WorldWideScience

Sample records for chronic aseptic sternal

  1. Sternal chondrosarcoma

    Directory of Open Access Journals (Sweden)

    Nelson Perelman Rosenberg

    2003-01-01

    Full Text Available Sternal neoplasms are extremely rare. It is difficult to make prospective evaluations due to the lack of consistent reports in the literature. The authors report the case of a woman in her seventies, who presented a chondrosarcoma of the sternum, treated by them.

  2. Sternal Talon, a novel repair for sternal dehiscence

    Science.gov (United States)

    Keita, Luther; Veerasingam, Dave

    2015-01-01

    Sternal dehiscence is a recognised complication after median sternotomy, occurring in 0.5-5% of cases with or without infection. A 72-year-old man presenting with collapse and ventricular tachycardia was investigated for a possible acute cardiac event 2 years after coronary artery bypass grafting for ischemic heart disease. Work-up chest X-ray showed displacement of all sternal wires, and computed tomography (CT) performed to investigate further showed sternal dehiscence with right ventricle wall herniation through the defect and sternal wire breakdown. A decision was made after discussion with the patient to repair the defect using 3 Sternal Talon devices and 2 sternal wires. The patient made an uncomplicated recovery, and the outpatient clinic review after discharge home showed satisfactory and stable sternal union. We report a case of non-infected sternal dehiscence managed successfully with the Sternal Talon without long-term complications. PMID:26336499

  3. Sternal exploration or closure

    Science.gov (United States)

    ... K., Anderson, E. Harper, J.G. Overview and management of sternal wound infection. Semin Plast Surg. Feb ... A. Chen, MD, PhD, Associate Professor of Medicine, Division of Cardiology, Harborview Medical Center, ...

  4. Sternal fractures and their management

    Directory of Open Access Journals (Sweden)

    Al-achraf Khoriati

    2013-01-01

    Full Text Available Sternal fractures are predominantly associated with deceleration injuries and blunt anterior chest trauma. Sternal trauma must be carefully evaluated by monitoring of vital parameters and it is of paramount importance that concomitant injuries are excluded. Nevertheless, routine admission of patients with isolated sternal fractures for observation is still common in today′s practice, which is often unnecessary. This article aims to describe the prognosis, the recommended assessment and management of patients with sternal fractures, to help clinicians make an evidence-based judgment regarding the need for hospitalization.

  5. The biology of aseptic osteolysis.

    Science.gov (United States)

    Holt, G; Murnaghan, C; Reilly, J; Meek, R M D

    2007-07-01

    Total hip arthroplasty is one of the most commonly performed and successful elective orthopaedic procedures. However, numerous failure mechanisms limit the long-term success including aseptic osteolysis, aseptic loosening, infection, and implant instability. Aseptic osteolysis and subsequent implant failure occur because of a chronic inflammatory response to implant-derived wear particles. To reduce particulate debris and their consequences, implants have had numerous design modifications including high-molecular-weight polyethylene sockets and noncemented implants that rely on bone ingrowth for fixation. Surgical techniques have improved cementation with the use of medullary plugs, cement guns, lavage of the canal, pressurization, centralization of the stem, and reduction in cement porosity. Despite these advances, aseptic osteolysis continues to limit implant longevity. Numerous proinflammatory cytokines, such as interleukin-1, interleukin-6, tumor necrosis factor-alpha, and prostaglandin E2, have proosteoclastogenic effects in response to implant-derived wear particles. However, none of these cytokines represents a final common pathway for the process of particle-induced osteoclast differentiation and maturation. Recent work has identified the fundamental role of the RANKL-RANK-NF-kappaB pathway not only in osteoclastogenesis but also in the development and function the immune system. Thus, the immune system and skeletal homeostasis may be linked in the process of osteoclastogenesis and osteolysis. PMID:17620815

  6. Syphilitic aseptic meningitis

    Science.gov (United States)

    Syphilitic aseptic meningitis is a complication of untreated syphilis. It involves inflammation of the tissues covering the ... Syphilis is a sexually transmitted disease caused by the spirochete bacteria Treponema pallidum . Syphilis has three main ...

  7. STERNAL FORAMEN: A CASE REPORT

    Directory of Open Access Journals (Sweden)

    Taqdees

    2015-05-01

    Full Text Available Sternal foramen is a congenital oval defect at the lower third of the sternum that is usually asymptomatic & occurs due to incomplete fusion of multiple ossification centres . During our routine osteology classes, a sternum with a foramen in the lower part of its body measuring about 11mmx10mm was found. Knowledge about such variation is important as it has risk of life threate ning complications like pneumothorax or even pericardial or cardiac puncture during sternal biopsy or acupuncture.

  8. Septic and aseptic arthritis: a continuum?

    Science.gov (United States)

    Taylor-Robinson, D; Keat, A

    1999-03-01

    This chapter considers the likelihood that a wide spectrum of infection-provoked arthritis exists, ranging from overt sepsis to apparently aseptic chronic arthritis in which very small numbers of causal bacteria can be detected only by using highly sensitive techniques. It asks whether joints are, as conventionally held, normally devoid of micro-organisms and how to judge the significance of bacteria detected within apparently sterile joints. Through a consideration of known septic, probably infective and apparently aseptic forms of arthritis, a set of criteria for attributing causality to putative arthritogenic micro-organisms is proposed. PMID:10952856

  9. Sternal wound infection revisited

    International Nuclear Information System (INIS)

    Sternal wound infections (SWIs) can be subdivided into two types, superficial or deep, that require different treatments. The clinical diagnosis of superficial SWI is normally easy to perform, whereas the involvement of deep tissues is frequently difficult to detect. Therefore, there is a need for an imaging study that permits the assessment of SWIs and is able to distinguish between superficial and deep SWI. The present work was a prospective study aiming to evaluate the role of technetium-99m hexamethylpropylene amine oxime (99mTc-HMPAO) labelled leucocyte scan in SWI management. Twenty-eight patients with suspected SWIs were included in the study. On the basis of clinical examination they were subdivided into three groups: patients with signs of superficial SWI (group 1), patients with signs of superficial SWI and suspected deep infection (group 2) and patients with suspected deep SWI without superficial involvement (group 3). Ten patients previously submitted to median sternotomy, but without suspected SWI, were also included in the study as a control group (group 4). All patients with suspected SWI had bacteriological examinations of wound secretion, if present. In addition 99mTc-HMPAO labelled leucocyte scan was performed in all patients. The patients of groups 1, 2 and 3 were treated on the basis of the clinical signs and microbiological findings, independently of the scintigraphic results. The patients of group 4 did not receive treatment. The final assessment of infection was based on histological and microbiological findings or on long-term clinical follow-up. Sensitivity, specificity, accuracy and positive and negative predictive values for scintigraphic and non-scintigraphic results were calculated. In the diagnosis of superficial and deep SWI, clinical and microbiological examination (combined) yielded, respectively, a sensitivity of 68.7% and 100%, a specificity of 77.3% and 80.8%, an accuracy of 73.7% and 86.8%, a positive predictive value of 68

  10. Reconstruction of sternal defect - a literature review

    DEFF Research Database (Denmark)

    Juhl, Alexander Andersen; Koudahl, Vibeke; Damsgaard, Tine Engberg

    2012-01-01

    OBJECTIVES: The management of sternal defects arisen after deep sternal wound infection is challenging and often requires extensive interdisciplinary teamwork between plastic and thoracic surgeons. In this study, the published literature on methods used to reconstruct sternal defects arisen as a...... result of deep sternal wound infection after open-heart surgery will be reviewed. DESIGN: The Cochrane, Embase, PubMed, and SveMed+ databases were searched in December 2011. Only papers regarding treatment of deep sternal wound infection after open-heart surgery in adults were included. RESULTS: The...... literature search identified 224 original papers that met the inclusion criteria. The majority dealt with surgical techniques. None of the studies regarding reconstructive options were designed as randomized controlled trials, and the levels of evidence are generally low. CONCLUSION: The treatment of deep...

  11. Failure analysis of explanted sternal wires.

    Science.gov (United States)

    Shih, Chun-Ming; Su, Yea-Yang; Lin, Shing-Jong; Shih, Chun-Che

    2005-05-01

    To classify and understand the mechanisms of surface damages and fracture mechanisms of sternal wires, explanted stainless steel sternal wires were collected from patients with sternal dehiscence following open-heart surgery. Surface alterations and fractured ends of sternal wires were examined and analyzed. Eighty fractured wires extracted from 25 patients from January 1999 to December 2003, with mean implantation interval of 55+/-149 days (range 5-729 days) after cardiac surgery, were studied by various techniques. The extracted wires were cleaned and the fibrotic tissues were removed. Irregularities and fractured ends were assayed by a scanning electron microscopy. After stereomicroscopy and documentation, the explants were cleaned with 1% sodium hypochlorite to remove the blood and tissues and was followed by cleaned with deionized water and alcohol. The explants were examined by stereomicroscopy, and irregularities on surface and fracture surfaces of sternal wires were assayed by scanning electron microscopy, energy dispersive X-ray analysis (EDAX) and X-ray mapping. The explants with surrounding fibrotic tissue were stained and examined with stereomicroscopy and transmission electronic microscopy. Corrosion pits were found on the surface of explanted sternal wires. EDAX and X-ray mapping examinations revealed diminution of nickel concentration in the severely corroded pits on sternal wires. A feature of transgranular cracking was observed for stress corrosion cracking and striation character for typical corrosion fatigue was also identified. TEM examination of tissue showed the metallic particles in phagolysosomes of macrophages inside the surrounding sternal tissue. The synergic effect of hostile environment and the stress could be the precursors of failures for sternal wires. PMID:15576179

  12. Aseptic technique in microgravity.

    Science.gov (United States)

    McCuaig, K

    1992-11-01

    Within the next decade, the United States will launch a space station into low Earth orbit as a preliminary step toward a manned mission to Mars. Provision of asepsis in the unique microgravity environment, essential in operative and invasive procedures, is addressed. An assessment of conventional terrestrial aseptic methods and possible modifications for a microgravity environment was done during the microgravity portion of parabolic flight on NASA KC-135 aircraft. During 110 parabolas on three flight days, a "surgical team" (surgeon, scrub nurse and circulating nurse) using a life size mannequin fastened to a prototype surgical "work station" (operating table), evaluated open and closed gloving (ten parabolas), skin preparation (six parabolas), surgical scrub methods (24 parabolas), gowning (22 parabolas) and draping (48 parabolas). Evaluated were povidone iodine solution, 1 percent povidone iodine detergent, Chloroxylenol with detergent, wet prep soap sponge, a water insoluble iodophor polymer (DuraPrep, 3M), disposable towels, disposable and reusable gowns, large and small disposable drapes with and without adhesive edges, disposable latex surgeon's gloves with and without packaging modifications and restraint mechanisms (tether, swiss seat, waist and foot restraint devices, fairfield and wire clamps and clips). Ease of use, provision of restraint for supplies and personnel and waste disposal were assessed. The literature was reviewed and its relevance to the space environment discussed, including risk factors, environmental contamination, immune status and microbiology. The microgravity environment, limited water supply and restricted operating area mandated that modifications of fabrication and packaging of supplies and technique be made to create and preserve asepsis. Material must meet stringent flammability and off-gassing standards. Either a chlorhexidine or povidone iodine detergent prepackaged brush and sponge would provide an adequate scrub plus

  13. Aseptic technique for cell culture.

    Science.gov (United States)

    Coté, R J

    2001-05-01

    This unit describes some of the ways that a laboratory can deal with the constant threat of microbial contamination in cell cultures. A protocol on aseptic technique is described first. This catch-all term universally appears in any set of instructions pertaining to procedures in which noncontaminating conditions must be maintained. In reality, aseptic technique encompasses all aspects of environmental control, personal hygiene, equipment and media sterilization, and associated quality control procedures needed to ensure that a procedure is, indeed, performed with aseptic, noncontaminating technique. Although cell culture can theoretically be carried out on an open bench in a low-traffic area, most cell culture work is carried out using a horizontal laminar-flow clean bench or a vertical laminar-flow biosafety cabinet. Both are described here. PMID:18228291

  14. Co-trimoxazole induced aseptic meningitis.

    OpenAIRE

    PASHANKAR, D.; McArdle, M.; A. Robinson

    1995-01-01

    A 15 year old boy presented with two episodes of aseptic meningitis-like reactions after ingestion of co-trimoxazole. The diagnosis of co-trimoxazole induced aseptic meningitis was made. This syndrome should be considered in the differential diagnosis of aseptic meningitis.

  15. Traumatic sternal fracture: Incidence, causes and CT features

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Hyo Weon; Kim, Young Tong; Jou, Sung Shick; Han, Jong Kyu; Bae, Won Kyung [Dept. of Radiology, Soonchunhyang University College of Medicine, Cheonan Hospital, Cheonan (Korea, Republic of)

    2015-05-15

    To evaluate the incidence of sternal fracture due to trauma, the CT features of sternal fractures, and the hospitalization period. The medical records and CT images of 755 patients who suffered trauma from January 2012 to August 2013 were analyzed retrospectively. We compared the incidence of sternal fracture due to various traumatic causes. We evaluated the location and shape of the sternal fracture on CT scans and the relationship between a sternal fracture and the hospitalization period. The incidence of sternal fracture was 9.27% (70/755) in all patients; 11.7% (53/453) due to a traffic accident (TA), and 5.63% (17/302) due to other causes. TA was the most frequent cause (75.71%) of a sternal fracture, fracture incidences after a TA differed by traumatic cause (p < 0.05). Among sternal fractures, the body was the most commonly involved (68.57%), one wall was limited (32.85%), and anteroposterior length increased (7.14%). Body fractures involving two or more segments included 33.33% of the cases. The hospitalization period was not related with sternal fracture (p = 0.30). Fracture was more frequent after a TA than due to other causes. Fracture incidences after a TA depended on the traumatic causes. Involvement of two or more segments and one wall-limitation were common among sternal fractures. Sternal fractures occurred even in slightly injured patients.

  16. Amoxicillin-induced aseptic meningoencephalitis

    OpenAIRE

    Radi Shahien; Vetaly Vieksler; Abdalla Bowirrat

    2010-01-01

    Radi Shahien1, Vetaly Vieksler1, Abdalla Bowirrat11Department of Neurology and Neurophysiology, Ziv Medical Center, Safed, IsraelAbstract: Meningitis is usually produced by an infectious agent, but there are multiple noninfectious causes. Drug-induced aseptic meningitis (DIAM) is an important entity and has been reported as an uncommon adverse reaction with numerous agents. Thus, DIAM constitutes a diagnostic and patient management challenge. We present a patient with three episodes of asepti...

  17. Amoxicillin-induced aseptic meningoencephalitis

    Directory of Open Access Journals (Sweden)

    Radi Shahien

    2010-06-01

    Full Text Available Radi Shahien1, Vetaly Vieksler1, Abdalla Bowirrat11Department of Neurology and Neurophysiology, Ziv Medical Center, Safed, IsraelAbstract: Meningitis is usually produced by an infectious agent, but there are multiple noninfectious causes. Drug-induced aseptic meningitis (DIAM is an important entity and has been reported as an uncommon adverse reaction with numerous agents. Thus, DIAM constitutes a diagnostic and patient management challenge. We present a patient with three episodes of aseptic meningitis due to amoxicillin, and then review the literature on this rare idiosyncratic event which may occur after local or systemic drug administration. A 77-year-old man was admitted to our hospital with fever, headache, and neck stiffness. Seven days before admission he had a dental and gingival inflammation. He was treated with two oral doses of 500 mg daily of amoxicillin for one week. The seventh day he awoke with the complaints that prompted hospital admittance. Amoxicillin was stopped 1 day before his admission. From his history we knew of two similar episodes: The first episode was after a dental procedure 3 months before this incident. He had received a 1-week course of postprocedure amoxicillin of 500 mg daily and had similar headache, fever, and chills during the entire course of treatment. He wasn’t admitted to the hospital, because he stopped taking amoxicillin and he felt spontaneous pain relief after taking symptomatic pain treatment. The second episodes was 6 months after his first admission, he had been admitted to our hospital with the same symptoms. Amoxicillin was stopped and changed with intravenous (IV ceftriaxone (CTRX for 10 days due to suspected partial untreated meningitis. The patient improved rapidly within 2 days and was discharged from the hospital. On the basis of these three confirmed episodes of meningitis after recurrent exposure to amoxicillin, with repetitive negative testing for viral, bacterial, and mycobacterial

  18. Sternal resection and reconstruction for local recurrence of breast cancer using the sternal allograft transplantation technique.

    Science.gov (United States)

    Dell'amore, Andrea; Nizar, Asadi; Dolci, Giampiero; Cassanelli, Nicola; Caroli, Guido; Luciano, Giulia; Greco, Domenico; Bini, Alessandro; Stella, Franco

    2013-03-01

    Sternal involvement in patients with breast cancer is relatively rare and its treatment is still controversial. Surgery is usually indicated in cases of single metastases in a multimodality protocol. Partial or complete sternectomy associated or not with the resection of surrounding tissues is the technique of choice to obtain safety margins and radical treatment of the disease. The most challenging part of the operation is the reconstruction of the anterior chest wall in order to avoid secondary complications and respiratory failure. In the last few years, different techniques and materials have been used to reconstruct the sternum. We report our experience in two patients with recurrent breast cancer using the sternal allograft technique to replace the sternum after partial sternectomy. The use of a sternal-allograft provides excellent functional and cosmetic results without complications during the follow-up period. The implantation technique is simple and reproducible. PMID:22884436

  19. Magnetic resonance imaging in the evaluation of patients with aseptic meningoencephalitis and connective tissue disorders

    Directory of Open Access Journals (Sweden)

    APPENZELLER SIMONE

    2000-01-01

    Full Text Available OBJECTIVE: To describe the role of magnetic resonance imaging (MRI in the evaluation of patients with chronic and recurrent aseptic meningitis.METHOD: A retrospective study of five patients with aseptic meningoencefalitis diagnosed by clinical and CSF findings. CT scans showed without no relevant findings. RESULTS: MRI showed small multifocal lesions hyperintense on T2 weighted images and FLAIR, with mild or no gadolinium enhancement, mainly in periventricular and subcortical regions. Meningoencephalitis preceded the diagnosis of the underlying disease in four patients (Behçet´s disease or systemic lupus erythematosus. After the introduction of adequate treatment for the rheumatic disease, they did not present further symptoms of aseptic meningoencephalitis. CONCLUSION: Aseptic meningoencephalitis can be an early presentation of an autoimmune disease. It is important to emphasize the role of MRI in the diagnosis and follow-up of these patients.

  20. Aseptic Plant Culture System (APCS) Project

    Data.gov (United States)

    National Aeronautics and Space Administration — Aseptic plant culture plays a significant role in biotechnology and plant physiology research, and in vegetative propagation of many plant species. The development...

  1. Aseptic Plant Culture System (APCS) Project

    Data.gov (United States)

    National Aeronautics and Space Administration — Aseptic plant culture plays a significant role in biotechnology and plant physiology research and in vegetative propagation of many plant species. The development...

  2. Sternal Wound Infection by Trichosporon inkin following Cardiac Surgery

    OpenAIRE

    Davies, Frances; Logan, Sarah; Johnson, Elizabeth; Klein, John L.

    2006-01-01

    Wound infection following cardiac surgery is well described but is rarely due to fungal infection. We describe a case of sternal wound infection caused by Trichosporon inkin with a fatal outcome, in an immunocompetent patient following aortic root surgery.

  3. Premature sternal fusion in gonadal dysgenesis with coarctation

    International Nuclear Information System (INIS)

    In reviewing lateral chest roentgenograms in three infants with Turner's syndrome and aortic coarctation, and in infant with mixed gonadal dysgenesis and aortic coarctation, we have found obvious sternal fusion abnormalities which are reported here. (orig./MG)

  4. Scintigraphic imaging with technetium-99M-labelled ceftizoxime is a reliable technique for the diagnosis of deep sternal wound infection in rats

    Energy Technology Data Exchange (ETDEWEB)

    Costa, Paulo Henrique Nogueira; Diniz, Simone Odilia Fernandes; Cardoso, Valbert Nascimento; Tarabal, Bernardo; Takenaka, Isabella; Braga, Otavio; Vidigal, Paula Vieira Teixeira; Gelape, Claudio Leo; Araujo, Ivana Duval, E-mail: phnc@uol.com.br [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil)

    2015-07-01

    Purpose: to evaluate whether scintigraphy with technetium-99m-labeled ceftizoxime ({sup 99m}Tc-CFT) can differentiate mediastinitis from aseptic inflammation associated with sternotomy. Methods: twenty female Wistar rats were randomly distributed into four groups: S (control) -partial upper median sternotomy with no treatment; SW (control) - sternotomy and treatment of sternal wounds with bone wax; SB - sternotomy and infection with Staphylococcus aureus; SWB - sternotomy with bone wax treatment and bacterial infection. Scintigraphy with {sup 99m}Tc-CFT was performed eight days after surgery and images were collected 210 and 360 min after infusion of the radiopharmaceutical. Results: no animals exhibited clinical signs of wound infection at the end of the experiment, although histological data verified acute inflammatory response in those experimentally infected with bacteria. Scintigraphic images revealed that tropism of {sup 99m}Tc-CFT to infected sternums was greater than to their non-infected counterparts. Mean counts of radioactivity in bacteria-infected sternal regions (SB and SWB) were significantly higher (p = 0.0007) than those of the respective controls (S and SW).Conclusion: scintigraphy with technetium-99m-labeled ceftizoxime is a method that can potentially detect infection post sternotomy and differentiate from aseptic inflammation in animals experimentally inoculated with S. aureus (author)

  5. Scintigraphic imaging with technetium-99M-labelled ceftizoxime is a reliable technique for the diagnosis of deep sternal wound infection in rats

    International Nuclear Information System (INIS)

    Purpose: to evaluate whether scintigraphy with technetium-99m-labeled ceftizoxime (99mTc-CFT) can differentiate mediastinitis from aseptic inflammation associated with sternotomy. Methods: twenty female Wistar rats were randomly distributed into four groups: S (control) -partial upper median sternotomy with no treatment; SW (control) - sternotomy and treatment of sternal wounds with bone wax; SB - sternotomy and infection with Staphylococcus aureus; SWB - sternotomy with bone wax treatment and bacterial infection. Scintigraphy with 99mTc-CFT was performed eight days after surgery and images were collected 210 and 360 min after infusion of the radiopharmaceutical. Results: no animals exhibited clinical signs of wound infection at the end of the experiment, although histological data verified acute inflammatory response in those experimentally infected with bacteria. Scintigraphic images revealed that tropism of 99mTc-CFT to infected sternums was greater than to their non-infected counterparts. Mean counts of radioactivity in bacteria-infected sternal regions (SB and SWB) were significantly higher (p = 0.0007) than those of the respective controls (S and SW).Conclusion: scintigraphy with technetium-99m-labeled ceftizoxime is a method that can potentially detect infection post sternotomy and differentiate from aseptic inflammation in animals experimentally inoculated with S. aureus (author)

  6. CT scan of bacterial and aseptic meningitis

    International Nuclear Information System (INIS)

    CT scans of the patients with aseptic and bacterial meningitis were reviewed and compared to previous reports. In aseptic meningitis, no abnormal CT findings were observed. In bacterial meningitis, CT findings were ventricular dilatation, subdural fluid collection, parenchymal low density, intracerebral hematoma and meningeal enhancement after contrast injection. Three patients among 48 suffered from status epileptics during the course of the illness. All of 3 patients developed parenchymal inhomogeneous low density and progressive ventricular dilatation which did not improve after ventricular peritoneal shunt surgery. We believe that these changes are most likely due to hypoxic hypoxemia during epileptic seizure and meningitis itself seems to play a little role. (author)

  7. Resuture using Shirodkar tape for sternal dehiscence after extended thymectomy via median sternotomy.

    Science.gov (United States)

    Sakuraba, Motoki; Miyamoto, Hideaki; Oh, Shiaki; Takahashi, Nobumasa; Miyasaka, Yoshikazu; Suzuki, Kenji

    2009-06-01

    Sternal dehiscence is one complication after median sternotomy. We followed a patient with sternal dehiscence for 6 months after extended thymectomy via median sternotomy. His diagnosis was myasthenia gravis without thymoma and with complicating diabetes mellitus. Sixteen days after the operation chest radiography revealed that one of six sternal wires was cut, although sternal dehiscence was not apparent. Six months after the operation, chest radiography revealed that five of six wires were cut. The patient experienced sternal dehiscence, could not cough, and felt pain at the median wound site. We implemented a resuture technique of the sternum using Shirodkar tape for postoperative sternal dehiscence. After the second operation, sternal dehiscence was not apparent. He was able to cough and had no respiratory deficiency. One year after the second operation, chest computed tomography revealed no sternal dehiscence. Shirodkar tape is extremely useful and is low in price. PMID:19533280

  8. Sternal fractures as a manifestation of abusive injury in children

    Energy Technology Data Exchange (ETDEWEB)

    Hechter, Sloane; Manson, David [Department of Diagnostic Imaging, Hospital for Sick Children, 555 University Ave, Toronto, Ontario, M5G 1X8 (Canada); Huyer, Dirk [Department of Pediatrics, Division of Suspected Child Abuse and Neglect, Hospital for Sick Children, Toronto, Ontario (Canada)

    2002-12-01

    Sternal fractures are rare injuries in children. The rarity of this injury is likely due to both the relative plasticity of the pediatric thorax and to the difficulty in establishing a radiographic diagnosis without dedicated views. Current literature suggests that this injury in young children is highly specific for abusive injury.Hypothesis. Sternal fractures are not highly specific for abusive injury. Materials and methods. This was a retrospective radiographic and clinical chart review of all documented sternal fractures over an 11-year period at a large pediatric hospital.Results. Of 12 children with sternal fractures identified, four were {<=}2 years of age and eight were {>=}3 years of age. The mechanism of injury was suspicious for child abuse in two children. Both of these children were {<=}2 years of age. In one toddler, an unwitnessed injury resulted in extensive initial familial anxiety until abusive injury was excluded.Conclusion. Sternal fractures are unusual injuries, yet they, in themselves, are not highly specific for abusive injury. (orig.)

  9. Sternal fractures as a manifestation of abusive injury in children

    International Nuclear Information System (INIS)

    Sternal fractures are rare injuries in children. The rarity of this injury is likely due to both the relative plasticity of the pediatric thorax and to the difficulty in establishing a radiographic diagnosis without dedicated views. Current literature suggests that this injury in young children is highly specific for abusive injury.Hypothesis. Sternal fractures are not highly specific for abusive injury. Materials and methods. This was a retrospective radiographic and clinical chart review of all documented sternal fractures over an 11-year period at a large pediatric hospital.Results. Of 12 children with sternal fractures identified, four were ≤2 years of age and eight were ≥3 years of age. The mechanism of injury was suspicious for child abuse in two children. Both of these children were ≤2 years of age. In one toddler, an unwitnessed injury resulted in extensive initial familial anxiety until abusive injury was excluded.Conclusion. Sternal fractures are unusual injuries, yet they, in themselves, are not highly specific for abusive injury. (orig.)

  10. A girl with sternal malformation/vascular dysplasia association

    Directory of Open Access Journals (Sweden)

    Na Yong Lee

    2013-03-01

    Full Text Available Sternal malformation/vascular dysplasia association is a rare congenital dysmorphology, which has not yet been reported in Korea. Its typical clinical features include a sternal cleft covered with atrophic skin, a median abdominal raphe extending from the sternal defect to the umbilicus, and cutaneous craniofacial hemangiomata. We report a case of a full-term newborn who presented with no anomalies at birth, except for a skin defect over the sternum and a supraumbilical raphe. Multiple hemangiomas appeared subsequently on her chin and upper chest wall, and respiratory distress due to subglottic hemangioma developed during the first 2 months of life. Her symptoms were controlled with oral prednisolone administration. No respiratory distress have recurred during the 3-year follow-up period.

  11. Upper Sternal Cleft With a Complex Congenital Heart Defect: Repair in a Single Stage.

    Science.gov (United States)

    Al-Yamani, Mohammed; Lavrand, Frederic; Thambo, Jean-Benoit; Roubertie, François

    2016-02-01

    Sternal clefts are extremely rare in association with complex congenital heart defects, and their management can be challenging. Complete surgical repair in early infancy, of both anomalies in a single stage, is advocated. Different surgical techniques exist for isolated sternal cleft repair, but they do not consider the difficulties of combining sternal defect closure and a cardiac operation with the unavoidable postoperative cardiac edema. We describe a successful surgical technique to repair a sternal cleft in a 3-month-old infant in a concomitant cardiac operation using an absorbable polyglactin 910 mesh plate and sternal osseous autografting to avoid postoperative cardiac distention. PMID:26777935

  12. Management of sternal osteomyelitis and mediastinal infection following median sternotomy

    Institute of Scientific and Technical Information of China (English)

    GAO Ju; WANG Wen-zhang; WANG You-li; LU Shu-qiang; CAI Ai-bing; YANG Zhi-fu; HAN Zhi-yi; LI Jiu-jiang; WEN Yu-ming; GENG Feng-yong

    2010-01-01

    Background Median sternotomy is considered the most usually performed procedure in cardiac operations. This study aimed to assess clinical effectiveness of bilateral pectoralis major muscle flaps (BPMMF) for management of sternal osteomyelitis and mediastinal infection following median sternotomy.Methods Clinical data were collected and retrospectively analyzed from twelve patients who underwent the BPMMF transposition for management of sternal osteomyelitis and mediastinal infection following median sternotomy from January 2006 to June 2009. Procedure consisted of rigorous debridement of necrotic tissues, dead space obliteration using the BPMMF, and placement of drainage tubes connected to a negative pressures generator for adequate drainage.Results No patients died of drainage, and all 12 patients had viable BPMMF when discharged from hospital. At 1 week post discharge, 2 patients presented with sternal infection but recovered following local debridement and medication. No patients showed infection recurrence during the follow-up period over 10 months.Conclusions Sternal osteomyelitis and mediastinal infection following median sternotomy may be effectively managed through rigorous debridement of infected soft tissues, resection of the damaged stermal segment, transposition of the BPMMF to fill the damaged sternum resulting from debridement, and adequate postoperative drainage.

  13. [A case of recurrent aseptic meningitis induced by ergot agents].

    Science.gov (United States)

    Ogawa, Tomoko; Tagawa, Asako; Hashimoto, Ritsuo; Kato, Hiroyuki

    2015-01-01

    We describe the case of a 29-year-old woman with recurrent aseptic meningitis that was caused by ergot agents. She miscarried at age 27, and the uterus constrictor methylergometrine was prescribed. Three days later, she developed aseptic meningitis and was hospitalized. Two years later, she again developed aseptic meningitis the day after she took ergotamine tartrate. In both events, her symptoms improved rapidly when the medication was stopped. The drug-induced lymphocyte stimulation test for methylergometrine yielded a value of 180%. Drug-induced meningitis is a rare form of recurrent aseptic meningitis. Many studies have reported cases of meningitis caused by non-steroidal anti-inflammatory drugs, but many other drugs can induce aseptic meningitis. To the best of our knowledge, this is the first case of aseptic meningitis induced by ergot agents. PMID:26103816

  14. La tuberculose sternale: à propos de 2 cas

    OpenAIRE

    Ouarssani, Aziz; Atoini, Fouad; Ait Lhou, Fatima; Idrissi Rguibi, Mustapha

    2012-01-01

    La tuberculose ostéoarticulaire touche surtout le rachis. L’atteinte sternale est rare, elle représente moins de 1% des ostéomyélites tuberculeuses. L’abcès froid compliqué par une fracture pathologique constitue le mode de révélation le plus fréquent. Le traitement chirurgical assure l’évacuation des abcès et permet le diagnostique histologique et bactériologique. On rapporte deux cas de tuberculose sternale âgés respectivement de 45 ans et de 10ans, colligés au service de pneumologie, l’exa...

  15. Local Collagen-Gentamicin for Prevention of Sternal Wound Infections

    OpenAIRE

    Friberg, Örjan

    2006-01-01

    In cardiac surgery, sternal wound infection (SWI) continues to be one of the most serious postoperative complications. Coagulase-negative staphylococci (CoNS) have become the most common causative agents of SWI. Prophylaxis with intravenous beta-lactam antibiotics (cephalosporins or in Sweden most commonly isoxazolyl penicillins) is routinely practised. However, many CoNS species are resistant to beta-lactam antibiotics. Vancomycin is often the only effective antibiotic available for treatmen...

  16. Aseptic meningitis caused by human parvovirus B19.

    OpenAIRE

    Okumura, A.; Ichikawa, T

    1993-01-01

    Reports on aseptic meningitis caused by human parvovirus B19 are extremely rare. A case of aseptic meningitis is described in which human parvovirus B19 DNA was detected in the acute phase in cerebrospinal fluid by the polymerase chain reaction.

  17. Possible Tick-Borne Human Enterovirus Resulting in Aseptic Meningitis

    OpenAIRE

    Freundt, Eric C.; Beatty, Douglas C.; Stegall-Faulk, Teresa; Wright, Stephen M.

    2005-01-01

    Enterovirus-specific genetic sequences were isolated from two Amblyomma americanum tick pools. Identical genetic sequences were later obtained from cerebrospinal fluid of a patient with aseptic meningitis and a recent history of tick attachment. These observations suggest the possibility of an emerging tick-borne human enterovirus associated with aseptic meningitis.

  18. Poorly differentiated thyroid carcinoma with sternal invasion. A case report and review of the literature

    OpenAIRE

    Quaratulain Sabih; Michael F. Spafford; Dietl, Charles A.

    2014-01-01

    INTRODUCTION: Surgical resection of poorly differentiated thyroid carcinoma with direct invasion of the sternum has not been previously reported. Only 4 cases of concomitant thyroidectomy and sternal resection and reconstruction for sternal metastases have been published. PRESENTATION OF CASE: A 66-year-old female with a poorly differentiated thyroid carcinoma and direct sternal invasion underwent total thyroidectomy and resection of the manubrium and both clavicular heads, and chest wall ...

  19. Semester-Long Assessment of Aseptic Technique in Microbiology Labs

    Directory of Open Access Journals (Sweden)

    Daniel Aruscavage

    2013-08-01

    Full Text Available Biology educators emphasize aseptic technique when teaching lab courses. Aseptic technique is very important in microbiology to ensure safety and prevent cross-contamination. Although it can be assessed throughout the semester by examining the students’ technique and observation of contamination, this tool offers a simple semester-long graded assessment of each student’s technique. The procedures allow the students to perform a quick exercise that can determine if cross-contamination occurs, thus determining if aseptic technique was observed. Instructors can quickly check for the presence of cross-contamination. After implementing this procedure, a quantifiable improvement in my students’ aseptic technique throughout the semester was observed. It was noted that between the middle and end of the semester there was a slight increase in the amount of cross-contamination but still well below the contamination observed at the beginning of the semester. This procedure was a valuable way to assess aseptic technique during the course of a semester. A search for “aseptic technique” on the American Society of Microbiology website reveals that several lab experiments and job opportunities mention the importance of aseptic technique. It is a skill that must be used for all laboratory procedures when working with microorganisms. It is important for both the safety of the students and for the proper handling of microorganisms. There are several good explanations of aseptic technique on the Internet, and the Nuffield Foundation provides a very good description of techniques (1. The goal of this project is to provide instructors with a tool to assess the aseptic technique of their students by using simple transfers of bacteria to fresh media to identify cross-contamination. When class experiments do not work students may not understand how poor aseptic technique impacted the project. This tool would work best for undergraduate students in an

  20. Giant Leaking Colloid Cyst Presenting with Aseptic Meningitis

    DEFF Research Database (Denmark)

    Bakhtevari, Mehrdad Hosseinzadeh; Sharifi, Guive; Jabbari, Reza;

    2015-01-01

    BACKGROUND: Colloid cysts are benign third ventricle lesions that need to be diagnosed correctly because of their association with sudden death. Chemical or aseptic meningitis is a rare presentation of a colloid cyst. METHODS: We present a case of a 69-year-old man with fever, alteration of mental...... status, and meningismus. Microbiological examination of the cerebrospinal fluid revealed aseptic meningitis. Brain imaging revealed a third ventricular colloid cyst with hydrocephalus. RESULTS: The tumor was resected via endoscopic intervention. There were no persistent operative complications related to...... the endoscopic procedure. CONCLUSIONS: Chemical or aseptic meningitis is an unusual clinical manifestation of a colloid cyst, complicating the differential diagnosis, especially in the elderly....

  1. Sex estimation from sternal measurements using multidetector computed tomography.

    Science.gov (United States)

    Ekizoglu, Oguzhan; Hocaoglu, Elif; Inci, Ercan; Bilgili, Mustafa Gokhan; Solmaz, Dilek; Erdil, Irem; Can, Ismail Ozgur

    2014-12-01

    We aimed to show the utility and reliability of sternal morphometric analysis for sex estimation.Sex estimation is a very important step in forensic identification. Skeletal surveys are main methods for sex estimation studies. Morphometric analysis of sternum may provide high accuracy rated data in sex discrimination. In this study, morphometric analysis of sternum was evaluated in 1 mm chest computed tomography scans for sex estimation. Four hundred forty 3 subjects (202 female, 241 male, mean age: 44 ± 8.1 [distribution: 30-60 year old]) were included the study. Manubrium length (ML), mesosternum length (2L), Sternebra 1 (S1W), and Sternebra 3 (S3W) width were measured and also sternal index (SI) was calculated. Differences between genders were evaluated by student t-test. Predictive factors of sex were determined by discrimination analysis and receiver operating characteristic (ROC) analysis. Male sternal measurement values are significantly higher than females (P < 0.001) while SI is significantly low in males (P < 0.001). In discrimination analysis, MSL has high accuracy rate with 80.2% in females and 80.9% in males. MSL also has the best sensitivity (75.9%) and specificity (87.6%) values. Accuracy rates were above 80% in 3 stepwise discrimination analysis for both sexes. Stepwise 1 (ML, MSL, S1W, S3W) has the highest accuracy rate in stepwise discrimination analysis with 86.1% in females and 83.8% in males. Our study showed that morphometric computed tomography analysis of sternum might provide important information for sex estimation. PMID:25501090

  2. Pseudomass of the sternal manubrium in osteogenesis imperfecta

    International Nuclear Information System (INIS)

    Skeletal abnormalities such as hypertrophic callus formation and ''popcorn'' calcifications are rare radiological findings of osteogenesis imperfecta, causing tumor-like appearances on imaging. We report on a 7-year-old girl with osteogenesis imperfecta presenting with hepatomegaly and palpable lymphadenopathy in the left inguinal region on physical examination. Computed tomography examination revealed a high-density mass-like lesion of the manubrium sterni. Ultrasonography and a lateral roentgenogram of the chest verified that this was a pseudomass caused by a bowed sternal manubrium. (orig.)

  3. Staphylococcus aureus sternal osteomyelitis: a rare cause of chest pain

    Directory of Open Access Journals (Sweden)

    Kaur M

    2015-10-01

    Full Text Available Chest pain is a common presenting symptom with a broad differential. Life-threatening cardiac and pulmonary etiologies of chest pain should be evaluated first. However, it is critical to perform a thorough assessment for other sources of chest pain in order to limit morbidity and mortality from less common causes. We present a rare case of a previously healthy 45 year old man who presented with focal, substernal, reproducible chest pain and Staphylococcus aureus bacteremia who was later found to have primary Staphylococcus aureus sternal osteomyelitis.

  4. Sternal Closure With Tie Bands: A Word of Caution.

    Science.gov (United States)

    Samuels, Louis

    2016-08-01

    The median sternotomy for cardiac operations can be reapproximated in a variety of ways. Traditionally, sternal wires have been used in several configurations to afford satisfactory closure. Alternative techniques include cables, plates, and clip-like devices. A relatively recent addition to the menu of options is the plastic tie band. Although a few studies have suggested its efficacy, this favorable experience has not been universal. The purpose of this report is to describe a failure in closure and the reaction of the soft tissue around it. PMID:27449444

  5. Radiation sterilization of plastic packing materials and aseptic packaging

    International Nuclear Information System (INIS)

    In the present day of 'satiation', quality, not quantity, is emphasized for foods, the consumers being oriented toward raw and healthy foodstuff. Aseptic Packaging is excellent means of conservation. While conventionally chemicals have been used for sterilization of packing materials for aseptic packaging, the sterilization by radiation is used in part recently. The following are described : history of aseptic packaging and its features, sterilization by radiation, γ-ray sterilization of large-sized containers, the development of an aseptic packaging system using electron rays, the occurrence of offensive odors from packing materials (comparison of odors from various materials, volatile substances occurring in irradiated polyethylene, influence of film grade upon the formation of carboxylic acid, influence of the irradiation conditions upon the occurrences of volatile substances, volatile substances occurring in the irradiation of bag-in-box packing materials), changes in properties of the packing materials. (Mori, K.)

  6. Semester-Long Assessment of Aseptic Technique in Microbiology Labs

    OpenAIRE

    Daniel Aruscavage

    2013-01-01

    Biology educators emphasize aseptic technique when teaching lab courses. Aseptic technique is very important in microbiology to ensure safety and prevent cross-contamination. Although it can be assessed throughout the semester by examining the students’ technique and observation of contamination, this tool offers a simple semester-long graded assessment of each student’s technique. The procedures allow the students to perform a quick exercise that can determine if cross-contamination occurs, ...

  7. Aseptic procedure in the ambulant wound management – legal and practical issues

    OpenAIRE

    Schwarzkopf, Andreas

    2007-01-01

    A greater part of the care of chronic wounds takes place in private homes in Germany. Not in every case it is possible to perform hygiene control of the environment. Personal hygiene ideas of patients may differ in a wide range. Teamwork together with surgeons is not always easy for wound managers. Aseptic care of wounds is possible under nearly every condition, if well elaborated processes are engaged. Hygiene in home care is defined by laws to protect nursing persons (BiostoffV, TRBA 250) a...

  8. MR features in patients with residual paralysis following aseptic meningitis

    International Nuclear Information System (INIS)

    MR studies were performed in three patients with paralysis in the lower extremities. Poliomyelitis-like paralysis can be caused by neurovirulent strains of nonpolioenteroviruses. Entervirus 71 (EV 71) is documented as one of the potentially neurovirulent strains and a causative agent of some epidemics (1-7). The clinical manifestations associated with the EV 71 infection include aseptic meningitis, hand-food-mouth disease (HFMD), acute respiratory illness and gastrointestinal disease(6). Although rarely fatal, flaccidparalysis can be followed by EV 71 induced aseptic meningitis. Anterior horn cell necrosis was suggested on MR in two patients with residual paralysis (7). MR features, however, have not yet been described in detail. In this report we present three cases of patients with clinical evidence of EV 71 induced aseptic meningitis whose MR studies showed residual changes in spinal cord

  9. Cat scratch disease complicated with aseptic meningitis and neuroretinitis

    Directory of Open Access Journals (Sweden)

    Vitor Laerte Pinto Jr.

    2008-04-01

    Full Text Available Cat scratch disease (CSD is a self limited condition characterized by fever, lymph node enlargement and less often eye involvement. Central nervous system involvement by Bartonella henselae infection is possibly an important cause of morbidity; its role as an agent of aseptic meningitis is unknown. We report a case of a 40 years-old man with CSD accompanied by aseptic meningitis and neuroretinitis. Serum indirect immmunofluorescence (IFI assays for B. henselae were positive and the cerebrospinal fluid (CSF analysis showed mononuclear pleocytosis and increased level of protein. Serological tests for other etiologies were negative. The patient responded well to antibiotic therapy with oral doxycicline plus rifampin and in the 12th day of hospitalization evolved to total regression of the headache and partial regression of the visual loss. Clinicians should consider CSD as a differential diagnosis when assessing previously healthy patients with aseptic meningitis associated with regional lymphadenopathy and epidemiological history of feline contact.

  10. MR features in patients with residual paralysis following aseptic meningitis

    Energy Technology Data Exchange (ETDEWEB)

    Suh, Dae Chul; Park, Young Seo [College of Medicine, Asan Meidcal Center, University of Ulsan, Seoul (Korea, Republic of)

    1991-01-15

    MR studies were performed in three patients with paralysis in the lower extremities. Poliomyelitis-like paralysis can be caused by neurovirulent strains of nonpolioenteroviruses. Entervirus 71 (EV 71) is documented as one of the potentially neurovirulent strains and a causative agent of some epidemics (1-7). The clinical manifestations associated with the EV 71 infection include aseptic meningitis, hand-food-mouth disease (HFMD), acute respiratory illness and gastrointestinal disease(6). Although rarely fatal, flaccidparalysis can be followed by EV 71 induced aseptic meningitis. Anterior horn cell necrosis was suggested on MR in two patients with residual paralysis (7). MR features, however, have not yet been described in detail. In this report we present three cases of patients with clinical evidence of EV 71 induced aseptic meningitis whose MR studies showed residual changes in spinal cord.

  11. Occult sternal metastasis identified by laminography in patients with chest pain.

    Science.gov (United States)

    LaBan, M M; Newman, J M

    1984-04-01

    Six patients with occult sternal metastasis presenting with chest pain, and four with sternal deformity associated with "arthritis" had undergone routine roentgenographic examinations, reported as "normal." Subsequent laminography of the sternum demonstrated lytic lesions confirmed by needle biopsy. Adenocarcinoma of the lung and breast were identified in two each of four patients; myeloma and kidney neoplasms were the primary source of malignancy in the remaining two patients. In widespread malignancy, metastasis to the skeletal chest wall is a well-recognized occurrence. Infrequently, it can be an isolated manifestation of an occult or recurrent malignancy, initially overlooked when routine roentgenograms are read as normal. Although sternal x-rays remain the most important means of diagnosis, in suspected cases of sternal metastasis laminography alone may initially reveal lytic lesions. PMID:6712441

  12. Congenital superior sternal cleft repair using our modified Sally technique: A case report

    Directory of Open Access Journals (Sweden)

    Tomoyuki Kuwata

    2014-12-01

    Full Text Available We report the case of an 8-month-old male neonate who underwent reconstructive surgery for a congenital superior sternal cleft to decrease the risk of commotio cordis. With regard to use of the Sally technique for the repair of a relatively wide cleft (4 × 4 cm, we were concerned about respiratory problems caused by compression following closure of the sternal halves. By closing the sternal halves imperfectly, elevation of intrapleural pressure can be avoided to some extent. By bridging the surplus resected cartilage from the lower sternum over the gap of the upper sternum, the heart is protected by more rigid material. We recommend our modified Sally technique because it is both flexible and effective for sternal cleft repair.

  13. Continuous Infusion of Nafcillin for Sternal Osteomyelitis in an Infant After Cardiac Surgery

    OpenAIRE

    Knoderer, Chad A.; Morris, Jennifer L.; Cox, Elaine G.

    2010-01-01

    We report the use of the continuous infusion of nafcillin for the treatment of an infant who had methicillinsusceptible Staphylococcus aureus sternal osteomyelitis not responsive to traditional nafcillin dosing. The patient was successfully treated with surgical debridement and the continuous infusion of nafcillin. To our knowledge, this is the first report describing the successful use of the continuous infusion of nafcillin to treat an infant who had sternal osteomyelitis after cardiac surg...

  14. Stroke Secondary to Aseptic Meningitis After Endovascular Treatment of a Giant Aneurysm with Parent Artery Occlusion

    International Nuclear Information System (INIS)

    Aseptic meningitis related to hydrogel-coated coils is a known complication, but it is extremely rare after platinum bare coil aseptic meningitis. Here we report the development of aseptic meningitis causing brain stem and cerebellar infarct in a patient with a giant aneurysm treated with bare platinum coils. We conclude that aneurysm size is an important factor affecting the occurrence of aseptic meningitis associated with stroke.

  15. Severe aseptic meningitis with hydrocephalus following iotrolan myelography: A case report

    International Nuclear Information System (INIS)

    A case of severe aseptic meningitis with communicating hydrocephalus following iotrolan myelography is presented. The patient's condition improved very quickly after corticosteroid therapy. Rapid improvement and absence of pathogenic organisms in the CSF culture strongly favor an aseptic meningitis. This is the first reported case of aseptic meningitis with the secondary development of hydrocephalus caused by iotrolan myelography

  16. Deep sternal wound infection after cardiac surgery: Evidences and controversies.

    Science.gov (United States)

    Cotogni, Paolo; Barbero, Cristina; Rinaldi, Mauro

    2015-11-01

    Despite many advances in prevention and perioperative care, deep sternal wound infection (DSWI) remains a pressing concern in cardiac surgery, with a still relevant incidence and with a considerable impact on in-hospital mortality and also on mid- and long-term survival. The permanent high impact of this complication is partially related to the increasing proportion of patients at high-risk for infection, as well as to the many patient and surgical risk factors involved in the pathogenesis of DSWI. The prophylactic antibiotic therapy is one of the most important tools in the prevention of DSWI. However, the choice of antibiotic, the dose, the duration, the adequate levels in serum and tissue, and the timing of antimicrobial prophylaxis are still controversial. The treatment of DSWI ranges from surgical revision with primary closure to surgical revision with open dressings or closed irrigation, from reconstruction with soft tissue flaps to negative pressure wound therapy (NPWT). However, to date, there have been no accepted recommendations regarding the best management of DSWI. Emerging evidence in the literature has validated the efficacy and safety of NPWT either as a single-line therapy, or as a "bridge" prior to final surgical closure. In conclusion, the careful control of patient and surgical risk factors - when possible, the proper antimicrobial prophylaxis, and the choice of validated techniques of treatment could contribute to keep DSWIs at a minimal rate. PMID:26557476

  17. Sternal Wound Infection after Cardiac Surgery: Management and Outcome.

    Directory of Open Access Journals (Sweden)

    Marie Dubert

    Full Text Available Sternal Wound Infection (SWI is a severe complication after cardiac surgery. Debridement associated with primary closure using Redon drains (RD is an effective treatment, but data on RD management and antibiotic treatment are scarce.We performed a single-center analysis of consecutive patients who were re-operated for SWI between 01/2009 and 12/2012. All patients underwent a closed drainage with RD (CDRD. Patients with endocarditis or those who died within the first 45 days were excluded from management analysis. RD fluid was cultured twice weekly. Variables recorded were clinical and biological data at SWI diagnosis, severity of SWI based on criteria for mediastinitis as defined by the Centers for Disease Control (CDC, antibiotic therapy, RD management and patient's outcome.160 patients developed SWI, 102 (64% fulfilled CDC criteria (CDC+ and 58 (36% did not (CDC- SWI. Initial antibiotic treatment and surgical management were similar in CDC+ and CDC- SWI. Patients with CDC+ SWI had a longer duration of antibiotic therapy and a mortality rate of 17% as compared to 3% in patients with CDC- SWI (p = 0.025. Rates of superinfection (10% and 9% and need for second reoperation (12% and 17% were similar. Failure (death or need for another reoperation was associated with female gender, higher EuroScore for prediction of operative mortality, and stay in the ICU.In patients with SWI, initial one-stage surgical debridement with CDRD is associated with favorable outcomes. CDC+ and CDC- SWI received essentially the same management, but CDC+ SWI has a more severe outcome.

  18. Osseous Hodgkin′s lymphoma with sternal involvement at presentation: Diagnostic challenges

    Directory of Open Access Journals (Sweden)

    Shikha Goyal

    2015-01-01

    Full Text Available Hodgkin′s lymphoma with sternal involvement at presentation is quite unusual. Owing to its rarity, it often poses vexing diagnostic challenges. We herein bring into focus a case of advanced stage Hodgkin′s lymphoma, presenting with a sternal mass, initially misdiagnosed and treated as Langerhans cell histiocytosis. On subsequent follow-up, the patient developed recurrence and repeat biopsy and imaging suggested Hodgkin′s lymphoma. The case report highlights the importance of clinical suspicion of unusual presentation of lymphohematopoietic tumors of the bone.

  19. Primary Sternal Osteomyelitis: A Case Report and Review of the Literature

    Directory of Open Access Journals (Sweden)

    Zubair Hasan

    2016-03-01

    Full Text Available Primary sternal osteomyelitis is a rare clinical entity generally caused by Staphylococcus aureus or Pseudomonas aeruginosa.Although rare it carries significant morbidity including spread to mediastinal structures and even mortality. Diagnosis is generally made on clinical suspicion in a patient with and anterior chest pain and swelling, fever and raised inflammatory markers. Management is generally aggressive surgical debridement and intravenous antibiotics. Hyperbaric oxygen can be used where available and reconstructive options need to be considered in those with extensive dissection. Herein we report the case of a 55 year old male with no previous chest surgery or trauma who presented with primary sternal osteomyelitis.

  20. EFFECT OF PASTEURIZATION TEMPERATURE AND ASEPTIC FILLING ON THE SHELF-LIFE OF MILK

    OpenAIRE

    Rodrigo Rodrigues PETRUS; Maria Teresa de Alvarenga FREIRE; Leone de Camargo SETOGUTE; Viviane Midori HIGAJO

    2011-01-01

    Aseptic filling process can contribute to extend the shelf-life of pasteurized milk. However, this technology is not still commercially practiced in Brazil for this product. The aim of this study was to evaluate the effect of the pasteurization temperature and aseptic filling on the stability of milk packaged in high density polyethylene bottle (HDPE). Three batches of one hundred bottles each were processed at 72, 83, and 94ºC/15s, followed by aseptic packaging and st...

  1. Selected Methods of the Chest Wall Reconstruction for Sternal Dehiscence after Median Sternotomy

    Directory of Open Access Journals (Sweden)

    Lewandowicz Edward

    2014-05-01

    Full Text Available Dehiscence of a median sternotomy wound is a potentially devastating and life-threatening complication of cardiac procedures.Depending on the localization, extensiveness, and profoundness of the defect a variety of muscle flaps may be used to cover the frontal mediastinum, in particular: pectoralis major, rectus abdominisor latissimus dorsi. In spite of several options for restoration of sternal integrity we cannot avoid following serious local complications increasing patients morbidity. The aim of this paper is to report a method of sternal dehiscence management. Surgical technique and its results are presented on the example of two patients treated in Plastic, Reconstructive and Aesthetic Surgery Clinic, Medical University in Łódź because of sternal dehiscence after cardiovascular procedure with sternotomy. Our experience indicates that modified bilateral pectoralis major flap seems to be effective surgical method of sternal dehiscence treatment. Also it is worth to remember that surgical procedure in this complication should be performed as soon as possible to decrease patient’s disability and to avoid following complications

  2. Ultrastructural study of tergal and posterior sternal glands in Prorhinotermes simplex (Isoptera: Rhinotermitidae)

    Czech Academy of Sciences Publication Activity Database

    Šobotník, Jan; Weyda, František; Hanus, Robert

    2005-01-01

    Roč. 102, č. 1 (2005), 81-88. ISSN 1210-5759 Institutional research plan: CEZ:AV0Z40550506 Keywords : tergal gland * posterior sternal gland * imago Subject RIV: CC - Organic Chemistry Impact factor: 0.745, year: 2005

  3. Mesenchymal Stem/Stromal Cells from Discarded Neonatal Sternal Tissue: In Vitro Characterization and Angiogenic Properties

    Directory of Open Access Journals (Sweden)

    Shuyun Wang

    2016-01-01

    Full Text Available Autologous and nonautologous bone marrow mesenchymal stem/stromal cells (MSCs are being evaluated as proangiogenic agents for ischemic and vascular disease in adults but not in children. A significant number of newborns and infants with critical congenital heart disease who undergo cardiac surgery already have or are at risk of developing conditions related to inadequate tissue perfusion. During neonatal cardiac surgery, a small amount of sternal tissue is usually discarded. Here we demonstrate that MSCs can be isolated from human neonatal sternal tissue using a nonenzymatic explant culture method. Neonatal sternal bone MSCs (sbMSCs were clonogenic, had a surface marker expression profile that was characteristic of bone marrow MSCs, were multipotent, and expressed pluripotency-related genes at low levels. Neonatal sbMSCs also demonstrated in vitro proangiogenic properties. Sternal bone MSCs cooperated with human umbilical vein endothelial cells (HUVECs to form 3D networks and tubes in vitro. Conditioned media from sbMSCs cultured in hypoxia also promoted HUVEC survival and migration. Given the neonatal source, ease of isolation, and proangiogenic properties, sbMSCs may have relevance to therapeutic applications.

  4. Role of Negative-Pressure Wound Therapy in Deep Sternal Wound Infection After Open Heart Surgery

    Directory of Open Access Journals (Sweden)

    Cemalettin Aydın

    2013-08-01

    Full Text Available Introduction: Mediastinitis is a devastating complication in open heart surgery. The most common treatments after debridement are rewiring with antibiotic irrigation. Vacuum assisted closure therapy is a recently introduced technique that promotes the healing of difficult wounds, including post-sternotomy mediastinitis.Patients and Methods: Forty one patients with deep sternal wound infection were divided into two groups based on the treatment method used. Twenty two patients with post-cardio to my deep sternal wound infection were treated primarily by vacuum assisted closure method (group A and 19 patients with deep sternal wound infection who received closed mediastinal irrigation were treated with antibiotics (group B between January 2006 and January 2010.Results: The two groups were compared. Three patients died during treatment in group B. The median healing time was significantly shorter in group A (mean, 13.5 ± 3.2 days compared to 18 days (mean, 21.2 ± 16.4 days in group B (p< 0.001. Deep sternal wound infection showed no recurrences after the vacuum treatment, while 7 (24% patients in group B suffered recurrences. Hospital stay was significantly shorter in group A (median, 30.5 days; mean, 32.2 ± 11.3 days vs. median, 45 days; mean, 49.2 ± 19.3 days (p= 0.001.Conclusion: A significantly shorter healing time was confirmed with vacuum assisted closure. Hospital stay remained significantly shorter in group A (35 vs. 46 days.

  5. Clinical application of mesenchymal stem cells for aseptic bone necrosis

    Directory of Open Access Journals (Sweden)

    Tomoki Aoyama

    2008-11-01

    Full Text Available Since 2007, we had started clinical trial using mesenchymal stem cell (MSCs for the treatment of aseptic bone necrosis as a first clinical trial permitted by Japanese Health, Labour and Welfare Ministry.Aseptic bone necrosis of the femoral head commonly occurs in patients with two to four decades, causing severe musculoskeletal disability. Although its diagnosis is easy with X-ray and MRI, there has been no gold standard invented for treatment of this disease. MSCs represent a stem cell population in adult tissues that can be isolated and expanded in culture, and differentiate into cells with different nature. Combination with β-tri-calcium phosphate and vascularized bone graft, we succeeded to treat bone necrosis of the femoral head.Regenerative medicine using stem cells is hopeful and shed a light on intractable disease. To become widespread, Basic, Translational, Application, and Developmental study is needed.? From an experience of cell therapy using MSCs, we started to research induced pluripotent stem cell (iPS for clinical application.

  6. Aseptic meningitis in Germany associated with echovirus type 13

    Directory of Open Access Journals (Sweden)

    Schreier Eckart

    2001-09-01

    Full Text Available Abstract Background Echoviruses are the commonest cause of aseptic meningitis. Echovirus type 13 which has not been isolated in Germany over a long period of time was the predominant enterovirus serotype associated with different local outbreaks of aseptic meningitis in Germany in 2000. Methods Virus isolation was performed from cerebrospinal fluid and stools. In order to study the genetic relationship of echovirus type 13 isolates, sequence analysis of a part of VP1 (~300 nt was carried out. Isolates from different geographic regions were compared to each other as well as to elder viruses (prototype strain from 1953, four isolates from 1965–1986. Results Overall, 55 isolates of echovirus type 13 were obtained from different parts of Germany. It was shown that the new isolated strains have a very high degree of homology on the nucleotide level (> 98% but differ significantly from the old strains (76–85%. Conclusions a Rare enterovirus serotypes can cause serious illness. b The molecular drift has also been shown for other enterovirus serotypes.

  7. The pathobiology and pathology of aseptic implant failure

    Science.gov (United States)

    2016-01-01

    Pathological assessment of periprosthetic tissues is important, not only for diagnosis, but also for understanding the pathobiology of implant failure. The host response to wear particle deposition in periprosthetic tissues is characterised by cell and tissue injury, and a reparative and inflammatory response in which there is an innate and adaptive immune response to the material components of implant wear. Physical and chemical characteristics of implant wear influence the nature of the response in periprosthetic tissues and account for the development of particular complications that lead to implant failure, such as osteolysis which leads to aseptic loosening, and soft-tissue necrosis/inflammation, which can result in pseudotumour formation. The innate response involves phagocytosis of implant-derived wear particles by macrophages; this is determined by pattern recognition receptors and results in expression of cytokines, chemokines and growth factors promoting inflammation and osteoclastogenesis; phagocytosed particles can also be cytotoxic and cause cell and tissue necrosis. The adaptive immune response to wear debris is characterised by the presence of lymphoid cells and most likely occurs as a result of a cell-mediated hypersensitivity reaction to cell and tissue components altered by interaction with the material components of particulate wear, particularly metal ions released from cobalt-chrome wear particles. Cite this article: Professor N. A. Athanasou. The pathobiology and pathology of aseptic implant failure. Bone Joint Res 2016;5:162–168. DOI: 10.1302/2046-3758.55.BJR-2016-0086. PMID:27146314

  8. Sternal Healing after Coronary Artery Bypass Grafting Using Bilateral Internal Thoracic Arteries: Assessment by Computed Tomography Scan

    OpenAIRE

    Shin, Yoon Cheol; Kim, Sue Hyun; Kim, Dong Jung; Kim, Dong Jin; Kim, Jun Sung; Lim, Cheong; Park, Kay-Hyun

    2015-01-01

    Background This study aimed to investigate sternal healing over time and the incidence of poor sternal healing in patients undergoing coronary artery bypass graft (CABG) surgery using bilateral internal thoracic arteries. Methods This study enrolled 197 patients who underwent isolated CABG using skeletonized bilateral internal thoracic arteries (sBITA) from 2006 through 2009. Postoperative computed tomography (CT) angiography was performed on all patients at monthly intervals for three to six...

  9. Endotoxin as a cause of aseptic meningitis after radionuclide cisternography

    International Nuclear Information System (INIS)

    The role of pyrogens in aseptic meningitis after radionuclide cisternography was studied by means of the Limulus test, a sensitive detector of endotoxin. During a 15-month period, 39 reactions associated with cisternography were reported. Ten samples of specific lots of the radioactive drugs implicated in 20 of these reactions were tested and all reacted strongly positive to the Limulus test. The less sensitive rabbit pyrogen test was negative for these preparations when tested on a dose-per-weight basis. Our findings apparently provide clinical evidence for the observation made in animals that endotoxin is at least 1,000 times more toxic intrathecally than intravenously. The data implicate endotoxin contamination as a cause of adverse reactions to radionuclide cisternography. We conclude that the USP pyrogen test is insufficiently sensitive for intrathecal injectables and should be supplemented by the Limulus test. (auth)

  10. Biosurfactant production using mixed cultures under non-aseptic conditions

    International Nuclear Information System (INIS)

    The use of surfactants is of increasing interest for remediation of petroleum hydrocarbons in groundwater and soil. Surfactants increase the accessibility of adsorbed hydrocarbons and mobilize immiscible petroleum hydrocarbons for treatment. Biosurfactants have the advantage of biodegradability and non-toxicity over their synthetic counterparts, and can be produced from renewable sources. In this study the production of biosurfactant from molasses was investigated in continuously stirred batch reactors. The effects of substrate concentration, yeast extract and peptone on biomass accumulation and biosurfactant production were investigated. Biosurfactant production was quantified by surface tension reduction and critical micelle dilution (CMD). Biosurfactant production was directly correlated with biomass production, and was improved with the addition of yeast extract. Centrifugation of the whole broth reduced surface tension. The performance of the biosurfactant produced from molasses under non-aseptic condition is comparable to other published results

  11. Sternal Osteomyelitis and Abscess Caused by Elbowing during a Basketball Game

    Directory of Open Access Journals (Sweden)

    Hideo Ichimura

    2012-01-01

    Full Text Available A 15-year-old boy was referred to our hospital for further investigation and treatment of sternal osteomyelitis due to blunt chest trauma, more specifically elbowing during a basketball game 19 days earlier. On an initial presentation, his chest was markedly swollen and chest computed tomography demonstrated a sternal fracture and massive fluid collection in the chest wall. Since his general condition remained fairly good, we initially selected minimal drainage concomitant with antibiotics; if it was unsuccessful, we planned to switch to a more radical debridement procedure. The patient recovered without further invasive intervention and was discharged on postoperative day 26. There is no sign of recurrence six months after operation. This case report indicates that minimal drainage would be a good option for treatment in a phased strategy.

  12. Sternal metastasis as an initial presentation of renal cell carcinoma: a case report

    OpenAIRE

    Batista, Raquel Ribeiro; Marchiori, Edson; Takayassu, Tatiana Chinem; Cabral, Fernanda Caseira; Cabral, Rafael Ferracini; Zanetti, Gláucia

    2009-01-01

    Renal cell carcinoma accounts for 85% of all solid renal tumors in adults. Nearly one quarter of patients has distant metastasis at presentation while another 50% develop metastasis during follow-up. A small percentage of these are solitary metastasis. We report here a case of solitary bone sternal metastasis as an initial presentation of clear-cell renal cell carcinoma in a 56-year-old woman. The prognosis for patients with metastasized renal cell carcinoma is poor; treatment of metastasis i...

  13. MR analysis of sternal bone marrow using STIR in hematologic diseases

    Energy Technology Data Exchange (ETDEWEB)

    Kozawa, Eito [Saitama Medical School, Moroyama (Japan)

    1998-12-01

    The magnetic resonance (MR) signal intensity pattern of sternal bone marrow was examined in 21 normal volunteers and 10 patients with aplastic anemia (n=4), multiple myeloma (2), AML (2), gammaglobulinemia (1) and MDS (1) using a sagittal STIR sequence. Double Echo STIR images (TR/TI/TE/NEX=2000/180/20, 100/1) were obtained with a CP body array coil. Craniocaudal phase-encoding with a handmade positioning device effectively avoided overlapping artifacts due to cardiac pulsation. In the normal volunteers, age showed a significant inverse correlation with the calculated SIR (signal intensity ratio of bone marrow relative to subcutaneous fat) using STIR with short TE. The SIR in the sternal body was significantly higher than that in the manubrium (p<0.05). Knowledge of the sternal bone marrow distribution according to age is useful for evaluating hematologic diseases. The proposed method provided high spatial resolution and an excellent bone marrow signal, and may be useful for determining site for aspiration. (author)

  14. Analysis of hip perfusion at early and reversible stages of aseptic hip necrosis

    International Nuclear Information System (INIS)

    Aim: A proper early diagnosis of aseptic hip necrosis is very important for further therapy.Since there has always been a question of the amount of perfusion in hips at different stages of aseptic hip necrosis we tried to impartially examine the perfusion in hips at early and reversible stages of aseptic hip necrosis. Material and Methods:Study included 143 patients with aseptic hip necrosis.The 550-740 MBq of Tc-99m-DPD were on bolus injected.All patients were subjected to 3-phase scintigraphy of hips and quantitative calculation of relative perfusion in the artery phase (3T) at early and repeated at reversible stages of aseptic hip necrosis. Results: At the early stage of aseptic hip necrosis the obtained 3T was decreased from 0.94-0.69 (3T=0.80).Scintigrams showed a moderate increase or diffuse accumulation. At the reversible stages we obtained 3T decreased from 0.92-0.71 (3T=0.79) thus evidencing hypoperfusion.Scintigrams showed an diffuse increased accumulation. Conclusion: With the aseptic hip necrosis quantitative analysis of perfusion in the artery phase-3T indicates that the perfusion is decreased at all stages of the process which however shows a significantly falling trend with the progress of the disease

  15. MRI of aseptic osteonecrosis in children with acute lymphoblastic leukemia

    International Nuclear Information System (INIS)

    Purpose: To evaluate the incidence, localisation, and course of symptomatic aseptic osteonecrosis (AON) in children undergoing treatment for acute lymphoblastic leukemia (ALL). Methods: 72 MRI examinations obtained from 26 children with bone pain selected from a group of 121 children with ALL were evaluated retrospectively. The area of the AON was determined by computer assisted planimetry. Follow-up examinations after 2-5 years were considered. Results: 10/121 (8.3%) of the children had symptomatic AON, the number of lesions varied between 1 and 24 per child. 62/66 lesions were localized within the lower extremities. 58% of the AON were positioned in the epiphysis and 42% in the meta- and diaphysis. The mean area of AON was 7.6 cm2 with a range of 0.5 to 50 cm2. Follow-up examinations revealed a regression in 19 AON, no change in 43 and a progression in 4 lesions. AON within the epiphysis with joint involvement or lesions greater than 9 cm2 more frequently showed a progression of AON with final joint destruction. An elevated risk for AON was seen in children older than 10 years and in children with intensified chemotherapy due to high-risk ALL. Conclusion: AON is a common complication in ALL-children under chemotherapy. Most frequently, the course is benign but large AON with joint involvement have an elevated risk for progression of AON with final joint destruction. (orig.)

  16. ASEPTIC INSTABILITY OF HIP ENDOPROSTHESIS IN PATIENTS WITH COXARTHROSIS

    Directory of Open Access Journals (Sweden)

    E.A. Persova

    2009-09-01

    Full Text Available Research Objective — study of bone tissue remodeling features at aseptic instability (Al of the femoral endoprosthesis in patients with coxarthrosis according to a level of biomechanical markers of bone resorption and formation. 41 patients with coxarthrosis have been examined, a primary total hip replacement was carried out in 27 patients of them (the comparison group, the endoprosthesis re-replacement was performed in 14 patients of the basic group with endoprosthesis Al. Among the examined patients there were 20 men and 21 women aged from 46 to 67. The control group contained 13 donors. All the patients were made double-energy x-ray absorptiometry, formation markers (osteo-calcin and alkaline phosphatase bone isoenzyme and bone resorption (C-terminal first type collagen telopeptide and calcium — phosphoric metabolism state were determined. The significant data were considered to be the data with probability index p<0,05. Bone tissue remodeling imbalance at Al of the femoral endoprosthesis in patients with coxarthrosis was characterized by the expressed prevalence of resorption processes over the osteogenesis, and higher speed of metabolic processes were expressed more in the group of the men with Al. The hip re-replacement at implant Al is carried out in metabolically unfavorable conditions of bone remodeling. The impartial assessment of Al features at the presurgical stage will allow to fulfil the adequate medicamentous correction of available abnormalities

  17. A new cable-tie based sternal closure system: description of the device, technique of implantation and first clinical evaluation

    Directory of Open Access Journals (Sweden)

    Grapow Martin TR

    2012-06-01

    Full Text Available Abstract Background Wire closure still remains the preferred technique despite reasonable disadvantages. Associated complications, such as infection and sternal instability, cause time- and cost-consuming therapies. We present a new tool for sternal closure with its first clinical experience and results. Methods The sternal ZipFixTM System is based on the cable-tie principle. It primarily consists of biocompatible Poly-Ether-Ether-Ketone implants and is predominantly used peristernally through the intercostal space. The system provides a large implant-to-bone contact for better force distribution and for avoiding bone cut through. Results 50 patients were closed with the ZipFixTM system. No sternal instability was observed at 30 days. Two patients developed a mediastinitis that necessitated the removal of the device; however, the ZipFixTM were intact and the sternum remained stable. Conclusions In our initial evaluation, the short-term results have shown that the sternal ZipFixTM can be used safely and effectively. It is fast, easy to use and serves as a potential alternative for traditional wire closure.

  18. 76 FR 60847 - Draft Guidance on Media Fills for Validation of Aseptic Preparations for Positron Emission...

    Science.gov (United States)

    2011-09-30

    ... media fill is the performance of an aseptic manufacturing procedure using a sterile microbiological... issued consistent with FDA's good guidance practices regulation (21 CFR 10.115). The draft guidance,...

  19. Enterovirus-D68 in the Cerebrospinal Fluid of Two Children with Aseptic Meningitis.

    Science.gov (United States)

    Esposito, Susanna; Lunghi, Giovanna; Zampiero, Alberto; Tagliabue, Claudia; Orlandi, Anna; Torresani, Erminio; Niesters, Hubert; Principi, Nicola

    2016-05-01

    This case report describes two previously healthy children with aseptic meningitis whose cerebrospinal fluid was positive for enterovirus-D68, which indicates direct involvement of this infectious agent in the development of this neurologic disease. PMID:26859634

  20. Scrub typhus meningitis: An under-recognized cause of aseptic meningitis in India

    Directory of Open Access Journals (Sweden)

    Kundavaram Paul Prabhakar Abhilash

    2015-01-01

    Conclusions: In endemic regions, scrub typhus should be considered in the differential diagnosis of aseptic meningitis. Modest elevation of cells in the CSF with lymphocytic pleocytosis and multi-organ involvement may indicate scrub typhus meningitis/meningo-encephalitis.

  1. Leptomeningeal contrast enhancement and blood-CSF barrier dysfunction in aseptic meningitis

    OpenAIRE

    Alonso, Angelika; Eisele, Philipp; Ebert, Anne D.; Griebe, Martin; Engelhardt, Britta; Szabo, Kristina; Hennerici, Michael G.; Gass, Achim

    2015-01-01

    OBJECTIVE To investigate the blood-CSF barrier (BCSFB) dysfunction in aseptic meningitis. METHODS In our case series of 14 patients with acute aseptic meningitis, we compared MRI characteristics with CSF findings. RESULTS Contrast enhancement in the sulcal space in a leptomeningeal pattern was visualized in 7 patients with BCSFB dysfunction categorized as moderate to severe as evidenced by the CSF/serum albumin ratio (Qalb) but was not present in those with mild or no barr...

  2. The changing epidemiology of pediatric aseptic meningitis in Daejeon, Korea from 1987 to 2003

    Directory of Open Access Journals (Sweden)

    Lee Mi-Hee

    2005-11-01

    Full Text Available Abstract Background Aseptic meningitis is a relatively frequent childhood disease and virologic data suggest that enteroviruses are the commonest etiologic agents. We evaluated the epidemiologic characteristics of aseptic meningitis in Daejeon, South Korea from 1987 to 2003. Methods 2201 medical records of children with aseptic meningitis admitted to The Catholic University of Korea, Daejeon St Mary's Hospital were retrospectively analyzed. Results Outbreaks of aseptic meningitis were observed in 1990, 1993, 1996, 1997, 2001 and 2002. The age distribution of cases was relatively uniform, with a higher incidence in those aged P = 0.001. Neurologic sequelae were observed in 0.7% of the patients. Conclusion Aseptic meningitis, rare before the 1980s in Korea, has since become a common clinical entity. Since 1990, outbreaks of aseptic meningitis have occurred every 1 to 3 years in Daejeon in keeping with Korea-wide epidemics. The frequency of disease affecting children less than one year of age may reflect herd immunity to the epidemic strain.

  3. A vascular bone necrosis in an untreated case of chronic myelogenous leukemia

    International Nuclear Information System (INIS)

    Hip pain due to aseptic necrosis of the femoral head was the first clinical manifestation of chronic myelogenous leukemia in a 9-year-old white female. An erroneous diagnosis of rheumatoid arthritis was first entertained. Physical examination showed splenomegaly, complete blood count revealed leucocytosis of 359 000. The initial radiograph of the involved hip was negative. Biopsy revealed aseptic necrosis of the femoral head. Chronic myelogenous leukemia (CML) was diagnosed on the basis of the peripheral blood smear and bone marrow biopsy. Two months later, radiograph, radionuclide bone scan, and magnetic resonance imaging (MR) of the involved hip were positive for aseptic necrosis of the femoral head. (orig.)

  4. Foramen esternal vs orificio por proyectil de arma de fuego Sternal foramen vs orifice of a gunshot wound

    Directory of Open Access Journals (Sweden)

    F. Rodes Lloret

    2004-01-01

    Full Text Available El foramen esternal es un defecto congénito de la osificación esternal. La importancia de su conocimiento, en el campo de la Antropología Forense, radica en la posibilidad de su confusión con un orificio por proyectil de arma de fuego. Presentamos un caso excepcional, en el que coexisten en el mismo esternón, un foramen esternal y un orificio por proyectil de arma de fuego. Las fotografias muestran las diferentes características de ambos orificios.Sternal foramen is a congenital defect of sternal ossification. The importance of studying this, in the area of Forensic anthropology, lies in the possibility of its confusion with the orifice of a gunshot wound. We present an exceptional example where a case of sternal foramen and the orifice of a gunshot wound coexist. The photographs illustrate the different characteristics of both orifices.

  5. Synovitis, acne, pustulosis, hyperostosis and osteitis (SAPHO) syndrome presenting a primary sternal lesion

    International Nuclear Information System (INIS)

    SAPHO syndrome-acronym for synovitis, acne, pustules, hyperostosis and osteitis, is a nosological entity including multiple affections with cutaneous and osteoarticular involvement. We report the case of a 59 years old female patient that consulted due to an acute sternal pain. After some months the patient showed a palm-plantar pustular exanthem, acne and fever. SAPHO syndrome was diagnosed based on a CT, an osseous gammagraphy and a biopsy of cutaneous lesions. The current actual tendency is to consider the SAPHO syndrome as a seronegative arthropathy with a similar pathophysiology to Reiter's syndrome. (author)

  6. Sternal and costochondral infections with gentamicin and methicillin resistant Staphylococcus aureus following thoracic surgery.

    Science.gov (United States)

    Cafferkey, M T; Luke, D A; Keane, C T

    1983-01-01

    Six patients in a thoracic unit developed sternal osteomyelitis and costochondritis following median sternotomy. Five of the patients were operated on in another hospital. Gentamicin and methicillin resistant Staphylococcus aureus was isolated in pure culture in each case. The S. aureus isolate from 2 patients was of the same phage type suggesting cross-infection. Antibiotic prophylaxis administered in the perioperative period was ineffective. One patient, treated with amikacin (to which all of the strains were sensitive in vitro) and cefuroxime, died from overwhelming infection in spite of débridement and resuturing of the wound. The remaining 5 patients were cured with vancomycin therapy usually coupled with surgical intervention. PMID:6557667

  7. Ant repellent effect of the sternal gland secretion ofPolistes dominulus (Christ) andP. sulcifer (Zimmermann). (Hymenoptera: Vespidae).

    Science.gov (United States)

    Dani, F R; Cannoni, S; Turillazzi, S; David Morgan, E

    1996-01-01

    The long-chain carboxylic acids identified in the sternal gland secretion ofPolistes dominulus andP. sulcifer females were tested individually on three species of ants,Crematogaster scutellaris, Formica cunicularia, andLasius sp., in order to verify if they have a repellent effect. The unsaturated acids (palmitoleic, linoleic, and oleic) act as repellents of all three ant species, while the saturated acids (lauric, myristic, palmitic, and stearic) have no effect. The mixture reproducing the secretion of the sternal glands ofP. dominulus maintained its repellency for at least four days. PMID:24226981

  8. Recurrent aseptic meningitis in association with Kikuchi-Fujimoto disease: case report and literature review

    Directory of Open Access Journals (Sweden)

    Komagamine Tomoko

    2012-09-01

    Full Text Available Abstract Background Kikuchi Fujimoto disease (KFD, or histiocytic necrotising lymphadenitis, is a benign and self-limiting condition characterised by primarily affecting the cervical lymph nodes. Recurrent aseptic meningitis in association with KFD is extremely rare and remains a diagnostic challenge. Case presentation We report a 28-year-old man who presented 7 episodes of aseptic meningitis associated with KFD over the course of 7 years. Histopathological findings of enlarged lymph nodes led to the diagnosis of KFD. The patient’s headache and lymphadenopathy spontaneously resolved without any sequelae. Conclusions A diagnosis of KFD should be considered when enlarged cervical lymph nodes are observed in patients with recurrent aseptic meningitis. A long-term prognosis remains uncertain, and careful follow-up is preferred.

  9. An investigation of the aseptic loosening of an AISI 316L stainless steel hip prosthesis

    International Nuclear Information System (INIS)

    The total replacement of joints by the implantation of permanently indwelling prosthetic components has been one of the major successes of modern surgery in terms of relieving pain and correcting deformity. However, the aseptic loosening of a prosthetic-joint component is the most common reason for joint-revision surgery. Furthermore, it is thought that wear particles are one of the major contributors to the development and perpetuation of aseptic loosening. The aim of the present study was to identify the factors related to the aseptic loosening of an AISI 316L stainless steel total hip prosthesis. The stem was evaluated by x-ray photoelectron spectroscopy, with polished and rough regions being analyzed in order to establish the differences in the chemical compositions of both regions. Specific areas were examined using scanning electron microscopy with energy dispersive x-ray spectroscopy and light microscopy.

  10. Sterility testing of a dispensing valve for aseptic function in food service applications.

    Science.gov (United States)

    Stopforth, J D; Kottapalli, B; Samadpour, M

    2008-03-01

    Manual dispensing equipment for aseptically packaged beverages or foods requires refrigeration of the product package following breakage of the hermetic seal. The food service industry would benefit greatly by implementing dispensing equipment that maintains the sterility of products after continued use without the need for refrigeration. The purpose of this study was to evaluate the ability of a valve, designed to operate aseptically and dispense products with or without refrigeration, to maintain the sterility of products following breakage of the hermetic seal and continued use simulating that of food service. Plastic packages equipped with the "aseptic" dispensing valve in a bag-in-box (BIB) format were aseptically filled with enrichment media with and without the addition of 1% cornstarch to simulate high- and low-viscosity products, respectively. BIBs filled with media were left uninoculated or inoculated (10(4) CFU/ml) with Staphylococcus aureus or Aspergillus niger on the interior of the spout 1 cm from the opening to simulate consumer misuse. Uninoculated and inoculated BIBs were stored at 25 degrees C, and media were dispensed once to twice per day, every day for up to 30 days to simulate food service use. Dispensates were observed for turbidity (compared with controls) indicating growth in BIBs and, thus, breach of sterility. Growth of samples taken aseptically through the package wall was checked microbiologically every 5 days by standard plating techniques. There was no breach in sterility until day 25. At day 25, uninoculated BIB (1 of 45 samples positive for growth) containing high-viscosity media and BIB inoculated with S. aureus (1 of 45 samples positive for growth) containing low-viscosity media became turbid. Viscosity and type of organism did not appear to influence the ability of the valve to maintain the sterility for > or =20 days. The results of this study provide evidence that the dispensing valve tested can maintain the sterility of

  11. Dual infection with hepatitis A and E virus presenting with aseptic meningitis:A case report

    Institute of Scientific and Technical Information of China (English)

    Kushal Naha; Suman Karanth; Mukhyaprana Prabhu; Manpreet Singh Sidhu

    2012-01-01

    ABSTRACT We report the case of a young male who presented with features of aseptic meningitis and elevated serum liver enzymes, but no symptoms or signs suggestive of an acute hepatitis. Subsequently, he was diagnosed with dual infection with hepatitisA andE viruses, and recovered completely with symptomatic therapy.Isolated aseptic meningitis, unaccompanied by hepatitic features is an unusual presentation of a hepatotrophic viral infection, and is yet to be reported with hepatitisA andE virus co-infection.

  12. The history of the management of sternal osteomyelitis and mediastinitis – from Hippocrates until today

    Directory of Open Access Journals (Sweden)

    Ennker, Ina Carolin

    2014-06-01

    Full Text Available Even during the time of Hippocrates, Galen and their colleagues recognized mediastinal affections. However, they were not considered with the surgical treatment. First progress in the treatment options of this severe disease, still denoted as ‘terra incognita’, over to today’s gold standard are pictured.The mediastinitis-registry which was founded by the German Society for Thoracic and Cardiovascular Surgery (DGTHG in 2011 and the recent establishment of the study group to adopt a guideline ‘diagnosis and therapy of postoperative mediastinitis/sternal osteomyelitis following cardiac surgery’ are attempts to a standardization of the treatment. Substantial advancement in the treatment of postoperative mediastinitis could be achieved in the past. The mortality dropped as low as less than 10%. With these implementations more benefit for the patients’ outcome can be expected.

  13. Excacerbation of systemic lupus erythematodes, aseptic meningitis and acute mental symptoms, following metrizamide lumbar myelography

    International Nuclear Information System (INIS)

    A clinical constellation of excacerbation of systemic lupus erythematodes (SLE), together with aseptic meningitis, and acutre mental symptoms occurred following lumbar myelography with metrizamide. Excacerbation of SLE has not been previously described following myelography with any contrast agent. Meningeal reactions and acute mental symptoms have been reported earlier, but this clinical constellation is new. (orig.)

  14. EFFECT OF PASTEURIZATION TEMPERATURE AND ASEPTIC FILLING ON THE SHELF-LIFE OF MILK

    Directory of Open Access Journals (Sweden)

    Rodrigo Rodrigues PETRUS

    2011-12-01

    Full Text Available Aseptic filling process can contribute to extend the shelf-life of pasteurized milk. However, this technology is not still commercially practiced in Brazil for this product. The aim of this study was to evaluate the effect of the pasteurization temperature and aseptic filling on the stability of milk packaged in high density polyethylene bottle (HDPE. Three batches of one hundred bottles each were processed at 72, 83, and 94ºC/15s, followed by aseptic packaging and storage at 9ºC, simulating a deficient cold chain scenario as found in the Brazilian market. Microbiological stability evaluation was based on mesophilic and psychrotrophic counts. Sensory shelf-life was estimated according to the ratings assigned to the attributes appearance, aroma, flavor and overall appreciation of milk samples. The pasteurization temperature, in the range investigated, did not affect the shelf-life of milk, which lasted up to 11 days for the three processed batches. The aseptic filling, associated to the employed thermal treatments, did not extend the shelf-life of milk stored under the abuse condition of 9°C, considering that the commercial product shelf-life in Brazil is of about 10 days.

  15. Aseptic osteonecrosis of femoral head and pregnancy. Report on two cases with MR imaging results

    International Nuclear Information System (INIS)

    Two further cases of aseptic osteonecrosis of femoral head during pregnancy are reported, and the literature reviewed of this rare etiology of debatable etiopathogenicity. The value of MR imaging is demonstrated both for early positive diagnosis and for the differential diagnosis from decalcifying algo -dystrophy

  16. 77 FR 21783 - Guidance on Media Fills for Validation of Aseptic Preparations for Positron Emission Tomography...

    Science.gov (United States)

    2012-04-11

    ... the same title was announced in the Federal Register on September 30, 2011 (76 FR 60847), and Docket... Preparations for Positron Emission Tomography Drugs; Availability AGENCY: Food and Drug Administration, HHS... guidance entitled ``Media Fills for Validation of Aseptic Preparations for Positron Emission...

  17. MICROBIO : A web-based program for processing and evaluation of microbiological controls on aseptic dispensing

    NARCIS (Netherlands)

    Postma, D.J.; Boom, F.A.; Bijleveld, Y.A.; Touw, D.J.; Veenbaas, T.; Essink-Tjebbes, C.M.; Verbrugge, P.

    2012-01-01

    Background: According to the Dutch GMP-hospital pharmacy directive (1) three types of microbiological controls are required when aseptic dispensing is performed: 1. microbiological monitoring of the air in the working area, the gloved hands of the operator and the work surface at the critical place

  18. Chronic meningitis in systemic lupus erythematosus: An unusual etiology

    Directory of Open Access Journals (Sweden)

    Anu Gupta

    2014-01-01

    Full Text Available Chronic aseptic meningitis is a rare manifestation of systemic lupus erythematosus (SLE. Apart from immunological causes and drugs, the aseptic meningitis group can include some unidentified viral infections that cannot be detected by routine microbiological testing. It is imperative to do complete cerebrospinal fluid (CSF workup before implicating the symptoms to disease activity or drugs, as untreated infections cause significant mortality in SLE. We present a case of young female with SLE who presented with chronic meningitis of an uncommon etiology.

  19. Heat transfer and lethality considerations in aseptic processing of liquid/particle mixtures: a review.

    Science.gov (United States)

    Ramaswamy, H S; Awuah, G B; Simpson, B K

    1997-04-01

    Consumer awareness and demand for nutritious yet inexpensive food products call for innovative processing techniques that have both safety and quality as primary objectives. These challenges appear to have been met by aseptic processing techniques, especially for liquid and high-acid foods. However, the extension of aseptic processing principles to low-acid foods containing discrete particles in viscous sauces has not been approved by regulatory agencies, particularly in North America. This apparent limitation is due primarily to the lack of adequate temperature monitoring devices to keep track of particles in dynamic motion, as well as to the residence time distribution of particles flowing in the continuous heat-hold-cool sections of the aseptic processing system. These problems have prompted active research to describe the phenomenal behavior of particulates through sound mathematical modeling and computer simulators. The accuracy of mathematical models depends heavily on how accurate input parametric values are. These parameters include the thermophysical properties of the carrier fluid and particles, as well as the aseptic processing system characteristics in relation to residence time distribution and the fluid-to-particle interfacial heat transfer coefficient. Apparently, several contradictory findings have been reported in the literature with respect to the effect of various processing parameters on the above-mentioned input parametric values. The need therefore arises for more collaborative studies involving the industry and academia. This review brings to perspective, the current status on the aseptic processing of particulate foods with respect to the critical processing parameters which affect the fluid-to-particle convective heat transfer coefficient associated with particulate laden products. PMID:9143820

  20. Resveratrol Protects against Titanium Particle-Induced Aseptic Loosening Through Reduction of Oxidative Stress and Inactivation of NF-κB.

    Science.gov (United States)

    Luo, Guotian; Li, Ziqing; Wang, Yu; Wang, Haixing; Zhang, Ziji; Chen, Weishen; Zhang, Yangchun; Xiao, Yinbo; Li, Chaohong; Guo, Ying; Sheng, Puyi

    2016-04-01

    Aseptic implant loosening is closely associated with chronic inflammation induced by implant wear debris, and reactive oxygen species (ROS) play an important role in this process. Resveratrol, a plant compound, has been reported to act as an antioxidant in many inflammatory conditions; however, its protective effect and mechanism against wear particle-induced oxidative stress remain unknown. In this study, we evaluated resveratrol's protective effects against wear particle-induced oxidative stress in RAW 264.7 macrophages. At non-toxic concentrations, resveratrol showed dose-dependent inhibition of nitric oxide (NO) production, ROS generation, and lipid peroxidation. It also downregulated the gene expression of oxidative enzymes, including inducible nitric oxide synthase (iNOS) and nicotinamide adenine dinucleotide phosphate (NADPH) oxidase (NOX)-1 and NOX-2, and promoted the gene expression and activities of antioxidant enzymes, including catalase (CAT), superoxide dismutase (SOD), glutathione reductase (GR), and glutathione peroxidase (GPx). This protective effect against wear particle-induced oxidative stress was accompanied by a reduction of gene expression and release of tumor necrosis factor-α (TNF-α), and decreased gene expression and phosphorylation of nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB). These findings demonstrate that resveratrol can inhibit wear particle-induced oxidative stress in macrophages, and may exert its antioxidant effect and protect against aseptic implant loosening. PMID:26878849

  1. Results of Three-Dimensional Conformal Radiation Therapy for the Treatment of a Solitary Sternal Relapse of Breast Cancer

    International Nuclear Information System (INIS)

    To evaluate the response and survival rate after three-dimensional conformal radiation therapy (3D-CRT) of patients with a solitary sternal relapse of breast cancer. Seventeen patients between May 1996 and June 2005 were evaluated with the salvage 3D-CRT treatment of a solitary sternal relapse of breast cancer. The treatment fields included the gross tumor volume with 2 cm margins. The total radiation dose was 35.0 ∼61.5 Gy (biologic effective dose of 43.7 ∼76.9 Gy10 using an α/β ratio of 10 Gy), with a daily dose of 1.8∼3.0 Gy. The tumor response was evaluated by the change in maximum tumor size via follow up CT scans 1∼3 months after the completion of treatment. An objective tumor response was achieved in all patients, with a complete response in 5 patients and a partial response in 12 patients. The 5-year overall survival rate was 51.9% (median survival time: 27 months), and the most important factor affecting overall survival was the disease-free interval (interval from primary surgery of breast cancer to the development of sternal metastasis): The 5-year overall survival rate was 61.8% for patients with a disease-free interval ≥12 months and 0.0% for patients < with disease-free interval <12 months (p=0.03). The response to 3D-CRT was good in patients with solitary sternal relapse of breast cancer. Particularly, patients with long disease-free interval from primary surgery survived significantly longer than patients with short disease-free interval from primary surgery

  2. Report of a child with aortic aneurysm, orofacial clefting, hemangioma, upper sternal defect, and marfanoid features: possible PHACE syndrome.

    Science.gov (United States)

    Slavotinek, Anne M; Dubovsky, Elizabeth; Dietz, Harry C; Lacbawan, Felicitas

    2002-07-01

    We report a female patient who had a scalp hemangioma, a cleft uvula, an upper sternal defect, pectus excavatum, arachnodactyly, pes planus, and joint hypermobility. She had rupture of an aortic aneurysm after minor trauma at 11 years of age. At 17 years of age, elective repair of a dilated, ectatic aorta was complicated by cerebral ischemia. Other vascular abnormalities in the proband included an aneurysm of the left subclavian artery, atresia of the right carotid artery, and calcified cerebral aneurysms. We believe that the proband's physical anomalies are best described by the PHACE (posterior fossa brain malformations, hemangiomas, arterial anomalies, coarctation of the aorta and cardiac defects, and eye abnormalities) phenotypic spectrum. This spectrum of physical anomalies also includes sternal clefting and hemagiomas as part of the sternal malformation/vascular dysplasia (SM/VD) association, as found in our patient, and the acronym PHACES has also been used. We consider that the PHACE phenotypic spectrum is likely to be broader than previously recognized and includes orofacial clefting and aortic dilatation and rupture. Our patient also had skeletal anomalies that lead to consideration of Marfan syndrome as a diagnosis. It should be recognized that there is clinical overlap between PHACE syndrome and Marfan syndrome when aortic dilatation is present. We would also like to emphasize the minor nature of the cutaneous findings in our patient despite her severe vascular complications. This is in contrast to previous reports of large or multiple hemangiomas in PHACE syndrome. PMID:12116239

  3. The use of antibiotic-impregnated cement beads in the management of sternal osteomyelitis after treatment for malignant lymphoma

    International Nuclear Information System (INIS)

    Currently, the majority of patients who develop Hodgkin's disease can be cured with radiotherapy and/or chemotherapy. A long follow up of cured patients has shown that the cumulative toxicity from treatment related complication rivals the mortality from Hodgkin's disease. We present a 38-year old male with Hodgkin's disease, treated with radiation and chemotherapy, who developed cardiac infarction and severe mediastinal fibrosis. After median sternotomy for cardiac bypass operation, he suffered from sternal osteitis and superior mediastinitis. A radical debridement must be avoided to protect the bypassed conduit embedded in the extended severe mediastinal fibrosis. Then after appropriate debridement and management of methicillin-resistant Staphylococcus aureus (MRSA) infection, latissimus dorsi myocutaneous flap transfer and use of vancomycin-impregnated cement beads achieved infection control. In this study we present our experience with bibliographical discussion. With the concept presented in this study, however, a consistent cure and prevention from subsequent infection-related morbidity and mortality were achieved even in the subset of the most severe, recalcitrant cases of sternal osteitis, and with an unacceptable rate of complications. This justifies the invasive nature of the procedure and suggests its application not only as a salvage operation for failures after previous interventions, but also as a primary approach for severe sternal osteomyelitis. (author)

  4. Effects of low dosage Co-60 irradiation in the course of aseptic arthritis of the knee joint of rabbits

    International Nuclear Information System (INIS)

    Purpose: Numerous clinical observations demonstrate the efficacy of low radiation doses in the treatment of painful osteoarthritis. Experimental investigations remain scarce. We investigated the effects of locally daily 5 times 1.0 Gy 60-Co irradiation on an artificially induced aseptic gonarthritis in rabbits. Material and methods: Three separate experiments (EV) were performed (10 rabbits per experiment, 5 treated/5 controls; duration: EV1: 18 days; EV2: 6 days; EV3: 29 days). An aseptic arthritis in the right knee joint of rabbits was induced by intraarticular injection of 0.5 ml papain solution (3%, 30,000 USP/mg) on day 0. The arthritic knee joint of the anesthesized animals was irradiated daily from day 1 to 5 with 5 times 1.0 Gy. The controls were sham-irradiated under the same conditions. The time course of arthritis in treated animals and sham-treated controls was evaluated by clinical, laboratory-chemical and histological criteria. The clinical investigation was performed daily, the puncture of the knee-joints was carried out several times in EV1, and at the end of experiments in EV2 and EV3. At the end of the observation period, animals were killed and the knee joints excised for histological analysis. Results: The intraarticular injection of papain caused a peracute inflammatory response in all animals. After 1 week the chronical stage was reached, and the experimental arthritis resolved slowly within several weeks. Local irradiation accelerated the decrease of inflammatory joint swelling, being significant by day 4. On day 6 the volume of synovial fluid in irradiated knee-joints was significantly smaller. The morphometric data indicated a reduction in thickness of synovial membrane, a decrease in number of synovial cell layers, and a decrease in distance between capillaries and the synovial membrane surface following irradiation of arthritic joints. Due to considerable individual variability, the morphometric data partially did not reach statistically

  5. Effect of the degree of sternal depression on the cardiac rotation in pectus excavatum: evaluation with spiral CT

    International Nuclear Information System (INIS)

    Objective: To evaluate the effects of the degree of sternal depression on the cardiac rotation in pectus excavatum by using spiral CT. Methods: Spiral CT features of 32 patients with surgically corrected pectus excavatum were retrospectively reviewed. They included 27 males and 5 females ranging in age from 6 months to 17 years (mean, 6.3 years). Analysis was based on relationship among the degree of sternal depression, CT depression index, cardiac rotation angle, and PV angle. Results: 32 cases of pectus excavatum presented the sternal depression (21 ± 7) mm, CT depression index 2.9 ± 1.8, cardiac rotation angle (55.9 ± 9.8) degree, and PV angle (49.8 ± 14.0) degree, respectively. The sternal depression (17 mm) in cases with CT depression index less than 2.4 was smaller than those with CT depression index 2.4-2.9 (21 mm) and CT depression index larger than 2.9 (27 mm) (F 5.39, P<0.01). Cardiac rotation angle (49.7 degree) in cases with CT depression index less than 2.4 was smaller than those with CT depression index 2.4-2.9 (55.5 degree) and CT depression index larger than 2.9 (66.9 degree) (F=7.44, P<0.01). PV angle (58.7 degree) in cases with CT depression index less than 2.4 was larger than those with CT depression index 2.4-2.9 (46.5 degree) and CT depression index more than 2.9 (42.4 degree) ( F=3.33, P<0.05). Cardiac rotation angle of pectus excavatum had positive correlation with the CT depression index (γ=0.73, P<0.01). Conclusion: Spiral CT is a better tool for revealing chest deformity and corresponding cardiac rotation. The degree of sternal depression in pectus excavatum directly influences the cardiac rotation, and they had positive correlation. (authors)

  6. [Aseptic osteonecrosis of the femoral head in cancer patients with neuropathies caused by vincristine and vinblastine].

    Science.gov (United States)

    Meneghello, A; Presacco, D; Di Maggio, C

    1989-06-01

    Aseptic osteonecrosis has been described in many and dissimilar pathologic conditions--most frequently as the aftermath of fractures or dislocations; in falciform anemia, obesity, alcoholism; in diseases requiring constant and heavy corticosteroid therapy, and also following renal transplantation. Many of these pathologies, especially alcoholism, diabetes, uremia, and collagen vascular diseases, have a common denominator: peripheral neuropathy, which is believed to be a pathogenetic factor supporting osteonecrosis. The authors analyze 3 cases of aseptic osteonecrosis of the femoral head in cancer patients treated with vincristine and/or vinblastine. Since in these subjects severe and persistent neuropathy preceded the onset of osteonecrosis, a possible relationship is postulated between the vincristine/vinblastine treatment and the onset of femoral head osteonecrosis, through the pathogenetic mechanism of peripheral neuropathy. PMID:2756179

  7. Irradiated or aseptically prepared frozen dairy desserts: acceptability to bone marrow transplant recipients

    International Nuclear Information System (INIS)

    Sterile ice cream and frozen yogurt were offered to immunosuppressed patients recovering from bone marrow transplantation. To obtain sterile products, two of the dairy desserts (prepackaged ice cream and frozen yogurt bars) were exposed to 40 kGy of cobalt 60 irradiation. Four different flavors of ice cream were aseptically prepared under a laminar airflow hood using commercially sterilized ingredients. A commercially sterile, frozen milk-based drink on the low-microbial menu served as the control. Ratings of the seven products by 17 patients indicated that a frozen vanilla milk-based drink and aseptically prepared chocolate ice cream were highly acceptable to recovering immunosuppressed patients who have difficulty eating most foods. However, the seven desserts received higher ratings from a sensory panel of healthy individuals than from the patient panel, confirming that new foods for the low-microbial diet should be ''market-tested'' by the targeted patient population before inclusion in the menu

  8. Intracranial Hypertension as an Acute Complication of Aseptic Meningoencephalitis with Leptomeningeal Contrast Enhancement on FLAIR MRI

    OpenAIRE

    Wolf, Marc E.; Eisele, Philipp; Schweizer, Yvonne; Alonso, Angelika; Gass, Achim; Hennerici, Michael G.; Szabo, Kristina

    2016-01-01

    We report a case of a 19-year-old woman who developed intracranial hypertension as an unusual clinical complication of severe aseptic meningoencephalitis probably due to a diminished cerebrospinal fluid reabsorption capacity or leptomeningeal transudation as a consequence of blood-brain barrier dysfunction. These severe inflammatory changes were accompanied by prominent leptomeningeal contrast enhancement best visualized on fluid-attenuated inversion recovery magnetic resonance imaging. In su...

  9. Role of the NFkB subunit p50 in particle induced, aseptic lung inflammation

    OpenAIRE

    Yin, Renfu

    2013-01-01

    We tested the hypothesis that pulmonary exposure to sterile carbon nanoparticles (CNP), a main constituent of urban air pollution, generates an acute inflammatory response by involving the p50 subunit of NFkB1, a pathway generally crucial for inflammatory gene expression in sepsis. Exposing wt and p50-deficinet mice to CNP caused an acute, aseptic neutrophilic alveolitis. While the storm of acute phase cytokines was much more pronounced in p50 mice, no genotype related difference in the numbe...

  10. Combination Gene Therapy Targeting On Interleukin-1β and Rankl for Wear Debris Induced Aseptic Loosening

    OpenAIRE

    Wang, Hao; Jia, Tang-Hong; Zacharias, Nora; Du, Hong-Xia; Wooley, Paul H; Yang, Shang-You

    2012-01-01

    This study investigated the efficacy of a combination gene therapy to repress IL-1 and RANKL for the treatment of particulate debris-induced aseptic loosening, and tried to explore the molecular mechanism the exogenous gene modifications on osteoclastogenesis. RAW cells activated by titanium particles were transduced with DFG-IL-1Ra and AAV-OPG individually or in combination for 4 weeks. Pro-inflammatory cytokines in culture media were determined by ELISA, and gene expressions of RANK, IL-1β,...

  11. Stability of aseptically packaged food as a function of oxidation initiated by a polymer contact surface

    OpenAIRE

    Berends, Corey L

    1996-01-01

    In this study, low density polyethylene (LDPE) and polyethylene terephalate (PETE) resin beads were ground to a coarse powder and exposed to sterilization treatments applied to the food contact surface of packaging materials used in aseptically processed and packaged food. Electron paranlagnetic resonance (EPR) analyzed free radical (-CH2CHCH=CHCHz-) production on the surface of LDPE exposed to heat (107°C) and treatments of heat (107°C) + 30% hydrogen peroxide solution (H20 2). As the tem...

  12. Dynamics of neutrophil extravasation and vascular permeability are uncoupled during aseptic cutaneous wounding

    OpenAIRE

    Kim, Min-Ho; Curry, Fitz-Roy E.; Simon, Scott I.

    2009-01-01

    Transport of macromolecules and transmigration of leukocytes across vascular endothelium are regulated by a tight molecular junction, but the mechanisms by which these two inflammatory events are differentially controlled in time and magnitude during aseptic cutaneous wounding remain elusive. A real-time fluorescence imaging technique was developed to simultaneously track influx of Alexa 680-labeled albumin and genetically tagged enhanced green fluorescent protein-neutrophils [polymorphonucle...

  13. Mesenteric Lymphadenopathy in Childhood Epidemic Aseptic Meningitis: Sonographic Features and Clinical Significance

    International Nuclear Information System (INIS)

    To evaluate the sonographic features of mesenteric lymphadenopathy in childhood epidemic aseptic meningitis and to assess their clinical significance. Thirty-three patients (25 male, 8 female: mean age, 8.6 years) with a diagnosis of aseptic meningitis were prospectively evaluated with abdominal ultrasonography for the presence of enlarged mesenteric nodes. The size and number of enlarged mesenteric lymph nodes were analyzed in relationship with the patient's age, between the patients with abdominal pain or diarrhea (16 cases, 48%) and asymptomatic patients (17 cases, 52%). Mesenteric lymphadenopathy was seen in 31 patients (94%), all 16 symptomatic and 15 of the 17 asymptomatic patients. The number of enlarged nodes was most prevalent between 6-10, seen in 16 patients (52%) and the largest node ranged in size from 4 to 8 mm. Among the 31 patients with mesenteric lymphadenopathy, the mean size of the largest node was statistically different between the symptomatic (6.0 mm) and asymptomatic (5.0 mm) groups (p = 0.021). The number of enlarged nodes and the patient's age were not statistically different between the two groups. Mesenteric lymphadenopathy was seen in almost all cases of childhood epidemic aseptic meningitis, and may be related to the mesenteric lymphadenitis caused by enterovirus

  14. A Rare Complication of Trimethoprim-Sulfamethoxazole: Drug Induced Aseptic Meningitis.

    Science.gov (United States)

    Jha, Pinky; Stromich, Jeremiah; Cohen, Mallory; Wainaina, Jane Njeri

    2016-01-01

    Drug induced aseptic meningitis is a rare but challenging diagnosis, most commonly reported with nonsteroidal anti-inflammatory drugs and antibiotics. Trimethoprim/sulfamethoxazole is a sulfonamide that is widely used in clinical practice for the treatment and prophylaxis of various infections. Drug induced aseptic meningitis, when seen with trimethoprim/sulfamethoxazole, occurs predominantly in patients with some degree of immune compromise and is less commonly seen in immune competent individuals. The patient often exhibits the classic symptoms of meningitis. Early diagnosis is important, since the cessation of the antibiotic leads to rapid clinical improvement. Trimethoprim/sulfamethoxazole induced aseptic meningitis has been underreported to FDA/MED-WATCH program. Here we report two cases of trimethoprim/sulfamethoxazole: an immune competent individual and immune compromised individual, both of which presented with signs of meningitis and a negative infectious workup. Trimethoprim/sulfamethoxazole is an uncommon and mysterious adverse reaction to a commonly used antibiotic. It should be considered in the differential diagnosis of patients presenting with acute signs and symptoms of meningitis especially after infectious causes have been ruled out. PMID:27579194

  15. Mesenteric Lymphadenopathy in Childhood Epidemic Aseptic Meningitis: Sonographic Features and Clinical Significance

    Energy Technology Data Exchange (ETDEWEB)

    Mun, Sung Hee; Park, Young Chan; Lee, Young Hwan [Catholic University of Daegu, College of Medicine, Daegu (Korea, Republic of)

    2006-09-15

    To evaluate the sonographic features of mesenteric lymphadenopathy in childhood epidemic aseptic meningitis and to assess their clinical significance. Thirty-three patients (25 male, 8 female: mean age, 8.6 years) with a diagnosis of aseptic meningitis were prospectively evaluated with abdominal ultrasonography for the presence of enlarged mesenteric nodes. The size and number of enlarged mesenteric lymph nodes were analyzed in relationship with the patient's age, between the patients with abdominal pain or diarrhea (16 cases, 48%) and asymptomatic patients (17 cases, 52%). Mesenteric lymphadenopathy was seen in 31 patients (94%), all 16 symptomatic and 15 of the 17 asymptomatic patients. The number of enlarged nodes was most prevalent between 6-10, seen in 16 patients (52%) and the largest node ranged in size from 4 to 8 mm. Among the 31 patients with mesenteric lymphadenopathy, the mean size of the largest node was statistically different between the symptomatic (6.0 mm) and asymptomatic (5.0 mm) groups (p = 0.021). The number of enlarged nodes and the patient's age were not statistically different between the two groups. Mesenteric lymphadenopathy was seen in almost all cases of childhood epidemic aseptic meningitis, and may be related to the mesenteric lymphadenitis caused by enterovirus

  16. Novel strategies for evaluating the effectiveness of aseptic sterilisation processes by means of a multi-sensor set-up

    OpenAIRE

    Reisert, Steffen

    2014-01-01

    The aseptic processing and packaging of food, in combination with the possibilities of aseptic storage, transport and packaging recycling, represents one of the most sustainable technologies in modern food processing and contributes significantly to reducing the losses of fruits, vegetables and milk and to increase the availability of this food all over the world. In contrast to conventional food processing methods, product and container are continuously sterilised separately and brought toge...

  17. Exchanging reamed nailing versus augmentative compression plating with autogenous bone grafting for aseptic femoral shaft nonunion: a retrospective cohort study

    OpenAIRE

    Jiang-ying, Ru; Yun-fei, Niu; Yu, Cong; Wen-bo, Kang; Hai-bin, Cang; Jian-ning, Zhao

    2015-01-01

    Objective: The purpose of this study was to compare the outcomes of exchanging reamed nailing (ERN) and augmentative compression plating (ACP) with autogenous bone grafting (BG) for the treatment of aseptic femoral shaft nonunion secondary to the treatment of intramedullary nailing (IMN).Methods: A multicenter retrospective study was performed for 178 patients (180 cases) of aseptic femoral shaft nonunion secondary to first treatment of IMN. All cases were fixed with either ERN (n=87) or ACP ...

  18. Another cause of chest pain: Staphylococcus aureus sternal osteomyelitis in an otherwise healthy adult

    Directory of Open Access Journals (Sweden)

    Vacek TP

    2014-09-01

    Full Text Available Thomas P Vacek, Shahnaz Rehman, Shipeng Yu, Ankush Moza, Ragheb Assaly Department of Internal Medicine, The University of Toledo Medical Center, Toledo OH, USAAbstract: Chest pain requires a detailed differential diagnosis with good history-taking skills to differentiate between cardiogenic and noncardiogenic causes. Moreover, when other symptoms such as fever and elevated white blood cell count are involved, it may be necessary to consider causes that include infectious sources. A 53-year-old female with no significant past medical history returned to the hospital with recurrent complaints of chest pain that was constant, substernal, reproducible, and exacerbated with inspiration and expiration. The chest pain was thought to be noncardiogenic, as electrocardiography did not demonstrate changes, and cardiac enzymes were found to be negative for signs of ischemia. The patient's blood cultures were analyzed from a previous admission and were shown to be positive for Staphylococcus aureus. The patient was started empirically on vancomycin, which was later switched to ceftriaxone as the bacteria were more sensitive to this antibiotic. A transthoracic echocardiogram did not demonstrate any vegetation or signs of endocarditis. There was a small right pleural effusion discovered on X-ray. Therefore, computed tomography as well as magnetic resonance imaging of the chest were performed, and showed osteomyelitis of the chest. The patient was continued on intravenous ceftriaxone for a total of 6 weeks. Tests for HIV, hepatitis A, B, and C were all found to be negative. The patient had no history of childhood illness, recurrent infections, or previous trauma to the chest, and had had no recent respiratory infections, pneumonia, or any underlying lung condition. Hence, her condition was thought to be a case of primary sternal osteomyelitis without known cause.Keywords: substernal, pleuritic, myocardial infarction, differential

  19. Use of a sternal elevator to reverse complete airway obstruction secondary to anterior mediastinal mass in an anesthetized child

    Directory of Open Access Journals (Sweden)

    Maria E. Linnaus

    2016-05-01

    Full Text Available Patients with an anterior mediastinal mass pose significant risk for cardiorespiratory compromise during surgical procedures and general anesthesia. Several techniques have been described to reverse airway obstruction in these patients. In extreme circumstances, patients may require cardiac bypass or extracorporeal membrane oxygenation (ECMO until definitive treatment of the mass and patient stabilization is achieved. We present a case in which the RulTract® system was used for emergency sternal elevation as a bridge to ECMO in acute respiratory collapse in an 11-year-old female with a minimally symptomatic anterior mediastinal mass.

  20. Sternal Cleft and Pectus Excavatum: A Combined Approach for the Correction of a Complex Anterior Chest Wall Malformation in a Teenager.

    Science.gov (United States)

    Tocchioni, Francesca; Ghionzoli, Marco; Lo Piccolo, Roberto; Deaconu, Diana E; Facchini, Flavio; Milanez De Campos, Jose R; Messineo, Antonio

    2015-06-01

    Congenital sternal cleft is a rare chest wall malformation. Because of the flexibility of the chest in infants, surgical repair should be performed by primary closure in the neonatal period. In adolescents and adults, different techniques have been suggested to overcome the lack of sternal bone tissue. We describe a very rare case of an 18-year-old woman with a complete bifid sternum associated with pectus excavatum for whom a satisfactory cosmetic and functional result was obtained by adequate surgical planning, which entailed a combination of two standardized surgical techniques. PMID:26046903

  1. Legal, ethical, and procedural bases for the use of aseptic techniques to implant electronic devices

    Science.gov (United States)

    Mulcahy, Daniel M.

    2013-01-01

    animals often mask the signs of infection to avoid attracting predators (Wobeser 2006). Guidance specific to sterilization of electronic devices for implantation is limited in the wildlife record (Burger et al. 1994; Mulcahy 2003). Few biologists have been formally trained in aseptic technique, but most biologists know that electronic devices should be treated in some way to reduce the chance for infection of the host animal by bacteria, viruses, parasites, and fungi. Most biologists (73%) who implant devices into fishes believe aseptic techniques are important (Wagner and Cooke 2005). However, I maintain that many biologists find it difficult to place the concept of asepsis into practice in their work because of confusion about what constitutes aseptic technique, a lack of surgical knowledge and training, the perception of increased costs, or the belief that aseptic surgeries are impractical or unnecessary for their application. Some have even argued that, while compromising surgical techniques in the field might result in complications or mortalities, the money saved would allow for a compensatory increase in sample size (Anderson and Talcott 2006). In this paper I define aseptic surgical techniques, document the legal and professional guidance for performing aseptic surgeries on wild animals, and present options for sterilizing electronic devices and surgical instruments for field use.

  2. Regulation of Extracellular Matrix Remodeling Proteins by Osteoblasts in Titanium Nanoparticle-Induced Aseptic Loosening Model.

    Science.gov (United States)

    Xie, Jing; Hou, Yanhua; Fu, Na; Cai, Xiaoxiao; Li, Guo; Peng, Qiang; Lin, Yunfeng

    2015-10-01

    Titanium (Ti)-wear particles, formed at the bone-implant interface, are responsible for aseptic loosening, which is a main cause of total joint replacement failure. There have been many studies on Ti particle-induced function changes in mono-cultured osteoblasts and synovial cells. However, little is known on extracellular matrix remodeling displayed by osteoblasts when in coexistence with Synovial cells. To further mimic the bone-implant interface environment, we firstly established a nanoscaled-Ti particle-induced aseptic loosening system by co-culturing osteoblasts and Synovial cells. We then explored the impact of the Synovial cells on Ti particle-engulfed osteoblasts in the mimicked flamed niche. The matrix metalloproteinases and lysyl oxidases expression levels, two protein families which are critical in osseointegration, were examined under induction by tumor necrosis factor-alpha. It was found that the co-culture between the osteoblasts and Synovial cells markedly increased the migration and proliferation of the osteoblasts, even in the Ti-particle engulfed osteoblasts. Importantly, the Ti-particle engulfed osteoblasts, induced by TNF-alpha after the co-culture, enhanced the release of the matrix metalloproteinases and reduced the expressions of lysyl oxidases. The regulation of extracellular matrix remodeling at the protein level was further assessed by investigations on gene expression of the matrix metalloproteinases and lysyl oxidases, which also suggested that the regulation started at the genetic level. Our research work has therefore revealed the critical role of multi cell-type interactions in the extracellular matrix remodeling within the peri-prosthetic tissues, which provides new insights on aseptic loosening and brings new clues about incomplete osseointegration between the implantation materials and their surrounding bones. PMID:26502645

  3. Male gender, Charnley class C, and severity of bone defects predict the risk for aseptic loosening in the cup of ABG I hip arthroplasty

    OpenAIRE

    Lostak Jiri; Zapletalova Jana; Havranek Vitezslav; Gallo Jiri

    2010-01-01

    Abstract Background We studied which factor could predict aseptic loosening in ABG I hip prosthesis with hydroxyapatite coating. Aseptic loosening and periprosthetic osteolysis are believed to be caused, at least in part, by increased polyethylene (PE) wear rate via particle disease. Based on it, increased PE wear rate should be associated with aseptic loosening regardless of the type of implant. Methods We analyzed data from 155 revisions of ABG I hip prostheses to examine the influence of p...

  4. Intracranial Hypertension as an Acute Complication of Aseptic Meningoencephalitis with Leptomeningeal Contrast Enhancement on FLAIR MRI

    Directory of Open Access Journals (Sweden)

    Marc E. Wolf

    2016-01-01

    Full Text Available We report a case of a 19-year-old woman who developed intracranial hypertension as an unusual clinical complication of severe aseptic meningoencephalitis probably due to a diminished cerebrospinal fluid reabsorption capacity or leptomeningeal transudation as a consequence of blood-brain barrier dysfunction. These severe inflammatory changes were accompanied by prominent leptomeningeal contrast enhancement best visualized on fluid-attenuated inversion recovery magnetic resonance imaging. In such a prolonged course, a continuous lumbar drainage might be a temporary option to provide rapid symptom relief to the patient.

  5. Influence of recycling rate increase of aseptic carton for long-life milk on GWP reduction

    International Nuclear Information System (INIS)

    Tetra Pak, through intensive cooperation with its supply chain, increased the post-consumer recycling rate of the aseptic packaging for long-life milk in the last 10 years. In continuation of a previous study that presented a superior overall performance in terms of reduction of the consumption of natural resources, air emissions and most of the water emissions, the objective of the present work was to apply life cycle assessment (LCA) to measure the global warming potential (GWP). The system was assessed using as functional unit 1000 liters of milk packaged in Tetra Pak Aseptic containers. The reduction of greenhouse gas emissions was calculated for recycling rates of 2%, 22%, 30%, 40% and 70% of the post-consumer residues in Scenarios I (only cardboard recycling) and II (total aseptic laminate recycling). Scenario I showed a 14% reduction in GWP, representing 26 kg of avoided CO2 equiv. emitted due to the efforts of Tetra Pak to increase the recycling rate from 2% (2000) to 22% (2004). If it will be possible to increase the recycling rate to 70% of post-consumer packages in the future, a 48% reduction of GWP could be attained. Methane exhibited the greatest mass reduction among the greenhouse emissions, since it is emitted during the production of cardboard and also as a result of anaerobic degradation in landfills. The total reduction of the energy requirements of the system due to the increase of the recycling rate (from 2% to 22%) is 154 MJ/1000 liters, a saving of 7%. Scenario II (which considers additional polyethylene and aluminum recycling) has a smaller effect on GWP reduction than Scenario I, since PE/AL represent only 25% of the total mass of the container. The major benefit of the recycling of aseptic cartons is the reduction of the amounts of virgin materials required and the consequent reduction of air emissions. The results of this study can be used to encourage the collection of post-consumer milk cartons as part of environmental education programs

  6. An efficient and aseptic preparation of 'sodium fluoride (18F) injection' in a GMP compliant facility

    International Nuclear Information System (INIS)

    'Sodium fluoride (18F) injection' is an isotonic NaCl solution containing [18F]NaF to be used as bone imaging agent. Although its new drug application (NDA) was approved by the United States (US) Food and Drug Administration (FDA) in 1972, it has not been commercially available since 1975 due to mostly the popularity of 99mTc-methylene diphosphonate (MDP). Recently, advances in positron emission tomography (PET)/CT technology and the often interrupted 99mTc supply have led to the renewed interest in the use of [18F]NaF to detect bone metastases in cancer patients. This report introduces an efficient, low-cost and aseptic preparation of 'Sodium fluoride (18F) injection' for PET scan. 18F-fluoride in target water from cyclotron was adsorbed onto four different forms of anion-exchange resins then desorbed by isotonic NaCl solution into the product vial. One of the resins that yielded the product at the suitable pH was used for the aseptic preparation. The components for this setup, including stopcocks, extension tubes, etc., were all single-use, individually packed and sterile. The process was done in a lead-line isolator maintained in grade A (PIC/S) aseptic condition. The quality of the obtained 'Sodium fluoride (18F) injection' was analyzed according to its monograph in the European Pharmacopoeia (EP). The resin in the chloride form yielded the product of pH 6.7 and was chosen for the subsequent preparation. The radiochemical yield was quantitative. The product met all criteria specified in EP, including biological, physical and chemical specifications. This method is an efficient, space-saving and extremely low-cost operation that easily performed in an aseptic environment meeting Good Manufacturing Practice (GMP) standard. The quality of the 'Sodium fluoride (18F) injection' so yielded meets EP specifications. This setup provides hospital with facility meeting GMP standard a cost effective and efficient method for ''Sodium fluoride (18F) injection'' production

  7. A case of aseptic vertebral necrosis in the context of metastatic lumbar disease

    Energy Technology Data Exchange (ETDEWEB)

    Panow, C. [Radiologie Florissant, Geneva (Switzerland); Valavanis, A. [Institut fuer Neuroradiologie, Universitaetsspital Zuerich (Switzerland)

    2002-03-01

    Aseptic bone necrosis has many well recognized etiologies: caisson disease, corticosteroids, alcohol, Gaucher's disease and sickle cell anemia being a few of a long list. Little attention has been paid to metastatic disease as a possible cause and we were unable to find reference in the literature to this association. We present imaging features of metastatic Ewing's sarcoma involving the vertebral spine, which, in certain aspects, mimics other well-known entities of this region, such as Kuemmell's and Scheuermann's diseases. (orig.)

  8. Study regarding to Asparagus officinalis L. calus reaction, subcultured on aseptic medium with various growth regulators

    Directory of Open Access Journals (Sweden)

    Floare HURGOIU

    2008-05-01

    Full Text Available In our studies, we investigated the effects of some growth regulators, in aseptic conditions, on obtaining Asparagus officinalis plantlets from calus, after 12 weeks of its inoculation.The most recomanded culture media, for obtaining a high number of multimodal stems was MS basal medium, with a mixture of 1mg/l BA and 1 mg/l IBA, which inducing a considerably calusogenesis, and a lot of regenerated plantlets from it, but finally, this medium-after 12 weeks of culture initiation, induced plantlets vitrification.

  9. Triphase scintigraphy with osteotropic radiopharmaceuticals in aseptic necrosis of tight bone

    International Nuclear Information System (INIS)

    Three-phase scintigraphy with 99mTc-diphosphonate complexes (pyrophosphate and diphosphonate) of hip joints has been carried out in patients with Perthes' and Chandler's diseases by investigation of selected zones from the pathologically altered and symmetric intact joints. Semiquantitative indices have been derived for perfusion, tissue and mineral metabolism and the ratio perfusion/mineral metabolism. The combination of decreased perfusion with slightly to moderately increased mineral metabolism is a typical indication of aseptic necrosis of the femoral head. The method allows early diagnosis of the disease in about 64% of the cases. 1 tab., 1 fig., 5 refs

  10. Combined exposure to big endothelin-1 and mechanical loading in bovine sternal cores promotes osteogenesis.

    Science.gov (United States)

    Meyer, Luisa A; Johnson, Michael G; Cullen, Diane M; Vivanco, Juan F; Blank, Robert D; Ploeg, Heidi-Lynn; Smith, Everett L

    2016-04-01

    Increased bone formation resulting from mechanical loading is well documented; however, the interactions of the mechanotransduction pathways are less well understood. Endothelin-1, a ubiquitous autocrine/paracrine signaling molecule promotes osteogenesis in metastatic disease. In the present study, it was hypothesized that exposure to big endothelin-1 (big ET1) and/or mechanical loading would promote osteogenesis in ex vivo trabecular bone cores. In a 2×2 factorial trial of daily mechanical loading (-2000με, 120cycles daily, "jump" waveform) and big ET1 (25ng/mL), 48 bovine sternal trabecular bone cores were maintained in bioreactor chambers for 23days. The bone cores' response to the treatment stimuli was assessed with percent change in core apparent elastic modulus (ΔEapp), static and dynamic histomorphometry, and prostaglandin E2 (PGE2) secretion. Two-way ANOVA with a post hoc Fisher's LSD test found no significant treatment effects on ΔEapp (p=0.25 and 0.51 for load and big ET1, respectively). The ΔEapp in the "no load + big ET1" (CE, 13±12.2%, p=0.56), "load + no big ET1" (LC, 17±3.9%, p=0.14) and "load + big ET1" (LE, 19±4.2%, p=0.13) treatment groups were not statistically different than the control group (CC, 3.3%±8.6%). Mineralizing surface (MS/BS), mineral apposition (MAR) and bone formation rates (BFR/BS) were significantly greater in LE than CC (p=0.037, 0.0040 and 0.019, respectively). While the histological bone formation markers in LC trended to be greater than CC (p=0.055, 0.11 and 0.074, respectively) there was no difference between CE and CC (p=0.61, 0.50 and 0.72, respectively). Cores in LE and LC had more than 50% greater MS/BS (p=0.037, p=0.055 respectively) and MAR (p=0.0040, p=0.11 respectively) than CC. The BFR/BS was more than two times greater in LE (p=0.019) and LC (p=0.074) than CC. The PGE2 levels were elevated at 8days post-osteotomy in all groups and the treatment groups remained elevated compared to the CC group on days 15

  11. Ionizing radiations in aseptic bottling: a comparison between technologies and safety requirements [beverages

    International Nuclear Information System (INIS)

    Ionizing radiations, commonly adopted in the medical field, are recently experiencing a wide diffusion in industrials applications. One of the most widespread uses of ionizing radiations refers to foodstuffs and packaging sterilization. In the aseptic bottling area, the application of this technology on polymeric caps is quickly developing. In such application, sterilization could be obtained with beta-rays, generated by an electron beam, or with gamma-rays, emitted by a radioactive source. After a brief explanation of physical properties of ionizing radiations, the aim of this paper is to discuss the use of radiations in aseptic bottling. Based on results available in literature, radiations effects on treated materials are discussed, as well as safety requirements aiming at reducing risks related to radiation exposure. Finally, sterilization plants with gamma and beta radiation are compared, with the aim of examining functioning principles and management complexity. As a result of the comparison between the two technologies, the electron beam (beta-rays) adoption for caps sterilization process proves to be preferable

  12. A Fuzzy Expert System for Distinguishing between Bacterial and Aseptic Meningitis

    Directory of Open Access Journals (Sweden)

    Mostafa Langarizadeh

    2015-05-01

    Full Text Available Introduction Bacterial meningitis is a known infectious disease which occurs at early ages and should be promptly diagnosed and treated. Bacterial and aseptic meningitis are hard to be distinguished. Therefore, physicians should be highly informed and experienced in this area. The main aim of this study was to suggest a system for distinguishing between bacterial and aseptic meningitis, using fuzzy logic.    Materials and Methods In the first step, proper attributes were selected using Weka 3.6.7 software. Six attributes were selected using Attribute Evaluator, InfoGainAttributeEval, and Ranker search method items. Then, a fuzzy inference engine was designed using MATLAB software, based on Mamdani’s fuzzy logic method with max-min composition, prod-probor, and centroid defuzzification. The rule base consisted of eight rules, based on the experience of three specialists and information extracted from textbooks. Results Data were extracted from 106 records of patients with meningitis (42 cases with bacterial meningitis in order to evaluate the proposed system. The system accuracy, specificity, and sensitivity were 89%, 92 %, and 97%, respectively. The area under the ROC curve was 0.93, and Kappa test revealed a good level of agreement (k=0.84, P

  13. Irradiation as a means of sterilizing packaging materials for aseptic systems

    International Nuclear Information System (INIS)

    Long shelf life of foodstuffs is essential in order to feed the nations of the world. For 'wet' products which quickly deteriorate in air, the use of refrigeration, retort processing and preservatives can be considered. For example, the metal can will continue to be a reliable means of keeping meat and vegetable products in good condition for long periods at ambient conditons. Today, people require food items to be free of preservatives and with a flavour and texture very close to the original, at all times of the year, at lowest cost. Minimal heat processing and immediate filling into a pre-sterilised container without any possibility of contact with the atmosphere, is the logical route to take to meet these requirements and constitutes an aseptic system. The filled product remains in prime condition for many months without the need for refrigeration and preservatives. Irradiation is a convenient and cheap means of pre-sterilising plastic bags for Bag-in-Box systems and the writer will describe how fruit juices and fruit purees are now being packaged aseptically in South Africa and overseas

  14. Prospective study on the chemokine CXCL13 in neuroborreliosis and other aseptic neuroinfections.

    Science.gov (United States)

    Pícha, D; Moravcová, L; Smíšková, D

    2016-09-15

    The study evaluates the clinical significance of CXCL13 (leukocyte chemoattractant synthesized in CSF ) in Lyme neuroborreliosis (LNB) and other aseptic CNS infections. 244 patients with symptoms of neuroinfection and/or LNB were divided into groups: A - patients with LNB-positive antibodies in serum and CSF (96) or CSF only (14); B - patients with aseptic non-borrelial neuroinfections (82); C - negative controls (52). Group A was divided into A1-A4 according to pleocytosis in CSF and AIIgG positivity. The highest CSF CXCL13 concentrations (max. 81,287.60pg/ml; median 1766.90pg/ml) were in A1 (positive AI, pleocytosis) and A3 (negative AIIgG, pleocytosis; max. 7201,60pg/ml, median 56.22pg/ml). A2 (positive AI without pleocytosis) and A4 (negative AI without pleocytosis) had low CXCL13 levels - A2 max. 650.50pg/ml (medianAI positivity. PMID:27538636

  15. A specific groove design for individualized healing in a canine partial sternal defect model by a polycaprolactone/hydroxyapatite scaffold coated with bone marrow stromal cells.

    Science.gov (United States)

    Xuan, Yiwen; Tang, Hua; Wu, Bin; Ding, Xinyu; Lu, Zhongyuan; Li, Wei; Xu, Zhifei

    2014-10-01

    The reconstruction of sternal defects remains clinically challenging for thoracic surgeons. Here we aimed to explore the individualized reconstruction of partial sternal defects with new biodegradable material in a large animal model. We used the fused deposition modeling (FDM) technique to manufacture polycaprolactone/hydroxyapatite (PCL/HA) tissue scaffolds with individualized grooves to repair the sternal defect. The defects were surgically created in a sternocostal joint of eighteen Beagle dogs. The animals were separated into three groups (n = 6): Blank group, PCL/HA group, and PCL/HA/BMSCs group. Radiographic examination, histological, and histomorphometric analyses were performed to evaluate the result. In the blank group, the defect site couldn't maintain its original integrity due to no bone union. In the PCL/HA group and PCL/HA/BMSCs group, it was observed that the scaffolds retained their shapes without significant degradation at 12 weeks. Both groups could observe new bone-union by radiographic and histological examination. And PCL/HA/BMSCs would be more mineralized tissue area at implant sites (p PCL/HA scaffolds with specific grooves could repair the sternal defect satisfactorily. Furthermore the scaffolds with BMSCs-seeded could enhance the amount of bone ingrowth and seemed to be more promising. PMID:24142768

  16. Factors associated with methicillin-resistant coagulase-negative staphylococci as causing organisms in deep sternal wound infections after cardiac surgery

    Directory of Open Access Journals (Sweden)

    R. Sommerstein

    2015-07-01

    Full Text Available Established preoperative antibiotic prophylaxis in cardiac surgery is ineffective against methicillin-resistant coagulase-negative staphylococci (CoNS. This case–control study aimed to determine factors predicting deep sternal wound infections due to methicillin-resistant CoNS. All cardiac surgery patients undergoing sternotomy between June 2009 and March 2013 prospectively documented in a Swiss tertiary care center were included. Among 1999 patients, 82 (4.1% developed deep sternal wound infection. CoNS were causal in 36 (44% patients, with 25/36 (69% being methicillin resistant. Early reintervention for noninfectious causes (odds ratio (OR 4.3; 95% confidence interval (CI 1.9–9.5 was associated with methicillin-resistant CoNS deep sternal wound infection. Among CoNS deep sternal wound infection, perioperative antimicrobial therapy (p 0.002, early reintervention for noninfectious causes (OR 7.9; 95% CI 0.9–71.1 and time between surgery and diagnosis of infection over 21 days (OR 10.8; 95% CI 1.2–97.8 were associated with methicillin resistance. These findings may help to better tailor preoperative antimicrobial prophylaxis.

  17. A diagnostic dilemma: drug-induced aseptic meningitis in a 45-year-old HIV-positive man.

    LENUS (Irish Health Repository)

    Rowley, D

    2014-03-01

    We describe a case of aseptic meningitis following the administration of moxifloxacin in a 45-year-old man with human immunodeficiency virus (HIV). At presentation he was receiving tuberculosis treatment on a modified regimen following severe hepatotoxicity; this included moxifloxacin, started 8 days previously. Initial cerebrospinal fluid (CSF) analysis was grossly abnormal. Anti-viral and -bacterial treatments were started. All microbiological tests proved negative and his moxifloxacin was withheld resulting in a complete normalisation of CSF. Drug-induced aseptic meningitis is a diagnosis of exclusion and presents a serious diagnostic dilemma. The decision to withhold medication cannot be taken lightly.

  18. Potential application of quantitative microbiological risk assessment techniques to an aseptic-UHT process in the food industry.

    Science.gov (United States)

    Pujol, Laure; Albert, Isabelle; Johnson, Nicholas Brian; Membré, Jeanne-Marie

    2013-04-01

    Aseptic ultra-high-temperature (UHT)-type processed food products (e.g., milk or soup) are ready to eat products which are consumed extensively globally due to a combination of their comparative high quality and long shelf life, with no cold chain or other preservation requirements. Due to the inherent microbial vulnerability of aseptic-UHT product formulations, the safety and stability-related performance objectives (POs) required at the end of the manufacturing process are the most demanding found in the food industry. The key determinants to achieving sterility, and which also differentiates aseptic-UHT from in-pack sterilised products, are the challenges associated with the processes of aseptic filling and sealing. This is a complex process that has traditionally been run using deterministic or empirical process settings. Quantifying the risk of microbial contamination and recontamination along the aseptic-UHT process, using the scientifically based process quantitative microbial risk assessment (QMRA), offers the possibility to improve on the currently tolerable sterility failure rate (i.e., 1 defect per 10,000 units). In addition, benefits of applying QMRA are (i) to implement process settings in a transparent and scientific manner; (ii) to develop a uniform common structure whatever the production line, leading to a harmonisation of these process settings, and; (iii) to bring elements of a cost-benefit analysis of the management measures. The objective of this article is to explore how QMRA techniques and risk management metrics may be applied to aseptic-UHT-type processed food products. In particular, the aseptic-UHT process should benefit from a number of novel mathematical and statistical concepts that have been developed in the field of QMRA. Probabilistic techniques such as Monte Carlo simulation, Bayesian inference and sensitivity analysis, should help in assessing the compliance with safety and stability-related POs set at the end of the manufacturing

  19. Clavicles, interclavicles, gastralia, and sternal ribs in sauropod dinosaurs: new reports from diplodocidae and their morphological, functional and evolutionary implications.

    Science.gov (United States)

    Tschopp, Emanuel; Mateus, Octávio

    2013-03-01

    Ossified gastralia, clavicles and sternal ribs are known in a variety of reptilians, including dinosaurs. In sauropods, however, the identity of these bones is controversial. The peculiar shapes of these bones complicate their identification, which led to various differing interpretations in the past. Here we describe different elements from the chest region of diplodocids, found near Shell, Wyoming, USA. Five morphotypes are easily distinguishable: (A) elongated, relatively stout, curved elements with a spatulate and a bifurcate end resemble much the previously reported sauropod clavicles, but might actually represent interclavicles; (B) short, L-shaped elements, mostly preserved as a symmetrical pair, probably are the real clavicles, as indicated by new findings in diplodocids; (C) slender, rod-like bones with rugose ends are highly similar to elements identified as sauropod sternal ribs; (D) curved bones with wide, probably medial ends constitute the fourth morphotype, herein interpreted as gastralia; and (E) irregularly shaped elements, often with extended rugosities, are included into the fifth morphotype, tentatively identified as sternal ribs and/or intercostal elements. To our knowledge, the bones previously interpreted as sauropod clavicles were always found as single bones, which sheds doubt on the validity of their identification. Various lines of evidence presented herein suggest they might actually be interclavicles - which are single elements. This would be the first definitive evidence of interclavicles in dinosauromorphs. Previously supposed interclavicles in the early sauropodomorph Massospondylus or the theropods Oviraptor and Velociraptor were later reinterpreted as clavicles or furculae. Independent from their identification, the existence of the reported bones has both phylogenetic and functional significance. Their presence in non-neosauropod Eusauropoda and Flagellicaudata and probable absence in rebbachisaurs and Titanosauriformes shows a

  20. Male gender, Charnley class C, and severity of bone defects predict the risk for aseptic loosening in the cup of ABG I hip arthroplasty

    Directory of Open Access Journals (Sweden)

    Lostak Jiri

    2010-10-01

    Full Text Available Abstract Background We studied which factor could predict aseptic loosening in ABG I hip prosthesis with hydroxyapatite coating. Aseptic loosening and periprosthetic osteolysis are believed to be caused, at least in part, by increased polyethylene (PE wear rate via particle disease. Based on it, increased PE wear rate should be associated with aseptic loosening regardless of the type of implant. Methods We analyzed data from 155 revisions of ABG I hip prostheses to examine the influence of patient, implant, surgery, and wear related factors on the rate of aseptic loosening at the site of the cup. This was calculated by stepwise logistic regression analysis. The stability of the implant and severity of bone defects were evaluated intraoperatively. Results We found that men (odds ratio, OR = 5.6; p = 0.004, patients with Charnley class C (OR = 6.71; p = 0.013, those having more severe acetabular bone defects (OR = 4 for each degree of severity; p = 0.002, and longer time to revision surgery (OR = 1.51 for each additional year; p = 0.012 had a greater chance of aseptic loosening of the cup. However, aseptic loosening was not directly predicted by polyethylene wear rate in our patients. Conclusion Severity of bone defects predicts the risk for aseptic loosening in ABG I cup. Factors potentially associated with the quality of bone bed and biomechanics of the hip might influence on the risk of aseptic loosening in this implant.

  1. Surgical treatment with sternal and rib resection for patients with post-irradiation ulcer of the chest wall

    International Nuclear Information System (INIS)

    Postoperative radiotherapy is widely performed in the treatment of patients with lymph node metastases from carcinoma of the breast, however, depending on the dose, cases are seen in which radiation ulcers develop and require surgical management. In the present paper we report a patient in whom postoperative radiotherapy was performed because parasternal lymph node metastasis was discovered at the time of surgery and who 15 months later experienced thoracic wall recurrence. Since metastasis to the contralateral lung was observed at that time, reoperation was not attempted, and when radiotherapy was again administered, an extensive radiation ulcer developed in association with sternal and costal necrosis. The skin and subcutaneous tissue together with the sternum and ribs were widely resected followed by the thoracoplasty using a latissimus dorsi musculocutaneous flap. Since there was no postoperative infection, the skin flap was accepted well, and the outcome was satisfactory from the standpoint of quality of life, we have reported the case. (author)

  2. Non-Polio Enteroviruses Aseptic Meningitis:Embaba Fever Hospital Admissions 2010-2011

    Directory of Open Access Journals (Sweden)

    Raafat A. Abdel-Twab¹, Kouka S. Abdel-Wahab2. Ahmed O. El-Kafrawi3, Moustafa A. Aly3, Laila A. EL-Bassiony4, May EL-Maamoun4, Caroline Fayez5

    2013-07-01

    Full Text Available Human enteroviruses (EV cause a wide spectrum of both common and uncommon illnesses among all age groups. Enterically transmitted. The objective of this study was to identify non-poliovirus EV as a cause of viral aseptic meningitis (VAM by two methods (cell culture and Real time PCR. From October 2010 to August 2011 cerebrospinal fluid (CSF samples were collected from 85 patients Embaba fever hospital admitted with symptoms of aseptic meningitis of any age and both sexes. The 85 CSF samples were inoculated into RD (human rhabdomyosarcoma cell line in three blind passages to amplify isolates producing EV-like CPE. A total of 14 (16.5% out of 85 CSF samples showed EV-like CPE. By Real time PCR 11 out of the 14 culture positive samples and 5 out of the 14 source of virus isolation original CSF were non polio EV positive. The frequency of non-polio EV meningitis hospital admissions was in the summer season (50%, spring (25%, late autumn (16.6% and least frequency in winter (8.4%. non-polio EV meningitis was detected in 6 out of 41 male patients (14.5% and in 6 out of 44 female patients (13.5%. Also non-polio EV meningitis was detected in all ages with marked increase of incidence in young children (41.6% and old age (50% and less in adult (8.4%. . In conclusionOur data showed that the non-polioviruses EV was associated with the majority of VAM during 2010 – 2011 at the Embaba fever hospital which serves Embaba, Shoubra Elkheema, Qualyba and neighbors localities in Egypt. Rapid detection of non-polio EV meningitis is essential for making decisions about patient management and treatment

  3. Establishing and Monitoring an Aseptic Workspace for Building the MOMA Mass Spectrometer

    Science.gov (United States)

    Lalime, Erin

    2016-01-01

    Mars Organic Molecule Analyzer (MOMA) is an instrument suite on the ESA ExoMars 2018 Rover, and the Mass Spectrometer (MOMA-MS) is being built at Goddard Space Flight Center (GSFC). As MOMA-MS is a life-detection instrument and it thus falls in the most stringent category of Planetary Protection (PP) biological cleanliness requirements. Less than 0.03 sporem2 is allowed in the instrument sample path. In order to meet these PP requirements, MOMA-MS must be built and maintained in a low bioburden environment. The MOMA-MS project at GSFC maintains three cleanrooms with varying levels of bioburden control. The Aseptic Assembly Cleanroom has the highest level of control, applying three different bioburden reducing methods: 70 IPA, 7.5 Hydrogen Peroxide, and Ultra-Violet C light. The three methods are used in rotation and each kills microbes by a different mechanism, reducing the likelihood of microorganisms developing resistance to all three. The Integration and Mars Chamber Cleanrooms use less biocidal cleaning, with the option to deploy extra techniques as necessary. To support the monitoring of cleanrooms and verification that MOMA-MS hardware meets PP requirements, a new Planetary Protection lab was established that currently has the capabilities of standard growth assays for spore or vegetative bacteria, rapid bioburden analysis that detects Adenosine Triphosphate (ATP), plus autoclave and DHMR verification. The cleanrooms are monitored both for vegetative microorganisms and by rapid ATP assay, and a clear difference in bioburden is observed between the aseptic the other cleanroom.

  4. Impact of donor arm cleaning with different aseptic solutions for prevention of contamination in blood bags.

    Science.gov (United States)

    Patel, Tanvi G; Shukla, Rinku V; Gupte, Snehalata C

    2013-03-01

    Transfusion associated sepsis cases are encountered occasionally and bacterial transmission remains the major cause. The goal of our study was to compare the efficacy of disinfectants in phlebotomy site preparation. After selection of donor the antecubital fossa area of the arm was disinfected with different types of disinfectants namely sprit (70% isopropyl alcohol), povidone iodine (0.5% w/v available iodine in distilled water), savlon (1.5% v/v chlorhexidine gluconate solution and 3.0% cetrimide solution) and combination of sprit and povidone iodine. Swabs were collected from 20 donors using a sterile forceps, after cleaning with different antiseptic solutions. Swab was streaked on blood agar plate aseptically and the plate was incubated at 37°C for 24 h. Colonies were counted and a single colony was re-cultured by growing on nutrient and Mac-Conkey agar. The biochemical characteristics were determined by performing Gram staining, Motility, Catalase and Oxidase tests. The mean values of colonies were significantly higher with savlon compared to other three solutions. The difference was statistically significant by "t" test (t values 1.7-3.0; P sp., Streptococcus sp., Micrococcus sp., Bacillus megaterium and Bacillus cereus were the organisms identified. After completion of bleeding, samples from the bag were aseptically inoculated in aerobic and anaerobic culture bottles to be tested on BacT/Alert system. The bag containing donor's blood did not show any contamination when three cleanings were carried out using sprit, povidone iodine and spirit respectively. PMID:24426327

  5. The Duration of Negative Pressure Wound Therapy Can Be Reduced Using the HeartShield Device in Patients With Deep Sternal Wound Infection.

    OpenAIRE

    Ingemansson, Richard; Malmsjö, Malin; Lindstedt Ingemansson, Sandra

    2014-01-01

    Background: Heart rupture resulting in lethal bleeding is a devastating complication associated with negative pressure wound therapy (NPWT) in patients with deep sternal wound infection (DSWI). We have previously reported that the use of a protective HeartShield device in combination with NPWT decreases the risk of damage to the heart. This article presents a retrospective analysis of NPWT duration with and without the HeartShield device. Subjects and patients: The study included 6 patients t...

  6. Major bleeding during negative pressure wound/V.A.C.® - therapy for postsurgical deep sternal wound infection - a critical appraisal

    Directory of Open Access Journals (Sweden)

    Segers Patrique

    2011-09-01

    Full Text Available Abstract Negative-pressure wound therapy, commercially known as vacuum-assisted closure (V.A.C.® therapy, has become one of the most popular (and efficacious interim (prior to flap reconstruction or definite methods of managing deep sternal wound infection. Complications such as profuse bleeding, which may occur during negative-pressure therapy but not necessarily due to it, are often attributed to a single factor and reported as such. However, despite the wealth of clinical experience internationally available, information regarding certain simple considerations is still lacking. Garnering information on all the factors that could possibly influence the outcome has become more difficult due to a (fortunate decrease in the incidence of deep sternal wound infection. If more insight is to be gained from fewer clinical cases, then various potentially confounding factors should be fully disclosed before complications can be attributed to the technique itself or improvements to negative-pressure wound therapy for deep sternal wound infection can be accepted as evidence-based and the guidelines for its use adapted. The authors propose the adoption of a simple checklist in such cases.

  7. Hands-up positioning during asymmetric sternal retraction for internal mammary artery harvest: a possible method to reduce brachial plexus injury.

    Science.gov (United States)

    Jellish, W S; Blakeman, B; Warf, P; Slogoff, S

    1997-02-01

    This study compares the hands-up (HU) with the arms at side (AAS) position to determine whether one is beneficial in reducing brachial plexus stress during asymmetric sternal retraction. Eighty patients undergoing cardiac surgery were assigned to either Group 1 (AAS) or Group 2 (HU). Perioperative neurologic evaluations of the brachial plexus were performed and somatosensory evoked potentials (SSEPs) were collected during internal mammary artery harvest using asymmetric sternal retraction. Demographic data, SSEP changes, and postoperative brachial plexus symptoms were compared between groups. SSEP amplitude decreased in 95% of all patients during retractor placement with substantial decreases (> 50%) observed on the left side in 50% of the AAS and 35% of the HU patients. Amplitude recovery was normally seen in both groups after asymmetric retractor removal. Similar changes were noted, to a lesser degree, on the right side. During asymmetric sternal retraction, HU positioning offered minimal benefit in reducing brachial plexus stress as measured by SSEP. Three of the seven AAS patients who reported brachial plexus symptoms had an ulnar nerve distribution of injury. However, none of the four patients with plexus symptoms in the HU group had ulnar nerve problems, suggesting that the higher incidence of postoperative symptoms observed with AAS positioning may occur from ulnar nerve compression. PMID:9024012

  8. MRI evaluation of aseptic osteonecrosis in children over the course of hyperbaric oxygen therapy

    Energy Technology Data Exchange (ETDEWEB)

    Scherer, A.; Engelbrecht, V.; May, P.; Moedder, U. [Duesseldorf Univ. (Germany). Inst. fuer Diagnostische Radiologie; Bernbeck, B.; Goebel, U. [Duesseldorf Univ. (Germany). Dept. of Pediatric Hematology and Oncology; Willers, R. [Duesseldorf Univ. (Germany). Inst. of Statistics

    2000-10-01

    Purpose: The study aimed at MRI evaluation of aseptic osteonecrosis (AON) in children over the course of hyperbaric oxygen (HBO) therapy. Material and methods: Retrospective analysis of 72 MRI studies in 20 children presenting with AON during chemotherapy. Two groups were differentiated: Gr. I (n=8) was treated exclusively with relief of weightbearing structures, Gr. II (n=12) was additionally treated with HBO therapy. The MRI examinations were evaluated by a point-score system (1-6 points) by two radiologists. Results: Gr. II initially showed more severe findings (average score: 3.4) in comparison to Gr. I (average score: 2.65). During the follow-up time period the average scores rose to 3.2 score-points in Gr. I and 4.1 points in Gr. II. No statistically significant difference was evident between the two groups in the course of AON. Conclusion: The majority of chemotherapy associated AON which initially present with advanced findings show a progression in MRI over their further course. HBO therapy in addition to the relief of affected weightbearing structures statistically shows no significant improvement in MRI morphology during the course of the treatment. (orig.)

  9. MRI evaluation of aseptic osteonecrosis in children over the course of hyperbaric oxygen therapy

    International Nuclear Information System (INIS)

    Purpose: The study aimed at MRI evaluation of aseptic osteonecrosis (AON) in children over the course of hyperbaric oxygen (HBO) therapy. Material and methods: Retrospective analysis of 72 MRI studies in 20 children presenting with AON during chemotherapy. Two groups were differentiated: Gr. I (n=8) was treated exclusively with relief of weightbearing structures, Gr. II (n=12) was additionally treated with HBO therapy. The MRI examinations were evaluated by a point-score system (1-6 points) by two radiologists. Results: Gr. II initially showed more severe findings (average score: 3.4) in comparison to Gr. I (average score: 2.65). During the follow-up time period the average scores rose to 3.2 score-points in Gr. I and 4.1 points in Gr. II. No statistically significant difference was evident between the two groups in the course of AON. Conclusion: The majority of chemotherapy associated AON which initially present with advanced findings show a progression in MRI over their further course. HBO therapy in addition to the relief of affected weightbearing structures statistically shows no significant improvement in MRI morphology during the course of the treatment. (orig.)

  10. Utilization of Aseptic Seedling Explants for In vitro Propagation of Indian Red Wood

    Directory of Open Access Journals (Sweden)

    Kishore Kumar CHIRUVELLA

    2013-12-01

    Full Text Available Micropropagation has been advocated as one of the most viable biotechnological tool for ex situ conservation of rare, endangered endemic medicinal plants germplasm. Rapid clonal micropropagation protocol for large-scale multiplication of an endemic medicinal plant Soymida febrifuga (Meliaceae was established from 15-day aseptic seedling cotyledonary node and shoot tip explants. High frequency of sprouting and shoot differentiation was observed from cotyledonary node explants compared to shoot tip, on Murashige and Skoog (MS medium fortified with BA, KN, 2-iP and CM. Of the cytokinins used, BA (3.0 mgl-1 supported highest average number and maximum multiple shoot differentiation (16.6. In vitro proliferated shoots were multiplied rapidly by culturing nodal segments as microcuttings, further subcultured on the same media for elongation. Elongated shoots upon transfer to MS medium fortified with IBA showed rooting within two weeks of culture. Rooted plantlets were successfully hardened and 75% of rooted shoots successfully survived on establishment to the soil. Plants looked healthy with no visually detectable phenotypic variations. This protocol provides a successful and rapid technique that can be used for ex situ conservation minimizing the pressure on wild populations and contributes to the conservation of this endemic medicinally potent flora.

  11. [Simultaneous determination of various aseptics and sweeteners in milk and dairy products].

    Science.gov (United States)

    Song, Ge; Jiang, Jindou; Zhang, Qiumei

    2010-03-01

    A method for simultaneous determination of acesulfame, benzoic acid, sodium saccharin, sorbic acid, and aspartame in milk and dairy products using high performance liquid chromatography (HPLC) was developed. The proteins in milk and dairy products were mostly eliminated by the precipitators. Three aseptics and two sweeteners were separated on a C18 column with the mobile phase of methanol-0.05 mol/L potassium dihydrogen phosphate under gradient elution. With a diode array detector, acesulfame, benzoic acid, and sorbic acid were detected at 230 nm and sodium saccharin and aspartame were detected at 210 nm. The recoveries were 96.0% - 103.5% with the relative standard deviations (RSDs) in the range of 1.93% - 2.76%. The detection limits of acesulfame, benzoic acid, sodium saccharin, sorbic acid and aspartame were 1.0, 1.0, 0.5, 1.0, and 1.5 microg/g, respectively. This method can be used for the routine analysis of these additives in milk and dairy products. PMID:20549988

  12. COMPARISON OF THE FREQUENCY AND COMPLICATIONS OF INAPPROPRIATE ANTIDIURETIC HORMONE SECRETION IN PATIENTS WITH SEPTIC AND ASEPTIC MENINGITIS

    Directory of Open Access Journals (Sweden)

    Ali HONARPISHEH MD

    2010-04-01

    Full Text Available ObjectiveDue to the high prevalence of syndrome of Inappropriate Antidiuretic Hormone Secretion (SIADH. This study was carried out to evaluate the prevalence and relevant parameters of SIADH in children with septic and aseptic memingitis hospitalized at Kashan Shahid Beheshti Hospital between 1996 and 2006.Materials & MethodsThis descriptive study was conducted on 230 patients with meningitis hospitalized in the pediatric wards of Kashan Shahid Beheshti Hospital between 1996 and 2006. Relevant information (age, gender, type of meningitis, serum sodium and potassium, urine specific gravity (USG, blood sugar, blood urea nitrogen, serum creatinin, hydration condition was collected from patients' records. Data was analyzed using Mann-Whitney and K2 tests.ResultsOut of 230 patients with meningitis, 33 had incomplete records and only 197 patients were recruited for this study. Sixty eight cases (34.5% suffered from SIADH. It was more frequent among 1-2 year old  children.According to this research, SIADH was diagnosed in 57% of the 121 patients with hyponatremia, 58.7% of the 167 patients with USG > 1.004, 74% of the 93 patients with serum osmolity ConclusionDue to the high prevalence of SIADH in septic and aseptic meningitis and its complication, it is recommended to restrict fluid therapy and monitor serum sodium, urine specific gravity and other diagnostic tests for SIADH.Keywords: Hyponatremia; Meningitis; SIADH, Septic, Aseptic

  13. Cardiomyogenic differentiation of human sternal bone marrow mesenchymal stem cells using a combination of basic fibroblast growth factor and hydrocortisone.

    Science.gov (United States)

    Hafez, Pezhman; Jose, Shinsmon; Chowdhury, Shiplu R; Ng, Min Hwei; Ruszymah, B H I; Abdul Rahman Mohd, Ramzisham

    2016-01-01

    The alarming rate of increase in myocardial infarction and marginal success in efforts to regenerate the damaged myocardium through conventional treatments creates an exceptional avenue for cell-based therapy. Adult bone marrow mesenchymal stem cells (MSCs) can be differentiated into cardiomyocytes, by treatment with 5-azacytidine, thus, have been anticipated as a therapeutic tool for myocardial infarction treatment. In this study, we investigated the ability of basic fibroblastic growth factor (bFGF) and hydrocortisone as a combined treatment to stimulate the differentiation of MSCs into cardiomyocytes. MSCs were isolated from sternal marrow of patients undergoing heart surgery (CABG). The isolated cells were initially monitored for the growth pattern, followed by characterization using ISCT recommendations. Cells were then differentiated using a combination of bFGF and hydrocortisone and evaluated for the expression of characteristic cardiac markers such as CTnI, CTnC, and Cnx43 at protein level using immunocytochemistry and flow cytometry, and CTnC and CTnT at mRNA level. The expression levels and pattern of the cardiac markers upon analysis with ICC and qRT-PCR were similar to that of 5-azacytidine induced cells and cultured primary human cardiomyocytes. However, flow cytometric evaluation revealed that induction with bFGF and hydrocortisone drives MSC differentiation to cardiomyocytes with a marginally higher efficiency. These results indicate that combination treatment of bFGF and hydrocortisone can be used as an alternative induction method for cardiomyogenic differentiation of MSCs for future clinical applications. PMID:26289249

  14. Osteometric sex discrimination from the sternal extremity of the fourth rib in a recent forensic sample from Southwestern Spain.

    Science.gov (United States)

    Macaluso, P James; Rico, Antonio; Santos, María; Lucena, Joaquín

    2012-11-30

    The discrimination of sex is central to the process of establishing a personal identification from human skeletal remains. Previous study has demonstrated that osteometric analysis of the sternal extremity of the fourth rib provides a reasonably accurate method for assessing this biological attribute in diverse human groups. As metric standards are generally population-specific, the purpose of the current research was to evaluate the degree of sexual dimorphism present in the fourth rib among contemporary Spaniards, a group thus far not investigated, and generate discriminant function equations which can be used to estimate the sex of unidentified remains in this population. Superior-inferior height and anterior-posterior breadth dimensions of the fourth rib were collected for a sample consisting of 60 males and 57 females derived from postmortem examinations performed at the Institute of Legal Medicine, Seville, Spain. The results demonstrated that both rib dimensions were highly sexually dimorphic (pclassification rates of 76.9% and 83.8% for breadth and height dimensions, respectively. Multivariate analysis incorporating both rib measurements improved the allocation accuracy to 86.3%, with an associated sex bias of only 0.7%. Therefore, the derived discriminant function equations, particularly those that incorporate rib height, can be effectively used in cases involving fragmentary remains in which more dimorphic elements such as the pelvis are not preserved, as well as complete skeletons to complement other metric and morphological sex assessment methods. PMID:23068090

  15. Age Estimation in Living Adults using 3D Volume Rendered CT Images of the Sternal Plastron and Lower Chest.

    Science.gov (United States)

    Oldrini, Guillaume; Harter, Valentin; Witte, Yannick; Martrille, Laurent; Blum, Alain

    2016-01-01

    Age estimation is commonly of interest in a judicial context. In adults, it is less documented than in children. The aim of this study was to evaluate age estimation in adults using CT images of the sternal plastron with volume rendering technique (VRT). The evaluation criteria are derived from known methods used for age estimation and are applicable in living or dead subjects. The VRT images of 456 patients were analyzed. Two radiologists performed age estimation independently from an anterior view of the plastron. Interobserver agreement and correlation coefficients between each reader's classification and real age were calculated. The interobserver agreement was 0.86, and the correlation coefficients between readers classifications and real age classes were 0.60 and 0.65. Spearman correlation coefficients were, respectively, 0.89, 0.67, and 0.71. Analysis of the plastron using VRT allows age estimation in vivo quickly and with results similar than methods such as Iscan, Suchey-Brooks, and radiographs used to estimate the age of death. PMID:27092960

  16. Successful human infection with P. falciparum using three aseptic Anopheles stephensi mosquitoes: a new model for controlled human malaria infection.

    Directory of Open Access Journals (Sweden)

    Matthew B Laurens

    Full Text Available Controlled human malaria infection (CHMI is a powerful method for assessing the efficacy of anti-malaria vaccines and drugs targeting pre-erythrocytic and erythrocytic stages of the parasite. CHMI has heretofore required the bites of 5 Plasmodium falciparum (Pf sporozoite (SPZ-infected mosquitoes to reliably induce Pf malaria. We reported that CHMI using the bites of 3 PfSPZ-infected mosquitoes reared aseptically in compliance with current good manufacturing practices (cGMP was successful in 6 participants. Here, we report results from a subsequent CHMI study using 3 PfSPZ-infected mosquitoes reared aseptically to validate the initial clinical trial. We also compare results of safety, tolerability, and transmission dynamics in participants undergoing CHMI using 3 PfSPZ-infected mosquitoes reared aseptically to published studies of CHMI using 5 mosquitoes. Nineteen adults aged 18-40 years were bitten by 3 Anopheles stephensi mosquitoes infected with the chloroquine-sensitive NF54 strain of Pf. All 19 participants developed malaria (100%; 12 of 19 (63% on Day 11. The mean pre-patent period was 258.3 hours (range 210.5-333.8. The geometric mean parasitemia at first diagnosis by microscopy was 9.5 parasites/µL (range 2-44. Quantitative polymerase chain reaction (qPCR detected parasites an average of 79.8 hours (range 43.8-116.7 before microscopy. The mosquitoes had a geometric mean of 37,894 PfSPZ/mosquito (range 3,500-152,200. Exposure to the bites of 3 aseptically-raised, PfSPZ-infected mosquitoes is a safe, effective procedure for CHMI in malaria-naïve adults. The aseptic model should be considered as a new standard for CHMI trials in non-endemic areas. Microscopy is the gold standard used for the diagnosis of Pf malaria after CHMI, but qPCR identifies parasites earlier. If qPCR continues to be shown to be highly specific, and can be made to be practical, rapid, and standardized, it should be considered as an alternative for diagnosis

  17. Chronic pancreatitis

    Science.gov (United States)

    Chronic pancreatitis - chronic; Pancreatitis - chronic - discharge; Pancreatic insufficiency - chronic; Acute pancreatitis - chronic ... abuse over many years. Repeated episodes of acute pancreatitis can lead to chronic pancreatitis. Genetics may be ...

  18. Superficial and deep sternal wound infection after more than 9000 coronary artery bypass graft (CABG: incidence, risk factors and mortality

    Directory of Open Access Journals (Sweden)

    Abbasi Kyomars

    2007-09-01

    Full Text Available Abstract Background Sternal wound infection (SWI is an uncommon but potentially life-threatening complication of cardiac surgery. Predisposing factors for SWI are multiple with varied frequencies in different studies. The purpose of this study was to assess the incidence, risk factors, and mortality of SWI after coronary artery bypass grafting (CABG at Tehran Heart Center. Methods This study prospectively evaluated multiple risk factors for SWI in 9201 patients who underwent CABG at Tehran Heart Center between January 2002 and February 2006. Cases of SWI were confirmed based on the criteria of the Centers for Disease Control and Prevention. Deep SWI (bone and mediastinitis was categorized according to the Oakley classification. Results In the study period, 9201 CABGs were performed with a total SWI rate of 0.47 percent (44 cases and deep SWI of 0.22 percent (21 cases. Perioperative (in-hospital mortality was 9.1% for total SWI and about 14% for deep SWI versus 1.1% for non-SWI CABG patients. Female gender, preoperative hypertension, high functional class, diabetes mellitus, obesity, prolonged intubation time (more than 48 h, and re-exploration for bleeding were significant risk factors for developing SWI (p = 0.05 in univariate analysis. In multivariate analysis, hypertension (OR = 10.7, re-exploration (OR = 13.4, and female gender (OR = 2.7 were identified as significant predictors of SWI (p Conclusion Rarely reported previously, the two risk factors of hypertension and the female gender were significant risk factors in our study. Conversely, some other risk factors such as cigarette smoking and age mentioned as significant in other reports were not significant in our study. Further studies are needed for better documentation.

  19. Colgajo de omento para tratamiento de dehiscencia de herida esternal Omental flap for management of sternal wound dehiscence

    Directory of Open Access Journals (Sweden)

    A. Pérez García

    2013-03-01

    Full Text Available La mediastinitis es una de las complicaciones más graves de la cirugía cardíaca. Aparece en el 0,5-5 % de las esternotomías y esta incidencia es mucho mayor en pacientes diabéticos, obesos, inmunodeprimidos, con enfermedad pulmonar obstructiva crónica (EPOC, etc. Presentamos el caso de una paciente diabética, obesa mórbida, que sufre mediastinitis tras doble by-pass coronario. Para la cobertura del defecto se empleó un colgajo de epiplon tunelizado transdiafragmático. El colgajo omental permite cubrir grandes defectos además de que posee capacidad antimicrobiana y favorece la revascularización tisular. Las características de este colgajo hacen que actualmente deba considerarse como primera elección en pacientes con grandes defectos esternales y trastornos de la inmunidad y la cicatrización.Mediastinitis is one of the most serious complications from cardiac surgery. It is reported to occur in 0'5-5 % of sternotomy incisions, and this incidence is much higher in diabetic patients, obese, immunocompromised, COPD, etc. We report a case of a diabetic and morbid obese woman suffering mediastinitis after double coronary bypass surgery. For the reconstruction a transdiaphragmatic tunnelled omental flap was used. The omentum is useful to cover large defects. It has antiinfective properties and promotes revascularization of neighbouring tissues. Omental flap can be a highly effective treatment for patients with large sternal wounds and immune disorders and wound healing disorders.

  20. Disinfection of packaging materials during aseptic packing. Studies on the microbicidal effect of uv-C radiation

    Energy Technology Data Exchange (ETDEWEB)

    Cerny, G. (Technische Univ. Muenchen (Germany, F.R.). Inst. fuer Lebensmitteltechnologie und Verpackung)

    1977-10-01

    Experiments were performed in order to determine the microbicidal effect of ultraviolet irradiation using a high intensity uv lamp recently developed by BBC, Baden (Switzerland). Conidiae of molds, Bacillus spores, and vegetative cells of yeasts were killed within a few seconds. The germicidal effect of uv rays upon B. subtilis spores was further studied in dependence of the distance from the uv lamp, the angle of inclination of the irradiated plane, and the humidity of air. The efficiency of the tested uv lamp seems to be sufficient for its use in aseptic plants provided that the irradiated packaging materials are smooth, uv-resistant, and rather free of dust particles.

  1. Chronic recurrent multifocal osteomyelitis (CRMO)

    International Nuclear Information System (INIS)

    Chronic recurrent multifocal osteomyelitis (CRMO) is an unusual clinical entity. More than 200 cases are described in the literature and it is presented here with special reference to its radiological aspects. It is an acquired disease of the skeleton which occurs predominantly during childhood and adolescence. About ten per cent of cases begin in early or, rarely, in later adult life. This variant is described here for the first time and is discussed as 'adult CRMO'. The underlying pathology is a bland, predominantly lympho-plasma cellular osteomyelitis which is self-limiting and leads to bone sclerosis (Garre). It probably involves an abnormal immune process which follows an infection but remains clinically latent and remains aseptic and sterile. In a quarter of cases there is an association with pustulosis palmo-plantaris and its relationship with psoriatic arthropathy is discussed. The clinical, histopathological and imaging features (radiological and particularly MRT) and the bone changes are described. (orig./AJ)

  2. Chronic Diarrhea

    Science.gov (United States)

    ... infections that cause chronic diarrhea be prevented? Chronic Diarrhea What is chronic diarrhea? Diarrhea that lasts for more than 2-4 ... represent a life-threatening illness. What causes chronic diarrhea? Chronic diarrhea has many different causes; these causes ...

  3. Percutaneous bone cement refixation of aseptically loose hip prostheses: the effect of interface tissue removal on injected cement volumes

    Energy Technology Data Exchange (ETDEWEB)

    Malan, Daniel F. [Leiden University Medical Center, Department of Orthopaedics, Leiden (Netherlands); Delft University of Technology, Department of Intelligent Systems, Delft (Netherlands); Valstar, Edward R. [Leiden University Medical Center, Department of Orthopaedics, Leiden (Netherlands); Delft University of Technology, Department of Biomechanical Engineering, Delft (Netherlands); Nelissen, Rob G.H.H. [Leiden University Medical Center, Department of Orthopaedics, Leiden (Netherlands)

    2014-11-15

    To quantify whether injected cement volumes differed between two groups of patients who underwent experimental minimally invasive percutaneous cement injection procedures to stabilize aseptically loose hip prostheses. One patient group was preoperatively treated using gene-directed enzyme prodrug therapy to remove fibrous interface tissue, while the other group received no preoperative treatment. It was hypothesized that cement penetration may have been inhibited by the presence of fibrous interface tissue in periprosthetic lesions. We analyzed 17 patients (14 female, 3 male, ages 72-91, ASA categories 2-4) who were treated at our institution. Osteolytic lesions and injected cement were manually delineated using 3D CT image segmentation, and the deposition of injected cement was quantified. Patients who underwent preoperative gene-directed enzyme therapy to remove fibrous tissue exhibited larger injected cement volumes than those who did not. The observed median increase in injected cement volume was 6.8 ml. Higher cement leakage volumes were also observed for this group. We conclude that prior removal of periprosthetic fibrous interface tissue may enable better cement flow and penetration. This might lead to better refixation of aseptically loosened prostheses. (orig.)

  4. COMPARISON OF THE FREQUENCY AND COMPLICATIONS OF INAPPROPRIATE ANTIDIURETIC HORMONE SECRETION IN PATIENTS WITH SEPTIC AND ASEPTIC MENINGITIS

    Directory of Open Access Journals (Sweden)

    Ali HONARPISHEH

    2010-03-01

    Full Text Available bjectiveDue to the high prevalence of syndrome of Inappropriate Antidiuretic Hormone Secretion (SIADH. This study was carried out to evaluate the prevalence and relevant parameters of SIADH in children with septic and aseptic memingitis hospitalized at Kashan Shahid Beheshti Hospital between 1996 and 2006.Materials & MethodsThis descriptive study was conducted on 230 patients with meningitis hospitalized in the pediatric wards of Kashan Shahid Beheshti Hospital between 1996 and 2006. Relevant information (age, gender, type of meningitis, serum sodium and potassium, urine specific gravity (USG, blood sugar, blood urea nitrogen, serum creatinin, hydration condition was collected from patients' records. Data was analyzed using Mann-Whitney and K2 tests.ResultsOut of 230 patients with meningitis, 33 had incomplete records and only 197 patients were recruited for this study. Sixty eight cases (34.5% suffered from SIADH. It was more frequent among 1-2 year old children.According to this research, SIADH was diagnosed in 57% of the 121 patients with hyponatremia, 58.7% of the 167 patients with USG > 1.004, 74% of the 93 patients with serum osmolity < 280 mOs/L and 100% of the patients with BUN < 10 mg%.ConclusionDue to the high prevalence of SIADH in septic and aseptic meningitis and its complication, it is recommended to restrict fluid therapy and monitor serum sodium, urine specific gravity and other diagnostic tests for SIADH.

  5. Percutaneous bone cement refixation of aseptically loose hip prostheses: the effect of interface tissue removal on injected cement volumes

    International Nuclear Information System (INIS)

    To quantify whether injected cement volumes differed between two groups of patients who underwent experimental minimally invasive percutaneous cement injection procedures to stabilize aseptically loose hip prostheses. One patient group was preoperatively treated using gene-directed enzyme prodrug therapy to remove fibrous interface tissue, while the other group received no preoperative treatment. It was hypothesized that cement penetration may have been inhibited by the presence of fibrous interface tissue in periprosthetic lesions. We analyzed 17 patients (14 female, 3 male, ages 72-91, ASA categories 2-4) who were treated at our institution. Osteolytic lesions and injected cement were manually delineated using 3D CT image segmentation, and the deposition of injected cement was quantified. Patients who underwent preoperative gene-directed enzyme therapy to remove fibrous tissue exhibited larger injected cement volumes than those who did not. The observed median increase in injected cement volume was 6.8 ml. Higher cement leakage volumes were also observed for this group. We conclude that prior removal of periprosthetic fibrous interface tissue may enable better cement flow and penetration. This might lead to better refixation of aseptically loosened prostheses. (orig.)

  6. Clinical and experimental study of the time course of X-ray and morphological changes in the femoral head aseptic necrosis

    International Nuclear Information System (INIS)

    X-ray and morphological data of 24 adult patients with the femoral head aseptic necrosis and the results of roentgenologic, pathohistologic and histochemical examination in the case of a given pathology in an experiment on 100 adult rabbits, are analyzed. The earliest (roentgenonegative) structural alterations in the case of aseptic osteonecrosis are established using histochemical methods. An important role of a complex X-ray examination including tomography and roentgenography with a direct image increase in the diagnosis of the femoral head aseptic necrosis and the decrease of the degree of the hip joint affection is noted. The results of investigations point to the value in the pathogenesis of the given disease of violations of the local lood circulation

  7. Treatment of Aseptic Hypertrophic Nonunion of the Lower Extremity with Less Invasive Stabilization System (New Approach to Hypertrophic Nonunion Treatment

    Directory of Open Access Journals (Sweden)

    Metin Uzun

    2015-01-01

    Full Text Available Aim. To evaluate whether aseptic hypertrophic nonunion in the long bones of the lower extremity can be treated successfully with LISS applied with closed methods without grafting. Materials and Methods. The study included 7 tibias and 9 femurs of 16 patients. All cases had hypertrophic nonunion. Initial surgical treatment was with intramedullary nailing in 14 cases, 6 of which had required an exchange of intramedullary nail. All the patients were treated with LISS plate with closed methods. Results. Union was obtained at mean 7 months in all patients. No implant loosening or breakage of the implant was observed and there was no requirement for secondary surgery. Conclusion. Cases of hypertrophic nonunion have excellent blood supply and biological potential. Therefore, there is no need for bone grafting and the addition of fracture stability is enough to achieve full union. Using a limited approach and percutaneous screw insertion, LISS provides fracture stabilization with soft tissue protection.

  8. Data on the cost effective surface sterilization method for C.carandas (L.) seeds and callus induction from aseptic seedling.

    Science.gov (United States)

    Bhadane, Bhushan S; Patil, Ravindra H

    2016-06-01

    Surface sterilization of explant is an important and most sensitive step in plant tissue culture. Inappropriate concentrations of sterilants have lethal effect in cell division and it restricts growth and development of explant. Therefore, suitable concentration, combinations and duration of exposure of sterilant is essential to raise in vitro cultures successfully. This data demonstrates use of various sterilizing agents for aseptic plantlet germination from seed of Carissa carandas (Apocynaceae). The present dataset provides information in support of cost-effective explant sterilization potential of benzalkonium chloride containing commercial bleach (Lizol) and its comparison with traditionally used surface sterilants in plant tissue culture i.e. 0.1% HgCl2 alone and in combination with 70% alcohol. The data on callogenic response using MS medium supplemented with plant growth regulators is also shared. PMID:27222851

  9. Re-admissions, re-operations and length of stay in hospital after aseptic revision knee replacement in Denmark

    DEFF Research Database (Denmark)

    Lindberg-Larsen, M.; Jørgensen, C. C.; Hansen, Torben Bæk; Solgaard, S.; Odgaard, A.; Kehlet, H.

    information from the Danish Knee Arthroplasty Registry. The 1218 revisions involving 1165 patients were subdivided into total revisions, large partial revisions, partial revisions and revisions of unicondylar replacements (UKR revisions). The mean age was 65.0 years (27 to 94) and the median length of......-admission. The age ranges of 76 to 80 years (p = 0.018) and the large partial revision subgroup (p = 0.073) were related to an increased risk of re-operation. The ages from 76 to 80 years (p < 0.001), age ≥ 81 years (p < 0.001) and surgical time > 120 min (p < 0.001) were related to increased length of hospital...... suggests that a length of hospital stay ≤ four days and discharge home at that time is safe following aseptic knee revision surgery in Denmark....

  10. Development of a handheld sensor system system for the online measurement of hydrogen peroxide in aseptic filling systems

    Energy Technology Data Exchange (ETDEWEB)

    Reisert, Steffen; Schoening, Michael J. [Institute of Nano- and Biotechnologies, Aachen University of Applied Sciences, Juelich (Germany); Henkel, Hartmut; Schneider, Andreas; Schaefer, Daniel [von Hoerner and Sulger GmbH, Schwetzingen (Germany); Friedrich, Peter [Aseptiksysteme and Foodtechnologie, Linnich (Germany); Berger, Joerg [Filldesign GmbH, Moenchengladbach (Germany)

    2010-04-15

    A handheld sensor system for the online measurement of hydrogen peroxide (H{sub 2}O{sub 2}) in aseptic sterilisation processes has been developed. It is based on a calorimetric-type gas sensor that consists of a differential set-up of two temperature sensors, of which one is catalytically activated and the second one is passivated and used as reference. The sensor principle relies in detecting a rise in temperature on the active sensor due to the exothermic reaction of H{sub 2}O{sub 2} on the catalytic surface. To characterise the sensor system towards H{sub 2}O{sub 2} sensitivity and other influencing factors, measurements have been carried out both at an experimental set-up and a manufacturer's sterilisation machine. Physical sensor characterisation was done by means of the optical microscopy. (Abstract Copyright [2010], Wiley Periodicals, Inc.)

  11. Ultrasound of Sternal Fracture

    Directory of Open Access Journals (Sweden)

    Shadi Lahham

    2015-12-01

    Full Text Available A 61-year-old female was brought in by ambulance after being the restrained driver of a head-on motor vehicle collision at 40MPH. There was positive airbag deployment and intrusion from the other vehicle. During workup, the patient complained of midline chest pain, and left chest wall pain. The patient was not in acute respiratory distress, and had the following vital signs: temperature 37°C, heart rate 84, blood pressure of 150/64, respiratory rate 18, and oxygen saturation of 97% on two liters of oxygen. On physical exam, breath sounds were heard bilaterally, with no acute cardiopulmonary issues identified. A bruise was identified on the lower abdomen, which was thought to be a potential seatbelt sign. A focused assessment with sonography for trauma was negative, and an ultrasound of additional chest and mediastinal structures was performed for the chest tenderness.

  12. Why does it take so long? ‘Lean processing’ in the aseptic compounding unit at the Midland Regional Hospital Tullamore

    LENUS (Irish Health Repository)

    Greene, C

    2011-06-01

    Increasing numbers of oncology\\/haematology patients attending Midland Regional Hospital Tullamore (MRHT) has increased the workload of the Regional Oncology Haematology Pharmacy (ROHP) compounding unit. Staff restrictions require optimisation of current workflow practices. This audit (November 2010 and June 2011) focused on workflow in the aseptic compounding unit.\\r\

  13. Plasmodium falciparum malaria challenge by the bite of aseptic Anopheles stephensi mosquitoes: results of a randomized infectivity trial.

    Directory of Open Access Journals (Sweden)

    Kirsten E Lyke

    Full Text Available BACKGROUND: Experimental infection of malaria-naïve volunteers by the bite of Plasmodium falciparum-infected mosquitoes is a preferred means to test the protective effect of malaria vaccines and drugs. The standard model relies on the bite of five infected mosquitoes to induce malaria. We examined the efficacy of malaria transmission using mosquitoes raised aseptically in compliance with current Good Manufacturing Practices (cGMPs. METHODS AND FINDINGS: Eighteen adults aged 18-40 years were randomized to receive 1, 3 or 5 bites of Anopheles stephensi mosquitoes infected with the chloroquine-sensitive NF54 strain of P. falciparum. Seventeen participants developed malaria; fourteen occurring on Day 11. The mean prepatent period was 10.9 days (9-12 days. The geometric mean parasitemia was 15.7 parasites/µL (range: 4-70 by microscopy. Polymerase chain reaction (PCR detected parasites 3.1 (range: 0-4 days prior to microscopy. The geometric mean sporozoite load was 16,753 sporozoites per infected mosquito (range: 1,000-57,500. A 1-bite participant withdrew from the study on Day 13 post-challenge and was PCR and smear negative. CONCLUSIONS: The use of aseptic, cGMP-compliant P. falciparum-infected mosquitoes is safe, is associated with a precise prepatent period compared to the standard model and appears more efficient than the standard approach, as it led to infection in 100% (6/6 of volunteers exposed to three mosquito bites and 83% (5/6 of volunteers exposed to one mosquito bite. TRIAL REGISTRATION: ClinicalTrials.gov NCT00744133.

  14. Pyrolysis of aseptic packages (tetrapak) in a laboratory screw type reactor and secondary thermal/catalytic tar decomposition

    International Nuclear Information System (INIS)

    Highlights: ► Pyrolysis of aseptic packages was carried out in a laboratory flow reactor. ► Distribution of tetrapak into the product yields was obtained. ► Composition of the pyrolysis products was estimated. ► Secondary thermal and catalytic decomposition of tars was studied. ► Two types of catalysts (dolomite and red clay marked AFRC) were used. - Abstract: Pyrolysis of aseptic packages (tetrapak cartons) in a laboratory apparatus using a flow screw type reactor and a secondary catalytic reactor for tar cracking was studied. The pyrolysis experiments were realized at temperatures ranging from 650 °C to 850 °C aimed at maximizing of the amount of the gas product and reducing its tar content. Distribution of tetrapak into the product yields at different conditions was obtained. The presence of H2, CO, CH4, CO2 and light hydrocarbons, HCx, in the gas product was observed. The Aluminum foil was easily separated from the solid product. The rest part of char was characterized by proximate and elemental analysis and calorimetric measurements. The total organic carbon in the tar product was estimated by elemental analysis of tars. Two types of catalysts (dolomite and red clay marked AFRC) were used for catalytic thermal tar decomposition. Three series of experiments (without catalyst in a secondary cracking reactor, with dolomite and with AFRC) at temperatures of 650, 700, 750, 800 and 850 °C were carried out. Both types of catalysts have significantly affected the content of tars and other components in pyrolytic gases. The effect of catalyst on the tetrapack distribution into the product yield on the composition of gas and on the total organic carbon in the tar product is presented in this work

  15. Pyrolysis of aseptic packages (tetrapak) in a laboratory screw type reactor and secondary thermal/catalytic tar decomposition

    Energy Technology Data Exchange (ETDEWEB)

    Haydary, J., E-mail: juma.haydary@stuba.sk [Institute of Chemical and Environmental Engineering, Faculty of Chemical and Food Technology, Slovak University of Technology, Radlinského 9, 812 37 Bratislava (Slovakia); Susa, D.; Dudáš, J. [Institute of Chemical and Environmental Engineering, Faculty of Chemical and Food Technology, Slovak University of Technology, Radlinského 9, 812 37 Bratislava (Slovakia)

    2013-05-15

    Highlights: ► Pyrolysis of aseptic packages was carried out in a laboratory flow reactor. ► Distribution of tetrapak into the product yields was obtained. ► Composition of the pyrolysis products was estimated. ► Secondary thermal and catalytic decomposition of tars was studied. ► Two types of catalysts (dolomite and red clay marked AFRC) were used. - Abstract: Pyrolysis of aseptic packages (tetrapak cartons) in a laboratory apparatus using a flow screw type reactor and a secondary catalytic reactor for tar cracking was studied. The pyrolysis experiments were realized at temperatures ranging from 650 °C to 850 °C aimed at maximizing of the amount of the gas product and reducing its tar content. Distribution of tetrapak into the product yields at different conditions was obtained. The presence of H{sub 2}, CO, CH{sub 4}, CO{sub 2} and light hydrocarbons, HCx, in the gas product was observed. The Aluminum foil was easily separated from the solid product. The rest part of char was characterized by proximate and elemental analysis and calorimetric measurements. The total organic carbon in the tar product was estimated by elemental analysis of tars. Two types of catalysts (dolomite and red clay marked AFRC) were used for catalytic thermal tar decomposition. Three series of experiments (without catalyst in a secondary cracking reactor, with dolomite and with AFRC) at temperatures of 650, 700, 750, 800 and 850 °C were carried out. Both types of catalysts have significantly affected the content of tars and other components in pyrolytic gases. The effect of catalyst on the tetrapack distribution into the product yield on the composition of gas and on the total organic carbon in the tar product is presented in this work.

  16. Complete genome sequence of a coxsackievirus B3 recombinant isolated from an aseptic meningitis outbreak in eastern China.

    Science.gov (United States)

    Zhang, Wenqiang; Lin, Xiaojuan; Jiang, Ping; Tao, Zexin; Liu, Xiaolin; Ji, Feng; Wang, Tongzhan; Wang, Suting; Lv, Hui; Xu, Aiqiang; Wang, Haiyan

    2016-08-01

    Coxsackievirus B3 (CV-B3) has frequently been associated with aseptic meningitis outbreaks in China. To identify sequence motifs related to aseptic meningitis and to construct an infectious clone, the genome sequence of 08TC170, a representative strain isolated from cerebrospinal fluid (CSF) samples from an outbreak in Shandong in 2008, was determined, and the coding regions for P1-P3 and VP1 were aligned. The first 21 and last 20 residues were "TTAAAACAGCCTGTGGGTTGT" and "ATTCTCCGCATTCGGTGCGG", respectively. The whole genome consisted of 7401 nucleotides, sharing 80.8 % identity with the prototype strain Nancy and low sequence similarity with members of clusters A-C. In contrast, 08TC170 showed high sequence similarity to members of cluster D. An especially high level of sequence identity (≥97.7 %) was found within a branch constituted by 08TC170 and four Chinese strains that clustered together in all of the P1-P3 phylogenic trees. In addition, 08TC170 also possessed a close relationship to the Hong Kong strain 26362/08 in VP1. Similarity plot analysis showed that 08TC170 was most similar to the Chinese CV-B3 strain SSM in P1 and the partial P2 coding region but to the CV-B5 or E-6 strain in 2C and following regions. A T277A mutation was found in 08TC170 and other strains isolated in 2008-2010, but not in strains isolated before 2008, which had high sequence similarity and formed the cluster A277. The results suggested that 08TC170 was the product of both intertypic recombination and point mutation, whose effects on viral neurovirulence will be investigated in a further study. The high homology between 08TC170 and other strains revealed their co-circulation in mainland China and Hong Kong and indicates that further surveillance is needed. PMID:27236460

  17. Aseptic meningitis in a large MMR vaccine campaign (590,609 people in Curitiba, Paraná, Brazil, 1998

    Directory of Open Access Journals (Sweden)

    ARRUDA Walter Oleschko

    2001-01-01

    Full Text Available The aseptic meningitis after Measles-Mumps-Rubella vaccine (MMR is a well recognized complication, and different incidences have been observed in several studies. We retrospectively analyzed forty cases of aseptic meningitis, during a large public immunization campaign (1998 in Curitiba, Southern Brazil (590,609 people, admitted in our Service. The vaccine utilized was Leningrad-3-Zagreb mumps strain, Edmonston-Zagreb measles strain, and RA 27#3 rubella strain. In all county, a total number of 87 cases were reported, resulting in a incidence of 1.7 cases per 10,000 given doses . The mean age was 23.7 ± 12.8 years. The female:male ratio was 1.35:1. Severe headache with meningismus (92.5%, fever (87.5%, nausea/vomiting (82.5% were the most common clinical findings. Three cases (7.5% developed mild mumps. All patients underwent cerebrospinal fluid (CSF tap with the following findings: mononuclear pleocytosis from 100 to 500 cells/mm³ in 17 cases (42.5%; 257.5 ± 260.6 cells/mm³; increased protein 28 cases (67.5%; 92.1 ± 76.9 mg/dL; glucose was normal in all cases (56.8 ± 11.2 mg/dL except in 4 (10% cases, which presented less than 44 mg/dL. All serological tests (latex to bacterial meningitis, Cryptococcus, cysticercosis, VDRL and bacteriological cultures were negative. Virus identification were also negative in 8 samples. None of the patients had neurological deficits or related symptoms after one year of onset. We believe the benefit of vaccination clearly outweights the incidence of benign vaccine-associated meningitis.

  18. Developmental dysplasia of the hip, age, BMI, place of residence and tobacco abuse increase the odds of aseptic loosening in Chinese patients.

    Directory of Open Access Journals (Sweden)

    Chuanlong Wu

    Full Text Available PURPOSE: The purpose of this hospital-based case-control study was to evaluate the patient-related risk factors for aseptic loosening after total hip arthroplasty (THA and total knee arthroplasty (TKA in Chinese patients. METHODS: From January 2000 to December 2012, 67 patients undergoing THA and TKA who developed aseptic loosening were detected as case subjects and 336 patients without aseptic loosening, matched by the year of index surgery and type of surgery, were selected as controls. Conditional logistic regression was used to compute odds ratios (ORs and 95% confidence intervals (CIs. RESULTS: The demographic factors and comorbid conditions associated with a risk-adjusted increase in aseptic loosening (in decreasing order of significance were a rural place of residence (OR = 2.28; 95% CI: 1.21-4.30; p = 0.011, body mass index (BMI ≥ 28 kg/m(2 (vs. 18.5-28 kg/m(2 (OR = 2.29; 95% CI: 1.19-4.41; p = 0.013, developmental dysplasia of the hip (DDH (OR = 2.91; 95% CI: 1.11-7.66; p = 0.030, tobacco abuse (OR = 2.88; 95% CI: 1.05-7.89; p = 0.039, and age <45 years (vs. 45-65 years (OR = 2.63; 95% CI: 1.01-6.80; p = 0.047. CONCLUSIONS: Patients aged <45 years and those with a BMI of ≥ 28 kg/m(2, a preoperative diagnosis of DDH, history of tobacco abuse, or living in rural areas are at increased risk for aseptic loosening after THA and TKA in Chinese population. Additional systematic large-scale studies are needed to verify these results.

  19. Characteristic of endocrine cells of rat small intestine after administration of cryopreserved placenta on the background of acute aseptic peritoneal inflammation

    Directory of Open Access Journals (Sweden)

    Shepitko K.V.

    2015-06-01

    Full Text Available Background. Modern conceptions about mechanisms of inflammation of the small intestine could not be formed without an understanding of intercellular relationships that are realized by biologically active signaling molecules produced by endocrine cells. Methods. The experimental study has been carried out on the small intestine extracted from 140 adult male rats. Electron and light microscopy methods were used. Acute aseptic inflammation was modeled by intraperitoneal carrageenan injection; influence of subcutaneously cryopreserved placenta injection was analyzed. Results. After modeling of the acute aseptic peritoneal inflammation the maximal increase of ECL-cells was noted on the 21st day. The slowest restoration of endocrine cells number occurred on all measured parameters and was observed on day 30th of the observation. In case of administration of cryopreserved placenta at the early stages (days 3rd – 7th the increase of average number of EC- and ECL-cells promoted the enhanced permeability of vessels in the lamina propria. The decrease in number of P-cells prevented the development of hyperacid gastritis. Reduction in the average number of D1- cells prevented the excessive vasodilatation and facilitated the excretion of excess fluid from the foci of inflammation. In simultaneous subcutaneous administration of cryopreserved placenta and modeling of acute aseptic peritoneal inflammation the number of ЕС- and ЕСL-cells increased, accelerating the vascular response to inflammation. Conclusion. Active appearance of low-differentiated cells including those with “shapes of mitosis” on the day 14th indicates restoration of structural components of the small intestine mucosa and processes of absorption and parietal digestion after placenta administration during acute aseptic inflammation. Citation: Shepitko KV. [Characteristic of endocrine cells of rat small intestine after administration of cryopreserved placenta on the background of

  20. Chronic recurrent multifocal osteomyelitis: how to suggest this diagnosis?

    International Nuclear Information System (INIS)

    Chronic recurrent multifocal osteomyelitis is a rare disorder that affects children and teenagers. Clinically, it is characterized by insidious onset of local swelling and pain in several metaphyses. A symmetric, recurrent and multifocal pattern is usual. Spinal involvement is possible. Inconstant association with a cutaneous affection (palmo-plantar pustulosis, acne fulminans, psoriasis), or less frequently with an inflammatory chronic gut disorder is described. Pathogenesis usually recognized is an enthesopathy. Enthesitis may progress to the osseous part of the enthese and produce an aseptic chronic osteomyelitis. Biopsy specimen with culture is certainly necessary to rule out bacterial osteomyelitis and bone tumor. It is particularly true when the bone lesion is isolated. Disease course is benign and self-limited. The clinical course is characterized by recurrences and remissions occurring for 6 to 10 years. Treatment based on non steroid anti-inflammatory drugs is usually effective. (authors)

  1. Aseptic germination and rapid propagation by tissue culture from space returned seeds of Rehmannia glutinosa f. hueiching ensis (Chan et Sehih) Hsiao

    International Nuclear Information System (INIS)

    Aseptic germination of Rehmannia glutinosa f. hueichingensis (Chan et Sehih) Hsiao seeds space returned and rapid propagation of plantlets were studied. The results were as follows: (1) When the sterilization time of 0.05% HgCl2 was 5 s, both the germination rate and the germination energy of the seeds reached the maximum, which were 68.33% and 53.33% respectively; (2) The best aseptic germination medium of the seeds was 1/4MS, the germination rate and the germination energy of the seeds were 76.67% and 65.08%; (3) The optimum rapid propagation medium of the plantlets was MS + 6-BA 1mg/L + NAA 0.002 mg/L, after grew in the medium for 28 d, height of the plantlets increased 7.85 cm, the propagation coefficient could achieve 6.56. (authors)

  2. Aseptic Meningitis Associated with ECHO Virus Type 9 Infection—With Special Reference to Variability by Sex and Incidence of Paralytic Sequelae

    Science.gov (United States)

    Portnoy, Bernard; Hanes, Bernard; Pierce, Nathaniel F.; Leedom, John M.; Kunzman, E. Eugene; Wehrle, Paul F.

    1965-01-01

    The clinical and clinical laboratory findings in a group of 104 patients with aseptic meningitis associated with ECHO-9 infection were widely variable. A male to female case ratio of 3.7:1 was noted, and the mean age of the female group was significantly greater than that of the male group. The median of cerebrospinal fluid leukocyte counts was significantly higher in the male than in the female patients. Clinical manifestations of the disease were similar to those noted in other reports. Residual paralysis was rare and mild. Further study of the ecology of aseptic meningitis seems indicated for elucidation of the factors governing variability of the disease by sex. PMID:14288142

  3. ASEPTIC MENINGITIS ASSOCIATED WITH ECHO VIRUS TYPE 9 INFECTION. WITH SPECIAL REFERENCE TO VARIABILITY BY SEX AND INCIDENCE OF PARALYTIC SEQUELAE.

    Science.gov (United States)

    PORTNOY, B; HANES, B; PIERCE, N F; LEEDOM, J M; KUNZMAN, E E; WEHRLE, P F

    1965-04-01

    The clinical and clinical laboratory findings in a group of 104 patients with aseptic meningitis associated with ECHO-9 infection were widely variable.A male to female case ratio of 3.7:1 was noted, and the mean age of the female group was significantly greater than that of the male group. The median of cerebrospinal fluid leukocyte counts was significantly higher in the male than in the female patients. Clinical manifestations of the disease were similar to those noted in other reports. Residual paralysis was rare and mild. Further study of the ecology of aseptic meningitis seems indicated for elucidation of the factors governing variability of the disease by sex. PMID:14288142

  4. 人工关节假体植入后无菌性松动的发病机制%Pathogenesis of aseptic prosthesis loosening after artificial prosthesis implantation

    Institute of Scientific and Technical Information of China (English)

    马玉超; 田京

    2012-01-01

    BACKGROUND: There are many clinical researches on aseptic loosening of artificial prosthesis, but the exact pathogenesis is still unclear.OBJECTIVE: To review the pathogenesis of prosthesis aseptic loosening after artificial prosthesis implantation.METHODS: A computer-based online search of PubMed and CNKI was performed to search related articles published between 2006 and 2011 with the key words of “artificial prosthesis, aseptic loosening” both in English and Chinese. A total of 77 articles were obtained, and finally 38 articles were included.RESULTS AND CONCLUSION: Aseptic loosening after long-term total hip replacement is one of the main failure reasons. In the recent years, analysis of revision total hip replacement for failed hip arthroplasty showed that aseptic loosening is the chief reason. The mechanism of aseptic loosening mainly includes mechanical mechanisms, biological and other mechanisms. With further research and the improvement of implantation method and prosthetic materials, aseptic loosening will eventually be minimized, so that the service life of prosthesis will be longer.%背景:对于人工关节无菌性松动的基础和临床研究很多,但其确切机制仍不甚明确.目的:综述人工关节假体植入后无菌性松动的发病机制.方法:由第一作者应用计算机检索PubMed和中国期刊全文数据库2006/2011相关文献.在标题、摘要、关键词中以"artificial prosthesis,aseptic loosening"或"人工关节、无菌性松动"为检索词进行检索.共检索到77篇文献,最终纳入符合标准的文献38篇.结果与结论:无菌性松动已成为人工关节置换后远期失败的主要原因之一.近年来对人工全髋关节置换后翻修病例回顾性分析的统计显示,无菌性松动位于翻修原因第1位.关于人工关节无菌性松动的机制主要分为机械机制、生物机制及其他机制,它们的共同结果是造成骨吸收、骨溶解,最终导致假体松动.随着研究

  5. Pyrolysis of aseptic packages (tetrapak) in a laboratory screw type reactor and secondary thermal/catalytic tar decomposition.

    Science.gov (United States)

    Haydary, J; Susa, D; Dudáš, J

    2013-05-01

    Pyrolysis of aseptic packages (tetrapak cartons) in a laboratory apparatus using a flow screw type reactor and a secondary catalytic reactor for tar cracking was studied. The pyrolysis experiments were realized at temperatures ranging from 650 °C to 850 °C aimed at maximizing of the amount of the gas product and reducing its tar content. Distribution of tetrapak into the product yields at different conditions was obtained. The presence of H2, CO, CH4, CO2 and light hydrocarbons, HCx, in the gas product was observed. The Aluminum foil was easily separated from the solid product. The rest part of char was characterized by proximate and elemental analysis and calorimetric measurements. The total organic carbon in the tar product was estimated by elemental analysis of tars. Two types of catalysts (dolomite and red clay marked AFRC) were used for catalytic thermal tar decomposition. Three series of experiments (without catalyst in a secondary cracking reactor, with dolomite and with AFRC) at temperatures of 650, 700, 750, 800 and 850 °C were carried out. Both types of catalysts have significantly affected the content of tars and other components in pyrolytic gases. The effect of catalyst on the tetrapack distribution into the product yield on the composition of gas and on the total organic carbon in the tar product is presented in this work. PMID:23428565

  6. Is the technetium-99m-fluoroquinolone complex discriminates between septic and aseptic inflammatory foci? in -vitro evaluation

    International Nuclear Information System (INIS)

    Aim: in-vitro evaluation of 99mTc-L-Flox and 99mTc-Cipro complexes. Method: four steps technique was used: 1-determination of the complexion capability of the tracers with the free purified DNA of both e. coli and s. aureus . 2- estimation the binding efficiency of the tracers to live and heat killed bacteria of different standard .3- comparing the bioactivity of the labeled and the non labeled fluoroquinolones using dick diffusion test.4- determination of the percent binding of the labeled fluoroquinolones to the plasma proteins using trichloroacetic acid (TCA) precipitation method. Results:the gathered results revealed the effective binding of the labeled fluoroquinolones to the purified DNA with high percent (65-68% for each species). High localization and binding of the tracers to the DNA of the live bacterial cell, which is the site of action of topoisomerase ll and IV, were observed, and not to the DNA of the dead one. High uptake of the tracers by the live resistant bacterial strain was noticed with low localization in their DNA. high bioavailability and plasma protein binding were observed. Conclusion: 99mTc- fluoroquinolones, in the present study, retained their antimicrobial activities and exhibited high targeting to the DNA of live sensitive bacteria and not to dead or resistant strains. These results lead to the ability of the labeled fluoroquinolones to image and identify septic foci from aseptic one

  7. Classification of acute stress using linear and non-linear heart rate variability analysis derived from sternal ECG

    DEFF Research Database (Denmark)

    Tanev, George; Saadi, Dorthe Bodholt; Hoppe, Karsten;

    2014-01-01

    Chronic stress detection is an important factor in predicting and reducing the risk of cardiovascular disease. This work is a pilot study with a focus on developing a method for detecting short-term psychophysiological changes through heart rate variability (HRV) features. The purpose of this pilot...... features. Standardizing non-linear HRV features for each subject was found to be an important factor for the improvement of the classification results....

  8. Aseptic loosening of the femoral implant after cemented total hip arthroplasty in dogs: 11 cases in 10 dogs (1991-1995)

    International Nuclear Information System (INIS)

    Objective-To determine clinical signs, radiographic findings, results of surgical management, and potential causes of aseptic loosening of the femoral implant (ALFI) in dogs that have undergone cemented total hip arthroplasty (THA). Design-Retrospective study. Animals-11 cases of ALFI in 10 dogs. Procedure-Medical records of all dogs undergoing THA revision surgery were reviewed. Only dogs with ALFI were included. The prosthesis and cement were removed by creating a longitudinal osteotomy of the cranial femoral cortex. Postoperative radiographs of all dogs that underwent THA during the study period were reviewed. Results-The most common clinical sign was intermittent, subtle. or non-weight-bearing lameness. On radiographs obtained after THA, contact of the distal stem tip with cortical endosteum was evident in all dogs. Radiographic changes at the time of diagnosis of ALFI included asymmetric periosteal reaction along the femoral diaphysis, radiolucent lines between the prosthesis and cement, altered implant position, and femoral fracture. Surgical revision yielded good or excellent results in 9 cases. In 1 dog. the implant became infected; in another, aseptic loosening recurred. Aseptic loosening was significantly more common in dogs in which there was contact between the distal stem tip and cortical endosteum than in dogs in which there was no contact. Clinical Implications-ALFI is an uncommon, but important, complication of THA, and radiography is warranted in dogs with clinical signs of ALFI. Initial centering of the prosthetic stem within the femoral shaft may reduce the incidence of ALFI

  9. Strontium-doped calcium polyphosphate/ultrahigh molecular weight polyethylene composites: A new class of artificial joint components with enhanced biological efficacy to aseptic loosening.

    Science.gov (United States)

    Gu, Zhipeng; Huang, Bingxue; Li, Yiwen; Tian, Meng; Li, Li; Yu, Xixun

    2016-04-01

    To enhance implant stability and prolong the service life of artificial joint component, a new approach was proposed to improve the wear resistance of artificial joint component and endow artificial joint component with the biological efficacy of resistance to aseptic loosening. Strontium calcium polyphosphate (SCPP) were interfused in ultrahigh molecular weight polyethylene (UHMWPE) by a combination of liquid nitrogen ball-milling and flat-panel curing process to prepare the SCPP/UHMWPE composites. The micro-structure, mechanical characterization, tribological characterization and bioactivities of various SCPP/UHMWPE composites were investigated. The results suggested that this method could statistically improve the wear resistance of UHMWPE resulting from a good SCPP particle dispersion. Moreover, it is also observed that the SCPP/UHMWPE composites-wear particles could promote the production of OPG by osteoblasts and decrease the production of RANKL by osteoblasts, and then increase the OPG/RANKL ratio. This indicated that the SCPP/UHMWPE composites had potential efficacy to prevent and treat aseptic loosening. Above all, the SCPP/UHMWPE composites with a suitable SCPP content would be the promising materials for fabricating artificial joint component with ability to resist aseptic loosening. PMID:26838880

  10. Progress of Aseptic Purification Technique of Cyanobacteria%蓝藻无菌化方法研究进展

    Institute of Scientific and Technical Information of China (English)

    李天丽; 郑凌凌; 张琪; 宋立荣

    2015-01-01

    随着微藻产业的蓬勃发展,蓝藻作为具有重要经济价值的资源受到人们越来越多的关注,其多糖和蛋白的开发已被应用于多个领域。为了更深入清晰地挖掘蓝藻的特性和功能,研究者首先需获得无菌的纯种藻株,这是深入开展蓝藻生理生化、遗传和毒性等研究的基础。重点综述了如何根据蓝藻的结构及生理特性选择合适的无菌化方法,介绍了基于蓝藻与污染菌之间差异性的无菌化方法,以期为蓝藻的无菌化工作提供参考。%With the vigorous development of the microalgae industry, people are paying much more attention to cyanobacteria according to its important economic value, as its polysaccharide and protein are applied in many fields.In order to excavate the characteristics and function of cyanobacteria more in-depth and clearly, it is necessary to obtain axenic cultures of cyanobacteria, which is also regarded as the foundation for the further research on physiological, biochemical, genetic and taxonomic characteristics of cyanobacteria.This paper mainly reviewed the chosen of appropriate aseptic purification methods based on their structures and physiological characteristics.Furthermore, the methods based on the differences between cyanobacteria and contaminated bacteria were introduced.The paper was expected to provide useful information for the works on purification of cyanobacteria.

  11. Combination gene therapy targeting on interleukin-1β and RANKL for wear debris-induced aseptic loosening.

    Science.gov (United States)

    Wang, H; Jia, T-H; Zacharias, N; Gong, W; Du, H-X; Wooley, P H; Yang, S-Y

    2013-02-01

    This study investigated the efficacy of a combination gene therapy to repress interleukin-1 (IL-1) and receptor activator of nuclear factor NF-kappa B ligand (RANKL) for the treatment of particulate debris-induced aseptic loosening, and tried to explore the molecular mechanism of the exogenous gene modifications on osteoclastogenesis. RAW cells activated by titanium particles were transduced with DFG-IL-1Ra (retroviral vector encoding IL-1 receptor antagonist) and AAV-OPG (adeno-associated viral vectors-osteoprotegerin) individually or in combination for 4 weeks. Pro-inflammatory cytokines in culture media were determined by enzyme-linked immunosorbent assay, and gene expressions of RANK, IL-1β, c-Fos, TRAF6, JNK1 and CPK were examined using real-time PCR. An established knee-implant-failure mouse model was employed to evaluate the efficacy of the in vivo double-gene therapy. The surgical implantation of a titanium alloy pin into the proximal tibia was followed by monthly challenge with titanium debris. Peri-implant gene transfers of IL-1Ra and OPG (respectively or in combination) were given 3 weeks after surgery. The combination of OPG and IL-1Ra gene transfer exhibited strong synergetic effects in blockage of inflammation and osteoclastogenesis at 8 weeks after gene modification. The combination therapy reversed peri-implant bone resorption and restored implant stability when compared with either single gene transduction. Real-time PCR data indicated that the action of IL-1Ra gene therapy may be mediated via the JNK1 pathway, while the reduction of osteoclastogenesis by OPG gene modification may be regulated by c-Fos expression. In addition, both gene modifications resulted in significant diminishment of TRAF6 expression. PMID:22318091

  12. The role of Card9 overexpression in peripheral blood mononuclear cells from patients with aseptic acute pancreatitis.

    Science.gov (United States)

    Yang, Zhi-wen; Weng, Cheng-zhao; Wang, Jing; Xu, Ping

    2016-03-01

    Activated mononuclear cells are an early event in the course of severe acute pancreatitis (SAP). To date, the molecular mechanism triggering peripheral blood mononuclear cells (PBMCs) is poorly understood. The aim of this paper was to determine the potential role of Card9 in SAP. We collected data from 72 subjects between January 2013 and June 2014. Subsequently, PBMCs were isolated on day 1, 3 and 5 of pancreatitis. Immunofluorescence staining, quantitative real-time PCR, Western blotting, immunoprecipitation and ELISA were used to determine the role of Card9 in SAP. Microbial culture showed that SAP patients at the early period did not develop any bacteria and fungi infection. Card9 expression in SAP patients was higher than that in mild acute pancreatitis and volunteer healthy controls, up to the peak on day 1. The monocyte-derived cytokines interleukin (IL)-17, IL-1β, IL-6 and tumour necrosis factor-α mediated by the induction of Card9 markedly increased in SAP patients compared with the control group. Furthermore, the inducible formation of Card9-Bcl10 complex was found in PBMCs, which may be involved in nuclear factor kappa B (NF-κB) and p38 activation in SAP. Receiver operating characteristic curve indicated that Card9 levels had a high sensitivity of 87.5% and specificity of 67.7%, showing the close correlation with SAP patients. Card9 overexpression was firstly found in aseptic SAP, which may be played an important role in NF-κB and p38 activation in PBMCs. It also provided the new insights into therapeutic interventions by targeting monocytes activation in SAP patients. PMID:26893103

  13. Chronic Bronchitis

    Science.gov (United States)

    Bronchitis is an inflammation of the bronchial tubes, the airways that carry air to your lungs. It ... chest tightness. There are two main types of bronchitis: acute and chronic. Chronic bronchitis is one type ...

  14. Added value of experts' knowledge to improve a quantitative microbial exposure assessment model--Application to aseptic-UHT food products.

    Science.gov (United States)

    Pujol, Laure; Johnson, Nicholas Brian; Magras, Catherine; Albert, Isabelle; Membré, Jeanne-Marie

    2015-10-15

    In a previous study, a quantitative microbial exposure assessment (QMEA) model applied to an aseptic-UHT food process was developed [Pujol, L., Albert, I., Magras, C., Johnson, N. B., Membré, J. M. Probabilistic exposure assessment model to estimate aseptic UHT product failure rate. 2015 International Journal of Food Microbiology. 192, 124-141]. It quantified Sterility Failure Rate (SFR) associated with Bacillus cereus and Geobacillus stearothermophilus per process module (nine modules in total from raw material reception to end-product storage). Previously, the probabilistic model inputs were set by experts (using knowledge and in-house data). However, only the variability dimension was taken into account. The model was then improved using expert elicitation knowledge in two ways. First, the model was refined by adding the uncertainty dimension to the probabilistic inputs, enabling to set a second order Monte Carlo analysis. The eight following inputs, and their impact on SFR, are presented in detail in this present study: D-value for each bacteria of interest (B. cereus and G. stearothermophilus) associated with the inactivation model for the UHT treatment step, i.e., two inputs; log reduction (decimal reduction) number associated with the inactivation model for the packaging sterilization step for each bacterium and each part of the packaging (product container and sealing component), i.e., four inputs; and bacterial spore air load of the aseptic tank and the filler cabinet rooms, i.e., two inputs. Second, the model was improved by leveraging expert knowledge to develop further the existing model. The proportion of bacteria in the product which settled on surface of pipes (between the UHT treatment and the aseptic tank on one hand, and between the aseptic tank and the filler cabinet on the other hand) leading to a possible biofilm formation for each bacterium, was better characterized. It was modeled as a function of the hygienic design level of the aseptic

  15. Chronic gastritis

    OpenAIRE

    Sipponen, Pentti; Maaroos, Heidi-Ingrid

    2015-01-01

    Abstract Prevalence of chronic gastritis has markedly declined in developed populations during the past decades. However, chronic gastritis is still one of the most common serious pandemic infections with such severe killing sequelae as peptic ulcer or gastric cancer. Globally, on average, even more than half of people may have a chronic gastritis at present. Helicobacter pylori infection in childhood is the main cause of chronic gastritis, which microbial origin is the key for the understand...

  16. Syphilitic aseptic meningitis

    Science.gov (United States)

    ... done to confirm the diagnosis. Tests include: FTA-ABS MHA-TP TP-PA TP-EIA Treatment The ... syphilis . Alternative Names Meningitis - syphilitic Images Central nervous system and peripheral nervous system References Hook EW III. ...

  17. Chronic prostatitis

    OpenAIRE

    Erickson, Bradley A.; Schaeffer, Anthony J.; Le, Brian

    2008-01-01

    Chronic prostatitis can cause pain and urinary symptoms, and usually occurs without positive bacterial cultures from prostatic secretions (known as chronic abacterial prostatitis or chronic pelvic pain syndrome, CP/CPPS). Bacterial infection can result from urinary tract instrumentation, but the cause and natural history of CP/CPPS are unknown.

  18. Idiopathic Facial Aseptic Granuloma in a 13-Year-Old Boy Dramatically Improved with Oral Doxycycline and Topical Metronidazole: Evidence for a Link with Childhood Rosacea

    Directory of Open Access Journals (Sweden)

    Camille Orion

    2016-07-01

    Full Text Available Idiopathic facial aseptic granuloma (IFAG is a rare, benign pediatric dermatological lesion that occurs in children between 8 months and 13 years of age. The pathogenesis of IFAG is still unclear but it is likely to be associated with granulomatous rosacea in childhood. Here we describe a case of IFAG in a 13-year-old boy who showed a dramatic response to oral doxycycline and topical metronidazole, which supports the hypothesis that IFAG may belong to the spectrum of rosacea.

  19. An experimental animal model of aseptic loosening of hip prostheses in sheep to study early biochemical changes at the interface membrane

    Directory of Open Access Journals (Sweden)

    Akens Margarete K

    2004-03-01

    Full Text Available Abstract Background Aseptic loosening of hip prosthesis as it occurs in clinical cases in human patients was attributed to wear particles of the implants, the response of the tissue dominated by macrophages and the production of inflammatory mediators and matrix degrading enzymes; however, the cascade of events initiating the process and their interaction regarding the time course is still open and discussed controversially. Therefore, the goal of this study was to establish an experimental animal model in sheep allowing to follow the cascade of early mechanical and biochemical events within the interface membrane and study the sequence of how they contribute to the pathological bone resorption necessary for aseptic loosening of the implant. Methods A cemented modular system (Biomedtrix was used as a hip replacement in 24 adult Swiss Alpine sheep, with one group receiving a complete cement mantle as controls (n = 12, and the other group a cement mantle with a standardized, lateral, primary defect in the cement mantle (n = 12. Animals were followed over time for 2 and 8.5 months (n = 6 each. After sacrifice, samples from the interface membranes were harvested from five different regions of the femur and joint capsule. Explant cell cultures were performed and supernatant of cultures were tested and assayed for nitric oxide, prostaglandin E2, caseinolytic and collagenolytic activity. RNA extraction and quantification were performed for inducible nitric oxide synthase, cyclooxygenase-2, interleukin 1, and interleukin 6. Overall differences between groups and time periods and interactions thereof were calculated using a factorial analysis of variance (ANOVA. Results The development of an interface membrane was noticed in both groups at both time points. However, in the controls the interface membrane regressed in thickness and biological activity, while both variables increased in the experimental group with the primary cement mantle defect over time

  20. Somatosensory evoked potential monitoring of the brachial plexus to predict nerve injury during internal mammary artery harvest: intraoperative comparisons of the Rultract and Pittman sternal retractors.

    Science.gov (United States)

    Jellish, W S; Martucci, J; Blakeman, B; Hudson, E

    1994-08-01

    Brachial plexus injury after coronary artery bypass grafting (CABG) continues to be a common problem postoperatively. With the use of somatosensory evoked potential monitoring (SSEP), neurologic integrity of the brachial plexus during internal mammary artery (IMA) harvest was assessed and the Rultract and Pittman sternal retractors were compared to determine what effect they had on SSEP characteristics. Results showed that the Rultract and Pittman retractors caused large decreases in SSEP amplitudes after insertion, (1.25 +/- 0.14 versus 0.72 +/- 0.09, P < 0.05; and 1.64 +/- 0.27 versus 0.91 +/- 0.14, P < 0.05) respectively. This decrease was noted in 85% of Rultract and 68.75% of Pittman patients, respectively. Amplitudes increased after retractor removal but never returned to baseline values. Cooley retractor placement in the patients not undergoing IMA harvest (control) produced only mild decreases in amplitude. Waveform latency increased in all groups after retractor placement, but these increases were thought to be clinically insignificant. Postoperatively, three patients in each of the IMA retractor groups had brachial plexus symptoms (18%), whereas only one patient in the control group had symptoms. Somatosensory evoked potential monitoring seems to be a sensitive intraoperative monitor for assessing brachial plexus injury during CABG. The nerve plexus seems to be most at risk for pathologic injury during retraction of the sternum for IMA harvest. Though the Rultract retractor caused greater changes in SSEP characteristics than the Pittman, no clinical outcome differences between the two could be ascertained. Using SSEP monitoring may reduce brachial plexus injury during IMA harvest by allowing early detection of nerve compromise and therapeutic interventions to alleviate the insult while under general anesthesia. PMID:7948794

  1. Ingestion of BioCell Collagen®, a novel hydrolyzed chicken sternal cartilage extract; enhanced blood microcirculation and reduced facial aging signs

    Directory of Open Access Journals (Sweden)

    Schwartz SR

    2012-07-01

    Full Text Available Stephen R Schwartz,1 Joosang Park21International Research Services Inc, Port Chester, NY, USA; 2BioCell Technology, LLC, Newport Beach, CA, USAAbstract: Skin aging and its clinical manifestation is associated with altered molecular metabolism in the extracellular matrix of the dermis. In a pilot open-label study, we investigated the effect of a dietary supplement, BioCell Collagen® (BCC, which contains a naturally occurring matrix of hydrolyzed collagen type II and low-molecular-weight hyaluronic acid and chondroitin sulfate, in 26 healthy females who displayed visible signs of natural and photoaging in the face. Daily supplementation with 1 g of BCC for 12 weeks led to a significant reduction of skin dryness/scaling (76%, P = 0.002 and global lines/wrinkles (13.2%, P = 0.028 as measured by visual/tactile score. Additionally, a significant increase in the content of hemoglobin (17.7%, P = 0.018 and collagen (6.3%, P = 0.002 in the skin dermis was observed after 6 weeks of supplementation. At the end of the study, the increase in hemoglobin remained significant (15%, P = 0.008, while the increase in collagen content was maintained, but the difference from baseline was not significant (3.5%, P = 0.134. This study provides preliminary data suggesting that dietary supplementation with BCC elicits several physiological events which can be harnessed to counteract natural photoaging processes to reduce visible aging signs in the human face. A controlled study is necessary to verify these observations.Keywords: BioCell Collagen, chicken sternal cartilage extract, hydrolyzed collagen type II, low-molecular-weight hyaluronic acid, skin aging

  2. Chronic migraine.

    Science.gov (United States)

    Schwedt, Todd J

    2014-01-01

    Chronic migraine is a disabling neurologic condition that affects 2% of the general population. Patients with chronic migraine have headaches on at least 15 days a month, with at least eight days a month on which their headaches and associated symptoms meet diagnostic criteria for migraine. Chronic migraine places an enormous burden on patients owing to frequent headaches; hypersensitivity to visual, auditory, and olfactory stimuli; nausea; and vomiting. It also affects society through direct and indirect medical costs. Chronic migraine typically develops after a slow increase in headache frequency over months to years. Several factors are associated with an increased risk of transforming to chronic migraine. The diagnosis requires a carefully performed patient interview and neurologic examination, sometimes combined with additional diagnostic tests, to differentiate chronic migraine from secondary headache disorders and other primary chronic headaches of long duration. Treatment takes a multifaceted approach that may include risk factor modification, avoidance of migraine triggers, drug and non-drug based prophylaxis, and abortive migraine treatment, the frequency of which is limited to avoid drug overuse. This article provides an overview of current knowledge regarding chronic migraine, including epidemiology, risk factors for its development, pathophysiology, diagnosis, management, and guidelines. The future of chronic migraine treatment and research is also discussed. PMID:24662044

  3. Chronic inflammatory polyneuropathy

    Science.gov (United States)

    Polyneuropathy - chronic inflammatory; CIDP; Chronic inflammatory demyelinating polyneuropathy ... of the body equally. Chronic inflammatory demyelinating polyneuropathy (CIDP) is the most common chronic neuropathy caused by ...

  4. High-dose continuous oxacillin infusion results in achievement of pharmacokinetics targets in critically ill patients with deep sternal wound infections following cardiac surgery.

    Science.gov (United States)

    Nesseler, Nicolas; Verdier, Marie-Clémence; Launey, Yoann; Malherbe, Alexandre; Dermu, Marine; Piau, Caroline; Flécher, Erwan; Tribut, Olivier; Mallédant, Yannick; Seguin, Philippe

    2014-09-01

    Knowledge regarding antimicrobial therapy strategies in deep sternal wound infections (DSWI) following cardiac surgery is limited. Therefore, we aimed to determine the steady-state plasma and mediastinal concentrations of oxacillin administered by continuous infusion in critically ill patients with DSWI and to compare these concentrations with the susceptibility of staphylococci recovered. A continuous infusion of oxacillin (150 to 200 mg/kg of body weight/24 h) was administered after a loading dose (50 mg/kg). Plasma and mediastinal concentrations of total and unbound oxacillin were determined 4 h after the loading dose (H4) and then at day 1 (H24) and day 2 (H48). Twelve patients were included. Nine patients exhibited bacteremia, 5 were in septic shock, 8 were positive for Staphylococcus aureus, and 4 were positive for coagulase-negative staphylococci. The median MIC (first to third interquartile range) was 0.25 (0.24 to 0.41) mg/liter. Median plasma concentrations of total and unbound oxacillin at H4, H24, and H48 were, respectively, 64.4 (41.4 to 78.5) and 20.4 (12.4 to 30.4) mg/liter, 56.9 (31.4 to 80.6) and 21.7 (6.5 to 27.3) mg/liter, and 57.5 (32.2 to 85.1) and 20 (14.3 to 35.7) mg/liter. The median mediastinal concentrations of total and unbound oxacillin at H4, H24, and H48 were, respectively, 2.3 (0.7 to 25.9) and 0.9 (oxacillin delivered by continuous infusion is a valuable strategy to achieve our pharmacokinetic target (4× MIC) at the site of action at H24. But concerns remain in cases of higher MICs, emphasizing the need for clinicians to obtain the MICs for the bacteria and to monitor oxacillin concentrations, especially the unbound forms, at the target site. PMID:24982092

  5. Cell lineage analysis of the mandibular segment of the amphipod Orchestia cavimana reveals that the crustacean paragnaths are sternal outgrowths and not limbs

    Directory of Open Access Journals (Sweden)

    Scholtz Gerhard

    2006-12-01

    Full Text Available Abstract The question of arthropod head segmentation has become one of the central issues in Evolutionary Developmental Biology. The number of theories pertaining to head segments progressively enlarges, old concepts have been revitalized, and nearly every conceivable composition of the arthropod head has at some point received discussion. One contentious issue involves a characteristic mouthpart in crustaceans – the lower lips or the so-called paragnaths. The paragnaths build the posterior border of the mouth region antagonistic to the upper lip – the labrum. We show here the development of the appendage-like structures in the mandibular region of the amphipod crustacean Orchestia cavimana at a high level of cellular resolution. The embryos are examined during development of the mouthparts using in vivo labeling. An invariant cell division pattern of the mandibular segment was detected by 4D-microscopy and a preliminary model for pattern of the first cleavages in the mandibular region created. With this indispensable precondition single ectodermal cells of the grid-like pattern were labeled with DiI – a lipophilic fluorescent dye – to trace cell lineages and determine the clonal composition of the developing mouthparts, especially the mandibular segment. From our data it is evident that the paragnaths are sternal outgrowths of the mandible segment. The assumption of the limb nature of paragnaths and the presence of an additional head segment between the mandibular and the second antennal segments are clearly refuted by our data. Our results show the power of cell lineage and clonal analyses for inferences on the nature, origin and thus homology of morphological structures. With this kind of investigation morphological and gene expression data can be complemented. We discuss notable similarities of paragnath anlagen to those of the hypopharynx complex in myriapods and hexapods. The fact that both structures grow out as two lateral buds

  6. Chronic pancreatitis

    OpenAIRE

    Kocher, Hemant M; Froeling, Fieke EM

    2008-01-01

    Chronic pancreatitis is characterised by long-standing inflammation of the pancreas owing to a wide variety of causes, including recurrent acute attacks of pancreatitis. Chronic pancreatitis affects 3–9 people in 100,000; 70% of cases are alcohol-induced.

  7. Chronic pancreatitis

    OpenAIRE

    Kocher, Hemant M; Kadaba, Raghu

    2011-01-01

    Chronic pancreatitis is characterised by long-standing inflammation of the pancreas due to a wide variety of causes, including recurrent acute attacks of pancreatitis. Chronic pancreatitis affects between 3 and 9 people in 100,000; 70% of cases are alcohol-induced.

  8. Chronic cholecystitis

    Science.gov (United States)

    ... foods may relieve symptoms in people. However, the benefit of a low-fat diet has not been proven. Alternative Names Cholecystitis - chronic Images Cholecystitis, CT scan Cholecystitis, cholangiogram Cholecystolithiasis Gallstones, cholangiogram Cholecystogram References Wang ...

  9. Chronic Pain

    Science.gov (United States)

    ... who have chronic pain may also have low self-esteem, depression, and anger. Causes & Risk Factors What causes ... as stretching and strengthening activities) and low-impact exercise (such as walking, swimming, or biking) can help ...

  10. Chronic Meningitis

    Science.gov (United States)

    ... School Lunch Lines FDA Cracks Down on Antibacterial Soaps Health Tip: Schedule a Back-to-School Dental ... the Professional Version Meningitis Introduction to Meningitis Acute Bacterial Meningitis Viral Meningitis Noninfectious Meningitis Recurrent Meningitis Chronic ...

  11. Chronic Pericarditis

    Science.gov (United States)

    ... Sugar Control Helps Fight Diabetic Eye Disease Are 'Workaholics' Prone to OCD, Anxiety? ALL NEWS > Resources First ... weeks after heart surgery) and is considered subacute. Causes Usually, the cause of chronic effusive pericarditis is ...

  12. Sternal Tuberculosis: An Uncommon Presentation

    OpenAIRE

    Manish Narang; Archana Dwivedi; Shiva Narang; Gopesh Mehrotra

    2011-01-01

    Primary tubercular osteomyelitis of sternum presenting as an acute swelling over chest is an extremely rare presentation in pediatric population. We herein report such a case which was diagnosed by CT scan showing lytic lesion and aspiration revealed positive culture for Mycobacterium tuberculosis. Child improved with antitubercular treatment.

  13. Sternal Tuberculosis: An Uncommon Presentation

    Directory of Open Access Journals (Sweden)

    Manish Narang

    2011-12-01

    Full Text Available Primary tubercular osteomyelitis of sternum presenting as an acute swelling over chest is an extremely rare presentation in pediatric population. We herein report such a case which was diagnosed by CT scan showing lytic lesion and aspiration revealed positive culture for Mycobacterium tuberculosis. Child improved with antitubercular treatment.

  14. Validation of an aseptic process for live attenuated varicella vaccine%水痘减毒活疫苗的无菌生产工艺验证

    Institute of Scientific and Technical Information of China (English)

    马相虎; 陈哲文; 晏子厚

    2015-01-01

    Objective To validate the effectiveness of the aseptic production process of live attenuated varicella vaccine (chickenpox vaccine) by media fill test.Methods The aseptic filling of the vaccine was simulated using Trypticase Soy Broth (TSB,3.2%),with filling volume of 0.6 ml per vial.The vials were incubated after filling,and the sterility of current production process was evaluated by the contamination situation of the media inside the vials.Results The filling batch numbers of 3 media fill tests were 10 160,10 181 and 10 175 vials,respectively.After successive incubation at 20-25 ℃ and 30-35 ℃,contamination rates of TSB all were 0.≥0.5μm airborne particulates were less than 70 per cubic meter at each sampling point in the production area.No ≥ 5.0 μm airborne particulate was detected.There was no colony of settle plate and surface microbial.The growth promotion test and microbial challenging test of TSB were both qualified.Conclusion The aseptic production process of chickenpox vaccine is conformed with good manufacture practice,which can assure its sterility.%目的 通过培养基模拟灌装试验,验证水痘减毒活疫苗(水痘疫苗)无菌生产工艺的有效性.方法 模拟水痘疫苗的无菌灌装工艺,对胰酪胨大豆肉汤培养基(TSB)按0.6 ml/瓶进行模拟灌装,对灌装后小瓶进行培养,根据小瓶内培养基的污染情况,评估现行水痘疫苗无菌生产工艺的有效性.结果 3次TSB模拟灌装试验的灌装批量分别为10 160、10 181和10 175瓶,经20~25℃和30~35℃先后培养后,均未出现TSB污染.在水痘疫苗生产区域的各监测点,≥0.5μm悬浮粒子均≤70粒/m3,≥5.0 μm悬浮粒子均为0;沉降菌和表面微生物的菌落计数均为0;培养基灵敏度检查和微生物挑战试验均合格.结论 水痘疫苗的无菌生产工艺符合药品生产质量管理规范的要求,可确保产品的无菌性.

  15. Evaluation of negative pressure vacuum-assisted system in acute and chronic wounds closure: our experience.

    Science.gov (United States)

    Chiummariello, S; Guarro, G; Pica, A; Alfano, C

    2012-10-01

    Negative-pressure therapy or vacuum-assisted closure (VAC) has been used in clinical applications since the 1940's and has increased in popularity over the past decade. This dressing technique consists of an open cell foam dressing put into the wound cavity, a vacuum pump produces a negative pressure and an adhesive drape. A controlled sub atmospheric pressure from 75 to 150 mmHg is applied. The vacuum-assisted closure has been applied by many clinicians to chronic wounds in humans; however it cannot be used as a replacement for surgical debridement. The initial treatment for every contaminated wound should be the necrosectomy. The VAC therapy has a complementary function and the range of its indications includes pressure sores, stasis ulcers, chronic wounds such as diabetic foot ulcers, post traumatic and post operative wounds, infected wounds such as necrotizing fasciitis or sternal wounds, soft-tissue injuries, bone exposed injuries, abdominal open wounds and for securing a skin graft. We describe our experience with the VAC dressing used to manage acute and chronic wounds in a series of 135 patients, with excellent results together with satisfaction of the patients. PMID:23095568

  16. Effects of Parasternal Block on Acute and Chronic Pain in Patients Undergoing Coronary Artery Surgery.

    Science.gov (United States)

    Doğan Bakı, Elif; Kavrut Ozturk, Nilgün; Ayoğlu, Rauf Umut; Emmiler, Mustafa; Karslı, Bilge; Uzel, Hanife

    2016-09-01

    Background Sternotomy causes considerable postoperative pain and postoperative pain management encompasses different analgesic regimens. In this study, we aimed to investigate the effect of peroperative parasternal block with levobupivacaine on acute and chronic pain after coronary artery bypass graft surgery. Materials and Methods A total of 81 patients undergoing coronary artery bypass graft surgery were included in this study. Patients were randomly allocated by opening an envelope to receive either parasternal block with pharmacologic analgesia (group P; before sternal wire placement: sternotomy and mediastinal tube sites were infiltrated with local anesthetics) or pharmacologic analgesia alone (group C) for postoperative pain relief. All patients received intravenous tramadol with patient-controlled analgesia at the end of the surgery. Demographic characteristics, vital signs, tramadol consumption, analgesic intake, and intensity of pain with a visual analogue scale were recorded for each patient. Six months after surgery, the patients' type of chronic pain was evaluated using the Leeds Assessment Neuropathic Symptoms and Signs pain scale questionnaire. Results Patients who received parasternal block experienced less pain and needed less opioid analgesic (125.75 ± 28.9 mg in group P vs 213.17 ± 61.25 mg in group C) for 24 hours postoperatively (P block had a benefical effect on the management of postoperative acute pain and decreased opioid consumption after surgery but had no significant effect in chronic post surgical pain. PMID:25900900

  17. Chronic myelogenous leukemia (CML)

    Science.gov (United States)

    CML; Chronic myeloid leukemia; Chronic granulocytic leukemia; Leukemia - chronic granulocytic ... nuclear disaster. It takes many years to develop leukemia from radiation exposure. Most people treated for cancer ...

  18. Chronic obstructive pulmonary disease

    Science.gov (United States)

    ... airways disease; Chronic obstructive lung disease; Chronic bronchitis; Emphysema; Bronchitis - chronic ... a protein called alpha-1 antitrypsin can develop emphysema. Other risk factors for COPD are: Exposure to ...

  19. The preparation of aseptic rabbit tissue cage infection model%兔组织笼无菌感染模型的制备

    Institute of Scientific and Technical Information of China (English)

    刘树玲; 丁丽; 邢昆

    2015-01-01

    目的:制备兔组织笼无菌感染模型,为药物药动学-药效学结合模型(pharmacokinetic‐pharmaco‐dynamic modeling ,PK‐PD)研究提供在体动物实验载体。方法选取健康家兔28只,耳缘静脉注射盐酸赛拉嗪注射液0.15ml/kg麻醉,每只分别背部备皮、切开皮肤,然后在皮下植入长约5cm的无菌中空胸腔引流管1个,继而在无菌操作下手术缝合。术后应用青霉素肌肉注射3d以预防感染。结果5只家兔先后因不同原因死亡,23只家兔均获得清亮的无菌组织液,成功建立兔组织模型,成功率为82.14%。结论通过严格控制无菌操作,选择合适的麻醉剂,手术刀口选择在兔背部,术后及时预防感染,可以成功制备兔组织笼无菌感染模型,并获得清亮的无菌组织液。%Objective To prepare a rabbit tissue cage model so as to provide drug animal carrier in vivo for drug PK‐PD modeling study .Methods 28 healthy rabbits were selected and injected with the anesthesia xylazine iv respectively .The back hair was cut in each rabbit ,and then the skin was cut open .A 5cm of sterile hollow chest tube drainage was implanted subcutaneously .In the end the wound was sewed up with aseptic technique .After op‐eration penicillin im was injected for 3 days to prevent infection .Results Among the 28 rabbits ,5 rabbits were dead due to different causes .Clear and sterile tissue fluid were gotten from other 23 rabbits .A rabbit tissue model was established successfully ,and the success rate was 82 .14% .Conclusion By stricted controlling aseptic opera‐tion ,selecting the appropriate anesthesia and surgical incision in the back of the rabbit ,timely postoperative anti‐infection ,a rabbit tissue cage model can be successfully established ,so does clear tissue fluid .

  20. Low back pain - chronic

    Science.gov (United States)

    Nonspecific back pain; Backache - chronic; Lumbar pain - chronic; Pain - back - chronic; Chronic back pain - low ... Low back pain is common. Almost everyone has back pain at some time in their life. Often, the exact cause of ...

  1. Chronic Pelvic Pain

    Science.gov (United States)

    ... Events Advocacy For Patients About ACOG Chronic Pelvic Pain Home For Patients Search FAQs Chronic Pelvic Pain ... Pain FAQ099, August 2011 PDF Format Chronic Pelvic Pain Gynecologic Problems What is chronic pelvic pain? What ...

  2. Employees with Chronic Pain

    Science.gov (United States)

    ... Home | Accommodation and Compliance Series: Employees with Chronic Pain By Beth Loy, Ph.D. Preface Introduction Information ... at http://AskJAN.org/soar. Information about Chronic Pain How prevalent is chronic pain? Chronic pain has ...

  3. Marked MMP-2 transcriptional up-regulation in mononuclear leukocytes invading the subarachnoidal space in aseptic suppurative steroid-responsive meningitis-arteritis in dogs.

    Science.gov (United States)

    Schwartz, M; Puff, C; Stein, V M; Baumgärtner, W; Tipold, A

    2010-02-15

    Canine Steroid-Responsive Meningitis-Arteritis (SRMA) is a suitable animal model for studies on the development of neutrophilic pleocytosis in aseptic meningitis. Samples of dogs in the acute phase of SRMA (n=16) were examined for gene expression of matrix metalloproteinases (MMP)-2 and -9 and tissue inhibitors of metalloproteinases (TIMP)-1 and -2. Results were compared to those of dogs under glucocorticosteroid treatment for SRMA (n=16) and dogs with other inflammatory and neoplastic diseases of the central nervous system (CNS) (n=19). Samples included mononuclear (PBMCs) and polymorphonuclear cells (PBPMNs) of peripheral blood and cerebrospinal fluid white blood cells (CSF WBCs). In the acute phase of SRMA CSF WBCs showed mRNA expression for MMP-2 and -9 and TIMP-1 and -2, highlighting a contribution of these cells to the overall content of MMPs and TIMPs in CSF. MMP-2 mRNA levels in CSF WBCs were significantly up-regulated in comparison to PBMC expression levels, suggesting that MMP-2 is relevant for PBMC invasion into the subarachnoidal space and that the expression is influenced by migratory activity through the blood-CSF-barrier. PMID:19733404

  4. Sensory characteristics and consumer acceptance of frozen cooked rice by a rapid freezing process compared to homemade and aseptic packaged cooked rice.

    Science.gov (United States)

    Kwak, Han Sub; Kim, Hye-Gyeong; Kim, Hyun Suk; Ahn, Yong Sik; Jung, Kyunghee; Jeong, Hyo-Young; Kim, Tae Hyeong

    2013-03-01

    Descriptive analysis and consumer acceptance tests were conducted with frozen (FCR), homemade (HCR), and aseptic-packaged (ACR) cooked rice products from two cultivars-IM and SD. FCR was prepared using a rapid freezing process, which may provide consumers with a quality similar to that of HCR. The intensity of the flavors of roasted, glutinous rice, rice cake, and rice starch and the textures of glutinousness, moistness, chunkiness, adhesiveness, and squishiness were all greater in the FCR as compared to the HCR and ACR (p0.05); however, in most cases these factors showed significant differences when compared with ACR (p<0.05). From partial least square regression analysis, cooked rice was positively related to sweet, transparency, glossiness, roasted, glutinousness, chunkiness, moistness, glutinous rice, adhesiveness, rice shape, rice starch, and squishiness attributes but negatively related to raw rice, old rice, old rice aroma, a particle feeling, off-aroma, white color, scatteredness, slickness, size of cooked rice, and firmness attributes. PMID:24471112

  5. 101例儿童无菌性脑炎的临床特点分析%The clinical features of 101 cases of children with aseptic encephalitis

    Institute of Scientific and Technical Information of China (English)

    王贤柱; 李玖军

    2015-01-01

    Objective To observe and discus the clinical features and outcome of aseptic encephali-tis in children. Methods One hundred and one cases treated in PICU of Shengjing Hospital of China Medi-cal University and diagnosed with aseptic encephalitis from December 2009 to December 2012 were enrolled. Results The clinical manifestations, signs, laboratory examinations and outcome were analyzed retrospec-tively. Among them, 54 cases were male,47 cases were female,12 cases aged from 1 month old to 6 months old,12 cases aged from 7 months old to 1 year old,36 cases aged from 2 years old to 3 years old,12 cases aged from 4 years old to 6 years old,19 cases aged from 7 years old to 14 years old. The fever was the most common clinical manifestation, a total of 92 cases ( 91. 1%) , followed by convulsions, a total of 79 cases (78. 2%),63 cases with meningeal irritation or pathological signs positive(62. 4%). The sensitivity of elec-troencephalography( EEG) was the highest for diagnosis of aseptic encephalitis,89 cases underwent EEG with abnormal rate of 84. 3%(75/101). Followed by head MRI scan,97 cases underwent head MRI scan with ab-normal rate of 55. 7%(54/101). All cases underwent cerebrospinal fluid examination,50 cases with white blood cells and(or) protein increased(49. 5%). The sensitivity of head CT scan was the lowest,the abnor-malities were found in 11 cases ( 17. 5%) among 63 cases underwent head CT scan. All cases were given comprehensive treatment of sedation, antifebrile, reducing intracranial pressure and nerve nutrational treat-ment. Seventy cases were cured,20 cases left neurological sequelae,7 cases gave up treatment,4 cases died. Conclusion The children aseptic encephalitis occurs in infants and young children,the incidence of male and female are equal. The clinical manifestations are diverse,the most common manifestations are fever and con-vulsion,EEG and MRI are with high sensitivity. Most patients have good outcome if received symptomatic treatment early

  6. The value of contrast and subtraction arthrography in the assessment of aseptic loosening of total hip prostheses: A meta-analysis

    International Nuclear Information System (INIS)

    Objective: To summarize and compare the diagnostic accuracy of contrast and subtraction arthrography in the assessment of aseptic loosening of total hip arthroplasties. Design: This meta-analysis was performed using methods described by the Cochrane Methods Group on Systematic Reviews of Screening and Diagnostic Tests. We included original, English-language papers published between January 1975 to October 2004 that examined contrast-enhanced arthrography with or without subtraction for diagnosis of loosening of total hip prostheses. A qualitative and quantitative analysis was performed by two investigators. Results: With regard to the acetabular component, pooled sensitivity and specificity for contrast arthrography was 70% (95% confidence interval, 52-84) and 74% (95% CI, 53-87), respectively. Subtraction arthrography had a significantly higher sensitivity of 89% (95% CI, 84-93) (p = 0.01), with a similar specificity of 76% (95% CI, 68-82). For the femoral component, pooled sensitivity and specificity for contrast arthrography were 63% (95% CI, 53-72) and 78% (95% CI, 68-86). Pooled estimates for subtraction arthrography revealed a significantly higher sensitivity of 86% (95% CI, 74-93) (p = 0.003). Specificity was 85% (95% CI, 77-91) and was similar to the data of contrast arthrography (p = 0.23). Conclusion: Using the present data we found that the subtraction arthrography is a sensitive technique for detection of loosening of total hip prostheses, offering added value over contrast arthrography, especially for evaluation of the femoral component

  7. 托盘包装和无菌包装在冷鲜羊肉贮藏中的对比%Comparison of pallet packaging and aseptic packaging in chilled mutton storage

    Institute of Scientific and Technical Information of China (English)

    王永刚; 王长明

    2015-01-01

    The pallet packaging and aseptic packaging were taken to do experiment respectively. The total number of colonies, pH and TVB -N of mutton in the process of storage under 3 ± 1℃were measured to research the effect of natural preservatives combined with pallet packing or aseptic packaging on extending mutton preservation. The results showed that the effect of aseptic packaging was better than the pallet packaging. Combined with the leaf,wild chrysanthemum flowers,and plum extract,mutton could keep second freshness in 15 days.%分别采用托盘包装和无菌包装进行试验,通过测定在3±1℃下贮存过程中菌落总数、pH值及TVB-N,了解天然防腐剂结合托盘包装或无菌包装对延长羊肉保鲜的效果。结果表明:无菌包装的包装效果优于托盘包装,结合大青叶、野菊花、乌梅提取液可使冷鲜羊肉15d内保持在二级鲜度。

  8. Chronic coughing

    International Nuclear Information System (INIS)

    Chronic coughing was acknowledged to result from pathological state of the respiratory organs. Cardiac diseases could be accompanied by coughing as well. It was recommended to perform x-ray examinations, including biomedical radiography of the chest, computerized tomography, scintiscanning with 67Ga-citrate, bronchi examination in order to exclude heart disease. The complex examination permitted to detect localization and type of the changes in the lungs and mediastinum, to distinguish benign tumor from malignant one

  9. Effects of low dosage Co-60 irradiation in the course of aseptic arthritis of the knee joint of rabbits; Effekte einer niedrig dosierten Co-60-Bestrahlung auf den Verlauf einer aseptischen Arthritis am Kniegelenk des Kaninchens

    Energy Technology Data Exchange (ETDEWEB)

    Fischer, U.; Koch, F.; Ludewig, E. [Univ. Leipzig (Germany). Veterinaermedizinische Fakultaet; Kamprad, F.; Melzer, R.; Hildebrandt, G. [Leipzig Univ. (Germany). Klinik fuer Strahlentherapie und Radioonkologie

    1998-12-01

    Purpose: Numerous clinical observations demonstrate the efficacy of low radiation doses in the treatment of painful osteoarthritis. Experimental investigations remain scarce. We investigated the effects of locally daily 5 times 1.0 Gy 60-Co irradiation on an artificially induced aseptic gonarthritis in rabbits. Material and methods: Three separate experiments (EV) were performed (10 rabbits per experiment, 5 treated/5 controls; duration: EV1: 18 days; EV2: 6 days; EV3: 29 days). An aseptic arthritis in the right knee joint of rabbits was induced by intraarticular injection of 0.5 ml papain solution (3%, 30,000 USP/mg) on day 0. The arthritic knee joint of the anesthesized animals was irradiated daily from day 1 to 5 with 5 times 1.0 Gy. The controls were sham-irradiated under the same conditions. The time course of arthritis in treated animals and sham-treated controls was evaluated by clinical, laboratory-chemical and histological criteria. The clinical investigation was performed daily, the puncture of the knee-joints was carried out several times in EV1, and at the end of experiments in EV2 and EV3. At the end of the observation period, animals were killed and the knee joints excised for histological analysis. Results: The intraarticular injection of papain caused a peracute inflammatory response in all animals. After 1 week the chronical stage was reached, and the experimental arthritis resolved slowly within several weeks. Local irradiation accelerated the decrease of inflammatory joint swelling, being significant by day 4. On day 6 the volume of synovial fluid in irradiated knee-joints was significantly smaller. The morphometric data indicated a reduction in thickness of synovial membrane, a decrease in number of synovial cell layers, and a decrease in distance between capillaries and the synovial membrane surface following irradiation of arthritic joints. Due to considerable individual variability, the morphometric data partially did not reach statistically

  10. Application of delayed sternal closure in surgery for children with complex congenital heart disease%延迟关胸技术在小儿复杂先天性心脏病手术中的应用

    Institute of Scientific and Technical Information of China (English)

    刘洋; 张刚成; 卢蓉; 余莹

    2015-01-01

    Objective To discuss the application value of delayed sternal closure in surgery for children with complex congenital heart disease. Methods A total of 79 children with complex congenital heart disease accepted delayed sternal closure after operations,including 36 cases of Switch operation,25 cases of TOF surgery,7 cases of TAPVC,3 cases of Rastelli operation,2 cases of palliative reconstruction of right ventricular outflow tract,2 cases of Nikaidoh operation,1 case of bidirectional Glenn operation,2 cases of aortic arch plasty and 1 case of aortopulmonary window repair. Results After delayed sternal clo-sure,there were 36 cases(45. 57% )of myocardial tissue edema,28 cases(35. 44% )of acute renal dam-age,28 cases(35. 44% )lung infection,22 cases(27. 85% )of severe wound bleeding,12 cases(15. 19% ) cases of pulmonary hemorrhage,8 cases(10. 13% )of acute liver damage,5 cases of high grade A-V block (6. 33% ),2 cases(2. 53% )of urinary tract infection and 1 case(1. 27% )in each of perfusion lung,deep vein thrombosis,paralytic ileus,diaphragmatic paralysis,intracranial hypertension and chylothorax. The av-erage open time of the sternum was(62. 2 ± 9. 3)h. There were 73 cases(92. 41% )of successful delay sternal closure and 6 cases(7. 59% )of death. Conclusion Delayed sternal closure is a simple,safe and effective solution for postoperative bleeding,myocardial edema,low cardiac output syndrome while does not increase the incidence of wound infection.%目的:探讨延迟关胸技术在小儿复杂先天性心脏病手术中的应用价值。方法小儿复杂先天性心脏病术后延迟关胸79例,其中大动脉调转(Switch)术36例,法洛四联症(TOF)根治术25例,完全肺静脉异位引流(TAPVC)矫治术7例,心室内隧道外管道(Rastelli)术3例,姑息右室流出道疏通术2例,主动脉移植(Nikaidoh)术2例,双向上腔肺动脉连接(Gleen)术1例,主动脉弓部成形术2例,主肺动脉窗修补术1例

  11. 胸骨正中切口术后胸骨骨髓炎及纵隔感染的修复重建%Reconstruction for poststernotomy sternal osteomyelitis and mediastinitis follow median sternotomy

    Institute of Scientific and Technical Information of China (English)

    王文璋; 高举; 王幼黎; 蔡爱兵; 高永顺

    2011-01-01

    Objective: To evaluate the clinical effect of debridement and thoracic reconstruction as surgical treatment for sternal osteomyelitis and mediastinitis after sternotomy. Methods: The surgical procedures, clinical results and follow-up of 58 cases of poststernotomy sternal osteomyelitis and mediastinitis those underwent debridement and thoracic reconstruction with pectoralis major muscle flaps from January 2008 to April 2011 were analyzed retrospectively. Results: All 58 muscle flaps remained alive. 52 patients recovered and discharged in 2 weeks ,4 patients were discharged in 4 weeks for infection. 2 patients presented subcutaneous infection at 1 week post discharge, but recovered following local debridement and medication. No patients showed subcutaneous infection recurrence during the follow-up period. Conclusion: Debridement and thoracic reconstruction with pectoralis major muscle flap are safe and effective in the treatment of poststemotomy sternal osteomyelitis and mediastinitis.%目的:探讨应用胸大肌肌瓣转移,修复重建治疗经胸骨正中切口术后,胸骨骨髓炎及纵隔感染的临床疗效.方法:回顾性分析我科自2008年1月至2011年4月,应用胸大肌肌瓣转移手术治疗58例胸骨正中切口,术后胸骨骨髓炎及纵隔感染患者的临床资料.手术方法为彻底清创,用转移的胸大肌肌瓣将胸骨缺损区填实消灭残腔,放置带负压吸引装置的引流管,保障伤口引流通畅.结果:58例患者肌瓣成活良好,52例2w内康复出院.4例患者因切口皮下感染延迟1 w出院,2例患者出院后1w再次出现伤口皮下感染,经局部清创、换药后伤口痊愈.所有患者经随访无感染复发.结论:手术彻底清除感染的软组织,咬除感染的胸骨,应用胸大肌肌瓣转移来填充清创后的胸骨缺损区,术后伤口充分引流,是治疗经胸骨正中切口手术术后胸骨骨髓炎及纵隔感染的有效方法.

  12. 微创改良胸肋抬举术治疗漏斗胸%Minimally invasive surgical treatment of improved costa sternales lifts in treatment of congenital funnel chest

    Institute of Scientific and Technical Information of China (English)

    杜佳辉; 赵松; 侯智亮; 薛颢雨; 贾敬周

    2012-01-01

    Objective To investigate the safety and effect of minimally invasive surgical treatment of improved costa ster-nales lifts in treatment the children with congenital funnel chest. Methods Fifty patients were retrospectively evaluated with congenital funnel chest including the males (n =35) and females(n = 15). There were eleven patients with asymmetric funnel chest and eight patients combined with costal margin holds the deformity. All the patients were enforced the minimally invasive costa sternales lifts technique. The improvement was a small longitudinal incision on the chest wall about 3 ~5cm. Intersecting sternum with the V - type keeped continuous complete and continuous periosteum after resection of cartilage. We exalted the fixed sternum after keepping the continuous rib periosteum and shortting the periosteum complete ribs. Results The sternum raised about an average of 3. 1 (1. 5 - 5.0) cm and the average spinula between sternum and spine was about 6. 2 (4.0 ~ 9. 7) cm. Follow - up 3 - 24months, funnel chest of all the patients were corrected and eight patients combined with costal margin were corrected satisfactorily. Only one patient left chest wall a-symmetry and flat chest. Serious complication was not observed. Conclusions The minimally invasive surgical treatment of improved costa sternales lifts in treatment of the children with congenital funnel chest may be a safe and effective method with small trauma and few complications and may be worthy to be popularized.%目的 探讨微创改良胸肋抬举术治疗儿童先天性漏斗胸的安全性和疗效.方法 回顾性分析先天性漏斗胸患儿50例,男35例,女15例.其中不对称漏斗胸11例,合并肋缘外翻畸形8例.均行微创改良胸肋抬举术,即胸壁纵行小切口,长3~5cm,V型横断胸骨保留其后骨膜连续完整,间断切除肋软骨,保留骨膜连续完整,折叠、缩短缝合肋骨骨膜,抬举并固定胸骨,从而矫治漏斗胸.结果 术后胸骨平均抬高3

  13. AUTOLOGOUS SERUM SKIN TESTING (ASST IN CHRONIC IDIOPATHIC URTICARIA

    Directory of Open Access Journals (Sweden)

    Arun

    2014-01-01

    Full Text Available Chronic idiopathic urticaria (CIU is a form of urticaria , in which there appears to be persistent activation of mast cells , but the mechanism of mast cell triggering is unknown. The Autologous serum skin test (ASST is an in vivo test which assesses auto reactivity. ASST could be good screening test for Autoreactive urticaria a subset of chronic idiopathic urticaria. AIMS : To study the clinical profile of chronic idiopathic urticaria and pattern of ASST among p atients of chronic idiopathic urticaria. METHODS : Study included 200 patients of CIU that were recruited from outpatient department (OPD. Patient s with a history of urticaria for more than 6 weeks were included in the study. The detailed history , cutaneou s and systemic examination was done. ASST was performed under strict aseptic precaution. RESULTS : Out of 200 patients 100 were male and 100 were female. Mean age of patients was 31.9 yrs. Most common age group was 25 - 34yrs. ASST was found positive in 36(18 % patients. In most of the patients duration of disease was less than 11months (42% with the mean duration of disease 21.74 months. Mean duration of wheal was 64.7 minutes , in which most of the patients (112 having duration of wheal less than 59 min. Hi story of angioedema was positive in 109(54.5% patients. Aggravating factors were positive in 50(25% patients in which drugs and cold were the most common. Family history of urticaria and angioedema was present in 35 patients. None of patient complained a ny adverse reactions during and after ASST. CONCLUSION : ASST is the easily available bed side test for the diagnosis of autoreactive urticaria. It is a simple , inexpensive , semi invasive and easy - to - perform test which can be done and recorded by the dermat ologist himself. ASST may help in diagnosis and management of chronic idiopathic urticaria.

  14. Chronic Insomnia

    OpenAIRE

    Buysse, Daniel J.

    2008-01-01

    Ms. F, a 42-year-old divorced woman, presents for evaluation of chronic insomnia. She complains of difficulty falling asleep, often 30 minutes or longer, and difficulty maintaining sleep during the night, with frequent awakenings that often last 30 minutes or longer. These symptoms occur nearly every night, with only one or two “good” nights per month. She typically goes to bed around 10:00 p.m. to give herself adequate time for sleep, and she gets out of bed around 7:00 a.m. on work days and...

  15. Acupuncture for Chronic Urinary Retention due to Spinal Cord Injury: A Systematic Review

    Directory of Open Access Journals (Sweden)

    Jia Wang

    2016-01-01

    Full Text Available No systematic review has been published on the use of acupuncture for the treatment of chronic urinary retention (CUR due to spinal cord injury (SCI. The aim of this review was to assess the effectiveness and safety of acupuncture for CUR due to SCI. Three randomized controlled trials (RCTs including 334 patients with CUR due to SCI were included. Meta-analysis showed that acupuncture plus rehabilitation training was much better than rehabilitation training alone in decreasing postvoid residual (PVR urine volume (MD −109.44, 95% CI −156.53 to −62.35. Likewise, a combination of acupuncture and aseptic intermittent catheterization was better than aseptic intermittent catheterization alone in improving response rates (RR 1.23, 95% CI 1.10 to 1.38. No severe adverse events were reported. In conclusion, acupuncture as a complementary therapy may have a potential effect in CUR due to SCI in decreasing PVR and improving bladder voiding. Additionally, acupuncture may be safe in treating CUR caused by SCI. However, due to the lack of high quality RCTs, we could not draw any definitive conclusions. More well-designed RCTs are needed to provide strong evidence.

  16. Acupuncture for Chronic Urinary Retention due to Spinal Cord Injury: A Systematic Review.

    Science.gov (United States)

    Wang, Jia; Zhai, Yanbing; Wu, Jiani; Zhao, Shitong; Zhou, Jing; Liu, Zhishun

    2016-01-01

    No systematic review has been published on the use of acupuncture for the treatment of chronic urinary retention (CUR) due to spinal cord injury (SCI). The aim of this review was to assess the effectiveness and safety of acupuncture for CUR due to SCI. Three randomized controlled trials (RCTs) including 334 patients with CUR due to SCI were included. Meta-analysis showed that acupuncture plus rehabilitation training was much better than rehabilitation training alone in decreasing postvoid residual (PVR) urine volume (MD -109.44, 95% CI -156.53 to -62.35). Likewise, a combination of acupuncture and aseptic intermittent catheterization was better than aseptic intermittent catheterization alone in improving response rates (RR 1.23, 95% CI 1.10 to 1.38). No severe adverse events were reported. In conclusion, acupuncture as a complementary therapy may have a potential effect in CUR due to SCI in decreasing PVR and improving bladder voiding. Additionally, acupuncture may be safe in treating CUR caused by SCI. However, due to the lack of high quality RCTs, we could not draw any definitive conclusions. More well-designed RCTs are needed to provide strong evidence. PMID:27190542

  17. 肿瘤型假体无菌性松动的治疗现状%Current status of the treatment of aseptic loosening in tumor prostheses

    Institute of Scientific and Technical Information of China (English)

    高明; 张清; 牛晓辉

    2014-01-01

    Aseptic loosening ( AL ) is one of the most common complications in tumor prostheses. Loss of bone quantity and decline of bone quality are the main challenges that orthopedists encounter when they deal with AL. Based on the latest reports, prosthesis revision is the primary choice in the treatment of AL, and it can provide relatively satisfactory outcomes when compared with other methods. While it needs enough bone quantity and good bone quality for prosthetic stability. In some reports, it can get a median Musculoskeletal Tumor Society ( MSTS ) functional score of 96% ( range: 50%-100% ) after an average follow-up of 101 months ( range: 47-155 months ) after the surgery. Besides this, allograft-prosthesis composites ( APCs ) are another choice. Allograft segments are used to construct a certain ifxation arm to get a more stable ifxation. However, its outcomes are not as satisfactory as that of prosthesis revision. According to some reports, after an average follow-up of 59 months after the surgery, it can provide an average MSTS functional score of 62% ( range: 57%-67% ). While we must take account that these patients receiving APCs always have less bone quantity and worse bone quality, when compared with those only receiving prosthetic treatment. In recent years, a new type of prosthesis based on extra-cortical plate ifxation has been used in the revision, which is superior to the conventional intramedullary stem prosthesis. The current results illustrate that it has certain application prospects, but high-quality studies are needed to further demonstrate it. When the loss of bone quantity and decline of bone quality are too serious to perform limb salvage treatment, rotationplasty and amputation may be a choice. However, great attention must be paid to their indications.

  18. [A case of agammaglobulinemia with chronic enteroviral meningomyelitis].

    Science.gov (United States)

    Ito, N; Kokubo, Y; Narita, Y; Naito, Y; Kuzuhara, S

    1996-02-01

    We report a 30-year-old man with agammaglobulinemia and chronic aseptic meningomyelitis. The patient was diagnosed as having X-linked recessive agammaglobulinemia at 4 years of age and gammaglobulin supplementation was started. He had TIA-like episodes several times since 25 years of age. He developed difficulty in micturition and impotence at 29 years of age. Neurological examination revealed bilateral deafness, contracture of knee joints, slight weakness and areflexia in the lower extremities, Babinski sign and dysuria. There was sensory disturbance in the lower extremity on the left. There was not consciousness disturbance or meningeal irritation sign. The cerebrospinal fluid findings included pleocytosis and increase in protein. Enterovirus RNA was detected in the cerebrospinal fluid by the modified polymerase chain reaction (PCR) method. MRI of lower spinal cord showed syrinx formation in the lumbosacral cord and CT of the brain showed bilateral temporal lobe atrophy and temporoparietal subdural fluid collection on the left. 123I-IMP SPECT showed decrease in the cerebral blood flow in the whole brain. EEG showed diffuse slow activity, suggesting the subclinical encephalopathy. Chronic enteroviral meningoencephalitis with agammaglobulinemia (CEMA) is one of the complications of agammaglobulinemia. However, myelitis without apparent encephalopathy is very rare. To our knowledge, there have been no reports of spinal sylinx formation in CEMA. PMID:8752685

  19. Chronic recurrent multifocal osteomyelitis: how to suggest this diagnosis?; L`osteite chronique recurrente multifocale. Un diagnostic qu`il faut savoir evoquer

    Energy Technology Data Exchange (ETDEWEB)

    Saint-Martin, Ch. [UCL Cliniques Saint-Luc, Bruxelles (Belgium); Kurelovic, I.; Soler, C.; Geoffray, A. [Fondation Laval, 06 - Nice (France); Durckel, J. [Hopital Hautepierre, 67 - Strasbourg (France)

    1997-09-01

    Chronic recurrent multifocal osteomyelitis is a rare disorder that affects children and teenagers. Clinically, it is characterized by insidious onset of local swelling and pain in several metaphyses. A symmetric, recurrent and multifocal pattern is usual. Spinal involvement is possible. Inconstant association with a cutaneous affection (palmo-plantar pustulosis, acne fulminans, psoriasis), or less frequently with an inflammatory chronic gut disorder is described. Pathogenesis usually recognized is an enthesopathy. Enthesitis may progress to the osseous part of the enthese and produce an aseptic chronic osteomyelitis. Biopsy specimen with culture is certainly necessary to rule out bacterial osteomyelitis and bone tumor. It is particularly true when the bone lesion is isolated. Disease course is benign and self-limited. The clinical course is characterized by recurrences and remissions occurring for 6 to 10 years. Treatment based on non steroid anti-inflammatory drugs is usually effective. (authors). 17 refs.

  20. Atypical Chronic Myelogenous Leukemia

    Science.gov (United States)

    ... myeloproliferative neoplasms, leukemia , and other conditions . Chronic Myelomonocytic Leukemia Key Points Chronic myelomonocytic leukemia is a disease ... chance of recovery) and treatment options. Chronic myelomonocytic leukemia is a disease in which too many myelocytes ...

  1. Living with Chronic Bronchitis

    Science.gov (United States)

    ... from the NHLBI on Twitter. Living With Chronic Bronchitis If you have chronic bronchitis, you can take steps to control your symptoms. ... and a pneumonia vaccine. If you have chronic bronchitis, you may benefit from pulmonary rehabilitation (PR). PR ...

  2. Is cementing technique the cause of early aseptic loosening of the tibial component in total knee arthroplasty? A report of 22 failed tibial components

    Directory of Open Access Journals (Sweden)

    Stefan Endres

    2011-05-01

    whether early aseptic loosening is still acceptable nowadays from the medical economic aspects also warrants discussion.

  3. The effect of Lipoxin A4 on the interaction between macrophage and osteoblast: possible role in the treatment of aseptic loosening

    Directory of Open Access Journals (Sweden)

    Sun Li

    2009-06-01

    Full Text Available Abstract Background Aseptic loosening (AL is the main problem of total joints replacement (TJR by the implantation of permanently prosthetic components. In vitro and in vivo studies have clearly demonstrated that wear debris and its byproducts could trigger inflammation in the peri-implant tissue. Lipoxins (LXs are endogenous eicosanoids synthesized locally from arachidonate acid (AA at sites of inflammation and mediate pro-resolving activity. A number of studies have demonstrated the effect of LXA4 to counteract inflammation in different cell and animal models, but till now, no relative report about the role of LXs in progress or prevention of AL. Methods Murine RAW264.7 macrophage cell line and MC3T3-E1 osteoblasts (OB cell line were purchased. Co-cultured model of these two cell lines was established. To explore the effect of exogenous Lipoxin A4 (LXA4 on polymethylmethacrylate (PMMA induced inflammation, pro-inflammatory cytokines including TNF-α, IL-1β, PGE2 and GM-CSF were measured by ELISA kits and bone resorption was quantified by measuring calcium release from 5-day-old mice calvaria in vitro. To determine further the endogenous effect of LXA4, cells were co-cultured and with or without 15-lipoxygease (15-LO blocking by 15-LO siRNA. Both real-time PCR and western blotting were applied to confirm the inhibitory efficiency of 15-LO by siRNA. Results 0.1 mg/ml, 0.5 mg/ml and 1.0 mg/ml PMMA showed a time-dependent manner to trigger production of all the pro-inflammatory cytokines studied. Exogenous 0–100 nM LXA4 presented an inhibitory effect on both generation of above cytokines and PMMA stimulated calvarial bone resorption with a dose-dependent manner. LXA4 in supernatant from neither rest macrophages nor macrophages cultured alone exposing to PMMA was detectable. In co-cultured cells challenged by PMMA, LXA4 was increased significantly, while, this enhance could be partly inhibited by 15-LO siRNA. When LXA4 generation was blocked

  4. 自制编号牌在骨科手术无菌包中的应用%Application of Aseptic Package with Self-made Numbered plate in Orthopedics Operation

    Institute of Scientific and Technical Information of China (English)

    梁佳佳; 廖涛

    2013-01-01

    Objective: To explore the application effect of self-made numbered plate in orthopedics operation sterile package. Meth-ods: Based on section of management time, aseptic package from January 2010 to August 2010 was divided into the control group and experimental group, working time of nurses, numbers of expired packages, effective usage rate of aseptic package and satisfac-tion degree of nursing were compared between two groups. Results: The experimental group working time of nurses shortened, the number of expired package minimized, the effective utilization rate of aseptic package was improved, and satisfaction degree of nurs-ing was better. Conclusion: The management of numbered aseptic package can greatly save the working time of nurses, improve work efficiency, avoid repeating sterilization that shortened equipment life, and reduce the cost of running hospital.%  目的:探讨自制编号牌在骨科手术无菌包中的应用效果。方法:将2010年1月至2010年8月的无菌包按照管理时间段分为对照组和实验组,对比两组护士工作时间、过期包个数、无菌包的有效使用率及护士满意度。结果:实验组护士的工作时间缩短,过期包数量减少,无菌包的有效使用率提高,护士满意度高。结论:对无菌包的编号管理大大节约了护士工作时间,提高了工作效率,避免了无菌包的重复灭菌而缩短器械使用寿命,降低了医院经济成本。

  5. Chronic urticaria

    Directory of Open Access Journals (Sweden)

    Sandeep Sachdeva

    2011-01-01

    Full Text Available Chronic urticaria (CU is a disturbing allergic condition of the skin. Although frequently benign, it may sometimes be a red flag sign of a serious internal disease. A multitude of etiologies have been implicated in the causation of CU, including physical, infective, vasculitic, psychological and idiopathic. An autoimmune basis of most of the ′idiopathic′ forms is now hypothesized. Histamine released from mast cells is the major effector in pathogenesis and it is clinically characterized by wheals that have a tendency to recur. Laboratory investigations aimed at a specific etiology are not always conclusive, though may be suggestive of an underlying condition. A clinical search for associated systemic disease is strongly advocated under appropriate circumstances. The mainstay of treatment remains H1 antihistaminics. These may be combined with complementary pharmacopeia in the form of H2 blockers, doxepin, nifedipine and leukotriene inhibitors. More radical therapy in the form of immunoglobulins, plasmapheresis and cyclophosphamide may be required for recalcitrant cases. Autologous transfusion and alternative remedies like acupuncture have prospects for future. A stepwise management results in favorable outcomes. An update on CU based on our experience with patients at a tertiary care centre is presented.

  6. Infecções do esterno pós revascularização do miocárdio: tratamento com retalhos miocutâneos e musculares Sternal infections after myocardial revascularization: treatment by myocutaneous and muscle flaps

    Directory of Open Access Journals (Sweden)

    Rubens T. de Barros

    1989-08-01

    Full Text Available No período de outubro de 1986 a janeiro de 1989, realizamos 445 esternotomias, sendo 158 para revascularização do miocárdio; em 92 pacientes, a artéria mamária interna esquerda (AMIE foi utilizada. Dos 445 casos, sete pacientes tiveram infecção do esterno no período pós-operatório imediato. O tempo médio de aparecimento foi de 8,7 dias (4-15 dias, sendo que seis pacientes eram do sexo masculino e a idade média foi de 48,8 anos (35-60 anos. Em todos os casos, os pacientes estavam sendo submetidos à primeira cirurgia, tendo como possíveis fatores associados diabete (um caso, embolia pulmonar com insuficiência respiratória (um caso, síndrome de baixo débito (três casos, cirurgia prolongada (um caso e dissecção da AMIE (seis casos. Na correção desta complicação, a associação de técnicas de cirurgia plástica, com a utilização de retalhos miocutâneos ou musculares, permitiu mais rápida recuperação dos pacientes, sem que tivéssemos óbitos nesta série. Os resultados estético e funcional foram considerados excelentes, com três pequenas deiscências tratadas ambulatorialmente. A identificação do germe através de cultura e a orientação do tratamento pelo antibiograma também se mostraram de grande importância, ao lado das técnicas cirúrgicas empregadas. Concluindo, julgamos que a intervenção precoce e agressiva nas infecções do esterno contribuiu, efetivamente, na queda da morbi-mortalidade desta complicação.During the period of October 1986 to January 1989 we executed 445 sternotomies; 158 of these were for myocardial revascularization. In 92 cases the left internal mammary artery (LIMA was used. Of 445 cases, 7 patients developed sternal infection in the immediate post operative period. The average time for the infection to appear was 8.7 days (4-15 days. Of these, 6 patients were male with an average age of 48.8 years (35-60 years. All cases were first operations; complicating factors were diabetes

  7. Chronic pain after hysterectomy

    DEFF Research Database (Denmark)

    Brandsborg, B; Nikolajsen, L; Kehlet, Henrik;

    2008-01-01

    BACKGROUND: Chronic pain is a well-known adverse effect of surgery, but the risk of chronic pain after gynaecological surgery is less established. METHOD: This review summarizes studies on chronic pain following hysterectomy. The underlying mechanisms and risk factors for the development of chronic...... post-hysterectomy pain are discussed. RESULTS AND CONCLUSION: Chronic pain is reported by 5-32% of women after hysterectomy. A guideline is proposed for future prospective studies. Udgivelsesdato: 2008-Mar...

  8. Untying chronic pain

    OpenAIRE

    Häuser, Winfried; Wolfe, Frederik; Henningsen, Peter; Schmutzer, Gabriele; Brähler, Elmar; Hinz, Andreas

    2014-01-01

    Background: Chronic pain is a major public health problem. The impact of stages of chronic pain adjusted for disease load on societal burden has not been assessed in population surveys. Methods: A cross-sectional survey with 4360 people aged ≥ 14 years representative of the German population was conducted. Measures obtained included demographic variables, presence of chronic pain (based on the definition of the International Association for the Study of Pain), chronic pain stages (by chronic ...

  9. Analysis of {sup 18} F-FDG uptake patterns in PET for diagnosis of septic and aseptic loosening after total hip arthroplasty

    Energy Technology Data Exchange (ETDEWEB)

    Cremerius, U.; Niethard, F.U. [Rheinisch-Westfaelische Technische Hochschule Aachen (Germany). Klinik fuer Nuklearmedizin; Mumme, T.; Reinartz, P.; Wirtz, D. [Rheinisch-Westfaelische Technische Hochschule Aachen (Germany). Orthopaedische Klinik; Buell, U.

    2003-12-01

    Aim: Identification of typical patterns for fluorodeoxyglucose (FDG) uptake in positron emission tomography (PET) to detect aseptic loosening of hip prosthesis (acetabular and/or femoral component) and prosthetic infection. Methods: 18 patients with painful hip prosthesis underwent PET using a dedicated full ring scanner after application of 200-300 MBq FDG. The interface between bone and surrounding soft tissue or bone as displayed on coronal slices was divided into 12 segments in accordance with the classifications of Delee and Gruen. FDG uptake in each of the segments was scored (0-3) by two independent observers. Intraoperative findings were regarded as the gold standard. Results: After surgical revision 14 acetabular components and 9 femoral components were found to be loose and prosthetic infection was present in 7 prostheses. Loosening of the acetabular component was correlated to enhanced uptake in the middle of the acetabular interface, while loosening of the femoral component was correlated to enhanced uptake in the proximal and middle segment of the lateral femoral interface and the proximal segment of the medial femoral interface. A similar pattern was found in prosthetic infection with high uptake along the middle portion of the lateral femoral interface. In 6 of 7 infected prostheses loosening of the acetabular and of the femoral component was present. Taking the typical uptake patterns as criteria for loosening and grade 3 uptake as an additional criterion for septic loosening the accuracy of PET imaging in the detection of loosening of the acetabular or the femoral component and of prosthetic infection was 72, 78 and 89%, respectively. Conclusion: This pilot study presents FDG-PET as a promising diagnostic tool for patients with painful hip prostheses. Its clinical value should be evaluated in a larger patient population. (orig.) [German] Ziel: Identifikation von Befundmustern in der Positronenemissionstomographie (PET) mit {sup 18}F

  10. MRI of aseptic osteonecrosis in children with acute lymphoblastic leukemia; Kernspintomographie von aseptischen Osteonekrosen bei Kindern und Jugendlichen mit einer akuten lymphoblastischen Leukaemie

    Energy Technology Data Exchange (ETDEWEB)

    Engelbrecht, V.; Scherer, A.; Moedder, U. [Duesseldorf Univ. (Germany). Inst. fuer Diagnostische Radiologie; Bruder, M. [Duesseldorf Univ. (Germany). Kinderklinik; Koerholz, D. [Leipzig Univ. (Germany). Kinderonkologie

    2000-04-01

    Purpose: To evaluate the incidence, localisation, and course of symptomatic aseptic osteonecrosis (AON) in children undergoing treatment for acute lymphoblastic leukemia (ALL). Methods: 72 MRI examinations obtained from 26 children with bone pain selected from a group of 121 children with ALL were evaluated retrospectively. The area of the AON was determined by computer assisted planimetry. Follow-up examinations after 2-5 years were considered. Results: 10/121 (8.3%) of the children had symptomatic AON, the number of lesions varied between 1 and 24 per child. 62/66 lesions were localized within the lower extremities. 58% of the AON were positioned in the epiphysis and 42% in the meta- and diaphysis. The mean area of AON was 7.6 cm{sup 2} with a range of 0.5 to 50 cm{sup 2}. Follow-up examinations revealed a regression in 19 AON, no change in 43 and a progression in 4 lesions. AON within the epiphysis with joint involvement or lesions greater than 9 cm{sup 2} more frequently showed a progression of AON with final joint destruction. An elevated risk for AON was seen in children older than 10 years and in children with intensified chemotherapy due to high-risk ALL. Conclusion: AON is a common complication in ALL-children under chemotherapy. Most frequently, the course is benign but large AON with joint involvement have an elevated risk for progression of AON with final joint destruction. (orig.) [German] Ziel: Erfassung von Haeufigkeit, Lokalisation und Verlauf von symptomatischen aseptischen Osteonekrosen (AON) bei Kindern und Jugendlichen unter der Therapie einer akuten lymphoblastischen Leukaemie (ALL). Methoden: In einer Gruppe von 121 Kindern mit ALL (Alter 1-17 Jahre) wurden retrospektiv 72 MRT der Extremitaeten bei 26 Kindern mit Knochenschmerzen bezueglich der Zahl, Groesse und Lokalisation von AON ausgewertet. Die Flaeche von AON wurde planimetrisch bestimmt. Verlaufskontrollen erstreckten sich ueber 2-5 Jahre. Ergebnisse: 10/121 (8,3%) der Kinder wiesen

  11. Chronic Otitis Media Resulting in Aortic Valve Replacement: A Case Report

    Directory of Open Access Journals (Sweden)

    Adem Guler

    2015-10-01

    Full Text Available The bicuspid aortic valve is known to be the most common congenital cardiac malformation, with an approximate incidence rate of 1-2% in the general population. Most patients are unaware of the disease until the onset of infective endocarditis, which is a life-threatening complication that may affect a heart valve or other cardiac structures at the site of endothelial damage. A 22-year-old man presented to our internal medicine clinic with a complaint of acute onset dyspnea and fatigue. His body temperature was 38 °C. A diastolic murmur was detected at the right sternal border. Two-dimensional transthoracic echocardiography revealed severe aortic insufficiency, and two-dimensional transesophageal echocardiography showed that the aortic valve was bicuspid. There was also a flail lesion extending the left ventricular outflow tract, resulting in pathological coaptation and severe aortic insufficiency. The patient was referred to our cardiovascular department for surgery. We herein present this case of a bicuspid aortic valve complicated by infective endocarditis due to the underlying disease of chronic otitis media related to a rare pathogen: Alloiococcus otitidis. The patient underwent a successful aortic valve replacement surgery due to aortic insufficiency following infective endocarditis. He was discharged on the 16th postoperative day in good condition.

  12. Chronic Otitis Media Resulting in Aortic Valve Replacement: A Case Report.

    Science.gov (United States)

    Guler, Adem; Sahin, Mehmet Ali; Gurkan Yesil, Fahri; Yildizoglu, Uzeyir; Demirkol, Sait; Arslan, Mehmet

    2015-04-01

    The bicuspid aortic valve is known to be the most common congenital cardiac malformation, with an approximate incidence rate of 1-2% in the general population. Most patients are unaware of the disease until the onset of infective endocarditis, which is a life-threatening complication that may affect a heart valve or other cardiac structures at the site of endothelial damage. A 22-year-old man presented to our internal medicine clinic with a complaint of acute onset dyspnea and fatigue. His body temperature was 38 (°)C. A diastolic murmur was detected at the right sternal border. Two-dimensional transthoracic echocardiography revealed severe aortic insufficiency, and two-dimensional transesophageal echocardiography showed that the aortic valve was bicuspid. There was also a flail lesion extending the left ventricular outflow tract, resulting in pathological coaptation and severe aortic insufficiency. The patient was referred to our cardiovascular department for surgery. We herein present this case of a bicuspid aortic valve complicated by infective endocarditis due to the underlying disease of chronic otitis media related to a rare pathogen: Alloiococcus otitidis. The patient underwent a successful aortic valve replacement surgery due to aortic insufficiency following infective endocarditis. He was discharged on the 16(th) postoperative day in good condition. PMID:26110009

  13. Chronic granulomatous disease

    Science.gov (United States)

    CGD; Fatal granulomatosis of childhood; Chronic granulomatous disease of childhood; Progressive septic granulomatosis ... In chronic granulomatous disease (CGD), immune system cells called ... some types of bacteria and fungi. This disorder leads to long- ...

  14. People Experiencing Chronic Homelessness

    Science.gov (United States)

    ... Experiencing Chronic Homelessness Share This: People Experiencing Chronic Homelessness We've made significant progress in our national ... the USICH newsletter. We know how to end homelessness. Let's do it, together. Sign up for our ...

  15. Chronic motor tic disorder

    Science.gov (United States)

    Chronic motor tic disorder is more common than Tourette syndrome . Chronic tics may be forms of Tourette syndrome. Tics usually start at age 5 or 6 and get worse until age 12. They often improve during adulthood.

  16. Chronic Diarrhea in Children

    Science.gov (United States)

    ... can include cramping abdominal pain nausea or vomiting fever chills bloody stools Children with chronic diarrhea who have ... can include cramping, abdominal pain, nausea or vomiting, fever, chills, or bloody stools. Children with chronic diarrhea who ...

  17. "Chronic Lyme Disease"

    Science.gov (United States)

    ... Content Marketing Share this: Main Content Area "Chronic Lyme Disease" What is "chronic Lyme disease?" Lyme disease is an infection caused by ... J Med 357:1422-30, 2008). How is Lyme disease treated? For early Lyme disease, a short ...

  18. Prostaglandins and chronic inflammation

    OpenAIRE

    Aoki, Tomohiro; Narumiya, Shuh

    2012-01-01

    Chronic inflammation is the basis of various chronic illnesses including cancer and vascular diseases. However, much has yet to be learned how inflammation becomes chronic. Prostaglandins (PGs) are well established as mediators of acute inflammation, and recent studies in experimental animals have provided evidence that they also function in transition to and maintenance of chronic inflammation. One role PGs play in such processes is amplification of cytokine signaling. As such, PGs can facil...

  19. Chronic Inflammatory Demyelinating Polyneuropathy

    OpenAIRE

    Dimachkie, Mazen M.; Barohn, Richard J.

    2013-01-01

    Chronic Inflammatory polyneuropathies are an important group of neuromuscular disorders that present chronically and progress over more than 8 weeks, being referred to as chronic inflammatory demyelinating polyneuropathy (CIDP). Despite tremendous progress in elucidating disease pathogenesis, the exact triggering event remains unknown. Our knowledge regarding diagnosis and management of CIDP and its variants continues to expand, resulting in improved opportunities for identification and treat...

  20. 3种植物无菌苗增殖与生根一体化技术研究%Studies on the Technology of Proliferation and Rooting Integration with Aseptic Seedlings in Three Species

    Institute of Scientific and Technical Information of China (English)

    梁称福

    2011-01-01

    Under conventional culture conditions ((25 ±3)℃, relative humidity 60%-70%, 1500-2000 lx for 10-12 h/d), aseptic buds or leaves from the plants of Aloe vera var.chinensis, Pelargonium citrosum vanleenii and triploid Populus tomentosa were respectively used to research the technology of proliferation and rooting integration.The results showed that: after 50 days when aseptic buds of Aloe vera var.chinensis were transferred in MS + 6-BA 2.0 mg/L+ NAA 0.1 mg/L+ AC 0.1%, the average number of differentiated buds reached 3.4 and the rooting rate reached 100% with 6.1 roots which were sturdy, long and yellow-white and 52.0 cm length of all roots per plant.After 45 days transferred in MS + 6-BA 3.0 mg/L + NAA 0.2 mg/L + AC 0.05%, aseptic buds of Pelargonium citrosum vanleenii proliferated most fastest with the average number of differentiated buds reaching 10.2, and the rooting rate amounted to 100% with dark-green leaves.After 55 days when aseptic leaves of triploid Populus tomentosa were transferred in MS + 6-BA 0.5 mg/L + KT 0.4 mg/L + NAA 0.2 mg/L + Ad 25.0 mg/L + AC 0.05%, differentiated buds arrived at an average of 8.6 and the rooting rate achieved 92% with more and longer, light-white roots.%在常规培养环境条件(温度(25士3)℃、湿度60%~70%、光强1500~2000lx,10-12h/天),以中华芦荟、驱蚊香草、三倍体毛杨无菌芽或叶片为材料,研究不同培养基对其无菌苗增殖、生根的影响,探讨其一体化成苗技术.结果表明:中华芦荟无菌芽转接在MS+6-BA2.0 mg/L+NAA 0.1 mg/L+AC 0.1%培养基中50天,分化芽数平均达3.4个;生根率达100%,单株根数达6.1条,单株总根长达52.0 cm,且根系粗长、黄白色.驱蚊香草无菌芽在MS+6-BA 3.0 mg/L+NAA 0.2 mg/L+AC 0.05%培养基中增殖速度最快,转接后45天分化芽数平均为10.2个;生根率为100%,生根苗叶片呈深绿色,生根质量好.三倍体毛白杨无菌叶片接种在MS+6-BA 0.5 mg/L+KT 0.4 mg/L+NAA 0.2 mg/L+Ad 25

  1. Effects of Colchicine Treatment on Aseptic Seedling Growth of Arnebia euchroma (Royle)Johnst%秋水仙素处理对新疆紫草无菌苗生长的影响

    Institute of Scientific and Technical Information of China (English)

    潘颀; 魏欢; 王芳; 郝爱花; 班娜

    2014-01-01

    The method of colchicine solution soaking was adopted to treat Arnebia euchroma (Royle) Johnst aseptic seedling.The results showed that the hypocotyl expands (42.1%-52.6%)promoted obvi-ously and inhibited the roots formation when Arnebia euchroma (Royle)Johnst seeds were soaked in col-chicine concentration of 100 mg/L,but it is not much effect on seeds germination.The aseptic seedling soa-king time shoulds not be more than 48 h.The germination rate was 66%~80% and the mutation rate was 12.50%-28.78%,Mutated with 25 mg/L colchicine at the temperature of 20 ℃ for 12 h to 24 h.After soaking by colchicine treatment produced abundant morphological variation.%采用秋水仙素溶液浸泡方法处理新疆紫草无菌苗.结果表明,秋水仙素浓度为100 mg/L时浸泡新疆紫草5子,明显促进下胚轴的膨大(42.1%~52.6%),抑制根的形成,但对5子萌发影响不大;无菌苗浸泡时$不宜超过48 h;苗龄为25 d、处理温度为20℃、秋水仙素浓度为25 mg/L、浸泡12~24 h时的萌发率为66%~80%,变异率为12.50%~28.78%;通过秋水仙素浸泡处理产生了丰富的形态变异.

  2. Heredity of chronic bronchitis

    DEFF Research Database (Denmark)

    Meteran, Howraman; Backer, Vibeke; Kyvik, Kirsten Ohm; Skytthe, Axel; Thomsen, Simon Francis

    2014-01-01

    BACKGROUND: Smoking is a major risk factor for lung diseases and lower respiratory symptoms, but since not all smokers develop chronic bronchitis and since chronic bronchitis is also diagnosed in never-smokers, it has been suggested that some individuals are more susceptible to develop chronic...... bronchitis due to genetics. OBJECTIVE: To study the relative influence of genetic and environmental factors on the variation in the susceptibility to chronic bronchitis. METHODS: In a population-based questionnaire study of 13,649 twins, 50-71 years of age, from the Danish Twin Registry, we calculated sex......-specific concordance rates and heritability of chronic bronchitis. The response rate was 75%. RESULTS: The prevalence of chronic bronchitis was 9.3% among men and 8.5% among women. The concordance rate for chronic bronchitis was higher in monozygotic twins than in dizygotic twins among women; 0.30 vs. 0.17, but not...

  3. Chronic granulomatous disease associated with chronic glomerulonephritis

    DEFF Research Database (Denmark)

    Frifelt, J J; Schønheyder, Henrik Carl; Valerius, Niels Henrik;

    1985-01-01

    A boy with chronic granulomatous disease (CGD) developed glomerulonephritis at the age of 12 years. The glomerulonephritis progressed to terminal uraemia at age 15 when maintenance haemodialysis was started. The clinical course was complicated by pulmonary aspergillosis and Pseudomonas septicaemia...

  4. Chronic diseases in adolescence

    OpenAIRE

    Rončević Nevenka; Stojadinović Aleksandra; Odri Irena

    2006-01-01

    Introduction. The prevalence of chronic diseases in adolescence is constantly increasing, especially in the last two decades. Adolescence is a period of important changes: body growth and development, sexual development, development of cognitive abilities, change in family relations and between peers, formation of personal identity and personal system of values, making decisions on future occupation etc. Chronic diseases in adolescence. Chronic disorders affect all development issues and repr...

  5. Chronic penile strangulation

    OpenAIRE

    Lopes, Roberto I.; Silvia I Lopes; Roberto N. Lopes

    2003-01-01

    Chronic penile strangulation is exceedingly rare with only 5 cases previously reported. We report an additional case of progressive penile lymphedema due to chronic intermittent strangulation caused by a rubber band applied to the penile base for 6 years. A 49-year-old man presented incapacity to exteriorize the glans penis. For erotic purposes, he had been using a rubber-enlarging band placed in the penile base for 6 years. With chronic use, he noticed that his penis swelled. Physical examin...

  6. Chronic obstructive pulmonary disease

    OpenAIRE

    NR Anthonisen

    2007-01-01

    The global prevalence of physiologically defined chronic obstructive pulmonary disease (COPD) in adults aged >40 yr is approximately 9-10 per cent. Recently, the Indian Study on Epidemiology of Asthma, Respiratory Symptoms and Chronic Bronchitis in Adults had shown that the overall prevalence of chronic bronchitis in adults >35 yr is 3.49 per cent. The development of COPD is multifactorial and the risk factors of COPD include genetic and environmental factors. Pathological changes in COPD are...

  7. Chronic Granulomatous Disease (CGD)

    Science.gov (United States)

    ... Share this: Main Content Area Chronic Granulomatous Disease (CGD) Phagocyte (purple) engulfing Staphylococcus aureus bacteria (yellow). Credit: NIAID CGD is a genetic disorder in which white blood ...

  8. Chronic silent otitis media.

    Science.gov (United States)

    Paparella, Michael M; Schachern, Patricia A; Cureoglu, Sebahattin

    2002-01-01

    Otitis media occurs along a continuum. For example, otitis media with effusion characterized by fluid pathology can lead to chronic otitis media plus chronic mastoiditis, characterized by the presence of intractable tissue pathology such as cholesteatoma, cholesterol granuloma or granulation tissue. The literature defines chronic otitis media as having a tympanic membrane perforation and otorrhea. Amongst many other sequelae, which can result from the continuum, an important common one is chronic silent otitis media. This overlooked entity which includes pathology beneath an intact tympanic membrane is commonly seen in our human temporal bone laboratory and in patients. The clinical pathological correlates of this important disease are discussed herein. PMID:12021496

  9. Managing your chronic pain

    Science.gov (United States)

    ... your chronic back pain To use the sharing features on this page, please enable JavaScript. Managing chronic pain means finding ways to make your back pain tolerable so you can live your life. You may not be able to ...

  10. Chronic diseases in adolescence

    Directory of Open Access Journals (Sweden)

    Rončević Nevenka

    2006-01-01

    Full Text Available Introduction. The prevalence of chronic diseases in adolescence is constantly increasing, especially in the last two decades. Adolescence is a period of important changes: body growth and development, sexual development, development of cognitive abilities, change in family relations and between peers, formation of personal identity and personal system of values, making decisions on future occupation etc. Chronic diseases in adolescence. Chronic disorders affect all development issues and represent an additional burden for adolescents. The interaction between chronic disorders and various development issues is complex and two-way: the disease may affect development, and development may affect the disease. Developmental, psychosocial and family factors are of great importance in the treatment of adolescents with chronic disorders. Chronic disorders affect all aspects of adolescent life, including relations with peers, school, nutrition, learning, traveling, entertainment, choice of occupation, plans for the future. Physicians should keep in mind that chronic diseases and their treatment represent only one aspect of person's life. Adolescents with chronic diseases have other needs as well, personal priorities, social roles and they expect these needs to be recognized and respected. Adolescent health care should be adjusted to the life style of adolescents.

  11. Sternal and vertebral fractures, a well-known association, usually overlooked: review of six clinical cases Fracturas vertebrales y fracturas concomitantes del esternón: revisión de seis casos Fraturas vertebrais e fraturas concomitantes do esterno: revisão de seis casos

    Directory of Open Access Journals (Sweden)

    Alvaro Silva G.

    2010-09-01

    Full Text Available OBJECTIVE: the association of sternal and vertebral fractures has previously been described in the literature. These lesions are frequently overlooked at the initial evaluation. The purpose of this study was to review and discuss the diagnostic methods used to diagnose these lesions and to highlight the importance of early recognition of these fractures. METHODS: we performed a retrospective analysis of six patients who suffered sternal and concomitant vertebral fractures. Clinical charts and imaging studies were reviewed. RESULTS: all patients were diagnosed with sternal fractures at the initial evaluation, but only two were diagnosed with vertebral fractures. CONCLUSION: failure to recognize these fractures at initial evaluation may be associated with the fact that the upper thoracic region is difficult to explore. In the presence of sternal fractures, a vertebral fracture must be ruled out even though major injuries are not present. A computer tomography (CT scan and magnetic resonance imaging (MRI should be obtained despite negative X-rays if clinical suspicion is present.OBJETIVO: la asociación de las fracturas del esternón y vertebrales ha sido descrita previamente en la literatura. Estas lesiones son frecuentemente descuidadas en la evaluación inicial. El objetivo de este estudio fue analizar y discutir los métodos diagnósticos utilizados para estas lesiones y resaltar la importancia del reconocimiento precoz de estas fracturas. MÉTODOS: fue realizado un análisis retrospectivo de seis pacientes que sufrieron concomitantemente fracturas del esternón y vertebrales, por medio del análisis de las historias clínicas y exámenes de imagen. RESULTADOS: todos los pacientes fueron diagnosticados con fracturas del esternón en la evaluación inicial, pero solamente dos fueron diagnosticados con fracturas vertebrales. CONCLUSIONES: el hecho de no reconocer estas fracturas en la evaluación inicial puede estar asociado a la dificultad de

  12. The Chronic Responsibility

    DEFF Research Database (Denmark)

    Ravn, Iben M; Frederiksen, Kirsten; Beedholm, Kirsten

    2016-01-01

    This article reports on the results of a Fairclough-inspired critical discourse analysis aiming to clarify how chronically ill patients are presented in contemporary Danish chronic care policies. Drawing on Fairclough’s three-dimensional framework for analyzing discourse, and using Dean’s concepts...... of governmentality as an interpretative lens, we analyzed and explained six policies published by the Danish Health and Medicines Authority between 2005 and 2013. The analysis revealed that discourses within the policy vision of chronic care consider chronically ill patients’ active role, lifestyle......, and health behavior to be the main factors influencing susceptibility to chronic diseases. We argue that this discursive construction naturalizes a division between people who can actively manage responsible self-care and those who cannot. Such discourses may serve the interests of those patients who...

  13. [Chronic migraine: treatment].

    Science.gov (United States)

    Pascual, Julio

    2012-04-10

    We define chronic migraine as that clinical situation in which migraine attacks appear 15 or more days per month. Until recently, and in spite of its negative impact, patients with chronic migraine were excluded of the clinical trials. This manuscript revises the current treatment of chronic migraine. The first step should include the avoidance of potential precipitating/aggravating factors for chronic migraine, mainly analgesic overuse and the treatment of comorbid disorders, such as anxiety and depression. The symptomatic treatment should be based on the use of nonsteroidal anti-inflammatory agents and triptans (in this case ergotamine-containing medications. Preventive treatment includes a 'transitional' treatment with nonsteroidal anti-inflammatory agents or steroids, while preventive treatment exerts its actions. Even though those medications efficacious in episodic migraine prevention are used, the only drugs with demonstrated efficacy in the preventive treatment of chronic migraine are topiramate and pericranial infiltrations of Onabotulinumtoxin A. PMID:22532241

  14. A Study to Assess the Association of Aseptic Practices Being Followed and its Effect on the Overall Outcome of Selected Special Care Newborn Units (SCNUs of Madhya Pradesh at Different Levels.

    Directory of Open Access Journals (Sweden)

    Mahore RK

    2015-04-01

    Full Text Available The neonatal mortality rate in India is high and stagnant. Special Care Newborn Units (SCNUs have been set up at different levels of Health Care Delivery System to provide quality newborn-care services in several hospitals to meet this challenge. Many units are located in the districts where the burden of neonatal deaths is high, and access to special newborn care is poor. The study was conducted to assess the functioning of SCNUs in six centers of India. The evaluation was based on an analysis of secondary data from the six units that had been functioning for at least three year. A cross-sectional survey was also conducted to assess the availability of Quality care and Aseptic practices implemented at different levels of SNCUs. Descriptive statistics were used for analyzing the inputs (Quality care and aseptic practices and outcomes (morbidity and mortality. The rate of mortality among admitted neonates was taken as the key outcome variable to assess the performance of the units. Chi-square test was used for analyzing the trend of case-fatality rate over a period of 3 years considering the first year of operationalization as the base. Correlation coefficients were estimated to understand the possible association of case-fatality rate with factors, such as bed:doctor ratio, bed:nurse ratio, average duration of stay, and bed occupancy rate, and the asepsis score was determined. The rates of admission increased from a median of 16.7 per 100 deliveries in 2012 to 19.5 per 100 deliveries in 2014. The case-fatality rate shows progressive decline in all the units in Last 3 years. Proportional mortality due to sepsis and low birthweight (LBW declined significantly over two years (LBW <2.5 kg. The major reasons for admission and the major causes of deaths were birth asphyxia, sepsis, and LBW/prematurity. The units had a varying nurse:bed ratio (1:1-1:2.14. The bed occupancy rate ranged from 83% to 121% (median 115%, and the average duration of stay

  15. Avaliação da qualidade de caldo de cana envasado a quente e por sistema asséptico Quality of sugarcane (Sacharum ssp. juice packed by hot fill and aseptic processes

    Directory of Open Access Journals (Sweden)

    Karin Samorano da Silva

    2006-12-01

    Full Text Available Dois processos térmicos foram aplicados ao caldo de cana com o objetivo de se obter um produto estável à temperatura ambiente. A variedade de cana de açúcar (Sacharum ssp. utilizada foi a RB72 - 454. A metodologia de planejamento fatorial foi aplicada a fim de se verificar a melhor combinação entre acidez (pH e doçura (°Brix. Houve uma tendência para melhor aceitação sensorial quando o pH foi maior que 4,0 e °Brix maior que 15. Primeiramente, o caldo foi submetido a 141 °C /10 s e envasado assepticamente em garrafas de vidro previamente esterilizadas. No segundo processo, o caldo foi submetido ao tratamento térmico a 110 °C /10 s e envasado a quente (90 ± 5 °C em garrafas de vidro. Análises físico-químicas, microbiológicas e sensoriais foram realizadas durante a estocagem dos lotes à temperatura ambiente. O lote processado assepticamente apresentou vida útil de 30 dias e o envasado a quente, 60 dias, não apresentando diferença estatística (p The objective of this work is to evaluate two thermal processes in order to obtain sugarcane (Sacharum ssp. juice stable at room temperature in glass bottles. An experimental methodology was applied to obtain the best combination between pH and °Brix based on the sensory results. There was a tendency for a better sensory acceptance for pH > 4.0 and °Brix > 15. Two thermal processes were applied to sterilize the juice. Firstly, the juice was submitted to 141 °C /10 s, and then aseptically filled in glass bottles previously sterilized. In the second process, the juice was submitted to 110 °C /10 s and filled into glass bottles at 90 ± 5 °C. Physical-chemical changes, microbiological counts and sensory acceptance were evaluated during the storage at room temperature. The shelf life of aseptically processed juice was 30 days and 60 days for the hot filled juice based on the sensory evaluation. These results indicated that the hot fill process was more efficient for sugarcane

  16. Chronic Inflammatory Demyelinating Polyneuropathy (CIDP)

    Science.gov (United States)

    ... People About NINDS NINDS Chronic Inflammatory Demyelinating Polyneuropathy (CIDP) Information Page Table of Contents (click to jump ... en Español What is Chronic Inflammatory Demyelinating Polyneuropathy (CIDP)? Chronic inflammatory demyelinating polyneuropathy (CIDP) is a neurological ...

  17. Stages of Chronic Myelogenous Leukemia

    Science.gov (United States)

    ... ALL Treatment Childhood AML Treatment Research Chronic Myelogenous Leukemia Treatment (PDQ®)–Patient Version General Information About Chronic Myelogenous Leukemia Go to Health Professional Version Key Points Chronic ...

  18. Stages of Chronic Lymphocytic Leukemia

    Science.gov (United States)

    ... ALL Treatment Childhood AML Treatment Research Chronic Lymphocytic Leukemia Treatment (PDQ®)–Patient Version General Information About Chronic Lymphocytic Leukemia Go to Health Professional Version Key Points Chronic ...

  19. Chronicity and control

    DEFF Research Database (Denmark)

    Whyte, Susan Reynolds

    2012-01-01

    This paper proposes a way of framing the study of ‘noncommunicable diseases’ within the more general area of chronic conditions. Focusing on Africa, it takes as points of departure the situation in Uganda, and the approach to health issues developed by a group of European and African colleagues...... over the years. It suggests a pragmatic analysis that places people's perceptions and practices within a field of possibilities shaped by policy, health care systems, and life conditions. In this field, the dimensions of chronicity and control are the distinctive analytical issues. They lead on to...... consideration of patterns of sociality related to chronic conditions and their treatment....

  20. Chronic Conditions Dashboard

    Data.gov (United States)

    U.S. Department of Health & Human Services — The CMS Chronic Conditions Dashboard presents statistical views of information on the prevalence, utilization and Medicare spending for Medicare beneficiaries with...

  1. Anemia of chronic disease

    Science.gov (United States)

    Anemia of inflammation; AOCD; ACD ... Anemia is a lower-than-normal number of red blood cells in the blood. Some conditions can lead to anemia of chronic disease include: Autoimmune disorders , such as ...

  2. What Is Chronic Pain?

    Medline Plus

    Full Text Available Already a member? Log In or Sign Up Home About Us Support the ACPA Contact Us Shop ... for Understanding Pain September is Pain Awareness Month Home Pain Management Tools Videos What Is Chronic Pain? ...

  3. Sleep and Chronic Disease

    Science.gov (United States)

    ... message, please visit this page: About CDC.gov . Sleep About Us About Sleep Key Sleep Disorders Sleep ... Sheets Data & Statistics Projects and Partners Resources Events Sleep and Chronic Disease Recommend on Facebook Tweet Share ...

  4. What Is Chronic Pain?

    Medline Plus

    Full Text Available ... after a period of time the spinal cord has changed, after a period of time there are ... absence of an apparent cause. But chronic pain has a physiological or neurological basis even when we ...

  5. What Is Chronic Pain?

    Medline Plus

    Full Text Available ... acute pain and both naturally expect that some cause will be found, and when it’s found, it ... pain even in the absence of an apparent cause. But chronic pain has a physiological or neurological ...

  6. Chronic rhinosinusitis pathogenesis.

    Science.gov (United States)

    Stevens, Whitney W; Lee, Robert J; Schleimer, Robert P; Cohen, Noam A

    2015-12-01

    There are a variety of medical conditions associated with chronic sinonasal inflammation, including chronic rhinosinusitis (CRS) and cystic fibrosis. In particular, CRS can be divided into 2 major subgroups based on whether nasal polyps are present or absent. Unfortunately, clinical treatment strategies for patients with chronic sinonasal inflammation are limited, in part because the underlying mechanisms contributing to disease pathology are heterogeneous and not entirely known. It is hypothesized that alterations in mucociliary clearance, abnormalities in the sinonasal epithelial cell barrier, and tissue remodeling all contribute to the chronic inflammatory and tissue-deforming processes characteristic of CRS. Additionally, the host innate and adaptive immune responses are also significantly activated and might be involved in pathogenesis. Recent advancements in the understanding of CRS pathogenesis are highlighted in this review, with special focus placed on the roles of epithelial cells and the host immune response in patients with cystic fibrosis, CRS without nasal polyps, or CRS with nasal polyps. PMID:26654193

  7. Chronic Hypertension in Pregnancy

    Science.gov (United States)

    ... very commonly used to treat chronic hypertension. This drug class can cause problems in the fetus, in- cluding an increased risk of birth de- fects 4 and kidney failure. Angiotensin II receptor blockers also should be avoided ...

  8. Chronic Conditions PUF

    Data.gov (United States)

    U.S. Department of Health & Human Services — The Chronic Conditions PUFs are aggregated files in which each record is a profile or cell defined by the characteristics of Medicare beneficiaries. A profile is...

  9. What Is Chronic Pain?

    Medline Plus

    Full Text Available ... ACPA Contact Us Shop FAQs The Art of Pain Management Resources Going to the ER Glossary Surveys What We Have Learned Communication Tools Videos Pain Management Programs Resource Guide to Chronic Pain Treatments Pain ...

  10. Chronic penile strangulation

    Directory of Open Access Journals (Sweden)

    Lopes Roberto I

    2003-01-01

    Full Text Available Chronic penile strangulation is exceedingly rare with only 5 cases previously reported. We report an additional case of progressive penile lymphedema due to chronic intermittent strangulation caused by a rubber band applied to the penile base for 6 years. A 49-year-old man presented incapacity to exteriorize the glans penis. For erotic purposes, he had been using a rubber-enlarging band placed in the penile base for 6 years. With chronic use, he noticed that his penis swelled. Physical examination revealed lymphedema of the penis, phimosis and a stricture in the penile base. The patient was submitted to circumcision and the lymphedema remained stable 10 months postoperatively. Chronic penile incarceration usually causes penile lymphedema and urinary disturbance. Treatment consists of removal of foreign devices and surgical treatment of lymphedema.

  11. Neuromodulation of chronic headaches

    DEFF Research Database (Denmark)

    Martelletti, Paolo; Jensen, Rigmor H; Antal, Andrea;

    2013-01-01

    The medical treatment of patients with chronic primary headache syndromes (chronic migraine, chronic tension-type headache, chronic cluster headache, hemicrania continua) is challenging as serious side effects frequently complicate the course of medical treatment and some patients may be even...... medically intractable. When a definitive lack of responsiveness to conservative treatments is ascertained and medication overuse headache is excluded, neuromodulation options can be considered in selected cases.Here, the various invasive and non-invasive approaches, such as hypothalamic deep brain...... proper RCT-based evidence is limited. The European Headache Federation herewith provides a consensus statement on the clinical use of neuromodulation in headache, based on theoretical background, clinical data, and side effect of each method. This international consensus further gives recommendations for...

  12. What Is Chronic Pain?

    Medline Plus

    Full Text Available ... Contact Us Shop FAQs The Art of Pain Management Resources Going to the ER Glossary Surveys What We Have Learned Communication Tools Videos Pain Management Programs Resource Guide to Chronic Pain Treatments Pain ...

  13. Chronic Conditions Chartbook

    Data.gov (United States)

    U.S. Department of Health & Human Services — Chronic Conditions among Medicare Beneficiaries is a chartbook prepared by the Centers for Medicare and Medicaid Services and created to provide an overview of...

  14. What Is Chronic Pain?

    Medline Plus

    Full Text Available ... Programs Resource Guide to Chronic Pain Treatments Pain Awareness Toolkits Partners for Understanding Pain September is Pain Awareness Month Home Pain Management Tools Videos What Is ...

  15. What Is Chronic Pain?

    Medline Plus

    Full Text Available ... chronic pain there may be no apparent physical injury or illness to explain it. The physician and ... expected period of healing for an illness or injury. You can experience pain even if you are ...

  16. Chronic Condition Data Warehouse

    Data.gov (United States)

    U.S. Department of Health & Human Services — The CMS Chronic Condition Data Warehouse (CCW) provides researchers with Medicare and Medicaid beneficiary, claims, and assessment data linked by beneficiary across...

  17. Chronic Fatigue Syndrome

    Science.gov (United States)

    Chronic fatigue syndrome (CFS) is a disorder that causes extreme fatigue. This fatigue is not the kind of tired feeling that ... activities. The main symptom of CFS is severe fatigue that lasts for 6 months or more. You ...

  18. Chronic dysimmune neuropathies: Beyond chronic demyelinating polyradiculoneuropathy

    Directory of Open Access Journals (Sweden)

    Khadilkar Satish

    2011-01-01

    Full Text Available The spectrum of chronic dysimmune neuropathies has widened well beyond chronic demyelinating polyradiculoneuropathy (CIDP. Pure motor (multifocal motor neuropathy, sensorimotor with asymmetrical involvement (multifocal acquired demylinating sensory and motor neuropathy, exclusively distal sensory (distal acquired demyelinating sensory neuropathy and very proximal sensory (chronic immune sensory polyradiculopathy constitute the variants of CIDP. Correct diagnosis of these entities is of importance in terms of initiation of appropriate therapy as well as prognostication of these patients. The rates of detection of immune-mediated neuropathies with monoclonal cell proliferation (monoclonal gammopathy of unknown significance, multiple myeloma, etc. have been facilitated as better diagnostic tools such as serum immunofixation electrophoresis are being used more often. Immune neuropathies associated with malignancies and systemic vasculitic disorders are being defined further and treated early with better understanding of the disease processes. As this field of dysimmune neuropathies will evolve in the future, some of the curious aspects of the clinical presentations and response patterns to different immunosuppressants or immunomodulators will be further elucidated. This review also discusses representative case studies.

  19. Idiopathic chronic eosinophilic pneumonia

    OpenAIRE

    Cordier Jean-François; Marchand Eric

    2006-01-01

    Abstract Idiopathic chronic eosinophilic pneumonia (ICEP) is characterized by subacute or chronic respiratory and general symptoms, alveolar and/or blood eosinophilia, and peripheral pulmonary infiltrates on chest imaging. Eosinophilia is present in most cases, usually in excess of 1000/mm3. In absence of significant blood eosinophilia, a diagnosis of ICEP is supported by the demonstration of bronchoalveolar lavage eosinophilia. ICEP is typically associated with eosinophil counts higher than ...

  20. Chronic osteomyelitis mimicking sarcoma

    OpenAIRE

    Gulmann, C; Young, O.; Tolan, M.; O’Riordan, D.; Leader, M

    2003-01-01

    This report describes a rare case of chronic osteomyelitis in a 60 year old man mimicking a soft tissue sarcoma. Chronic osteomyelitis is an infrequent cause of a soft tissue mass and is usually diagnosed clinically by a combination of radiology and microbiology. Rarely, COM can mimic a primary bony neoplasm, but this is the first reported case where it mimicked a soft tissue sarcoma. The clinical, radiological, and histological appearances of this case will be discussed.

  1. Hypertension in Chronic Glomerulonephritis.

    Science.gov (United States)

    Ihm, Chun-Gyoo

    2015-12-01

    Chronic glomerulonephritis (GN), which includes focal segmental glomerulosclerosis and proliferative forms of GN such as IgA nephropathy, increases the risk of hypertension. Hypertension in chronic GN is primarily volume dependent, and this increase in blood volume is not related to the deterioration of renal function. Patients with chronic GN become salt sensitive as renal damage including arteriolosclerosis progresses and the consequent renal ischemia causes the stimulation of the intrarenal renin-angiotensin-aldosterone system(RAAS). Overactivity of the sympathetic nervous system also contributes to hypertension in chronic GN. According to the KDIGO guideline, the available evidence indicates that the target BP should be ≤140mmHg systolic and ≤90mmHg diastolic in chronic kidney disease patients without albuminuria. In most patients with an albumin excretion rate of ≥30mg/24 h (i.e., those with both micro-and macroalbuminuria), a lower target of ≤130mmHg systolic and ≤80mmHg diastolic is suggested. The use of agents that block the RAAS system is recommended or suggested in all patients with an albumin excretion rate of ≥30mg/ 24 h. The combination of a RAAS blockade with a calcium channel blocker and a diuretic may be effective in attaining the target BP, and in reducing the amount of urinary protein excretion in patients with chronic GN. PMID:26848302

  2. Chronic complicated osteomyelitis of the appendicular skeleton: diagnosis with technetium-99m labelled monoclonal antigranulocyte antibody-immunoscintigraphy

    International Nuclear Information System (INIS)

    Chronic post-traumatic osteomyelitis (OM) represents a particular challenge for nuclear medicine and radiology since clinical and biochemical parameters are frequently unreliable. The aim of this study was to investigate the value of combined bone scan (BS) and immunoscintigraphy (IS) with technetium-99m labelled monoclonal antigranulocyte antibody (MAB) in patients with suspected chronic OM of the appendicular skeleton. Twenty-four patients (17 females and 7 males) with suspected chronic post-traumatic OM were evaluated with three-phase BS/99mTc-MAB-IS. The final diagnosis was established by means of bone culture and histology in 19 cases and clinical follow-up in five cases. The studies were reviewed by two independent and experienced observers; the interobserver agreement was calculated by kappa statistics. The sensitivity, specificity and accuracy of BS alone were 92%, 18% and 58%, respectively. Combined BS/99mTc-MAB-IS had a sensitivity, specificity and accuracy of 84%, 72% and 79%, respectively. Of 24 studies, 11 were true-positive, two false-negative, eight true-negative and three false-positive. Two patients presented with unexpected ectopic haematopoietic bone marrow in the appendicular skeleton that caused false-positive results. A high degree of interobserver agreement was found (κ=0.85). It is concluded that combined BS/99mTc-MAB-IS represents a very sensitive and reproducible method with an acceptable specificity for the investigation of chronic OM. Problems may occur in the differentiation of low-grade OM from aseptic inflammation. Another problem is ectopic marrow that may occur in the appendicular skeleton due to a chronic inflammatory stimulus. A former intramedullary intervention in the femur with displacement of haematopoietic marrow may also lead to an ectopic location. (orig.). With 2 figs., 1 tab

  3. Chronic Osteomyelitis in Sternum Mimicking Bone Metastasis of Lung Cancer Patient

    International Nuclear Information System (INIS)

    Primary sternal osteomyelitis without predisposing factors is a rare condition, and it is hardly differentiated from metastatic bone tumor especially in patient with the history of primary malignancy because osteomyelitis shares frequently common findings with metastatic bone lesion on 18F-FDG PET and bone scan. Although there have been several publications of primary osteomyelitis mimicking bone metastasis in the spine or extremities, we report a case of primary sternal osteomyelitis in the patient with lung cancer, which has, to our knowledge, not been reported before

  4. Chronic Osteomyelitis in Sternum Mimicking Bone Metastasis of Lung Cancer Patient

    Energy Technology Data Exchange (ETDEWEB)

    Im, Hyung Jun; Kim, Yu Keong; Lee, Sang Mi; Lee, Won Woo; Kim, Sang Eun [Seoul National University Bundang Hospital, Seoul (Korea, Republic of)

    2009-06-15

    Primary sternal osteomyelitis without predisposing factors is a rare condition, and it is hardly differentiated from metastatic bone tumor especially in patient with the history of primary malignancy because osteomyelitis shares frequently common findings with metastatic bone lesion on {sup 18}F-FDG PET and bone scan. Although there have been several publications of primary osteomyelitis mimicking bone metastasis in the spine or extremities, we report a case of primary sternal osteomyelitis in the patient with lung cancer, which has, to our knowledge, not been reported before.

  5. Chronic daily headaches

    Directory of Open Access Journals (Sweden)

    Fayyaz Ahmed

    2012-01-01

    Full Text Available Chronic Daily Headache is a descriptive term that includes disorders with headaches on more days than not and affects 4% of the general population. The condition has a debilitating effect on individuals and society through direct cost to healthcare and indirectly to the economy in general. To successfully manage chronic daily headache syndromes it is important to exclude secondary causes with comprehensive history and relevant investigations; identify risk factors that predict its development and recognise its sub-types to appropriately manage the condition. Chronic migraine, chronic tension-type headache, new daily persistent headache and medication overuse headache accounts for the vast majority of chronic daily headaches. The scope of this article is to review the primary headache disorders. Secondary headaches are not discussed except medication overuse headache that often accompanies primary headache disorders. The article critically reviews the literature on the current understanding of daily headache disorders focusing in particular on recent developments in the treatment of frequent headaches.

  6. Management of chronic paronychia

    Directory of Open Access Journals (Sweden)

    Vineet Relhan

    2014-01-01

    Full Text Available Chronic paronychia is an inflammatory disorder of the nail folds of a toe or finger presenting as redness, tenderness, and swelling. It is recalcitrant dermatoses seen commonly in housewives and housemaids. It is a multifactorial inflammatory reaction of the proximal nail fold to irritants and allergens. Repeated bouts of inflammation lead to fibrosis of proximal nail fold with poor generation of cuticle, which in turn exposes the nail further to irritants and allergens. Thus, general preventive measures form cornerstone of the therapy. Though previously anti-fungals were the mainstay of therapy, topical steroid creams have been found to be more effective in the treatment of chronic paronychia. In recalcitrant cases, surgical treatment may be resorted to, which includes en bloc excision of the proximal nail fold or an eponychial marsupialization, with or without nail plate removal. Newer therapies and surgical modalities are being employed in the management of chronic paronychia. In this overview, we review recent epidemiological studies, present current thinking on the pathophysiology leading to chronic paronychia, discuss the challenges chronic paronychia presents, and recommend a commonsense approach to management.

  7. Colagenopatía y meningitis aséptica recurrente en una paciente de 88 años Colagenopathy and recurrent aseptic meningitis in an 88 year old patient

    Directory of Open Access Journals (Sweden)

    Fernando J. VAzquez

    2004-02-01

    Full Text Available La meningitis aséptica recurrente (MAR en ancianos es rara y generalmente es secundaria a drogas. Su asociación a colagenopatías en ancianos ha sido raramente informada. El Síndrome de Sjögren (SS en ocasiones afecta el sistema nervioso central, pero la MAR asociada a SS es rara en este grupo etario. Se presenta una paciente de 88 años, autoválida, con antecedentes de xerostomía, xeroftalmos, Raynaud, disfagia y agrandamiento parotídeo recurrente autolimitado. En el año 2001 cursó una meningitis linfocítica y evolucionó con recuperación completa. Un año después volvió a presentar una meningitis linfocítica aséptica. Se descartaron causas infecciosas. Se demostró FAN 1/160 con patrón nucleolar moteado, Ac anti Ro y anti RNP positivos y anticoagulante lúpico positivo. Se confirmó sequedad ocular y la biopsia de labio fue compatible con SS. Evolucionó con resolución completa en 10 días sin tratamiento. Se interpretó como una enfermedad mixta del tejido conectivo (EMTC con síntomas predominantemente de SS, que cursó una MAR en su forma pura. La EMTC y el SS deberían ser considerados entre los diagnósticos diferenciales de la MAR, inclusive en ancianos.Recurrent aseptic meningitis (RAM infrequent in elderly patients and generally secondary to drugs. Its association with rheumatologic diseases is also seldom reported in the elderly. Sjögren Syndrome (SS sometimes affects the central nevous system, but the association between recurrent meningitis and SS is rare, specially in this age-group. We present an 88 year-old autovalid patient, with a history of xerostomia, xerophthalmia, Raynaud, dysphagia, and recurrent parotid enlargement. In 2001 she developed a lymphocytic meningitis with a complete remission. A year later, she developed again an aseptic lymphocytic meningitis. We ruled out infeccious causes. We found a FAN titer 1/160 with a nucleolar-mottled pattern, positive anti Ro and anti RNP antibodies and a positive

  8. Storage stability of cashew apple juice preserved by hot fill and aseptic processes Estabilidade do suco de caju preservado pelo método ''hot fill'' e processo asséptico

    Directory of Open Access Journals (Sweden)

    Maria Cecília Oliveira Costa

    2003-12-01

    Full Text Available Cashew (Anacardium occidentale L. apples from Pacajus, Ceará State, Brazil, were processed into high pulp content juice. The juice was packed either by hot fill or an aseptic process and evaluated for physical, physical-chemical, and sensorial changes during a 12-month storage period at room temperature. The results indicated that pH, soluble solids, total acidity, total sugar content and color did not change significantly during storage nor were affected by the type of filling. The sensorial analysis showed that juice acceptance remained high throughout the storage period regardless of the filling system. Differences in juice viscosity persisted between both processes.Pedúnculos de caju (Anacardium occidentale L. de Pacajus, Estado do Ceará, Brasil, foram processados na forma de suco com alto teor de polpa. O suco foi acondicionado através do processo hot fill ou asséptico e verificada as alterações físicas, físico-químicas e sensoriais durante armazenagem por doze meses à temperatura ambiente. Os resultados indicaram que pH, sólidos solúveis, acidez total, conteúdo de açúcar e cor não mudaram de modo significativo durante a armazenagem nem foram afetadas pelo modo de acondicionamento. Análise sensorial mostrou que a aceitação do suco foi mantida alta durante o período de armazenagem a despeito do sistema de enchimento. Diferenças na viscosidade dos sucos persistiram entre ambos processos.

  9. Lactoferrin in Chronic Pancreatitis

    Directory of Open Access Journals (Sweden)

    Chun Xiang Jin

    2009-05-01

    Full Text Available The present review is focused on the clinical significance of lactoferrin in pancreatic secretions and stone formation in chronic pancreatitis, and of serum anti-lactoferrin antibody in autoimmune pancreatitis. Lactoferrin secretion is increased in pancreatic secretions in calcified and non-calcified chronic pancreatitis. Lactoferrin, pancreatic stone protein and trypsin are present in pancreatic stones. We cannot conclude which protein is more important for the precipitate and stone formation. The presence of antilactoferrin antibody has been reported in serum in autoimmune diseases, such as autoimmune pancreatitis. The coincidental appearance of autoimmune pancreatitis with extrapancreatic autoimmune diseases strongly suggests a common autoimmune mechanism and lactoferrin is a candidate antigen. Lactoferrin may play an important role as a precipitate protein in pancreatic stone formation in chronic pancreatitis and as an autoantigen in autoimmune pancreatitis. Further studies are required to better understand the role of lactoferin.

  10. Chronic urticaria: recent advances.

    Science.gov (United States)

    Greaves, Malcolm W; Tan, Kian Teo

    2007-10-01

    Chronic urticaria is an umbrella term, which encompasses physical urticarias, chronic "idiopathic" urticaria and urticarial vasculitis. It is important to recognize patients with physical urticarias as the investigation and treatment differs in important ways from patients with idiopathic chronic urticaria or urticarial vasculitis. Although relatively uncommon, urticarial vasculitis is an important diagnosis to make and requires histological confirmation by biopsy. Underlying systemic disease and systemic involvement, especially of the kidneys, should be sought. It is now recognized that chronic "idiopathic" urticaria includes a subset with an autoimmune basis caused by circulating autoantibodies against the high affinity IgE receptor (FceR1) and less commonly against IgE. Although the autologous serum skin test has been proven useful in prompting search for and characterization of circulating wheal-producing factors in chronic urticaria, its specificity as a screening test for presence of functional anti-FceR1 is low, and confirmation by demonstration of histamine-releasing activity in the patient's serum must be the benchmark test in establishing this diagnosis. Improved screening tests are being sought; for example, ability of the chronic urticaria patient's serum to evoke expression of CD 203c on donor human basophils is showing some promise. The strong association between autoimmune thyroid disease and autoimmune urticaria is also an area of ongoing research. Drug treatment continues to be centered on the H1 antihistamines, and the newer second-generation compounds appear to be safe and effective even in off-label dosage. Use of systemic steroids should be confined to special circumstances such as tapering regimens for acute flare-ups. Use of leukotriene antagonists is becoming popular, but the evidence for efficacy is conflicting. Cyclosporin is also effective and can be used in selected cases of autoimmune urticaria, and it is also effective in non

  11. Omalizumab for chronic urticaria

    DEFF Research Database (Denmark)

    Ivyanskiy, Ilya; Sand, Carsten; Thomsen, Simon Francis

    2012-01-01

    urticaria. We present a case series of 19 patients with chronic urticaria treated in a university department with omalizumab and give an overview of the existing literature comprising an additional 59 cases as well as a total of 139 patients enrolled in two randomized controlled trials comparing omalizumab......Omalizumab is a recombinant humanized monoclonal antibody that blocks the high-affinity Fc receptor of IgE. Omalizumab has been approved for the treatment of moderate to severe asthma; however, there is currently more and more data showing promising results in the management also of chronic...

  12. Chronic lead poisoning

    Energy Technology Data Exchange (ETDEWEB)

    Hess, K.; Straub, P.W.

    1974-02-19

    A detailed description is given of the complex pathological picture observed in the case of a worker with 30 years' occupational exposure to lead in an accumulator factory (evolution of the disease, clinical findings, autopsy). In spite of a typical clinical picture, lead is not held responsible for the terminal encephalopathy, in view of the fact that Alzheimer's syndrome was discovered at autopsy. However, the neurovegetative asthenia and progressive kidney disease without hypertonia, but with uraemia, which preceded the encephalopathy are in all probability due to chronic lead poisoning. The article discusses the diagnosis and symptomatology of chronic lead poisoning, encephalopathy and kidney disease.

  13. Low chronic radiation doses

    International Nuclear Information System (INIS)

    In the context of the Chernobyl and Fukushima accidents where large territories have been contaminated durably and as consequence where local populations are submitted to chronic low radiation doses, IRSN (French institute for radiation protection and nuclear safety) has led various studies to assess the impact of chronic low doses. Studies about the effects of uranium on marine life show that the impact is strongly dependent on the initial state of the individual (zebra Danio rerio fish). The studies about the impact of chronic low doses due to cesium and strontium contamination show different bio-accumulations: 137Cs is found in the animal's whole body with higher concentrations in muscles and kidneys while 90Sr is found almost exclusively in bones and it accumulates more in female mice than in males. The study dedicated to the sanitary impact of chronic low doses on the workers of the nuclear industry shows a higher risk for developing a leukemia, a pleural cancer or a melanoma but no correlation appears between doses and the appearance of the pleural cancer or the melanoma. (A.C.)

  14. Chronic kidney disease

    Science.gov (United States)

    ... enable JavaScript. Chronic kidney disease is the slow loss of kidney function over time. The main job of the kidneys is to remove wastes and excess water from the body. Causes ... over months or years. You may not notice any symptoms for some time. The loss of function may be so slow that you ...

  15. Refractory chronic migraine

    DEFF Research Database (Denmark)

    Martelletti, Paolo; Katsarava, Zaza; Lampl, Christian;

    2014-01-01

    The debate on the clinical definition of refractory Chronic Migraine (rCM) is still far to be concluded. The importance to create a clinical framing of these rCM patients resides in the complete disability they show, in the high risk of serious adverse events from acute and preventative drugs and...

  16. Chronic fatigue syndrome.

    NARCIS (Netherlands)

    Prins, J.B.; Meer, J.W.M. van der; Bleijenberg, G.

    2006-01-01

    During the past two decades, there has been heated debate about chronic fatigue syndrome (CFS) among researchers, practitioners, and patients. Few illnesses have been discussed so extensively. The existence of the disorder has been questioned, its underlying pathophysiology debated, and an effective

  17. [Chronic lichenoid keratosis].

    Science.gov (United States)

    Skorupka, M; Kuhn, A; Mahrle, G

    1992-02-01

    We report on a 41-year-old woman with keratosis lichenoides chronica, a disorder first described by Kaposi in 1886 as "lichen moniliformis", who later also developed chronic lymphatic leukaemia. Since Kaposi's original report, 38 additional cases have been reported. Occurrence of keratosis lichenoides chronica associated with malignant disorders has not previously been described. PMID:1548136

  18. Chronic Mononucleosis Syndrome

    OpenAIRE

    Shortt, S. E. D.; Haynes, E. R.

    1986-01-01

    Debilitating illness in patients with only vague symptoms and minimal findings from physical examination and routine laboratory tests is frustrating for both patient and physician. A case of chronic mononucleosis is presented, and the literature describing the clinical and laboratory features of the syndrome is reviewed, with reference to four recent studies. Guidelines for diagnosis are suggested.

  19. What Is Chronic Pain?

    Medline Plus

    Full Text Available ... with chronic pain is that when we start looking for an explanation it’s not so much that we’re looking in the wrong place, but we may be looking in the wrong time. And what I mean ...

  20. Chronic Myeloproliferative Neoplasms Treatment

    Science.gov (United States)

    ... Cancers by Body Location Childhood Cancers Adolescent & Young Adult Cancers Metastatic Cancer Recurrent Cancer Research NCI’s Role in ... on the hands and feet. Muscle pain. Itching. Diarrhea . Stages of Chronic Myeloproliferative Neoplasms Key Points There is no standard staging system ...

  1. Autoantibodies in chronic pancreatitis

    DEFF Research Database (Denmark)

    Rumessen, J J; Marner, B; Pedersen, N T;

    1985-01-01

    In 60 consecutive patients clinically suspected of having chronic pancreatitis the serum concentration of the immunoglobulins (IgA, IgG, IgM), the IgG- and IgA-type non-organ-specific autoantibodies against nuclear material (ANA), smooth and striated muscle, mitochondria, basal membrane, and...

  2. What Is Chronic Pain?

    Medline Plus

    Full Text Available ... manageable, but chronic pain is different. And because it is different, we need to think about it in very different ways. Ed Covington, M.D.: ... no apparent physical injury or illness to explain it. The physician and the patient are accustomed to ...

  3. Chronic Pain: Symptoms, Diagnosis, & Treatment

    Science.gov (United States)

    ... in the treatment. Treatment With chronic pain, the goal of treatment is to reduce pain and improve ... some treatments used for chronic pain. Less invasive psychotherapy, relaxation therapies, biofeedback, and behavior modification may also ...

  4. Screening for Chronic Kidney Disease

    Science.gov (United States)

    Understanding Task Force Recommendations Screening for Chronic Kidney Disease The U.S. Preventive Services Task Force (Task Force) has issued a final recommendation on Screening for Chronic Kidney Disease (CKD) . This recommendation ...

  5. Chronic Fatigue Syndrome (CFS): Symptoms

    Science.gov (United States)

    ... please visit this page: About CDC.gov . Chronic Fatigue Syndrome (CFS) Share Compartir Symptoms On this Page ... Symptoms What's the Clinical Course of CFS? Chronic fatigue syndrome can be misdiagnosed or overlooked because its ...

  6. Chronic obstructive pulmonary disease

    Directory of Open Access Journals (Sweden)

    V K Vijayan

    2013-01-01

    Full Text Available The global prevalence of physiologically defined chronic obstructive pulmonary disease (COPD in adults aged >40 yr is approximately 9-10 per cent. Recently, the Indian Study on Epidemiology of Asthma, Respiratory Symptoms and Chronic Bronchitis in Adults had shown that the overall prevalence of chronic bronchitis in adults >35 yr is 3.49 per cent. The development of COPD is multifactorial and the risk factors of COPD include genetic and environmental factors. Pathological changes in COPD are observed in central airways, small airways and alveolar space. The proposed pathogenesis of COPD includes proteinase-antiproteinase hypothesis, immunological mechanisms, oxidant-antioxidant balance, systemic inflammation, apoptosis and ineffective repair. Airflow limitation in COPD is defined as a postbronchodilator FEV1 (forced expiratory volume in 1 sec to FVC (forced vital capacity ratio <0.70. COPD is characterized by an accelerated decline in FEV1. Co morbidities associated with COPD are cardiovascular disorders (coronary artery disease and chronic heart failure, hypertension, metabolic diseases (diabetes mellitus, metabolic syndrome and obesity, bone disease (osteoporosis and osteopenia, stroke, lung cancer, cachexia, skeletal muscle weakness, anaemia, depression and cognitive decline. The assessment of COPD is required to determine the severity of the disease, its impact on the health status and the risk of future events (e.g., exacerbations, hospital admissions or death and this is essential to guide therapy. COPD is treated with inhaled bronchodilators, inhaled corticosteroids, oral theophylline and oral phosphodiesterase-4 inhibitor. Non pharmacological treatment of COPD includes smoking cessation, pulmonary rehabilitation and nutritional support. Lung volume reduction surgery and lung transplantation are advised in selected severe patients. Global strategy for the diagnosis, management and prevention of Chronic Obstructive Pulmonary Disease

  7. Defining and Measuring Chronic Conditions

    Centers for Disease Control (CDC) Podcasts

    2013-05-20

    This podcast is an interview with Dr. Anand Parekh, U.S. Department of Health and Human Services Deputy Assistant Secretary for Health, and Dr. Samuel Posner, Preventing Chronic Disease Editor in Chief, about the definition and burden of multiple chronic conditions in the United States.  Created: 5/20/2013 by Preventing Chronic Disease (PCD), National Center for Chronic Disease Prevention and Health Promotion (NCCDPHP).   Date Released: 5/20/2013.

  8. Studies on aseptic higher plants, (4)

    International Nuclear Information System (INIS)

    The relationship between sterilized soil and plant growth was discussed in the last report, and it was recognized that γ-ray sterilization was more advantageous than autoclave sterilization. Therefore, radishes were cultured under sterile condition in the γ-ray sterilized soil in an acrylamide isolator. After completing their reproductive growth, the possibility of completion of the next generation was investigated. Fighttron was applied for culture environment. The life cycle was completed, and sterilized seeds of the first generation were obtained after fructification. These seeds were cultivated in the acrylamide isolator under exactly the same conditions. They bloomed, fructified and produced the sterilized seeds of the second generation. Flowering, fructification and generation inheritance were thus proved to be possible even under the sterile condition. (Kobatake, H.)

  9. Chronic complicated osteomyelitis

    International Nuclear Information System (INIS)

    Fourteen patients with prior trauma and/or surgery of the lower extremity and suspected active chronic osteomyelitis underwent MR imaging. Eleven patients also underwent In-111 scanning. All patients had surgical confirmation, MR imaging could assess the extent of abnormal marrow and distinguish abnormal marrow due to granulation tissue from active osteomyelitis. The presence and extent of soft-tissue infection could be determined and distinguished from bone involvement in spite of tissue distortion. The course and origin of sinus tracts could be followed. MR imaging was more sensitive to active infection than In-111 scanning. All 11 cases of active osteomyelitis were correctly diagnosed with MR imaging. In-111 scans were positive in only five of the eight cases of active infection in which scans were obtained. MR imaging is useful in chronic complicated osteomyelitis

  10. Acetaminophen for Chronic Pain

    DEFF Research Database (Denmark)

    Ennis, Zandra Nymand; Dideriksen, Dorthe; Vaegter, Henrik Bjarke;

    2016-01-01

    conducted according to PRISMA guidelines. All studies were conducted in patients with hip- or knee osteoarthritis and six out of seven studies had observation periods of less than three months. All included studies showed no or little efficacy with dubious clinical relevance. In conclusion, there is little......Acetaminophen (paracetamol) is the most commonly used analgesic worldwide and recommended as first-line treatment in all pain conditions by WHO. We performed a systematic literature review to evaluate the efficacy of acetaminophen when used for chronic pain conditions. Applying three broad search...... evidence to support the efficacy of acetaminophen treatment in patients with chronic pain conditions. Assessment of continuous efficacy in the many patients using acetaminophen worldwide is recommended. This article is protected by copyright. All rights reserved....

  11. [Pauciarticular juvenile chronic arthritis].

    Science.gov (United States)

    Hertzberger-ten Cate, R; Fiselier, T

    1991-10-01

    On basis of clinical and immunogenetic factors most children with pauciarticular juvenile chronic arthritis can be included in one of the subtypes: type 1 and type 2 pauciarticular JCA. Type 1 occurs in young children, mainly girls, with involvement of knees, ankles or elbows. In the majority of children antinuclear antibodies can be detected. The presence of these autoantibodies is associated with chronic anterior uveitis. Type 2 or the juvenile spondylarthropathies include morbus Bechterew, the reactive arthritides and arthritis associated with psoriasis and inflammatory bowel diseases. Large joints of the lower extremities are involved, back pain is unusual at onset, but enthesitis is frequently present. There is a strong association with HLA-B27. Treatment of both subsets consists of non-steroidal anti-inflammatory drugs, application of intra-articular steroids, physio- and hydrotherapy and splinting. In children with a polyarticular course of type 1, or a prolonged course of type 2 disease modifying drugs are often needed. PMID:1957301

  12. Chronic progressive multiple sclerosis

    International Nuclear Information System (INIS)

    A long-lasting immunological suppression action seems to be produced by total lymphoid irradiation; some authors emphasize the favorable effect of this treatment on chronic progressive multiple sclerosis. In order to evaluate the actual role of TLI, 6 patients affected with chronic progressive multiple sclerosis were submitted to TLI with shaped and personalized fields at the Istituto del Radio, University of Brescia, Italy. The total dose delivered was 19.8 Gy in 4 weeks, 1.8 Gy/day, 5d/w; a week elapsed between the first and the second irradiation course. Disability according to Kurtzke scale was evaluated, together with blood lymphocyte count and irradiation side-effects, over a mean follow-up period of 20.8 months (range: 13-24). Our findings indicate that: a) disease progression was not markedly reduced by TLI; b) steroid hormones responsivity was restored after irradiation, and c) side-effects were mild and tolerable

  13. Estabilidade dos carotenoides,antocianinas e vitamina C presentes no suco tropical de acerola (Malpighia emarginata DC. adoçado envasado pelos processos Hot-Fill e asséptico Stability of carotenoids, anthocyanins and vitamin C presents in acerola sweetened tropical juice preserved by hot fill and aseptic processes

    Directory of Open Access Journals (Sweden)

    Claisa Andréa Silva de Freitas

    2006-10-01

    Full Text Available As frutas tropicais são muito aceitas pelos consumidores, e são importantes fontes de componentes antioxidantes. A acerola, conhecida por conter grandes quantidades de vitamina C, é também rica em antocianinas e carotenóides. O presente trabalho teve por objetivo avaliar a estabilidade dos carotenóides totais, antocianinas totais e vitamina C do suco tropical de acerola adoçado, elaborado pelos processos Hot Fill (garrafas de vidro e asséptico (embalagens cartonadas, durante 350 dias de armazenamento em condições similares às de comercialização (28ºC ± 2ºC. Ao final do experimento observou-se que não houve perdas de antocianinas totais para o processo Hot Fill, no entanto, para o processo asséptico constatou-se uma redução de 86,89% dos teores iniciais. Os valores de carotenóides totais permaneceram inalterados nas amostras do processo asséptico, enquanto nas do Hot Fill houve uma redução de 12,5%. Constatou-se redução nos teores de vitamina C da ordem de 23,61% para o processo Hot Fill e de 35,95% para o processo asséptico.Tropical fruits are widely accepted by consumers, and important sources of antioxidant compounds. Acerola, known to have high vitamin C levels, is also rich in anthocyanins and carotenoids. The purpose of this work was to evaluate the stability of the total carotenoids, total anthocyanins and ascorbic acid of the acerola sweetened tropical juice produced by the Hot Fill (glass bottles and aseptic (packings carton process during 350 days of storage in similar conditions of trade (28ºC ± 2ºC. It was observed that there were not losses of total anthocyanins for the process Hot Fill, however for the aseptic process a reduction of 86.89% of the initial values was observed. The values of total corotenoids stayed unaffected in the samples of the aseptic process, while in the one of the Hot Fill there was a reduction of 12.5%. A reduction in the values of ascorbic acid of 23.61% was observed for the Hot

  14. Chronic Cough in Childhood

    OpenAIRE

    Alexander, David S.

    1982-01-01

    Persistent cough in children is a symptom, and the cause should be ascertained. Reactive airways disease is the most common reason for chronic cough in children over three to six months of age, especially at night. Under three months, the cause is likely to be more serious. Cough often disturbs parents more than the child, and physicians should consider parents' need for sleep and relief when deciding whether or not to prescribe cough suppressants. Investigations depend on the child's age, th...

  15. Chronic cough in children.

    Science.gov (United States)

    Wagner, Johana B Castro; Pine, Harold S

    2013-08-01

    The management of chronic cough, a common complaint in children, is challenging for most health care professionals. Millions of dollars are spent every year on unnecessary testing and treatment. A rational approach based on a detailed interview and a thorough physical examination guides further intervention and management. Inexpensive and simple homemade syrups based on dark honey have proved to be an effective measure when dealing with cough in children. PMID:23905830

  16. Chronic inflammatory systemic diseases

    OpenAIRE

    Straub, Rainer H.; Schradin, Carsten

    2016-01-01

    It has been recognized that during chronic inflammatory systemic diseases (CIDs) maladaptations of the immune, nervous, endocrine and reproductive system occur. Maladaptation leads to disease sequelae in CIDs. The ultimate reason of disease sequelae in CIDs remained unclear because clinicians do not consider bodily energy trade-offs and evolutionary medicine. We review the evolution of physiological supersystems, fitness consequences of genes involved in CIDs during different life-history sta...

  17. Chronic pneumonitis of infancy

    Energy Technology Data Exchange (ETDEWEB)

    Abe, Katsumi; Kamata, Noriko; Okazaki, Eiwa [Department of Radiology, Tokyo Metropolitan Komagome Hospital, 3-18-22 Honkomagome, Bunkyo-ku, Tokyo 113-8677 (Japan); Moriyama, Sachiko; Funata, Nobuaki [Department of Pathology, Tokyo Metropolitan Komagome Hospital, 3-18-22 Honkomagome, Bunkyo-ku, Tokyo 113-8677 (Japan); Takita, Junko; Yamada, Hideo; Takayama, Naohide [Department of Pediatrics, Tokyo Metropolitan Komagome Hospital, 3-18-22 Honkomagome, Bunkyo-ku, Tokyo 113-8677 (Japan)

    2002-07-01

    Chronic pneumonitis of infancy (CPI) is a very rare lung disease in infants and young children. We report a 33-day-old infant with CPI, focusing on the radiologic aspects of the disease. Chest radiographs showed variable and non-specific appearances including ground-glass shadowing, consolidation, volume loss, and hyperinflation. Dense alveolar opacities progressed as CPI advanced. The radiologic features of our case reflected pathologic changes. (orig.)

  18. Renal failure (chronic)

    OpenAIRE

    Clase, Catherine

    2009-01-01

    Chronic renal failure is characterised by a gradual and sustained decline in renal clearance or glomerular filtration rate (GFR). Continued progression of renal failure will lead to renal function too low to sustain healthy life. In developed countries, such people will be offered renal replacement therapy in the form of dialysis or renal transplantation. Requirement for dialysis or transplantation is termed end-stage renal disease (ESRD).Diabetes, glomerulonephritis, hypertension, pyelone...

  19. Chronic cough hypersensitivity syndrome

    OpenAIRE

    Morice, Alyn H.

    2013-01-01

    Chronic cough has been suggested to be due to three conditions, asthma, post nasal drip, and reflux disease. A different paradigm has evolved in which cough is viewed as the primary condition characterised by afferent neuronal hypersensitivity and different aspects of this syndrome are manifest in the different phenotypes of cough. There are several advantages to viewing cough hypersensitivity as the unifying diagnosis; Communication with patients is aided, aetiology is not restricted and the...

  20. EBV CHRONIC INFECTIONS

    Directory of Open Access Journals (Sweden)

    Delia Racciatti

    2010-02-01

    Full Text Available

    The infection from Epstein-Barr virus (EBV or virus of infectious mononucleosis, together with other herpesviruses’ infections, represents a prototype of persistent viral infections characterized by the property of the latency. Although the reactivations of the latent infection are associated with the resumption of the viral replication and eventually with the “shedding”, it is still not clear if this virus can determine chronic infectious diseases, more or less evolutive. These diseases could include some pathological conditions actually defined as “idiopathic”and characterized by the “viral persistence” as the more credible pathogenetic factor. Among the so-called idiopathic syndromes, the “chronic fatigue syndrome” (CFS aroused a great interest around the eighties of the last century when, just for its relationship with EBV, it was called “chronic mononucleosis” or “chronic EBV infection”.

    Today CFS, as defined in 1994 by the CDC of Atlanta (USA, really represents a multifactorial syndrome characterized by a chronic course, where reactivation and remission phases alternate, and by a good prognosis

  1. Chronic alloantibody mediated rejection

    OpenAIRE

    Smith, R. Neal; Colvin, Robert B.

    2011-01-01

    Alloantibodies clearly cause acute antibody mediated rejection, and all available evidence supports their pathogenic etiology in the development of chronic alloantibody mediated rejection (CAMR). But the slow evolution of this disease, the on-going immunosuppression, the variations in titer of alloantibodies, and variation in antigenic targets all complicate identifying which dynamic factors are most important clinically and pathologically. This review highlights the pathological factors rela...

  2. Clinicoroentgenological control in chronic pneumonia

    International Nuclear Information System (INIS)

    A comprehensive clinicoroentgenological study was used to examine 494 patients with chronic pneumonia. Morphological and functional changes observed in the pulmonary pare and functional changes observed in the pulmonary parenchyma and bronchial tree were studied. Types of pneumosclerosis, tigns of exacerbation of chronic pneumonia and abscess formation, morphological and functional disorders of bronchial penetrability in the pneumonic zone were described. Three forms of chronic pneumonia: bronchial, bronchiectatic and abscessing are signled out. The bronchial form is subdivided into chronic pneumonia with chronic bronchitis without deformity and wi.th deforming chronic bronchitis. In the bronchiectatic form pneumonia can be with cylindrical, saccular and cyst-like bronchiectasia. The general diagnosis of chronic pneumonia is established clinically depending on type and variants in 89-94% of cases, by X-ray and sonographic findings in all patients; types and variants of disease are most frequently defined after bronchography

  3. Chronic obstructive pulmonary disease.

    Science.gov (United States)

    Barnes, Peter J; Burney, Peter G J; Silverman, Edwin K; Celli, Bartolome R; Vestbo, Jørgen; Wedzicha, Jadwiga A; Wouters, Emiel F M

    2015-01-01

    Chronic obstructive pulmonary disease (COPD) is a common disease with high global morbidity and mortality. COPD is characterized by poorly reversible airway obstruction, which is confirmed by spirometry, and includes obstruction of the small airways (chronic obstructive bronchiolitis) and emphysema, which lead to air trapping and shortness of breath in response to physical exertion. The most common risk factor for the development of COPD is cigarette smoking, but other environmental factors, such as exposure to indoor air pollutants - especially in developing countries - might influence COPD risk. Not all smokers develop COPD and the reasons for disease susceptibility in these individuals have not been fully elucidated. Although the mechanisms underlying COPD remain poorly understood, the disease is associated with chronic inflammation that is usually corticosteroid resistant. In addition, COPD involves accelerated ageing of the lungs and an abnormal repair mechanism that might be driven by oxidative stress. Acute exacerbations, which are mainly triggered by viral or bacterial infections, are important as they are linked to a poor prognosis. The mainstay of the management of stable disease is the use of inhaled long-acting bronchodilators, whereas corticosteroids are beneficial primarily in patients who have coexisting features of asthma, such as eosinophilic inflammation and more reversibility of airway obstruction. Apart from smoking cessation, no treatments reduce disease progression. More research is needed to better understand disease mechanisms and to develop new treatments that reduce disease activity and progression. PMID:27189863

  4. Imaging of chronic osteomyelitis

    International Nuclear Information System (INIS)

    The diagnosis of chronic osteomyelitis is made on the basis of clinical, radiologic and histologic findings. The role of imaging in patients with known chronic osteomyelitis is to detect and to delineate areas of active infection. To correctly interpret the imaging findings, it is essential to take both the individual clinical findings and previous imaging studies into account. Reliable signs of active infection are bone marrow abscess, sequestra and sinus tract formation. Only the combined evaluation of bony changes together with alterations of the adjacent soft tissues provides good diagnostic accuracy. Projection radiography gives an overview of the condition of the bone, which provides the basis for follow-up and the selection of further imaging modalities. Computed tomography can be used to evaluate even discrete or complex bony alterations and to guide percutaneous biopsy or drainage. Magnetic resonance imaging achieves the best diagnostic sensitivity and specificity and provides superior contrast as well as anatomical resolution in both bone marrow and soft tissues. In this paper the features and clinical relevance of imaging in primary chronic osteomyelitis, posttraumatic osteomyelitis, tuberculous spondylitis and osteomyelitis of the diabetic foot are reviewed, with particular respect to MRI. (orig.)

  5. Identical mitochondrial somatic mutations unique to chronic periodontitis and coronary artery disease

    Directory of Open Access Journals (Sweden)

    Tokala Pallavi

    2016-01-01

    Full Text Available Context: The inflammatory processes involved in chronic periodontitis and coronary artery diseases (CADs are similar and produce reactive oxygen species that may result in similar somatic mutations in mitochondrial deoxyribonucleic acid (mtDNA. Aims: The aims of the present study were to identify somatic mtDNA mutations in periodontal and cardiac tissues from subjects undergoing coronary artery bypass surgery and determine what fraction was identical and unique to these tissues. Settings and Design: The study population consisted of 30 chronic periodontitis subjects who underwent coronary artery surgery after an angiogram had indicated CAD. Materials and Methods: Gingival tissue samples were taken from the site with deepest probing depth; coronary artery tissue samples were taken during the coronary artery bypass grafting procedures, and blood samples were drawn during this surgical procedure. These samples were stored under aseptic conditions and later transported for mtDNA analysis. Statistical Analysis Used: Complete mtDNA sequences were obtained and aligned with the revised Cambridge reference sequence (NC_012920 using sequence analysis and auto assembler tools. Results: Among the complete mtDNA sequences, a total of 162 variations were spread across the whole mitochondrial genome and present only in the coronary artery and the gingival tissue samples but not in the blood samples. Among the 162 variations, 12 were novel and four of the 12 novel variations were found in mitochondrial NADH dehydrogenase subunit 5 complex I gene (33.3%. Conclusions: Analysis of mtDNA mutations indicated 162 variants unique to periodontitis and CAD. Of these, 12 were novel and may have resulted from destructive oxidative forces common to these two diseases.

  6. History of Chronic Subdural Hematoma.

    Science.gov (United States)

    Lee, Kyeong-Seok

    2015-10-01

    Trephination or trepanation is an intentional surgical procedure performed from the Stone Age. It looks like escaping a black evil from the head. This technique is still used for treatment of chronic subdural hematoma (SDH). Now, we know the origin, pathogenesis and natural history of this lesion. The author try to explore the history of trephination and modern discovery of chronic SDH. The author performed a detailed electronic search of PubMed. By the key word of chronic SDH, 2,593 articles were found without language restriction in May 2015. The author reviewed the fact and way, discovering the present knowledge on the chronic SDH. The first authentic report of chronic SDH was that of Wepfer in 1657. Chronic SDH was regarded as a stroke in 17th century. It was changed as an inflammatory disease in 19th century by Virchow, and became a traumatic lesion in 20th century. However, trauma is not necessary in many cases of chronic SDHs. The more important prerequisite is sufficient potential subdural space, degeneration of the brain. Modifying Virchow's description, chronic SDH is sometimes traumatic, but most often caused by severe degeneration of the brain. From Wepfer's first description, nearly 350 years passed to explore the origin, pathogenesis, and fate of chronic SDH. The nature of the black evil in the head of the Stone Age is uncovering by many authors riding the giant's shoulder. Chronic SDH should be categorized as a degenerative lesion instead of a traumatic lesion. PMID:27169062

  7. Chronic radiation syndrome

    Energy Technology Data Exchange (ETDEWEB)

    Akleyev, Alexander V. [Urals Research Centre for Radiation Medicine, Chelyabinsk (Russian Federation). Clinical Dept.

    2014-04-01

    Comprehensive analysis of chronic radiation syndrome, covering epidemiology, pathogenesis, pathoanatomy, diagnosis and treatment. Based on observations in a unique sample of exposed residents of the Techa riverside villages in the Urals. Casts new light on the condition. Of value for all practitioners and researchers with an interest in chronic radiation syndrome. This book covers all aspects of chronic radiation syndrome (CRS) based on observations in a unique sample of residents of the Techa riverside villages in the southern Urals who were exposed to radioactive contamination in the 1950s owing to releases of liquid radioactive wastes from Mayak Production Association, which produced plutonium for weapons. In total, 940 cases of CRS were diagnosed in this population and these patients were subjected to detailed analysis. The opening chapters address the definition and classification of CRS, epidemiology and pathogenesis, covering molecular and cellular mechanisms, radioadaptation, and the role of tissue reactions. The pathoanatomy of CRS during the development and recovery stages is discussed for all organ systems. Clinical manifestations of CRS at the different stages are then described in detail and the dynamics of hematopoietic changes are thoroughly examined. In the following chapters, principles of diagnosis (including assessment of the exposure doses to critical organs) and differential diagnosis from a wide range of other conditions are discussed and current and potential treatment options, described. The medical and social rehabilitation of persons with CRS is also covered. This book, which casts new light on the condition, will be of value for all practitioners and researchers with an interest in CRS.

  8. Chronic inflammatory demyelinative polyneuropathy

    DEFF Research Database (Denmark)

    Said, Gérard; Krarup, Christian

    2013-01-01

    Chronic inflammatory demyelinative polyneuropathy (CIDP) is an acquired polyneuropathy presumably of immunological origin. It is characterized by a progressive or a relapsing course with predominant motor deficit. The diagnosis rests on the association of non-length-dependent predominantly motor...... deficit following a progressive or a relapsing course associated with increased CSF protein content. The demonstration of asymmetrical demyelinating features on nerve conduction studies is needed for diagnosis. The outcome depends on the amplitude of axon loss associated with demyelination. CIDP must be...... differentiated from acquired demyelinative neuropathies associated with monoclonal gammopathies. CIDP responds well to treatment with corticosteroids, intravenous immunoglobulins, and plasma exchanges, at least initially....

  9. Pathogenesis of chronic urticaria.

    Science.gov (United States)

    Kaplan, A P; Greaves, M

    2009-06-01

    Chronic urticaria is defined as the presence of urticaria (hives) for at least 6 weeks with the assumption that it occurs daily or close to it. If we eliminate physical urticarias and urticarial vasculitis from consideration, the remainder can be divided into autoimmune chronic urticaria (45%) and idiopathic chronic urticaria (55%). The autoimmune subgroup is associated with the IgG anti-IgE receptor alpha subunit in 35-40% of patients and IgG anti-IgE in an additional 5-10%. These autoantibodies have been shown to activate blood basophils and cutaneous mast cells in vitro with augmentation of basophil activation by complement and release of C5a, in particular. Binding methods (immunoblot and ELISA) yield positives in many autoimmune diseases as well as occasional normal subjects or patients with other forms of urticaria but most such sera are non-functional. Activation of basophils or mast cells causing histamine release is quite specific for chronic urticaria and defines the autoimmune subgroup. Although pathogenicity is not formally proven, the antibodies cause wealing upon intradermal injection, and removal of the autoantibody leads to remission. A cellular infiltrate is seen to be characterized by mast cell degranulation and infiltration of CD4+ T lymphocytes, monocytes, neutrophils, eosinophils, and basophils. The intensity of the infiltrate and clinical severity of the disease (including accompanying angio-oedema) is more severe in the autoimmune subpopulation. This latter group also has a higher evidence of human leucocyte antigen DR alleles associated with autoimmunity and a 25% incidence of antithyroid antibodies with diagnosed hypothyroidism in some. Hypo-responsiveness of patients' basophils to anti-IgE and hyperresponsiveness to serum defines another subpopulation (at least 50%) that overlaps the idiopathic and autoimmune subgroups. Hypo-responsiveness to anti-IgE has been shown to be associated with elevated levels of cytoplasmic phosphatases that

  10. [Chronic nonbacterial osteomyelitis].

    Science.gov (United States)

    Keskitalo, Paula; Remes-Pakarinen, Terhi; Vähäsalo, Paula; Niinimäki, Jaakko; Kröger, Liisa

    2016-01-01

    Chronic nonbacterial osteomyelitis is an autoinflammatory disease occurring mainly in children and adolescents, typically involving recurrent or persistent osteitic foci. The symptom is bone pain, possibly accompanied by soft tissue tenderness. Some patients exhibit symptoms of systemic inflammation. The. precise etiology of the disease is not known, but an imbalance of inflammatory and anti-inflammatory cytokines is presumed to play a role in the development of the disease. While an anti-inflammatory analgesic is in most cases sufficient to calm down the osteitis, the use of corticosteroids, anti- TNF-a inhibitors or bisphosphonates is required in some cases. PMID:26939487

  11. Sexuality and chronic illness.

    Science.gov (United States)

    Steinke, Elaine E

    2013-11-01

    Sexual function is often affected in individuals living with chronic illness and their partners, and multiple comorbidities increase the likelihood of sexual dysfunction. This review focuses on the areas of cardiovascular disease, respiratory conditions, and cancer, all areas for which there are practical, evidence-based strategies to guide sexual counseling. Although nurses have been reluctant to address the topic of sexuality in practice, a growing number of studies suggest that patients want nurses to address their concerns and provide resources to them. Thus, nurses must be proactive in initiating conversations on sexual issues to fill this gap in practice. PMID:24066783

  12. Understanding Chronically Reported Families

    OpenAIRE

    Jonson-Reid, Melissa; Emery, Clifton R.; Drake, Brett; Stahlschmidt, Mary Jo

    2010-01-01

    Although a strong literature on child maltreatment re-reporting exists, much of that literature stops at the first re-report. The literature on chronic re-reporting, meaning reports beyond the second report, is scant. The authors follow Loman’s lead in focusing on reports beyond the first two to determine what factors predict these “downstream” report stages. Cross-sector, longitudinal administrative data are used. The authors analyze predictors at each of the first four recurrences (first to...

  13. Chronic wound management and research

    OpenAIRE

    Romanelli M

    2014-01-01

    Marco Romanelli Wound Healing Research Unit, Division of Dermatology, University of Pisa, Pisa, ItalyI would like to share with you a new open access peer-reviewed journal – Chronic Wound Care Management and Research, published by Dove Medical Press. Chronic Wound Care Management and Research is an international, peer-reviewed, open-access online journal publishing original research, case reports, reviews, editorials, and commentaries on the management of chronic wounds and...

  14. Chronic urticaria: new management options

    OpenAIRE

    Greenberger, Paul A.

    2014-01-01

    Chronic urticaria is defined as episodic or daily hives lasting for at least 6 weeks and impairs quality of life. Two main subtypes include chronic idiopathic (spontaneous) urticaria and inducible (physical) urticaria, but some patients have urticarial vasculitis. “Autoimmune chronic urticaria” implies the presence of histamine releasing or mast cell activating autoantibodies to IgE or FcϵRI, the high affinity receptor on mast cells and basophils. In patients not readily controlled with label...

  15. Chronic avulsive injuries of childhood

    International Nuclear Information System (INIS)

    Children and adolescents are prone to avulsive injuries related to a combination of their propensity for great strength, ability to sustain extreme levels of activity, and immature growing apophyses. Appropriate interpretation of imaging studies showing chronic avulsive injuries is essential so that the irregularity and periostitis that can be associated with chronic avulsions is not misinterpreted as probable malignancy. This article reviews the chronic avulsive injuries of childhood. (orig.)

  16. Chronic avulsive injuries of childhood

    Energy Technology Data Exchange (ETDEWEB)

    Donnelly, L.F.; Helms, C.A. [Dept. of Radiology, Duke Univ. Medical Center, Durham, NC (United States); Bisset, G.S. III [Dept. of Radiology, Duke Univ. Medical Center, Durham, NC (United States)]|[Department of Pediatrics, Duke University Medical Center, Durham, NC (United States); Squire, D.L. [Department of Pediatrics, Duke University Medical Center, Durham, NC (United States)

    1999-03-01

    Children and adolescents are prone to avulsive injuries related to a combination of their propensity for great strength, ability to sustain extreme levels of activity, and immature growing apophyses. Appropriate interpretation of imaging studies showing chronic avulsive injuries is essential so that the irregularity and periostitis that can be associated with chronic avulsions is not misinterpreted as probable malignancy. This article reviews the chronic avulsive injuries of childhood. (orig.) With 12 figs., 8 refs.

  17. Hyperphosphatemia of Chronic Kidney Disease

    OpenAIRE

    Hruska, Keith A.; Mathew, Suresh; Lund, Richard; Qiu, Ping; Pratt, Raymond

    2008-01-01

    Observational studies have determined hyperphosphatemia to be a cardiovascular risk factor in chronic kidney disease. Mechanistic studies have elucidated that hyperphosphatemia is a direct stimulus to vascular calcification, which is one cause of morbid cardiovascular events contributing to the excess mortality of chronic kidney disease. This review describes the pathobiology of hyperphosphatemia that develops as a consequence of positive phosphate balance in chronic kidney disease and the me...

  18. [Psychosomatic approach for chronic migraine].

    Science.gov (United States)

    Hashizume, Masahiro

    2011-11-01

    From psychosomatic view point, the psychological or social stresses and depressive or anxiety disorders are very important factors in the course and the maintenance for migraine patients. These factors are very complex, and often lead the migraine becoming chronic. In the psychosomatic approach, not only the physical assessment for chronic migraine but also the assessments for stress and mental states are done. As the psychosomatic therapies for chronic migraine, autogenic training, biofeedback therapy and cognitive therapy are effective. PMID:22277516

  19. Obstructive Jaundice in Chronic Pancreatitis

    OpenAIRE

    Hollands, M. J.; Little, J. M.

    1989-01-01

    Significant obstructive jaundice in chronic pancreatitis is generally considered to be rare. Eleven of 57 consecutive patients with proven chronic pancreatitis have developed significant obstructive jaundice of more than transient duration. Eight presented as jaundice complicating known pancreatitis and three as jaundice of unknown cause. Life table analysis showed a steady rise in the risk of developing jaundice up to the end of 10 years from the onset of chronic pancreatitis. Jaundice was f...

  20. Diagnostic dilemmas in chronic urticaria.

    Science.gov (United States)

    Toubi, E; Grattan, C; Zuberbier, T

    2015-06-01

    The European Academy of Allergy and Clinical Immunology (EAACI)/Global Allergy and Asthma European Network (GA(2) LEN)/European Dermatology Forum (EDF)/World Allergy Organization (WAO) recently published updated recommendations for the classification, diagnosis and management of chronic urticaria (CU). This article discusses several cases of CU that provide examples of how the recommendations in the guidelines can be implemented in the diagnosis of chronic spontaneous urticaria (CSU) (also called chronic idiopathic urticaria [CIU]), chronic inducible urticaria (CINDU) or CU with comorbidities. PMID:26053291

  1. Understanding Biofilms in Chronic Sinusitis.

    Science.gov (United States)

    Tajudeen, Bobby A; Schwartz, Joseph S; Palmer, James N

    2016-02-01

    Chronic sinusitis is a burdensome disease that has substantial individual and societal impact. Although great advances in medical and surgical therapies have been made, some patients continue to have recalcitrant infections. Microbial biofilms have been implicated as a cause of recalcitrant chronic sinusitis, and recent studies have tried to better understand the pathogenesis of chronic sinusitis as it relates to microbial biofilms. Here, we provide an overview of biofilms in chronic sinusitis with emphasis on pathogenesis, treatment, and future directions. In addition, recent evidence is presented, elucidating the role of bitter taste receptors as a possible key factor leading to biofilm formation. PMID:26758863

  2. Idiopathic chronic eosinophilic pneumonia

    Directory of Open Access Journals (Sweden)

    Cordier Jean-François

    2006-04-01

    Full Text Available Abstract Idiopathic chronic eosinophilic pneumonia (ICEP is characterized by subacute or chronic respiratory and general symptoms, alveolar and/or blood eosinophilia, and peripheral pulmonary infiltrates on chest imaging. Eosinophilia is present in most cases, usually in excess of 1000/mm3. In absence of significant blood eosinophilia, a diagnosis of ICEP is supported by the demonstration of bronchoalveolar lavage eosinophilia. ICEP is typically associated with eosinophil counts higher than lymphocyte counts in the bronchoalveolar lavage. ICEP is a rare disorder of unknown cause. Its exact prevalence remains unknown. ICEP may affect every age group but is rare in childhood. It is twice as frequent in women as in men. One third to one half of the ICEP patients have a history of asthma. The mainstay of treatment of ICEP is systemic corticosteroids. Response to oral corticosteroid therapy is dramatic and has led to the consideration of corticosteroid challenge as a diagnostic test for ICEP. Nevertheless, relapses or development of severe asthma are frequent when tapering or withdrawing treatment. Long-term oral corticosteroid therapy is necessary in up to half of the patients.

  3. [Toilet of chronic wound].

    Science.gov (United States)

    Strok, Nevenka; Huljev, Dubravko

    2013-10-01

    Chronic wound toilet, with appropriate care of the surrounding skin, is one of the basic steps that must be performed in the treatment of patients with chronic wound. On wound cleaning and bandaging, it is of utmost importance to choose an appropriate technique of cleansing, select an appropriate solution for leaching and choose an appropriate wound dressing. In this way, the wound is protected from dirt from the environment and microorganisms, while protecting the surrounding tissue from the wound exudate, providing optimal conditions for better and faster wound healing and contributing to improved patient quality of life. The frequency of dressing change is individual and must be tailored to each patient in correlation with the psychosocial status of the patient, the type of the wound, the amount and type of wound exudate, as well as what is to be put on the wound. One of the most important elements in wound toilet is appropriate care for the surrounding skin. Basic guidelines for skin care must meet three basic criteria: adequate washing and cleansing of the skin, maintain the physiological balance of the skin and protect the skin from external damage. PMID:24371977

  4. Chronic Hepatitis C.

    Science.gov (United States)

    Tran, Tram T.; Martin, Paul

    2001-12-01

    Infection with hepatitis C virus (HCV) accounts for 40% of cases of chronic liver disease in the United States and is now the most common indication for liver transplantation. Estimates suggest that 4 million people (1.8%) of the American population are or have been infected with HCV. Currently, the treatment of choice for patients with chronic HCV infection is recombinant interferon alfa with ribavirin. Pegylated interferons are a promising new development, and in combination with ribavirin, they will rapidly become the standard of care. The goals of therapy are to slow disease progression, improve hepatic histology, reduce infectivity, and reduce the risk of hepatocellular carcinoma. Sustained virologic response, which generally implies the absence of viremia for 6 months or more following completion of therapy, is increasingly being regarded as a cure, with evidence of slowing or even regression of fibrosis on follow-up liver biopsy. A number of factors have been shown to be predictive of a sustained response, including viral genotype other than 1, low serum HCV RNA levels, absence of cirrhosis, younger age, female gender, and shorter duration of infection. Disease severity as assessed by liver biopsy, comorbidities, and possible contraindications to therapy should be weighed in the decision to begin treatment. Counseling patients regarding transmission, natural history, and drug and alcohol abstinence also should be included in management. Close monitoring should be done during treatment for side effects of interferon, including depression and bone marrow suppression. Hemolytic anemia is the major side effect of ribavirin. PMID:11696276

  5. The chronic leukaemias

    Directory of Open Access Journals (Sweden)

    Peter Jacobs

    1989-09-01

    Full Text Available The slow progression of both chronic granulocytic and lymphocytic leukaemia, when compared to their acute counterparts, has been used as an argument to support less aggressive therapy or even, in some instances, a watch-and-wait policy. This conservative approach is bolstered by a number of observations including the ease with which haematologic control can initially be achieved, the older age of patients with the lymphocytic variant and the paucity of controlled data showing that long disease-free survival or cure can result from the use of aggressive treatment. Given these circumstances, it is not surprising that many such individuals are managed outside specialised centres using a variety of agents and schedules, both of which may, on occasions, be inappropriate. Accumulating evidence suggests a need to reconsider these practices since cure is now possible in selected patients with chronic granulocytic leukaemia while the use of multi-drug regimens in the lymphatic form can significantly improve survival. These advances are the result of carefully conducted clinical trials involving many individuals the world over and constitute the basis fo r advocating early referral to those institutions where all the necessary expertise is available.

  6. Canine chronic inflammatory rhinitis.

    Science.gov (United States)

    Windsor, Rebecca C; Johnson, Lynelle R

    2006-05-01

    Chronic inflammatory rhinitis is commonly found in dogs with chronic nasal disease and is characterized by lymphoplasmacytic infiltrates in the nasal mucosa in the absence of an obvious etiologic process. The pathogenesis of lymphoplasmacytic rhinitis remains unknown. Animals respond poorly to antibiotics, oral glucocorticoids, and antihistamines, making primary infectious, immune-mediated, or allergic etiologies unlikely. Aberrant immune response to inhaled organisms or allergens may induce inflammation in some animals. Common clinical signs include nasal discharge, sneezing, coughing, epistaxis, and stertor. Diagnosis is made by performing a thorough history, physical examination, radiography or advanced imaging (via computed tomography or magnetic resonance imaging), rhinoscopy, and nasal mucosal biopsy to rule out primary etiologies of nasal discharge. Treatment strategies have included various antibiotics, antihistamines, oral and inhalant steroids, nonsteroidal antiinflammatories, and antifungal medications. Some dogs may respond partially to doxycycline or azithromycin, although it is unclear whether response is related to antimicrobial or antiinflammatory properties of these drugs. Hydration of the nasal cavity through nasal drops or aerosols may limit nasal discharge, and some animals may improve with inhalant (but rarely oral) glucocorticoids. PMID:16711613

  7. Clinical Scenarios in Chronic Kidney Disease: Chronic Tubulointerstitial Diseases.

    Science.gov (United States)

    Meola, Mario; Samoni, Sara; Petrucci, Ilaria

    2016-01-01

    Chronic tubulointerstitial diseases are a common final pathway toward chronic renal failure regardless the primary damage (glomerular, vascular or directly the tubulointerstitium). Chronic tubulointerstitial nephritis (CTN) is characterized by interstitial scarring, fibrosis and tubule atrophy, resulting in progressive chronic kidney disease. Most frequent causes of CTN are drugs, heavy metals, obstructive uropathy, nephrolithiasis, reflux disease, immunologic diseases, neoplasia, ischemia, metabolic diseases, genetics and miscellaneous. At ultrasound (US), kidneys' morphological aspect is similar in all forms of chronic interstitial nephropathy and only chronic pyelonephritis with or without reflux shows distinguishing characteristics. In interstitial nephropathy, kidneys' profiles are finely irregular and corticomedullary differentiation is altered because of a diffused hyperechogenicity. The only indirect sign of chronic interstitial damage can be derived from the value of intrarenal resistive indexes that hardly overcome 0.75. US is mandatory in clinical chronic pyelonephritis work-up because it provides information on kidney's diameter and on growth nomogram in children. Renal profiles can be more or less altered depending on the number of cortical scars and the presence of pseudonodular areas of segmental compensatory hypertrophy. In the early stages, US diagnosis of renal tuberculosis is difficult because parenchymal lesions are non-specific. US sensitivity in the diagnosis of hydronephrosis is very high, close to 100% and, finally, US is the first choice imaging technique in the diagnosis of urinary lithiasis. PMID:27169608

  8. Molecular genetics of chronic neutrophilic leukemia, chronic myelomonocytic leukemia and atypical chronic myeloid leukemia

    OpenAIRE

    Li, Bing; Gale, Robert Peter; Xiao, Zhijian

    2014-01-01

    According to the 2008 World Health Organization classification, chronic neutrophilic leukemia, chronic myelomonocytic leukemia and atypical chronic myeloid leukemia are rare diseases. The remarkable progress in our understanding of the molecular genetics of myeloproliferative neoplasms and myelodysplastic/myeloproliferative neoplasms has made it clear that there are some specific genetic abnormalities in these 3 rare diseases. At the same time, there is considerable overlap among these disord...

  9. Folate Deficiency in Chronic Pancreatitis

    Directory of Open Access Journals (Sweden)

    Gopalakrishna Rajesh

    2010-07-01

    Full Text Available Dear Sir, While there has been a spurt of interest in genetic alterations associated with pancreatitis in the past few years, interest in the role of environmental factors has largely focused on alcoholism and smoking with insufficient attention being paid to the contributions of nutritional deficiency, and the role of environmental toxins in the pathogenesis of pancreatitis. Braganza and Dormandy [1] argue convincingly about the role played by cytochrome P450 monooxygenases (especially CYP1A enzyme induction by xenobiotics and the resultant oxidative stress, as also the now increasingly recognized reductive stress posed by the metabolites in initiating pancreatic injury. Their article underlines the important part played by the deficiency of methyl and thiol molecules in different stages of the progression of pancreatic damage. Furthermore, they attempt to establish a link between environmental and genetic factors and bring in a holistic view on the etiopathogenesis of chronic pancreatitis. We have recently demonstrated lower plasma methionine levels in two cohorts of chronic pancreatitis patients; one of tropical chronic pancreatitis and the other, of alcoholic chronic pancreatitis as compared to healthy controls [2] which suggests that deficiency of methyl groups may be a factor in various forms of pancreatitis. Similarly, we have shown lower red cell glutathione levels in chronic pancreatitis patients with tropical chronic pancreatitis and alcoholic chronic pancreatitis, indicating deficiency of thiol molecules. In addition, we have demonstrated significantly higher levels of plasma total homocysteine in chronic pancreatitis patients than in healthy controls. Moreover, our study has shown that there is a deficiency of red cell folate in the majority of chronic pancreatitis patients, more so in tropical chronic pancreatitis; and that folate deficiency appeared to be the key factor in hyperhomocysteinemia in chronic pancreatitis patients

  10. Chronic Kidney Disease and Medicines

    Science.gov (United States)

    ... from our online catalog. Alternate Language URL Español Chronic Kidney Disease and Medicines: What You Need to Know Page ... What you need to know Because you have chronic kidney disease, you should take steps to protect your kidneys. ...

  11. Program for the Chronically Ill.

    Science.gov (United States)

    Schoenherr, Arline; Schnarr, Barbara

    The program for chronically ill students in the Detroit public schools is described. Forms are presented listing needed information and implications for teachers of the following conditions: diabetes, sickle cell anemia, chronic renal failure, congenital heart disease, hemophilia, rheumatoid arthritis, asthma, leukemia, and cystic fibrosis. The…

  12. Chronic diseases and mental disorder.

    NARCIS (Netherlands)

    Verhaak, P.F.M.; Heijmans, M.J.W.M.; Peters, L.; Rijken, M.

    2005-01-01

    The aim of this study was to achieve a better understanding of the relationship between chronic medical illness and mental distress. Therefore, the association between chronic medical illness and mental distress was analysed, taking into account the modifying effects of generic disease characteristi

  13. Chronic granulomatous disease

    International Nuclear Information System (INIS)

    Chronic granulomatous disease (CGD) is a rare congenital immunodeficiency characterized by recurrent bacterial and fungal infections as well as granuloma formation. The manifestations of this disease can involve single or multiple organ systems. The lungs are the most commonly affected organ; however, lymphatic, hepatic, skeletal, gastrointestinal, genitourinary, head and neck, and central nervous system involvement have also been described. Most patients present with symptoms in their first few years of life. Due to the nonspecific manner in which patients present, the pediatric radiologist may be among the first to recognize the pattern of infection, inflammation, and granuloma formation leading to a diagnosis of CGD. The purpose of this paper is to review the imaging findings of CGD that can manifest throughout the body. (orig.)

  14. Chronic granulomatous disease

    Energy Technology Data Exchange (ETDEWEB)

    Towbin, Alexander J. [Cincinnati Children' s Hospital Medical Center, Department of Radiology, Cincinnati, OH (United States); Chaves, Ian [Advocate Illinois Masonic Medical Center, Department of Internal Medicine, Chicago, IL (United States)

    2010-05-15

    Chronic granulomatous disease (CGD) is a rare congenital immunodeficiency characterized by recurrent bacterial and fungal infections as well as granuloma formation. The manifestations of this disease can involve single or multiple organ systems. The lungs are the most commonly affected organ; however, lymphatic, hepatic, skeletal, gastrointestinal, genitourinary, head and neck, and central nervous system involvement have also been described. Most patients present with symptoms in their first few years of life. Due to the nonspecific manner in which patients present, the pediatric radiologist may be among the first to recognize the pattern of infection, inflammation, and granuloma formation leading to a diagnosis of CGD. The purpose of this paper is to review the imaging findings of CGD that can manifest throughout the body. (orig.)

  15. Approaching chronic cough.

    Science.gov (United States)

    Poulose, Vijo; Tiew, Pei Yee; How, Choon How

    2016-02-01

    Chronic cough is one of the most common reasons for referral to a respiratory physician. Although fatal complications are rare, it may cause considerable distress in the patient's daily life. Western and local data shows that in patients with a normal chest radiograph, the most common causes are postnasal drip syndrome, postinfectious cough, gastro-oesophageal reflux disease and cough variant asthma. Less common causes are the use of angiotensin-converting enzyme inhibitors, smoker's cough and nonasthmatic eosinophilic bronchitis. A detailed history-taking and physical examination will provide a diagnosis in most patients, even at the primary care level. Some cases may need further investigations or specialist referral for diagnosis. PMID:26892615

  16. Chronic hypophosphatemic osteopathy

    Energy Technology Data Exchange (ETDEWEB)

    Koppers, B.; Schmid, L.; Hofmann, E.; Sauer, E.

    1980-07-01

    The process of chronic hypophosphatemic vitamine D-resistant rickets is described by observation of two cases. With the male patient - our first case - the disease was sporadic and had not been recognized for a long time. In his early adulthood it manifested itself as Umbauzonen (pseudofractures) in the larger context of active osteomalacia. It was possible to observe the pseudofractures before and while the patient was medicamentously treated. High doses of vitamine D 3 and dosage of phosphate mitigated the complaints although with respect to the radiological, scintigraphical, humoral and histological findings there was only slow improvement or no improvement at all. The patient's daughter is affected by the disease as well. In her case the pathological signs of her bones became better when treated with vitamine D 3.

  17. 'Chronic' identities in mental illness.

    Science.gov (United States)

    von Peter, Sebastian

    2013-04-01

    The term 'chronicity' is still widely used in psychiatric discourse and practice. A category employed in political, administrative and therapeutic contexts, it guides practitioners' beliefs and actions. This paper attempts a review of the attitudes and procedures that result as a consequence of identifying 'chronically' disturbed identities in clinical practice. An essentially social, relational and materialist understanding of mental illness is used to highlight the kind of thinking underlying the notion of 'chronic' identities in day-to-day psychiatric routines. Problematising the notions of singularity and expressiveness, as well as mind/body- and self/other-distinctions, it claims the category itself is responsible for creating a 'chronic' kind of being. A spatial metaphor is presented in the conclusion, illustrating a mental strategy by which we can re-shape our thinking about 'chronic' identities. It attempts to describe how the shift from an epistemological to a praxeographic approach could build a more complete understanding of mental illness. PMID:23528064

  18. Genetics Home Reference: chronic granulomatous disease

    Science.gov (United States)

    ... for This Condition autosomal recessive chronic granulomatous disease CGD granulomatous disease, chronic X-linked chronic granulomatous disease ... Network Patient Support and Advocacy Resources (6 links) CGD Society Immune Deficiency Foundation International Patient Organisation for ...

  19. Chronic Cough in Adults (Beyond the Basics)

    Science.gov (United States)

    ... of Use ©2016 UpToDate, Inc. Patient education: Chronic cough in adults (Beyond the Basics) Authors Ronald C ... and helps to prevent infection. However, sometimes a cough can become a chronic condition. A chronic cough ...

  20. Chronic Liver Disease and African Americans

    Science.gov (United States)

    ... American > Chronic Liver Disease Chronic Liver Disease and African Americans Among African Americans, chronic liver disease is a ... white women. At a glance – Cancer Rates for African Americans (2008-2012) Cancer Incidence Rates per 100,000 – ...

  1. Treatment Options by Stage (Chronic Lymphocytic Leukemia)

    Science.gov (United States)

    ... ALL Treatment Childhood AML Treatment Research Chronic Lymphocytic Leukemia Treatment (PDQ®)–Patient Version General Information About Chronic Lymphocytic Leukemia Go to Health Professional Version Key Points Chronic ...

  2. Treatment Option Overview (Chronic Lymphocytic Leukemia)

    Science.gov (United States)

    ... ALL Treatment Childhood AML Treatment Research Chronic Lymphocytic Leukemia Treatment (PDQ®)–Patient Version General Information About Chronic Lymphocytic Leukemia Go to Health Professional Version Key Points Chronic ...

  3. Treatment Options for Chronic Myelogenous Leukemia

    Science.gov (United States)

    ... ALL Treatment Childhood AML Treatment Research Chronic Myelogenous Leukemia Treatment (PDQ®)–Patient Version General Information About Chronic Myelogenous Leukemia Go to Health Professional Version Key Points Chronic ...

  4. General Information about Chronic Myelogenous Leukemia

    Science.gov (United States)

    ... ALL Treatment Childhood AML Treatment Research Chronic Myelogenous Leukemia Treatment (PDQ®)–Patient Version General Information About Chronic Myelogenous Leukemia Go to Health Professional Version Key Points Chronic ...

  5. Treatment Option Overview (Chronic Myelogenous Leukemia)

    Science.gov (United States)

    ... ALL Treatment Childhood AML Treatment Research Chronic Myelogenous Leukemia Treatment (PDQ®)–Patient Version General Information About Chronic Myelogenous Leukemia Go to Health Professional Version Key Points Chronic ...

  6. Neuroimmune interactions in itch: Do chronic itch, chronic pain, and chronic cough share similar mechanisms?

    Science.gov (United States)

    Ji, Ru-Rong

    2015-12-01

    Itch and pain are closely related but also clearly distinct sensations. Pain is known to suppress itch, while analgesics such as morphine can provoke itch. However, in pathological and chronic conditions, pain and itch also have similarities. Dysfunction of the nervous system, as manifested by neural plastic changes in primary sensory neurons of the peripheral nervous system (peripheral sensitization) and spinal cord and brain stem neurons in the central nervous system (central sensitization) will result in chronic pain and itch. Importantly, these diseases also result from immune dysfunction, since inflammatory mediators can directly activate or sensitize nociceptive and pruriceptive neurons in the peripheral and central nervous system, leading to pain and itch hypersensitivity. In this mini-review, I discuss the roles of Toll-like receptors (TLRs), transient receptor potential ankyrin 1 (TRPA1) ion channel, and Nav1.7 sodium channel in regulating itch and inflammation, with special emphasis of neuronal TLR signaling and the interaction of TLR7 and TRPA1. Chronic pain and chronic itch are debilitating diseases and dramatically impact the life quality of patients. Targeting TLRs for the control of inflammation, neuroinflammation (inflammation restricted in the nervous system), and hyperexcitability of nociceptors and pruriceptors will lead to new therapeutics for the relief of chronic pain and chronic itch. Finally, given the shared mechanisms among chronic cough, chronic pain, and chronic itch and the demonstrated efficacy of the neuropathic pain drug gabapentin in treating chronic cough, novel therapeutics targeting TRPA1, Nav1.7, and TLRs may also help to alleviate refractory cough via modulating neuron-immune interaction. PMID:26351759

  7. [Mnemonic complaints and chronic migraine].

    Science.gov (United States)

    Santos-Lasaosa, S; Viloria-Alebesque, A; Morandeira-Rivas, C; Lopez Del Val, L J; Bellosta-Diago, E; Velazquez-Benito, A

    2013-08-16

    INTRODUCTION. Patients with chronic migraine often report lower cognitive performance, which affects their quality of life. AIMS. To analyse whether the mnemonic capacity of patients with chronic migraine is altered or not. SUBJECTS AND METHODS. A cross-sectional study was conducted in patients with chronic migraine evaluated consecutively in our unit, and paired by age (18-60 years) and gender with a control group consisting of cognitively healthy volunteers. The following cognitive instruments were administered: Folstein Minimental State Examination (MMSE), Memory Alteration Test (M@T), Montreal Cognitive Assessment (MoCA) and working memory. RESULTS. A total of 30 patients with chronic migraine were included (mean age: 49.33 ± 10.05 years) paired with a control group of 30 healthy volunteers (mean age: 44.83 ± 10.91 years). The mean elapsed time since onset of the patients with chronic migraine was 4.47 ± 2.74 years. On performing a comparative analysis between the two groups, significant differences were found with overall lower scores in the group of patients with chronic migraine in the MoCA (24.16 versus 29), M@T (43.76 versus 48.8) and working memory tests (17.5 versus 24.26). Performance in the MMSE was similar in both groups. CONCLUSIONS. Patients with chronic migraine can have lower cognitive performance regardless of distracting elements, such as pharmacological factors or psychiatric comorbidity, since chronic migraine can be understood as yet another element within the spectrum of chronic pain. PMID:23884868

  8. Common Questions About Chronic Prostatitis.

    Science.gov (United States)

    Holt, James D; Garrett, W Allan; McCurry, Tyler K; Teichman, Joel M H

    2016-02-15

    Chronic prostatitis is relatively common, with a lifetime prevalence of 1.8% to 8.2%. Risk factors include conditions that facilitate introduction of bacteria into the urethra and prostate (which also predispose the patient to urinary tract infections) and conditions that can lead to chronic neuropathic pain. Chronic prostatitis must be differentiated from other causes of chronic pelvic pain, such as interstitial cystitis/bladder pain syndrome and pelvic floor dysfunction; prostate and bladder cancers; benign prostatic hyperplasia; urolithiasis; and other causes of dysuria, urinary frequency, and nocturia. The National Institutes of Health divides prostatitis into four syndromes: acute bacterial prostatitis, chronic bacterial prostatitis (CBP), chronic nonbacterial prostatitis (CNP)/chronic pelvic pain syndrome (CPPS), and asymptomatic inflammatory prostatitis. CBP and CNP/CPPS both lead to pelvic pain and lower urinary tract symptoms. CBP presents as recurrent urinary tract infections with the same organism identified on repeated cultures; it responds to a prolonged course of an antibiotic that adequately penetrates the prostate, if the urine culture suggests sensitivity. If four to six weeks of antibiotic therapy is effective but symptoms recur, another course may be prescribed, perhaps in combination with alpha blockers or nonopioid analgesics. CNP/CPPS, accounting for more than 90% of chronic prostatitis cases, presents as prostatic pain lasting at least three months without consistent culture results. Weak evidence supports the use of alpha blockers, pain medications, and a four- to six-week course of antibiotics for the treatment of CNP/CPPS. Patients may also be referred to a psychologist experienced in managing chronic pain. Experts on this condition recommend a combination of treatments tailored to the patient's phenotypic presentation. Urology referral should be considered when appropriate treatment is ineffective. Additional treatments include pelvic

  9. Chronic Obstructive Pulmonary Disease (COPD) Includes: Chronic Bronchitis and Emphysema

    Science.gov (United States)

    ... Obstructive Pulmonary Disease (COPD) Includes: Chronic Bronchitis and Emphysema Recommend on Facebook Tweet Share Compartir Data are ... of adults who have ever been diagnosed with emphysema: 3.4 million Percent of adults who have ...

  10. Chronic Thromboembolic Pulmonary Hypertension Associated with Chronic Inflammation.

    Science.gov (United States)

    Kuse, Naoyuki; Abe, Shinji; Kuribayashi, Hidehiko; Fukuda, Asami; Kusunoki, Yuji; Narato, Ritsuko; Saito, Hitoshi; Gemma, Akihiko

    2016-01-01

    Chronic thromboembolic pulmonary hypertension (CTEPH) is one of the leading causes of severe pulmonary hypertension. According to previously reported studies in the pertinent literature, chronic inflammatory conditions may be implicated in the development of CTEPH. We herein describe the case of a 56-year-old woman who was diagnosed with CTEPH in association with chronic infection. The patient had experienced five episodes of pneumonia in the five years prior to the diagnosis of CTEPH. Blood tests from the previous five years of outpatient follow-up demonstrated that the C-reactive protein level was slightly elevated. This case suggests that a relationship exists between chronic inflammation and CTEPH, and furthermore, may contribute towards elucidating the pathophysiology of CTEPH. PMID:27250055

  11. Chronic infections in hip arthroplasties

    DEFF Research Database (Denmark)

    Lange, Jeppe; Troelsen, Anders; Thomsen, Reimar W; Søballe, Kjeld

    2012-01-01

    Two-stage revision is regarded by many as the best treatment of chronic infection in hip arthroplasties. Some international reports, however, have advocated one-stage revision. No systematic review or meta-analysis has ever compared the risk of reinfection following one-stage and two-stage revisi......Two-stage revision is regarded by many as the best treatment of chronic infection in hip arthroplasties. Some international reports, however, have advocated one-stage revision. No systematic review or meta-analysis has ever compared the risk of reinfection following one-stage and two......-stage revisions for chronic infection in hip arthroplasties....

  12. Chronic paronychia in a hairdresser.

    Science.gov (United States)

    Allouni, A; Yousif, A; Akhtar, S

    2014-09-01

    Chronic paronychia is a common occupational disease. It is multifactorial and affects a number of different groups of workers. However, the condition is not described as affecting hairdressers although hairdressing is associated with a range of other occupation-related hand conditions. We report an unusual case of chronic paronychia in a female hairdresser which occurred as a consequence of a hair shaft penetrating beneath the nail fold. Personal hygiene with thorough removal of any hairs that have penetrated the epidermis and wearing clean gloves can prevent the condition. We suggest that clinicians should be aware of the types of occupation and mechanisms involved in patients developing chronic paronychia. PMID:24985481

  13. Prevalence of chronic conditions – Chronic Airflow Obstruction

    OpenAIRE

    Ireland and Northern Ireland Population Health Observatory (INIsPHO)

    2012-01-01

    IPH has estimated and forecast clinical diagnosis rates of CAO among adults for the years 2010, 2015 and 2020. In the Republic of Ireland, the data are based on the Survey of Lifestyle, Attitudes and Nutrition (SLÁN) 2007. The data describe the number of people who report that they have experienced doctor-diagnosed chronic bronchitis, chronic obstructive lung (pulmonary) disease, or emphysema in the previous 12 months (annual clinical diagnosis). Data is available by age and sex for each Loca...

  14. STUDY ON CHRONIC LYMPHEDEMA

    Directory of Open Access Journals (Sweden)

    Aromal Chekavar

    2014-03-01

    Full Text Available INTRODUCTION: Little attention has been given to the impact of long standing lymphedema and its complications. AIM: The aim of the study was to prepare a profile of long standing lymphedema complications PATIENTS AND METHODS: A total of 88 patients with lymphedema were included in this hospital based descriptive study. The study was designed to include age, sex, etiology, duration, prophylaxis and complications observed in each patient and entered into a proforma separately. RESULTS: A total of 88 cases studied, 74 cases are lower limb and 14 cases are upper limb lymphedema. Among 74 cases of lower limb lymphedema 4 cases occurred after inguinal lymphadenectomy and upper limb lypmhedema are secondary to postmodified radical mastectomy. A total of 40 cases in 88 patients had complications of lymphedema, among 88 cases studied 54 male and 34 were female patients 29 patients had cellulitis 3 patients had infected ulcer with maggots and 1 patient had lymphoma, among 88 patients 50 patients was on regular benzathine pencillin prophylaxis. Incidence of complications is 37.5 percent and incidence of complication in patient on penicillin prophylaxis 28.4 percent. Our study does not show no significant statistical correlation between benzathine prophylaxis and occurrence of complications. (pvalue0.727. CONCLUSION: The study provided relevant information about complications of lymphoedema, Pencillin prophylaxis is not found effective in reducing recurrent cellulitis episodes in chronic lymphedema. In our series we found one case of lymphoma (Diffuse large cell lymphoma developing in lymphedematous tissue of lower limb.

  15. Microbiology of chronic rhinosinusitis.

    Science.gov (United States)

    Brook, I

    2016-07-01

    Most sinus infections are viral and only a small percentage develop bacterial infection. Rhino-, influenza, and para-influenza viruses are the most frequent viral causes of sinusitis. The most common bacterial isolates from children and adult patients with community-acquired acute bacterial sinusitis are Streptococcus pneumoniae, Haemophilus influenzae, Moraxella catarrhalis, and Streptococcus pyogenes. Staphylococcus aureus and anaerobic organisms (Prevotella and Porphyromonas, Fusobacterium, and Peptostreptococcus spp.) are the commonest isolates in chronic rhinosinusitis (CRS). Aerobic and anaerobic beta lactamase-producing bacteria (BLPB) were recovered from over a third of these patients. Methicillin-resistant S. aureus (MRSA) accounted for over 60 % of S. aureus isolates. Pseudomonas aeruginosa and other aerobic and facultative Gram-negative rods are frequently recovered in nosocomial sinusitis, the immunocompromised host, individuals with human immunodeficiency virus infection, and in cystic fibrosis. The CRS infection evolves the formation of a biofilm that might play a significant role in the pathogenesis and persistence of CRS. The microbiology of sinusitis is influenced by previous antimicrobial therapy, vaccinations, and the presence of normal flora capable of interfering with the growth of pathogens. Recognition of the unique microbiology of CRS and their antimicrobial susceptibility is of great importance when selecting antimicrobial therapy. PMID:27086363

  16. [Chronic lymphocytic leukemia].

    Science.gov (United States)

    Aoki, Sadao

    2016-03-01

    Currently, several novel drugs are available for chronic lymphocytic leukemia (CLL) in Western countries. Of these drugs, those that inhibit the B-cell receptor (BCR) signaling pathway are the most promising. Ibrutinib inhibits BTK in the BCR pathway and can be administered orally. The results of several clinical trials suggest that ibrutinib is highly effective against relapsed/resistant (RR) and treatment-naïve CLL. Furthermore, ibrutinib shows equivalent efficacy on CLL with the 17p deletion. Idelalisib, which also blocks the BCR pathway, inhibits PIK3delta and induces CLL cell death. Clinical trials have shown outstanding efficacy of idelalisib against RR-CLL, especially when administered with antiCD20 antibodies. This drug is also effective against CLL with the 17p deletion. ABT-199 is another novel drug; it inhibits BCL2 signaling, not the BCR pathway, and can be administered orally. The efficacy of ABT-199 against RR-CLL has been demonstrated in a number of clinical trials. These drugs have only mild toxicity and can be used for patients in poor general condition. Unfortunately, none of these drugs have yet been approved in Japan. Rapid resolution of the 'drug lag' problem is necessary. PMID:27076234

  17. Treatment of chronic inflammatory neuropathies

    NARCIS (Netherlands)

    F. Eftimov

    2015-01-01

    This thesis focuses on the efficacy of existing and alternative treatments in chronic inflammatory demyelinating polyradiculoneuropathy (CIDP) and multifocal motor neuropathy (MMN) and explores predictors of treatment response in patients with CIDP treated with corticosteroids. The efficacy of intra

  18. Sexuality and Chronic Kidney Disease

    Science.gov (United States)

    ... and erection difficulties. Therapy also can help a person work through the effects of chronic illness on sexual functioning. A sex therapist can be a psychiatrist, psychologist, physician, or social ...

  19. What Is Chronic Lymphocytic Leukemia?

    Science.gov (United States)

    ... Topic Normal bone marrow, blood, and lymphoid tissue What is chronic lymphocytic leukemia? Cancer starts when cells ... body, including the lymph nodes, liver, and spleen. What is leukemia? Leukemia is a cancer that starts ...

  20. What Is Chronic Myeloid Leukemia?

    Science.gov (United States)

    ... leukemia? Next Topic Normal bone marrow and blood What is chronic myeloid leukemia? Cancer starts when cells ... their treatment is the same as for adults. What is leukemia? Leukemia is a cancer that starts ...

  1. Chronic urticaria: new management options.

    Science.gov (United States)

    Greenberger, Paul A

    2014-01-01

    Chronic urticaria is defined as episodic or daily hives lasting for at least 6 weeks and impairs quality of life. Two main subtypes include chronic idiopathic (spontaneous) urticaria and inducible (physical) urticaria, but some patients have urticarial vasculitis. "Autoimmune chronic urticaria" implies the presence of histamine releasing or mast cell activating autoantibodies to IgE or FcϵRI, the high affinity receptor on mast cells and basophils. In patients not readily controlled with labeled dosages of second generation H1 receptor antagonists (antihistamines), there is evidence for reduction of urticaria using up to 4 fold increases in labeled dosages. The biologic modifier, omalizumab, helps to reduce lesions of chronic urticaria within 1-2 weeks. PMID:25383135

  2. COPD (Chronic Obstructive Pulmonary Disease)

    Science.gov (United States)

    ... page from the NHLBI on Twitter. What Is COPD? Español COPD, or chronic obstructive pulmonary (PULL-mun- ... can clog them. Normal Lungs and Lungs With COPD Figure A shows the location of the lungs ...

  3. Management of chronic musculoskeletal pain.

    Science.gov (United States)

    Uhl, Richard L; Roberts, Timothy T; Papaliodis, Dean N; Mulligan, Michael T; Dubin, Andrew H

    2014-02-01

    Chronic musculoskeletal pain results from a complex interplay of mechanical, biochemical, psychological, and social factors. Effective management is markedly different from that of acute musculoskeletal pain. Understanding the physiology of pain transmission, modulation, and perception is crucial for effective management. Pharmacologic and nonpharmacologic therapies such as psychotherapy and biofeedback exercises can be used to manage chronic pain. Evidence-based treatment recommendations have been made for chronic pain conditions frequently encountered by orthopaedic surgeons, including low back, osteoarthritic, posttraumatic, and neuropathic pain. Extended-release tramadol; select tricyclic antidepressants, serotonin reuptake inhibitors, and anticonvulsants; and topical medications such as lidocaine, diclofenac, and capsaicin are among the most effective treatments. However, drug efficacy varies significantly by indication. Orthopaedic surgeons should be familiar with the widely available safe and effective nonnarcotic options for chronic musculoskeletal pain. PMID:24486756

  4. Chronic Conditions among Medicare Beneficiaries

    Data.gov (United States)

    U.S. Department of Health & Human Services — The data used in the chronic condition reports are based upon CMS administrative enrollment and claims data for Medicare beneficiaries enrolled in the...

  5. How to investigate: Chronic pain.

    Science.gov (United States)

    Hague, Matthew; Shenker, Nicholas

    2014-12-01

    Chronic pain is defined as an unpleasant sensory and emotional experience persisting longer than the normal process of healing, usually longer than 3 months. About a fifth of the world's population is believed to suffer from chronic pain. In Europe, chronic pain accounts for nearly 500 m lost working days, and it costs the European economy >€34 billion (£28 billion) every year. Establishing a reliable diagnosis is the primary challenge in evaluating a patient with chronic pain. Common diagnoses not to miss include seronegative spondyloarthritides, endocrine abnormalities including severe vitamin D deficiency and polymyalgia rheumatica. Once important or treatable diagnoses have been ruled out, the history can be used as a tool to establish a therapeutic plan for shared decision-making using the biopsychosocial model. Onward referral to pain clinics can be helpful for more involved patient management, but often good outcomes are achieved with the support of primary care. PMID:26096090

  6. Chronic cough and pulmonary infiltrates

    International Nuclear Information System (INIS)

    Case of chronic cough and pulmonary infiltrates, in patient feminine of 66 years who she consults for scheme of cough with mucous expectoration that it increases with the exhibition to the powder and the cold

  7. Correlation between Aminotransferase Ratio (AST/ALT and Other Biochemical Parameters in Chronic Liver Disease of Viral Origin

    Directory of Open Access Journals (Sweden)

    Shah Md Fazlul Karim

    2015-03-01

    Full Text Available Background: In recent years the ratio of aspartate aminotransferase (AST to alanine aminotransferase (ALT in patients of chronic liver disease (CLD of various origins has gained much attention. This variable is readily available, easy to interpret, and inexpensive and the clinical utility of the AST/ALT ratio in the diagnostic workup of patients with CLD is quite promising. Objective: The present study was designed to find out the link between aminotransferase (AST/ALT ratio with commonly measured biochemical parameters of liver function tests in CLD of viral origin. Materials and method: This cross sectional study was carried out in the department of Biochemistry, Sir Salimullah Medical College, Dhaka, Bangladesh. Forty four biopsy proven diagnosed subjects of chronic viral hepatitis without cirrhosis of both sex were selected purposively. With aseptic precaution 5 mL venous blood was collected from each subject and common liver function tests (serum AST, ALT, AST/ALT ratio, alkaline phosphatase, total bilirubin, serum total protein, serum albumin, serum globulin, serum albumin/globulin ratio, prothrombin time and viral serology (HBsAg, Anti HDV antibody, Anti HCV antibody were performed. Data were analyzed by SPSS version 19 for Windows. Pearson’s correlation test was done to determine association between AST/ALT with other biochemical parameters. Results: Mean(±SD age of the study subjects was 32.55±10.55 years (range 20-50 years with 48 (77.7% male and 14 (22.6% female subjects. Pearson’s correlation test was done between AST to ALT ratio with other biochemical parameters and prothrombin time showed significant positive correlation (p <0.01. Conclusion: In our study we found significant positive correlation between AST/ALT with prothrombin time in CLD subjects without cirrhosis.

  8. Chronic giardiasis of the stomach.

    OpenAIRE

    Quincey, C.; James, P.D.; Steele, R. J.

    1992-01-01

    Two cases of chronic giardiasis of the stomach diagnosed from gastric mucosal biopsy specimens are reported. The first case was associated with an acute-on-chronic gastritis and Helicobacter-like organisms, and the second with an adenocarcinoma of the stomach. In both cases the trophozoites had been missed in earlier biopsy specimens. As far as is known this is the first report of giardiasis of the stomach.

  9. Therapeutic Vaccines for Chronic Infections

    Science.gov (United States)

    Autran, Brigitte; Carcelain, Guislaine; Combadiere, Béhazine; Debre, Patrice

    2004-07-01

    Therapeutic vaccines aim to prevent severe complications of a chronic infection by reinforcing host defenses when some immune control, albeit insufficient, can already be demonstrated and when a conventional antimicrobial therapy either is not available or has limited efficacy. We focus on the rationale and challenges behind this still controversial strategy and provide examples from three major chronic infectious diseases-human immunodeficiency virus, hepatitis B virus, and human papillomavirus-for which the efficacy of therapeutic vaccines is currently being evaluated.

  10. Neurostimulation for chronic cluster headache

    OpenAIRE

    Wolter, Tilman; Kaube, Holger

    2012-01-01

    Neurostimulation techniques for the treatment of primary headache syndromes, particularly of chronic cluster headache, have received much interest in recent years. Occipital nerve stimulation (ONS) has yielded favourable clinical results and, despite the limited numbers of published cases, is becoming a routine treatment for refractory chronic cluster headache in specialized centres. Meanwhile, other promising techniques such as spinal cord stimulation (SCS) or sphenopalate ganglion stimulati...

  11. Chronic Lyme Disease: An appraisal

    OpenAIRE

    Marques, Adriana

    2008-01-01

    Chronic Lyme disease” is a confusing term that has been used to describe very different patient populations. Studies have shown that most patients diagnosed with “chronic Lyme disease” either have no objective evidence of previous or current infection with B. burgdorferi or are patients that should be classified as having post-Lyme disease syndrome, which is defined as continuing or relapsing non-specific symptoms (such as fatigue, musculoskeletal pain, and cognitive complaints) in a patient...

  12. Nutrition in Chronic Liver Disease

    OpenAIRE

    Marco Silva; Sara Gomes; Armando Peixoto; Paulo Torres-Ramalho; Hélder Cardoso; Rosa Azevedo; Carla Cunha; Guilherme Macedo

    2015-01-01

    Protein-calorie malnutrition is a transversal condition to all stages of chronic liver disease. Early recognition of micro or macronutrient deficiencies is essential, because the use of nutritional supplements reduces the risk of complications. The diet of patients with chronic liver disease is based on a standard diet with supplements addition as necessary. Restrictions may be harmful and should be individualized. Treatment management should aim to maintain an adequate protein and caloric...

  13. Chronic Anorexia Nervosa: Medical Mimic

    OpenAIRE

    Borson, Soo; Katon, Wayne

    1981-01-01

    While anorexia nervosa is typically construed as an acute, dramatic disorder of younger women, long-term follow-up studies indicate that morbidity is chronic or relapsing in 30 percent to 50 percent of cases and sometimes leads to death. In older patients or those with atypical clinical features or obscure complications, chronic starvation may mimic other diseases, and rigid adherence to current diagnostic criteria may impede recognition and appropriate treatment. Anorexia nervosa should be v...

  14. Occupational chronic obstructive pulmonary disease

    DEFF Research Database (Denmark)

    Omland, Oyvind; Würtz, Else Toft; Aasen, Tor Brøvig;

    2014-01-01

    Occupational-attributable chronic obstructive pulmonary disease (COPD) presents a substantial health challenge. Focusing on spirometric criteria for airflow obstruction, this review of occupational COPD includes both population-wide and industry-specific exposures.......Occupational-attributable chronic obstructive pulmonary disease (COPD) presents a substantial health challenge. Focusing on spirometric criteria for airflow obstruction, this review of occupational COPD includes both population-wide and industry-specific exposures....

  15. Chronic diseases and mental disorder.

    OpenAIRE

    Verhaak, P.F.M.; Heijmans, M.J.W.M.; L. Peters; Rijken, M.

    2005-01-01

    The aim of this study was to achieve a better understanding of the relationship between chronic medical illness and mental distress. Therefore, the association between chronic medical illness and mental distress was analysed, taking into account the modifying effects of generic disease characteristics (concerning course, control and possible stressful consequences), physical quality of life indicators and social and relationship problems. Panel data from the Dutch national Panel of Patients w...

  16. Chronic folliculitis in Sri Lanka

    OpenAIRE

    Kumarasinghe S; Kumarasinghe M

    1996-01-01

    Chronic folliculitis (CF) is a chronic infection of hair follicles leading to atrophy and loss of the affected hairs. This study was done on 51 patients with CF presenting at the Dermatology Clinic at General Hospital Matara, Sri Lanka, to identify specific clinical features and aetiological factors, and to study histopathology. Pus cultures were done on 25 cases. Biopsies were done on 6 patients. CF was commoner in males (59%); 76% were under 34 years, and 39% had occupa...

  17. Voice in chronic hemodialyzed individuals

    Directory of Open Access Journals (Sweden)

    Radish Kumar Balasubramanium

    2010-01-01

    Full Text Available Objective: Chronic hemodialysis affects various body systems, one of which is the respiratory system. Since respiration is the prime source for speech, vocal dysfunctions are expected to be present in patients with chronic hemodialysis. The present study attempts to shed light on the changes in acoustic and aerodynamic characteristics of voice, if any, in patients with chronic hemodialysis. Materials and Methods: Phonation of sustained vowel/a/sample was subjected to acoustic analysis using VAGHMI software. Sustained duration of/a/,/s/, and/z/ was recorded for the purpose of aerodynamic analysis. The independent t test was employed to find the significant difference between the two groups. Results: Chronic hemodialyzed subjects showed significant deviation in frequency, perturbation, and aerodynamic measures when compared to normal subjects. These results are discussed with respect to the underlying pathophysiology. Conclusion: The results of the present study revealed that subjects with chronic hemodialysis exhibit clinical evidence of voice disorders. Vocal deviations in chronic hemodialyzed subjects are explained due to the influence of the renal system on the respiratory and the phonatory system and the negative fluid balance effect of hemodialysis.

  18. Neurovascular Unit in Chronic Pain

    Directory of Open Access Journals (Sweden)

    Beatrice Mihaela Radu

    2013-01-01

    Full Text Available Chronic pain is a debilitating condition with major socioeconomic impact, whose neurobiological basis is still not clear. An involvement of the neurovascular unit (NVU has been recently proposed. In particular, the blood-brain barrier (BBB and blood-spinal cord barrier (BSCB, two NVU key players, may be affected during the development of chronic pain; in particular, transient permeabilization of the barrier is suggested by several inflammatory- and nerve-injury-based pain models, and we argue that the clarification of molecular BBB/BSCB permeabilization events will shed new light in understanding chronic pain mechanisms. Possible biases in experiments supporting this theory and its translational potentials are discussed. Moving beyond an exclusive focus on the role of the endothelium, we propose that our understanding of the mechanisms subserving chronic pain will benefit from the extension of research efforts to the NVU as a whole. In this view, the available evidence on the interaction between analgesic drugs and the NVU is here reviewed. Chronic pain comorbidities, such as neuroinflammatory and neurodegenerative diseases, are also discussed in view of NVU changes, together with innovative pharmacological solutions targeting NVU components in chronic pain treatment.

  19. Chronic Cough in Otorhinolaryngologic Routine

    Directory of Open Access Journals (Sweden)

    Palheta Neto, Francisco Xavier

    2011-04-01

    Full Text Available Introduction: The chronic cough is sometimes manifested as an imprecise symptom, but of great importance for both the diagnosis and the prognosis. In an otorhinolaryngologic approach, several illnesses that can occur with it can be numbered, including 2 of the 3 main causes of chronic cough. Objective: To identify the main otorhinolaryngologic diseases showing the chronic cough as one of their manifestations. Method: A literature's revision was performed in several scientific articles, specialized books and consultation in Birene and Scielo databases. Literature's revision: cough production in the upper airways is usually associated with an inflammatory reaction by stimulating sensitive receptors of these areas or by mechanic stimulus. The main cause of the chronic cough in the otorhinolaryngology day-to-day is the post-nasal drip, gathering together by itself 02 of the most common diseases: rhinitis and sinusitis. Laryngitis as a result of gastroesophageal reflux (GER stands out in the index of chronic cough etiology, but it is not as severe as GER . Neoplasias are also somewhat frequent causes of cough, and the difficulty in diagnosing the cough cause is common in this disease group. Motility disorder, laryngeal irritation persistence, parasitic disease and injuries by inhalation of toxic products were also found as a cause of cough for longer than 03 months. Conclusion:Chronic cough is a frequent and important finding in otorhinolaryngology and cannot be underestimated, and a careful anamnesis is the best way to determine the etiology and perform a correct treatment for the patient's disease.

  20. Guideline of Chronic Urticaria Beyond.

    Science.gov (United States)

    Fine, Lauren M; Bernstein, Jonathan A

    2016-09-01

    Urticaria is a relatively common condition that if chronic can persist for weeks, months or years and affect quality of life significantly. The etiology is often difficult to determine, especially as it becomes chronic. Many cases of chronic urticaria are thought to be autoimmune, although there is no consensus that testing for autoimmunity alters the diagnostic or management strategies or outcomes. Many times, urticaria is easily managed with antihistamines and/or short courses of oral corticosteroids, but too often control is insufficient and additional therapies must be added. For years, immune modulating medications, such as cyclosporine and Mycophenolate Mofetil, have been used in cases refractory to antihistamines and oral corticosteroids, although the evidence supporting their efficacy and safety has been limited. Omalizumab was recently approved for the treatment of chronic urticaria unresponsive to H1-antagonists. This IgG anti-IgE monoclonal antibody has been well demonstrated to safely and effectively control chronic urticaria at least partially in approximately 2/3 of cases. However, the mechanism of action and duration of treatment for omalizumab is still unclear. It is hoped that as the pathobiology of chronic urticaria becomes better defined, future therapies that target specific mechanistic pathways will be developed that continue to improve the management of these often challenging patients. PMID:27334777

  1. Immunopathology of chronic rhinosinusitis

    Directory of Open Access Journals (Sweden)

    Atsushi Kato

    2015-04-01

    Full Text Available Chronic rhinosinusitis (CRS is a heterogeneous disease characterized by local inflammation of the upper airways and sinuses which persists for at least 12 weeks. CRS can be divided into two phenotypes dependent on the presence of nasal polyps (NPs; CRS with NPs (CRSwNP and CRS without NPs (CRSsNP. Immunological patterns in the two diseases are known to be different. Inflammation in CRSsNP is rarely investigated and limited studies show that CRSsNP is characterized by type 1 inflammation. Inflammation in CRSwNP is well investigated and CRSwNP in Western countries shows type 2 inflammation and eosinophilia in NPs. In contrast, mixed inflammatory patterns are found in CRSwNP in Asia and the ratio of eosinophilic NPs and non-eosinophilic NPs is almost 50:50 in these countries. Inflammation in eosinophilic NPs is mainly controlled by type 2 cytokines, IL-5 and IL-13, which can be produced from several immune cells including Th2 cells, mast cells and group 2 innate lymphoid cells (ILC2s that are all elevated in eosinophilic NPs. IL-5 strongly induces eosinophilia. IL-13 activates macrophages, B cells and epithelial cells to induce recruitment of eosinophils and Th2 cells, IgE mediated reactions and remodeling. Epithelial derived cytokines, TSLP, IL-33 and IL-1 can directly and indirectly control type 2 cytokine production from these cells in eosinophilic NPs. Recent clinical trials showed the beneficial effect on eosinophilic NPs and/or asthma by monoclonal antibodies against IL-5, IL-4Rα, IgE and TSLP suggesting that they can be therapeutic targets for eosinophilic CRSwNP.

  2. 鸡胸软骨酶解产物的表征及对类风湿关节炎大鼠的免疫调节作用%Characterization of Pepsin Hydrolysate of Chicken Sternal Cartilage and Its Immunoregulatory Function in Rats with Rheumatoid Arthritis

    Institute of Scientific and Technical Information of China (English)

    曹慧; 张忠慧; 许时婴

    2012-01-01

    目的:探讨鸡软骨酶解产物的理化性质及对类风湿性关节炎(RA)大鼠的免疫调节作用。方法:采用胃蛋白酶水解鸡胸软骨,研究软骨酶解产物的组成及理化性质,并建立大鼠类风湿性关节炎模型,探讨软骨酶解产物对大鼠类风湿性关节炎的免疫调节作用。结果:鸡胸软骨酶解产物的主要成分为Ⅱ型胶原,变性温度为43.843℃,在pH值大于5.8,NaCl浓度大于0.9mol/L时,溶解度较低。口服鸡胸软骨酶解产物显著抑制了RA大鼠的足掌肿胀,并降低了其血清抗Ⅱ型胶原(CII)抗体及滑膜炎性细胞因子的水平。结论:鸡胸软骨酶解产物可能通过调节Th1细胞因子的表达、纠正失衡的Th1/Th2细胞因子网络及降低血清特异性抗CII抗体的水平对RA产生防治作用。%Purpose: To investigate physicochemical properties of the pepsin hydrolysate of chicken sternal cartilage and its immunoregulatory function in rats with rheumatoid arthritis (RA). Methods: RA was induced in rats by collagen type II injections. Results: The pepsin hydrolysate consisted mainly of collagen type II with a denaturation temperature of 43.843℃. However, the solubility was low at pH above 5.8 and NaC1 concentrations above 0.9 mol/L. Oral administration of the hydrolysate decreased significantly the swelling of paws, the serum level of anti-collagen type II antibody and secretion of proinflammatory cytokines in RA rats. Condusion: The pepsin bydrolysate can prevent and treat RA probably by regulating the expression of Thl and Th2 cytokines, correcting the imbalance of Thl/Th2 cytokines network, and decreasing the serum concentration of anti-collagen type II antibody.

  3. Diagnosis and management of chronic pancreatitis

    OpenAIRE

    Gupta, V.; TOSKES, P.

    2005-01-01

    Chronic pancreatitis represents a condition that is challenging for clinicians secondary to the difficulty in making an accurate diagnosis and the less than satisfactory means of managing chronic pain. This review emphasises the various manifestations that patients with chronic pancreatitis may have and describes recent advances in medical and surgical therapy. It is probable that many patients with chronic abdominal pain are suffering from chronic pancreatitis that is not appreciated. As the...

  4. [Chronic illness and contraception].

    Science.gov (United States)

    Saarikoski, S

    1987-01-01

    In recent years sterilization that can cause problems of the psyche and marital life has been recommended much less frequently with respect to chronic diseases. As regards heart and hypertensive diseases pregnancy is always contraindicated in case of 3rd and 4th disease categories and sterilization is recommended according to the New York Heart Association. As far as 1st and 2nd category patients are concerned if the load carrying capacity is normal pregnancy could be undertaken. Combination pills are not recommended for contraception because they can cause fluid retention or increase the risk of thrombosis. If the patient has a higher-than-normal risk of developing thrombosis or infection, for instance, those who wear pacemakers only tablets containing progesterone or subdermal capsule implants can be used. In those with blood pressure problems the additional use of the IUD is also advised. Among diseases of neurological and psychic origin the effect of hormonal contraceptives is weakened by antiepileptics, but even in such cases older combination pills of larger doses of active ingredients can be employed. Migraine is exacerbated in 1/3 of patients; here IUDs can be used. Even the contraceptive tablets themselves can induce depression. In psychosis methods requiring regular attention can be easily forgotten, therefore the IUD is the most suitable device. In diabetes progesterone and other progestogens reduce insulin response, harm carbohydrate metabolism; therefore in young people the IUD is preferred an in older women with children even sterilization can be employed. Hormonal tablets must not be used in hyperlipidemia and liver diseases. Caution must be exercised in hyperthyroidism and in endocrine disorders (e.g., Cushing's syndrome); if it is accompanied by blood pressure disorders appropriate treatment is required. In kidney diseases pregnancy is contraindicated if it is accompanied by blood pressure increase or a higher level of creatine. On the other hand

  5. Chronic physical illness: a psychophysiological approach for chronic physical illness.

    Science.gov (United States)

    Purdy, Jana

    2013-03-01

    Growing evidence demonstrates that psychological risk variables can contribute to physical disease. In an effort to thoroughly investigate potential etiological origins and optimal interventions, this broad review is divided into five sections: the stress response, chronic diseases, mind-body theoretical models, psychophysiological interventions, and integrated health care solutions. The stress response and its correlation to chronic disorders such as cardiovascular, gastrointestinal, autoimmune, metabolic syndrome, and chronic pain are comprehensively explored. Current mind-body theoretical models, including peripheral nerve pathway, neurophysiological, and integrative theories, are reviewed to elucidate the biological mechanisms behind psychophysiological interventions. Specific interventions included are psychotherapy, mindfulness meditation, yoga, and psychopharmacology. Finally, the author advocates for an integrated care approach as a means by which to blur the sharp distinction between physical and psychological health. Integrated care approaches can utilize psychiatric nurse practitioners for behavioral assessment, intervention, research, advocacy, consultation, and education to optimize health outcomes. PMID:23483831

  6. Pharmacologic Agents for Chronic Diarrhea.

    Science.gov (United States)

    Lee, Kwang Jae

    2015-10-01

    Chronic diarrhea is usually associated with a number of non-infectious causes. When definitive treatment is unavailable, symptomatic drug therapy is indicated. Pharmacologic agents for chronic diarrhea include loperamide, 5-hydroxytryptamine type 3 (5-HT3) receptor antagonists, diosmectite, cholestyramine, probiotics, antispasmodics, rifaximin, and anti-inflammatory agents. Loperamide, a synthetic opiate agonist, decreases peristaltic activity and inhibits secretion, resulting in the reduction of fluid and electrolyte loss and an increase in stool consistency. Cholestyramine is a bile acid sequestrant that is generally considered as the first-line treatment for bile acid diarrhea. 5-HT3 receptor antagonists have significant benefits in patients with irritable bowel syndrome (IBS) with diarrhea. Ramosetron improves stool consistency as well as global IBS symptoms. Probiotics may have a role in the prevention of antibiotic-associated diarrhea. However, data on the role of probiotics in the treatment of chronic diarrhea are lacking. Diosmectite, an absorbent, can be used for the treatment of chronic functional diarrhea, radiation-induced diarrhea, and chemotherapy-induced diarrhea. Antispasmodics including alverine citrate, mebeverine, otilonium bromide, and pinaverium bromide are used for relieving diarrheal symptoms and abdominal pain. Rifaximin can be effective for chronic diarrhea associated with IBS and small intestinal bacterial overgrowth. Budesonide is effective in both lymphocytic colitis and collagenous colitis. The efficacy of mesalazine in microscopic colitis is weak or remains uncertain. Considering their mechanisms of action, these agents should be prescribed properly. PMID:26576135

  7. Periodontitis in Chronic Heart Failure.

    Science.gov (United States)

    Fröhlich, Hanna; Herrmann, Kristina; Franke, Jennifer; Karimi, Alamara; Täger, Tobias; Cebola, Rita; Katus, Hugo A; Zugck, Christian; Frankenstein, Lutz

    2016-08-01

    Periodontal disease has been associated with an increased risk of cardiovascular events. The purpose of our study was to investigate whether a correlation between periodontitis and chronic heart failure exists, as well as the nature of the underlying cause. We enrolled 71 patients (mean age, 54 ± 13 yr; 56 men) who had stable chronic heart failure; all underwent complete cardiologic and dental evaluations. The periodontal screening index was used to quantify the degree of periodontal disease. We compared the findings to those in the general population with use of data from the 4th German Dental Health Survey. Gingivitis, moderate periodontitis, and severe periodontitis were present in 17 (24%), 17 (24%), and 37 (52%) patients, respectively. Severe periodontitis was more prevalent among chronic heart failure patients than in the general population. In contrast, moderate periodontitis was more prevalent in the general population (P <0.00001). The severity of periodontal disease was not associated with the cause of chronic heart failure or the severity of heart failure symptoms. Six-minute walking distance was the only independent predictor of severe periodontitis. Periodontal disease is highly prevalent in chronic heart failure patients regardless of the cause of heart failure. Prospective trials are warranted to clarify the causal relationship between both diseases. PMID:27547136

  8. Periodontitis in Chronic Heart Failure

    Science.gov (United States)

    Fröhlich, Hanna; Herrmann, Kristina; Franke, Jennifer; Karimi, Alamara; Täger, Tobias; Cebola, Rita; Katus, Hugo A.; Zugck, Christian

    2016-01-01

    Periodontal disease has been associated with an increased risk of cardiovascular events. The purpose of our study was to investigate whether a correlation between periodontitis and chronic heart failure exists, as well as the nature of the underlying cause. We enrolled 71 patients (mean age, 54 ± 13 yr; 56 men) who had stable chronic heart failure; all underwent complete cardiologic and dental evaluations. The periodontal screening index was used to quantify the degree of periodontal disease. We compared the findings to those in the general population with use of data from the 4th German Dental Health Survey. Gingivitis, moderate periodontitis, and severe periodontitis were present in 17 (24%), 17 (24%), and 37 (52%) patients, respectively. Severe periodontitis was more prevalent among chronic heart failure patients than in the general population. In contrast, moderate periodontitis was more prevalent in the general population (P periodontal disease was not associated with the cause of chronic heart failure or the severity of heart failure symptoms. Six-minute walking distance was the only independent predictor of severe periodontitis. Periodontal disease is highly prevalent in chronic heart failure patients regardless of the cause of heart failure. Prospective trials are warranted to clarify the causal relationship between both diseases. PMID:27547136

  9. Pharmacological challenges in chronic pancreatitis

    Directory of Open Access Journals (Sweden)

    Anne Estrup Olesen

    2013-01-01

    Full Text Available Drug absorption in patients with chronic pancreatitis might be affected by the pathophysiology of the disease. The exocrine pancreatic insufficiency is associated with changes in gastrointestinal intraluminal pH, motility disorder, bacterial overgrowth and changed pancreatic gland secretion. Together these factors can result in malabsorption and may also affect the efficacy of pharmacological intervention. The lifestyle of chronic pancreatitis patients may also contribute to gastrointestinal changes. Many patients limit their food intake because of the pain caused by eating and in some cases food intake is more or less substituted with alcohol, tobacco and coffee. Alcohol and drug interaction are known to influence the pharmacokinetics by altering either drug absorption or by affecting liver metabolism. Since patients suffering from chronic pancreatitis experience severe pain, opioids are often prescribed as pain treatment. Opioids have intrinsic effects on gastrointestinal motility and hence can modify the absorption of other drugs taken at the same time. Furthermore, the increased fluid absorption caused by opioids will decrease water available for drug dissolution and may hereby affect absorption of the drug. As stated above many factors can influence drug absorption and metabolism in patients with chronic pancreatitis. The factors may not have clinical relevance, but may explain inter-individual variations in responses to a given drug, in patients with chronic pancreatitis.

  10. [Neurosurgical treatment of chronic pain].

    Science.gov (United States)

    Fontaine, D; Blond, S; Mertens, P; Lanteri-Minet, M

    2015-02-01

    Neurosurgical treatment of pain used two kind of techniques: 1) Lesional techniques interrupt the transmission of nociceptive neural input by lesionning the nociceptive pathways (drezotomy, cordotomy, tractotomy…). They are indicated to treat morphine-resistant cancer pain and few cases of selected neuropathic pain. 2) Neuromodulation techniques try to decrease pain by reinforcing inhibitory and/or to limit activatory mechanisms. Chronic electrical stimulation of the nervous system (peripheral nerve stimulation, spinal cord stimulation, motor cortex stimulation…) is used to treat chronic neuropathic pain. Intrathecal infusion of analgesics (morphine, ziconotide…), using implantable pumps, allows to increase their efficacy and to reduce their side effects. These techniques can improve, sometimes dramatically, selected patients with severe and chronic pain, refractory to all other treatments. The quality of the analgesic outcome depends on the relevance of the indications. PMID:25681114

  11. The burden of chronic pain

    DEFF Research Database (Denmark)

    Kurita, Geana Paula; Sjøgren, Per; Juel, Knud; Højsted, Jette; Ekholm, Kim Ola Michael

    2012-01-01

    the adult Danish population and to analyze associated factors such as diseases, immigration, and opioid use. This cross-sectional survey combines individual-based information from the Danish Health Survey (2010) and official Danish health and socioeconomic, individual-based registers. The simple...... random sample consisted of 25,000 individuals (≥16 years old) living in Denmark. In all, 60.7% completed a mailed or online questionnaire. Associations were examined with multiple logistic regression analysis. The study population consisted of 14,925 individuals in whom a high prevalence of chronic pain...... (26.8%, 95% confidence interval: 26.1 to 27.5) and a high prevalence of opioid consumption (4.5%) were observed. Other aspects of particular note: (1) a higher prevalence of chronic pain occurred among individuals with cardiovascular and chronic pulmonary diseases than among individuals with cancer...

  12. Aminoadamantanes for chronic hepatitis C

    DEFF Research Database (Denmark)

    Lamers, Mieke H; Broekman, Mark; Drenth, Joost Ph;

    2014-01-01

    BACKGROUND: Around 3% of the world's population (approximately 160 million people) are chronically infected with hepatitis C virus. The proportion of infected people who develop clinical symptoms varies between 5% and 40%. Combination therapy with pegylated interferon-alpha plus ribavirin...... response in genotype 1 infected patients to at least 70%. There is therefore an unmet need for drugs that can achieve a higher proportion of sustained virological response. Aminoadamantanes are antiviral drugs used for treatment of patients with chronic hepatitis C. OBJECTIVES: To assess the beneficial...... and harmful effects of aminoadamantanes for patients with chronic hepatitis C infection by conducting a systematic review with meta-analyses of randomised clinical trials, as well as trial sequential analyses. SEARCH METHODS: We conducted electronic searches of the Cochrane Hepato-Biliary Group Controlled...

  13. Radiodiagnosis of posttraumatic chronic osteomyelitis

    International Nuclear Information System (INIS)

    163 patients with posttraumatic chronic osteomyelitis were observed. Osteomyelitis developed after an open fracture in the absence of osteosynthesis in 9 cases only. In the rest 154 cases of osteomyelitis some type of osteosynthesis was used for fracture treatment. The X-ray signs of posttraumatic chronic osteomyelitis are varied. Correct and early recognition of this pathology requires a clear-cut idea of its features with relation to the nature of fracture, the type of osteosynthesis and peculiarity of reparative processes. It requires multiple use of various X-ray methods of which the main are roentgenography, tomography and fistulography

  14. Asthma: a chronic infectious disease?

    Science.gov (United States)

    Caramori, Gaetano; Papadopoulos, Nikos; Contoli, Marco; Marku, Brunilda; Forini, Giacomo; Pauletti, Alessia; Johnston, Sebastian L; Papi, Alberto

    2012-09-01

    There are increasing data to support the "hygiene" and "microbiota" hypotheses of a protective role of infections in modulating the risk of subsequent development of asthma. There is less evidence that respiratory infections can actually cause the development of asthma. There is some evidence that rhinovirus respiratory infections are associated with the development of asthma, particularly in childhood, whereas these infections in later life seem to have a weaker association with the development of asthma. The role of bacterial infections in chronic asthma remains unclear. This article reviews the available evidence indicating that asthma may be considered as a chronic infectious disease. PMID:22929096

  15. Roentgenofunctional diagnosis of chronic enterocolitis

    Energy Technology Data Exchange (ETDEWEB)

    Antonovich, V.B.; Khashem, U.Kh. (Tsentral' nyj Inst. Usovershenstvovaniya Vrachej, Moscow (USSR))

    The paper is concerned with the findings of multimodality roentgenofunctional diagnosis of chronic enterocolitis in 100 patients. A radiofunctional study was performed under the conditions of X-ray TV and videomagnetic recording of the stomach, duodenum and small intestine using barium swallow. Simultaneously the gall bladder and bile ducts condition was studied. All the patients underwent colon examination with the help of a contrast enema (primary double contrast examination) and 24 h after taking barium swallow and food. The study showed that changes in the small intestine in chronic enterocolitis were combined with a certain regularity of those in the stomach, duodenum, colon and gall bladder.

  16. Chronic Venous Disease under pressure

    NARCIS (Netherlands)

    S.W.I. Reeder (Suzan)

    2013-01-01

    textabstractIn chapter 1 we provide a general introduction of this thesis. Chronic venous disease (CVD) is a common medical condition that affects 2-64% of the worldwide population and leads to leg ulcers in 1% of the Western population. Venous leg ulceration (VLU) has an unfavorable prognosis with

  17. CHANGING TRENDS IN CHRONIC PANCREATITIS

    Directory of Open Access Journals (Sweden)

    Sreenidhi

    2014-02-01

    Full Text Available BACKGROUND: AIMS : To determine the demographic profile , to evaluate risk factors of chronic pancreatitis , frequency of complications and therapeutic modalities for management of chronic pancreatitis . METHODS : Data analyzed retrospectively from 177 patients of chronic pancreatitis admitted in the Department of Surgery in our institute between Jan 2003 & Decembe r 2012 . RESULTS : Male predominance , mean age of presentation is 32yrs , 66% with Alcohol consumption was the main risk factor , with associated diabetes and gall stones. Pain abdomen was the commonest mode of presentation , and USG sensitivity rate was 55%. P arenchymal calcification , Ductal calculi , pseudocyst were the commonest complications. Medical line of management was the initial therapy and surgical intervention was done as indicated. Number of readmissions noted. CONCLUSIONS : Although Kerala is known for highest prevalence of chronic pancreatitis in our country , it is a noted di sease & is on the rise in the state of Karnataka. Mean age of onset is older as compared to two decades ago and also a shift of etiology from tropical t o a lcoholic pancreatitis has been noted.

  18. CHRONIC PANNICULITIS-case report

    Directory of Open Access Journals (Sweden)

    I. Drljević,

    2005-08-01

    Full Text Available The case shows chronic panniculitis in a thirty-year-old female patient without general symptoms. The disease is very rare and its etiology is unknown. Clinical picture is characterized by subcutaneous, erythematous nodules on lower legs, sometimes occuring on the trunk. The diagnosis was based on anamnesis, clinical and laboratory findings,and dermatopathology.

  19. Anemia in Chronic Kidney Disease

    Science.gov (United States)

    ... Disease Organizations​​ . (PDF, 345 KB)​​​​​ Alternate Language URL Anemia in Chronic Kidney Disease Page Content On this ... Nutrition Points to Remember Clinical Trials What is anemia? Anemia is a condition in which the body ...

  20. Fibromyalgia and Chronic Pain Syndromes

    Science.gov (United States)

    Choy, Ernest; Clauw, Daniel J.; Goldenberg, Don L.; Harris, Richard E.; Helfenstein, Milton; Jensen, Troels Staehelin; Noguchi, Koichi; Silverman, Stuart L.; Ushida, Takahiro; Wang, Guochun

    2016-01-01

    This manuscript, developed by a group of chronic pain researchers and clinicians from around the world, aims to address the state of knowledge about fibromyalgia (FM) and identify ongoing challenges in the field of FM and other chronic pain syndromes that may be characterized by pain centralization/amplification/hypersensitivity. There have been many exciting developments in research studies of the pathophysiology and treatment of FM and related syndromes that have the potential to improve the recognition and management of patients with FM and other conditions with FM-like pain. However, much of the new information has not reached all clinicians, especially primary care clinicians, who have the greatest potential to use this new knowledge to positively impact their patients’ lives. Furthermore, there are persistent misconceptions about FM and a lack of consensus regarding the diagnosis and treatment of FM. This paper presents a framework for future global efforts to improve the understanding and treatment of FM and other associated chronic pain syndromes, disseminate research findings, identify ways to enhance advocacy for these patients, and improve global efforts to collaborate and reach consensus about key issues related to FM and chronic pain in general. PMID:27022674

  1. Mucociliary clearance in chronic sinusitis

    OpenAIRE

    Birdi, Surinder Mohan; Singh, Sunder; Singh, Ajit

    1998-01-01

    Mucociliary clearance is an important defence mechanism of upper and lower respiratory tracts. Any disturbance in the mechanism leads to stagnation of secretions and secondary infection with prolonged mucociliary clearance time. The present study was undertaken to establish normal mucociliary clearance time in our region and to evaluate its diagnostic and prognostic potential in chronic sinusitis of variable duration with and without obstructive diseases.

  2. Multiculturalism, chronic illness, and disability.

    Science.gov (United States)

    Groce, N E; Zola, I K

    1993-05-01

    To gain at least an initial understanding of the underlying beliefs and attitudes in a cross-cultural situation, we believe that the three key points discussed in this paper should prove a significant point of departure: 1. Traditional beliefs about the cause of chronic illness or disability will play a significant role in determining family and community attitudes toward individuals with a disability and will influence when, how, and why medical input is sought. 2. The expectation of survival on the part of parents and community will have an effect on the amount of time, energy, and cooperation shown by family and community for the individual who has an impairment. 3. The expectations by family and community for the social role(s) and individual with a chronic illness or disability will hold will affect a broad range of issues, including education, social integration, and independence. Furthermore, although chronic illness and disability are often considered as issues distinct from the full range of problems encountered in society for immigrant and minority groups, in fact, these issues could not be more closely tied. The frequently discussed concerns within the ethnic and minority community about the role of the family, integration and acculturation, social articulation with the greater American society, stress, cross-cultural misunderstanding, and outright prejudice can all compound the problems encountered for the chronically ill or disabled individual in a multicultural society. PMID:8479830

  3. Electroacupuncture treatment of chronic insomniacs

    Institute of Scientific and Technical Information of China (English)

    RUAN Jing-wen; WANG Chu-huai; LIAO Xin-xue; YAN Ying-shuo; HU Yue-hua; RAO Zhong-dong; WEN Ming; ZENG Xiao-xiang; LAI Xin-sheng

    2009-01-01

    Background Due to the quick rhythm of life and work pressure, more and more people suffer from sleep quality problems. In this study, we investigated the effect of electroacupuncture on sleep quality of chronic insomniacs and the safety of electroacupuncture therapy.Methods Four courses of electroacupuncture treatment were applied to 47 patients. With pre-treatment and post-treatment self-control statistical method, Pittsburgh sleep quality index (PSQI) scores were used for evaluating sleep quality. Polysomnogram was used for detecting insomniacs' changes in sleep architecture. The safety of electroacupuncture was evaluated by monitoring the self-designed adverse events and side effects during treatment and post-treatment.Results Electroacupuncture considerably improved insomniacs' sleep quality and social function during the daytime.Electroacupuncture had certain repairing effect on the disruption in sleep architecture. At the same time,electroacupuncture prolonged slow wave sleep (SWS) time and relatively rapid eye movement sleep (REM sleep) time.There was no hangover, addiction or decrements in vigilance during the daytime (incidence rate was 0). However,insomnia rebound rate was about 23% within one month.Conclusions These results suggest that electroacupuncture has beneficial effect on sleep quality improvement in the patients with chronic insomnia, which may be associated with repairing sleep architecture, reconstructing sleep continuity,as well as prolonging SWS time and REM sleep time. Electroacupuncture treatment for chronic insomnia is safe.Therefore, electroacupuncture therapy could be a promising avenue of treatment for chronic insomnia.

  4. [Chronic prostatitis and Bechterew's disease].

    Science.gov (United States)

    Kohlicek, J; Svec, V

    1977-11-01

    A group of patients between 35 and 65 years old with chronic prostatitis were examined for the presence of Becherew's disease. In this connection the New York and Roman criterions for morbus Bechterew were applied. There were found one ankyosing spondylarthritis, one ankylosis of the sacroiliac joint, and 11 times a tentative sacroileitis were stated. Altogether the proved and tentative findings were only 3.68 per cent of all examinations. In our countries the morbus Bechterew is found in 0,21 per cent of the normal population. So the protion of the Bechterew's disease in patients with chronic prostatitis is indeed a little higher than average, but not so frequent as often pretended in recent times. After a second series 58 patients being treated because of Bechterew's disease of different stages and different terms were examined for the possibility of a simultaneously elapsing chronic prostatitis. A chronic prostatitis was found in 38 per cent of these patients which correspondents to the incidence published in literature for the medium-age manhood. Nobody of the test persons had complaints on the part of the urologenital tract. PMID:602457

  5. Looking after chronically ill dogs

    DEFF Research Database (Denmark)

    Christiansen, Stine B.; Kristensen, Annemarie Thuri; Sandøe, Peter;

    2013-01-01

    Studies in human medicine show that care of chronically ill family members can affect the caregiver's life in several ways and cause "caregiver burden." Companion animals are offered increasingly advanced veterinary treatments, sometimes involving home care. Owners choosing such treatments could ...

  6. Chronic Condition Public Use File (PUF)

    Data.gov (United States)

    U.S. Department of Health & Human Services — This release contains the Chronic Conditions Public Use Files (PUF) with information from Medicare claims. The CMS Chronic Conditions PUF is an aggregated file in...

  7. Pregabalin for Pain Treatment in Chronic Pancreatitis

    DEFF Research Database (Denmark)

    Olesen, Søren Schou; Bowense, S; Wilder-Smith, Oliver; van Goor, H; Drewes, Asbjørn Mohr

    2011-01-01

    Intractable pain usually dominates the clinical presentation of chronic pancreatitis (CP). Slowing of electroencephalogram (EEG) rhythmicity has been associated with abnormal cortical pain processing in other chronic pain disorders. The aim of this study was to investigate the spectral distribution...

  8. Risk Factors for Chronic Kidney Disease

    Science.gov (United States)

    ... Materials Webinars Tips & Stories Links & Resources Learn About Chronic Kidney Disease Kidney Glossary Ask Our Expert Toll-Free Helpline: ... Questions What You Can Do Download all the chronic kidney disease information presented here. Preview Our CKD Booklets Stage ...

  9. Epclusa Approved for Chronic Hepatitis C

    Science.gov (United States)

    ... news/fullstory_159609.html Epclusa Approved for Chronic Hepatitis C Combination drug treats six major forms of ... to treat the six major strains of chronic hepatitis C virus (HCV). Epclusa combines sofosbuvir, FDA-approved ...

  10. Helping a Child Manage a Chronic Illness

    Science.gov (United States)

    ... https://medlineplus.gov/news/fullstory_160011.html Helping a Child Manage a Chronic Illness Feeling they have control over their ... News) -- Children and teens who feel confident handling a chronic illness on their own appear better able ...

  11. Chronic Fatigue Syndrome (CFS): Who's at Risk?

    Science.gov (United States)

    ... please visit this page: About CDC.gov . Chronic Fatigue Syndrome (CFS) Share Compartir Who's at Risk? More ... explore this possibility Related Links Disability and Chronic Fatigue Syndrome Print page View page in: Español (Spanish) ...

  12. Percutaneous osteoplasty for painful sternal lesion from multiple myeloma

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Bing; Wu, Chun-Gen; Li, Ming-Hua; Gu, Yi-Feng; Cheng, Yong-De [Shanghai Jiao Tong University, Department of Diagnostic and Interventional Radiology, Shanghai 6th People' s Hospital, Shanghai (China)

    2009-03-15

    Percutaneous osteoplasty (POP) as a technical extension of percutaneous vertebroplasty has been used as a treatment for osteolytic lesions in weight-bearing bones besides the vertebrae, and has demonstrated beneficial outcomes in terms of pain relief and functional improvement. However, its efficacy in non-weight-bearing bones is not well known. Herein, we present the case of a patient with an osteolytic lesion from multiple myeloma in the sternum, a non-weight-bearing bone, who obtained sustained pain relief and improvement of life quality after POP. These data suggest that POP may be an alternative treatment for osteolytic lesions in non-weight-bearing bones. (orig.)

  13. Sternal development in the pediatric population: evaluation using computed tomography

    International Nuclear Information System (INIS)

    The normal development of the sternum using CT imaging is not known. To describe the normal development of the sternum in children on chest CT imaging. CT imaging of 300 patients (150 male, 150 female), mean age: 4.97 years (range: 0.01-9.9 years), were evaluated retrospectively. The presence and number of ossification centers in the manubrium, each individual mesosternal segment and the xiphoid were reviewed. Additionally, the vertical and horizontal fusion between ossification centers was evaluated. Differences among age and gender were calculated. Descriptive statistics, analysis of variances (ANOVA), chi-square and Fisher exact tests were performed for statistical analysis. Manubrium: A single ossification center was seen in 88% of cases and two or three ossification centers were seen in 12%. More manubrial ossification centers were correlated to a younger age (P 0.05). Xiphoid: Absence was seen in 67% of the patients. Bifid xiphoid was seen in 1% of the patients. The normal development of the different components of the sternum is a process with wide variation among children. The large variability of mesosternal ossification center types should not be confused with pathology. (orig.)

  14. Percutaneous osteoplasty for painful sternal lesion from multiple myeloma

    International Nuclear Information System (INIS)

    Percutaneous osteoplasty (POP) as a technical extension of percutaneous vertebroplasty has been used as a treatment for osteolytic lesions in weight-bearing bones besides the vertebrae, and has demonstrated beneficial outcomes in terms of pain relief and functional improvement. However, its efficacy in non-weight-bearing bones is not well known. Herein, we present the case of a patient with an osteolytic lesion from multiple myeloma in the sternum, a non-weight-bearing bone, who obtained sustained pain relief and improvement of life quality after POP. These data suggest that POP may be an alternative treatment for osteolytic lesions in non-weight-bearing bones. (orig.)

  15. Fibromyalgia syndrome in chronic urticaria patients

    OpenAIRE

    Aylin Gözübüyükoğulları; Duru Tabanlıoğlu Onan; Nuran Allı

    2014-01-01

    Background and Design: The aim of our study was to determine the frequency of fibromyalgia syndrome in chronic urticaria patients. Materials and Methods: The study was carried out with the participation of 100 chronic urticaria patients and 61 control group patients. Chronic urticaria patients were investigated for the etiology of urticaria and the autologous serum skin test was performed in those patients. Both the chronic urticaria patients and the controls were evaluated for fibromyalgi...

  16. Oriental Medical Treatment of chronic Acalculous Cholecystitis

    OpenAIRE

    Hae-Yeon Lee; Jung-Han Park; Hyun-Seok Cho; Jung-Chul Kim; Tae-Hyun Baik; Jong-Seong Wi

    2004-01-01

    Chronic acalculous cholecystitis gets possession of about 12 to 13 percent of patients with chronic cholecystitis. Pathologically it is characterised by chronic inflammation and thickening of the gallbladder wall but doesn't come across stones. Clinical symptoms are vague and include abdominal discomfort and distension, nausea, flatulence and intolerance of fatty foods. A patient on chronic acalculous cholecystitis diagnosed from his clinical symtoms and abdominal ultrasonogram was treated by...

  17. Chronic daily headache: biochemical and neurotransmitter abnormalities

    OpenAIRE

    Gallai, Virgilio; Sarchielli, Paola; Genco, Sergio; Alberti, Andrea; D'Andrea, Giovanni

    2000-01-01

    Although chronic daily headache (CDH) represents one of the most relevant complaints of patients in headache centers, the mechanisms underlying the chronicization of head pain are poorly understood. Experimental animal models of chronic pain suggest the involvement of a functional disturbance of several neuronal pathways. The disturbances include an abnormal excitability of nociceptive fibers supplying pain-sensitive structures in the brain responsible for peripheral sensitization (chronic ne...

  18. A CLINICAL STUDY OF CHRONIC DEPRESSION

    OpenAIRE

    Singhal, S; Kumar, S.; Agarwal, A K

    1991-01-01

    SUMMARY Neurological status of chronic depressive states have not been resolved as yet. Recent classificatory systems ICD-X and DSM-III-R have included chronic depression under affective disorders and have done away with the category of neurotic depression. The present study was undertaken with the aims of (a) to study clinical variables associated with major subtypes of chronic depression (chronic major depression and dysthymia) and (b) to investigate personality characteristics and life eve...

  19. Airway oxidative stress in chronic cough

    OpenAIRE

    Koskela, Heikki O; Purokivi, Minna K

    2013-01-01

    Background The mechanisms of chronic cough are unclear. Many reactive oxygen species affect airway sensory C-fibres which are capable to induce cough. Several chronic lung diseases are characterised by cough and oxidative stress. In asthma, an association between the cough severity and airway oxidative stress has been demonstrated. The present study was conducted to investigate whether airway oxidative stress is associated with chronic cough in subjects without chronic lung diseases. Methods ...

  20. Vitamin D deficiency in chronic idiopathic urticaria.

    OpenAIRE

    2015-01-01

    Chronic urticaria is the most common skin diseases, characterized by chronic cutaneous lesions which severely debilitates patients in several aspects of their everyday life. Vitamin D is known to exert several actions in the immune system and to influence function and differentiation of mast cells, central role players in the pathogenesis of chronic idiopathic urticaria. This study was performed to evaluate the relationship between vitamin D levels and susceptibility to chronic idiopathic urt...

  1. [Dutch language area definition of chronic fatigue].

    NARCIS (Netherlands)

    Korenromp, I.H.; Meeus, M.; Bleijenberg, G.

    2012-01-01

    Chronic fatigue is a frequent but unspecific characteristic of many diseases. However, a clear definition of 'chronic fatigue' is still lacking. The Flemish-Dutch Research Group - Chronic Fatigue (VNO-CHROVER) has taken the opportunity to formulate such a definition that can be widely applied. This

  2. Managing chronic pain in family practice.

    OpenAIRE

    Librach, S. L.

    1993-01-01

    Pain is common in family practice. In dealing with chronic pain, both the family physician and the patient often have problems in defining and in understanding the origin of chronic pain and in providing effective pain relief. This article explores a practical, holistic approach to understanding and managing chronic pain.

  3. Chinese medicinal herbs for chronic hepatitis B

    DEFF Research Database (Denmark)

    Liu, J; McIntosh, H; Lin, Haili

    2001-01-01

    Chronic hepatitis B is a serious health problem worldwide. Chinese medicinal herbs are widely used for treatment of chronic hepatitis B in China and many clinical trials have been conducted. This systematic review is to assess the efficacy and safety of Chinese medicinal herbs for chronic hepatitis...

  4. Risk factors for sternal wound infections and application of the STS score in coronary artery bypass graft surgery Fatores de risco para infecção de ferida esternal e aplicação do escore da STS em pacientes submetidos à cirurgia de revascularização miocárdica

    Directory of Open Access Journals (Sweden)

    Pedro Silvio Farsky

    2011-12-01

    Full Text Available BACKGROUND: Sternal wound infection (SWI after coronary artery bypass graft (CABG surgery is a major complication. Identifying patients at risk of SWI is essential for the application of preventive measures. OBJECTIVE: To identify the pre- and intra-operative risk factors, apply the STS risk score and determine the correlation between the risk score and microorganisms isolated from surgical wounds in a Brazilian hospital. METHODS: This is a retrospective analysis of a database of all CABG surgeries performed in a single institution from 2006 to 2008. Chi-square analysis was used for categorical variables and Student's t-test was used for quantitative variables. Multivariate logistic regression model was used to identify independent risk factors for SWI. P 40 kg/m² (OR 6.27, 95%CI 2.53-15.48; P40 kg/m², number of affected coronary arteries and use of bilateral internal thoracic artery were associated with a higher risk of infection. The STS risk score can be successfully used and there was no correlation between microorganisms, the score and risk factors at our institution.FUNDAMENTO: A infecção de ferida operatória esternal após cirurgia de revascularização miocárdica (CRM é uma grave complicação. Identificar pacientes com risco elevado é fundamental para introdução de medidas de preventivas. OBJETIVO: Identificar os fatores de risco pré e intra-operatórios, avaliar o escore de risco da STS e correlação entre o escore e os microorganismos isolados em ferida operatória em hospital brasileiro. MÉTODOS: Análise retrospectiva de um banco de dados prospectivamente coletado de todas as CRM realizadas em centro único, no período de 2006 a 2008. Teste do qui-quadrado foi utilizado para variáveis categóricas e teste t-Student, para variáveis quantitativas. Modelo multivariado por regressão logística foi utilizado para identificação de fatores de risco independente para infecção de ferida esternal. P40 kg/m² (OR 5,38; IC

  5. Chronic pain management: nonpharmacological therapies for chronic pain.

    Science.gov (United States)

    Chang, Ku-Lang; Fillingim, Roger; Hurley, Robert W; Schmidt, Siegfried

    2015-05-01

    Nonpharmacologic therapies have become a vital part of managing chronic pain (CP). Although these can be used as stand-alone therapies, nonpharmacologic treatments often are used to augment and complement pharmacologic treatments (ie, multimodal therapy). Nonpharmacologic approaches can be classified as behavioral, cognitive, integrative, and physical therapies. Core principles in developing a treatment plan are explaining the nature of the CP condition, setting appropriate goals, and developing a comprehensive treatment approach and plan for adherence. Clinicians should become familiar with these interventions so that they can offer patients flexibility in the pain management approach. Effective noninvasive treatment modalities for CP include behavioral therapy for short-term pain relief; cognitive behavioral therapy for reducing long-term pain and disability; hypnosis as adjunctive therapy; guided imagery, diaphragmatic breathing, and muscle relaxation, especially for cancer-related pain; mindfulness-based stress reduction for patients with chronic low back pain; acupuncture for multiple pain conditions; combination manipulation, manual therapy, endurance exercise, stretching, and strengthening for chronic neck pain; animal-assisted therapy; and S-adenosyl-L-methionine for joint pain. Guidelines for use of these treatment modalities are based on expert panel recommendations in combination with data from randomized controlled trials. PMID:25970869

  6. [Chronic cough: common problem, discontended patients].

    Science.gov (United States)

    Koskela, Heikki; Purokivi, Minna

    2014-01-01

    The prevalence of chronic cough is 10 to 15%. It has a strong negative impact on the patients' quality of life and it often causes depression. Many patients find medications unhelpful. Successful management of chronic cough requires the identification of the underlying condition like chronic rhinosinusitis, asthma, and asthma-like syndrome, and esophageal reflux disease. If the underlying condition cannot be identified or if the drug trials fail to help, the patient probably suffers from idiopathic chronic cough. A new paradigm has been introduced in which chronic cough is regarded as a primary condition. PMID:25558624

  7. Magnetic resonance images of chronic patellar tendinitis

    International Nuclear Information System (INIS)

    Chronic patellar tendinitis can be a frustrating diagnostic and therapeutic problem. This report evaluates seven tendons in five patients with chronic patellar tendinitis. The etiologies included 'jumper's knee' and Osgood-Schlatter disease. In all cases magnetic resonance images (MRI) showed thickening of the tendon. Some of the tendons had focal areas of thickening which helped establish the etiology. All cases had intratendinous areas of increased signal which, in four cases, proved to be chronic tendon tears. MRI is useful in evaluating chronic patellar tendinitis because it establishes the diagnosis, detects associated chronic tears, and may help determine appropriate rehabilitation. (orig.)

  8. Magnetic resonance images of chronic patellar tendinitis

    Energy Technology Data Exchange (ETDEWEB)

    Bodne, D.; Quinn, S.F.; Murray, W.T.; Cochran, C.; Bolton, T.; Rudd, S.; Lewis, K.; Daines, P.; Bishop, J.

    1988-01-01

    Chronic patellar tendinitis can be a frustrating diagnostic and therapeutic problem. This report evaluates seven tendons in five patients with chronic patellar tendinitis. The etiologies included 'jumper's knee' and Osgood-Schlatter disease. In all cases magnetic resonance images (MRI) showed thickening of the tendon. Some of the tendons had focal areas of thickening which helped establish the etiology. All cases had intratendinous areas of increased signal which, in four cases, proved to be chronic tendon tears. MRI is useful in evaluating chronic patellar tendinitis because it establishes the diagnosis, detects associated chronic tears, and may help determine appropriate rehabilitation. (orig.)

  9. Bone morbidity in chronic myeloproliferative neoplasms

    DEFF Research Database (Denmark)

    Farmer, Sarah; Ocias, Lukas Frans; Vestergaard, Hanne;

    2015-01-01

    Patients with the classical Philadelphia chromosome-negative chronic myeloproliferative neoplasms including essential thrombocythemia, polycythemia vera and primary myelofibrosis often suffer from comorbidities, in particular, cardiovascular diseases and thrombotic events. Apparently, there is also...... neoplasms. Chronic inflammation has been suggested to explain the initiation of clonal development and progression in chronic myeloproliferative neoplasms. Decreased bone mineral density and enhanced fracture risk are well-known manifestations of many chronic systemic inflammatory diseases. As opposed to...... systemic mastocytosis (SM) where pathogenic mechanisms for bone manifestations probably involve effects of mast cell mediators on bone metabolism, the mechanisms responsible for increased fracture risk in other chronic myeloproliferative neoplasms are not known....

  10. Prevalence of chronic kidney disease among people living with HIV/AIDS in Burundi: a cross-sectional study

    Directory of Open Access Journals (Sweden)

    Nzorijana Janvière

    2011-08-01

    Full Text Available Abstract Background Since little is known about chronic kidney disease (CKD among people living with HIV/AIDS (PLWHA in Sub-Saharan Africa, the prevalence and nature of CKD were assessed in Burundi through a multicenter cross-sectional study. Methods Patients underwent assessments at baseline and 3 months later. Glomerular Filtration Rate (GFR was estimated using abbreviated 4-variable Modification of Diet in Renal Diseases (MDRD and Cockroft-Gault estimation methods. Patients were classified at month 3 into various CKD stages using the National Kidney Foundation (NKF definition, which combines GFR and urinary abnormalities. Risk factors for presence of proteinuria (PRO and aseptic leukocyturia (LEU were further analyzed using multiple logistic regression. Results Median age of the patients in the study (N = 300 was 40 years, 70.3% were female and 71.7% were on highly active antiretroviral therapy. Using the MDRD method, CKD prevalence in patients was 45.7%, 30.2% of whom being classified as stage 1 according to the NKF classification, 13.5% as stage 2 and 2% as stage 3. No patient was classified as stage 4 or 5. Among CKD patients with urinary abnormality, PRO accounted for 6.1% and LEU for 18.4%. Significant associations were found between LEU and non-steroidal anti-inflammatory drug (NSAID use, previous history of tuberculosis, low body mass index and female gender and between PRO and high viral load. Conclusion Our study, using a very sensitive definition for CKD evaluation, suggests a potentially high prevalence of CKD among PLWHA in Burundi. Patients should be regularly monitored and preventative measures implemented, such as monitoring NSAID use and adjustment of drug dosages according to body weight. Urine dipsticks could be used as a screening tool to detect patients at risk of renal impairment.

  11. Melatonin in Chronic Pain Syndromes.

    Science.gov (United States)

    Danilov, Andrei; Kurganova, Julia

    2016-06-01

    Melatonin is a neurohormone secreted by epiphysis and extrapineal structures. It performs several functions including chronobiotic, antioxidant, oncostatic, immune modulating, normothermal, and anxiolytic functions. Melatonin affects the cardiovascular system and gastrointestinal tract, participates in reproduction and metabolism, and body mass regulation. Moreover, recent studies have demonstrated melatonin efficacy in relation to pain syndromes. The present paper reviews the studies on melatonin use in fibromyalgia, headaches, irritable bowel syndrome, chronic back pain, and rheumatoid arthritis. The paper discusses the possible mechanisms of melatonin analgesic properties. On one hand, circadian rhythms normalization results in sleep improvement, which is inevitably disordered in chronic pain syndromes, and activation of melatonin adaptive capabilities. On the other hand, there is evidence of melatonin-independent analgesic effect involving melatonin receptors and several neurotransmitter systems. PMID:26984272

  12. Endothelins in chronic liver disease

    DEFF Research Database (Denmark)

    Møller, Søren; Henriksen, Jens Henrik

    1996-01-01

    and neurohumoral dysregulation found in cirrhosis. Recent studies have shown that the ET system is highly activated in most cirrhotic patients. Circulating ET-1 and ET-3 levels have a positive relation to the severity of the disease and fluid retention, with the highest values recorded in patients...... venous hypertension. In addition, marked associations with disturbance of systemic haemodynamics and with abnormal distribution of blood volume have been reported. Although the pathophysiological importance of the ET system in chronic liver disease is not completely understood, similarities to other......This review describes recent progress in the accumulation of knowledge about the endothelins (ETs), a family of vasoactive 21-amino acid polypeptides, in chronic liver disease. Particular prominence is given to the dynamics of ET-1 and ET-3 and their possible relation to the disturbed circulation...

  13. Basophil responsiveness in chronic urticaria.

    Science.gov (United States)

    Saini, Sarbjit S

    2009-07-01

    Chronic urticaria is a common skin disease without an etiology in the majority of cases. The similarity of symptoms and pathology to allergen-induced skin reactions supports the idea that skin mast cell and blood basophil IgE receptor activation is involved; however, no exogenous allergen trigger has been identified. Recent evidence supports a role for blood basophils in disease expression. Specifically, blood basopenia is noted in active disease with the recruitment of blood basophils to skin lesional sites. In addition, blood basophils display altered IgE receptor-mediated degranulation that reverts in disease remission. In active chronic idiopathic urticaria (CIU) subjects, changes in IgE receptor-signaling molecule expression levels accompany the altered degranulation function in blood basophils. The arrival of therapies targeting IgE has further shown that altered blood basophil degranulation behavior has potential use as a disease biomarker in CIU. PMID:19656475

  14. Antidepressants in chronic idiopathic urticaria.

    Science.gov (United States)

    Yasharpour, Michelle R; Randhawa, Inderpal

    2011-01-01

    Chronic idiopathic urticaria (CIU) is a common disease estimated to affect 0.1% of the population and can be very difficult to treat. Many psychotropic medications have been reported to be successful in treating refractory CIU. The purpose of this article was to discuss the pathophysiology of chronic urticaria and provide practicing allergists and dermatologists alternative treatment options in the management of refractory CIU, especially in those who have concurrent psychiatric comorbidity. A review was performed of pertinent literature pertaining to the pathophysiology of CIU and the many psychotropic medications reportedly successful in disease management. Although more research is needed, this article serves to broaden the mind of the physician treating CIU. PMID:22221435

  15. Lithium clearance in chronic nephropathy

    DEFF Research Database (Denmark)

    Kamper, A L; Holstein-Rathlou, N H; Leyssac, P P;

    1989-01-01

    1. Lithium clearance measurements were made in 72 patients with chronic nephropathy of different aetiology and moderate to severely reduced renal function. 2. Lithium clearance was strictly correlated with glomerular filtration rate, and there was no suggestion of distal tubular reabsorption of...... clearance data were independent of whether renal disease was of primarily glomerular or tubular origin and, further, were not influenced by long-term conventional antihypertensive treatment. 6. It is concluded that, even with a reduced kidney function, the data are compatible with the suggestion that...... lithium clearance may be a measure of the delivery of sodium and water from the renal proximal tubule. With this assumption it was found that adjustment of the sodium excretion in chronic nephropathy initially takes place in the distal parts of the nephron (loop of Henle, distal tubule and collecting duct...

  16. Lithium clearance in chronic nephropathy

    DEFF Research Database (Denmark)

    Kamper, A L; Holstein-Rathlou, N H; Leyssac, P P;

    1989-01-01

    1. Lithium clearance measurements were made in 72 patients with chronic nephropathy of different aetiology and moderate to severely reduced renal function. 2. Lithium clearance was strictly correlated with glomerular filtration rate, and there was no suggestion of distal tubular reabsorption of...... lithium or influence of osmotic diuresis. 3. Fractional reabsorption of lithium was reduced in most patients with glomerular filtration rates below 25 ml/min. 4. Calculated fractional distal reabsorption of sodium was reduced in most patients with glomerular filtration rates below 50 ml/min. 5. Lithium...... lithium clearance may be a measure of the delivery of sodium and water from the renal proximal tubule. With this assumption it was found that adjustment of the sodium excretion in chronic nephropathy initially takes place in the distal parts of the nephron (loop of Henle, distal tubule and collecting duct...

  17. Endothelins in chronic liver disease

    DEFF Research Database (Denmark)

    Møller, S; Henriksen, Jens Henrik Sahl

    1996-01-01

    This review describes recent progress in the accumulation of knowledge about the endothelins (ETs), a family of vasoactive 21-amino acid polypeptides, in chronic liver disease. Particular prominence is given to the dynamics of ET-1 and ET-3 and their possible relation to the disturbed circulation...... with functional renal failure. Studies on liver biopsies have revealed synthesis of ET-1 in hepatic endothelial and other cells, and recent investigations have identified the hepatosplanchnic system as a major source of ET-1 and ET-3 spillover into the circulation, with a direct relation to portal...... venous hypertension. In addition, marked associations with disturbance of systemic haemodynamics and with abnormal distribution of blood volume have been reported. Although the pathophysiological importance of the ET system in chronic liver disease is not completely understood, similarities to other...

  18. Insomnia and chronic heart failure.

    Science.gov (United States)

    Hayes, Don; Anstead, Michael I; Ho, Julia; Phillips, Barbara A

    2009-09-01

    Insomnia is highly prevalent in patients with chronic disease including chronic heart failure (CHF) and is a significant contributing factor to fatigue and poor quality of life. The pathophysiology of CHF often leads to fatigue, due to nocturnal symptoms causing sleep disruption, including cough, orthopnea, paroxysmal nocturnal dyspnea, and nocturia. Inadequate cardiac function may lead to hypoxemia or poor perfusion of the cerebrum, skeletal muscle, or visceral body organs, which result in organ dysfunction or failure and may contribute to fatigue. Sleep disturbances negatively affect all dimensions of quality of life and is related to increased risk of comorbidities, including depression. This article reviews insomnia in CHF, cardiac medication side-effects related to sleep disturbances, and treatment options. PMID:18758945

  19. Clinicomicrobiological study of chronic paronychia

    Directory of Open Access Journals (Sweden)

    Guha P

    1992-01-01

    Full Text Available A total of 261 digits affected in 100 patients of chronic paronychia were studied for clinical features. The bacteriological and mycological flora have been examined in 25 cases of the above 100 cases which were most severely affected. Aerobic bacteria were found in all cases. Staphylococcus aureus was seen in 60 percent. Klebsiella in 16 percent, Escherichia coli in 12 percent, Pseudomonas aeruginosa in 12 percent, Proteus mirabillis in 8 percent, Staphylococcus epidermidis in 4 percent and Streptococcus viridans in 4 percent. Culture for fungus revealed Candida albicans in 64 percent and other species such as C. krusei, C. stellatoides, C. viswanathi, C. parapsilosis and C. tropicalis were present in 1 case each. No fungus was detected in 4 cases(16percent. The present investigation was designed to compare the bacterial and mycotic flora of the nail folds of patients of chronic paronychia with that of western countries.

  20. Pharmacological challenges in chronic pancreatitis

    DEFF Research Database (Denmark)

    Olesen, Anne Estrup; Brokjaer, Anne; Fischer, Iben Wendelboe Deleuran;

    2014-01-01

    . Together these factors can result in malabsorption and may also affect the efficacy of pharmacological intervention. The lifestyle of chronic pancreatitis patients may also contribute to gastrointestinal changes. Many patients limit their food intake because of the pain caused by eating and in some cases......Drug absorption in patients with chronic pancreatitis might be affected by the pathophysiology of the disease. The exocrine pancreatic insufficiency is associated with changes in gastrointestinal intraluminal pH, motility disorder, bacterial overgrowth and changed pancreatic gland secretion...... often prescribed as pain treatment. Opioids have intrinsic effects on gastrointestinal motility and hence can modify the absorption of other drugs taken at the same time. Furthermore, the increased fluid absorption caused by opioids will decrease water available for drug dissolution and may hereby...

  1. Aspergillosis in Chronic Granulomatous Disease

    OpenAIRE

    Jill King; Henriet, Stefanie S. V.; Adilia Warris

    2016-01-01

    Patients with chronic granulomatous disease (CGD) have the highest life-time incidence of invasive aspergillosis and despite the availability of antifungal prophylaxis, infections by Aspergillus species remain the single most common infectious cause of death in CGD. Recent developments in curative treatment options, such as haematopoietic stem cell transplantation, will change the prevalence of infectious complications including invasive aspergillosis in CGD patients. However, invasive asperg...

  2. Chronic granulomatous disease of childhood

    International Nuclear Information System (INIS)

    Chronic granulomatous disease (CGD) of childhood is a rare entity. The disease is characterized by recurrent infections with granuloma and abscess formation caused by an inherited defective neutrophil leukocyte function. The most common sites of involvements are the lungs, lymph nodes, skin, liver, spleen and bones. Rarely are other organs affected. Two children with CGD are presented. The children were cousins, the older with bone, lung and splenic involvement. The younger had circumferential thickening of the gastric antrum. (orig./GDG)

  3. Treatment of chronic inflammatory neuropathies

    OpenAIRE

    Schaik, van, I.N.; Eftimov, F.

    2015-01-01

    This thesis focuses on the efficacy of existing and alternative treatments in chronic inflammatory demyelinating polyradiculoneuropathy (CIDP) and multifocal motor neuropathy (MMN) and explores predictors of treatment response in patients with CIDP treated with corticosteroids. The efficacy of intravenous immunoglobulin (IVIg) in CIDP and MMN was confirmed in meta-analyses. In CIDP, IVIg efficacy was similar to the efficacy of plasma exchange, prednisolone and intravenous methylprednisolone. ...

  4. [Antidiarrheal drugs for chronic diarrhea].

    Science.gov (United States)

    Vohmann, B; Hoffmann, J C

    2013-11-01

    Chronic diarrhea can be caused by multiple disease entities. Basic diagnostic tests are required in order to administer specific therapies whenever possible. If no specific treatment can be used, a symptomatic management should be initiated in order to prevent massive electrolyte- and water losses. Substances that can be used are loperamide, cholestyramine, bulking agents, probiotics, anticholinergic agents and in severe cases opioids. If used properly these agents can be prescribed longterm with an acceptable side effect profile. PMID:24163167

  5. Chronic Inflammation in Cancer Development

    OpenAIRE

    Multhoff, Gabriele; Molls, Michael; Radons, Jürgen

    2012-01-01

    Chronic inflammatory mediators exert pleiotropic effects in the development of cancer. On the one hand, inflammation favors carcinogenesis, malignant transformation, tumor growth, invasion, and metastatic spread; on the other hand inflammation can stimulate immune effector mechanisms that might limit tumor growth. The link between cancer and inflammation depends on intrinsic and extrinsic pathways. Both pathways result in the activation of transcription factors such as NF-κB, STAT-3, and HIF-...

  6. DIAGNOSIS AND MANAGEMENT CHRONIC INSOMNIA

    OpenAIRE

    G.A Dian Puspitha Candra

    2013-01-01

    Insomnia is defined as difficulty to start sleeping, maintain it, or low quality sleeping, if the condition persist for more than one month, it is called chronic insomnia. Diagnosis is made through anamnesa and sleep wake diaries, aktigraphy, polisomnography. Pharmachologycally drugs that have been used to treat insomnia are benzodiazepin reseptor agonis, antihistamine, antidepressant. Non pharmacological ways include behavioural intervention for insomnia, give significant result in decreasin...

  7. Chronic Cutaneous Hyalophomycosis by Paecilomyces

    OpenAIRE

    BOUFFLETTE, Nicolas; Arrese Estrada, Jorge; Leonard, Philippe; Nikkels, Arjen

    2014-01-01

    Paecilomyces lilacinus is a ubiquitous saprophytic fungus that rarely causes infections in humans, frequently affecting the eyes and the skin. Cutaneous and subcutaneous infections mainly occur in immunocompromised hosts but have occasionally been reported in immunocompetent patients. The clinical spectrum is highly heterogeneous and diagnosis is often delayed. A 60-year-old woman with idiopathic chronic necrotizing vasculitis treated since 10 years with a series of immunosuppressive thera...

  8. Chronic Psychosocial Stress and Hypertension

    OpenAIRE

    Spruill, Tanya M.

    2010-01-01

    Genetic and behavioral factors do not fully explain the development of hypertension, and there is increasing evidence suggesting that psychosocial factors may also play an important role. Exposure to chronic stress has been hypothesized as a risk factor for hypertension, and occupational stress, stressful aspects of the social environment, and low socioeconomic status have each been studied extensively. The study of discrimination is a more recent and rapidly growing area of investigation and...

  9. Chronic pain and invasive therapy

    OpenAIRE

    Alessandro Rocco; Pierangelo Di Marco; Marta Luzi; Alessandra Canneti; Carlo Reale

    2009-01-01

    The chronic pain “three-step” OMS ladder is likely to be revised, in order to introduce a “fourth step” including clinical indications for the invasive analgesic procedures. The number of patients who undergo such procedures is likely to increase, as well as modern oncology and palliative medicine development. Most of invasive approaches include central (spinal neuromodulation) and peripheral (gangliar neurolysis, percutaneous vertebral reduction) techniques, as well as pharmacological (opioi...

  10. Chronic pancreatitis and pancreatic carcinoma.

    OpenAIRE

    Evans, J D; Morton, D. G.; Neoptolemos, J. P.

    1997-01-01

    The differential diagnosis between pancreatic cancer and chronic pancreatitis is very important as the management and prognosis of these two diseases is different. In most patients with pancreatic disease, the diagnosis can be established but there is a subgroup of patients in whom it is difficult to differentiate between these conditions because the clinical presentation is often similar and currently available diagnostic tests may be unable to distinguish between an inflammatory or neoplast...

  11. Treatment of Chronic Venous Insufficiency

    OpenAIRE

    KÖKSAL, Cengiz; Alsalehi, Saleh; Kocamaz, Özgür; Sunar, Hasan

    2009-01-01

    Chronic venous insufficiency (CVI), with its high prevalence, high cost of diagnosis and treatment, substantial loss in manpower and negative effects on quality of life, is an important health issue. A comprehensive knowledge of the anatomy and functions of venous system is a must to understand the pathophysiology of CVI. The diagnosis of CVI is made by history, physical examination and noninvasive tests. The traditional surgical strategy for CVI treatment is high ligation of saphenofemoral v...

  12. Treatment of Chronic Venous Insufficiency

    OpenAIRE

    Cengiz Köksal; Saleh Alsalehi; Özgür Kocamaz; Hasan Sunar

    2010-01-01

    Chronic venous insufficiency (CVI), with its high prevalence, high cost of diagnosis and treatment, substantial loss in manpower and negative effects on quality of life, is an important health issue. A comprehensive knowledge of the anatomy and functions of venous system is a must to understand the pathophysiology of CVI. The iagnosis of CVI is made by history, physical examination and noninvasive tests. The traditional surgical strategy for CVI treatment is high ligation of saphenofemoral ve...

  13. Chronic Infection and Severe Asthma.

    Science.gov (United States)

    Carr, Tara F; Kraft, Monica

    2016-08-01

    Chronic bacterial infection is implicated in both the development and severity of asthma. The atypical bacteria Mycoplasma pneumoniae and Chlamydophila pneumoniae have been identified in the airways of asthmatics and correlated with clinical features such as adult onset, exacerbation risks, steroid sensitivity, and symptom control. Asthmatic patients with evidence of bacterial infection may benefit from antibiotic treatment directed towards these atypical organisms. Examination of the airway microbiome may identify microbial communities that confer risk for or protection from severe asthma. PMID:27401621

  14. Chronic Pruritus: a Paraneoplastic Sign

    OpenAIRE

    Yosipovitch, Gil

    2010-01-01

    Chronic itch could be a presenting sign of malignancy. Pruritus of lymphoma is the common prototype of paraneoplastic itch and can precede other clinical signs by weeks and months. Paraneopalstic pruritus has also been associated with solid tumors and is an important clinical symptom in paraneoplastic skin diseases such as erythroderma, Grovers disease, malignant acanthosis nigricans, generalized granuloma annulare, Bazex syndrome and dermatomyositis. In any case with high index of suspicion ...

  15. Superoxide dismutases in chronic gastritis.

    Science.gov (United States)

    Švagelj, Dražen; Terzić, Velimir; Dovhanj, Jasna; Švagelj, Marija; Cvrković, Mirta; Švagelj, Ivan

    2016-04-01

    Human gastric diseases have shown significant changes in the activity and expression of superoxide dismutase (SOD) isoforms. The aim of this study was to detect Mn-SOD activity and expression in the tissue of gastric mucosa, primarily in chronic gastritis (immunohistochemical Helicobacter pylori-negative gastritis, without other pathohistological changes) and to evaluate their possible connection with pathohistological diagnosis. We examined 51 consecutive outpatients undergoing endoscopy for upper gastrointestinal symptoms. Patients were classified based on their histopathological examinations and divided into three groups: 51 patients (archive samples between 2004-2009) with chronic immunohistochemical Helicobacter pylori-negative gastritis (mononuclear cells infiltration were graded as absent, moderate, severe) divided into three groups. Severity of gastritis was graded according to the updated Sydney system. Gastric tissue samples were used to determine the expression of Mn-SOD with anti-Mn-SOD Ab immunohistochemically. The Mn-SOD expression was more frequently present in specimens with severe and moderate inflammation of gastric mucosa than in those with normal mucosa. In patients with normal histological finding, positive immunoreactivity of Mn-SOD was not found. Our results determine the changes in Mn-SOD expression occurring in the normal gastric mucosa that had undergone changes in the intensity of chronic inflammatory infiltrates in the lamina propria. PMID:26765960

  16. NAFLD and Chronic Kidney Disease

    Directory of Open Access Journals (Sweden)

    Morgan Marcuccilli

    2016-04-01

    Full Text Available Non-alcoholic fatty liver disease (NAFLD is the most common cause of chronic liver disease in developed countries and it is now considered a risk factor for cardiovascular disease. Evidence linking NAFLD to the development and progression of chronic kidney disease (CKD is emerging as a popular area of scientific interest. The rise in simultaneous liver-kidney transplantation as well as the significant cost associated with the presence of chronic kidney disease in the NAFLD population make this entity a worthwhile target for screening and therapeutic intervention. While several cross-sectional and case control studies have been published to substantiate these theories, very little data exists on the underlying cause of NAFLD and CKD. In this review, we will discuss the most recent publications on the diagnosis of NAFLD as well new evidence regarding the pathophysiology of NAFLD and CKD as an inflammatory disorder. These mechanisms include the role of obesity, the renin-angiotensin system, and dysregulation of fructose metabolism and lipogenesis in the development of both disorders. Further investigation of these pathways may lead to novel therapies that aim to target the NAFLD and CKD. However, more prospective studies that include information on both renal and liver histology will be necessary in order to understand the relationship between these diseases.

  17. Pericytes in chronic lung disease.

    Science.gov (United States)

    Rowley, Jessica E; Johnson, Jill R

    2014-01-01

    Pericytes are mesenchymal cells embedded within the abluminal surface of the endothelium of microvessels such as capillaries, pre-capillary arterioles, post-capillary and collecting venules, where they maintain microvascular homeostasis and participate in angiogenesis. In addition to their roles in supporting the vasculature and facilitating leukocyte extravasation, pericytes have been recently investigated as a subpopulation of mesenchymal stem cells (MSCs) due to their capacity to differentiate into numerous cell types including the classic MSC triad, i.e. osteocytes, chondrocytes and adipocytes. Other studies in models of fibrotic inflammatory disease of the lung have demonstrated a vital role of pericytes in myofibroblast activation, collagen deposition and microvascular remodelling, which are hallmark features of chronic lung diseases such as asthma, chronic obstructive pulmonary disorder, pulmonary fibrosis and pulmonary hypertension. Further studies into the mechanisms of the pericyte-to-myofibroblast transition and migration to fibrotic foci will hopefully clarify the role of these cells in chronic lung disease and confirm the importance of pericytes in human fibrotic pulmonary disease. PMID:25034005

  18. Meditation's impact on chronic illness.

    Science.gov (United States)

    Bonadonna, Ramita

    2003-01-01

    Meditation is becoming widely popular as an adjunct to conventional medical therapies. This article reviews the literature regarding the experience of chronic illness, theories about meditation, and clinical effects of this self-care practice. Eastern theories of meditation include Buddhist psychology. The word Buddha means the awakened one, and Buddhist meditators have been called the first scientists, alluding to more than 2500 years of precise, detailed observation of inner experience. The knowledge that comprises Buddhist psychology was derived inductively from the historical figure's (Prince Siddhartha Gautama) diligent self-inquiry. Western theories of meditation include Jungian, Benson's relaxation response, and transpersonal psychology. Clinical effects of meditation impact a broad spectrum of physical and psychological symptoms and syndromes, including reduced anxiety, pain, and depression, enhanced mood and self-esteem, and decreased stress. Meditation has been studied in populations with fibromyalgia, cancer, hypertension, and psoriasis. While earlier studies were small and lacked experimental controls, the quality and quantity of valid research is growing. Meditation practice can positively influence the experience of chronic illness and can serve as a primary, secondary, and/or tertiary prevention strategy. Health professionals demonstrate commitment to holistic practice by asking patients about use of meditation, and can encourage this self-care activity. Simple techniques for mindfulness can be taught in the clinical setting. Living mindfully with chronic illness is a fruitful area for research, and it can be predicted that evidence will grow to support the role of consciousness in the human experience of disease. PMID:14650573

  19. Chronic Hemodialysis in Small Children.

    Science.gov (United States)

    Novljan, Gregor; Rus, Rina R; Premru, Vladimir; Ponikvar, Rafael; Battelino, Nina

    2016-06-01

    When peritoneal dialysis is inapplicable, chronic hemodialysis (HD) becomes the only available treatment option in small children. Due to small patient size, central venous catheters (CVC) are mainly used for vascular access. Over the past 4 years, four children weighing less than 15 kg received chronic HD in our unit. A total of 848 dialysis sessions were performed. Altogether, 21 catheters were inserted. In all but one occasion, uncuffed catheters were used. Catheter revision was performed 15 times during the study period, either due to infection or catheter malfunction. The median number of catheter revisions and the median line survival was 3.0/patient-year and 53 days (range; 6-373 days), respectively. There were 14 episodes of catheter related infections requiring 11 CVC revisions (78.6%). The median rate of line infections was 2.8/patient-year. Chronic HD in small children is demanding and labor intensive. Issues pertain mainly to CVCs and limit its long-term use. PMID:27312919

  20. Widespread pain in chronic epicondylitis.

    Science.gov (United States)

    Pienimäki, Tuomo; Siira, Pertti; Vanharanta, Heikki

    2011-10-01

    We studied the associations of widespread pain with other pain and functional measures among patients with chronic epicondylitis. A total of 190 patients (66% females) participated in the study; with a mean age 43.7, mean duration of symptoms 48weeks, chronic lateral (n=160) and medial (n=30) epicondylitis. We analysed clinical status, grip strength and cubital pain thresholds and interviewed pain and disability, leisure time physical activity, strenuous hobby activities for arms, duration of symptoms, other systemic and upper extremity disorders, arm operations, and work ability. The location of pain was analysed using a whole-body pain drawing, categorized into three groups; the highest of which was classified as widespread pain. A total of 85 patients (45%) reported widespread pain. It was highly associated with female gender, high pain scores, decreased grip strength and pain thresholds (p<0.001 for all), with increased number of positive manual tests, low level of hobby strain for arms and physical activity, long duration of symptoms, and sick leave (p for all <0.05). It was also related to upper extremity disorders and arm surgery, but not with operated epicondylitis, other systemic diseases, workload or work ability. In addition, 39% of patients without other disease reported widespread pain. Widespread pain is common in chronic epicondylitis with and without other diseases, and is related to high pain scores, decreased function of the arm, long duration of symptoms, sick leave, and with a low level of physical activity. PMID:21565536