receptors are dimers composed of an alpha and a beta chain. Vertebrate genomes encode an expanded set of integrin alpha and beta chains in comparison with protostomes such as drosophila or the nematode worm. The publication of the genome of a basal chordate, Ciona intestinalis, provides a unique opportunity to gain further insight into how and when the expanded integrin supergene family found in vertebrates evolved. Results The Ciona genome encodes eleven α and five β chain genes that are highly homologous to their vertebrate homologues. Eight of the α chains contain an A-domain that lacks the short alpha helical region present in the collagen-binding vertebrate alpha chains. Phylogenetic analyses indicate the eight A-domain containing α chains cluster to form an ascidian-specific clade that is related to but, distinct from, the vertebrate A-domain clade. Two Ciona α chains cluster in laminin-binding clade and the remaining chain clusters in the clade that binds the RGD tripeptide sequence. Of the five Ciona β chains, three form an ascidian-specific clade, one clusters in the vertebrate β1 clade and the remaining Ciona chain is the orthologue of the vertebrate β4 chain. Conclusion The Ciona repertoire of integrin genes provides new insight into the basic set of these receptors available at the beginning of vertebrate evolution. The ascidian and vertebrate α chain A-domain clades originated from a common precursor but radiated separately in each lineage. It would appear that the acquisition of collagen binding capabilities occurred in the chordate lineage after the divergence of ascidians.

  3. Perforation with and without vinegar injection as a mitigation strategy against two invasive tunicates, Ciona intestinalis and Styela clava

    Directory of Open Access Journals (Sweden)

    Marianne PARENT

    2011-01-01

    Full Text Available Ciona intestinalis and Styela clava, two nuisance species for Prince Edward Island’s blue mussel industry, were treated with individual perforations using nails or hypodermic needles. Other treatments using the same species included simultaneous perforations using perforation devices with low, medium and high needle density, either with or without vinegar injections. Mortality levels estimated for all ranges of individual perforations were significantly higher than mortality levels estimated in control groups during treatments conducted at laboratory facilities. Mortality of C. intestinalis reached 100% for 60 individual perforations or injection of 0.05 mL of vinegar. In S. clava, 100 individual perforations resulted in 100% mortality. Two applications of the high-density perforation device resulted in 80% mortality of C. intestinalis. During field testing, two applications of the same high-density needle device did not significantly decrease C. intestinalis wet weight, regardless of the addition of vinegar. The field applicability of perforation upon tunicates fouling mussel socks was at least in part limited by the uneven surface created by the mussels and the possible inhibition of bacterial growth caused by low water temperatures. Perforation and vinegar injection showed to be successful in laboratory trials and should be further studied with different perforation devices under field conditions.

  4. Nitric oxide affects ERK signaling through down-regulation of MAP kinase phosphatase levels during larval development of the ascidian Ciona intestinalis.

    Directory of Open Access Journals (Sweden)

    Immacolata Castellano

    Full Text Available In the ascidian Ciona intestinalis larval development and metamorphosis require a complex interplay of events, including nitric oxide (NO production, MAP kinases (ERK, JNK and caspase-3 activation. We have previously shown that NO levels affect the rate of metamorphosis, regulate caspase activity and promote an oxidative stress pathway, resulting in protein nitration. Here, we report that NO down-regulates MAP kinase phosphatases (mkps expression affecting positively ERK signaling. By pharmacological approach, we observed that the reduction of endogenous NO levels caused a decrease of ERK phosphorylation, whereas increasing levels of NO induced ERK activation. We have also identified the ERK gene network affected by NO, including mpk1, mpk3 and some key developmental genes by quantitative gene expression analysis. We demonstrate that NO induces an ERK-independent down-regulation of mkp1 and mkp3, responsible for maintaining the ERK phosphorylation levels necessary for transcription of key metamorphic genes, such as the hormone receptor rev-erb and the van willebrand protein vwa1c. These results add new insights into the role played by NO during larval development and metamorphosis in Ciona, highlighting the cross-talk between different signaling pathways.

  5. Isolation and Characterization of a Shewanella Phage–Host System from the Gut of the Tunicate, Ciona intestinalis

    Directory of Open Access Journals (Sweden)

    Brittany Leigh

    2017-03-01

    Full Text Available Outnumbering all other biological entities on earth, bacteriophages (phages play critical roles in structuring microbial communities through bacterial infection and subsequent lysis, as well as through horizontal gene transfer. While numerous studies have examined the effects of phages on free-living bacterial cells, much less is known regarding the role of phage infection in host-associated biofilms, which help to stabilize adherent microbial communities. Here we report the cultivation and characterization of a novel strain of Shewanella fidelis from the gut of the marine tunicate Ciona intestinalis, inducible prophages from the S. fidelis genome, and a strain-specific lytic phage recovered from surrounding seawater. In vitro biofilm assays demonstrated that lytic phage infection affects biofilm formation in a process likely influenced by the accumulation and integration of the extracellular DNA released during cell lysis, similar to the mechanism that has been previously shown for prophage induction.

  6. Morphological Differences between Larvae of the Ciona intestinalis Species Complex: Hints for a Valid Taxonomic Definition of Distinct Species.

    Science.gov (United States)

    Pennati, Roberta; Ficetola, Gentile Francesco; Brunetti, Riccardo; Caicci, Federico; Gasparini, Fabio; Griggio, Francesca; Sato, Atsuko; Stach, Thomas; Kaul-Strehlow, Sabrina; Gissi, Carmela; Manni, Lucia

    2015-01-01

    The cosmopolitan ascidian Ciona intestinalis is the most common model species of Tunicata, the sister-group of Vertebrata, and widely used in developmental biology, genomics and evolutionary studies. Recently, molecular studies suggested the presence of cryptic species hidden within the C. intestinalis species, namely C. intestinalis type A and type B. So far, no substantial morphological differences have been identified between individuals belonging to the two types. Here we present morphometric, immunohistochemical, and histological analyses, as well as 3-D reconstructions, of late larvae obtained by cross-fertilization experiments of molecularly determined type A and type B adults, sampled in different seasons and in four different localities. Our data point to quantitative and qualitative differences in the trunk shape of larvae belonging to the two types. In particular, type B larvae exhibit a longer pre-oral lobe, longer and relatively narrower total body length, and a shorter ocellus-tail distance than type A larvae. All these differences were found to be statistically significant in a Discriminant Analysis. Depending on the number of analyzed parameters, the obtained discriminant function was able to correctly classify > 93% of the larvae, with the remaining misclassified larvae attributable to the existence of intra-type seasonal variability. No larval differences were observed at the level of histology and immunohistochemical localization of peripheral sensory neurons. We conclude that type A and type B are two distinct species that can be distinguished on the basis of larval morphology and molecular data. Since the identified larval differences appear to be valid diagnostic characters, we suggest to raise both types to the rank of species and to assign them distinct names.

  7. Morphological Differences between Larvae of the Ciona intestinalis Species Complex: Hints for a Valid Taxonomic Definition of Distinct Species.

    Directory of Open Access Journals (Sweden)

    Roberta Pennati

    Full Text Available The cosmopolitan ascidian Ciona intestinalis is the most common model species of Tunicata, the sister-group of Vertebrata, and widely used in developmental biology, genomics and evolutionary studies. Recently, molecular studies suggested the presence of cryptic species hidden within the C. intestinalis species, namely C. intestinalis type A and type B. So far, no substantial morphological differences have been identified between individuals belonging to the two types. Here we present morphometric, immunohistochemical, and histological analyses, as well as 3-D reconstructions, of late larvae obtained by cross-fertilization experiments of molecularly determined type A and type B adults, sampled in different seasons and in four different localities. Our data point to quantitative and qualitative differences in the trunk shape of larvae belonging to the two types. In particular, type B larvae exhibit a longer pre-oral lobe, longer and relatively narrower total body length, and a shorter ocellus-tail distance than type A larvae. All these differences were found to be statistically significant in a Discriminant Analysis. Depending on the number of analyzed parameters, the obtained discriminant function was able to correctly classify > 93% of the larvae, with the remaining misclassified larvae attributable to the existence of intra-type seasonal variability. No larval differences were observed at the level of histology and immunohistochemical localization of peripheral sensory neurons. We conclude that type A and type B are two distinct species that can be distinguished on the basis of larval morphology and molecular data. Since the identified larval differences appear to be valid diagnostic characters, we suggest to raise both types to the rank of species and to assign them distinct names.

  8. Chondroitin 4-O-sulfotransferases are required for cell adhesion and morphogenesis in the Ciona intestinalis embryo.

    Science.gov (United States)

    Nakamura, Jun; Tetsukawa, Akira; Fujiwara, Shigeki

    2015-01-01

    Chondroitin sulfate (CS) is a carbohydrate component of proteoglycans. Several types of sulfotransferases determine the pattern of CS sulfation, and thus regulate the biological functions of proteoglycans. The protochordate ascidians are the closest relatives of vertebrates, but the functions of their sulfotransferases have not been investigated. Here, we show that two chondroitin 4-O-sulfotransferases (C4STs) play important roles in the embryonic morphogenesis of the ascidian Ciona intestinalis. Ci-C4ST-like1 is predominantly expressed in the epidermis and muscle. Epidermal and muscle cells became spherical upon the injection of a Ci-C4ST-like1-specific morpholino oligo (MO), thus suggesting weakened cell adhesion. Co-injection of a Ci-C4ST-like1-expressing transgene rescued the phenotype, suggesting that the effects of the MO were specific. Ci-C4ST-like3 was expressed in the central nervous system, muscle, and mesenchyme. A specific MO appeared to affect cell adhesion in the epidermis and muscle. Convergent extension movement of notochordal cells was also impaired. Forced expression of Ci-C4ST-like3 restored normal morphogenesis, suggesting that the effects of the MO were specific. The present study suggests that Ci-C4ST-like1 and Ci-C4ST-like3 are required for cell adhesion mainly in the epidermis and muscle.

  9. Fibronectin contributes to notochord intercalation in the invertebrate chordate, Ciona intestinalis

    Directory of Open Access Journals (Sweden)

    Fernando Segade

    2016-08-01

    Full Text Available Abstract Background Genomic analysis has upended chordate phylogeny, placing the tunicates as the sister group to the vertebrates. This taxonomic rearrangement raises questions about the emergence of a tunicate/vertebrate ancestor. Results Characterization of developmental genes uniquely shared by tunicates and vertebrates is one promising approach for deciphering developmental shifts underlying acquisition of novel, ancestral traits. The matrix glycoprotein Fibronectin (FN has long been considered a vertebrate-specific gene, playing a major instructive role in vertebrate embryonic development. However, the recent computational prediction of an orthologous “vertebrate-like” Fn gene in the genome of a tunicate, Ciona savignyi, challenges this viewpoint suggesting that Fn may have arisen in the shared tunicate/vertebrate ancestor. Here we verify the presence of a tunicate Fn ortholog. Transgenic reporter analysis was used to characterize a Ciona Fn enhancer driving expression in the notochord. Targeted knockdown in the notochord lineage indicates that FN is required for proper convergent extension. Conclusions These findings suggest that acquisition of Fn was associated with altered notochord morphogenesis in the vertebrate/tunicate ancestor.

  10. Ciona intestinalis as a Marine Model System to Study Some Key Developmental Genes Targeted by the Diatom-Derived Aldehyde Decadienal

    Directory of Open Access Journals (Sweden)

    Anna Lettieri

    2015-03-01

    Full Text Available The anti-proliferative effects of diatoms, described for the first time in copepods, have also been demonstrated in benthic invertebrates such as polychaetes, sea urchins and tunicates. In these organisms PUAs (polyunsaturated aldehydes induce the disruption of gametogenesis, gamete functionality, fertilization, embryonic mitosis, and larval fitness and competence. These inhibitory effects are due to the PUAs, produced by diatoms in response to physical damage as occurs during copepod grazing. The cell targets of these compounds remain largely unknown. Here we identify some of the genes targeted by the diatom PUA 2-trans-4-trans-decadienal (DD using the tunicate Ciona intestinalis. The tools, techniques and genomic resources available for Ciona, as well as the suitability of Ciona embryos for medium-to high-throughput strategies, are key to their employment as model organisms in different fields, including the investigation of toxic agents that could interfere with developmental processes. We demonstrate that DD can induce developmental aberrations in Ciona larvae in a dose-dependent manner. Moreover, through a preliminary analysis, DD is shown to affect the expression level of genes involved in stress response and developmental processes.

  11. Ciona intestinalis as a marine model system to study some key developmental genes targeted by the diatom-derived aldehyde decadienal.

    Science.gov (United States)

    Lettieri, Anna; Esposito, Rosaria; Ianora, Adrianna; Spagnuolo, Antonietta

    2015-03-17

    The anti-proliferative effects of diatoms, described for the first time in copepods, have also been demonstrated in benthic invertebrates such as polychaetes, sea urchins and tunicates. In these organisms PUAs (polyunsaturated aldehydes) induce the disruption of gametogenesis, gamete functionality, fertilization, embryonic mitosis, and larval fitness and competence. These inhibitory effects are due to the PUAs, produced by diatoms in response to physical damage as occurs during copepod grazing. The cell targets of these compounds remain largely unknown. Here we identify some of the genes targeted by the diatom PUA 2-trans-4-trans-decadienal (DD) using the tunicate Ciona intestinalis. The tools, techniques and genomic resources available for Ciona, as well as the suitability of Ciona embryos for medium-to high-throughput strategies, are key to their employment as model organisms in different fields, including the investigation of toxic agents that could interfere with developmental processes. We demonstrate that DD can induce developmental aberrations in Ciona larvae in a dose-dependent manner. Moreover, through a preliminary analysis, DD is shown to affect the expression level of genes involved in stress response and developmental processes.

  12. Further EST analysis of endocrine genes that are preferentially expressed in the neural complex of Ciona intestinalis: receptor and enzyme genes associated with endocrine system in the neural complex.

    Science.gov (United States)

    Sekiguchi, Toshio; Kawashima, Takeshi; Satou, Yutaka; Satoh, Nori

    2007-01-15

    Identification of orthologs of vertebrate neuropeptides and hypothalamic hormones in the neural complex of ascidians suggests integral roles of the ascidian neural complex in the endocrine system. In the present study, we investigated endocrine-related genes expressed in the neural complex of Ciona intestinalis. Comprehensive analyses of 3'-end sequences of the neural complex cDNAs placed 10,029 clones into 4051 independent clusters or genes, 1524 of them being expressed preferentially in this organ. Comparison of the 1524 genes with the human proteome databank demonstrated that 476 matched previously identified human proteins with distinct functions. Further analyses of sequence similarity of the 476 genes demonstrated that 21 genes are candidates for those involved in the endocrine system. Although we cannot detect hormone or peptide candidates, we found 21 genes such as receptors for peptide ligands, receptor-modulating proteins, and processing enzymes. We then characterized the Ciona prohormone convertase 2 (Ci-PC2) and carboxypeptidase E (Ci-CPE), which are associated with endoproteolytic processing of peptide hormone precursors. Furthermore, genes encoding these transcripts are expressed specifically in the neural complex of young adult ascidians. These data provide the molecular basis for further functional studies of the endocrine role of the neural complex of ascidians.

  13. Localization of CiCBR in the invertebrate chordate Ciona intestinalis: evidence of an ancient role for cannabinoid receptors as axonal regulators of neuronal signalling.

    Science.gov (United States)

    Egertová, Michaela; Elphick, Maurice R

    2007-06-01

    CiCBR is a G-protein-coupled receptor in the sea-squirt Ciona intestinalis and the first ortholog of vertebrate CB(1) and CB(2) cannabinoid receptors to be identified in an invertebrate (Elphick et al. [2003] Gene 302:95-101). Here we have used Western blotting and immunocytochemistry to examine expression of CiCBR in adult Ciona, employing novel antibodies to the C-terminal tail of CiCBR. Consistent with the expected mass for CiCBR, a approximately 47-kDa band was detected in Ciona membranes, and immunocytochemical analysis of serial sections of Ciona revealed intense immunoreactivity in the cerebral ganglion localised in a dense meshwork of fibers in the neuropile. Accordingly, Western blot analysis of neural complex homogenates revealed the presence of a approximately 47-kDa band. CiCBR immunoreactivity was also observed in axons exiting the ganglion in the anterior and posterior nerves, and analysis of whole-mount preparations revealed that these axons project over the interior surface of the oral and atrial siphons. Isolated CiCBR-immunoreactive axons not associated with the anterior and posterior nerves were observed projecting through the cortical layer of the cerebral ganglion. Central and peripheral CiCBR-immunoreactive fibers were studded with intensely stained varicosities, indicative of a role for CiCBR in regulation of axonal release of neurotransmitters, neuromodulators, or neurohormones. Collectively, our data suggest that the well-established role that the CB(1) receptor has as an axonal regulator of neurotransmitter release in mammals may have originated with ancestral-type cannabinoid receptors in invertebrate chordates before the emergence of CB(1)- and CB(2)-type receptors in vertebrates.

  14. Combining environmental suitability and population abundances to evaluate the invasive potential of the tunicate Ciona intestinalis along the temperate South American coast

    Directory of Open Access Journals (Sweden)

    Stella M. Januario

    2015-10-01

    Full Text Available The tunicate Ciona intestinalis is an opportunistic invader with high potential for causing economic losses in aquaculture centers. Recent phylogenetic and population genetic analysis support the existence of a genetic complex described as C. intestinalis with two main dominant species (sp A and B occurring worldwide. In Chile, the species has been observed around 30°S of latitude, but no official reports exist for the presence of C. intestinalis in southern regions (above 40°S, where most of the mollusk aquaculture centers are located. Here, we used occurrences from multiple invaded regions and extensive field sampling to model and validate the environmental conditions that allow the species to persist and to find the geographic areas with the most suitable environmental conditions for the spread of C. intestinalis in the Chilean coast. By studying the potential expansion of C. intestinalis southward in the Chilean Coast, we aimed to provide valuable information that might help the development of control plans before the species becomes a significant problem, especially above 40°S. Our results highlight that, by using portions of the habitat that are apparently distinguishable, the species seem to be not only genetically distinct, but ecologically distinct as well. The two regional models fitted for sp A and for sp B showed disagreement on which sections of Chilean coastline are considered more suitable for these species. While the model for sp A identifies moderately to highly suitable areas between 30° and 40°S, the model for sp B classifies the areas around 45°S as the most appropriate. Data from field sampling show a positive linear relationship between density of C. intestinalis and the index of suitability for sp A in aquaculture centers. Understanding the relation of the distinct species with the surrounding environment provided valuable insights about probable routes of dispersion in Chile, especially into those areas considered

  15. The central nervous system of the ascidian larva: mitotic history of cells forming the neural tube in late embryonic Ciona intestinalis.

    Science.gov (United States)

    Cole, Alison G; Meinertzhagen, Ian A

    2004-07-15

    Ascidian larvae develop after an invariant pattern of embryonic cleavage. Fewer than 400 cells constitute the larval central nervous system (CNS), which forms without either extensive migration or cell death. We catalogue the mitotic history of these cells in Ciona intestinalis, using confocal microscopy of whole-mount embryos at stages from neurulation until hatching. The positions of cells contributing to the CNS were reconstructed from confocal image stacks of embryonic nuclei, and maps of successive stages were used to chart the mitotic descent, thereby creating a cell lineage for each cell. The entire CNS is formed from 10th- to 14th-generation cells. Although minor differences exist in cell position, lineage is invariant in cells derived from A-line blastomeres, which form the caudal nerve cord and visceral ganglion. We document the lineage of five pairs of presumed motor neurons within the visceral ganglion: one pair arises from A/A 10.57, and four from progeny of A/A 9.30. The remaining cells of the visceral ganglion are in their 13th and 14th generations at hatching, with most mitotic activity ceasing around 85% of embryonic development. Of the approximately 330 larval cells previously reported in the CNS of Ciona, we document the lineage of 226 that derive predominantly from A-line blastomeres.

  16. The diatom-derived aldehyde decadienal affects life cycle transition in the ascidian Ciona intestinalis through nitric oxide/ERK signalling.

    Science.gov (United States)

    Castellano, Immacolata; Ercolesi, Elena; Romano, Giovanna; Ianora, Adrianna; Palumbo, Anna

    2015-03-01

    Polyunsaturated aldehydes (PUAs) are fatty-acid-derived metabolites produced by some microalgae, including different diatom species. PUAs are mainly produced as a wound-activated defence mechanism against microalgal predators or released from senescent cells at the end of a bloom. PUAs, including 2,4-trans-decadienal (DD), induce deleterious effects on embryonic and larval development of several planktonic and benthic organisms. Here, we report on the effects of DD on larval development and metamorphosis of the ascidian Ciona intestinalis. Ciona larval development is regulated by the cross-talking of different molecular events, including nitric oxide (NO) production, ERK activation and caspase 3-dependent apoptosis. We report that treatment with DD at the competence larval stage results in a delay in metamorphosis. DD affects redox balance by reducing total glutathione and NO levels. By biochemical and quantitative gene expression analysis, we identify the NO-signalling network affected by DD, including the upregulation of ERK phosphatase mkp1 and consequent reduction of ERK phosphorylation, with final changes in the expression of downstream ERK target genes. Overall, these results give new insights into the molecular pathways induced in marine organisms after exposure to PUAs during larval development, demonstrating that this aldehyde affects key checkpoints of larval transition from the vegetative to the reproductive life stage.

  17. Trunk lateral cells are neural crest-like cells in the ascidian Ciona intestinalis: insights into the ancestry and evolution of the neural crest.

    Science.gov (United States)

    Jeffery, William R; Chiba, Takuto; Krajka, Florian Razy; Deyts, Carole; Satoh, Nori; Joly, Jean-Stéphane

    2008-12-01

    Neural crest-like cells (NCLC) that express the HNK-1 antigen and form body pigment cells were previously identified in diverse ascidian species. Here we investigate the embryonic origin, migratory activity, and neural crest related gene expression patterns of NCLC in the ascidian Ciona intestinalis. HNK-1 expression first appeared at about the time of larval hatching in dorsal cells of the posterior trunk. In swimming tadpoles, HNK-1 positive cells began to migrate, and after metamorphosis they were localized in the oral and atrial siphons, branchial gill slits, endostyle, and gut. Cleavage arrest experiments showed that NCLC are derived from the A7.6 cells, the precursors of trunk lateral cells (TLC), one of the three types of migratory mesenchymal cells in ascidian embryos. In cleavage arrested embryos, HNK-1 positive TLC were present on the lateral margins of the neural plate and later became localized adjacent to the posterior sensory vesicle, a staging zone for their migration after larval hatching. The Ciona orthologues of seven of sixteen genes that function in the vertebrate neural crest gene regulatory network are expressed in the A7.6/TLC lineage. The vertebrate counterparts of these genes function downstream of neural plate border specification in the regulatory network leading to neural crest development. The results suggest that NCLC and neural crest cells may be homologous cell types originating in the common ancestor of tunicates and vertebrates and support the possibility that a putative regulatory network governing NCLC development was co-opted to produce neural crest cells during vertebrate evolution.

  18. Molecular and functional characterization of cionin receptors in the ascidian, Ciona intestinalis: the evolutionary origin of the vertebrate cholecystokinin/gastrin family.

    Science.gov (United States)

    Sekiguchi, Toshio; Ogasawara, Michio; Satake, Honoo

    2012-04-01

    Cholecystokinin (CCK) and gastrin are vertebrate brain-gut peptides featured by a sulfated tyrosine residue and a C-terminally amidated tetrapeptide consensus sequence. Cionin, identified in the ascidian, Ciona intestinalis, the closest species to vertebrates, harbors two sulfated tyrosines and the CCK/gastrin consensus tetrapeptide sequence. While a putative cionin receptor, cior, was cloned, the ligand-receptor relationship between cionin and CioR remains unidentified. Here, we identify two cionin receptors, CioR1 and CioR2, which are the aforementioned putative cionin receptor and its novel paralog respectively. Phylogenetic analysis revealed that CioRs are homologous to vertebrate CCK receptors (CCKRs) and diverged from a common ancestor in the Ciona-specific lineage. Cionin activates intracellular calcium mobilization in cultured cells expressing CioR1 or CioR2. Monosulfated and nonsulfated cionin exhibited less potent or no activity, indicating that CioRs possess pharmacological features similar to the vertebrate CCK-specific receptor CCK1R, rather than its subtype CCK2R, given that a sulfated tyrosine in CCK is required for binding to CCK1R, but not to CCK2R. Collectively, the present data reveal that CioRs share a common ancestor with vertebrate CCKRs and indicate that CCK and CCK1R form the ancestral ligand-receptor pair in the vertebrate CCK/gastrin system. Cionin is expressed in the neural complex, digestive organs, oral siphon and atrial siphons, whereas the expression of ciors was detected mainly in these tissues and the ovary. Furthermore, cioninergic neurons innervate both of the siphons. These results suggest that cionin is involved in the regulation of siphonal functions.

  19. Transcription of meiotic-like-pathway genes in Giardia intestinalis

    Directory of Open Access Journals (Sweden)

    Sandra P Melo

    2008-06-01

    Full Text Available The reproductive mechanism of Giardia intestinalis, considered one of the earliest divergent eukaryotes, has not been fully defined yet. Some evidence supports the hypothesis that Giardia is an exclusively asexual organism with a clonal population structure. However, the high genetic variability, the variation in ploidy during its life cycle, the low heterozygosity and the existence of genes involved in the meiotic-like recombination pathway in the parasite's genome cast doubt on exclusively asexual nature of Giardia. In this work, semiquantitative RT-PCR analysis was used to assess the transcription pattern of three meiosis-like-specific genes involved in homologues recombination: dmc1, hop1 and spo11. The mRNAs were amplified during the parasite's differentiation processes, encystation and excystation, and expression was found at each stage of its life cycle. A semiquantitative assessment also suggests that expression of some of the genes is regulated during encystation process.

  20. Transcription of meiotic-like-pathway genes in Giardia intestinalis.

    Science.gov (United States)

    Melo, Sandra P; Gómez, Vanessa; Castellanos, Isabel C; Alvarado, Magda E; Hernández, Paula C; Gallego, Amanda; Wasserman, Moisés

    2008-06-01

    The reproductive mechanism of Giardia intestinalis, considered one of the earliest divergent eukaryotes, has not been fully defined yet. Some evidence supports the hypothesis that Giardia is an exclusively asexual organism with a clonal population structure. However, the high genetic variability, the variation in ploidy during its life cycle, the low heterozygosity and the existence of genes involved in the meiotic-like recombination pathway in the parasite's genome cast doubt on exclusively asexual nature of Giardia. In this work, semiquantitative RT-PCR analysis was used to assess the transcription pattern of three meiosis-like-specific genes involved in homologues recombination: dmc1, hop1 and spo11. The mRNAs were amplified during the parasite's differentiation processes, encystation and excystation, and expression was found at each stage of its life cycle. A semiquantitative assessment also suggests that expression of some of the genes is regulated during encystation process.

  1. Distinctive expression patterns of Hedgehog pathway genes in the Ciona intestinalis larva: implications for a role of Hedgehog signaling in postembryonic development and chordate evolution.

    Science.gov (United States)

    Islam, A F M Tariqul; Moly, Pricila Khan; Miyamoto, Yuki; Kusakabe, Takehiro G

    2010-02-01

    Members of the Hedgehog (Hh) family are soluble ligands that orchestrate a wide spectrum of developmental processes ranging from left-right axis determination of the embryo to tissue patterning and organogenesis. Tunicates, including ascidians, are the closest relatives of vertebrates, and elucidation of Hh signaling in ascidians should provide an important clue towards better understanding the role of this pathway in development. In previous studies, expression patterns of genes encoding Hh and its downstream factor Gli have been examined up to the tailbud stage in the ascidian embryo, but their expression in the larva has not been reported. Here we show the spatial expression patterns of hedgehog (Ci-hh1, Ci-hh2), patched (Ci-ptc), smoothened (Ci-smo), and Gli (Ci-Gli) orthologs in larvae of the ascidian Ciona intestinalis. The expression patterns of Ci-hh2 and Ci-Gli dramatically change during the period between the late tailbud embryo and the swimming larva. At the larval stage, expression of Ci-Gli was found in a central part of the endoderm and in the visceral ganglion, while Ci-hh2 was expressed in two discrete endodermal regions, anteriorly and posteriorly adjacent to the cells expressing Gli. The expression patterns of these genes suggest that the Hh ligand controls postembryonic development of the endoderm and the central nervous system. Expression of a gene encoding Hh in the anterior and/or pharyngeal endoderm is probably an ancient chordate character; diversification of regulation and targets of the Hh signaling in this region may have played a major role in the evolution of chordate body structures.

  2. Transcription of meiotic-like-pathway genes in Giardia intestinalis

    OpenAIRE

    2008-01-01

    The reproductive mechanism of Giardia intestinalis, considered one of the earliest divergent eukaryotes, has not been fully defined yet. Some evidence supports the hypothesis that Giardia is an exclusively asexual organism with a clonal population structure. However, the high genetic variability, the variation in ploidy during its life cycle, the low heterozygosity and the existence of genes involved in the meiotic-like recombination pathway in the parasite's genome cast doubt on exclusively ...

  3. 薄荷醇麻醉剥离参苗与玻璃海鞘分离的研究%Detaching effect of menthol on the attachment of sea cucumber (Apostichopus japonicus) apart from sea squirt (Ciona intes-tinalis)

    Institute of Scientific and Technical Information of China (English)

    张艳萍; 韩莎; 李成林; 赵斌; 胡炜

    2016-01-01

    在刺参苗种工厂化生产期间,以体积浓度为0.1%~0.5%薄荷醇作为麻醉剂,通过对玻璃海鞘和不同规格参苗进行麻醉剥离实验,研究参苗与敌害生物——玻璃海鞘分离的效果,从而达到高效清除玻璃海鞘的目的。结果表明:薄荷醇溶液对玻璃海鞘无剥离和杀除的作用效果;大规格(0.58 g±0.05 g)刺参选用浓度0.4%~0.5%薄荷醇溶液麻醉20 min,中规格(0.32 g±0.05 g)刺参选用浓度0.2%~0.5%薄荷醇溶液麻醉20min,小规格(0.17 g±0.01 g)刺参选用浓度0.4%~0.5%薄荷醇溶液麻醉10min以及选用浓度0.1%~0.3%薄荷醇溶液麻醉20 min,抖动脱落率均可达90%以上,麻醉剥离效果显著。麻醉剥离后的刺参经1h 的恢复即可达到自然状态,营正常活动附着,无排脏或化皮等不良应激反应。因此,采用薄荷醇麻醉剥离参苗可为安全高效清除玻璃海鞘及分苗的生产环节提供省工省力、高效便捷的方法。%This study aims to develop an efficient method for removing sea squirtCiona intestinalisfrom the sea cucumber nursery system. The detaching effects of menthol (0.1%~0.5% in volume) on the attachment of sea squirt C. intestinalis and different-sized sea cucumber (Apostichopus japonicus) were tested. The results showed that menthol was ineffective in killing or detachingC. intestinalisfrom the attachment. The detaching effect of menthol on different-sized sea cucumbers significantly differed. Over 90% of detachment shaking from settlement substrate was found in the large-sized (0.58 g ± 0.05 g) juveniles exposed to 0.4%~0.5% of menthol for 20 min, me-dium-sized (0.32 g ± 0.05 g) juveniles exposed to 0.2%~0.5% of menthol for 20 min, and small-sized (0.17 g ± 0.01g) exposed to 0.4%~0.5% of menthol for 10 min or exposed to 0.1%~0.3% of menthol for 20 min. These juve-niles, after being detached from the attachment, recovered to reattach after 1 h without ulceration and evisceration. Therefore, this method is

  4. Exploiting the extraordinary genetic polymorphism of ciona for developmental genetics with whole genome sequencing.

    Science.gov (United States)

    Abdul-Wajid, Sarah; Veeman, Michael T; Chiba, Shota; Turner, Thomas L; Smith, William C

    2014-05-01

    Studies in tunicates such as Ciona have revealed new insights into the evolutionary origins of chordate development. Ciona populations are characterized by high levels of natural genetic variation, between 1 and 5%. This variation has provided abundant material for forward genetic studies. In the current study, we make use of deep sequencing and homozygosity mapping to map spontaneous mutations in outbred populations. With this method we have mapped two spontaneous developmental mutants. In Ciona intestinalis we mapped a short-tail mutation with strong phenotypic similarity to a previously identified mutant in the related species Ciona savignyi. Our bioinformatic approach mapped the mutation to a narrow interval containing a single mutated gene, α-laminin3,4,5, which is the gene previously implicated in C. savignyi. In addition, we mapped a novel genetic mutation disrupting neural tube closure in C. savignyi to a T-type Ca(2+) channel gene. The high efficiency and unprecedented mapping resolution of our study is a powerful advantage for developmental genetics in Ciona, and may find application in other outbred species.

  5. Distinguishing contemporary hybridization from past introgression with postgenomic ancestry-informative SNPs in strongly differentiated Ciona species.

    Science.gov (United States)

    Bouchemousse, Sarah; Liautard-Haag, Cathy; Bierne, Nicolas; Viard, Frédérique

    2016-11-01

    Biological introductions bring into contact species that can still hybridize. The evolutionary outcomes of such secondary contacts may be diverse (e.g. adaptive introgression from or into the introduced species) but are not yet well examined in the wild. The recent secondary contact between the non-native sea squirt Ciona robusta (formerly known as C. intestinalis type A) and its native congener C. intestinalis (formerly known as C. intestinalis type B), in the Western English Channel, provides an excellent case study to examine. To examine contemporary hybridization between the two species, we developed a panel of 310 ancestry-informative SNPs from a population transcriptomic study. Hybridization rates were examined on 449 individuals sampled in eight sites from the sympatric range and five sites from allopatric ranges. The results clearly showed an almost complete absence of contemporary hybridization between the two species in syntopic localities, with only one-first-generation hybrid and no other genotype compatible with recent backcrosses. Despite the almost lack of contemporary hybridization, shared polymorphisms were observed in sympatric and allopatric populations of both species. Furthermore, one allopatric population from SE Pacific exhibited a higher rate of shared polymorphisms compared to all other C. robusta populations. Altogether, these results indicate that the observed level of shared polymorphism is more probably the outcome of ancient gene flow spread afterwards at a worldwide scale. They also emphasize efficient reproductive barriers preventing hybridization between introduced and native species, which suggests hybridization should not impede too much the expansion and the establishment of the non-native species in its introduction range.

  6. A multicassette Gateway vector set for high throughput and comparative analyses in ciona and vertebrate embryos.

    Directory of Open Access Journals (Sweden)

    Agnès Roure

    Full Text Available BACKGROUND: The past few years have seen a vast increase in the amount of genomic data available for a growing number of taxa, including sets of full length cDNA clones and cis-regulatory sequences. Large scale cross-species comparisons of protein function and cis-regulatory sequences may help to understand the emergence of specific traits during evolution. PRINCIPAL FINDINGS: To facilitate such comparisons, we developed a Gateway compatible vector set, which can be used to systematically dissect cis-regulatory sequences, and overexpress wild type or tagged proteins in a variety of chordate systems. It was developed and first characterised in the embryos of the ascidian Ciona intestinalis, in which large scale analyses are easier to perform than in vertebrates, owing to the very efficient embryo electroporation protocol available in this organism. Its use was then extended to fish embryos and cultured mammalian cells. CONCLUSION: This versatile vector set opens the way to the mid- to large-scale comparative analyses of protein function and cis-regulatory sequences across chordate evolution. A complete user manual is provided as supplemental material.

  7. Pneumatosis intestinalis: CT findings and clinical features

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Hye Lin; Lee, Hae Kyung; Park, Seong Jin; Yi, Boem Ha; Ko, Bong Min; Hong, Hyun Sook; Paik, Sang Hyun [Soonchunhyang University Hospital Bucheon, Bucheon (Korea, Republic of)

    2008-02-15

    The purpose of this study is to evaluate the CT findings and clinical features of patients with pneumatosis intestinalis. From January 2001 to October 2007, 15 patients with pneumatosis intestinalis were diagnosed by the use of CT. We analyzed the clinical features and CT findings to assess the involvement site, the presence of portal and mesenteric vein gas, and the existence of accompanied ischemic change. Of the 15 patients, five patients had end stage renal disease (33.3%), two patients underwent a gastrectomy, one patient underwent a laminectomy, one patient had tuberculous enteritis, one patient had lung cancer and one patient had pneumonia. Four patients presented with no specific disease. There was portal or mesenteric venous gas in six cases, and strangulation or an ischemic change of the bowel in five cases. Otherwise, pneumatosis intestinalis was associated with hydropneumoperitoneum in two cases, pneumoperitoneum in one case and a single case of perforated appendicitis. Nine patients underwent surgery for ischemic change of the bowel, pneumoperitoneum, appendicitis, and a clinical sign of panperitonitis. Among the remaining six patients, three patients recovered and were discharged, and three patients expired during progression of the disease. End stage renal disease is the most common condition associated with pneumatosis intestinalis. The presence of portomesenteric venous gas, ischemic change of the bowel, and linear pneumatosis intestinalis are indicative of a poor prognosis.

  8. Functional Brachyury binding sites establish a temporal read-out of gene expression in the Ciona notochord.

    Directory of Open Access Journals (Sweden)

    Lavanya Katikala

    2013-10-01

    Full Text Available The appearance of the notochord represented a milestone in Deuterostome evolution. The notochord is necessary for the development of the chordate body plan and for the formation of the vertebral column and numerous organs. It is known that the transcription factor Brachyury is required for notochord formation in all chordates, and that it controls transcription of a large number of target genes. However, studies of the structure of the cis-regulatory modules (CRMs through which this control is exerted are complicated in vertebrates by the genomic complexity and the pan-mesodermal expression territory of Brachyury. We used the ascidian Ciona, in which the single-copy Brachyury is notochord-specific and CRMs are easily identifiable, to carry out a systematic characterization of Brachyury-downstream notochord CRMs. We found that Ciona Brachyury (Ci-Bra controls most of its targets directly, through non-palindromic binding sites that function either synergistically or individually to activate early- and middle-onset genes, respectively, while late-onset target CRMs are controlled indirectly, via transcriptional intermediaries. These results illustrate how a transcriptional regulator can efficiently shape a shallow gene regulatory network into a multi-tiered transcriptional output, and provide insights into the mechanisms that establish temporal read-outs of gene expression in a fast-developing chordate embryo.

  9. Distinct Roles of Soluble and Transmembrane Adenylyl Cyclases in the Regulation of Flagellar Motility in Ciona Sperm

    Directory of Open Access Journals (Sweden)

    Kogiku Shiba

    2014-07-01

    Full Text Available Adenylyl cyclase (AC is a key enzyme that synthesizes cyclic AMP (cAMP at the onset of the signaling pathway to activate sperm motility. Here, we showed that both transmembrane AC (tmAC and soluble AC (sAC are distinctly involved in the regulation of sperm motility in the ascidian Ciona intestinalis. A tmAC inhibitor blocked both cAMP synthesis and the activation of sperm motility induced by the egg factor sperm activating and attracting factor (SAAF, as well as those induced by theophylline, an inhibitor of phoshodiesterase. It also significantly inhibited cAMP-dependent phosphorylation of a set of proteins at motility activation. On the other hand, a sAC inhibitor does not affect on SAAF-induced transient increase of cAMP, motility activation or protein phosphorylation, but it reduced swimming velocity to half in theophylline-induced sperm. A sAC inhibitor KH-7 induced circular swimming trajectory with smaller diameter and significantly suppressed chemotaxis of sperm to SAAF. These results suggest that tmAC is involved in the basic mechanism for motility activation through cAMP-dependent protein phosphorylation, whereas sAC plays distinct roles in increase of flagellar beat frequency and in the Ca2+-dependent chemotactic movement of sperm.

  10. Pneumatosis Cystoides Intestinalis: A Rare Benign Cause of Pneumoperitoneum

    Directory of Open Access Journals (Sweden)

    Puneet Devgun

    2013-01-01

    Full Text Available Pneumatosis cystoides intestinalis is a rare gastrointestinal complication in the course of connective tissue diseases, especially in scleroderma, that can lead to pneumoperitoneum or obstruction. Findings on plain radiography may reveal radiolucent linear or bubbly circular air bubbles in the bowel wall, with or without free gas accumulation in the peritoneal cavity. Treatment of pneumatosis cystoides intestinalis ranges from supportive care to laparotomy.

  11. Pseudocystic pheochromocytoma associated with pneumatosis cystoides intestinalis

    Energy Technology Data Exchange (ETDEWEB)

    Alanen, A.; Kormano, M.

    1982-02-01

    The authors report a case of a large pseudocystic pheochromocytoma, which initially was operated on and histologically diagnosed as a pancreatic pseudocyst. After recurrence, a multilocular cystic tumor was found both by ultrasonography and CT. ERCP demonstrated a cut-off of the pancreatic duct. Re-operation revealed a cystic adrenal tumor anastomosed to the stomach. The operation was complicated by a hypertensive crisis and a subsequent subendocardial infarction. In the preoperative period the patient had continuous diarrhea and pneumatosis cystoides intestinalis was demonstrated by double contrast barium enema. The pneumatosis disappeared within three months but a recurrent tumor appeared. The importance of CT in the preoperative work-up of upper abdominal lesions is emphasized, as atypical cystic masses may cause differential diagnostic problems in surgery or even in localized biopsies, while CT would give a better overall view of the tumor.

  12. Revised lineage of larval photoreceptor cells in Ciona reveals archetypal collaboration between neural tube and neural crest in sensory organ formation.

    Science.gov (United States)

    Oonuma, Kouhei; Tanaka, Moeko; Nishitsuji, Koki; Kato, Yumiko; Shimai, Kotaro; Kusakabe, Takehiro G

    2016-12-01

    The Ciona intestinalis larva has two distinct photoreceptor organs, a conventional pigmented ocellus and a nonpigmented ocellus, that are asymmetrically situated in the brain. The ciliary photoreceptor cells of these ocelli resemble visual cells of the vertebrate retina. Precise elucidation of the lineage of the photoreceptor cells will be key to understanding the developmental mechanisms of these cells as well as the evolutionary relationships between the photoreceptor organs of ascidians and vertebrates. Photoreceptor cells of the pigmented ocellus have been thought to develop from anterior animal (a-lineage) blastomeres, whereas the developmental origin of the nonpigmented ocellus has not been determined. Here, we show that the photoreceptor cells of both ocelli develop from the right anterior vegetal hemisphere: those of the pigmented ocellus from the right A9.14 cell and those of the nonpigmented ocellus from the right A9.16 cell. The pigmented ocellus is formed by a combination of two lineages of cells with distinct embryonic origins: the photoreceptor cells originate from a medial portion of the A-lineage neural plate, while the pigment cell originates from the lateral edge of the a-lineage neural plate. In light of the recently proposed close evolutionary relationship between the ocellus pigment cell of ascidians and the cephalic neural crest of vertebrates, the ascidian ocellus may represent a prototypic contribution of the neural crest to a cranial sensory organ.

  13. Two Cases of Pneumatosis Intestinalis during Cetuximab Therapy for Advanced Head and Neck Cancer

    Directory of Open Access Journals (Sweden)

    James A. Miller

    2015-01-01

    Full Text Available Pneumatosis intestinalis is a rare but known potential complication of treatment with cetuximab. Here we present two cases of pneumatosis intestinalis occurring in patients who were receiving cetuximab as treatment for advanced head and neck cancer. In both cases, cetuximab was discontinued after discovery of the pneumatosis intestinalis.

  14. Cytometric Approach for Detection of Encephalitozoon intestinalis, an Emergent Agent▿

    Science.gov (United States)

    Barbosa, Joana; Rodrigues, Acácio Gonçalves; Pina-Vaz, Cidália

    2009-01-01

    Encephalitozoon intestinalis is responsible for intestinal disease in patients with AIDS and immunocompetent patients. The infectious form is a small spore that is resistant to water treatment procedures. Its detection is very important, but detection is very cumbersome and time-consuming. Our main objective was to develop and optimize a specific flow cytometric (FC) protocol for the detection of E. intestinalis in hospital tap water and human feces. To determine the optimal specific antibody (Microspor-FA) concentration, a known concentration of E. intestinalis spores (Waterborne, Inc.) was suspended in hospital tap water and stool specimens with different concentrations of Microspor-FA, and the tap water and stool specimens were incubated under different conditions. The sensitivity limit and specificity were also evaluated. To study spore infectivity, double staining with propidium iodide (PI) and Microspor-FA was undertaken. Distinct approaches for filtration and centrifugation of the stool specimens were used. E. intestinalis spores stained with 10 μg/ml of Microspor-FA at 25°C overnight provided the best results. The detection limit was 5 × 104 spores/ml, and good specificity was demonstrated. Simultaneous staining with Microspor-FA and PI ensured that the E. intestinalis spores were dead and therefore noninfectious. With the stool specimens, better spore recovery was observed with a saturated solution of NaCl and centrifugation at 1,500 × g for 15 min. A new approach for the detection of E. intestinalis from tap water or human feces that ensures that the spores are not viable is now available and represents an important step for the prevention of this threat to public health. PMID:19439525

  15. Characterization of RNase MRP RNA and novel snoRNAs from Giardia intestinalis and Trichomonas vaginalis

    Directory of Open Access Journals (Sweden)

    Chen Xiaowei S

    2011-11-01

    Full Text Available Abstract Background Eukaryotic cells possess a complex network of RNA machineries which function in RNA-processing and cellular regulation which includes transcription, translation, silencing, editing and epigenetic control. Studies of model organisms have shown that many ncRNAs of the RNA-infrastructure are highly conserved, but little is known from non-model protists. In this study we have conducted a genome-scale survey of medium-length ncRNAs from the protozoan parasites Giardia intestinalis and Trichomonas vaginalis. Results We have identified the previously 'missing' Giardia RNase MRP RNA, which is a key ribozyme involved in pre-rRNA processing. We have also uncovered 18 new H/ACA box snoRNAs, expanding our knowledge of the H/ACA family of snoRNAs. Conclusions Results indicate that Giardia intestinalis and Trichomonas vaginalis, like their distant multicellular relatives, contain a rich infrastructure of RNA-based processing. From here we can investigate the evolution of RNA processing networks in eukaryotes.

  16. Pneumatosis Intestinalis in a Patient with Acute Promyelocytic Leukemia

    Directory of Open Access Journals (Sweden)

    Abhishek Mangaonkar

    2015-01-01

    Full Text Available Pneumatosis Intestinalis is a rare condition characterized by the presence of gas within the intestinal wall. We describe a case of a 33-year-old woman with acute promyelocytic leukemia who developed nausea and nonbloody diarrhea. CT showed intramural air in transverse and descending colon. Patient clinically improved with conservative management.

  17. Giardia intestinalis incorporates heme into cytosolic cytochrome b₅.

    Science.gov (United States)

    Pyrih, Jan; Harant, Karel; Martincová, Eva; Sutak, Robert; Lesuisse, Emmanuel; Hrdý, Ivan; Tachezy, Jan

    2014-02-01

    The anaerobic intestinal pathogen Giardia intestinalis does not possess enzymes for heme synthesis, and it also lacks the typical set of hemoproteins that are involved in mitochondrial respiration and cellular oxygen stress management. Nevertheless, G. intestinalis may require heme for the function of particular hemoproteins, such as cytochrome b5 (cytb5). We have analyzed the sequences of eukaryotic cytb5 proteins and identified three distinct cytb5 groups: group I, which consists of C-tail membrane-anchored cytb5 proteins; group II, which includes soluble cytb5 proteins; and group III, which comprises the fungal cytb5 proteins. The majority of eukaryotes possess both group I and II cytb5 proteins, whereas three Giardia paralogs belong to group II. We have identified a fourth Giardia cytb5 paralog (gCYTb5-IV) that is rather divergent and possesses an unusual 134-residue N-terminal extension. Recombinant Giardia cytb5 proteins, including gCYTb5-IV, were expressed in Escherichia coli and exhibited characteristic UV-visible spectra that corresponded to heme-loaded cytb5 proteins. The expression of the recombinant gCYTb5-IV in G. intestinalis resulted in the increased import of extracellular heme and its incorporation into the protein, whereas this effect was not observed when gCYTb5-IV containing a mutated heme-binding site was expressed. The electrons for Giardia cytb5 proteins may be provided by the NADPH-dependent Tah18-like oxidoreductase GiOR-1. Therefore, GiOR-1 and cytb5 may constitute a novel redox system in G. intestinalis. To our knowledge, G. intestinalis is the first anaerobic eukaryote in which the presence of heme has been directly demonstrated.

  18. Pneumatosis Intestinalis: A Case Report and Approach to Management

    Directory of Open Access Journals (Sweden)

    Sean Donovan

    2011-01-01

    Full Text Available Pneumatosis intestinalis (PI, defined as gas within the bowel wall, is an uncommon radiographic sign which can represent a wide spectrum of diseases and a variety of underlying diagnoses. Because its etiology can vary greatly, management of PI ranges from surgical intervention to outpatient observation (see, Greenstein et al. (2007, Morris et al. (2008, and Peter et al. (2003. Since PI is infrequently encountered, clinicians may be unfamiliar with its diagnosis and management; this unfamiliarity, combined with the potential necessity for urgent intervention, may place the clinician confronted with PI in a precarious medical scenario. We present a case of pneumatosis intestinalis in a patient who posed a particularly challenging diagnostic dilemma for the primary team. Furthermore, we explore the differential diagnosis prior to revealing the intervention offered to our patient; our concise yet inclusive differential and thought process for rapid evaluation may be of benefit to clinicians presented with similar clinical scenarios.

  19. Surgical aspects of pneumatosis cystoides intestinalis: two case reports

    OpenAIRE

    Schröpfer, Engelbert; Meyer, Thomas

    2009-01-01

    Introduction Pneumatosis cystoides intestinalis is a rare disease usually caused by an underlying condition. It is defined as air filled cysts within the wall of the gastrointestinal tract. The purpose of this paper is the development of an algorithm for the surgical therapy of PCI based one two case reports. Case presentations A 17-year-old girl with Down syndrome and leucopenia due to chemotherapy for acute lymphatic leukemia was admitted with acute septic conditions and PCI. Explorative la...

  20. Recurrent pneumatosis intestinalis in a patient with dermatomyositis

    OpenAIRE

    2013-01-01

    A 51-year-old woman with dermatomyositis (DM) on chronic immunosuppressive therapy was hospitalised for evaluation of haematuria. Surprisingly, abdominal imaging demonstrated pneumoperitoneum and pneumatosis intestinalis (PI). Her abdominal examination and white cell count were normal, but she subsequently developed nausea and fever. Owing to concern for perforation, a hemicolectomy was performed. Pathology revealed PI without inflammatory, ischaemic or neoplastic features, and she recovered ...

  1. Pneumatosis intestinalis leading to perioperative hypovolemic shock: Case report

    Directory of Open Access Journals (Sweden)

    Nishio Minoru

    2011-05-01

    Full Text Available Abstract Pneumatosis intestinalis (PI is an uncommon disorder defined as multiple foci of gas within the intestinal wall. Despite recognition of an increasing number of cases of PI, the optimal management strategy, whether through surgical or other means, remains controversial. The present report describes the case of a patient with PI who underwent exploratory laparotomy without specific findings and who ultimately died due to extensive intestinal hemorrhage that was possibly triggered by surgery.

  2. Core histone genes of Giardia intestinalis: genomic organization, promoter structure, and expression

    Directory of Open Access Journals (Sweden)

    Adam Rodney D

    2007-04-01

    Full Text Available Abstract Background Giardia intestinalis is a protist found in freshwaters worldwide, and is the most common cause of parasitic diarrhea in humans. The phylogenetic position of this parasite is still much debated. Histones are small, highly conserved proteins that associate tightly with DNA to form chromatin within the nucleus. There are two classes of core histone genes in higher eukaryotes: DNA replication-independent histones and DNA replication-dependent ones. Results We identified two copies each of the core histone H2a, H2b and H3 genes, and three copies of the H4 gene, at separate locations on chromosomes 3, 4 and 5 within the genome of Giardia intestinalis, but no gene encoding a H1 linker histone could be recognized. The copies of each gene share extensive DNA sequence identities throughout their coding and 5' noncoding regions, which suggests these copies have arisen from relatively recent gene duplications or gene conversions. The transcription start sites are at triplet A sequences 1–27 nucleotides upstream of the translation start codon for each gene. We determined that a 50 bp region upstream from the start of the histone H4 coding region is the minimal promoter, and a highly conserved 15 bp sequence called the histone motif (him is essential for its activity. The Giardia core histone genes are constitutively expressed at approximately equivalent levels and their mRNAs are polyadenylated. Competition gel-shift experiments suggest that a factor within the protein complex that binds him may also be a part of the protein complexes that bind other promoter elements described previously in Giardia. Conclusion In contrast to other eukaryotes, the Giardia genome has only a single class of core histone genes that encode replication-independent histones. Our inability to locate a gene encoding the linker histone H1 leads us to speculate that the H1 protein may not be required for the compaction of Giardia's small and gene-rich genome.

  3. Two mannose-binding lectin homologues and an MBL-associated serine protease are expressed in the gut epithelia of the urochordate species Ciona intestinalis

    DEFF Research Database (Denmark)

    Skjoedt, Mikkel-ole; Palarasah, Yaseelan; Rasmussen, Karina

    2010-01-01

    interchain disulphide bridges between N-terminal cysteine residues and cysteines located between the neck region and the CRD. RT-PCR showed a tissue specific expression of CioMBL in the gut and by immunohistochemistry analysis we also demonstrated that CioMBL co-localize with an MBL-associated serine...... protease in the epithelia cells lining the stomach and intestine. In conclusion we present two urochordate MBLs and identify an associated serine protease, which support the concept of an evolutionary ancient origin of the lectin complement pathway....

  4. Ciona intestinalis as a Marine Model System to Study Some Key Developmental Genes Targeted by the Diatom-Derived Aldehyde Decadienal

    OpenAIRE

    Anna Lettieri; Rosaria Esposito; Adrianna Ianora; Antonietta Spagnuolo

    2015-01-01

    The anti-proliferative effects of diatoms, described for the first time in copepods, have also been demonstrated in benthic invertebrates such as polychaetes, sea urchins and tunicates. In these organisms PUAs (polyunsaturated aldehydes) induce the disruption of gametogenesis, gamete functionality, fertilization, embryonic mitosis, and larval fitness and competence. These inhibitory effects are due to the PUAs, produced by diatoms in response to physical damage as occurs during copepod grazin...

  5. The diatom-derived aldehyde decadienal affects life cycle transition in the ascidian Ciona intestinalis through nitric oxide/ERK signalling

    OpenAIRE

    Castellano, Immacolata; Ercolesi, Elena; Romano, Giovanna; Ianora, Adrianna; Palumbo, Anna

    2015-01-01

    Polyunsaturated aldehydes (PUAs) are fatty-acid-derived metabolites produced by some microalgae, including different diatom species. PUAs are mainly produced as a wound-activated defence mechanism against microalgal predators or released from senescent cells at the end of a bloom. PUAs, including 2,4-trans-decadienal (DD), induce deleterious effects on embryonic and larval development of several planktonic and benthic organisms. Here, we report on the effects of DD on larval development and m...

  6. Etude comparative des conditions environnementales potentiellement limitantes dans l'etablissement d'une espece aquatique envahissante Clona intestinalis (Linnaeus, 1767) dans deux systemes de bassins versants a l'ile-du Prince-Edouard, Canada

    Science.gov (United States)

    Mclaughlin, Janelle

    rate, larval establishment and survival of juvenile tunicates. All these elements can potentially be key factors on limiting the establishment of a population of C. intestinalis in the Orwell Bay aquatic system. Keywords: Invasive species, watershed, biogeography, tunicate, Ciona intestinalis, universal soil loss equation, hydrodynamic modeling, correspondence analysis, turbidity, environmental tolerance.

  7. Diagnostic laparoscopy for pneumatosis intestinalis in a very elderly patient: A case report

    Directory of Open Access Journals (Sweden)

    Shuhei Ito

    2017-09-01

    Conclusion: Diagnostic laparoscopy may be a useful option for definitively ruling out the lethal conditions associated with pneumatosis intestinalis in frail elderly patients with severe conditions in the emergency setting.

  8. Common coinfections of Giardia intestinalis and Helicobacter pylori in non-symptomatic Ugandan children.

    Directory of Open Access Journals (Sweden)

    Johan Ankarklev

    Full Text Available BACKGROUND: The protozoan parasite Giardia intestinalis and the pathogenic bacterium Helicobacter pylori are well known for their high prevalences in human hosts worldwide. The prevalence of both organisms is known to peak in densely populated, low resource settings and children are infected early in life. Different Giardia genotypes/assemblages have been associated with different symptoms and H. pylori with induction of cancer. Despite this, not much data are available from sub-Saharan Africa with regards to the prevalence of different G. intestinalis assemblages and their potential association with H. pylori infections. METHODOLOGY/PRINCIPAL FINDINGS: Fecal samples from 427 apparently healthy children, 0-12 years of age, living in urban Kampala, Uganda were analyzed for the presence of H. pylori and G. intestinalis. G. intestinalis was found in 86 (20.1% out of the children and children age 1<5 years had the highest rates of colonization. H. pylori was found in 189 (44.3% out of the 427 children and there was a 3-fold higher risk of concomitant G. intestinalis and H. pylori infections compared to non-concomitant G. intestinalis infection, OR = 2.9 (1.7-4.8. No significant association was found in the studied population with regard to the presence of Giardia and gender, type of toilet, source of drinking water or type of housing. A panel of 45 G. intestinalis positive samples was further analyzed using multi-locus genotyping (MLG on three loci, combined with assemblage-specific analyses. Giardia MLG analysis yielded a total of five assemblage AII, 25 assemblage B, and four mixed assemblage infections. The assemblage B isolates were highly genetically variable but no significant association was found between Giardia assemblage type and H. pylori infection. CONCLUSIONS/SIGNIFICANCE: This study shows that Giardia assemblage B dominates in children in Kampala, Uganda and that the presence of H. pylori is an associated risk factor for G

  9. Pneumatosis Intestinalis: Can We Avoid Surgical Intervention in Nonsurgical Patients?

    Directory of Open Access Journals (Sweden)

    Ayman Al-Talib

    2009-09-01

    Full Text Available Pneumatosis intestinalis (PI is the presence of gas within the wall of the gastrointestinal tract and represents a tremendous spectrum of conditions and outcomes, ranging from benign diseases to abdominal sepsis and death. It is seen with increased frequency in patients who are immunocompromised because of steroids, chemotherapy, radiation therapy, or AIDS. PI may result from intraluminal bacterial gas entering the bowel wall due to increased mucosal permeability caused by defects in bowel wall lymphoid tissue. We present a case of PI who was treated conservatively and in whom PI resolved completely and we present a literature review of conservative management. It is not difficult to make a precise diagnosis of PI and to prevent unnecessary surgical intervention, especially when PI presents without clinical evidence of peritonitis. Conservative treatment is possible and safe for selected patients. Awareness of these rare causes of PI and close observation of selected patients without peritonitis may prevent unnecessary invasive surgical explorations.

  10. Recurrent pneumatosis intestinalis in a patient with dermatomyositis.

    Science.gov (United States)

    Zarbalian, Yousef; von Rosenvinge, Erik C; Twadell, William; Mikdashi, Jamal

    2013-08-23

    A 51-year-old woman with dermatomyositis (DM) on chronic immunosuppressive therapy was hospitalised for evaluation of haematuria. Surprisingly, abdominal imaging demonstrated pneumoperitoneum and pneumatosis intestinalis (PI). Her abdominal examination and white cell count were normal, but she subsequently developed nausea and fever. Owing to concern for perforation, a hemicolectomy was performed. Pathology revealed PI without inflammatory, ischaemic or neoplastic features, and she recovered uneventfully. Her immunosuppressive therapy was discontinued. Six months later, a follow-up CT of the abdomen revealed recurrence of PI. As she was asymptomatic, she was managed conservatively with resolution of PI on subsequent imaging. PI is characterised by the presence of gas within the wall of the intestine. Its aetiology is often unclear but this case highlights the association between PI and both immunosuppressive therapy and DM. A review of PI in patients with DM suggests that clinically stable patients may be observed, while avoiding surgical intervention.

  11. A one-dimensional model of PCP signaling: polarized cell behavior in the notochord of the ascidian Ciona.

    Science.gov (United States)

    Kourakis, Matthew J; Reeves, Wendy; Newman-Smith, Erin; Maury, Benoit; Abdul-Wajid, Sarah; Smith, William C

    2014-11-01

    Despite its importance in development and physiology the planar cell polarity (PCP) pathway remains one of the most enigmatic signaling mechanisms. The notochord of the ascidian Ciona provides a unique model for investigating the PCP pathway. Interestingly, the notochord appears to be the only embryonic structure in Ciona activating the PCP pathway. Moreover, the Ciona notochord as a single-file array of forty polarized cells is a uniquely tractable system for the study of polarization dynamics and the transmission of the PCP pathway. Here, we test models for propagation of a polarizing signal, interrogating temporal, spatial and signaling requirements. A simple cell-cell relay cascading through the entire length of the notochord is not supported; instead a more complex mechanism is revealed, with interactions influencing polarity between neighboring cells, but not distant ones. Mechanisms coordinating notochord-wide polarity remain elusive, but appear to entrain general (i.e., global) polarity even while local interactions remain important. However, this global polarizer does not appear to act as a localized, spatially-restricted determinant. Coordination of polarity along the long axis of the notochord requires the PCP pathway, a role we demonstrate is temporally distinct from this pathway's earlier role in convergent extension and intercalation. We also reveal polarity in the notochord to be dynamic: a cell's polarity state can be changed and then restored, underscoring the Ciona notochord's amenability for in vivo studies of PCP. Copyright © 2014 Elsevier Inc. All rights reserved.

  12. 3D-printed microwell arrays for Ciona microinjection and timelapse imaging.

    Directory of Open Access Journals (Sweden)

    Clint Gregory

    Full Text Available Ascidians such as Ciona are close chordate relatives of the vertebrates with small, simple embryonic body plans and small, simple genomes. The tractable size of the embryo offers considerable advantages for in toto imaging and quantitative analysis of morphogenesis. For functional studies, Ciona eggs are considerably more challenging to microinject than the much larger eggs of other model organisms such as zebrafish and Xenopus. One of the key difficulties is in restraining the eggs so that the microinjection needle can be easily introduced and withdrawn. Here we develop and test a device to cast wells in agarose that are each sized to hold a single egg. This injection mold is fabricated by micro-resolution stereolithography with a grid of egg-sized posts that cast corresponding wells in agarose. This 3D printing technology allows the rapid and inexpensive testing of iteratively refined prototypes. In addition to their utility in microinjection, these grids of embryo-sized wells are also valuable for timelapse imaging of multiple embryos.

  13. In vitro antimicrobial activities of methanolic extract from marine alga Enteromorpha intestinalis

    Institute of Scientific and Technical Information of China (English)

    Ibrahim; Darah; Sheh-Hong; Lim

    2015-01-01

    Objective:To extract the bioactive compound from Enteromorpha intestinalis(E. intestinalis) and determine its in vitro antimicrobial activity. Methods: E. intestinalis was extracted by methanol and subjected to antimicrobial screening. The antimicrobial activity was studied by using disc diffusion and broth dilution method. The effect of the extract on the growth profile of the bacterial was also examined via time-kill assay. Microscopy observations using SEM was done to determine the major alterations in the microstructure of methicillin-resistant Staphylococcus aureus(MRSA). Results: The results showed methanolic extract of E. intestinalis exhibited a favourable antimicrobial activity against tested bacteria with produced inhibition zone ranging from 8.0-19.0 mm. However, all the tested fungi and yeast were resistant to the extract treatment. Time kill assay suggested that methanolic extract of E. intestinalis had completely inhibited MRSA growth and also exhibited prolonged antibacterial activity. The main abnormalities noted from the microscopic observations were the structural deterioration in the normal morphology and complete collapsed of the bacteria cells after 36 h of treatment. Conclusions: The significant antibacterial activity shown by crude extract suggested its potential against MRSA infection. The extract may have potential to develop as antibacterial agent in pharmaceutical use.

  14. In vitro antimicrobial activities of methanolic extract from marine alga Enteromorpha intestinalis

    Institute of Scientific and Technical Information of China (English)

    Ibrahim Darah; Sheh-Hong Lim

    2015-01-01

    To extract the bioactive compound from Enteromorpha intestinalis (E. intestinalis) and determine its in vitro antimicrobial activity. Methods: E. intestinalis was extracted by methanol and subjected to antimicrobial screening. The antimicrobial activity was studied by using disc diffusion and broth dilution method. The effect of the extract on the growth profile of the bacterial was also examined via time-kill assay. Microscopy observations using SEM was done to determine the major alterations in the microstructure of methicillin-resistant Staphylococcus aureus (MRSA). Results: The results showed methanolic extract of E. intestinalis exhibited a favourable antimicrobial activity against tested bacteria with produced inhibition zone ranging from 8.0-19.0 mm. However, all the tested fungi and yeast were resistant to the extract treatment. Time kill assay suggested that methanolic extract of E. intestinalis had completely inhibited MRSA growth and also exhibited prolonged antibacterial activity. The main abnormalities noted from the microscopic observations were the structural deterioration in the normal morphology and complete collapsed of the bacteria cells after 36 h of treatment. Conclusions: The significant antibacterial activity shown by crude extract suggested its potential against MRSA infection. The extract may have potential to develop as antibacterial agent in pharmaceutical use.

  15. Stable transfection of Eimeria intestinalis and investigation of its life cycle, reproduction and immunogenicity

    Directory of Open Access Journals (Sweden)

    Tuanyuan eShi

    2016-05-01

    Full Text Available Rabbit coccidiosis, caused by infection of Eimeria spp. is one of the most severe parasitic diseases in rabbits. E. intestinalis is one of the most immunogenic species in rabbit coccidia. Due to the lack of genomic information and unsuccessful in vitro cultivation, genetic manipulation of rabbit coccidia lagged behind other apicomplexan parasites. Using regulatory sequences from E. tenella, we obtained a transgenic line of E. intestinalis expressing yellow fluorescent protein (YFP. YFP was continuously expressed throughout the whole life cycle. Morphological features of E. intestinalis in the different developmental stages were dynamically observed with the transgenic line. Some important features in the endogenous development stages were observed. Trophozoites were found as early as 4 h post inoculation. Two-types of schizonts and merozoites were observed in first three of the four schizogonies. Beside jejunum and ileum, gametogony stage and oocysts were also found in the duodenum and vermiform appendix. In addition, the transgenic strain was highly immunogenic but less pathogenic than the wild type. Considering the high immunogenicity of E. intestinalis and amenability to transfection with foreign genes, transgenic E. intestinalis could be a promising oral eukaryotic vaccine vector.

  16. [Study of anemia in giardiasis intestinalis in Tunisian preschool children].

    Science.gov (United States)

    Gharbi, T; Chaker, E; Boughedir, J; el Mabrouk, S; Ben Rayana, M C

    1999-11-01

    The present work is based upon a prospective in study done in a semi-urban area of suburbs of Tunis, from february to November 1997. A total of 302 children aged between 6 month to 5 years were enrolled in the survey. The study aimed at assessing the extention of parasitoses in preschool aged children. The relationship between the Giardiasis intestinalis and ferropenic anemia. The prevalence of anemia is 31.78% (n = 302). The parasitologic analysis has shown that 113 children out of 302 are infected; 37.41%. We observed an obvious predominance of Giardia Lamblia: 62% (n = 113) pathogenic protozoon. The rate of anemia parasited children is amounted to 19.78%. During the Giardiasis, anemia is present in 23.17% of the cases. The Polyparasitism concerns 16% of the infested children. This anemia could be caused by a global bad absorption syndrome or by a ferro-elective bad absorption. A proper sanitary education, a purification action and also a curative treatment of the beaners carriers will be the only guarantees to decrease its morbidity.

  17. Clinical analysis of 20 cases of pneumatosis cystoides intestinalis

    Directory of Open Access Journals (Sweden)

    Rui TONG

    2016-03-01

    Full Text Available Objective  To review the experiences of diagnosis and treatment of pneumatosis cystoides intestinalis (PCI, and study the clinical characteristics of the disease in order to improve the diagnosis and treatment. Methods  Clinical data from 20 patients with endoscopically confirmed PCI were retrospectively analyzed. They were admitted to the Chinese PLA General Hospital from June 1995 to June 2015. Results  Among the patients 16 of them were male,and the other four were female. The main clinical manifestations were abdominal distention, diarrhea, abdominal pain and mucous bloody stool. The diagnosis relied mainly on colonoscopy and pathological examination. Laparoscopy assisted colorectal cancer resection was performed in 1 patient, laparostomy and repair of sigmoid colon perforation in 1, endoscopic treatment in 5 cases, drug administration and hyperbaric oxygen therapy in 2, drug treatment alone in 7, and no treatment in 4. Conclusions  The final diagnosis depends on endoscopic findings. No treatment is recommended to patients with no symptoms. The management of patients with PCI includes antibiotics, oxygen therapy, endoscopic therapy, surgery, and appropriate therapy related to the underlying cause of PCI. The prognosis is good. DOI: 10.11855/j.issn.0577-7402.2016.02.09

  18. Pneumatosis intestinalis in children after allogeneic bone marrow transplantation

    Energy Technology Data Exchange (ETDEWEB)

    Yeager, A.M.; Kanof, M.E.; Lake, A.M.; Kramer, S.S.; Jones, B.; Saral, R.; Santos, G.W.

    1987-01-01

    Four children, ages 3 to 8 years, developed pneumatosis intestinalis (PI) after allogeneic bone marrow transplantation (BMT) for acute leukemia or severe aplastic anemia. PI was detected at a median of 48 days (range, 10-63 days) after BMT and was associated with abdominal symptoms and clinical signs. All patients had severe systemic and/or highgrade cutaneous acute graft-versus-host disease (AGVHD) at some time after BMT and were receiving corticosteroids at the time of development of PI; however, PI was associated with concomitant severe AGVHD in only one patient. One patient with PI had Hafnia alvei bacteremia and another patient had gastroenteritis due to rotavirus and adenovirus. All patients were treated with supportive care and systemic broad-spectrum antibiotics, and PI resolved 2-16 days after onset. Two patients died with BMT-associated complications unrelated to PI. Multiple factors contribute to the development of PI after BMT, and the prognosis for recovery from PI is good with medical management alone. Overall survival in these patients is dependent on the frequency and severity of other conditions, such as AGVHD and opportunistic infections, after BMT.

  19. [Prevalence of Encephalitozoon intestinalis and Enterocytozoon bieneusi in HIV positive patients to Maracaibo, Venezuela].

    Science.gov (United States)

    Rivero-Rodríguez, Zulbey; Hernández Sierra, Amparo; Arráiz, Nailet; Bracho Mora, Angela; Villalobos Perozo, Rafael

    2013-03-01

    Microsporidioses are considered emerging and opportunistic infections in immunocompromised individuals worldwide. The purpose of this study was to identify the species of intestinal microsporidia in patients with HIV-AIDS from the Servicio Autónomo Hospital Universitario de Maracaibo, Venezuela (SAHUM). Fecal samples were collected from 50 patients with confirmed diagnosis of HIV, during the years 2007 and 2008; the CD4 values were obtained from 42 patients. The samples were analyzed by separate PCRs to identify Encephalitozoon intestinalis and Enterocytozoon bieneusi. Microsporidia species showed a 36% prevalence: ten patients had Encephalitozoon intestinalis, four Enterocytozoon bieneusi and four both species. An inverse and statistically significant relationship between the CD4 count and the presence of microsporidia in the fecal sample was also found. It is remarkable the high prevalence of microsporidia species observed in the HIV patients studied, with a predominance of E. intestinalis.

  20. Genome-wide analyses of recombination suggest that Giardia intestinalis assemblages represent different species.

    Science.gov (United States)

    Xu, Feifei; Jerlström-Hultqvist, Jon; Andersson, Jan O

    2012-10-01

    Giardia intestinalis is a major cause of waterborne enteric disease in humans. The species is divided into eight assemblages suggested to represent separate Giardia species based on host specificities and the genetic divergence of marker genes. We have investigated whether genome-wide recombination occurs between assemblages using the three available G. intestinalis genomes. First, the relative nonsynonymous substitution rates of the homologs were compared for 4,009 positional homologs. The vast majority of these comparisons indicate genetic isolation without interassemblage recombinations. Only a region of 6 kbp suggests genetic exchange between assemblages A and E, followed by gene conversion events. Second, recombination-detecting software fails to identify within-gene recombination between the different assemblages for most of the homologs. Our results indicate very low frequency of recombination between the syntenic core genes, suggesting that G. intestinalis assemblages are genetically isolated lineages and thus should be viewed as separated Giardia species.

  1. Dynamics of cell polarity in tissue morphogenesis: a comparative view from Drosophila and Ciona.

    Science.gov (United States)

    Veeman, Michael T; McDonald, Jocelyn A

    2016-01-01

    Tissues in developing embryos exhibit complex and dynamic rearrangements that shape forming organs, limbs, and body axes. Directed migration, mediolateral intercalation, lumen formation, and other rearrangements influence the topology and topography of developing tissues. These collective cell behaviors are distinct phenomena but all involve the fine-grained control of cell polarity. Here we review recent findings in the dynamics of polarized cell behavior in both the Drosophila ovarian border cells and the Ciona notochord. These studies reveal the remarkable reorganization of cell polarity during organ formation and underscore conserved mechanisms of developmental cell polarity including the Par/atypical protein kinase C (aPKC) and planar cell polarity pathways. These two very different model systems demonstrate important commonalities but also key differences in how cell polarity is controlled in tissue morphogenesis. Together, these systems raise important, broader questions on how the developmental control of cell polarity contributes to morphogenesis of diverse tissues across the metazoa.

  2. Clinical and CT features of benign pneumatosis intestinalis in pediatric hematopoietic stem cell transplant and oncology patients

    Energy Technology Data Exchange (ETDEWEB)

    McCarville, M.B.; Goodin, Geoffrey S. [St. Jude Children' s Research Hospital, Department of Radiological Sciences, Memphis, TN (United States); The University of Tennessee College of Medicine, Department of Radiology, Memphis, TN (United States); Whittle, Sarah B. [St. Jude Children' s Research Hospital, Department of Radiological Sciences, Memphis, TN (United States); Li, Chin-Shang; Smeltzer, Matthew P. [St. Jude Children' s Research Hospital, Department of Biostatistics, Memphis, TN (United States); Hale, Gregory A. [St. Jude Children' s Research Hospital, Department of Oncology, Memphis, TN (United States); The University of Tennessee College of Medicine, Department of Pediatrics, Memphis, TN (United States); Kaufman, Robert A. [St. Jude Children' s Research Hospital, Department of Radiological Sciences, Memphis, TN (United States); The University of Tennessee College of Medicine, Department of Radiology, Memphis, TN (United States); The University of Tennessee College of Medicine, Department of Pediatrics, Memphis, TN (United States)

    2008-10-15

    Pneumatosis intestinalis in children is associated with a wide variety of underlying conditions and often has a benign course. The CT features of this condition have not been systematically investigated. Defining benign pneumatosis intestinalis as pneumatosis intestinalis that resolved with medical management alone, we sought to: (1) determine whether the incidence of benign pneumatosis intestinalis had increased at our pediatric cancer hospital; (2) characterize CT features of benign pneumatosis intestinalis; and (3) determine the relationship between imaging features and clinical course of benign pneumatosis intestinalis in this cohort. Radiology reports from November 1994 to December 2006 were searched for ''pneumatosis intestinalis,'' ''free intraperitoneal air,'' and ''portal venous air or gas.'' Corresponding imaging was reviewed by two radiologists who confirmed pneumatosis intestinalis and recorded the presence of extraluminal free air, degree of intramural gaseous distension, number of involved bowel segments, and time to pneumatosis resolution. The search revealed 12 boys and 4 girls with pneumatosis intestinalis; 11 were hematopoietic stem cell transplant recipients. The annual incidences of benign pneumatosis have not changed at our institution. Increases in intramural distension marginally correlated with the number of bowel segments involved (P=0.08). Three patients had free air and longer times to resolution of pneumatosis (P=0.03). Male children may be at increased risk of benign pneumatosis intestinalis. The incidence of benign pneumatosis at our institution is proportional to the number of hematopoietic stem cell transplants. The degree of intramural distension may correlate with the number of bowel segments involved. Patients with free air have a longer time to resolution of benign pneumatosis. (orig.)

  3. The Superoxide Reductase from the Early Diverging Eukaryote Giardia Intestinalis

    Energy Technology Data Exchange (ETDEWEB)

    Cabelli, D.E.; Testa, F.; Mastronicola, D.; Bordi, E.; Pucillo, L.P.; Sarti, P.; Saraiva, L.M.; Giuffre, A.; Teixeira, M.

    2011-10-15

    Unlike superoxide dismutases (SODs), superoxidereductases (SORs) eliminate superoxide anion (O{sub 2}{sup {sm_bullet}-}) not through its dismutation, but via reduction to hydrogen peroxide (H{sub 2}O{sub 2}) in the presence of an electron donor. The microaerobic protist Giardia intestinalis, responsible for a common intestinal disease in humans, though lacking SOD and other canonical reactive oxygen species-detoxifying systems, is among the very few eukaryotes encoding a SOR yet identified. In this study, the recombinant SOR from Giardia (SOR{sub Gi}) was purified and characterized by pulse radiolysis and stopped-flow spectrophotometry. The protein, isolated in the reduced state, after oxidation by superoxide or hexachloroiridate(IV), yields a resting species (T{sub final}) with Fe{sup 3+} ligated to glutamate or hydroxide depending on pH (apparent pK{sub a} = 8.7). Although showing negligible SOD activity, reduced SOR{sub Gi} reacts with O{sub 2}{sup {sm_bullet}-} with a pH-independent second-order rate constant k{sub 1} = 1.0 x 10{sup 9} M{sup -1} s{sup -1} and yields the ferric-(hydro)peroxo intermediate T{sub 1}; this in turn rapidly decays to the T{sub final} state with pH-dependent rates, without populating other detectable intermediates. Immunoblotting assays show that SOR{sub Gi} is expressed in the disease-causing trophozoite of Giardia. We propose that the superoxide-scavenging activity of SOR in Giardia may promote the survival of this air-sensitive parasite in the fairly aerobic proximal human small intestine during infection.

  4. Genome analysis and comparative genomics of a Giardia intestinalis assemblage E isolate

    Directory of Open Access Journals (Sweden)

    Andersson Jan O

    2010-10-01

    Full Text Available Abstract Background Giardia intestinalis is a protozoan parasite that causes diarrhea in a wide range of mammalian species. To further understand the genetic diversity between the Giardia intestinalis species, we have performed genome sequencing and analysis of a wild-type Giardia intestinalis sample from the assemblage E group, isolated from a pig. Results We identified 5012 protein coding genes, the majority of which are conserved compared to the previously sequenced genomes of the WB and GS strains in terms of microsynteny and sequence identity. Despite this, there is an unexpectedly large number of chromosomal rearrangements and several smaller structural changes that are present in all chromosomes. Novel members of the VSP, NEK Kinase and HCMP gene families were identified, which may reveal possible mechanisms for host specificity and new avenues for antigenic variation. We used comparative genomics of the three diverse Giardia intestinalis isolates P15, GS and WB to define a core proteome for this species complex and to identify lineage-specific genes. Extensive analyses of polymorphisms in the core proteome of Giardia revealed differential rates of divergence among cellular processes. Conclusions Our results indicate that despite a well conserved core of genes there is significant genome variation between Giardia isolates, both in terms of gene content, gene polymorphisms, structural chromosomal variations and surface molecule repertoires. This study improves the annotation of the Giardia genomes and enables the identification of functionally important variation.

  5. Bacteroides faecis and Bacteroides intestinalis recovered from clinical specimens of human intestinal origin.

    Science.gov (United States)

    Lee, Yangsoon; Kim, Hyun Soo; Yong, Dongeun; Jeong, Seok Hoon; Lee, Kyungwon; Chong, Yunsop

    2015-01-01

    We report three cases of recently named Bacteroides spp. isolates, two B. faecis isolates and one B. intestinalis isolate from clinical specimens of inpatients at a Korean tertiary-care hospital in 2011. All isolates were susceptible to piperacillin-tazobactam, imipenem, meropenem, chloramphenicol, and metronidazole.

  6. Free Air Intraperitoneally During Chemotherapy for Acute Lymphoblastic Leukemia : Consider Pneumatosis Cystoides Intestinalis

    NARCIS (Netherlands)

    Groninger, Ellis; Hulscher, Jan B. F.; Timmer, Bert; Tamminga, Rienk Y. J.; Broens, Paul M. A.

    2010-01-01

    Intraperitoneal free air in a child with acute lymphoblastic leukemia (ALL) treated with induction chemotherapy is an ominous sign suspective of gastrointestinal perforation. We report a case of pneumatosis cystoides intestinalis (PCI) with free intraperitoneal air without bowel perforation in a chi

  7. Free Air Intraperitoneally During Chemotherapy for Acute Lymphoblastic Leukemia : Consider Pneumatosis Cystoides Intestinalis

    NARCIS (Netherlands)

    Groninger, Ellis; Hulscher, Jan B. F.; Timmer, Bert; Tamminga, Rienk Y. J.; Broens, Paul M. A.

    Intraperitoneal free air in a child with acute lymphoblastic leukemia (ALL) treated with induction chemotherapy is an ominous sign suspective of gastrointestinal perforation. We report a case of pneumatosis cystoides intestinalis (PCI) with free intraperitoneal air without bowel perforation in a

  8. Pantoea intestinalis sp. nov., isolated from the human gut.

    Science.gov (United States)

    Prakash, Om; Nimonkar, Yogesh; Vaishampayan, Ankita; Mishra, Mrinal; Kumbhare, Shreyas; Josef, Neetha; Shouche, Yogesh S

    2015-10-01

    A novel bacterial strain, 29Y89BT, was isolated from a faecal sample of a healthy human subject. Cells were Gram-stain-negative, motile, non-spore-forming and rod-shaped. Strain 29Y89BT formed cream-coloured colonies 2 mm in diameter on trypticase soy agar and showed optimum growth at 35 °C. Strain 29Y89BT showed highest 16S rRNA gene sequence similarity to Pantoea gaviniae A18/07T (98.4 %) followed by Pantoea calida 1400/07T (97.2 %). Multi-locus sequence analysis using atpD (ATP synthase β subunit), gyrB (DNA gyrase), infB (initiation translation factor 2) and rpoB (RNA polymerase β subunit) genes also supported the result of 16S rRNA gene sequence based phylogeny. Strain 29Y89BT showed 62 and 40.7 % DNA-DNA relatedness with P. calida DSM 22759T and P. gaviniae DSM 22758T. Strain 29Y89BT contained C17  : 0 cyclo, C19  : 0 cyclo ω8c, C16 : 0, C14 : 0 and C12 : 0 as predominant fatty acids. In addition, strain 29Y89BT showed physiological and phenotypic differences from its closest relatives P. gaviniae DSM 22758T and P. calida DSM 22759T. The polar lipid profile mainly comprised phospholipids. The DNA G+C content was 59.1 mol%. Thus, based on the findings of the current study, strain 29Y89BT showed clear delineations from its closest relatives P. gaviniae DSM 22758T and P. calida DSM 22759T, and is thus considered to represent a novel species of the genus Pantoea, for which the name Pantoea intestinalis sp. nov. is proposed. The type strain is 29Y89BT ( = DSM 28113T = MCC 2554T).

  9. Spatial and Molecular Epidemiology of Giardia intestinalis Deep in the Amazon, Brazil.

    Directory of Open Access Journals (Sweden)

    Beatriz Coronato Nunes

    Full Text Available Current control policies for intestinal parasitosis focuses on soil-transmitted helminths, being ineffective against Giardia intestinalis, a highly prevalent protozoon that impacts children's nutritional status in developing countries. The objective of this study was to explore spatial and molecular epidemiology of Giardia intestinalis in children of Amerindian descent in the Brazilian Amazon.A cross sectional survey was performed in the Brazilian Amazon with 433 children aged 1 to 14 years. Fecal samples were processed through parasitological techniques and molecular characterization. Prevalence of G. intestinalis infection was 16.9% (73/433, reaching 22.2% (35/158 among children aged 2-5 years, and a wide distribution throughout the city with some hot spots. Positivity-rate was similar among children living in distinct socioeconomic strata (48/280 [17.1%] and 19/116 [16.4%] below and above the poverty line, respectively. Sequencing of the β-giardin gene revealed 52.2% (n = 12 of assemblage A and 47.8% (n = 11 of assemblage B with high haplotype diversity for the latter. The isolates clustered into two well-supported G. intestinalis clades. A total of 38 haplotypes were obtained, with the following subassemblages distribution: 5.3% (n = 2 AII, 26.3% (n = 10 AIII, 7.9% (n = 3 BIII, and 60.5% (n = 23 new B genotypes not previously described.Giardia intestinalis infection presents a high prevalence rate among Amerindian descended children living in Santa Isabel do Rio Negro/Amazon. The wide distribution observed in a small city suggests the presence of multiple sources of infection, which could be related to environmental contamination with feces, possibly of human and animal origin, highlighting the need of improving sanitation, safe water supply and access to diagnosis and adequate treatment of infections.

  10. Draft genome sequencing of giardia intestinalis assemblage B isolate GS: is human giardiasis caused by two different species?

    Directory of Open Access Journals (Sweden)

    Oscar Franzén

    2009-08-01

    Full Text Available Giardia intestinalis is a major cause of diarrheal disease worldwide and two major Giardia genotypes, assemblages A and B, infect humans. The genome of assemblage A parasite WB was recently sequenced, and the structurally compact 11.7 Mbp genome contains simplified basic cellular machineries and metabolism. We here performed 454 sequencing to 16x coverage of the assemblage B isolate GS, the only Giardia isolate successfully used to experimentally infect animals and humans. The two genomes show 77% nucleotide and 78% amino-acid identity in protein coding regions. Comparative analysis identified 28 unique GS and 3 unique WB protein coding genes, and the variable surface protein (VSP repertoires of the two isolates are completely different. The promoters of several enzymes involved in the synthesis of the cyst-wall lack binding sites for encystation-specific transcription factors in GS. Several synteny-breaks were detected and verified. The tetraploid GS genome shows higher levels of overall allelic sequence polymorphism (0.5 versus <0.01% in WB. The genomic differences between WB and GS may explain some of the observed biological and clinical differences between the two isolates, and it suggests that assemblage A and B Giardia can be two different species.

  11. Genome Sequence of "Candidatus Methanomassiliicoccus intestinalis" Issoire-Mx1, a Third Thermoplasmatales-Related Methanogenic Archaeon from Human Feces.

    Science.gov (United States)

    Borrel, Guillaume; Harris, Hugh M B; Parisot, Nicolas; Gaci, Nadia; Tottey, William; Mihajlovski, Agnès; Deane, Jennifer; Gribaldo, Simonetta; Bardot, Olivier; Peyretaillade, Eric; Peyret, Pierre; O'Toole, Paul W; Brugère, Jean-François

    2013-07-11

    "Candidatus Methanomassiliicoccus intestinalis" Issoire-Mx1 is a methanogenic archaeon found in the human gut and is a representative of the novel order of methanogens related to Thermoplasmatales. Its complete genome sequence is presented here.

  12. Preparation and Antitumor Activity of CS5931, A Novel Polypeptide from Sea Squirt Ciona Savignyi

    Directory of Open Access Journals (Sweden)

    Xiaoshuang Chen

    2016-03-01

    Full Text Available CS5931 is a novel anticancer agent isolated from the sea squirt Ciona savignyi. However, its content in the species is very low, and developing a novel approach for production of the polypeptide is promising. In the present study, we expressed and purified the polypeptide from E. coli, and the fermentation conditions were studied using response surface methodology. The yield of CS5931 was increased from 2.0 to 7.5 mg/L. The denaturing and renaturation conditions were also studied. Using the optimized renaturation condition, the anticancer activity of refolding CS5931 was increased significantly; the value of IC50 was decreased from 23.2 to 11.6 μM. In vivo study using xenograft nude mice bearing HCT116 cancer cells revealed that CS5931 was able to inhibit the growth of tumor significantly. The study provides a useful approach for obtaining enough amount of CS5931 for further study. This study is also important for developing the polypeptide as a novel anticancer agent.

  13. Stool sample storage conditions for the preservation of Giardia intestinalis DNA

    Directory of Open Access Journals (Sweden)

    Salih Kuk

    2012-12-01

    Full Text Available Stool is chemically complex and the extraction of DNA from stool samples is extremely difficult. Haemoglobin breakdown products, such as bilirubin, bile acids and mineral ions, that are present in the stool samples, can inhibit DNA amplification and cause molecular assays to produce false-negative results. Therefore, stool storage conditions are highly important for the diagnosis of intestinal parasites and other microorganisms through molecular approaches. In the current study, stool samples that were positive for Giardia intestinalis were collected from five different patients. Each sample was stored using one out of six different storage conditions [room temperature (RT, +4ºC, -20ºC, 70% alcohol, 10% formaldehyde or 2.5% potassium dichromate] for DNA extraction procedures at one, two, three and four weeks. A modified QIAamp Stool Mini Kit procedure was used to isolate the DNA from stored samples. After DNA isolation, polymerase chain reaction (PCR amplification was performed using primers that target the β-giardin gene. A G. intestinalis-specific 384 bp band was obtained from all of the cyst-containing stool samples that were stored at RT, +4ºC and -20ºC and in 70% alcohol and 2.5% potassium dichromate; however, this band was not produced by samples that had been stored in 10% formaldehyde. Moreover, for the stool samples containing trophozoites, the same G. intestinalis-specific band was only obtained from the samples that were stored in 2.5% potassium dichromate for up to one month. As a result, it appears evident that the most suitable storage condition for stool samples to permit the isolation of G. intestinalis DNA is in 2.5% potassium dichromate; under these conditions, stool samples may be stored for one month.

  14. Pneumatosis cystoides intestinalis of the ascending colon related to acarbose treatment: a case report

    Directory of Open Access Journals (Sweden)

    Vogel Yilin

    2009-09-01

    Full Text Available Abstract Introduction Pneumatosis cystoides intestinalis is characterized by the presence of multiple gas-filled cysts in the intestinal wall, the submucosa and/or subserosa of the intestine. The term pneumatosis cystoides coli is synonymous with pneumatosis cystoides intestinalis when the disorder is limited to the colon. It is a secondary finding caused by a wide variety of underlying gastrointestinal or extragastrointestinal diseases but rarely occurs in the course of treatment with an α-glucosidase inhibitor. This is the first report of pneumatosis cystoides intestinalis after 12 years of treatment with the α-glucosidase inhibitor acarbose. Case presentation A 65-year-old Caucasian German woman was referred to our hospital for hemicolectomy. She had been treated for type 2 diabetes mellitus with an α-glucosidase inhibitor (acarbose, 150 mg daily for 12 years. Three months before referral, she had complained of left abdominal pain. 'Polyposis coli' in the ascending colon and diverticulosis were diagnosed. Colonoscopy and computed tomography scans of the abdomen were repeated and revealed pneumatosis cystoides coli located in the ascending colon, whereas diverticulosis of the sigmoid colon was confirmed. Histological examination of a biopsy specimen only showed colon mucosa. After discontinuing administration of the α-glucosidase inhibitor for 3 months and on repeated colonoscopy, the polypoid lesions had completely disappeared. Conclusion This case illustrates that pneumatosis cystoides coli can be a source of diagnostic confusion. Pneumatosis cystoides coli must be considered in the initial differential diagnosis of patients especially in the presence of multiple colonic polypoid lesions. It is important to take pneumatosis cystoides intestinalis into consideration when prescribing α-glucosidase inhibitors to patients with diabetes who have diabetic autonomic neuropathy with decreased intestinal motility, or to patients taking steroids.

  15. Arginine Consumption by the Intestinal Parasite Giardia intestinalis Reduces Proliferation of Intestinal Epithelial Cells

    OpenAIRE

    Britta Stadelmann; Merino, María C.; Lo Persson; Staffan G Svärd

    2012-01-01

    In the field of infectious diseases the multifaceted amino acid arginine has reached special attention as substrate for the host´s production of the antimicrobial agent nitric oxide (NO). A variety of infectious organisms interfere with this part of the host immune response by reducing the availability of arginine. This prompted us to further investigate additional roles of arginine during pathogen infections. As a model we used the intestinal parasite Giardia intestinalis that actively consu...

  16. Screening and isolation of the algicidal compounds from marine green alga Ulva intestinalis

    Science.gov (United States)

    Sun, Xue; Jin, Haoliang; Zhang, Lin; Hu, Wei; Li, Yahe; Xu, Nianjun

    2016-07-01

    Twenty species of seaweed were collected from the coast of Zhejiang, China, extracted with ethanol, and screened for algicidal activity against red tide microalgae Heterosigma akashiwo and Prorocentrum micans. Inhibitory effects of fresh and dried tißsues of green alga Ulva intestinalis were assessed and the main algicidal compounds were isolated, purified, and identified. Five seaweed species, U. intestinalis, U. fasciata, Grateloupia romosissima, Chondria crassicaulis, and Gracilariopsis lemaneiformis, were investigated for their algicidal activities. Fresh tissues of 8.0 and 16.0 mg/mL of U. intestinalis dissolved in media significantly inhibited growth of H. akashiwo and P. micans, respectively. Dried tissue and ethyl acetate (EtOAc) extracts of U. intestinalis at greater than 1.2 and 0.04 mg/mL, respectively, were fatal to H. akashiwo, while its water and EtOAc extracts in excess of 0.96 and 0.32 mg/mL, respectively, were lethal to P. micans. Three algicidal compounds in the EtOAc extracts were identified as 15-ethoxy-(6z,9z,12z)-hexadecatrienoic acid (I), (6E,9E,12E)-(2-acetoxy- β-D-glucose)-octadecatrienoic acid ester (II) and hexadecanoic acid (III). Of these, compound II displayed the most potent algicidal activity with IC50 values of 4.9 and 14.1 µg/mL for H. akashiwo and P. micans, respectively. Compound I showed moderate algicidal activity with IC50 values of 13.4 and 24.7 µg/mL for H. akashiwo and P. micans, respectively. These findings suggested that certain macroalgae or products therefrom could be used as effective biological control agents against red tide algae.

  17. Nuclear inheritance and genetic exchange in Giardia intestinalis, a divergent eukaryote with two nuclei

    OpenAIRE

    2011-01-01

    The divergent eukaryotic parasite Giardia intestinalis is a major cause of diarrheal disease worldwide. The Giardia life cycle consists of two major stages: the binucleate trophozoite, which is found attached to the wall of the small intestine, and the infectious cyst, which is able to persist for weeks in the environment. The two nuclei in the trophozoite are equivalent and remain independent during mitosis. Although Giardia is presumed to be asexual based on the lack of an observed sexual c...

  18. Enteromorpha intestinalis Derived Seaweed Liquid Fertilizers as Prospective Biostimulant for Glycine max

    Directory of Open Access Journals (Sweden)

    Chetna Mathur

    2015-12-01

    Full Text Available ABSTRACT In the present study, the potential of seaweed liquid fertilizer (SLF of marine algae Enteromorpha intestinalis was evaluated for its effect on seed germination, yield, biochemical parameters and pigment characteristics of Glycine maxE. intestinalis was collected form Mandapam coast of Gulf of Mannar, Tamil Nadu, and the dried seaweeds were used for the preparation of SLF. G. max seeds were germinated with four different concentrations (20, 40, 60, and 100% of SLF; its growth and yield parameters were evaluated and compared with chemical fertilizer and control. The morphological and bio-chemical parameters such as seed germination (100%, root (6.6cm and shoot length (5.4 cm, carbohydrates (0.098 mg/g, protein (0.56 mg/g, pigment (0.444 mg/g chl a; 1.073 mg/g chl b; 3.70 mg/g carotenoids of the plant was found maximum at a concentration of 60% SLF. The phenol content (3.25 mg/g was maximum in 40% SLF. The GC-MS analysis of SLF revealed the presence of notable benzoic compounds involved in plant growth promotion. Results showed thatE. intestinalis derived SLF was potential biostimulant forG. max. Thus, marine algae based fertilizer could be an effective and alternate to the chemical fertilizers emphasizing the need for systematic evaluation programme for SLF on various crops.

  19. Pneumatosis intestinalis due to gastrointestinal amyloidosis: A case report & review of literature

    Science.gov (United States)

    Khalid, Filza; Kaiyasah, Hadiel; Binfadil, Wafa; Majid, Maiyasa; Hazim, Wessam; ElTayeb, Yousif

    2016-01-01

    Introduction Pneumatosis intestinalis (PI) is not a disease but a radiological finding with a poorly understood pathogenesis. It can be divided into primary/idiopathic (15%) or secondary (85%) Kim et al. 2007, based on the factors thought to play a role in its development. Amongst the rare causes of secondary PI is gastrointestinal (GI) amyloidosis. Presentation of the case We report a case of a 46-year-old gentleman who presented with a one month history of acute on chronic abdominal pain, associated with one episode of melena. Upon further investigation, he was found to have pneumoperitoneum. He was taken to the operating theatre, where he was noted to have features of pneumatosis intestinalis of the small bowel with no evidence of bowel perforation. Postoperatively, he underwent an upper GI endoscopy with biopsies that revealed GI amyloidosis. Discussion One of the rare causes that can lead to secondary PI is GI amyloidosis as proven in our case. Patients with symptomatic gastrointestinal amyloidosis usually present with one of four syndromes: gastrointestinal bleeding, malabsorption, protein-losing gastroenteropathy, and, less often, gastrointestinal dysmotility. Conclusion GI amyloidosis is a rare cause of secondary pneumatosis intestinalis. The presentation of the disease varies from patient to patient, therefore, the management should be tailored accordingly. PMID:27085104

  20. Consumption and feeding preference of Echinogammarus marinus on two different algae: Fucus vesiculosus and Ulva intestinalis

    Science.gov (United States)

    Martins, Irene; Leite, Nuno; Constantino, Emanuel

    2014-01-01

    Echinogammarus marinus constitutes the most abundant amphipod species in Fucus spp. assemblages from many North Atlantic estuaries. However, there are some doubts about the real use of fucoids by the amphipod. Whilst some studies report the ingestion of Fucus vesiculosus by E. marinus, others suggest that the amphipod preference for fucoids is mostly related to sheltering rather than feeding, due to the high phlorotannin content of brown algae. The purpose of the present work was to disentangle this issue by checking the consumption rate and feeding preference of E. marinus on F. vesiculosus, its preferential habitat, and on Ulva intestinalis, a green algae abundant in the Mondego estuary (Western Coast of Portugal) and usually considered as highly palatable for herbivores. In a 2-stage laboratorial setup, fresh disks of the two types of algae were offered to E. marinus for three days. Consumption rates were estimated from differences between algal and animal initial and final fresh weights using a control correction factor, while preference was tested by differences in algal consumption rates when no choice was offered (stage 1) and when the two algae were offered simultaneously (stage 2). Results showed that E. marinus effectively consumed fresh F. vesiculosus in much higher amounts than U. intestinalis and significantly preferred to consume F. vesiculosus over U. intestinalis. Therefore, feeding habits must be one of the factors related to the close association of the amphipod with F. vesiculosus, although other factors may also be involved (e.g. sheltering).

  1. Metamorphosis of the invasive ascidian Ciona savignyi: environmental variables and chemical exposure

    Directory of Open Access Journals (Sweden)

    Patrick L. Cahill

    2016-02-01

    Full Text Available In this study, the effects of environmental variables on larval metamorphosis of the solitary ascidian Ciona savignyi were investigated in a laboratory setting. The progression of metamorphic changes were tracked under various temperature, photoperiod, substrate, larval density, and vessel size regimes. Metamorphosis was maximised at 18 °C, 12:12 h subdued light:dark, smooth polystyrene substrate, and 10 larvae mL−1 in a twelve-well tissue culture plate. Eliminating the air-water interface by filling culture vessels to capacity further increased the proportion of metamorphosed larvae; 87 ± 5% of larvae completed metamorphosis within 5 days compared to 45 ± 5% in control wells. The effects of the reference antifouling compounds polygodial, portimine, oroidin, chlorothalonil, and tolylfluanid on C. savignyi were subsequently determined, highlighting (1 the sensitivity of C. savignyi metamorphosis to chemical exposure and (2 the potential to use C. savignyi larvae to screen for bioactivity in an optimised laboratory setting. The compounds were bioactive in the low ng mL−1 to high µg mL−1 range. Polygodial was chosen for additional investigations, where it was shown that mean reductions in the proportions of larvae reaching stage E were highly repeatable both within (repeatability = 14 ± 9% and between (intermediate precision = 17 ± 3% independent experiments. An environmental extract had no effect on the larvae but exposing larvae to both the extract and polygodial reduced potency relative to polygodial alone. This change in potency stresses the need for caution when working with complex samples, as is routinely implemented when isolating natural compounds from their biological source. Overall, the outcomes of this study highlight the sensitivity of C. savignyi metamorphosis to environmental variations and chemical exposure.

  2. Administration of kefir-fermented milk protects mice against Giardia intestinalis infection.

    Science.gov (United States)

    Franco, Mariana Correa; Golowczyc, Marina A; De Antoni, Graciela L; Pérez, Pablo F; Humen, Martín; Serradell, María de los Angeles

    2013-12-01

    Giardiasis, caused by the protozoan Giardia intestinalis, is one of the most common intestinal diseases worldwide and constitutes an important problem for the public health systems of various countries. Kefir is a probiotic drink obtained by fermenting milk with 'kefir grains', which consist mainly of bacteria and yeasts that coexist in a complex symbiotic association. In this work, we studied the ability of kefir to protect mice from G. intestinalis infection, and characterized the host immune response to this probiotic in the context of the intestinal infection. Six- to 8-week-old C75BL/6 mice were separated into four groups: controls, kefir mice (receiving 1 : 100 dilution of kefir in drinking water for 14 days), Giardia mice (infected orally with 4×10(7) trophozoites of G. intestinalis at day 7) and Giardia-kefir mice (kefir-treated G. intestinalis-infected mice), and killed at 2 or 7 days post-infection. Kefir administration was able to significantly reduce the intensity of Giardia infection at 7 days post-infection. An increase in the percentage of CD4(+) T cells at 2 days post-infection was observed in the Peyer's patches (PP) of mice belonging to the Giardia group compared with the control and kefir groups, while the percentage of CD4(+) T cells in PP in the Giardia-kefir group was similar to that of controls. At 2 days post-infection, a reduction in the percentage of B220-positive major histocompatibility complex class II medium cells in PP was observed in infected mice compared with the other groups. At 7 days post-infection, Giardia-infected mice showed a reduction in RcFcε-positive cells compared with the control group, suggesting a downregulation of the inflammatory response. However, the percentages of RcFcε-positive cells did not differ from controls in the kefir and Giardia-kefir groups. An increase in IgA-positive cells was observed in the lamina propria of the kefir group compared with controls at 2 days post-infection. Interestingly, the

  3. Arginine consumption by the intestinal parasite Giardia intestinalis reduces proliferation of intestinal epithelial cells.

    Science.gov (United States)

    Stadelmann, Britta; Merino, María C; Persson, Lo; Svärd, Staffan G

    2012-01-01

    In the field of infectious diseases the multifaceted amino acid arginine has reached special attention as substrate for the hosts production of the antimicrobial agent nitric oxide (NO). A variety of infectious organisms interfere with this part of the host immune response by reducing the availability of arginine. This prompted us to further investigate additional roles of arginine during pathogen infections. As a model we used the intestinal parasite Giardia intestinalis that actively consumes arginine as main energy source and secretes an arginine-consuming enzyme, arginine deiminase (ADI). Reduced intestinal epithelial cell (IEC) proliferation is a common theme during bacterial and viral intestinal infections, but it has never been connected to arginine-consumption. Our specific question was thereby, whether the arginine-consumption by Giardia leads to reduced IEC proliferation, in addition to NO reduction. In vitro cultivation of human IEC lines in arginine-free or arginine/citrulline-complemented medium, as well as in interaction with different G. intestinalis isolates, were used to study effects on host cell replication by MTT assay. IEC proliferation was further analyzed by DNA content analysis, polyamine measurements and expressional analysis of cell cycle regulatory genes. IEC proliferation was reduced upon arginine-withdrawal and also in an arginine-dependent manner upon interaction with G. intestinalis or addition of Giardia ADI. We show that arginine-withdrawal by intestinal pathogens leads to a halt in the cell cycle in IECs through reduced polyamine levels and upregulated cell cycle inhibitory genes. This is of importance with regards to intestinal tissue homeostasis that is affected through reduced cell proliferation. Thus, the slower epithelial cell turnover helps the pathogen to maintain a more stable niche for colonization. This study also shows why supplementation therapy of diarrhea patients with arginine/citrulline is helpful and that

  4. Arginine consumption by the intestinal parasite Giardia intestinalis reduces proliferation of intestinal epithelial cells.

    Directory of Open Access Journals (Sweden)

    Britta Stadelmann

    Full Text Available In the field of infectious diseases the multifaceted amino acid arginine has reached special attention as substrate for the hosts production of the antimicrobial agent nitric oxide (NO. A variety of infectious organisms interfere with this part of the host immune response by reducing the availability of arginine. This prompted us to further investigate additional roles of arginine during pathogen infections. As a model we used the intestinal parasite Giardia intestinalis that actively consumes arginine as main energy source and secretes an arginine-consuming enzyme, arginine deiminase (ADI. Reduced intestinal epithelial cell (IEC proliferation is a common theme during bacterial and viral intestinal infections, but it has never been connected to arginine-consumption. Our specific question was thereby, whether the arginine-consumption by Giardia leads to reduced IEC proliferation, in addition to NO reduction. In vitro cultivation of human IEC lines in arginine-free or arginine/citrulline-complemented medium, as well as in interaction with different G. intestinalis isolates, were used to study effects on host cell replication by MTT assay. IEC proliferation was further analyzed by DNA content analysis, polyamine measurements and expressional analysis of cell cycle regulatory genes. IEC proliferation was reduced upon arginine-withdrawal and also in an arginine-dependent manner upon interaction with G. intestinalis or addition of Giardia ADI. We show that arginine-withdrawal by intestinal pathogens leads to a halt in the cell cycle in IECs through reduced polyamine levels and upregulated cell cycle inhibitory genes. This is of importance with regards to intestinal tissue homeostasis that is affected through reduced cell proliferation. Thus, the slower epithelial cell turnover helps the pathogen to maintain a more stable niche for colonization. This study also shows why supplementation therapy of diarrhea patients with arginine/citrulline is helpful

  5. Immune responsiveness associated with experimental Encephalitozoon intestinalis infection in immunocompetent rats

    Directory of Open Access Journals (Sweden)

    Omalu ICJ

    2007-01-01

    Full Text Available Purpose: Microsporidial infections have been recognized as an increasingly important infection in immuncompromised patients, particularly those infected with HIV/AIDS. This study was designed to study immune responses associated with experimental Encephalitozoon intestinalis infection in immunocompetent rats. Materials and Methods: Thirty-four Rats in 3 groups, A (Control, B (Intraperitoneal and C (Oral were given injections of 0.5 ml of 2 x 10 6 of purified spores of Encephalitotozoon intestinalis spores and were observed for serum specific IgG for 21 days using both direct and indirect ELISA. Results: In indirect ELISA, specific lgG were detected on days 7, 14 and 21 for the group B rats and on day 21 for group C and in direct ELISA method, specific lgG were detected in-group B rats on days 7 and 21, for group C rats on day 21 only, while in the control rats, specific lgG were not detected. There was no significant difference between the direct and indirect methods (df=1, X 2 , P>0.05. E. intestinalis was observed in stool samples of rats in 1/12 (08.33% on days 14 and 21 in group B, and in 4/10 (33.33%, 3/10 (25.00% and 2/10 (16.67% on days 7, 14 and 21 respectively in group C. In group A, which is the control rats, no microsporidia were observed on days 0, 7, 14 and 21. Conclusions: There were no changes in the T-lymphocyte counts of rats prior to and after inoculation with spores. Extensive lesions were observed along the intestinal walls especially on the middle and lower sections of group C rats only.

  6. Albendazole and its derivative JVG9 induce encystation on Giardia intestinalis trophozoites.

    Science.gov (United States)

    Pérez-Rangel, Armando; Hernández, José Manuel; Castillo-Romero, Araceli; Yépez-Mulia, Lilián; Castillo, Rafael; Hernández-Luis, Francisco; Nogueda-Torres, Benjamín; Luna-Arias, Juan Pedro; Radilla, Gerardo; León-Avila, Gloria

    2013-09-01

    In the present study, we evaluated the effect of an albendazole (ABZ) derivative JVG9 on cultured Giardia intestinalis. To assess the JVG9 effects, we evaluated the tubulin cytoskeleton by confocal microscopy, and we found that the characteristic staining was modified. The scanning electron microscopy images revealed extremely damaged trophozoites and cyst-like cells. The confocal images revealed that this drug triggered the expression of cyst wall protein 1 and encystation. We also found that at low doses, AL triggered the encystation process too.

  7. Efecto de la ciclosporina A en ratones C57BL/6 infectados con Encephalitozoon intestinalis.

    Directory of Open Access Journals (Sweden)

    Ana Luz Galván

    2006-03-01

    Full Text Available Introducción. Encephalitozoon intestinalis es un microsporidio parásito del intestino, que puede diseminarse en pacientes inmunocomprometidos. Existen referencias de modelos animales inmunosuprimidos para el estudio de la microsporidiosis utilizando fármacos que producen supresión total de la respuesta inmune; sin embargo, no se han estudiado los efectos de inmunosupresores con acción selectiva sobre los componentes de esta respuesta. Objetivo. Evaluar el efecto de la inmunosupresión con ciclosporina A (CsA en ratones C57BL/6 infectados con E. intestinalis. Materiales y métodos. Se utilizaron 80 ratones C57BL/6 distribuidos en cuatro grupos: infectados, inmunosuprimidos e infectados, inmunosuprimidos no infectados y controles. La inmunosupresión con CsA (50 mg/kg se realizó vía intraperitoneal durante todo el estudio. En la semanas 2, 3, 4 y 6 posteriores a la infección se obtuvo sangre para determinar los anticuerpos, y materia fecal para evaluar la cinética de excreción de esporas. Además, se extrajeron varios órganos para estudiar la histopatología y observar la posible diseminación del parásito. Resultados. La producción de anticuerpos IgG fue mayor en los ratones inmunocompetentes infectados que en los inmunosuprimidos infectados con E. intestinalis. No se encontró el parásito en órganos diferentes al intestino delgado en los dos grupos infectados. Sin embargo, la excreción de esporas, tanto en heces como en líquido duodenal, fue mayor en el grupo inmunosuprimido infectado. Conclusión. La CsA en el modelo en ratón no indujo la diseminación de E. intestinalis ni la exacerbación de la enfermedad, pero contribuyó al aumento en la cinética de excreción de esporas y la disminución de la producción de anticuerpos IgG en los ratones inmunosuprimidos infectados.

  8. Dynamics of cell polarity in tissue morphogenesis: a comparative view from Drosophila and Ciona [version 1; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    Michael T. Veeman

    2016-06-01

    Full Text Available Tissues in developing embryos exhibit complex and dynamic rearrangements that shape forming organs, limbs, and body axes. Directed migration, mediolateral intercalation, lumen formation, and other rearrangements influence the topology and topography of developing tissues. These collective cell behaviors are distinct phenomena but all involve the fine-grained control of cell polarity. Here we review recent findings in the dynamics of polarized cell behavior in both the Drosophila ovarian border cells and the Ciona notochord. These studies reveal the remarkable reorganization of cell polarity during organ formation and underscore conserved mechanisms of developmental cell polarity including the Par/atypical protein kinase C (aPKC and planar cell polarity pathways. These two very different model systems demonstrate important commonalities but also key differences in how cell polarity is controlled in tissue morphogenesis. Together, these systems raise important, broader questions on how the developmental control of cell polarity contributes to morphogenesis of diverse tissues across the metazoa.

  9. A Rare Case of Hypermobile Mesentery With Segmental Small Bowel Pneumatosis Cystoides Intestinalis

    Science.gov (United States)

    Pipaliya, Nirav; Poddar, Prateik; Pandey, Vikas; Ingle, Meghraj; Sawant, Prabha

    2015-01-01

    Pneumatosis intestinalis is a rare condition that affects 0.03% of the population. Pneumatosis cystoides intestinalis (PCI) is characterized by the presence of multiple gas-filled cysts in the intestinal wall and the submucosa and/or intestinal subserosa. It is usually a secondary finding caused by a wide variety of underlying gastrointestinal or extragastrointestinal diseases. Here, we present the case of a 47-year-old man who was referred to our gastroenterology department with a history suggestive of intermittent small bowel obstruction associated with abdominal pain. Abdominal computed tomography demonstrated PCI of the small bowel. The mesentery and branches of the superior mesenteric artery and superior mesenteric vein were twisted with minimal pneumoperitoneum. Exploratory laparotomy was performed, and demonstrated segmental small bowel PCI secondary to hypermobile mesentery. The affected segment of the ileum was resected, and jejunoileal anastomosis was performed. Here, we report a rare case of segmental PCI probably due to repeated twisting of hypermobile mesentery. The clinical and imaging features of this disorder may mimic those of visceral perforation or bowel ischemia. PCI can be a cause of severe abdominal pain that may require surgical intervention. PMID:26576141

  10. Ligula intestinalis (Cestoda: Diphyllobothriidae) in Kenya: a field investigation into host specificity and behavioural alterations.

    Science.gov (United States)

    Britton, J R; Jackson, M C; Harper, D M

    2009-09-01

    Within the distribution of Ligula intestinalis, a tapeworm affecting freshwater fishes, there are genetically distinct and well-separated phylogenetic clusters. East Africa is represented by a single monophyletic clade which is understudied compared with Euro-Mediterranean clades. The present field investigation in the Lake Baringo and Naivasha catchments, Kenya, revealed that this L. intestinalis clade was highly host-specific, present in only 2 of 12 fishes examined; Barbus paludinosus in Naivasha and Barbus lineomaculatus in Baringo. In infected fish, cestodes comprised up to 20% of body weight. Only 1 parasite was recorded per fish, a contrast to infected fishes in Europe where mixed infections are commonplace. In B. lineomaculatus in Baringo, only fish of greater than 64 mm in length were parasitized. The highest parasite prevalence was recorded in fish of 70-77 mm in length, and reduced for lengths of 78-84 mm. Parasitized fish were significantly associated with a particular type of habitat, occurring most frequently in shallow littoral areas, and being absent from open water and rocky shore habitats. Uninfected fish were present in all habitats. This relationship between spatial occupancy and parasite prevalence is suggested to arise from behavioural alterations induced by the parasite that promotes completion of the parasite life cycle.

  11. Protection against diarrhea associated with Giardia intestinalis is lost with Multi-Nutrient Supplementation: A Study in Tanzanian Children

    NARCIS (Netherlands)

    Veenemans, J.; Mank, T.; Ottenhof, M.; Baidjoe, A.Y.; Mbugi, E.V.; Demir, A.Y.; Wielders, J.P.M.; Savelkoul, H.F.J.; Verhoef, J.C.M.

    2011-01-01

    Background - Asymptomatic carriage of Giardia intestinalis is highly prevalent among children in developing countries, and evidence regarding its role as a diarrhea-causing agent in these settings is controversial. Impaired linear growth and cognition have been associated with giardiasis, presumably

  12. Coinfection with Hymenolepis nana, Hymenolepis diminuta, Giardia intestinalis, and Human Immunodeficiency Virus: A Case Report with Complex Immunologic Interactions.

    Science.gov (United States)

    Pérez-Chacón, Gladymar; Pocaterra, Leonor A; Rojas, Elsy; Hernán, Aurora; Jiménez, Juan Carlos; Núñez, Luz

    2017-02-20

    We describe the case of a 43-year-old human immunodeficiency virus-infected man receiving combined antiretroviral therapy and coinfected with Hymenolepis nana, Hymenolepis diminuta, and Giardia intestinalis, presenting as chronic diarrhea and critical weight loss. Immunological aspects of these interactions are reviewed.

  13. Protection against diarrhea associated with Giardia intestinalis is lost with Multi-Nutrient Supplementation: A Study in Tanzanian Children

    NARCIS (Netherlands)

    Veenemans, J.; Mank, T.; Ottenhof, M.; Baidjoe, A.Y.; Mbugi, E.V.; Demir, A.Y.; Wielders, J.P.M.; Savelkoul, H.F.J.; Verhoef, J.C.M.

    2011-01-01

    Background - Asymptomatic carriage of Giardia intestinalis is highly prevalent among children in developing countries, and evidence regarding its role as a diarrhea-causing agent in these settings is controversial. Impaired linear growth and cognition have been associated with giardiasis, presumably

  14. Pneumatosis cystoides intestinalis in patients with antinuclear antibody negative systemic lupus erythematosus and dermatomyositis: report of two cases

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Soo Yeon; Cho, On Koo; Koh, Byung Hee; Kim, Yong Soo; Song, Soon Young [College of Medicine, Hanyang University, Seoul (Korea, Republic of)

    2007-04-15

    Pneumatosis cystoides intestinalis (PCI) occurring in association with collagen vascular disease is an unusual combination that presents with intramural gas in the gastrointestinal tract. We report two cases of PCI, one with antinuclear antibody (ANA) negative SLE and the other with dermatomyositis, with a review of the relevant literature.

  15. Chemotactic response with a constant delay-time mechanism in Ciona spermatozoa revealed by a high time resolution analysis of flagellar motility

    Directory of Open Access Journals (Sweden)

    Daisuke Miyashiro

    2015-01-01

    Full Text Available During their chemotactic swimming toward eggs, sperm cells detect their species-specific chemoattractant and sense concentration gradients by unknown mechanisms. After sensing the attractant, sperm cells commonly demonstrate a series of responses involving different swimming patterns by changing flagellar beats, gradually approaching a swimming path toward the eggs, which is the source of chemoattractants. Shiba et al. observed a rapid increase in intracellular Ca2+ concentrations in Ciona spermatozoa after sensing chemoattractants; however, the biochemical processes occurring inside the sperm cells are unclear. In the present study, we focused on the timing and sensing mechanism of chemical signal detection in Ciona. One of the most crucial problems to be solved is defining the initial epoch of chemotactic responses. We adopted a high rate of video recording (600 Hz for detailed analysis of sperm motion and a novel method for detecting subtle signs of beat forms and moving paths of sperm heads. From these analyses, we estimated a virtual sensing point of the attractant before initiation of motility responses and found that the time delay from sensing to motility responses was almost constant. To evaluate the efficiency of this constant delay model, we performed computer simulation of chemotactic behaviors of Ciona spermatozoa.

  16. Chemotactic response with a constant delay-time mechanism in Ciona spermatozoa revealed by a high time resolution analysis of flagellar motility

    Science.gov (United States)

    Miyashiro, Daisuke; Shiba, Kogiku; Miyashita, Tahahiro; Baba, Shoji A.; Yoshida, Manabu; Kamimura, Shinji

    2015-01-01

    ABSTRACT During their chemotactic swimming toward eggs, sperm cells detect their species-specific chemoattractant and sense concentration gradients by unknown mechanisms. After sensing the attractant, sperm cells commonly demonstrate a series of responses involving different swimming patterns by changing flagellar beats, gradually approaching a swimming path toward the eggs, which is the source of chemoattractants. Shiba et al. observed a rapid increase in intracellular Ca2+ concentrations in Ciona spermatozoa after sensing chemoattractants; however, the biochemical processes occurring inside the sperm cells are unclear. In the present study, we focused on the timing and sensing mechanism of chemical signal detection in Ciona. One of the most crucial problems to be solved is defining the initial epoch of chemotactic responses. We adopted a high rate of video recording (600 Hz) for detailed analysis of sperm motion and a novel method for detecting subtle signs of beat forms and moving paths of sperm heads. From these analyses, we estimated a virtual sensing point of the attractant before initiation of motility responses and found that the time delay from sensing to motility responses was almost constant. To evaluate the efficiency of this constant delay model, we performed computer simulation of chemotactic behaviors of Ciona spermatozoa. PMID:25572419

  17. Chemotactic response with a constant delay-time mechanism in Ciona spermatozoa revealed by a high time resolution analysis of flagellar motility.

    Science.gov (United States)

    Miyashiro, Daisuke; Shiba, Kogiku; Miyashita, Tahahiro; Baba, Shoji A; Yoshida, Manabu; Kamimura, Shinji

    2015-01-08

    During their chemotactic swimming toward eggs, sperm cells detect their species-specific chemoattractant and sense concentration gradients by unknown mechanisms. After sensing the attractant, sperm cells commonly demonstrate a series of responses involving different swimming patterns by changing flagellar beats, gradually approaching a swimming path toward the eggs, which is the source of chemoattractants. Shiba et al. observed a rapid increase in intracellular Ca(2+) concentrations in Ciona spermatozoa after sensing chemoattractants; however, the biochemical processes occurring inside the sperm cells are unclear. In the present study, we focused on the timing and sensing mechanism of chemical signal detection in Ciona. One of the most crucial problems to be solved is defining the initial epoch of chemotactic responses. We adopted a high rate of video recording (600 Hz) for detailed analysis of sperm motion and a novel method for detecting subtle signs of beat forms and moving paths of sperm heads. From these analyses, we estimated a virtual sensing point of the attractant before initiation of motility responses and found that the time delay from sensing to motility responses was almost constant. To evaluate the efficiency of this constant delay model, we performed computer simulation of chemotactic behaviors of Ciona spermatozoa.

  18. A low-virulence Eimeria intestinalis isolate from rabbit (Oryctolagus cuniculus) in China: molecular identification, pathogenicity, and immunogenicity.

    Science.gov (United States)

    Shi, Tuanyuan; Bao, Guolian; Fu, Yuan; Suo, Xun; Hao, Lili

    2014-03-01

    An Eimeria intestinalis isolated from a rabbit in China was first identified by amplifying the 18S small subunit (SSU) ribosomal RNA gene. The size of the amplified fragment was 1521 bp. The 18S SSU RNA gene of the E. intestinalis isolate shared 99% sequence identity with E. intestinalis isolates from France and the Czech Republic, with 100 and 96% coverage, respectively. Then, the pathogenicity and immunogenicity of the E. intestinalis isolate were evaluated in specific pathogen free (SPF) rabbits. In the pathogenicity assay, SPF rabbits in four groups were infected with 5 × 10(3), 5 × 10(4), 5 × 10(5), and 0 sporulated oocysts, respectively. Clinical signs including diarrhoea, constipation, loss of appetite, and reduction of body weight gain were observed in rabbits inoculated with 5 × 10(4) and 5 × 10(5) oocysts. And one rabbit (25 %) inoculated with 5 × 10(5) oocysts died 15 days after the inoculation. In the immunogenicity assay, SPF rabbits in five groups (named B1, B2, B3, B4, and B5) were immunised with 5 × 10(1), 5 × 10(2), 5 × 10(3), 0, and 0 sporulated oocysts, respectively. All rabbits but the B5 group were challenged with 1 × 10(6) oocysts. After the challenge, no or slight clinical signs were seen in rabbits of the B2 and B3 groups. Compared with the control, a 69.6 and 84.5% reduction of oocyst output was observed in the B2 and B3 groups, respectively. The body weight gain of the two groups was obviously higher than that of the challenge control group. All the results show that the E. intestinalis isolate has low virulence but immunogenicity in rabbit.

  19. Dicty_cDB: VHA612 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available inalis cDNA, clone:cits45g14, 5' end, single read. 80 4e-13 2 BW503370 |BW503370.1 Ciona intestinalis early ...9, 5' end, single read. 80 5e-13 2 BW505135 |BW505135.1 Ciona intestinalis early juvenile cDNA, clone: cijm0

  20. In vitro susceptibilities of the AIDS-associated microsporidian Encephalitozoon intestinalis to albendazole, its sulfoxide metabolite, and 12 additional benzimidazole derivatives.

    OpenAIRE

    Katiyar, S. K.; Edlind, T D

    1997-01-01

    Recent reports have described the successful treatment of Encephalitozoon intestinalis infection in AIDS patients with albendazole. However, this compound is rapidly metabolized in vivo to albendazole sulfoxide, and furthermore it is only 1 of about 15 commercially developed benzimidazole derivatives. To compare the activities of albendazole, albendazole sulfoxide, and other benzimidazoles, an in vitro system involving infection of green monkey kidney cell (E6) monolayers with E. intestinalis...

  1. The Epidemiology of Ligula intestinalis (Phylum Platyhelminthes within the Cyprinid Populations Inhabiting the Danubian Delta Area

    Directory of Open Access Journals (Sweden)

    Laura Daniela Urdes

    2013-05-01

    Full Text Available This prevalence study was conducted between the years 2003 and 2008. The survey aimed at assessing the occurrence of the plerocercoid Ligula intestinalis within five cyprinid populations, cyprinus carpio, carassius gibelio, hypophtalmichthys molitrix, ctenopharingodon idella and abramis brama, from four natural complexes: Sontea-Fortuna, Gorgova-Uzlina, Dunavat-Dranov and Razim-Sinoie. Of the four study sites, the highest frequency of the disease was recorded within the Razim-Sinoie lakes, probably due to an apparently higher number of piscivorous birds and copepods that may have inhabited this area during the study time period. Only A. brama and H. molitrix were found infected by the helminth, with a mean prevalence of the cases in A. brama of 16.31% and in H. molitrix of 13.06%.

  2. Evidence for karyogamy and exchange of genetic material in the binucleate intestinal parasite Giardia intestinalis.

    Science.gov (United States)

    Poxleitner, Marianne K; Carpenter, Meredith L; Mancuso, Joel J; Wang, Chung-Ju R; Dawson, Scott C; Cande, W Zacheus

    2008-03-14

    The diplomonad parasite Giardia intestinalis contains two functionally equivalent nuclei that are inherited independently during mitosis. Although presumed to be asexual, Giardia has low levels of allelic heterozygosity, indicating that the two nuclear genomes may exchange genetic material. Fluorescence in situ hybridization performed with probes to an episomal plasmid suggests that plasmids are transferred between nuclei in the cyst, and transmission electron micrographs demonstrate fusion between cyst nuclei. Green fluorescent protein fusions of giardial homologs of meiosis-specific genes localized to the nuclei of cysts, but not the vegetative trophozoite. These data suggest that the fusion of nuclei, or karyogamy, and subsequently somatic homologous recombination facilitated by the meiosis gene homologs, occur in the giardial cyst.

  3. Mind the gap – context dependency in invasive species impacts: a case study of the ascidian Ciona robusta

    Directory of Open Access Journals (Sweden)

    Tamara B. Robinson

    2017-01-01

    Full Text Available In the face of increasing invasions and limited resources, appropriate management of invasive species requires prioritisation of species for management action. This process often relies on knowledge of species specific impacts. However, as studies explicitly measuring impact of marine alien species are rare, prioritisation of management actions is often based on studies from outside the geographic area of interest. Further, few impact studies account for context dependency (e.g. seasonal variability or distinct environmental regimes, raising the question of how transferrable knowledge about the impact of a species is between invaded ranges. This study addressed this question by using the widespread invasive solitary ascidian Ciona robusta as a case study for assessing impacts across two invaded regions: South Africa and California, USA. We replicated a previously conducted experiment from California that showed that C. robusta depresses local species richness in San Francisco Bay. Our South African experiment showed no effect of C. robusta on species richness, the Shannon-Weiner diversity index or community composition, despite experiments being carried out over two years and at two depths. While these results may reflect strong density dependency in the impact of C. robusta, they serve to highlight context dependency in invasive species impacts. This suggests that until studies of impact in marine systems become common place, context dependency should be explicitly addressed as a source of uncertainty during the prioritisation of species for management action.

  4. Recovery of DNA of Giardia intestinalis cysts from surface water concentrates measured with PCR and real time PCR

    Directory of Open Access Journals (Sweden)

    Adamska M.

    2011-11-01

    Full Text Available The most important restriction for the detection in water samples is the low concentration of Giardia intestinalis cysts, additional difficulty is the presence of PCR inhibitors. We have carried out trials in order to assess the sensitivity of semi-nested PCR and TaqMan real time PCR on the basis of DNA extracted from G. intestinalis cysts coming from spiked environmental and distilled water samples, filtrated with the use of Filta-Max® equipment (1623 Method. Removal of inhibitors was carried out with addition of BSA in different concentrations. During the filtration and concentration of water samples, losses of cysts have been recorded. Moreover, addition of BSA to the PCR and real time PCR mix increases the sensitivity of reaction. The optimal concentration of BSA for semi-nested PCR was 15 and 20 ng/μl, whereas for real time PCR 5 ng/μl.

  5. Synthesis of nitro(benzo)thiazole acetamides and in vitro antiprotozoal effect against amitochondriate parasites Giardia intestinalis and Trichomonas vaginalis.

    Science.gov (United States)

    Navarrete-Vázquez, Gabriel; Chávez-Silva, Fabiola; Colín-Lozano, Blanca; Estrada-Soto, Samuel; Hidalgo-Figueroa, Sergio; Guerrero-Álvarez, Jorge; Méndez, Sara T; Reyes-Vivas, Horacio; Oria-Hernández, Jesús; Canul-Canché, Jaqueline; Ortiz-Andrade, Rolffy; Moo-Puc, Rosa

    2015-05-01

    We synthesized four 5-nitrothiazole (1-4) and four 6-nitrobenzothiazole acetamides (5-8) using an easy two step synthetic route. All compounds were tested in vitro against amitochondriate parasites Giardia intestinalis and Trichomonas vaginalis, showing excellent antiprotozoal effects. IC₅₀'s of the most potent compounds range from nanomolar to low micromolar order, being more active than their drugs of choice. Compound 1 (IC₅₀=122 nM), was 44-times more active than Metronidazole, and 10-fold more effective than Nitazoxanide against G. intestinalis and showed good trichomonicidal activity (IC₅₀=2.24 μM). This compound did not display in vitro cytotoxicity against VERO cells. The in vitro inhibitory effect of compounds 1-8 and Nitazoxanide against G. intestinalis fructose-1,6-biphosphate aldolase (GiFBPA) was evaluated as potential drug target, showing a clear inhibitory effect over the enzyme activity. Molecular docking of compounds 1, 4 and Nitazoxanide into the ligand binding pocket of GiFBPA, revealed contacts with the active site residues of the enzyme. Ligand efficiency metrics of 1 revealed optimal combinations of physicochemical and antiprotozoal properties, better than Nitazoxanide.

  6. Molecular Detection of Giardia intestinalis from Stray Dogs in Animal Shelters of Gyeongsangbuk-do (Province) and Daejeon, Korea.

    Science.gov (United States)

    Shin, Jin-Cheol; Reyes, Alisha Wehdnesday Bernardo; Kim, Sang-Hun; Kim, Suk; Park, Hyung-Jin; Seo, Kyoung-Won; Song, Kun-Ho

    2015-08-01

    Giardia is a major public health concern and considered as reemerging in industrialized countries. The present study investigated the prevalence of giardiosis in 202 sheltered dogs using PCR. The infection rate was 33.2% (67/202); Gyeongsangbuk-do and Daejeon showed 25.7% (39/152, P<0.0001) and 56% (28/50), respectively. The prevalence of infected female dogs (46.7%, P<0.001) was higher than in male dogs (21.8%). A higher prevalence (43.5%, P<0.0001) was observed in mixed breed dogs than purebred (14.1%). Although most of the fecal samples collected were from dogs of ≥1 year of age which showed only 27.4% positive rate, 61.8% (P<0.001) of the total samples collected from young animals (<1 year of age) were positive for G. intestinalis. A significantly higher prevalence in symptomatic dogs (60.8%, P<0.0001) was observed than in asymptomatic dogs (23.8%). Furthermore, the analysis of nucleotide sequences of the samples revealed that G. intestinalis Assemblages A and C were found in the feces of dogs from Gyeongsangbuk-do and Daejeon. Since G. intestinalis Assemblage A has been known to infect humans, our results suggest that dogs can act as an important reservoir of giardiosis in Korea. Hence, hygienic management should be given to prevent possible transmission to humans.

  7. Bacteroides intestinalis DSM 17393, a member of the human colonic microbiome, upregulates multiple endoxylanases during growth on xylan

    Science.gov (United States)

    Wang, Kui; Pereira, Gabriel V.; Cavalcante, Janaina J. V.; Zhang, Meiling; Mackie, Roderick; Cann, Isaac

    2016-01-01

    Many human diets contain arabinoxylan, and the ease of genome sequencing coupled with reduced cost have led to unraveling the arsenal of genes utilized by the colonic Bacteroidetes to depolymerize this polysaccharide. The colonic Bacteroidetes with potential to ferment arabinoxylans include Bacteroides intestinalis. In this study, we analyzed the hydrolytic activities of members of a xylan degradation cluster encoded on the genome of Bacteroides intestinalis DSM 17393. Here, it is demonstrated that a cocktail of the xylanolytic enzymes completely hydrolyze arabinoxylans found in human diets. We show that this bacterium and relatives have evolved and secrete a unique bifunctional endoxylanase/arabinofuranosidase in the same polypeptide. The bifunctional enzyme and other secreted enzymes attack the polysaccharides extracellularly to remove the side-chains, exposing the xylan backbone for cleavage to xylo-oligosaccharides and xylose. These end products are transported into the cell where a β-xylosidase cleaves the oligosaccharides to fermentable sugars. While our experiments focused on B. intestinalis, it is likely that the extracellular enzymes also release nutrients to members of the colonic microbial community that practice cross-feeding. The presence of the genes characterized in this study in other colonic Bacteroidetes suggests a conserved strategy for energy acquisition from arabinoxylan, a component of human diets. PMID:27681607

  8. Indagine sulle malattie infiammatorie croniche intestinali in un'azienda ULSS veneta

    Directory of Open Access Journals (Sweden)

    G. Moretti

    2003-05-01

    Full Text Available

    Obiettivi: l’epidemiologia delle malattie infiammatorie croniche intestinali fino ad adesso in Italia è stata poco studiata. Da alcuni studi emerge una minor incidenza di questi fenomeni nel Sud Europa rispetto al Nord Europa e agli Stati Uniti. Lo scopo di questa indagine è quello di valutare l’incidenza della Rettocolite Ulcerosa (RU e del Morbo di Crohn (MC nella popolazione dell’Azienda ULSS 17, situata nella provincia di Padova.

    Metodi: per la realizzazione di questa indagine ci si è avvalsi della collaborazione di 23 Medici di Medicina Generale (MMG operanti in 14 comuni dell’ULSS 17. I dati sono stati prelevati dal sistema informatizzato comune ai 23 MMG (Millenium, in base ai codici 555 e 556 dell’ICD9. È stato considerato il periodo di tempo 1995 - 2001. La popolazione media di riferimento è di 29.740 abitanti. Risultati: nel periodo considerato sono stati registrati in totale 45 nuovi casi, 35 casi di RU e 10 di MC. L’incidenza media della RU è stata di 16,76/100.000, quella del MC di 4,7/100.000. La RU ha avuto un’incidenza maggiore nel sesso maschile (rapporto 2:1, mentre per il MC si rileva l’opposto (rapporto 2:3. L’età media alla diagnosi per la RU è stata di 44 anni, quella del MC di 51,9. Dall’analisi temporale si evidenzia un progressivo aumento dell’incidenza del MC, mentre la RCU è più costante.

    Conclusioni: paragonando i risultati ottenuti con quelli di altre indagini condotte in Italia, l’incidenza delle malattie infiammatorie croniche intestinali è apparentemente più elevata nel territorio dell’ULSS 17. Dalla revisione della letteratura nazionale e internazionale emerge che variazioni dell’incidenza di questi fenomeni possono essere ricondotte ad un diverso accesso ai servizi sanitari, a diverse pratiche diagnostiche o alla presenza di fattori di rischio di tipo genetico o ambientale

  9. ACAM, a novel member of the neural IgCAM family, mediates anterior neural tube closure in a primitive chordate.

    Science.gov (United States)

    Morales Diaz, Heidi; Mejares, Emil; Newman-Smith, Erin; Smith, William C

    2016-01-01

    The neural IgCAM family of cell adhesion molecules, which includes NCAM and related molecules, has evolved via gene duplication and alternative splicing to allow for a wide range of isoforms with distinct functions and homophilic binding properties. A search for neural IgCAMs in ascidians (Ciona intestinalis, Ciona savignyi, and Phallusia mammillata) has identified a novel set of truncated family members that, unlike the known members, lack fibronectin III domains and consist of only repeated Ig domains. Within the tunicates this form appears to be unique to the ascidians, and it was designated ACAM, for Ascidian Cell Adhesion Molecule. In C. intestinalis ACAM is expressed in the developing neural plate and neural tube, with strongest expression in the anterior sensory vesicle precursor. Unlike the two other conventional neural IgCAMs in C. intestinalis, which are expressed maternally and throughout the morula and blastula stages, ACAM expression initiates at the gastrula stage. Moreover, C. intestinalis ACAM is a target of the homeodomain transcription factor OTX, which plays an essential role in the development of the anterior central nervous system. Morpholino (MO) knockdown shows that ACAM is required for neural tube closure. In MO-injected embryos neural tube closure was normal caudally, but the anterior neuropore remained open. A similar phenotype was seen with overexpression of a secreted version of ACAM. The presence of ACAM in ascidians highlights the diversity of this gene family in morphogenesis and neurodevelopment.

  10. Modulation of oxygen binding to insect hemoglobins: the structure of hemoglobin from the botfly Gasterophilus intestinalis.

    Science.gov (United States)

    Pesce, Alessandra; Nardini, Marco; Dewilde, Sylvia; Hoogewijs, David; Ascenzi, Paolo; Moens, Luc; Bolognesi, Martino

    2005-12-01

    Hemoglobins (Hbs) reversibly bind gaseous diatomic ligands (e.g., O2) as the sixth heme axial ligand of the penta-coordinate deoxygenated form. Selected members of the Hb superfamily, however, display a functionally relevant hexa-coordinate heme Fe atom in their deoxygenated state. Endogenous heme hexa-coordination is generally provided in these Hbs by the E7 residue (often His), which thus modulates accessibility to the heme distal pocket and reactivity of the heme toward exogenous ligands. Such a pivotal role of the E7 residue is prominently shown by analysis of the functional and structural properties of insect Hbs. Here, we report the 2.6 A crystal structure of oxygenated Gasterophilus intestinalis Hb1, a Hb known to display a penta-coordinate heme in the deoxygenated form. The structure is analyzed in comparison with those of Drosophila melanogaster Hb, exhibiting a hexa-coordinate heme in its deoxygenated derivative, and of Chironomus thummi thummi HbIII, which displays a penta-coordinate heme in the deoxygenated form. Despite evident structural differences in the heme distal pockets, the distinct molecular mechanisms regulating O2 binding to the three insect Hbs result in similar O(2 affinities (P50 values ranging between 0.12 torr and 0.46 torr).

  11. Pneumatosis intestinalis and portal venous gas secondary to Gefitinib therapy for lung adenocarcinoma

    Directory of Open Access Journals (Sweden)

    Lee Joo

    2012-03-01

    Full Text Available Abstract Background Pneumatosis intestinalis (PI, defined as the presence of gas in the bowel wall, and portal venous gas (PVG are relatively rare radiological findings. Although several chemotherapeutic agents and anti-vascular endothelial growth factor agents are reported to be associated with PI and PVG, an association with anti-epidermal growth factor receptor (EGFR agents has not been described previously. Case presentation The present report describes a case of PI and PVG secondary to treatment with an EGFR tyrosine kinase inhibitor. A 66-year-old woman who had been diagnosed with metastatic lung adenocarcinoma presented with nausea, vomiting and abdominal distension after commencing gefitinib. A computed tomography (CT scan of the abdomen revealed PI extending from the ascending colon to the rectum, hepatic PVG, and infarction of the liver. Gefitinib therapy was discontinued immediately and the patient was managed conservatively. A follow-up CT scan 2 weeks later revealed that the PI and hepatic PVG had completely resolved. Conclusion This is the first report of PI and PVG caused by EGFR tyrosine kinase inhibitor. Although these complications are extremely rare, clinicians should be aware of the risk of PI and PVG in patients undergoing targeted molecular therapy.

  12. Two New Xylanases with Different Substrate Specificities from the Human Gut Bacterium Bacteroides intestinalis DSM 17393

    KAUST Repository

    Hong, Pei-Ying

    2014-01-24

    Xylan is an abundant plant cell wall polysaccharide and is a dominant component of dietary fiber. Bacteria in the distal human gastrointestinal tract produce xylanase enzymes to initiate the degradation of this complex heteropolymer. These xylanases typically derive from glycoside hydrolase (GH) families 10 and 11; however, analysis of the genome sequence of the xylan-degrading human gut bacterium Bacteroides intestinalis DSM 17393 revealed the presence of two putative GH8 xylanases. In the current study, we demonstrate that the two genes encode enzymes that differ in activity. The xyn8A gene encodes an endoxylanase (Xyn8A), and rex8A encodes a reducing-end xylose-releasing exo-oligoxylanase (Rex8A). Xyn8A hydrolyzed both xylopentaose (X5) and xylohexaose (X6) to a mixture of xylobiose (X2) and xylotriose (X3), while Rex8A hydrolyzed X3 through X6 to a mixture of xylose (X1) and X2. Moreover, rex8A is located downstream of a GH3 gene (xyl3A) that was demonstrated to exhibit β-xylosidase activity and would be able to further hydrolyze X2 to X1. Mutational analyses of putative active site residues of both Xyn8A and Rex8A confirm their importance in catalysis by these enzymes. Recent genome sequences of gut bacteria reveal an increase in GH8 Rex enzymes, especially among the Bacteroidetes, indicating that these genes contribute to xylan utilization in the human gut.

  13. The minimal proteome in the reduced mitochondrion of the parasitic protist Giardia intestinalis.

    Directory of Open Access Journals (Sweden)

    Petr L Jedelský

    Full Text Available The mitosomes of Giardia intestinalis are thought to be mitochondria highly-reduced in response to the oxygen-poor niche. We performed a quantitative proteomic assessment of Giardia mitosomes to increase understanding of the function and evolutionary origin of these enigmatic organelles. Mitosome-enriched fractions were obtained from cell homogenate using Optiprep gradient centrifugation. To distinguish mitosomal proteins from contamination, we used a quantitative shot-gun strategy based on isobaric tagging of peptides with iTRAQ and tandem mass spectrometry. Altogether, 638 proteins were identified in mitosome-enriched fractions. Of these, 139 proteins had iTRAQ ratio similar to that of the six known mitosomal markers. Proteins were selected for expression in Giardia to verify their cellular localizations and the mitosomal localization of 20 proteins was confirmed. These proteins include nine components of the FeS cluster assembly machinery, a novel diflavo-protein with NADPH reductase activity, a novel VAMP-associated protein, and a key component of the outer membrane protein translocase. None of the novel mitosomal proteins was predicted by previous genome analyses. The small proteome of the Giardia mitosome reflects the reduction in mitochondrial metabolism, which is limited to the FeS cluster assembly pathway, and a simplicity in the protein import pathway required for organelle biogenesis.

  14. Absence of a conventional spindle mitotic checkpoint in the binucleated single-celled parasite Giardia intestinalis.

    Science.gov (United States)

    Markova, Kristyna; Uzlikova, Magdalena; Tumova, Pavla; Jirakova, Klara; Hagen, Guy; Kulda, Jaroslav; Nohynkova, Eva

    2016-10-01

    The spindle assembly checkpoint (SAC) joins the machinery of chromosome-to-spindle microtubule attachment with that of the cell cycle to prevent missegregation of chromosomes during mitosis. Although a functioning SAC has been verified in a limited number of organisms, it is regarded as an evolutionarily conserved safeguard mechanism. In this report, we focus on the existence of the SAC in a single-celled parasitic eukaryote, Giardia intestinalis. Giardia belongs to Excavata, a large and diverse supergroup of unicellular eukaryotes in which SAC control has been nearly unexplored. We show that Giardia cells with absent or defective mitotic spindles due to the inhibitory effects of microtubule poisons do not arrest in mitosis; instead, they divide without any delay, enter the subsequent cell cycle and even reduplicate DNA before dying. We identified a limited repertoire of kinetochore and SAC components in the Giardia genome, indicating that this parasite is ill equipped to halt mitosis before the onset of anaphase via SAC control of chromosome-spindle microtubule attachment. Finally, based on overexpression, we show that Giardia Mad2, a core SAC protein in other eukaryotes, localizes along intracytoplasmic portions of caudal flagellar axonemes, but never within nuclei, even in mitotic cells with blocked spindles, where the SAC should be active. These findings are consistent with the absence of a conventional SAC, known from yeast and metazoans, in the parasitic protist Giardia.

  15. Lactobacillus rhamnosus GG antagonizes Giardia intestinalis induced oxidative stress and intestinal disaccharidases: an experimental study.

    Science.gov (United States)

    Goyal, Nisha; Rishi, Praveen; Shukla, Geeta

    2013-06-01

    The present study describes the in vivo modulatory potential of Lactobacillus rhamnosus GG (LGG), an effective probiotic, in Giardia intestinalis-infected BALB/c mice. Experimentally, it was observed that oral administration of lactobacilli prior or simultaneous with Giardia trophozoites to mice, efficiently (p Giardia-infected mice, showed a significant increase in the levels of antioxidants [reduced glutathione (GSH) and superoxide dismutase (SOD)] and intestinal disaccharidases [sucrase and lactase] and decreased levels of oxidants in the small intestine, in comparison with Giardia-infected mice. Histopathological findings also revealed almost normal cellular morphology of the small intestine in probiotic-fed Giardia-infected mice compared with fused enterocytes, villous atrophy and increased infiltration of lymphocytes in Giardia-infected mice. The results of the present study has shed new light on the anti-oxidative properties of LGG in Giardia mediated tissue injury, thereby suggesting that the effects of probiotic LGG are biologically plausible and could be used as an alternative microbial interference therapy.

  16. Two New Xylanases with Different Substrate Specificities from the Human Gut Bacterium Bacteroides intestinalis DSM 17393

    Science.gov (United States)

    Hong, Pei-Ying; Iakiviak, Michael; Dodd, Dylan; Zhang, Meiling; Mackie, Roderick I.

    2014-01-01

    Xylan is an abundant plant cell wall polysaccharide and is a dominant component of dietary fiber. Bacteria in the distal human gastrointestinal tract produce xylanase enzymes to initiate the degradation of this complex heteropolymer. These xylanases typically derive from glycoside hydrolase (GH) families 10 and 11; however, analysis of the genome sequence of the xylan-degrading human gut bacterium Bacteroides intestinalis DSM 17393 revealed the presence of two putative GH8 xylanases. In the current study, we demonstrate that the two genes encode enzymes that differ in activity. The xyn8A gene encodes an endoxylanase (Xyn8A), and rex8A encodes a reducing-end xylose-releasing exo-oligoxylanase (Rex8A). Xyn8A hydrolyzed both xylopentaose (X5) and xylohexaose (X6) to a mixture of xylobiose (X2) and xylotriose (X3), while Rex8A hydrolyzed X3 through X6 to a mixture of xylose (X1) and X2. Moreover, rex8A is located downstream of a GH3 gene (xyl3A) that was demonstrated to exhibit β-xylosidase activity and would be able to further hydrolyze X2 to X1. Mutational analyses of putative active site residues of both Xyn8A and Rex8A confirm their importance in catalysis by these enzymes. Recent genome sequences of gut bacteria reveal an increase in GH8 Rex enzymes, especially among the Bacteroidetes, indicating that these genes contribute to xylan utilization in the human gut. PMID:24463968

  17. Two new xylanases with different substrate specificities from the human gut bacterium Bacteroides intestinalis DSM 17393.

    Science.gov (United States)

    Hong, Pei-Ying; Iakiviak, Michael; Dodd, Dylan; Zhang, Meiling; Mackie, Roderick I; Cann, Isaac

    2014-04-01

    Xylan is an abundant plant cell wall polysaccharide and is a dominant component of dietary fiber. Bacteria in the distal human gastrointestinal tract produce xylanase enzymes to initiate the degradation of this complex heteropolymer. These xylanases typically derive from glycoside hydrolase (GH) families 10 and 11; however, analysis of the genome sequence of the xylan-degrading human gut bacterium Bacteroides intestinalis DSM 17393 revealed the presence of two putative GH8 xylanases. In the current study, we demonstrate that the two genes encode enzymes that differ in activity. The xyn8A gene encodes an endoxylanase (Xyn8A), and rex8A encodes a reducing-end xylose-releasing exo-oligoxylanase (Rex8A). Xyn8A hydrolyzed both xylopentaose (X5) and xylohexaose (X6) to a mixture of xylobiose (X2) and xylotriose (X3), while Rex8A hydrolyzed X3 through X6 to a mixture of xylose (X1) and X2. Moreover, rex8A is located downstream of a GH3 gene (xyl3A) that was demonstrated to exhibit β-xylosidase activity and would be able to further hydrolyze X2 to X1. Mutational analyses of putative active site residues of both Xyn8A and Rex8A confirm their importance in catalysis by these enzymes. Recent genome sequences of gut bacteria reveal an increase in GH8 Rex enzymes, especially among the Bacteroidetes, indicating that these genes contribute to xylan utilization in the human gut.

  18. Elongation factor 1-alpha is released into the culture medium during growth of Giardia intestinalis trophozoites.

    Science.gov (United States)

    Skarin, Hanna; Ringqvist, Emma; Hellman, Ulf; Svärd, Staffan G

    2011-04-01

    The molecular pathogenesis of the intestinal parasite Giardia intestinalis is still not fully understood but excretory-secretory products have been suggested to be important during host-parasite interactions. Here we used SDS-PAGE gels and MALDI-TOF analysis to identify proteins released by Giardia trophozoites during in vitro growth. Serum proteins (mainly bovine serum albumin) in the growth medium, bind to the parasite surface and they are continuously released, which interfere with parasite secretome characterization. However, we identified two released Giardia proteins: elongation factor-1 alpha (EF-1α) and a 58 kDa protein, identified as arginine deiminase (ADI). This is the first description of EF-1α as a released/secreted Giardia protein, whereas ADI has been identified in an earlier secretome study. Two genes encoding EF-1α were detected in the Giardia WB genome 35 kbp apart with almost identical coding sequences but with different promoter and 3' regions. Promoter luciferase-fusions showed that both genes are transcribed in trophozoites. The EF-1α protein localizes to the nuclear region in trophozoites but it relocalizes to the cytoplasm during host-cell interaction. Recombinant EF-1α is recognized by serum from giardiasis patients. Our results suggest that released EF-1α protein can be important during Giardia infections.

  19. Acute necrotizing colitis with pneumatosis intestinalis in an Amazonian manatee calf.

    Science.gov (United States)

    Guerra Neto, Guilherme; Galvão Bueno, Marina; Silveira Silva, Rodrigo Otavio; Faria Lobato, Francisco Carlos; Plácido Guimarães, Juliana; Bossart, Gregory D; Marmontel, Miriam

    2016-08-09

    On 25 January 2014, a 1 mo old female Amazonian manatee Trichechus inunguis calf weighing 12 kg was rescued by air transport in Guajará, Brazil, and transferred to Mamirauá Institute's Community-based Amazonian Manatee Rehabilitation Center. The calf presented piercing/cutting lesions on the back, neck, and head, in addition to dehydration and intermittent involuntary buoyancy. X-ray analysis revealed a large amount of gases in the gastrointestinal tract. Daily procedures included wound cleaning and dressing, clinical and laboratory monitoring, treatment for intestinal tympanism, and artificial feeding. Adaptation to the nursing formula included 2 kinds of whole milk. Up to 20 d post-rescue the calf presented appetite, was active, and gained weight progressively. Past this period the calf started losing weight and presented constant involuntary buoyancy and died after 41 d in rehabilitation. The major findings at necropsy were pneumatosis intestinalis in cecum and colon, pulmonary edema, and hepatomegaly. The microscopic examination revealed pyogranulomatous and necrohemohrragic colitis with multinucleated giant cells, acute multifocal lymphadenitis with lymphoid depletion in cortical and paramedullary regions of mesenteric lymph nodes, and diffuse severe acinar atrophy of the pancreas. Anaerobic cultures of fragments of cecum and colon revealed colonies genotyped as Clostridium perfringens type A. We speculate that compromised immunity, thermoregulatory failure, and intolerance to artificial diet may have been contributing factors to the infection, leading to enterotoxemia and death.

  20. Transcript mapping of mitochondrial genome and its application%动物线粒体基因组的转录物作图与应用

    Institute of Scientific and Technical Information of China (English)

    姚杨; 黄原

    2010-01-01

    线粒体转录物作图是研究线粒体基因组表达、调控和序列主要有表达序列标签(expressed sequence tag,EST)文库测序、5'和3'cDNA末端快速扩增(rapid amplification of cDNA ends,RACE)技术和RT-PCR方法,采用这些方法已经对果蝇(Drosophila melanogaster)、按蚊(Anopheles funestus)、玻璃海鞘(Ciona intestinalis)、猪(Sus scrofa domestica)等线粒体转录组进行了分析.研究显示,脊椎动物和无脊椎动物的线粒体基因组分别产生3个和5个多顺反子的初级转录物,并通过tRNA间断模型(tRNA punctuation model)加工.线粒体转录物的分析结果为正确注释线粒体基因组序列提供了重要信息.

  1. Ligula intestinalis infection as a potential source of bias in the bioindication of endocrine disruption in the European chub Leuciscus cephalus.

    Science.gov (United States)

    Schabuss, M; Gemeiner, M; Gleiss, A; Lewis, J W; Miller, I; Möstl, E; Schober, U; Tschulenk, W; Walter, I; Grillitsch, B

    2005-03-01

    European chub Leuciscus cephalus collected from five localities in the lowland and subalpine regions of Austria were analysed for oestrogenic effects of endocrine-disrupting chemicals and the presence of the plerocercoid of the tapeworm Ligula intestinalis. Of 1494 chub analysed, only seven (six males, one female) were found to be infected with single, but large plerocercoids up to 15 cm in length. Ligula-infected fish showed comparatively immature gonads, as demonstrated by the gonadosomatic index and gamete developmental stages. Plasma levels of the egg precursor protein vitellogenin also showed concentrations ranging below the detection limit. The present results indicate that chub infected with L. intestinalis and exposed to exogenous oestrogenic compounds can result in reduced gonadal maturation and produce false oestrogen-positive diagnoses in male fish. For plasma vitellogenin levels, L. intestinalis infections can result in false oestrogen-negative diagnoses in male and female fish.

  2. A study of infestation of Alburnoides bipunctatus with Ligula intestinalis in Latian reservoir Dam Lake, Tehran province, Iran: A histopathological stud

    Directory of Open Access Journals (Sweden)

    Iraj Sohrabi Haghdoos

    2011-06-01

    Full Text Available . Objective: The objective of this study was to report infestation of the fish with Ligula intestinalis as a food borne zoonoses and to study its histopathological effects on one Alburnoides bipunctatus in Latian reservoir Dam Lake, Tehran province, Iran. Material and methods: In July 2010, 6 fish (Alburnoides bipunctatus from Latian reservoir Dam Lake, Tehran province, Iran were referred to Laboratory. After autopsy, two of them (Mature and Female were found infested with plerocercoid of Ligula intestinalis based on taxonomical features. For histopathological studies samples were stained with Haematoxylin and Eosin (H&E and observed under light microscopy. Results: Pathological findings showed inflammation of the reservoir adipose tissue (in the loose conjunctive tissue between lipocytes surrounding intestine. Severe atrophy in follicular cells of ovary was evident. In liver cholangiohepastitis with metaplastic hyperplasia was seen. Conclusion: Considering the importance ofLigula intestinalis as a food borne parasite, performance of other comprehensive studies is a necessity.

  3. In vitro activity of 'Mexican Arnica' Heterotheca inuloides Cass natural products and some derivatives against Giardia intestinalis.

    Science.gov (United States)

    Rodríguez-Chávez, José Luis; Rufino-González, Yadira; Ponce-Macotela, Martha; Delgado, Guillermo

    2015-04-01

    Giardiasis is a gastrointestinal disease that affects humans and other animals caused by parasitic protists of the genus Giardia. Giardia intestinalis (Syn. Giardia lamblia; Giardia duodenalis) infections can cause acute or chronic diarrhoea, dehydration, abdominal discomfort and weight loss. Metronidazole is the most widely used drug for treating giardiasis. Although effective, metronidazol has undesirable secondary effects. Plants used in traditional medicine as antidiarrhoeals or antiparasitics may represent alternative sources for new compounds to treat giardiasis. Heterotheca inuloides Cass. (Asteraceae/Compositae) plant is widely used in Mexican traditional medicine. The following secondary metabolites were isolated from H. inuloides flowers: 7-hydroxy-3,4-dihydrocadalene (1), 7-hydroxycadalene (2), 3,7-dihydroxy-3(4H)-isocadalen-4-one (3), 1R,4R-hydroxy-1,2,3,4-tetrahydrocadalen-15-oic acid (4), quercetin (5), quercetin-3,7,3'-trimethyl ether (6), quercetin-3,7,3',4'-tetramethyl ether (7) and eriodictyol-7,4'-dimethyl ether (8). The activity of these compounds against Giardia intestinalis trophozoites was assessed in vitro as was the activity of the semisynthetic compounds 7-acetoxy-3,4-dihydrocadalene (9), 7-benzoxy-3,4-dihydrocadalene (10), 7-acetoxycadalene (11), 7-benzoxycadalene (12), quercetin pentaacetate (13) and 7-hydroxycalamenene (14). Among these, 7-hydroxy-3,4-dihydrocadalene (1) and 7-hydroxycalamenene (14) were the most active, whereas the remaining compounds showed moderate or no activity. The G. intestinalis trophozoites exposed to compound 1 showed marked changes in cellular architecture along with ultrastructural disorganization. The aim of this study was to evaluate the giardicidal activity of selected H. inuloides metabolites and some semisynthetic derivatives using an in vitro experimental model of giardiasis.

  4. Functional characterization of peroxiredoxins from the human protozoan parasite Giardia intestinalis.

    Directory of Open Access Journals (Sweden)

    Daniela Mastronicola

    Full Text Available The microaerophilic protozoan parasite Giardia intestinalis, causative of one of the most common human intestinal diseases worldwide, infects the mucosa of the proximal small intestine, where it has to cope with O2 and nitric oxide (NO. Elucidating the antioxidant defense system of this pathogen lacking catalase and other conventional antioxidant enzymes is thus important to unveil novel potential drug targets. Enzymes metabolizing O2, NO and superoxide anion (O2 (-• have been recently reported for Giardia, but it is yet unknown how the parasite copes with H2O2 and peroxynitrite (ONOO(-. Giardia encodes two yet uncharacterized 2-cys peroxiredoxins (Prxs, GiPrx1a and GiPrx1b. Peroxiredoxins are peroxidases implicated in virulence and drug resistance in several parasitic protozoa, able to protect from nitroxidative stress and repair oxidatively damaged molecules. GiPrx1a and a truncated form of GiPrx1b (deltaGiPrx1b were expressed in Escherichia coli, purified and functionally characterized. Both Prxs effectively metabolize H2O2 and alkyl-hydroperoxides (cumyl- and tert-butyl-hydroperoxide in the presence of NADPH and E. coli thioredoxin reductase/thioredoxin as the reducing system. Stopped-flow experiments show that both proteins in the reduced state react with ONOO(- rapidly (k = 4×10(5 M(-1 s(-1 and 2×10(5 M(-1 s(-1 at 4°C, for GiPrx1a and deltaGiPrx1b, respectively. Consistent with a protective role against oxidative stress, expression of GiPrx1a (but not deltaGiPrx1b is induced in parasitic cells exposed to air O2 for 24 h. Based on these results, GiPrx1a and deltaGiPrx1b are suggested to play an important role in the antioxidant defense of Giardia, possibly contributing to pathogenesis.

  5. Clinical significance of pneumatosis intestinalis - correlation of MDCT-findings with treatment and outcome

    Energy Technology Data Exchange (ETDEWEB)

    Treyaud, Marc-Olivier; Duran, Rafael; Knebel, Jean-Francois; Meuli, Reto A.; Schmidt, Sabine [Lausanne University Hospital, Department of Diagnostic and Interventional Radiology, Lausanne (Switzerland); Zins, Marc [Fondation Hopital St Joseph, Department of Radiology, Paris (France)

    2017-01-15

    To evaluate the clinical significance of pneumatosis intestinalis (PI) including the influence on treatment and outcome. Two radiologists jointly reviewed MDCT-examinations of 149 consecutive emergency patients (53 women, mean age 64, range 21-95) with PI of the stomach (n = 4), small (n = 68) and/or large bowel (n = 96). PI extension, distribution and possibly associated porto-mesenteric venous gas (PMVG) were correlated with other MDCT-findings, risk factors, clinical management, laboratory, histopathology, final diagnosis and outcome. The most frequent cause of PI was intestinal ischemia (n = 80,53.7 %), followed by infection (n = 18,12.1 %), obstructive (n = 12,8.1 %) and non-obstructive (n = 10,6.7 %) bowel dilatation, unknown aetiologies (n = 8,5.4 %), drugs (n = 8,5.4 %), inflammation (n = 7,4.7 %), and others (n = 6,4 %). Neither PI distribution nor extension significantly correlated with underlying ischemia. Overall mortality was 41.6 % (n = 62), mostly related to intestinal ischemia (p = 0.003). Associated PMVG significantly correlated with underlying ischemia (p = 0.009), as did the anatomical distribution of PMVG (p = 0.015). Decreased mural contrast-enhancement was the only other MDCT-feature significantly associated with ischemia (p p < 0.001). Elevated white blood count significantly correlated with ischemia (p = 0.03). In emergency patients, ischemia remains the most common aetiology of PI, showing the highest mortality. PI with associated PMVG is an alerting sign. PI together with decreased mural contrast-enhancement indicates underlying ischemia. (orig.)

  6. Encephalitozoon intestinalis Inhibits Dendritic Cell Differentiation through an IL-6-Dependent Mechanism.

    Science.gov (United States)

    Bernal, Carmen E; Zorro, Maria M; Sierra, Jelver; Gilchrist, Katherine; Botero, Jorge H; Baena, Andres; Ramirez-Pineda, Jose R

    2016-01-01

    Microsporidia are a group of intracellular pathogens causing self-limited and severe diseases in immunocompetent and immunocompromised individuals, respectively. A cellular type 1 adaptive response, mediated by IL-12, IFNγ, CD4+, and CD8+ T cells has been shown to be essential for host resistance, and dendritic cells (DC) play a key role at eliciting anti-microsporidial immunity. We investigated the in vitro response of DC and DC precursors/progenitors to infection with Encephalitozoon intestinalis (Ei), a common agent of human microsporidosis. Ei-exposed DC cultures up-regulated the surface expression of MHC class II and the costimulatory molecules CD86 and CD40, only when high loads of spores were used. A vigorous secretion of IL-6 but not of IL-1β or IL-12p70 was also observed in these cultures. Ei-exposed DC cultures consisted of immature infected and mature bystander DC, as assessed by MHC class II and costimulatory molecules expression, suggesting that intracellular Ei spores deliver inhibitory signals in DC. Moreover, Ei selectively inhibited the secretion of IL-12p70 in LPS-stimulated DC. Whereas Ei-exposed DC promoted allogeneic naïve T cell proliferation and IL-2 and IFNγ secretion in DC-CD4+ T cell co-cultures, separated co-cultures with bystander or infected DCs showed stimulation or inhibition of IFNγ secretion, respectively. When DC precursors/progenitors were exposed to Ei spores, a significant inhibition of DC differentiation was observed without shifting the development toward cells phenotypically or functionally compatible with myeloid-derived suppressor cells. Neutralization experiments demonstrated that this inhibitory effect is IL-6-dependent. Altogether this investigation reveals a novel potential mechanism of immune escape of microsporidian parasites through the modulation of DC differentiation and maturation.

  7. Novel structural components of the ventral disc and lateral crest in Giardia intestinalis.

    Directory of Open Access Journals (Sweden)

    Kari D Hagen

    2011-12-01

    Full Text Available Giardia intestinalis is a ubiquitous parasitic protist that is the causative agent of giardiasis, one of the most common protozoan diarrheal diseases in the world. Giardia trophozoites attach to the intestinal epithelium using a specialized and elaborate microtubule structure, the ventral disc. Surrounding the ventral disc is a less characterized putatively contractile structure, the lateral crest, which forms a continuous perimeter seal with the substrate. A better understanding of ventral disc and lateral crest structure, conformational dynamics, and biogenesis is critical for understanding the mechanism of giardial attachment to the host. To determine the components comprising the ventral disc and lateral crest, we used shotgun proteomics to identify proteins in a preparation of isolated ventral discs. Candidate disc-associated proteins, or DAPs, were GFP-tagged using a ligation-independent high-throughput cloning method. Based on disc localization, we identified eighteen novel DAPs, which more than doubles the number of known disc-associated proteins. Ten of the novel DAPs are associated with the lateral crest or outer edge of the disc, and are the first confirmed components of this structure. Using Fluorescence Recovery After Photobleaching (FRAP with representative novel DAP::GFP strains we found that the newly identified DAPs tested did not recover after photobleaching and are therefore structural components of the ventral disc or lateral crest. Functional analyses of the novel DAPs will be central toward understanding the mechanism of ventral disc-mediated attachment and the mechanism of disc biogenesis during cell division. Since attachment of Giardia to the intestine via the ventral disc is essential for pathogenesis, it is possible that some proteins comprising the disc could be potential drug targets if their loss or disruption interfered with disc biogenesis or function, preventing attachment.

  8. Mass Death of Predatory Carp, Chanodichthys erythropterus, Induced by Plerocercoid Larvae of Ligula intestinalis (Cestoda: Diphyllobothriidae)

    Science.gov (United States)

    Sohn, Woon-Mok; Na, Byoung-Kuk; Jung, Soo Gun; Kim, Koo Hwan

    2016-01-01

    We describe here the mass death of predatory carp, Chanodichthys erythropterus, in Korea induced by plerocercoid larvae of Ligula intestinalis as a result of host manipulation. The carcasses of fish with ligulid larvae were first found in the river-edge areas of Chilgok-bo in Nakdong-gang (River), Korea at early February 2016. This ecological phenomena also occurred in the adjacent areas of 3 dams of Nakdong-gang, i.e., Gangjeong-bo, Dalseong-bo, and Hapcheon-Changnyeong-bo. Total 1,173 fish carcasses were collected from the 4 regions. To examine the cause of death, we captured 10 wondering carp in the river-edge areas of Hapcheon-Changnyeong-bo with a landing net. They were 24.0-28.5 cm in length and 147-257 g in weight, and had 2-11 plerocercoid larvae in the abdominal cavity. Their digestive organs were slender and empty, and reproductive organs were not observed at all. The plerocercoid larvae occupied almost all spaces of the abdominal cavity under the air bladders. The proportion of larvae per fish was 14.6-32.1% of body weight. The larvae were ivory-white, 21.5-63.0 cm long, and 6.0-13.8 g in weight. We suggest that the preference for the river-edge in infected fish during winter is a modified behavioral response by host manipulation of the tapeworm larvae. The life cycle of this tapeworm seems to be successfully continued as the infected fish can be easily eaten by avian definitive hosts. PMID:27417095

  9. Encephalitozoon intestinalis Inhibits Dendritic Cell Differentiation through an IL-6-Dependent Mechanism

    Science.gov (United States)

    Bernal, Carmen E.; Zorro, Maria M.; Sierra, Jelver; Gilchrist, Katherine; Botero, Jorge H.; Baena, Andres; Ramirez-Pineda, Jose R.

    2016-01-01

    Microsporidia are a group of intracellular pathogens causing self-limited and severe diseases in immunocompetent and immunocompromised individuals, respectively. A cellular type 1 adaptive response, mediated by IL-12, IFNγ, CD4+, and CD8+ T cells has been shown to be essential for host resistance, and dendritic cells (DC) play a key role at eliciting anti-microsporidial immunity. We investigated the in vitro response of DC and DC precursors/progenitors to infection with Encephalitozoon intestinalis (Ei), a common agent of human microsporidosis. Ei-exposed DC cultures up-regulated the surface expression of MHC class II and the costimulatory molecules CD86 and CD40, only when high loads of spores were used. A vigorous secretion of IL-6 but not of IL-1β or IL-12p70 was also observed in these cultures. Ei-exposed DC cultures consisted of immature infected and mature bystander DC, as assessed by MHC class II and costimulatory molecules expression, suggesting that intracellular Ei spores deliver inhibitory signals in DC. Moreover, Ei selectively inhibited the secretion of IL-12p70 in LPS-stimulated DC. Whereas Ei-exposed DC promoted allogeneic naïve T cell proliferation and IL-2 and IFNγ secretion in DC-CD4+ T cell co-cultures, separated co-cultures with bystander or infected DCs showed stimulation or inhibition of IFNγ secretion, respectively. When DC precursors/progenitors were exposed to Ei spores, a significant inhibition of DC differentiation was observed without shifting the development toward cells phenotypically or functionally compatible with myeloid-derived suppressor cells. Neutralization experiments demonstrated that this inhibitory effect is IL-6-dependent. Altogether this investigation reveals a novel potential mechanism of immune escape of microsporidian parasites through the modulation of DC differentiation and maturation. PMID:26870700

  10. Encephalitozoon intestinalis inhibits dendritic cell differentiation through an IL-6-dependent mechanism

    Directory of Open Access Journals (Sweden)

    Carmen Elisa Bernal Silva

    2016-02-01

    Full Text Available AbstractMicrosporidia are a group of intracellular pathogens causing self-limited and severe diseases in immunocompetent and immunocompromised individuals, respectively. A cellular type 1 adaptive response, mediated by IL-12, IFNg, CD4+ and CD8+ T cells has been shown to be essential for host resistance, and dendritic cells (DC play a key role at eliciting anti-microsporidial immunity. We investigated the in vitro response of DC and DC precursors/progenitors to infection with Encephalitozoon intestinalis (Ei, a common agent of human microsporidosis. Ei-exposed DC cultures up-regulated the surface expression of MHC class II and the costimulatory molecules CD86 and CD40, only when high loads of spores were used. A vigorous secretion of IL-6 but not of IL-1b or IL-12p70 was also observed in these cultures. Ei-exposed DC cultures consisted of immature infected and mature bystander DC, as assessed by MHC class II and costimulatory molecules expression, suggesting that intracellular Ei spores deliver inhibitory signals in DC. Moreover, Ei selectively inhibited the secretion of IL-12p70 in LPS-stimulated DC. Whereas Ei-exposed DC promoted allogeneic naïve T cell proliferation and IL-2 and IFNg secretion in DC-CD4+ T cell co-cultures, separated co-cultures with bystander or infected DCs showed stimulation or inhibition of IFNg secretion, respectively. When DC precursors/progenitors were exposed to Ei spores, a significant inhibition of DC differentiation was observed without shifting the development towards cells phenotypically or functionally compatible with myeloid-derived suppressor cells. Neutralization experiments demonstrated that this inhibitory effect is IL-6-dependent. Altogether this investigation reveals a novel potential mechanism of immune escape of microsporidian parasites through the modulation of DC differentiation and maturation.

  11. Giardia intestinalis and nutritional status in children participating in the complementary nutrition program, Antioquia, Colombia, May to October 2006.

    Science.gov (United States)

    Botero-Garcés, Jorge H; García-Montoya, Gisela M; Grisales-Patiño, Dayvin; Aguirre-Acevedo, Daniel C; Alvarez-Uribe, Martha C

    2009-01-01

    Giardia intestinalis infection is prevalent throughout the world and widely distributed in developing countries. In general, children display serious consequences to their state of health, including slow height-weight development; therefore, the main aim of this study was to determine the association between Giardia infection and the nutritional status of children who participate in the program of complementary feeding (Mejoramiento Alimentario y Nutricional de Antioquia (MANA) - Instituto Colombiano de Bienestar Familiar (ICBF)). A cross-sectional study examining the association of giardiasis with nutritional status was conducted. A total of 2035 children aged eight months to six years-old were studied. Data were collected using structured questionnaires, anthropometric measurements and laboratory analysis of blood and stool samples. Analysis of the results showed that 27.6% of children were infected with G. intestinalis, while 8.1% and 1.9% were mildly and significantly underweight, respectively, and 14.1% presented stunting. Giardiasis was statistically identified as a strong predictor of stunting in this study population.

  12. Insights into the structure and inhibition of Giardia intestinalis arginine deiminase: homology modeling, docking, and molecular dynamics studies.

    Science.gov (United States)

    Trejo-Soto, Pedro Josué; Aguayo-Ortiz, Rodrigo; Yépez-Mulia, Lilián; Hernández-Campos, Alicia; Medina-Franco, José Luis; Castillo, Rafael

    2016-01-01

    Giardia intestinalis arginine deiminase (GiADI) is an important metabolic enzyme involved in the energy production and defense of this protozoan parasite. The lack of this enzyme in the human host makes GiADI an attractive target for drug design against G. intestinalis. One approach in the design of inhibitors of GiADI could be computer-assisted studies of its crystal structure, such as docking; however, the required crystallographic structure of the enzyme still remains unresolved. Because of its relevance, in this work, we present a three-dimensional structure of GiADI obtained from its amino acid sequence using the homology modeling approximation. Furthermore, we present an approximation of the most stable dimeric structure of GiADI identified through molecular dynamics simulation studies. An in silico analysis of druggability using the structure of GiADI was carried out in order to know if it is a good target for design and optimization of selective inhibitors. Potential GiADI inhibitors were identified by docking of a set of 3196 commercial and 19 in-house benzimidazole derivatives, and molecular dynamics simulation studies were used to evaluate the stability of the ligand-enzyme complexes.

  13. Período de oviposición de Gasterophilus nasalis y G. intestinalis en equinos: VIII Región, Chile Egg laying period of Gasterophilus nasalis and G. intestinalis on horses: 8th Region, Chile

    Directory of Open Access Journals (Sweden)

    G Sievers

    2005-01-01

    Full Text Available Con el objetivo de conocer el período de oviposición de Gasterophilus nasalis y su relación con las condiciones climáticas locales se realizó, cada dos semanas, el conteo de los huevos colocados en los pelos de la región submaxilar de 10 caballos Hackney en un predio de la VIII Región, Chile, desde noviembre del 2002 a mayo del 2003 (37°, 03', S.; 72°, 33' O.. Los caballos se mantuvieron a potrero sin tratamientos antiparasitarios. Después de cada conteo se extrajeron algunos huevos para ser analizados en el laboratorio y luego se procedió a teñir los restantes con una solución de azul de metileno con el fin de poder determinar los nuevos huevos depositados en la próxima fecha de observación. G. nasalis inició la oviposición en la región intermandibular de los caballos a fines de noviembre de 2002. Las posturas máximas de 853 y 945 huevos durante dos semanas se registraron en los 10 caballos a mediados de diciembre de 2002 y a mediados de enero de 2003 respectivamente. Luego se mantuvo la postura en alrededor de 300 huevos cada dos semanas, hasta inicios de abril y concluyó en mayo de 2003. El período de oviposición coincidió con temperaturas medias superiores a los 15°C; las precipitaciones influyeron negativamente sobre la postura de huevos. A inicios de marzo de 2003 se registró sorpresivamente la oviposición de huevos de G. intestinalis en las regiones preesternal, del encuentro, costo-esternal, inguinal y los miembros de los caballos. El número de huevos aumentó en forma constante hasta mediados de abril, superando los 2000 huevos en dos semanas en los 10 caballos. Por la ubicación de la postura de los huevos y su particular morfología se confirma la presencia de G. intestinalis en Chile. No se pudo determinar el momento en que concluye su oviposición ni la relación con las condiciones climáticas. Se concluye que G. nasalis comienza la oviposición a fines de noviembre y dura hasta inicios de mayo

  14. 浒苔挥发性风味成分分析%Analysis of Volatile Flavor Compounds from Enteromorpha intestinalis

    Institute of Scientific and Technical Information of China (English)

    宋绍华; 裘迪红

    2012-01-01

    采用顶空固相微萃取-气质联用法对新鲜肠浒苔的挥发性风味成分进行测定,并加以感官评定分析比较风味物质组成。结果表明:浒苔的主要特征性风味物质是顺-3-十七烯,该物质在新鲜肠浒苔中含量高达59.54%,其次是棕榈醛、(E,E)-2,4-庚二烯醛、β-紫罗兰酮、壬醛、反式-2-己烯醛、2,4-戊二烯醛以及反,反-2,4-癸二烯醛等。%Headspace solid phase microextraction (HS-SPME) coupled with gas chromatography-mass spectrometer (GC-MS) was used to determine the volatile flavor compounds of the green macroalga Enteromorpha intestinalis. A comparative sensory evaluation of the main flavor substances was also done. The results showed that the main characteristic volatile flavor compound ofEnteromorpha intestinalis were (Z)-3-heptadecene, with a content as high as 59.43% in fresh samples. The other volatile flavors were hexadecanal, (E,E)-2,4-heptadienal, beta-ionone, nonanal, (E)-2-hexenal, 2,4 - pentadienal, (E,E)-2,4-decadienal, and so on.

  15. Transcription factories

    Science.gov (United States)

    Rieder, Dietmar; Trajanoski, Zlatko; McNally, James G.

    2012-01-01

    There is considerable evidence that transcription does not occur homogeneously or diffusely throughout the nucleus, but rather at a number of specialized, discrete sites termed transcription factories. The factories are composed of ~4–30 RNA polymerase molecules, and are associated with many other molecules involved in transcriptional activation and mRNA processing. Some data suggest that the polymerase molecules within a factory remain stationary relative to the transcribed DNA, which is thought to be reeled through the factory site. There is also some evidence that transcription factories could help organize chromatin and nuclear structure, contributing to both the formation of chromatin loops and the clustering of active and co-regulated genes. PMID:23109938

  16. First report of [i]Enterocytozoon[/i] bieneusi and [i]Encephalitozoon intestinalis[/i] infection of wild mice in Slovakia

    Directory of Open Access Journals (Sweden)

    Oľga Danišová

    2015-05-01

    Full Text Available Increased risk of zoonotic transmission of the potential human pathogenic species [i]Enterocytozoon bieneusi[/i], [i]Encephalitozoon intestinalis[/i] and [i]Encephalitozoon cuniculi [/i]was detected in wild immunocompetent mice (Mus musculus musculus; n=280. Analysis was conducted with the use of PMP1/PMP2 primers and SYBR Green RT-PCR. Using Real Time PCR and comparing the sequences with sequences in the GenBank, [i]E. bieneusi[/i] was detected in 3 samples (1.07 %, [i]E. cuniculi [/i]in 1 sample (0.35 % and [i]E. intestinalis[/i] in 1 sample (0.35 %. The results of this report document the low host specificity of detected microsporidia species, and imply the importance of synanthropic rodents as a potential source of human microsporidial infection.

  17. Comparison of efficiency of various DNA extraction methods from cysts of Giardia intestinalis measured by PCR and TaqMan real time PCR.

    Science.gov (United States)

    Adamska, M; Leońska-Duniec, A; Maciejewska, A; Sawczuk, M; Skotarczak, B

    2010-12-01

    The aim of the presented study was to work out an effective method of extraction of DNA from Giardia intestinalis cysts as well as a sensitive and specific method for detection of DNA of this protozoan using a polymerase chain reaction (PCR). Twelve protocols for DNA extraction have been compared. Purification and extraction of DNA were preceded by additional actions in order to destroy the cysts' wall. The highest effectiveness of DNA extraction was obtained in case of alternating application of freezing the samples in liquid nitrogen and their incubation in water bath in the temperature of 100 degrees C, and then the extraction with the QIAamp DNA Tissue Mini Kit (QIAGEN)--T kit--with an all night long incubation with proteinase K in 56 degrees C. Effectiveness of DNA extraction with the use of each kit after extraction with each treatment was measured by nested PCR product of beta-giardin gene fragment and C(T) values of real time PCR of the SSU rRNA gene of G. intestinalis. The detection limit, defined as the lowest number detected in 100% cases, was 100 cysts per 200 microl when effectiveness was evaluated with nested PCR and 50 oocysts with real time PCR after extraction DNA with T kit. Results of our comparative studies have shown that all stages preceding the molecular detection of G. intestinalis DNA are equally important, and materially influence on the final effect and this version of method seems to be very useful for the sensitive detection of DNA of G. intestinalis.

  18. Comparison of efficiency of various DNA extraction methods from cysts of Giardia intestinalis measured by PCR and TaqMan real time PCR

    Directory of Open Access Journals (Sweden)

    Adamska M.

    2010-12-01

    Full Text Available The aim of the presented study was to work out an effective method of extraction of DNA from Giardia intestinalis cysts as well as a sensitive and specific method for detection of DNA of this protozoan using a polymerase chain reaction (PCR. Twelve protocols for DNA extraction have been compared. Purification and extraction of DNA were preceded by additional actions in order to destroy the cysts’ wall. The highest effectiveness of DNA extraction was obtained in case of alternating application of freezing the samples in liquid nitrogen and their incubation in water bath in the temperature of 100 ˚C, and then the extraction with the QIAamp DNA Tissue Mini Kit (QIAGEN – T kit – with an all night long incubation with proteinase K in 56 ˚C. Effectiveness of DNA extraction with the use of each kit after extraction with each treatment was measured by nested PCR product of β-giardin gene fragment and CT values of real time PCR of the SSU rRNA gene of G. intestinalis. The detection limit, defined as the lowest number detected in 100 % cases, was 100 cysts per 200 μl when effectiveness was evaluated with nested PCR and 50 oocysts with real time PCR after extraction DNA with T kit. Results of our comparative studies have shown that all stages preceding the molecular detection of G. intestinalis DNA are equally important, and materially influence on the final effect and this version of method seems to be very useful for the sensitive detection of DNA of G. intestinalis.

  19. Occurrence of Encephalitozoon intestinalis in the Red ruffed lemur (Varecia rubra) and the Ring-tailed lemur (Lemur catta) housed in the Poznan Zoological Garden, Poland.

    Science.gov (United States)

    Słodkowicz-Kowalska, Anna; Majewska, Anna C; Trzesowska, Ewa; Skrzypczak, Łukasz

    2012-01-01

    Encephalitozoon intestinalis is one of the most common microsporidial species found in humans worldwide but it has rarely been identified in animals. The presence of this pathogen has been detected in a few species of domestic, captive and wild mammals as well as in three species of birds. The aim of the present study was to examine fecal samples obtained from mammals housed in the Poznan Zoological Garden, Poland, for the presence of potentially human-infectious microsporidia. A total of 339 fresh fecal samples collected from 75 species of mammals belonging to 27 families and 8 orders were examined for the presence of microsporidian spores. Microsporidian spores were identified in 3 out of 339 (0.9%) examined fecal samples. All samples identified as positive by chromotrope 2R and calcofluor white M2R were also positive by the FISH assay. Using multiplex FISH in all 3 fecal samples, only spores of E. intestinalis were identified in 2 out of 14 Ring-tailed lemurs (Lemur catta) and in one out of 17 Red ruffed lemurs (Varecia variegata rubra). To our knowledge this is the first diagnosis of E. intestinalis in Ring-tailed and Red ruffed lemurs. It should be mentioned that both lemur species are listed by the IUCN Red List of Threatened Species. Although the lemurs were asymptomatically infected, the possibility of widespread infection or death of these animals remains in the event of an elevated stress or a decrease in their immunological functions.

  20. Helium ion microscopy and ultra-high-resolution scanning electron microscopy analysis of membrane-extracted cells reveals novel characteristics of the cytoskeleton of Giardia intestinalis.

    Science.gov (United States)

    Gadelha, Ana Paula Rocha; Benchimol, Marlene; de Souza, Wanderley

    2015-06-01

    Giardia intestinalis presents a complex microtubular cytoskeleton formed by specialized structures, such as the adhesive disk, four pairs of flagella, the funis and the median body. The ultrastructural organization of the Giardia cytoskeleton has been analyzed using different microscopic techniques, including high-resolution scanning electron microscopy. Recent advances in scanning microscopy technology have opened a new venue for the characterization of cellular structures and include scanning probe microscopy techniques such as ultra-high-resolution scanning electron microscopy (UHRSEM) and helium ion microscopy (HIM). Here, we studied the organization of the cytoskeleton of G. intestinalis trophozoites using UHRSEM and HIM in membrane-extracted cells. The results revealed a number of new cytoskeletal elements associated with the lateral crest and the dorsal surface of the parasite. The fine structure of the banded collar was also observed. The marginal plates were seen linked to a network of filaments, which were continuous with filaments parallel to the main cell axis. Cytoplasmic filaments that supported the internal structures were seen by the first time. Using anti-actin antibody, we observed a labeling in these filamentous structures. Taken together, these data revealed new surface characteristics of the cytoskeleton of G. intestinalis and may contribute to an improved understanding of the structural organization of trophozoites.

  1. CS5931, a Novel Polypeptide in Ciona savignyi, Represses Angiogenesis via Inhibiting Vascular Endothelial Growth Factor (VEGF and Matrix Metalloproteinases (MMPs

    Directory of Open Access Journals (Sweden)

    Ge Liu

    2014-03-01

    Full Text Available CS5931 is a novel polypeptide from Ciona savignyi with anticancer activities. Previous study in our laboratory has shown that CS5931 can induce cell death via mitochondrial apoptotic pathway. In the present study, we found that the polypeptide could inhibit angiogenesis both in vitro and in vivo. CS5931 inhibited the proliferation, migration and formation of capillary-like structures of HUVECs (Human Umbilical Vein Endothelial Cell in a dose-dependent manner. Additionally, CS5931 repressed spontaneous angiogenesis of the zebrafish vessels. Further studies showed that CS5931 also blocked vascular endothelial growth factor (VEGF production but without any effect on its mRNA expression. Moreover, CS5931 reduced the expression of matrix metalloproteinases (MMP-2 and MMP-9 both on protein and mRNA levels in HUVEC cells. We demonstrated that CS5931 possessed strong anti-angiogenic activity both in vitro and in vivo, possible via VEGF and MMPs. This study indicates that CS5931 has the potential to be developed as a novel therapeutic agent as an inhibitor of angiogenesis for the treatment of cancer.

  2. Primer aislamiento de Encephalitozoon intestinalis a partir de muestra de materia fecal de un paciente colombiano con sida

    Directory of Open Access Journals (Sweden)

    Ana Luz Galván

    2008-09-01

    Full Text Available Introducción. Los microsporidios son agentes de infecciones oportunistas en pacientes con sida y con trasplantes, principalmente. Enterocytozoon bieneusi y Encephalitozoon intestinalis son los más frecuentes, asociados con infecciones entéricas. Los cultivos celulares han contribuido al conocimiento de los microsporidios. En Colombia no se han obtenido aislamientos provenientes de pacientes con microsporidiosis y, por consiguiente, no existen cepas autóctonas de los mismos. Objetivo. Establecer el cultivo celular de microsporidios intestinales a partir de materia fecal de pacientes parasitados. Materiales y métodos. Se realizó concentración agua-éter de la materia fecal positiva para microsporidios y el sedimento resultante se trató con una mezcla de antibióticos y antimicóticos durante 18 horas a 37 oC. Se inocularon células Vero previamente cultivadas en placas de 24 pozos y en medio RPMI con suplemento de suero bovino fetal al 10% y antibióticos, con las esporas concentradas. Los cultivos se mantuvieron a 37 oC al 5% de CO2. Se cambió de medio cada dos días y se evaluó la presencia de esporas en los sobrenadantes mediante Gram-cromótropo rápido en caliente. Resultados. En la segunda semana después de la infección, se encontraron esporas de microsporidios con morfología y coloración características. Mediante PCR se determinó que el microsporidio encontrado correspondía a la especie E. intestinalis. Conclusión. Se estableció el cultivo in vitro de microsporidios de materia fecal. Este protocolo es importante para la obtención y el mantenimiento de cepas autóctonas en Colombia, y contribuirá a las investigaciones de aspectos bioquímicos, inmunológicos y epidemiológicos de dichas cepas.

  3. High occurrence of Blastocystis sp. subtypes 1-3 and Giardia intestinalis assemblage B among patients in Zanzibar, Tanzania.

    Science.gov (United States)

    Forsell, Joakim; Granlund, Margareta; Samuelsson, Linn; Koskiniemi, Satu; Edebro, Helén; Evengård, Birgitta

    2016-06-29

    Blastocystis is a common intestinal parasite with worldwide distribution but the distribution of Blastocystis and its subtypes in East Africa is largely unknown. In this study, we investigate the distribution of Blastocystis subtypes in Zanzibar, Tanzania and report the prevalence of intestinal parasites using both molecular methods and microscopy. Stool samples were collected from both diarrhoeic and non-diarrhoeic outpatients in Zanzibar. In addition to microscopy, real-time PCR for Blastocystis, Entamoeba histolytica and E. dispar, Giardia intestinalis, Cryptosporidium spp., and Dientamoeba fragilis was used. Blastocystis subtypes were determined by a conventional PCR followed by partial sequencing of the SSU-rRNA gene. Genetic assemblages of Giardia were determined by PCR with assemblage specific primers. Intestinal parasites were detected in 85 % of the 174 participants, with two or more parasites present in 56 %. Blastocystis sp. and Giardia intestinalis were the most common parasites, identified by PCR in 61 and 53 % of the stool samples respectively, but no correlation between carriage of Blastocystis and Giardia was found. The Blastocystis subtype distribution was ST1 34.0 %, ST2 26.4 %, ST3 25.5 %, ST7 0.9 %, and 13.2 % were positive only by qPCR (non-typable). The Giardia genetic assemblages identified were A 6.5 %, B 85 %, A + B 4.3 %, and non-typable 4.3 %. The detection rate with microscopy was substantially lower than with PCR, 20 % for Blastocystis and 13.8 % for Giardia. The prevalence of Blastocystis increased significantly with age while Giardia was most prevalent in children two to five years old. No correlation between diarrhoea and the identification of Giardia, Blastocystis, or their respective genetic subtypes could be shown and, as a possible indication of parasite load, the mean cycle threshold values in the qPCR for Giardia were equal in diarrhoeic and non-diarrhoeic patients. Carriage of intestinal parasites was very

  4. ESTIMACIÓN DE LA FRECUENCIA DE INFECCIÓN POR GIARDIA INTESTINALIS EN COMUNIDADES INDÍGENAS Y AFROS DE COLOMBIA: ESTUDIO DE CORTE TRASVERSAL

    Directory of Open Access Journals (Sweden)

    María Carolina Merchán Garzón

    2016-04-01

    Full Text Available

    Introducción: Las infecciones parasitarias intestinales son un importante problema de salud púbica. Las parasitosis como la giardiasis, son de particular relevancia para el estudio de la salud en comunidades aisladas en Colombia.

    Objetivo: describir la frecuencia de infección por G. intestinalis en 21 comunidades aisladas colombianas (18 comunidades indígenas y 3 comunidades negras.

    Materiales y Métodos: análisis microscópico en campo de muestras de materia fecal de 671 muestras de voluntarios de 21 comunidades aisladas colombianas. Cálculo de prevalencia por comunidad y descripción de las condiciones nutricionales y de manejo de agua y excretas en las comunidades.

    Resultados: la prevalencia global de infección por G. intestinalis en las comunidades aisladas estudiadas fue del 11% en comunidades indígenas y del 9% en comunidades negras. Las prevalencias por comunidad varían entre 0% hasta el 63%. El 100% de los individuos evaluados presentó algún tipo de parasitismo intestinal.

    Discusión: el parasitismo intestinal por G. intestinalis tiene prevalencias similares a otros grupos indígenas de Sur América. La causa del parasitismo intestinal debe ser considerada según comunidad y de acuerdo a factores de riesgo conocidos, como manejo de excretas y acceso a agua potable.

    GIARDIA INTESTINALIS INFECTION FREQUENCY ESTIMATE AMONG ABORIGINAL AND BLACK COMMUNITIES IN COLOMBIA: A CROSS-SECTIONAL STUDY

    ABSTRACT

    Introduction: Intestinal parasitic infections are a major problem of public health. Parasitic diseases such as giardiasis, are relevant for the study of health in isolated communities in Colombia.

    Objective: To describe the frequency of G. intestinalis infection in 21 isolated communities in Colombia (18 indigenous communities and 3

  5. Pneumatosis Intestinalis as the Initial Presentation of Systemic Sclerosis: A Case Report and Review of the Literature

    Directory of Open Access Journals (Sweden)

    Farshid Ejtehadi

    2012-01-01

    Full Text Available Introduction. Pneumatosis intestinalis (PI is an uncommon pathology characterised by the presence of gas within the intestinal wall. It has been associated with various conditions, including connective tissue diseases. This is the first report of PI being the initial presentation of systemic sclerosis. Case Presentation. The patient, a 75-year-old female, presented with an 8-month history of worsening dysphagia and epigastric pain, as well as other nonspecific symptoms. Initial investigations with an oesophagogastroduodenoscopy diagnosed Candida oesophagitis and also identified an extrinsic compression of the gastric antrum. Subsequently a CT scan of the abdomen and pelvis showed moderately dilated small bowel loops and PI. Due to the patient’s stability, non-critical clinical condition, conservative management was instituted. More detailed investigations confirmed the diagnosis of systemic sclerosis with positive anticentromeric and antinuclear antibodies. The patient improved on methotrexate and was discharged with appropriate outpatient follow-up. Discussion. PI is a rare but well-documented pathology associated with connective tissue diseases, such as systemic sclerosis. In most cases, conservative management is preferable to surgical intervention, depending on the patient’s clinical presentation and progress. This is the first report of PI being the initial presentation of a patient with systemic sclerosis responsive to conservative management.

  6. Dynamics and effects of Ligula intestinalis (L.) infection in the native fish Barbus callensis Valenciennes, 1842 in Algeria.

    Science.gov (United States)

    Rouis, Sonia Ould; Rouis, Abdelhalim Ould; Dumont, Henri J; Magellan, Kit; Arab, Abdeslem

    2016-03-01

    The dynamics of the emergence, duration, and decline phases in epizootic cycles are well known for humans and some crops, but they are poorly understood for host-parasite systems in the wild. Parasites may be particularly insidious as they are often introduced unintentionally, simultaneously with their hosts, and later transferred to species in the new location. Here we investigate the epizootic dynamics of the tapeworm Ligula intestinalis in the Hamiz reservoir, Algeria, and explore its effects on the cyprinid fish Barbus callensis. Regular sampling was conducted from October 2005 to February 2008 with intermittent surveys carried out until 2010. Five percent of the 566 specimens of B. callensis that were caught were infected, with the maximum number of parasites found in spring. There was no obvious difference in weight between uninfected fish and infected ones, and infection did not affect fish condition. However, infected fish were significantly longer than uninfected fish and had inhibited gonad development. The proportion of infected fish caught was significantly higher in year 1 and by the second winter, infection collapsed to zero. The Ligula infection thus appeared to have minimal ecological effects and be of a temporary nature, thus exhibiting an epizootic cycle. Taken together, our data indicates that this infection declined or even failed during our study period. Failure may be due to the specific genetic strain of Ligula, but invasive carp may also have been influential in both the introduction and subsequent decline of this parasite.

  7. Pneumatosis cystoides intestinalis following alpha-glucosidase inhibitor treatment: A case report and review of the literature

    Institute of Scientific and Technical Information of China (English)

    Tatsuhiro Tsujimoto; Hiroshi Fukui; Erika Shioyama; Kei Moriya; Hideto Kawaratani; Yasuyo Shirai; Masahisa Toyohara; Akira Mitoro; Jun-ichi Yarnao; Hisao Fujii

    2008-01-01

    A 69-year-old man was diagnosed as having myasthenia gravis (MG) in September 2004, and treated with thymectomy and prednisolone. He was then diagnosed as having steroid-induced diabetes mellitus, and received sulfonylurea (SU) therapy in May 2005. An alpha-glucosidase inhibitor (αGI) was added in March 2006, resulting in good glycemic control. He experienced symptoms of abdominal distention, increased flatus, and constipation in October 2007, and was admitted into our hospital in late November with hematochezia. Plain abdominal radiography revealed small linear radiolucent clusters in the wall of the colon. Computed tomography (CT) showed intramural air in the sigmoid colon. Colonoscopy revealed multiple smooth surfaced hemispherical protrusions in the sigmoid colon. The diagnosis of pneumatosis cystoides intestinalis (PCI) was made on the basis of these findings. As the αGI voglibose was suspected as the cause of this patient's PCI, treatment was conservative, ceasing voglibose, with fasting and fluid supplementation. The patient progressed well, and was discharged 2 wk later. Recently, several reports of PCI associated with αGI therapy have been published, predominantly in Japan where αGIs are commonly used. If the use of αGIs becomes more widespread, we can expect more reports of this condition on a global scale. The possibility of PCI should be considered in diabetic patients complaining of gastrointestinal symptoms, and the gastrointestinal tract should be thoroughly investigated in these patients.

  8. Structural organization of very small chromosomes: study on a single-celled evolutionary distant eukaryote Giardia intestinalis.

    Science.gov (United States)

    Tůmová, Pavla; Uzlíková, Magdalena; Wanner, Gerhard; Nohýnková, Eva

    2015-03-01

    During mitotic prophase, chromosomes of the pathogenic unicellular eukaryote Giardia intestinalis condense in each of the cell's two nuclei. In this study, Giardia chromosomes were investigated using light microscopy, high-resolution field emission scanning electron microscopy, and in situ hybridization. For the first time, we describe the overall morphology, condensation stages, and mitotic segregation of these chromosomes. Despite the absence of several genes involved in the cohesion and condensation pathways in the Giardia genome, we observed chromatin organization similar to those found in eukaryotes, i.e., 10-nm nucleosomal fibrils, 30-nm fibrils coiled to chromomeres or in parallel arrangements, and closely aligned sister chromatids. DNA molecules of Giardia terminate with telomeric repeats that we visualized on each of the four chromatid endings of metaphase chromosomes. Giardia chromosomes lack primary and secondary constrictions, thus preventing their classification based on the position of the centromere. The anaphase poleward segregation of sister chromatids is atypical in orientation and tends to generate lagging chromatids between daughter nuclei. In the Giardia genome database, we identified two putative members of the kleisin family thought to be responsible for condensin ring establishment. Thus far, Giardia chromosomes (300 nm to 1.5 μm) are the smallest chromosomes that were analyzed at the ultrastructural level. This study complements the existing molecular and sequencing data on Giardia chromosomes with cytological and ultrastructural information.

  9. IFN-gamma, IL-5, IL-6 and IgE in patients infected with Giardia intestinalis.

    Directory of Open Access Journals (Sweden)

    Violetta Dymicka-Piekarska

    2009-05-01

    Full Text Available The immune system, its cellular and humoral response, is engaged by the host organism to fight against parasitic infections. The study group consisted of 90 patients (58 women and 32 men, aged 18-72 years, infected with G. intestinalis. The diagnosis was established based on laboratory investigations (stool examination, choloscopy, GSA-65. Blood for analysis was collected before (G1, and 2 weeks (G2 and 2 months (G3 after antiparasitic treatment. Control group consisted of 40 healthy subjects (22 women and 18 men, aged 20-45 years. The concentrations of IgE were assayed using a set of VIDAS (bioMerieux and the concentrations of IL-5, IL-6, IFN-gamma were determined using a set of Quantikine human (R&D Systems. It was revealed that in giardiosis the concentrations of IgE and IL-5 in blood serum were twice as high, the concentration of IL-6 was two and a half times higher and the concentration of IFN-gamma was almost four times higher as compared to healthy controls.

  10. Comparative analysis of enzyme-linked immunosorbent assay and direct microscopy for the diagnosis of Giardia intestinalis in fecal samples

    Directory of Open Access Journals (Sweden)

    Shipra Singhal

    2015-01-01

    Full Text Available Context: Giardiasis is one of the most common nonviral infections causing diarrheal illness worldwide. In this prospective cross-sectional study, we evaluated the RIDASCREEN ® Giardia kit for detection of Giardia intestinalis in stool samples and compared the results with direct microscopy. Materials and methods: A total of 360 fecal samples were collected. They were then processed by wet film, iodine preparation and an enzyme-linked immunosorbent assay (ELISA kit to determine the presence of Giardia trophozoites and cysts. Statistical analysis was performed by sensitivity, specificity, positive predictive value, negative predictive value and diagnostic accuracy. Results and Conclusion: Of the 360 cases, 17.2% samples were positive for Giardia by direct microscopy and 23.6% were found to be positive by ELISA (sensitivity ~97%, but specificity was ~92% only. Because of less specificity, we need to perform ELISA in congruence with direct microscopy, etc. Further studies need to be performed on a larger sample size using other molecular tests in order to get more accurate estimations.

  11. Transcription elongation

    Science.gov (United States)

    Imashimizu, Masahiko; Shimamoto, Nobuo; Oshima, Taku; Kashlev, Mikhail

    2014-01-01

    Regulation of transcription elongation via pausing of RNA polymerase has multiple physiological roles. The pausing mechanism depends on the sequence heterogeneity of the DNA being transcribed, as well as on certain interactions of polymerase with specific DNA sequences. In order to describe the mechanism of regulation, we introduce the concept of heterogeneity into the previously proposed alternative models of elongation, power stroke and Brownian ratchet. We also discuss molecular origins and physiological significances of the heterogeneity. PMID:25764114

  12. Reference gene selection for quantitative gene expression studies during biological invasions: A test on multiple genes and tissues in a model ascidian Ciona savignyi.

    Science.gov (United States)

    Huang, Xuena; Gao, Yangchun; Jiang, Bei; Zhou, Zunchun; Zhan, Aibin

    2016-01-15

    As invasive species have successfully colonized a wide range of dramatically different local environments, they offer a good opportunity to study interactions between species and rapidly changing environments. Gene expression represents one of the primary and crucial mechanisms for rapid adaptation to local environments. Here, we aim to select reference genes for quantitative gene expression analysis based on quantitative Real-Time PCR (qRT-PCR) for a model invasive ascidian, Ciona savignyi. We analyzed the stability of ten candidate reference genes in three tissues (siphon, pharynx and intestine) under two key environmental stresses (temperature and salinity) in the marine realm based on three programs (geNorm, NormFinder and delta Ct method). Our results demonstrated only minor difference for stability rankings among the three methods. The use of different single reference gene might influence the data interpretation, while multiple reference genes could minimize possible errors. Therefore, reference gene combinations were recommended for different tissues - the optimal reference gene combination for siphon was RPS15 and RPL17 under temperature stress, and RPL17, UBQ and TubA under salinity treatment; for pharynx, TubB, TubA and RPL17 were the most stable genes under temperature stress, while TubB, TubA and UBQ were the best under salinity stress; for intestine, UBQ, RPS15 and RPL17 were the most reliable reference genes under both treatments. Our results suggest that the necessity of selection and test of reference genes for different tissues under varying environmental stresses. The results obtained here are expected to reveal mechanisms of gene expression-mediated invasion success using C. savignyi as a model species.

  13. Antimicrobial and antioxidant activities of Cystoseira crinita Duby and Ulva intestinalis Linnaeus from the coastal region of Sinop, Turkey

    Institute of Scientific and Technical Information of China (English)

    İsmet Berber; Cumhur Avşar; Hilal Koyuncu

    2015-01-01

    Objective:To evaluate in vitro antimicrobial, antioxidant activities and total phenol contents of Cystoseira crinita and Ulva intestinalis species collected from the coastal region of Sinop. Methods:The antimicrobial activity of each methanolic algae sample was screened by using disc diffusion method against to 15 bacteria and 3 yeasts. The antioxidant potential of the extracts on the stable radical 1,1-diphenyl-2-picrylhydrazyl was determined. The total phenolic content of the 3 methanolic extracts of the seaweed samples were determined by the Folin-Ciocalteu method. Results:The results of antimicrobial assay showed that extracts were more effective against Gram-positive bacteria rather than Gram-negative. In addition, while the algal extracts had antifungal efficacy against Candida krusei, the other yeast strains were not affected at all. According to the findings of antioxidant activity, all methanolic extracts displayed good free radical scavenging activity ranging from IC50=(32.19 ± 0.08) mg/mL to the IC50=(37.57 ± 0.11) mg/mL. The total phenols content of the macroalgal extracts were found as between (5.10 ± 0.16) mg gallic acid equivalent/g and (87.70 ± 1.03) mg gallic acid equivalent/g. In this sense, our findings confirmed that there was a positive linear correlations (r=0.86) between total phenol contents and the IC50 values. Conclusions:The data gathered from this study suggested that the seaweeds can be used as a potential natural seafood sources owing to the antimicrobial efficiency and good antioxidant activity.

  14. Biochemical and Structural Analyses of Two Cryptic Esterases in Bacteroides intestinalis and their Synergistic Activities with Cognate Xylanases.

    Science.gov (United States)

    Wefers, Daniel; Cavalcante, Janaina J V; Schendel, Rachel R; Deveryshetty, Jaigeeth; Wang, Kui; Wawrzak, Zdzislaw; Mackie, Roderick I; Koropatkin, Nicole M; Cann, Isaac

    2017-08-04

    Arabinoxylans are constituents of the human diet. Although not utilizable by the human host, they can be fermented by colonic bacteria. The arabinoxylan backbone is decorated with arabinose side chains that may be substituted with ferulic acid, thus limiting depolymerization to fermentable sugars. We investigated the polypeptides encoded by two genes upregulated during growth of the colonic bacterium Bacteroides intestinalis on wheat arabinoxylan. The recombinant proteins, designated BiFae1A and BiFae1B, were functionally assigned esterase activities. Both enzymes were active on acetylated substrates, although each showed a higher ferulic acid esterase activity on methyl-ferulate. BiFae1A showed a catalytic efficiency of 12mM s(-1) on para-nitrophenyl-acetate, and on methyl-ferulate, the value was 27 times higher. BiFae1B showed low catalytic efficiencies for both substrates. Furthermore, the two enzymes released ferulic acid from various structural elements, and NMR spectroscopy indicated complete de-esterification of arabinoxylan oligosaccharides from wheat bran. BiFae1A is a tetramer based on the crystal structure, whereas BiFae1B is a dimer in solution based on size exclusion chromatography. The structure of BiFae1A was solved to 1.98Å resolution, and two tetramers were observed in the asymmetric unit. A flexible loop that may act as a hinge over the active site and likely coordinates critical interactions with the substrate was prominent in BiFae1A. Sequence alignments of the esterase domains in BiFae1B with the feruloyl esterase from Clostridium thermocellum suggest that both domains lack the flexible hinge in BiFae1A, an observation that may partly provide a molecular basis for the differences in activities in the two esterases. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. First detection and genotyping of Giardia intestinalis in stool samples collected from children in Ghazni Province, eastern Afghanistan and evaluation of the PCR assay in formalin-fixed specimens.

    Science.gov (United States)

    Lass, Anna; Karanis, Panagiotis; Korzeniewski, Krzysztof

    2017-08-01

    It is estimated that faecal-orally transmitted diseases are common in Afghanistan, as a consequence of poor hygienic standards of life and widespread contamination of water and food with both human and animal faeces. However, there is little information in the literature concerning infections caused by intestinal parasites in the Afghan population. In this study, we report the occurrence of Giardia intestinalis assemblages (A and B) in formalin-fixed stool samples collected from 245 Afghan schoolchildren living in Ghazni Province in eastern Afghanistan. Detection of the parasite's DNA and genotyping was performed using real-time PCR, specific to the β-giardin gene of G. intestinalis. Positive results were recorded in 52 (21.2%) samples. Genotyping was successful in 39 faecal samples and showed the predominance of assemblage B of G. intestinalis in this population (15 assemblage A and 24 assemblage B). Co-infection with both genotypes A and B was detected in four samples. Additionally, we evaluated the effect of 10% buffered formalin fixative on the detection of G. intestinalis DNA using real-time PCR and nested PCR characterised by different lengths of PCR products (74 and 479 bp, respectively). The human faeces containing the Giardia cysts were tested for 16 weeks. Amplification of G. intestinalis DNA with real-time PCR was possible up to 6 weeks of preservation of stool sample in formalin, compared to only 2 weeks with nested PCR. This suggests that real-time PCR is a more suitable tool in cases where stool samples have to be kept in formalin for longer periods of time.

  16. Giardia intestinalis and nutritional status in children participating in the complementary nutrition program, Antioquia, Colombia, May to October 2006 Giardia intestinalis e estado nutricional em crianças participantes do programa de nutrição complementar, melhoramento alimentar e nutricional da Antioquia (MANA - Instituto Colombiano de Bem-Estar Familiar (ICBF, Antióquia, Colombia, maio a outubro de 2006

    Directory of Open Access Journals (Sweden)

    Jorge H. Botero-Garcés

    2009-06-01

    Full Text Available Giardia intestinalis infection is prevalent throughout the world and widely distributed in developing countries. In general, children display serious consequences to their state of health, including slow height-weight development; therefore, the main aim of this study was to determine the association between Giardia infection and the nutritional status of children who participate in the program of complementary feeding (Mejoramiento Alimentario y Nutricional de Antioquia (MANA - Instituto Colombiano de Bienestar Familiar (ICBF. A cross-sectional study examining the association of giardiasis with nutritional status was conducted. A total of 2035 children aged eight months to six years-old were studied. Data were collected using structured questionnaires, anthropometric measurements and laboratory analysis of blood and stool samples. Analysis of the results showed that 27.6% of children were infected with G. intestinalis, while 8.1% and 1.9% were mildly and significantly underweight, respectively, and 14.1% presented stunting. Giardiasis was statistically identified as a strong predictor of stunting in this study population.A infecção pela Giardia intestinalis está amplamente distribuída no mundo apresentando a maior prevalência nos países em desenvolvimento. Em crianças, esta parasitose pode ter conseqüências graves no estado geral de saúde assim como no ganho de peso e estatura. O objetivo desta pesquisa foi estabelecer a associação entre a infecção com Giardia e o estado nutricional das crianças beneficiárias do programa de complementação alimentar - MANA. Um estudo de corte no qual foram avaliadas 2035 crianças entre os oito meses e os seis anos de idade foi realizado. A informação foi obtida a partir de questionários estruturados, medições antropométricas e exame de fezes. Os resultados mostraram que 27,6% das crianças estavam infectadas com Giardia intestinalis, das quais 8,1% apresentaram desnutrição moderada

  17. The life cycle of Neocladocystis intestinalis (Vaz, 1932) (Digenea: Cryptogonimidae), in Aylacostoma chloroticum (Prosobranchia: Thiaridae), and Salminus brasiliensis (Characiformes: Characidae), in Argentina.

    Science.gov (United States)

    Quintana, Manuel G; Ostrowski de Núñez, Margarita

    2016-07-01

    The life cycle of Neocladocystis intestinalis (Vaz, 1932) was resolved experimentally. The prosobranchiate snail Aylacostoma chloroticum Hylton Scott (Thiaridae) collected in the Yacyretá Dam, Province of Misiones, Argentina, was found naturally infected with cercariae that possessed pigmented eye spots, 7 pairs of penetration glands, 12 pairs of flame cells, and a V-shaped, or Y-shaped excretory vesicle with very short stem. The cercariae developed in oval cysts, which were found on fin rays, and under scales of naturally and experimentally exposed tetragonopterid fish species and of experimentally exposed poecilid and prochilodont fish species. Adults were obtained experimentally from juvenile Salminus brasiliensis (Characidae), bred in captivity, and infected with metacercariae from albino Gymnocorymbus ternetzi (Tetragonopteridae), which had been exposed to emerging cercariae.

  18. Lúpus eritematoso sistêmico complicado por vasculite intestinal e pneumatose intestinal Systemic lupus erythematosus complicated by intestinal vasculitis and pneumatosis intestinalis

    Directory of Open Access Journals (Sweden)

    Débora Karine Marinello

    2010-10-01

    Full Text Available As manifestações gastrointestinais no lúpus eritematoso sistêmico (LES não são incomuns. Frequentemente são encontrados sintomas inespecíficos, como dor abdominal, náuseas, vômitos e diarreia. Por outro lado, a pneumatose intestinal, caracterizada por múltiplos cistos preenchidos por ar na parede intestinal, é uma condição raramente associada ao LES. Descreve-se a seguir o caso de um homem de 20 anos que foi internado por febre, perda ponderal, cefaleia e artrite, cuja investigação mostrou tratar-se de LES. Na evolução, apresentou quadro abdominal sugestivo de vasculite intestinal, com tomografia computadorizada de abdome revelando sinal do duplo halo ou do alvo e pneumatose intestinal. Realizado tratamento conservador com antibioticoterapia endovenosa, repouso intestinal e nutrição parenteral total, com resolução do quadro abdominal.Gastrointestinal manifestations in systemic lupus erythematosus (SLE are not uncommon. Non specific symptoms are often observed, such as abdominal pain, nausea, vomiting and diarrhea. On the other hand, pneumatosis cystoides intestinalis, which is characterized by multiple gas-filled cysts located throughout the intestinal wall, is a rare condition in SLE. We describe a case of a 20-year-old man who was admitted with fever, weight loss, headache and arthralgia and had a diagnosis of systemic lupus erythematosus. During his hospital stay, he developed abdominal symptoms that suggested intestinal vasculitis. The computed tomography of the abdomen showed the double halo sign, or target sign and pneumatosis cystoides intestinalis. The patient presented complete recovery after conservative treatment, with intestinal rest and total parenteral nutrition.

  19. Boosting transcription by transcription: enhancer-associated transcripts.

    Science.gov (United States)

    Darrow, Emily M; Chadwick, Brian P

    2013-12-01

    Enhancers are traditionally viewed as DNA sequences located some distance from a promoter that act in cis and in an orientation-independent fashion to increase utilization of specific promoters and thereby regulate gene expression. Much progress has been made over the last decade toward understanding how these distant elements interact with target promoters, but how transcription is enhanced remains an object of active inquiry. Recent reports convey the prevalence and diversity of enhancer transcription and transcripts and support both as key factors with mechanistically distinct, but not mutually exclusive roles in enhancer function. Decoupling the causes and effects of transcription on the local chromatin landscape and understanding the role of enhancer transcripts in the context of long-range interactions are challenges that require additional attention. In this review, we focus on the possible functions of enhancer transcription by highlighting several recent enhancer RNA papers and, within the context of other enhancer studies, speculate on the role of enhancer transcription in regulating differential gene expression.

  20. 儿童真菌性肠炎患者血清IL-27增高及其意义%Clinical significance of increased serum IL-27 in children with mycosis intestinalis

    Institute of Scientific and Technical Information of China (English)

    程娟娟; 潘敏; 韩志君; 葛小丽

    2012-01-01

    Objective To evaluate the diagnostic value of serum IL-27 on children with mycosis intestinalis. Methods The serum level of IL-27 and PCT of 89 children with mycosis intestinalis, 61 viralgastroenteritis and 41 healthy volunteers were detected by ELJSA. The association between IL-27 and white blood cell count and PCT was analysed. The diagnostic value of IL-27 on children with mycosis intestinalis was evaluated by receiver operating characteristics (ROC) curve analysis. Results The level of serum IL-27 was significantly increased in children with mycosis intestinalis than that of viral intestinalis group and healthy control group ( P <0.01). The level of serum IL-27 positive correlated with PCT, was observed in children with mycosis intestinalis. Area under cure (AUC) confirmed by ROC analysis was 0.82 (95% Confidence interval (CI): 0.63-0. 89) for IL-27. At the best cut-off value of 0. 82 pg/ml, the diagnostic sensitivity and specificity of IL-27 are 0.75 and 0.79 respectively. Conclusions Serum IL-27 has high diagnostic performance for children with mycosis intestinalis, which should be an early biomarker for children with mycosis intestinalis.%目的 评价血清IL-27对儿童真菌性肠炎的诊断价值.方法 收集89例儿童真菌性肠炎,61例儿童病毒性肠炎和41例健康对照者的临床资料及血清.酶联免疫吸附试验(ELISA)检测血清中IL-27和降钙素原(Procalcitionin,PCT)的水平,全自动血球分析仪检测各项白细胞参数,分析IL-27与白细胞计数和PCT的相关性,采用受试者工作曲线(ROC)法评价血清IL-27对儿童真菌性肠炎患者的诊断价值.结果 儿童真菌性肠炎患者血清IL-27水平较儿童病毒性肠炎组和健康对照组显著增高(P<0.01),儿童真菌性肠炎患者IL-27的水平与白细胞计数无显著相关性(R=-0.198,P>0.05),与PCT水平呈显著正相关(R=0.419,P<0.01).IL-27诊断儿童真菌性肠炎的ROC曲线下面积为0.82(95%可信区间:0.63~0.89,P<0

  1. CardioTF, a database of deconstructing transcriptional circuits in the heart system

    Directory of Open Access Journals (Sweden)

    Yisong Zhen

    2016-08-01

    Full Text Available Background: Information on cardiovascular gene transcription is fragmented and far behind the present requirements of the systems biology field. To create a comprehensive source of data for cardiovascular gene regulation and to facilitate a deeper understanding of genomic data, the CardioTF database was constructed. The purpose of this database is to collate information on cardiovascular transcription factors (TFs, position weight matrices (PWMs, and enhancer sequences discovered using the ChIP-seq method. Methods: The Naïve-Bayes algorithm was used to classify literature and identify all PubMed abstracts on cardiovascular development. The natural language learning tool GNAT was then used to identify corresponding gene names embedded within these abstracts. Local Perl scripts were used to integrate and dump data from public databases into the MariaDB management system (MySQL. In-house R scripts were written to analyze and visualize the results. Results: Known cardiovascular TFs from humans and human homologs from fly, Ciona, zebrafish, frog, chicken, and mouse were identified and deposited in the database. PWMs from Jaspar, hPDI, and UniPROBE databases were deposited in the database and can be retrieved using their corresponding TF names. Gene enhancer regions from various sources of ChIP-seq data were deposited into the database and were able to be visualized by graphical output. Besides biocuration, mouse homologs of the 81 core cardiac TFs were selected using a Naïve-Bayes approach and then by intersecting four independent data sources: RNA profiling, expert annotation, PubMed abstracts and phenotype. Discussion: The CardioTF database can be used as a portal to construct transcriptional network of cardiac development. Availability and Implementation: Database URL: http://www.cardiosignal.org/database/cardiotf.html.

  2. Prevalence of microsporidiosis due to Enterocytozoon bieneusi and Encephalitozoon (Septata) intestinalis among patients with AIDS-related diarrhea: determination by polymerase chain reaction to the microsporidian small-subunit rRNA gene.

    Science.gov (United States)

    Coyle, C M; Wittner, M; Kotler, D P; Noyer, C; Orenstein, J M; Tanowitz, H B; Weiss, L M

    1996-11-01

    Microsporidia are emerging as opportunistic pathogens in patients with AIDS. Enterocytozoon bieneusi and Encephalitozoon (Septata) intestinalis have been implicated in enteric infections in AIDS patients with chronic diarrhea, a wasting syndrome, and malabsorption. We used the polymerase chain reaction (PCR) and primers that amplify the conserved regions of the small-subunit rRNA (SSU-rRNA) gene of E. bieneusi and E. intestinalis in tissue specimens from HIV-infected patients with and without diarrhea to examine the association between microsporidia and diarrhea in patients with AIDS. Tissue specimens were obtained from 68 patients with AIDS and diarrhea (mean CD4 lymphocyte count, 21/mm3) and 43 AIDS patients without diarrhea (mean CD4 lymphocyte count, 60/mm3). By means of PCR with use of the SSU-rRNA primers specific for E. bieneusi and E. intestinalis, we found that 44% of patients with diarrhea were infected with microsporidia, whereas only 2.3% of the patients without diarrhea were infected with microsporidia (P < .001). There was a clear association between the presence of microsporidia and diarrhea. In addition, the SSU-rRNA primers proved to be sensitive and specific when used in this clinical setting.

  3. Transcription in archaea

    Science.gov (United States)

    Kyrpides, N. C.; Ouzounis, C. A.; Woese, C. R. (Principal Investigator)

    1999-01-01

    Using the sequences of all the known transcription-associated proteins from Bacteria and Eucarya (a total of 4,147), we have identified their homologous counterparts in the four complete archaeal genomes. Through extensive sequence comparisons, we establish the presence of 280 predicted transcription factors or transcription-associated proteins in the four archaeal genomes, of which 168 have homologs only in Bacteria, 51 have homologs only in Eucarya, and the remaining 61 have homologs in both phylogenetic domains. Although bacterial and eukaryotic transcription have very few factors in common, each exclusively shares a significantly greater number with the Archaea, especially the Bacteria. This last fact contrasts with the obvious close relationship between the archaeal and eukaryotic transcription mechanisms per se, and in particular, basic transcription initiation. We interpret these results to mean that the archaeal transcription system has retained more ancestral characteristics than have the transcription mechanisms in either of the other two domains.

  4. Serum levels of zinc, copper, iron, cobalt, magnesium, and selenium elements in children diagnosed with Giardia intestinalis and Enterobiosis vermicularis in Hatay, Turkey.

    Science.gov (United States)

    Culha, Gülnaz; Sangün, Mustafa Kemal

    2007-07-01

    The intestinal parasites are noted to be an important health problem in Turkey as similarly reported in the globe. The aim of this study was to investigate the changes in total content of essential elements, namely, zinc, iron, copper, cobalt, magnesium, and selenium, in children infected with intestinal parasites aged between 6 and 12 years inhabiting in Hatay Province, Turkey. These essential elements were measured in the children/patient who was positive for intestinal parasites, Giardia intestinalis and Enterobius vermicularis. Scores were obtained from the positive study group (SG), and their age matched the healthy children control group (CG). Serological levels of zinc, iron, copper, cobalt, magnesium, and selenium were analyzed by Varian Liberty Series II inductively coupled plasma atomic emission spectrometer (ICP-AES). The mean magnesium concentrations were found to be statistically different at 95% confidence interval level between study groups. As a result of this study, selenium was found to be uncorrelated with all other elements examined; whereas, copper was observed to have statistically significant correlations with cobalt, magnesium, and zinc. In addition, cobalt-magnesium, cobalt-zinc, and magnesium-zinc metal pairs were found to have statistically significant correlations based on study findings.

  5. Mapping Yeast Transcriptional Networks

    OpenAIRE

    Hughes, Timothy R; de Boer, Carl G.

    2013-01-01

    The term “transcriptional network” refers to the mechanism(s) that underlies coordinated expression of genes, typically involving transcription factors (TFs) binding to the promoters of multiple genes, and individual genes controlled by multiple TFs. A multitude of studies in the last two decades have aimed to map and characterize transcriptional networks in the yeast Saccharomyces cerevisiae. We review the methodologies and accomplishments of these studies, as well as challenges we now face....

  6. A Nonnatural Transcriptional Coactivator

    Science.gov (United States)

    Nyanguile, Origene; Uesugi, Motonari; Austin, David J.; Verdine, Gregory L.

    1997-12-01

    In eukaryotes, sequence-specific DNA-binding proteins activate gene expression by recruiting the transcriptional apparatus and chromatin remodeling proteins to the promoter through protein-protein contacts. In many instances, the connection between DNA-binding proteins and the transcriptional apparatus is established through the intermediacy of adapter proteins known as coactivators. Here we describe synthetic molecules with low molecular weight that act as transcriptional coactivators. We demonstrate that a completely nonnatural activation domain in one such molecule is capable of stimulating transcription in vitro and in vivo. The present strategy provides a means of gaining external control over gene activation through intervention using small molecules.

  7. Massively Systematic Transcript End Readout (MASTER): Transcription Start Site Selection, Transcriptional Slippage, and Transcript Yields

    Science.gov (United States)

    Vvedenskaya, Irina O.; Zhang, Yuanchao; Goldman, Seth R.; Valenti, Anna; Visone, Valeria; Taylor, Deanne M.; Ebright, Richard H.; Nickels, Bryce E.

    2015-01-01

    SUMMARY We report the development of a next-generation sequencing-based technology that entails construction of a DNA library comprising up to at least 47 (~16,000) bar-coded sequences, production of RNA transcripts, and analysis of transcript ends and transcript yields ("massively systematic transcript end readout," MASTER). Using MASTER, we define full inventories of transcription start sites ("TSSomes") of Escherichia coli RNA polymerase for initiation at a consensus core promoter in vitro and in vivo, we define the TSS-region DNA-sequence determinants for TSS selection, reiterative initiation ("slippage synthesis"), and transcript yield, and we define effects of DNA topology and NTP concentration. The results reveal that slippage synthesis occurs from the majority of TSS-region DNA sequences and that TSS-region DNA sequences have profound, up to 100-fold, effects on transcript yield. The results further reveal that TSSomes depend on DNA topology, consistent with the proposal that TSS selection involves transcription-bubble expansion ("scrunching") and transcription-bubble contraction ("anti-scrunching"). PMID:26626484

  8. Massively Systematic Transcript End Readout, "MASTER": Transcription Start Site Selection, Transcriptional Slippage, and Transcript Yields.

    Science.gov (United States)

    Vvedenskaya, Irina O; Zhang, Yuanchao; Goldman, Seth R; Valenti, Anna; Visone, Valeria; Taylor, Deanne M; Ebright, Richard H; Nickels, Bryce E

    2015-12-17

    We report the development of a next-generation sequencing-based technology that entails construction of a DNA library comprising up to at least 4(7) (∼ 16,000) barcoded sequences, production of RNA transcripts, and analysis of transcript ends and transcript yields (massively systematic transcript end readout, "MASTER"). Using MASTER, we define full inventories of transcription start sites ("TSSomes") of Escherichia coli RNA polymerase for initiation at a consensus core promoter in vitro and in vivo; we define the TSS-region DNA sequence determinants for TSS selection, reiterative initiation ("slippage synthesis"), and transcript yield; and we define effects of DNA topology and NTP concentration. The results reveal that slippage synthesis occurs from the majority of TSS-region DNA sequences and that TSS-region DNA sequences have profound, up to 100-fold, effects on transcript yield. The results further reveal that TSSomes depend on DNA topology, consistent with the proposal that TSS selection involves transcription-bubble expansion ("scrunching") and transcription-bubble contraction ("anti-scrunching").

  9. Early Chordate Origins of the Vertebrate Second Heart Field

    Science.gov (United States)

    Stolfi, Alberto; Gainous, T. Blair; Young, John J.; Mori, Alessandro; Levine, Michael; Christiaen, Lionel

    2016-01-01

    The vertebrate heart is formed from diverse embryonic territories, including the first and second heart fields. The second heart field (SHF) gives rise to the right ventricle and outflow tract, yet its evolutionary origins are unclear. We found that heart progenitor cells of the simple chordate Ciona intestinalis also generate precursors of the atrial siphon muscles (ASMs). These precursors express Islet and Tbx1/10, evocative of the splanchnic mesoderm that produces the lower jaw muscles and SHF of vertebrates. Evidence is presented that the transcription factor COE is a critical determinant of ASM fate. We propose that the last common ancestor of tunicates and vertebrates possessed multipotent cardiopharyngeal muscle precursors, and that their reallocation might have contributed to the emergence of the SHF. PMID:20671188

  10. The Transcription Factor Encyclopedia

    DEFF Research Database (Denmark)

    Yusuf, Dimas; Butland, Stefanie L; Swanson, Magdalena I

    2012-01-01

    ABSTRACT: Here we present the Transcription Factor Encyclopedia (TFe), a new web-based compendium of mini review articles on transcription factors (TFs) that is founded on the principles of open access and collaboration. Our consortium of over 100 researchers has collectively contributed over 130...

  11. The transcriptional landscape

    DEFF Research Database (Denmark)

    Nielsen, Henrik

    2011-01-01

    The application of new and less biased methods to study the transcriptional output from genomes, such as tiling arrays and deep sequencing, has revealed that most of the genome is transcribed and that there is substantial overlap of transcripts derived from the two strands of DNA. In protein codi...

  12. Mechanical Properties of Transcription

    Science.gov (United States)

    Sevier, Stuart A.; Levine, Herbert

    2017-06-01

    The mechanical properties of transcription have recently been shown to play a central role in gene expression. However, a full physical characterization of this central biological process is lacking. In this Letter, we introduce a simple description of the basic physical elements of transcription where RNA elongation, RNA polymerase rotation, and DNA supercoiling are coupled. The resulting framework describes the relative amount of RNA polymerase rotation and DNA supercoiling that occurs during RNA elongation. Asymptotic behavior is derived and can be used to experimentally extract unknown mechanical parameters of transcription. Mechanical limits to transcription are incorporated through the addition of a DNA supercoiling-dependent RNA polymerase velocity. This addition can lead to transcriptional stalling and resulting implications for gene expression, chromatin structure and genome organization are discussed.

  13. 肠艾美耳球虫河北株18S rDNA部分序列测定及系统发育分析%The Sequence and Phylogenetic Analysis of 18S rDNA of E.intestinalis

    Institute of Scientific and Technical Information of China (English)

    方素芳; 崔平; 顾小龙; 索勋

    2011-01-01

    Using single-oocyst seperation technology, E. intestinalis was isolated from rabbit in Hebei,then inoculated coccidia-free rabbits to propagate. Its genomic DNA was extracted by the method of CATB. Using conservative primer of 18S rDNA of Eimeria, 18S rDNA gene fragment of E. intestinalis HB was amplified and sequenced. Among E. intestinalis HB and 11 species of rabbit-infecting Eimeria in the GenBank, the phylogenetic tree was constructed based on their 18S rDNA sequences by DNAstar software. The amplification results indicated that the gene fragment was amplified with 1 521 bp. The analysis of the percent identity showed that E. intestinalis HB shared the homology of 92.6%-99.9% with 18S rDNA sequence of 11 species of rabbit infecting Eimeria. The homology between E. intestinalis HB and E. intestinalis (EF694012) is 99.9%. The tree of phylogenetic analysis show that E. intestinalis HB and E. intestinalis (EF694012) are the most close.%从河北某兔场单卵囊分离肠艾美耳球虫并接种无球虫兔进行增殖,CTAB法提取肠艾美耳球虫卵囊基因组DNA.利用艾美耳属球虫18S rDNA保守引物,PCR扩增肠艾美耳球虫18S rDNA片段,产物纯化后测序.测得的序列用DNAstar软件分析并与GenBank公布的11种兔球虫(EF694007-EF694017)的相应序列进行同源性分析,并绘制系统进化树.结果表明,扩增出的18S rDNA片段大小为1 521 bp.序列分析显示,肠艾美耳球虫河北株18S rDNA与GenBank公布的11种兔球虫相应序列同源性为92.6%~99.9%,肠艾美耳球虫河北株与国外肠艾美耳球虫(EF694012)18S rDNA相似性达99.9%.系统发育进化树显示,肠艾美耳球虫河北株与肠艾美耳球虫(EF694012)亲缘关系最近.

  14. [Prevalence and polyparasitism of intestinal protozoa and spatial distribution of Entamoeba histolytica, E. dispar and Giardia intestinalis from pupils in the rural zone of Man in Côte d'Ivoire].

    Science.gov (United States)

    Ouattara, Mamadou; Silué, Kigbafori Dieudonné; N'Guéssan, Aya Nicaise; Yapi, Ahoua; Barbara, Matthys; Raso, Giovanna; Utzinger, Juerg; N'Goran, Eliezer

    2008-01-01

    Diseases caused by environmental contamination by micro-organisms, including intestinal helminths and protozoa, are prevalent in developing countries. According to some authors, their strong expansion in some zones of these countries is due primarily to favourable climatic conditions, combined with inadequate hygiene measures and cleaning and the generally low socio-economic level. Progress in disease control has resulted from new studies that improve our understanding of the epidemiology of helminthiases and from the availability of simple tools that are inexpensive and effective against these diseases (chemotherapy with albendazole and mebendazole). On the other hand, surprisingly few such studies have looked at intestinal protozoa, although the WHO reports that approximately 480 million individuals throughout the world are infested by amoebiasis caused by the protozoon Entamoeba histolytica and that 40,000-110,000 people die from it each year. Giardiasis, a cosmopolitan parasitosis, is due to another intestinal protozoon called Giardia intestinalis. To help develop a database on these parasites, we conducted a cross-sectional epidemiological survey in the Man region in western Côte d'Ivoire. Its objectives were to determine the prevalence of intestinal protozoa, to evaluate polyparasitism and to assess the spatial distribution of the pathogenic protozoal species, E. histolytica and G. intestinalis. Overall, 4466 stools samples taken from pupils aged 6 to 16 years of age at 57 different schools were analyzed under an optical microscope by the formol-ether stool concentration method, after preservation in sodium acetate-acetic acid-formalin (SAF). The most common protozoa species in this area were Endolimax nanus (83.8%) and E. coli (74.7%). The regional prevalence of G. intestinalis was 17.5% and of E. histolytica/E. dispar 11.3%. Both species were found in each of the 57 schools. The prevalence of E. histolytica/E. dispar exceeded 15% in six schools, and its

  15. Evolution of anterior Hox regulatory elements among chordates

    Directory of Open Access Journals (Sweden)

    Natale Alfonso

    2011-11-01

    Full Text Available Abstract Background The Hox family of transcription factors has a fundamental role in segmentation pathways and axial patterning of embryonic development and their clustered organization is linked with the regulatory mechanisms governing their coordinated expression along embryonic axes. Among chordates, of particular interest are the Hox paralogous genes in groups 1-4 since their expression is coupled to the control of regional identity in the anterior nervous system, where the highest structural diversity is observed. Results To investigate the degree of conservation in cis-regulatory components that form the basis of Hox expression in the anterior nervous system, we have used assays for transcriptional activity in ascidians and vertebrates to compare and contrast regulatory potential. We identified four regulatory sequences located near the CiHox1, CiHox2 and CiHox4 genes of the ascidian Ciona intestinalis which direct neural specific domains of expression. Using functional assays in Ciona and vertebrate embryos in combination with sequence analyses of enhancer fragments located in similar positions adjacent to Hox paralogy group genes, we compared the activity of these four Ciona cis-elements with a series of neural specific enhancers from the amphioxus Hox1-3 genes and from mouse Hox paralogous groups 1-4. Conclusions This analysis revealed that Kreisler and Krox20 dependent enhancers critical in segmental regulation of the hindbrain appear to be specific for the vertebrate lineage. In contrast, neural enhancers that function as Hox response elements through the action of Hox/Pbx binding motifs have been conserved during chordate evolution. The functional assays reveal that these Hox response cis-elements are recognized by the regulatory components of different and extant species. Together, our results indicate that during chordate evolution, cis-elements dependent upon Hox/Pbx regulatory complexes, are responsible for key aspects of

  16. DNA supercoiling during transcription.

    Science.gov (United States)

    Ma, Jie; Wang, Michelle D

    2016-11-01

    The twin-supercoiled-domain model describes how transcription can drive DNA supercoiling, and how DNA supercoiling, in turn plays an important role in regulating gene transcription. In vivo and in vitro experiments have disclosed many details of the complex interactions in this relationship, and recently new insights have been gained with the help of genome-wide DNA supercoiling mapping techniques and single molecule methods. This review summarizes the general mechanisms of the interplay between DNA supercoiling and transcription, considers the biological implications, and focuses on recent important discoveries and technical advances in this field. We highlight the significant impact of DNA supercoiling in transcription, but also more broadly in all processes operating on DNA.

  17. DNA supercoiling during transcription

    Science.gov (United States)

    Ma, Jie; Wang, Michelle D.

    2017-01-01

    The twin-supercoiled-domain model describes how transcription can drive DNA supercoiling, and how DNA supercoiling, in turn plays an important role in regulating gene transcription. In vivo and in vitro experiments have disclosed many details of the complex interactions in this relationship, and recently new insights have been gained with the help of genome-wide DNA supercoiling mapping techniques and single molecule methods. This review summarizes the general mechanisms of the interplay between DNA supercoiling and transcription, considers the biological implications, and focuses on recent important discoveries and technical advances in this field. We highlight the significant impact of DNA supercoiling in transcription, but also more broadly in all processes operating on DNA.

  18. Pneumatosis intestinalis after etoposide-based chemotherapy in a patient with metastatic small cell lung cancer: successful conservative management of a rare condition.

    Science.gov (United States)

    Faria, Luiza Dib Batista Bugiato; Anjos, Carlos Henrique Dos; Fernandes, Gustavo Dos Santos; Carvalho, Igor Fernando da Silva

    2016-01-01

    A 69-year-old male patient, smoker, was diagnosed with small cell lung cancer metastatic to lung, liver and central nervous system. He received chemotherapy with carboplatin AUC 5 on day 1 and etoposide 100mg/m2 on days 1, 2 and 3. During the first cycle, the patient presented with febrile neutropenia and abdominal distension. Chest, abdomen and pelvis computed tomography scan was performed and detected gas dissecting the wall of sigmoid colon extending to the mesosigmoid. Patient had no abdominal pain, nausea, vomiting, and on physical examination he had no peritoneal irritation, tachycardia or hemodynamic instability compatible with perforation or acute abdomen. Therefore, the radiological finding was interpreted as pneumatosis intestinalis caused by chemotherapy with etoposide. Pneumatosis resolved after continuous oxygen therapy. The second cycle was administered after a complete resolution of the clinical condition and etoposide dose was reduced by 30%. The patient experienced a remarkable evolution. RESUMO Paciente do gênero masculino, 69 anos, fumante, diagnosticado com câncer de pulmão de pequenas células, metastático para pulmão, fígado e sistema nervoso central. Foi administrada quimioterapia com carboplatina AUC 5 no dia 1 e etoposídeo 100mg/m2 nos dias 1, 2 e 3. Durante o primeiro ciclo, o paciente apresentou neutropenia febril e distensão abdominal. Tomografias de tórax, abdome e pelve detectaram gás dissecando a parede do cólon sigmoide, com extensão para o mesossigmoide. O paciente não apresentava dor abdominal, náusea, vômito e não tinha sinais de irritação peritoneal, taquicardia ou instabilidade hemodinâmica compatíveis com perfuração ou abdome agudo. O achado radiológico foi interpretado como pneumatose intestinal causada por etoposídeo. A resolução do quadro ocorreu após suplementação de oxigênio. O segundo ciclo foi administrado após resolução completa do quadro, com redução da dose do quimioterápico em 30

  19. Smad transcription factors.

    Science.gov (United States)

    Massagué, Joan; Seoane, Joan; Wotton, David

    2005-12-01

    Smad transcription factors lie at the core of one of the most versatile cytokine signaling pathways in metazoan biology-the transforming growth factor-beta (TGFbeta) pathway. Recent progress has shed light into the processes of Smad activation and deactivation, nucleocytoplasmic dynamics, and assembly of transcriptional complexes. A rich repertoire of regulatory devices exerts control over each step of the Smad pathway. This knowledge is enabling work on more complex questions about the organization, integration, and modulation of Smad-dependent transcriptional programs. We are beginning to uncover self-enabled gene response cascades, graded Smad response mechanisms, and Smad-dependent synexpression groups. Our growing understanding of TGFbeta signaling through the Smad pathway provides general principles for how animal cells translate complex inputs into concrete behavior.

  20. Protein: FBA5 [TP Atlas

    Lifescience Database Archive (English)

    Full Text Available FBA5 VSOP(voltage sensor-only protein1) HVCN1 VSOP, VSX1 Voltage-gated hydrogen cha...nnel 1 Hydrogen voltage-gated channel 1, Voltage sensor domain-only protein 7719 Ciona intestinalis 778897 Q1JV40 ...

  1. The transcription factor encyclopedia.

    Science.gov (United States)

    Yusuf, Dimas; Butland, Stefanie L; Swanson, Magdalena I; Bolotin, Eugene; Ticoll, Amy; Cheung, Warren A; Zhang, Xiao Yu Cindy; Dickman, Christopher T D; Fulton, Debra L; Lim, Jonathan S; Schnabl, Jake M; Ramos, Oscar H P; Vasseur-Cognet, Mireille; de Leeuw, Charles N; Simpson, Elizabeth M; Ryffel, Gerhart U; Lam, Eric W-F; Kist, Ralf; Wilson, Miranda S C; Marco-Ferreres, Raquel; Brosens, Jan J; Beccari, Leonardo L; Bovolenta, Paola; Benayoun, Bérénice A; Monteiro, Lara J; Schwenen, Helma D C; Grontved, Lars; Wederell, Elizabeth; Mandrup, Susanne; Veitia, Reiner A; Chakravarthy, Harini; Hoodless, Pamela A; Mancarelli, M Michela; Torbett, Bruce E; Banham, Alison H; Reddy, Sekhar P; Cullum, Rebecca L; Liedtke, Michaela; Tschan, Mario P; Vaz, Michelle; Rizzino, Angie; Zannini, Mariastella; Frietze, Seth; Farnham, Peggy J; Eijkelenboom, Astrid; Brown, Philip J; Laperrière, David; Leprince, Dominique; de Cristofaro, Tiziana; Prince, Kelly L; Putker, Marrit; del Peso, Luis; Camenisch, Gieri; Wenger, Roland H; Mikula, Michal; Rozendaal, Marieke; Mader, Sylvie; Ostrowski, Jerzy; Rhodes, Simon J; Van Rechem, Capucine; Boulay, Gaylor; Olechnowicz, Sam W Z; Breslin, Mary B; Lan, Michael S; Nanan, Kyster K; Wegner, Michael; Hou, Juan; Mullen, Rachel D; Colvin, Stephanie C; Noy, Peter John; Webb, Carol F; Witek, Matthew E; Ferrell, Scott; Daniel, Juliet M; Park, Jason; Waldman, Scott A; Peet, Daniel J; Taggart, Michael; Jayaraman, Padma-Sheela; Karrich, Julien J; Blom, Bianca; Vesuna, Farhad; O'Geen, Henriette; Sun, Yunfu; Gronostajski, Richard M; Woodcroft, Mark W; Hough, Margaret R; Chen, Edwin; Europe-Finner, G Nicholas; Karolczak-Bayatti, Magdalena; Bailey, Jarrod; Hankinson, Oliver; Raman, Venu; LeBrun, David P; Biswal, Shyam; Harvey, Christopher J; DeBruyne, Jason P; Hogenesch, John B; Hevner, Robert F; Héligon, Christophe; Luo, Xin M; Blank, Marissa Cathleen; Millen, Kathleen Joyce; Sharlin, David S; Forrest, Douglas; Dahlman-Wright, Karin; Zhao, Chunyan; Mishima, Yuriko; Sinha, Satrajit; Chakrabarti, Rumela; Portales-Casamar, Elodie; Sladek, Frances M; Bradley, Philip H; Wasserman, Wyeth W

    2012-01-01

    Here we present the Transcription Factor Encyclopedia (TFe), a new web-based compendium of mini review articles on transcription factors (TFs) that is founded on the principles of open access and collaboration. Our consortium of over 100 researchers has collectively contributed over 130 mini review articles on pertinent human, mouse and rat TFs. Notable features of the TFe website include a high-quality PDF generator and web API for programmatic data retrieval. TFe aims to rapidly educate scientists about the TFs they encounter through the delivery of succinct summaries written and vetted by experts in the field. TFe is available at http://www.cisreg.ca/tfe.

  2. The Transcription Factor Encyclopedia

    DEFF Research Database (Denmark)

    Yusuf, Dimas; Butland, Stefanie L; Swanson, Magdalena I

    2012-01-01

    mini review articles on pertinent human, mouse and rat TFs. Notable features of the TFe website include a high-quality PDF generator and web API for programmatic data retrieval. TFe aims to rapidly educate scientists about the TFs they encounter through the delivery of succinct summaries written......ABSTRACT: Here we present the Transcription Factor Encyclopedia (TFe), a new web-based compendium of mini review articles on transcription factors (TFs) that is founded on the principles of open access and collaboration. Our consortium of over 100 researchers has collectively contributed over 130...

  3. Rhythm quantization for transcription

    NARCIS (Netherlands)

    Cemgil, A.T.; Desain, P.W.M.; Kappen, H.J.

    1999-01-01

    Automatic Music Transcription is the extraction of an acceptable notation from performed music. One important task in this problem is rhythm quantization which refers to categorization of note durations. Although quantization of a pure mechanical performance is rather straightforward, the task becom

  4. Bayesian Music Transcription

    NARCIS (Netherlands)

    Cemgil, A.T.

    2004-01-01

    Music transcription refers to extraction of a human readable and interpretable description from a recording of a music performance. The final goal is to implement a program that can automatically infer a musical notation that lists the pitch levels of notes and corresponding score positions in any a

  5. Mapping yeast transcriptional networks.

    Science.gov (United States)

    Hughes, Timothy R; de Boer, Carl G

    2013-09-01

    The term "transcriptional network" refers to the mechanism(s) that underlies coordinated expression of genes, typically involving transcription factors (TFs) binding to the promoters of multiple genes, and individual genes controlled by multiple TFs. A multitude of studies in the last two decades have aimed to map and characterize transcriptional networks in the yeast Saccharomyces cerevisiae. We review the methodologies and accomplishments of these studies, as well as challenges we now face. For most yeast TFs, data have been collected on their sequence preferences, in vivo promoter occupancy, and gene expression profiles in deletion mutants. These systematic studies have led to the identification of new regulators of numerous cellular functions and shed light on the overall organization of yeast gene regulation. However, many yeast TFs appear to be inactive under standard laboratory growth conditions, and many of the available data were collected using techniques that have since been improved. Perhaps as a consequence, comprehensive and accurate mapping among TF sequence preferences, promoter binding, and gene expression remains an open challenge. We propose that the time is ripe for renewed systematic efforts toward a complete mapping of yeast transcriptional regulatory mechanisms.

  6. Bayesian Music Transcription

    NARCIS (Netherlands)

    Cemgil, A.T.

    2004-01-01

    Music transcription refers to extraction of a human readable and interpretable description from a recording of a music performance. The final goal is to implement a program that can automatically infer a musical notation that lists the pitch levels of notes and corresponding score positions in any

  7. Transcription Dynamics in Living Cells.

    Science.gov (United States)

    Lenstra, Tineke L; Rodriguez, Joseph; Chen, Huimin; Larson, Daniel R

    2016-07-01

    The transcription cycle can be roughly divided into three stages: initiation, elongation, and termination. Understanding the molecular events that regulate all these stages requires a dynamic view of the underlying processes. The development of techniques to visualize and quantify transcription in single living cells has been essential in revealing the transcription kinetics. They have revealed that (a) transcription is heterogeneous between cells and (b) transcription can be discontinuous within a cell. In this review, we discuss the progress in our quantitative understanding of transcription dynamics in living cells, focusing on all parts of the transcription cycle. We present the techniques allowing for single-cell transcription measurements, review evidence from different organisms, and discuss how these experiments have broadened our mechanistic understanding of transcription regulation.

  8. Non-transcriptional regulatory processes shape transcriptional network dynamics

    OpenAIRE

    Ray, J. Christian J; Tabor, Jeffrey J.; Igoshin, Oleg A.

    2011-01-01

    Information about the extra- or intracellular environment is often captured as biochemical signals propagating through regulatory networks. These signals eventually drive phenotypic changes, typically by altering gene expression programs in the cell. Reconstruction of transcriptional regulatory networks has given a compelling picture of bacterial physiology, but transcriptional network maps alone often fail to describe phenotypes. In many cases, the dynamical performance of transcriptional re...

  9. Eukaryotic transcription factors

    DEFF Research Database (Denmark)

    Staby, Lasse; O'Shea, Charlotte; Willemoës, Martin

    2017-01-01

    Gene-specific transcription factors (TFs) are key regulatory components of signaling pathways, controlling, for example, cell growth, development, and stress responses. Their biological functions are determined by their molecular structures, as exemplified by their structured DNA-binding domains...... targeting specific cis-acting elements in genes, and by the significant lack of fixed tertiary structure in their extensive intrinsically disordered regions. Recent research in protein intrinsic disorder (ID) has changed our understanding of transcriptional activation domains from 'negative noodles' to ID...... them to participate in large interactomes, how they use only a few hydrophobic residues, short sequence motifs, prestructured motifs, and coupled folding and binding for their interactions with co-activators, and how their accessibility to post-translational modification affects their interactions...

  10. DNA Topoisomerases in Transcription

    DEFF Research Database (Denmark)

    Rødgaard, Morten Terpager

    2015-01-01

    This Ph.D. thesis summarizes the main results of my studies on the interplay between DNA topoisomerases and transcription. The work was performed from 2011 to 2015 at Aarhus University in the Laboratory of Genome Research, and was supervised by associate professor Anni H. Andersen. Most of the ex......This Ph.D. thesis summarizes the main results of my studies on the interplay between DNA topoisomerases and transcription. The work was performed from 2011 to 2015 at Aarhus University in the Laboratory of Genome Research, and was supervised by associate professor Anni H. Andersen. Most...... topoisomerase-DNA cleavage complex. The second study is an investigation of how topoisomerases influence gene regulation by keeping the genome in an optimal topological state....

  11. SNFing HIV transcription

    Directory of Open Access Journals (Sweden)

    Bukrinsky Michael

    2006-08-01

    Full Text Available Abstract The SWI/SNF chromatin remodeling complex is an essential regulator of transcription of cellular genes. HIV-1 infection induces exit of a core component of SWI/SNF, Ini1, into the cytoplasm and its association with the viral pre-integration complex. Several recent papers published in EMBO Journal, Journal of Biological Chemistry, and Retrovirology provide new information regarding possible functions of Ini1 and SWI/SNF in HIV life cycle. It appears that Ini1 has an inhibitory effect on pre-integration steps of HIV replication, but also contributes to stimulation of Tat-mediated transcription. This stimulation involves displacement of the nucleosome positioned at the HIV promoter.

  12. Investigation of taxa of the family Pasteurellaceae isolated from Syrian and European hamsters and proposal of Mesocricetibacter intestinalis gen. nov., sp. nov. and Cricetibacter osteomyelitidis gen. nov., sp. nov.

    Science.gov (United States)

    Christensen, H; Nicklas, W; Bisgaard, M

    2014-11-01

    Eleven strains from hamster of Bisgaard taxa 23 and 24, also referred to as Krause's groups 2 and 1, respectively, were investigated by a polyphasic approach including data published previously. Strains showed small, regular and circular colonies with smooth and shiny appearance, typical of members of the family Pasteurellaceae. The strains formed two monophyletic groups based on 16S rRNA gene sequence comparison to other members of the family Pasteurellaceae. Partial rpoB sequencing as well as published data on DNA-DNA hybridization showed high genotypic relationships within both groups. Menaquinone 7 (MK7) was found in strains of both groups as well as an unknown ubiquinone with shorter chain length than previously reported for any other member of the family Pasteurellaceae. A new genus with one species, Mesocricetibacter intestinalis gen. nov., sp. nov., is proposed to accommodate members of taxon 24 of Bisgaard whereas members of taxon 23 of Bisgaard are proposed to represent Cricetibacter osteomyelitidis gen. nov., sp. nov. Major fatty acids of type strains of type species of both genera are C(14:0), C(14:0) 3-OH/iso-C(16:1) I, C(16:1)ω7c and C(16:0). The two genera are clearly separated by phenotype from each other and from existing genera of the family Pasteurellaceae. The type strain of Mesocricetibacter intestinalis is HIM 933/7(T) ( =Kunstyr 246/85(T) =CCUG 28030(T) =DSM 28403(T)) while the type strain of Cricetibacter osteomyelitidis is HIM943/7(T) ( =Kunstyr 507/85(T) =CCUG 36451(T) =DSM 28404(T)).

  13. Deciphering Transcriptional Regulation

    DEFF Research Database (Denmark)

    Valen, Eivind

    RNA); and ii) translation, in which the mRNA is translated into a protein. This thesis focus on the ¿rst of these steps, transcription, and speci¿cally the initiation of this. Simpli¿ed, initiation is preceded by the binding of several proteins, known as transcription factors (TFs), to DNA. This takes place......The myriad of cells in the human body are all made from the same blueprint: the human genome. At the heart of this diversity lies the concept of gene regulation, the process in which it is decided which genes are used where and when. Genes do not function as on/off buttons, but more like a volume...... control spanning the range from completely muted to cranked up to maximum. The volume, in this case, is the production rate of proteins. This production is the result of a two step procedure: i) transcription, in which a small part of DNA from the genome (a gene) is transcribed into an RNA molecule (an m...

  14. Non-transcriptional regulatory processes shape transcriptional network dynamics.

    Science.gov (United States)

    Ray, J Christian J; Tabor, Jeffrey J; Igoshin, Oleg A

    2011-10-11

    Information about the extra- or intracellular environment is often captured as biochemical signals that propagate through regulatory networks. These signals eventually drive phenotypic changes, typically by altering gene expression programmes in the cell. Reconstruction of transcriptional regulatory networks has given a compelling picture of bacterial physiology, but transcriptional network maps alone often fail to describe phenotypes. Cellular response dynamics are ultimately determined by interactions between transcriptional and non-transcriptional networks, with dramatic implications for physiology and evolution. Here, we provide an overview of non-transcriptional interactions that can affect the performance of natural and synthetic bacterial regulatory networks.

  15. Regulated assembly of transcription factors and control of transcription initiation.

    Science.gov (United States)

    Beckett, D

    2001-11-30

    Proteins that function in regulation of transcription initiation are typically homo or hetero-oligomeric. Results of recent biophysical studies of transcription regulators indicate that the assembly of these proteins is often subject to regulation. This regulation of assembly dictates the frequency of transcription initiation via its influence on the affinity of a transcription regulator for DNA and its affect on target site selection. Factors that modulate transcription factor assembly include binding of small molecules, post-translational modification, DNA binding and interactions with other proteins. Here, the results of recent structural and/or thermodynamic studies of a number of transcription regulators that are subject to regulated assembly are reviewed. The accumulated data indicate that this phenomenon is ubiquitous and that mechanisms utilized in eukaryotes and prokaryotes share common features. Copyright 2001 Academic Press.

  16. Is real-time PCR-based diagnosis similar in performance to routine parasitological examination for the identification of Giardia intestinalis, Cryptosporidium parvum/Cryptosporidium hominis and Entamoeba histolytica from stool samples? Evaluation of a new commercial multiplex PCR assay and literature review.

    Science.gov (United States)

    Laude, A; Valot, S; Desoubeaux, G; Argy, N; Nourrisson, C; Pomares, C; Machouart, M; Le Govic, Y; Dalle, F; Botterel, F; Bourgeois, N; Cateau, E; Leterrier, M; Le Pape, P; Morio, F

    2016-02-01

    Microscopy is the reference standard for routine laboratory diagnosis in faecal parasitology but there is growing interest in alternative methods to overcome the limitations of microscopic examination, which is time-consuming and highly dependent on an operator's skills and expertise. Compared with microscopy, DNA detection by PCR is simple and can offer a better turnaround time. However, PCR performances remain difficult to assess as most studies have been conducted on a limited number of positive clinical samples and used in-house PCR methods. Our aim was to evaluate a new multiplex PCR assay (G-DiaParaTrio; Diagenode Diagnostics), targeting Giardia intestinalis, Cryptosporidium parvum/Cryptosporidium hominis and Entamoeba histolytica. To minimize the turnaround time, PCR was coupled with automated DNA extraction (QiaSymphony; Qiagen). The PCR assay was evaluated using a reference panel of 185 samples established by routine microscopic examination using a standardized protocol including Ziehl-Neelsen staining and adhesin detection by ELISA (E. histolytica II; TechLab). This panel, collected from 12 French parasitology laboratories, included 135 positive samples for G. intestinalis (n = 38), C. parvum/C. hominis (n = 26), E. histolytica (n = 5), 21 other gastrointestinal parasites, together with 50 negative samples. In all, the G-DiaParaTrio multiplex PCR assay identified 38 G. intestinalis, 25 C. parvum/C. hominis and five E. histolytica leading to sensitivity/specificity of 92%/100%, 96%/100% and 100%/100% for G. intestinalis, C. parvum/C. hominis and E. histolytica, respectively. This new multiplex PCR assay offers fast and reliable results, similar to microscopy-driven diagnosis for the detection of these gastrointestinal protozoa, allowing its implementation in routine clinical practice.

  17. Transcriptional Silencing of Retroviral Vectors

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Duch, M.; Pedersen, F.S.

    1996-01-01

    . Extinction of long-term vector expression has been observed after implantation of transduced hematopoietic cells as well as fibroblasts, myoblasts and hepatocytes. Here we review the influence of vector structure, integration site and cell type on transcriptional silencing. While down-regulation of proviral...... transcription is known from a number of cellular and animal models, major insight has been gained from studies in the germ line and embryonal cells of the mouse. Key elements for the transfer and expression of retroviral vectors, such as the viral transcriptional enhancer and the binding site for the t......RNA primer for reverse transcription may have a major influence on transcriptional silencing. Alterations of these elements of the vector backbone as well as the use of internal promoter elements from housekeeping genes may contribute to reduce transcriptional silencing. The use of cell culture and animal...

  18. Nucleocytoplasmic shuttling of transcription factors

    DEFF Research Database (Denmark)

    Cartwright, P; Helin, K

    2000-01-01

    To elicit the transcriptional response following intra- or extracellular stimuli, the signals need to be transmitted to their site of action within the nucleus. The nucleocytoplasmic shuttling of transcription factors is a mechanism mediating this process. The activation and inactivation...... of the transcriptional response is essential for cells to progress through the cell cycle in a normal manner. The involvement of cytoplasmic and nuclear accessory molecules, and the general nuclear membrane transport components, are essential for this process. Although nuclear import and export for different...... transcription factor families are regulated by similar mechanisms, there are several differences that allow for the specific activation of each transcription factor. This review discusses the general import and export pathways found to be common amongst many different transcription factors, and highlights...

  19. Nucleocytoplasmic shuttling of transcription factors

    DEFF Research Database (Denmark)

    Cartwright, P; Helin, K

    2000-01-01

    To elicit the transcriptional response following intra- or extracellular stimuli, the signals need to be transmitted to their site of action within the nucleus. The nucleocytoplasmic shuttling of transcription factors is a mechanism mediating this process. The activation and inactivation...... transcription factor families are regulated by similar mechanisms, there are several differences that allow for the specific activation of each transcription factor. This review discusses the general import and export pathways found to be common amongst many different transcription factors, and highlights...... of the transcriptional response is essential for cells to progress through the cell cycle in a normal manner. The involvement of cytoplasmic and nuclear accessory molecules, and the general nuclear membrane transport components, are essential for this process. Although nuclear import and export for different...

  20. DNA topology and transcription

    Science.gov (United States)

    Kouzine, Fedor; Levens, David; Baranello, Laura

    2014-01-01

    Chromatin is a complex assembly that compacts DNA inside the nucleus while providing the necessary level of accessibility to regulatory factors conscripted by cellular signaling systems. In this superstructure, DNA is the subject of mechanical forces applied by variety of molecular motors. Rather than being a rigid stick, DNA possesses dynamic structural variability that could be harnessed during critical steps of genome functioning. The strong relationship between DNA structure and key genomic processes necessitates the study of physical constrains acting on the double helix. Here we provide insight into the source, dynamics, and biology of DNA topological domains in the eukaryotic cells and summarize their possible involvement in gene transcription. We emphasize recent studies that might inspire and impact future experiments on the involvement of DNA topology in cellular functions. PMID:24755522

  1. DNA topology and transcription.

    Science.gov (United States)

    Kouzine, Fedor; Levens, David; Baranello, Laura

    2014-01-01

    Chromatin is a complex assembly that compacts DNA inside the nucleus while providing the necessary level of accessibility to regulatory factors conscripted by cellular signaling systems. In this superstructure, DNA is the subject of mechanical forces applied by variety of molecular motors. Rather than being a rigid stick, DNA possesses dynamic structural variability that could be harnessed during critical steps of genome functioning. The strong relationship between DNA structure and key genomic processes necessitates the study of physical constrains acting on the double helix. Here we provide insight into the source, dynamics, and biology of DNA topological domains in the eukaryotic cells and summarize their possible involvement in gene transcription. We emphasize recent studies that might inspire and impact future experiments on the involvement of DNA topology in cellular functions.

  2. The post-transcriptional operon

    DEFF Research Database (Denmark)

    Tenenbaum, Scott A.; Christiansen, Jan; Nielsen, Henrik

    2011-01-01

    A post-transcriptional operon is a set of monocistronic mRNAs encoding functionally related proteins that are co-regulated by a group of RNA-binding proteins and/or small non-coding RNAs so that protein expression is coordinated at the post-transcriptional level. The post-transcriptional operon...... model (PTO) is used to describe data from an assortment of methods (e.g. RIP-Chip, CLIP-Chip, miRNA profiling, ribosome profiling) that globally address the functionality of mRNA. Several examples of post-transcriptional operons have been documented in the literature and demonstrate the usefulness...

  3. Promoter-mediated transcriptional dynamics.

    Science.gov (United States)

    Zhang, Jiajun; Zhou, Tianshou

    2014-01-21

    Genes in eukaryotic cells are typically regulated by complex promoters containing multiple binding sites for a variety of transcription factors, but how promoter dynamics affect transcriptional dynamics has remained poorly understood. In this study, we analyze gene models at the transcriptional regulation level, which incorporate the complexity of promoter structure (PS) defined as transcriptional exits (i.e., ON states of the promoter) and the transition pattern (described by a matrix consisting of transition rates among promoter activity states). We show that multiple exits of transcription are the essential origin of generating multimodal distributions of mRNA, but promoters with the same transition pattern can lead to multimodality of different modes, depending on the regulation of transcriptional factors. In turn, for similar mRNA distributions in the models, the mean ON or OFF time distributions may exhibit different characteristics, thus providing the supplemental information on PS. In addition, we demonstrate that the transcriptional noise can be characterized by a nonlinear function of mean ON and OFF times. These results not only reveal essential characteristics of promoter-mediated transcriptional dynamics but also provide signatures useful for inferring PS based on characteristics of transcriptional outputs. Copyright © 2014 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  4. Mastering Transcription: Multiplexed Analysis of Transcription Start Site Sequences.

    Science.gov (United States)

    Hochschild, Ann

    2015-12-17

    In this issue of Molecular Cell, Vvedenskaya et al. (2015) describe a high-throughput sequencing-based methodology for the massively parallel analysis of transcription from a high-complexity barcoded template library both in vitro and in vivo, providing a powerful new tool for the study of transcription.

  5. Transcriptional and post-transcriptional profile of human chromosome 21.

    Science.gov (United States)

    Nikolaev, Sergey I; Deutsch, Samuel; Genolet, Raphael; Borel, Christelle; Parand, Leila; Ucla, Catherine; Schütz, Frederic; Duriaux Sail, Genevieve; Dupré, Yann; Jaquier-Gubler, Pascale; Araud, Tanguy; Conne, Beatrice; Descombes, Patrick; Vassalli, Jean-Dominique; Curran, Joseph; Antonarakis, Stylianos E

    2009-08-01

    Recent studies have demonstrated extensive transcriptional activity across the human genome, a substantial fraction of which is not associated with any functional annotation. However, very little is known regarding the post-transcriptional processes that operate within the different classes of RNA molecules. To characterize the post-transcriptional properties of expressed sequences from human chromosome 21 (HSA21), we separated RNA molecules from three cell lines (GM06990, HeLa S3, and SK-N-AS) according to their ribosome content by sucrose gradient fractionation. Polyribosomal-associated RNA and total RNA were subsequently hybridized to genomic tiling arrays. We found that approximately 50% of the transcriptional signals were located outside of annotated exons and were considered as TARs (transcriptionally active regions). Although TARs were observed among polysome-associated RNAs, RT-PCR and RACE experiments revealed that approximately 40% were likely to represent nonspecific cross-hybridization artifacts. Bioinformatics discrimination of TARs according to conservation and sequence complexity allowed us to identify a set of high-confidence TARs. This set of TARs was significantly depleted in the polysomes, suggesting that it was not likely to be involved in translation. Analysis of polysome representation of RefSeq exons showed that at least 15% of RefSeq transcripts undergo significant post-transcriptional regulation in at least two of the three cell lines tested. Among the regulated transcripts, enrichment analysis revealed an over-representation of genes involved in Alzheimer's disease (AD), including APP and the BACE1 protease that cleaves APP to produce the pathogenic beta 42 peptide. We demonstrate that the combination of RNA fractionation and tiling arrays is a powerful method to assess the transcriptional and post-transcriptional properties of genomic regions.

  6. Neumatosis intestinal asociada a neumatosis portal intrahepática por oclusión intestinal: presentación de un caso Pneumatosis intestinalis and intrahepatic portal venous gas associated with small bowel occlusion: case report

    Directory of Open Access Journals (Sweden)

    Lucas E Granero

    2010-04-01

    Full Text Available La neumatosis intestinal es una entidad muy infrecuente asociada a varias patologías, como el infarto intestino-mesentérico, la enterocolitis necrotizante y la enfermedad pulmonar obstructiva crónica. Se caracteriza por la presencia de gas en la subserosa o submucosa a través del tracto gastrointestinal. Presentamos el caso de un paciente de sexo masculino de 63 años de edad que consultó por dolor en abdomen superior, vómitos y fiebre elevada (39º nueve días después de una gastrectomía total por cáncer. La radiografía directa de abdomen constató distensión intestinal y la tomografía computada (TC demostró distensión intestinal, edema mesentérico, neumatosis intestinal a través del intestino delgado y neumatosis portal, preferentemente en el lóbulo hepático izquierdo. Se realizó una laparotomía de urgencia que reveló únicamente distensión intestinal por adherencias, sin evidenciar necrosis intestinal. El paciente evolucionó desfavorablemente, falleciendo posteriormente. Reportamos un nuevo caso y revisamos la literatura de la neumatosis intestinal asociada con neumatosis portal.The pneumatosis intestinalis is a very infrequent condition associated with a number of diseases, such as mesenteric infarction, necrotizing enterocolitis, and obstructive pulmonary disease characterized by the presence of subserosal or submucosal gas cyst throughout the gastrointestinal tract. A 63- year- old man complained of upper abdominal pain, vomiting and high fever (39º C on the nine day after total gastrectomy for cancer. Abdominal X-ray revealed intestinal distension. The abdominal Computed Tomography (CT showed intestinal dilatation, mesenteric oedema, diffuse pneumatosis throughout the small intestine and gas in the portal venous system predominantly in the left hepatic lobe. It was performed emergency activity that revealed intestinal distension secondary to adhesion without intestinal necrosis. The patient had a downhill course

  7. Mechanosensitive mechanisms in transcriptional regulation.

    Science.gov (United States)

    Mammoto, Akiko; Mammoto, Tadanori; Ingber, Donald E

    2012-07-01

    Transcriptional regulation contributes to the maintenance of pluripotency, self-renewal and differentiation in embryonic cells and in stem cells. Therefore, control of gene expression at the level of transcription is crucial for embryonic development, as well as for organogenesis, functional adaptation, and regeneration in adult tissues and organs. In the past, most work has focused on how transcriptional regulation results from the complex interplay between chemical cues, adhesion signals, transcription factors and their co-regulators during development. However, chemical signaling alone is not sufficient to explain how three-dimensional (3D) tissues and organs are constructed and maintained through the spatiotemporal control of transcriptional activities. Accumulated evidence indicates that mechanical cues, which include physical forces (e.g. tension, compression or shear stress), alterations in extracellular matrix (ECM) mechanics and changes in cell shape, are transmitted to the nucleus directly or indirectly to orchestrate transcriptional activities that are crucial for embryogenesis and organogenesis. In this Commentary, we review how the mechanical control of gene transcription contributes to the maintenance of pluripotency, determination of cell fate, pattern formation and organogenesis, as well as how it is involved in the control of cell and tissue function throughout embryogenesis and adult life. A deeper understanding of these mechanosensitive transcriptional control mechanisms should lead to new approaches to tissue engineering and regenerative medicine.

  8. Transcriptional networks controlling adipocyte differentiation

    DEFF Research Database (Denmark)

    Siersbæk, R; Mandrup, Susanne

    2011-01-01

    Adipocyte differentiation is regulated by a complex cascade of signals that drive the transcriptional reprogramming of the fibroblastic precursors. Genome-wide analyses of chromatin accessibility and binding of adipogenic transcription factors make it possible to generate "snapshots" of the trans...

  9. Structural basis of transcription activation.

    Science.gov (United States)

    Feng, Yu; Zhang, Yu; Ebright, Richard H

    2016-06-10

    Class II transcription activators function by binding to a DNA site overlapping a core promoter and stimulating isomerization of an initial RNA polymerase (RNAP)-promoter closed complex into a catalytically competent RNAP-promoter open complex. Here, we report a 4.4 angstrom crystal structure of an intact bacterial class II transcription activation complex. The structure comprises Thermus thermophilus transcription activator protein TTHB099 (TAP) [homolog of Escherichia coli catabolite activator protein (CAP)], T. thermophilus RNAP σ(A) holoenzyme, a class II TAP-dependent promoter, and a ribotetranucleotide primer. The structure reveals the interactions between RNAP holoenzyme and DNA responsible for transcription initiation and reveals the interactions between TAP and RNAP holoenzyme responsible for transcription activation. The structure indicates that TAP stimulates isomerization through simple, adhesive, stabilizing protein-protein interactions with RNAP holoenzyme. Copyright © 2016, American Association for the Advancement of Science.

  10. Structural basis of transcription elongation.

    Science.gov (United States)

    Martinez-Rucobo, Fuensanta W; Cramer, Patrick

    2013-01-01

    For transcription elongation, all cellular RNA polymerases form a stable elongation complex (EC) with the DNA template and the RNA transcript. Since the millennium, a wealth of structural information and complementary functional studies provided a detailed three-dimensional picture of the EC and many of its functional states. Here we summarize these studies that elucidated EC structure and maintenance, nucleotide selection and addition, translocation, elongation inhibition, pausing and proofreading, backtracking, arrest and reactivation, processivity, DNA lesion-induced stalling, lesion bypass, and transcriptional mutagenesis. In the future, additional structural and functional studies of elongation factors that control the EC and their possible allosteric modes of action should result in a more complete understanding of the dynamic molecular mechanisms underlying transcription elongation. This article is part of a Special Issue entitled: RNA polymerase II Transcript Elongation. Copyright © 2012 Elsevier B.V. All rights reserved.

  11. Thermodynamic Model of Transcription Elongation

    Science.gov (United States)

    Tadigotla, Vasisht; O'Maoileidigh, Daibhid; Sengupta, Anirvan; Epshtein, Vitaly; Ebright, Richard; Nudler, Evgeny; Ruckenstein, Andrei

    2006-03-01

    We present a statistical mechanics approach to the prediction of backtracked pauses in prokaryotic transcription elongation derived from structural models of the transcription elongation complex (TEC). Our algorithm is based on the thermodynamic stability of TEC along the DNA template calculated from the sequence dependent free-energy of DNA-DNA, DNA-RNA and RNA-RNA base pairing associated with (a) the translocation and size fluctuations of the transcription bubble; (b) the changes in the DNA-RNA hybrid; and (c) the changes in the RNA folding free-energy. The calculations involve no adjustable parameters apart from a cutoff used to discriminate paused from non-paused complexes. When applied to 100 experimental pauses in transcription elongation by E. coli RNA polymerase on ten DNA templates the approach produces highly statistically significant results. Transcription elongation is an inherently kinetic process and a simplified kinetic model with the same predictive power is presented separately.

  12. Transcription regulation mechanisms of bacteriophages

    Science.gov (United States)

    Yang, Haiquan; Ma, Yingfang; Wang, Yitian; Yang, Haixia; Shen, Wei; Chen, Xianzhong

    2014-01-01

    Phage diversity significantly contributes to ecology and evolution of new bacterial species through horizontal gene transfer. Therefore, it is essential to understand the mechanisms underlying phage-host interactions. After initial infection, the phage utilizes the transcriptional machinery of the host to direct the expression of its own genes. This review presents a view on the transcriptional regulation mechanisms of bacteriophages, and its contribution to phage diversity and classification. Through this review, we aim to broaden the understanding of phage-host interactions while providing a reference source for researchers studying the regulation of phage transcription. PMID:25482231

  13. Sigma Factors for Cyanobacterial Transcription

    Directory of Open Access Journals (Sweden)

    Sousuke Imamura

    2009-04-01

    Full Text Available Cyanobacteria are photosynthesizing microorganisms that can be used as a model for analyzing gene expression. The expression of genes involves transcription and translation. Transcription is performed by the RNA polymerase (RNAP holoenzyme, comprising a core enzyme and a sigma (σ factor which confers promoter selectivity. The unique structure, expression, and function of cyanobacterial σ factors (and RNAP core subunits are summarized here based on studies, reported previously. The types of promoter recognized by the σ factors are also discussed with regard to transcriptional regulation.

  14. RNA-guided transcriptional regulation

    Energy Technology Data Exchange (ETDEWEB)

    Church, George M.; Mali, Prashant G.; Esvelt, Kevin M.

    2016-02-23

    Methods of modulating expression of a target nucleic acid in a cell are provided including introducing into the cell a first foreign nucleic acid encoding one or more RNAs complementary to DNA, wherein the DNA includes the target nucleic acid, introducing into the cell a second foreign nucleic acid encoding a nuclease-null Cas9 protein that binds to the DNA and is guided by the one or more RNAs, introducing into the cell a third foreign nucleic acid encoding a transcriptional regulator protein or domain, wherein the one or more RNAs, the nuclease-null Cas9 protein, and the transcriptional regulator protein or domain are expressed, wherein the one or more RNAs, the nuclease-null Cas9 protein and the transcriptional regulator protein or domain co-localize to the DNA and wherein the transcriptional regulator protein or domain regulates expression of the target nucleic acid.

  15. The eukaryotic gene transcription machinery.

    Science.gov (United States)

    Kornberg, R D

    2001-08-01

    Seven purified proteins may be combined to reconstitute regulated, promoter-dependent RNA polymerase II transcription: five general transcription factors, Mediator, and RNA polymerase II. The entire system has been conserved across species from yeast to humans. The structure of RNA polymerase II, consisting of 10 polypeptides with a mass of about 500 kDa, has been determined at atomic resolution. On the basis of this structure, that of an actively transcribing RNA polymerase II complex has been determined as well.

  16. Thermodynamic and Kinetic Modeling of Transcriptional Pausing

    National Research Council Canada - National Science Library

    Vasisht R. Tadigotla; Dáibhid Ó. Maoiléidigh; Anirvan M. Sengupta; Vitaly Epshtein; Richard H. Ebright; Evgeny Nudler; Andrei E. Ruckenstein

    2006-01-01

    We present a statistical mechanics approach for the prediction of backtracked pauses in bacterial transcription elongation derived from structural models of the transcription elongation complex (EC...

  17. National Capital Planning Commission Meeting Transcripts

    Data.gov (United States)

    National Capital Planning Commission — Transcripts of the monthly (with the exception of August) National Capital Planning Commission meeting transcripts are provided for research to confirm actions taken...

  18. Escherichia coli transcriptional regulatory network

    Directory of Open Access Journals (Sweden)

    Agustino Martinez-Antonio

    2011-06-01

    Full Text Available Escherichia coli is the most well-know bacterial model about the function of its molecular components. In this review are presented several structural and functional aspects of their transcriptional regulatory network constituted by transcription factors and target genes. The network discussed here represent to 1531 genes and 3421 regulatory interactions. This network shows a power-law distribution with a few global regulators and most of genes poorly connected. 176 of genes in the network correspond to transcription factors, which form a sub-network of seven hierarchical layers where global regulators tend to be set in superior layers while local regulators are located in the lower ones. There is a small set of proteins know as nucleoid-associated proteins, which are in a high cellular concentrations and reshape the nucleoid structure to influence the running of global transcriptional programs, to this mode of regulation is named analog regulation. Specific signal effectors assist the activity of most of transcription factors in E. coli. These effectors switch and tune the activity of transcription factors. To this type of regulation, depending of environmental signals is named the digital-precise-regulation. The integration of regulatory programs have place in the promoter region of transcription units where it is common to observe co-regulation among global and local TFs as well as of TFs sensing exogenous and endogenous conditions. The mechanistic logic to understand the harmonious operation of regulatory programs in the network should consider the globalism of TFs, their signal perceived, coregulation, genome position, and cellular concentration. Finally, duplicated TFs and their horizontal transfer influence the evolvability of members of the network. The most duplicated and transferred TFs are located in the network periphery.

  19. Mobilicoccus pelagius gen. nov., sp. nov. and Piscicoccus intestinalis gen. nov., sp. nov., two new members of the family Dermatophilaceae, and reclassification of Dermatophilus chelonae (Masters et al. 1995) as Austwickia chelonae gen. nov., comb. nov.

    Science.gov (United States)

    Hamada, Moriyuki; Iino, Takao; Iwami, Takahiro; Harayama, Shigeaki; Tamura, Tomohiko; Suzuki, Ken-ichiro

    2010-01-01

    Two Gram-positive bacteria, designated strains Aji5-31(T) and Ngc37-23(T), were isolated from the intestinal tracts of fishes. 16S rRNA gene sequence analysis indicated that both strains were related to the members of the family Dermatophilaceae, with 95.6-96.9% 16S rRNA gene sequence similarities. The family Dermatophilaceae contains 2 genera and 3 species: Dermatophilus congolensis, Dermatophilus chelonae and Kineosphaera limosa. However, it has been suggested that the taxonomic position of D. chelonae should be reinvestigated using a polyphasic approach, because the chemotaxonomic characteristics are not known (Stackebrandt, 2006; Stackebrandt and Schumann, 2000). Our present study revealed that strains Aji5-31(T), Ngc37-23(T) and D. chelonae NBRC 105200(T) should be separated from the other members of the family Dermatophilaceae on the basis of the following characteristics: the predominant menaquinone of strain Aji5-31(T) is MK-8(H(2)), strain Ngc37-23(T) possesses iso- branched fatty acids as major components, and the menaquinone composition of D. chelonae is MK-8(H(4)), MK-8 and MK-8(H(2)) (5 : 3 : 2, respectively). On the basis of these distinctive phenotypic characteristics and phylogenetic analysis results, it is proposed that strains Aji5-31(T) and Ngc37-23(T) be classified as two novel genera and species of the family Dermatophilaceae. The names are Mobilicoccus pelagius gen. nov., sp. nov. and Piscicoccus intestinalis gen. nov., sp. nov., and the type strains are Aji5-31(T) (=NBRC 104925(T) =DSM 22762(T)) and Ngc37-23(T) (=NBRC 104926(T) =DSM 22761(T)), respectively. In addition, D. chelonae should be reassigned to a new genus of the family Dermatophilaceae with the name Austwickia chelonae gen. nov., comb. nov.

  20. Structural basis of transcription initiation.

    Science.gov (United States)

    Zhang, Yu; Feng, Yu; Chatterjee, Sujoy; Tuske, Steve; Ho, Mary X; Arnold, Eddy; Ebright, Richard H

    2012-11-23

    During transcription initiation, RNA polymerase (RNAP) binds and unwinds promoter DNA to form an RNAP-promoter open complex. We have determined crystal structures at 2.9 and 3.0 Å resolution of functional transcription initiation complexes comprising Thermus thermophilus RNA polymerase, σ(A), and a promoter DNA fragment corresponding to the transcription bubble and downstream double-stranded DNA of the RNAP-promoter open complex. The structures show that σ recognizes the -10 element and discriminator element through interactions that include the unstacking and insertion into pockets of three DNA bases and that RNAP recognizes the -4/+2 region through interactions that include the unstacking and insertion into a pocket of the +2 base. The structures further show that interactions between σ and template-strand single-stranded DNA (ssDNA) preorganize template-strand ssDNA to engage the RNAP active center.

  1. Transcription factors - Methods and protocols

    Directory of Open Access Journals (Sweden)

    CarloAlberto Redi

    2011-03-01

    Full Text Available A hearty wellcome to prof. Higgins editorial toil: a necessary tool for those colleagues (young and older fighting each day with the transcription factor they are involved with. In fact, the book is a full coverage compendium of state of the art papers dealing with practical thecniques and theoretical concepts about transcription factors. Each of the chapters (twenty-four is written by colleagues already working with one of the many trascription factors we become acquainted with. For the sake of the reader the volume is divided in four parts: Part I is a brief (when compared to the others three ! introductory presentation of the shuttling (i.e., transcription factor nuclear-cytoplasmic trafficking achieved by three reviews presentation of this biologically critical phenomenon. Part II (nine chapters is devoted to the necessary techniques to study nuclear translocation ...............

  2. Pervasive transcription: detecting functional RNAs in bacteria.

    Science.gov (United States)

    Lybecker, Meghan; Bilusic, Ivana; Raghavan, Rahul

    2014-01-01

    Pervasive, or genome-wide, transcription has been reported in all domains of life. In bacteria, most pervasive transcription occurs antisense to protein-coding transcripts, although recently a new class of pervasive RNAs was identified that originates from within annotated genes. Initially considered to be non-functional transcriptional noise, pervasive transcription is increasingly being recognized as important in regulating gene expression. The function of pervasive transcription is an extensively debated question in the field of transcriptomics and regulatory RNA biology. Here, we highlight the most recent contributions addressing the purpose of pervasive transcription in bacteria and discuss their implications.

  3. NAC transcription factors in senescence

    DEFF Research Database (Denmark)

    Podzimska-Sroka, Dagmara; O'Shea, Charlotte; Gregersen, Per L.;

    2015-01-01

    Within the last decade, NAC transcription factors have been shown to play essential roles in senescence, which is the focus of this review. Transcriptome analyses associate approximately one third of Arabidopsis NAC genes and many crop NAC genes with senescence, thereby implicating NAC genes...... as important regulators of the senescence process. The consensus DNA binding site of the NAC domain is used to predict NAC target genes, and protein interaction sites can be predicted for the intrinsically disordered transcription regulatory domains of NAC proteins. The molecular characteristics...

  4. Subventricular zone microglia transcriptional networks.

    Science.gov (United States)

    Starossom, Sarah C; Imitola, Jaime; Wang, Yue; Cao, Li; Khoury, Samia J

    2011-07-01

    Microglia play an important role in inflammatory diseases of the central nervous system. There is evidence of microglial diversity with distinct phenotypes exhibiting either neuroprotection and repair or neurotoxicity. However the precise molecular mechanisms underlying this diversity are still unknown. Using a model of experimental autoimmune encephalomyelitis (EAE) we performed transcriptional profiling of isolated subventricular zone microglia from the acute and chronic disease phases of EAE. We found that microglia exhibit disease phase specific gene expression signatures, that correspond to unique gene ontology functions and genomic networks. Our data demonstrate for the first time, distinct transcriptional networks of microglia activation in vivo, that suggests a role as mediators of injury or repair.

  5. Parallel evolution of chordate cis-regulatory code for development.

    Directory of Open Access Journals (Sweden)

    Laura Doglio

    2013-11-01

    Full Text Available Urochordates are the closest relatives of vertebrates and at the larval stage, possess a characteristic bilateral chordate body plan. In vertebrates, the genes that orchestrate embryonic patterning are in part regulated by highly conserved non-coding elements (CNEs, yet these elements have not been identified in urochordate genomes. Consequently the evolution of the cis-regulatory code for urochordate development remains largely uncharacterised. Here, we use genome-wide comparisons between C. intestinalis and C. savignyi to identify putative urochordate cis-regulatory sequences. Ciona conserved non-coding elements (ciCNEs are associated with largely the same key regulatory genes as vertebrate CNEs. Furthermore, some of the tested ciCNEs are able to activate reporter gene expression in both zebrafish and Ciona embryos, in a pattern that at least partially overlaps that of the gene they associate with, despite the absence of sequence identity. We also show that the ability of a ciCNE to up-regulate gene expression in vertebrate embryos can in some cases be localised to short sub-sequences, suggesting that functional cross-talk may be defined by small regions of ancestral regulatory logic, although functional sub-sequences may also be dispersed across the whole element. We conclude that the structure and organisation of cis-regulatory modules is very different between vertebrates and urochordates, reflecting their separate evolutionary histories. However, functional cross-talk still exists because the same repertoire of transcription factors has likely guided their parallel evolution, exploiting similar sets of binding sites but in different combinations.

  6. Structural insights into transcription complexes.

    Science.gov (United States)

    Berger, Imre; Blanco, Alexandre G; Boelens, Rolf; Cavarelli, Jean; Coll, Miquel; Folkers, Gert E; Nie, Yan; Pogenberg, Vivian; Schultz, Patrick; Wilmanns, Matthias; Moras, Dino; Poterszman, Arnaud

    2011-08-01

    Control of transcription allows the regulation of cell activity in response to external stimuli and research in the field has greatly benefited from efforts in structural biology. In this review, based on specific examples from the European SPINE2-COMPLEXES initiative, we illustrate the impact of structural proteomics on our understanding of the molecular basis of gene expression. While most atomic structures were obtained by X-ray crystallography, the impact of solution NMR and cryo-electron microscopy is far from being negligible. Here, we summarize some highlights and illustrate the importance of specific technologies on the structural biology of protein-protein or protein/DNA transcription complexes: structure/function analysis of components the eukaryotic basal and activated transcription machinery with focus on the TFIID and TFIIH multi-subunit complexes as well as transcription regulators such as members of the nuclear hormone receptor families. We also discuss molecular aspects of promoter recognition and epigenetic control of gene expression. Copyright © 2011 Elsevier Inc. All rights reserved.

  7. Structural insights into transcription complexes

    NARCIS (Netherlands)

    Berger, I.; Blanco, A.G.; Boelens, R.; Cavarelli, J.; Coll, M.; Folkers, G.E.; Nie, Y.; Pogenberg, V.; Schultz, P.; Wilmanns, M.; Moras, D.; Poterszman, A.

    2011-01-01

    Control of transcription allows the regulation of cell activity in response to external stimuli and research in the field has greatly benefited from efforts in structural biology. In this review, based on specific examples from the European SPINE2-COMPLEXES initiative, we illustrate the impact of

  8. Transcription factor-based biosensor

    Science.gov (United States)

    Dietrich, Jeffrey A; Keasling, Jay D

    2013-10-08

    The present invention provides for a system comprising a BmoR transcription factor, a .sigma..sup.54-RNA polymerase, and a pBMO promoter operatively linked to a reporter gene, wherein the pBMO promoter is capable of expression of the reporter gene with an activated form of the BmoR and the .sigma..sup.54-RNA polymerase.

  9. Regulating transcription traffic around DSBs.

    Science.gov (United States)

    Plosky, Brian S

    2015-05-07

    If a double-strand break (DSB) occurs and either a DNA polymerase or RNA polymerase is coming along, how do we save the train? In this issue of Molecular Cell, Ui et al. (2015) describe a connection between an elongation factor and a repressive complex to prevent transcription in proximity to a DSB.

  10. HDG1 transcription factor targets

    NARCIS (Netherlands)

    Horstman, A.; Boutilier, K.A.; Sanchez Perez, Gabino

    2015-01-01

    The AIL transcription factor BABY BOOM (BBM) is required together with the related PLETHORA proteins for embryo and root meristem development and its expression is sufficient to confer pluripotency and totipotency to somatic tissues. We show that BBM and other AIL proteins interact with multiple

  11. Transcription factors in alkaloid biosynthesis.

    Science.gov (United States)

    Yamada, Yasuyuki; Sato, Fumihiko

    2013-01-01

    Higher plants produce a large variety of low-molecular weight secondary compounds. Among them, nitrogen-containing alkaloids are the most biologically active and are often used pharmaceutically. Whereas alkaloid chemistry has been intensively investigated, alkaloid biosynthesis, including the relevant biosynthetic enzymes, genes and their regulation, and especially transcription factors, is largely unknown, as only a limited number of plant species produce certain types of alkaloids and they are difficult to study. Recently, however, several groups have succeeded in isolating the transcription factors that are involved in the biosynthesis of several types of alkaloids, including bHLH, ERF, and WRKY. Most of them show Jasmonate (JA) responsiveness, which suggests that the JA signaling cascade plays an important role in alkaloid biosynthesis. Here, we summarize the types and functions of transcription factors that have been isolated in alkaloid biosynthesis, and characterize their similarities and differences compared to those in other secondary metabolite pathways, such as phenylpropanoid and terpenoid biosyntheses. The evolution of this biosynthetic pathway and regulatory network, as well as the application of these transcription factors to metabolic engineering, is discussed.

  12. Transcriptional networks in plant immunity.

    Science.gov (United States)

    Tsuda, Kenichi; Somssich, Imre E

    2015-05-01

    Next to numerous abiotic stresses, plants are constantly exposed to a variety of pathogens within their environment. Thus, their ability to survive and prosper during the course of evolution was strongly dependent on adapting efficient strategies to perceive and to respond to such potential threats. It is therefore not surprising that modern plants have a highly sophisticated immune repertoire consisting of diverse signal perception and intracellular signaling pathways. This signaling network is intricate and deeply interconnected, probably reflecting the diverse lifestyles and infection strategies used by the multitude of invading phytopathogens. Moreover it allows signal communication between developmental and defense programs thereby ensuring that plant growth and fitness are not significantly retarded. How plants integrate and prioritize the incoming signals and how this information is transduced to enable appropriate immune responses is currently a major research area. An important finding has been that pathogen-triggered cellular responses involve massive transcriptional reprogramming within the host. Additional key observations emerging from such studies are that transcription factors (TFs) are often sites of signal convergence and that signal-regulated TFs act in concert with other context-specific TFs and transcriptional co-regulators to establish sensory transcription regulatory networks required for plant immunity.

  13. Stepwise mechanism for transcription fidelity

    Directory of Open Access Journals (Sweden)

    Zorov Savva

    2010-05-01

    Full Text Available Abstract Background Transcription is the first step of gene expression and is characterized by a high fidelity of RNA synthesis. During transcription, the RNA polymerase active centre discriminates against not just non-complementary ribo NTP substrates but also against complementary 2'- and 3'-deoxy NTPs. A flexible domain of the RNA polymerase active centre, the Trigger Loop, was shown to play an important role in this process, but the mechanisms of this participation remained elusive. Results Here we show that transcription fidelity is achieved through a multi-step process. The initial binding in the active centre is the major discrimination step for some non-complementary substrates, although for the rest of misincorporation events discrimination at this step is very poor. During the second step, non-complementary and 2'-deoxy NTPs are discriminated against based on differences in reaction transition state stabilization and partly in general base catalysis, for correct versus non-correct substrates. This step is determined by two residues of the Trigger Loop that participate in catalysis. In the following step, non-complementary and 2'-deoxy NTPs are actively removed from the active centre through a rearrangement of the Trigger Loop. The only step of discrimination against 3'-deoxy substrates, distinct from the ones above, is based on failure to orient the Trigger Loop catalytic residues in the absence of 3'OH. Conclusions We demonstrate that fidelity of transcription by multi-subunit RNA polymerases is achieved through a stepwise process. We show that individual steps contribute differently to discrimination against various erroneous substrates. We define the mechanisms and contributions of each of these steps to the overall fidelity of transcription.

  14. Auto and cross regulatory elements control Onecut expression in the ascidian nervous system.

    Science.gov (United States)

    Pezzotti, Maria Rosa; Locascio, Annamaria; Racioppi, Claudia; Fucci, Laura; Branno, Margherita

    2014-06-15

    The expression pattern of Onecut genes in the central and peripheral nervous systems is highly conserved in invertebrates and vertebrates but the regulatory networks in which they are involved are still largely unknown. The presence of three gene copies in vertebrates has revealed the functional roles of the Onecut genes in liver, pancreas and some populations of motor neurons. Urochordates have only one Onecut gene and are the closest living relatives of vertebrates and thus represent a good model system to understand its regulatory network and involvement in nervous system formation. In order to define the Onecut genetic cascade, we extensively characterized the Onecut upstream cis-regulatory DNA in the ascidian Ciona intestinalis. Electroporation experiments using a 2.5kb genomic fragment and of a series of deletion constructs identified a small region of 262bp able to reproduce most of the Onecut expression profile during embryonic development. Further analyses, both bioinformatic and in vivo using transient transgenes, permitted the identification of transcription factors responsible for Onecut endogenous expression. We provide evidence that Neurogenin is a direct activator of Onecut and that an autoregulatory loop is responsible for the maintenance of its expression. Furthermore, for the first time we propose the existence of a direct connection among Neurogenin, Onecut and Rx transcription factors in photoreceptor cell formation.

  15. Differential gene expression along the animal-vegetal axis in the ascidian embryo is maintained by a dual functional protein Foxd.

    Science.gov (United States)

    Tokuhiro, Shin-Ichi; Tokuoka, Miki; Kobayashi, Kenji; Kubo, Atsushi; Oda-Ishii, Izumi; Satou, Yutaka

    2017-05-01

    In many animal embryos, a specific gene expression pattern is established along the animal-vegetal axis soon after zygotic transcription begins. In the embryo of the ascidian Ciona intestinalis, soon after the division that separates animal and vegetal hemispheres into distinct blastomeres, maternal Gata.a and β-catenin activate specific genes in the animal and vegetal blastomeres, respectively. On the basis of these initial distinct gene expression patterns, gene regulatory networks promote animal cells to become ectodermal tissues and vegetal cells to become endomesodermal tissues and a part of the nerve cord. In the vegetal hemisphere, β-catenin directly activates Foxd, an essential transcription factor gene for specifying endomesodermal fates. In the present study, we found that Foxd also represses the expression of genes that are activated specifically in the animal hemisphere, including Dmrt1, Prdm1-r.a (Bz1), Prdm1-r.b (Bz2), and Otx. A reporter assay showed that Dmrt1 expression was directly repressed by Foxd, and a chromatin immunoprecipitation assay showed that Foxd was bound to the upstream regions of Dmrt1, Prdm1-r.a, Prdm1-r.b, and Otx. Thus, Foxd has a dual function of activating specific gene expression in the vegetal hemisphere and of repressing the expression of genes that are normally expressed in the animal hemisphere. This dual function stabilizes the initial patterning along the animal-vegetal axis by β-catenin and Gata.a.

  16. Dicty_cDB: Contig-U11222-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 77510 ) Ciona intestinalis cDNA, clone:cign079c11, 5' end... 44 3e-06 2 ( FF601093 ) Le_emcl1_06F12_M13Reverse Little Skate (Leucoraj...us laevis ... 58 7e-04 1 ( FF599758 ) Le_emcl1_11O22_M13Reverse Little Skate (Leucoraja... 58 7e-04 1 ( EJ48

  17. Dicty_cDB: Contig-U15926-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available Y875327 ) AresSEQ2501 Amorphotheca resinae pBluescript (Eco... 44 2e-08 5 ( GE416681 ) 294498490 Nasonia vit...omplete s... 44 5e-06 2 ( DY878641 ) AresSEQ6757 Amorphotheca resinae pBluescript (Eco... 44 5e-06 4 ( DR689...6 3 ( BW436239 ) Ciona intestinalis cDNA, clone:cijv034b09, 5'end,... 40 9e-06 3 ( DY876305 ) AresSEQ3731 Amorphotheca resina

  18. Investigating transcription reinitiation through in vitro approaches.

    Science.gov (United States)

    Dieci, Giorgio; Fermi, Beatrice; Bosio, Maria Cristina

    2014-01-01

    By influencing the number of RNA molecules repeatedly synthesized from the same gene, the control of transcription reinitiation has the potential to shape the transcriptome. Transcription reinitiation mechanisms have been mainly addressed in vitro, through approaches based on both crude and reconstituted systems. These studies support the notion that transcription reinitiation and its regulation rely on dedicated networks of molecular interactions within transcription machineries. At the same time, comparison with in vivo transcription rates suggests that additional mechanisms, factors and conditions must exist in the nucleus, whose biochemical elucidation is a fascinating challenge for future in vitro transcription studies.

  19. Transcription Against an Applied Force

    Science.gov (United States)

    Yin, Hong; Wang, Michelle D.; Svoboda, Karel; Landick, Robert; Block, Steven M.; Gelles, Jeff

    1995-12-01

    The force produced by a single molecule of Escherichia coli RNA polymerase during transcription was measured optically. Polymerase immobilized on a surface was used to transcribe a DNA template attached to a polystyrene bead 0.5 micrometer in diameter. The bead position was measured by interferometry while a force opposing translocation of the polymerase along the DNA was applied with an optical trap. At saturating nucleoside triphosphate concentrations, polymerase molecules stalled reversibly at a mean applied force estimated to be 14 piconewtons. This force is substantially larger than those measured for the cytoskeletal motors kinesin and myosin and exceeds mechanical loads that are estimated to oppose transcriptional elongation in vivo. The data are consistent with efficient conversion of the free energy liberated by RNA synthesis into mechanical work.

  20. Rethinking transcription coupled DNA repair.

    Science.gov (United States)

    Kamarthapu, Venu; Nudler, Evgeny

    2015-04-01

    Nucleotide excision repair (NER) is an evolutionarily conserved, multistep process that can detect a wide variety of DNA lesions. Transcription coupled repair (TCR) is a subpathway of NER that repairs the transcribed DNA strand faster than the rest of the genome. RNA polymerase (RNAP) stalled at DNA lesions mediates the recruitment of NER enzymes to the damage site. In this review we focus on a newly identified bacterial TCR pathway in which the NER enzyme UvrD, in conjunction with NusA, plays a major role in initiating the repair process. We discuss the tradeoff between the new and conventional models of TCR, how and when each pathway operates to repair DNA damage, and the necessity of pervasive transcription in maintaining genome integrity. Copyright © 2015 Elsevier Ltd. All rights reserved.

  1. Sry is a transcriptional activator.

    Science.gov (United States)

    Dubin, R A; Ostrer, H

    1994-09-01

    The SRY gene functions as a genetic switch in gonadal ridge initiating testis determination. The mouse Sry and human SRY open reading frames (ORFs) share a conserved DNA-binding domain (the HMG-box) yet exhibit no additional homology outside this region. As judged by the accumulation of lacZ-SRY hybrid proteins in the nucleus, both the human and mouse SRY ORFs contain a nuclear localization signal. The mouse Sry HMG-box domain selectively binds the sequence NACAAT in vitro when challenged with a random pool of oligonucleotides and binds AACAAT with the highest affinity. When put under the control of a heterologous promotor, the mouse Sry gene activated transcription of a reporter gene containing multiple copies of the AACAAT binding site. Activation was likewise observed for a GAL4-responsive reporter gene, when the mouse Sry gene was linked to the DNA-binding domain of GAL4. Using this system, the activation function was mapped to a glutamine/histidine-rich domain. In addition, LexA-mouse Sry fusion genes activated a LexA-responsive reporter gene in yeast. In contrast, a GAL4-human SRY fusion gene did not cause transcriptional activation. These studies suggest that both the human and the mouse SRY ORFs encode nuclear, DNA-binding proteins and that the mouse Sry ORF can function as a transcriptional activator with separable DNA-binding and activator domains.

  2. Functionality of intergenic transcription: an evolutionary comparison.

    Directory of Open Access Journals (Sweden)

    Philipp Khaitovich

    2006-10-01

    Full Text Available Although a large proportion of human transcription occurs outside the boundaries of known genes, the functional significance of this transcription remains unknown. We have compared the expression patterns of known genes as well as intergenic transcripts within the ENCODE regions between humans and chimpanzees in brain, heart, testis, and lymphoblastoid cell lines. We find that intergenic transcripts show patterns of tissue-specific conservation of their expression, which are comparable to exonic transcripts of known genes. This suggests that intergenic transcripts are subject to functional constraints that restrict their rate of evolutionary change as well as putative positive selection to an extent comparable to that of classical protein-coding genes. In brain and testis, we find that part of this intergenic transcription is caused by widespread use of alternative promoters. Further, we find that about half of the expression differences between humans and chimpanzees are due to intergenic transcripts.

  3. Functionality of Intergenic Transcription: An Evolutionary Comparison

    Science.gov (United States)

    Visagie, Johann; Giger, Thomas; Joerchel, Sabrina; Petzold, Ekkehard; Green, Richard E; Lachmann, Michael; Pääbo, Svante

    2006-01-01

    Although a large proportion of human transcription occurs outside the boundaries of known genes, the functional significance of this transcription remains unknown. We have compared the expression patterns of known genes as well as intergenic transcripts within the ENCODE regions between humans and chimpanzees in brain, heart, testis, and lymphoblastoid cell lines. We find that intergenic transcripts show patterns of tissue-specific conservation of their expression, which are comparable to exonic transcripts of known genes. This suggests that intergenic transcripts are subject to functional constraints that restrict their rate of evolutionary change as well as putative positive selection to an extent comparable to that of classical protein-coding genes. In brain and testis, we find that part of this intergenic transcription is caused by widespread use of alternative promoters. Further, we find that about half of the expression differences between humans and chimpanzees are due to intergenic transcripts. PMID:17040132

  4. Giardia intestinalis: conservation of the variant-specific surface protein VSP417-1 (TSA417) and identification of a divergent homologue encoded at a duplicated locus in genetic group II isolates.

    Science.gov (United States)

    Ey, P L; Darby, J M

    1998-11-01

    The stability of the gene encoding TSA417, a 72-kDa variant-specific surface protein (VSP) produced by trophozoites of Giardia intestinalis isolate WB-C6, was investigated in isolates of similar (Assemblage A / Group I) or distinct (Assemblage A / Group II) genotype. Using primers specific for the WB-C6 tsa417 gene, DNA amplified in polymerase chain reactions from genomic DNA indicated the presence, in every isolate, of an intact coding sequence possessing conserved restriction sites diagnostic for this locus (herein designated vsp417-1). Sequence analysis of the DNA amplified from the genomes of genetic Group I ("A-I") isolates revealed complete identity with the published WB-C6 tsa417 (vsp417-1(A-I)) sequence. Equivalent products, amplified from the genomes of genetic Group II ("A-II") isolates, similarly yielded an invariant and apparently allelic 2142-bp coding sequence (designated vsp417-1(A-II)) possessing 79% nucleotide identity with vsp417-1(A-I) and polymorphisms unique to Group II organisms. The encoded polypeptides (VSP417-1(A-I) and VSP417-1(A-II)) are identical at 75% of amino acid positions. Substitutions are concentrated within the N-terminal portions of the proteins, but the overall structure of VSP417-1 has changed little during the evolution of the Group I and Group II genotypes from their common clonal ancestor. An additional 0.7-kb DNA, representing a separate locus (vsp417-5) encoding a 22.3-kDa VSP, was amplified from genetic Group II genomes exclusively but only using particular primer combinations. The vsp417-5(A-II) gene exhibits >85% sequence identity with the 5' and 3' segments of vsp417-1(A-I) and vsp417-1(A-II) but it lacks a 1482-bp segment that comprises the central portion of the vsp417-1 locus. Excision of this segment seems to have occurred by intragenic recombination, possibly initiated by a stem loop formed between palindromic sequences which border the 1482-bp segment within vsp417-1 but which are contiguous in vsp417-5(A

  5. Mutual interdependence of splicing and transcription elongation.

    Science.gov (United States)

    Brzyżek, Grzegorz; Świeżewski, Szymon

    2015-01-01

    Transcription and splicing are intrinsically linked, as splicing needs a pre-mRNA substrate to commence. The more nuanced view is that the rate of transcription contributes to splicing regulation. On the other hand there is accumulating evidence that splicing has an active role in controlling transcription elongation by DNA-dependent RNA polymerase II (RNAP II). We briefly review those mechanisms and propose a unifying model where splicing controls transcription elongation to provide an optimal timing for successive rounds of splicing.

  6. The great repression: chromatin and cryptic transcription.

    Science.gov (United States)

    Hennig, Bianca P; Fischer, Tamás

    2013-01-01

    The eukaryotic chromatin structure is essential in correctly defining transcription units. Impairing this structure can activate cryptic promoters, and lead to the accumulation of aberrant RNA transcripts. Here we discuss critical pathways that are responsible for the repression of cryptic transcription and the maintenance of genome integrity.

  7. TAF7: traffic controller in transcription initiation.

    Science.gov (United States)

    Gegonne, Anne; Devaiah, Ballachanda N; Singer, Dinah S

    2013-01-01

    TAF7, a component of the TFIID complex, controls the first steps of transcription. It interacts with and regulates the enzymatic activities of transcription factors that regulate RNA polymerase II progression. Its diverse functions in transcription initiation are consistent with its essential role in cell proliferation.

  8. Interplay between DNA supercoiling and transcription elongation.

    Science.gov (United States)

    Ma, Jie; Wang, Michelle

    2014-01-01

    Transcription-coupled DNA supercoiling has been shown to be an important regulator of transcription that is broadly present in the cell. Here we review experimental work which shows that RNA polymerase is a powerful torsional motor that can alter DNA topology and structure, and DNA supercoiling in turn directly affects transcription elongation.

  9. A unified model for yeast transcript definition.

    Science.gov (United States)

    de Boer, Carl G; van Bakel, Harm; Tsui, Kyle; Li, Joyce; Morris, Quaid D; Nislow, Corey; Greenblatt, Jack F; Hughes, Timothy R

    2014-01-01

    Identifying genes in the genomic context is central to a cell's ability to interpret the genome. Yet, in general, the signals used to define eukaryotic genes are poorly described. Here, we derived simple classifiers that identify where transcription will initiate and terminate using nucleic acid sequence features detectable by the yeast cell, which we integrate into a Unified Model (UM) that models transcription as a whole. The cis-elements that denote where transcription initiates function primarily through nucleosome depletion, and, using a synthetic promoter system, we show that most of these elements are sufficient to initiate transcription in vivo. Hrp1 binding sites are the major characteristic of terminators; these binding sites are often clustered in terminator regions and can terminate transcription bidirectionally. The UM predicts global transcript structure by modeling transcription of the genome using a hidden Markov model whose emissions are the outputs of the initiation and termination classifiers. We validated the novel predictions of the UM with available RNA-seq data and tested it further by directly comparing the transcript structure predicted by the model to the transcription generated by the cell for synthetic DNA segments of random design. We show that the UM identifies transcription start sites more accurately than the initiation classifier alone, indicating that the relative arrangement of promoter and terminator elements influences their function. Our model presents a concrete description of how the cell defines transcript units, explains the existence of nongenic transcripts, and provides insight into genome evolution.

  10. 18 CFR 1b.12 - Transcripts.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Transcripts. 1b.12 Section 1b.12 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF ENERGY GENERAL RULES RULES RELATING TO INVESTIGATIONS § 1b.12 Transcripts. Transcripts, if any,...

  11. Evolutionary Transition of Promoter and Gene Body DNA Methylation across Invertebrate-Vertebrate Boundary.

    Science.gov (United States)

    Keller, Thomas E; Han, Priscilla; Yi, Soojin V

    2016-04-01

    Genomes of invertebrates and vertebrates exhibit highly divergent patterns of DNA methylation. Invertebrate genomes tend to be sparsely methylated, and DNA methylation is mostly targeted to a subset of transcription units (gene bodies). In a drastic contrast, vertebrate genomes are generally globally and heavily methylated, punctuated by the limited local hypo-methylation of putative regulatory regions such as promoters. These genomic differences also translate into functional differences in DNA methylation and gene regulation. Although promoter DNA methylation is an important regulatory component of vertebrate gene expression, its role in invertebrate gene regulation has been little explored. Instead, gene body DNA methylation is associated with expression of invertebrate genes. However, the evolutionary steps leading to the differentiation of invertebrate and vertebrate genomic DNA methylation remain unresolved. Here we analyzed experimentally determined DNA methylation maps of several species across the invertebrate-vertebrate boundary, to elucidate how vertebrate gene methylation has evolved. We show that, in contrast to the prevailing idea, a substantial number of promoters in an invertebrate basal chordate Ciona intestinalis are methylated. Moreover, gene expression data indicate significant, epigenomic context-dependent associations between promoter methylation and expression in C. intestinalis. However, there is no evidence that promoter methylation in invertebrate chordate has been evolutionarily maintained across the invertebrate-vertebrate boundary. Rather, body-methylated invertebrate genes preferentially obtain hypo-methylated promoters among vertebrates. Conversely, promoter methylation is preferentially found in lineage- and tissue-specific vertebrate genes. These results provide important insights into the evolutionary origin of epigenetic regulation of vertebrate gene expression. © The Author(s) 2015. Published by Oxford University Press on behalf

  12. The synapsin gene family in basal chordates: evolutionary perspectives in metazoans

    Directory of Open Access Journals (Sweden)

    De Bernardi Fiorenza

    2010-01-01

    Full Text Available Abstract Background Synapsins are neuronal phosphoproteins involved in several functions correlated with both neurotransmitter release and synaptogenesis. The comprehension of the basal role of the synapsin family is hampered in vertebrates by the existence of multiple synapsin genes. Therefore, studying homologous genes in basal chordates, devoid of genome duplication, could help to achieve a better understanding of the complex functions of these proteins. Results In this study we report the cloning and characterization of the Ciona intestinalis and amphioxus Branchiostoma floridae synapsin transcripts and the definition of their gene structure using available C. intestinalis and B. floridae genomic sequences. We demonstrate the occurrence, in both model organisms, of a single member of the synapsin gene family. Full-length synapsin genes were identified in the recently sequenced genomes of phylogenetically diverse metazoans. Comparative genome analysis reveals extensive conservation of the SYN locus in several metazoans. Moreover, developmental expression studies underline that synapsin is a neuronal-specific marker in basal chordates and is expressed in several cell types of PNS and in many, if not all, CNS neurons. Conclusion Our study demonstrates that synapsin genes are metazoan genes present in a single copy per genome, except for vertebrates. Moreover, we hypothesize that, during the evolution of synapsin proteins, new domains are added at different stages probably to cope up with the increased complexity in the nervous system organization. Finally, we demonstrate that protochordate synapsin is restricted to the post-mitotic phase of CNS development and thereby is a good marker of postmitotic neurons.

  13. Transcriptional and post-transcriptional regulation of a NAC1 transcription factor in Medicago truncatula roots.

    Science.gov (United States)

    D'haeseleer, Katrien; Den Herder, Griet; Laffont, Carole; Plet, Julie; Mortier, Virginie; Lelandais-Brière, Christine; De Bodt, Stefanie; De Keyser, Annick; Crespi, Martin; Holsters, Marcelle; Frugier, Florian; Goormachtig, Sofie

    2011-08-01

    • Legume roots develop two types of lateral organs, lateral roots and nodules. Nodules develop as a result of a symbiotic interaction with rhizobia and provide a niche for the bacteria to fix atmospheric nitrogen for the plant. • The Arabidopsis NAC1 transcription factor is involved in lateral root formation, and is regulated post-transcriptionally by miRNA164 and by SINAT5-dependent ubiquitination. We analyzed in Medicago truncatula the role of the closest NAC1 homolog in lateral root formation and in nodulation. • MtNAC1 shows a different expression pattern in response to auxin than its Arabidopsis homolog and no changes in lateral root number or nodulation were observed in plants affected in MtNAC1 expression. In addition, no interaction was found with SINA E3 ligases, suggesting that post-translational regulation of MtNAC1 does not occur in M. truncatula. Similar to what was found in Arabidopsis, a conserved miR164 target site was retrieved in MtNAC1, which reduced protein accumulation of a GFP-miR164 sensor. Furthermore, miR164 and MtNAC1 show an overlapping expression pattern in symbiotic nodules, and overexpression of this miRNA led to a reduction in nodule number. • This work suggests that regulatory pathways controlling a conserved transcription factor are complex and divergent between M. truncatula and Arabidopsis.

  14. Transcriptional Regulation of Heart Development in Zebrafish

    Science.gov (United States)

    Lu, Fei; Langenbacher, Adam D.; Chen, Jau-Nian

    2016-01-01

    Cardiac transcription factors orchestrate the complex cellular and molecular events required to produce a functioning heart. Misregulation of the cardiac transcription program leads to embryonic developmental defects and is associated with human congenital heart diseases. Recent studies have expanded our understanding of the regulation of cardiac gene expression at an additional layer, involving the coordination of epigenetic and transcriptional regulators. In this review, we highlight and discuss discoveries made possible by the genetic and embryological tools available in the zebrafish model organism, with a focus on the novel functions of cardiac transcription factors and epigenetic and transcriptional regulatory proteins during cardiogenesis. PMID:27148546

  15. Contribution of transcription to animal early development.

    Science.gov (United States)

    Wang, Jianbin; Davis, Richard E

    2014-01-01

    In mature gametes and during the oocyte-to-embryo transition, transcription is generally silenced and gene expression is post-transcriptionally regulated. However, we recently discovered that major transcription can occur immediately after fertilization, prior to pronuclear fusion, and in the first cell division of the oocyte-to-embryo transition in the nematode Ascaris suum. We postulate that the balance between transcriptional and post-transcriptional regulation during the oocyte-to-embryo transition may largely be determined by cell cycle length and thus the time available for the genome to be transcribed.

  16. Transcription factories: genetic programming in three dimensions.

    Science.gov (United States)

    Edelman, Lucas Brandon; Fraser, Peter

    2012-04-01

    Among the most intensively studied systems in molecular biology is the eukaryotic transcriptional apparatus, which expresses genes in a regulated manner across hundreds of different cell types. Several studies over the past few years have added weight to the concept that transcription takes place within discrete 'transcription factories' assembled inside the cell nucleus. These studies apply innovative technical approaches to gain insights into the molecular constituents, dynamical behaviour and organizational regulators of transcription factories, providing exciting insights into the spatial dimension of transcriptional control.

  17. Contributions of in vitro transcription to the understanding of human RNA polymerase III transcription.

    Science.gov (United States)

    Dumay-Odelot, Hélène; Durrieu-Gaillard, Stéphanie; El Ayoubi, Leyla; Parrot, Camila; Teichmann, Martin

    2014-01-01

    Human RNA polymerase III transcribes small untranslated RNAs that contribute to the regulation of essential cellular processes, including transcription, RNA processing and translation. Analysis of this transcription system by in vitro transcription techniques has largely contributed to the discovery of its transcription factors and to the understanding of the regulation of human RNA polymerase III transcription. Here we review some of the key steps that led to the identification of transcription factors and to the definition of minimal promoter sequences for human RNA polymerase III transcription.

  18. The Journey of a Transcription Factor

    DEFF Research Database (Denmark)

    Pireyre, Marie

    MYBs to activate transcription of GLS biosynthetic genes. A lot is known about transcriptional regulation of these nine GLS regulators. This thesis aimed at identifying regulatory mechanisms at the protein level, allowing rapid and specific regulation of transcription factors using GLS as a model....... The general introduction and the first chapter provide background on protein level regulation and underline the importance of these mechanisms in regulating transcription factors. The remaining chapters report the identification of multiple new regulators of MYB transcription factors, potentially involved...... in their regulation at multiple steps of their activation. Plant signaling in connection with transcription factor regulation is an exciting field, allowing research on multiple regulatory mechanisms. This thesis shed light on the importance of integrating all steps of transcription factor activation in a regulatory...

  19. Transcriptional networks in leaf senescence.

    Science.gov (United States)

    Schippers, Jos H M

    2015-10-01

    Plant senescence is a natural phenomenon known for the appearance of beautiful autumn colors and the ripening of cereals in the field. Senescence is a controlled process that plants utilize to remobilize nutrients from source leaves to developing tissues. While during the past decades, molecular components underlying the onset of senescence have been intensively studied, knowledge remains scarce on the age-dependent mechanisms that control the onset of senescence. Recent advances have uncovered transcriptional networks regulating the competence to senesce. Here, gene regulatory networks acting as internal timing mechanisms for the onset of senescence are highlighted, illustrating that early and late leaf developmental phases are highly connected.

  20. The transcriptional regulation of pluripotency

    Institute of Scientific and Technical Information of China (English)

    Jia-Chi Yeo; Huck-Hui Ng

    2013-01-01

    The defining features of embryonic stem cells (ESCs) are their self-renewing and pluripotent capacities.Indeed,the ability to give rise into all cell types within the organism not only allows ESCs to function as an ideal in vitro tool to study embryonic development,but also offers great therapeutic potential within the field of regenerative medicine.However,it is also this same remarkable developmental plasticity that makes the efficient control of ESC differentiation into the desired cell type very difficult.Therefore,in order to harness ESCs for clinical applications,a detailed understanding of the molecular and cellular mechanisms controlling ESC pluripotency and lineage commitment is necessary.In this respect,through a variety of transcriptomic approaches,ESC pluripotency has been found to be regulated by a system of ESC-associated transcription factors; and the external signalling environment also acts as a key factor in modulating the ESC transcriptome.Here in this review,we summarize our current understanding of the transcriptional regulatory network in ESCs,discuss how the control of various signalling pathways could influence pluripotency,and provide a future outlook of ESC research.

  1. DBD: a transcription factor prediction database.

    Science.gov (United States)

    Kummerfeld, Sarah K; Teichmann, Sarah A

    2006-01-01

    Regulation of gene expression influences almost all biological processes in an organism; sequence-specific DNA-binding transcription factors are critical to this control. For most genomes, the repertoire of transcription factors is only partially known. Hitherto transcription factor identification has been largely based on genome annotation pipelines that use pairwise sequence comparisons, which detect only those factors similar to known genes, or on functional classification schemes that amalgamate many types of proteins into the category of 'transcription factor'. Using a novel transcription factor identification method, the DBD transcription factor database fills this void, providing genome-wide transcription factor predictions for organisms from across the tree of life. The prediction method behind DBD identifies sequence-specific DNA-binding transcription factors through homology using profile hidden Markov models (HMMs) of domains. Thus, it is limited to factors that are homologus to those HMMs. The collection of HMMs is taken from two existing databases (Pfam and SUPERFAMILY), and is limited to models that exclusively detect transcription factors that specifically recognize DNA sequences. It does not include basal transcription factors or chromatin-associated proteins, for instance. Based on comparison with experimentally verified annotation, the prediction procedure is between 95% and 99% accurate. Between one quarter and one-half of our genome-wide predicted transcription factors represent previously uncharacterized proteins. The DBD (www.transcriptionfactor.org) consists of predicted transcription factor repertoires for 150 completely sequenced genomes, their domain assignments and the hand curated list of DNA-binding domain HMMs. Users can browse, search or download the predictions by genome, domain family or sequence identifier, view families of transcription factors based on domain architecture and receive predictions for a protein sequence.

  2. Mitotic Transcriptional Activation: Clearance of Actively Engaged Pol II via Transcriptional Elongation Control in Mitosis.

    Science.gov (United States)

    Liang, Kaiwei; Woodfin, Ashley R; Slaughter, Brian D; Unruh, Jay R; Box, Andrew C; Rickels, Ryan A; Gao, Xin; Haug, Jeffrey S; Jaspersen, Sue L; Shilatifard, Ali

    2015-11-05

    Although it is established that some general transcription factors are inactivated at mitosis, many details of mitotic transcription inhibition (MTI) and its underlying mechanisms are largely unknown. We have identified mitotic transcriptional activation (MTA) as a key regulatory step to control transcription in mitosis for genes with transcriptionally engaged RNA polymerase II (Pol II) to activate and transcribe until the end of the gene to clear Pol II from mitotic chromatin, followed by global impairment of transcription reinitiation through MTI. Global nascent RNA sequencing and RNA fluorescence in situ hybridization demonstrate the existence of transcriptionally engaged Pol II in early mitosis. Both genetic and chemical inhibition of P-TEFb in mitosis lead to delays in the progression of cell division. Together, our study reveals a mechanism for MTA and MTI whereby transcriptionally engaged Pol II can progress into productive elongation and finish transcription to allow proper cellular division.

  3. New developments in the second heart field.

    Science.gov (United States)

    Zaffran, Stéphane; Kelly, Robert G

    2012-07-01

    During cardiac looping the heart tube elongates by addition of progenitor cells from adjacent pharyngeal mesoderm to the arterial and venous poles. This cell population, termed the second heart field, was first identified ten years ago and many studies in the intervening decade have refined our understanding of how heart tube elongation takes place and identified signaling pathways that regulate proliferation and differentiation during progressive contribution of second heart field cells to the embryonic heart. It has also become apparent that defective second heart field development results in common congenital heart anomalies affecting both the conotruncal region and venous pole of the heart, including atrial and atrioventricular septal defects. In this review we focus on a series of recent papers that have identified new regulators of second heart field development, in particular the retinoic acid signaling pathway and HOX, SIX and EYA transcription factors. We also discuss new findings concerning the regulation of fibroblast growth factor signaling during second heart field deployment and studies that have implicated FGF10 and FGF3 in outflow tract development in addition to FGF8. Second heart field derived parts of the heart share common progenitor cells in pharyngeal mesoderm with craniofacial skeletal muscles and recent findings from xenopus, zebrafish and the protochordate Ciona intestinalis provide insights into the evolution of the second heart field during vertebrate radiation.

  4. Accessorizing the human mitochondrial transcription machinery.

    Science.gov (United States)

    Bestwick, Megan L; Shadel, Gerald S

    2013-06-01

    The human genome comprises large chromosomes in the nucleus and mitochondrial DNA (mtDNA) housed in the dynamic mitochondrial network. Human cells contain up to thousands of copies of the double-stranded, circular mtDNA molecule that encodes essential subunits of the oxidative phosphorylation complexes and the rRNAs and tRNAs needed to translate these in the organelle matrix. Transcription of human mtDNA is directed by a single-subunit RNA polymerase, POLRMT, which requires two primary transcription factors, TFB2M (transcription factor B2, mitochondrial) and TFAM (transcription factor A, mitochondrial), to achieve basal regulation of the system. Here, we review recent advances in understanding the structure and function of the primary human transcription machinery and the other factors that facilitate steps in transcription beyond initiation and provide more intricate control over the system. Copyright © 2013 Elsevier Ltd. All rights reserved.

  5. The molecular basis of eucaryotic transcription.

    Science.gov (United States)

    Kornberg, R D

    2007-12-01

    Thanks to the Nobel Foundation for permission to publish this Lecture. We report here the Nobel Lecture delivered by Professor RD Kornberg describing his research in the understanding of transcription in eucaryotes. The amazing work by Professor Kornberg goes from the discovery of the nucleosome to the structural and functional studies of pol II transcription complexes. His research sheds light on fundamental molecular biology problems such as transcription initiation, fidelity of transcription, RNA release at the end of transcription, and many more. This is a beautiful report on how structural and functional studies can be combined to really understand in an accurate and detailed way how proteins combine in huge molecular complexes to regulate one of the most important cellular processes: gene transcription.

  6. Structural basis of eukaryotic gene transcription.

    Science.gov (United States)

    Boeger, Hinrich; Bushnell, David A; Davis, Ralph; Griesenbeck, Joachim; Lorch, Yahli; Strattan, J Seth; Westover, Kenneth D; Kornberg, Roger D

    2005-02-07

    An RNA polymerase II promoter has been isolated in transcriptionally activated and repressed states. Topological and nuclease digestion analyses have revealed a dynamic equilibrium between nucleosome removal and reassembly upon transcriptional activation, and have further shown that nucleosomes are removed by eviction of histone octamers rather than by sliding. The promoter, once exposed, assembles with RNA polymerase II, general transcription factors, and Mediator in a approximately 3 MDa transcription initiation complex. X-ray crystallography has revealed the structure of RNA polymerase II, in the act of transcription, at atomic resolution. Extension of this analysis has shown how nucleotides undergo selection, polymerization, and eventual release from the transcribing complex. X-ray and electron crystallography have led to a picture of the entire transcription initiation complex, elucidating the mechanisms of promoter recognition, DNA unwinding, abortive initiation, and promoter escape.

  7. Catching transcriptional regulation by thermostatistical modeling

    Science.gov (United States)

    Frank, Till D.; Cheong, Alex; Okada-Hatakeyama, Mariko; Kholodenko, Boris N.

    2012-08-01

    Gene expression is frequently regulated by multiple transcription factors (TFs). Thermostatistical methods allow for a quantitative description of interactions between TFs, RNA polymerase and DNA, and their impact on the transcription rates. We illustrate three different scales of the thermostatistical approach: the microscale of TF molecules, the mesoscale of promoter energy levels and the macroscale of transcriptionally active and inactive cells in a cell population. We demonstrate versatility of combinatorial transcriptional activation by exemplifying logic functions, such as AND and OR gates. We discuss a metric for cell-to-cell transcriptional activation variability known as Fermi entropy. Suitability of thermostatistical modeling is illustrated by describing the experimental data on transcriptional induction of NFκB and the c-Fos protein.

  8. Systematic genetic analysis of transcription factors to map the fission yeast transcription-regulatory network.

    Science.gov (United States)

    Chua, Gordon

    2013-12-01

    Mapping transcriptional-regulatory networks requires the identification of target genes, binding specificities and signalling pathways of transcription factors. However, the characterization of each transcription factor sufficiently for deciphering such networks remains laborious. The recent availability of overexpression and deletion strains for almost all of the transcription factor genes in the fission yeast Schizosaccharomyces pombe provides a valuable resource to better investigate transcription factors using systematic genetics. In the present paper, I review and discuss the utility of these strain collections combined with transcriptome profiling and genome-wide chromatin immunoprecipitation to identify the target genes of transcription factors.

  9. Transcription in Archaea: in vitro transcription assays for mjRNAP.

    Science.gov (United States)

    Smollett, Katherine; Blombach, Fabian; Werner, Finn

    2015-01-01

    The fully recombinant Methanocaldococcus jannaschii RNA polymerase allows for a detailed dissection of the different stages of the transcription. In the previous chapter, we discussed how to purify the different components of the M. jannaschii transcription system, the RNA polymerase subunits, and general transcription factors and how to assemble a functional M. jannaschii enzyme. Standard in vitro transcription assays can be used to examine the different stages of transcription. In this chapter, we describe how some of these assays have been optimized for M. jannaschii RNA polymerase, which transcribes at much higher temperatures than many other transcription complexes.

  10. Transcriptional Regulation and Macrophage Differentiation.

    Science.gov (United States)

    Hume, David A; Summers, Kim M; Rehli, Michael

    2016-06-01

    Monocytes and macrophages are professional phagocytes that occupy specific niches in every tissue of the body. Their survival, proliferation, and differentiation are controlled by signals from the macrophage colony-stimulating factor receptor (CSF-1R) and its two ligands, CSF-1 and interleukin-34. In this review, we address the developmental and transcriptional relationships between hematopoietic progenitor cells, blood monocytes, and tissue macrophages as well as the distinctions from dendritic cells. A huge repertoire of receptors allows monocytes, tissue-resident macrophages, or pathology-associated macrophages to adapt to specific microenvironments. These processes create a broad spectrum of macrophages with different functions and individual effector capacities. The production of large transcriptomic data sets in mouse, human, and other species provides new insights into the mechanisms that underlie macrophage functional plasticity.

  11. Balanced Branching in Transcription Termination

    CERN Document Server

    Harrington, K J; Liang, S

    2000-01-01

    The theory of stochastic transcription termination based on free-energy competition requires two or more reaction rates to be delicately balanced over a wide range of physical conditions. A large body of work on glasses and large molecules suggests that this should be impossible in such a large system in the absence of a new organizing principle of matter. We review the experimental literature of termination and find no evidence for such a principle but many troubling inconsistencies, most notably anomalous memory effects. These suggest that termination has a deterministic component and may conceivably be not stochastic at all. We find that a key experiment by Wilson and von Hippel allegedly refuting deterministic termination was an incorrectly analyzed regulatory effect of Mg2+ binding.

  12. Harnessing transcription for bioproduction in cyanobacteria

    DEFF Research Database (Denmark)

    Stensjö, Karin; Vavitsas, Konstantinos; Tyystjärvi, Taina

    2017-01-01

    of cyanobacteria. A wide variety of expression systems will be required to adjust both the expression of heterologous enzyme(s) and metabolic routes to the best possible balance, allowing the optimal production of a particular substance. In bacteria, transcription, especially the initiation of transcription, has...... a central role in adjusting gene expression and thus also metabolic fluxes of cells according to environmental cues. Here we summarize the recent progress in developing tools for efficient cyanofactories, focusing especially on transcriptional regulation....

  13. Thermodynamic and kinetic modeling of transcriptional pausing

    OpenAIRE

    Tadigotla, Vasisht R.; Maoiléidigh, Dáibhid Ó; Sengupta, Anirvan M.; Epshtein, Vitaly; Ebright, Richard H.; Nudler, Evgeny; Ruckenstein, Andrei E.

    2006-01-01

    We present a statistical mechanics approach for the prediction of backtracked pauses in bacterial transcription elongation derived from structural models of the transcription elongation complex (EC). Our algorithm is based on the thermodynamic stability of the EC along the DNA template calculated from the sequence-dependent free energy of DNA–DNA, DNA–RNA, and RNA–RNA base pairing associated with (i) the translocational and size fluctuations of the transcription bubble; (ii) changes in the as...

  14. A New Vaccinia Virus Intermediate Transcription Factor

    OpenAIRE

    Sanz, Patrick; Moss, Bernard

    1998-01-01

    Transcription of the vaccinia virus genome is mediated by a virus-encoded multisubunit DNA-dependent RNA polymerase in conjunction with early-, intermediate-, and late-stage-specific factors. Previous studies indicated that two virus-encoded proteins (capping enzyme and VITF-1) and one unidentified cellular protein (VITF-2) are required for specific transcription of an intermediate promoter template in vitro. We have now extensively purified an additional virus-induced intermediate transcript...

  15. Control and signal processing by transcriptional interference

    OpenAIRE

    2009-01-01

    A transcriptional activator can suppress gene expression by interfering with transcription initiated by another activator. Transcriptional interference has been increasingly recognized as a regulatory mechanism of gene expression. The signals received by the two antagonistically acting activators are combined by the polymerase trafficking along the DNA. We have designed a dual-control genetic system in yeast to explore this antagonism systematically. Antagonism by an upstream activator bears ...

  16. Evolutionary dynamics of prokaryotic transcriptional regulatory networks.

    Science.gov (United States)

    Madan Babu, M; Teichmann, Sarah A; Aravind, L

    2006-04-28

    The structure of complex transcriptional regulatory networks has been studied extensively in certain model organisms. However, the evolutionary dynamics of these networks across organisms, which would reveal important principles of adaptive regulatory changes, are poorly understood. We use the known transcriptional regulatory network of Escherichia coli to analyse the conservation patterns of this network across 175 prokaryotic genomes, and predict components of the regulatory networks for these organisms. We observe that transcription factors are typically less conserved than their target genes and evolve independently of them, with different organisms evolving distinct repertoires of transcription factors responding to specific signals. We show that prokaryotic transcriptional regulatory networks have evolved principally through widespread tinkering of transcriptional interactions at the local level by embedding orthologous genes in different types of regulatory motifs. Different transcription factors have emerged independently as dominant regulatory hubs in various organisms, suggesting that they have convergently acquired similar network structures approximating a scale-free topology. We note that organisms with similar lifestyles across a wide phylogenetic range tend to conserve equivalent interactions and network motifs. Thus, organism-specific optimal network designs appear to have evolved due to selection for specific transcription factors and transcriptional interactions, allowing responses to prevalent environmental stimuli. The methods for biological network analysis introduced here can be applied generally to study other networks, and these predictions can be used to guide specific experiments.

  17. Heritable change caused by transient transcription errors.

    Directory of Open Access Journals (Sweden)

    Alasdair J E Gordon

    2013-06-01

    Full Text Available Transmission of cellular identity relies on the faithful transfer of information from the mother to the daughter cell. This process includes accurate replication of the DNA, but also the correct propagation of regulatory programs responsible for cellular identity. Errors in DNA replication (mutations and protein conformation (prions can trigger stable phenotypic changes and cause human disease, yet the ability of transient transcriptional errors to produce heritable phenotypic change ('epimutations' remains an open question. Here, we demonstrate that transcriptional errors made specifically in the mRNA encoding a transcription factor can promote heritable phenotypic change by reprogramming a transcriptional network, without altering DNA. We have harnessed the classical bistable switch in the lac operon, a memory-module, to capture the consequences of transient transcription errors in living Escherichia coli cells. We engineered an error-prone transcription sequence (A9 run in the gene encoding the lac repressor and show that this 'slippery' sequence directly increases epigenetic switching, not mutation in the cell population. Therefore, one altered transcript within a multi-generational series of many error-free transcripts can cause long-term phenotypic consequences. Thus, like DNA mutations, transcriptional epimutations can instigate heritable changes that increase phenotypic diversity, which drives both evolution and disease.

  18. Swinger RNAs with sharp switches between regular transcription and transcription systematically exchanging ribonucleotides: Case studies.

    Science.gov (United States)

    Seligmann, Hervé

    2015-09-01

    During RNA transcription, DNA nucleotides A,C,G, T are usually matched by ribonucleotides A, C, G and U. However occasionally, this rule does not apply: transcript-DNA homologies are detectable only assuming systematic exchanges between ribonucleotides. Nine symmetric (X ↔ Y, e.g. A ↔ C) and fourteen asymmetric (X ↔ Y ↔ Z, e.g. A ↔ C ↔ G) exchanges exist, called swinger transcriptions. Putatively, polymerases occasionally stabilize in unspecified swinger conformations, possibly similar to transient conformations causing punctual misinsertions. This predicts chimeric transcripts, part regular, part swinger-transformed, reflecting polymerases switching to swinger polymerization conformation(s). Four chimeric Genbank transcripts (three from human mitochondrion and one murine cytosolic) are described here: (a) the 5' and 3' extremities reflect regular polymerization, the intervening sequence exchanges systematically between ribonucleotides (swinger rule G ↔ U, transcript (1), with sharp switches between regular and swinger sequences; (b) the 5' half is 'normal', the 3' half systematically exchanges ribonucleotides (swinger rule C ↔ G, transcript (2), with an intercalated sequence lacking homology; (c) the 3' extremity fits A ↔ G exchanges (10% of transcript length), the 5' half follows regular transcription; the intervening region seems a mix of regular and A ↔ G transcriptions (transcript 3); (d) murine cytosolic transcript 4 switches to A ↔ U + C ↔ G, and is fused with A ↔ U + C ↔ G swinger transformed precursor rRNA. In (c), each concomitant transcript 5' and 3' extremities match opposite genome strands. Transcripts 3 and 4 combine transcript fusions with partial swinger transcriptions. Occasional (usually sharp) switches between regular and swinger transcriptions reveal greater coding potential than detected until now, suggest stable polymerase swinger conformations.

  19. Transcriptional interference by RNA polymerase pausing and dislodgement of transcription factors.

    Science.gov (United States)

    Palmer, Adam C; Egan, J Barry; Shearwin, Keith E

    2011-01-01

    Transcriptional interference is the in cis suppression of one transcriptional process by another. Mathematical modeling shows that promoter occlusion by elongating RNA polymerases cannot produce strong interference. Interference may instead be generated by (1) dislodgement of slow-to-assemble pre-initiation complexes and transcription factors and (2) prolonged occlusion by paused RNA polymerases.

  20. Transcription of Byzantine Chant - Problems, Possibilities, Formats

    DEFF Research Database (Denmark)

    Troelsgård, Christian

    2007-01-01

    Discusses the problems and possibilities for transsription of Byzantine chant on the basis of medieval musical manuscripts. A relatively 'neutral' style of transcription is suggested for musicological purposes.......Discusses the problems and possibilities for transsription of Byzantine chant on the basis of medieval musical manuscripts. A relatively 'neutral' style of transcription is suggested for musicological purposes....

  1. Transcription and the aspect ratio of DNA

    DEFF Research Database (Denmark)

    Olsen, Kasper Wibeck; Bohr, Jakob

    2013-01-01

    analysis of transcription. It is shown that under certain reasonable assumptions transcription is only possible if the aspect ratio is in the regime corresponding to further twisting. We find this constraint to be in agreement with long-established crystallographic studies of DNA....

  2. 36 CFR 1150.92 - Official transcript.

    Science.gov (United States)

    2010-07-01

    ... 36 Parks, Forests, and Public Property 3 2010-07-01 2010-07-01 false Official transcript. 1150.92 Section 1150.92 Parks, Forests, and Public Property ARCHITECTURAL AND TRANSPORTATION BARRIERS COMPLIANCE BOARD PRACTICE AND PROCEDURES FOR COMPLIANCE HEARINGS The Record § 1150.92 Official transcript. The...

  3. Using Virtual Reference Transcripts for Staff Training.

    Science.gov (United States)

    Ward, David

    2003-01-01

    Describes a method of library staff training based on chat transcript analysis in which graduate student workers at a university reference desk examined transcripts of actual virtual reference desk transactions to analyze reference interviews. Discusses reference interview standards, reference desk behavior, and reference interview skills in…

  4. Phonetic Transcription of African American Vernacular English.

    Science.gov (United States)

    Pollock, Karen E.; Meredith, Linette Hinton

    2001-01-01

    This article summarizes African American Vernacular English (AAVE) phonological features from the perspective of phonetic transcription. Relevant International Phonetic Alphabet symbols and diacritics are discussed, as well as the importance of transcription detail when differentiating dialect variation from phonological delay or disorder. A chart…

  5. RNA polymerase II collision interrupts convergent transcription

    DEFF Research Database (Denmark)

    Hobson, David J; Wei, Wu; Steinmetz, Lars M

    2012-01-01

    Antisense noncoding transcripts, genes-within-genes, and convergent gene pairs are prevalent among eukaryotes. The existence of such transcription units raises the question of what happens when RNA polymerase II (RNAPII) molecules collide head-to-head. Here we use a combination of biochemical...

  6. Transcriptional profiling of epidermal differentiation.

    Science.gov (United States)

    Radoja, Nada; Gazel, Alix; Banno, Tomohiro; Yano, Shoichiro; Blumenberg, Miroslav

    2006-10-03

    In epidermal differentiation basal keratinocytes detach from the basement membrane, stop proliferating, and express a new set of structural proteins and enzymes, which results in an impermeable protein/lipid barrier that protects us. To define the transcriptional changes essential for this process, we purified large quantities of basal and suprabasal cells from human epidermis, using the expression of beta4 integrin as the discriminating factor. The expected expression differences in cytoskeletal, cell cycle, and adhesion genes confirmed the effective separation of the cell populations. Using DNA microarray chips, we comprehensively identify the differences in genes expressed in basal and differentiating layers of the epidermis, including the ECM components produced by the basal cells, the proteases in both the basal and suprabasal cells, and the lipid and steroid metabolism enzymes in suprabasal cells responsible for the permeability barrier. We identified the signaling pathways specific for the two populations and found two previously unknown paracrine and one juxtacrine signaling pathway operating between the basal and suprabasal cells. Furthermore, using specific expression signatures, we identified a new set of late differentiation markers and mapped their chromosomal loci, as well as a new set of melanocyte-specific markers. The data represent a quantum jump in understanding the mechanisms of epidermal differentiation.

  7. Nickel-responsive transcriptional regulators.

    Science.gov (United States)

    Musiani, Francesco; Zambelli, Barbara; Bazzani, Micaela; Mazzei, Luca; Ciurli, Stefano

    2015-09-01

    Nickel is an essential micronutrient for a large number of living organisms, but it is also a toxic metal ion when it accumulates beyond the sustainable level as it may result if and when its cellular trafficking is not properly governed. Therefore, the homeostasis and metabolism of nickel is tightly regulated through metal-specific protein networks that respond to the available Ni(II) concentration. These are directed by specific nickel sensors, able to couple Ni(II) binding to a change in their DNA binding affinity and/or specificity, thus translating the cellular level of Ni(II) into a modification of the expression of the proteins devoted to modulating nickel uptake, efflux and cellular utilization. This review describes the Ni(II)-dependent transcriptional regulators discovered so far, focusing on their structural features, metal coordination modes and metal binding thermodynamics. Understanding these properties is essential to comprehend how these sensors correlate nickel availability to metal coordination and functional responses. A broad and comparative study, described here, reveals some general traits that characterize the binding stoichiometry and Ni(II) affinity of these metallo-sensors.

  8. In silico identification of the sea squirt selenoproteome

    Directory of Open Access Journals (Sweden)

    Jiang Liang

    2010-05-01

    Full Text Available Abstract Background Computational methods for identifying selenoproteins have been developed rapidly in recent years. However, it is still difficult to identify the open reading frame (ORF of eukaryotic selenoprotein gene, because the TGA codon for a selenocysteine (Sec residue in the active centre of selenoprotein is traditionally a terminal signal of protein translation. Although the identification of selenoproteins from genomes through bioinformatics methods has been conducted in bacteria, unicellular eukaryotes, insects and several vertebrates, only a few results have been reported on the ancient chordate selenoproteins. Results A gene assembly algorithm SelGenAmic has been constructed and presented in this study for identifying selenoprotein genes from eukaryotic genomes. A method based on this algorithm was developed to build an optimal TGA-containing-ORF for each TGA in a genome, followed by protein similarity analysis through conserved sequence alignments to screen out selenoprotein genes form these ORFs. This method improved the sensitivity of detecting selenoproteins from a genome due to the design that all TGAs in the genome were investigated for its possibility of decoding as a Sec residue. Using this method, eighteen selenoprotein genes were identified from the genome of Ciona intestinalis, leading to its member of selenoproteome up to 19. Among them a selenoprotein W gene was found to have two SECIS elements in the 3'-untranslated region. Additionally, the disulfide bond formation protein A (DsbA was firstly identified as a selenoprotein in the ancient chordates of Ciona intestinalis, Ciona savignyi and Branchiostoma floridae, while selenoprotein DsbAs had only been found in bacteria and green algae before. Conclusion The method based on SelGenAmic algorithm is capable of identifying eukaryotic selenoprotein genes from their genomes. Application of this method to Ciona intestinalis proves its successes in finding Sec-decoding TGA

  9. Spatial organization of transcription in bacterial cells.

    Science.gov (United States)

    Weng, Xiaoli; Xiao, Jie

    2014-07-01

    Prokaryotic transcription has been extensively studied over the past half a century. However, there often exists a gap between the structural, mechanistic description of transcription obtained from in vitro biochemical studies, and the cellular, phenomenological observations from in vivo genetic studies. It is now accepted that a living bacterial cell is a complex entity; the heterogeneous cellular environment is drastically different from the homogenous, well-mixed situation in vitro. Where molecules are inside a cell may be important for their function; hence, the spatial organization of different molecular components may provide a new means of transcription regulation in vivo, possibly bridging this gap. In this review, we survey current evidence for the spatial organization of four major components of transcription [genes, transcription factors, RNA polymerase (RNAP) and RNAs] and critically analyze their biological significance. Copyright © 2014 Elsevier Ltd. All rights reserved.

  10. The Journey of a Transcription Factor

    DEFF Research Database (Denmark)

    Pireyre, Marie

    Plants have developed astonishing networks regulating their metabolism to adapt to their environment. The complexity of these networks is illustrated by the expansion of families of regulators such as transcription factors in the plant kingdom. Transcription factors specifically impact...... transcriptional networks by integrating exogenous and endogenous stimuli and regulating gene expression accordingly. Regulation of transcription factors and their activation is thus highly important to modulate the transcriptional programs and increase fitness of the plant in a given environment. Plant metabolism...... is regulated to allocate resources to growth and/or defense at different time points. Among plant chemical defenses are the amino acid-derived glucosinolates (GLS). Their absolute and relative accumulation is tightly regulated at basal level, but also in response to e.g. pathogen attack and hormone stimuli...

  11. Transcriptional Regulation of Plant Secondary Metabolism

    Institute of Scientific and Technical Information of China (English)

    Chang-Qing Yang; Xin Fang; Xiu-Ming Wu; Ying-Bo Mao; Ling-Jian Wang; Xiao-Ya Chen

    2012-01-01

    Plant secondary metabolites play critical roles in plant-environment interactions.They are synthesized in different organs or tissues at particular developmental stages,and in response to various environmental stimuli,both biotic and abiotic.Accordingly,corresponding genes are regulated at the transcriptional level by multiple transcription factors.Several families of transcription factors have been identified to participate in controlling the biosynthesis and accumulation of secondary metabolites.These regulators integrate internal (often developmental) and external signals,bind to corresponding cis-elements — which are often in the promoter regions — to activate or repress the expression of enzyme-coding genes,and some of them interact with other transcription factors to form a complex.In this review,we summarize recent research in these areas,with an emphasis on newly-identified transcription factors and their functions in metabolism regulation.

  12. Transcriptional factors, Mafs and their biological roles

    Institute of Scientific and Technical Information of China (English)

    Mariko Tsuchiya; Ryoichi Misaka; Kosaku Nitta; Ken Tsuchiya

    2015-01-01

    The Maf family of transcription factors is characterizedby a typical bZip structure; these transcription factorsact as important regulators of the development anddifferentiation of many organs and tissues, includingthe kidney. The Maf family consists of two subgroupsthat are characterized according to their structure largeMaf transcription factors and small Maf transcriptionfactors. The large Maf subgroup consists of fourproteins, designated as MAFA, MAFB, c-MAF and neuralretina-specific leucine zipper. In particular, MAFA is adistinct molecule that has been attracting the attentionof researchers because it acts as a strong transactivatorof insulin, suggesting that Maf transcription factors arelikely to be involved in systemic energy homeostasis. Inthis review, we focused on the regulation of glucose/energy balance by Maf transcription factors in variousorgans.

  13. Transcription Factor Networks in Drosophila melanogaster

    Directory of Open Access Journals (Sweden)

    David Y. Rhee

    2014-09-01

    Full Text Available Specific cellular fates and functions depend on differential gene expression, which occurs primarily at the transcriptional level and is controlled by complex regulatory networks of transcription factors (TFs. TFs act through combinatorial interactions with other TFs, cofactors, and chromatin-remodeling proteins. Here, we define protein-protein interactions using a coaffinity purification/mass spectrometry method and study 459 Drosophila melanogaster transcription-related factors, representing approximately half of the established catalog of TFs. We probe this network in vivo, demonstrating functional interactions for many interacting proteins, and test the predictive value of our data set. Building on these analyses, we combine regulatory network inference models with physical interactions to define an integrated network that connects combinatorial TF protein interactions to the transcriptional regulatory network of the cell. We use this integrated network as a tool to connect the functional network of genetic modifiers related to mastermind, a transcriptional cofactor of the Notch pathway.

  14. Histone variants in plant transcriptional regulation.

    Science.gov (United States)

    Jiang, Danhua; Berger, Frédéric

    2017-01-01

    Chromatin based organization of eukaryotic genome plays a profound role in regulating gene transcription. Nucleosomes form the basic subunits of chromatin by packaging DNA with histone proteins, impeding the access of DNA to transcription factors and RNA polymerases. Exchange of histone variants in nucleosomes alters the properties of nucleosomes and thus modulates DNA exposure during transcriptional regulation. Growing evidence indicates the important function of histone variants in programming transcription during developmental transitions and stress response. Here we review how histone variants and their deposition machineries regulate the nucleosome stability and dynamics, and discuss the link between histone variants and transcriptional regulation in plants. This article is part of a Special Issue entitled: Plant Gene Regulatory Mechanisms and Networks, edited by Dr. Erich Grotewold and Dr. Nathan Springer.

  15. Combinatorial Regulation in Yeast Transcription Networks

    Science.gov (United States)

    Li, Hao

    2006-03-01

    Yeast has evolved a complex network to regulate its transcriptional program in response to changes in environment. It is quite common that in response to an external stimulus, several transcription factors will be activated and they work in combinations to control different subsets of genes in the genome. We are interested in how the promoters of genes are designed to integrate signals from multiple transcription factors and what are the functional and evolutionary constraints. To answer how, we have developed a number of computational algorithms to systematically map the binding sites and target genes of transcription factors using sequence and gene expression data. To analyze the functional constraints, we have employed mechanistic models to study the dynamic behavior of genes regulated by multiple factors. We have also developed methods to trace the evolution of transcriptional networks via comparative analysis of multiple species.

  16. Transcription-dependent degradation controls the stability of the SREBP family of transcription factors.

    Science.gov (United States)

    Sundqvist, Anders; Ericsson, Johan

    2003-11-25

    Cholesterol metabolism is tightly controlled by members of the sterol regulatory element-binding protein (SREBP) family of transcription factors. Here we demonstrate that the ubiquitination and degradation of SREBPs depend on their transcriptional activity. Mutations in the transactivation or DNA-binding domains of SREBPs inhibit their transcriptional activity and stabilize the proteins. The transcriptional activity and degradation of these mutants are restored when fused to heterologous transactivation or DNA-binding domains. When SREBP1a was fused to the DBD of Gal4, the ubiquitination and degradation of the fusion protein depended on coexpression of a promoter-reporter gene containing Gal4-binding sites. In addition, disruption of the interaction between WT SREBP and endogenous p300/CBP resulted in inhibition of SREBP-dependent transcription and stabilization of SREBP. Chemical inhibitors of transcription reduced the degradation of transcriptionally active SREBP1a, whereas they had no effect on the stability of transcriptionally inactive mutants, demonstrating that transcriptional activation plays an important role in the degradation of SREBPs. Thus, transcription-dependent degradation of SREBP constitutes a feedback mechanism to regulate the expression of genes involved in cholesterol metabolism and may represent a general mechanism to regulate the duration of transcriptional responses.

  17. Intermittent Transcription Dynamics for the Rapid Production of Long Transcripts of High Fidelity

    Directory of Open Access Journals (Sweden)

    Martin Depken

    2013-10-01

    Full Text Available Normal cellular function relies on the efficient and accurate readout of the genetic code. Single-molecule experiments show that transcription and replication are highly intermittent processes that are frequently interrupted by polymerases pausing and reversing directions. Although intermittent dynamics in replication are known to result from proofreading, their origin and significance during transcription remain controversial. Here, we theoretically investigate transcriptional fidelity and show that the kinetic scheme provided by the RNA-polymerase backtracking and transcript-cleavage pathway can account for measured error rates. Importantly, we find that intermittent dynamics provide an enormous increase in the rate of producing long transcripts of high fidelity. Our results imply that intermittent dynamics during transcription may have evolved as a way to mitigate the competing demands of speed and fidelity in the transcription of extended sequences.

  18. Hereditary profiles of disorderly transcription?

    Directory of Open Access Journals (Sweden)

    Simons Johannes WIM

    2006-04-01

    Full Text Available Abstract Background Microscopic examination of living cells often reveals that cells from some cell strains appear to be in a permanent state of disarray without obvious reason. In all probability such a disorderly state affects cell functioning. The aim of this study was to establish whether a disorderly state could occur that adversely affects gene expression profiles and whether such a state might have biomedical consequences. To this end, the expression profiles of the 14 genes of the proteasome derived from the GEO SAGE database were utilized as a model system. Results By adopting the overall expression profile as the standard for normal expression, deviation in transcription was frequently observed. Each deviating tissue exhibited its own characteristic profile of over-expressed and under-expressed genes. Moreover such a specific deviating profile appeared to be epigenetic in origin and could be stably transmitted to a clonal derivative e.g. from a precancerous normal tissue to its tumor. A significantly greater degree of deviation was observed in the expression profiles from the tumor tissues. The changes in the expression of different genes display a network of interdependencies. Therefore our hypothesis is that deviating profiles reflect disorder in the localization of genes within the nucleus The underlying cause(s for these disorderly states remain obscure; it could be noise and/or deterministic chaos. Presence of mutational damage does not appear to be predominantly involved. Conclusion As disturbances in expression profiles frequently occur and have biomedical consequences, its determination could prove of value in several fields of biomedical research. Reviewers This article was reviewed by Trey Ideker, Itai Yanai and Stephan Beck

  19. Prunus transcription factors: Breeding perspectives

    Directory of Open Access Journals (Sweden)

    Valmor João Bianchi

    2015-06-01

    Full Text Available Many plant processes depend on differential gene expression, which is generally controlled by complex proteins called transcription factors (TFs. In peach, 1,533 TFs have been identified, accounting for about 5.5% of the 27,852 protein-coding genes. These TFs are the reference for the rest of the Prunus species. TF studies in Prunus have been performed on the gene expression analysis of different agronomic traits, including control of the flowering process, fruit quality, and biotic and abiotic stress resistance. These studies, using quantitative RT-PCR, have mainly been performed in peach, and to a lesser extent in other species, including almond, apricot, black cherry, Fuji cherry, Japanese apricot, plum, and sour and sweet cherry. Other tools have also been used in TF studies, including cDNA-AFLP, LC-ESI-MS, RNA and DNA blotting or mapping. More recently, new tools assayed include microarray and high-throughput DNA sequencing (DNA-Seq and RNA sequencing (RNA-Seq. New functional genomics opportunities include genome resequencing and the well-known synteny among Prunus genomes and transcriptomes. These new functional studies should be applied in breeding programs in the development of molecular markers. With the genome sequences available, some strategies that have been used in model systems (such as SNP genotyping assays and genotyping-by-sequencing may be applicable in the functional analysis of Prunus TFs as well. In addition, the knowledge of the gene functions and position in the peach reference genome of the TFs represents an additional advantage. These facts could greatly facilitate the isolation of genes via QTL (quantitative trait loci map-based cloning in the different Prunus species, following the association of these TFs with the identified QTLs using the peach reference genome.

  20. Evolution and diversification of the basal transcription machinery.

    Science.gov (United States)

    Duttke, Sascha H C

    2015-03-01

    Transcription initiation was once thought to be regulated primarily by sequence-specific transcription factors with the basal transcription machinery being largely invariant. Gradually it became apparent that the basal transcription machinery greatly diversified during evolution and new studies now demonstrate that diversification of the TATA-binding protein (TBP) family yielded specialized and largely independent transcription systems.

  1. Nuclear Actin in Development and Transcriptional Reprogramming.

    Science.gov (United States)

    Misu, Shinji; Takebayashi, Marina; Miyamoto, Kei

    2017-01-01

    Actin is a highly abundant protein in eukaryotic cells and dynamically changes its polymerized states with the help of actin-binding proteins. Its critical function as a constituent of cytoskeleton has been well-documented. Growing evidence demonstrates that actin is also present in nuclei, referred to as nuclear actin, and is involved in a number of nuclear processes, including transcriptional regulation and chromatin remodeling. The contribution of nuclear actin to transcriptional regulation can be explained by its direct interaction with transcription machineries and chromatin remodeling factors and by controlling the activities of transcription factors. In both cases, polymerized states of nuclear actin affect the transcriptional outcome. Nuclear actin also plays an important role in activating strongly silenced genes in somatic cells for transcriptional reprogramming. When these nuclear functions of actin are considered, it is plausible to speculate that nuclear actin is also implicated in embryonic development, in which numerous genes need to be activated in a well-coordinated manner. In this review, we especially focus on nuclear actin's roles in transcriptional activation, reprogramming and development, including stem cell differentiation and we discuss how nuclear actin can be an important player in development and cell differentiation.

  2. Colon cancer associated transcripts in human cancers.

    Science.gov (United States)

    Chen, Yincong; Xie, Haibiao; Gao, Qunjun; Zhan, Hengji; Xiao, Huizhong; Zou, Yifan; Zhang, Fuyou; Liu, Yuchen; Li, Jianfa

    2017-08-02

    Long non-coding RNAs serve as important regulators in complicated cellular activities, including cell differentiation, proliferation and death. Dysregulation of long non-coding RNAs occurs in the formation and progression of cancers. The family of colon cancer associated transcripts, long non-coding RNAs colon cancer associated transcript-1 and colon cancer associated transcript-2 are known as oncogenes involved in various cancers. Colon cancer associated transcript-1 is a novel lncRNA located in 8q24.2, and colon cancer associated transcript-2 maps to the 8q24.21 region encompassing rs6983267. Colon cancer associated transcripts have close associations with clinical characteristics, such as lymph node metastasis, high TNM stage and short overall survival. Knockdown of them can reverse the malignant phenotypes of cancer cells, including proliferation, migration, invasion and apoptosis. Moreover, they can increase the expression level of c-MYC and oncogenic microRNAs via activating a series of complex mechanisms. In brief, the family of colon cancer associated transcripts may serve as potential biomarkers or therapeutic targets for human cancers. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  3. Notation systems for transcription: an empirical investigation.

    Science.gov (United States)

    Romero, Catherine; O'Connell, Daniel C; Kowal, Sabine

    2002-11-01

    A 21-syllable question posed by Bernard Shaw in a CNN television interview with Margaret Thatcher was presented to 90 participants, either as an audio recording or as a typed transcript or as both. Participants were asked to speak it, as closely as possible, as Shaw had (or, in conditions without the audio recording, as he might have). The typed version was either an ordinary transcript or a transcript in one of three transcription systems used currently in research on spoken discourse, all of which incorporate notations for prosody. Hence, there were nine conditions in all, with five women and five men in each. Contrary to the experimental hypothesis, approximations to Shaw's original temporal measures of performance were not degraded but were instead improved significantly by the addition of a prosodically notated transcript to the audio recording and significantly more in the absence of the audio recording. Presentation of the ordinary transcript alone produced the worst approximation to Shaw's temporal measures. The usefulness, accuracy, and readability of transcripts prepared according to detailed notation systems are discussed.

  4. Transcriptional Regulation by CHIP/LDB Complexes

    Science.gov (United States)

    Bronstein, Revital; Levkovitz, Liron; Yosef, Nir; Yanku, Michaela; Ruppin, Eytan; Sharan, Roded; Westphal, Heiner; Oliver, Brian; Segal, Daniel

    2010-01-01

    It is increasingly clear that transcription factors play versatile roles in turning genes “on” or “off” depending on cellular context via the various transcription complexes they form. This poses a major challenge in unraveling combinatorial transcription complex codes. Here we use the powerful genetics of Drosophila combined with microarray and bioinformatics analyses to tackle this challenge. The nuclear adaptor CHIP/LDB is a major developmental regulator capable of forming tissue-specific transcription complexes with various types of transcription factors and cofactors, making it a valuable model to study the intricacies of gene regulation. To date only few CHIP/LDB complexes target genes have been identified, and possible tissue-dependent crosstalk between these complexes has not been rigorously explored. SSDP proteins protect CHIP/LDB complexes from proteasome dependent degradation and are rate-limiting cofactors for these complexes. By using mutations in SSDP, we identified 189 down-stream targets of CHIP/LDB and show that these genes are enriched for the binding sites of APTEROUS (AP) and PANNIER (PNR), two well studied transcription factors associated with CHIP/LDB complexes. We performed extensive genetic screens and identified target genes that genetically interact with components of CHIP/LDB complexes in directing the development of the wings (28 genes) and thoracic bristles (23 genes). Moreover, by in vivo RNAi silencing we uncovered novel roles for two of the target genes, xbp1 and Gs-alpha, in early development of these structures. Taken together, our results suggest that loss of SSDP disrupts the normal balance between the CHIP-AP and the CHIP-PNR transcription complexes, resulting in down-regulation of CHIP-AP target genes and the concomitant up-regulation of CHIP-PNR target genes. Understanding the combinatorial nature of transcription complexes as presented here is crucial to the study of transcription regulation of gene batteries required

  5. CHD chromatin remodelers and the transcription cycle.

    Science.gov (United States)

    Murawska, Magdalena; Brehm, Alexander

    2011-01-01

    It is well established that ATP-dependent chromatin remodelers modulate DNA access of transcription factors and RNA polymerases by "opening" or "closing" chromatin structure. However, this view is far too simplistic. Recent findings have demonstrated that these enzymes not only set the stage for the transcription machinery to act but are actively involved at every step of the transcription process. As a consequence, they affect initiation, elongation, termination and RNA processing. In this review we will use the CHD family as a paradigm to illustrate the progress that has been made in revealing these new concepts.

  6. Our evolving knowledge of the transcriptional landscape.

    Science.gov (United States)

    Hume, David A

    2008-01-01

    The development of a genome-scale approach to identification of the 5' ends of capped mRNAs (CAGE) has given new insights into many aspects of mammalian RNApolII transcription control. They include the identification of the minimal initiator motif, the different types of proximal promoter architecture, the promoters of noncoding RNAs, the transcription of retrotransposons, and the extensive impact of alternative promoters on the proteome. CAGE also offers applications as a form of expression profiling that measures promoter use, allowing more precise development of transcriptional network models.

  7. Folding Kinetics of Riboswitch Transcriptional Terminators

    Science.gov (United States)

    Sauerwine, Benjamin; Widom, Michael

    2009-03-01

    Riboswitches control the expression of genes in bacteria by halting gene transcription or allowing it to proceed based on the presence of ligands in solution. A key feature of every riboswitch is a transcriptional terminator in which the messenger RNA folds into a secondary structure with the stem-loop structure of a hairpin. Through kinetic Monte Carlo simulation we show that terminators have been naturally selected to fold with high reliability on the time-scale of gene transcription. This efficient folding behavior is preserved among two classes of riboswitch and among two species of bacteria.

  8. Optogenetic control of transcription in zebrafish.

    Directory of Open Access Journals (Sweden)

    Hongtao Liu

    Full Text Available Light inducible protein-protein interactions are powerful tools to manipulate biological processes. Genetically encoded light-gated proteins for controlling precise cellular behavior are a new and promising technology, called optogenetics. Here we exploited the blue light-induced transcription system in yeast and zebrafish, based on the blue light dependent interaction between two plant proteins, blue light photoreceptor Cryptochrome 2 (CRY2 and the bHLH transcription factor CIB1 (CRY-interacting bHLH 1. We demonstrate the utility of this system by inducing rapid transcription suppression and activation in zebrafish.

  9. Divergent transcriptional and translational signals in Archaea

    DEFF Research Database (Denmark)

    Torarinsson, E; Klenk, H. P.; Garrett, Roger A.

    2005-01-01

    Many Archaea, in contrast to bacteria, produce a high proportion of leaderless transcripts, show a wide variation in their consensus Shine-Dalgarno (S-D) sequences and frequently use GUG and UUG start codons. In order to understand the basis for these differences, 18 complete archaeal genomes were...... examined for sequence signals that are positionally conserved upstream from genes. These functional motifs include box A promoter sequences for leaderless transcripts and S-D sequences for transcripts with leaders. Most of the box A sequences were preceded by a BRE-like motif and followed by a previously...... for the 18 Archaea, reveal that usage of high levels of both S-D motifs, and GUG and UUG start codons occurs exclusively in the shorter branched Archaea. High levels of leaderless transcripts are found in the longer branched Archaea....

  10. Transcriptional networks and chromatin remodeling controlling adipogenesis

    DEFF Research Database (Denmark)

    Siersbæk, Rasmus; Nielsen, Ronni; Mandrup, Susanne

    2012-01-01

    remodeling have revealed 'snapshots' of this cascade and the chromatin landscape at specific time-points of differentiation. These studies demonstrate that multiple adipogenic transcription factors co-occupy hotspots characterized by an open chromatin structure and specific epigenetic modifications...

  11. Comparison of Transcription Factor Binding Site Models

    KAUST Repository

    Bhuyan, Sharifulislam

    2012-05-01

    Modeling of transcription factor binding sites (TFBSs) and TFBS prediction on genomic sequences are important steps to elucidate transcription regulatory mechanism. Dependency of transcription regulation on a great number of factors such as chemical specificity, molecular structure, genomic and epigenetic characteristics, long distance interaction, makes this a challenging problem. Different experimental procedures generate evidence that DNA-binding domains of transcription factors show considerable DNA sequence specificity. Probabilistic modeling of TFBSs has been moderately successful in identifying patterns from a family of sequences. In this study, we compare performances of different probabilistic models and try to estimate their efficacy over experimental TFBSs data. We build a pipeline to calculate sensitivity and specificity from aligned TFBS sequences for several probabilistic models, such as Markov chains, hidden Markov models, Bayesian networks. Our work, containing relevant statistics and evaluation for the models, can help researchers to choose the most appropriate model for the problem at hand.

  12. The RNA polymerase I transcription machinery.

    Science.gov (United States)

    Russell, Jackie; Zomerdijk, Joost C B M

    2006-01-01

    The rRNAs constitute the catalytic and structural components of the ribosome, the protein synthesis machinery of cells. The level of rRNA synthesis, mediated by Pol I (RNA polymerase I), therefore has a major impact on the life and destiny of a cell. In order to elucidate how cells achieve the stringent control of Pol I transcription, matching the supply of rRNA to demand under different cellular growth conditions, it is essential to understand the components and mechanics of the Pol I transcription machinery. In this review, we discuss: (i) the molecular composition and functions of the Pol I enzyme complex and the two main Pol I transcription factors, SL1 (selectivity factor 1) and UBF (upstream binding factor); (ii) the interplay between these factors during pre-initiation complex formation at the rDNA promoter in mammalian cells; and (iii) the cellular control of the Pol I transcription machinery.

  13. Topologies for perfect adaptation in gene transcription

    Science.gov (United States)

    Shi, Wenjia; Tang, Chao

    2014-03-01

    Adaptation is commonly used in sensory systems and signaling networks to allow the detection of further stimuli. Despite enzymatic network topologies for adaptation have been investigated systematically, the topology of transcriptional network that could perform adaptation still remains unclear, due to the complexity of transcriptional regulation. Here, we systematically investigated all three-node transcriptional networks, and found the topologies of transcriptional networks for adaptation are different from that of enzymatic ones. While both negative feedback loop (NFBL) and incoherent feed forward loop (IFFL) are capable of performing adaptation analytically, a positive self-regulation on buffer node is necessary for NFBL topology and more flexible structures emerge for IFFL than that of enzymatic networks. Most of the simulation results agree with analytical predictions. This study may explain the mechanism of adapted gene regulation behavior and supply a design table for gene regulatory adaptation.

  14. Interactions of transcription factors with chromatin.

    Science.gov (United States)

    van Bakel, Harm

    2011-01-01

    Sequence-specific transcription factors (TFs) play a central role in regulating transcription initiation by directing the recruitment and activity of the general transcription machinery and accessory factors. It is now well established that many of the effects exerted by TFs in eukaryotes are mediated through interactions with a host of coregulators that modify the chromatin state, resulting in a more open (in case of activation) or closed conformation (in case of repression). The relationship between TFs and chromatin is a two-way street, however, as chromatin can in turn influence the recognition and binding of target sequences by TFs. The aim of this chapter is to highlight how this dynamic interplay between TF-directed remodelling of chromatin and chromatin-adjusted targeting of TF binding determines where and how transcription is initiated, and to what degree it is productive.

  15. Contributions of nuclear architecture to transcriptional control.

    Science.gov (United States)

    Stein, G S; van Wijnen, A J; Stein, J; Lian, J B; Montecino, M

    1995-01-01

    Three parameters of nuclear structure contribute to transcriptional control. The linear representation of promoter elements provides competency for physiological responsiveness within the contexts of development as well as cycle- and phenotype-dependent regulation. Chromatin structure and nucleosome organization reduce distances between independent regulatory elements providing a basis for integrating components of transcriptional control. The nuclear matrix supports gene expression by imposing physical constraints on chromatin related to three-dimensional genomic organization. In addition, the nuclear matrix facilitates gene localization as well as the concentration and targeting of transcription factors. Several lines of evidence are presented that are consistent with involvement of multiple levels of nuclear architecture in cell growth and tissue-specific gene expression during differentiation. Growth factor and steroid hormone responsive modifications in chromatin structure, nucleosome organization, and the nuclear matrix that influence transcription of the cell cycle-regulated histone gene and the bone tissue-specific osteocalcin gene during progressive expression of the osteoblast phenotype are considered.

  16. Dynamics of transcription-translation networks

    Science.gov (United States)

    Hudson, D.; Edwards, R.

    2016-09-01

    A theory for qualitative models of gene regulatory networks has been developed over several decades, generally considering transcription factors to regulate directly the expression of other transcription factors, without any intermediate variables. Here we explore a class of models that explicitly includes both transcription and translation, keeping track of both mRNA and protein concentrations. We mainly deal with transcription regulation functions that are steep sigmoids or step functions, as is often done in protein-only models, though translation is governed by a linear term. We extend many aspects of the protein-only theory to this new context, including properties of fixed points, description of trajectories by mappings between switching points, qualitative analysis via a state-transition diagram, and a result on periodic orbits for negative feedback loops. We find that while singular behaviour in switching domains is largely avoided, non-uniqueness of solutions can still occur in the step-function limit.

  17. Transcription Factors in Xylem Development. Final report

    Energy Technology Data Exchange (ETDEWEB)

    Sederoff, Ronald; Whetten, Ross; O' Malley, David; Campbell, Malcolm

    1999-07-01

    Answers to the following questions are answered in this report. do the two pine Byb proteins previously identified as candidate transcription factors bind to DNA and activate transcription? In what cell types are tehse Myb proteins expressed? Are these proteins localized to the nucleus? Do other proteins in pine xylem interact with these Myb proteins? Does altered expression of these genes have an impact on xylogenesis, specifically the expression of monolignol biosynthetic genes?

  18. A Discriminative Model for Polyphonic Piano Transcription

    Directory of Open Access Journals (Sweden)

    Poliner Graham E

    2007-01-01

    Full Text Available We present a discriminative model for polyphonic piano transcription. Support vector machines trained on spectral features are used to classify frame-level note instances. The classifier outputs are temporally constrained via hidden Markov models, and the proposed system is used to transcribe both synthesized and real piano recordings. A frame-level transcription accuracy of 68% was achieved on a newly generated test set, and direct comparisons to previous approaches are provided.

  19. Transcriptional inhibition by the retinoblastoma protein

    DEFF Research Database (Denmark)

    Fattaey, A; Helin, K; Harlow, E

    1993-01-01

    The retinoblastoma protein, pRB, appears to play a key role in coordinating the regulation of cell cycle position and transcriptional events. pRB undergoes specific cell-cycle-dependent phosphorylation, being underphosphorylated in G1 and heavily phosphorylated in S, G2, and M......-mediated transcription would be lost by mutation in the retinoblastoma gene in human tumours, by pRB's interaction with DNA tumour virus oncoproteins, or by phosphorylation during the cell cycle....

  20. Co-transcriptional splicing in two yeasts

    OpenAIRE

    Herzel, Lydia

    2015-01-01

    Cellular function and physiology are largely established through regulated gene expression. The first step in gene expression, transcription of the genomic DNA into RNA, is a process that is highly aligned at the levels of initiation, elongation and termination. In eukaryotes, protein-coding genes are exclusively transcribed by RNA polymerase II (Pol II). Upon transcription of the first 15-20 nucleotides (nt), the emerging nascent RNA 5’ end is modified with a 7-methylguanosyl cap. This is on...

  1. Transcription Factors in Xylem Development. Final report

    Energy Technology Data Exchange (ETDEWEB)

    Sederoff, Ronald; Whetten, Ross; O' Malley, David; Campbell, Malcolm

    1999-07-01

    Answers to the following questions are answered in this report. do the two pine Byb proteins previously identified as candidate transcription factors bind to DNA and activate transcription? In what cell types are tehse Myb proteins expressed? Are these proteins localized to the nucleus? Do other proteins in pine xylem interact with these Myb proteins? Does altered expression of these genes have an impact on xylogenesis, specifically the expression of monolignol biosynthetic genes?

  2. A unified architecture of transcriptional regulatory elements

    DEFF Research Database (Denmark)

    Andersson, Robin; Sandelin, Albin Gustav; Danko, Charles G.

    2015-01-01

    Gene expression is precisely controlled in time and space through the integration of signals that act at gene promoters and gene-distal enhancers. Classically, promoters and enhancers are considered separate classes of regulatory elements, often distinguished by histone modifications. However...... and enhancers are considered a single class of functional element, with a unified architecture for transcription initiation. The context of interacting regulatory elements and the surrounding sequences determine local transcriptional output as well as the enhancer and promoter activities of individual elements....

  3. Biophysical models of transcription in cells

    Science.gov (United States)

    Choubey, Sandeep

    Cells constantly face environmental challenges and deal with them by changing their gene expression patterns. They make decisions regarding which genes to express and which genes not to express based on intra-cellular and environmental cues. These decisions are often made by regulating the process of transcription. While the identities of the different molecules that take part in regulating transcription have been determined for a number of different genes, their dynamics inside the cell are still poorly understood. One key feature of these regulatory dynamics is that the numbers of the bio-molecules involved is typically small, resulting in large temporal fluctuations in transcriptional outputs (mRNA and protein). In this thesis I show that measurements of the cell-to-cell variability of the distribution of transcribing RNA polymerases along a gene provide a previously unexplored method for deciphering the mechanism of its transcription in vivo. First, I propose a simple kinetic model of transcription initiation and elongation from which I calculate transcribing RNA polymerase copy-number fluctuations. I test my theory against published data obtained for yeast genes and propose a novel mechanism of transcription. Rather than transcription being initiated through a single rate-limiting step, as was previously proposed, my single-cell analysis reveals the presence of at least two rate limiting steps. Second, I compute the distribution of inter-polymerase distance distribution along a gene and propose a method for analyzing inter-polymerase distance distributions acquired in experiments. By applying this method to images of polymerases transcribing ribosomal genes in E.coli I show that one model of regulation of these genes is consistent with inter-polymerase distance data while a number of other models are not. The analytical framework described in this thesis can be used to extract quantitative information about the dynamics of transcription from single

  4. Control of transcription by cell size.

    Directory of Open Access Journals (Sweden)

    Chia-Yung Wu

    Full Text Available Cell size increases significantly with increasing ploidy. Differences in cell size and ploidy are associated with alterations in gene expression, although no direct connection has been made between cell size and transcription. Here we show that ploidy-associated changes in gene expression reflect transcriptional adjustment to a larger cell size, implicating cellular geometry as a key parameter in gene regulation. Using RNA-seq, we identified genes whose expression was altered in a tetraploid as compared with the isogenic haploid. A significant fraction of these genes encode cell surface proteins, suggesting an effect of the enlarged cell size on the differential regulation of these genes. To test this hypothesis, we examined expression of these genes in haploid mutants that also produce enlarged size. Surprisingly, many genes differentially regulated in the tetraploid are identically regulated in the enlarged haploids, and the magnitude of change in gene expression correlates with the degree of size enlargement. These results indicate a causal relationship between cell size and transcription, with a size-sensing mechanism that alters transcription in response to size. The genes responding to cell size are enriched for those regulated by two mitogen-activated protein kinase pathways, and components in those pathways were found to mediate size-dependent gene regulation. Transcriptional adjustment to enlarged cell size could underlie other cellular changes associated with polyploidy. The causal relationship between cell size and transcription suggests that cell size homeostasis serves a regulatory role in transcriptome maintenance.

  5. Promoter proximal polyadenylation sites reduce transcription activity

    DEFF Research Database (Denmark)

    Andersen, Pia Kjølhede; Lykke-Andersen, Søren; Jensen, Torben Heick

    2012-01-01

    Gene expression relies on the functional communication between mRNA processing and transcription. We previously described the negative impact of a point-mutated splice donor (SD) site on transcription. Here we demonstrate that this mutation activates an upstream cryptic polyadenylation (CpA) site...... RNA polymerase II-transcribed genes use specialized termination mechanisms to maintain high transcription levels.......Gene expression relies on the functional communication between mRNA processing and transcription. We previously described the negative impact of a point-mutated splice donor (SD) site on transcription. Here we demonstrate that this mutation activates an upstream cryptic polyadenylation (CpA) site......, which in turn causes reduced transcription. Functional depletion of U1 snRNP in the context of the wild-type SD triggers the same CpA event accompanied by decreased RNA levels. Thus, in accordance with recent findings, U1 snRNP can shield premature pA sites. The negative impact of unshielded pA sites...

  6. DMD transcript imbalance determines dystrophin levels.

    Science.gov (United States)

    Spitali, Pietro; van den Bergen, Janneke C; Verhaart, Ingrid E C; Wokke, Beatrijs; Janson, Anneke A M; van den Eijnde, Rani; den Dunnen, Johan T; Laros, Jeroen F J; Verschuuren, Jan J G M; 't Hoen, Peter A C; Aartsma-Rus, Annemieke

    2013-12-01

    Duchenne and Becker muscular dystrophies are caused by out-of-frame and in-frame mutations, respectively, in the dystrophin encoding DMD gene. Molecular therapies targeting the precursor-mRNA are in clinical trials and show promising results. These approaches will depend on the stability and expression levels of dystrophin mRNA in skeletal muscles and heart. We report that the DMD gene is more highly expressed in heart than in skeletal muscles, in mice and humans. The transcript mutated in the mdx mouse model shows a 5' to 3' imbalance compared with that of its wild-type counterpart and reading frame restoration via antisense-mediated exon skipping does not correct this event. We also report significant transcript instability in 22 patients with Becker dystrophy, clarifying the fact that transcript imbalance is not caused by premature nonsense mutations. Finally, we demonstrate that transcript stability, rather than transcriptional rate, is an important determinant of dystrophin protein levels in patients with Becker dystrophy. We suggest that the availability of the complete transcript is a key factor to determine protein abundance and thus will influence the outcome of mRNA-targeting therapies.

  7. The regulation of transcription in memory consolidation.

    Science.gov (United States)

    Alberini, Cristina M; Kandel, Eric R

    2014-12-04

    De novo transcription of DNA is a fundamental requirement for the formation of long-term memory. It is required during both consolidation and reconsolidation, the posttraining and postreactivation phases that change the state of the memory from a fragile into a stable and long-lasting form. Transcription generates both mRNAs that are translated into proteins, which are necessary for the growth of new synaptic connections, as well as noncoding RNA transcripts that have regulatory or effector roles in gene expression. The result is a cascade of events that ultimately leads to structural changes in the neurons that mediate long-term memory storage. The de novo transcription, critical for synaptic plasticity and memory formation, is orchestrated by chromatin and epigenetic modifications. The complexity of transcription regulation, its temporal progression, and the effectors produced all contribute to the flexibility and persistence of long-term memory formation. In this article, we provide an overview of the mechanisms contributing to this transcriptional regulation underlying long-term memory formation.

  8. Mitochondrial transcription: is a pattern emerging?

    Science.gov (United States)

    Jaehning, J A

    1993-04-01

    Despite the striking similarities of RNA polymerases and transcription signals shared by eubacteria, archaebacteria and eukaryotes, there has been little indication that transcription in mitochondria is related to any previously characterized model. Only in yeast has the subunit structure of the mitochondrial RNA polymerase been determined. The yeast enzyme is composed of a core related to polymerases from bacteriophage T7 and T3, and a promoter recognition factor similar to bacterial sigma factors. Soluble systems for studying mitochondrial transcript initiation in vitro have been described from several organisms, and used to determine consensus sequences at or near transcription start sites. Comparison of these sequences from fungi, plants, and amphibians with the T7/T3 promoter suggests some intriguing similarities. Mammalian mitochondrial promoters do not fit this pattern but instead appear to utilize upstream sites, the target of a transcriptional stimulatory factor, to position the RNA polymerase. The recent identification of a possible homologue of the mammalian upstream factor in yeast mitochondria may indicate that a pattern will eventually be revealed relating the transcriptional machineries of all eukaryotic mitochondria.

  9. Transcriptional elongation factor ENL phosphorylated by ATM recruits polycomb and switches off transcription for DSB repair.

    Science.gov (United States)

    Ui, Ayako; Nagaura, Yuko; Yasui, Akira

    2015-05-07

    Transcription is repressed if a DNA double-strand break (DSB) is introduced in close proximity to a transcriptional activation site at least in part by H2A-ubiquitination. While ATM signaling is involved, how it controls H2A-ubiquitination remains unclear. Here, we identify that, in response to DSBs, a transcriptional elongation factor, ENL (MLLT1), is phosphorylated by ATM at conserved SQ sites. This phosphorylation increases the interaction between ENL and the E3-ubiquitin-ligase complex of Polycomb Repressive Complex 1 (PRC1) via BMI1. This interaction promotes enrichment of PRC1 at transcription elongation sites near DSBs to ubiquitinate H2A leading to transcriptional repression. ENL SQ sites and BMI1 are necessary for KU70 accumulation at DSBs near active transcription sites and cellular resistance to DSBs. Our data suggest that ATM-dependent phosphorylation of ENL functions as switch from elongation to Polycomb-mediated repression to preserve genome integrity.

  10. Structure and regulatory function of plant transcription factors

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    The expression of inducible genes in plants is regulated byspecific transcription factors at the transcriptional level. A typical transcription factor usually contains a DNA-binding domain, a transcription regulation domain, a dimerization site and a nuclear localization domain. These functional domains define the characteristic, localization and regulatory role of a transcription factor. Transcription factors recognize and bind to specific cis-acting elements or interact with other proteins, and then activate or repress the transcription of target genes by their functional domains. In recent years, elucidation on the structure and function of transcription factors has become an important subject in plant molecular biology.

  11. MADS-box gene evolution - structure and transcription patterns

    DEFF Research Database (Denmark)

    Johansen, Bo; Pedersen, Louise Buchholt; Skipper, Martin;

    2002-01-01

    Mads-box genes, ABC model, Evolution, Phylogeny, Transcription patterns, Gene structure, Conserved motifs......Mads-box genes, ABC model, Evolution, Phylogeny, Transcription patterns, Gene structure, Conserved motifs...

  12. Functional consequences of splicing of the antisense transcript COOLAIR on FLC transcription

    DEFF Research Database (Denmark)

    Marquardt, Sebastian; Raitskin, Oleg; Wu, Zhe

    2014-01-01

    perturbs a cotranscriptional feedback mechanism linking COOLAIR processing to FLC gene body histone demethylation and reduced FLC transcription. The importance of COOLAIR splicing in this repression mechanism was confirmed by disrupting COOLAIR production and mutating the COOLAIR proximal splice acceptor...... site. Our findings suggest that altered splicing of a long noncoding transcript can quantitatively modulate gene expression through cotranscriptional coupling mechanisms.......Antisense transcription is widespread in many genomes; however, how much is functional is hotly debated. We are investigating functionality of a set of long noncoding antisense transcripts, collectively called COOLAIR, produced at Arabidopsis FLOWERING LOCUS C (FLC). COOLAIR initiates just...

  13. Microprocessor mediates transcriptional termination of long noncoding RNA transcripts hosting microRNAs.

    Science.gov (United States)

    Dhir, Ashish; Dhir, Somdutta; Proudfoot, Nick J; Jopling, Catherine L

    2015-04-01

    MicroRNAs (miRNAs) play a major part in the post-transcriptional regulation of gene expression. Mammalian miRNA biogenesis begins with cotranscriptional cleavage of RNA polymerase II (Pol II) transcripts by the Microprocessor complex. Although most miRNAs are located within introns of protein-coding transcripts, a substantial minority of miRNAs originate from long noncoding (lnc) RNAs, for which transcript processing is largely uncharacterized. We show, by detailed characterization of liver-specific lnc-pri-miR-122 and genome-wide analysis in human cell lines, that most lncRNA transcripts containing miRNAs (lnc-pri-miRNAs) do not use the canonical cleavage-and-polyadenylation pathway but instead use Microprocessor cleavage to terminate transcription. Microprocessor inactivation leads to extensive transcriptional readthrough of lnc-pri-miRNA and transcriptional interference with downstream genes. Consequently we define a new RNase III-mediated, polyadenylation-independent mechanism of Pol II transcription termination in mammalian cells.

  14. When transcription goes on Holliday: Double Holliday junctions block RNA polymerase II transcription in vitro.

    Science.gov (United States)

    Pipathsouk, Anne; Belotserkovskii, Boris P; Hanawalt, Philip C

    2017-02-01

    Non-canonical DNA structures can obstruct transcription. This transcription blockage could have various biological consequences, including genomic instability and gratuitous transcription-coupled repair. Among potential structures causing transcription blockage are Holliday junctions (HJs), which can be generated as intermediates in homologous recombination or during processing of stalled replication forks. Of particular interest is the double Holliday junction (DHJ), which contains two HJs. Topological considerations impose the constraint that the total number of helical turns in the DNA duplexes between the junctions cannot be altered as long as the flanking DNA duplexes are intact. Thus, the DHJ structure should strongly resist transient unwinding during transcription; consequently, it is predicted to cause significantly stronger blockage than single HJ structures. The patterns of transcription blockage obtained for RNA polymerase II transcription in HeLa cell nuclear extracts were in accordance with this prediction. However, we did not detect transcription blockage with purified T7 phage RNA polymerase; we discuss a possible explanation for this difference. In general, our findings implicate naturally occurring Holliday junctions in transcription arrest. Copyright © 2016 Elsevier B.V. All rights reserved.

  15. Dynamic analysis of stochastic transcription cycles.

    Directory of Open Access Journals (Sweden)

    Claire V Harper

    2011-04-01

    Full Text Available In individual mammalian cells the expression of some genes such as prolactin is highly variable over time and has been suggested to occur in stochastic pulses. To investigate the origins of this behavior and to understand its functional relevance, we quantitatively analyzed this variability using new mathematical tools that allowed us to reconstruct dynamic transcription rates of different reporter genes controlled by identical promoters in the same living cell. Quantitative microscopic analysis of two reporter genes, firefly luciferase and destabilized EGFP, was used to analyze the dynamics of prolactin promoter-directed gene expression in living individual clonal and primary pituitary cells over periods of up to 25 h. We quantified the time-dependence and cyclicity of the transcription pulses and estimated the length and variation of active and inactive transcription phases. We showed an average cycle period of approximately 11 h and demonstrated that while the measured time distribution of active phases agreed with commonly accepted models of transcription, the inactive phases were differently distributed and showed strong memory, with a refractory period of transcriptional inactivation close to 3 h. Cycles in transcription occurred at two distinct prolactin-promoter controlled reporter genes in the same individual clonal or primary cells. However, the timing of the cycles was independent and out-of-phase. For the first time, we have analyzed transcription dynamics from two equivalent loci in real-time in single cells. In unstimulated conditions, cells showed independent transcription dynamics at each locus. A key result from these analyses was the evidence for a minimum refractory period in the inactive-phase of transcription. The response to acute signals and the result of manipulation of histone acetylation was consistent with the hypothesis that this refractory period corresponded to a phase of chromatin remodeling which significantly

  16. Molecular signatures that are distinctive characteristics of the vertebrates and chordates and supporting a grouping of vertebrates with the tunicates.

    Science.gov (United States)

    Gupta, Radhey S

    2016-01-01

    Members of the phylum Chordata and the subphylum Vertebrata are presently distinguished solely on the basis of morphological characteristics. The relationship of the vertebrates to the two non-vertebrate chordate subphyla is also a subject of debate. Analyses of protein sequences have identified multiple conserved signature indels (CSIs) that are specific for Chordata or for Vertebrata. Five CSIs in 4 important proteins are specific for the Vertebrata, whereas two other CSIs are uniquely found in all sequenced chordate species including Ciona intestinalis and Oikapleura dioica (Tunicates) as well as Branchiostoma floridae (Cephalochordates). The shared presence of these molecular signatures by all vertebrates/chordate species, but in no other animal taxa, strongly indicates that the genetic changes represented by the identified CSIs diagnose monophyletic groups. Two other discovered CSIs are uniquely shared by different vertebrate species and by either one (Ciona intestinalis) or both tunicate (Ciona and Oikapleura) species, but they are not found in Branchiostoma or other animal species. Specific presence of these CSIs in different vertebrates and either one or both tunicate species provides strong independent evidence that the vertebrate species are more closely related to the urochordates (tunicates) than to the cephalochordates.

  17. An overview on transcriptional regulators in Streptomyces.

    Science.gov (United States)

    Romero-Rodríguez, Alba; Robledo-Casados, Ivonne; Sánchez, Sergio

    2015-08-01

    Streptomyces are Gram-positive microorganisms able to adapt and respond to different environmental conditions. It is the largest genus of Actinobacteria comprising over 900 species. During their lifetime, these microorganisms are able to differentiate, produce aerial mycelia and secondary metabolites. All of these processes are controlled by subtle and precise regulatory systems. Regulation at the transcriptional initiation level is probably the most common for metabolic adaptation in bacteria. In this mechanism, the major players are proteins named transcription factors (TFs), capable of binding DNA in order to repress or activate the transcription of specific genes. Some of the TFs exert their action just like activators or repressors, whereas others can function in both manners, depending on the target promoter. Generally, TFs achieve their effects by using one- or two-component systems, linking a specific type of environmental stimulus to a transcriptional response. After DNA sequencing, many streptomycetes have been found to have chromosomes ranging between 6 and 12Mb in size, with high GC content (around 70%). They encode for approximately 7000 to 10,000 genes, 50 to 100 pseudogenes and a large set (around 12% of the total chromosome) of regulatory genes, organized in networks, controlling gene expression in these bacteria. Among the sequenced streptomycetes reported up to now, the number of transcription factors ranges from 471 to 1101. Among these, 315 to 691 correspond to transcriptional regulators and 31 to 76 are sigma factors. The aim of this work is to give a state of the art overview on transcription factors in the genus Streptomyces.

  18. Extraction of transcript diversity from scientific literature.

    Directory of Open Access Journals (Sweden)

    Parantu K Shah

    2005-06-01

    Full Text Available Transcript diversity generated by alternative splicing and associated mechanisms contributes heavily to the functional complexity of biological systems. The numerous examples of the mechanisms and functional implications of these events are scattered throughout the scientific literature. Thus, it is crucial to have a tool that can automatically extract the relevant facts and collect them in a knowledge base that can aid the interpretation of data from high-throughput methods. We have developed and applied a composite text-mining method for extracting information on transcript diversity from the entire MEDLINE database in order to create a database of genes with alternative transcripts. It contains information on tissue specificity, number of isoforms, causative mechanisms, functional implications, and experimental methods used for detection. We have mined this resource to identify 959 instances of tissue-specific splicing. Our results in combination with those from EST-based methods suggest that alternative splicing is the preferred mechanism for generating transcript diversity in the nervous system. We provide new annotations for 1,860 genes with the potential for generating transcript diversity. We assign the MeSH term "alternative splicing" to 1,536 additional abstracts in the MEDLINE database and suggest new MeSH terms for other events. We have successfully extracted information about transcript diversity and semiautomatically generated a database, LSAT, that can provide a quantitative understanding of the mechanisms behind tissue-specific gene expression. LSAT (Literature Support for Alternative Transcripts is publicly available at http://www.bork.embl.de/LSAT/.

  19. Identification of epididymis-specific transcripts in the mouse and rat by transcriptional profiling

    Institute of Scientific and Technical Information of China (English)

    Daniel S. Johnston; Terry T. Turner; Joshua N. Finger; Tracy L. Owtscharuk; S. Kopf; Scott A. Jelinsky

    2007-01-01

    As part of our efforts to identify novel contraceptive targets in the epididymis we performed transcriptional profiling on each of the 10 and 19 segments of the mouse and rat epididymidis, respectively, using Affymetrix whole genome microarrays. A total of 17 096 and 16 360 probe sets representing transcripts were identified as being expressed in the segmented mouse and rat epididymal transcriptomes, respectively. Comparison of the expressed murine transcripts against a mouse transcriptional profiling database derived from 22 other mouse tissues identified 77transcripts that were expressed uniquely in the epididymis. The expression of these genes was further evaluated by reverse transcription polymerase chain reaction (RT-PCR) analysis of RNA from 21 mouse tissues. RT-PCR analysis confirmed epididymis-specific expression of Defensin Beta 13 and identified two additional genes with expression restricted only to the epididymis and testis. Comparison of the 16 360 expressed transcripts in the rat epididymis with data of 21 other tissues from a rat transcriptional profiling database identified 110 transcripts specific for the epididymis.Sixty-two of these transcripts were further investigated by qPCR analysis. Only Defensin 22 (E3 epididymal protein)was shown to be completely specific for the epididymis. In addition, 14 transcripts showed more than 100-fold selective expression in the epididymis. The products of these genes might play important roles in epididymal and/or sperm function and further investigation and validation as contraceptive targets are warranted. The results of the studies described in this report are available at the Mammalian Reproductive Genetics (MRG) Database (http://mrg.genetics.washington.edu/).

  20. Structural analysis of nucleosomal barrier to transcription.

    Science.gov (United States)

    Gaykalova, Daria A; Kulaeva, Olga I; Volokh, Olesya; Shaytan, Alexey K; Hsieh, Fu-Kai; Kirpichnikov, Mikhail P; Sokolova, Olga S; Studitsky, Vasily M

    2015-10-27

    Thousands of human and Drosophila genes are regulated at the level of transcript elongation and nucleosomes are likely targets for this regulation. However, the molecular mechanisms of formation of the nucleosomal barrier to transcribing RNA polymerase II (Pol II) and nucleosome survival during/after transcription remain unknown. Here we show that both DNA-histone interactions and Pol II backtracking contribute to formation of the barrier and that nucleosome survival during transcription likely occurs through allosterically stabilized histone-histone interactions. Structural analysis indicates that after Pol II encounters the barrier, the enzyme backtracks and nucleosomal DNA recoils on the octamer, locking Pol II in the arrested state. DNA is displaced from one of the H2A/H2B dimers that remains associated with the octamer. The data reveal the importance of intranucleosomal DNA-protein and protein-protein interactions during conformational changes in the nucleosome structure on transcription. Mechanisms of nucleosomal barrier formation and nucleosome survival during transcription are proposed.

  1. Thermodynamic and kinetic modeling of transcriptional pausing.

    Science.gov (United States)

    Tadigotla, Vasisht R; O Maoiléidigh, Dáibhid; Sengupta, Anirvan M; Epshtein, Vitaly; Ebright, Richard H; Nudler, Evgeny; Ruckenstein, Andrei E

    2006-03-21

    We present a statistical mechanics approach for the prediction of backtracked pauses in bacterial transcription elongation derived from structural models of the transcription elongation complex (EC). Our algorithm is based on the thermodynamic stability of the EC along the DNA template calculated from the sequence-dependent free energy of DNA-DNA, DNA-RNA, and RNA-RNA base pairing associated with (i) the translocational and size fluctuations of the transcription bubble; (ii) changes in the associated DNA-RNA hybrid; and (iii) changes in the cotranscriptional RNA secondary structure upstream of the RNA exit channel. The calculations involve no adjustable parameters except for a cutoff used to discriminate paused from nonpaused complexes. When applied to 100 experimental pauses in transcription elongation by Escherichia coli RNA polymerase on 10 DNA templates, the approach produces statistically significant results. We also present a kinetic model for the rate of recovery of backtracked paused complexes. A crucial ingredient of our model is the incorporation of kinetic barriers to backtracking resulting from steric clashes of EC with the cotranscriptionally generated RNA secondary structure, an aspect not included explicitly in previous attempts at modeling the transcription elongation process.

  2. Control and signal processing by transcriptional interference

    Science.gov (United States)

    Buetti-Dinh, Antoine; Ungricht, Rosemarie; Kelemen, János Z; Shetty, Chetak; Ratna, Prasuna; Becskei, Attila

    2009-01-01

    A transcriptional activator can suppress gene expression by interfering with transcription initiated by another activator. Transcriptional interference has been increasingly recognized as a regulatory mechanism of gene expression. The signals received by the two antagonistically acting activators are combined by the polymerase trafficking along the DNA. We have designed a dual-control genetic system in yeast to explore this antagonism systematically. Antagonism by an upstream activator bears the hallmarks of competitive inhibition, whereas a downstream activator inhibits gene expression non-competitively. When gene expression is induced weakly, the antagonistic activator can have a positive effect and can even trigger paradoxical activation. Equilibrium and non-equilibrium models of transcription shed light on the mechanism by which interference converts signals, and reveals that self-antagonism of activators imitates the behavior of feed-forward loops. Indeed, a synthetic circuit generates a bell-shaped response, so that the induction of expression is limited to a narrow range of the input signal. The identification of conserved regulatory principles of interference will help to predict the transcriptional response of genes in their genomic context. PMID:19690569

  3. Chromatin insulation by a transcriptional activator.

    Science.gov (United States)

    Sutter, Nathan B; Scalzo, David; Fiering, Steven; Groudine, Mark; Martin, David I K

    2003-02-04

    In eukaryotic genomes, transcriptionally active regions are interspersed with silent chromatin that may repress genes in its vicinity. Chromatin insulators are elements that can shield a locus from repressive effects of flanking chromatin. Few such elements have been characterized in higher eukaryotes, but transcriptional activating elements are an invariant feature of active loci and have been shown to suppress transgene silencing. Hence, we have assessed the ability of a transcriptional activator to cause chromatin insulation, i.e., to relieve position effects at transgene integration sites in cultured cells. The transgene contained a series of binding sites for the metal-inducible transcriptional activator MTF, linked to a GFP reporter. Clones carrying single integrated transgenes were derived without selection for expression, and in most clones the transgene was silent. Induction of MTF resulted in transition of the transgene from the silent to the active state, prolongation of the active state, and a marked narrowing of the range of expression levels at different genomic sites. At one genomic site, prolonged induction of MTF resulted in suppression of transgene silencing that persisted after withdrawal of the induction stimulus. These results are consistent with MTF acting as a chromatin insulator and imply that transcriptional activating elements can insulate active loci against chromatin repression.

  4. RNA Pol II Dynamics Modulate Co-transcriptional Chromatin Modification, CTD Phosphorylation, and Transcriptional Direction.

    Science.gov (United States)

    Fong, Nova; Saldi, Tassa; Sheridan, Ryan M; Cortazar, Michael A; Bentley, David L

    2017-05-18

    Eukaryotic genes are marked by conserved post-translational modifications on the RNA pol II C-terminal domain (CTD) and the chromatin template. How the 5'-3' profiles of these marks are established is poorly understood. Using pol II mutants in human cells, we found that slow transcription repositioned specific co-transcriptionally deposited chromatin modifications; histone H3 lysine 36 trimethyl (H3K36me3) shifted within genes toward 5' ends, and histone H3 lysine 4 dimethyl (H3K4me2) extended farther upstream of start sites. Slow transcription also evoked a hyperphosphorylation of CTD Ser2 residues at 5' ends of genes that is conserved in yeast. We propose a "dwell time in the target zone" model to explain the effects of transcriptional dynamics on the establishment of co-transcriptionally deposited protein modifications. Promoter-proximal Ser2 phosphorylation is associated with a longer pol II dwell time at start sites and reduced transcriptional polarity because of strongly enhanced divergent antisense transcription at promoters. These results demonstrate that pol II dynamics help govern the decision between sense and divergent antisense transcription. Copyright © 2017 Elsevier Inc. All rights reserved.

  5. A bacteriophage transcription regulator inhibits bacterial transcription initiation by σ-factor displacement.

    Science.gov (United States)

    Liu, Bing; Shadrin, Andrey; Sheppard, Carol; Mekler, Vladimir; Xu, Yingqi; Severinov, Konstantin; Matthews, Steve; Wigneshweraraj, Sivaramesh

    2014-04-01

    Bacteriophages (phages) appropriate essential processes of bacterial hosts to benefit their own development. The multisubunit bacterial RNA polymerase (RNAp) enzyme, which catalyses DNA transcription, is targeted by phage-encoded transcription regulators that selectively modulate its activity. Here, we describe the structural and mechanistic basis for the inhibition of bacterial RNAp by the transcription regulator P7 encoded by Xanthomonas oryzae phage Xp10. We reveal that P7 uses a two-step mechanism to simultaneously interact with the catalytic β and β' subunits of the bacterial RNAp and inhibits transcription initiation by inducing the displacement of the σ(70)-factor on initial engagement of RNAp with promoter DNA. The new mode of interaction with and inhibition mechanism of bacterial RNAp by P7 underscore the remarkable variety of mechanisms evolved by phages to interfere with host transcription.

  6. Controllability analysis of transcriptional regulatory networks reveals circular control patterns among transcription factors

    DEFF Research Database (Denmark)

    Österlund, Tobias; Bordel, Sergio; Nielsen, Jens

    2015-01-01

    Transcriptional regulation is the most committed type of regulation in living cells where transcription factors (TFs) control the expression of their target genes and TF expression is controlled by other TFs forming complex transcriptional regulatory networks that can be highly interconnected. Here...... we analyze the topology and organization of nine transcriptional regulatory networks for E. coli, yeast, mouse and human, and we evaluate how the structure of these networks influences two of their key properties, namely controllability and stability. We calculate the controllability for each network...... as a measure of the organization and interconnectivity of the network. We find that the number of driver nodes n(D) needed to control the whole network is 64% of the TFs in the E. coli transcriptional regulatory network in contrast to only 17% for the yeast network, 4% for the mouse network and 8...

  7. Deciphering the Innate Lymphoid Cell Transcriptional Program

    Directory of Open Access Journals (Sweden)

    Cyril Seillet

    2016-10-01

    Full Text Available Innate lymphoid cells (ILCs are enriched at mucosal surfaces, where they provide immune surveillance. All ILC subsets develop from a common progenitor that gives rise to pre-committed progenitors for each of the ILC lineages. Currently, the temporal control of gene expression that guides the emergence of these progenitors is poorly understood. We used global transcriptional mapping to analyze gene expression in different ILC progenitors. We identified PD-1 to be specifically expressed in PLZF+ ILCp and revealed that the timing and order of expression of the transcription factors NFIL3, ID2, and TCF-1 was critical. Importantly, induction of ILC lineage commitment required only transient expression of NFIL3 prior to ID2 and TCF-1 expression. These findings highlight the importance of the temporal program that permits commitment of progenitors to the ILC lineage, and they expand our understanding of the core transcriptional program by identifying potential regulators of ILC development.

  8. Transcription factor CTCF and mammalian genome organization

    Directory of Open Access Journals (Sweden)

    Kotova E. S.

    2014-07-01

    Full Text Available The CTCF transcription factor is thought to be one of the main participants in various gene regulatory networks including transcription activation and repression, formation of independently functioning chromatin domains, regulation of imprinting etc. Sequencing of human and other genomes opened up a possibility to ascertain the genomic distribution of CTCF binding sites and to identify CTCF-dependent cis-regulatory elements, including insulators. In the review, we summarized recent data on CTCF functioning within a framework of the chromatin loop domain hypothesis of large-scale regulation of the genome activity. Its fundamental properties allow CTCF to serve as a transcription factor, an insulator protein and a dispersed genome-wide demarcation tool able to recruit various factors that emerge in response to diverse external and internal signals, and thus to exert its signal-specific function(s.

  9. Transcriptional network underlying Caenorhabditis elegans vulval development.

    Science.gov (United States)

    Inoue, Takao; Wang, Minqin; Ririe, Ted O; Fernandes, Jolene S; Sternberg, Paul W

    2005-04-05

    The vulval development of Caenorhabditis elegans provides an opportunity to investigate genetic networks that control gene expression during organogenesis. During the fourth larval stage (L4), seven vulval cell types are produced, each of which executes a distinct gene expression program. We analyze how the expression of cell-type-specific genes is regulated. Ras and Wnt signaling pathways play major roles in generating the spatial pattern of cell types and regulate gene expression through a network of transcription factors. One transcription factor (lin-29) primarily controls the temporal expression pattern. Other transcription factors (lin-11, cog-1, and egl-38) act in combination to control cell-type-specific gene expression. The complexity of the network arises in part because of the dynamic nature of gene expression, in part because of the presence of seven cell types, and also because there are multiple regulatory paths for gene expression within each cell type.

  10. Battles and hijacks: noncoding transcription in plants.

    Science.gov (United States)

    Ariel, Federico; Romero-Barrios, Natali; Jégu, Teddy; Benhamed, Moussa; Crespi, Martin

    2015-06-01

    Noncoding RNAs have emerged as major components of the eukaryotic transcriptome. Genome-wide analyses revealed the existence of thousands of long noncoding RNAs (lncRNAs) in several plant species. Plant lncRNAs are transcribed by the plant-specific RNA polymerases Pol IV and Pol V, leading to transcriptional gene silencing, as well as by Pol II. They are involved in a wide range of regulatory mechanisms impacting on gene expression, including chromatin remodeling, modulation of alternative splicing, fine-tuning of miRNA activity, and the control of mRNA translation or accumulation. Recently, dual noncoding transcription by alternative RNA polymerases was implicated in epigenetic and chromatin conformation dynamics. This review integrates the current knowledge on the regulatory mechanisms acting through plant noncoding transcription.

  11. Runx transcription factors in neuronal development

    Directory of Open Access Journals (Sweden)

    Shiga Takashi

    2008-08-01

    Full Text Available Abstract Runt-related (Runx transcription factors control diverse aspects of embryonic development and are responsible for the pathogenesis of many human diseases. In recent years, the functions of this transcription factor family in the nervous system have just begun to be understood. In dorsal root ganglion neurons, Runx1 and Runx3 play pivotal roles in the development of nociceptive and proprioceptive sensory neurons, respectively. Runx appears to control the transcriptional regulation of neurotrophin receptors, numerous ion channels and neuropeptides. As a consequence, Runx contributes to diverse aspects of the sensory system in higher vertebrates. In this review, we summarize recent progress in determining the role of Runx in neuronal development.

  12. Battles and hijacks: Noncoding transcription in plants

    KAUST Repository

    Ariel, Federico

    2015-06-01

    Noncoding RNAs have emerged as major components of the eukaryotic transcriptome. Genome-wide analyses revealed the existence of thousands of long noncoding RNAs (lncRNAs) in several plant species. Plant lncRNAs are transcribed by the plant-specific RNA polymerases Pol IV and Pol V, leading to transcriptional gene silencing, as well as by Pol II. They are involved in a wide range of regulatory mechanisms impacting on gene expression, including chromatin remodeling, modulation of alternative splicing, fine-tuning of miRNA activity, and the control of mRNA translation or accumulation. Recently, dual noncoding transcription by alternative RNA polymerases was implicated in epigenetic and chromatin conformation dynamics. This review integrates the current knowledge on the regulatory mechanisms acting through plant noncoding transcription. © 2015 Elsevier Ltd.

  13. Transcription and the Pitch Angle of DNA

    CERN Document Server

    Olsen, Kasper W

    2013-01-01

    The question of the value of the pitch angle of DNA is visited from the perspective of a geometrical analysis of transcription. It is suggested that for transcription to be possible, the pitch angle of B-DNA must be smaller than the angle of zero-twist. At the zero-twist angle the double helix is maximally rotated and its strain-twist coupling vanishes. A numerical estimate of the pitch angle for B-DNA based on differential geometry is compared with numbers obtained from existing empirical data. The crystallographic studies shows that the pitch angle is approximately 38 deg., less than the corresponding zero-twist angle of 41.8 deg., which is consistent with the suggested principle for transcription.

  14. Transcription regulatory networks analysis using CAGE

    KAUST Repository

    Tegnér, Jesper N.

    2009-10-01

    Mapping out cellular networks in general and transcriptional networks in particular has proved to be a bottle-neck hampering our understanding of biological processes. Integrative approaches fusing computational and experimental technologies for decoding transcriptional networks at a high level of resolution is therefore of uttermost importance. Yet, this is challenging since the control of gene expression in eukaryotes is a complex multi-level process influenced by several epigenetic factors and the fine interplay between regulatory proteins and the promoter structure governing the combinatorial regulation of gene expression. In this chapter we review how the CAGE data can be integrated with other measurements such as expression, physical interactions and computational prediction of regulatory motifs, which together can provide a genome-wide picture of eukaryotic transcriptional regulatory networks at a new level of resolution. © 2010 by Pan Stanford Publishing Pte. Ltd. All rights reserved.

  15. Switching on cilia: transcriptional networks regulating ciliogenesis.

    Science.gov (United States)

    Choksi, Semil P; Lauter, Gilbert; Swoboda, Peter; Roy, Sudipto

    2014-04-01

    Cilia play many essential roles in fluid transport and cellular locomotion, and as sensory hubs for a variety of signal transduction pathways. Despite having a conserved basic morphology, cilia vary extensively in their shapes and sizes, ultrastructural details, numbers per cell, motility patterns and sensory capabilities. Emerging evidence indicates that this diversity, which is intimately linked to the different functions that cilia perform, is in large part programmed at the transcriptional level. Here, we review our understanding of the transcriptional control of ciliary biogenesis, highlighting the activities of FOXJ1 and the RFX family of transcriptional regulators. In addition, we examine how a number of signaling pathways, and lineage and cell fate determinants can induce and modulate ciliogenic programs to bring about the differentiation of distinct cilia types.

  16. Mechanisms of biotic resistance across complex life cycles.

    Science.gov (United States)

    Rius, Marc; Potter, Elaine E; Aguirre, J David; Stachowicz, John J

    2014-01-01

    Biotic resistance is the ability of communities to inhibit the establishment, spread or impact of novel species. However, the interactions that underlie biotic resistance depend heavily on the contexts in which species interact. Consequently, studies of biotic resistance that consider single processes, patches, species or life-history stages may provide an incomplete picture of the capacity for communities to resist invasion. Many organisms have multiphasic life cycles, where individuals can occupy distinct niches at different stages of the life history. Generally, studies of biotic resistance focus on interactions within a single life-history stage, and interactions at other life-history stages are overlooked. Here, we demonstrate that different mechanisms of biotic resistance occur across the life history and together limit the invasion success of an introduced marine invertebrate (Ciona intestinalis) in Northern California. We tested the role of interactions (competition and predation) with the resident community in limiting the abundance of Ciona through experiments conducted on fertilization, larval survival, settlement, early postsettlement survival, and the survival of juveniles and adults. Under some circumstances, Ciona became abundant in mid-successional stages and showed more rapid growth rates than a morphologically similar native species, Ascidia ceratodes. However, predators reduced Ciona abundance much more than that of Ascidia at several life stages. Furthermore, Ciona appeared to be a weaker competitor at the adult stage. Early life-history interactions with other sessile species at the fertilization, larval and recruit stages had modest to no effects on Ciona abundance. The presence of biotic resistance mechanisms acting at multiple life stages, and potentially under different conditions, suggests that different components of biotic resistance interact to enhance the resident community's resistance to invasion.

  17. IKAROS: a multifunctional regulator of the polymerase II transcription cycle.

    Science.gov (United States)

    Bottardi, Stefania; Mavoungou, Lionel; Milot, Eric

    2015-09-01

    Transcription factors are important determinants of lineage specification during hematopoiesis. They favor recruitment of cofactors involved in epigenetic regulation, thereby defining patterns of gene expression in a development- and lineage-specific manner. Additionally, transcription factors can facilitate transcription preinitiation complex (PIC) formation and assembly on chromatin. Interestingly, a few lineage-specific transcription factors, including IKAROS, also regulate transcription elongation. IKAROS is a tumor suppressor frequently inactivated in leukemia and associated with a poor prognosis. It forms a complex with the nucleosome remodeling and deacetylase (NuRD) complex and the positive transcription elongation factor b (P-TEFb), which is required for productive transcription elongation. It has also been reported that IKAROS interacts with factors involved in transcription termination. Here we review these and other recent findings that establish IKAROS as the first transcription factor found to act as a multifunctional regulator of the transcription cycle in hematopoietic cells.

  18. The LIM Homeodomain Transcription Factor LHX6

    Science.gov (United States)

    Zhang, Zichao; Gutierrez, Diana; Li, Xiao; Bidlack, Felicitas; Cao, Huojun; Wang, Jianbo; Andrade, Kelsey; Margolis, Henry C.; Amendt, Brad A.

    2013-01-01

    LHX6 is a LIM-homeobox transcription factor expressed during embryogenesis; however, the molecular mechanisms regulating LHX6 transcriptional activities are unknown. LHX6 and the PITX2 homeodomain transcription factor have overlapping expression patterns during tooth and craniofacial development, and in this report, we demonstrate new transcriptional mechanisms for these factors. PITX2 and LHX6 are co-expressed in the oral and dental epithelium and epithelial cell lines. Lhx6 expression is increased in Pitx2c transgenic mice and decreased in Pitx2 null mice. PITX2 activates endogenous Lhx6 expression and the Lhx6 promoter, whereas LHX6 represses its promoter activity. Chromatin immunoprecipitation experiments reveal endogenous PITX2 binding to the Lhx6 promoter. LHX6 directly interacts with PITX2 to inhibit PITX2 transcriptional activities and activation of multiple promoters. Bimolecular fluorescence complementation assays reveal an LHX6·PITX2 nuclear interaction in living cells. LHX6 has a dominant repressive effect on the PITX2 synergistic activation with LEF-1 and β-catenin co-factors. Thus, LHX6 acts as a transcriptional repressor and represses the expression of several genes involved in odontogenesis. We have identified specific defects in incisor, molar, mandible, bone, and root development and late stage enamel formation in Lhx6 null mice. Amelogenin and ameloblastin expression is reduced and/or delayed in the Lhx6 null mice, potentially resulting from defects in dentin deposition and ameloblast differentiation. Our results demonstrate that LHX6 regulates cell proliferation in the cervical loop and promotes cell differentiation in the anterior region of the incisor. We demonstrate new molecular mechanisms for LHX6 and an interaction with PITX2 for normal craniofacial and tooth development. PMID:23229549

  19. Cryptic speciation in a model invertebrate chordate.

    Science.gov (United States)

    Caputi, Luigi; Andreakis, Nikos; Mastrototaro, Francesco; Cirino, Paola; Vassillo, Mauro; Sordino, Paolo

    2007-05-29

    We applied independent species concepts to clarify the phylogeographic structure of the ascidian Ciona intestinalis, a powerful model system in chordate biology and for comparative genomic studies. Intensive research with this marine invertebrate is based on the assumption that natural populations globally belong to a single species. Therefore, understanding the true taxonomic classification may have implications for experimental design and data management. Phylogenies inferred from mitochondrial and nuclear DNA markers accredit the existence of two cryptic species: C. intestinalis sp. A, genetically homogeneous, distributed in the Mediterranean, northeast Atlantic, and Pacific, and C. intestinalis sp. B, geographically structured and encountered in the North Atlantic. Species-level divergence is further entailed by cross-breeding estimates. C. intestinalis A and B from allopatric populations cross-fertilize, but hybrids remain infertile because of defective gametogenesis. Although anatomy illustrates an overall interspecific similarity lacking in diagnostic features, we provide consistent tools for in-field and in-laboratory species discrimination. Finding of two cryptic taxa in C. intestinalis raises interest in a new tunicate genome as a gateway to studies in speciation and ecological adaptation of chordates.

  20. The retinoblastoma protein as a transcriptional repressor

    DEFF Research Database (Denmark)

    Helin, K; Ed, H

    1993-01-01

    The retinoblastoma protein (pRB) is one of the best-studied tumour suppressor gene products. Its loss during the genesis of many human tumours, its inactivation by several DNA tumour virus oncoproteins, and its ability to inhibit cell growth when introduced into dividing cells all suggest that pRB...... negatively regulates some aspect of normal cell growth. The discovery that pRB associates with transcription factors such as E2F has provided the first model for pRB function. In this review, we discuss how pRB may regulate cell growth by repressing transcription of genes essential for cell proliferation....

  1. Angiotensinogen Gene Transcription in Pulmonary Fibrosis

    Science.gov (United States)

    Uhal, Bruce D.; Dang, My-Trang T.; Li, Xiaopeng; Abdul-Hafez, Amal

    2012-01-01

    An established body of literature supports the hypothesis that activation of a local tissue angiotensin (ANG) system in the extravascular tissue compartment of the lungs is required for lung fibrogenesis. Transcriptional activation of the angiotensinogen (AGT) gene is believed to be a critical and necessary step in this activation. This paper summarizes the data in support of this theory and discusses transcriptional regulation of AGT, with an emphasis on lung AGT synthesis as a determinant of fibrosis severity. Genetic data linking AGT polymorphisms to the severity of disease in Idiopathic Pulmonary Fibrosis are also discussed. PMID:22500179

  2. Angiotensinogen Gene Transcription in Pulmonary Fibrosis

    Directory of Open Access Journals (Sweden)

    Bruce D. Uhal

    2012-01-01

    Full Text Available An established body of literature supports the hypothesis that activation of a local tissue angiotensin (ANG system in the extravascular tissue compartment of the lungs is required for lung fibrogenesis. Transcriptional activation of the angiotensinogen (AGT gene is believed to be a critical and necessary step in this activation. This paper summarizes the data in support of this theory and discusses transcriptional regulation of AGT, with an emphasis on lung AGT synthesis as a determinant of fibrosis severity. Genetic data linking AGT polymorphisms to the severity of disease in Idiopathic Pulmonary Fibrosis are also discussed.

  3. Direct competition assay for transcription fidelity.

    Science.gov (United States)

    Lubkowska, Lucyna; Kireeva, Maria L

    2015-01-01

    Accurate transcription is essential for faithful information flow from DNA to RNA and to the protein. Mechanisms of cognate substrate selection by RNA polymerases are currently elucidated by structural, genetic, and biochemical approaches. Here, we describe a fast and reliable approach to quantitative analyses of transcription fidelity, applicable to analyses of RNA polymerase selectivity against misincorporation, incorporation of dNMPs, and chemically modified rNMP analogues. The method is based on different electrophoretic mobility of RNA oligomers of the same length but differing in sequence.

  4. Transcriptional networks leading to symbiotic nodule organogenesis.

    Science.gov (United States)

    Soyano, Takashi; Hayashi, Makoto

    2014-08-01

    The symbiosis with nitrogen-fixing bacteria leading to root nodules is a relatively recent evolutionary innovation and limited to a distinct order of land plants. It has long been a mystery how plants have invented this complex trait. However, recent advances in molecular genetics of model legumes has elucidated genes involved in the development of root nodules, providing insights into this process. Here we discuss how the de novo assembly of transcriptional networks may account for the predisposition to nodulate. Transcriptional networks and modes of gene regulation from the arbuscular mycorrhizal symbiosis, nitrate responses and aspects of lateral root development have likely all contributed to the emergence and development of root nodules.

  5. Peroxisome proliferator-activated receptor gamma recruits the positive transcription elongation factor b complex to activate transcription and promote adipogenesis

    DEFF Research Database (Denmark)

    Iankova, Irena; Petersen, Rasmus K; Annicotte, Jean-Sébastien

    2006-01-01

    Positive transcription elongation factor b (P-TEFb) phosphorylates the C-terminal domain of RNA polymerase II, facilitating transcriptional elongation. In addition to its participation in general transcription, P-TEFb is recruited to specific promoters by some transcription factors such as c-Myc...

  6. Transcriptional regulation of topology modulators and transcription regulators of Mycobacterium tuberculosis.

    Science.gov (United States)

    Ghosh, Soumitra; Padmanabhan, Bhavna; Godbole, Adwait Anand; Tare, Priyanka; Ahmed, Wareed; Vasu, Kommireddy; China, Arnab; Kumar, Rupesh; Mitra, Anirban; Nagaraja, Valakunja

    2016-07-01

    Mycobacterium tuberculosis (Mtb) is a formidable pathogen which has the ability to survive the hostile environment of the host by evading the host defense system. The re-configuration of its transcriptional and metabolic process allows the pathogen to confront the adverse environment within the host macrophages. The factors that assist the transcription and modulate the DNA topology would have to play a key role in the regulation of global gene expression of the organism. How transcription of these essential housekeeping genes alters in response to growth conditions and environmental stress has not been addressed together in a set of experimental conditions in Mtb. Now, we have mapped the transcription start sites (TSS) and promoters of several genes that play a central role in the regulation of DNA topology and transcription in Mtb. Using in vivo reporter assays, we validated the activity of the identified promoter elements in different growth conditions. The variation in transcript abundance of these essential genes was also analyzed in growth phase-dependent manner. These data provide the first glimpse into the specific adaptive changes in the expression of genes involved in transcription and DNA topology modulation in Mtb.

  7. Plant NAC-type transcription factor proteins contain a NARD domain for repression of transcriptional activation.

    Science.gov (United States)

    Hao, Yu-Jun; Song, Qing-Xin; Chen, Hao-Wei; Zou, Hong-Feng; Wei, Wei; Kang, Xu-Sheng; Ma, Biao; Zhang, Wan-Ke; Zhang, Jin-Song; Chen, Shou-Yi

    2010-10-01

    Plant-specific transcription factor NAC proteins play essential roles in many biological processes such as development, senescence, morphogenesis, and stress signal transduction pathways. In the NAC family, some members function as transcription activators while others act as repressors. In the present study we found that though the full-length GmNAC20 from soybean did not have transcriptional activation activity, the carboxy-terminal activation domain of GmNAC20 had high transcriptional activation activity in the yeast assay system. Deletion experiments revealed an active repression domain with 35 amino acids, named NARD (NAC Repression Domain), in the d subdomain of NAC DNA-binding domain. NARD can reduce the transcriptional activation ability of diverse transcription factors when fused to either the amino-terminal or the carboxy-terminal of the transcription factors. NARD-like sequences are also present in other NAC family members and they are functional repression domain when fused to VP16 in plant protoplast assay system. Mutation analysis of conserved amino acid residues in NARD showed that the hydrophobic LVFY motif may partially contribute to the repression function. It is hypothesized that the interactions between the repression domain NARD and the carboxy-terminal activation domain may finally determine the ability of NAC family proteins to regulate downstream gene expressions.

  8. A compendium of nucleosome and transcript profiles reveals determinants of chromatin architecture and transcription.

    Science.gov (United States)

    van Bakel, Harm; Tsui, Kyle; Gebbia, Marinella; Mnaimneh, Sanie; Hughes, Timothy R; Nislow, Corey

    2013-05-01

    Nucleosomes in all eukaryotes examined to date adopt a characteristic architecture within genes and play fundamental roles in regulating transcription, yet the identity and precise roles of many of the trans-acting factors responsible for the establishment and maintenance of this organization remain to be identified. We profiled a compendium of 50 yeast strains carrying conditional alleles or complete deletions of genes involved in transcriptional regulation, histone biology, and chromatin remodeling, as well as compounds that target transcription and histone deacetylases, to assess their respective roles in nucleosome positioning and transcription. We find that nucleosome patterning in genes is affected by many factors, including the CAF-1 complex, Spt10, and Spt21, in addition to previously reported remodeler ATPases and histone chaperones. Disruption of these factors or reductions in histone levels led genic nucleosomes to assume positions more consistent with their intrinsic sequence preferences, with pronounced and specific shifts of the +1 nucleosome relative to the transcription start site. These shifts of +1 nucleosomes appear to have functional consequences, as several affected genes in Ino80 mutants exhibited altered expression responses. Our parallel expression profiling compendium revealed extensive transcription changes in intergenic and antisense regions, most of which occur in regions with altered nucleosome occupancy and positioning. We show that the nucleosome-excluding transcription factors Reb1, Abf1, Tbf1, and Rsc3 suppress cryptic transcripts at their target promoters, while a combined analysis of nucleosome and expression profiles identified 36 novel transcripts that are normally repressed by Tup1/Cyc8. Our data confirm and extend the roles of chromatin remodelers and chaperones as major determinants of genic nucleosome positioning, and these data provide a valuable resource for future studies.

  9. A compendium of nucleosome and transcript profiles reveals determinants of chromatin architecture and transcription.

    Directory of Open Access Journals (Sweden)

    Harm van Bakel

    2013-05-01

    Full Text Available Nucleosomes in all eukaryotes examined to date adopt a characteristic architecture within genes and play fundamental roles in regulating transcription, yet the identity and precise roles of many of the trans-acting factors responsible for the establishment and maintenance of this organization remain to be identified. We profiled a compendium of 50 yeast strains carrying conditional alleles or complete deletions of genes involved in transcriptional regulation, histone biology, and chromatin remodeling, as well as compounds that target transcription and histone deacetylases, to assess their respective roles in nucleosome positioning and transcription. We find that nucleosome patterning in genes is affected by many factors, including the CAF-1 complex, Spt10, and Spt21, in addition to previously reported remodeler ATPases and histone chaperones. Disruption of these factors or reductions in histone levels led genic nucleosomes to assume positions more consistent with their intrinsic sequence preferences, with pronounced and specific shifts of the +1 nucleosome relative to the transcription start site. These shifts of +1 nucleosomes appear to have functional consequences, as several affected genes in Ino80 mutants exhibited altered expression responses. Our parallel expression profiling compendium revealed extensive transcription changes in intergenic and antisense regions, most of which occur in regions with altered nucleosome occupancy and positioning. We show that the nucleosome-excluding transcription factors Reb1, Abf1, Tbf1, and Rsc3 suppress cryptic transcripts at their target promoters, while a combined analysis of nucleosome and expression profiles identified 36 novel transcripts that are normally repressed by Tup1/Cyc8. Our data confirm and extend the roles of chromatin remodelers and chaperones as major determinants of genic nucleosome positioning, and these data provide a valuable resource for future studies.

  10. Polyphenol Compound as a Transcription Factor Inhibitor

    Directory of Open Access Journals (Sweden)

    Seyeon Park

    2015-10-01

    Full Text Available A target-based approach has been used to develop novel drugs in many therapeutic fields. In the final stage of intracellular signaling, transcription factor–DNA interactions are central to most biological processes and therefore represent a large and important class of targets for human therapeutics. Thus, we focused on the idea that the disruption of protein dimers and cognate DNA complexes could impair the transcriptional activation and cell transformation regulated by these proteins. Historically, natural products have been regarded as providing the primary leading compounds capable of modulating protein–protein or protein-DNA interactions. Although their mechanism of action is not fully defined, polyphenols including flavonoids were found to act mostly as site-directed small molecule inhibitors on signaling. There are many reports in the literature of screening initiatives suggesting improved drugs that can modulate the transcription factor interactions responsible for disease. In this review, we focus on polyphenol compound inhibitors against dimeric forms of transcription factor components of intracellular signaling pathways (for instance, c-jun/c-fos (Activator Protein-1; AP-1, c-myc/max, Nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB and β-catenin/T cell factor (Tcf.

  11. NAC transcription factors: structurally distinct, functionally diverse

    DEFF Research Database (Denmark)

    Olsen, Addie Nina; Ernst, Heidi A; Leggio, Leila Lo;

    2005-01-01

    NAC proteins constitute one of the largest families of plant-specific transcription factors, and the family is present in a wide range of land plants. Here, we summarize the biological and molecular functions of the NAC family, paying particular attention to the intricate regulation of NAC protei...

  12. Regulation of the Ets transcription factor Tel

    NARCIS (Netherlands)

    Roukens, Mark Guido

    2010-01-01

    In this thesis we report novel studies on the molecular regulation of the transcriptional repressor Tel (Translocation Ets Leukemia). The work in this thesis is presented as follows: Chapter 1 is an introduction which summarizes the literature about Tel and its Drosophila orthologue Yan as it was k

  13. HIV-1 transcription and latency: an update

    Science.gov (United States)

    2013-01-01

    Combination antiretroviral therapy, despite being potent and life-prolonging, is not curative and does not eradicate HIV-1 infection since interruption of treatment inevitably results in a rapid rebound of viremia. Reactivation of latently infected cells harboring transcriptionally silent but replication-competent proviruses is a potential source of persistent residual viremia in cART-treated patients. Although multiple reservoirs may exist, the persistence of resting CD4+ T cells carrying a latent infection represents a major barrier to eradication. In this review, we will discuss the latest reports on the molecular mechanisms that may regulate HIV-1 latency at the transcriptional level, including transcriptional interference, the role of cellular factors, chromatin organization and epigenetic modifications, the viral Tat trans-activator and its cellular cofactors. Since latency mechanisms may also operate at the post-transcriptional level, we will consider inhibition of nuclear RNA export and inhibition of translation by microRNAs as potential barriers to HIV-1 gene expression. Finally, we will review the therapeutic approaches and clinical studies aimed at achieving either a sterilizing cure or a functional cure of HIV-1 infection, with a special emphasis on the most recent pharmacological strategies to reactivate the latent viruses and decrease the pool of viral reservoirs. PMID:23803414

  14. Mitochondrial transcription: how does it end?

    Science.gov (United States)

    Byrnes, James; Garcia-Diaz, Miguel

    2011-01-01

    The structure of the mitochondrial transcription termination factor (MTERF1) provides novel insight into the mechanism of binding, recognition of the termination sequence and the conformational changes involved in mediating termination. Besides its functional implications, this structure provides a framework to understand the consequences of numerous diseases associated with mitochondrial DNA mutations.

  15. Genetic and epigenetic control of RKIP transcription.

    Science.gov (United States)

    Datar, Ila; Tegegne, Hanna; Qin, Kevin; Al-Mulla, Fahd; Bitar, Milad S; Trumbly, Robert J; Yeung, Kam C

    2014-01-01

    Raf kinase inhibitory protein (RKIP) is known to modulate key signaling cascades and regulate normal physiological processes such as cellular proliferation, differentiation, and apoptosis. The expression of RKIP is found to be downregulated in several cancer metastases and the repressed RKIP expression can be reactivated on treatment with chemotherapeutic agents. RKIP is a proven tumor metastasis suppressor gene and investigating the mechanisms of transcriptional regulation of RKIP is therefore of immense clinical importance. In this review, we discuss the basal expression of RKIP in various tissues and the genetic aspects of the RKIP chromosomal locus including the structure of the RKIP promoter as well as gene regulatory elements such as enhancers. We also review the genetic and epigenetic modulation of RKIP transcription through EZH2, a component of the polycomb repressive complex 2 (PRC2) and sequence specific transcription factors (TFs) BACH1 and Snail. Emerging experimental evidence supports a unifying model in which both these TFs repress RKIP transcription in cancers by recruiting the EZH2 containing repressive complex to the proximal RKIP promoter. Finally, we review the known mechanisms employed by different types of chemotherapeutic agents to activate RKIP expression in cancer cells.

  16. Systematic clustering of transcription start site landscapes

    DEFF Research Database (Denmark)

    Zhao, Xiaobei; Valen, Eivind; Parker, Brian J;

    2011-01-01

    Genome-wide, high-throughput methods for transcription start site (TSS) detection have shown that most promoters have an array of neighboring TSSs where some are used more than others, forming a distribution of initiation propensities. TSS distributions (TSSDs) vary widely between promoters...

  17. Harmonics of circadian gene transcription in mammals.

    Directory of Open Access Journals (Sweden)

    Michael E Hughes

    2009-04-01

    Full Text Available The circadian clock is a molecular and cellular oscillator found in most mammalian tissues that regulates rhythmic physiology and behavior. Numerous investigations have addressed the contribution of circadian rhythmicity to cellular, organ, and organismal physiology. We recently developed a method to look at transcriptional oscillations with unprecedented precision and accuracy using high-density time sampling. Here, we report a comparison of oscillating transcription from mouse liver, NIH3T3, and U2OS cells. Several surprising observations resulted from this study, including a 100-fold difference in the number of cycling transcripts in autonomous cellular models of the oscillator versus tissues harvested from intact mice. Strikingly, we found two clusters of genes that cycle at the second and third harmonic of circadian rhythmicity in liver, but not cultured cells. Validation experiments show that 12-hour oscillatory transcripts occur in several other peripheral tissues as well including heart, kidney, and lungs. These harmonics are lost ex vivo, as well as under restricted feeding conditions. Taken in sum, these studies illustrate the importance of time sampling with respect to multiple testing, suggest caution in use of autonomous cellular models to study clock output, and demonstrate the existence of harmonics of circadian gene expression in the mouse.

  18. Reverse Transcription of Retroviruses and LTR Retrotransposons.

    Science.gov (United States)

    Hughes, Stephen H

    2015-04-01

    The enzyme reverse transcriptase (RT) was discovered in retroviruses almost 50 years ago. The demonstration that other types of viruses, and what are now called retrotransposons, also replicated using an enzyme that could copy RNA into DNA came a few years later. The intensity of the research in both the process of reverse transcription and the enzyme RT was greatly stimulated by the recognition, in the mid-1980s, that human immunodeficiency virus (HIV) was a retrovirus and by the fact that the first successful anti-HIV drug, azidothymidine (AZT), is a substrate for RT. Although AZT monotherapy is a thing of the past, the most commonly prescribed, and most successful, combination therapies still involve one or both of the two major classes of anti-RT drugs. Although the basic mechanics of reverse transcription were worked out many years ago, and the first high-resolution structures of HIV RT are now more than 20 years old, we still have much to learn, particularly about the roles played by the host and viral factors that make the process of reverse transcription much more efficient in the cell than in the test tube. Moreover, we are only now beginning to understand how various host factors that are part of the innate immunity system interact with the process of reverse transcription to protect the host-cell genome, the host cell, and the whole host, from retroviral infection, and from unwanted retrotransposition.

  19. Mitochondrial transcription: How does it end

    Energy Technology Data Exchange (ETDEWEB)

    J Byrnes; M Garcia-Diaz

    2011-12-31

    The structure of the mitochondrial transcription termination factor (MTERF1) provides novel insight into the mechanism of binding, recognition of the termination sequence and the conformational changes involved in mediating termination. Besides its functional implications, this structure provides a framework to understand the consequences of numerous diseases associated with mitochondrial DNA mutations.

  20. The Lrp family of transcriptional regulators

    NARCIS (Netherlands)

    Brinkman, A.B.; Ettema, T.J.G.; Vos, de W.M.; Oost, van der J.

    2003-01-01

    Genome analysis has revealed that members of the Lrp family of transcriptional regulators are widely distributed among prokaryotes, both bacteria and archaea. The archetype Leucine-responsive Regulatory Protein from Escherichia coli is a global regulator involved in modulating a variety of metabolic

  1. TRANSFAC: transcriptional regulation, from patterns to profiles.

    Science.gov (United States)

    Matys, V; Fricke, E; Geffers, R; Gössling, E; Haubrock, M; Hehl, R; Hornischer, K; Karas, D; Kel, A E; Kel-Margoulis, O V; Kloos, D-U; Land, S; Lewicki-Potapov, B; Michael, H; Münch, R; Reuter, I; Rotert, S; Saxel, H; Scheer, M; Thiele, S; Wingender, E

    2003-01-01

    The TRANSFAC database on eukaryotic transcriptional regulation, comprising data on transcription factors, their target genes and regulatory binding sites, has been extended and further developed, both in number of entries and in the scope and structure of the collected data. Structured fields for expression patterns have been introduced for transcription factors from human and mouse, using the CYTOMER database on anatomical structures and developmental stages. The functionality of Match, a tool for matrix-based search of transcription factor binding sites, has been enhanced. For instance, the program now comes along with a number of tissue-(or state-)specific profiles and new profiles can be created and modified with Match Profiler. The GENE table was extended and gained in importance, containing amongst others links to LocusLink, RefSeq and OMIM now. Further, (direct) links between factor and target gene on one hand and between gene and encoded factor on the other hand were introduced. The TRANSFAC public release is available at http://www.gene-regulation.com. For yeast an additional release including the latest data was made available separately as TRANSFAC Saccharomyces Module (TSM) at http://transfac.gbf.de. For CYTOMER free download versions are available at http://www.biobase.de:8080/index.html.

  2. 40 CFR 164.82 - Transcripts.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Transcripts. 164.82 Section 164.82 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) PESTICIDE PROGRAMS RULES OF PRACTICE GOVERNING HEARINGS, UNDER THE FEDERAL INSECTICIDE, FUNGICIDE, AND RODENTICIDE ACT, ARISING FROM REFUSALS...

  3. Transcriptional Responses to the Auxin Hormone

    NARCIS (Netherlands)

    Weijers, Dolf; Wagner, Doris

    2016-01-01

    Auxin is arguably the most important signaling molecule in plants, and the last few decades have seen remarkable breakthroughs in understanding its production, transport, and perception. Recent investigations have focused on transcriptional responses to auxin, providing novel insight into the fun

  4. TCP transcription factors: architectures of plant form.

    Science.gov (United States)

    Manassero, Nora G Uberti; Viola, Ivana L; Welchen, Elina; Gonzalez, Daniel H

    2013-04-01

    After its initial definition in 1999, the TCP family of transcription factors has become the focus of a multiplicity of studies related with plant development at the cellular, organ, and tissue levels. Evidence has accumulated indicating that TCP transcription factors are the main regulators of plant form and architecture and constitute a tool through which evolution shapes plant diversity. The TCP transcription factors act in a multiplicity of pathways related with cell proliferation and hormone responses. In recent years, the molecular pathways of TCP protein action and biochemical studies on their mode of interaction with DNA have begun to shed light on their mechanism of action. However, the available information is fragmented and a unifying view of TCP protein action is lacking, as well as detailed structural studies of the TCP-DNA complex. Also important, the possible role of TCP proteins as integrators of plant developmental responses to the environment has deserved little attention. In this review, we summarize the current knowledge about the structure and functions of TCP transcription factors and analyze future perspectives for the study of the role of these proteins and their use to modify plant development.

  5. Harmonics of circadian gene transcription in mammals.

    Science.gov (United States)

    Hughes, Michael E; DiTacchio, Luciano; Hayes, Kevin R; Vollmers, Christopher; Pulivarthy, S; Baggs, Julie E; Panda, Satchidananda; Hogenesch, John B

    2009-04-01

    The circadian clock is a molecular and cellular oscillator found in most mammalian tissues that regulates rhythmic physiology and behavior. Numerous investigations have addressed the contribution of circadian rhythmicity to cellular, organ, and organismal physiology. We recently developed a method to look at transcriptional oscillations with unprecedented precision and accuracy using high-density time sampling. Here, we report a comparison of oscillating transcription from mouse liver, NIH3T3, and U2OS cells. Several surprising observations resulted from this study, including a 100-fold difference in the number of cycling transcripts in autonomous cellular models of the oscillator versus tissues harvested from intact mice. Strikingly, we found two clusters of genes that cycle at the second and third harmonic of circadian rhythmicity in liver, but not cultured cells. Validation experiments show that 12-hour oscillatory transcripts occur in several other peripheral tissues as well including heart, kidney, and lungs. These harmonics are lost ex vivo, as well as under restricted feeding conditions. Taken in sum, these studies illustrate the importance of time sampling with respect to multiple testing, suggest caution in use of autonomous cellular models to study clock output, and demonstrate the existence of harmonics of circadian gene expression in the mouse.

  6. Virtual Reference Transcript Analysis: A Few Models.

    Science.gov (United States)

    Smyth, Joanne

    2003-01-01

    Describes the introduction of virtual, or digital, reference service at the University of New Brunswick libraries. Highlights include analyzing transcripts from LIVE (Library Information in a Virtual Environment); reference question types; ACRL (Association of College and Research Libraries) information literacy competency standards; and the Big 6…

  7. ETS transcription factors in embryonic vascular development.

    Science.gov (United States)

    Craig, Michael P; Sumanas, Saulius

    2016-07-01

    At least thirteen ETS-domain transcription factors are expressed during embryonic hematopoietic or vascular development and potentially function in the formation and maintenance of the embryonic vasculature or blood lineages. This review summarizes our current understanding of the specific roles played by ETS factors in vasculogenesis and angiogenesis and the implications of functional redundancies between them.

  8. Interaction of Restin with transcription factors

    Institute of Scientific and Technical Information of China (English)

    WU; Yousheng; LU; Fan; QI; Yinxin; WANG; Ruihua; ZHANG; Jia

    2005-01-01

    Restin, a member of melanoma-associated antigen superfamily gene, was first cloned from differentiated leukemia cell induced by all trans-retinoic acid, and was able to inhibit cell proliferation, but the molecular mechanism was not clear. Since Restin was localized in cell nucleus, and its homolog member, Necdin (neuronal growth suppressor factor), could interact with transcription factors p53 and E2F1, we proposed that Restin might also function as Necdin through interacting with some transcription factors. In this study, transcription factors p53, AP1,ATFs and E2Fs were cloned and used in the mammalian two-hybrid system to identify their interaction with Restin. The results showed that only ATF3 had a strong interaction with Restin. It is interesting to know that ATF3 was an important transcription factor for G1 cell cycle initiation in physiological stress response. It was possible that the inhibition of cell proliferation by Restin might be related with the inhibition of ATF3 activity.

  9. 20 CFR 901.47 - Transcript.

    Science.gov (United States)

    2010-04-01

    ... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false Transcript. 901.47 Section 901.47 Employees' Benefits JOINT BOARD FOR THE ENROLLMENT OF ACTUARIES REGULATIONS GOVERNING THE PERFORMANCE OF ACTUARIAL SERVICES UNDER THE EMPLOYEE RETIREMENT INCOME SECURITY ACT OF 1974 Suspension or Termination of...

  10. Transcriptional enhancer from milk protein genes

    Energy Technology Data Exchange (ETDEWEB)

    Casperson, Gerald F. (Ballwin, MO); Schmidhauser, Christian T. (Berkeley, CA); Bissell, Mina J. (Berkeley, CA)

    1999-01-01

    The invention relates to novel enhancer nucleotide sequences which stimulate transcription of heterologous DNA in cells in culture. The enhancers are derived from major milk protein genes by the process of deletion mapping and functional analysis. The invention also relates to expression vectors containing the novel enhancers.

  11. Transcriptional enhancer from milk protein genes

    Energy Technology Data Exchange (ETDEWEB)

    Casperson, G.F.; Schmidhauser, C.T.; Bissell, M.J.

    1999-12-21

    The invention relates to novel enhancer nucleotide sequences which stimulate transcription of heterologous DNA in cells in culture. The enhancers are derived from major milk protein genes by the process of deletion mapping and functional analysis. The invention also relates to expression vectors containing the novel enhancers.

  12. Transcriptional control of hepatocanalicular transporter gene expression

    NARCIS (Netherlands)

    Muller, M

    2000-01-01

    Transport processes for larger organic solutes at the canalicular membrane are mainly driven by members of the superfamily of ATP-binding cassette (ABC) transporters. The funct ions of these transporters range from bile component secretion to xenobiotica and phase II-conjugate export. The transcript

  13. Insights into centromeric transcription in mitosis.

    Science.gov (United States)

    Liu, Hong

    2016-01-01

    The major role of RNA polymerase II (RNAP II) is to generate mRNAs. I recently uncovered a novel function of RNAP II in chromosome segregation in mitosis, installing the cohesin protector, Shugoshin, at centromeres. Here I will discuss the current understanding of RNAP II-dependent centromeric transcription in mitosis.

  14. Cross-Family Transcription Factor Interactions

    NARCIS (Netherlands)

    Bemer, Marian; Dijk, van Aalt-Jan; Immink, Richard G.H.; Angenent, Gerco C.

    2017-01-01

    Specific and dynamic gene expression strongly depends on transcription factor (TF) activity and most plant TFs function in a combinatorial fashion. They can bind to DNA and control the expression of the corresponding gene in an additive fashion or cooperate by physical interactions, forming larger p

  15. Transcriptional networks in epithelial-mesenchymal transition.

    Directory of Open Access Journals (Sweden)

    Christo Venkov

    Full Text Available Epithelial-mesenchymal transition (EMT changes polarized epithelial cells into migratory phenotypes associated with loss of cell-cell adhesion molecules and cytoskeletal rearrangements. This form of plasticity is seen in mesodermal development, fibroblast formation, and cancer metastasis.Here we identify prominent transcriptional networks active during three time points of this transitional process, as epithelial cells become fibroblasts. DNA microarray in cultured epithelia undergoing EMT, validated in vivo, were used to detect various patterns of gene expression. In particular, the promoter sequences of differentially expressed genes and their transcription factors were analyzed to identify potential binding sites and partners. The four most frequent cis-regulatory elements (CREs in up-regulated genes were SRY, FTS-1, Evi-1, and GC-Box, and RNA inhibition of the four transcription factors, Atf2, Klf10, Sox11, and SP1, most frequently binding these CREs, establish their importance in the initiation and propagation of EMT. Oligonucleotides that block the most frequent CREs restrain EMT at early and intermediate stages through apoptosis of the cells.Our results identify new transcriptional interactions with high frequency CREs that modulate the stability of cellular plasticity, and may serve as targets for modulating these transitional states in fibroblasts.

  16. The pre-vertebrate origins of neurogenic placodes.

    Science.gov (United States)

    Abitua, Philip Barron; Gainous, T Blair; Kaczmarczyk, Angela N; Winchell, Christopher J; Hudson, Clare; Kamata, Kaori; Nakagawa, Masashi; Tsuda, Motoyuki; Kusakabe, Takehiro G; Levine, Michael

    2015-08-27

    The sudden appearance of the neural crest and neurogenic placodes in early branching vertebrates has puzzled biologists for over a century. These embryonic tissues contribute to the development of the cranium and associated sensory organs, which were crucial for the evolution of the vertebrate "new head". A previous study suggests that rudimentary neural crest cells existed in ancestral chordates. However, the evolutionary origins of neurogenic placodes have remained obscure owing to a paucity of embryonic data from tunicates, the closest living relatives to those early vertebrates. Here we show that the tunicate Ciona intestinalis exhibits a proto-placodal ectoderm (PPE) that requires inhibition of bone morphogenetic protein (BMP) and expresses the key regulatory determinant Six1/2 and its co-factor Eya, a developmental process conserved across vertebrates. The Ciona PPE is shown to produce ciliated neurons that express genes for gonadotropin-releasing hormone (GnRH), a G-protein-coupled receptor for relaxin-3 (RXFP3) and a functional cyclic nucleotide-gated channel (CNGA), which suggests dual chemosensory and neurosecretory activities. These observations provide evidence that Ciona has a neurogenic proto-placode, which forms neurons that appear to be related to those derived from the olfactory placode and hypothalamic neurons of vertebrates. We discuss the possibility that the PPE-derived GnRH neurons of Ciona resemble an ancestral cell type, a progenitor to the complex neuronal circuit that integrates sensory information and neuroendocrine functions in vertebrates.

  17. In Vitro Transcription Assays and Their Application in Drug Discovery.

    Science.gov (United States)

    Yang, Xiao; Ma, Cong

    2016-09-20

    In vitro transcription assays have been developed and widely used for many years to study the molecular mechanisms involved in transcription. This process requires multi-subunit DNA-dependent RNA polymerase (RNAP) and a series of transcription factors that act to modulate the activity of RNAP during gene expression. Sequencing gel electrophoresis of radiolabeled transcripts is used to provide detailed mechanistic information on how transcription proceeds and what parameters can affect it. In this paper we describe the protocol to study how the essential elongation factor NusA regulates transcriptional pausing, as well as a method to identify an antibacterial agent targeting transcription initiation through inhibition of RNAP holoenzyme formation. These methods can be used a as platform for the development of additional approaches to explore the mechanism of action of the transcription factors which still remain unclear, as well as new antibacterial agents targeting transcription which is an underutilized drug target in antibiotic research and development.

  18. Optical tweezers studies of transcription by eukaryotic RNA polymerases.

    Science.gov (United States)

    Lisica, Ana; Grill, Stephan W

    2017-03-01

    Transcription is the first step in the expression of genetic information and it is carried out by large macromolecular enzymes called RNA polymerases. Transcription has been studied for many years and with a myriad of experimental techniques, ranging from bulk studies to high-resolution transcript sequencing. In this review, we emphasise the advantages of using single-molecule techniques, particularly optical tweezers, to study transcription dynamics. We give an overview of the latest results in the single-molecule transcription field, focusing on transcription by eukaryotic RNA polymerases. Finally, we evaluate recent quantitative models that describe the biophysics of RNA polymerase translocation and backtracking dynamics.

  19. Evolution of transcriptional networks in yeast: alternative teams of transcriptional factors for different species

    OpenAIRE

    Adriana Muñoz; Daniella Santos Muñoz; Aleksey Zimin; Yorke, James A.

    2016-01-01

    Background The diversity in eukaryotic life reflects a diversity in regulatory pathways. Nocedal and Johnson argue that the rewiring of gene regulatory networks is a major force for the diversity of life, that changes in regulation can create new species. Results We have created a method (based on our new “ping-pong algorithm) for detecting more complicated rewirings, where several transcription factors can substitute for one or more transcription factors in the regulation of a family of co-r...

  20. Transcriptional and post-transcriptional regulation of nucleotide excision repair genes in human cells

    Energy Technology Data Exchange (ETDEWEB)

    Lefkofsky, Hailey B. [Translational Oncology Program, University of Michigan Medical School, Ann Arbor, MI (United States); Veloso, Artur [Translational Oncology Program, University of Michigan Medical School, Ann Arbor, MI (United States); Department of Radiation Oncology, University of Michigan Medical School, Ann Arbor, MI (United States); Bioinformatics Program, Department of Computational Medicine and Bioinformatics, University of Michigan, Ann Arbor, MI (United States); Ljungman, Mats, E-mail: ljungman@umich.edu [Translational Oncology Program, University of Michigan Medical School, Ann Arbor, MI (United States); Department of Radiation Oncology, University of Michigan Medical School, Ann Arbor, MI (United States); Department of Environmental Health Sciences, School of Public Health, University of Michigan, Ann Arbor, MI (United States)

    2015-06-15

    Nucleotide excision repair (NER) removes DNA helix-distorting lesions induced by UV light and various chemotherapeutic agents such as cisplatin. These lesions efficiently block the elongation of transcription and need to be rapidly removed by transcription-coupled NER (TC-NER) to avoid the induction of apoptosis. Twenty-nine genes have been classified to code for proteins participating in nucleotide excision repair (NER) in human cells. Here we explored the transcriptional and post-transcriptional regulation of these NER genes across 13 human cell lines using Bru-seq and BruChase-seq, respectively. Many NER genes are relatively large in size and therefore will be easily inactivated by UV-induced transcription-blocking lesions. Furthermore, many of these genes produce transcripts that are rather unstable. Thus, these genes are expected to rapidly lose expression leading to a diminished function of NER. One such gene is ERCC6 that codes for the CSB protein critical for TC-NER. Due to its large gene size and high RNA turnover rate, the ERCC6 gene may act as dosimeter of DNA damage so that at high levels of damage, ERCC6 RNA levels would be diminished leading to the loss of CSB expression, inhibition of TC-NER and the promotion of cell death.

  1. CRTR-1, a developmentally regulated transcriptional repressor related to the CP2 family of transcription factors.

    Science.gov (United States)

    Rodda, S; Sharma, S; Scherer, M; Chapman, G; Rathjen, P

    2001-02-02

    CP2-related proteins comprise a family of DNA-binding transcription factors that are generally activators of transcription and expressed ubiquitously. We reported a differential display polymerase chain reaction fragment, Psc2, which was expressed in a regulated fashion in mouse pluripotent cells in vitro and in vivo. Here, we report further characterization of the Psc2 cDNA and function. The Psc2 cDNA contained an open reading frame homologous to CP2 family proteins. Regions implicated in DNA binding and oligomeric complex formation, but not transcription activation, were conserved. Psc2 expression in vivo during embryogenesis and in the adult mouse demonstrated tight spatial and temporal regulation, with the highest levels of expression in the epithelial lining of distal convoluted tubules in embryonic and adult kidneys. Functional analysis demonstrated that PSC2 repressed transcription 2.5-15-fold when bound to a heterologous promoter in ES, 293T, and COS-1 cells. The N-terminal 52 amino acids of PSC2 were shown to be necessary and sufficient for this activity and did not share obvious homology with reported repressor motifs. These results represent the first report of a CP2 family member that is expressed in a developmentally regulated fashion in vivo and that acts as a direct repressor of transcription. Accordingly, the protein has been named CP2-Related Transcriptional Repressor-1 (CRTR-1).

  2. Transcription-coupled DNA repair in prokaryotes.

    Science.gov (United States)

    Ganesan, Ann; Spivak, Graciela; Hanawalt, Philip C

    2012-01-01

    Transcription-coupled repair (TCR) is a subpathway of nucleotide excision repair (NER) that acts specifically on lesions in the transcribed strand of expressed genes. First reported in mammalian cells, TCR was then documented in Escherichia coli. In this organism, an RNA polymerase arrested at a lesion is displaced by the transcription repair coupling factor, Mfd. This protein recruits the NER lesion-recognition factor UvrA, and then dissociates from the DNA. UvrA binds UvrB, and the assembled UvrAB* complex initiates repair. In mutants lacking active Mfd, TCR is absent. A gene transcribed by the bacteriophage T7 RNA polymerase in E. coli also requires Mfd for TCR. The CSB protein (missing or defective in cells of patients with Cockayne syndrome, complementation group B) is essential for TCR in humans. CSB and its homologs in higher eukaryotes are likely functional equivalents of Mfd. Copyright © 2012 Elsevier Inc. All rights reserved.

  3. HIV transcription is induced in dying cells

    Energy Technology Data Exchange (ETDEWEB)

    Woloschak, G.E.; Chang-Liu, Chin-Mei [Argonne National Lab., IL (United States); Schreck, S. [Argonne National Lab., IL (United States)]|[Univ. of South Carolina, Columbia, SC (United States). Dept. of Chemistry; Panozzo, J. [Loyola Univ. Medical Center, Maywood, IL (United States); Libertin, C.R. [Loyola Univ. Medical Center, Maywood, IL (United States)

    1996-02-01

    Using HeLa cells stably transfected with an HIV-LTR-CAT construct, we demonstrated a peak in CAT induction that occurs in viable (but not necessarily cell-division-competent) cells 24 h following exposure to some cell-killing agents. {gamma} rays were the only cell-killing agent which did not induce HIV transcription; this can be attributed to the fact that {gamma}-ray-induced apoptotic death requires functional p53, which is not present in HeLa cells. For all other agents, HIV-LTR induction was dose-dependent and correlated with the amount of cell killing that occurred in the culture. Doses which caused over 99% cell killing induced HIV-LTR transcription maximally, demonstrating that cells that will go on to die by 14 days are the cells expressing HIV-LTR-CAT.

  4. Structural basis for transcription inhibition by tagetitoxin.

    Science.gov (United States)

    Vassylyev, Dmitry G; Svetlov, Vladimir; Vassylyeva, Marina N; Perederina, Anna; Igarashi, Noriyuki; Matsugaki, Naohiro; Wakatsuki, Soichi; Artsimovitch, Irina

    2005-12-01

    Tagetitoxin (Tgt) inhibits transcription by an unknown mechanism. A structure at a resolution of 2.4 A of the Thermus thermophilus RNA polymerase (RNAP)-Tgt complex revealed that the Tgt-binding site within the RNAP secondary channel overlaps that of the stringent control effector ppGpp, which partially protects RNAP from Tgt inhibition. Tgt binding is mediated exclusively through polar interactions with the beta and beta' residues whose substitutions confer resistance to Tgt in vitro. Importantly, a Tgt phosphate, together with two active site acidic residues, coordinates the third Mg(2+) ion, which is distinct from the two catalytic metal ions. We show that Tgt inhibits all RNAP catalytic reactions and propose a mechanism in which the Tgt-bound Mg(2+) ion has a key role in stabilization of an inactive transcription intermediate. Remodeling of the active site by metal ions could be a common theme in the regulation of catalysis by nucleic acid enzymes.

  5. The world according to GARP transcription factors.

    Science.gov (United States)

    Safi, Alaeddine; Medici, Anna; Szponarski, Wojciech; Ruffel, Sandrine; Lacombe, Benoît; Krouk, Gabriel

    2017-10-01

    Plant specific GARP transcription factor family (made of ARR-B and G2-like) contains genes with very diverse in planta functions: nutrient sensing, root and shoot development, floral transition, chloroplast development, circadian clock oscillation maintenance, hormonal transport and signaling. In this work we review: first, their structural but distant relationships with MYB transcription factors, second, their role in planta, third, the diversity of their Cis-regulatory elements, fourth, their potential protein partners. We conclude that the GARP family may hold keys to understand the interactions between nutritional signaling pathways (nitrogen and phosphate at least) and development. Understanding how plant nutrition and development are coordinated is central to understand how to adapt plants to an ever-changing environment. Consequently GARPs are likely to attract increasing research attentions, as they are likely at the crossroads of these fundamental processes. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. Comprehensive transcriptional map of primate brain development

    Science.gov (United States)

    Bakken, Trygve E.; Miller, Jeremy A.; Ding, Song-Lin; Sunkin, Susan M.; Smith, Kimberly A.; Ng, Lydia; Szafer, Aaron; Dalley, Rachel A.; Royall, Joshua J.; Lemon, Tracy; Shapouri, Sheila; Aiona, Kaylynn; Arnold, James; Bennett, Jeffrey L.; Bertagnolli, Darren; Bickley, Kristopher; Boe, Andrew; Brouner, Krissy; Butler, Stephanie; Byrnes, Emi; Caldejon, Shiella; Carey, Anita; Cate, Shelby; Chapin, Mike; Chen, Jefferey; Dee, Nick; Desta, Tsega; Dolbeare, Tim A.; Dotson, Nadia; Ebbert, Amanda; Fulfs, Erich; Gee, Garrett; Gilbert, Terri L.; Goldy, Jeff; Gourley, Lindsey; Gregor, Ben; Gu, Guangyu; Hall, Jon; Haradon, Zeb; Haynor, David R.; Hejazinia, Nika; Hoerder-Suabedissen, Anna; Howard, Robert; Jochim, Jay; Kinnunen, Marty; Kriedberg, Ali; Kuan, Chihchau L.; Lau, Christopher; Lee, Chang-Kyu; Lee, Felix; Luong, Lon; Mastan, Naveed; May, Ryan; Melchor, Jose; Mosqueda, Nerick; Mott, Erika; Ngo, Kiet; Nyhus, Julie; Oldre, Aaron; Olson, Eric; Parente, Jody; Parker, Patrick D.; Parry, Sheana; Pendergraft, Julie; Potekhina, Lydia; Reding, Melissa; Riley, Zackery L.; Roberts, Tyson; Rogers, Brandon; Roll, Kate; Rosen, David; Sandman, David; Sarreal, Melaine; Shapovalova, Nadiya; Shi, Shu; Sjoquist, Nathan; Sodt, Andy J.; Townsend, Robbie; Velasquez, Lissette; Wagley, Udi; Wakeman, Wayne B.; White, Cassandra; Bennett, Crissa; Wu, Jennifer; Young, Rob; Youngstrom, Brian L.; Wohnoutka, Paul; Gibbs, Richard A.; Rogers, Jeffrey; Hohmann, John G.; Hawrylycz, Michael J.; Hevner, Robert F.; Molnár, Zoltán; Phillips, John W.; Dang, Chinh; Jones, Allan R.; Amaral, David G.; Bernard, Amy; Lein, Ed S.

    2017-01-01

    The transcriptional underpinnings of brain development remain poorly understood, particularly in humans and closely related non-human primates. We describe a high resolution transcriptional atlas of rhesus monkey brain development that combines dense temporal sampling of prenatal and postnatal periods with fine anatomical parcellation of cortical and subcortical regions associated with human neuropsychiatric disease. Gene expression changes more rapidly before birth, both in progenitor cells and maturing neurons, and cortical layers and areas acquire adult-like molecular profiles surprisingly late postnatally. Disparate cell populations exhibit distinct developmental timing but also unexpected synchrony of processes underlying neural circuit construction including cell projection and adhesion. Candidate risk genes for neurodevelopmental disorders including primary microcephaly, autism spectrum disorder, intellectual disability, and schizophrenia show disease-specific spatiotemporal enrichment within developing neocortex. Human developmental expression trajectories are more similar to monkey than rodent, and approximately 9% of genes show human-specific regulation with evidence for prolonged maturation or neoteny. PMID:27409810

  7. The "fourth dimension" of gene transcription.

    Science.gov (United States)

    O'Malley, Bert W

    2009-05-01

    The three dimensions of space provide our relationship to position on the earth, but the fourth dimension of time has an equally profound influence on our lives. Everything from light and sound to weather and biology operate on the principle of measurable temporal periodicity. Consequently, a wide variety of time clocks affect all aspects of our existence. The annual (and biannual) cycles of activity, metabolism, and mating, the monthly physiological clocks of women and men, and the 24-h diurnal rhythms of humans are prime examples. Should it be surprising to us that the fourth dimension also impinges upon gene expression and that the genome itself is regulated by the fastest running of all biological clocks? Recent evidence substantiates the existence of such a ubiquitin-dependent transcriptional clock that is based upon the activation and destruction of transcriptional coactivators.

  8. Improving accuracy of transcripts in qualitative research.

    Science.gov (United States)

    MacLean, Lynne M; Meyer, Mechthild; Estable, Alma

    2004-01-01

    Everyone who has worked with qualitative interview data has run into problems with transcription error, even if they do the transcribing themselves. A thoughtful, accurate, reliable, multilingual transcriptionist with a quick turnaround time is worth her or his weight in gold. In this article, the authors examine some transcription circumstances that seem to bring about their own consistent set of problems. Based on their experiences, the authors examine the following issues: use of voice recognition systems; notation choices; processing and active listening versus touch typing; transcriptionist effect; emotionally loaded audiotaped material; class and/or cultural differences among interviewee, interviewer, and transcriptionist; and some errors that arise when working in a second language. The authors offer suggestions for working with transcriptionists as part of the qualitative research team.

  9. Computational Investigations of Post-Transcriptional Regulation

    DEFF Research Database (Denmark)

    Rasmussen, Simon Horskjær

    are the “switches” of combinatorial regulation. RBP hotspots are highly accessible AU-rich regions that are more frequently bound by RBPs and they are frequently in the vicinity of miRNA target sites. To further investigate this, an experimental design and analysis method, to further unravel combinatorial...... investigated using high-throughput data. Analysis of IMP RIP-seq, iCLIP and RNA-seq datasets identified transcripts associated with cytoplasmic IMP ribonucleoproteins. Many of these transcripts were functionally involved in actin cytoskeletal remodeling. Further analyses of this data permitted estimation...... of a bipartite motif, composed of an AU-rich and a CA-rich domain. In addition, a regulatory motif discovery method was developed and applied to identify motifs using differential expression data and CLIP-data in the above investigations. This thesis increased the understanding of the role of RBPs in miRNA...

  10. Computational Investigations of Post-Transcriptional Regulation

    DEFF Research Database (Denmark)

    Rasmussen, Simon Horskjær

    are the “switches” of combinatorial regulation. RBP hotspots are highly accessible AU-rich regions that are more frequently bound by RBPs and they are frequently in the vicinity of miRNA target sites. To further investigate this, an experimental design and analysis method, to further unravel combinatorial...... investigated using high-throughput data. Analysis of IMP RIP-seq, iCLIP and RNA-seq datasets identified transcripts associated with cytoplasmic IMP ribonucleoproteins. Many of these transcripts were functionally involved in actin cytoskeletal remodeling. Further analyses of this data permitted estimation...... of a bipartite motif, composed of an AU-rich and a CA-rich domain. In addition, a regulatory motif discovery method was developed and applied to identify motifs using differential expression data and CLIP-data in the above investigations. This thesis increased the understanding of the role of RBPs in mi...

  11. DNA Transcription Mechanism with a Moving Enzyme

    CERN Document Server

    Ting, J J L

    1997-01-01

    Previous numerical investigations of an one-dimensional DNA model with an extended modified coupling constant by transcripting enzyme are integrated to longer time and demonstrated explicitly the trapping of breathers by DNA chains with realistic parameters obtained from experiments. Furthermore, collective coordinate method is used to explain a previously observed numerical evidence that breathers placed far from defects are difficult to trap, and the motional effect of RNA-polymerase is investigated.

  12. Evolution of transcriptional regulation in "Escherichia coli"

    OpenAIRE

    Wolf, Luise

    2014-01-01

    During gene expression, transcription initiation marks the first step towards synthesis of functional proteins. Expression levels of specific types of RNA molecules in the cell depend on the underlying genotype of the promoter sequence. Prediction of expression levels from the promoter sequence alone can have important implications for the design of artificial promoters. In this work, we explored promoter determinants that cause differences in expression levels and tracked how ...

  13. Rad51 activates polyomavirus JC early transcription.

    Directory of Open Access Journals (Sweden)

    Martyn K White

    Full Text Available The human neurotropic polyomavirus JC (JCV causes the fatal CNS demyelinating disease progressive multifocal leukoencephalopathy (PML. JCV infection is very common and after primary infection, the virus is able to persist in an asymptomatic state. Rarely, and usually only under conditions of immune impairment, JCV re-emerges to actively replicate in the astrocytes and oligodendrocytes of the brain causing PML. The regulatory events involved in the reactivation of active viral replication in PML are not well understood but previous studies have implicated the transcription factor NF-κB acting at a well-characterized site in the JCV noncoding control region (NCCR. NF-κB in turn is regulated in a number of ways including activation by cytokines such as TNF-α, interactions with other transcription factors and epigenetic events involving protein acetylation--all of which can regulate the transcriptional activity of JCV. Active JCV infection is marked by the occurrence of rapid and extensive DNA damage in the host cell and the induction of the expression of cellular proteins involved in DNA repair including Rad51, a major component of the homologous recombination-directed double-strand break DNA repair machinery. Here we show that increased Rad51 expression activates the JCV early promoter. This activation is co-operative with the stimulation caused by NF-κB p65, abrogated by mutation of the NF-κB binding site or siRNA to NFκB p65 and enhanced by the histone deacetylase inhibitor sodium butyrate. These data indicate that the induction of Rad51 resulting from infection with JCV acts through NF-κB via its binding site to stimulate JCV early transcription. We suggest that this provides a novel positive feedback mechanism to enhance viral gene expression during the early stage of JCV infection.

  14. Transcriptional upregulation of restin by p53

    Institute of Scientific and Technical Information of China (English)

    WANG RuiHua; LU Fan; FU HaiYan; WU YouSheng; YANG GuoDong; ZHAO WenMing; Zhao ZhongLiang

    2007-01-01

    Restin, belonging to the melanoma-associated antigen superfamily, was firstly cloned from the differentiated HL-60 cells when induced by all-trans retinoic acid ( ATRA ) in our lab. Our previous results showed that restin might be correlated to cell cycle arrest. Due to the importance of p53 in the regulation of cell growth and the relationship between p53 and ATRA, we tried to test the relationship between p53 and restin. Firstly, transfection results showed that p53 was able to upregulate the expression of restin at the transcriptional level when p53 was transfected into eukaryotic cells. Secondly, the bioinformatics analysis revealed that the upstream sequence (about 2 kb) from the first ATG of the ORF of restin gene contained a p53 binding site. In order to confirm that p53 was involved in the transcriptional regulation of restin, we cloned the upstream sequence of restin and constructed the promoter luciferase reporter system. From the luciferase activity, we demonstrated that the promoter of restin gene could be induced by ATRA. Then, another two luciferase reporter plasmids driven by the reporter of restin with no (RP△p53-luc) or mutant (mRP-luc) p53 binding site were constructed to see the regulation of restin by p53. Results showed that the transcriptional upregulation of restin gene was not due to the putative p53 binding site on the upstream of restin gene. We proposed that p53 upregulated restin transcription through an indirect way rather than direct interaction with the cis-activating element of the restin promoter.

  15. Transcriptional upregulation of restin by p53

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    Restin, belonging to the melanoma-associated antigen superfamily, was firstly cloned from the differentiated HL-60 cells when induced by all-trans retinoic acid ( ATRA ) in our lab. Our previous results showed that restin might be correlated to cell cycle arrest. Due to the importance of p53 in the regulation of cell growth and the relationship between p53 and ATRA, we tried to test the relationship between p53 and restin. Firstly, transfection results showed that p53 was able to upregulate the expression of restin at the transcriptional level when p53 was transfected into eukaryotic cells. Secondly, the bioinformatics analysis revealed that the upstream sequence (about 2 kb) from the first ATG of the ORF of restin gene contained a p53 binding site. In order to confirm that p53 was involved in the transcriptional regulation of restin, we cloned the upstream sequence of restin and constructed the promoter luciferase reporter system. From the luciferase activity, we demonstrated that the promoter of restin gene could be induced by ATRA. Then, another two luciferase reporter plasmids driven by the reporter of restin with no (RP?p53-luc) or mutant (mRP-luc) p53 binding site were constructed to see the regulation of restin by p53. Results showed that the transcriptional upregulation of restin gene was not due to the putative p53 binding site on the upstream of restin gene. We proposed that p53 upregulated restin transcription through an indirect way rather than direct interaction with the cis-activating element of the restin promoter.

  16. Discontent with content analysis of online transcripts

    Directory of Open Access Journals (Sweden)

    Judith Guevarra Enriquez

    2009-12-01

    Full Text Available Content analysis has dominated computer-mediated communication and educational technology studies for some time, and a review of its practices applied to online corpus of data or messages is overdue. We are confronted with complexity given the various foci, nuances and models for theorising learning and applying methods. One common suggestion to deal with the complexity in content analysis is a call for standardisation by replication or systematic research studies. This article presents its ‘discontent' with content analysis, discussing the issues and concerns that surround the analysis of online transcripts. It does not attempt to resolve nor provide a definitive answer. Instead, it is an open inquiry into another way of looking at online content. It presents an alternative or perhaps an extension of what we have come to know as content analysis. It argues for the notion of genres as another way of conceptualising online transcripts. It proposes two things: first that in performing transcript analysis, it is worthwhile to think how messages relate to a system of interactions that persists even beyond the online environment; secondly, there is an emergent and recurring metastructuring that is at work in online environments that is worth exploring, instead of imposing structures – models and frameworks that do not fit the emerging communicative practices of participants.

  17. Supercoiling of the DNA Template during Transcription

    Science.gov (United States)

    Liu, Leroy F.; Wang, James C.

    1987-10-01

    Transcription of a right-handed double-helical DNA requires a relative rotation of the RNA polymerase and its nascent RNA around the DNA. We describe conditions under which the resistance to the rotational motion of the transcription ensemble around the DNA can be large. In such cases, the advancing polymerase generates positive supercoils in the DNA template ahead of it and negative supercoils behind it. Mutual annihilation of the positively and negatively supercoiled regions may be prevented by anchoring points on the DNA to a large structure, or, in the case of an unanchored plasmid, by the presence of two oppositely oriented transcription units. In prokaryotes, DNA topoisomerase I preferentially removes negative supercoils and DNA gyrase (topoisomerase II) removes positive ones. Our model thus provides an explanation for the experimentally observed high degree of negative or positive supercoiling of intracellular pBR322 DNA when DNA topoisomerase I or gyrase is respectively inhibited. We discuss the implications of our model in terms of supercoiling regulation, DNA conformational transitions, and gene regulation in both prokaryotes and eukaryotes.

  18. Addressing some Common Problems in Transcript Analysis

    Directory of Open Access Journals (Sweden)

    Patrick J. Fahy

    2001-01-01

    Full Text Available Computer conferencing is one of the more useful parts of computer-mediated communications (CMC, and is virtually ubiquitous in distance education. The temptation to analyze the resulting interaction has resulted in only partial success, however (Henri, 1992; Kanuka and Anderson, 1998; Rourke, Anderson, Garrison and Archer, 1999; Fahy, Crawford, Ally, Cookson, Keller and Prosser, 2000. Some suggest the problem is made more complex by failings of both technique and, more seriously, theory capable of guiding transcript analysis research (Gunawardena, Lowe and Anderson, 1997.We have previously described development and pilot-testing of an instrument and a process for transcript analysis, call the the TAT (Transcript Analysis Tool, based on a model originally developed by Zhu (1996. We found that the instrument and coding procedures used provided acceptable – sometimes excellent – levels of interrater reliability (varying from 70 percent to 94 percent in pilot applications, depending upon user training and practice with the instrument, and that results of pilots indicated the TAT discriminated well among the various types of statements found in online conferences (Fahy, et al., 2000.

  19. Adaptive evolution of transcription factor binding sites

    Directory of Open Access Journals (Sweden)

    Berg Johannes

    2004-10-01

    Full Text Available Abstract Background The regulation of a gene depends on the binding of transcription factors to specific sites located in the regulatory region of the gene. The generation of these binding sites and of cooperativity between them are essential building blocks in the evolution of complex regulatory networks. We study a theoretical model for the sequence evolution of binding sites by point mutations. The approach is based on biophysical models for the binding of transcription factors to DNA. Hence we derive empirically grounded fitness landscapes, which enter a population genetics model including mutations, genetic drift, and selection. Results We show that the selection for factor binding generically leads to specific correlations between nucleotide frequencies at different positions of a binding site. We demonstrate the possibility of rapid adaptive evolution generating a new binding site for a given transcription factor by point mutations. The evolutionary time required is estimated in terms of the neutral (background mutation rate, the selection coefficient, and the effective population size. Conclusions The efficiency of binding site formation is seen to depend on two joint conditions: the binding site motif must be short enough and the promoter region must be long enough. These constraints on promoter architecture are indeed seen in eukaryotic systems. Furthermore, we analyse the adaptive evolution of genetic switches and of signal integration through binding cooperativity between different sites. Experimental tests of this picture involving the statistics of polymorphisms and phylogenies of sites are discussed.

  20. Repetitive Elements in Mycoplasma hyopneumoniae Transcriptional Regulation

    Science.gov (United States)

    Cattani, Amanda Malvessi; Siqueira, Franciele Maboni; Guedes, Rafael Lucas Muniz; Schrank, Irene Silveira

    2016-01-01

    Transcriptional regulation, a multiple-step process, is still poorly understood in the important pig pathogen Mycoplasma hyopneumoniae. Basic motifs like promoters and terminators have already been described, but no other cis-regulatory elements have been found. DNA repeat sequences have been shown to be an interesting potential source of cis-regulatory elements. In this work, a genome-wide search for tandem and palindromic repetitive elements was performed in the intergenic regions of all coding sequences from M. hyopneumoniae strain 7448. Computational analysis demonstrated the presence of 144 tandem repeats and 1,171 palindromic elements. The DNA repeat sequences were distributed within the 5’ upstream regions of 86% of transcriptional units of M. hyopneumoniae strain 7448. Comparative analysis between distinct repetitive sequences found in related mycoplasma genomes demonstrated different percentages of conservation among pathogenic and nonpathogenic strains. qPCR assays revealed differential expression among genes showing variable numbers of repetitive elements. In addition, repeats found in 206 genes already described to be differentially regulated under different culture conditions of M. hyopneumoniae strain 232 showed almost 80% conservation in relation to M. hyopneumoniae strain 7448 repeats. Altogether, these findings suggest a potential regulatory role of tandem and palindromic DNA repeats in the M. hyopneumoniae transcriptional profile. PMID:28005945

  1. Alternative Spliced Transcripts as Cancer Markers

    Directory of Open Access Journals (Sweden)

    Otavia L. Caballero

    2001-01-01

    Full Text Available Eukaryotic mRNAs are transcribed as precursors containing their intronic sequences. These are subsequently excised and the exons are spliced together to form mature mRNAs. This process can lead to transcript diversification through the phenomenon of alternative splicing. Alternative splicing can take the form of one or more skipped exons, variable position of intron splicing or intron retention. The effect of alternative splicing in expanding protein repertoire might partially underlie the apparent discrepancy between gene number and the complexity of higher eukaryotes. It is likely that more than 50% form. Many cancer-associated genes, such as CD44 and WT1 are alternatively spliced. Variation of the splicing process occurs during tumor progression and may play a major role in tumorigenesis. Furthermore, alternatively spliced transcripts may be extremely useful as cancer markers, since it appears likely that there may be striking contrasts in usage of alternatively spliced transcript variants between normal and tumor tissue than in alterations in the general levels of gene expression.

  2. The Mediator complex and transcription regulation

    Science.gov (United States)

    Poss, Zachary C.; Ebmeier, Christopher C.

    2013-01-01

    The Mediator complex is a multi-subunit assembly that appears to be required for regulating expression of most RNA polymerase II (pol II) transcripts, which include protein-coding and most non-coding RNA genes. Mediator and pol II function within the pre-initiation complex (PIC), which consists of Mediator, pol II, TFIIA, TFIIB, TFIID, TFIIE, TFIIF and TFIIH and is approximately 4.0 MDa in size. Mediator serves as a central scaffold within the PIC and helps regulate pol II activity in ways that remain poorly understood. Mediator is also generally targeted by sequence-specific, DNA-binding transcription factors (TFs) that work to control gene expression programs in response to developmental or environmental cues. At a basic level, Mediator functions by relaying signals from TFs directly to the pol II enzyme, thereby facilitating TF-dependent regulation of gene expression. Thus, Mediator is essential for converting biological inputs (communicated by TFs) to physiological responses (via changes in gene expression). In this review, we summarize an expansive body of research on the Mediator complex, with an emphasis on yeast and mammalian complexes. We focus on the basics that underlie Mediator function, such as its structure and subunit composition, and describe its broad regulatory influence on gene expression, ranging from chromatin architecture to transcription initiation and elongation, to mRNA processing. We also describe factors that influence Mediator structure and activity, including TFs, non-coding RNAs and the CDK8 module. PMID:24088064

  3. Transcriptional analysis of Pleurotus ostreatus laccase genes.

    Science.gov (United States)

    Pezzella, Cinzia; Lettera, Vincenzo; Piscitelli, Alessandra; Giardina, Paola; Sannia, Giovanni

    2013-01-01

    Fungal laccases (p-diphenol:oxygen oxidoreductase; EC 1.10.3.2) are multi-copper-containing oxidases that catalyse the oxidation of a great variety of phenolic compounds and aromatic amines through simultaneous reduction of molecular oxygen to water. Fungi generally produce several laccase isoenzymes encoded by complex multi-gene families. The Pleurotus ostreatus genome encodes 11 putative laccase coding genes, and only six different laccase isoenzymes have been isolated and characterised so far. Laccase expression was found to be regulated by culture conditions and developmental stages even if the redundancy of these genes still raises the question about their respective functions in vivo. In this context, laccase transcript profiling analysis has been used to unravel the physiological role played by the different isoforms produced by P. ostreatus. Even if reported results depict a complex picture of the transcriptional responses exhibited by the analysed laccase genes, they were allowed to speculate on the isoform role in vivo. Among the produced laccases, LACC10 (POXC) seems to play a major role during vegetative growth, since its transcription is downregulated when the fungus starts the fructification process. Furthermore, a new tessera has been added to the puzzling mosaic of the heterodimeric laccase LACC2 (POXA3). LACC2 small subunit seems to play an additional physiological role during fructification, beside that of LACC2 complex activation/stabilisation.

  4. Transcriptional regulation of mononuclear phagocyte development

    Directory of Open Access Journals (Sweden)

    Roxane eTussiwand

    2015-10-01

    Full Text Available IntroductionThe mononuclear-phagocyte system (MPS, which comprises dendritic cells (DCs, macrophages and monocytes, is a heterogeneous group of myeloid cells. The complexity of the MPS is equally reflected by the plasticity in function and phenotype that characterizes each subset depending on their location and activation state. Specialized subsets of Mononuclear Phagocytes (MP reside in defined anatomical locations, are critical for the homeostatic maintenance of tissues, and provide the link between innate and adaptive immune responses during infections. The ability of MP to maintain or to induce the correct tolerogenic or inflammatory milieu also resides in their complex subset specialization. Such subset heterogeneity is obtained through lineage diversification and specification, which is controlled by defined transcriptional networks and programs. Understanding the MP biology means to define their transcriptional signature, which is required during lineage commitment, and which characterizes each subset’s features. This review will focus on the transcriptional regulation of the MPS; in particular what determines lineage commitment and functional identity; we will emphasizes recent advances in the field of single cell analysis and highlight unresolved questions in the field.

  5. [The Effect of Transcription on Enhancer Activity in Drosophila melanogaster].

    Science.gov (United States)

    Erokhin, M M; Davydova, A I; Lomaev, D V; Georgiev, P G; Chetverina, D A

    2016-01-01

    In higher eukaryotes, the level of gene transcription is under the control of DNA regulatory elements, such as promoter, from which transcription is initiated with the participation of RNA polymerase II and general transcription factors, as well as the enhancer, which increase the rate of transcription with the involvement of activator proteins and cofactors. It was demonstrated that enhancers are often located in the transcribed regions of the genome. We showed earlier that transcription negatively affected the activity of enhancers in Drosophila in model transgenic systems. In this study, we tested the effect of the distance between the leading promoter, enhancer, and target promoter on the inhibitory effect of transcriptions of different strengths. It was demonstrated that the negative effect of transcription remained, but weakened with increased distance between the leading promoter and enhancer and with decreased distance between the enhancer and target promoter. Thus, transcription can modulate the activity of enhancers by controlling its maximum level.

  6. Theoretical analysis of transcription process with polymerase stalling

    CERN Document Server

    Li, Jingwei

    2015-01-01

    Experimental evidences show that in gene transcription, RNA polymerase has the possibility to be stalled at certain position of the transcription template. This may be due to the template damage, or protein barriers. Once stalled, polymerase may backtrack along the template to the previous nucleotide to wait for the repair of the damaged site, or simply bypass the barrier or damaged site and consequently synthesize an incorrect messenger RNA, or degrade and detach from the template. Thus, the {\\it effective} transcription rate (the rate to synthesize correct product mRNA) and the transcription {\\it effectiveness} (the ratio of the {\\it effective} transcription rate to the {\\it effective} transcription initiation rate) are both influenced by polymerase stalling events. This study shows that, Without backtracking, detachment of stalled polymerase can also help to increase the {\\it effective} transcription rate and transcription {\\it effectiveness}. Generally, the increase of bypass rate of the stalled polymeras...

  7. Controllability analysis of transcriptional regulatory networks reveals circular control patterns among transcription factors.

    Science.gov (United States)

    Österlund, Tobias; Bordel, Sergio; Nielsen, Jens

    2015-05-01

    Transcriptional regulation is the most committed type of regulation in living cells where transcription factors (TFs) control the expression of their target genes and TF expression is controlled by other TFs forming complex transcriptional regulatory networks that can be highly interconnected. Here we analyze the topology and organization of nine transcriptional regulatory networks for E. coli, yeast, mouse and human, and we evaluate how the structure of these networks influences two of their key properties, namely controllability and stability. We calculate the controllability for each network as a measure of the organization and interconnectivity of the network. We find that the number of driver nodes nD needed to control the whole network is 64% of the TFs in the E. coli transcriptional regulatory network in contrast to only 17% for the yeast network, 4% for the mouse network and 8% for the human network. The high controllability (low number of drivers needed to control the system) in yeast, mouse and human is due to the presence of internal loops in their regulatory networks where the TFs regulate each other in a circular fashion. We refer to these internal loops as circular control motifs (CCM). The E. coli transcriptional regulatory network, which does not have any CCMs, shows a hierarchical structure of the transcriptional regulatory network in contrast to the eukaryal networks. The presence of CCMs also has influence on the stability of these networks, as the presence of cycles can be associated with potential unstable steady-states where even small changes in binding affinities can cause dramatic rearrangements of the state of the network.

  8. Evolution of transcriptional networks in yeast: alternative teams of transcriptional factors for different species

    Directory of Open Access Journals (Sweden)

    Adriana Muñoz

    2016-11-01

    Full Text Available Abstract Background The diversity in eukaryotic life reflects a diversity in regulatory pathways. Nocedal and Johnson argue that the rewiring of gene regulatory networks is a major force for the diversity of life, that changes in regulation can create new species. Results We have created a method (based on our new “ping-pong algorithm for detecting more complicated rewirings, where several transcription factors can substitute for one or more transcription factors in the regulation of a family of co-regulated genes. An example is illustrative. A rewiring has been reported by Hogues et al. that RAP1 in Saccharomyces cerevisiae substitutes for TBF1/CBF1 in Candida albicans for ribosomal RP genes. There one transcription factor substitutes for another on some collection of genes. Such a substitution is referred to as a “rewiring”. We agree with this finding of rewiring as far as it goes but the situation is more complicated. Many transcription factors can regulate a gene and our algorithm finds that in this example a “team” (or collection of three transcription factors including RAP1 substitutes for TBF1 for 19 genes. The switch occurs for a branch of the phylogenetic tree containing 10 species (including Saccharomyces cerevisiae, while the remaining 13 species (Candida albicans are regulated by TBF1. Conclusions To gain insight into more general evolutionary mechanisms, we have created a mathematical algorithm that finds such general switching events and we prove that it converges. Of course any such computational discovery should be validated in the biological tests. For each branch of the phylogenetic tree and each gene module, our algorithm finds a sub-group of co-regulated genes and a team of transcription factors that substitutes for another team of transcription factors. In most cases the signal will be small but in some cases we find a strong signal of switching. We report our findings for 23 Ascomycota fungi species.

  9. BEND3 mediates transcriptional repression and heterochromatin organization.

    Science.gov (United States)

    Khan, Abid; Prasanth, Supriya G

    2015-01-01

    Transcription repression plays a central role in gene regulation. Transcription repressors utilize diverse strategies to mediate transcriptional repression. We have recently demonstrated that BEND3 (BANP, E5R and Nac1 domain) protein represses rDNA transcription by stabilizing a NoRC component. We discuss the role of BEND3 as a global regulator of gene expression and propose a model whereby BEND3 associates with chromatin remodeling complexes to modulate gene expression and heterochromatin organization.

  10. Structural basis of transcription initiation by RNA polymerase II.

    OpenAIRE

    Sainsbury, S.; Bernecky, C.; Cramer, P

    2015-01-01

    Transcription of eukaryotic protein-coding genes commences with the assembly of a conserved initiation complex, which consists of RNA polymerase II (Pol II) and the general transcription factors, at promoter DNA. After two decades of research, the structural basis of transcription initiation is emerging. Crystal structures of many components of the initiation complex have been resolved, and structural information on Pol II complexes with general transcription factors has recently been obtaine...

  11. Computational Analysis of the Transcriptional Regulation of the Actin Family

    Institute of Scientific and Technical Information of China (English)

    郑家顺; 吴加金; 孙之荣

    2002-01-01

    Transcriptional regulation is a very important regulatory step in the regulation of gene expression. Transcription factors (TFs) play an important role in controlling the temporal special specificity of gene expression. The regulation area of actin genes was analyzed statistically to predict the transcription factor binding sites in the regulatory area. A group of transcription factors located in most of the sequences is believed to play an important role in co-regulating the expression of actin genes.

  12. Transcription Factor Families Regulate the Anthocyanin Biosynthetic Pathway in Capsicum

    Science.gov (United States)

    Anthocyanin structural gene transcription requires the expression of at least one member of each of three transcription factor families - MYC, MYB and WD40. These transcription factors form a complex that binds to structural gene promoters, thereby modulating gene expression. Capsicum annuum display...

  13. Predicting Phonetic Transcription Agreement: Insights from Research in Infant Vocalizations

    Science.gov (United States)

    Ramsdell, Heather L.; Oller, D. Kimbrough; Ethington, Corinna A.

    2007-01-01

    The purpose of this study is to provide new perspectives on correlates of phonetic transcription agreement. Our research focuses on phonetic transcription and coding of infant vocalizations. The findings are presumed to be broadly applicable to other difficult cases of transcription, such as found in severe disorders of speech, which similarly…

  14. Role of transcription at centromeres in budding yeast.

    Science.gov (United States)

    Ohkuni, Kentaro; Kitagawa, Katsumi

    2012-01-01

    Centromeres are specialized chromosomal loci that are essential for proper chromosome segregation. Recent data show that a certain level of active transcription, regulated by transcription factors Cbf1 and Ste12, makes a direct contribution to centromere function in Saccharomyces cerevisiae. Here, we discuss the requirement and function of transcription at centromeres.

  15. In silico and wet lab approaches to study transcriptional regulation

    NARCIS (Netherlands)

    Hestand, Matthew Scott

    2010-01-01

    Gene expression is a complicated process with multiple types of regulation, including binding of proteins termed transcription factors. This thesis looks at transcription factors and transcription factor binding site discovery through computational predictions and wet lab work to better elucidate th

  16. 45 CFR 1703.404 - Copying and transcription charges.

    Science.gov (United States)

    2010-10-01

    ... 45 Public Welfare 4 2010-10-01 2010-10-01 false Copying and transcription charges. 1703.404... Copying and transcription charges. (a) The Commission will charge fees for furnishing records at the rate of ten cents per page for photocopies and at the actual cost of transcription. When the...

  17. Friedreich's ataxia--a case of aberrant transcription termination?

    Science.gov (United States)

    Butler, Jill Sergesketter; Napierala, Marek

    2015-01-01

    Reduced expression of the mitochondrial protein Frataxin (FXN) is the underlying cause of Friedreich's ataxia. We propose a model of premature termination of FXN transcription induced by pathogenic expanded GAA repeats that links R-loop structures, antisense transcription, and heterochromatin formation as a novel mechanism of transcriptional repression in Friedreich's ataxia.

  18. Expression analysis of OsbZIP transcription factors in resistance ...

    African Journals Online (AJOL)

    zino

    2013-08-21

    Aug 21, 2013 ... Plant basic leucine zipper (bZIP) proteins play an essential role in the genes ... Key words: OsbZIP transcription factors, rice blast, resistance ... quantitative reverse transcriptions polymerase chain reaction. ... eukaryotes, which shared two common structures: a .... RNA extration and reverse transcription.

  19. Validation, automatic generation and use of broad phonetic transcriptions

    NARCIS (Netherlands)

    Bael, Cristophe Patrick Jan Van

    2007-01-01

    Broad phonetic transcriptions represent the pronunciation of words as strings of characters from specifically designed symbol sets. In everyday life, broad phonetic transcriptions are often used as aids to pronounce (foreign) words. In addition, broad phonetic transcriptions are often used for lingu

  20. Breaking up the transcription logjam can improve cash flow.

    Science.gov (United States)

    Paulik, Dennis

    2004-06-01

    Using more than 20 transcription companies to handle its annual volume of 36 million lines, Health Midwest knew it had to gain control of the document transcription and delivery process. By centralizing its transcription service, the organization saved $600,000 and reduced days in accounts receivable by 10 days.

  1. Transcription Tales or Let Not Love's Labour Be Lost

    Science.gov (United States)

    Downs, Yvonne

    2010-01-01

    Drawing heavily on my MA dissertation but influenced by subsequent transcription experience, I relate how a technical problem in the recording of an interview necessitated deliberations on the nature and purpose of transcription that continue to have repercussions for my transcription practice and, furthermore, for my understanding of research as…

  2. DNA residence time is a regulatory factor of transcription repression.

    Science.gov (United States)

    Clauß, Karen; Popp, Achim P; Schulze, Lena; Hettich, Johannes; Reisser, Matthias; Escoter Torres, Laura; Uhlenhaut, N Henriette; Gebhardt, J Christof M

    2017-08-21

    Transcription comprises a highly regulated sequence of intrinsically stochastic processes, resulting in bursts of transcription intermitted by quiescence. In transcription activation or repression, a transcription factor binds dynamically to DNA, with a residence time unique to each factor. Whether the DNA residence time is important in the transcription process is unclear. Here, we designed a series of transcription repressors differing in their DNA residence time by utilizing the modular DNA binding domain of transcription activator-like effectors (TALEs) and varying the number of nucleotide-recognizing repeat domains. We characterized the DNA residence times of our repressors in living cells using single molecule tracking. The residence times depended non-linearly on the number of repeat domains and differed by more than a factor of six. The factors provoked a residence time-dependent decrease in transcript level of the glucocorticoid receptor-activated gene SGK1. Down regulation of transcription was due to a lower burst frequency in the presence of long binding repressors and is in accordance with a model of competitive inhibition of endogenous activator binding. Our single molecule experiments reveal transcription factor DNA residence time as a regulatory factor controlling transcription repression and establish TALE-DNA binding domains as tools for the temporal dissection of transcription regulation. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  3. Human cytomegalovirus IE2 protein interacts with transcription activating factors

    Institute of Scientific and Technical Information of China (English)

    XU; Jinping(徐进平); YE; Linbai(叶林柏)

    2002-01-01

    The human cytomegalovirus (HCMV) IE86 Cdna was cloned into Pgex-2T and fusion protein GST-IE86 was expressed in E. Coli. SDS-PAGE and Western blot assay indicated that fusion protein GST-IE86 with molecular weight of 92 ku is soluble in the supernatant of cell lysate. Protein GST and fusion protein GST-IE86 were purified by affinity chromatography. The technology of co-separation and specific affinity chromatography was used to study the interactions of HCMV IE86 protein with some transcriptional regulatory proteins and transcriptional factors. The results indicated that IE86 interacts separately with transcriptional factor TFIIB and promoter DNA binding transcription trans-activating factors SP1, AP1 and AP2 to form a heterogenous protein complex. These transcriptional trans-activating factors, transcriptional factor and IE86 protein were adsorbed and retained in the affinity chromatography simultaneously. But IE86 protein could not interact with NF-Кb, suggesting that the function of IE86 protein that can interact with transcriptional factor and transcriptional trans-activating factors has no relevance to protein glycosylation. IE86 protein probably has two domains responsible for binding transcriptional trans-activating regulatory proteins and transcriptional factors respectively, thus activating the transcription of many genes. The interactions accelerated the assembly of the transcriptional initiation complexes.

  4. Validation, automatic generation and use of broad phonetic transcriptions

    NARCIS (Netherlands)

    Bael, Cristophe Patrick Jan Van

    2007-01-01

    Broad phonetic transcriptions represent the pronunciation of words as strings of characters from specifically designed symbol sets. In everyday life, broad phonetic transcriptions are often used as aids to pronounce (foreign) words. In addition, broad phonetic transcriptions are often used for

  5. Combined in vitro transcription and reverse transcription to amplify and label complex synthetic oligonucleotide probe libraries.

    Science.gov (United States)

    Murgha, Yusuf; Beliveau, Brian; Semrau, Kassandra; Schwartz, Donald; Wu, Chao-Ting; Gulari, Erdogan; Rouillard, Jean-Marie

    2015-06-01

    Oligonucleotide microarrays allow the production of complex custom oligonucleotide libraries for nucleic acid detection-based applications such as fluorescence in situ hybridization (FISH). We have developed a PCR-free method to make single-stranded DNA (ssDNA) fluorescent probes through an intermediate RNA library. A double-stranded oligonucleotide library is amplified by transcription to create an RNA library. Next, dye- or hapten-conjugate primers are used to reverse transcribe the RNA to produce a dye-labeled cDNA library. Finally the RNA is hydrolyzed under alkaline conditions to obtain the single-stranded fluorescent probes library. Starting from unique oligonucleotide library constructs, we present two methods to produce single-stranded probe libraries. The two methods differ in the type of reverse transcription (RT) primer, the incorporation of fluorescent dye, and the purification of fluorescent probes. The first method employs dye-labeled reverse transcription primers to produce multiple differentially single-labeled probe subsets from one microarray library. The fluorescent probes are purified from excess primers by oligonucleotide-bead capture. The second method uses an RNA:DNA chimeric primer and amino-modified nucleotides to produce amino-allyl probes. The excess primers and RNA are hydrolyzed under alkaline conditions, followed by probe purification and labeling with amino-reactive dyes. The fluorescent probes created by the combination of transcription and reverse transcription can be used for FISH and to detect any RNA and DNA targets via hybridization.

  6. Elucidating MicroRNA Regulatory Networks Using Transcriptional, Post-transcriptional, and Histone Modification Measurements

    Directory of Open Access Journals (Sweden)

    Sara J.C. Gosline

    2016-01-01

    Full Text Available MicroRNAs (miRNAs regulate diverse biological processes by repressing mRNAs, but their modest effects on direct targets, together with their participation in larger regulatory networks, make it challenging to delineate miRNA-mediated effects. Here, we describe an approach to characterizing miRNA-regulatory networks by systematically profiling transcriptional, post-transcriptional and epigenetic activity in a pair of isogenic murine fibroblast cell lines with and without Dicer expression. By RNA sequencing (RNA-seq and CLIP (crosslinking followed by immunoprecipitation sequencing (CLIP-seq, we found that most of the changes induced by global miRNA loss occur at the level of transcription. We then introduced a network modeling approach that integrated these data with epigenetic data to identify specific miRNA-regulated transcription factors that explain the impact of miRNA perturbation on gene expression. In total, we demonstrate that combining multiple genome-wide datasets spanning diverse regulatory modes enables accurate delineation of the downstream miRNA-regulated transcriptional network and establishes a model for studying similar networks in other systems.

  7. Elucidating MicroRNA Regulatory Networks Using Transcriptional, Post-transcriptional, and Histone Modification Measurements.

    Science.gov (United States)

    Gosline, Sara J C; Gurtan, Allan M; JnBaptiste, Courtney K; Bosson, Andrew; Milani, Pamela; Dalin, Simona; Matthews, Bryan J; Yap, Yoon S; Sharp, Phillip A; Fraenkel, Ernest

    2016-01-12

    MicroRNAs (miRNAs) regulate diverse biological processes by repressing mRNAs, but their modest effects on direct targets, together with their participation in larger regulatory networks, make it challenging to delineate miRNA-mediated effects. Here, we describe an approach to characterizing miRNA-regulatory networks by systematically profiling transcriptional, post-transcriptional and epigenetic activity in a pair of isogenic murine fibroblast cell lines with and without Dicer expression. By RNA sequencing (RNA-seq) and CLIP (crosslinking followed by immunoprecipitation) sequencing (CLIP-seq), we found that most of the changes induced by global miRNA loss occur at the level of transcription. We then introduced a network modeling approach that integrated these data with epigenetic data to identify specific miRNA-regulated transcription factors that explain the impact of miRNA perturbation on gene expression. In total, we demonstrate that combining multiple genome-wide datasets spanning diverse regulatory modes enables accurate delineation of the downstream miRNA-regulated transcriptional network and establishes a model for studying similar networks in other systems.

  8. Sumoylation delays the ATF7 transcription factor subcellular localization and inhibits its transcriptional activity.

    Science.gov (United States)

    Hamard, Pierre-Jacques; Boyer-Guittaut, Michaël; Camuzeaux, Barbara; Dujardin, Denis; Hauss, Charlotte; Oelgeschläger, Thomas; Vigneron, Marc; Kedinger, Claude; Chatton, Bruno

    2007-01-01

    Over the past few years, small ubiquitin-like modifier (SUMO) modification has emerged as an important regulator of diverse pathways and activities including protein localization and transcriptional regulation. We identified a consensus sumoylation motif (IKEE), located within the N-terminal activation domain of the ATF7 transcription factor and thus investigated the role of this modification. ATF7 is a ubiquitously expressed transcription factor, homologous to ATF2, that binds to CRE elements within specific promoters. This protein is able to heterodimerize with Jun or Fos proteins and its transcriptional activity is mediated by interaction with TAF12, a subunit of the general transcription factor TFIID. In the present article, we demonstrate that ATF7 is sumoylated in vitro (using RanBP2 as a E3-specific ligase) and in vivo. Moreover, we show that ATF7 sumoylation affects its intranuclear localization by delaying its entry into the nucleus. Furthermore, SUMO conjugation inhibits ATF7 transactivation activity by (i) impairing its association with TAF12 and (ii) blocking its binding-to-specific sequences within target promoters.

  9. RNA-guided transcriptional regulation in planta via synthetic dCas9-based transcription factors

    KAUST Repository

    Piatek, Agnieszka Anna

    2014-11-14

    Targeted genomic regulation is a powerful approach to accelerate trait discovery and development in agricultural biotechnology. Bacteria and archaea use clustered regularly interspaced short palindromic repeats (CRISPRs) and CRISPR-associated (Cas) regulatory systems for adaptive molecular immunity against foreign nucleic acids introduced by invading phages and conjugative plasmids. The type II CRISPR/Cas system has been adapted for genome editing in many cell types and organisms. A recent study used the catalytically inactive Cas9 (dCas9) protein combined with guide-RNAs (gRNAs) as a DNA-targeting platform to modulate gene expression in bacterial, yeast, and human cells. Here, we modified this DNA-targeting platform for targeted transcriptional regulation in planta by developing chimeric dCas9-based transcriptional activators and repressors. To generate transcriptional activators, we fused the dCas9 C-terminus with the activation domains of EDLL and TAL effectors. To generate a transcriptional repressor, we fused the dCas9 C-terminus with the SRDX repression domain. Our data demonstrate that dCas9 fusion with the EDLL activation domain (dCas9:EDLL) and the TAL activation domain (dCas9:TAD), guided by gRNAs complementary to selected promoter elements, induce strong transcriptional activation on Bs3

  10. Swinger RNA self-hybridization and mitochondrial non-canonical swinger transcription, transcription systematically exchanging nucleotides.

    Science.gov (United States)

    Seligmann, Hervé

    2016-06-21

    Stem-loop hairpins punctuate mitochondrial post-transcriptional processing. Regulation of mitochondrial swinger transcription, transcription producing RNAs matching the mitogenome only assuming systematic exchanges between nucleotides (23 bijective transformations along 9 symmetric exchanges XY, e.g. AG, and 14 asymmetric exchanges X>Y>Z>X, e.g. A>G>C>A) remains unknown. Does swinger RNA self-hybridization regulate swinger, as regular, transcription? Groups of 8 swinger transformations share canonical self-hybridization properties within each group, group 0 includes identity (regular) transcription. The human mitogenome has more stem-loop hairpins than randomized sequences for all groups. Group 2 transformations reveal complementarity of the light strand replication origin (OL) loop and a neighboring tRNA gene, detecting the longtime presumed OL/tRNA homology. Non-canonical G=U pairings in hairpins increases with swinger RNA detection. These results confirm biological relevancy of swinger-transformed DNA/RNA, independently of, and in combination with, previously detected swinger DNA/RNA and swinger peptides. Swinger-transformed mitogenomes include unsuspected multilayered information.

  11. Dicty_cDB: Contig-U15836-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 23, 5'-en... 44 0.40 2 ( EE001618 ) ROE00012490 Rhizopus oryzae Company Rhizopus oryz... 38 0.48 2 ( DX80105...OE00012886 Rhizopus oryzae Company Rhizopus oryz... 38 0.52 2 ( CF611828 ) laf05h12.y1 Gastric Epithelial Pr...BW408568 ) Ciona intestinalis cDNA, clone:cima803m04, 3'end,... 44 0.64 2 ( EE008462 ) ROE00004420 Rhizopus oryzae Company...Brassica oleracea genom... 38 0.66 3 ( EE009624 ) ROE00004013 Rhizopus oryzae Company Rhizopus oryz... 38 0.

  12. Dicty_cDB: Contig-U15674-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 9807 ) Ciona intestinalis cDNA, clone:rcibd066d24, 3' en... 113 2e-20 2 ( EE005021 ) ROE00010379 Rhizopus oryzae Company...-20 4 ( EE006561 ) ROE00006529 Rhizopus oryzae Company Rhizopus oryz... 86 2e-20 3 ( EE007078 ) ROE00002595 Rhizopus oryzae Company... Rhizopus oryz... 86 2e-20 3 ( EE007685 ) ROE00004444 Rhizopus oryzae Company Rhizopu... ) ROE00003177 Rhizopus oryzae Company Rhizopus oryz... 86 3e-20 3 ( EE009077 ) R...OE00000022 Rhizopus oryzae Company Rhizopus oryz... 86 3e-20 3 ( CB891330 ) EST648299 KV3 Medicago truncatul

  13. Dicty_cDB: Contig-U01152-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available BP002118 ) Ciona intestinalis cDNA, clone:ciad25e20, 5' end,... 48 0.001 3 ( CU617458 ) Theobroma cacao, mR...NA sequence (KZ0AAN4YE07FM1). 44 0.001 2 ( CU617341 ) Theobroma cacao, mRNA sequence (KZ0AAN3YE07FM1). 44 0....001 2 ( CU616827 ) Theobroma cacao, mRNA sequence (KZ0AAN11YB02FM1). 44 0.001 2 (

  14. Dicty_cDB: Contig-U16513-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AAAATAAAATATAAAATAAAATTTTAAAAAAAATAAAAAAAAAAA TAAATGTTATTCTTATTAAATCA Gap no gap Contig length 1273 Chromoso...uences producing significant alignments: (bits) Value N ( AC116979 ) Dictyostelium discoideum chromosome 2 m...21588 ) Ciona intestinalis cDNA, clone:cima840i18, 3'end,... 46 2e-09 3 >( AC116979 ) Dictyostelium discoideum chromo...40 |pid:none) Brassica napus var. napus clone BN... 95 1e-25 AM502244_64( AM502244 |pid:none) Leishmania infantum chromo...some 26. 100 4e-24 AC159426_24( AC159426 |pid:none) Trypanosoma brucei chromosome 7 c... 104 8e-

  15. Gridded genomic libraries of different chordate species: a reference library system for basic and comparative genetic studies of chordate genomes.

    Science.gov (United States)

    Burgtorf, C; Welzel, K; Hasenbank, R; Zehetner, G; Weis, S; Lehrach, H

    1998-09-01

    The use of genomic libraries maintained in arrayed format is becoming a more and more popular tool for the analysis of molecular evolution and comparative molecular development. Being able to use already existing reference libraries considerably reduces the work load, and if results are made publicly available, it will facilitate in silica experiments in the future. Here we describe the construction and preliminary characterization of six cosmid libraries of different chordate species, Ciona intestinalis (Hemichordate), Branchiostoma floridae (Cephalochordate), Lampetra fluviatilis (Cyclostoma), Xiphophorus maculatus, and Danio rerio (Osteichthyes) in Lawrist7 and Fugu rubripes in Lawrist4.

  16. Coupled transcription and translation within nuclei of mammalian cells.

    Science.gov (United States)

    Iborra, F J; Jackson, D A; Cook, P R

    2001-08-10

    It is widely assumed that the vital processes of transcription and translation are spatially separated in eukaryotes and that no translation occurs in nuclei. We localized translation sites by incubating permeabilized mammalian cells with [3H]lysine or lysyl-transfer RNA tagged with biotin or BODIPY; although most nascent polypeptides were cytoplasmic, some were found in discrete nuclear sites known as transcription "factories." Some of this nuclear translation also depends on concurrent transcription by RNA polymerase II. This coupling is simply explained if nuclear ribosomes translate nascent transcripts as those transcripts emerge from still-engaged RNA polymerases, much as they do in bacteria.

  17. Structural basis of transcription initiation by RNA polymerase II.

    Science.gov (United States)

    Sainsbury, Sarah; Bernecky, Carrie; Cramer, Patrick

    2015-03-01

    Transcription of eukaryotic protein-coding genes commences with the assembly of a conserved initiation complex, which consists of RNA polymerase II (Pol II) and the general transcription factors, at promoter DNA. After two decades of research, the structural basis of transcription initiation is emerging. Crystal structures of many components of the initiation complex have been resolved, and structural information on Pol II complexes with general transcription factors has recently been obtained. Although mechanistic details await elucidation, available data outline how Pol II cooperates with the general transcription factors to bind to and open promoter DNA, and how Pol II directs RNA synthesis and escapes from the promoter.

  18. Non-canonical transcription initiation: the expanding universe of transcription initiating substrates.

    Science.gov (United States)

    Barvík, Ivan; Rejman, Dominik; Panova, Natalya; Šanderová, Hana; Krásný, Libor

    2016-10-30

    RNA polymerase (RNAP) is the central enzyme of transcription of the genetic information from DNA into RNA. RNAP recognizes four main substrates: ATP, CTP, GTP and UTP. Experimental evidence from the past several years suggests that, besides these four NTPs, other molecules can be used to initiate transcription: (i) ribooligonucleotides (nanoRNAs) and (ii) coenzymes such as NAD(+), NADH, dephospho-CoA and FAD. The presence of these molecules at the 5' ends of RNAs affects the properties of the RNA. Here, we discuss the expanding portfolio of molecules that can initiate transcription, their mechanism of incorporation, effects on RNA and cellular processes, and we present an outlook toward other possible initiation substrates.

  19. Fluctuation sensitivity of a transcriptional signaling cascade

    Science.gov (United States)

    Pilkiewicz, Kevin R.; Mayo, Michael L.

    2016-09-01

    The internal biochemical state of a cell is regulated by a vast transcriptional network that kinetically correlates the concentrations of numerous proteins. Fluctuations in protein concentration that encode crucial information about this changing state must compete with fluctuations caused by the noisy cellular environment in order to successfully transmit information across the network. Oftentimes, one protein must regulate another through a sequence of intermediaries, and conventional wisdom, derived from the data processing inequality of information theory, leads us to expect that longer sequences should lose more information to noise. Using the metric of mutual information to characterize the fluctuation sensitivity of transcriptional signaling cascades, we find, counter to this expectation, that longer chains of regulatory interactions can instead lead to enhanced informational efficiency. We derive an analytic expression for the mutual information from a generalized chemical kinetics model that we reduce to simple, mass-action kinetics by linearizing for small fluctuations about the basal biological steady state, and we find that at long times this expression depends only on a simple ratio of protein production to destruction rates and the length of the cascade. We place bounds on the values of these parameters by requiring that the mutual information be at least one bit—otherwise, any received signal would be indistinguishable from noise—and we find not only that nature has devised a way to circumvent the data processing inequality, but that it must be circumvented to attain this one-bit threshold. We demonstrate how this result places informational and biochemical efficiency at odds with one another by correlating high transcription factor binding affinities with low informational output, and we conclude with an analysis of the validity of our assumptions and propose how they might be tested experimentally.

  20. Effects of hemorrhage on cytokine gene transcription.

    Science.gov (United States)

    Shenkar, R; Abraham, E

    1993-08-01

    Injury and blood loss are often followed by infection and the rapid development of organ system dysfunction, frequently involving mucosal sites, such as the lung and intestine. To examine possible mechanisms contributing to these conditions, we used semiquantitative polymerase chain reactions to determine cytokine mRNA expression among cellular populations isolated from mucosal and systemic anatomic sites of mice at predetermined time points following 30% blood volume hemorrhage with resuscitation 1 hr later. Within 1 hr after hemorrhage, significant increases were observed in mRNA levels for IL-1 alpha, IL-1 beta, IL-5, and TGF-beta in intraparenchymal pulmonary mononuclear cells. The levels of TGF-beta transcripts among alveolar macrophages were increased 1 hr following blood loss, and increase in IL-1 alpha transcripts was found starting 2 hr posthemorrhage. Cells from Peyer's patches showed significant increases in mRNA levels for IL-1 beta, IL-2, IL-5, IL-6, IFN-gamma, and TGF-beta during the 4 hr following hemorrhage. Significant increases in mRNA levels for IL-1 beta, TNF-alpha, and TGF-beta were present within 4 hr of blood loss among cells isolated from mesenteric lymph nodes. The expression of mRNA for most cytokines was not significantly altered in splenocytes or peripheral blood mononuclear cells at any time point following hemorrhage. These experiments demonstrate that blood loss, even if resuscitated, produces significant increases in proinflammatory and immunoregulatory cytokine gene transcription as early as 1 hr following hemorrhage. These posthemorrhage alterations in cytokine mRNA expression were particularly prominent at mucosal sites, suggesting a mechanism for the increased incidence of pulmonary and intestinal involvement in organ system failure following severe blood loss and injury.

  1. Extensive polycistronism and antisense transcription in the mammalian Hox clusters.

    Directory of Open Access Journals (Sweden)

    Gaëll Mainguy

    Full Text Available The Hox clusters play a crucial role in body patterning during animal development. They encode both Hox transcription factor and micro-RNA genes that are activated in a precise temporal and spatial sequence that follows their chromosomal order. These remarkable collinear properties confer functional unit status for Hox clusters. We developed the TranscriptView platform to establish high resolution transcriptional profiling and report here that transcription in the Hox clusters is far more complex than previously described in both human and mouse. Unannotated transcripts can represent up to 60% of the total transcriptional output of a cluster. In particular, we identified 14 non-coding Transcriptional Units antisense to Hox genes, 10 of which (70% have a detectable mouse homolog. Most of these Transcriptional Units in both human and mouse present conserved sizeable sequences (>40 bp overlapping Hox transcripts, suggesting that these Hox antisense transcripts are functional. Hox clusters also display at least seven polycistronic clusters, i.e., different genes being co-transcribed on long isoforms (up to 30 kb. This work provides a reevaluated framework for understanding Hox gene function and dys-function. Such extensive transcriptions may provide a structural explanation for Hox clustering.

  2. Bacterial Transcription as a Target for Antibacterial Drug Development.

    Science.gov (United States)

    Ma, Cong; Yang, Xiao; Lewis, Peter J

    2016-03-01

    Transcription, the first step of gene expression, is carried out by the enzyme RNA polymerase (RNAP) and is regulated through interaction with a series of protein transcription factors. RNAP and its associated transcription factors are highly conserved across the bacterial domain and represent excellent targets for broad-spectrum antibacterial agent discovery. Despite the numerous antibiotics on the market, there are only two series currently approved that target transcription. The determination of the three-dimensional structures of RNAP and transcription complexes at high resolution over the last 15 years has led to renewed interest in targeting this essential process for antibiotic development by utilizing rational structure-based approaches. In this review, we describe the inhibition of the bacterial transcription process with respect to structural studies of RNAP, highlight recent progress toward the discovery of novel transcription inhibitors, and suggest additional potential antibacterial targets for rational drug design.

  3. Using both strands: The fundamental nature of antisense transcription.

    Science.gov (United States)

    Murray, Struan C; Mellor, Jane

    2016-01-01

    Non-coding transcription across the antisense strands of genes is an abundant, pervasive process in eukaryotes from yeast to humans, however its biological function remains elusive. Here, we provide commentary on a recent study of ours, which demonstrates a genome-wide role for antisense transcription: establishing a unique, dynamic chromatin architecture over genes. Antisense transcription increases the level of nucleosome occupancy and histone acetylation at the promoter and body of genes, without necessarily modulating the level of protein-coding sense transcription. It is also associated with high levels of histone turnover. By allowing genes to sample a wider range of chromatin configurations, antisense transcription could serve to make genes more sensitive to changing signals, priming them for responses to developmental programs or stressful cellular environments. Given the abundance of antisense transcription and the breadth of these chromatin changes, we propose that antisense transcription represents a fundamental, canonical feature of eukaryotic genes.

  4. Structural basis of transcription by bacterial and eukaryotic RNA polymerases.

    Science.gov (United States)

    Sekine, Shun-ichi; Tagami, Shunsuke; Yokoyama, Shigeyuki

    2012-02-01

    DNA-dependent RNA polymerase (RNAP) is responsible for cellular gene transcription. Although crystallographic studies on prokaryotic and eukaryotic RNAPs have elucidated the basic RNAP architectures, the structural details of many essential events during transcription initiation, elongation, and termination are still largely unknown. Recent crystallographic studies on a bacterial RNAP and yeast RNAP II have revealed different RNAP structural states from that of the normal transcribing complex, as well as the basis of transcription factor functions, advancing our understanding of transcription. These studies have highlighted unexpected similarities in many fundamental aspects of transcription mechanisms between the bacterial and eukaryotic transcription machineries. Remarkable differences also exist between the bacterial and eukaryotic transcription systems, suggesting directions for future studies. Copyright © 2011 Elsevier Ltd. All rights reserved.

  5. A chromatin-based mechanism for limiting divergent noncoding transcription

    DEFF Research Database (Denmark)

    Marquardt, Sebastian; Escalante-Chong, Renan; Pho, Nam

    2014-01-01

    In addition to their annotated transcript, many eukaryotic mRNA promoters produce divergent noncoding transcripts. To define determinants of divergent promoter directionality, we used genomic replacement experiments. Sequences within noncoding transcripts specified their degradation pathways......, and functional protein-coding transcripts could be produced in the divergent direction. To screen for mutants affecting the ratio of transcription in each direction, a bidirectional fluorescent protein reporter construct was introduced into the yeast nonessential gene deletion collection. We identified chromatin...... assembly as an important regulator of divergent transcription. Mutations in the CAF-I complex caused genome-wide derepression of nascent divergent noncoding transcription. In opposition to the CAF-I chromatin assembly pathway, H3K56 hyperacetylation, together with the nucleosome remodeler SWI...

  6. Transcription arrest caused by long nascent RNA chains

    DEFF Research Database (Denmark)

    Bentin, Thomas; Cherny, Dmitry; Larsen, H Jakob

    2004-01-01

    the number of active elongation complexes. Thus transcription behaved as an all-or-none process. The mechanism of transcription inhibition was explored using electron microscopy and further biochemical experiments. The data suggest that multiple mechanisms may contribute to the observed effects. Part......The transcription process is highly processive. However, specific sequence elements encoded in the nascent RNA may signal transcription pausing and/or termination. We find that under certain conditions nascent RNA chains can have a strong and apparently sequence-independent inhibitory effect...... on transcription. Using phage T3 RNA polymerase (T3 RNAP) and covalently closed circular (cccDNA) DNA templates that did not contain any strong termination signal, transcription was severely inhibited after a short period of time. Less than approximately 10% residual transcriptional activity remained after 10 min...

  7. Mitochondrial biology. Replication-transcription switch in human mitochondria.

    Science.gov (United States)

    Agaronyan, Karen; Morozov, Yaroslav I; Anikin, Michael; Temiakov, Dmitry

    2015-01-30

    Coordinated replication and expression of the mitochondrial genome is critical for metabolically active cells during various stages of development. However, it is not known whether replication and transcription can occur simultaneously without interfering with each other and whether mitochondrial DNA copy number can be regulated by the transcription machinery. We found that interaction of human transcription elongation factor TEFM with mitochondrial RNA polymerase and nascent transcript prevents the generation of replication primers and increases transcription processivity and thereby serves as a molecular switch between replication and transcription, which appear to be mutually exclusive processes in mitochondria. TEFM may allow mitochondria to increase transcription rates and, as a consequence, respiration and adenosine triphosphate production without the need to replicate mitochondrial DNA, as has been observed during spermatogenesis and the early stages of embryogenesis.

  8. Evidence for a common evolutionary rate in metazoan transcriptional networks.

    Science.gov (United States)

    Carvunis, Anne-Ruxandra; Wang, Tina; Skola, Dylan; Yu, Alice; Chen, Jonathan; Kreisberg, Jason F; Ideker, Trey

    2015-12-18

    Genome sequences diverge more rapidly in mammals than in other animal lineages, such as birds or insects. However, the effect of this rapid divergence on transcriptional evolution remains unclear. Recent reports have indicated a faster divergence of transcription factor binding in mammals than in insects, but others found the reverse for mRNA expression. Here, we show that these conflicting interpretations resulted from differing methodologies. We performed an integrated analysis of transcriptional network evolution by examining mRNA expression, transcription factor binding and cis-regulatory motifs across >25 animal species, including mammals, birds and insects. Strikingly, we found that transcriptional networks evolve at a common rate across the three animal lineages. Furthermore, differences in rates of genome divergence were greatly reduced when restricting comparisons to chromatin-accessible sequences. The evolution of transcription is thus decoupled from the global rate of genome sequence evolution, suggesting that a small fraction of the genome regulates transcription.

  9. Cdk phosphorylation of the Ste11 transcription factor constrains differentiation-specific transcription to G1

    DEFF Research Database (Denmark)

    Kjaerulff, Søren; Andersen, Nicoline Resen; Borup, Mia Trolle;

    2007-01-01

    Eukaryotic cells normally differentiate from G(1); here we investigate the mechanism preventing expression of differentiation-specific genes outside G(1). In fission yeast, induction of the transcription factor Ste11 triggers sexual differentiation. We find that Ste11 is only active in G(1) when...... S phase. When we mutated T82 to aspartic acid, mimicking constant phosphorylation, cells no longer underwent differentiation. Conversely, changing T82 to alanine rendered Ste11-controlled transcription constitutive through the cell cycle, and allowed mating from S phase with increased frequency...

  10. Transcriptional delay stabilizes bistable gene networks

    Science.gov (United States)

    Gupta, Chinmaya; López, José Manuel; Ott, William; Josić, Krešimir; Bennett, Matthew R.

    2014-01-01

    Transcriptional delay can significantly impact the dynamics of gene networks. Here we examine how such delay affects bistable systems. We investigate several stochastic models of bistable gene networks and find that increasing delay dramatically increases the mean residence times near stable states. To explain this, we introduce a non-Markovian, analytically tractable reduced model. The model shows that stabilization is the consequence of an increased number of failed transitions between stable states. Each of the bistable systems that we simulate behaves in this manner. PMID:23952450

  11. Accessorizing the human mitochondrial transcription machinery

    OpenAIRE

    Bestwick, Megan L; Shadel, Gerald S

    2013-01-01

    The human genome comprises large chromosomes in the nucleus and mitochondrial DNA (mtDNA) housed in the dynamic mitochondrial network. Human cells contain up to thousands of copies of the double-stranded, circular mtDNA molecule that encodes essential subunits of the oxidative phosphorylation complexes and the rRNAs and tRNAs needed to translate these in the organelle matrix. Transcription of human mtDNA is directed by a single-subunit RNA polymerase, POLRMT, which requires two primary transc...

  12. Statistics for Transcription Factor Binding Sites

    OpenAIRE

    2008-01-01

    Transcription factors (TFs) play a key role in gene regulation. They interact with specific binding sites or motifs on the DNA sequence and regulate expression of genes downstream of these binding sites. In silico prediction of potential binding of a TF to a binding site is an important task in computational biology. From a statistical point of view, the DNA sequence is a long text consisting of four different letters ('A','C','G', and 'T'). The binding of a TF to the sequence corresponds to ...

  13. Transcriptional regulation by Polycomb group proteins

    DEFF Research Database (Denmark)

    Di Croce, Luciano; Helin, Kristian

    2013-01-01

    Polycomb group (PcG) proteins are epigenetic regulators of transcription that have key roles in stem-cell identity, differentiation and disease. Mechanistically, they function within multiprotein complexes, called Polycomb repressive complexes (PRCs), which modify histones (and other proteins......) and silence target genes. The dynamics of PRC1 and PRC2 components has been the focus of recent research. Here we discuss our current knowledge of the PRC complexes, how they are targeted to chromatin and how the high diversity of the PcG proteins allows these complexes to influence cell identity....

  14. RNA polymerase: the vehicle of transcription.

    Science.gov (United States)

    Borukhov, Sergei; Nudler, Evgeny

    2008-03-01

    RNA polymerase (RNAP) is the principal enzyme of gene expression and regulation for all three divisions of life: Eukaryota, Archaea and Bacteria. Recent progress in the structural and biochemical characterization of RNAP illuminates this enzyme as a flexible, multifunctional molecular machine. During each step of the transcription cycle, RNAP undergoes elaborate conformational changes. As many fundamental and previously mysterious aspects of how RNAP works begin to be understood, this enzyme reveals intriguing similarities to man-made engineered devices. These resemblances can be found in the mechanics of RNAP-DNA complex formation, in RNA chain initiation and in the elongation processes. Here we highlight recent advances in understanding RNAP function and regulation.

  15. The RNA polymerase I transcription machinery

    OpenAIRE

    Russell, Jackie; Zomerdijk, Joost C. B. M.

    2006-01-01

    The rRNAs constitute the catalytic and structural components of the ribosome, the protein synthesis machinery of cells. The level of rRNA synthesis, mediated by Pol I (RNA polymerase I), therefore has a major impact on the life and destiny of a cell. In order to elucidate how cells achieve the stringent control of Pol I transcription, matching the supply of rRNA to demand under different cellular growth conditions, it is essential to understand the components and mechanics of the Pol I transc...

  16. Post-transcriptional gene silencing across kingdoms.

    Science.gov (United States)

    Cogoni, C; Macino, G

    2000-12-01

    Post-transcriptional gene silencing (PTGS) as a consequence of the introduction of either transgenes or double-stranded RNA molecules has been found to occur in a number of species. In the past year, studies in different systems have greatly enhanced our understanding of the molecular mechanisms of these phenomena. The ubiquitous presence of PTGS in both the plant and animal kingdoms and the finding of common genetic mechanisms suggest that PTGS is a universal gene-regulation system fundamental in biological processes such as protection against viruses and transposons.

  17. Transcriptional programs controlling perinatal lung maturation.

    Directory of Open Access Journals (Sweden)

    Yan Xu

    Full Text Available The timing of lung maturation is controlled precisely by complex genetic and cellular programs. Lung immaturity following preterm birth frequently results in Respiratory Distress Syndrome (RDS and Broncho-Pulmonary Dysplasia (BPD, which are leading causes of mortality and morbidity in preterm infants. Mechanisms synchronizing gestational length and lung maturation remain to be elucidated. In this study, we designed a genome-wide mRNA expression time-course study from E15.5 to Postnatal Day 0 (PN0 using lung RNAs from C57BL/6J (B6 and A/J mice that differ in gestational length by ∼30 hr (B6transcriptional networks controlling lung maturation. We identified both temporal and strain dependent gene expression patterns during lung maturation. For time dependent changes, cell adhesion, vasculature development, and lipid metabolism/transport were major bioprocesses induced during the saccular stage of lung development at E16.5-E17.5. CEBPA, PPARG, VEGFA, CAV1 and CDH1 were found to be key signaling and transcriptional regulators of these processes. Innate defense/immune responses were induced at later gestational ages (E18.5-20.5, STAT1, AP1, and EGFR being important regulators of these responses. Expression of RNAs associated with the cell cycle and chromatin assembly was repressed during prenatal lung maturation and was regulated by FOXM1, PLK1, chromobox, and high mobility group families of transcription factors. Strain dependent lung mRNA expression differences peaked at E18.5. At this time, mRNAs regulating surfactant and innate immunity were more abundantly expressed in lungs of B6 (short gestation than in A/J (long gestation mice, while expression of genes involved in chromatin assembly and histone modification were expressed at lower levels in B6 than in A/J mice. The present study systemically mapped key regulators

  18. Vessel generator noise as a settlement cue for marine biofouling species.

    Science.gov (United States)

    McDonald, J I; Wilkens, S L; Stanley, J A; Jeffs, A G

    2014-01-01

    Underwater noise is increasing globally, largely due to increased vessel numbers and international ocean trade. Vessels are also a major vector for translocation of non-indigenous marine species which can have serious implications for biosecurity. The possibility that underwater noise from fishing vessels may promote settlement of biofouling on hulls was investigated for the ascidian Ciona intestinalis. Spatial differences in biofouling appear to be correlated with spatial differences in the intensity and frequency of the noise emitted by the vessel's generator. This correlation was confirmed in laboratory experiments where C. intestinalis larvae showed significantly faster settlement and metamorphosis when exposed to the underwater noise produced by the vessel generator. Larval survival rates were also significantly higher in treatments exposed to vessel generator noise. Enhanced settlement attributable to vessel generator noise may indicate that vessels not only provide a suitable fouling substratum, but vessels running generators may be attracting larvae and enhancing their survival and growth.

  19. Women's hidden transcripts about abortion in Brazil.

    Science.gov (United States)

    Nations, M K; Misago, C; Fonseca, W; Correia, L L; Campbell, O M

    1997-06-01

    Two folk medical conditions, "delayed" (atrasada) and "suspended" (suspendida) menstruation, are described as perceived by poor Brazilian women in Northeast Brazil. Culturally prescribed methods to "regulate" these conditions and provoke menstrual bleeding are also described, including ingesting herbal remedies, patent drugs, and modern pharmaceuticals. The ingestion of such self-administered remedies is facilitated by the cognitive ambiguity, euphemisms, folklore, etc., which surround conception and gestation. The authors argue that the ethnomedical conditions of "delayed" and "suspended" menstruation and subsequent menstrual regulation are part of the "hidden reproductive transcript" of poor and powerless Brazilian women. Through popular culture, they voice their collective dissent to the official, public opinion about the illegality and immorality of induced abortion and the chronic lack of family planning services in Northeast Brazil. While many health professionals consider women's explanations of menstrual regulation as a "cover-up" for self-induced abortions, such popular justifications may represent either an unconscious or artful manipulation of hegemonic, anti-abortion ideology expressed in prudent, unobtrusive and veiled ways. The development of safer abortion alternatives should consider women's hidden reproductive transcripts.

  20. Molecular basis of transcription initiation in Archaea.

    Science.gov (United States)

    De Carlo, Sacha; Lin, Shih-Chieh; Taatjes, Dylan J; Hoenger, Andreas

    2010-01-01

    Compared with eukaryotes, the archaeal transcription initiation machinery-commonly known as the Pre-Initiation Complex-is relatively simple. The archaeal PIC consists of the TFIIB ortholog TFB, TBP, and an 11-subunit RNA polymerase (RNAP). The relatively small size of the entire archaeal PIC makes it amenable to structural analysis. Using purified RNAP, TFB, and TBP from the thermophile Pyrococcus furiosus, we assembled the biochemically active PIC at 65ºC. The intact archaeal PIC was isolated by implementing a cross-linking technique followed by size-exclusion chromatography, and the structure of this 440 kDa assembly was determined using electron microscopy and single-particle reconstruction techniques. Combining difference maps with crystal structure docking of various sub-domains, TBP and TFB were localized within the macromolecular PIC. TBP/TFB assemble near the large RpoB subunit and the RpoD/L "foot" domain behind the RNAP central cleft. This location mimics that of yeast TBP and TFIIB in complex with yeast RNAP II. Collectively, these results define the structural organization of the archaeal transcription machinery and suggest a conserved core PIC architecture.