Protocol: methodology for chromatin immunoprecipitation (ChIP in Chlamydomonas reinhardtii
Directory of Open Access Journals (Sweden)
Strenkert Daniela
2011-11-01
Full Text Available Abstract We report on a detailed chromatin immunoprecipitation (ChIP protocol for the unicellular green alga Chlamydomonas reinhardtii. The protocol is suitable for the analysis of nucleosome occupancy, histone modifications and transcription factor binding sites at the level of mononucleosomes for targeted and genome-wide studies. We describe the optimization of conditions for crosslinking, chromatin fragmentation and antibody titer determination and provide recommendations and an example for the normalization of ChIP results as determined by real-time PCR.
Kaufmann, K.; Muiño, J.M.; Østerås, M.; Farinelli, L.; Krajewski, P.; Angenent, G.C.
2010-01-01
Chromatin immunoprecipitation (ChIP) is a powerful technique to study interactions between transcription factors (TFs) and DNA in vivo. For genome-wide de novo discovery of TF-binding sites, the DNA that is obtained in ChIP experiments needs to be processed for sequence identification. The sequences
Komar, Dorota N; Mouriz, Alfonso; Jarillo, José A; Piñeiro, Manuel
2016-01-14
Intricate gene regulatory networks orchestrate biological processes and developmental transitions in plants. Selective transcriptional activation and silencing of genes mediate the response of plants to environmental signals and developmental cues. Therefore, insights into the mechanisms that control plant gene expression are essential to gain a deep understanding of how biological processes are regulated in plants. The chromatin immunoprecipitation (ChIP) technique described here is a procedure to identify the DNA-binding sites of proteins in genes or genomic regions of the model species Arabidopsis thaliana. The interactions with DNA of proteins of interest such as transcription factors, chromatin proteins or posttranslationally modified versions of histones can be efficiently analyzed with the ChIP protocol. This method is based on the fixation of protein-DNA interactions in vivo, random fragmentation of chromatin, immunoprecipitation of protein-DNA complexes with specific antibodies, and quantification of the DNA associated with the protein of interest by PCR techniques. The use of this methodology in Arabidopsis has contributed significantly to unveil transcriptional regulatory mechanisms that control a variety of plant biological processes. This approach allowed the identification of the binding sites of the Arabidopsis chromatin protein EBS to regulatory regions of the master gene of flowering FT. The impact of this protein in the accumulation of particular histone marks in the genomic region of FT was also revealed through ChIP analysis.
Komar, Dorota N.; Mouriz, Alfonso; Jarillo, José A.; Piñeiro, Manuel
2016-01-01
Intricate gene regulatory networks orchestrate biological processes and developmental transitions in plants. Selective transcriptional activation and silencing of genes mediate the response of plants to environmental signals and developmental cues. Therefore, insights into the mechanisms that control plant gene expression are essential to gain a deep understanding of how biological processes are regulated in plants. The chromatin immunoprecipitation (ChIP) technique described here is a proced...
Directory of Open Access Journals (Sweden)
Daniel Castellano-Castillo
Full Text Available Chromatin immunoprecipitation (ChIP has gained importance to identify links between the genome and the proteome. Adipose tissue has emerged as an active tissue, which secretes a wide range of molecules that have been related to metabolic and obesity-related disorders, such as diabetes, cardiovascular failure, metabolic syndrome, or cancer. In turn, epigenetics has raised the importance in discerning the possible relationship between metabolic disorders, lifestyle and environment. However, ChIP application in human adipose tissue is limited by several factors, such as sample size, frozen sample availability, high lipid content and cellular composition of the tissue. Here, we optimize the standard protocol of ChIP for small pieces of frozen human adipose tissue. In addition, we test ChIP for the histone mark H3K4m3, which is related to active promoters, and validate the performance of the ChIP by analyzing gene promoters for factors usually studied in adipose tissue using qPCR. Our improvements result in a higher performance in chromatin shearing and DNA recovery of adipocytes from the tissue, which may be useful for ChIP-qPCR or ChIP-seq analysis.
McCullough, Shaun D; On, Doan M; Bowers, Emma C
2017-05-02
Histone modifications work in concert with DNA methylation to regulate cellular structure, function, and response to environmental stimuli. More than 130 unique histone modifications have been described to date, and chromatin immunoprecipitation (ChIP) allows for the exploration of their associations with the regulatory regions of target genes and other DNA/chromatin-associated proteins across the genome. Many variations of ChIP have been developed in the 30 years since its earliest version came into use, which makes it challenging for users to integrate the procedure into their research programs. Furthermore, the differences in ChIP protocols can confound efforts to increase reproducibility across studies. The streamlined ChIP procedure presented here can be readily applied to samples from a wide range of in vitro studies (cell lines and primary cells) and clinical samples (peripheral leukocytes) in toxicology. We also provide detailed guidance on the optimization of critical protocol parameters, such as chromatin fixation, fragmentation, and immunoprecipitation, to increase efficiency and improve reproducibility. Expanding toxicoepigenetic studies to more readily include histone modifications will facilitate a more comprehensive understanding of the role of the epigenome in environmental exposure effects and the integration of epigenetic data in mechanistic toxicology, adverse outcome pathways, and risk assessment. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.
Chromatin immunoprecipitation to analyze DNA binding sites of HMGA2.
Directory of Open Access Journals (Sweden)
Nina Winter
Full Text Available BACKGROUND: HMGA2 is an architectonic transcription factor abundantly expressed during embryonic and fetal development and it is associated with the progression of malignant tumors. The protein harbours three basically charged DNA binding domains and an acidic protein binding C-terminal domain. DNA binding induces changes of DNA conformation and hence results in global overall change of gene expression patterns. Recently, using a PCR-based SELEX (Systematic Evolution of Ligands by Exponential Enrichment procedure two consensus sequences for HMGA2 binding have been identified. METHODOLOGY/PRINCIPAL FINDINGS: In this investigation chromatin immunoprecipitation (ChIP experiments and bioinformatic methods were used to analyze if these binding sequences can be verified on chromatin of living cells as well. CONCLUSION: After quantification of HMGA2 protein in different cell lines the colon cancer derived cell line HCT116 was chosen for further ChIP experiments because of its 3.4-fold higher HMGA2 protein level. 49 DNA fragments were obtained by ChIP. These fragments containing HMGA2 binding sites have been analyzed for their AT-content, location in the human genome and similarities to sequences generated by a SELEX study. The sequences show a significantly higher AT-content than the average of the human genome. The artificially generated SELEX sequences and short BLAST alignments (11 and 12 bp of the ChIP fragments from living cells show similarities in their organization. The flanking regions are AT-rich, whereas a lower conservation is present in the center of the sequences.
Chromatin Immunoprecipitation (ChIP) using Drosophila tissue
Tran, Vuong; Gan, Qiang; Chen, Xin
2012-01-01
Epigenetics remains a rapidly developing field that studies how the chromatin state contributes to differential gene expression in distinct cell types at different developmental stages. Epigenetic regulation contributes to a broad spectrum of biological processes, including cellular differentiation during embryonic development and homeostasis in adulthood. A critical strategy in epigenetic studies is to examine how various histone modifications and chromatin factors regulate gene expression. ...
Nohara, Kazunari; Chen, Zheng; Yoo, Seung-Hee
2017-07-06
Chromatin immunoprecipitation (ChIP) is a powerful method to determine protein binding to chromatin DNA. Fiber-rich skeletal muscle, however, has been a challenge for ChIP due to technical difficulty in isolation of high-quality nuclei with minimal contamination of myofibrils. Previous protocols have attempted to purify nuclei before cross-linking, which incurs the risk of altered DNA-protein interaction during the prolonged nuclei preparation process. In the current protocol, we first cross-linked the skeletal muscle tissue collected from mice, and the tissues were minced and sonicated. Since we found that ultracentrifugation was not able to separate nuclei from myofibrils using cross-linked muscle tissue, we devised a sequential filtration procedure to obtain high-quality nuclei devoid of significant myofibril contamination. We subsequently prepared chromatin by using an ultrasonicator, and ChIP assays with anti-BMAL1 antibody revealed robust circadian binding pattern of BMAL1 to target gene promoters. This filtration protocol constitutes an easily applicable method to isolate high-quality nuclei from cross-linked skeletal muscle tissue, allowing consistent sample processing for circadian and other time-sensitive studies. In combination with next-generation sequencing (NGS), our method can be deployed for various mechanistic and genomic studies focusing on skeletal muscle function.
International Nuclear Information System (INIS)
Railo, Antti; Pajunen, Antti; Itaeranta, Petri; Naillat, Florence; Vuoristo, Jussi; Kilpelaeinen, Pekka; Vainio, Seppo
2009-01-01
Wnt proteins are important regulators of embryonic development, and dysregulated Wnt signalling is involved in the oncogenesis of several human cancers. Our knowledge of the downstream target genes is limited, however. We used a chromatin immunoprecipitation-based assay to isolate and characterize the actual gene segments through which Wnt-activatable transcription factors, TCFs, regulate transcription and an Affymetrix microarray analysis to study the global transcriptional response to the Wnt3a ligand. The anti-β-catenin immunoprecipitation of DNA-protein complexes from mouse NIH3T3 fibroblasts expressing a fusion protein of β-catenin and TCF7 resulted in the identification of 92 genes as putative TCF targets. GeneChip assays of gene expression performed on NIH3T3 cells and the rat pheochromocytoma cell line PC12 revealed 355 genes in NIH3T3 and 129 genes in the PC12 cells with marked changes in expression after Wnt3a stimulus. Only 2 Wnt-regulated genes were shared by both cell lines. Surprisingly, Disabled-2 was the only gene identified by the chromatin immunoprecipitation approach that displayed a marked change in expression in the GeneChip assay. Taken together, our approaches give an insight into the complex context-dependent nature of Wnt pathway transcriptional responses and identify Disabled-2 as a potential new direct target for Wnt signalling.
Burlibașa, Liliana; Suciu, Ilinca
2015-12-01
Oogenesis is a critical event in the formation of female gamete, whose role in development is to transfer genomic information to the next generation. During this process, the gene expression pattern changes dramatically concomitant with genome remodelling, while genomic information is stably maintained. The aim of the present study was to investigate the presence of H4 acetylation of the oocyte and somatic 5S rRNA genes in Triturus cristatus, using chromatin immunoprecipitation assay (ChIP). Our findings suggest that some epigenetic mechanisms such as histone acetylation could be involved in the transcriptional regulation of 5S rRNA gene families.
An optimized protocol for isolating primary epithelial cell chromatin for ChIP.
Directory of Open Access Journals (Sweden)
James A Browne
Full Text Available A critical part of generating robust chromatin immunoprecipitation (ChIP data is the optimization of chromatin purification and size selection. This is particularly important when ChIP is combined with next-generation sequencing (ChIP-seq to identify targets of DNA-binding proteins, genome-wide. Current protocols refined by the ENCODE consortium generally use a two-step cell lysis procedure that is applicable to a wide variety of cell types. However, the isolation and size selection of chromatin from primary human epithelial cells may often be particularly challenging. These cells tend to form sheets of formaldehyde cross-linked material in which cells are resistant to membrane lysis, nuclei are not released and subsequent sonication produces extensive high molecular weight contamination. Here we describe an optimized protocol to prepare high quality ChIP-grade chromatin from primary human bronchial epithelial cells. The ENCODE protocol was used as a starting point to which we added the following key steps to separate the sheets of formaldehyde-fixed cells prior to lysis. (1 Incubation of the formaldehyde-fixed adherent cells in Trypsin-EDTA (0.25% room temperature for no longer than 5 min. (2 Equilibration of the fixed cells in detergent-free lysis buffers prior to each lysis step. (3 The addition of 0.5% Triton X-100 to the complete cell membrane lysis buffer. (4 Passing the cell suspension (in complete cell membrane lysis buffer through a 25-gauge needle followed by continuous agitation on ice for 35 min. Each step of the modified protocol was documented by light microscopy using the Methyl Green-Pyronin dual dye, which stains cytoplasm red (Pyronin and the nuclei grey-blue (Methyl green. This modified method is reproducibly effective at producing high quality sheared chromatin for ChIP and is equally applicable to other epithelial cell types.
Sequential chromatin immunoprecipitation to detect SUMOylated MeCP2 in neurons
Directory of Open Access Journals (Sweden)
Tao Wu
2016-03-01
Full Text Available The small ubiquitin-like modifier (SUMO is a short peptide that can be covalently linked to proteins altering their function. SUMOylation is an essential post-translational modification (PTM. Because of its dynamic nature, low abundance levels, and technical limitations, the occupation of endogenous SUMOylated transcription factors at genomic loci is challenging to detect. The chromatin regulator Methyl CpG binding protein 2 (MeCP2 is subjected to PTMs including SUMO. Mutations in MeCP2 lead to Rett syndrome, a severe neurodevelopmental disorder. Here, we present an efficient method to perform sequential chromatin immunoprecipitation (Seq-ChIP for detecting SUMOylated MeCP2 in neurons. This Seq-ChIP technique is a useful tool to determine the occupancy of SUMOylated transcription and chromatin factors at specific genomic regions.
Nguyen-Duc, Trong; Peeters, Eveline; Muyldermans, Serge; Charlier, Daniel; Hassanzadeh-Ghassabeh, Gholamreza
2013-01-01
Nanobodies® are single-domain antibody fragments derived from camelid heavy-chain antibodies. Because of their small size, straightforward production in Escherichia coli, easy tailoring, high affinity, specificity, stability and solubility, nanobodies® have been exploited in various biotechnological applications. A major challenge in the post-genomics and post-proteomics era is the identification of regulatory networks involving nucleic acid–protein and protein–protein interactions. Here, we apply a nanobody® in chromatin immunoprecipitation followed by DNA microarray hybridization (ChIP-chip) for genome-wide identification of DNA–protein interactions. The Lrp-like regulator Ss-LrpB, arguably one of the best-studied specific transcription factors of the hyperthermophilic archaeon Sulfolobus solfataricus, was chosen for this proof-of-principle nanobody®-assisted ChIP. Three distinct Ss-LrpB-specific nanobodies®, each interacting with a different epitope, were generated for ChIP. Genome-wide ChIP-chip with one of these nanobodies® identified the well-established Ss-LrpB binding sites and revealed several unknown target sequences. Furthermore, these ChIP-chip profiles revealed auxiliary operator sites in the open reading frame of Ss-lrpB. Our work introduces nanobodies® as a novel class of affinity reagents for ChIP. Taking into account the unique characteristics of nanobodies®, in particular, their short generation time, nanobody®-based ChIP is expected to further streamline ChIP-chip and ChIP-Seq experiments, especially in organisms with no (or limited) possibility of genetic manipulation. PMID:23275538
Optimal use of tandem biotin and V5 tags in ChIP assays
K.E. Kolodziej (Katarzyna); F. Pourfarzad, F. (Farzin); E. de Boer (Ernie); S. Krpic (Sanja); F.G. Grosveld (Frank); J. Strouboulis (John)
2009-01-01
textabstractBackground: Chromatin immunoprecipitation (ChIP) assays coupled to genome arrays (Chip-on-chip) or massive parallel sequencing (ChIP-seq) lead to the genome wide identification of binding sites of chromatin associated proteins. However, the highly variable quality of antibodies and the
National Research Council Canada - National Science Library
Sharma, Dipali
2005-01-01
.... Using chromatin immunoprecipitation (ChIP), we examined the chromatin status and repressor complex associated with silenced ER and changes in the key regulatory factors during reactivation by inhibitors of DNMT...
Directory of Open Access Journals (Sweden)
Weishaupt Holger
2010-01-01
Full Text Available Abstract Dynamic chromatin structure is a fundamental property of gene transcriptional regulation, and has emerged as a critical modulator of physiological processes during cellular differentiation and development. Analysis of chromatin structure using molecular biology and biochemical assays in rare somatic stem and progenitor cells is key for understanding these processes but poses a great challenge because of their reliance on millions of cells. Through the development of a miniaturized genome-scale chromatin immunoprecipitation method (miniChIP–chip, we have documented the genome-wide chromatin states of low abundant populations that comprise hematopoietic stem cells and immediate progeny residing in murine bone marrow. In this report, we describe the miniChIP methodology that can be used for increasing an understanding of the epigenetic mechanisms underlying hematopoietic stem and progenitor cell function. Application of this method will reveal the contribution of dynamic chromatin structure in regulating the function of other somatic stem cell populations, and how this process becomes perturbed in pathological conditions. Additional file 1 Click here for file
DEFF Research Database (Denmark)
Comet, Itys; Schuettengruber, Bernd; Sexton, Tom
2011-01-01
to insulate genes from regulatory elements or to take part in long-distance interactions. Using a high-resolution chromatin conformation capture (H3C) method, we show that the Drosophila gypsy insulator behaves as a conformational chromatin border that is able to prohibit contacts between a Polycomb response...... element (PRE) and a distal promoter. On the other hand, two spaced gypsy elements form a chromatin loop that is able to bring an upstream PRE in contact with a downstream gene to mediate its repression. Chromatin immunoprecipitation (ChIP) profiles of the Polycomb protein and its associated H3K27me3...... histone mark reflect this insulator-dependent chromatin conformation, suggesting that Polycomb action at a distance can be organized by local chromatin topology....
Rogge, George A; Shen, Li-Ling; Kuhar, Michael J
2010-07-16
Both over expression of cyclic AMP response element binding protein (CREB) in the nucleus accumbens (NAc), and intra-accumbal injection of cocaine- and amphetamine-regulated transcript (CART) peptides, have been shown to decrease cocaine reward. Also, over expression of CREB in the rat NAc increased CART mRNA and peptide levels, but it is not known if this was due to a direct action of P-CREB on the CART gene promoter. The goal of this study was to test if CREB and P-CREB bound directly to the CRE site in the CART promoter, using chromatin immunoprecipitation (ChIP) assays. ChIP assay with anti-CREB antibodies showed an enrichment of the CART promoter fragment containing the CRE region over IgG precipitated material, a non-specific control. Forskolin, which was known to increase CART mRNA levels in GH3 cells, was utilized to show that the drug increased levels of P-CREB protein and P-CREB binding to the CART promoter CRE-containing region. A region of the c-Fos promoter containing a CRE cis-regulatory element was previously shown to bind P-CREB, and it was used here as a positive control. These data suggest that the effects of CREB over expression on blunting cocaine reward could be, at least in part, attributed to the increased expression of the CART gene by direct interaction of P-CREB with the CART promoter CRE site, rather than by some indirect action. Copyright (c) 2010 Elsevier B.V. All rights reserved.
Determination of local chromatin composition by CasID.
Schmidtmann, Elisabeth; Anton, Tobias; Rombaut, Pascaline; Herzog, Franz; Leonhardt, Heinrich
2016-09-02
Chromatin structure and function are determined by a plethora of proteins whose genome-wide distribution is typically assessed by immunoprecipitation (ChIP). Here, we developed a novel tool to investigate the local chromatin environment at specific DNA sequences. We combined the programmable DNA binding of dCas9 with the promiscuous biotin ligase BirA* (CasID) to biotinylate proteins in the direct vicinity of specific loci. Subsequent streptavidin-mediated precipitation and mass spectrometry identified both known and previously unknown chromatin factors associated with repetitive telomeric, major satellite and minor satellite DNA. With super-resolution microscopy, we confirmed the localization of the putative transcription factor ZNF512 at chromocenters. The versatility of CasID facilitates the systematic elucidation of functional protein complexes and locus-specific chromatin composition.
Highly expressed loci are vulnerable to misleading ChIP localization of multiple unrelated proteins
Teytelman, L.; Thurtle, D.M.; Rine, J.; van Oudenaarden, A.
2013-01-01
Chromatin immunoprecipitation (ChIP) is the gold-standard technique for localizing nuclear proteins in the genome. We used ChIP, in combination with deep sequencing (Seq), to study the genome-wide distribution of the Silent information regulator (Sir) complex in Saccharomyces cerevisiae. We analyzed
ChIP on SNP-chip for genome-wide analysis of human histone H4 hyperacetylation
Directory of Open Access Journals (Sweden)
Porter Christopher J
2007-09-01
Full Text Available Abstract Background SNP microarrays are designed to genotype Single Nucleotide Polymorphisms (SNPs. These microarrays report hybridization of DNA fragments and therefore can be used for the purpose of detecting genomic fragments. Results Here, we demonstrate that a SNP microarray can be effectively used in this way to perform chromatin immunoprecipitation (ChIP on chip as an alternative to tiling microarrays. We illustrate this novel application by mapping whole genome histone H4 hyperacetylation in human myoblasts and myotubes. We detect clusters of hyperacetylated histone H4, often spanning across up to 300 kilobases of genomic sequence. Using complementary genome-wide analyses of gene expression by DNA microarray we demonstrate that these clusters of hyperacetylated histone H4 tend to be associated with expressed genes. Conclusion The use of a SNP array for a ChIP-on-chip application (ChIP on SNP-chip will be of great value to laboratories whose interest is the determination of general rules regarding the relationship of specific chromatin modifications to transcriptional status throughout the genome and to examine the asymmetric modification of chromatin at heterozygous loci.
Fujisawa, Masaki; Nakano, Toshitsugu; Ito, Yasuhiro
2011-01-30
During ripening, climacteric fruits increase their ethylene level and subsequently undergo various physiological changes, such as softening, pigmentation and development of aroma and flavor. These changes occur simultaneously and are caused by the highly synchronized expression of numerous genes at the onset of ripening. In tomatoes, the MADS-box transcription factor RIN has been regarded as a key regulator responsible for the onset of ripening by acting upstream of both ethylene- and non-ethylene-mediated controls. However, except for LeACS2, direct targets of RIN have not been clarified, and little is known about the transcriptional cascade for ripening. Using immunoprecipitated (IPed) DNA fragments recovered by chromatin immunoprecipitation (ChIP) with anti-RIN antibody from ripening tomato fruit, we analyzed potential binding sites for RIN (CArG-box sites) in the promoters of representative ripening-induced genes by quantitative PCR. Results revealed nearly a 5- to 20-fold enrichment of CArG boxes in the promoters of LeACS2, LeACS4, PG, TBG4, LeEXP1, and LeMAN4 and of RIN itself, indicating direct interaction of RIN with their promoters in vivo. Moreover, sequence analysis and genome mapping of 51 cloned IPed DNAs revealed potential RIN binding sites. Quantitative PCR revealed that four of the potential binding sites were enriched 4- to 17-fold in the IPed DNA pools compared with the controls, indicating direct interaction of RIN with these sites in vivo. Near one of the four CArG boxes we found a gene encoding a protein similar to thioredoxin y1. An increase in the transcript level of this gene was observed with ripening in normal fruit but not in the rin mutant, suggesting that RIN possibly induces its expression. The presented results suggest that RIN controls fruit softening and ethylene production by the direct transcriptional regulation of cell-wall-modifying genes and ethylene biosynthesis genes during ripening. Moreover, the binding of RIN to its own
Directory of Open Access Journals (Sweden)
Anita M Quintana
2011-02-01
Full Text Available The c-Myb transcription factor is a critical regulator of proliferation and stem cell differentiation, and mutated alleles of c-Myb are oncogenic, but little is known about changes in c-Myb activity during the cell cycle. To map the association of c-Myb with specific target genes during the cell cycle, we developed a novel Fix-Sort-ChIP approach, in which asynchronously growing cells were fixed with formaldehyde, stained with Hoechst 33342 and separated into different cell cycle fractions by flow sorting, then processed for chromatin immunoprecipitation (ChIP assays. We found that c-Myb actively repositions, binding to some genes only in specific cell cycle phases. In addition, the specificity of c-Myb is dramatically different in small subpopulations of cells, for example cells in the G2/M phase of the cell cycle, than in the bulk population. The repositioning of c-Myb during the cell cycle is not due to changes in its expression and also occurs with ectopically expressed, epitope-tagged versions of c-Myb. The repositioning occurs in established cell lines, in primary human CD34+ hematopoietic progenitors and in primary human acute myeloid leukemia cells. The combination of fixation, sorting and ChIP analysis sheds new light on the dynamic nature of gene regulation during the cell cycle and provides a new type of tool for the analysis of gene regulation in small subsets of cells, such as cells in a specific phase of the cell cycle.
Comparing genome-wide chromatin profiles using ChIP-chip or ChIP-seq
Johannes, Frank; Wardenaar, Rene; Colomé Tatché, Maria; Mousson, Florence; de Graaf, Petra; Mokry, Michal; Guryev, Victor; Timmers, H. Th. Marc; Cuppen, Edwin; Jansen, Ritsert C.; Bateman, Alex
2010-01-01
Motivation: ChIP-chip and ChIP-seq technologies provide genomewide measurements of various types of chromatin marks at an unprecedented resolution. With ChIP samples collected from different tissue types and/ or individuals, we can now begin to characterize stochastic or systematic changes in
Comparing genome-wide chromatin profiles using ChIP-chip or ChIP-seq
Johannes, F.; Wardenaar, R.; Colome-Tatche, M.; Mousson, F.; de Graaf, P.; Mokry, M.; Guryev, V.; Timmers, H.T.; Cuppen, E.; Jansen, R.
2010-01-01
MOTIVATION: ChIP-chip and ChIP-seq technologies provide genome-wide measurements of various types of chromatin marks at an unprecedented resolution. With ChIP samples collected from different tissue types and/or individuals, we can now begin to characterize stochastic or systematic changes in
Directory of Open Access Journals (Sweden)
Nakano Toshitsugu
2011-01-01
Full Text Available Abstract Background During ripening, climacteric fruits increase their ethylene level and subsequently undergo various physiological changes, such as softening, pigmentation and development of aroma and flavor. These changes occur simultaneously and are caused by the highly synchronized expression of numerous genes at the onset of ripening. In tomatoes, the MADS-box transcription factor RIN has been regarded as a key regulator responsible for the onset of ripening by acting upstream of both ethylene- and non-ethylene-mediated controls. However, except for LeACS2, direct targets of RIN have not been clarified, and little is known about the transcriptional cascade for ripening. Results Using immunoprecipitated (IPed DNA fragments recovered by chromatin immunoprecipitation (ChIP with anti-RIN antibody from ripening tomato fruit, we analyzed potential binding sites for RIN (CArG-box sites in the promoters of representative ripening-induced genes by quantitative PCR. Results revealed nearly a 5- to 20-fold enrichment of CArG boxes in the promoters of LeACS2, LeACS4, PG, TBG4, LeEXP1, and LeMAN4 and of RIN itself, indicating direct interaction of RIN with their promoters in vivo. Moreover, sequence analysis and genome mapping of 51 cloned IPed DNAs revealed potential RIN binding sites. Quantitative PCR revealed that four of the potential binding sites were enriched 4- to 17-fold in the IPed DNA pools compared with the controls, indicating direct interaction of RIN with these sites in vivo. Near one of the four CArG boxes we found a gene encoding a protein similar to thioredoxin y1. An increase in the transcript level of this gene was observed with ripening in normal fruit but not in the rin mutant, suggesting that RIN possibly induces its expression. Conclusions The presented results suggest that RIN controls fruit softening and ethylene production by the direct transcriptional regulation of cell-wall-modifying genes and ethylene biosynthesis genes
Chabbert, Christophe D; Adjalley, Sophie H; Steinmetz, Lars M; Pelechano, Vicent
2018-01-01
Chromatin immunoprecipitation followed by sequencing (ChIP-Seq) or microarray hybridization (ChIP-on-chip) are standard methods for the study of transcription factor binding sites and histone chemical modifications. However, these approaches only allow profiling of a single factor or protein modification at a time.In this chapter, we present Bar-ChIP, a higher throughput version of ChIP-Seq that relies on the direct ligation of molecular barcodes to chromatin fragments. Bar-ChIP enables the concurrent profiling of multiple DNA-protein interactions and is therefore amenable to experimental scale-up, without the need for any robotic instrumentation.
Modern techniques for the analysis of chromatin and nuclear organization in C. elegans.
Askjaer, Peter; Ercan, Sevinç; Meister, Peter
2014-04-02
In recent years, Caenorhabditis elegans has emerged as a new model to investigate the relationships between nuclear architecture, cellular differentiation, and organismal development. On one hand, C. elegans with its fixed lineage and transparent body is a great model organism to observe gene functions in vivo in specific cell types using microscopy. On the other hand, two different techniques have been applied in nematodes to identify binding sites for chromatin-associated proteins genome-wide: chromatin immunoprecipitation (ChIP), and Dam-mediated identification (DamID). We summarize here all three techniques together as they are complementary. We also highlight strengths and differences of the individual approaches.
DEFF Research Database (Denmark)
Kooistra, Susanne M; van den Boom, Vincent; Thummer, Rajkumar P
2010-01-01
Previous reports showed that embryonic stem (ES) cells contain hyperdynamic and globally transcribed chromatin-properties that are important for ES cell pluripotency and differentiation. Here, we demonstrate a role for undifferentiated embryonic cell transcription factor 1 (UTF1) in regulating ES...... cell chromatin structure. Using chromatin immunoprecipitation-on-chip analysis, we identified >1,700 UTF1 target genes that significantly overlap with previously identified Nanog, Oct4, Klf-4, c-Myc, and Rex1 targets. Gene expression profiling showed that UTF1 knock down results in increased expression...... of a large set of genes, including a significant number of UTF1 targets. UTF1 knock down (KD) ES cells are, irrespective of the increased expression of several self-renewal genes, Leukemia inhibitory factor (LIF) dependent. However, UTF1 KD ES cells are perturbed in their differentiation in response...
Optimal use of tandem biotin and V5 tags in ChIP assays
Directory of Open Access Journals (Sweden)
Krpic Sanja
2009-02-01
Full Text Available Abstract Background Chromatin immunoprecipitation (ChIP assays coupled to genome arrays (Chip-on-chip or massive parallel sequencing (ChIP-seq lead to the genome wide identification of binding sites of chromatin associated proteins. However, the highly variable quality of antibodies and the availability of epitopes in crosslinked chromatin can compromise genomic ChIP outcomes. Epitope tags have often been used as more reliable alternatives. In addition, we have employed protein in vivo biotinylation tagging as a very high affinity alternative to antibodies. In this paper we describe the optimization of biotinylation tagging for ChIP and its coupling to a known epitope tag in providing a reliable and efficient alternative to antibodies. Results Using the biotin tagged erythroid transcription factor GATA-1 as example, we describe several optimization steps for the application of the high affinity biotin streptavidin system in ChIP. We find that the omission of SDS during sonication, the use of fish skin gelatin as blocking agent and choice of streptavidin beads can lead to significantly improved ChIP enrichments and lower background compared to antibodies. We also show that the V5 epitope tag performs equally well under the conditions worked out for streptavidin ChIP and that it may suffer less from the effects of formaldehyde crosslinking. Conclusion The combined use of the very high affinity biotin tag with the less sensitive to crosslinking V5 tag provides for a flexible ChIP platform with potential implications in ChIP sequencing outcomes.
Optimal use of tandem biotin and V5 tags in ChIP assays
Kolodziej, Katarzyna E; Pourfarzad, Farzin; de Boer, Ernie; Krpic, Sanja; Grosveld, Frank; Strouboulis, John
2009-01-01
Background Chromatin immunoprecipitation (ChIP) assays coupled to genome arrays (Chip-on-chip) or massive parallel sequencing (ChIP-seq) lead to the genome wide identification of binding sites of chromatin associated proteins. However, the highly variable quality of antibodies and the availability of epitopes in crosslinked chromatin can compromise genomic ChIP outcomes. Epitope tags have often been used as more reliable alternatives. In addition, we have employed protein in vivo biotinylation tagging as a very high affinity alternative to antibodies. In this paper we describe the optimization of biotinylation tagging for ChIP and its coupling to a known epitope tag in providing a reliable and efficient alternative to antibodies. Results Using the biotin tagged erythroid transcription factor GATA-1 as example, we describe several optimization steps for the application of the high affinity biotin streptavidin system in ChIP. We find that the omission of SDS during sonication, the use of fish skin gelatin as blocking agent and choice of streptavidin beads can lead to significantly improved ChIP enrichments and lower background compared to antibodies. We also show that the V5 epitope tag performs equally well under the conditions worked out for streptavidin ChIP and that it may suffer less from the effects of formaldehyde crosslinking. Conclusion The combined use of the very high affinity biotin tag with the less sensitive to crosslinking V5 tag provides for a flexible ChIP platform with potential implications in ChIP sequencing outcomes. PMID:19196479
Schoppee Bortz, Pamela D.; Wamhoff, Brian R.
2011-01-01
The “quantitative” ChIP, a tool commonly used to study protein-DNA interactions in cells and tissue, is a difficult assay often plagued with technical error. We present, herein, the process required to merge multiple protocols into a quick, reliable and easy method and an approach to accurately quantify ChIP DNA prior to performing PCR. We demonstrate that high intensity sonication for at least 30 min is required for full cellular disruption and maximum DNA recovery because ChIP lysis buffers fail to lyse formaldehyde-fixed cells. In addition, extracting ChIP DNA with chelex-100 yields samples that are too dilute for evaluation of shearing efficiency or quantification via nanospectrophotometry. However, DNA extracted from the Mock-ChIP supernatant via the phenol-chloroform-isoamyl alcohol (PCIA) method can be used to evaluate DNA shearing efficiency and used as the standard in a fluorescence-based microplate assay. This enabled accurate quantification of DNA in chelex-extracted ChIP samples and normalization to total DNA concentration prior to performing real-time PCR (rtPCR). Thus, a quick ChIP assay that can be completed in nine bench hours over two days has been validated along with a rapid, accurate and repeatable way to quantify ChIP DNA. The resulting rtPCR data more accurately depicts treatment effects on protein-DNA interactions of interest. PMID:22046253
A Bayesian deconvolution strategy for immunoprecipitation-based DNA methylome analysis
Down, Thomas A.; Rakyan, Vardhman K.; Turner, Daniel J.; Flicek, Paul; Li, Heng; Kulesha, Eugene; Gräf, Stefan; Johnson, Nathan; Herrero, Javier; Tomazou, Eleni M.; Thorne, Natalie P.; Bäckdahl, Liselotte; Herberth, Marlis; Howe, Kevin L.; Jackson, David K.; Miretti, Marcos M.; Marioni, John C.; Birney, Ewan; Hubbard, Tim J. P.; Durbin, Richard; Tavaré, Simon; Beck, Stephan
2009-01-01
DNA methylation is an indispensible epigenetic modification of mammalian genomes. Consequently there is great interest in strategies for genome-wide/whole-genome DNA methylation analysis, and immunoprecipitation-based methods have proven to be a powerful option. Such methods are rapidly shifting the bottleneck from data generation to data analysis, necessitating the development of better analytical tools. Until now, a major analytical difficulty associated with immunoprecipitation-based DNA methylation profiling has been the inability to estimate absolute methylation levels. Here we report the development of a novel cross-platform algorithm – Bayesian Tool for Methylation Analysis (Batman) – for analyzing Methylated DNA Immunoprecipitation (MeDIP) profiles generated using arrays (MeDIP-chip) or next-generation sequencing (MeDIP-seq). The latter is an approach we have developed to elucidate the first high-resolution whole-genome DNA methylation profile (DNA methylome) of any mammalian genome. MeDIP-seq/MeDIP-chip combined with Batman represent robust, quantitative, and cost-effective functional genomic strategies for elucidating the function of DNA methylation. PMID:18612301
Salomon-Kent, Ronit; Marom, Ronit; John, Sam; Dundr, Miroslav; Schiltz, Louis R; Gutierrez, Jose; Workman, Jerry; Benayahu, Dafna; Hager, Gordon L
2015-09-01
Mesenchymal stem cells' differentiation into several lineages is coordinated by a complex of transcription factors and co-regulators which bind to specific gene promoters. The Chromatin-Related Mesenchymal Modulator, CHD9 demonstrated in vitro its ability for remodeling activity to reposition nucleosomes in an ATP-dependent manner. Epigenetically, CHD9 binds with modified H3-(K9me2/3 and K27me3). Previously, we presented a role for CHD9 with RNA Polymerase II (Pol II)-dependent transcription of tissue specific genes. Far less is known about CHD9 function in RNA Polymerase I (Pol I) related transcription of the ribosomal locus that also drives specific cell fate. We here describe a new form, the nucleolar CHD9 (n-CHD9) that is dynamically associated with Pol I, fibrillarin, and upstream binding factor (UBF) in the nucleoli, as shown by imaging and molecular approaches. Inhibitors of transcription disorganized the nucleolar compartment of transcription sites where rDNA is actively transcribed. Collectively, these findings link n-CHD9 with RNA pol I transcription in fibrillar centers. Using chromatin immunoprecipitation (ChIP) and tilling arrays (ChIP- chip), we find an association of n-CHD9 with Pol I related to rRNA biogenesis. Our new findings support the role for CHD9 in chromatin regulation and association with rDNA genes, in addition to its already known function in transcription control of tissue specific genes. © 2015 Wiley Periodicals, Inc.
Wei, Yingying; Wu, George; Ji, Hongkai
2013-05-01
Mapping genome-wide binding sites of all transcription factors (TFs) in all biological contexts is a critical step toward understanding gene regulation. The state-of-the-art technologies for mapping transcription factor binding sites (TFBSs) couple chromatin immunoprecipitation (ChIP) with high-throughput sequencing (ChIP-seq) or tiling array hybridization (ChIP-chip). These technologies have limitations: they are low-throughput with respect to surveying many TFs. Recent advances in genome-wide chromatin profiling, including development of technologies such as DNase-seq, FAIRE-seq and ChIP-seq for histone modifications, make it possible to predict in vivo TFBSs by analyzing chromatin features at computationally determined DNA motif sites. This promising new approach may allow researchers to monitor the genome-wide binding sites of many TFs simultaneously. In this article, we discuss various experimental design and data analysis issues that arise when applying this approach. Through a systematic analysis of the data from the Encyclopedia Of DNA Elements (ENCODE) project, we compare the predictive power of individual and combinations of chromatin marks using supervised and unsupervised learning methods, and evaluate the value of integrating information from public ChIP and gene expression data. We also highlight the challenges and opportunities for developing novel analytical methods, such as resolving the one-motif-multiple-TF ambiguity and distinguishing functional and non-functional TF binding targets from the predicted binding sites. The online version of this article (doi:10.1007/s12561-012-9066-5) contains supplementary material, which is available to authorized users.
Directory of Open Access Journals (Sweden)
Xin Li
2008-06-01
Full Text Available Abstract Background Target genes of a transcription factor (TF Pou5f1 (Oct3/4 or Oct4, which is essential for pluripotency maintenance and self-renewal of embryonic stem (ES cells, have previously been identified based on their response to Pou5f1 manipulation and occurrence of Chromatin-immunoprecipitation (ChIP-binding sites in promoters. However, many responding genes with binding sites may not be direct targets because response may be mediated by other genes and ChIP-binding site may not be functional in terms of transcription regulation. Results To reduce the number of false positives, we propose to separate responding genes into groups according to direction, magnitude, and time of response, and to apply the false discovery rate (FDR criterion to each group individually. Using this novel algorithm with stringent statistical criteria (FDR Pou5f1 suppression and published ChIP data, we identified 420 tentative target genes (TTGs for Pou5f1. The majority of TTGs (372 were down-regulated after Pou5f1 suppression, indicating that the Pou5f1 functions as an activator of gene expression when it binds to promoters. Interestingly, many activated genes are potent suppressors of transcription, which include polycomb genes, zinc finger TFs, chromatin remodeling factors, and suppressors of signaling. Similar analysis showed that Sox2 and Nanog also function mostly as transcription activators in cooperation with Pou5f1. Conclusion We have identified the most reliable sets of direct target genes for key pluripotency genes – Pou5f1, Sox2, and Nanog, and found that they predominantly function as activators of downstream gene expression. Thus, most genes related to cell differentiation are suppressed indirectly.
DIVERSITY in binding, regulation, and evolution revealed from high-throughput ChIP.
Mitra, Sneha; Biswas, Anushua; Narlikar, Leelavati
2018-04-23
Genome-wide in vivo protein-DNA interactions are routinely mapped using high-throughput chromatin immunoprecipitation (ChIP). ChIP-reported regions are typically investigated for enriched sequence-motifs, which are likely to model the DNA-binding specificity of the profiled protein and/or of co-occurring proteins. However, simple enrichment analyses can miss insights into the binding-activity of the protein. Note that ChIP reports regions making direct contact with the protein as well as those binding through intermediaries. For example, consider a ChIP experiment targeting protein X, which binds DNA at its cognate sites, but simultaneously interacts with four other proteins. Each of these proteins also binds to its own specific cognate sites along distant parts of the genome, a scenario consistent with the current view of transcriptional hubs and chromatin loops. Since ChIP will pull down all X-associated regions, the final reported data will be a union of five distinct sets of regions, each containing binding sites of one of the five proteins, respectively. Characterizing all five different motifs and the corresponding sets is important to interpret the ChIP experiment and ultimately, the role of X in regulation. We present diversity which attempts exactly this: it partitions the data so that each partition can be characterized with its own de novo motif. Diversity uses a Bayesian approach to identify the optimal number of motifs and the associated partitions, which together explain the entire dataset. This is in contrast to standard motif finders, which report motifs individually enriched in the data, but do not necessarily explain all reported regions. We show that the different motifs and associated regions identified by diversity give insights into the various complexes that may be forming along the chromatin, something that has so far not been attempted from ChIP data. Webserver at http://diversity.ncl.res.in/; standalone (Mac OS X/Linux) from https
Benard, Anne; Janssen, Connie M; van den Elsen, Peter J; van Eggermond, Marja C J A; Hoon, Dave S B; van de Velde, Cornelis J H; Kuppen, Peter J K
2014-12-01
The apoptosis pathway of programmed cell death is frequently deregulated in cancer. An intact apoptosis pathway is required for proper response to anti-cancer treatment. We investigated the chromatin status of key apoptosis genes in the apoptosis pathway in colorectal cancer cell lines in relation to apoptosis induced by chemo-, immune- or radiation therapy. Using chromatin immunoprecipitation (ChIP), we measured the presence of transcription-activating histone modifications H3Ac and H3K4me3 and silencing modifications H3K9me3 and H3K27me3 at the gene promoter regions of key apoptosis genes Bax, Bcl2, Caspase-9, Fas (CD95) and p53. Cell lines DLD1, SW620, Colo320, Caco2, Lovo and HT29 were treated with cisplatin, anti-Fas or radiation. The apoptotic response was measured by flow cytometry using propidium iodide and annexin V-FITC. The chromatin status of the apoptosis genes reflected the activation status of the intrinsic (Bax, Bcl2, Caspase-9 and p53) and extrinsic (Fas) pathways. An active intrinsic apoptotic pathway corresponded to sensitivity to cisplatin and radiation treatment of cell lines DLD1, SW620 and Colo320. An active Fas promoter corresponded to an active extrinsic apoptotic pathway in cell line DLD1. mRNA expression data correlated with the chromatin status of the apoptosis genes as measured by ChIP. In conclusion, the results presented in this study indicate that the balance between activating and silencing histone modifications, reflecting the chromatin status of apoptosis genes, can be used to predict the response of tumor cells to different anti-cancer therapies and could provide a novel target to sensitize tumors to obtain adequate treatment responses.
Characterization of Chromatin Structure-associated Histone Modifications in Breast Cancer Cells
Directory of Open Access Journals (Sweden)
Chang Pyo Hong
2012-09-01
Full Text Available Chromatin structure and dynamics that are influenced by epigenetic marks, such as histone modification and DNA methylation, play a crucial role in modulating gene transcription. To understand the relationship between histone modifications and regulatory elements in breast cancer cells, we compared our chromatin immunoprecipitation sequencing (ChIP-Seq histone modification patterns for histone H3K4me1, H3K4me3, H3K9/16ac, and H3K27me3 in MCF-7 cells with publicly available formaldehyde-assisted isolation of regulatory elements (FAIRE-chip signals in human chromosomes 8, 11, and 12, identified by a method called FAIRE. Active regulatory elements defined by FAIRE were highly associated with active histone modifications, like H3K4me3 and H3K9/16ac, especially near transcription start sites. The H3K9/16ac-enriched genes that overlapped with FAIRE signals (FAIRE-H3K9/14ac were moderately correlated with gene expression levels. We also identified functional sequence motifs at H3K4me1-enriched FAIRE sites upstream of putative promoters, suggesting that regulatory elements could be associated with H3K4me1 to be regarded as distal regulatory elements. Our results might provide an insight into epigenetic regulatory mechanisms explaining the association of histone modifications with open chromatin structure in breast cancer cells.
Scaffold Attachment Factor B1: A Novel Chromatin Regulator of Prostate Cancer Metabolism
2016-10-01
AWARD NUMBER: W81XWH-14-1-0152 TITLE: Scaffold Attachment Factor B1: A Novel Chromatin Regulator of Prostate Cancer Metabolism PRINCIPAL...TITLE AND SUBTITLE 5a. CONTRACT NUMBER W81XWH-14-1-0152 Scaffold Attachment Factor B1: A Novel Chromatin Regulator of Prostate Cancer Metabolism... chromatin immunoprecipitation-next generation DNA sequencing (ChIP-seq) and integrative network modeling to identify the SAFB1 cistrome and the extent of
Benferhat, Rima; Josse, Thibaut; Albaud, Benoit; Gentien, David; Mansuroglu, Zeyni; Marcato, Vasco; Souès, Sylvie; Le Bonniec, Bernard; Bouloy, Michèle; Bonnefoy, Eliette
2012-10-01
Rift Valley fever virus (RVFV) is a highly pathogenic Phlebovirus that infects humans and ruminants. Initially confined to Africa, RVFV has spread outside Africa and presently represents a high risk to other geographic regions. It is responsible for high fatality rates in sheep and cattle. In humans, RVFV can induce hepatitis, encephalitis, retinitis, or fatal hemorrhagic fever. The nonstructural NSs protein that is the major virulence factor is found in the nuclei of infected cells where it associates with cellular transcription factors and cofactors. In previous work, we have shown that NSs interacts with the promoter region of the beta interferon gene abnormally maintaining the promoter in a repressed state. In this work, we performed a genome-wide analysis of the interactions between NSs and the host genome using a genome-wide chromatin immunoprecipitation combined with promoter sequence microarray, the ChIP-on-chip technique. Several cellular promoter regions were identified as significantly interacting with NSs, and the establishment of NSs interactions with these regions was often found linked to deregulation of expression of the corresponding genes. Among annotated NSs-interacting genes were present not only genes regulating innate immunity and inflammation but also genes regulating cellular pathways that have not yet been identified as targeted by RVFV. Several of these pathways, such as cell adhesion, axonal guidance, development, and coagulation were closely related to RVFV-induced disorders. In particular, we show in this work that NSs targeted and modified the expression of genes coding for coagulation factors, demonstrating for the first time that this hemorrhagic virus impairs the host coagulation cascade at the transcriptional level.
Bayesian Modeling of ChIP-chip Data Through a High-Order Ising Model
Mo, Qianxing
2010-01-29
ChIP-chip experiments are procedures that combine chromatin immunoprecipitation (ChIP) and DNA microarray (chip) technology to study a variety of biological problems, including protein-DNA interaction, histone modification, and DNA methylation. The most important feature of ChIP-chip data is that the intensity measurements of probes are spatially correlated because the DNA fragments are hybridized to neighboring probes in the experiments. We propose a simple, but powerful Bayesian hierarchical approach to ChIP-chip data through an Ising model with high-order interactions. The proposed method naturally takes into account the intrinsic spatial structure of the data and can be used to analyze data from multiple platforms with different genomic resolutions. The model parameters are estimated using the Gibbs sampler. The proposed method is illustrated using two publicly available data sets from Affymetrix and Agilent platforms, and compared with three alternative Bayesian methods, namely, Bayesian hierarchical model, hierarchical gamma mixture model, and Tilemap hidden Markov model. The numerical results indicate that the proposed method performs as well as the other three methods for the data from Affymetrix tiling arrays, but significantly outperforms the other three methods for the data from Agilent promoter arrays. In addition, we find that the proposed method has better operating characteristics in terms of sensitivities and false discovery rates under various scenarios. © 2010, The International Biometric Society.
A hidden Ising model for ChIP-chip data analysis
Mo, Q.
2010-01-28
Motivation: Chromatin immunoprecipitation (ChIP) coupled with tiling microarray (chip) experiments have been used in a wide range of biological studies such as identification of transcription factor binding sites and investigation of DNA methylation and histone modification. Hidden Markov models are widely used to model the spatial dependency of ChIP-chip data. However, parameter estimation for these models is typically either heuristic or suboptimal, leading to inconsistencies in their applications. To overcome this limitation and to develop an efficient software, we propose a hidden ferromagnetic Ising model for ChIP-chip data analysis. Results: We have developed a simple, but powerful Bayesian hierarchical model for ChIP-chip data via a hidden Ising model. Metropolis within Gibbs sampling algorithm is used to simulate from the posterior distribution of the model parameters. The proposed model naturally incorporates the spatial dependency of the data, and can be used to analyze data with various genomic resolutions and sample sizes. We illustrate the method using three publicly available datasets and various simulated datasets, and compare it with three closely related methods, namely TileMap HMM, tileHMM and BAC. We find that our method performs as well as TileMap HMM and BAC for the high-resolution data from Affymetrix platform, but significantly outperforms the other three methods for the low-resolution data from Agilent platform. Compared with the BAC method which also involves MCMC simulations, our method is computationally much more efficient. Availability: A software called iChip is freely available at http://www.bioconductor.org/. Contact: moq@mskcc.org. © The Author 2010. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oxfordjournals.org.
In Vivo Chromatin Targets of the Transcription Factor Yin Yang 2 in Trophoblast Stem Cells
Pérez-Palacios, Raquel; Macías-Redondo, Sofía; Climent, María; Contreras-Moreira, Bruno; Muniesa, Pedro; Schoorlemmer, Jon
2016-01-01
Background Yin Yang 2 (YY2) is a zinc finger protein closely related to the well-characterized Yin Yang 1 (YY1). YY1 is a DNA-binding transcription factor, with defined functions in multiple developmental processes, such as implantation, cell differentiation, X inactivation, imprinting and organogenesis. Yy2 has been treated as a largely immaterial duplication of Yy1, as they share high homology in the Zinc Finger-region and similar if not identical in vitro binding sites. In contrast to these similarities, gene expression alterations in HeLa cells with attenuated levels of either Yy1 or Yy2 were to some extent gene-specific. Moreover, the chromatin binding sites for YY2, except for its association with transposable retroviral elements (RE) and Endogenous Retroviral Elements (ERVs), remain to be identified. As a first step towards defining potential Yy2 functions matching or complementary to Yy1, we considered in vivo DNA binding sites of YY2 in trophoblast stem (TS) cells. Results We report the presence of YY2 protein in mouse-derived embryonic stem (ES) and TS cell lines. Following up on our previous report on ERV binding by YY2 in TS cells, we investigated the tissue-specificity of REX1 and YY2 binding and confirm binding to RE/ERV targets in both ES cells and TS cells. Because of the higher levels of expression, we chose TS cells to understand the role of Yy2 in gene and chromatin regulation. We used in vivo YY2 association as a measure to identify potential target genes. Sequencing of chromatin obtained in chromatin-immunoprecipitation (ChIP) assays carried out with αYY2 serum allowed us to identify a limited number of chromatin targets for YY2. Some putative binding sites were validated in regular ChIP assays and gene expression of genes nearby was altered in the absence of Yy2. Conclusions YY2 binding to ERVs is not confined to TS cells. In vivo binding sites share the presence of a consensus binding motif. Selected sites were uniquely bound by YY2 as
FACT facilitates chromatin transcription by RNA polymerases I and III
DEFF Research Database (Denmark)
Birch, Joanna L; Tan, Bertrand C-M; Panov, Kostya I
2009-01-01
Efficient transcription elongation from a chromatin template requires RNA polymerases (Pols) to negotiate nucleosomes. Our biochemical analyses demonstrate that RNA Pol I can transcribe through nucleosome templates and that this requires structural rearrangement of the nucleosomal core particle....... The subunits of the histone chaperone FACT (facilitates chromatin transcription), SSRP1 and Spt16, co-purify and co-immunoprecipitate with mammalian Pol I complexes. In cells, SSRP1 is detectable at the rRNA gene repeats. Crucially, siRNA-mediated repression of FACT subunit expression in cells results...... in a significant reduction in 47S pre-rRNA levels, whereas synthesis of the first 40 nt of the rRNA is not affected, implying that FACT is important for Pol I transcription elongation through chromatin. FACT also associates with RNA Pol III complexes, is present at the chromatin of genes transcribed by Pol III...
SignalSpider: Probabilistic pattern discovery on multiple normalized ChIP-Seq signal profiles
Wong, Kachun; Li, Yue; Peng, Chengbin; Zhang, Zhaolei
2014-01-01
Motivation: Chromatin immunoprecipitation (ChIP) followed by high-throughput sequencing (ChIP-Seq) measures the genome-wide occupancy of transcription factors in vivo. Different combinations of DNA-binding protein occupancies may result in a gene
Experiment list: SRX112178 [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available line=OS25 ES cells || chip antibody=8WG16 (MMS-126R, Covance) || chip antibody manufacturer=Covance || chromatin=Fixed || beads...=Magnetic beads http://dbarchive.biosciencedbc.jp/kyushu-u/mm
Experiment list: SRX112184 [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available line=OS25 ES cells || chip antibody=CTD4H8 (MMS-128P, Covance) || chip antibody manufacturer=Covance || chromatin=Fixed || beads...=Sepharose beads http://dbarchive.biosciencedbc.jp/kyushu-u/m
Experiment list: SRX112179 [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available =OS25 ES cells || chip antibody=H5 (MMS-129R, Covance) || chip antibody manufacturer=Covance || chromatin=Fixed || beads=Magnetic bea...ds http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/eachDa
Experiment list: SRX112176 [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available e=OS25 ES cells || chip antibody=CTD4H8 (MMS-128P, Covance) || chip antibody manufacturer=Covance || chromatin=Fixed || beads...=Magnetic beads http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/e
International Nuclear Information System (INIS)
Wang Liu; Zheng Aihua; Yi Ling; Xu Chongren; Ding Mingxiao; Deng Hongkui
2004-01-01
Nuclear reprogramming is critical for animal cloning and stem cell creation through nuclear transfer, which requires extensive remodeling of chromosomal architecture involving dramatic changes in chromatin-binding proteins. To understand the mechanism of nuclear reprogramming, it is critical to identify chromatin-binding factors specify the reprogramming process. In this report, we have developed a high-throughput selection method, based on T7 phage display and chromatin immunoprecipitation, to isolate chromatin-binding factors expressed in mouse embryonic stem cells using primary mouse embryonic fibroblast chromatin. Seven chromatin-binding proteins have been isolated by this method. We have also isolated several chromatin-binding proteins involved in hepatocyte differentiation. Our method provides a powerful tool to rapidly and selectively identify chromatin-binding proteins. The method can be used to study epigenetic modification of chromatin during nuclear reprogramming, cell differentiation, and transdifferentiation
Normalization and experimental design for ChIP-chip data
Directory of Open Access Journals (Sweden)
Alekseyenko Artyom A
2007-06-01
Full Text Available Abstract Background Chromatin immunoprecipitation on tiling arrays (ChIP-chip has been widely used to investigate the DNA binding sites for a variety of proteins on a genome-wide scale. However, several issues in the processing and analysis of ChIP-chip data have not been resolved fully, including the effect of background (mock control subtraction and normalization within and across arrays. Results The binding profiles of Drosophila male-specific lethal (MSL complex on a tiling array provide a unique opportunity for investigating these topics, as it is known to bind on the X chromosome but not on the autosomes. These large bound and control regions on the same array allow clear evaluation of analytical methods. We introduce a novel normalization scheme specifically designed for ChIP-chip data from dual-channel arrays and demonstrate that this step is critical for correcting systematic dye-bias that may exist in the data. Subtraction of the mock (non-specific antibody or no antibody control data is generally needed to eliminate the bias, but appropriate normalization obviates the need for mock experiments and increases the correlation among replicates. The idea underlying the normalization can be used subsequently to estimate the background noise level in each array for normalization across arrays. We demonstrate the effectiveness of the methods with the MSL complex binding data and other publicly available data. Conclusion Proper normalization is essential for ChIP-chip experiments. The proposed normalization technique can correct systematic errors and compensate for the lack of mock control data, thus reducing the experimental cost and producing more accurate results.
Chereji, Razvan V; Bharatula, Vasudha; Elfving, Nils; Blomberg, Jeanette; Larsson, Miriam; Morozov, Alexandre V; Broach, James R; Björklund, Stefan
2017-09-06
Mediator is a multi-unit molecular complex that plays a key role in transferring signals from transcriptional regulators to RNA polymerase II in eukaryotes. We have combined biochemical purification of the Saccharomyces cerevisiae Mediator from chromatin with chromatin immunoprecipitation in order to reveal Mediator occupancy on DNA genome-wide, and to identify proteins interacting specifically with Mediator on the chromatin template. Tandem mass spectrometry of proteins in immunoprecipitates of mediator complexes revealed specific interactions between Mediator and the RSC, Arp2/Arp3, CPF, CF 1A and Lsm complexes in chromatin. These factors are primarily involved in chromatin remodeling, actin assembly, mRNA 3'-end processing, gene looping and mRNA decay, but they have also been shown to enter the nucleus and participate in Pol II transcription. Moreover, we have found that Mediator, in addition to binding Pol II promoters, occupies chromosomal interacting domain (CID) boundaries and that Mediator in chromatin associates with proteins that have been shown to interact with CID boundaries, such as Sth1, Ssu72 and histone H4. This suggests that Mediator plays a significant role in higher-order genome organization. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Miao, Feng; Smith, David D.; Zhang, Lingxiao; Min, Andrew; Feng, Wei; Natarajan, Rama
2008-01-01
OBJECTIVE—The complexity of interactions between genes and the environment is a major challenge for type 1 diabetes studies. Nuclear chromatin is the interface between genetics and environment and the principal carrier of epigenetic information. Because histone tail modifications in chromatin are linked to gene transcription, we hypothesized that histone methylation patterns in cells from type 1 diabetic patients can provide novel epigenetic insights into type 1 diabetes and its complications. RESEARCH DESIGN AND METHODS—We used chromatin immunoprecipitation (ChIP) linked to microarray (ChIP-chip) approach to compare genome-wide histone H3 lysine 9 dimethylation (H3K9me2) patterns in blood lymphocytes and monocytes from type 1 diabetic patients versus healthy control subjects. Bioinformatics evaluation of methylated candidates was performed by Ingenuity Pathway Analysis (IPA) tools. RESULTS—A subset of genes in the type 1 diabetic cohort showed significant increase in H3K9me2 in lymphocytes but not in monocytes. CLTA4, a type 1 diabetes susceptibility gene, was one of the candidates displaying increased promoter H3K9me2 in type 1 diabetes. IPA identified two high-scoring networks that encompassed genes showing altered H3K9me2. Many of them were associated with autoimmune and inflammation-related pathways, such as transforming growth factor-β, nuclear factor-κB, p38 mitogen-activated protein kinase, toll-like receptor, and interleukin-6. IPA also revealed biological relationships between these networks and known type 1 diabetes candidate genes. CONCLUSIONS—The concerted and synergistic alteration of histone methylation within the identified network in lymphocytes might have an effect on the etiology of type 1 diabetes and its complications. These studies provide evidence of a novel association between type 1 diabetes and altered histone methylation of key genes that are components of type 1 diabetes–related biological pathways and also a new
Directory of Open Access Journals (Sweden)
Nicole C Riddle
2012-09-01
Full Text Available Chromatin environments differ greatly within a eukaryotic genome, depending on expression state, chromosomal location, and nuclear position. In genomic regions characterized by high repeat content and high gene density, chromatin structure must silence transposable elements but permit expression of embedded genes. We have investigated one such region, chromosome 4 of Drosophila melanogaster. Using chromatin-immunoprecipitation followed by microarray (ChIP-chip analysis, we examined enrichment patterns of 20 histone modifications and 25 chromosomal proteins in S2 and BG3 cells, as well as the changes in several marks resulting from mutations in key proteins. Active genes on chromosome 4 are distinct from those in euchromatin or pericentric heterochromatin: while there is a depletion of silencing marks at the transcription start sites (TSSs, HP1a and H3K9me3, but not H3K9me2, are enriched strongly over gene bodies. Intriguingly, genes on chromosome 4 are less frequently associated with paused polymerase. However, when the chromatin is altered by depleting HP1a or POF, the RNA pol II enrichment patterns of many chromosome 4 genes shift, showing a significant decrease over gene bodies but not at TSSs, accompanied by lower expression of those genes. Chromosome 4 genes have a low incidence of TRL/GAGA factor binding sites and a low T(m downstream of the TSS, characteristics that could contribute to a low incidence of RNA polymerase pausing. Our data also indicate that EGG and POF jointly regulate H3K9 methylation and promote HP1a binding over gene bodies, while HP1a targeting and H3K9 methylation are maintained at the repeats by an independent mechanism. The HP1a-enriched, POF-associated chromatin structure over the gene bodies may represent one type of adaptation for genes embedded in repetitive DNA.
Utilizing next-generation sequencing technology, combined with ChIP (Chromatin Immunoprecipitation) technology, we analyzed histone modification (acetylation) induced by butyrate and the large-scale mapping of the epigenomic landscape of normal histone H3 and acetylated histone H3K9 and H3K27. To d...
Mason, Christopher E.; Shu, Feng-Jue; Wang, Cheng; Session, Ryan M.; Kallen, Roland G.; Sidell, Neil; Yu, Tianwei; Liu, Mei Hui; Cheung, Edwin; Kallen, Caleb B.
2010-01-01
Location analysis for estrogen receptor-? (ER?)-bound cis-regulatory elements was determined in MCF7 cells using chromatin immunoprecipitation (ChIP)-on-chip. Here, we present the estrogen response element (ERE) sequences that were identified at ER?-bound loci and quantify the incidence of ERE sequences under two stringencies of detection:
Transcriptional regulatory networks downstream of TAL1/SCL in T-cell acute lymphoblastic leukemia
Palomero, Teresa; Odom, Duncan T.; O'Neil, Jennifer; Ferrando, Adolfo A.; Margolin, Adam; Neuberg, Donna S.; Winter, Stuart S.; Larson, Richard S.; Li, Wei; Liu, X. Shirley; Young, Richard A.; Look, A. Thomas
2006-01-01
Aberrant expression of 1 or more transcription factor oncogenes is a critical component of the molecular pathogenesis of human T-cell acute lymphoblastic leukemia (T-ALL); however, oncogenic transcriptional programs downstream of T-ALL oncogenes are mostly unknown. TAL1/SCL is a basic helix-loop-helix (bHLH) transcription factor oncogene aberrantly expressed in 60% of human T-ALLs. We used chromatin immunoprecipitation (ChIP) on chip to identify 71 direct transcriptional targets of TAL1/SCL. ...
STAT5 induces miR-21 expression in cutaneous T cell lymphoma
DEFF Research Database (Denmark)
Lindahl, Lise M; Fredholm, Simon; Joseph, Claudine
2016-01-01
was inhibited by Tofacitinib (CP-690550), a clinical-grade JAK3 inhibitor. Chromatin immunoprecipitation (ChIP) analysis showed direct binding of STAT5 to the miR-21 promoter. Cytokine starvation ex vivo triggered a decrease in miR-21 expression, whereas IL-2 induced an increased miR-21 expression in primary SS...
Experiment list: SRX142526 [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available source_name=C2C12 || biomaterial_provider=Barbara Wold lab || lab=Caltech-m || lab description=Wold - Califonia Institute of Technolo...gy || datatype=ChipSeq || datatype description=Chromatin
Quantized correlation coefficient for measuring reproducibility of ChIP-chip data
Directory of Open Access Journals (Sweden)
Kuroda Mitzi I
2010-07-01
Full Text Available Abstract Background Chromatin immunoprecipitation followed by microarray hybridization (ChIP-chip is used to study protein-DNA interactions and histone modifications on a genome-scale. To ensure data quality, these experiments are usually performed in replicates, and a correlation coefficient between replicates is used often to assess reproducibility. However, the correlation coefficient can be misleading because it is affected not only by the reproducibility of the signal but also by the amount of binding signal present in the data. Results We develop the Quantized correlation coefficient (QCC that is much less dependent on the amount of signal. This involves discretization of data into set of quantiles (quantization, a merging procedure to group the background probes, and recalculation of the Pearson correlation coefficient. This procedure reduces the influence of the background noise on the statistic, which then properly focuses more on the reproducibility of the signal. The performance of this procedure is tested in both simulated and real ChIP-chip data. For replicates with different levels of enrichment over background and coverage, we find that QCC reflects reproducibility more accurately and is more robust than the standard Pearson or Spearman correlation coefficients. The quantization and the merging procedure can also suggest a proper quantile threshold for separating signal from background for further analysis. Conclusions To measure reproducibility of ChIP-chip data correctly, a correlation coefficient that is robust to the amount of signal present should be used. QCC is one such measure. The QCC statistic can also be applied in a variety of other contexts for measuring reproducibility, including analysis of array CGH data for DNA copy number and gene expression data.
Quantized correlation coefficient for measuring reproducibility of ChIP-chip data.
Peng, Shouyong; Kuroda, Mitzi I; Park, Peter J
2010-07-27
Chromatin immunoprecipitation followed by microarray hybridization (ChIP-chip) is used to study protein-DNA interactions and histone modifications on a genome-scale. To ensure data quality, these experiments are usually performed in replicates, and a correlation coefficient between replicates is used often to assess reproducibility. However, the correlation coefficient can be misleading because it is affected not only by the reproducibility of the signal but also by the amount of binding signal present in the data. We develop the Quantized correlation coefficient (QCC) that is much less dependent on the amount of signal. This involves discretization of data into set of quantiles (quantization), a merging procedure to group the background probes, and recalculation of the Pearson correlation coefficient. This procedure reduces the influence of the background noise on the statistic, which then properly focuses more on the reproducibility of the signal. The performance of this procedure is tested in both simulated and real ChIP-chip data. For replicates with different levels of enrichment over background and coverage, we find that QCC reflects reproducibility more accurately and is more robust than the standard Pearson or Spearman correlation coefficients. The quantization and the merging procedure can also suggest a proper quantile threshold for separating signal from background for further analysis. To measure reproducibility of ChIP-chip data correctly, a correlation coefficient that is robust to the amount of signal present should be used. QCC is one such measure. The QCC statistic can also be applied in a variety of other contexts for measuring reproducibility, including analysis of array CGH data for DNA copy number and gene expression data.
Wang, Liangjun; Jahren, Neal; Miller, Ellen L; Ketel, Carrie S; Mallin, Daniel R; Simon, Jeffrey A
2010-06-01
Sex Comb on Midleg (SCM) is a transcriptional repressor in the Polycomb group (PcG), but its molecular role in PcG silencing is not known. Although SCM can interact with Polycomb repressive complex 1 (PRC1) in vitro, biochemical studies have indicated that SCM is not a core constituent of PRC1 or PRC2. Nevertheless, SCM is just as critical for Drosophila Hox gene silencing as canonical subunits of these well-characterized PcG complexes. To address functional relationships between SCM and other PcG components, we have performed chromatin immunoprecipitation studies using cultured Drosophila Schneider line 2 (S2) cells and larval imaginal discs. We find that SCM associates with a Polycomb response element (PRE) upstream of the Ubx gene which also binds PRC1, PRC2, and the DNA-binding PcG protein Pleiohomeotic (PHO). However, SCM is retained at this Ubx PRE despite genetic disruption or knockdown of PHO, PRC1, or PRC2, suggesting that SCM chromatin targeting does not require prior association of these other PcG components. Chromatin immunoprecipitations (IPs) to test the consequences of SCM genetic disruption or knockdown revealed that PHO association is unaffected, but reduced levels of PRE-bound PRC2 and PRC1 were observed. We discuss these results in light of current models for recruitment of PcG complexes to chromatin targets.
Wang, Liangjun; Jahren, Neal; Miller, Ellen L.; Ketel, Carrie S.; Mallin, Daniel R.; Simon, Jeffrey A.
2010-01-01
Sex Comb on Midleg (SCM) is a transcriptional repressor in the Polycomb group (PcG), but its molecular role in PcG silencing is not known. Although SCM can interact with Polycomb repressive complex 1 (PRC1) in vitro, biochemical studies have indicated that SCM is not a core constituent of PRC1 or PRC2. Nevertheless, SCM is just as critical for Drosophila Hox gene silencing as canonical subunits of these well-characterized PcG complexes. To address functional relationships between SCM and other PcG components, we have performed chromatin immunoprecipitation studies using cultured Drosophila Schneider line 2 (S2) cells and larval imaginal discs. We find that SCM associates with a Polycomb response element (PRE) upstream of the Ubx gene which also binds PRC1, PRC2, and the DNA-binding PcG protein Pleiohomeotic (PHO). However, SCM is retained at this Ubx PRE despite genetic disruption or knockdown of PHO, PRC1, or PRC2, suggesting that SCM chromatin targeting does not require prior association of these other PcG components. Chromatin immunoprecipitations (IPs) to test the consequences of SCM genetic disruption or knockdown revealed that PHO association is unaffected, but reduced levels of PRE-bound PRC2 and PRC1 were observed. We discuss these results in light of current models for recruitment of PcG complexes to chromatin targets. PMID:20351181
DEFF Research Database (Denmark)
Gabriele, Michele; Vulto-van Silfhout, Anneke T; Germain, Pierre-Luc
2017-01-01
that define a syndrome of cognitive impairment, behavioral alterations, intrauterine growth restriction, feeding problems, and various congenital malformations. Our combined clinical and molecular data define "YY1 syndrome" as a haploinsufficiency syndrome. Through immunoprecipitation of YY1-bound chromatin...... on the YY1-bound enhancers, underscoring a crucial role for YY1 in enhancer regulation. Collectively, these results define a clinical syndrome caused by haploinsufficiency of YY1 through dysregulation of key transcriptional regulators....
Experiment list: SRX190193 [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available rce_name=HL-60 || biomaterial_provider=ATCC || datatype=ChipSeq || datatype description=Chromatin IP Sequencing || antibody antibody...description=Mouse monoclonal to RNA polymerase II CTD repeat YSPTSPS antibody... (4H8) - ChIP Grade. Antibody Target: POL2 || antibody targetdescription=This gene encod...es the largest subunit of RNA polymerase II, the polymerase responsible for synthesizing messenger RNA in eukaryotes || antibody... vendorname=abcam || antibody vendorid=ab5408 || controlid=SL
Experiment list: SRX100504 [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available .1 source_name=U87 || biomaterial_provider=ATCC || datatype=ChipSeq || datatype description=Chromatin IP Sequencing || antibody antib...odydescription=Mouse monoclonal to RNA polymerase II CTD repeat YSPTSPS antibody... (4H8) - ChIP Grade. Antibody Target: POL2 || antibody targetdescription=This gene e...ncodes the largest subunit of RNA polymerase II, the polymerase responsible for synthesizing messenger RNA in eukaryotes || antibody... vendorname=abcam || antibody vendorid=ab5408 || controli
Experiment list: SRX100529 [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available aterial_provider=WiCell Research Institute || datatype=ChipSeq || datatype description=Chromatin IP Sequencing || antibody antibody...description=Mouse monoclonal to RNA polymerase II CTD repeat YSPTSPS antibody... (4H8) - ChIP Grade. Antibody Target: POL2 || antibody targetdescription=This gene encode...s the largest subunit of RNA polymerase II, the polymerase responsible for synthesizing messenger RNA in eukaryotes || antibody... vendorname=abcam || antibody vendorid=ab5408 || controlid=SL9
Experiment list: SRX190244 [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available 1610.1 source_name=PANC-1 || biomaterial_provider=ATCC || datatype=ChipSeq || datatype description=Chromatin IP Sequencing || antibod...y antibodydescription=Mouse monoclonal to RNA polymerase... II CTD repeat YSPTSPS antibody (4H8) - ChIP Grade. Antibody Target: POL2 || antibody targetdescription=This...r RNA in eukaryotes || antibody vendorname=abcam || antibody vendorid=ab5408 || c...ontrolid=SL2340 || labexpid=SL2343,SL5609 || softwareversion=MACS || cell sex=M || antibody=Pol2-4H8 || antibody antibody
Directory of Open Access Journals (Sweden)
Soonok Kim
2010-05-01
Full Text Available Significant progress has been made in defining the central signaling networks in many organisms, but collectively we know little about the downstream targets of these networks and the genes they regulate. To reconstruct the regulatory circuit of calcineurin signal transduction via MoCRZ1, a Magnaporthe oryzae C2H2 transcription factor activated by calcineurin dephosphorylation, we used a combined approach of chromatin immunoprecipitation - chip (ChIP-chip, coupled with microarray expression studies. One hundred forty genes were identified as being both a direct target of MoCRZ1 and having expression concurrently differentially regulated in a calcium/calcineurin/MoCRZ1 dependent manner. Highly represented were genes involved in calcium signaling, small molecule transport, ion homeostasis, cell wall synthesis/maintenance, and fungal virulence. Of particular note, genes involved in vesicle mediated secretion necessary for establishing host associations, were also found. MoCRZ1 itself was a target, suggesting a previously unreported autoregulation control point. The data also implicated a previously unreported feedback regulation mechanism of calcineurin activity. We propose that calcium/calcineurin regulated signal transduction circuits controlling development and pathogenicity manifest through multiple layers of regulation. We present results from the ChIP-chip and expression analysis along with a refined model of calcium/calcineurin signaling in this important plant pathogen.
Energy Technology Data Exchange (ETDEWEB)
Xu, Ren; Spencer, Virginia A.; Bissell, Mina J.
2006-05-25
Extracellular cues play crucial roles in the transcriptional regulation of tissue-specific genes, but whether and how these signals lead to chromatin remodeling is not understood and subject to debate. Using chromatin immunoprecipitation (ChIP) assays and mammary-specific genes as models, we show here that extracellular matrix (ECM) molecules and prolactin cooperate to induce histone acetylation and binding of transcription factors and the SWI/SNF complex to the {beta}- and ?-casein promoters. Introduction of a dominant negative Brg1, an ATPase subunit of SWI/SNF complex, significantly reduced both {beta}- and ?-casein expression, suggesting that SWI/SNF-dependent chromatin remodeling is required for transcription of mammary-specific genes. ChIP analyses demonstrated that the ATPase activity of SWI/SNF is necessary for recruitment of RNA transcriptional machinery, but not for binding of transcription factors or for histone acetylation. Coimmunoprecipitation analyses showed that the SWI/SNF complex is associated with STAT5, C/EBP{beta}, and glucocorticoid receptor (GR). Thus, ECM- and prolactin-regulated transcription of the mammary-specific casein genes requires the concerted action of chromatin remodeling enzymes and transcription factors.
Experiment list: SRX099378 [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available 2.5,9.2,1453 GSM803106: Aio Ikaros knockout chromatin source_name=mouse Ik knockout DP thymocytes || genetic... background=C57BL/6 x129S4/SvJae || genotype=Ikaros knockout || cell type=DP thymocytes || chip antibody=hom
Rad51-Rad52 mediated maintenance of centromeric chromatin in Candida albicans.
Directory of Open Access Journals (Sweden)
Sreyoshi Mitra
2014-04-01
Full Text Available Specification of the centromere location in most eukaryotes is not solely dependent on the DNA sequence. However, the non-genetic determinants of centromere identity are not clearly defined. While multiple mechanisms, individually or in concert, may specify centromeres epigenetically, most studies in this area are focused on a universal factor, a centromere-specific histone H3 variant CENP-A, often considered as the epigenetic determinant of centromere identity. In spite of variable timing of its loading at centromeres across species, a replication coupled early S phase deposition of CENP-A is found in most yeast centromeres. Centromeres are the earliest replicating chromosomal regions in a pathogenic budding yeast Candida albicans. Using a 2-dimensional agarose gel electrophoresis assay, we identify replication origins (ORI7-LI and ORI7-RI proximal to an early replicating centromere (CEN7 in C. albicans. We show that the replication forks stall at CEN7 in a kinetochore dependent manner and fork stalling is reduced in the absence of the homologous recombination (HR proteins Rad51 and Rad52. Deletion of ORI7-RI causes a significant reduction in the stalled fork signal and an increased loss rate of the altered chromosome 7. The HR proteins, Rad51 and Rad52, have been shown to play a role in fork restart. Confocal microscopy shows declustered kinetochores in rad51 and rad52 mutants, which are evidence of kinetochore disintegrity. CENP-ACaCse4 levels at centromeres, as determined by chromatin immunoprecipitation (ChIP experiments, are reduced in absence of Rad51/Rad52 resulting in disruption of the kinetochore structure. Moreover, western blot analysis reveals that delocalized CENP-A molecules in HR mutants degrade in a similar fashion as in other kinetochore mutants described before. Finally, co-immunoprecipitation assays indicate that Rad51 and Rad52 physically interact with CENP-ACaCse4 in vivo. Thus, the HR proteins Rad51 and Rad52
Experiment list: SRX150696 [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available -1 || cell organism=human || cell description=pancreatic carcinoma, (PMID: 1140870) PANC-1 was established from a panc...SRX150696 hg19 Input control Input control Pancreas PANC-1 Tissue=Pancreas/Duct|Dis...ease=Epithelioid Carcinoma 41671673,95.8,10.4,1584 GSM935617: USC ChipSeq PANC-1 Input UCDavis source_name=PANC... || datatype=ChipSeq || datatype description=Chromatin IP Sequencing || cell=PANC...reatic carcinoma, which was extracted via pancreatico-duodenectomy specimen from a 56-year-old Cau
Experiment list: SRX199860 [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available | cell organism=human || cell description=pancreatic carcinoma, (PMID: 1140870) PANC-1 was established from a panc...SRX199860 hg19 Input control Input control Pancreas PANC-1 Tissue=Pancreas/Duct|Dis...ease=Epithelioid Carcinoma 27365308,98.2,3.6,969 GSM1022632: UW ChipSeq PANC-1 InputRep1 source_name=PANC-1 ...datatype=ChipSeq || datatype description=Chromatin IP Sequencing || cell=PANC-1 |...reatic carcinoma, which was extracted via pancreatico-duodenectomy specimen from a 56-year-old Caucasi
Experiment list: SRX099380 [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available .7,8.5,497 GSM803108: Mi2beta Ikaros knockout chromatin source_name=mouse Ik knockout DP thymocytes || genet...ic background=C57BL/6 x129S4/SvJae || genotype=Ikaros knockout || cell type=DP thymocytes || chip antibody=h
Experiment list: SRX099379 [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available 66262,95.2,8.3,424 GSM803107: input DNA Ikaros knockout chromatin source_name=mouse Ik knockout DP thymocyte...s || genetic background=C57BL/6 x129S4/SvJae || genotype=Ikaros knockout || cell type=DP thymocytes || chip
Cai, Hanyang; Zhao, Lihua; Wang, Lulu; Zhang, Man; Su, Zhenxia; Cheng, Yan; Zhao, Heming; Qin, Yuan
2017-06-01
Flowering plants display a remarkable diversity in inflorescence architecture, and pedicel length is one of the key contributors to this diversity. In Arabidopsis thaliana, the receptor-like kinase ERECTA (ER) mediated signaling pathway plays important roles in regulating inflorescence architecture by promoting cell proliferation. However, the regulating mechanism remains elusive in the pedicel. Genetic interactions between ERECTA signaling and the chromatin remodeling complex SWR1 in the control of inflorescence architecture were studied. Comparative transcriptome analysis was applied to identify downstream components. Chromatin immunoprecipitation and nucleosome occupancy was further investigated. The results indicated that the chromatin remodeler SWR1 coordinates with ERECTA signaling in regulating inflorescence architecture by activating the expression of PRE1 family genes and promoting pedicel elongation. It was found that SWR1 is required for the incorporation of the H2A.Z histone variant into nucleosomes of the whole PRE1 gene family and the ERECTA controlled expression of PRE1 gene family through regulating nucleosome dynamics. We propose that utilization of a chromatin remodeling complex to regulate gene expression is a common theme in developmental control across kingdoms. These findings shed light on the mechanisms through which chromatin remodelers orchestrate complex transcriptional regulation of gene expression in coordination with a developmental cue. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.
Riakhovskiĭ, A A; Tillib, S V
2007-09-01
Using the method of immunoprecipitation of the in vivo crosslinked and sheared by sonication chromatin, mapping of potential trithorax-associated regulatory elements within the extended (9 kb) promoter region of the fork head gene (fkh) in the Drosophila melanogaster salivary gland cells was performed. Relative homogeneity of the salivary gland cells, along with the parallel use of the antibodies to different domains of the same trithorax protein (TRX), and the introduction of cross-hybridization steps for additional specific enrichment of initial DNA libraries, provided improvement of the method effectiveness and identification of one major and two less expressed potential TRX-binding sites.
Experiment list: SRX190029 [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available l organism=human || cell description=pancreatic carcinoma, (PMID: 1140870) PANC-1 was established from a panc...SRX190029 hg19 Input control Input control Pancreas PANC-1 Tissue=Pancreas/Duct|Dis...ease=Epithelioid Carcinoma 27365308,98.2,3.6,980 GSM945246: UW ChipSeq PANC-1 Input source_name=PANC-1 || bi...ype=ChipSeq || datatype description=Chromatin IP Sequencing || cell=PANC-1 || cel...reatic carcinoma, which was extracted via pancreatico-duodenectomy specimen from a 56-year-old Caucasian in
EBV Latency Types Adopt Alternative Chromatin Conformations
Tempera, Italo; Klichinsky, Michael; Lieberman, Paul M.
2011-01-01
Epstein-Barr Virus (EBV) can establish latent infections with distinct gene expression patterns referred to as latency types. These different latency types are epigenetically stable and correspond to different promoter utilization. Here we explore the three-dimensional conformations of the EBV genome in different latency types. We employed Chromosome Conformation Capture (3C) assay to investigate chromatin loop formation between the OriP enhancer and the promoters that determine type I (Qp) or type III (Cp) gene expression. We show that OriP is in close physical proximity to Qp in type I latency, and to Cp in type III latency. The cellular chromatin insulator and boundary factor CTCF was implicated in EBV chromatin loop formation. Combining 3C and ChIP assays we found that CTCF is physically associated with OriP-Qp loop formation in type I and OriP-Cp loop formation in type III latency. Mutations in the CTCF binding site located at Qp disrupt loop formation between Qp and OriP, and lead to the activation of Cp transcription. Mutation of the CTCF binding site at Cp, as well as siRNA depletion of CTCF eliminates both OriP-associated loops, indicating that CTCF plays an integral role in loop formation. These data indicate that epigenetically stable EBV latency types adopt distinct chromatin architectures that depend on CTCF and mediate alternative promoter targeting by the OriP enhancer. PMID:21829357
EBV latency types adopt alternative chromatin conformations.
Directory of Open Access Journals (Sweden)
Italo Tempera
2011-07-01
Full Text Available Epstein-Barr Virus (EBV can establish latent infections with distinct gene expression patterns referred to as latency types. These different latency types are epigenetically stable and correspond to different promoter utilization. Here we explore the three-dimensional conformations of the EBV genome in different latency types. We employed Chromosome Conformation Capture (3C assay to investigate chromatin loop formation between the OriP enhancer and the promoters that determine type I (Qp or type III (Cp gene expression. We show that OriP is in close physical proximity to Qp in type I latency, and to Cp in type III latency. The cellular chromatin insulator and boundary factor CTCF was implicated in EBV chromatin loop formation. Combining 3C and ChIP assays we found that CTCF is physically associated with OriP-Qp loop formation in type I and OriP-Cp loop formation in type III latency. Mutations in the CTCF binding site located at Qp disrupt loop formation between Qp and OriP, and lead to the activation of Cp transcription. Mutation of the CTCF binding site at Cp, as well as siRNA depletion of CTCF eliminates both OriP-associated loops, indicating that CTCF plays an integral role in loop formation. These data indicate that epigenetically stable EBV latency types adopt distinct chromatin architectures that depend on CTCF and mediate alternative promoter targeting by the OriP enhancer.
Experiment list: SRX152077 [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available ll organism=human || cell description=pancreatic carcinoma, (PMID: 1140870) PANC-1 was established from a panc...SRX152077 hg19 Histone H3K4me3 Pancreas PANC-1 Tissue=Pancreas/Duct|Disease=Epithel...ioid Carcinoma 53620150,97.5,34.9,29597 GSM945856: USC ChipSeq PANC-1 H3K4me3B UCDavis source_name=PANC-1 ||...type=ChipSeq || datatype description=Chromatin IP Sequencing || cell=PANC-1 || ce...reatic carcinoma, which was extracted via pancreatico-duodenectomy specimen from a 56-year-old Caucasian i
Chen, Xiaoyong; Wilson, James B; McChesney, Patricia; Williams, Stacy A; Kwon, Youngho; Longerich, Simonne; Marriott, Andrew S; Sung, Patrick; Jones, Nigel J; Kupfer, Gary M
2014-09-12
Fanconi anemia is a genetic disease resulting in bone marrow failure, birth defects, and cancer that is thought to encompass a defect in maintenance of genomic stability. Mutations in 16 genes (FANCA, B, C, D1, D2, E, F, G, I, J, L, M, N, O, P, and Q) have been identified in patients, with the Fanconi anemia subtype J (FA-J) resulting from homozygous mutations in the FANCJ gene. Here, we describe the direct interaction of FANCD2 with FANCJ. We demonstrate the interaction of FANCD2 and FANCJ in vivo and in vitro by immunoprecipitation in crude cell lysates and from fractions after gel filtration and with baculovirally expressed proteins. Mutation of the monoubiquitination site of FANCD2 (K561R) preserves interaction with FANCJ constitutively in a manner that impedes proper chromatin localization of FANCJ. FANCJ is necessary for FANCD2 chromatin loading and focus formation in response to mitomycin C treatment. Our results suggest not only that FANCD2 regulates FANCJ chromatin localization but also that FANCJ is necessary for efficient loading of FANCD2 onto chromatin following DNA damage caused by mitomycin C treatment. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
Directory of Open Access Journals (Sweden)
Jeron Andreas
2012-12-01
Full Text Available Abstract Background The transcription factor (TF forkhead box P3 (FOXP3 is constitutively expressed at high levels in naturally occurring CD4+CD25+ regulatory T cells (nTregs. It is not only the most accepted marker for that cell population but is also considered lineage determinative. Chromatin immunoprecipitation (ChIP of TFs in combination with genomic tiling microarray analysis (ChIP-on-chip has been shown to be an appropriate tool for identifying FOXP3 transcription factor binding sites (TFBSs on a genome-wide scale. In combination with microarray expression analysis, the ChIP-on-chip technique allows identification of direct FOXP3 target genes. Results ChIP-on-chip analysis of the human FOXP3 expressed in resting and PMA/ionomycin–stimulated Jurkat T cells revealed several thousand putative FOXP3 binding sites and demonstrated the importance of intronic regions for FOXP3 binding. The analysis of expression data showed that the stimulation-dependent down-regulation of IL-22 was correlated with direct FOXP3 binding in the IL-22 promoter region. This association was confirmed by real-time PCR analysis of ChIP-DNA. The corresponding ChIP-region also contained a matching FOXP3 consensus sequence. Conclusions Knowledge of the general distribution patterns of FOXP3 TFBSs in the human genome under resting and activated conditions will contribute to a better understanding of this TF and its influence on direct target genes, as well as its importance for the phenotype and function of Tregs. Moreover, FOXP3-dependent repression of Th17-related IL-22 may be relevant to an understanding of the phenomenon of Treg/Th17 cell plasticity.
DEFF Research Database (Denmark)
Ehrensberger, Andreas Hasso; Svejstrup, Jesper Qualmann
2012-01-01
attributed to high kinetic barriers that affect all cells equally and can only be overcome by rare stochastic events. The barriers to reprogramming are likely to involve transformations of chromatin state because (i) inhibitors of chromatin-modifying enzymes can enhance the efficiency of reprogramming...... and (ii) knockdown or knock-out of chromatin-modifying enzymes can lower the efficiency of reprogramming. Here, we review the relationship between chromatin state transformations (chromatin reprogramming) and cellular reprogramming, with an emphasis on transcription factors, chromatin remodeling factors...
Directory of Open Access Journals (Sweden)
Laurie A Steiner
Full Text Available CTCF and cohesinSA-1 are regulatory proteins involved in a number of critical cellular processes including transcription, maintenance of chromatin domain architecture, and insulator function. To assess changes in the CTCF and cohesinSA-1 interactomes during erythropoiesis, chromatin immunoprecipitation coupled with high throughput sequencing and mRNA transcriptome analyses via RNA-seq were performed in primary human hematopoietic stem and progenitor cells (HSPC and primary human erythroid cells from single donors.Sites of CTCF and cohesinSA-1 co-occupancy were enriched in gene promoters in HSPC and erythroid cells compared to single CTCF or cohesin sites. Cell type-specific CTCF sites in erythroid cells were linked to highly expressed genes, with the opposite pattern observed in HSPCs. Chromatin domains were identified by ChIP-seq with antibodies against trimethylated lysine 27 histone H3, a modification associated with repressive chromatin. Repressive chromatin domains increased in both number and size during hematopoiesis, with many more repressive domains in erythroid cells than HSPCs. CTCF and cohesinSA-1 marked the boundaries of these repressive chromatin domains in a cell-type specific manner.These genome wide data, changes in sites of protein occupancy, chromatin architecture, and related gene expression, support the hypothesis that CTCF and cohesinSA-1 have multiple roles in the regulation of gene expression during erythropoiesis including transcriptional regulation at gene promoters and maintenance of chromatin architecture. These data from primary human erythroid cells provide a resource for studies of normal and perturbed erythropoiesis.
Effects of fast neutrons on chromatin: dependence on chromatin structure
Energy Technology Data Exchange (ETDEWEB)
Radu, L. [Dept. of Molecular Genetics, V. Babes National Inst., Bd. Timisoara, Bucharest (Romania); Constantinescu, B. [Dept. of Cyclotron, H. Hulubei National Inst., Bucharest (Romania); Gazdaru, D. [Dept. of Biophysics, Physics Faculty, Univ. of Bucharest (Romania)
2002-07-01
The effects of fast neutrons (10-100 Gy) on chromatin extracted from normal (liver of Wistar rats) and tumor (Walker carcinosarcoma maintained on Wistar rats) tissues were compared. The spectroscopic assays used were (i) chromatin intrinsic fluorescence, (ii) time-resolved fluorescence of chromatin-proflavine complexes, and (iii) fluorescence resonance energy transfer (FRET) between dansyl chloride and acridine orange coupled to chromatin. For both normal and tumor chromatin, the intensity of intrinsic fluorescence specific for acidic and basic proteins decreased with increasing dose. The relative contributions of the excited-state lifetime of proflavine bound to chromatin were reduced upon fast-neutron irradiation, indicating a decrease in the proportion of chromatin DNA available for ligand binding. The Forster energy transfer efficiencies were also modified by irradiation. These effects were larger for chromatin from tumor tissue. In the range 0-100 Gy, fast neutrons induced alterations in DNA and acidic and basic proteins, as well as in global chromatin structure. The radiosensitivity of chromatin extracted from tumor tissue seems to be higher than that of chromatin extracted from normal tissue, probably because of its higher euchromatin (loose)-heterochromatin (compact) ratio. (author)
Effects of fast neutrons on chromatin: dependence on chromatin structure
International Nuclear Information System (INIS)
Radu, L.; Constantinescu, B.; Gazdaru, D.
2002-01-01
The effects of fast neutrons (10-100 Gy) on chromatin extracted from normal (liver of Wistar rats) and tumor (Walker carcinosarcoma maintained on Wistar rats) tissues were compared. The spectroscopic assays used were (i) chromatin intrinsic fluorescence, (ii) time-resolved fluorescence of chromatin-proflavine complexes, and (iii) fluorescence resonance energy transfer (FRET) between dansyl chloride and acridine orange coupled to chromatin. For both normal and tumor chromatin, the intensity of intrinsic fluorescence specific for acidic and basic proteins decreased with increasing dose. The relative contributions of the excited-state lifetime of proflavine bound to chromatin were reduced upon fast-neutron irradiation, indicating a decrease in the proportion of chromatin DNA available for ligand binding. The Forster energy transfer efficiencies were also modified by irradiation. These effects were larger for chromatin from tumor tissue. In the range 0-100 Gy, fast neutrons induced alterations in DNA and acidic and basic proteins, as well as in global chromatin structure. The radiosensitivity of chromatin extracted from tumor tissue seems to be higher than that of chromatin extracted from normal tissue, probably because of its higher euchromatin (loose)-heterochromatin (compact) ratio. (author)
Yin, Hang; Sweeney, Sarah; Raha, Debasish; Snyder, Michael; Lin, Haifan
2011-12-01
Epigenetic research has been focused on cell-type-specific regulation; less is known about common features of epigenetic programming shared by diverse cell types within an organism. Here, we report a modified method for chromatin immunoprecipitation and deep sequencing (ChIP-Seq) and its use to construct a high-resolution map of the Drosophila melanogaster key histone marks, heterochromatin protein 1a (HP1a) and RNA polymerase II (polII). These factors are mapped at 50-bp resolution genome-wide and at 5-bp resolution for regulatory sequences of genes, which reveals fundamental features of chromatin modification landscape shared by major adult Drosophila cell types: the enrichment of both heterochromatic and euchromatic marks in transposons and repetitive sequences, the accumulation of HP1a at transcription start sites with stalled polII, the signatures of histone code and polII level/position around the transcriptional start sites that predict both the mRNA level and functionality of genes, and the enrichment of elongating polII within exons at splicing junctions. These features, likely conserved among diverse epigenomes, reveal general strategies for chromatin modifications.
Chung, Dongjun; Kuan, Pei Fen; Li, Bo; Sanalkumar, Rajendran; Liang, Kun; Bresnick, Emery H; Dewey, Colin; Keleş, Sündüz
2011-07-01
Chromatin immunoprecipitation followed by high-throughput sequencing (ChIP-seq) is rapidly replacing chromatin immunoprecipitation combined with genome-wide tiling array analysis (ChIP-chip) as the preferred approach for mapping transcription-factor binding sites and chromatin modifications. The state of the art for analyzing ChIP-seq data relies on using only reads that map uniquely to a relevant reference genome (uni-reads). This can lead to the omission of up to 30% of alignable reads. We describe a general approach for utilizing reads that map to multiple locations on the reference genome (multi-reads). Our approach is based on allocating multi-reads as fractional counts using a weighted alignment scheme. Using human STAT1 and mouse GATA1 ChIP-seq datasets, we illustrate that incorporation of multi-reads significantly increases sequencing depths, leads to detection of novel peaks that are not otherwise identifiable with uni-reads, and improves detection of peaks in mappable regions. We investigate various genome-wide characteristics of peaks detected only by utilization of multi-reads via computational experiments. Overall, peaks from multi-read analysis have similar characteristics to peaks that are identified by uni-reads except that the majority of them reside in segmental duplications. We further validate a number of GATA1 multi-read only peaks by independent quantitative real-time ChIP analysis and identify novel target genes of GATA1. These computational and experimental results establish that multi-reads can be of critical importance for studying transcription factor binding in highly repetitive regions of genomes with ChIP-seq experiments.
Directory of Open Access Journals (Sweden)
Dongjun Chung
2011-07-01
Full Text Available Chromatin immunoprecipitation followed by high-throughput sequencing (ChIP-seq is rapidly replacing chromatin immunoprecipitation combined with genome-wide tiling array analysis (ChIP-chip as the preferred approach for mapping transcription-factor binding sites and chromatin modifications. The state of the art for analyzing ChIP-seq data relies on using only reads that map uniquely to a relevant reference genome (uni-reads. This can lead to the omission of up to 30% of alignable reads. We describe a general approach for utilizing reads that map to multiple locations on the reference genome (multi-reads. Our approach is based on allocating multi-reads as fractional counts using a weighted alignment scheme. Using human STAT1 and mouse GATA1 ChIP-seq datasets, we illustrate that incorporation of multi-reads significantly increases sequencing depths, leads to detection of novel peaks that are not otherwise identifiable with uni-reads, and improves detection of peaks in mappable regions. We investigate various genome-wide characteristics of peaks detected only by utilization of multi-reads via computational experiments. Overall, peaks from multi-read analysis have similar characteristics to peaks that are identified by uni-reads except that the majority of them reside in segmental duplications. We further validate a number of GATA1 multi-read only peaks by independent quantitative real-time ChIP analysis and identify novel target genes of GATA1. These computational and experimental results establish that multi-reads can be of critical importance for studying transcription factor binding in highly repetitive regions of genomes with ChIP-seq experiments.
The Role of Vitamin D Stimulation of Mullerian Inhibiting Substance (MIS) in Prostate Cancer Therapy
2008-12-01
calcitriol for 6 hr and cross -linked by addition of 1% formaldehyde. Chromatin was prepared and digested with micrococcal nuclease for 12 min at 37...immunoprecipitates eluted with ChIP elution buffer. The cross -links were reversed by incubation at 65°C for 30 min. Proteinase K was added and incubated at 65°C...coactivator interaction and causes hereditary 1,25-dihydroxyvitamin D-resistant rickets without alopecia. Mol Endocrinol 16:2538-2546 26. Dresser DW
Phosphorylation-dependent regulation of plant chromatin and chromatin-associated proteins
Bigeard, Jean; Rayapuram, Naganand; Pflieger, Delphine; Hirt, Heribert
2014-01-01
In eukaryotes, most of the DNA is located in the nucleus where it is organized with histone proteins in a higher order structure as chromatin. Chromatin and chromatin-associated proteins contribute to DNA-related processes such as replication and transcription as well as epigenetic regulation. Protein functions are often regulated by PTMs among which phosphorylation is one of the most abundant PTM. Phosphorylation of proteins affects important properties, such as enzyme activity, protein stability, or subcellular localization. We here describe the main specificities of protein phosphorylation in plants and review the current knowledge on phosphorylation-dependent regulation of plant chromatin and chromatin-associated proteins. We also outline some future challenges to further elucidate protein phosphorylation and chromatin regulation.
Phosphorylation-dependent regulation of plant chromatin and chromatin-associated proteins
Bigeard, Jean
2014-07-10
In eukaryotes, most of the DNA is located in the nucleus where it is organized with histone proteins in a higher order structure as chromatin. Chromatin and chromatin-associated proteins contribute to DNA-related processes such as replication and transcription as well as epigenetic regulation. Protein functions are often regulated by PTMs among which phosphorylation is one of the most abundant PTM. Phosphorylation of proteins affects important properties, such as enzyme activity, protein stability, or subcellular localization. We here describe the main specificities of protein phosphorylation in plants and review the current knowledge on phosphorylation-dependent regulation of plant chromatin and chromatin-associated proteins. We also outline some future challenges to further elucidate protein phosphorylation and chromatin regulation.
Experiment list: SRX143825 [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available SRX143825 mm9 Input control Input control Neural Cerebellum MeSH Description=The pa...ntain balance, and learn motor skills. 38330550,73.2,10.7,868 GSM918733: LICR ChipSeq Cerebellum Input adult-8wks source_name=Cerebel...ption=Chromatin IP Sequencing || cell=Cerebellum || cell organism=mouse || cell description=Cerebellum || ce...lum || biomaterial_provider=1)LICR lab; 2)CSHL lab || lab=LICR-m || lab description
Bruinsma, Robijn; Grosberg, Alexander Y.; Rabin, Yitzhak; Zidovska, Alexandra
2014-01-01
Following recent observations of large scale correlated motion of chromatin inside the nuclei of live differentiated cells, we present a hydrodynamic theory—the two-fluid model—in which the content of a nucleus is described as a chromatin solution with the nucleoplasm playing the role of the solvent and the chromatin fiber that of a solute. This system is subject to both passive thermal fluctuations and active scalar and vector events that are associated with free energy consumption, such as ATP hydrolysis. Scalar events drive the longitudinal viscoelastic modes (where the chromatin fiber moves relative to the solvent) while vector events generate the transverse modes (where the chromatin fiber moves together with the solvent). Using linear response methods, we derive explicit expressions for the response functions that connect the chromatin density and velocity correlation functions to the corresponding correlation functions of the active sources and the complex viscoelastic moduli of the chromatin solution. We then derive general expressions for the flow spectral density of the chromatin velocity field. We use the theory to analyze experimental results recently obtained by one of the present authors and her co-workers. We find that the time dependence of the experimental data for both native and ATP-depleted chromatin can be well-fitted using a simple model—the Maxwell fluid—for the complex modulus, although there is some discrepancy in terms of the wavevector dependence. Thermal fluctuations of ATP-depleted cells are predominantly longitudinal. ATP-active cells exhibit intense transverse long wavelength velocity fluctuations driven by force dipoles. Fluctuations with wavenumbers larger than a few inverse microns are dominated by concentration fluctuations with the same spectrum as thermal fluctuations but with increased intensity. PMID:24806919
DEFF Research Database (Denmark)
Jakobsen, Janus S; Bagger, Frederik O; Hasemann, Marie S
2015-01-01
BACKGROUND: Chromatin-Immunoprecipitation coupled with deep sequencing (ChIP-seq) is used to map transcription factor occupancy and generate epigenetic profiles genome-wide. The requirement of nano-scale ChIP DNA for generation of sequencing libraries has impeded ChIP-seq on in vivo tissues of low...... transcription factor (CEBPA) and histone mark (H3K4me3) ChIP. We further demonstrate that genomic profiles are highly resilient to changes in carrier DNA to ChIP DNA ratios. CONCLUSIONS: This represents a significant advance compared to existing technologies, which involve either complex steps of pre...... cell numbers. RESULTS: We describe a robust, simple and scalable methodology for ChIP-seq of low-abundant cell populations, verified down to 10,000 cells. By employing non-mammalian genome mapping bacterial carrier DNA during amplification, we reliably amplify down to 50 pg of ChIP DNA from...
Xue, Yutong; Gibbons, Richard; Yan, Zhijiang; Yang, Dafeng; McDowell, Tarra L; Sechi, Salvatore; Qin, Jun; Zhou, Sharleen; Higgs, Doug; Wang, Weidong
2003-09-16
ATRX syndrome is characterized by X-linked mental retardation associated with alpha-thalassemia. The gene mutated in this disease, ATRX, encodes a plant homeodomain-like finger and a SWI2/SNF2-like ATPase motif, both of which are often found in chromatin-remodeling enzymes, but ATRX has not been characterized biochemically. By immunoprecipitation from HeLa extract, we found that ATRX is in a complex with transcription cofactor Daxx. The following evidence supports that ATRX and Daxx are components of an ATP-dependent chromatin-remodeling complex: (i) Daxx and ATRX can be coimmunoisolated by antibodies specific for each protein; (ii) a proportion of Daxx cofractionates with ATRX as a complex of 1 MDa by gel-filtration analysis; (iii) in extract from cells of a patient with ATRX syndrome, the level of the Daxx-ATRX complex is correspondingly reduced; (iv) a proportion of ATRX and Daxx colocalize in promyelocytic leukemia nuclear bodies, with which Daxx had previously been located; and (v) the ATRX complex displays ATP-dependent activities that resemble those of other chromatin-remodeling complexes, including triple-helix DNA displacement and alteration of mononucleosome disruption patterns. But unlike the previously described SWI/SNF or NURD complexes, the ATRX complex does not randomize DNA phasing of the mononucleosomes, suggesting that it may remodel chromatin differently. Taken together, the results suggest that ATRX functions in conjunction with Daxx in a novel chromatin-remodeling complex. The defects in ATRX syndrome may result from inappropriate expression of genes controlled by this complex.
Experiment list: SRX190249 [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available datatype description=Chromatin IP Sequencing || antibody antibodydescription=Mous...e monoclonal to RNA polymerase II CTD repeat YSPTSPS antibody (4H8) - ChIP Grade. Antibody Target: POL2 || antibody...ible for synthesizing messenger RNA in eukaryotes || antibody vendorname=abcam || antibody... vendorid=ab5408 || controlid=SL1714 || labexpid=SL1963,SL5611 || softwareversion=MACS || cell sex=F || antibody...=Pol2-4H8 || antibody antibodydescription=Mouse monoclonal to RNA polymerase II CTD repeat YSPTSPS antibody
International Nuclear Information System (INIS)
Pantic, Igor; Basailovic, Milos; Paunovic, Jovana; Pantic, Senka
2015-01-01
Highlights: •We analyzed chromatin structure and nuclear envelope of 200 hippocampal pyramidal neurons. •Fractal and GLCM mathematical parameters were calculated each chromatin structure. •Nuclear shape was quantified by calculating circularity of the nuclear envelope. •Circularity was in significant relationship with chromatin fractal dimension. •Strong correlation was detected between circularity and some GLCM parameters. -- Abstract: In this study we tested the existence and strength of the relationship between circularity of nuclear envelope and mathematical parameters of chromatin structure. Coronal sections of the brain were made in 10 male albino mice. The brain tissue was stained using a modification of Feulgen method for DNA visualization. A total of 200 hippocampal pyramidal neurons (20 per animal) were visualized using DEM 200 High-Speed Color CMOS Chip and Olympus CX21FS1 microscope. Circularity of the nuclear membrane was calculated in ImageJ (NIH, USA) after the nuclear segmentation, based on the freehand selection of the nuclear regions of interest. Circularity was determined from the values of area and perimeter. For each chromatin structure, using fractal and grey level co-occurrence matrix (GLCM) algorithms, we determined the values of fractal dimension, lacunarity, angular second moment, GLCM entropy, inverse difference moment, GLCM correlation, and GLCM contrast. It was found that circularity is in a significant correlation (p < 0.05) with fractal dimension as the main parameter of fractal complexity analysis. Also, circularity was in a very strong relationship (p < 0.001) with certain parameters of grey level co-occurrence matrix such as the angular second moment and GLCM correlation. This is the first study to indicate that nuclear shape is significantly related to mathematical parameters of higher chromatin organization. Also, it seems that circularity of the nuclear envelope is a good predictor of certain features of chromatin
Yang, Chia-Chun; Andrews, Erik H; Chen, Min-Hsuan; Wang, Wan-Yu; Chen, Jeremy J W; Gerstein, Mark; Liu, Chun-Chi; Cheng, Chao
2016-08-12
Chromatin immunoprecipitation followed by massively parallel DNA sequencing (ChIP-seq) or microarray hybridization (ChIP-chip) has been widely used to determine the genomic occupation of transcription factors (TFs). We have previously developed a probabilistic method, called TIP (Target Identification from Profiles), to identify TF target genes using ChIP-seq/ChIP-chip data. To achieve high specificity, TIP applies a conservative method to estimate significance of target genes, with the trade-off being a relatively low sensitivity of target gene identification compared to other methods. Additionally, TIP's output does not render binding-peak locations or intensity, information highly useful for visualization and general experimental biological use, while the variability of ChIP-seq/ChIP-chip file formats has made input into TIP more difficult than desired. To improve upon these facets, here we present are fined TIP with key extensions. First, it implements a Gaussian mixture model for p-value estimation, increasing target gene identification sensitivity and more accurately capturing the shape of TF binding profile distributions. Second, it enables the incorporation of TF binding-peak data by identifying their locations in significant target gene promoter regions and quantifies their strengths. Finally, for full ease of implementation we have incorporated it into a web server ( http://syslab3.nchu.edu.tw/iTAR/ ) that enables flexibility of input file format, can be used across multiple species and genome assembly versions, and is freely available for public use. The web server additionally performs GO enrichment analysis for the identified target genes to reveal the potential function of the corresponding TF. The iTAR web server provides a user-friendly interface and supports target gene identification in seven species, ranging from yeast to human. To facilitate investigating the quality of ChIP-seq/ChIP-chip data, the web server generates the chart of the
Qiao, F; Moss, A; Kupfer, G M
2001-06-29
Fanconi anemia (FA) is a genetic disease characterized by congenital defects, bone marrow failure, and cancer susceptibility. Cells from patients with FA exhibit genomic instability and hypersensitivity to DNA cross linking agents such as mitomycin C. Despite the identification of seven complementation groups and the cloning of six genes, the function of the encoded gene products remains elusive. The FancA (Fanconi anemia complementation group A), FancC, and FancG proteins have been detected within a nuclear complex, but no change in level, binding, or localization has been reported as a result of drug treatment or cell cycle. We show that in immunofluorescence studies, FancA appears as a non-nucleolar nuclear protein that is excluded from condensed, mitotic chromosomes. Biochemical fractionation reveals that the FA proteins are found in nuclear matrix and chromatin and that treatment with mitomycin C results in increase of the FA proteins in nuclear matrix and chromatin fractions. This induction occurs in wild-type cells and mutant FA-D (Fanconi complementation group D) cells but not in mutant FA-A cells. Immunoprecipitation of FancA protein in chromatin demonstrates the coprecipitation of FancA, FancC, and FancG, showing that the FA proteins move together as a complex. Also, fractionation of mitotic cells confirms the lack of FA proteins in chromatin or the nuclear matrix. Furthermore, phosphorylation of FancG was found to be temporally correlated with exit of the FA complex from chromosomes at mitosis. Taken together, these findings suggest a role for FA proteins in chromatin and nuclear matrix.
DEFF Research Database (Denmark)
Jensen, Michael Krogh; Lindemose, Søren; De Masi, Federico
2013-01-01
ATAF1, an Arabidopsis thaliana NAC transcription factor, plays important roles in plant adaptation to environmental stress and development. To search for ATAF1 target genes, we used protein binding microarrays and chromatin-immunoprecipitation (ChIP). This identified T[A,C,G]CGT[A,G] and TT[A,C,G...... abscisic acid (ABA) phytohormone biosynthetic gene NCED3. ChIP-qPCR and expression analysis showed that ATAF1 binding to the NCED3 promoter correlated with increased NCED3 expression and ABA hormone levels. These results indicate that ATAF1 regulates ABA biosynthesis....
DEFF Research Database (Denmark)
Ahmed, Shaaima; Valen, Eivind; Sandelin, Albin Gustav
2009-01-01
genes with little knowledge of what was occurring at other genomic regions. In this study, we showed using chromatin immunoprecipitation followed by hybridization to promoter focused microarrays (ChIP-chip) that 2,3,7,8-tetrachlorodibenzo-p-dioxin treatment significantly increased the overlap of genomic...... , suggesting that AHR was the important factor determining the recruitment of ER to these regions. RNA interference-mediated knockdown of AHR confirmed its requirement for the recruitment of ER to some, but not all, of the shared regions. Our findings demonstrate not only that dioxin induces the recruitment...
Experiment list: SRX186751 [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available | biomaterial_provider=Lonza || datatype=ChipSeq || datatype description=Chromatin IP Sequencing || antibody antibody...description=Rabbit polyclonal antibody raised against a peptide containi...ng K79 di-methylation. Antibody Target: H3K79me2 || antibody targetdescription=H3K79me2 is a mark of the tra...nscriptional transition region - the region between the initiation marks (K4me3, etc) and the elongation marks (K36me3). || antibody... vendorname=Active Motif || antibody vendorid=39143 || co
Experiment list: SRX186750 [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available l_provider=Lonza || datatype=ChipSeq || datatype description=Chromatin IP Sequencing || antibody antibodydes...cription=Rabbit polyclonal antibody raised against a peptide containing K79 di-me...thylation. Antibody Target: H3K79me2 || antibody targetdescription=H3K79me2 is a mark of the transcriptional... transition region - the region between the initiation marks (K4me3, etc) and the elongation marks (K36me3). || antibody... vendorname=Active Motif || antibody vendorid=39143 || controlid=wgEn
Experiment list: SRX186672 [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available RC || datatype=ChipSeq || datatype description=Chromatin IP Sequencing || antibody antibody...description=Rabbit polyclonal antibody raised against a peptide corresponding to the C-terminus of... H2AZ. Antibody Target: H2AZ || antibody targetdescription=H2A.Z is a sequence variant of Histone H2A. || antibody... vendorname=Millipore || antibody vendorid=07-594 || controlid=wgEncodeEH00...3132 || replicate=1,2 || softwareversion=ScriptureVPaperR3 || cell sex=F || antibody=H2A.Z || antibody antibody
Genome-wide profiling of DNA-binding proteins using barcode-based multiplex Solexa sequencing.
Raghav, Sunil Kumar; Deplancke, Bart
2012-01-01
Chromatin immunoprecipitation (ChIP) is a commonly used technique to detect the in vivo binding of proteins to DNA. ChIP is now routinely paired to microarray analysis (ChIP-chip) or next-generation sequencing (ChIP-Seq) to profile the DNA occupancy of proteins of interest on a genome-wide level. Because ChIP-chip introduces several biases, most notably due to the use of a fixed number of probes, ChIP-Seq has quickly become the method of choice as, depending on the sequencing depth, it is more sensitive, quantitative, and provides a greater binding site location resolution. With the ever increasing number of reads that can be generated per sequencing run, it has now become possible to analyze several samples simultaneously while maintaining sufficient sequence coverage, thus significantly reducing the cost per ChIP-Seq experiment. In this chapter, we provide a step-by-step guide on how to perform multiplexed ChIP-Seq analyses. As a proof-of-concept, we focus on the genome-wide profiling of RNA Polymerase II as measuring its DNA occupancy at different stages of any biological process can provide insights into the gene regulatory mechanisms involved. However, the protocol can also be used to perform multiplexed ChIP-Seq analyses of other DNA-binding proteins such as chromatin modifiers and transcription factors.
Chromatin Structure and Function
Wolffe, Alan P
1999-01-01
The Third Edition of Chromatin: Structure and Function brings the reader up-to-date with the remarkable progress in chromatin research over the past three years. It has been extensively rewritten to cover new material on chromatin remodeling, histone modification, nuclear compartmentalization, DNA methylation, and transcriptional co-activators and co-repressors. The book is written in a clear and concise fashion, with 60 new illustrations. Chromatin: Structure and Function provides the reader with a concise and coherent account of the nature, structure, and assembly of chromatin and its active
PeakAnalyzer: Genome-wide annotation of chromatin binding and modification loci
Directory of Open Access Journals (Sweden)
Tammoja Kairi
2010-08-01
Full Text Available Abstract Background Functional genomic studies involving high-throughput sequencing and tiling array applications, such as ChIP-seq and ChIP-chip, generate large numbers of experimentally-derived signal peaks across the genome under study. In analyzing these loci to determine their potential regulatory functions, areas of signal enrichment must be considered relative to proximal genes and regulatory elements annotated throughout the target genome Regions of chromatin association by transcriptional regulators should be distinguished as individual binding sites in order to enhance downstream analyses, such as the identification of known and novel consensus motifs. Results PeakAnalyzer is a set of high-performance utilities for the automated processing of experimentally-derived peak regions and annotation of genomic loci. The programs can accurately subdivide multimodal regions of signal enrichment into distinct subpeaks corresponding to binding sites or chromatin modifications, retrieve genomic sequences encompassing the computed subpeak summits, and identify positional features of interest such as intersection with exon/intron gene components, proximity to up- or downstream transcriptional start sites and cis-regulatory elements. The software can be configured to run either as a pipeline component for high-throughput analyses, or as a cross-platform desktop application with an intuitive user interface. Conclusions PeakAnalyzer comprises a number of utilities essential for ChIP-seq and ChIP-chip data analysis. High-performance implementations are provided for Unix pipeline integration along with a GUI version for interactive use. Source code in C++ and Java is provided, as are native binaries for Linux, Mac OS X and Windows systems.
Experiment list: SRX186742 [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available l_provider=ATCC || datatype=ChipSeq || datatype description=Chromatin IP Sequencing || antibody antibodydesc...ription=Rabbit polyclonal antibody raised against a peptide corresponding to the ...C-terminus of H2AZ. Antibody Target: H2AZ || antibody targetdescription=H2A.Z is a sequence variant of Histone H2A. || antibody... vendorname=Millipore || antibody vendorid=07-594 || controlid=wgEncodeEH003076 || replic...ate=1,2 || softwareversion=ScriptureVPaperR3 || cell sex=M || antibody=H2A.Z || antibody antibody
Experiment list: SRX186752 [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available aterial_provider=Lonza || datatype=ChipSeq || datatype description=Chromatin IP Sequencing || antibody antibody...description=Rabbit polyclonal antibody raised against a peptide corresponding ...to the C-terminus of H2AZ. Antibody Target: H2AZ || antibody targetdescription=H2A.Z is a sequence variant of Histone H2A. || antibod...y vendorname=Millipore || antibody vendorid=07-594 || controlid=wgEncodeEH000060 ||... replicate=1,2 || softwareversion=ScriptureVPaperR3 || cell sex=U || antibody=H2A.Z || antibody antibody
Experiment list: SRX186726 [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available rovider=Lonza || datatype=ChipSeq || datatype description=Chromatin IP Sequencing || antibody antibodydescri...terminus of H2AZ. Antibody Target: H2AZ || antibody targetdescription=H2A.Z is a sequence variant of Histone H2A. || antibody... vendorname=Millipore || antibody vendorid=07-594 || controlid=wgEncodeEH000105 || replicat...e=1,2 || softwareversion=ScriptureVPaperR3 || cell sex=U || antibody=H2A.Z || antibody antibody...description=Rabbit polyclonal antibody raised against a peptide corresponding to the C-terminu
Experiment list: SRX186723 [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available K || biomaterial_provider=Lonza || datatype=ChipSeq || datatype description=Chromatin IP Sequencing || antibody antibody...description=Rabbit polyclonal antibody raised against a peptide conta...ining K79 di-methylation. Antibody Target: H3K79me2 || antibody targetdescription=H3K79me2 is a mark of the ...dy vendorname=Active Motif || antibody vendorid=39143 ||... controlid=wgEncodeEH000072 || replicate=1,2 || softwareversion=ScriptureVPaperR3 || cell sex=M || antibody=H3K79me2 || antibody anti
Experiment list: SRX190252 [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available -1 || cell organism=human || cell description=pancreatic carcinoma, (PMID: 1140870) PANC-1 was established from a panc...SRX190252 hg19 Input control Input control Pancreas PANC-1 Tissue=Pancreas/Duct|Dis...ease=Epithelioid Carcinoma 117194289,90.9,30.1,1440 GSM1010796: HudsonAlpha ChipSeq PANC-1 RevXlinkChromatin...atin IP Sequencing || controlid=SL3776,SL2340 || labexpid=SL3776,SL2340 || cell=PANC...reatic carcinoma, which was extracted via pancreatico-duodenectomy specimen from a 56-year-old
Proteomic interrogation of human chromatin.
Directory of Open Access Journals (Sweden)
Mariana P Torrente
Full Text Available Chromatin proteins provide a scaffold for DNA packaging and a basis for epigenetic regulation and genomic maintenance. Despite understanding its functional roles, mapping the chromatin proteome (i.e. the "Chromatome" is still a continuing process. Here, we assess the biological specificity and proteomic extent of three distinct chromatin preparations by identifying proteins in selected chromatin-enriched fractions using mass spectrometry-based proteomics. These experiments allowed us to produce a chromatin catalog, including several proteins ranging from highly abundant histone proteins to less abundant members of different chromatin machinery complexes. Using a Normalized Spectral Abundance Factor approach, we quantified relative abundances of the proteins across the chromatin enriched fractions giving a glimpse into their chromosomal abundance. The large-scale data sets also allowed for the discovery of a variety of novel post-translational modifications on the identified chromatin proteins. With these comparisons, we find one of the probed methods to be qualitatively superior in specificity for chromatin proteins, but inferior in proteomic extent, evidencing a compromise that must be made between biological specificity and broadness of characterization. Additionally, we attempt to identify proteins in eu- and heterochromatin, verifying the enrichments by characterizing the post-translational modifications detected on histone proteins from these chromatin regions. In summary, our results provide insights into the value of different methods to extract chromatin-associated proteins and provide starting points to study the factors that may be involved in directing gene expression and other chromatin-related processes.
van Driel, R.
2007-01-01
Chromatin molecules have properties that set them aside from all other biomacromolecules in the cell. (i) Chromosomes, which are single chromatin molecules, are the largest macromolecules in eukaryotic cells. (ii) Chromatin molecules carry the cell's genetic and epigenetic information and all
Analysis of Myc-induced histone modifications on target chromatin.
Directory of Open Access Journals (Sweden)
Francesca Martinato
Full Text Available The c-myc proto-oncogene is induced by mitogens and is a central regulator of cell growth and differentiation. The c-myc product, Myc, is a transcription factor that binds a multitude of genomic sites, estimated to be over 10-15% of all promoter regions. Target promoters generally pre-exist in an active or poised chromatin state that is further modified by Myc, contributing to fine transcriptional regulation (activation or repression of the afferent gene. Among other mechanisms, Myc recruits histone acetyl-transferases to target chromatin and locally promotes hyper-acetylation of multiple lysines on histones H3 and H4, although the identity and combination of the modified lysines is unknown. Whether Myc dynamically regulates other histone modifications (or marks at its binding sites also remains to be addressed. Here, we used quantitative chromatin immunoprecipitation (qChIP to profile a total of 24 lysine-acetylation and -methylation marks modulated by Myc at target promoters in a human B-cell line with a regulatable c-myc transgene. Myc binding promoted acetylation of multiple lysines, primarily of H3K9, H3K14, H3K18, H4K5 and H4K12, but significantly also of H4K8, H4K91 and H2AK5. Dimethylation of H3K79 was also selectively induced at target promoters. A majority of target promoters showed co-induction of multiple marks - in various combinations - correlating with recruitment of the two HATs tested (Tip60 and HBO1, incorporation of the histone variant H2A.Z and transcriptional activation. Based on this and previous findings, we surmise that Myc recruits the Tip60/p400 complex to achieve a coordinated histone acetylation/exchange reaction at activated promoters. Our data are also consistent with the additive and redundant role of multiple acetylation events in transcriptional activation.
Directory of Open Access Journals (Sweden)
Syed M Meeran
Full Text Available Breast cancer is the most common cancer and the leading cause of cancer death in women. Although tamoxifen therapy is successful for some patients, it does not provide adequate benefit for those who have estrogen receptor (ER-negative cancers. Therefore, we approached novel treatment strategies by combining two potential bioactive dietary supplements for the reactivation of ERα expression for effective treatment of ERα-negative breast cancer with tamoxifen. Bioactive dietary supplements such as green tea polyphenols (GTPs and sulforaphane (SFN inhibit DNA methyltransferases (DNMTs and histone deacetylases (HDACs, respectively, which are of central importance to cancer prevention. In the present study, we have observed that treatment of ERα-negative breast cancer cells with GTPs and SFN alone or in combination leads to the reactivation of ERα expression. The combination of 20 µg/mL GTPs and 5 µM SFN was found to be the optimal dose of ERα-reactivation at 3 days in MDA-MB-231 cells. The reactivation of ERα expression was consistently correlated with ERα promoter hypomethylation and hyperacetylation. Chromatin immunoprecipitation (ChIP analysis of the ERα promoter revealed that GTPs and SFN altered the binding of ERα-transcriptional co-repressor complex thereby contributing to ERα-reactivation. In addition, treatment with tamoxifen in combination with GTPs and SFN significantly increased both cell death and inhibition of cellular proliferation in MDA-MB-231 cells in comparison to treatment with tamoxifen alone. Collectively, our findings suggest that a novel combination of bioactive-HDAC inhibitors with bioactive-demethylating agents is a promising strategy for the effective treatment of hormonal refractory breast cancer with available anti-estrogens.
Experiment list: SRX186686 [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available me=NH-A || biomaterial_provider=Lonza || datatype=ChipSeq || datatype description=Chromatin IP Sequencing || antibody antibody...description=Rabbit polyclonal antibody raised against a peptide... containing K79 di-methylation. Antibody Target: H3K79me2 || antibody targetdescription=H3K79me2 is a mark o...ation marks (K36me3). || antibody vendorname=Active Motif || antibody vendorid=39...143 || controlid=wgEncodeEH001027 || replicate=1,2 || softwareversion=ScriptureVPaperR3 || cell sex=U || antibody=H3K79me2 || antibod
Experiment list: SRX186696 [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available nza || datatype=ChipSeq || datatype description=Chromatin IP Sequencing || antibody antibodydescription=Rabbit polyclonal antibody...f H2AZ. Antibody Target: H2AZ || antibody targetdescription=H2A.Z is a sequence variant of Histone H2A. || antibody... vendorname=Millipore || antibody vendorid=07-594 || controlid=wgEncodeEH000093 || replicate=1,2 || s...oftwareversion=ScriptureVPaperR3 || cell sex=U || antibody=H2A.Z || antibody antibody...description=Rabbit polyclonal antibody raised against a peptide corresponding to the C-terminus of H2AZ.
Experiment list: SRX186665 [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available rovider=DSMZ || datatype=ChipSeq || datatype description=Chromatin IP Sequencing || antibody antibodydescrip...ation. Antibody Target: H3K79me2 || antibody targetdescription=H3K79me2 is a mark of the transcriptional tra...nsition region - the region between the initiation marks (K4me3, etc) and the elongation marks (K36me3). || antibody... vendorname=Active Motif || antibody vendorid=39143 || controlid=wgEncode...EH002434 || replicate=1,2 || softwareversion=ScriptureVPaperR3 || cell sex=M || antibody=H3K79me2 || antibody antibody
Experiment list: SRX186661 [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available r=DSMZ || datatype=ChipSeq || datatype description=Chromatin IP Sequencing || antibody antibodydescription=Rabbit polyclonal antibody...s of H2AZ. Antibody Target: H2AZ || antibody targetdescription=H2A.Z is a sequence variant of Histone H2A. || antibody... vendorname=Millipore || antibody vendorid=07-594 || controlid=wgEncodeEH002434 || replicate=1,2 |...| softwareversion=ScriptureVPaperR3 || cell sex=M || antibody=H2A.Z || antibody antibody...description=Rabbit polyclonal antibody raised against a peptide corresponding to the C-terminus of H2
Combining genomic and proteomic approaches for epigenetics research
Han, Yumiao; Garcia, Benjamin A
2014-01-01
Epigenetics is the study of changes in gene expression or cellular phenotype that do not change the DNA sequence. In this review, current methods, both genomic and proteomic, associated with epigenetics research are discussed. Among them, chromatin immunoprecipitation (ChIP) followed by sequencing and other ChIP-based techniques are powerful techniques for genome-wide profiling of DNA-binding proteins, histone post-translational modifications or nucleosome positions. However, mass spectrometry-based proteomics is increasingly being used in functional biological studies and has proved to be an indispensable tool to characterize histone modifications, as well as DNA–protein and protein–protein interactions. With the development of genomic and proteomic approaches, combination of ChIP and mass spectrometry has the potential to expand our knowledge of epigenetics research to a higher level. PMID:23895656
Chromatin replication and epigenome maintenance
DEFF Research Database (Denmark)
Alabert, Constance; Groth, Anja
2012-01-01
Stability and function of eukaryotic genomes are closely linked to chromatin structure and organization. During cell division the entire genome must be accurately replicated and the chromatin landscape reproduced on new DNA. Chromatin and nuclear structure influence where and when DNA replication...... initiates, whereas the replication process itself disrupts chromatin and challenges established patterns of genome regulation. Specialized replication-coupled mechanisms assemble new DNA into chromatin, but epigenome maintenance is a continuous process taking place throughout the cell cycle. If DNA...
Chromatin Flavors: Chromatin composition and domain organization in Drosophila melanogaster
J.G. van Bemmel (Joke)
2012-01-01
textabstractChromatin was originally identified by W. Flemming in 1882 as not much more than the stainable substance of the cell nucleus. Flemming named this substance according to the Greek word “chroma”, meaning color. In 1911 chromatin was characterized as proteins, named histones, that
Heterogeneous chromatin target model
International Nuclear Information System (INIS)
Watanabe, Makoto
1996-01-01
The higher order structure of the entangled chromatin fibers in a chromosome plays a key role in molecular control mechanism involved in chromosome mutation due to ionizing radiations or chemical mutagens. The condensed superstructure of chromatin is not so rigid and regular as has been postulated in general. We have proposed a rheological explanation for the flexible network system ('chromatin network') that consists of the fluctuating assembly of nucleosome clusters linked with supertwisting DNA in a chromatin fiber ('Supertwisting Particulate Model'). We have proposed a 'Heterosensitive Target Model' for cellular radiosensitivity that is a modification of 'Heterogeneous Target Model'. The heterogeneity of chromatin target is derived from the highly condensed organization of chromatin segments consist of unstable and fragile sites in the fluctuating assembly of nucleosome clusters, namely 'supranucleosomal particles' or 'superbeads'. The models have been principally supported by our electron microscopic experiments employing 'surface - spreading whole - mount technique' since 1967. However, some deformation and artifacts in the chromatin structure are inevitable with these electron microscopic procedures. On the contrary, the 'atomic force microscope (AFM)' can be operated in liquid as well as in the air. A living specimen can be examined without any preparative procedures. Micromanipulation of the isolated chromosome is also possible by the precise positional control of a cantilever on the nanometer scale. The living human chromosomes were submerged in a solution of culture medium and observed by AFM using a liquid immersion cell. The surface - spreading whole - mount technique was applicable for this observation. The particulate chromatin segments of nucleosome clusters were clearly observed within mitotic human chromosomes in a living hydrated condition. These findings support the heterogeneity of chromatin target in a living cell. (J.P.N.)
Chromatin replication and histone dynamics
DEFF Research Database (Denmark)
Alabert, Constance; Jasencakova, Zuzana; Groth, Anja
2017-01-01
Inheritance of the DNA sequence and its proper organization into chromatin is fundamental for genome stability and function. Therefore, how specific chromatin structures are restored on newly synthesized DNA and transmitted through cell division remains a central question to understand cell fate...... choices and self-renewal. Propagation of genetic information and chromatin-based information in cycling cells entails genome-wide disruption and restoration of chromatin, coupled with faithful replication of DNA. In this chapter, we describe how cells duplicate the genome while maintaining its proper...... organization into chromatin. We reveal how specialized replication-coupled mechanisms rapidly assemble newly synthesized DNA into nucleosomes, while the complete restoration of chromatin organization including histone marks is a continuous process taking place throughout the cell cycle. Because failure...
dDYRK2 and Minibrain interact with the chromatin remodelling factors SNR1 and TRX.
Kinstrie, Ross; Lochhead, Pamela A; Sibbet, Gary; Morrice, Nick; Cleghon, Vaughn
2006-08-15
The DYRKs (dual specificity tyrosine phosphorylation-regulated kinases) are a conserved family of protein kinases that autophosphorylate a tyrosine residue in their activation loop by an intra-molecular mechanism and phosphorylate exogenous substrates on serine/threonine residues. Little is known about the identity of true substrates for DYRK family members and their binding partners. To address this question, we used full-length dDYRK2 (Drosophila DYRK2) as bait in a yeast two-hybrid screen of a Drosophila embryo cDNA library. Of 14 independent dDYRK2 interacting clones identified, three were derived from the chromatin remodelling factor, SNR1 (Snf5-related 1), and three from the essential chromatin component, TRX (trithorax). The association of dDYRK2 with SNR1 and TRX was confirmed by co-immunoprecipitation studies. Deletion analysis showed that the C-terminus of dDYRK2 modulated the interaction with SNR1 and TRX. DYRK family member MNB (Minibrain) was also found to co-precipitate with SNR1 and TRX, associations that did not require the C-terminus of the molecule. dDYRK2 and MNB were also found to phosphorylate SNR1 at Thr102 in vitro and in vivo. This phosphorylation required the highly conserved DH-box (DYRK homology box) of dDYRK2, whereas the DH-box was not essential for phosphorylation by MNB. This is the first instance of phosphorylation of SNR1 or any of its homologues and implicates the DYRK family of kinases with a role in chromatin remodelling.
DEFF Research Database (Denmark)
Alabert, Constance; Bukowski-Wills, Jimi-Carlo; Lee, Sung-Po
2014-01-01
To maintain genome function and stability, DNA sequence and its organization into chromatin must be duplicated during cell division. Understanding how entire chromosomes are copied remains a major challenge. Here, we use nascent chromatin capture (NCC) to profile chromatin proteome dynamics during...... replication in human cells. NCC relies on biotin-dUTP labelling of replicating DNA, affinity purification and quantitative proteomics. Comparing nascent chromatin with mature post-replicative chromatin, we provide association dynamics for 3,995 proteins. The replication machinery and 485 chromatin factors...... such as CAF-1, DNMT1 and SUV39h1 are enriched in nascent chromatin, whereas 170 factors including histone H1, DNMT3, MBD1-3 and PRC1 show delayed association. This correlates with H4K5K12diAc removal and H3K9me1 accumulation, whereas H3K27me3 and H3K9me3 remain unchanged. Finally, we combine NCC enrichment...
Driessen, Rosalie Paula Catharina
2014-01-01
Understanding of chromatin organization and compaction in Archaea is currently limited. The genome of several megabasepairs long is folded by a set of small chromatin proteins to fit into the micron-sized cell. A first step in understanding archaeal chromatin organization is to study the action of
Experiment list: SRX186753 [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available der=Lonza || datatype=ChipSeq || datatype description=Chromatin IP Sequencing || antibody antibodydescription=Rabbit polyclonal antib...on. Antibody Target: H3K79me2 || antibody targetdescription=H3K79me2 is a mark of the transcriptional transi...tion region - the region between the initiation marks (K4me3, etc) and the elongation marks (K36me3). || antibody... vendorname=Active Motif || antibody vendorid=39143 || controlid=wgEncodeEH0...00093 || replicate=1,2 || softwareversion=ScriptureVPaperR3 || cell sex=U || antibody=H3K79me2 || antibody antibody
Alternative epigenetic chromatin states of polycomb target genes.
Directory of Open Access Journals (Sweden)
Yuri B Schwartz
2010-01-01
Full Text Available Polycomb (PcG regulation has been thought to produce stable long-term gene silencing. Genomic analyses in Drosophila and mammals, however, have shown that it targets many genes, which can switch state during development. Genetic evidence indicates that critical for the active state of PcG target genes are the histone methyltransferases Trithorax (TRX and ASH1. Here we analyze the repertoire of alternative states in which PcG target genes are found in different Drosophila cell lines and the role of PcG proteins TRX and ASH1 in controlling these states. Using extensive genome-wide chromatin immunoprecipitation analysis, RNAi knockdowns, and quantitative RT-PCR, we show that, in addition to the known repressed state, PcG targets can reside in a transcriptionally active state characterized by formation of an extended domain enriched in ASH1, the N-terminal, but not C-terminal moiety of TRX and H3K27ac. ASH1/TRX N-ter domains and transcription are not incompatible with repressive marks, sometimes resulting in a "balanced" state modulated by both repressors and activators. Often however, loss of PcG repression results instead in a "void" state, lacking transcription, H3K27ac, or binding of TRX or ASH1. We conclude that PcG repression is dynamic, not static, and that the propensity of a target gene to switch states depends on relative levels of PcG, TRX, and activators. N-ter TRX plays a remarkable role that antagonizes PcG repression and preempts H3K27 methylation by acetylation. This role is distinct from that usually attributed to TRX/MLL proteins at the promoter. These results have important implications for Polycomb gene regulation, the "bivalent" chromatin state of embryonic stem cells, and gene expression in development.
Directory of Open Access Journals (Sweden)
Deepti Jain
Full Text Available Plants respond to different forms of stresses by inducing transcription of a common and distinct set of genes by concerted actions of a cascade of transcription regulators. We previously reported that a gene, CaZF encoding a C2H2-zinc finger family protein from chickpea (Cicer arietinum imparted high salinity tolerance when expressed in tobacco plants. We report here that in addition to promoting tolerance against dehydration, salinity and high temperature, the CaZF overexpressing plants exhibited similar phenotype of growth and development like the plants overexpressing CAP2, encoding an AP2-family transcription factor from chickpea. To investigate any relationship between these two genes, we performed gene expression analysis in the overexpressing plants, promoter-reporter analysis and chromatin immunoprecipitation. A number of transcripts that exhibited enhanced accumulation upon expression of CAP2 or CaZF in tobacco plants were found common. Transient expression of CAP2 in chickpea leaves resulted in increased accumulation of CaZF transcript. Gel mobility shift and transient promoter-reporter assays suggested that CAP2 activates CaZF promoter by interacting with C-repeat elements (CRTs in CaZF promoter. Chromatin immunoprecipitation (ChIP assay demonstrated an in vivo interaction of CAP2 protein with CaZF promoter.
Lybæk, Helle; de Bruijn, Diederik; den Engelsman-van Dijk, Anke H A; Vanichkina, Darya; Nepal, Chirag; Brendehaug, Atle; Houge, Gunnar
2014-03-01
It was recently shown that duplications of the RevSex element, located 0.5 Mb upstream of SOX9, cause XX-disorder of sex development (DSD), and that deletions cause XY-DSD. To explore how a 148 kb RevSex duplication could have turned on gonadal SOX9 expression in the absence of SRY in an XX-male, we examined the chromatin landscape in primary skin fibroblast cultures from the index, his RevSex duplication-carrier father and six controls. The ENCODE project supports the notion that chromatin state maps show overlap between different cell types, i.e., that our study of fibroblasts could be of biological relevance. We examined the SOX9 regulatory region by high-resolution ChIP-on-chip experiments (a kind of "chromatin-CGH") and DNA methylation investigations. The RevSex duplication was associated with chromatin changes predicting better accessibility of the SRY-responsive TESCO enhancer region 14-15 kb upstream of SOX9. Four kb downstream of the TESCO evolutionary conserved region, a peak of the enhancer/promoter-associated H3K4me3 mark was found together with a major dip of the repressive H3K9me3 chromatin mark. Similar differences were also found when three control males were compared with three control females. A marked male/female difference was a more open chromatin signature in males starting ~400 kb upstream of SOX9 and increasing toward the SOX9 promoter. In the RevSex duplication-carrier father, two positions of DNA hypomethylation were also found, one corresponding to the H3K4me3 peak mentioned above. Our results suggest that the RevSex duplication could operate by inducing long-range epigenetic changes. Furthermore, the differences in chromatin state maps between males and females suggest that the Y chromosome or X chromosome dosage may affect chromatin conformation, i.e., that sex-dependent gene regulation may take place by chromatin modification.
Chromatin Remodelers: From Function to Dysfunction
Directory of Open Access Journals (Sweden)
Gernot Längst
2015-06-01
Full Text Available Chromatin remodelers are key players in the regulation of chromatin accessibility and nucleosome positioning on the eukaryotic DNA, thereby essential for all DNA dependent biological processes. Thus, it is not surprising that upon of deregulation of those molecular machines healthy cells can turn into cancerous cells. Even though the remodeling enzymes are very abundant and a multitude of different enzymes and chromatin remodeling complexes exist in the cell, the particular remodeling complex with its specific nucleosome positioning features must be at the right place at the right time in order to ensure the proper regulation of the DNA dependent processes. To achieve this, chromatin remodeling complexes harbor protein domains that specifically read chromatin targeting signals, such as histone modifications, DNA sequence/structure, non-coding RNAs, histone variants or DNA bound interacting proteins. Recent studies reveal the interaction between non-coding RNAs and chromatin remodeling complexes showing importance of RNA in remodeling enzyme targeting, scaffolding and regulation. In this review, we summarize current understanding of chromatin remodeling enzyme targeting to chromatin and their role in cancer development.
Effect of hyperthermia on replicating chromatin
International Nuclear Information System (INIS)
Warters, R.L.; Roti Roti, J.L.
1981-01-01
The extent of heat-induced structural alterations in chromatin containing nascent (pulse-labeled) DNA was assayed using the enzyme micrococcal nuclease. The basic nucleosome structure in nascent and mature chromatin of S-phase cells appeared unaltered for up to 16 hr after exposure to hyperthermic temperatures as high as 48 0 C for 15 min. However, the rate of nuclease digestion of DNA in both nascent and mature chromatin is inhibited following exposure to hyperthermic temperatures. In unheated cells, pulse-labeled nascent DNA matured into mature chromatin structure with a half-time of 2.5 min. The half-time for the maturation of pulse-labeled DNA from nascent into mature chromatin increased in a linear manner as a function of increasing temperature of exposure with constant heating time at temperatures above 43 0 C. Both the reduced nuclease digestibility of nascent DNA and the increased time for chromatin structural changes could be due to the increased protein mass of chromatin following hyperthermia
Chromatin maturation depends on continued DNA-replication
International Nuclear Information System (INIS)
Schlaeger, E.J.; Puelm, W.; Knippers, R.
1983-01-01
The structure of [ 3 H]thymidine pulse-labeled chromatin in lymphocytes differs from that of non-replicating chromatin by several operational criteria which are related to the higher nuclease sensitivity of replicating chromatin. These structural features of replicating chromatin rapidly disappear when the [ 3 H]thymidine pulse is followed by a chase in the presence of an excess of non-radioactive thymidine. However, when the rate of DNA replication is reduced, as in cycloheximide-treated lymphocytes, chromatin maturation is retarded. No chromatin maturation is observed when nuclei from pulse-labeled lymphocytes are incubated in vitro in the absence of DNA precursors. In contrast, when these nuclei are incubated under conditions known to be optimal for DNA replication, the structure of replicating chromatin is efficiently converted to that of 'mature', non-replicating chromatin. The authors conclude that the properties of nascent DNA and/or the distance from the replication fork are important factors in chromatin maturation. (Auth.)
DEFF Research Database (Denmark)
Södersten, Erik; Feyder, Michael; Lerdrup, Mads
2014-01-01
. Here, we present in vivo evidence for a previously unrecognized plasticity of PcG-repressed genes in terminally differentiated brain neurons of parkisonian mice. We show that acute administration of the dopamine precursor, L-DOPA, induces a remarkable increase in H3K27me3S28 phosphorylation....... The induction of the H3K27me3S28p histone mark specifically occurs in medium spiny neurons expressing dopamine D1 receptors and is dependent on Msk1 kinase activity and DARPP-32-mediated inhibition of protein phosphatase-1. Chromatin immunoprecipitation (ChIP) experiments showed that increased H3K27me3S28p...
The Chromatin Scaffold Protein SAFB1 Renders Chromatin Permissive for DNA Damage Signaling
DEFF Research Database (Denmark)
Altmeyer, Matthias; Toledo Lazaro, Luis Ignacio; Gudjonsson, Thorkell
2013-01-01
Although the general relevance of chromatin modifications for genotoxic stress signaling, cell-cycle checkpoint activation, and DNA repair is well established, how these modifications reach initial thresholds in order to trigger robust responses remains largely unexplored. Here, we identify...... the chromatin-associated scaffold attachment factor SAFB1 as a component of the DNA damage response and show that SAFB1 cooperates with histone acetylation to allow for efficient γH2AX spreading and genotoxic stress signaling. SAFB1 undergoes a highly dynamic exchange at damaged chromatin in a poly......(ADP-ribose)-polymerase 1- and poly(ADP-ribose)-dependent manner and is required for unperturbed cell-cycle checkpoint activation and guarding cells against replicative stress. Altogether, our data reveal that transient recruitment of an architectural chromatin component is required in order to overcome physiological...
Directory of Open Access Journals (Sweden)
Sebastian Weiterer
Full Text Available Chromatin immunoprecipitation in combination with a genome-wide analysis via high-throughput sequencing is the state of the art method to gain genome-wide representation of histone modification or transcription factor binding profiles. However, chromatin immunoprecipitation analysis in the context of human experimental samples is limited, especially in the case of blood cells. The typically extremely low yields of precipitated DNA are usually not compatible with library amplification for next generation sequencing. We developed a highly reproducible protocol to present a guideline from the first step of isolating monocytes from a blood sample to analyse the distribution of histone modifications in a genome-wide manner.The protocol describes the whole work flow from isolating monocytes from human blood samples followed by a high-sensitivity and small-scale chromatin immunoprecipitation assay with guidance for generating libraries compatible with next generation sequencing from small amounts of immunoprecipitated DNA.
Lim, Daniel A; Suárez-Fariñas, Mayte; Naef, Felix; Hacker, Coleen R; Menn, Benedicte; Takebayashi, Hirohide; Magnasco, Marcelo; Patil, Nila; Alvarez-Buylla, Arturo
2006-01-01
Neural stem cells and neurogenesis persist in the adult mammalian brain subventricular zone (SVZ). Cells born in the rodent SVZ migrate to the olfactory bulb (Ob) where they differentiate into interneurons. To determine the gene expression and functional profile of SVZ neurogenesis, we performed three complementary sets of transcriptional analysis experiments using Affymetrix GeneChips: (1) comparison of adult mouse SVZ and Ob gene expression profiles with those of the striatum, cerebral cortex, and hippocampus; (2) profiling of SVZ stem cells and ependyma isolated by fluorescent-activated cell sorting (FACS); and (3) analysis of gene expression changes during in vivo SVZ regeneration after anti-mitotic treatment. Gene Ontology (GO) analysis of data from these three separate approaches showed that in adult SVZ neurogenesis, RNA splicing and chromatin remodeling are biological processes as statistically significant as cell proliferation, transcription, and neurogenesis. In non-neurogenic brain regions, RNA splicing and chromatin remodeling were not prominent processes. Fourteen mRNA splicing factors including Sf3b1, Sfrs2, Lsm4, and Khdrbs1/Sam68 were detected along with 9 chromatin remodeling genes including Mll, Bmi1, Smarcad1, Baf53a, and Hat1. We validated the transcriptional profile data with Northern blot analysis and in situ hybridization. The data greatly expand the catalogue of cell cycle components, transcription factors, and migration genes for adult SVZ neurogenesis and reveal RNA splicing and chromatin remodeling as prominent biological processes for these germinal cells.
Chromatin dynamics in genome stability
DEFF Research Database (Denmark)
Nair, Nidhi; Shoaib, Muhammad; Sørensen, Claus Storgaard
2017-01-01
Genomic DNA is compacted into chromatin through packaging with histone and non-histone proteins. Importantly, DNA accessibility is dynamically regulated to ensure genome stability. This is exemplified in the response to DNA damage where chromatin relaxation near genomic lesions serves to promote...... access of relevant enzymes to specific DNA regions for signaling and repair. Furthermore, recent data highlight genome maintenance roles of chromatin through the regulation of endogenous DNA-templated processes including transcription and replication. Here, we review research that shows the importance...... of chromatin structure regulation in maintaining genome integrity by multiple mechanisms including facilitating DNA repair and directly suppressing endogenous DNA damage....
A ChIP-chip approach reveals a novel role for transcription factor IRF1 in the DNA damage response.
Frontini, Mattia; Vijayakumar, Meeraa; Garvin, Alexander; Clarke, Nicole
2009-03-01
IRF1 is a transcription factor that regulates key processes in the immune system and in tumour suppression. To gain further insight into IRF1's role in these processes, we searched for new target genes by performing chromatin immunoprecipitation coupled to a CpG island microarray (ChIP-chip). Using this approach we identified 202 new IRF1-binding sites with high confidence. Functional categorization of the target genes revealed a surprising cadre of new roles that can be linked to IRF1. One of the major functional categories was the DNA damage response pathway. In order to further validate our findings, we show that IRF1 can regulate the mRNA expression of a number of the DNA damage response genes in our list. In particular, we demonstrate that the mRNA and protein levels of the DNA repair protein BRIP1 [Fanconi anemia gene J (FANC J)] are upregulated after IRF1 over-expression. We also demonstrate that knockdown of IRF1 by siRNA results in loss of BRIP1 expression, abrogation of BRIP1 foci after DNA interstrand crosslink (ICL) damage and hypersensitivity to the DNA crosslinking agent, melphalan; a characteristic phenotype of FANC J cells. Taken together, our data provides a more complete understanding of the regulatory networks controlled by IRF1 and reveals a novel role for IRF1 in regulating the ICL DNA damage response.
A ChIP–chip approach reveals a novel role for transcription factor IRF1 in the DNA damage response
Frontini, Mattia; Vijayakumar, Meeraa; Garvin, Alexander; Clarke, Nicole
2009-01-01
IRF1 is a transcription factor that regulates key processes in the immune system and in tumour suppression. To gain further insight into IRF1's role in these processes, we searched for new target genes by performing chromatin immunoprecipitation coupled to a CpG island microarray (ChIP–chip). Using this approach we identified 202 new IRF1-binding sites with high confidence. Functional categorization of the target genes revealed a surprising cadre of new roles that can be linked to IRF1. One of the major functional categories was the DNA damage response pathway. In order to further validate our findings, we show that IRF1 can regulate the mRNA expression of a number of the DNA damage response genes in our list. In particular, we demonstrate that the mRNA and protein levels of the DNA repair protein BRIP1 [Fanconi anemia gene J (FANC J)] are upregulated after IRF1 over-expression. We also demonstrate that knockdown of IRF1 by siRNA results in loss of BRIP1 expression, abrogation of BRIP1 foci after DNA interstrand crosslink (ICL) damage and hypersensitivity to the DNA crosslinking agent, melphalan; a characteristic phenotype of FANC J cells. Taken together, our data provides a more complete understanding of the regulatory networks controlled by IRF1 and reveals a novel role for IRF1 in regulating the ICL DNA damage response. PMID:19129219
Borysov, Sergiy; Bryant, Victoria L; Alexandrow, Mark G
2015-01-01
Of critical importance to many of the events underlying transcriptional control of gene expression are modifications to core and linker histones that regulate the accessibility of trans-acting factors to the DNA substrate within the context of chromatin. Likewise, control over the initiation of DNA replication, as well as the ability of the replication machinery to proceed during elongation through the multiple levels of chromatin condensation that are likely to be encountered, is known to involve the creation of chromatin accessibility. In the latter case, chromatin access will likely need to be a transient event so as to prevent total genomic unraveling of the chromatin that would be deleterious to cells. While there are many molecular and biochemical approaches in use to study histone changes and their relationship to transcription and chromatin accessibility, few techniques exist that allow a molecular dissection of the events underlying DNA replication control as it pertains to chromatin changes and accessibility. Here, we outline a novel experimental strategy for addressing the ability of specific proteins to induce large-scale chromatin unfolding (decondensation) in vivo upon site-specific targeting to an engineered locus. Our laboratory has used this powerful system in novel ways to directly address the ability of DNA replication proteins to create chromatin accessibility, and have incorporated modifications to the basic approach that allow for a molecular genetic analysis of the mechanisms and associated factors involved in causing chromatin decondensation by a protein of interest. Alternative approaches involving co-expression of other proteins (competitors or stimulators), concurrent drug treatments, and analysis of co-localizing histone modifications are also addressed, all of which are illustrative of the utility of this experimental system for extending basic findings to physiologically relevant mechanisms. Although used by our group to analyze
UV-induced structural changes in chromatin
International Nuclear Information System (INIS)
Lang, H.; Zimmer, C.; Vengerov, Yu.Yu.
1985-01-01
UV-induced structural alterations of chromatin were studied by means of CD, electron microscopic, and gel electrophoretic measurements. The results indicate that chromatin undergoes serious structural changes after irradiation even at very low fluences. In the low fluence range the structural transitions from the higher ordered chromatin structure to the unfolded state occur without detectable changes in the content of histone H1 and of the core histones. Histone H1 disappears only at fluences above 10 kJ/m 2 . Furthermore, DNA in chromatin is much more sensitive against UV-irradiation and shows a higher degree of strand scission relative to free DNA. While fragmentation in free DNA occurs at fluences above 15 kJ/m 2 , it occurs even at 5.5 kJ/m 2 in the case of chromatin. The biological meaning of the observed UV-induced structural alterations of chromatin is discussed. (author)
Neutron-scattering studies of chromatin
International Nuclear Information System (INIS)
Bradbury, E.M.; Baldwin, J.P.; Carpenter, B.G.; Hjelm, R.P.; Hancock, R.; Ibel, K.
1976-01-01
It is clear that a knowledge of the basic molecular structure of chromatin is a prerequisite for any progress toward an understanding of chromosome organization. With a two-component system, protein and nucleic acid, neutrons have a particularly powerful application to studies of the spatial arrangements of these components because of the ability, by contrast matching with H 2 O-D 2 O mixtures, to obtain neutron-scattering data on the individual components. With this approach it has been shown that the neutron diffraction of chromatin is consistent with a ''beads on a string'' model in which the bead consists of a protein core with DNA coiled on the outside. However, because chromatin is a gel and gives limited structural data, confirmation of such a model requires extension of the neutron studies by deuteration of specific chromatin components and the isolation of chromatin subunits. Although these studies are not complete, the neutron results so far obtained support the subunit model described above
Chromatin challenges during DNA replication and repair
DEFF Research Database (Denmark)
Groth, Anja; Rocha, Walter; Verreault, Alain
2007-01-01
Inheritance and maintenance of the DNA sequence and its organization into chromatin are central for eukaryotic life. To orchestrate DNA-replication and -repair processes in the context of chromatin is a challenge, both in terms of accessibility and maintenance of chromatin organization. To meet...... the challenge of maintenance, cells have evolved efficient nucleosome-assembly pathways and chromatin-maturation mechanisms that reproduce chromatin organization in the wake of DNA replication and repair. The aim of this Review is to describe how these pathways operate and to highlight how the epigenetic...... landscape may be stably maintained even in the face of dramatic changes in chromatin structure....
Spectroscopic study of fast-neutron-irradiated chromatin
International Nuclear Information System (INIS)
Radu, L.; Gazdaru, D.; Constantinescu, B.
2004-01-01
The effects produced by fast neutrons (0-100 Gy) on chromatin structure were analyzed by (i) [ 1 H]-NMR spectroscopy, (ii) time resolved spectroscopy, and (iii) fluorescence resonance energy transfer (FRET). Two types of chromatin were tested: (i) a chromatin from a normal tissue (liver of Wistar rats) and (ii) a chromatin from a tumoral tissue (Guerin limphotrope epithelioma, a rat solid tumor). The fast-neutron action on chromatin determines greater values of the [ 1 H]-NMR transverse relaxation time, indicating a more injured structure. Time-resolved fluorescence measurements show that the relative contribution of the excited state lifetime of bound ethidium bromide to chromatin DNA diminishes with increasing irradiation doses. This reflects the damage that occurs in DNA structure: production of single- and double-strand breaks due to sugar and base modifications. By the FRET method, the distance between dansyl chloride and acridine orange coupled at chromatin was determined. This distance increases upon fast-neutron action. The radiosensitivity of the tumor tissue chromatin seems higher than that of the normal tissue chromatin, probably because of its higher (loose) euchromatin/(compact) heterochromatin ratio. As the values of the physical parameters analyzed are specific for a determined dose, the establishment of these parameters may constitute a criterion for the microdosimetry of chromatin radiolesions produced by fast neutrons. (author)
Spectroscopic study of fast-neutron-irradiated chromatin
Energy Technology Data Exchange (ETDEWEB)
Radu, L. [V. Babes National Inst., Dept. of Molecular Genetics, Bucharest (Romania)]. E-mail: serbanradu@pcnet.ro; Gazdaru, D. [Bucharest Univ., Dept. of Biophysics, Physics Faculty, Bucharest (Romania); Constantinescu, B. [H. Hulubei National Inst., Dept. of Cyclotron, Bucharest (Romania)
2004-02-01
The effects produced by fast neutrons (0-100 Gy) on chromatin structure were analyzed by (i) [{sup 1}H]-NMR spectroscopy, (ii) time resolved spectroscopy, and (iii) fluorescence resonance energy transfer (FRET). Two types of chromatin were tested: (i) a chromatin from a normal tissue (liver of Wistar rats) and (ii) a chromatin from a tumoral tissue (Guerin limphotrope epithelioma, a rat solid tumor). The fast-neutron action on chromatin determines greater values of the [{sup 1}H]-NMR transverse relaxation time, indicating a more injured structure. Time-resolved fluorescence measurements show that the relative contribution of the excited state lifetime of bound ethidium bromide to chromatin DNA diminishes with increasing irradiation doses. This reflects the damage that occurs in DNA structure: production of single- and double-strand breaks due to sugar and base modifications. By the FRET method, the distance between dansyl chloride and acridine orange coupled at chromatin was determined. This distance increases upon fast-neutron action. The radiosensitivity of the tumor tissue chromatin seems higher than that of the normal tissue chromatin, probably because of its higher (loose) euchromatin/(compact) heterochromatin ratio. As the values of the physical parameters analyzed are specific for a determined dose, the establishment of these parameters may constitute a criterion for the microdosimetry of chromatin radiolesions produced by fast neutrons. (author)
Chromatin remodeling, development and disease
International Nuclear Information System (INIS)
Ko, Myunggon; Sohn, Dong H.; Chung, Heekyoung; Seong, Rho H.
2008-01-01
Development is a stepwise process in which multi-potent progenitor cells undergo lineage commitment, differentiation, proliferation and maturation to produce mature cells with restricted developmental potentials. This process is directed by spatiotemporally distinct gene expression programs that allow cells to stringently orchestrate intricate transcriptional activation or silencing events. In eukaryotes, chromatin structure contributes to developmental progression as a blueprint for coordinated gene expression by actively participating in the regulation of gene expression. Changes in higher order chromatin structure or covalent modification of its components are considered to be critical events in dictating lineage-specific gene expression during development. Mammalian cells utilize multi-subunit nuclear complexes to alter chromatin structure. Histone-modifying complex catalyzes covalent modifications of histone tails including acetylation, methylation, phosphorylation and ubiquitination. ATP-dependent chromatin remodeling complex, which disrupts histone-DNA contacts and induces nucleosome mobilization, requires energy from ATP hydrolysis for its catalytic activity. Here, we discuss the diverse functions of ATP-dependent chromatin remodeling complexes during mammalian development. In particular, the roles of these complexes during embryonic and hematopoietic development are reviewed in depth. In addition, pathological conditions such as tumor development that are induced by mutation of several key subunits of the chromatin remodeling complex are discussed, together with possible mechanisms that underlie tumor suppression by the complex
Jégu, Teddy
2015-10-12
Chromatin architecture determines transcriptional accessibility to DNA and consequently gene expression levels in response to developmental and environmental stimuli. Recently, chromatin remodelers such as SWI/SNF complexes have been recognized as key regulators of chromatin architecture. To gain insight into the function of these complexes during root development, we have analyzed Arabidopsis knock-down lines for one sub-unit of SWI/SNF complexes: BAF60. Here, we show that BAF60 is a positive regulator of root development and cell cycle progression in the root meristem via its ability to down-regulate cytokinin production. By opposing both the deposition of active histone marks and the formation of a chromatin regulatory loop, BAF60 negatively regulates two crucial target genes for cytokinin biosynthesis (IPT3 and IPT7) and one cell cycle inhibitor (KRP7). Our results demonstrate that SWI/SNF complexes containing BAF60 are key factors governing the equilibrium between formation and dissociation of a chromatin loop controlling phytohormone production and cell cycle progression.
Jé gu, Teddy; Domenichini, Sé verine; Blein, Thomas; Ariel, Federico; Christ, Auré lie; Kim, SoonKap; Crespi, Martin; Boutet-Mercey, Sté phanie; Mouille, Gré gory; Bourge, Mickaë l; Hirt, Heribert; Bergounioux, Catherine; Raynaud, Cé cile; Benhamed, Moussa
2015-01-01
Chromatin architecture determines transcriptional accessibility to DNA and consequently gene expression levels in response to developmental and environmental stimuli. Recently, chromatin remodelers such as SWI/SNF complexes have been recognized as key regulators of chromatin architecture. To gain insight into the function of these complexes during root development, we have analyzed Arabidopsis knock-down lines for one sub-unit of SWI/SNF complexes: BAF60. Here, we show that BAF60 is a positive regulator of root development and cell cycle progression in the root meristem via its ability to down-regulate cytokinin production. By opposing both the deposition of active histone marks and the formation of a chromatin regulatory loop, BAF60 negatively regulates two crucial target genes for cytokinin biosynthesis (IPT3 and IPT7) and one cell cycle inhibitor (KRP7). Our results demonstrate that SWI/SNF complexes containing BAF60 are key factors governing the equilibrium between formation and dissociation of a chromatin loop controlling phytohormone production and cell cycle progression.
Methylated DNA Immunoprecipitation Analysis of Mammalian Endogenous Retroviruses.
Rebollo, Rita; Mager, Dixie L
2016-01-01
Endogenous retroviruses are repetitive sequences found abundantly in mammalian genomes which are capable of modulating host gene expression. Nevertheless, most endogenous retrovirus copies are under tight epigenetic control via histone-repressive modifications and DNA methylation. Here we describe a common method used in our laboratory to detect, quantify, and compare mammalian endogenous retrovirus DNA methylation. More specifically we describe methylated DNA immunoprecipitation (MeDIP) followed by quantitative PCR.
International Nuclear Information System (INIS)
Ryabchenko, N.I.; Ivannik, B.P.
1987-01-01
A study was made of chromatin endonucleolysis in hypotonized thymocytes incubating in digestive buffers containing different concentrations of potassium, magnesium, calcium, and mercaptoethanol. Inhibition of endonucleolysis by univalent cation during the first 20 min of incubation was followed by intensive chromatin degradation. A decrease in free potassium content retarded chromatin degradation and enhanced the inhibiting effect of the univalent cations. The regularities of changes in the rate of chromatin endonucleolysis in different digestive buffers were similar with both exposed and intact thymocytes
Estradiol-Induced Transcriptional Regulation of Long Non-Coding RNA, HOTAIR.
Bhan, Arunoday; Mandal, Subhrangsu S
2016-01-01
HOTAIR (HOX antisense intergenic RNA) is a 2.2 kb long non-coding RNA (lncRNA), transcribed from the antisense strand of homeobox C (HOXC) gene locus in chromosome 12. HOTAIR acts as a scaffolding lncRNA. It interacts and guides various chromatin-modifying complexes such as PRC2 (polycomb-repressive complex 2) and LSD1 (lysine-specific demethylase 1) to the target gene promoters leading to their gene silencing. Various studies have demonstrated that HOTAIR overexpression is associated with breast cancer. Recent studies from our laboratory demonstrate that HOTAIR is required for viability of breast cancer cells and is transcriptionally regulated by estradiol (E2) in vitro and in vivo. This chapter describes protocols for analysis of the HOTAIR promoter, cloning, transfection and dual luciferase assays, knockdown of protein synthesis by antisense oligonucleotides, and chromatin immunoprecipitation (ChIP) assay. These protocols are useful for studying the estrogen-mediated transcriptional regulation of lncRNA HOTAIR, as well as other protein coding genes and non-coding RNAs.
Quantitative ChIP-Seq Normalization Reveals Global Modulation of the Epigenome
Directory of Open Access Journals (Sweden)
David A. Orlando
2014-11-01
Full Text Available Epigenomic profiling by chromatin immunoprecipitation coupled with massively parallel DNA sequencing (ChIP-seq is a prevailing methodology used to investigate chromatin-based regulation in biological systems such as human disease, but the lack of an empirical methodology to enable normalization among experiments has limited the precision and usefulness of this technique. Here, we describe a method called ChIP with reference exogenous genome (ChIP-Rx that allows one to perform genome-wide quantitative comparisons of histone modification status across cell populations using defined quantities of a reference epigenome. ChIP-Rx enables the discovery and quantification of dynamic epigenomic profiles across mammalian cells that would otherwise remain hidden using traditional normalization methods. We demonstrate the utility of this method for measuring epigenomic changes following chemical perturbations and show how reference normalization of ChIP-seq experiments enables the discovery of disease-relevant changes in histone modification occupancy.
Zhang, Ye; Wong, Michael; Hada, Megumi; Wu, Honglu
2015-01-01
Microgravity has been shown to alter global gene expression patterns and protein levels both in cultured cells and animal models. It has been suggested that the packaging of chromatin fibers in the interphase nucleus is closely related to genome function, and the changes in transcriptional activity are tightly correlated with changes in chromatin folding. This study explores the changes of chromatin conformation and chromatin-chromatin interactions in the simulated microgravity environment, and investigates their correlation to the expression of genes located at different regions of the chromosome. To investigate the folding of chromatin in interphase under various culture conditions, human epithelial cells, fibroblasts, and lymphocytes were fixed in the G1 phase. Interphase chromosomes were hybridized with a multicolor banding in situ hybridization (mBAND) probe for chromosome 3 which distinguishes six regions of the chromosome as separate colors. After images were captured with a laser scanning confocal microscope, the 3-dimensional structure of interphase chromosome 3 was reconstructed at multi-mega base pair scale. In order to determine the effects of microgravity on chromosome conformation and orientation, measures such as distance between homologous pairs, relative orientation of chromosome arms about a shared midpoint, and orientation of arms within individual chromosomes were all considered as potentially impacted by simulated microgravity conditions. The studies revealed non-random folding of chromatin in interphase, and suggested an association of interphase chromatin folding with radiation-induced chromosome aberration hotspots. Interestingly, the distributions of genes with expression changes over chromosome 3 in cells cultured under microgravity environment are apparently clustered on specific loci and chromosomes. This data provides important insights into how mammalian cells respond to microgravity at molecular level.
Chromatin meets its organizers.
Bodnar, Megan S; Spector, David L
2013-06-06
Chromatin organization and gene-gene interactions are critical components of carrying out developmental programs. Phillips-Cremins et al. identify a series of unexpected architectural proteins that work in a combinatorial manner to functionally organize chromatin in a cell-type-specific manner at the submegabase-length scale. Copyright © 2013 Elsevier Inc. All rights reserved.
Chromatin in embryonic stem cell neuronal differentiation.
Meshorer, E
2007-03-01
Chromatin, the basic regulatory unit of the eukaryotic genetic material, is controlled by epigenetic mechanisms including histone modifications, histone variants, DNA methylation and chromatin remodeling. Cellular differentiation involves large changes in gene expression concomitant with alterations in genome organization and chromatin structure. Such changes are particularly evident in self-renewing pluripotent embryonic stem cells, which begin, in terms of cell fate, as a tabula rasa, and through the process of differentiation, acquire distinct identities. Here I describe the changes in chromatin that accompany neuronal differentiation, particularly of embryonic stem cells, and discuss how chromatin serves as the master regulator of cellular destiny.
Radiation response and chromatin dynamics
International Nuclear Information System (INIS)
Ikura, Tsuyoshi
2009-01-01
Described is a recent progress in studies of chromatin structural alterations induced by DNA damage by radiation. DNA in eukaryotes exists in the chromatin structure and different mechanisms of response to damage and repair of DNA from those in prokaryotes have been recognized. Chromatin is composed from its unit structure of mono-nucleosome, which is formed from DNA and an octamer of core histones of H2A, H2B, H3 and H4. When DNA is damaged, histone structural alterations are required for repair factors and checkpoint proteins to access the damaged site. At the actual genome damage, chemical modification of histone to work as a code occurs dependently on the damage where chromatin remodeling factors and histone chaperone participate for structural alteration and remodeling. As well, the exchange of histone variants and fluidization of histones are recently reported. Known chemical modification involves phosphorylation, acetylation and ubiquitination of H2AX (a variant of H2A), and acetylation and methylation of H3. Each complex of TIP60, NuA4 and INO80 is known to be included in the regulation of chromatin with damaged/repaired DNA for remodeling, but little is known about recruitment of the factors concerned at the damage site. Regulatory mechanisms in above chromatin dynamics with consideration of quality and timing of radiation should be further elucidated for understanding the precise response to DNA damage. (K.T.)
An essential GT motif in the lamin A promoter mediates activation by CREB-binding protein
International Nuclear Information System (INIS)
Janaki Ramaiah, M.; Parnaik, Veena K.
2006-01-01
Lamin A is an important component of nuclear architecture in mammalian cells. Mutations in the human lamin A gene lead to highly degenerative disorders that affect specific tissues. In studies directed towards understanding the mode of regulation of the lamin A promoter, we have identified an essential GT motif at -55 position by reporter gene assays and mutational analysis. Binding of this sequence to Sp transcription factors has been observed in electrophoretic mobility shift assays and by chromatin immunoprecipitation studies. Further functional analysis by co-expression of recombinant proteins and ChIP assays has shown an important regulatory role for CREB-binding protein in promoter activation, which is mediated by the GT motif
A Long-Distance Chromatin Affair
Denker, Annette; de Laat, Wouter
2015-01-01
Changes in transcription factor binding sequences result in correlated changes in chromatin composition locally and at sites hundreds of kilobases away. New studies demonstrate that this concordance is mediated via spatial chromatin interactions that constitute regulatory modules of the human
Directory of Open Access Journals (Sweden)
Maria Jesus Iglesias
Full Text Available Macrophages play a critical role in innate immunity, and the expression of early response genes orchestrate much of the initial response of the immune system. Macrophages undergo extensive transcriptional reprogramming in response to inflammatory stimuli such as Lipopolysaccharide (LPS.To identify gene transcription regulation patterns involved in early innate immune responses, we used two genome-wide approaches--gene expression profiling and chromatin immunoprecipitation-sequencing (ChIP-seq analysis. We examined the effect of 2 hrs LPS stimulation on early gene expression and its relation to chromatin remodeling (H3 acetylation; H3Ac and promoter binding of Sp1 and RNA polymerase II phosphorylated at serine 5 (S5P RNAPII, which is a marker for transcriptional initiation. Our results indicate novel and alternative gene regulatory mechanisms for certain proinflammatory genes. We identified two groups of up-regulated inflammatory genes with respect to chromatin modification and promoter features. One group, including highly up-regulated genes such as tumor necrosis factor (TNF, was characterized by H3Ac, high CpG content and lack of TATA boxes. The second group, containing inflammatory mediators (interleukins and CCL chemokines, was up-regulated upon LPS stimulation despite lacking H3Ac in their annotated promoters, which were low in CpG content but did contain TATA boxes. Genome-wide analysis showed that few H3Ac peaks were unique to either +/-LPS condition. However, within these, an unpacking/expansion of already existing H3Ac peaks was observed upon LPS stimulation. In contrast, a significant proportion of S5P RNAPII peaks (approx 40% was unique to either condition. Furthermore, data indicated a large portion of previously unannotated TSSs, particularly in LPS-stimulated macrophages, where only 28% of unique S5P RNAPII peaks overlap annotated promoters. The regulation of the inflammatory response appears to occur in a very specific manner at
Rougeot, Julien; Renard, Myrtille; Randsholt, Neel B; Peronnet, Frédérique; Mouchel-Vielh, Emmanuèle
2013-01-01
Drosophila wings mainly consist of two cell types, vein and intervein cells. Acquisition of either fate depends on specific expression of genes that are controlled by several signaling pathways. The nuclear mechanisms that translate signaling into regulation of gene expression are not completely understood, but they involve chromatin factors from the Trithorax (TrxG) and Enhancers of Trithorax and Polycomb (ETP) families. One of these is the ETP Corto that participates in intervein fate through interaction with the Drosophila EGF Receptor--MAP kinase ERK pathway. Precise mechanisms and molecular targets of Corto in this process are not known. We show here that Corto interacts with the Elongin transcription elongation complex. This complex, that consists of three subunits (Elongin A, B, C), increases RNA polymerase II elongation rate in vitro by suppressing transient pausing. Analysis of phenotypes induced by EloA, B, or C deregulation as well as genetic interactions suggest that the Elongin complex might participate in vein vs intervein specification, and antagonizes corto as well as several TrxG genes in this process. Chromatin immunoprecipitation experiments indicate that Elongin C and Corto bind the vein-promoting gene rhomboid in wing imaginal discs. We propose that Corto and the Elongin complex participate together in vein vs intervein fate, possibly through tissue-specific transcriptional regulation of rhomboid.
Directory of Open Access Journals (Sweden)
Julien Rougeot
Full Text Available Drosophila wings mainly consist of two cell types, vein and intervein cells. Acquisition of either fate depends on specific expression of genes that are controlled by several signaling pathways. The nuclear mechanisms that translate signaling into regulation of gene expression are not completely understood, but they involve chromatin factors from the Trithorax (TrxG and Enhancers of Trithorax and Polycomb (ETP families. One of these is the ETP Corto that participates in intervein fate through interaction with the Drosophila EGF Receptor--MAP kinase ERK pathway. Precise mechanisms and molecular targets of Corto in this process are not known. We show here that Corto interacts with the Elongin transcription elongation complex. This complex, that consists of three subunits (Elongin A, B, C, increases RNA polymerase II elongation rate in vitro by suppressing transient pausing. Analysis of phenotypes induced by EloA, B, or C deregulation as well as genetic interactions suggest that the Elongin complex might participate in vein vs intervein specification, and antagonizes corto as well as several TrxG genes in this process. Chromatin immunoprecipitation experiments indicate that Elongin C and Corto bind the vein-promoting gene rhomboid in wing imaginal discs. We propose that Corto and the Elongin complex participate together in vein vs intervein fate, possibly through tissue-specific transcriptional regulation of rhomboid.
New mitotic regulators released from chromatin
Directory of Open Access Journals (Sweden)
Hideki eYokoyama
2013-12-01
Full Text Available Faithful action of the mitotic spindle segregates duplicated chromosomes into daughter cells. Perturbations of this process result in chromosome mis-segregation, leading to chromosomal instability and cancer development. Chromosomes are not simply passengers segregated by spindle microtubules but rather play a major active role in spindle assembly. The GTP bound form of the Ran GTPase (RanGTP, produced around chromosomes, locally activates spindle assembly factors. Recent studies have uncovered that chromosomes organize mitosis beyond spindle formation. They distinctly regulate other mitotic events, such as spindle maintenance in anaphase, which is essential for chromosome segregation. Furthermore, the direct function of chromosomes is not only to produce RanGTP but, in addition, to release key mitotic regulators from chromatin. Chromatin-remodeling factors and nuclear pore complex proteins, which have established functions on chromatin in interphase, dissociate from mitotic chromatin and function in spindle assembly or maintenance. Thus, chromosomes actively organize their own segregation using chromatin-releasing mitotic regulators as well as RanGTP.
A transient ischemic environment induces reversible compaction of chromatin.
Kirmes, Ina; Szczurek, Aleksander; Prakash, Kirti; Charapitsa, Iryna; Heiser, Christina; Musheev, Michael; Schock, Florian; Fornalczyk, Karolina; Ma, Dongyu; Birk, Udo; Cremer, Christoph; Reid, George
2015-11-05
Cells detect and adapt to hypoxic and nutritional stress through immediate transcriptional, translational and metabolic responses. The environmental effects of ischemia on chromatin nanostructure were investigated using single molecule localization microscopy of DNA binding dyes and of acetylated histones, by the sensitivity of chromatin to digestion with DNAseI, and by fluorescence recovery after photobleaching (FRAP) of core and linker histones. Short-term oxygen and nutrient deprivation of the cardiomyocyte cell line HL-1 induces a previously undescribed chromatin architecture, consisting of large, chromatin-sparse voids interspersed between DNA-dense hollow helicoid structures 40-700 nm in dimension. The chromatin compaction is reversible, and upon restitution of normoxia and nutrients, chromatin transiently adopts a more open structure than in untreated cells. The compacted state of chromatin reduces transcription, while the open chromatin structure induced upon recovery provokes a transitory increase in transcription. Digestion of chromatin with DNAseI confirms that oxygen and nutrient deprivation induces compaction of chromatin. Chromatin compaction is associated with depletion of ATP and redistribution of the polyamine pool into the nucleus. FRAP demonstrates that core histones are not displaced from compacted chromatin; however, the mobility of linker histone H1 is considerably reduced, to an extent that far exceeds the difference in histone H1 mobility between heterochromatin and euchromatin. These studies exemplify the dynamic capacity of chromatin architecture to physically respond to environmental conditions, directly link cellular energy status to chromatin compaction and provide insight into the effect ischemia has on the nuclear architecture of cells.
Optical tweezers stretching of chromatin
Pope, L.H.; Bennink, Martin L.; Greve, Jan
2003-01-01
Recently significant success has emerged from exciting research involving chromatin stretching using optical tweezers. These experiments, in which a single chromatin fibre is attached by one end to a micron-sized bead held in an optical trap and to a solid surface or second bead via the other end,
Directory of Open Access Journals (Sweden)
Serena Nicolai
Full Text Available The CSB protein, a member of the SWI/SNF ATP dependent chromatin remodeling family of proteins, plays a role in a sub-pathway of nucleotide excision repair (NER known as transcription coupled repair (TCR. CSB is frequently mutated in Cockayne syndrome group B, a segmental progeroid human autosomal recessive disease characterized by growth failure and degeneration of multiple organs. Though initially classified as a DNA repair protein, recent studies have demonstrated that the loss of CSB results in pleiotropic effects. Identification of novel proteins belonging to the CSB interactome may be useful not only for predicting the molecular basis for diverse pathological symptoms of CS-B patients but also for unraveling the functions of CSB in addition to its authentic role in DNA repair. In this study, we performed tandem affinity purification (TAP technology coupled with mass spectrometry and co-immunoprecipitation studies to identify and characterize the proteins that potentially interact with CSB-TAP. Our approach revealed 33 proteins that were not previously known to interact with CSB. These newly identified proteins indicate potential roles for CSB in RNA metabolism involving repression and activation of transcription process and in the maintenance of chromatin dynamics and integrity.
Characterization of joining sites of a viral histone H4 on host insect chromosomes.
Directory of Open Access Journals (Sweden)
Sunil Kumar
Full Text Available A viral histone H4 (CpBV-H4 is encoded in a polydnavirus, Cotesia plutellae bracovirus (CpBV. It plays a crucial role in parasitism of an endoparasitoid wasp, C. plutellae, against diamondback moth, Plutella xylostella, by altering host gene expression in an epigenetic mode by its N-terminal tail after joining host nucleosomes. Comparative transcriptomic analysis between parasitized and nonparasitized P. xylostella by RNA-Seq indicated that 1,858 genes were altered at more than two folds in expression levels at late parasitic stage, including 877 up-regulated genes and 981 down-regulated genes. Among parasitic factors altering host gene expression, CpBV-H4 alone explained 16.3% of these expressional changes. To characterize the joining sites of CpBV-H4 on host chromosomes, ChIP-Seq (chromatin immunoprecipitation followed by deep sequencing was applied to chromatins extracted from parasitized larvae. It identified specific 538 ChIP targets. Joining sites were rich (60.2% in AT sequence. Almost 40% of ChIP targets included short nucleotide repeat sequences presumably recognizable by transcriptional factors and chromatin remodeling factors. To further validate these CpBV-H4 targets, CpBV-H4 was transiently expressed in nonparasitized host at late larval stage and subjected to ChIP-Seq. Two kinds of ChIP-Seqs shared 51 core joining sites. Common targets were close (within 1 kb to genes regulated at expression levels by CpBV-H4. However, other host genes not close to CpBV-H4 joining sites were also regulated by CpBV-H4. These results indicate that CpBV-H4 joins specific chromatin regions of P. xylostella and controls about one sixth of the total host genes that were regulated by C. plutellae parasitism in an epigenetic mode.
Transcriptional networks and chromatin remodeling controlling adipogenesis
DEFF Research Database (Denmark)
Siersbæk, Rasmus; Nielsen, Ronni; Mandrup, Susanne
2012-01-01
Adipocyte differentiation is tightly controlled by a transcriptional cascade, which directs the extensive reprogramming of gene expression required to convert fibroblast-like precursor cells into mature lipid-laden adipocytes. Recent global analyses of transcription factor binding and chromatin...... remodeling have revealed 'snapshots' of this cascade and the chromatin landscape at specific time-points of differentiation. These studies demonstrate that multiple adipogenic transcription factors co-occupy hotspots characterized by an open chromatin structure and specific epigenetic modifications....... Such transcription factor hotspots are likely to represent key signaling nodes which integrate multiple adipogenic signals at specific chromatin sites, thereby facilitating coordinated action on gene expression....
Forn, Marta; Muñoz, Mar; Tauriello, Daniele V F; Merlos-Suárez, Anna; Rodilla, Verónica; Bigas, Anna; Batlle, Eduard; Jordà, Mireia; Peinado, Miguel A
2013-12-01
DNA methylation and chromatin remodeling are frequently implicated in the silencing of genes involved in carcinogenesis. Long Range Epigenetic Silencing (LRES) is a mechanism of gene inactivation that affects multiple contiguous CpG islands and has been described in different human cancer types. However, it is unknown whether there is a coordinated regulation of the genes embedded in these regions in normal cells and in early stages of tumor progression. To better characterize the molecular events associated with the regulation and remodeling of these regions we analyzed two regions undergoing LRES in human colon cancer in the mouse model. We demonstrate that LRES also occurs in murine cancer in vivo and mimics the molecular features of the human phenomenon, namely, downregulation of gene expression, acquisition of inactive histone marks, and DNA hypermethylation of specific CpG islands. The genes embedded in these regions showed a dynamic and autonomous regulation during mouse intestinal cell differentiation, indicating that, in the framework considered here, the coordinated regulation in LRES is restricted to cancer. Unexpectedly, benign adenomas in Apc(Min/+) mice showed overexpression of most of the genes affected by LRES in cancer, which suggests that the repressive remodeling of the region is a late event. Chromatin immunoprecipitation analysis of the transcriptional insulator CTCF in mouse colon cancer cells revealed disrupted chromatin domain boundaries as compared with normal cells. Malignant regression of cancer cells by in vitro differentiation resulted in partial reversion of LRES and gain of CTCF binding. We conclude that genes in LRES regions are plastically regulated in cell differentiation and hyperproliferation, but are constrained to a coordinated repression by abolishing boundaries and the autonomous regulation of chromatin domains in cancer cells. Copyright © 2013 Federation of European Biochemical Societies. Published by Elsevier B.V. All
Structured illumination to spatially map chromatin motions.
Bonin, Keith; Smelser, Amanda; Moreno, Naike Salvador; Holzwarth, George; Wang, Kevin; Levy, Preston; Vidi, Pierre-Alexandre
2018-05-01
We describe a simple optical method that creates structured illumination of a photoactivatable probe and apply this method to characterize chromatin motions in nuclei of live cells. A laser beam coupled to a diffractive optical element at the back focal plane of an excitation objective generates an array of near diffraction-limited beamlets with FWHM of 340 ± 30 nm, which simultaneously photoactivate a 7 × 7 matrix pattern of GFP-labeled histones, with spots 1.70 μm apart. From the movements of the photoactivated spots, we map chromatin diffusion coefficients at multiple microdomains of the cell nucleus. The results show correlated motions of nearest chromatin microdomain neighbors, whereas chromatin movements are uncorrelated at the global scale of the nucleus. The method also reveals a DNA damage-dependent decrease in chromatin diffusion. The diffractive optical element instrumentation can be easily and cheaply implemented on commercial inverted fluorescence microscopes to analyze adherent cell culture models. A protocol to measure chromatin motions in nonadherent human hematopoietic stem and progenitor cells is also described. We anticipate that the method will contribute to the identification of the mechanisms regulating chromatin mobility, which influences most genomic processes and may underlie the biogenesis of genomic translocations associated with hematologic malignancies. (2018) COPYRIGHT Society of Photo-Optical Instrumentation Engineers (SPIE).
Anti-chromatin antibodies in juvenile rheumatoid arthritis
Directory of Open Access Journals (Sweden)
V. Gerloni
2011-09-01
Full Text Available Objective: to evaluate the prevalence and clinical significance of anti-chromatin antibodies (Abs in juvenile rheumatoid arthritis (JRA. Methods: IgG anti-chromatin Abs were detected by an enzyme-linked immunosorbent assay (ELISA, in sera of 94 children with JRA (10 children with systemic, 38 with polyarticular and 46 with oligoarticular disease onset. As control group, 33 age- and-sex-matched healthy children (HC were also examined. Results: Abs to chromatin were detected in 24/94 (25,5% of children suffering from JRA. Particularly, the higher prevalence of anti-chromatin Abs has been found in children with oligoarticular (30,4% and polyarticular (23,7% onset JRA. In these groups Abs titers were significantly higher compared to systemic JRA and HC (p=0.003. Anti-chromatin Abs were observed more frequently in patients with oligoarticular disease and chronic uveitis (21,7%. Furthermore, higher levels of anti-chromatin Abs has been found in all the patients treated with anti-TNFα therapy (p<0.0001. Conclusions: our results confirm previous data about the prevalence of anti-chromatin Abs in JRA. These Abs were significantly higher in the group of patients with oligoarticular onset with past or present hystory of ocular involvement and in the group with polyarticular JRA treated with biologic therapy. A long-term follow-up study could be useful to evaluate the potential utility of these autoantibodies.
Map of open and closed chromatin domains in Drosophila genome.
Milon, Beatrice; Sun, Yezhou; Chang, Weizhong; Creasy, Todd; Mahurkar, Anup; Shetty, Amol; Nurminsky, Dmitry; Nurminskaya, Maria
2014-11-18
Chromatin compactness has been considered a major determinant of gene activity and has been associated with specific chromatin modifications in studies on a few individual genetic loci. At the same time, genome-wide patterns of open and closed chromatin have been understudied, and are at present largely predicted from chromatin modification and gene expression data. However the universal applicability of such predictions is not self-evident, and requires experimental verification. We developed and implemented a high-throughput analysis for general chromatin sensitivity to DNase I which provides a comprehensive epigenomic assessment in a single assay. Contiguous domains of open and closed chromatin were identified by computational analysis of the data, and correlated to other genome annotations including predicted chromatin "states", individual chromatin modifications, nuclear lamina interactions, and gene expression. While showing that the widely trusted predictions of chromatin structure are correct in the majority of cases, we detected diverse "exceptions" from the conventional rules. We found a profound paucity of chromatin modifications in a major fraction of closed chromatin, and identified a number of loci where chromatin configuration is opposite to that expected from modification and gene expression patterns. Further, we observed that chromatin of large introns tends to be closed even when the genes are expressed, and that a significant proportion of active genes including their promoters are located in closed chromatin. These findings reveal limitations of the existing predictive models, indicate novel mechanisms of epigenetic regulation, and provide important insights into genome organization and function.
International Nuclear Information System (INIS)
Friedland, W.; Kundrat, P.
2015-01-01
The module that simulates the kinetics and yields of radiation-induced chromosome aberrations within the biophysical code PARTRAC is described. Radiation track structures simulated by Monte Carlo methods are overlapped with multi-scale models of DNA and chromatin to assess the resulting DNA damage. Spatial mobility of individual DNA ends from double-strand breaks is modelled simultaneously with their processing by the non-homologous end-joining enzymes. To score diverse types of chromosome aberrations, the joined ends are classified regarding their original chromosomal location, orientation and the involvement of centromeres. A comparison with experimental data on dicentrics induced by gamma and alpha particles shows that their relative dose dependence is predicted correctly, although the absolute yields are overestimated. The critical model assumptions on chromatin mobility and on the initial damage recognition and chromatin remodelling steps and their future refinements to solve this issue are discussed. (authors)
Fast neutron irradiation effects on liver chromatin structure
International Nuclear Information System (INIS)
Constantinescu, B.; Radu, L.
1996-01-01
The growing interest in neutron therapy requires complex studies on the mechanisms of neutron action on biological systems, especially on chromatin. The chromatin was extracted from a normal tissue-livers of Wistar rats - and from a tumoral tissue - Walker tumour maintained on Wistar rats. Irradiation doses from 5 Gy to 100 Gy by fast neutron intense beams produced via d(13.5 MeV) +Be (thick target) reaction at Bucharest U-120 Classical Cyclotron were used. To study the post-irradiation effects, various methods were employed. So, the variation in the 260 nm absorbency in chromatin thermal transition was pursuit. The chromatin-ethidium bromide complexes fluorescence with λ ex =480 nm and λ em =600 nm was analyzed. To determine chromatin DNA strand breaks a fluorimetric method, with cells' suspensions as starting material was used. This method requires a partial treatment with alkali producing three components: T-estimating the total fluorescence of DNA double helix, P-assigning the untwisting rate and B-the blank, where DNA is completely unfolded The percentsge of DNA double strand,-D-, remaining after this treatment, is: %D=100x(P-B)/(T-B). The intrinsic chromatin fluorescence was determined for tyrosine (λ ex =280 nm, λ em =305 nm), specific for badic chromatin prooteins, and for tryptophane (λ ex =290 nm, λ em =345 nm) specific for acid chromatin proteins. Polyacrylamide gel electrophoresis was performed: The double fluorescent labelling of chromatin was realized with acridine orange for DNA and with dansyl chloride for chromatin proteins. Fluorescence intensity determinations were done with λ ex =505 nm, λ em =530 nm for acridine orange and with λ ex =323 nm, λ em =505 nm for dansyl chloride. A Pye Unicam SP 1800 spectrophotometer and a Aminco SPF 500 spectrofluorimeter were employed. (author)
Chromatin-modifying proteins in cancer
DEFF Research Database (Denmark)
Fog, Cathrine K; Jensen, Klaus T; Lund, Anders Henrik
2007-01-01
-despite the fact that all cells in the organism contain the same genetic information. A large amount of data gathered over the last decades has demonstrated that deregulation of chromatin-modifying proteins is etiologically involved in the development and progression of cancer. Here we discuss how epigenetic...... alterations influence cancer development and review known cancer-associated alterations in chromatin-modifying proteins....
Saez, Angela; Rodrigues, Americo; Santiago, Julia; Rubio, Silvia; Rodriguez, Pedro L.
2008-01-01
Abscisic acid (ABA) has an important role for plant growth, development, and stress adaptation. HYPERSENSITIVE TO ABA1 (HAB1) is a protein phosphatase type 2C that plays a key role as a negative regulator of ABA signaling; however, the molecular details of HAB1 action in this process are not known. A two-hybrid screen revealed that SWI3B, an Arabidopsis thaliana homolog of the yeast SWI3 subunit of SWI/SNF chromatin-remodeling complexes, is a prevalent interacting partner of HAB1. The interaction mapped to the N-terminal half of SWI3B and required an intact protein phosphatase catalytic domain. Bimolecular fluorescence complementation and coimmunoprecipitation assays confirmed the interaction of HAB1 and SWI3B in the nucleus of plant cells. swi3b mutants showed a reduced sensitivity to ABA-mediated inhibition of seed germination and growth and reduced expression of the ABA-responsive genes RAB18 and RD29B. Chromatin immunoprecipitation experiments showed that the presence of HAB1 in the vicinity of RD29B and RAB18 promoters was abolished by ABA, which suggests a direct involvement of HAB1 in the regulation of ABA-induced transcription. Additionally, our results uncover SWI3B as a novel positive regulator of ABA signaling and suggest that HAB1 modulates ABA response through the regulation of a putative SWI/SNF chromatin-remodeling complex. PMID:19033529
Chromatin Dynamics of the mouse β-globin locus
M.P.C. van de Corput (Mariëtte); E. de Boer (Ernie); T.A. Knoch (Tobias); W.A. van Cappellen (Gert); M. Lesnussa (Michael); H.J.F.M.M. Eussen (Bert)
2010-01-01
textabstractLately it has become more clear that (subtle) changes in 3D organization of chromatin can either trigger transcription or silence genes or gene clusters. It has also been postulated that due to changes in chromatin structure, a change in chromatin accessibility of transcription factors
Endorf, Elizabeth B; Qing, Hua; Aono, Jun; Terami, Naoto; Doyon, Geneviève; Hyzny, Eric; Jones, Karrie L; Findeisen, Hannes M; Bruemmer, Dennis
2017-02-01
Aberrant proliferation of smooth muscle cells (SMC) in response to injury induces pathological vascular remodeling during atherosclerosis and neointima formation. Telomerase is rate limiting for tissue renewal and cell replication; however, the physiological role of telomerase in vascular diseases remains to be determined. The goal of the present study was to determine whether telomerase reverse transcriptase (TERT) affects proliferative vascular remodeling and to define the molecular mechanism by which TERT supports SMC proliferation. We first demonstrate high levels of TERT expression in replicating SMC of atherosclerotic and neointimal lesions. Using a model of guidewire-induced arterial injury, we demonstrate decreased neointima formation in TERT-deficient mice. Studies in SMC isolated from TERT-deficient and TERT overexpressing mice with normal telomere length established that TERT is necessary and sufficient for cell proliferation. TERT deficiency did not induce a senescent phenotype but resulted in G1 arrest albeit hyperphosphorylation of the retinoblastoma protein. This proliferative arrest was associated with stable silencing of the E2F1-dependent S-phase gene expression program and not reversed by ectopic overexpression of E2F1. Finally, chromatin immunoprecipitation and accessibility assays revealed that TERT is recruited to E2F1 target sites and promotes chromatin accessibility for E2F1 by facilitating the acquisition of permissive histone modifications. These data indicate a previously unrecognized role for TERT in neointima formation through epigenetic regulation of proliferative gene expression in SMC. © 2016 American Heart Association, Inc.
Chromatin damage induced by fast neutrons or UV laser radiation
Energy Technology Data Exchange (ETDEWEB)
Radu, L.; Constantinescu, B.; Gazdaru, D.; Mihailescu, I
2002-07-01
Chromatin samples from livers of Wistar rats were subjected to fast neutron irradiation in doses of 10-100 Gy or to a 248 nm excimer laser radiation, in doses of 0.5-3 MJ.m{sup -2}. The action of the radiation on chromatin was monitored by chromatin intrinsic fluorescence and fluorescence lifetimes (of bound ethidium bromide to chromatin) and by analysing fluorescence resonance energy transfer between dansyl chloride and acridine orange coupled to chromatin. For the mentioned doses of UV excimer laser radiation, the action on chromatin was more intense than in the case of fast neutrons. The same types of damage are produced by the two radiations: acidic and basic destruction of chromatin protein structure, DNA strand breaking and the increase of the distance between DNA and proteins in chromatin. (author)
Chromatin damage induced by fast neutrons or UV laser radiation
International Nuclear Information System (INIS)
Radu, L.; Constantinescu, B.; Gazdaru, D.; Mihailescu, I.
2002-01-01
Chromatin samples from livers of Wistar rats were subjected to fast neutron irradiation in doses of 10-100 Gy or to a 248 nm excimer laser radiation, in doses of 0.5-3 MJ.m -2 . The action of the radiation on chromatin was monitored by chromatin intrinsic fluorescence and fluorescence lifetimes (of bound ethidium bromide to chromatin) and by analysing fluorescence resonance energy transfer between dansyl chloride and acridine orange coupled to chromatin. For the mentioned doses of UV excimer laser radiation, the action on chromatin was more intense than in the case of fast neutrons. The same types of damage are produced by the two radiations: acidic and basic destruction of chromatin protein structure, DNA strand breaking and the increase of the distance between DNA and proteins in chromatin. (author)
The chromatin remodeler SPLAYED regulates specific stress signaling pathways.
Directory of Open Access Journals (Sweden)
Justin W Walley
2008-12-01
Full Text Available Organisms are continuously exposed to a myriad of environmental stresses. Central to an organism's survival is the ability to mount a robust transcriptional response to the imposed stress. An emerging mechanism of transcriptional control involves dynamic changes in chromatin structure. Alterations in chromatin structure are brought about by a number of different mechanisms, including chromatin modifications, which covalently modify histone proteins; incorporation of histone variants; and chromatin remodeling, which utilizes ATP hydrolysis to alter histone-DNA contacts. While considerable insight into the mechanisms of chromatin remodeling has been gained, the biological role of chromatin remodeling complexes beyond their function as regulators of cellular differentiation and development has remained poorly understood. Here, we provide genetic, biochemical, and biological evidence for the critical role of chromatin remodeling in mediating plant defense against specific biotic stresses. We found that the Arabidopsis SWI/SNF class chromatin remodeling ATPase SPLAYED (SYD is required for the expression of selected genes downstream of the jasmonate (JA and ethylene (ET signaling pathways. SYD is also directly recruited to the promoters of several of these genes. Furthermore, we show that SYD is required for resistance against the necrotrophic pathogen Botrytis cinerea but not the biotrophic pathogen Pseudomonas syringae. These findings demonstrate not only that chromatin remodeling is required for selective pathogen resistance, but also that chromatin remodelers such as SYD can regulate specific pathways within biotic stress signaling networks.
DEFF Research Database (Denmark)
Borch-Jensen, Jonas; Roepstorff, Peter; Møller-Jensen, Jakob
2011-01-01
enterotoxigenic Escherischia coli, GM1-nanodiscs were employed for co-immunoprecipitation. The B subunit of heat labile enterotoxin was identified as a specific interaction partner by mass spectrometry, thus demonstrating that nanodisc technology is useful for highly specific detection and identification...
Probing Chromatin-modifying Enzymes with Chemical Tools
Fischle, Wolfgang
2016-02-04
Chromatin is the universal template of genetic information in all eukaryotic organisms. Chemical modifications of the DNA-packaging histone proteins and the DNA bases are crucial signaling events in directing the use and readout of eukaryotic genomes. The enzymes that install and remove these chromatin modifications as well as the proteins that bind these marks govern information that goes beyond the sequence of DNA. Therefore, these so-called epigenetic regulators are intensively studied and represent promising drug targets in modern medicine. We summarize and discuss recent advances in the field of chemical biology that have provided chromatin research with sophisticated tools for investigating the composition, activity, and target sites of chromatin modifying enzymes and reader proteins.
The Role of Chromatin-Associated Proteins in Cancer
DEFF Research Database (Denmark)
Helin, Kristian; Minucci, Saverio
2017-01-01
The organization of the chromatin structure is essential for maintaining cell-type-specific gene expression and therefore for cell identity. This structure is highly dynamic and is regulated by a large number of chromatin-associated proteins that are required for normal development...... and differentiation. Recurrent somatic mutations have been found with high frequency in genes coding for chromatin-associated proteins in cancer, and several of these are required for cancer maintenance. In this review, we discuss recent advances in understanding the role of chromatin-associated proteins...
Studying RNA-protein interactions in vivo by RNA immunoprecipitation
DEFF Research Database (Denmark)
Selth, Luke A; Close, Pierre; Svejstrup, Jesper Q
2011-01-01
and have significant effects on gene expression. RNA immunoprecipitation (RIP) is a powerful technique used to detect direct and indirect interactions between individual proteins and specific RNA molecules in vivo. Here, we describe RIP methods for both yeast and mammalian cells.......The crucial roles played by RNA-binding proteins in all aspects of RNA metabolism, particularly in the regulation of transcription, have become increasingly evident. Moreover, other factors that do not directly interact with RNA molecules can nevertheless function proximally to RNA polymerases...
Reprogramming the chromatin landscape
DEFF Research Database (Denmark)
Miranda, Tina B; Voss, Ty C; Sung, Myong-Hee
2013-01-01
, mechanistic details defining the cellular interactions between ER and GR are poorly understood. We investigated genome-wide binding profiles for ER and GR upon coactivation and characterized the status of the chromatin landscape. We describe a novel mechanism dictating the molecular interplay between ER...... and GR. Upon induction, GR modulates access of ER to specific sites in the genome by reorganization of the chromatin configuration for these elements. Binding to these newly accessible sites occurs either by direct recognition of ER response elements or indirectly through interactions with other factors...
Chromatin dynamics resolved with force spectroscopy
Chien, Fan-Tso
2011-01-01
In eukaryotic cells, genomic DNA is organized in chromatin fibers composed of nucleosomes as structural units. A nucleosome contains 1.7 turns of DNA wrapped around a histone octamer and is connected to the adjacent nucleosomes with linker DNA. The folding of chromatin fibers effectively increases
A microscopic analysis of Arabidopsis chromatin
Willemse, J.J.
2007-01-01
Genetic information of eukaryotic organisms is stored as DNA in the nuclei of their cells. Nuclear DNA is associated with several proteins, which together form chromatin. The most abundant chromatin proteins arehistones,they arrange the initial packaging step of the DNA. DNA
PREDICTION OF CHROMATIN STATES USING DNA SEQUENCE PROPERTIES
Bahabri, Rihab R.
2013-06-01
Activities of DNA are to a great extent controlled epigenetically through the internal struc- ture of chromatin. This structure is dynamic and is influenced by different modifications of histone proteins. Various combinations of epigenetic modification of histones pinpoint to different functional regions of the DNA determining the so-called chromatin states. How- ever, the characterization of chromatin states by the DNA sequence properties remains largely unknown. In this study we aim to explore whether DNA sequence patterns in the human genome can characterize different chromatin states. Using DNA sequence motifs we built binary classifiers for each chromatic state to eval- uate whether a given genomic sequence is a good candidate for belonging to a particular chromatin state. Of four classification algorithms (C4.5, Naive Bayes, Random Forest, and SVM) used for this purpose, the decision tree based classifiers (C4.5 and Random Forest) yielded best results among those we evaluated. Our results suggest that in general these models lack sufficient predictive power, although for four chromatin states (insulators, het- erochromatin, and two types of copy number variation) we found that presence of certain motifs in DNA sequences does imply an increased probability that such a sequence is one of these chromatin states.
Chromatin organization and cellular sensitivity to ionizing radiation
International Nuclear Information System (INIS)
Szumiel, I.; Walicka, M.
1987-01-01
The paper briefly describes chromatin organization in mammalian cells and reviews experimental work concerning relations between chromatin structure and accesibility of damaged DNA to repair enzymes. The ''contact effect'', the size of super-coiled DNA domains and ADP-ribosylation of chromatin proteins are discussed in relation to cellular radiosensitivity. 88 refs. (author)
The AID-induced DNA damage response in chromatin
DEFF Research Database (Denmark)
Daniel, Jeremy A; Nussenzweig, André
2013-01-01
Chemical modifications to the DNA and histone protein components of chromatin can modulate gene expression and genome stability. Understanding the physiological impact of changes in chromatin structure remains an important question in biology. As one example, in order to generate antibody diversity...... with somatic hypermutation and class switch recombination, chromatin must be made accessible for activation-induced cytidine deaminase (AID)-mediated deamination of cytosines in DNA. These lesions are recognized and removed by various DNA repair pathways but, if not handled properly, can lead to formation...... of oncogenic chromosomal translocations. In this review, we focus the discussion on how chromatin-modifying activities and -binding proteins contribute to the native chromatin environment in which AID-induced DNA damage is targeted and repaired. Outstanding questions remain regarding the direct roles...
Local Nucleosome Dynamics Facilitate Chromatin Accessibility in Living Mammalian Cells
Directory of Open Access Journals (Sweden)
Saera Hihara
2012-12-01
Full Text Available Genome information, which is three-dimensionally organized within cells as chromatin, is searched and read by various proteins for diverse cell functions. Although how the protein factors find their targets remains unclear, the dynamic and flexible nature of chromatin is likely crucial. Using a combined approach of fluorescence correlation spectroscopy, single-nucleosome imaging, and Monte Carlo computer simulations, we demonstrate local chromatin dynamics in living mammalian cells. We show that similar to interphase chromatin, dense mitotic chromosomes also have considerable chromatin accessibility. For both interphase and mitotic chromatin, we observed local fluctuation of individual nucleosomes (∼50 nm movement/30 ms, which is caused by confined Brownian motion. Inhibition of these local dynamics by crosslinking impaired accessibility in the dense chromatin regions. Our findings show that local nucleosome dynamics drive chromatin accessibility. We propose that this local nucleosome fluctuation is the basis for scanning genome information.
Chromatin Remodeling and Plant Immunity.
Chen, W; Zhu, Q; Liu, Y; Zhang, Q
Chromatin remodeling, an important facet of the regulation of gene expression in eukaryotes, is performed by two major types of multisubunit complexes, covalent histone- or DNA-modifying complexes, and ATP-dependent chromosome remodeling complexes. Snf2 family DNA-dependent ATPases constitute the catalytic subunits of ATP-dependent chromosome remodeling complexes, which accounts for energy supply during chromatin remodeling. Increasing evidence indicates a critical role of chromatin remodeling in the establishment of long-lasting, even transgenerational immune memory in plants, which is supported by the findings that DNA methylation, histone deacetylation, and histone methylation can prime the promoters of immune-related genes required for disease defense. So what are the links between Snf2-mediated ATP-dependent chromosome remodeling and plant immunity, and what mechanisms might support its involvement in disease resistance? © 2017 Elsevier Inc. All rights reserved.
Global chromatin fibre compaction in response to DNA damage
International Nuclear Information System (INIS)
Hamilton, Charlotte; Hayward, Richard L.; Gilbert, Nick
2011-01-01
Highlights: ► Robust KAP1 phosphorylation in response to DNA damage in HCT116 cells. ► DNA repair foci are found in soluble chromatin. ► Biophysical analysis reveals global chromatin fibre compaction after DNA damage. ► DNA damage is accompanied by rapid linker histone dephosphorylation. -- Abstract: DNA is protected by packaging it into higher order chromatin fibres, but this can impede nuclear processes like DNA repair. Despite considerable research into the factors required for signalling and repairing DNA damage, it is unclear if there are concomitant changes in global chromatin fibre structure. In human cells DNA double strand break (DSB) formation triggers a signalling cascade resulting in H2AX phosphorylation (γH2AX), the rapid recruitment of chromatin associated proteins and the subsequent repair of damaged sites. KAP1 is a transcriptional corepressor and in HCT116 cells we found that after DSB formation by chemicals or ionising radiation there was a wave of, predominantly ATM dependent, KAP1 phosphorylation. Both KAP1 and phosphorylated KAP1 were readily extracted from cells indicating they do not have a structural role and γH2AX was extracted in soluble chromatin indicating that sites of damage are not attached to an underlying structural matrix. After DSB formation we did not find a concomitant change in the sensitivity of chromatin fibres to micrococcal nuclease digestion. Therefore to directly investigate higher order chromatin fibre structures we used a biophysical sedimentation technique based on sucrose gradient centrifugation to compare the conformation of chromatin fibres isolated from cells before and after DNA DSB formation. After damage we found global chromatin fibre compaction, accompanied by rapid linker histone dephosphorylation, consistent with fibres being more regularly folded or fibre deformation being stabilized by linker histones. We suggest that following DSB formation, although there is localised chromatin unfolding to
Cytoplasmic chromatin triggers inflammation in senescence and cancer.
Dou, Zhixun; Ghosh, Kanad; Vizioli, Maria Grazia; Zhu, Jiajun; Sen, Payel; Wangensteen, Kirk J; Simithy, Johayra; Lan, Yemin; Lin, Yanping; Zhou, Zhuo; Capell, Brian C; Xu, Caiyue; Xu, Mingang; Kieckhaefer, Julia E; Jiang, Tianying; Shoshkes-Carmel, Michal; Tanim, K M Ahasan Al; Barber, Glen N; Seykora, John T; Millar, Sarah E; Kaestner, Klaus H; Garcia, Benjamin A; Adams, Peter D; Berger, Shelley L
2017-10-19
Chromatin is traditionally viewed as a nuclear entity that regulates gene expression and silencing. However, we recently discovered the presence of cytoplasmic chromatin fragments that pinch off from intact nuclei of primary cells during senescence, a form of terminal cell-cycle arrest associated with pro-inflammatory responses. The functional significance of chromatin in the cytoplasm is unclear. Here we show that cytoplasmic chromatin activates the innate immunity cytosolic DNA-sensing cGAS-STING (cyclic GMP-AMP synthase linked to stimulator of interferon genes) pathway, leading both to short-term inflammation to restrain activated oncogenes and to chronic inflammation that associates with tissue destruction and cancer. The cytoplasmic chromatin-cGAS-STING pathway promotes the senescence-associated secretory phenotype in primary human cells and in mice. Mice deficient in STING show impaired immuno-surveillance of oncogenic RAS and reduced tissue inflammation upon ionizing radiation. Furthermore, this pathway is activated in cancer cells, and correlates with pro-inflammatory gene expression in human cancers. Overall, our findings indicate that genomic DNA serves as a reservoir to initiate a pro-inflammatory pathway in the cytoplasm in senescence and cancer. Targeting the cytoplasmic chromatin-mediated pathway may hold promise in treating inflammation-related disorders.
Fragmentation of chromatin with 125I radioactive disintegrations
International Nuclear Information System (INIS)
Turner, G.N.; Nobis, P.; Dewey, W.C.
1976-01-01
The DNA in Chinese hamster cells was labeled first for 3 h with [ 3 H]TdR and then for 3 h with [ 125 I]UdR. Chromatin was extracted, frozen, and stored at -30 0 C until 1.0 x 10 17 and 1.25 x 10 17 disintegrations/g of labeled DNA occurred for 125 I and 3 H, respectively. Velocity sedimentation of chromatin (DNA with associated chromosomal proteins) in neutral sucrose gradients indicated that the localized energy from the 125 I disintegrations, which gave about 1 double-strand break/disintegration plus an additional 1.3 single strand breaks, selectively fragmented the [ 125 I] chromatin into pieces smaller than the [ 3 H] chromatin. In other words, 125 I disintegrations caused much more localized damage in the chromatin labeled with 125 I than in the chromatin labeled with 3 H, and fragments induced in DNA by 125 I disintegrations were not held together by the associated chromosomal proteins. Use of this 125 I technique for studying chromosomal proteins associated with different regions in the cellular DNA is discussed. For these studies, the number of disintegrations required for fragmenting DNA molecules of different sizes is illustrated
Chromatin Immunoprecipitation of Replication Factors Moving with the Replication Fork
Rapp, Jordan B.; Ansbach, Alison B.; Noguchi, Chiaki; Noguchi, Eishi
2009-01-01
Replication of chromosomes involves a variety of replication proteins including DNA polymerases, DNA helicases, and other accessory factors. Many of these proteins are known to localize at replication forks and travel with them as components of the replisome complex. Other proteins do not move with replication forks but still play an essential role in DNA replication. Therefore, in order to understand the mechanisms of DNA replication and its controls, it is important to examine localization ...
Sulforaphane modulates telomerase activity via epigenetic regulation in prostate cancer cell lines.
Abbas, Ata; Hall, J Adam; Patterson, William L; Ho, Emily; Hsu, Anna; Al-Mulla, Fahd; Georgel, Philippe T
2016-02-01
Epidemiologic studies have revealed that diets rich in sulforaphane (SFN), an isothiocyanate present in cruciferous vegetables, are associated with a marked decrease in prostate cancer incidence. The chemo-preventive role of SFN is associated with its histone de-acetylase inhibitor activity. However, the effect of SFN on chromatin composition and dynamic folding, especially in relation to HDAC inhibitor activity, remains poorly understood. In this study, we found that SFN can inhibit the expression and activity of human telomerase reverse transcriptase (hTERT), the catalytic subunit of telomerase, in 2 prostate cancer cell lines. This decrease in gene expression is correlated with SFN-induced changes in chromatin structure and composition. The SFN-mediated changes in levels of histone post-translational modifications, more specifically acetylation of histone H3 lysine 18 and di-methylation of histone H3 lysine 4, 2 modifications linked with high risk of prostate cancer recurrence, were associated with regulatory elements within the hTERT promoter region. Chromatin condensation may also play a role in SFN-mediated hTERT repression, since expression and recruitment of MeCP2, a known chromatin compactor, were altered in SFN treated prostate cancer cells. Chromatin immuno-precipitation (ChIP) of MeCP2 showed enrichment over regions of the hTERT promoter with increased nucleosome density. These combined results strongly support a role for SFN in the mediation of epigenetic events leading to the repression of hTERT in prostate cancer cells. This ability of SFN to modify chromatin composition and structure associated with target gene expression provides a new model by which dietary phytochemicals may exert their chemoprevention activity.
Guarding against Collateral Damage during Chromatin Transactions
DEFF Research Database (Denmark)
Altmeyer, Matthias; Lukas, Jiri
2013-01-01
Signal amplifications are vital for chromatin function, yet they also bear the risk of transforming into unrestrained, self-escalating, and potentially harmful responses. Examples of inbuilt limitations are emerging, revealing how chromatin transactions are confined within physiological boundaries....
A role for chromatin topology in imprinted domain regulation.
MacDonald, William A; Sachani, Saqib S; White, Carlee R; Mann, Mellissa R W
2016-02-01
Recently, many advancements in genome-wide chromatin topology and nuclear architecture have unveiled the complex and hidden world of the nucleus, where chromatin is organized into discrete neighbourhoods with coordinated gene expression. This includes the active and inactive X chromosomes. Using X chromosome inactivation as a working model, we utilized publicly available datasets together with a literature review to gain insight into topologically associated domains, lamin-associated domains, nucleolar-associating domains, scaffold/matrix attachment regions, and nucleoporin-associated chromatin and their role in regulating monoallelic expression. Furthermore, we comprehensively review for the first time the role of chromatin topology and nuclear architecture in the regulation of genomic imprinting. We propose that chromatin topology and nuclear architecture are important regulatory mechanisms for directing gene expression within imprinted domains. Furthermore, we predict that dynamic changes in chromatin topology and nuclear architecture play roles in tissue-specific imprint domain regulation during early development and differentiation.
LENUS (Irish Health Repository)
Murphy, Derek M
2009-01-01
BACKGROUND: Neuroblastoma, a cancer derived from precursor cells of the sympathetic nervous system, is a major cause of childhood cancer related deaths. The single most important prognostic indicator of poor clinical outcome in this disease is genomic amplification of MYCN, a member of a family of oncogenic transcription factors. METHODOLOGY: We applied MYCN chromatin immunoprecipitation to microarrays (ChIP-chip) using MYCN amplified\\/non-amplified cell lines as well as a conditional knockdown cell line to determine the distribution of MYCN binding sites within all annotated promoter regions. CONCLUSION: Assessment of E-box usage within consistently positive MYCN binding sites revealed a predominance for the CATGTG motif (p<0.0016), with significant enrichment of additional motifs CATTTG, CATCTG, CAACTG in the MYCN amplified state. For cell lines over-expressing MYCN, gene ontology analysis revealed enrichment for the binding of MYCN at promoter regions of numerous molecular functional groups including DNA helicases and mRNA transcriptional regulation. In order to evaluate MYCN binding with respect to other genomic features, we determined the methylation status of all annotated CpG islands and promoter sequences using methylated DNA immunoprecipitation (MeDIP). The integration of MYCN ChIP-chip and MeDIP data revealed a highly significant positive correlation between MYCN binding and DNA hypermethylation. This association was also detected in regions of hemizygous loss, indicating that the observed association occurs on the same homologue. In summary, these findings suggest that MYCN binding occurs more commonly at CATGTG as opposed to the classic CACGTG E-box motif, and that disease associated over expression of MYCN leads to aberrant binding to additional weaker affinity E-box motifs in neuroblastoma. The co-localization of MYCN binding and DNA hypermethylation further supports the dual role of MYCN, namely that of a classical transcription factor affecting the
Identification of a p53-response element in the promoter of the proline oxidase gene
International Nuclear Information System (INIS)
Maxwell, Steve A.; Kochevar, Gerald J.
2008-01-01
Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site
Institute of Scientific and Technical Information of China (English)
CHEN Li; CHEN Bo-bin; LI Jun-jie; JIN Wei; SHAO Zhi-min
2011-01-01
Objective To explore the activity of PEA3 ( polyomavirus enhancer activator 3 ) on CXCL12 (Chemokine CXC motif ligand 12) transcription and to reveal the role of PEA3 involved in CXCL12-mediated metastasis and angiogenesis in breast cancer. Methods Methods such as cell transfection, ChIP assay (chromatin immunoprecipitation ), and siRNA (small interfering RNA) were applied to demonstrate and confirm the interaction between PEA3 and CXCL12. Results Over-expression of PEA3 could increase the CXCL12 mRNA level and the CXCL12 promoter activity in human MCF-7 breast cancer cells. ChIP assay demonstrated that PEA3 could bind to the CXCL12 promoter in the cells transfected with PEA3 expression vector. PEA3 siRNA decreased CXCL12 promoter activity and the binding of PEA3 to the CXCL12 promoter in MCF-7 cells. Conclusions PEA3 could activate CXCL12 promoter transcription. It may be a potential mechanism of tumor angiogenesis and metastasis regarding of PEA3 and CXCL12.
Interactions between the nuclear matrix and an enhancer of the tryptophan oxygenase gene
International Nuclear Information System (INIS)
Kaneoka, Hidenori; Miyake, Katsuhide; Iijima, Shinji
2009-01-01
The gene for tryptophan oxygenase (TO) is expressed in adult hepatocytes in a tissue- and differentiation-specific manner. The TO promoter has two glucocorticoid-responsive elements (GREs), and its expression is regulated by glucocorticoid hormone in the liver. We found a novel GRE in close proximity to a scaffold/matrix attachment region (S/MAR) that was located around -8.5 kb from the transcriptional start site of the TO gene by electrophoretic mobility shift and chromatin immunoprecipitation (ChIP) assays. A combination of nuclear fractionation and quantitative PCR analysis showed that the S/MAR was tethered to the nuclear matrix in both fetal and adult hepatocytes. ChIP assay showed that, in adult hepatocytes, the S/MAR-GRE and the promoter proximal regions interacted with lamin and heterogeneous nuclear ribonucleoprotein U in a dexamethasone dependent manner, but this was not the case in fetal cells, suggesting that developmental stage-specific expression of the TO gene might rely on the binding of the enhancer (the -8.5 kb S/MAR-GRE) and the promoter to the inner nuclear matrix.
Interactions between the nuclear matrix and an enhancer of the tryptophan oxygenase gene
Energy Technology Data Exchange (ETDEWEB)
Kaneoka, Hidenori [Department of Biotechnology, Graduate School of Engineering, Nagoya University, Furo-cho, Chikusa-ku, Nagoya 464-8603 (Japan); Miyake, Katsuhide, E-mail: miyake@nubio.nagoya-u.ac.jp [Department of Biotechnology, Graduate School of Engineering, Nagoya University, Furo-cho, Chikusa-ku, Nagoya 464-8603 (Japan); Iijima, Shinji [Department of Biotechnology, Graduate School of Engineering, Nagoya University, Furo-cho, Chikusa-ku, Nagoya 464-8603 (Japan)
2009-10-02
The gene for tryptophan oxygenase (TO) is expressed in adult hepatocytes in a tissue- and differentiation-specific manner. The TO promoter has two glucocorticoid-responsive elements (GREs), and its expression is regulated by glucocorticoid hormone in the liver. We found a novel GRE in close proximity to a scaffold/matrix attachment region (S/MAR) that was located around -8.5 kb from the transcriptional start site of the TO gene by electrophoretic mobility shift and chromatin immunoprecipitation (ChIP) assays. A combination of nuclear fractionation and quantitative PCR analysis showed that the S/MAR was tethered to the nuclear matrix in both fetal and adult hepatocytes. ChIP assay showed that, in adult hepatocytes, the S/MAR-GRE and the promoter proximal regions interacted with lamin and heterogeneous nuclear ribonucleoprotein U in a dexamethasone dependent manner, but this was not the case in fetal cells, suggesting that developmental stage-specific expression of the TO gene might rely on the binding of the enhancer (the -8.5 kb S/MAR-GRE) and the promoter to the inner nuclear matrix.
Histone Deacetylase Inhibition Downregulates Collagen 3A1 in Fibrotic Lung Fibroblasts
Directory of Open Access Journals (Sweden)
Victor J. Thannickal
2013-09-01
Full Text Available Idiopathic pulmonary fibrosis (IPF is a deadly disease characterized by chronic inflammation and excessive collagen accumulation in the lung. Myofibroblasts are the primary collagen-producing cells in pulmonary fibrosis. Histone deacetylase inhibitor (HDACi can affect gene expression, and some, such as suberoylanilide hydroxamic acid (SAHA, are US FDA approved for cancer treatment. In this study, we investigated SAHA’s effects on the expression of collagen III alpha 1 (COL3A1 in primary human IPF fibroblasts and in a murine model of pulmonary fibrosis. We observed that increased COL3A1 expression in IPF fibroblasts can be substantially reduced by SAHA treatment at the level of transcription as detected by RT-PCR; collagen III protein level was also reduced, as detected by Western blots and immunofluorescence. The deacetylation inhibitor effect of SAHA was verified by observing higher acetylation levels of both histone H3 and H4 in treated IPF cells. Chromatin immunoprecipitation (ChIP experiments demonstrated that the reduced expression of COL3A1 by SAHA is with increased association of the repressive chromatin marker, H3K27Me3, and decreased association of the active chromatin marker, H3K9Ac. In our murine model of bleomycin-induced pulmonary fibrosis, the SAHA treated group demonstrated significantly less collagen III, as detected by immunohistochemistry. Our data indicate that the HDACi SAHA alters the chromatin associated with COL3A1, resulting in its decreased expression.
The nucleosome: orchestrating DNA damage signaling and repair within chromatin.
Agarwal, Poonam; Miller, Kyle M
2016-10-01
DNA damage occurs within the chromatin environment, which ultimately participates in regulating DNA damage response (DDR) pathways and repair of the lesion. DNA damage activates a cascade of signaling events that extensively modulates chromatin structure and organization to coordinate DDR factor recruitment to the break and repair, whilst also promoting the maintenance of normal chromatin functions within the damaged region. For example, DDR pathways must avoid conflicts between other DNA-based processes that function within the context of chromatin, including transcription and replication. The molecular mechanisms governing the recognition, target specificity, and recruitment of DDR factors and enzymes to the fundamental repeating unit of chromatin, i.e., the nucleosome, are poorly understood. Here we present our current view of how chromatin recognition by DDR factors is achieved at the level of the nucleosome. Emerging evidence suggests that the nucleosome surface, including the nucleosome acidic patch, promotes the binding and activity of several DNA damage factors on chromatin. Thus, in addition to interactions with damaged DNA and histone modifications, nucleosome recognition by DDR factors plays a key role in orchestrating the requisite chromatin response to maintain both genome and epigenome integrity.
Rapid and reversible epigenome editing by endogenous chromatin regulators.
Braun, Simon M G; Kirkland, Jacob G; Chory, Emma J; Husmann, Dylan; Calarco, Joseph P; Crabtree, Gerald R
2017-09-15
Understanding the causal link between epigenetic marks and gene regulation remains a central question in chromatin biology. To edit the epigenome we developed the FIRE-Cas9 system for rapid and reversible recruitment of endogenous chromatin regulators to specific genomic loci. We enhanced the dCas9-MS2 anchor for genome targeting with Fkbp/Frb dimerizing fusion proteins to allow chemical-induced proximity of a desired chromatin regulator. We find that mSWI/SNF (BAF) complex recruitment is sufficient to oppose Polycomb within minutes, leading to activation of bivalent gene transcription in mouse embryonic stem cells. Furthermore, Hp1/Suv39h1 heterochromatin complex recruitment to active promoters deposits H3K9me3 domains, resulting in gene silencing that can be reversed upon washout of the chemical dimerizer. This inducible recruitment strategy provides precise kinetic information to model epigenetic memory and plasticity. It is broadly applicable to mechanistic studies of chromatin in mammalian cells and is particularly suited to the analysis of endogenous multi-subunit chromatin regulator complexes.Understanding the link between epigenetic marks and gene regulation requires the development of new tools to directly manipulate chromatin. Here the authors demonstrate a Cas9-based system to recruit chromatin remodelers to loci of interest, allowing rapid, reversible manipulation of epigenetic states.
Chromatin decondensed by acetylation shows an elevated radiation response
International Nuclear Information System (INIS)
Nackerdien, Z.; Michie, J.; Boehm, L.
1989-01-01
V-79 Chinese hamster lung fibroblasts exposed to 5 mM n-sodium butyrate were irradiated with 60Co gamma rays and cell survival was determined by the cell colony assay. In a separate set of experiments the acetylated chromatin obtained from these cells was irradiated and the change of molecular weight of the DNA was evaluated by alkaline sucrose density centrifugation. At a survival level of 10(-2) to 10(-4) cells exposed to butyrate were found to be 1.3-1.4 times more radiosensitive than control cells. Exposure of isolated chromatin to 100 Gy of 60Co gamma irradiation generated 0.9 +/- 0.03 single-strand breaks (ssb) per 10 Gy per 10(8) Da and 2.0 +/- 0.3 ssb/10 Gy/10(8) Da for control and acetylated chromatin, respectively. The elevated radiation sensitivity of chromatin relaxed by acetylation is in good agreement with previous results on chromatin expanded by histone H1 depletion. Packing and accessibility of DNA in chromatin appear to be major factors which influence the radiation sensitivity. The intrinsic radiation sensitivity of chromatin in various packing states is discussed in light of the variation of radiation sensitivity of whole cells in the cell cycle which incorporates repair
Transcription Through Chromatin - Dynamic Organization of Genes
Indian Academy of Sciences (India)
different proteins involved in the synthesis of mRNA from the. DNA template. ... CBP - CREB Binding Protein. CHRAC. Chromatin .... nucleosomal interactions, and thereby change the chromatin structure, as per the ..... methyltransferases in gene regulation is yet to be elucidated. .... Molecular Biology and. Genetics Unit.
Chen, Dijun; Kaufmann, Kerstin
2017-01-01
Key transcription factors (TFs) controlling the morphogenesis of flowers and leaves have been identified in the model plant Arabidopsis thaliana. Recent genome-wide approaches based on chromatin immunoprecipitation (ChIP) followed by high-throughput DNA sequencing (ChIP-seq) enable systematic identification of genome-wide TF binding sites (TFBSs) of these regulators. Here, we describe a computational pipeline for analyzing ChIP-seq data to identify TFBSs and to characterize gene regulatory networks (GRNs) with applications to the regulatory studies of flower development. In particular, we provide step-by-step instructions on how to download, analyze, visualize, and integrate genome-wide data in order to construct GRNs for beginners of bioinformatics. The practical guide presented here is ready to apply to other similar ChIP-seq datasets to characterize GRNs of interest.
Vacuum ultraviolet (VUV) absorption spectra of chromatin and its components
International Nuclear Information System (INIS)
Dodonova, N.Y.; Kiseleva, M.N.; Petrov, M.Y.; Tsyganenko, N.M.; Bubyakina, V.V.; Chikhirzhina, G.I.
1984-01-01
The electron absorption spectra of thin films of chromatin and chromatin components in the ultraviolet region (140-280 nm) were investigated. The absorption coefficients μ(lambda) of chromatin, nucleosomes with and without histone H1, total histones (TH), and DNA were compared. The spectra of nucleosomes differ from the sum-spectrum of DNA plus TH. The chromatin and nucleosome spectra are not similar in the spectral region of 190-160 nm. The lack of additivity of absorption coefficients at different wavelengths may be explained by different conformational changes of DNA, TH in nucleosomes and chromatin during the process of drying aqueous solutions for the preparation of thin films. The μ(lambda) values are useful for an estimate of the DNA and TH absorption in chromatin and nucleosomes in discussing UV and VUV irradiation damages. (Auth.)
The Latest Twists in Chromatin Remodeling.
Blossey, Ralf; Schiessel, Helmut
2018-01-05
In its most restrictive interpretation, the notion of chromatin remodeling refers to the action of chromatin-remodeling enzymes on nucleosomes with the aim of displacing and removing them from the chromatin fiber (the effective polymer formed by a DNA molecule and proteins). This local modification of the fiber structure can have consequences for the initiation and repression of the transcription process, and when the remodeling process spreads along the fiber, it also results in long-range effects essential for fiber condensation. There are three regulatory levels of relevance that can be distinguished for this process: the intrinsic sequence preference of the histone octamer, which rules the positioning of the nucleosome along the DNA, notably in relation to the genetic information coded in DNA; the recognition or selection of nucleosomal substrates by remodeling complexes; and, finally, the motor action on the nucleosome exerted by the chromatin remodeler. Recent work has been able to provide crucial insights at each of these three levels that add new twists to this exciting and unfinished story, which we highlight in this perspective. Copyright © 2017 Biophysical Society. Published by Elsevier Inc. All rights reserved.
Accounting for immunoprecipitation efficiencies in the statistical analysis of ChIP-seq data
Bao, Yanchun; Vinciotti, Veronica; Wit, Ernst; 't Hoen, Peter A C
2013-01-01
Background: ImmunoPrecipitation (IP) efficiencies may vary largely between different antibodies and between repeated experiments with the same antibody. These differences have a large impact on the quality of ChIP-seq data: a more efficient experiment will necessarily lead to a higher signal to
Pattison, Jillian M.; Wright, Jason B.; Cole, Michael D.
2015-01-01
The majority of the genome consists of intergenic and non-coding DNA sequences shown to play a major role in different gene regulatory networks. However, the specific potency of these distal elements as well as how these regions exert function across large genomic distances remains unclear. To address these unresolved issues, we closely examined the chromatin architecture around proto-oncogenic loci in the mouse and human genomes to demonstrate a functional role for chromatin looping in distal gene regulation. Using cell culture models, we show that tumorigenic retroviral integration sites within the mouse genome occur near existing large chromatin loops and that this chromatin architecture is maintained within the human genome as well. Significantly, as mutagenesis screens are not feasible in humans, we demonstrate a way to leverage existing screens in mice to identify disease relevant human enhancers and expose novel disease mechanisms. For instance, we characterize the epigenetic landscape upstream of the human Cyclin D1 locus to find multiple distal interactions that contribute to the complex cis-regulation of this cell cycle gene. Furthermore, we characterize a novel distal interaction upstream of the Cyclin D1 gene which provides mechanistic evidence for the abundant overexpression of Cyclin D1 occurring in multiple myeloma cells harboring a pathogenic translocation event. Through use of mapped retroviral integrations and translocation breakpoints, our studies highlight the importance of chromatin looping in oncogene expression, elucidate the epigenetic mechanisms crucial for distal cis-regulation, and in one particular instance, explain how a translocation event drives tumorigenesis through upregulation of a proto-oncogene. PMID:25799187
Directory of Open Access Journals (Sweden)
Nan Zhong
Full Text Available We developed and optimized a high-throughput project workflow to generate renewable recombinant antibodies to human proteins involved in epigenetic signalling. Three different strategies to produce phage display compatible protein antigens in bacterial systems were compared, and we found that in vivo biotinylation through the use of an Avi tag was the most productive method. Phage display selections were performed on 265 in vivo biotinylated antigen domains. High-affinity Fabs (<20nM were obtained for 196. We constructed and optimized a new expression vector to produce in vivo biotinylated Fabs in E. coli. This increased average yields up to 10-fold, with an average yield of 4 mg/L. For 118 antigens, we identified Fabs that could immunoprecipitate their full-length endogenous targets from mammalian cell lysates. One Fab for each antigen was converted to a recombinant IgG and produced in mammalian cells, with an average yield of 15 mg/L. In summary, we have optimized each step of the pipeline to produce recombinant antibodies, significantly increasing both efficiency and yield, and also showed that these Fabs and IgGs can be generally useful for chromatin immunoprecipitation (ChIP protocols.
Pax6 interacts with Iba1 and shows age-associated alterations in brain of aging mice.
Maurya, Shashank Kumar; Mishra, Rajnikant
2017-07-01
The Pax6, a transcriptional regulator and multifunctional protein, has been found critical for neurogenesis, neuro-degeneration, mental retardation, neuroendocrine tumors, glioblastoma and astrocytomas. The age-associated alteration in the expression of Pax6 in neuron and glia has also been observed in the immunologically privileged brain. Therefore, it is presumed that Pax6 may modulate brain immunity by activation of microglia either directly interacting with genes or proteins of microglia or indirectly though inflammation associated with neurodegeneration. This report describes evaluation of expression, co-localization and interactions of Pax6 with Ionized binding protein1 (Iba1) in brain of aging mice by Immunohistochemistry, Chromatin Immuno-precipitation (ChIP) and Co-immunoprecipitation (Co-IP), respectively. The co-localization of Pax6 with Iba1 was observed in the cerebellum, cerebral cortex, hippocampus, midbrain and olfactory lobe. The Pax6 and Iba1 also interact physically. The age-dependent alteration in their expression and co-localization were also observed in mice. Results indicate Pax6-dependent activities of Iba1 in the remodelling of microglia during immunological surveillance of the brain. Copyright © 2017 Elsevier B.V. All rights reserved.
Chromatin structure and evolution in the human genome
Directory of Open Access Journals (Sweden)
Dunlop Malcolm G
2007-05-01
Full Text Available Abstract Background Evolutionary rates are not constant across the human genome but genes in close proximity have been shown to experience similar levels of divergence and selection. The higher-order organisation of chromosomes has often been invoked to explain such phenomena but previously there has been insufficient data on chromosome structure to investigate this rigorously. Using the results of a recent genome-wide analysis of open and closed human chromatin structures we have investigated the global association between divergence, selection and chromatin structure for the first time. Results In this study we have shown that, paradoxically, synonymous site divergence (dS at non-CpG sites is highest in regions of open chromatin, primarily as a result of an increased number of transitions, while the rates of other traditional measures of mutation (intergenic, intronic and ancient repeat divergence as well as SNP density are highest in closed regions of the genome. Analysis of human-chimpanzee divergence across intron-exon boundaries indicates that although genes in relatively open chromatin generally display little selection at their synonymous sites, those in closed regions show markedly lower divergence at their fourfold degenerate sites than in neighbouring introns and intergenic regions. Exclusion of known Exonic Splice Enhancer hexamers has little affect on the divergence observed at fourfold degenerate sites across chromatin categories; however, we show that closed chromatin is enriched with certain classes of ncRNA genes whose RNA secondary structure may be particularly important. Conclusion We conclude that, overall, non-CpG mutation rates are lowest in open regions of the genome and that regions of the genome with a closed chromatin structure have the highest background mutation rate. This might reflect lower rates of DNA damage or enhanced DNA repair processes in regions of open chromatin. Our results also indicate that dS is a poor
Extensive Variation in Chromatin States Across Humans
Kasowski, M.
2013-10-17
The majority of disease-associated variants lie outside protein-coding regions, suggesting a link between variation in regulatory regions and disease predisposition. We studied differences in chromatin states using five histone modifications, cohesin, and CTCF in lymphoblastoid lines from 19 individuals of diverse ancestry. We found extensive signal variation in regulatory regions, which often switch between active and repressed states across individuals. Enhancer activity is particularly diverse among individuals, whereas gene expression remains relatively stable. Chromatin variability shows genetic inheritance in trios, correlates with genetic variation and population divergence, and is associated with disruptions of transcription factor binding motifs. Overall, our results provide insights into chromatin variation among humans.
Extensive Variation in Chromatin States Across Humans
Kasowski, M.; Kyriazopoulou-Panagiotopoulou, S.; Grubert, F.; Zaugg, J. B.; Kundaje, A.; Liu, Y.; Boyle, A. P.; Zhang, Q. C.; Zakharia, F.; Spacek, D. V.; Li, J.; Xie, D.; Olarerin-George, A.; Steinmetz, L. M.; Hogenesch, J. B.; Kellis, M.; Batzoglou, S.; Snyder, M.
2013-01-01
The majority of disease-associated variants lie outside protein-coding regions, suggesting a link between variation in regulatory regions and disease predisposition. We studied differences in chromatin states using five histone modifications, cohesin, and CTCF in lymphoblastoid lines from 19 individuals of diverse ancestry. We found extensive signal variation in regulatory regions, which often switch between active and repressed states across individuals. Enhancer activity is particularly diverse among individuals, whereas gene expression remains relatively stable. Chromatin variability shows genetic inheritance in trios, correlates with genetic variation and population divergence, and is associated with disruptions of transcription factor binding motifs. Overall, our results provide insights into chromatin variation among humans.
Formation of DNA-protein crosslinks in gamma-irradiated chromatin
International Nuclear Information System (INIS)
Mee, L.K.
1985-01-01
Gamma-irradiation of chromatin in vitro and in vivo induces DNA-protein crosslinks which are stable to salt and detergent treatment. The efficiency of crosslink formation is 100 times greater in irradiated isolated chromatin than in chromatin irradiated in cells before isolation. Gamma-irradiation of isolated chromatin in the presence of radical scavengers shows that OH . is the most effective radical for the promotion of crosslinking whereas e/sub aq//sup -/ and O/sub 2//sup -/ are essentially ineffective. For chromatin irradiated in the cell before isolation, fewer crosslinks are formed in air than in an atmosphere of nitrogen; the greatest effect is found in cells irradiated in an atmosphere of nitrous oxide, suggesting that OH . may be involved in the formation of crosslinks in vivo. On the basis of comparing radiation-induced crosslinking in whole chromating (DNA, H1 histone, the core histones - H2A, H2B, H3 and H4 - and non-histone chromosomal proteins) and in a chromatin subunit (DNA and the core histones), the authors identified the core histones as the specific chromosomal proteins predominantly involved in crosslinking to DNA
Directory of Open Access Journals (Sweden)
Sha Ky
2010-08-01
Full Text Available Abstract Background Tissue differentiation is accompanied by genome-wide changes in the underlying chromatin structure and dynamics, or epigenome. By controlling when, where, and what regulatory factors have access to the underlying genomic DNA, the epigenome influences the cell's transcriptome and ultimately its function. Existing genomic methods for analyzing cell-type-specific changes in chromatin generally involve two elements: (i a source for purified cells (or nuclei of distinct types, and (ii a specific treatment that partitions or degrades chromatin by activity or structural features. For many cell types of great interest, such assays are limited by our inability to isolate the relevant cell populations in an organism or complex tissue containing an intertwined mixture of other cells. This limitation has confined available knowledge of chromatin dynamics to a narrow range of biological systems (cell types that can be sorted/separated/dissected in large numbers and tissue culture models or to amalgamations of diverse cell types (tissue chunks, whole organisms. Results Transgene-driven expression of DNA/chromatin modifying enzymes provides one opportunity to query chromatin structures in expression-defined cell subsets. In this work we combine in vivo expression of a bacterial DNA adenine methyltransferase (DAM with high throughput sequencing to sample tissue-specific chromatin accessibility on a genome-wide scale. We have applied the method (DALEC: Direct Asymmetric Ligation End Capture towards mapping a cell-type-specific view of genome accessibility as a function of differentiated state. Taking advantage of C. elegans strains expressing the DAM enzyme in diverse tissues (body wall muscle, gut, and hypodermis, our efforts yield a genome-wide dataset measuring chromatin accessibility at each of 538,000 DAM target sites in the C. elegans (diploid genome. Conclusions Validating the DALEC mapping results, we observe a strong association
Pascali, Chiara; Teichmann, Martin
2013-01-01
RNA polymerase III (Pol III) transcription is regulated by modifications of the chromatin. DNA methylation and post-translational modifications of histones, such as acetylation, phosphorylation and methylation have been linked to Pol III transcriptional activity. In addition to being regulated by modifications of DNA and histones, Pol III genes and its transcription factors have been implicated in the organization of nuclear chromatin in several organisms. In yeast, the ability of the Pol III transcription system to contribute to nuclear organization seems to be dependent on direct interactions of Pol III genes and/or its transcription factors TFIIIC and TFIIIB with the structural maintenance of chromatin (SMC) protein-containing complexes cohesin and condensin. In human cells, Pol III genes and transcription factors have also been shown to colocalize with cohesin and the transcription regulator and genome organizer CCCTC-binding factor (CTCF). Furthermore, chromosomal sites have been identified in yeast and humans that are bound by partial Pol III machineries (extra TFIIIC sites - ETC; chromosome organizing clamps - COC). These ETCs/COC as well as Pol III genes possess the ability to act as boundary elements that restrict spreading of heterochromatin.
Neutron scattering studies on chromatin higher-order structure
Energy Technology Data Exchange (ETDEWEB)
Graziano, V.; Gerchman, S.E.; Schneider, D.K.; Ramakrishnan, V. [Brookhaven National Laboratory, Upton, NY (United States)
1994-12-31
We have been engaged in studies of the structure and condensation of chromatin into the 30nm filament using small-angle neutron scattering. We have also used deuterated histone H1 to determine its location in the chromatin 30nm filament. Our studies indicate that chromatin condenses with increasing ionic strength to a limiting structure that has a mass per unit length of 6-7 nucleosomes/11 nm. They also show that the linker histone H1/H5 is located in the interior of the chromatin filament, in a position compatible with its binding to the inner face of the nucleosome. Analysis of the mass per unit length as a function of H5 stoichiometry suggests that 5-7 contiguous nucleosomes need to have H5 bound before a stable higher order structure can exist.
Neutron scattering studies on chromatin higher-order structure
International Nuclear Information System (INIS)
Graziano, V.; Gerchman, S.E.; Schneider, D.K.; Ramakrishnan, V.
1994-01-01
We have been engaged in studies of the structure and condensation of chromatin into the 30nm filament using small-angle neutron scattering. We have also used deuterated histone H1 to determine its location in the chromatin 30nm filament. Our studies indicate that chromatin condenses with increasing ionic strength to a limiting structure that has a mass per unit length of 6-7 nucleosomes/11 nm. They also show that the linker histone H1/H5 is located in the interior of the chromatin filament, in a position compatible with its binding to the inner face of the nucleosome. Analysis of the mass per unit length as a function of H5 stoichiometry suggests that 5-7 contiguous nucleosomes need to have H5 bound before a stable higher order structure can exist
Radiation-induced cell death by chromatin loss
International Nuclear Information System (INIS)
Campbell, I.R.; Warenius, H.M.
1989-01-01
A model is proposed which relates reproductive death of cells caused by radiation to loss of chromatin at cell division. This loss of chromatin can occur through chromosomal deletions or through the formation of asymmetrical chromosomal exchanges. It is proposed that smaller doses of radiation produce fewer chromatin breaks, which are more likely to be accurately repaired, compared with larger doses. Consequently, smaller doses of radiation are less efficient in causing cell death, leading to a shoulder on the cell survival curve. Experimental evidence supports this model, and the fit between the derived formula and experimental cell survival curves is good. The derived formula approximates to the linear-quadratic equation at low doses of radiation. (author)
Chromatin architecture and gene expression in Escherichia coli
DEFF Research Database (Denmark)
Willenbrock, Hanni; Ussery, David
2004-01-01
Two recent genome-scale analyses underscore the importance of DNA topology and chromatin structure in regulating transcription in Escherichia coli.......Two recent genome-scale analyses underscore the importance of DNA topology and chromatin structure in regulating transcription in Escherichia coli....
International Nuclear Information System (INIS)
Lebedev, D. V.; Filatov, M. V.; Kuklin, A. I.; Islamov, A. Kh.; Stellbrink, J.; Pantina, R. A.; Denisov, Yu. Yu.; Toperverg, B. P.; Isaev-Ivanov, V. V.
2008-01-01
The chromatin organization in chicken erythrocyte nuclei was studied by small-angle neutron scattering in the scattering-vector range from 1.5 x 10 -1 to 10 -4 A -1 with the use of the contrast-variation technique. This scattering-vector range corresponds to linear dimensions from 4 nm to 6 μm and covers the whole hierarchy of chromatin structures, from the nucleosomal structure to the entire nucleus. The results of the present study allowed the following conclusions to be drawn: (1) both the chromatin-protein structure and the structure of the nucleic acid component in chicken erythrocyte nuclei have mass-fractal properties, (2) the structure of the protein component of chromatin exhibits a fractal behavior on scales extending over two orders of magnitude, from the nucleosomal size to the size of an entire nucleus, and (3) the structure of the nucleic acid component of chromatin in chicken erythrocyte nuclei is likewise of a fractal nature and has two levels of organization or two phases with the crossover point at about 300-400 nm
International Nuclear Information System (INIS)
Noskov, V.A.; Kintsurashvili, L.N.; Smirnova, T.A.; Manamsh'yan, T.A.; Kir'yanov, G.I.; Vanyushin, B.F.
1986-01-01
A method has been perfected for producing soluble chromatin from whole wheat sprouts at low ionic strength. The chromatin preparations isolated possess a native structure: they have a nucleosome organization. Under identical conditions the soluble wheat chromatin undergoes more profound degradation by DNase I and staphylococcal nuclease than the chromatin from the rat liver. The DNA contained in the isolated chromatin is capable of accepting CHnumber groups from S-[methyl- 3 H]-adenosylmethionine during incubation with DNA methylase EcoRII; not all the CC A/T GG sequences in DNA are methylated in vivo. Chromatin from gibberellin A 3 -treated wheat sprout DNA accepts 40% fewer CH 3 groups than that from the control sprouts, which is probably due to the greater compactness of the chromatin. In the case of longer incubation, the level of methylation of the chromatin falls, which may be associated with the presence of DNA-demethylating activity
Replicating chromatin: a tale of histones
DEFF Research Database (Denmark)
Groth, Anja
2009-01-01
Chromatin serves structural and functional roles crucial for genome stability and correct gene expression. This organization must be reproduced on daughter strands during replication to maintain proper overlay of epigenetic fabric onto genetic sequence. Nucleosomes constitute the structural...... framework of chromatin and carry information to specify higher-order organization and gene expression. When replication forks traverse the chromosomes, nucleosomes are transiently disrupted, allowing the replication machinery to gain access to DNA. Histone recycling, together with new deposition, ensures...
Tracking the mechanical dynamics of human embryonic stem cell chromatin
Directory of Open Access Journals (Sweden)
Hinde Elizabeth
2012-12-01
Full Text Available Abstract Background A plastic chromatin structure has emerged as fundamental to the self-renewal and pluripotent capacity of embryonic stem (ES cells. Direct measurement of chromatin dynamics in vivo is, however, challenging as high spatiotemporal resolution is required. Here, we present a new tracking-based method which can detect high frequency chromatin movement and quantify the mechanical dynamics of chromatin in live cells. Results We use this method to study how the mechanical properties of chromatin movement in human embryonic stem cells (hESCs are modulated spatiotemporally during differentiation into cardiomyocytes (CM. Notably, we find that pluripotency is associated with a highly discrete, energy-dependent frequency of chromatin movement that we refer to as a ‘breathing’ state. We find that this ‘breathing’ state is strictly dependent on the metabolic state of the cell and is progressively silenced during differentiation. Conclusions We thus propose that the measured chromatin high frequency movements in hESCs may represent a hallmark of pluripotency and serve as a mechanism to maintain the genome in a transcriptionally accessible state. This is a result that could not have been observed without the high spatial and temporal resolution provided by this novel tracking method.
Regulation of the Apolipoprotein Gene Cluster by a Long Noncoding RNA
Directory of Open Access Journals (Sweden)
Paul Halley
2014-01-01
Full Text Available Apolipoprotein A1 (APOA1 is the major protein component of high-density lipoprotein (HDL in plasma. We have identified an endogenously expressed long noncoding natural antisense transcript, APOA1-AS, which acts as a negative transcriptional regulator of APOA1 both in vitro and in vivo. Inhibition of APOA1-AS in cultured cells resulted in the increased expression of APOA1 and two neighboring genes in the APO cluster. Chromatin immunoprecipitation (ChIP analyses of a ∼50 kb chromatin region flanking the APOA1 gene demonstrated that APOA1-AS can modulate distinct histone methylation patterns that mark active and/or inactive gene expression through the recruitment of histone-modifying enzymes. Targeting APOA1-AS with short antisense oligonucleotides also enhanced APOA1 expression in both human and monkey liver cells and induced an increase in hepatic RNA and protein expression in African green monkeys. Furthermore, the results presented here highlight the significant local modulatory effects of long noncoding antisense RNAs and demonstrate the therapeutic potential of manipulating the expression of these transcripts both in vitro and in vivo.
Retinoid X Receptor α-Dependent HBV Minichromosome Remodeling and Viral Replication.
Zhang, Yan; He, Song; Guo, Jin-Jun; Peng, Hong; Fan, Jia-Hao; Li, Qing-Ling
2017-01-01
The HBV covalently closed circular DNA (cccDNA) is organized into a minichromosome in the nuclei of infected hepatocytes through interactions with histone and nonhistone proteins. Retinoid X receptor α (RXRα), a liver-enriched nuclear receptor, participates in regulation of HBV replication and transcription through modulation of HBV enhancer 1 and core promoter activity. This study investigated RXRα involvement in HBV cccDNA epigenetic modifications. Quantitative cccDNA chromatin immunoprecipitation (ChIP) was applied to study the recruitment of RXRα, histones, and chromatin-modifying enzymes to HBV minichromosome in HepG2 cells after transfection of the linear HBV genome. RXRα Was found to directly bind to HBV cccDNA; recruitment of RXRα to HBV mini-chromosome paralleled HBV replication, histone recruitment, and histone acetylation in HBVcccDNA. Moreover, RXRα overexpression or knock-down significantly increased or impaired the recruitment of the p300 acetyltransferase to cccDNAminichromosome. Our results confirmed the regulation of RXRα on HBV replication in vitro and demonstrated the modulation of RXRα on HBV cccDNA epigenetics. These findings provide a profound theoretical and experimental basis for late-model antiviral treatment acting on the HBV cccDNA and minichromosome.
Pimanda, John E; Chan, Wan Y I; Wilson, Nicola K; Smith, Aileen M; Kinston, Sarah; Knezevic, Kathy; Janes, Mary E; Landry, Josette-Renée; Kolb-Kokocinski, Anja; Frampton, Jonathan; Tannahill, David; Ottersbach, Katrin; Follows, George A; Lacaud, Georges; Kouskoff, Valerie; Göttgens, Berthold
2008-12-01
Endoglin is an accessory receptor for TGF-beta signaling and is required for normal hemangioblast, early hematopoietic, and vascular development. We have previously shown that an upstream enhancer, Eng -8, together with the promoter region, mediates robust endothelial expression yet is inactive in blood. To identify hematopoietic regulatory elements, we used array-based methods to determine chromatin accessibility across the entire locus. Subsequent transgenic analysis of candidate elements showed that an endothelial enhancer at Eng +9 when combined with an element at Eng +7 functions as a strong hemato-endothelial enhancer. Chromatin immunoprecipitation (ChIP)-chip analysis demonstrated specific binding of Ets factors to the promoter as well as to the -8, +7+9 enhancers in both blood and endothelial cells. By contrast Pu.1, an Ets factor specific to the blood lineage, and Gata2 binding was only detected in blood. Gata2 was bound only at +7 and GATA motifs were required for hematopoietic activity. This modular assembly of regulators gives blood and endothelial cells the regulatory freedom to independently fine-tune gene expression and emphasizes the role of regulatory divergence in driving functional divergence.
Immunoprecipitation of Tri-methylated Capped RNA.
Hayes, Karen E; Barr, Jamie A; Xie, Mingyi; Steitz, Joan A; Martinez, Ivan
2018-02-05
Cellular quiescence (also known as G 0 arrest) is characterized by reduced DNA replication, increased autophagy, and increased expression of cyclin-dependent kinase p27 Kip1 . Quiescence is essential for wound healing, organ regeneration, and preventing neoplasia. Previous findings indicate that microRNAs (miRNAs) play an important role in regulating cellular quiescence. Our recent publication demonstrated the existence of an alternative miRNA biogenesis pathway in primary human foreskin fibroblast (HFF) cells during quiescence. Indeed, we have identified a group of pri-miRNAs (whose mature miRNAs were found induced during quiescence) modified with a 2,2,7-trimethylguanosine (TMG)-cap by the trimethylguanosine synthase 1 (TGS1) protein and transported to the cytoplasm by the Exportin-1 (XPO1) protein. We used an antibody against (TMG)-caps (which does not cross-react with the (m 7 G)-caps that most pri-miRNAs or mRNAs contain [Luhrmann et al ., 1982]) to perform RNA immunoprecipitations from total RNA extracts of proliferating or quiescent HFFs. The novelty of this assay is the specific isolation of pri-miRNAs as well as other non-coding RNAs containing a TMG-cap modification.
Savic, Velibor
2013-01-01
In the last decade, a lot has been done in elucidating the sequence of events that occur at the nascent double strand DNA break. Nevertheless, the overall structure formed by the DNA damage response (DDR) factors around the break site, the repair focus, remains poorly understood. Although most of the data presented so far only address events that occur in chromatin in cis around the break, there are strong indications that in mammalian systems it may also occur in trans, analogous to the recent findings showing this if budding yeast. There have been attempts to address the issue but the final proof is still missing due to lack of a proper experimental system. If found to be true, the spatial distribution of DDR factors would have a major impact on the neighboring chromatin both in cis and in trans, significantly affecting local chromatin function; gene transcription and potentially other functions.
Cruickshank, Mark N; Fenwick, Emily; Karimi, Mahdad; Abraham, Lawrence J; Ulgiati, Daniela
2009-08-01
Stringent developmental transcription requires multiple transcription factor (TF) binding sites, cell-specific expression of signaling molecules, TFs and co-regulators and appropriate chromatin structure. During B-lymphopoiesis, human Complement receptor 2 (CR2/CD21) is detected on immature and mature B cells but not on B cell precursors and plasma cells. We examined cell- and stage-specific human CR2 gene regulation using cell lines modeling B-lymphopoiesis. Chromatin accessibility assays revealed a region between -409 and -262 with enhanced accessibility in mature B cells and pre-B cells, compared to either non-lymphoid or plasma cell-types, however, accessibility near the transcription start site (TSS) was elevated only in CR2-expressing B cells. A correlation between histone acetylation and CR2 expression was observed, while histone H3K4 dimethylation was enriched near the TSS in both CR2-expressing B cells and non-expressing pre-B cells. Candidate sites within the CR2 promoter were identified which could regulate chromatin, including a matrix attachment region associated with CDP, SATB1/BRIGHT and CEBP-beta sites as well as two CBF1 sites. ChIP assays verified that both CBF1 and C/EBP-beta bind the CR2 promoter in B cells raising the possibility that these factors facilitate or respond to alterations in chromatin structure to control the timing and/or level of CR2 transcription.
Silicon Chip-to-Chip Mode-Division Multiplexing
DEFF Research Database (Denmark)
Baumann, Jan Markus; Porto da Silva, Edson; Ding, Yunhong
2018-01-01
A chip-to-chip mode-division multiplexing connection is demonstrated using a pair of multiplexers/demultiplexers fabricated on the silicon-on-insulator platform. Successful mode multiplexing and demultiplexing is experimentally demonstrated, using the LP01, LP11a and LP11b modes.......A chip-to-chip mode-division multiplexing connection is demonstrated using a pair of multiplexers/demultiplexers fabricated on the silicon-on-insulator platform. Successful mode multiplexing and demultiplexing is experimentally demonstrated, using the LP01, LP11a and LP11b modes....
Classical and Nonclassical Estrogen Receptor Action on Chromatin Templates
National Research Council Canada - National Science Library
Nordeen, Steven
2000-01-01
.... Using newly-developed approaches, I investigated mechanisms of estrogen/estrogen receptor action on chromatin templates in vitro in order to better understand the role of chromatin in steroid-regulated gene expression...
Classical and Nonclassical Estrogen Receptor Action on Chromatin Templaces
National Research Council Canada - National Science Library
Nordeen, Steve
2001-01-01
.... Using newly-developed approaches, I investigated mechanisms of estrogen/estrogen receptor action on chromatin templates in vitro in order to better understand the role of chromatin in steroid-regulated gene expression...
ATP-Dependent Chromatin Remodeling Factors and Their Roles in Affecting Nucleosome Fiber Composition
Directory of Open Access Journals (Sweden)
Alexandra Lusser
2011-10-01
Full Text Available ATP-dependent chromatin remodeling factors of the SNF2 family are key components of the cellular machineries that shape and regulate chromatin structure and function. Members of this group of proteins have broad and heterogeneous functions ranging from controlling gene activity, facilitating DNA damage repair, promoting homologous recombination to maintaining genomic stability. Several chromatin remodeling factors are critical components of nucleosome assembly processes, and recent reports have identified specific functions of distinct chromatin remodeling factors in the assembly of variant histones into chromatin. In this review we will discuss the specific roles of ATP-dependent chromatin remodeling factors in determining nucleosome composition and, thus, chromatin fiber properties.
Deoxyribonuclease probing of sea urchin embryo chromatin
International Nuclear Information System (INIS)
Landsman, D.
1983-01-01
The role that the sea urchin, Parechinus angulosus, embryo and sperm histone variants plays in chromatin structure has been investigated. Chromatin structure has been determined at different levels of resolution in sperm and in developing embryos using micrococcal nuclease, pancreatic deoxyribonuclease (DNase I) and restriction endonucleases. Micrococcal nuclease and restriction endonuclease digestions of sea urchin gastrula chromatin have been analysed and it is shown that it is not possible to isolate large polynucleosomal chromatin complexes which are soluble in low ionic strength buffers. The repeat length for sperm is significantly larger than blastula and gastrula repeat lengths whereas blastula and gastrula repeat lengths are not significantly different. Nucleosomal core particles have been isolated from early blastula, gastrula and sperm of sea urchins. After DNase I digestion of 5'-labelled core particles the rate constants of cutting of the DNA at the susceptible sites on these core particles have been determined. The DNase I digestion kinetics of blastula and gastrula core particles are similar whereas sperm core particles are digested at a slower rate, mainly at the sites which are closest to the ends of the core particle DNA
Autism genes keep turning up chromatin.
Lasalle, Janine M
2013-06-19
Autism-spectrum disorders (ASD) are complex genetic disorders collectively characterized by impaired social interactions and language as well as repetitive and restrictive behaviors. Of the hundreds of genes implicated in ASD, those encoding proteins acting at neuronal synapses have been most characterized by candidate gene studies. However, recent unbiased genome-wide analyses have turned up a multitude of novel candidate genes encoding nuclear factors implicated in chromatin remodeling, histone demethylation, histone variants, and the recognition of DNA methylation. Furthermore, the chromatin landscape of the human genome has been shown to influence the location of de novo mutations observed in ASD as well as the landscape of DNA methylation underlying neurodevelopmental and synaptic processes. Understanding the interactions of nuclear chromatin proteins and DNA with signal transduction pathways and environmental influences in the developing brain will be critical to understanding the relevance of these ASD candidate genes and continued uncovering of the "roots" of autism etiology.
Capturing Structural Heterogeneity in Chromatin Fibers.
Ekundayo, Babatunde; Richmond, Timothy J; Schalch, Thomas
2017-10-13
Chromatin fiber organization is implicated in processes such as transcription, DNA repair and chromosome segregation, but how nucleosomes interact to form higher-order structure remains poorly understood. We solved two crystal structures of tetranucleosomes with approximately 11-bp DNA linker length at 5.8 and 6.7 Å resolution. Minimal intramolecular nucleosome-nucleosome interactions result in a fiber model resembling a flat ribbon that is compatible with a two-start helical architecture, and that exposes histone and DNA surfaces to the environment. The differences in the two structures combined with electron microscopy reveal heterogeneous structural states, and we used site-specific chemical crosslinking to assess the diversity of nucleosome-nucleosome interactions through identification of structure-sensitive crosslink sites that provide a means to characterize fibers in solution. The chromatin fiber architectures observed here provide a basis for understanding heterogeneous chromatin higher-order structures as they occur in a genomic context. Copyright © 2017 Elsevier Ltd. All rights reserved.
Nuclear visions enhanced: chromatin structure, organization and dynamics
Meshorer, Eran; Herrmann, Harald; Raška, Ivan
2011-01-01
The EMBO Workshop on ‘Chromatin Structure, Organization and Dynamics' took place in April 2011 in Prague, Czech Republic. Participants presented data on the generation of models of the genome, working to correlate changes in the organization of chromatin with the functional state of the genome.
An evaluation of two-channel ChIP-on-chip and DNA methylation microarray normalization strategies
2012-01-01
Background The combination of chromatin immunoprecipitation with two-channel microarray technology enables genome-wide mapping of binding sites of DNA-interacting proteins (ChIP-on-chip) or sites with methylated CpG di-nucleotides (DNA methylation microarray). These powerful tools are the gateway to understanding gene transcription regulation. Since the goals of such studies, the sample preparation procedures, the microarray content and study design are all different from transcriptomics microarrays, the data pre-processing strategies traditionally applied to transcriptomics microarrays may not be appropriate. Particularly, the main challenge of the normalization of "regulation microarrays" is (i) to make the data of individual microarrays quantitatively comparable and (ii) to keep the signals of the enriched probes, representing DNA sequences from the precipitate, as distinguishable as possible from the signals of the un-enriched probes, representing DNA sequences largely absent from the precipitate. Results We compare several widely used normalization approaches (VSN, LOWESS, quantile, T-quantile, Tukey's biweight scaling, Peng's method) applied to a selection of regulation microarray datasets, ranging from DNA methylation to transcription factor binding and histone modification studies. Through comparison of the data distributions of control probes and gene promoter probes before and after normalization, and assessment of the power to identify known enriched genomic regions after normalization, we demonstrate that there are clear differences in performance between normalization procedures. Conclusion T-quantile normalization applied separately on the channels and Tukey's biweight scaling outperform other methods in terms of the conservation of enriched and un-enriched signal separation, as well as in identification of genomic regions known to be enriched. T-quantile normalization is preferable as it additionally improves comparability between microarrays. In
Insights into Chromatin Structure and Dynamics in Plants
Directory of Open Access Journals (Sweden)
Stefanie Rosa
2013-11-01
Full Text Available The packaging of chromatin into the nucleus of a eukaryotic cell requires an extraordinary degree of compaction and physical organization. In recent years, it has been shown that this organization is dynamically orchestrated to regulate responses to exogenous stimuli as well as to guide complex cell-type-specific developmental programs. Gene expression is regulated by the compartmentalization of functional domains within the nucleus, by distinct nucleosome compositions accomplished via differential modifications on the histone tails and through the replacement of core histones by histone variants. In this review, we focus on these aspects of chromatin organization and discuss novel approaches such as live cell imaging and photobleaching as important tools likely to give significant insights into our understanding of the very dynamic nature of chromatin and chromatin regulatory processes. We highlight the contribution plant studies have made in this area showing the potential advantages of plants as models in understanding this fundamental aspect of biology.
Shelterin Protects Chromosome Ends by Compacting Telomeric Chromatin
Bandaria, Jigar N.; Qin, Peiwu; Berk, Veysel; Chu, Steven; Yildiz, Ahmet
2016-01-01
SUMMARY Telomeres, repetitive DNA sequences at chromosome ends, are shielded against the DNA damage response (DDR) by the shelterin complex. To understand how shelterin protects telomere ends, we investigated the structural organization of telomeric chromatin in human cells using super-resolution microscopy. We found that telomeres form compact globular structures through a complex network of interactions between shelterin subunits and telomeric DNA, and not by DNA methylation, histone deacetylation or histone trimethylation at telomeres and subtelomeric regions. Mutations that abrogate shelterin assembly or removal of individual subunits from telomeres cause up to a 10-fold increase in telomere volume. Decompacted telomeres become more accessible to telomere-associated proteins and accumulate DDR signals. Recompaction of telomeric chromatin using an orthogonal method displaces DDR signals from telomeres. These results reveal the chromatin remodeling activity of shelterin and demonstrate that shelterin-mediated compaction of telomeric chromatin provides robust protection of chromosome ends against the DDR machinery. PMID:26871633
RNA is an integral component of chromatin that contributes to its structural organization.
Directory of Open Access Journals (Sweden)
Antonio Rodríguez-Campos
Full Text Available Chromatin structure is influenced by multiples factors, such as pH, temperature, nature and concentration of counterions, post-translational modifications of histones and binding of structural non-histone proteins. RNA is also known to contribute to the regulation of chromatin structure as chromatin-induced gene silencing was shown to depend on the RNAi machinery in S. pombe, plants and Drosophila. Moreover, both in Drosophila and mammals, dosage compensation requires the contribution of specific non-coding RNAs. However, whether RNA itself plays a direct structural role in chromatin is not known. Here, we report results that indicate a general structural role for RNA in eukaryotic chromatin. RNA is found associated to purified chromatin prepared from chicken liver, or cultured Drosophila S2 cells, and treatment with RNase A alters the structural properties of chromatin. Our results indicate that chromatin-associated RNAs, which account for 2%-5% of total chromatin-associated nucleic acids, are polyA(- and show a size similar to that of the DNA contained in the corresponding chromatin fragments. Chromatin-associated RNA(s are not likely to correspond to nascent transcripts as they are also found bound to chromatin when cells are treated with alpha-amanitin. After treatment with RNase A, chromatin fragments of molecular weight >3.000 bp of DNA showed reduced sedimentation through sucrose gradients and increased sensitivity to micrococcal nuclease digestion. This structural transition, which is observed both at euchromatic and heterochromatic regions, proceeds without loss of histone H1 or any significant change in core-histone composition and integrity.
Hi-C Chromatin Interaction Networks Predict Co-expression in the Mouse Cortex
Hulsman, Marc; Lelieveldt, Boudewijn P. F.; de Ridder, Jeroen; Reinders, Marcel
2015-01-01
The three dimensional conformation of the genome in the cell nucleus influences important biological processes such as gene expression regulation. Recent studies have shown a strong correlation between chromatin interactions and gene co-expression. However, predicting gene co-expression from frequent long-range chromatin interactions remains challenging. We address this by characterizing the topology of the cortical chromatin interaction network using scale-aware topological measures. We demonstrate that based on these characterizations it is possible to accurately predict spatial co-expression between genes in the mouse cortex. Consistent with previous findings, we find that the chromatin interaction profile of a gene-pair is a good predictor of their spatial co-expression. However, the accuracy of the prediction can be substantially improved when chromatin interactions are described using scale-aware topological measures of the multi-resolution chromatin interaction network. We conclude that, for co-expression prediction, it is necessary to take into account different levels of chromatin interactions ranging from direct interaction between genes (i.e. small-scale) to chromatin compartment interactions (i.e. large-scale). PMID:25965262
Epigenetic regulation of open chromatin in pluripotent stem cells
Kobayashi, Hiroshi; Kikyo, Nobuaki
2014-01-01
The recent progress in pluripotent stem cell research has opened new avenues of disease modeling, drug screening, and transplantation of patient-specific tissues that had been unimaginable until a decade ago. The central mechanism underlying pluripotency is epigenetic gene regulation; the majority of cell signaling pathways, both extracellular and cytoplasmic, eventually alter the epigenetic status of their target genes during the process of activating or suppressing the genes to acquire or maintain pluripotency. It has long been thought that the chromatin of pluripotent stem cells is globally open to enable the timely activation of essentially all genes in the genome during differentiation into multiple lineages. The current article reviews descriptive observations and the epigenetic machinery relevant to what is supposed to be globally open chromatin in pluripotent stem cells. This includes microscopic appearance, permissive gene transcription, chromatin remodeling complexes, histone modifications, DNA methylation, noncoding RNAs, dynamic movement of chromatin proteins, nucleosome accessibility and positioning, and long-range chromosomal interactions. Detailed analyses of each element, however, have revealed that the globally open chromatin hypothesis is not necessarily supported by some of the critical experimental evidence, such as genome-wide nucleosome accessibility and nucleosome positioning. Further understanding of the epigenetic gene regulation is expected to determine the true nature of the so-called globally open chromatin in pluripotent stem. PMID:24695097
Contribution of Topological Domains and Loop Formation to 3D Chromatin Organization
Directory of Open Access Journals (Sweden)
Vuthy Ea
2015-07-01
Full Text Available Recent investigations on 3D chromatin folding revealed that the eukaryote genomes are both highly compartmentalized and extremely dynamic. This review presents the most recent advances in topological domains’ organization of the eukaryote genomes and discusses the relationship to chromatin loop formation. CTCF protein appears as a central factor of these two organization levels having either a strong insulating role at TAD borders, or a weaker architectural role in chromatin loop formation. TAD borders directly impact on chromatin dynamics by restricting contacts within specific genomic portions thus confining chromatin loop formation within TADs. We discuss how sub-TAD chromatin dynamics, constrained into a recently described statistical helix conformation, can produce functional interactions by contact stabilization.
Genome-wide analysis of CDX2 binding in intestinal epithelial cells (Caco-2)
DEFF Research Database (Denmark)
Boyd, Mette; Hansen, Morten; Jensen, Tine G K
2010-01-01
The CDX2 transcription factor is known to play a crucial role in inhibiting proliferation, promoting differentiation and the expression of intestinal specific genes in intestinal cells. The overall effect of CDX2 in intestinal cells has previously been investigated in conditional knock-out mice......, revealing a critical role of CDX2 in the formation of the normal intestinal identity. The identification of direct targets of transcription factors is a key problem in the study of gene regulatory networks. The ChIP-seq technique combines chromatin immunoprecipitation (ChIP) with next generation sequencing...... resulting in a high throughput experimental method of identifying direct targets of specific transcription factors. The method was applied to CDX2, leading to the identification of the direct binding of CDX2 to several known and novel target genes in the intestinal cell. Examination of the transcript levels...
DEFF Research Database (Denmark)
Zhu, Xuefeng; Wirén, Marianna; Sinha, Indranil
2006-01-01
Mediator exists in a free form containing the Med12, Med13, CDK8, and CycC subunits (the Srb8-11 module) and a smaller form, which lacks these four subunits and associates with RNA polymerase II (Pol II), forming a holoenzyme. We use chromatin immunoprecipitation (ChIP) and DNA microarrays...... to investigate genome-wide localization of Mediator and the Srb8-11 module in fission yeast. Mediator and the Srb8-11 module display similar binding patterns, and interactions with promoters and upstream activating sequences correlate with increased transcription activity. Unexpectedly, Mediator also interacts...... with the downstream coding region of many genes. These interactions display a negative bias for positions closer to the 5' ends of open reading frames (ORFs) and appear functionally important, because downregulation of transcription in a temperature-sensitive med17 mutant strain correlates with increased Mediator...
Nucleolar chromatin organization at different activities of soybean root meristematic cell nucleoli.
Stępiński, Dariusz
2013-06-01
Nucleolar chromatin, including nucleolus-associated chromatin as well as active and inactive condensed ribosomal DNA (rDNA) chromatin, derives mostly from secondary constrictions known as nucleolus organizer regions containing rDNA genes on nucleolus-forming chromosomes. This chromatin may occupy different nucleolar positions being in various condensation states which may imply different rDNA transcriptional competence. Sections of nucleoli originating from root meristematic cells of soybean seedlings grown at 25 °C (the control), then subjected to chilling stress (10 °C), and next transferred again to 25 °C (the recovery) were used to measure profile areas occupied by nucleolar condensed chromatin disclosed with sodium hydroxide methylation-acetylation plus uranyl acetate technique. The biggest total area of condensed chromatin was found in the nucleoli of chilled plants, while the smallest was found in those of recovered plants in relation to the amounts of chromatin in the control nucleoli. The condensed nucleolar chromatin, in the form of different-sized and different-shaped clumps, was mainly located in fibrillar centers. One can suppose that changes of condensed rDNA chromatin amounts might be a mechanism controlling the number of transcriptionally active rDNA genes as the nucleoli of plants grown under these experimental conditions show different transcriptional activity and morphology.
DEFF Research Database (Denmark)
Fismen, S; Hedberg, A; Fenton, K A
2009-01-01
Murine and human lupus nephritis are characterized by glomerular deposits of electron-dense structures (EDS). Dominant components of EDS are chromatin fragments and IgG antibodies. Whether glomerular EDS predispose for similar deposits in skin is unknown. We analysed (i) whether dermo-epidermal i......Murine and human lupus nephritis are characterized by glomerular deposits of electron-dense structures (EDS). Dominant components of EDS are chromatin fragments and IgG antibodies. Whether glomerular EDS predispose for similar deposits in skin is unknown. We analysed (i) whether dermo......-epidermal immune complex deposits have similar molecular composition as glomerular deposits, (ii) whether chromatin fragments bind dermo-epidermal structures, and (iii) whether deposits in nephritic glomeruli predispose for accumulation of similar deposits in skin. Paired skin and kidney biopsies from nephritic...... (NZBxNZW)F1 and MRL-lpr/lpr mice and from five patients with lupus nephritis were analysed by immunofluorescence, immune electron microscopy (IEM) and co-localization TUNEL IEM. Affinity of chromatin fragments for membrane structures was determined by surface plasmon resonance. Results demonstrated (i...
Chromatin regulation at the frontier of synthetic biology
Keung, Albert J.; Joung, J. Keith; Khalil, Ahmad S.; Collins, James J.
2016-01-01
As synthetic biology approaches are extended to diverse applications throughout medicine, biotechnology and basic biological research, there is an increasing need to engineer yeast, plant and mammalian cells. Eukaryotic genomes are regulated by the diverse biochemical and biophysical states of chromatin, which brings distinct challenges, as well as opportunities, over applications in bacteria. Recent synthetic approaches, including `epigenome editing', have allowed the direct and functional dissection of many aspects of physiological chromatin regulation. These studies lay the foundation for biomedical and biotechnological engineering applications that could take advantage of the unique combinatorial and spatiotemporal layers of chromatin regulation to create synthetic systems of unprecedented sophistication. PMID:25668787
Cytogenetic abnormality in man, wider implications of theories of sex chromatin origin.
MILES, C P
1962-01-01
Female nuclei may be identified by means of sex chromatin. In general the number of sex chromatin bodies is one less than the number of X chromosomes. An exception to this rule is a case of sex chromatin-positive XO Turner's syndrome. This case suggests the possibility of sex chromatin-positive XY males, and it may be evidence for chromosomal differentiation.
Widespread Chromatin Accessibility at Repetitive Elements Links Stem Cells with Human Cancer
Directory of Open Access Journals (Sweden)
Nicholas C. Gomez
2016-11-01
Full Text Available Chromatin regulation is critical for differentiation and disease. However, features linking the chromatin environment of stem cells with disease remain largely unknown. We explored chromatin accessibility in embryonic and multipotent stem cells and unexpectedly identified widespread chromatin accessibility at repetitive elements. Integrating genomic and biochemical approaches, we demonstrate that these sites of increased accessibility are associated with well-positioned nucleosomes marked by distinct histone modifications. Differentiation is accompanied by chromatin remodeling at repetitive elements associated with altered expression of genes in relevant developmental pathways. Remarkably, we found that the chromatin environment of Ewing sarcoma, a mesenchymally derived tumor, is shared with primary mesenchymal stem cells (MSCs. Accessibility at repetitive elements in MSCs offers a permissive environment that is exploited by the critical oncogene responsible for this cancer. Our data demonstrate that stem cells harbor a unique chromatin landscape characterized by accessibility at repetitive elements, a feature associated with differentiation and oncogenesis.
Chd1 remodelers maintain open chromatin and regulate the epigenetics of differentiation
Energy Technology Data Exchange (ETDEWEB)
Persson, Jenna [Department of Biosciences and Nutrition, Center for Biosciences, Karolinska Institutet (Sweden); Ekwall, Karl, E-mail: karl.ekwall@ki.se [Department of Biosciences and Nutrition, Center for Biosciences, Karolinska Institutet (Sweden); School of Life Sciences, University College Sodertorn, NOVUM, Huddinge (Sweden)
2010-05-01
Eukaryotic DNA is packaged around octamers of histone proteins into nucleosomes, the basic unit of chromatin. In addition to enabling meters of DNA to fit within the confines of a nucleus, the structure of chromatin has functional implications for cell identity. Covalent chemical modifications to the DNA and to histones, histone variants, ATP-dependent chromatin remodelers, small noncoding RNAs and the level of chromatin compaction all contribute to chromosomal structure and to the activity or silencing of genes. These chromatin-level alterations are defined as epigenetic when they are heritable from mother to daughter cell. The great diversity of epigenomes that can arise from a single genome permits a single, totipotent cell to generate the hundreds of distinct cell types found in humans. Two recent studies in mouse and in fly have highlighted the importance of Chd1 chromatin remodelers for maintaining an open, active chromatin state. Based on evidence from fission yeast as a model system, we speculate that Chd1 remodelers are involved in the disassembly of nucleosomes at promoter regions, thus promoting active transcription and open chromatin. It is likely that these nucleosomes are specifically marked for disassembly by the histone variant H2A.Z.
Chd1 remodelers maintain open chromatin and regulate the epigenetics of differentiation
International Nuclear Information System (INIS)
Persson, Jenna; Ekwall, Karl
2010-01-01
Eukaryotic DNA is packaged around octamers of histone proteins into nucleosomes, the basic unit of chromatin. In addition to enabling meters of DNA to fit within the confines of a nucleus, the structure of chromatin has functional implications for cell identity. Covalent chemical modifications to the DNA and to histones, histone variants, ATP-dependent chromatin remodelers, small noncoding RNAs and the level of chromatin compaction all contribute to chromosomal structure and to the activity or silencing of genes. These chromatin-level alterations are defined as epigenetic when they are heritable from mother to daughter cell. The great diversity of epigenomes that can arise from a single genome permits a single, totipotent cell to generate the hundreds of distinct cell types found in humans. Two recent studies in mouse and in fly have highlighted the importance of Chd1 chromatin remodelers for maintaining an open, active chromatin state. Based on evidence from fission yeast as a model system, we speculate that Chd1 remodelers are involved in the disassembly of nucleosomes at promoter regions, thus promoting active transcription and open chromatin. It is likely that these nucleosomes are specifically marked for disassembly by the histone variant H2A.Z.
Chromatinization of the KSHV Genome During the KSHV Life Cycle
Energy Technology Data Exchange (ETDEWEB)
Uppal, Timsy [Department of Microbiology and Immunology, School of Medicine, University of Nevada, 1664 N Virginia Street, MS 320, Reno, NV 89557 (United States); Jha, Hem C. [Department of Microbiology and the Tumor Virology Program of the Abramson Cancer Center, Perelman School of Medicine at the University of Pennsylvania, 201E Johnson Pavilion, 3610 Hamilton Walk, Philadelphia, PA 19104 (United States); Verma, Subhash C. [Department of Microbiology and Immunology, School of Medicine, University of Nevada, 1664 N Virginia Street, MS 320, Reno, NV 89557 (United States); Robertson, Erle S., E-mail: erle@mail.med.upenn.edu [Department of Microbiology and the Tumor Virology Program of the Abramson Cancer Center, Perelman School of Medicine at the University of Pennsylvania, 201E Johnson Pavilion, 3610 Hamilton Walk, Philadelphia, PA 19104 (United States)
2015-01-14
Kaposi’s sarcoma-associated herpesvirus (KSHV) belongs to the gamma herpesvirus family and is the causative agent of various lymphoproliferative diseases in humans. KSHV, like other herpesviruses, establishes life-long latent infection with the expression of a limited number of viral genes. Expression of these genes is tightly regulated by both the viral and cellular factors. Recent advancements in identifying the expression profiles of viral transcripts, using tilling arrays and next generation sequencing have identified additional coding and non-coding transcripts in the KSHV genome. Determining the functions of these transcripts will provide a better understanding of the mechanisms utilized by KSHV in altering cellular pathways involved in promoting cell growth and tumorigenesis. Replication of the viral genome is critical in maintaining the existing copies of the viral episomes during both latent and lytic phases of the viral life cycle. The replication of the viral episome is facilitated by viral components responsible for recruiting chromatin modifying enzymes and replication factors for altering the chromatin complexity and replication initiation functions, respectively. Importantly, chromatin modification of the viral genome plays a crucial role in determining whether the viral genome will persist as latent episome or undergo lytic reactivation. Additionally, chromatinization of the incoming virion DNA, which lacks chromatin structure, in the target cells during primary infection, helps in establishing latent infection. Here, we discuss the recent advancements on our understating of KSHV genome chromatinization and the consequences of chromatin modifications on viral life cycle.
Chromatinization of the KSHV Genome During the KSHV Life Cycle
International Nuclear Information System (INIS)
Uppal, Timsy; Jha, Hem C.; Verma, Subhash C.; Robertson, Erle S.
2015-01-01
Kaposi’s sarcoma-associated herpesvirus (KSHV) belongs to the gamma herpesvirus family and is the causative agent of various lymphoproliferative diseases in humans. KSHV, like other herpesviruses, establishes life-long latent infection with the expression of a limited number of viral genes. Expression of these genes is tightly regulated by both the viral and cellular factors. Recent advancements in identifying the expression profiles of viral transcripts, using tilling arrays and next generation sequencing have identified additional coding and non-coding transcripts in the KSHV genome. Determining the functions of these transcripts will provide a better understanding of the mechanisms utilized by KSHV in altering cellular pathways involved in promoting cell growth and tumorigenesis. Replication of the viral genome is critical in maintaining the existing copies of the viral episomes during both latent and lytic phases of the viral life cycle. The replication of the viral episome is facilitated by viral components responsible for recruiting chromatin modifying enzymes and replication factors for altering the chromatin complexity and replication initiation functions, respectively. Importantly, chromatin modification of the viral genome plays a crucial role in determining whether the viral genome will persist as latent episome or undergo lytic reactivation. Additionally, chromatinization of the incoming virion DNA, which lacks chromatin structure, in the target cells during primary infection, helps in establishing latent infection. Here, we discuss the recent advancements on our understating of KSHV genome chromatinization and the consequences of chromatin modifications on viral life cycle
Coursey, Tami; Regedanz, Elizabeth; Bisaro, David M
2018-04-01
Plants employ RNA-directed DNA methylation (RdDM) and dimethylation of histone 3 lysine 9 (H3K9me2) to silence geminiviruses and transposable elements (TEs). We previously showed that canonical RdDM (Pol IV-RdDM) involving RNA polymerases IV and V (Pol IV and Pol V) is required for Arabidopsis thaliana to recover from infection with Beet curly top virus lacking a suppressor protein that inhibits methylation (BCTV L2 - ). Recovery, which is characterized by reduced viral DNA levels and symptom remission, allows normal floral development. Here, we used formaldehyde-assisted isolation of regulatory elements (FAIRE) to confirm that >90% of BCTV L2 - chromatin is highly compacted during recovery, and a micrococcal nuclease-chromatin immunoprecipitation assay showed that this is largely due to increased nucleosome occupancy. Physical compaction correlated with augmented cytosine and H3K9 methylation and with reduced viral gene expression. We additionally demonstrated that these phenomena are dependent on Pol V and by extension the Pol IV-RdDM pathway. BCTV L2 - was also used to evaluate the impact of viral infection on host loci, including repressed retrotransposons Ta3 and Athila6A Remarkably, an unexpected Pol V-dependent hypersuppression of these TEs was observed, resulting in transcript levels even lower than those detected in uninfected plants. Hypersuppression is likely to be especially important for natural recovery from wild-type geminiviruses, as viral L2 and AL2 proteins cause ectopic TE expression. Thus, Pol IV-RdDM targets both viral and TE chromatin during recovery, simultaneously silencing the majority of viral genomes and maintaining host genome integrity by enforcing tighter control of TEs in future reproductive tissues. IMPORTANCE In plants, RdDM pathways use small RNAs to target cytosine and H3K9 methylation, thereby silencing DNA virus genomes and transposable elements (TEs). Further, Pol IV-RdDM involving Pol IV and Pol V is a key aspect of host
Chromatin Repressive Complexes in Stem Cells, Development, and Cancer
DEFF Research Database (Denmark)
Laugesen, Anne; Helin, Kristian
2014-01-01
The chromatin environment is essential for the correct specification and preservation of cell identity through modulation and maintenance of transcription patterns. Many chromatin regulators are required for development, stem cell maintenance, and differentiation. Here, we review the roles...
HAMLET interacts with histones and chromatin in tumor cell nuclei.
Düringer, Caroline; Hamiche, Ali; Gustafsson, Lotta; Kimura, Hiroshi; Svanborg, Catharina
2003-10-24
HAMLET is a folding variant of human alpha-lactalbumin in an active complex with oleic acid. HAMLET selectively enters tumor cells, accumulates in their nuclei and induces apoptosis-like cell death. This study examined the interactions of HAMLET with nuclear constituents and identified histones as targets. HAMLET was found to bind histone H3 strongly and to lesser extent histones H4 and H2B. The specificity of these interactions was confirmed using BIAcore technology and chromatin assembly assays. In vivo in tumor cells, HAMLET co-localized with histones and perturbed the chromatin structure; HAMLET was found associated with chromatin in an insoluble nuclear fraction resistant to salt extraction. In vitro, HAMLET bound strongly to histones and impaired their deposition on DNA. We conclude that HAMLET interacts with histones and chromatin in tumor cell nuclei and propose that this interaction locks the cells into the death pathway by irreversibly disrupting chromatin organization.
Small chromosomal regions position themselves autonomously according to their chromatin class.
van de Werken, Harmen J G; Haan, Josien C; Feodorova, Yana; Bijos, Dominika; Weuts, An; Theunis, Koen; Holwerda, Sjoerd J B; Meuleman, Wouter; Pagie, Ludo; Thanisch, Katharina; Kumar, Parveen; Leonhardt, Heinrich; Marynen, Peter; van Steensel, Bas; Voet, Thierry; de Laat, Wouter; Solovei, Irina; Joffe, Boris
2017-06-01
The spatial arrangement of chromatin is linked to the regulation of nuclear processes. One striking aspect of nuclear organization is the spatial segregation of heterochromatic and euchromatic domains. The mechanisms of this chromatin segregation are still poorly understood. In this work, we investigated the link between the primary genomic sequence and chromatin domains. We analyzed the spatial intranuclear arrangement of a human artificial chromosome (HAC) in a xenospecific mouse background in comparison to an orthologous region of native mouse chromosome. The two orthologous regions include segments that can be assigned to three major chromatin classes according to their gene abundance and repeat repertoire: (1) gene-rich and SINE-rich euchromatin; (2) gene-poor and LINE/LTR-rich heterochromatin; and (3) gene-depleted and satellite DNA-containing constitutive heterochromatin. We show, using fluorescence in situ hybridization (FISH) and 4C-seq technologies, that chromatin segments ranging from 0.6 to 3 Mb cluster with segments of the same chromatin class. As a consequence, the chromatin segments acquire corresponding positions in the nucleus irrespective of their chromosomal context, thereby strongly suggesting that this is their autonomous property. Interactions with the nuclear lamina, although largely retained in the HAC, reveal less autonomy. Taken together, our results suggest that building of a functional nucleus is largely a self-organizing process based on mutual recognition of chromosome segments belonging to the major chromatin classes. © 2017 van de Werken et al.; Published by Cold Spring Harbor Laboratory Press.
Restoring chromatin after replication: How new and old histone marks come together
DEFF Research Database (Denmark)
Jasencakova, Zusana; Groth, Anja
2010-01-01
In dividing cells genome stability and function rely on faithful transmission of both DNA sequence and its organization into chromatin. In the course of DNA replication chromatin undergoes transient genome-wide disruption followed by restoration on new DNA. This involves tight coordination of DNA...... replication and chromatin assembly processes in time and space. Dynamic recycling and de novo deposition of histones are fundamental for chromatin restoration. Histone post-translational modifications (PTMs) are thought to have a causal role in establishing distinct chromatin structures. Here we discuss PTMs...... present on new and parental histones and how they influence genome stability and restoration of epigenetically defined domains. Newly deposited histones must change their signature in the process of chromatin restoration, this may occur in a step-wise fashion involving replication-coupled processes...
Mechanism of chromatin degradation in thymocytes of irradiated rats
International Nuclear Information System (INIS)
Zotova, R.N.; Umanskij, S.R.; Tokarskaya, V.I.
1983-01-01
A biphase change in poly (ADP-ribose) polymerase activity of the thymocyte chromatin was observed after 10 Gy irradiation of rats: during the first minutes the incorporation of 14 C-NAD increased by 40% then started decreasing to make 110, 60 and 35% after 1, 2 and 3 h, respectively. Irradiation of rat thymus chromatin in vitro sharply decreased poly (ADP-ribose) polymerase activity. The possible role of changes in the poly (ADP-ribose) synthesis in the activation of nuclear Ca/Mg-dependent endonuclease and in the postirradiation degradation of the thymocyte chromatin is discussed
Genome-Wide Methylated DNA Immunoprecipitation Analysis of Patients with Polycystic Ovary Syndrome
Shen, Hao-ran; Qiu, Li-hua; Zhang, Zhi-qing; Qin, Yuan-yuan; Cao, Cong; Di, Wen
2013-01-01
Polycystic ovary syndrome (PCOS) is a complex, heterogeneous disorder of uncertain etiology. Recent studies suggested that insulin resistance (IR) plays an important role in the development of PCOS. In the current study, we aimed to investigate the molecular mechanism of IR in PCOS. We employed genome-wide methylated DNA immunoprecipitation (MeDIP) analysis to characterize genes that are differentially methylated in PCOS patients vs. healthy controls. Besides, we also identified the different...
Flip chip assembly of thinned chips for hybrid pixel detector applications
International Nuclear Information System (INIS)
Fritzsch, T; Zoschke, K; Rothermund, M; Oppermann, H; Woehrmann, M; Ehrmann, O; Lang, K D; Huegging, F
2014-01-01
There is a steady trend to ultra-thin microelectronic devices. Especially for future particle detector systems a reduced readout chip thickness is required to limit the loss of tracking precision due to scattering. The reduction of silicon thickness is performed at wafer level in a two-step thinning process. To minimize the risk of wafer breakage the thinned wafer needs to be handled by a carrier during the whole process chain of wafer bumping. Another key process is the flip chip assembly of thinned readout chips onto thin sensor tiles. Besides the prevention of silicon breakage the minimization of chip warpage is one additional task for a high yield and reliable flip chip process. A new technology using glass carrier wafer will be described in detail. The main advantage of this technology is the combination of a carrier support during wafer processing and the chip support during flip chip assembly. For that a glass wafer is glue-bonded onto the backside of the thinned readout chip wafer. After the bump deposition process the glass-readout chip stack is diced in one step. Finally the glass carrier chip is released by laser illumination after flip chip assembly of the readout chip onto sensor tile. The results of the flip chip assembly process development for the ATLAS IBL upgrade are described more in detail. The new ATLAS FEI4B chip with a size of 20 × 19 mm 2 is flip chip bonded with a thickness of only 150 μm, but the capability of this technology has been demonstrated on hybrid modules with a reduced readout chip thickness of down to 50 μm which is a major step for ultra-thin electronic systems
Directory of Open Access Journals (Sweden)
Li Jia
Full Text Available The androgen receptor (AR is a steroid-activated transcription factor that binds at specific DNA locations and plays a key role in the etiology of prostate cancer. While numerous studies have identified a clear connection between AR binding and expression of target genes for a limited number of loci, high-throughput elucidation of these sites allows for a deeper understanding of the complexities of this process.We have mapped 189 AR occupied regions (ARORs and 1,388 histone H3 acetylation (AcH3 loci to a 3% continuous stretch of human genomic DNA using chromatin immunoprecipitation (ChIP microarray analysis. Of 62 highly reproducible ARORs, 32 (52% were also marked by AcH3. While the number of ARORs detected in prostate cancer cells exceeded the number of nearby DHT-responsive genes, the AcH3 mark defined a subclass of ARORs much more highly associated with such genes -- 12% of the genes flanking AcH3+ARORs were DHT-responsive, compared to only 1% of genes flanking AcH3-ARORs. Most ARORs contained enhancer activities as detected in luciferase reporter assays. Analysis of the AROR sequences, followed by site-directed ChIP, identified binding sites for AR transcriptional coregulators FoxA1, CEBPbeta, NFI and GATA2, which had diverse effects on endogenous AR target gene expression levels in siRNA knockout experiments.We suggest that only some ARORs function under the given physiological conditions, utilizing diverse mechanisms. This diversity points to differential regulation of gene expression by the same transcription factor related to the chromatin structure.
Fast neutron biological effects on normal and tumor chromatin
International Nuclear Information System (INIS)
Constantinescu, B.; Bugoi, Roxana; Paunica, Tatiana; Radu, Liliana
1997-01-01
Growing interest in neutron therapy and radioprotection requires complex studies on the mechanisms of neutron action on biological systems, especially on chromatin (the complex of deoxyribonucleic acid-DNA- with proteins in eukaryotic cells). Our study aims to investigate the fast neutrons induced damages in normal and tumor chromatin, studying thermal transition, intrinsic fluorescence and fluorescence of chromatin-ethidium bromide complexes behavior versus irradiation dose. The Bucharest U-120 variable energy Cyclotron was employed as an intense source of fast neutrons produced by 13.5 MeV deuterons on a thick beryllium target (166.5 mg/cm 2 ) placed at 20 angle against the incident beam. The average energy is 5.24 MeV. The total yield at 0 angle is 6.7 x 10 16 n/sr·C·MeV. To determine neutron and gamma irradiation doses, home made thermoluminescent detectors-TLD(γ) and TLD (γ + n) were used: for gamma MgF 2 : Mn mixed with Teflon pellets (φ 12.5 mm, 0.6±0.1 mm thick) and for gamma plus neutrons MgF 2 :Mn mixed with 6 LiF and Teflon pellets (same dimensions). Using a 8.022 x 10 -2 albedo factor value and the equivalence 1Gy (n)=2·10 10 fast neutron/cm 2 , the dose for the irradiation of 1.2 x 10 2 Gy/μC, with an estimated precision of 15% C for neutrons and 7.8 x 10 -4 Gy/μC for gamma, at 10 cm behind Be target, was found, respectively. A diminution of the negative fluorescence intensity for chromatin-ethidium bromide complexes with the increasing of neutron dose (from 0.98 at 5 Gy to 0.85 at 100 Gy) was observed for normal chromatin. This fact reflects chromatin DNA injuries, with the decrease of double helix DNA proportion. To study the influence of gyrostan, thyroxine and D3 vitamin treatments on fast neutron radiolysis in tumor chromatin,10 mg/kg of anticancer drug gyrostan, 40μg/kg of hormonal compound thyroxine and 30,000 IU/kg of D3 vitamin were administrated, separately or associated, to Wistar rats bearing Walker carcinosarcoma. Representing
Cytology of DNA Replication Reveals Dynamic Plasticity of Large-Scale Chromatin Fibers.
Deng, Xiang; Zhironkina, Oxana A; Cherepanynets, Varvara D; Strelkova, Olga S; Kireev, Igor I; Belmont, Andrew S
2016-09-26
In higher eukaryotic interphase nuclei, the 100- to >1,000-fold linear compaction of chromatin is difficult to reconcile with its function as a template for transcription, replication, and repair. It is challenging to imagine how DNA and RNA polymerases with their associated molecular machinery would move along the DNA template without transient decondensation of observed large-scale chromatin "chromonema" fibers [1]. Transcription or "replication factory" models [2], in which polymerases remain fixed while DNA is reeled through, are similarly difficult to conceptualize without transient decondensation of these chromonema fibers. Here, we show how a dynamic plasticity of chromatin folding within large-scale chromatin fibers allows DNA replication to take place without significant changes in the global large-scale chromatin compaction or shape of these large-scale chromatin fibers. Time-lapse imaging of lac-operator-tagged chromosome regions shows no major change in the overall compaction of these chromosome regions during their DNA replication. Improved pulse-chase labeling of endogenous interphase chromosomes yields a model in which the global compaction and shape of large-Mbp chromatin domains remains largely invariant during DNA replication, with DNA within these domains undergoing significant movements and redistribution as they move into and then out of adjacent replication foci. In contrast to hierarchical folding models, this dynamic plasticity of large-scale chromatin organization explains how localized changes in DNA topology allow DNA replication to take place without an accompanying global unfolding of large-scale chromatin fibers while suggesting a possible mechanism for maintaining epigenetic programming of large-scale chromatin domains throughout DNA replication. Copyright © 2016 Elsevier Ltd. All rights reserved.
Dynamics of Histone Tails within Chromatin
Bernier, Morgan; North, Justin; Page, Michael; Jaroniec, Christopher; Hammel, Christopher; Poirier, Michael
2012-02-01
Genetic information in humans is encoded within DNA molecules that is wrapped around histone octamer proteins and compacted into a highly conserved structural polymer, chromatin. The physical and material properties of chromatin appear to influence gene expression by altering the accessibility of proteins to the DNA. The tails of the histones are flexible domains that are thought to play a role in regulating DNA accessibility and compaction; however the molecular mechanisms for these phenomena are not understood. I will present CW-EPR studies on site directed spin labeled nucleosomes that probe the structure and dynamics of these histone tails within nucleosomes.
Kurat, Christoph F; Yeeles, Joseph T P; Patel, Harshil; Early, Anne; Diffley, John F X
2017-01-05
The integrity of eukaryotic genomes requires rapid and regulated chromatin replication. How this is accomplished is still poorly understood. Using purified yeast replication proteins and fully chromatinized templates, we have reconstituted this process in vitro. We show that chromatin enforces DNA replication origin specificity by preventing non-specific MCM helicase loading. Helicase activation occurs efficiently in the context of chromatin, but subsequent replisome progression requires the histone chaperone FACT (facilitates chromatin transcription). The FACT-associated Nhp6 protein, the nucleosome remodelers INO80 or ISW1A, and the lysine acetyltransferases Gcn5 and Esa1 each contribute separately to maximum DNA synthesis rates. Chromatin promotes the regular priming of lagging-strand DNA synthesis by facilitating DNA polymerase α function at replication forks. Finally, nucleosomes disrupted during replication are efficiently re-assembled into regular arrays on nascent DNA. Our work defines the minimum requirements for chromatin replication in vitro and shows how multiple chromatin factors might modulate replication fork rates in vivo. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.
Adachi, Akira; Senmatsu, Satoshi; Asada, Ryuta; Abe, Takuya; Hoffman, Charles S; Ohta, Kunihiro; Hirota, Kouji
2018-05-03
Numerous noncoding RNA transcripts are detected in eukaryotic cells. Noncoding RNAs transcribed across gene promoters are involved in the regulation of mRNA transcription via chromatin modulation. This function of noncoding RNA transcription was first demonstrated for the fission yeast fbp1 gene, where a cascade of noncoding RNA transcription events induces chromatin remodeling to facilitate transcription factor binding. We recently demonstrated that the noncoding RNAs from the fbp1 upstream region facilitate binding of the transcription activator Atf1 and thereby promote histone acetylation. Histone acetylation by histone acetyl transferases (HATs) and ATP-dependent chromatin remodelers (ADCRs) are implicated in chromatin remodeling, but the interplay between HATs and ADCRs in this process has not been fully elucidated. Here, we examine the roles played by two distinct ADCRs, Snf22 and Hrp3, and by the HAT Gcn5 in the transcriptional activation of fbp1. Snf22 and Hrp3 redundantly promote disassembly of chromatin in the fbp1 upstream region. Gcn5 critically contributes to nucleosome eviction in the absence of either Snf22 or Hrp3, presumably by recruiting Hrp3 in snf22∆ cells and Snf22 in hrp3∆ cells. Conversely, Gcn5-dependent histone H3 acetylation is impaired in snf22∆/hrp3∆ cells, suggesting that both redundant ADCRs induce recruitment of Gcn5 to the chromatin array in the fbp1 upstream region. These results reveal a previously unappreciated interplay between ADCRs and histone acetylation in which histone acetylation facilitates recruitment of ADCRs, while ADCRs are required for histone acetylation.
Circadian expression profiles of chromatin remodeling factor genes in Arabidopsis.
Lee, Hong Gil; Lee, Kyounghee; Jang, Kiyoung; Seo, Pil Joon
2015-01-01
The circadian clock is a biological time keeper mechanism that regulates biological rhythms to a period of approximately 24 h. The circadian clock enables organisms to anticipate environmental cycles and coordinates internal cellular physiology with external environmental cues. In plants, correct matching of the clock with the environment confers fitness advantages to plant survival and reproduction. Therefore, circadian clock components are regulated at multiple layers to fine-tune the circadian oscillation. Epigenetic regulation provides an additional layer of circadian control. However, little is known about which chromatin remodeling factors are responsible for circadian control. In this work, we analyzed circadian expression of 109 chromatin remodeling factor genes and identified 17 genes that display circadian oscillation. In addition, we also found that a candidate interacts with a core clock component, supporting that clock activity is regulated in part by chromatin modification. As an initial attempt to elucidate the relationship between chromatin modification and circadian oscillation, we identified novel regulatory candidates that provide a platform for future investigations of chromatin regulation of the circadian clock.
Toxic effects of lead and nickel nitrate on rat liver chromatin components.
Rabbani-Chadegani Iii, Azra; Fani, Nesa; Abdossamadi, Sayeh; Shahmir, Nosrat
2011-01-01
The biological activity of heavy metals is related to their physicochemical interaction with biological receptors. In the present study, the effect of low concentrations of nickel nitrate and lead nitrate (lead nitrate to chromatin compared to nickel nitrate. Also, the binding affinity of lead nitrate to histone proteins free in solution was higher than nickel. On the basis of the results, it is concluded that lead reacts with chromatin components even at very low concentrations and induce chromatin aggregation through histone-DNA cross-links. Whereas, nickel nitrate is less effective on chromatin at low concentrations, suggesting higher toxicity of lead nitrate on chromatin compared to nickel. Copyright © 2010 Wiley Periodicals, Inc.
Effect of triiodothyronine on rat liver chromatin protein kinase
International Nuclear Information System (INIS)
Kruh, J.; Tichonicky, L.
1976-01-01
1) Injection of triiodothyronine to rats stimulates protein kinase activity in liver chromatin nonhistone proteins. A significant increase was found after two daily injections. A 4-fold increase was observed with the purified enzyme after eight daily injections of the hormone. No variations were observed in cytosol protein kinase activity. Electrophoretic pattern, effect of heat denaturation, effect of p-hydroxymercuribenzoate seem to indicate that the enzyme present in treated rats is not identical to the enzyme in control animals, which suggests that thyroid hormone has induced nuclear protein kinase. Diiodothyronine, 3, 3', 5'-triiodothyronine have no effect on protein kinase. 2) Chromatin non-histone proteins isolated from rats injected with triiodothyronine incorporated more 32 P when incubated with [γ- 32 P]ATP than the chromatin proteins from untreated rats. Thyroidectomy reduced the in vitro 32 P incorporation. It is suggested that some of the biological activity of thyroid hormone could be mediated through its effect on chromatin non-histone proteins. (orig.) [de
Chromatin proteins and modifications as drug targets
DEFF Research Database (Denmark)
Helin, Kristian; Dhanak, Dashyant
2013-01-01
A plethora of groundbreaking studies have demonstrated the importance of chromatin-associated proteins and post-translational modifications of histones, proteins and DNA (so-called epigenetic modifications) for transcriptional control and normal development. Disruption of epigenetic control...... is a frequent event in disease, and the first epigenetic-based therapies for cancer treatment have been approved. A generation of new classes of potent and specific inhibitors for several chromatin-associated proteins have shown promise in preclinical trials. Although the biology of epigenetic regulation...
The effect of higher order chromatin structure on DNA damage and repair
International Nuclear Information System (INIS)
Yasui, L.S.; Warters, R.L.; Higashikubo, R.
1985-01-01
Alterations in chromatin structure are thought to play an important role in various radiobiological end points, i.e., DNA damage, DNA damage repair and cell survival. The authors use here the isoleucine deprivation technique to decondense higher order chromatin structure and asses X-ray induced DNA damage, DNA damage repair and cell survival on cells with decondensed chromatin as compared to controls. This chromatin decondensation manifests itself as a 30 fold decrease in nuclear area occupied by heterochromatin, an increased rate of Micrococcal nuclease digestion, 15% increased ethidium bromide intercalation and an altered binding capacity of Hl histone. These chromatin/nuclear changes do not affect X-ray induced DNA damage as measured by the alkaline elution technique or cell survival but slows DNA damage repair by 2 fold. Therefore, even though the chromatin appears more accessible to DNA damage and repair processes, these particular nuclear changes do not affect the DNA damaging effects of X-rays and in addition, repair is not enhanced by the ''relaxed'' state of chromatin. It is proposed that the altered metabolic state of isoleucine deprived cells provides a less efficient system for the repair of X-ray induced DNA damage
Vibrational energy relaxation: proposed pathway of fast local chromatin denaturation
International Nuclear Information System (INIS)
Harder, D.; Greinert, R.
2002-01-01
The molecular mechanism responsible for the a component of exchange-type chromosome aberrations, of chromosome fragmentation and of reproductive cell death is one of the unsolved issues of radiation biology. Under review is whether vibrational energy relaxation in the constitutive biopolymers of chromatin, induced by inelastic energy deposition events and mediated via highly excited vibrational states, may provide a pathway of fast local chromatin denaturation, thereby producing the severe DNA lesion able to interact chemically with other, non-damaged chromatin. (author)
Directory of Open Access Journals (Sweden)
Palladino Michael A
2012-12-01
Full Text Available Abstract Background Spermatic cord torsion can lead to testis ischemia (I and subsequent ischemia-reperfusion (I/R causing germ cell-specific apoptosis. Previously, we demonstrated that the hypoxia-inducible factor-1 (HIF-1 transcription factor, a key regulator of physiological responses to hypoxia, is abundant in Leydig cells in normoxic and ischemic testes. We hypothesize that testicular HIF-1 activates the expression of antiapoptotic target genes to protect Leydig cells from apoptosis. In silico analysis of testis genes containing a consensus hypoxia response element (HRE, 5’-RCGTG-3’ identified myeloid cell leukemia-1 (Mcl-1 as a potential HIF-1 target gene. The purpose of this study was to determine whether HIF-1 shows DNA-binding activity in normoxic and ischemic testes and whether Mcl-1 is a target gene of testicular HIF-1. Methods The testicular HIF-1 DNA-binding capacity was analyzed in vitro using a quantitative enzyme-linked immunosorbent assay (ELISA and electrophoretic mobility shift assays (EMSA. MCL-1 protein expression was evaluated by immunoblot analysis and immunohistochemistry. The binding of testicular HIF-1 to the Mcl-1 gene was examined via chromatin immunoprecipitation (ChIP analysis. Results The ELISA and EMSA assays demonstrated that testicular HIF-1 from normoxic and ischemic testes binds DNA equally strongly, suggesting physiological roles for HIF-1 in the normoxic testis, unlike most tissues in which HIF-1 is degraded under normoxic conditions and is only activated by hypoxia. MCL-1 protein was determined to be abundant in both normoxic and ischemic testes and expressed in Leydig cells. In a pattern identical to that of HIF-1 expression, the steady-state levels of MCL-1 were not significantly affected by I or I/R and MCL-1 co-localized with HIF-1α in Leydig cells. Chromatin immunoprecipitation (ChIP analysis using a HIF-1 antibody revealed sequences enriched for the Mcl-1 promoter. Conclusions The results
Ascl1 Coordinately Regulates Gene Expression and the Chromatin Landscape during Neurogenesis
Directory of Open Access Journals (Sweden)
Alexandre A.S.F. Raposo
2015-03-01
Full Text Available The proneural transcription factor Ascl1 coordinates gene expression in both proliferating and differentiating progenitors along the neuronal lineage. Here, we used a cellular model of neurogenesis to investigate how Ascl1 interacts with the chromatin landscape to regulate gene expression when promoting neuronal differentiation. We find that Ascl1 binding occurs mostly at distal enhancers and is associated with activation of gene transcription. Surprisingly, the accessibility of Ascl1 to its binding sites in neural stem/progenitor cells remains largely unchanged throughout their differentiation, as Ascl1 targets regions of both readily accessible and closed chromatin in proliferating cells. Moreover, binding of Ascl1 often precedes an increase in chromatin accessibility and the appearance of new regions of open chromatin, associated with de novo gene expression during differentiation. Our results reveal a function of Ascl1 in promoting chromatin accessibility during neurogenesis, linking the chromatin landscape at Ascl1 target regions with the temporal progression of its transcriptional program.
HACking the centromere chromatin code: insights from human artificial chromosomes.
Bergmann, Jan H; Martins, Nuno M C; Larionov, Vladimir; Masumoto, Hiroshi; Earnshaw, William C
2012-07-01
The centromere is a specialized chromosomal region that serves as the assembly site of the kinetochore. At the centromere, CENP-A nucleosomes form part of a chromatin landscape termed centrochromatin. This chromatin environment conveys epigenetic marks regulating kinetochore formation. Recent work sheds light on the intricate relationship between centrochromatin state, the CENP-A assembly pathway and the maintenance of centromere function. Here, we review the emerging picture of how chromatin affects mammalian kinetochore formation. We place particular emphasis on data obtained from Human Artificial Chromosome (HAC) biology and the targeted engineering of centrochromatin using synthetic HACs. We discuss implications of these findings, which indicate that a delicate balance of histone modifications and chromatin state dictates both de novo centromere formation and the maintenance of centromere identity in dividing cell populations.
Local changes of higher-order chromatin structure during DSB-repair
International Nuclear Information System (INIS)
Falk, M; Lukasova, E; Gabrielova, B; Ondrej, V; Kozubek, S
2008-01-01
We show that double-strand breaks (DSBs) induced in DNA of human cells by γ-radiation arise mainly in active, gene-rich, decondensed chromatin. We demonstrate that DSBs show limited movement in living cells, occasionally resulting in their permanent clustering, which poses a risk of incorrect DNA rejoining. In addition, some DSBs remain unrepaired for several days after irradiation, forming lesions repairable only with difficulty which are hazardous for genome stability. These 'late' DSBs colocalize with heterochromatin markers (dimethylated histone H3 at lysine 9, HP1 and CENP-A proteins), despite the low density of the surrounding chromatin. This indicates that there is epigenetic silencing of loci close to unrepaired DSBs and/or stabilization of damaged decondensed chromatin loops during repair and post-repair reconstitution of chromatin structure
Higher-order structure of Saccharomyces cerevisiae chromatin
International Nuclear Information System (INIS)
Lowary, P.T.; Widom, J.
1989-01-01
We have developed a method for partially purifying chromatin from Saccharomyces cerevisiae (baker's yeast) to a level suitable for studies of its higher-order folding. This has required the use of yeast strains that are free of the ubiquitous yeast killer virus. Results from dynamic light scattering, electron microscopy, and x-ray diffraction show that the yeast chromatin undergoes a cation-dependent folding into 30-nm filaments that resemble those characteristic of higher-cell chromatin; moreover, the packing of nucleosomes within the yeast 30-nm filaments is similar to that of higher cells. These results imply that yeast has a protein or protein domain that serves the role of the histone H 1 found in higher cells; physical and genetic studies of the yeast activity could help elucidate the structure and function of H 1. Images of the yeast 30-nm filaments can be used to test crossed-linker models for 30-nm filament structure
Oncogenic N-Ras Stimulates SRF-Mediated Transactivation via H3 Acetylation at Lysine 9
Directory of Open Access Journals (Sweden)
Sun-Ju Yi
2018-01-01
Full Text Available Signal transduction pathways regulate the gene expression by altering chromatin dynamics in response to mitogens. Ras proteins are key regulators linking extracellular stimuli to a diverse range of biological responses associated with gene regulation. In mammals, the three ras genes encode four Ras protein isoforms: H-Ras, K-Ras4A, K-Ras4B, and N-Ras. Although emerging evidence suggests that Ras isoforms differentially regulate gene expressions and are functionally nonredundant, the mechanisms underlying Ras specificity and Ras signaling effects on gene expression remain unclear. Here, we show that oncogenic N-Ras acts as the most potent regulator of SRF-, NF-κB-, and AP-1-dependent transcription. N-Ras-RGL2 axis is a distinct signaling pathway for SRF target gene expression such as Egr1 and JunB, as RGL2 Ras binding domain (RBD significantly impaired oncogenic N-Ras-induced SRE activation. By monitoring the effect of Ras isoforms upon the change of global histone modifications in oncogenic Ras-overexpressed cells, we discovered that oncogenic N-Ras elevates H3K9ac/H3K23ac levels globally in the chromatin context. Importantly, chromatin immunoprecipitation (ChIP assays revealed that H3K9ac is significantly enriched at the promoter and coding regions of Egr1 and JunB. Collectively, our findings define an undocumented role of N-Ras in modulating of H3 acetylation and in gene regulation.
Oxidative stress signaling to chromatin in health and disease
Kreuz, Sarah
2016-06-20
Oxidative stress has a significant impact on the development and progression of common human pathologies, including cancer, diabetes, hypertension and neurodegenerative diseases. Increasing evidence suggests that oxidative stress globally influences chromatin structure, DNA methylation, enzymatic and non-enzymatic post-translational modifications of histones and DNA-binding proteins. The effects of oxidative stress on these chromatin alterations mediate a number of cellular changes, including modulation of gene expression, cell death, cell survival and mutagenesis, which are disease-driving mechanisms in human pathologies. Targeting oxidative stress-dependent pathways is thus a promising strategy for the prevention and treatment of these diseases. We summarize recent research developments connecting oxidative stress and chromatin regulation.
SUMO-2 Orchestrates Chromatin Modifiers in Response to DNA Damage
DEFF Research Database (Denmark)
Hendriks, Ivo A; Treffers, Louise W; Verlaan-de Vries, Matty
2015-01-01
dynamically SUMOylated interaction networks of chromatin modifiers, transcription factors, DNA repair factors, and nuclear body components. SUMOylated chromatin modifiers include JARID1B/KDM5B, JARID1C/KDM5C, p300, CBP, PARP1, SetDB1, and MBD1. Whereas SUMOylated JARID1B was ubiquitylated by the SUMO......-targeted ubiquitin ligase RNF4 and degraded by the proteasome in response to DNA damage, JARID1C was SUMOylated and recruited to the chromatin to demethylate histone H3K4....
Differential affinity of mammalian histone H1 somatic subtypes for DNA and chromatin
Directory of Open Access Journals (Sweden)
Mora Xavier
2007-05-01
Full Text Available Abstract Background Histone H1 is involved in the formation and maintenance of chromatin higher order structure. H1 has multiple isoforms; the subtypes differ in timing of expression, extent of phosphorylation and turnover rate. In vertebrates, the amino acid substitution rates differ among subtypes by almost one order of magnitude, suggesting that each subtype might have acquired a unique function. We have devised a competitive assay to estimate the relative binding affinities of histone H1 mammalian somatic subtypes H1a-e and H1° for long chromatin fragments (30–35 nucleosomes in physiological salt (0.14 M NaCl at constant stoichiometry. Results The H1 complement of native chromatin was perturbed by adding an additional amount of one of the subtypes. A certain amount of SAR (scaffold-associated region DNA was present in the mixture to avoid precipitation of chromatin by excess H1. SAR DNA also provided a set of reference relative affinities, which were needed to estimate the relative affinities of the subtypes for chromatin from the distribution of the subtypes between the SAR and the chromatin. The amounts of chromatin, SAR and additional H1 were adjusted so as to keep the stoichiometry of perturbed chromatin similar to that of native chromatin. H1 molecules freely exchanged between the chromatin and SAR binding sites. In conditions of free exchange, H1a was the subtype of lowest affinity, H1b and H1c had intermediate affinities and H1d, H1e and H1° the highest affinities. Subtype affinities for chromatin differed by up to 19-fold. The relative affinities of the subtypes for chromatin were equivalent to those estimated for a SAR DNA fragment and a pUC19 fragment of similar length. Avian H5 had an affinity ~12-fold higher than H1e for both DNA and chromatin. Conclusion H1 subtypes freely exchange in vitro between chromatin binding sites in physiological salt (0.14 M NaCl. The large differences in relative affinity of the H1 subtypes for
Temporal profiling of the chromatin proteome reveals system-wide responses to replication inhibition
DEFF Research Database (Denmark)
Khoudoli, Guennadi A; Gillespie, Peter J; Stewart, Graeme
2008-01-01
Although the replication, expression, and maintenance of DNA are well-studied processes, the way that they are coordinated is poorly understood. Here, we report an analysis of the changing association of proteins with chromatin (the chromatin proteome) during progression through interphase...... of the cell cycle. Sperm nuclei were incubated in Xenopus egg extracts, and chromatin-associated proteins were analyzed by mass spectrometry at different times. Approximately 75% of the proteins varied in abundance on chromatin by more than 15%, suggesting that the chromatin proteome is highly dynamic....... Proteins were then assigned to one of 12 different clusters on the basis of their pattern of chromatin association. Each cluster contained functional groups of proteins involved in different nuclear processes related to progression through interphase. We also blocked DNA replication by inhibiting either...
Chromatin modifications and the DNA damage response to ionizing radiation
International Nuclear Information System (INIS)
Kumar, Rakesh; Horikoshi, Nobuo; Singh, Mayank; Gupta, Arun; Misra, Hari S.; Albuquerque, Kevin; Hunt, Clayton R.; Pandita, Tej K.
2013-01-01
In order to survive, cells have evolved highly effective repair mechanisms to deal with the potentially lethal DNA damage produced by exposure to endogenous as well as exogenous agents. Ionizing radiation exposure induces highly lethal DNA damage, especially DNA double-strand breaks (DSBs), that is sensed by the cellular machinery and then subsequently repaired by either of two different DSB repair mechanisms: (1) non-homologous end joining, which re-ligates the broken ends of the DNA and (2) homologous recombination, that employs an undamaged identical DNA sequence as a template, to maintain the fidelity of DNA repair. Repair of DSBs must occur within the natural context of the cellular DNA which, along with specific proteins, is organized to form chromatin, the overall structure of which can impede DNA damage site access by repair proteins. The chromatin complex is a dynamic structure and is known to change as required for ongoing cellular processes such as gene transcription or DNA replication. Similarly, during the process of DNA damage sensing and repair, chromatin needs to undergo several changes in order to facilitate accessibility of the repair machinery. Cells utilize several factors to modify the chromatin in order to locally open up the structure to reveal the underlying DNA sequence but post-translational modification of the histone components is one of the primary mechanisms. In this review, we will summarize chromatin modifications by the respective chromatin modifying factors that occur during the DNA damage response.
Citrullination regulates pluripotency and histone H1 binding to chromatin
DEFF Research Database (Denmark)
Christophorou, Maria A; Castelo-Branco, Gonçalo; Halley-Stott, Richard P
2014-01-01
citrullination of core histones has been linked to transcriptional regulation and the DNA damage response. PADI4 (also called PAD4 or PADV), the only PADI with a nuclear localization signal, was previously shown to act in myeloid cells where it mediates profound chromatin decondensation during the innate immune...... and activating their expression. Its inhibition lowers the percentage of pluripotent cells in the early mouse embryo and significantly reduces reprogramming efficiency. Using an unbiased proteomic approach we identify linker histone H1 variants, which are involved in the generation of compact chromatin, as novel...... PADI4 substrates. Citrullination of a single arginine residue within the DNA-binding site of H1 results in its displacement from chromatin and global chromatin decondensation. Together, these results uncover a role for citrullination in the regulation of pluripotency and provide new mechanistic...
Directory of Open Access Journals (Sweden)
Julian Sosnik
Full Text Available The nuclear landscape plays an important role in the regulation of tissue and positional specific genes in embryonic and developing cells. Changes in this landscape can be dynamic, and are associated with the differentiation of cells during embryogenesis, and the de-differentiation of cells during induced pluripotent stem cell (iPSC formation and in many cancers. However, tools to quantitatively characterize these changes are limited, especially in the in vivo context, where numerous tissue types are present and cells are arranged in multiple layers. Previous tools have been optimized for the monolayer nature of cultured cells. Therefore, we present a new algorithm to quantify the condensation of chromatin in two in vivo systems. We first developed this algorithm to quantify changes in chromatin compaction and validated it in differentiating spermatids in zebrafish testes. Our algorithm successfully detected the typical increase in chromatin compaction as these cells differentiate. We then employed the algorithm to quantify the changes that occur in amphibian limb cells as they participate in a regenerative response. We observed that the chromatin in the limb cells de-compacts as they contribute to the regenerating organ. We present this new tool as an open sourced software that can be readily accessed and optimized to quantify chromatin compaction in complex multi-layered samples.
High-Frequency Promoter Firing Links THO Complex Function to Heavy Chromatin Formation
DEFF Research Database (Denmark)
Mouaikel, John; Causse, Sébastien Z; Rougemaille, Mathieu
2013-01-01
The THO complex is involved in transcription, genome stability, and messenger ribonucleoprotein (mRNP) formation, but its precise molecular function remains enigmatic. Under heat shock conditions, THO mutants accumulate large protein-DNA complexes that alter the chromatin density of target genes...... (heavy chromatin), defining a specific biochemical facet of THO function and a powerful tool of analysis. Here, we show that heavy chromatin distribution is dictated by gene boundaries and that the gene promoter is necessary and sufficient to convey THO sensitivity in these conditions. Single......-molecule fluorescence insitu hybridization measurements show that heavy chromatin formation correlates with an unusually high firing pace of the promoter with more than 20 transcription events per minute. Heavy chromatin formation closely follows the modulation of promoter firing and strongly correlates with polymerase...
[Automated morphometric evaluation of the chromatin structure of liver cell nuclei after vagotomy].
Butusova, N N; Zhukotskiĭ, A V; Sherbo, I V; Gribkov, E N; Dubovaia, T K
1989-05-01
The morphometric analysis of the interphase chromatine structure of the hepatic cells nuclei was carried out on the automated TV installation for the quantitative analysis of images "IBAS-2" (by the OPTON firm, the FRG) according to 50 optical and geometric parameters during various periods (1.2 and 4 weeks) after the vagotomy operation. It is determined that upper-molecular organisation of chromatine undergoes the biggest changes one week after operation, and changes of granular component are more informative than changes of the nongranular component (with the difference 15-20%). It was also revealed that chromatine components differ in tinctorial properties, which are evidently dependent on physicochemical characteristics of the chromatine under various functional conditions of the cell. As a result of the correlation analysis the group of morphometric indices of chromatine structure was revealed, which are highly correlated with level of transcription activity of chromatine during various terms after denervation. The correlation quotient of these parameters is 0.85-0.97. The summing up: vagus denervation of the liver causes changes in the morphofunctional organisation of the chromatine.
N-Butyrate alters chromatin accessibility to DNA repair enzymes
International Nuclear Information System (INIS)
Smith, P.J.
1986-01-01
Current evidence suggests that the complex nature of mammalian chromatin can result in the concealment of DNA damage from repair enzymes and their co-factors. Recently it has been proposed that the acetylation of histone proteins in chromatin may provide a surveillance system whereby damaged regions of DNA become exposed due to changes in chromatin accessibility. This hypothesis has been tested by: (i) using n-butyrate to induce hyperacetylation in human adenocarcinoma (HT29) cells; (ii) monitoring the enzymatic accessibility of chromatin in permeabilised cells; (iii) measuring u.v. repair-associated nicking of DNA in intact cells and (iv) determining the effects of n-butyrate on cellular sensitivity to DNA damaging agents. The results indicate that the accessibility of chromatin to Micrococcus luteus u.v. endonuclease is enhanced by greater than 2-fold in n-butyrate-treated cells and that there is a corresponding increase in u.v. repair incision rates in intact cells exposed to the drug. Non-toxic levels of n-butyrate induce a block to G1 phase transit and there is a significant growth delay on removal of the drug. Resistance of HT29 cells to u.v.-radiation and adriamycin is enhanced in n-butyrate-treated cells whereas X-ray sensitivity is increased. Although changes in the responses of cells to DNA damaging agents must be considered in relation to the effects of n-butyrate on growth rate and cell-cycle distribution, the results are not inconsistent with the proposal that increased enzymatic-accessibility/repair is biologically favourable for the resistance of cells to u.v.-radiation damage. Overall the results support the suggested operation of a histone acetylation-based chromatin surveillance system in human cells
Regulation of chromatin structure by poly(ADP-ribosylation
Directory of Open Access Journals (Sweden)
Sascha eBeneke
2012-09-01
Full Text Available The interaction of DNA with proteins in the context of chromatin has to be tightly regulated to achieve so different tasks as packaging, transcription, replication and repair. The very rapid and transient post-translational modification of proteins by poly(ADP-ribose has been shown to take part in all four. Originally identified as immediate cellular answer to a variety of genotoxic stresses, already early data indicated the ability of this highly charged nucleic acid-like polymer to modulate nucleosome structure, the basic unit of chromatin. At the same time the enzyme responsible for synthesizing poly(ADP-ribose, the zinc-finger protein poly(ADP-ribose polymerase-1 (PARP1, was shown to control transcription initiation as basic factor TFIIC within the RNA-polymerase II machinery. Later research focused more on PARP-mediated regulation of DNA repair and cell death, but in the last few years, transcription as well as chromatin modulation has re-appeared on the scene. This review will discuss the impact of PARP1 on transcription and transcription factors, its implication in chromatin remodeling for DNA repair and probably also replication, and its role in controlling epigenetic events such as DNA methylation and the functionality of the insulator protein CCCTC-binding factor.
Flip chip assembly of thinned chips for hybrid pixel detector applications
Fritzsch, T; Woehrmann, M; Rothermund, M; Huegging, F; Ehrmann, O; Oppermann, H; Lang, K.D
2014-01-01
There is a steady trend to ultra-thin microelectronic devices. Especially for future particle detector systems a reduced readout chip thickness is required to limit the loss of tracking precision due to scattering. The reduction of silicon thickness is performed at wafer level in a two-step thinning process. To minimize the risk of wafer breakage the thinned wafer needs to be handled by a carrier during the whole process chain of wafer bumping. Another key process is the flip chip assembly of thinned readout chips onto thin sensor tiles. Besides the prevention of silicon breakage the minimization of chip warpage is one additional task for a high yield and reliable flip chip process. A new technology using glass carrier wafer will be described in detail. The main advantage of this technology is the combination of a carrier support during wafer processing and the chip support during flip chip assembly. For that a glass wafer is glue-bonded onto the backside of the thinned readout chip wafer. After the bump depo...
Abu Samra, Dina Bashir Kamil; Al Kilani, Alia; Hamdan, Samir; Sakashita, Kosuke; Gadhoum, Samah Z.; Merzaban, Jasmeen
2015-01-01
Selectins (E-, P-, and L-selectins) interact with glycoprotein ligands to mediate the essential tethering/rolling step in cell transport and delivery that captures migrating cells from the circulating flow. In this work, we developed a real time immunoprecipitation assay on a surface plasmon resonance chip that captures native glycoforms of two well known E-selectin ligands (CD44/hematopoietic cell E-/L-selectin ligand and P-selectin glycoprotein ligand-1) from hematopoietic cell extracts. Here we present a comprehensive characterization of their binding to E-selectin. We show that both ligands bind recombinant monomeric E-selectin transiently with fast on- and fast off-rates, whereas they bind dimeric E-selectin with remarkably slow onand off-rates. This binding requires the sialyl Lewis x sugar moiety to be placed on both O- and N-glycans, and its association, but not dissociation, is sensitive to the salt concentration. Our results suggest a mechanism through which monomeric selectins mediate initial fast on and fast off kinetics to help capture cells out of the circulating shear flow; subsequently, tight binding by dimeric/oligomeric selectins is enabled to significantly slow rolling. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
Abu Samra, Dina Bashir Kamil
2015-06-29
Selectins (E-, P-, and L-selectins) interact with glycoprotein ligands to mediate the essential tethering/rolling step in cell transport and delivery that captures migrating cells from the circulating flow. In this work, we developed a real time immunoprecipitation assay on a surface plasmon resonance chip that captures native glycoforms of two well known E-selectin ligands (CD44/hematopoietic cell E-/L-selectin ligand and P-selectin glycoprotein ligand-1) from hematopoietic cell extracts. Here we present a comprehensive characterization of their binding to E-selectin. We show that both ligands bind recombinant monomeric E-selectin transiently with fast on- and fast off-rates, whereas they bind dimeric E-selectin with remarkably slow onand off-rates. This binding requires the sialyl Lewis x sugar moiety to be placed on both O- and N-glycans, and its association, but not dissociation, is sensitive to the salt concentration. Our results suggest a mechanism through which monomeric selectins mediate initial fast on and fast off kinetics to help capture cells out of the circulating shear flow; subsequently, tight binding by dimeric/oligomeric selectins is enabled to significantly slow rolling. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
High-throughput assessment of context-dependent effects of chromatin proteins
Brueckner, L. (Laura); Van Arensbergen, J. (Joris); Akhtar, W. (Waseem); L. Pagie (Ludo); B. van Steensel (Bas)
2016-01-01
textabstractBackground: Chromatin proteins control gene activity in a concerted manner. We developed a high-throughput assay to study the effects of the local chromatin environment on the regulatory activity of a protein of interest. The assay combines a previously reported multiplexing strategy
International Nuclear Information System (INIS)
Li, K.; Cai, R.; Dai, B.B.; Zhang, X.Q.; Wang, H.J.; Ge, S.F.; Xu, W.R.; Lu, J.
2007-01-01
Special AT-rich binding protein 1 (SATB1), a cell type-specific nuclear matrix attachment region (MAR) DNA-binding protein, tethers to a specific DNA sequence and regulates gene expression through chromatin remodeling and HDAC (histone deacetylase complex) recruitment. In this study, a SATB1 eukaryotic expression plasmid was transfected into the human erythroleukemia K562 cell line and individual clones that stably over-expressed the SATB1 protein were isolated. Microarray analysis revealed that hundreds of genes were either up- or down-regulated in the SATB1 over-expressing K562 cell lines. One of these was the extra-cellular matrix glycoprotein, SPARC (human secreted protein acidic and rich in cysteine). siRNA knock-down of SATB1 also reduced SPARC expression, which was consistent with elevated SPARC levels in the SATB1 over-expressing cell line. Bioinformatics software Mat-inspector showed that a 17 bp DNA sequence in the third intron of SPARC possessed a high potential for SATB1 binding; a finding confirmed by Chromatin immunoprecipitation (ChIP) with anti-SATB1 antibody. Our results show for the first time that forced-expression of SATB1 in K562 cells triggers SPARC up-regulation by binding to a 17 bp DNA sequence in the third intron
ATP-dependent chromatin remodeling in the DNA-damage response
Directory of Open Access Journals (Sweden)
Lans Hannes
2012-01-01
Full Text Available Abstract The integrity of DNA is continuously challenged by metabolism-derived and environmental genotoxic agents that cause a variety of DNA lesions, including base alterations and breaks. DNA damage interferes with vital processes such as transcription and replication, and if not repaired properly, can ultimately lead to premature aging and cancer. Multiple DNA pathways signaling for DNA repair and DNA damage collectively safeguard the integrity of DNA. Chromatin plays a pivotal role in regulating DNA-associated processes, and is itself subject to regulation by the DNA-damage response. Chromatin influences access to DNA, and often serves as a docking or signaling site for repair and signaling proteins. Its structure can be adapted by post-translational histone modifications and nucleosome remodeling, catalyzed by the activity of ATP-dependent chromatin-remodeling complexes. In recent years, accumulating evidence has suggested that ATP-dependent chromatin-remodeling complexes play important, although poorly characterized, roles in facilitating the effectiveness of the DNA-damage response. In this review, we summarize the current knowledge on the involvement of ATP-dependent chromatin remodeling in three major DNA repair pathways: nucleotide excision repair, homologous recombination, and non-homologous end-joining. This shows that a surprisingly large number of different remodeling complexes display pleiotropic functions during different stages of the DNA-damage response. Moreover, several complexes seem to have multiple functions, and are implicated in various mechanistically distinct repair pathways.
International Nuclear Information System (INIS)
Cho, Yoon-Kyoung; Kim, Tae-hyeong; Lee, Jeong-Gun
2010-01-01
We report the on-chip concentration of bacteria using a dielectrophoretic (DEP) chip with 3D electrodes and subsequent laser-based DNA extraction in the same chip. The DEP chip has a set of interdigitated Au post electrodes with 50 µm height to generate a network of non-uniform electric fields for the efficient trapping by DEP. The metal post array was fabricated by photolithography and subsequent Ni and Au electroplating. Three model bacteria samples (Escherichia coli, Staphylococcus epidermidis, Streptococcus mutans) were tested and over 80-fold concentrations were achieved within 2 min. Subsequently, on-chip DNA extraction from the concentrated bacteria in the 3D DEP chip was performed by laser irradiation using the laser-irradiated magnetic bead system (LIMBS) in the same chip. The extracted DNA was analyzed with silicon chip-based real-time polymerase chain reaction (PCR). The total process of on-chip bacteria concentration and the subsequent DNA extraction can be completed within 10 min including the manual operation time.
DNA repair goes hip-hop: SMARCA and CHD chromatin remodellers join the break dance.
Rother, Magdalena B; van Attikum, Haico
2017-10-05
Proper signalling and repair of DNA double-strand breaks (DSB) is critical to prevent genome instability and diseases such as cancer. The packaging of DNA into chromatin, however, has evolved as a mere obstacle to these DSB responses. Posttranslational modifications and ATP-dependent chromatin remodelling help to overcome this barrier by modulating nucleosome structures and allow signalling and repair machineries access to DSBs in chromatin. Here we recap our current knowledge on how ATP-dependent SMARCA- and CHD-type chromatin remodellers alter chromatin structure during the signalling and repair of DSBs and discuss how their dysfunction impacts genome stability and human disease.This article is part of the themed issue 'Chromatin modifiers and remodellers in DNA repair and signalling'. © 2017 The Authors.
Overexpression of hypoxia-inducible factor prolyl- hydoxylase ...
African Journals Online (AJOL)
Jane
2011-08-08
Aug 8, 2011 ... which is regulated by HIF prolyl-dydoxylase -mediated degradation. Taken together, our results ..... Chromatin immunoprecipitation analysis of gene ... phosphatidylinositol 3-kinase/Akt pathway. Endocrinology, 148(5):.
National Research Council Canada - National Science Library
Chang, Christine S
2006-01-01
.... Performed data analysis of genome-wide chromatin immunoprecipitation experiments with ERalpha, RNA polymerase III and histone modification markers and correlate the binding data with expression profiles upon estrogen stimulation.
Directory of Open Access Journals (Sweden)
Ahyar Ahmad
2010-07-01
Full Text Available Chromatin assembly factor-1 (CAF-1, a protein complex consisting of three subunits, p150, p60, and p48, is highly conserved from yeast to humans and facilitated nucleosome assembly of newly replicated DNA. The p48 subunit, CAF-1p48 (p48, with seven WD (Trp-Asp repeat motifs, is a member of the WD protein family. The immunoprecipitation experiment revealed that ß-propeller structure of p48 was less stringent for it's binding to HDAC-1, but more stringent for its binding to both histones H4 and CAF-1p60 but not to ASF-1, indicating that the proper ß-propeller structure of p48 is essential for the binding to these two proteins histone H4 and CAF-1p60. Complementation experiments, involving missense and truncated mutants of FLAG-tagged p48, revealed that mutations of every of seven WD dipeptide motifs, like both the N-terminal and C-terminal truncated mutations, could not rescue for the tet-induced lethality. These results indicate not only that p48 is essential for the viability of vertebrate cells, although the yeast p48 homolog is nonessential, but also that all the seven WD dipeptide motifs are necessary for the maintenance of the proper structure of p48 that is fundamentally important for cell viability. Keywords: Chromatin assembly factor-1, complementation experiments, viability
Probing chromatin structure with nuclease sensitivity assays.
Gregory, R I; Khosla, S; Feil, R
2001-01-01
To further our understanding of genomic imprinting it will be essential to identify key control elements, and to investigate their regulation by both epigenetic modifications (such as DNA methylation) and trans-acting factors. So far, sequence elements that regulate parental allele-specific gene expression have been identified in a number of imprinted loci, either because of their differential DNA methylation or through functional studies in transgenic mice (1,2). A systematic search for allele-specific chromatin features constitutes an alternative strategy to identify elements that regulate imprinting. The validity of such an in vivo chromatin approach derives from the fact that in several known imprinting control-elements, a specialized organization of chromatin characterized by nuclease hypersensitivity is present on only one of the two parental chromosome (3). For example, the differentially methylated 5 -portion of the human SNRPN gene-a sequence element that controls imprinting in the Prader-Willi and Angelman syndromes' domain on chromosome 15q11- q13-has strong DNase-I hypersensitive sites on the unmethylated paternal chromosome (4). A differentially methylated region that regulates the imprinting of H19 and that of the neighboring insulin-like growth factor-2 gene on mouse chromosome 7 was also found to have parental chromosome-specific hypersensitive sites (5,6). The precise nature of the allelic nuclease hypersensitivity in these and other imprinted loci remains to be determined in more detail, for example, by applying complementary chromatin methodologies (7,8). However, it is commonly observed that a nuclease hypersensitive site corresponds to a small region where nucleosomes are absent or partially disrupted.
Homoeologous chromatin exchange in a radiation-induced gene transfer
International Nuclear Information System (INIS)
Dvorak, J.; Knott, D.R.
1977-01-01
Some of the ionizing-radiation-induced translocations between alien and wheat chromosomes show no deleterious effects and are transmitted normally through the pollen. Translocations of this type will be called ''compensating''. In one such compensating translocation, designated T4, it was found that chromatin in the long arm of wheat chromosome 7D was replaced with homoeologous chromatin of the Agropyron chromosome
Homoeologous chromatin exchange in a radiation-induced gene transfer
Energy Technology Data Exchange (ETDEWEB)
Dvorak, J; Knott, D R [Department of Crop Science, University of Saskatchewan, Saskatoon, Saskatchewan, Canada
1977-03-01
Some of the ionizing-radiation-induced translocations between alien and wheat chromosomes show no deleterious effects and are transmitted normally through the pollen. Translocations of this type will be called ''compensating''. In one such compensating translocation, designated T4, it was found that chromatin in the long arm of wheat chromosome 7D was replaced with homologous chromatin of the Agropyron chromosome.
Smith, Owen K.; Aladjem, Mirit I.
2014-01-01
The DNA replication program is, in part, determined by the epigenetic landscape that governs local chromosome architecture and directs chromosome duplication. Replication must coordinate with other biochemical processes occurring concomitantly on chromatin, such as transcription and remodeling, to insure accurate duplication of both genetic and epigenetic features and to preserve genomic stability. The importance of genome architecture and chromatin looping in coordinating cellular processes on chromatin is illustrated by two recent sets of discoveries. First, chromatin-associated proteins that are not part of the core replication machinery were shown to affect the timing of DNA replication. These chromatin-associated proteins could be working in concert, or perhaps in competition, with the transcriptional machinery and with chromatin modifiers to determine the spatial and temporal organization of replication initiation events. Second, epigenetic interactions are mediated by DNA sequences that determine chromosomal replication. In this review we summarize recent findings and current models linking spatial and temporal regulation of the replication program with epigenetic signaling. We discuss these issues in the context of the genome’s three-dimensional structure with an emphasis on events occurring during the initiation of DNA replication. PMID:24905010
Directory of Open Access Journals (Sweden)
Anil K Singh
2010-03-01
Full Text Available Resistin is a cysteine rich protein, mainly expressed and secreted by circulating human mononuclear cells. While several factors responsible for transcription of mouse resistin gene have been identified, not much is known about the factors responsible for the differential expression of human resistin.We show that the minimal promoter of human resistin lies within approximately 80 bp sequence upstream of the transcriptional start site (-240 whereas binding sites for cRel, CCAAT enhancer binding protein alpha (C/EBP-alpha, activating transcription factor 2 (ATF-2 and activator protein 1 (AP-1 transcription factors, important for induced expression, are present within sequences up to -619. Specificity Protein 1(Sp1 binding site (-276 to -295 is also present and an interaction of Sp1 with peroxisome proliferator activating receptor gamma (PPARgamma is necessary for constitutive expression in U937 cells. Indeed co-immunoprecipitation assay demonstrated a direct physical interaction of Sp1 with PPARgamma in whole cell extracts of U937 cells. Phorbol myristate acetate (PMA upregulated the expression of resistin mRNA in U937 cells by increasing the recruitment of Sp1, ATF-2 and PPARgamma on the resistin gene promoter. Furthermore, PMA stimulation of U937 cells resulted in the disruption of Sp1 and PPARgamma interaction. Chromatin immunoprecipitation (ChIP assay confirmed the recruitment of transcription factors phospho ATF-2, Sp1, Sp3, PPARgamma, chromatin modifier histone deacetylase 1 (HDAC1 and the acetylated form of histone H3 but not cRel, C/EBP-alpha and phospho c-Jun during resistin gene transcription.Our findings suggest a complex interplay of Sp1 and PPARgamma along with other transcription factors that drives the expression of resistin in human monocytic U937 cells.
Chromatin organisation and cancer prognosis: a pan-cancer study.
Kleppe, Andreas; Albregtsen, Fritz; Vlatkovic, Ljiljana; Pradhan, Manohar; Nielsen, Birgitte; Hveem, Tarjei S; Askautrud, Hanne A; Kristensen, Gunnar B; Nesbakken, Arild; Trovik, Jone; Wæhre, Håkon; Tomlinson, Ian; Shepherd, Neil A; Novelli, Marco; Kerr, David J; Danielsen, Håvard E
2018-03-01
Chromatin organisation affects gene expression and regional mutation frequencies and contributes to carcinogenesis. Aberrant organisation of DNA has been correlated with cancer prognosis in analyses of the chromatin component of tumour cell nuclei using image texture analysis. As yet, the methodology has not been sufficiently validated to permit its clinical application. We aimed to define and validate a novel prognostic biomarker for the automatic detection of heterogeneous chromatin organisation. Machine learning algorithms analysed the chromatin organisation in 461 000 images of tumour cell nuclei stained for DNA from 390 patients (discovery cohort) treated for stage I or II colorectal cancer at the Aker University Hospital (Oslo, Norway). The resulting marker of chromatin heterogeneity, termed Nucleotyping, was subsequently independently validated in six patient cohorts: 442 patients with stage I or II colorectal cancer in the Gloucester Colorectal Cancer Study (UK); 391 patients with stage II colorectal cancer in the QUASAR 2 trial; 246 patients with stage I ovarian carcinoma; 354 patients with uterine sarcoma; 307 patients with prostate carcinoma; and 791 patients with endometrial carcinoma. The primary outcome was cancer-specific survival. In all patient cohorts, patients with chromatin heterogeneous tumours had worse cancer-specific survival than patients with chromatin homogeneous tumours (univariable analysis hazard ratio [HR] 1·7, 95% CI 1·2-2·5, in the discovery cohort; 1·8, 1·0-3·0, in the Gloucester validation cohort; 2·2, 1·1-4·5, in the QUASAR 2 validation cohort; 3·1, 1·9-5·0, in the ovarian carcinoma cohort; 2·5, 1·8-3·4, in the uterine sarcoma cohort; 2·3, 1·2-4·6, in the prostate carcinoma cohort; and 4·3, 2·8-6·8, in the endometrial carcinoma cohort). After adjusting for established prognostic patient characteristics in multivariable analyses, Nucleotyping was prognostic in all cohorts except for the prostate carcinoma
CHD chromatin remodelers and the transcription cycle
Murawska, Magdalena
2011-01-01
It is well established that ATP-dependent chromatin remodelers modulate DNA access of transcription factors and RNA polymerases by “opening” or “closing” chromatin structure. However, this view is far too simplistic. Recent findings have demonstrated that these enzymes not only set the stage for the transcription machinery to act but also are actively involved at every step of the transcription process. As a consequence, they affect initiation, elongation, termination and RNA processing. In this review we will use the CHD family as a paradigm to illustrate the progress that has been made in revealing these new concepts. PMID:22223048
Modulation of chromatin access during adipocyte differentiation
DEFF Research Database (Denmark)
Mandrup, Susanne; Hager, Gordon L
2012-01-01
identified; however, it is not until recently that we have begun to understand how these factors act at a genome-wide scale. In a recent publication we have mapped the genome-wide changes in chromatin structure during differentiation of 3T3-L1 preadipocytes and shown that a major reorganization...... of the chromatin landscape occurs within few hours following the addition of the adipogenic cocktail. In addition, we have mapped the genome-wide profiles of several of the early adipogenic transcription factors and shown that they act in a highly cooperative manner to drive this dramatic remodeling process....
DEFF Research Database (Denmark)
Rennie, Sarah; Dalby, Maria; van Duin, Lucas
2018-01-01
Transcriptional regulation is tightly coupled with chromosomal positioning and three-dimensional chromatin architecture. However, it is unclear what proportion of transcriptional activity is reflecting such organisation, how much can be informed by RNA expression alone and how this impacts disease...... proportion of total levels and is highly informative of topological associating domain activities and organisation, revealing boundaries and chromatin compartments. Furthermore, expression data alone accurately predict individual enhancer-promoter interactions, drawing features from expression strength...... between transcription and chromatin architecture....
2016-01-01
The release of this second volume of CHIPS 2020 coincides with the 50th anniversary of Moore’s Law, a critical year marked by the end of the nanometer roadmap and by a significantly reduced annual rise in chip performance. At the same time, we are witnessing a data explosion in the Internet, which is consuming 40% more electrical power every year, leading to fears of a major blackout of the Internet by 2020. The messages of the first CHIPS 2020, published in 2012, concerned the realization of quantum steps for improving the energy efficiency of all chip functions. With this second volume, we review these messages and amplify upon the most promising directions: ultra-low-voltage electronics, nanoscale monolithic 3D integration, relevant-data, brain- and human-vision-inspired processing, and energy harvesting for chip autonomy. The team of authors, enlarged by more world leaders in low-power, monolithic 3D, video, and Silicon brains, presents new vistas in nanoelectronics, promising Moore-like exponential g...
A Poly-ADP-Ribose Trigger Releases the Auto-Inhibition of a Chromatin Remodeling Oncogene
DEFF Research Database (Denmark)
Singh, Hari R; Nardozza, Aurelio P; Möller, Ingvar R
2017-01-01
DNA damage triggers chromatin remodeling by mechanisms that are poorly understood. The oncogene and chromatin remodeler ALC1/CHD1L massively decompacts chromatin in vivo yet is inactive prior to DNA-damage-mediated PARP1 induction. We show that the interaction of the ALC1 macrodomain......-macrodomain interactions, promotes an ungated conformation, and activates the remodeler's ATPase. ALC1 fragments lacking the regulatory macrodomain relax chromatin in vivo without requiring PARP1 activation. Further, the ATPase restricts the macrodomain's interaction with PARP1 under non-DNA damage conditions. Somatic...... cancer mutants disrupt ALC1's auto-inhibition and activate chromatin remodeling. Our data show that the NAD+-metabolite and nucleic acid PAR triggers ALC1 to drive chromatin relaxation. Modular allostery in this oncogene tightly controls its robust, DNA-damage-dependent activation....
DEFF Research Database (Denmark)
Alexiadis, V; Waldmann, T; Andersen, Jens S.
2000-01-01
The structure of chromatin regulates the genetic activity of the underlying DNA sequence. We report here that the protein encoded by the proto-oncogene DEK, which is involved in acute myelogenous leukemia, induces alterations of the superhelical density of DNA in chromatin. The change in topology...
Chromatin-bound RNA and the neurobiology of psychiatric disease.
Tushir, J S; Akbarian, S
2014-04-04
A large, and still rapidly expanding literature on epigenetic regulation in the nervous system has provided fundamental insights into the dynamic regulation of DNA methylation and post-translational histone modifications in the context of neuronal plasticity in health and disease. Remarkably, however, very little is known about the potential role of chromatin-bound RNAs, including many long non-coding transcripts and various types of small RNAs. Here, we provide an overview on RNA-mediated regulation of chromatin structure and function, with focus on histone lysine methylation and psychiatric disease. Examples of recently discovered chromatin-bound long non-coding RNAs important for neuronal health and function include the brain-derived neurotrophic factor antisense transcript (Bdnf-AS) which regulates expression of the corresponding sense transcript, and LOC389023 which is associated with human-specific histone methylation signatures at the chromosome 2q14.1 neurodevelopmental risk locus by regulating expression of DPP10, an auxillary subunit for voltage-gated K(+) channels. We predict that the exploration of chromatin-bound RNA will significantly advance our current knowledge base in neuroepigenetics and biological psychiatry. Copyright © 2013 IBRO. Published by Elsevier Ltd. All rights reserved.
Connecting the dots: chromatin and alternative splicing in EMT.
Warns, Jessica A; Davie, James R; Dhasarathy, Archana
2016-02-01
Nature has devised sophisticated cellular machinery to process mRNA transcripts produced by RNA Polymerase II, removing intronic regions and connecting exons together, to produce mature RNAs. This process, known as splicing, is very closely linked to transcription. Alternative splicing, or the ability to produce different combinations of exons that are spliced together from the same genomic template, is a fundamental means of regulating protein complexity. Similar to transcription, both constitutive and alternative splicing can be regulated by chromatin and its associated factors in response to various signal transduction pathways activated by external stimuli. This regulation can vary between different cell types, and interference with these pathways can lead to changes in splicing, often resulting in aberrant cellular states and disease. The epithelial to mesenchymal transition (EMT), which leads to cancer metastasis, is influenced by alternative splicing events of chromatin remodelers and epigenetic factors such as DNA methylation and non-coding RNAs. In this review, we will discuss the role of epigenetic factors including chromatin, chromatin remodelers, DNA methyltransferases, and microRNAs in the context of alternative splicing, and discuss their potential involvement in alternative splicing during the EMT process.
HPeak: an HMM-based algorithm for defining read-enriched regions in ChIP-Seq data
Directory of Open Access Journals (Sweden)
Maher Christopher A
2010-07-01
Full Text Available Abstract Background Protein-DNA interaction constitutes a basic mechanism for the genetic regulation of target gene expression. Deciphering this mechanism has been a daunting task due to the difficulty in characterizing protein-bound DNA on a large scale. A powerful technique has recently emerged that couples chromatin immunoprecipitation (ChIP with next-generation sequencing, (ChIP-Seq. This technique provides a direct survey of the cistrom of transcription factors and other chromatin-associated proteins. In order to realize the full potential of this technique, increasingly sophisticated statistical algorithms have been developed to analyze the massive amount of data generated by this method. Results Here we introduce HPeak, a Hidden Markov model (HMM-based Peak-finding algorithm for analyzing ChIP-Seq data to identify protein-interacting genomic regions. In contrast to the majority of available ChIP-Seq analysis software packages, HPeak is a model-based approach allowing for rigorous statistical inference. This approach enables HPeak to accurately infer genomic regions enriched with sequence reads by assuming realistic probability distributions, in conjunction with a novel weighting scheme on the sequencing read coverage. Conclusions Using biologically relevant data collections, we found that HPeak showed a higher prevalence of the expected transcription factor binding motifs in ChIP-enriched sequences relative to the control sequences when compared to other currently available ChIP-Seq analysis approaches. Additionally, in comparison to the ChIP-chip assay, ChIP-Seq provides higher resolution along with improved sensitivity and specificity of binding site detection. Additional file and the HPeak program are freely available at http://www.sph.umich.edu/csg/qin/HPeak.
Fujita, Yosuke; Morinobu, Shigeru; Takei, Shiro; Fuchikami, Manabu; Matsumoto, Tomoya; Yamamoto, Shigeto; Yamawaki, Shigeto
2012-05-01
Histone acetylation, which alters the compact chromatin structure and changes the accessibility of DNA to regulatory proteins, is emerging as a fundamental mechanism for regulating gene expression. Histone deacetylase (HDAC) inhibitors increase histone acetylation and enhance fear extinction. In this study, we examined whether vorinostat, an HDAC inhibitor, facilitates fear extinction, using a contextual fear conditioning (FC) paradigm, in Sprague-Dawley rats. We found that vorinostat facilitated fear extinction. Next, the levels of global acetylated histone H3 and H4 were measured by Western blotting. We also assessed the effect of vorinostat on the hippocampal levels of NMDA receptor mRNA by real-time quantitative PCR (RT-PCR) and protein by Western blotting. 2 h after vorinostat administration, the levels acetylated histones and NR2B mRNA, but not NR1 or NR2A mRNA, were elevated in the hippocampus. The NR2B protein level was elevated 4 h after vorinostat administration. Last, we investigated the levels of acetylated histones and phospho-CREB (p-CREB) binding at the promoter of the NR2B gene using the chromatin immunoprecipitation (ChIP) assay followed by RT-PCR. The ChIP assay revealed increases in the levels of acetylated histones and they were accompanied by enhanced binding of p-CREB to its binding site at the promoter of the NR2B gene 2 h after vorinostat administration. These findings suggest that vorinostat increases the expression of NR2B in the hippocampus by enhancing histone acetylation, and this process may be implicated in fear extinction. Copyright © 2012 Elsevier Ltd. All rights reserved.
DNA packing in chromatine, a manifestation of the Bonnet transformation.
Blum, Z; Lidin, S
1988-08-01
The packing of DNA is described using the formalism of differential geometry. Winding of the DNA double helix around the histone 2-5 octamer forming a nucleosome and the condensation of the so-formed bead-on-a-string chromatine aided by histone 1 is interpreted as two consecutive isometric, i.e. Bonnet, transformations. The DNA double helix can be approximated to a helicoid which can be transformed isometrically to a catenoid, an approximation of the nucleosome. Owing to the organization of the histone octamer the extended chromatine takes a helicoidal shape allowing a second Bonnet transformation to consummate the condensation into a chromatine fibre.
Effect of Seminal Vesicles and Dithiotritol (Dtt on Stability of Sperm Chromatin
Directory of Open Access Journals (Sweden)
MH Nasr-Esfahani
2005-04-01
Full Text Available Introduction: Different studies have shown that there is no relation between sperm chromatin stability and fertilization rate in both IVF and ICSI patients. However, the relation between SDS tests, as a detergent, along with DTT as reducer of disulphide bridges has not been studied so far in ICSI patients. Since different concentrations of DTT can induce different degrees of sperm chromatin decondensation, the aim of this study was to evaluate the effect of different concentrations of DTT on sperm chromatin decondensation in IVF and ICSI cases. Methods: During this study, 85 patients were divided into two groups according to their treatment procedure (IVF or ICSI.Semen samples of each patient was evaluated for sperm chromatin tests including SDS, SDS+EDTA & SDS+DTT for assessment of free thiole groups level (-SH, amount of non covalent bond between Zn and thioles(-SH Zn SH- and levels of disulfide bond (-S-S- in sperm chromatin, respectively. In this study, seminal fructose concentration, corrected seminal fructose level and true corrected fructose level as indicators of seminal vesicle function on sperm chromatin stability were assessed. Results: No correlation was observed between any of the above tests and rate of fertilization, both in IVF and ICSI cases. However, in IVF patients, a significant correlation was observed between SDS, SDS+DTT test and seminal fructose level, while in ICSI patients, only a significant correlation was observed between SDS+DTT and corrected or true fructose concentration. Conclusion: Since no correlation was observed between sperm chromatin test and fertilization rate, it is suggested that the chromatin status of these samples are adequate for fertilization to take place and extent of disulphide bridges has no effect on fertilization rate. However, the amount of disulphide bound present in sperms of ICSI and IVF patients are different, and this difference is related to seminal vesicle performance in these patients.
Default assembly of early adenovirus chromatin
International Nuclear Information System (INIS)
Spector, David J.
2007-01-01
In adenovirus particles, the viral nucleoprotein is organized into a highly compacted core structure. Upon delivery to the nucleus, the viral nucleoprotein is very likely to be remodeled to a form accessible to the transcription and replication machinery. Viral protein VII binds to intra-nuclear viral DNA, as do at least two cellular proteins, SET/TAF-Iβ and pp32, components of a chromatin assembly complex that is implicated in template remodeling. We showed previously that viral DNA-protein complexes released from infecting particles were sensitive to shearing after cross-linking with formaldehyde, presumably after transport of the genome into the nucleus. We report here the application of equilibrium-density gradient centrifugation to the analysis of the fate of these complexes. Most of the incoming protein VII was recovered in a form that was not cross-linked to viral DNA. This release of protein VII, as well as the binding of SET/TAF-Iβ and cellular transcription factors to the viral chromatin, did not require de novo viral gene expression. The distinct density profiles of viral DNA complexes containing protein VII, compared to those containing SET/TAF-Iβ or transcription factors, were consistent with the notion that the assembly of early viral chromatin requires both the association of SET/TAF-1β and the release of protein VII
Higher order chromatin organization in cancer
Reddy, Karen L.; Feinberg, Andrew P.
2013-01-01
In spite of our increased understanding of how genomes are dysregulated in cancer and a plethora of molecular diagnostic tools, the front line and ‘gold standard’ detection of cancer remains the pathologist’s detection of gross changes in cellular and tissue structure, most strikingly nuclear dis-organization. In fact, for over 140 years it has been noted that nuclear morphology is often disrupted in cancer. Even today, nuclear morphology measures include nuclear size, shape, DNA content (ploidy) and ‘chromatin organization’. Given the importance of nuclear shape to diagnoses of cancer phenotypes, it is surprising and frustrating that we currently lack a detailed understanding to explain these changes and how they might arise and relate to molecular events in the cell. It is an implicit hypothesis that perturbation of chromatin and epigenetic signatures may lead to alterations in nuclear structure (or vice versa) and that these perturbations lie at the heart of cancer genesis. In this review, we attempt to synthesize research leading to our current understanding on how chromatin interactions at the nuclear lamina, epigenetic modulation and gene regulation may intersect in cancer and offer a perspective on critical experiments that would help clarify how nuclear architecture may contribute to the cancerous phenotype. We also discuss the historical understanding of nuclear structure in normal cells and as a diagnostic in cancer. PMID:23266653
Price of forest chips decreasing
International Nuclear Information System (INIS)
Hakkila, P.
2001-01-01
Use of forest chips was studied in 1999 in the national Puuenergia (Wood Energy) research program. Wood combusting heating plants were questioned about are the main reasons restricting the increment of the use of forest chips. Heating plants, which did not use forest chips at all or which used less than 250 m 3 (625 bulk- m 3 ) in 1999 were excluded. The main restrictions for additional use of forest chips were: too high price of forest chips; lack of suppliers and/or uncertainty of deliveries; technical problems of reception and processing of forest chips; insufficiency of boiler output especially in winter; and unsatisfactory quality of chips. The price of forest chips becomes relatively high because wood biomass used for production of forest chips has to be collected from wide area. Heavy equipment has to be used even though small fragments of wood are processed, which increases the price of chips. It is essential for forest chips that the costs can be pressed down because competition with fossil fuels, peat and industrial wood residues is hard. Low market price leads to the situation in which forest owner gets no price of the raw material, the entrepreneurs operate at the limit of profitability and renovation of machinery is difficult, and forest chips suppliers have to sell the chips at prime costs. Price of forest chips has decreased significantly during the past decade. Nominal price of forest chips is now lower than two decades ago. The real price of chips has decreased even more than the nominal price, 35% during the past decade and 20% during the last five years. Chips, made of small diameter wood, are expensive because the price includes the felling costs and harvesting is carried out at thinning lots. Price is especially high if chips are made of delimbed small diameter wood due to increased the work and reduced amount of chips. The price of logging residue chips is most profitable because cutting does not cause additional costs. Recovery of chips is
Gelpí, Carmen; Pérez, Elena; Roldan, Cristina
2014-09-01
The aim of this study was to compare the degree of agreement of a novel Zenit RA chemiluminescent immunoassay (CLIA) from A. Menarini Diagnostics (Florence, Italy) and the gold standard immunoprecipitation assay to screen for the presence of specific anti-U1snRNP, anti-Sm, anti-Ro/SS-A, anti-La/SS-B, anti-Jo-1((his)tRNA-Synthetase) and anti-Scl-70(Topo I) antibodies. We studied 114 sera, 98 from patients with well-defined autoimmune connective tissue diseases and 16 from blood donor volunteers. All samples were fully characterized using the new chemiluminescent immunoassay and immunoprecipitation. In addition, all the samples were analyzed by indirect immunofluorescence (IIF) and anti-Scl-70(Topo I) antibodies were analyzed by immunoblot (IB) assay. Discrepant samples were analyzed using a commercial dot blot technique (Recomline from Mikrogen). The simple Kappa coefficient was used to measure the level of agreement between the results of Zenit RA CLIA and the gold standard. The Kappa agreement between Zenit RA CLIA and gold standard immunoprecipitation, as well as IB and IIFassays for the presence of anti-Scl-70(Topo I)(0.948) was excellent. The concordance between Zenit RA CLIA and gold standard immunoprecipitation for the presence of anti-U1snRNP (0.883), anti-Ro/SS-A (0.878), anti-Jo-1((his)tRNA-Synthetase) (0.791) and anti-Sm (0.786) was good, and excellent when the cut-off was raised to 14 U/ml (arbitrary units/ml). Between Zenit RA CLIA and gold standard immunoprecipitation for the presence of anti-La/SS-B, the Kappa agreement had a value of 0.689, but this improved to 0.775 when the cut-off was raised to14 U/ml. Precision was good based on the evaluation of replicate samples. Inter-assay coefficient variation was lower than 3.4 % (CV in %) in all the kits and <1.2 % (CV in %) for intra-assay measurements. Our findings show that Zenit RA CLIA was specific and sensitive to detect anti-U1snRNP, anti-Sm, anti-Ro/SS-A, anti-La/SS-B, anti-Jo-1((his
Modern human sperm freezing: Effect on DNA, chromatin and acrosome integrity
Directory of Open Access Journals (Sweden)
Tahereh Rahiminia
2017-08-01
Conclusion: Sperm in Vapour was healthier in terms of DNA, chromatin and acrosome integrity. In contrast of higher motility and normal morphology; DNA, chromatin and acrosome integrity were decreased in Vit. However, these findings were more acceptable in SSV or Vapour.
Babbitt, G A
2010-10-15
The spurious (or nonfunctional) binding of transcription factors (TF) to the wrong locations on DNA presents a formidable challenge to genomes given the relatively low ceiling for sequence complexity within the short lengths of most binding motifs. The high potential for the occurrence of random motifs and subsequent nonfunctional binding of many transcription factors should theoretically lead to natural selection against the occurrence of spurious motif throughout the genome. However, because of the active role that chromatin can influence over eukaryotic gene regulation, it may also be expected that many supposed spurious binding sites could escape purifying selection if (A) they simply occur in regions of high nucleosome occupancy or (B) their surrounding chromatin was dynamically involved in their identity and function. We compared nucleosome occupancy and the presence/absence of functionally conserved chromatin context to the strength of selection against spurious binding of various TF binding motifs in Saccharomyces yeast. While we find no direct relationship with nucleosome occupancy, we find strong evidence that transcription factors spatially associated with evolutionarily conserved chromatin states are under relaxed selection against accidental binding. Transcription factors (with/without) a conserved chromatin context were found to occur on average, (87.7%/49.3%) of their expected frequencies. Functional binding motifs with conserved chromatin contexts were also significantly shorter in length and more often clustered. These results indicate a role of chromatin context dependency in relaxing selection against spurious binding in nearly half of all TF binding motifs throughout the yeast genome. 2010 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Lobanenkov, V.V.; Mironov, N.M.; Kupriyanova, E.I.; Shapot, V.S.
1986-01-01
Isolated cell nuclei were incubated with nucleases, and then the chromatin was extracted with a low-salt buffer. When degradation of the nuclear chromatin DNase I or micrococcal nuclease is intensified, solubilization of the deoxyribonucleoprotein (DNP) in low-salt buffer at first increases, reaching a maximum in the case of hydrolysis of 2-4% of the nuclear DNA, but after intensive treatment with nucleases, it decreases sharply. Soluble fragmented chromatin is aggregated during treatment with DNase I. The addition of exogenous products of nuclease treatment of isolated nuclei to a preparation of gelatinous chromatin induces its aggregation. Pretreatment of nuclear chromatin with RNase prevents the solubilization of DNP by solutions with low ionic strength. Certain experimental data obtained using rigorous nuclease treatment are discussed; for their interpretation it is necessary to consider the effect of aggregation of fragmented chromatin by products of its nuclease degradation
Chromatin Pioneers | Center for Cancer Research
Taking advantage of their ability to explore provocative ideas, NCI investigators pioneered the study of chromatin to demonstrate its functional importance and lay the groundwork for understanding its role in cancer and other diseases.
MRN1 implicates chromatin remodeling complexes and architectural factors in mRNA maturation
DEFF Research Database (Denmark)
Düring, Louis; Thorsen, Michael; Petersen, Darima
2012-01-01
A functional relationship between chromatin structure and mRNA processing events has been suggested, however, so far only a few involved factors have been characterized. Here we show that rsc nhp6¿¿ mutants, deficient for the function of the chromatin remodeling factor RSC and the chromatin....... Genetic interactions are observed between 2 µm-MRN1 and the splicing deficient mutants snt309¿, prp3, prp4, and prp22, and additional genetic analyses link MRN1, SNT309, NHP6A/B, SWI/SNF, and RSC supporting the notion of a role of chromatin structure in mRNA processing....
High-resolution mapping reveals links of HP1 with active and inactive chromatin components.
Directory of Open Access Journals (Sweden)
Elzo de Wit
2007-03-01
Full Text Available Heterochromatin protein 1 (HP1 is commonly seen as a key factor of repressive heterochromatin, even though a few genes are known to require HP1-chromatin for their expression. To obtain insight into the targeting of HP1 and its interplay with other chromatin components, we have mapped HP1-binding sites on Chromosomes 2 and 4 in Drosophila Kc cells using high-density oligonucleotide arrays and the DNA adenine methyltransferase identification (DamID technique. The resulting high-resolution maps show that HP1 forms large domains in pericentric regions, but is targeted to single genes on chromosome arms. Intriguingly, HP1 shows a striking preference for exon-dense genes on chromosome arms. Furthermore, HP1 binds along entire transcription units, except for 5' regions. Comparison with expression data shows that most of these genes are actively transcribed. HP1 target genes are also marked by the histone variant H3.3 and dimethylated histone 3 lysine 4 (H3K4me2, which are both typical of active chromatin. Interestingly, H3.3 deposition, which is usually observed along entire transcription units, is limited to the 5' ends of HP1-bound genes. Thus, H3.3 and HP1 are mutually exclusive marks on active chromatin. Additionally, we observed that HP1-chromatin and Polycomb-chromatin are nonoverlapping, but often closely juxtaposed, suggesting an interplay between both types of chromatin. These results demonstrate that HP1-chromatin is transcriptionally active and has extensive links with several other chromatin components.
Chromatin-regulating proteins as targets for cancer therapy
International Nuclear Information System (INIS)
Oike, Takahiro; Ogiwara, Hideaki; Kohno, Takashi; Amornwichet, Napapat; Nakano, Takashi
2014-01-01
Chromatin-regulating proteins represent a large class of novel targets for cancer therapy. In the context of radiotherapy, acetylation and deacetylation of histones by histone acetyltransferases (HATs) and histone deacetylases (HDACs) play important roles in the repair of DNA double-strand breaks generated by ionizing irradiation, and are therefore attractive targets for radiosensitization. Small-molecule inhibitors of HATs (garcinol, anacardic acid and curcumin) and HDACs (vorinostat, sodium butyrate and valproic acid) have been shown to sensitize cancer cells to ionizing irradiation in preclinical models, and some of these molecules are being tested in clinical trials, either alone or in combination with radiotherapy. Meanwhile, recent large-scale genome analyses have identified frequent mutations in genes encoding chromatin-regulating proteins, especially in those encoding subunits of the SWI/SNF chromatin-remodeling complex, in various human cancers. These observations have driven researchers toward development of targeted therapies against cancers carrying these mutations. DOT1L inhibition in MLL-rearranged leukemia, EZH2 inhibition in EZH2-mutant or MLL-rearranged hematologic malignancies and SNF5-deficient tumors, BRD4 inhibition in various hematologic malignancies, and BRM inhibition in BRG1-deficient tumors have demonstrated promising anti-tumor effects in preclinical models, and these strategies are currently awaiting clinical application. Overall, the data collected so far suggest that targeting chromatin-regulating proteins is a promising strategy for tomorrow's cancer therapy, including radiotherapy and molecularly targeted chemotherapy. (author)
Adam, Salomé; Dabin, Juliette; Chevallier, Odile; Leroy, Olivier; Baldeyron, Céline; Corpet, Armelle; Lomonte, Patrick; Renaud, Olivier; Almouzni, Geneviève; Polo, Sophie E
2016-10-06
Chromatin integrity is critical for cell function and identity but is challenged by DNA damage. To understand how chromatin architecture and the information that it conveys are preserved or altered following genotoxic stress, we established a system for real-time tracking of parental histones, which characterize the pre-damage chromatin state. Focusing on histone H3 dynamics after local UVC irradiation in human cells, we demonstrate that parental histones rapidly redistribute around damaged regions by a dual mechanism combining chromatin opening and histone mobilization on chromatin. Importantly, parental histones almost entirely recover and mix with new histones in repairing chromatin. Our data further define a close coordination of parental histone dynamics with DNA repair progression through the damage sensor DDB2 (DNA damage-binding protein 2). We speculate that this mechanism may contribute to maintaining a memory of the original chromatin landscape and may help preserve epigenome stability in response to DNA damage. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.
Non coding RNA: sequence-specific guide for chromatin modification and DNA damage signaling
Directory of Open Access Journals (Sweden)
Sofia eFrancia
2015-11-01
Full Text Available Chromatin conformation shapes the environment in which our genome is transcribed into RNA. Transcription is a source of DNA damage, thus it often occurs concomitantly to DNA damage signaling. Growing amounts of evidence suggest that different types of RNAs can, independently from their protein-coding properties, directly affect chromatin conformation, transcription and splicing, as well as promote the activation of the DNA damage response (DDR and DNA repair. Therefore, transcription paradoxically functions to both threaten and safeguard genome integrity. On the other hand, DNA damage signaling is known to modulate chromatin to suppress transcription of the surrounding genetic unit. It is thus intriguing to understand how transcription can modulate DDR signaling while, in turn, DDR signaling represses transcription of chromatin around the DNA lesion. An unexpected player in this field is the RNA interference (RNAi machinery, which play roles in transcription, splicing and chromatin modulation in several organisms. Non-coding RNAs (ncRNAs and several protein factors involved in the RNAi pathway are well known master regulators of chromatin while only recent reports suggest that ncRNAs are involved in DDR signaling and homology-mediated DNA repair. Here, we discuss the experimental evidence supporting the idea that ncRNAs act at the genomic loci from which they are transcribed to modulate chromatin, DDR signaling and DNA repair.
Reading the maps: Organization and function of chromatin types in Drosophila
Braunschweig, U.
2010-01-01
The work presented in this thesis shows that the Drosophila genome is organized in chromatin domains with many implications for gene regulation, nuclear organization, and evolution. Furthermore it provides examples of how maps of chromatin protein binding, combined with computational approaches, can
Epigenetic regulation and chromatin remodeling in learning and memory.
Kim, Somi; Kaang, Bong-Kiun
2017-01-13
Understanding the underlying mechanisms of memory formation and maintenance has been a major goal in the field of neuroscience. Memory formation and maintenance are tightly controlled complex processes. Among the various processes occurring at different levels, gene expression regulation is especially crucial for proper memory processing, as some genes need to be activated while some genes must be suppressed. Epigenetic regulation of the genome involves processes such as DNA methylation and histone post-translational modifications. These processes edit genomic properties or the interactions between the genome and histone cores. They then induce structural changes in the chromatin and lead to transcriptional changes of different genes. Recent studies have focused on the concept of chromatin remodeling, which consists of 3D structural changes in chromatin in relation to gene regulation, and is an important process in learning and memory. In this review, we will introduce three major epigenetic processes involved in memory regulation: DNA methylation, histone methylation and histone acetylation. We will also discuss general mechanisms of long-term memory storage and relate the epigenetic control of learning and memory to chromatin remodeling. Finally, we will discuss how epigenetic mechanisms can contribute to the pathologies of neurological disorders and cause memory-related symptoms.
STUDY OF CHIP IGNITION AND CHIP MORPHOLOGY AFTER MILLING OF MAGNESIUM ALLOYS
Directory of Open Access Journals (Sweden)
Ireneusz Zagórski
2016-12-01
Full Text Available The paper analyses the impact of specified technological parameters of milling (vc, fz, ap on time to ignition. Stages leading to chip ignition were analysed. Metallographic images of magnesium chip were presented. No significant difference was observed in time to ignition in different chip fractions. Moreover, the surface of chips was free of products of ignition and signs of strong oxidation.
The oestrogen receptor alpha-regulated lncRNA NEAT1 is a critical modulator of prostate cancer
Chakravarty, Dimple; Sboner, Andrea; Nair, Sujit S.; Giannopoulou, Eugenia; Li, Ruohan; Hennig, Sven; Mosquera, Juan Miguel; Pauwels, Jonathan; Park, Kyung; Kossai, Myriam; MacDonald, Theresa Y.; Fontugne, Jacqueline; Erho, Nicholas; Vergara, Ismael A.; Ghadessi, Mercedeh; Davicioni, Elai; Jenkins, Robert B.; Palanisamy, Nallasivam; Chen, Zhengming; Nakagawa, Shinichi; Hirose, Tetsuro; Bander, Neil H.; Beltran, Himisha; Fox, Archa H.; Elemento, Olivier; Rubin, Mark A.
2014-01-01
The androgen receptor (AR) plays a central role in establishing an oncogenic cascade that drives prostate cancer progression. Some prostate cancers escape androgen dependence and are often associated with an aggressive phenotype. The oestrogen receptor alpha (ERα) is expressed in prostate cancers, independent of AR status. However, the role of ERα remains elusive. Using a combination of chromatin immunoprecipitation (ChIP) and RNA-sequencing data, we identified an ERα-specific non-coding transcriptome signature. Among putatively ERα-regulated intergenic long non-coding RNAs (lncRNAs), we identified nuclear enriched abundant transcript 1 (NEAT1) as the most significantly overexpressed lncRNA in prostate cancer. Analysis of two large clinical cohorts also revealed that NEAT1 expression is associated with prostate cancer progression. Prostate cancer cells expressing high levels of NEAT1 were recalcitrant to androgen or AR antagonists. Finally, we provide evidence that NEAT1 drives oncogenic growth by altering the epigenetic landscape of target gene promoters to favour transcription. PMID:25415230
Energy Technology Data Exchange (ETDEWEB)
Boone, Lindsey R.; Niesen, Melissa I. [Department of Molecular Medicine, College of Medicine, University of South Florida, Tampa, FL (United States); Jaroszeski, Mark [Department of Chemical and Biomedical Engineering, College of Engineering, University of South Florida, Tampa, FL (United States); Ness, Gene C., E-mail: gness@hsc.usf.edu [Department of Molecular Medicine, College of Medicine, University of South Florida, Tampa, FL (United States)
2009-07-31
The promoter elements and transcription factors necessary for triiodothyronine (T{sub 3}) induction of hepatic HMG-CoA reductase (HMGR) were investigated by transfecting rat livers with wild type and mutant HMGR promoter-luciferase constructs using in vivo electroporation. Mutations in the sterol response element (SRE), nuclear factor-y (NF-Y) site, and the newly identified upstream transcription factor-2 (USF-2) site essentially abolished the T{sub 3} response. Chromatin immunoprecipitation (ChIP) analysis demonstrated that T{sub 3} treatment caused a 4-fold increase in in vivo binding of USF-2 to the HMGR promoter. Co-transfection of the wild type HMGR promoter with siRNAs to USF-2, SREBP-2, or NF-Y nearly abolished the T{sub 3} induction, as measured by promoter activity. These data provide in vivo evidence for functional roles for USF-2, SREBP-2, and NF-Y in mediating the T{sub 3}-induction of hepatic HMGR transcription.
Creekmore, Amy L; Ziegler, Yvonne S; Bonéy, Jamie L; Nardulli, Ann M
2007-03-15
We have used a chromatin immunoprecipitation (ChIP)-based cloning strategy to isolate and identify genes associated with estrogen receptor alpha (ERalpha) in MCF-7 human breast cancer cells. One of the gene regions isolated was a 288bp fragment from the ninth intron of the breast cancer 1 associated ring domain (BARD1) gene. We demonstrated that ERalpha associated with this region of the endogenous BARD 1 gene in MCF-7 cells, that ERalpha bound to three of five ERE half sites located in the 288bp BARD1 region, and that this 288bp BARD1 region conferred estrogen responsiveness to a heterologous promoter. Importantly, treatment of MCF-7 cells with estrogen increased BARD1 mRNA and protein levels. These findings demonstrate that ChIP cloning strategies can be utilized to successfully isolate regulatory regions that are far removed from the transcription start site and assist in identifying cis elements involved in conferring estrogen responsiveness.
The importance of topoisomerases for chromatin regulated genes
DEFF Research Database (Denmark)
Fredsøe, Jacob Christian; Pedersen, Jakob Madsen; Rødgaard, Morten Terpager
2013-01-01
DNA topoisomerases are enzymes, which function to relieve torsional stress in the DNA helix by introducing transient breaks into the DNA molecule. By use of Saccharomyces cerevisiae and microarray technology we have previously shown that topoisomerases are required for the activation of chromatin...... topoisomerases for optimal activation, but in contrast to the PHO5 gene, topoisomerases are not required for chromatin remodeling of the GAL1/10 promoter region, indicating a different role of the enzymes. We are currently performing a detailed investigation of the GAL genes to elucidate the precise role...
Chromatin Structure of Epstein-Barr Virus Latent Episomes.
Lieberman, Paul M
2015-01-01
EBV latent infection is characterized by a highly restricted pattern of viral gene expression. EBV can establish latent infections in multiple different tissue types with remarkable variation and plasticity in viral transcription and replication. During latency, the viral genome persists as a multi-copy episome, a non-integrated-closed circular DNA with nucleosome structure similar to cellular chromosomes. Chromatin assembly and histone modifications contribute to the regulation of viral gene expression, DNA replication, and episome persistence during latency. This review focuses on how EBV latency is regulated by chromatin and its associated processes.
Directory of Open Access Journals (Sweden)
Amlan Ganguly
2018-02-01
Full Text Available With aggressive scaling of device geometries, density of manufacturing faults is expected to increase. Therefore, yield of complex Multi-Processor Systems-on-Chips (MP-SoCs will decrease due to higher probability of manufacturing defects especially, in dies with large area. Therefore, disintegration of large SoCs into smaller chips called chiplets will improve yield and cost of complex platform-based systems. This will also provide functional flexibility, modular scalability as well as the capability to integrate heterogeneous architectures and technologies in a single unit. However, with scaling of the number of chiplets in such a system, the shared resources in the system such as the interconnection fabric and memory modules will become performance bottlenecks. Additionally, the integration of heterogeneous chiplets operating at different frequencies and voltages can be challenging. State-of-the-art inter-chip communication requires power-hungry high-speed I/O circuits and data transfer over long wired traces on substrates. This increases energy consumption and latency while decreasing data bandwidth for chip-to-chip communication. In this paper, we explore the advances and the challenges of interconnecting a multi-chip system with millimeter-wave (mm-wave wireless interconnects from a variety of perspectives spanning multiple aspects of the wireless interconnection design. Our discussion on the recent advances include aspects such as interconnection topology, physical layer, Medium Access Control (MAC and routing protocols. We also present some potential paradigm-shifting applications as well as complementary technologies of wireless inter-chip communications.
The alteration of chromatin domains during damage repair induced by ionizing radiation
International Nuclear Information System (INIS)
Cress, A.E.; Olson, K.M.; Olson, G.B.
1995-01-01
Several groups previously have reported the ability of chromatin structure to influence the production of damage induced by ionizing radiation. The authors' interest has been to determine whether chromatin structural alterations exist after ionizing radiation during a repair interval. The earlier work investigated this question using biochemical techniques. The crosslinking of nuclear structural proteins to DNA after ionizing radiation was observed. In addition, they found that the chromatin structure in vitro as measured by sucrose density gradient sedimentation, was altered after ionizing radiation. These observations added to earlier studies in which digital imaging techniques showed an alteration in feulgen-positive DNA after irradiation prompted the present study. The object of this study was to detect whether the higher order structure of DNA into chromatin domains within interphase human cells was altered in interphase cells in response to a radiation induced damage. The present study takes advantage of the advances in the detection of chromatin domains in situ using DNA specific dyes and digital image processing of established human T and B cell lines
Studies on the Chromatin Isolated from the Organs of Animals Received Whole-body X-ray Irradiation
International Nuclear Information System (INIS)
Han, Su Nam
1967-01-01
Within experimental chromatin, the total protein: DNA ratio did not vary in the same organs of control and irradiated rats. However, the amount of RNA and total protein associated with the DNA varied considerably among the different types of chromatin. In particular, the content of chromatin was the highest in the irradiated tissue, and the lowest in the chromatin control tissue. RNA and total protein ratio of chromatins from brain, liver, testis and spleen declined with experimental organs. 2) There was the same quantitative relationship between the amount of RNA and the amount histone-protein associated with DNA in each chromatin. 3) RNA:DNA ratio of chromatin showed a 1.5-2 times increase in the irradiated organs except brain. However, RNA:DNA ratio was decreased in chromatin by irradiation. 4) Histone-protein: Residual protein ratio was greatly varied among the organs. However, the effect was not found by irradiation. 5) Priming activity of chromatins showed a higher value in testis and the activity was greater in organs with higher metabolic activity. 6) Inhibition of Actinomycin D observable in chromatin for testis, liver, spleen and brain declined without relationship between irradiated and non-irradiated conditions. Ammonium sulfate in DNA of chromatin from histone showed increased priming activity with dissociation by Electrostatics. It may give different effect of ammonium sulfate on stimulation by property of chromatins. 7) It is suggested that the results support a proposal that the higher sensitivity of radioactive in testis, spleen by irradiated showed a increase and decrease lower-sensitivity of radioactive from brain, liver than did priming activity under the radioactive conditions.
Studies on the Chromatin Isolated from the Organs of Animals Received Whole-body X-ray Irradiation
Energy Technology Data Exchange (ETDEWEB)
Han, Su Nam [Seoul National University College of Medicine, Seoul (Korea, Republic of)
1967-09-15
Within experimental chromatin, the total protein: DNA ratio did not vary in the same organs of control and irradiated rats. However, the amount of RNA and total protein associated with the DNA varied considerably among the different types of chromatin. In particular, the content of chromatin was the highest in the irradiated tissue, and the lowest in the chromatin control tissue. RNA and total protein ratio of chromatins from brain, liver, testis and spleen declined with experimental organs. 2) There was the same quantitative relationship between the amount of RNA and the amount histone-protein associated with DNA in each chromatin. 3) RNA:DNA ratio of chromatin showed a 1.5-2 times increase in the irradiated organs except brain. However, RNA:DNA ratio was decreased in chromatin by irradiation. 4) Histone-protein: Residual protein ratio was greatly varied among the organs. However, the effect was not found by irradiation. 5) Priming activity of chromatins showed a higher value in testis and the activity was greater in organs with higher metabolic activity. 6) Inhibition of Actinomycin D observable in chromatin for testis, liver, spleen and brain declined without relationship between irradiated and non-irradiated conditions. Ammonium sulfate in DNA of chromatin from histone showed increased priming activity with dissociation by Electrostatics. It may give different effect of ammonium sulfate on stimulation by property of chromatins. 7) It is suggested that the results support a proposal that the higher sensitivity of radioactive in testis, spleen by irradiated showed a increase and decrease lower-sensitivity of radioactive from brain, liver than did priming activity under the radioactive conditions.
A feature-based approach to modeling protein-DNA interactions.
Directory of Open Access Journals (Sweden)
Eilon Sharon
Full Text Available Transcription factor (TF binding to its DNA target site is a fundamental regulatory interaction. The most common model used to represent TF binding specificities is a position specific scoring matrix (PSSM, which assumes independence between binding positions. However, in many cases, this simplifying assumption does not hold. Here, we present feature motif models (FMMs, a novel probabilistic method for modeling TF-DNA interactions, based on log-linear models. Our approach uses sequence features to represent TF binding specificities, where each feature may span multiple positions. We develop the mathematical formulation of our model and devise an algorithm for learning its structural features from binding site data. We also developed a discriminative motif finder, which discovers de novo FMMs that are enriched in target sets of sequences compared to background sets. We evaluate our approach on synthetic data and on the widely used TF chromatin immunoprecipitation (ChIP dataset of Harbison et al. We then apply our algorithm to high-throughput TF ChIP data from mouse and human, reveal sequence features that are present in the binding specificities of mouse and human TFs, and show that FMMs explain TF binding significantly better than PSSMs. Our FMM learning and motif finder software are available at http://genie.weizmann.ac.il/.
The possible role of chromatin conformation changes in adaptive responses to ionizing radiation
International Nuclear Information System (INIS)
Ekhtiar, A.; Ammer, A.; Jbawi, A.; Othman, A.
2012-05-01
Organisms are affected by different DNA damaging agents naturally present in the environment or released as a result of human activity. Many defense mechanisms have evolved in organisms to minimize genotoxic damage. One of them is induced radioresistance or adaptive response. The adaptive response could be considered as a nonspecific phenomenon in which exposure to minimal stress could result in increased resistance to higher levels of the same or to other types of stress some hours later. A better understanding of the molecular mechanism underlying the adaptive response may lead to an improvement of cancer treatment, risk assessment and risk management strategies, radiation protection. The aim of current study was to study the possible role of chromatin conformation changes induced by ionizing radiation on the adaptive responses in human lymphocyte. For this aim the chromatin conformation have been studied in human lymphocytes from three non-smoking and three smoking healthy volunteers prior, and after espouser to gamma radiation (adaptive dose 0.1 Gy, challenge dose 1.5 Gy and adaptive + dose challenge). Chromosomal aberrations and micronucleus have been used as end point to study radio cytotoxicity and adaptive response. Our results indicated individual differences in radio adaptive response and the level of this response was dependent of chromatin de condensation induced by a adaptive small dose.The results showed that different dose of gamma rays induce a chromatin de condensation in human lymphocyte. The maximum chromatin relaxation were record when lymphocyte exposed to adaptive dose (0.1 Gy.). Results also showed that Adaptive dose have affected on the induction of challenge dose (1.5 Gy) of chromosome aberration and micronucleus . The comparison of results of chromatin de condensation induction as measured by flow cytometry and cytogenetic damages measured by chromosomal aberrations or micronucleus, was showed a proportionality of adaptive response with
International Nuclear Information System (INIS)
Suciu, D.; Bojan, O.
1981-01-01
Evidence is presented indicating that mouse thymus, spleen, kidney, lung and heart contain a protease activity with relatively high specificity for histones. It is suggested that degradation of chromatin occurring in irradiated lymphoid tissues is produced by the action of alkaline endonuclease in association with this histone protease. The autodigestion of chromatin was assessed by determining the release of soluble chromatin from cells suspended in sucrose media of low ionic strength. It was found that the protease inhibitors, phenylmethylsulphonyl fluoride and especially NaHSO 3 , were also capable of depressing the activity of alkaline endonuclease, the fragmentation of chromatin, and the release of soluble chromatin. The results suggest that the release of histones from irradiated lymphoid tissues cannot be considered as a determinant step in the fragmentation of DNA in chromatin. (author)
Systematic dissection of roles for chromatin regulators in a yeast stress response.
Directory of Open Access Journals (Sweden)
Assaf Weiner
Full Text Available Packaging of eukaryotic genomes into chromatin has wide-ranging effects on gene transcription. Curiously, it is commonly observed that deletion of a global chromatin regulator affects expression of only a limited subset of genes bound to or modified by the regulator in question. However, in many single-gene studies it has become clear that chromatin regulators often do not affect steady-state transcription, but instead are required for normal transcriptional reprogramming by environmental cues. We therefore have systematically investigated the effects of 83 histone mutants, and 119 gene deletion mutants, on induction/repression dynamics of 170 transcripts in response to diamide stress in yeast. Importantly, we find that chromatin regulators play far more pronounced roles during gene induction/repression than they do in steady-state expression. Furthermore, by jointly analyzing the substrates (histone mutants and enzymes (chromatin modifier deletions we identify specific interactions between histone modifications and their regulators. Combining these functional results with genome-wide mapping of several histone marks in the same time course, we systematically investigated the correspondence between histone modification occurrence and function. We followed up on one pathway, finding that Set1-dependent H3K4 methylation primarily acts as a gene repressor during multiple stresses, specifically at genes involved in ribosome biosynthesis. Set1-dependent repression of ribosomal genes occurs via distinct pathways for ribosomal protein genes and ribosomal biogenesis genes, which can be separated based on genetic requirements for repression and based on chromatin changes during gene repression. Together, our dynamic studies provide a rich resource for investigating chromatin regulation, and identify a significant role for the "activating" mark H3K4me3 in gene repression.
Prediction of highly expressed genes in microbes based on chromatin accessibility
DEFF Research Database (Denmark)
Willenbrock, Hanni; Ussery, David
2007-01-01
BACKGROUND: It is well known that gene expression is dependent on chromatin structure in eukaryotes and it is likely that chromatin can play a role in bacterial gene expression as well. Here, we use a nucleosomal position preference measure of anisotropic DNA flexibility to predict highly expressed...
C-terminal region of DNA ligase IV drives XRCC4/DNA ligase IV complex to chromatin
International Nuclear Information System (INIS)
Liu, Sicheng; Liu, Xunyue; Kamdar, Radhika Pankaj; Wanotayan, Rujira; Sharma, Mukesh Kumar; Adachi, Noritaka; Matsumoto, Yoshihisa
2013-01-01
Highlights: •Chromatin binding of XRCC4 is dependent on the presence of DNA ligase IV. •C-terminal region of DNA ligase IV alone can recruit itself and XRCC4 to chromatin. •Two BRCT domains of DNA ligase IV are essential for the chromatin binding of XRCC4. -- Abstract: DNA ligase IV (LIG4) and XRCC4 form a complex to ligate two DNA ends at the final step of DNA double-strand break (DSB) repair through non-homologous end-joining (NHEJ). It is not fully understood how these proteins are recruited to DSBs. We recently demonstrated radiation-induced chromatin binding of XRCC4 by biochemical fractionation using detergent Nonidet P-40. In the present study, we examined the role of LIG4 in the recruitment of XRCC4/LIG4 complex to chromatin. The chromatin binding of XRCC4 was dependent on the presence of LIG4. The mutations in two BRCT domains (W725R and W893R, respectively) of LIG4 reduced the chromatin binding of LIG4 and XRCC4. The C-terminal fragment of LIG4 (LIG4-CT) without N-terminal catalytic domains could bind to chromatin with XRCC4. LIG4-CT with W725R or W893R mutation could bind to chromatin but could not support the chromatin binding of XRCC4. The ability of C-terminal region of LIG4 to interact with chromatin might provide us with an insight into the mechanisms of DSB repair through NHEJ
Directory of Open Access Journals (Sweden)
Ottaviani Diego
2008-05-01
Full Text Available Abstract Background The major histocompatibility complex (MHC is essential for human immunity and is highly associated with common diseases, including cancer. While the genetics of the MHC has been studied intensively for many decades, very little is known about the epigenetics of this most polymorphic and disease-associated region of the genome. Methods To facilitate comprehensive epigenetic analyses of this region, we have generated a genomic tiling array of 2 Kb resolution covering the entire 4 Mb MHC region. The array has been designed to be compatible with chromatin immunoprecipitation (ChIP, methylated DNA immunoprecipitation (MeDIP, array comparative genomic hybridization (aCGH and expression profiling, including of non-coding RNAs. The array comprises 7832 features, consisting of two replicates of both forward and reverse strands of MHC amplicons and appropriate controls. Results Using MeDIP, we demonstrate the application of the MHC array for DNA methylation profiling and the identification of tissue-specific differentially methylated regions (tDMRs. Based on the analysis of two tissues and two cell types, we identified 90 tDMRs within the MHC and describe their characterisation. Conclusion A tiling array covering the MHC region was developed and validated. Its successful application for DNA methylation profiling indicates that this array represents a useful tool for molecular analyses of the MHC in the context of medical genomics.
Macrogenomic engineering via modulation of the scaling of chromatin packing density.
Almassalha, Luay M; Bauer, Greta M; Wu, Wenli; Cherkezyan, Lusik; Zhang, Di; Kendra, Alexis; Gladstein, Scott; Chandler, John E; VanDerway, David; Seagle, Brandon-Luke L; Ugolkov, Andrey; Billadeau, Daniel D; O'Halloran, Thomas V; Mazar, Andrew P; Roy, Hemant K; Szleifer, Igal; Shahabi, Shohreh; Backman, Vadim
2017-11-01
Many human diseases result from the dysregulation of the complex interactions between tens to thousands of genes. However, approaches for the transcriptional modulation of many genes simultaneously in a predictive manner are lacking. Here, through the combination of simulations, systems modelling and in vitro experiments, we provide a physical regulatory framework based on chromatin packing-density heterogeneity for modulating the genomic information space. Because transcriptional interactions are essentially chemical reactions, they depend largely on the local physical nanoenvironment. We show that the regulation of the chromatin nanoenvironment allows for the predictable modulation of global patterns in gene expression. In particular, we show that the rational modulation of chromatin density fluctuations can lead to a decrease in global transcriptional activity and intercellular transcriptional heterogeneity in cancer cells during chemotherapeutic responses to achieve near-complete cancer cell killing in vitro. Our findings represent a 'macrogenomic engineering' approach to modulating the physical structure of chromatin for whole-scale transcriptional modulation.
The role of proteins and metal ions in the protection of chromatin DNA at fast neutrons action
International Nuclear Information System (INIS)
Radu, L.; Preoteasa, V.; Radulescu, I.; Constantinescu, B.
1997-01-01
The role of chromatin proteins and of some ions on the fast neutrons actions on chromatin DNA from rat Walker tumors was analysed. The DNA in chromatin is effectively protected against fast neutrons actions by DNA bound proteins and specially by histones, because of the limited accessibility of the condensed chromatin DNA to hydroxyl radicals and of the scavenging of radicals by the chromatin proteins. The ions utilised protect chromatin DNA against the damage produced ed by fast neutrons, through the induction of structural DNA changes with a less accessibility to OH radicals. (authors)
International Nuclear Information System (INIS)
Lesne, Annick; Victor, Jean–Marc; Bécavin, Christophe
2012-01-01
Allostery is a key concept of molecular biology which refers to the control of an enzyme activity by an effector molecule binding the enzyme at another site rather than the active site (allos = other in Greek). We revisit here allostery in the context of chromatin and argue that allosteric principles underlie and explain the functional architecture required for spacetime coordination of gene expression at all scales from DNA to the whole chromosome. We further suggest that this functional architecture is provided by the chromatin fiber itself. The structural, mechanical and topological features of the chromatin fiber endow chromosomes with a tunable signal transduction from specific (or nonspecific) effectors to specific (or nonspecific) active sites. Mechanical constraints can travel along the fiber all the better since the fiber is more compact and regular, which speaks in favor of the actual existence of the (so-called 30 nm) chromatin fiber. Chromatin fiber allostery reconciles both the physical and biochemical approaches of chromatin. We illustrate this view with two supporting specific examples. Moreover, from a methodological point of view, we suggest that the notion of chromatin fiber allostery is particularly relevant for systemic approaches. Finally we discuss the evolutionary power of allostery in the context of chromatin and its relation to modularity. (perspective)
Lesne, Annick; Bécavin, Christophe; Victor, Jean–Marc
2012-02-01
Allostery is a key concept of molecular biology which refers to the control of an enzyme activity by an effector molecule binding the enzyme at another site rather than the active site (allos = other in Greek). We revisit here allostery in the context of chromatin and argue that allosteric principles underlie and explain the functional architecture required for spacetime coordination of gene expression at all scales from DNA to the whole chromosome. We further suggest that this functional architecture is provided by the chromatin fiber itself. The structural, mechanical and topological features of the chromatin fiber endow chromosomes with a tunable signal transduction from specific (or nonspecific) effectors to specific (or nonspecific) active sites. Mechanical constraints can travel along the fiber all the better since the fiber is more compact and regular, which speaks in favor of the actual existence of the (so-called 30 nm) chromatin fiber. Chromatin fiber allostery reconciles both the physical and biochemical approaches of chromatin. We illustrate this view with two supporting specific examples. Moreover, from a methodological point of view, we suggest that the notion of chromatin fiber allostery is particularly relevant for systemic approaches. Finally we discuss the evolutionary power of allostery in the context of chromatin and its relation to modularity.
Mechanism of chromatin degradation in thymocytes of irradiated rats
International Nuclear Information System (INIS)
Nikonova, L.V.; Nelipovich, P.A.; Umanskij, S.R.
1983-01-01
Chromatin digestion in isolated thymocyte nuclei with DNAase I, micrococcal nuclease and nuclease from Serratia marcescens was studied. It was shown that 3 h after irradiation (10 Gy), the kinetics of accumulation of acid soluble and salt soluble products of DNA degradation, caused by exogenous nucleases, remains unchanged. The administration of cycloheximide does not influence the sensitivity of chromatin to DNAase I and somewhat increases the rate of salt soluble products formation upon the nuclease from S, marcescens treatment
The histone chaperone TAF-I/SET/INHAT is required for transcription in vitro of chromatin templates.
Gamble, Matthew J; Erdjument-Bromage, Hediye; Tempst, Paul; Freedman, Leonard P; Fisher, Robert P
2005-01-01
To uncover factors required for transcription by RNA polymerase II on chromatin, we fractionated a mammalian cell nuclear extract. We identified the histone chaperone TAF-I (also known as INHAT [inhibitor of histone acetyltransferase]), which was previously proposed to repress transcription, as a potent activator of chromatin transcription responsive to the vitamin D3 receptor or to Gal4-VP16. TAF-I associates with chromatin in vitro and can substitute for the related protein NAP-1 in assembling chromatin onto cloned DNA templates in cooperation with the remodeling enzyme ATP-dependent chromatin assembly factor (ACF). The chromatin assembly and transcriptional activation functions are distinct, however, and can be dissociated temporally. Efficient transcription of chromatin assembled with TAF-I still requires the presence of TAF-I during the polymerization reaction. Conversely, TAF-I cannot stimulate transcript elongation when added after the other factors necessary for assembly of a preinitiation complex on naked DNA. Thus, TAF-I is required to facilitate transcription at a step after chromatin assembly but before transcript elongation.
International Nuclear Information System (INIS)
Mee, L.K.; Adelstein, S.J.; Stein, G.
1978-01-01
Chromatin has been isolated from cultured Chinese-hamster lung fibroblasts as an expanded aqueous gel. The DNA in isolated chromatin has been examined by sedimentation on alkaline sucrose gradients. The average molecular weight of the DNA has been determined to be 50 million. γ -irradiation of isolated chromatin degraded the DNA to lower molecular weight. The yield of single-strand breaks in the DNA was 0.02 single-strand breaks per krad-10 6 dalton, calculated from a dose-range of 1 to 400 krad and covering a DNA molecular weight range of 2 x 10 7 to 1.4 x 10 5 . There was a considerable difference in the efficiency of the formation of single-strand breaks in DNA irradiated as isolated chromatin compared with chromatin irradiated in whole cells before isolation. For isolated chromatin, values of 6 eV per break have been calculated compared with about 80 eV per break for chromatin irradiated in whole cells, which suggest a large contribution from indirect action by aqueous radicals in isolated chromatin. (author)
International Nuclear Information System (INIS)
Pierce, S.W.; Victoria, E.J.; Masouredis, S.P.
1990-01-01
The relationship between determinants recognized by warm-type immunoglobulin G red cell autoantibodies and the Rh antigens was characterized by autoantibody competitive inhibition of iodine 125 Rh alloantibody binding and autoantibody immunoprecipitation of iodine 125 red blood cell membrane proteins. The majority of blood donor autoantibody recognized epitopes that are closely related to Rh antigens as determined by competitive inhibition studies. Eighteen of 20 (90%) autoantibodies inhibited anti-Rh(c) binding, 15 inhibited anti-Rh(E), 5 inhibited anti-Rh(D), and only 2 failed to inhibit any of the three Rh alloantibodies tested. Autoantibodies that inhibited anti-Rh(D) also inhibited anti-Rh(c) and anti-Rh(E) and all those that inhibited anti-Rh(E) also inhibited anti-Rh(c). Autoantibodies that inhibited all three Rh alloantibodies immunoprecipitated 30 kd membrane polypeptides, as did two of the three autoantibodies that inhibited only anti-Rh(c) and anti-Rh(E). One autoantibody in this group and two autoantibodies that inhibited only anti-Rh(c), as well as an autoantibody that did not inhibit any of the Rh alloantibodies, immunoprecipitated only a single membrane polypeptide identified as band 3. The majority of normal donor red blood cell autoantibodies inhibited the binding of Rh alloantibodies, which indicates that they either bound to the Rh polypeptides or to epitopes on band 3 that were closely associated with the Rh complex
Titration and hysteresis in epigenetic chromatin silencing
International Nuclear Information System (INIS)
Dayarian, Adel; Sengupta, Anirvan M
2013-01-01
Epigenetic mechanisms of silencing via heritable chromatin modifications play a major role in gene regulation and cell fate specification. We consider a model of epigenetic chromatin silencing in budding yeast and study the bifurcation diagram and characterize the bistable and the monostable regimes. The main focus of this paper is to examine how the perturbations altering the activity of histone modifying enzymes affect the epigenetic states. We analyze the implications of having the total number of silencing proteins, given by the sum of proteins bound to the nucleosomes and the ones available in the ambient, to be constant. This constraint couples different regions of chromatin through the shared reservoir of ambient silencing proteins. We show that the response of the system to perturbations depends dramatically on the titration effect caused by the above constraint. In particular, for a certain range of overall abundance of silencing proteins, the hysteresis loop changes qualitatively with certain jump replaced by continuous merger of different states. In addition, we find a nonmonotonic dependence of gene expression on the rate of histone deacetylation activity of Sir2. We discuss how these qualitative predictions of our model could be compared with experimental studies of the yeast system under anti-silencing drugs. (paper)
Limitations and possibilities of low cell number ChIP-seq
Directory of Open Access Journals (Sweden)
Gilfillan Gregor D
2012-11-01
Full Text Available Abstract Background Chromatin immunoprecipitation coupled with high-throughput DNA sequencing (ChIP-seq offers high resolution, genome-wide analysis of DNA-protein interactions. However, current standard methods require abundant starting material in the range of 1–20 million cells per immunoprecipitation, and remain a bottleneck to the acquisition of biologically relevant epigenetic data. Using a ChIP-seq protocol optimised for low cell numbers (down to 100,000 cells / IP, we examined the performance of the ChIP-seq technique on a series of decreasing cell numbers. Results We present an enhanced native ChIP-seq method tailored to low cell numbers that represents a 200-fold reduction in input requirements over existing protocols. The protocol was tested over a range of starting cell numbers covering three orders of magnitude, enabling determination of the lower limit of the technique. At low input cell numbers, increased levels of unmapped and duplicate reads reduce the number of unique reads generated, and can drive up sequencing costs and affect sensitivity if ChIP is attempted from too few cells. Conclusions The optimised method presented here considerably reduces the input requirements for performing native ChIP-seq. It extends the applicability of the technique to isolated primary cells and rare cell populations (e.g. biobank samples, stem cells, and in many cases will alleviate the need for cell culture and any associated alteration of epigenetic marks. However, this study highlights a challenge inherent to ChIP-seq from low cell numbers: as cell input numbers fall, levels of unmapped sequence reads and PCR-generated duplicate reads rise. We discuss a number of solutions to overcome the effects of reducing cell number that may aid further improvements to ChIP performance.
Large-scale Comparative Study of Hi-C-based Chromatin 3D Structure Modeling Methods
Wang, Cheng
2018-05-17
Chromatin is a complex polymer molecule in eukaryotic cells, primarily consisting of DNA and histones. Many works have shown that the 3D folding of chromatin structure plays an important role in DNA expression. The recently proposed Chro- mosome Conformation Capture technologies, especially the Hi-C assays, provide us an opportunity to study how the 3D structures of the chromatin are organized. Based on the data from Hi-C experiments, many chromatin 3D structure modeling methods have been proposed. However, there is limited ground truth to validate these methods and no robust chromatin structure alignment algorithms to evaluate the performance of these methods. In our work, we first made a thorough literature review of 25 publicly available population Hi-C-based chromatin 3D structure modeling methods. Furthermore, to evaluate and to compare the performance of these methods, we proposed a novel data simulation method, which combined the population Hi-C data and single-cell Hi-C data without ad hoc parameters. Also, we designed a global and a local alignment algorithms to measure the similarity between the templates and the chromatin struc- tures predicted by different modeling methods. Finally, the results from large-scale comparative tests indicated that our alignment algorithms significantly outperform the algorithms in literature.
Testing Whether Defective Chromatin Assembly in S-Phase Contributes to Breast Cancer
National Research Council Canada - National Science Library
Adams, Peter
2003-01-01
.... We used a dominant negative mutant of (chromatin assembly factor-I) CAF1, a complex that assembles newly synthesized DNA into nucleosomes, to inhibit S-phase chromatin assembly and found that this induced S-phase arrest...
Testing Whether Defective Chromatin Assembly in S-Phase Contributes to Breast Cancer
National Research Council Canada - National Science Library
Adams, Peter
2004-01-01
.... We used a dominant negative mutant of (chromatin assembly factor-I) CAF1, a complex that assembles newly synthesized DNA into nucleosomes, to inhibit S-phase chromatin assembly and found that this induced S-phase arrest...
CTCF Prevents the Epigenetic Drift of EBV Latency Promoter Qp
Tempera, Italo; Wiedmer, Andreas; Dheekollu, Jayaraju; Lieberman, Paul M.
2010-01-01
The establishment and maintenance of Epstein-Barr Virus (EBV) latent infection requires distinct viral gene expression programs. These gene expression programs, termed latency types, are determined largely by promoter selection, and controlled through the interplay between cell-type specific transcription factors, chromatin structure, and epigenetic modifications. We used a genome-wide chromatin-immunoprecipitation (ChIP) assay to identify epigenetic modifications that correlate with different latency types. We found that the chromatin insulator protein CTCF binds at several key regulatory nodes in the EBV genome and may compartmentalize epigenetic modifications across the viral genome. Highly enriched CTCF binding sites were identified at the promoter regions upstream of Cp, Wp, EBERs, and Qp. Since Qp is essential for long-term maintenance of viral genomes in type I latency and epithelial cell infections, we focused on the role of CTCF in regulating Qp. Purified CTCF bound ∼40 bp upstream of the EBNA1 binding sites located at +10 bp relative to the transcriptional initiation site at Qp. Mutagenesis of the CTCF binding site in EBV bacmids resulted in a decrease in the recovery of stable hygromycin-resistant episomes in 293 cells. EBV lacking the Qp CTCF site showed a decrease in Qp transcription initiation and a corresponding increase in Cp and Fp promoter utilization at 8 weeks post-transfection. However, by 16 weeks post-transfection, bacmids lacking CTCF sites had no detectable Qp transcription and showed high levels of histone H3 K9 methylation and CpG DNA methylation at the Qp initiation site. These findings provide direct genetic evidence that CTCF functions as a chromatin insulator that prevents the promiscuous transcription of surrounding genes and blocks the epigenetic silencing of an essential promoter, Qp, during EBV latent infection. PMID:20730088
DEFF Research Database (Denmark)
Siersbæk, Rasmus; Nielsen, Ronni; John, Sam
2011-01-01
hypersensitive site analysis to investigate the genome-wide changes in chromatin structure that accompany the binding of adipogenic transcription factors. These analyses revealed a dramatic and dynamic modulation of the chromatin landscape during the first hours of adipocyte differentiation that coincides...... and chromatin remodelling and is required for their establishment. Furthermore, a subset of early remodelled C/EBP-binding sites persists throughout differentiation and is later occupied by PPARγ, indicating that early C/EBP family members, in addition to their well-established role in activation of PPARγ...
The global relationship between chromatin physical topology, fractal structure, and gene expression
DEFF Research Database (Denmark)
Almassalha, Luay M; Tiwari, A; Ruhoff, P T
2017-01-01
in an empty space, but in a highly complex, interrelated, and dense nanoenvironment that profoundly influences chemical interactions. We explored the relationship between the physical nanoenvironment of chromatin and gene transcription in vitro. We analytically show that changes in the fractal dimension, D...... show that the increased heterogeneity of physical structure of chromatin due to increase in fractal dimension correlates with increased heterogeneity of gene networks. These findings indicate that the higher order folding of chromatin topology may act as a molecular-pathway independent code regulating...
Chip-to-Chip Half Duplex Spiking Data Communication over Power Supply Rails
Hashida, Takushi; Nagata, Makoto
Chip-to-chip serial data communication is superposed on power supply over common Vdd/Vss connections through chip, package, and board traces. A power line transceiver demonstrates half duplex spiking communication at more than 100Mbps. A pair of transceivers consumes 1.35mA from 3.3V, at 130Mbps. On-chip power line LC low pass filter attenuates pseudo-differential communication spikes by 30dB, purifying power supply current for internal circuits. Bi-directional spiking communication was successfully examined in a 90-nm CMOS prototype setup of on-chip waveform capturing. A micro controller forwards clock pulses to and receives data streams from a comparator based waveform capturer formed on a different chip, through a single pair of power and ground traces. The bit error rate is small enough not to degrade waveform acquisition capability, maintaining the spurious free dynamic range of higher than 50dB.
Control of trichome branching by Chromatin Assembly Factor-1
Directory of Open Access Journals (Sweden)
Hennig Lars
2008-05-01
Full Text Available Abstract Background Chromatin dynamics and stability are both required to control normal development of multicellular organisms. Chromatin assembly factor CAF-1 is a histone chaperone that facilitates chromatin formation and the maintenance of specific chromatin states. In plants and animals CAF-1 is essential for normal development, but it is poorly understood which developmental pathways require CAF-1 function. Results Mutations in all three CAF-1 subunits affect Arabidopsis trichome morphology and lack of CAF-1 function results in formation of trichomes with supernumerary branches. This phenotype can be partially alleviated by external sucrose. In contrast, other aspects of the CAF-1 mutant phenotype, such as defective meristem function and organ formation, are aggravated by external sucrose. Double mutant analyses revealed epistatic interactions between CAF-1 mutants and stichel, but non-epistatic interactions between CAF-1 mutants and glabra3 and kaktus. In addition, mutations in CAF-1 could partly suppress the strong overbranching and polyploidization phenotype of kaktus mutants. Conclusion CAF-1 is required for cell differentiation and regulates trichome development together with STICHEL in an endoreduplication-independent pathway. This function of CAF-1 can be partially substituted by application of exogenous sucrose. Finally, CAF-1 is also needed for the high degree of endoreduplication in kaktus mutants and thus for the realization of kaktus' extreme overbranching phenotype.
Mass Spectrometry-Based Proteomics for the Analysis of Chromatin Structure and Dynamics
Directory of Open Access Journals (Sweden)
Monica Soldi
2013-03-01
Full Text Available Chromatin is a highly structured nucleoprotein complex made of histone proteins and DNA that controls nearly all DNA-dependent processes. Chromatin plasticity is regulated by different associated proteins, post-translational modifications on histones (hPTMs and DNA methylation, which act in a concerted manner to enforce a specific “chromatin landscape”, with a regulatory effect on gene expression. Mass Spectrometry (MS has emerged as a powerful analytical strategy to detect histone PTMs, revealing interplays between neighbouring PTMs and enabling screens for their readers in a comprehensive and quantitative fashion. Here we provide an overview of the recent achievements of state-of-the-art mass spectrometry-based proteomics for the detailed qualitative and quantitative characterization of histone post-translational modifications, histone variants, and global interactomes at specific chromatin regions. This synopsis emphasizes how the advances in high resolution MS, from “Bottom Up” to “Top Down” analysis, together with the uptake of quantitative proteomics methods by chromatin biologists, have made MS a well-established method in the epigenetics field, enabling the acquisition of original information, highly complementary to that offered by more conventional, antibody-based, assays.
A high-resolution map of the three-dimensional chromatin interactome in human cells.
Jin, Fulai; Li, Yan; Dixon, Jesse R; Selvaraj, Siddarth; Ye, Zhen; Lee, Ah Young; Yen, Chia-An; Schmitt, Anthony D; Espinoza, Celso A; Ren, Bing
2013-11-14
A large number of cis-regulatory sequences have been annotated in the human genome, but defining their target genes remains a challenge. One strategy is to identify the long-range looping interactions at these elements with the use of chromosome conformation capture (3C)-based techniques. However, previous studies lack either the resolution or coverage to permit a whole-genome, unbiased view of chromatin interactions. Here we report a comprehensive chromatin interaction map generated in human fibroblasts using a genome-wide 3C analysis method (Hi-C). We determined over one million long-range chromatin interactions at 5-10-kb resolution, and uncovered general principles of chromatin organization at different types of genomic features. We also characterized the dynamics of promoter-enhancer contacts after TNF-α signalling in these cells. Unexpectedly, we found that TNF-α-responsive enhancers are already in contact with their target promoters before signalling. Such pre-existing chromatin looping, which also exists in other cell types with different extracellular signalling, is a strong predictor of gene induction. Our observations suggest that the three-dimensional chromatin landscape, once established in a particular cell type, is relatively stable and could influence the selection or activation of target genes by a ubiquitous transcription activator in a cell-specific manner.
Micro- and nanoscale devices for the investigation of epigenetics and chromatin dynamics
Aguilar, Carlos A.; Craighead, Harold G.
2013-10-01
Deoxyribonucleic acid (DNA) is the blueprint on which life is based and transmitted, but the way in which chromatin -- a dynamic complex of nucleic acids and proteins -- is packaged and behaves in the cellular nucleus has only begun to be investigated. Epigenetic modifications sit 'on top of' the genome and affect how DNA is compacted into chromatin and transcribed into ribonucleic acid (RNA). The packaging and modifications around the genome have been shown to exert significant influence on cellular behaviour and, in turn, human development and disease. However, conventional techniques for studying epigenetic or conformational modifications of chromosomes have inherent limitations and, therefore, new methods based on micro- and nanoscale devices have been sought. Here, we review the development of these devices and explore their use in the study of DNA modifications, chromatin modifications and higher-order chromatin structures.
Vitamin D receptor (VDR) promoter targeting through a novel chromatin remodeling complex.
Kato, Shigeaki; Fujiki, Ryoji; Kitagawa, Hirochika
2004-05-01
We have purified nuclear complexes for Vitamin D receptor (VDR), and identified one of them as a novel ATP-dependent chromatine remodeling containing Williams syndrome transcription factor (WSTF), that is supposed to be responsible for Williams syndrome. This complex (WSTF including nucleosome assembly complex (WINAC)) exhibited an ATP-dependent chromatin remodeling activity in vitro. Transient expression assays revealed that WINAC potentiates ligand-induced function of VDR in gene activation and repression. Thus, this study describes a molecular basis of the VDR function on chromosomal DNA through chromatine remodeling.
Energy Technology Data Exchange (ETDEWEB)
Radu, L. [Department of Molecular Genetics and Radiobiology, Babes National Institute, Bucharest (Romania)], E-mail: lilianajradu@yahoo.fr; Mihailescu, I. [Department of Lasers, Laser, Plasma and Radiation Physics Institute, Bucharest (Romania); Radu, S. [Department of Computer Science, Polytechnics University, Bucharest (Romania); Gazdaru, D. [Department of Biophysics, Bucharest University (Romania)
2007-09-21
The analysis of chromatin damage produced by a 248 nm excimer laser radiation, for doses of 0.3-3 MJ/m{sup 2} was carried out by time-resolved spectroscopy and fluorescence resonance energy transfer (FRET). The chromatin was extracted from a normal and a tumoral tissue of Wistar rats. The decrease with laser dose of the relative contribution of the excited state lifetimes of ethidium bromide (EtBr) bounded to chromatin constitutes an evidence of the reduction of chromatin deoxyribonucleic acid (DNA) double-strand structure. FRET was performed from dansyl chloride to acridine orange, both coupled to chromatin. The increase of the average distance between these ligands, under the action of laser radiation, reflects a loosening of the chromatin structure. The radiosensitivity of tumor tissue chromatin is higher than that of a normal tissue. The determination of the chromatin structure modification in an excimer laser field can be of interest in laser therapy.
International Nuclear Information System (INIS)
Radu, L.; Mihailescu, I.; Radu, S.; Gazdaru, D.
2007-01-01
The analysis of chromatin damage produced by a 248 nm excimer laser radiation, for doses of 0.3-3 MJ/m 2 was carried out by time-resolved spectroscopy and fluorescence resonance energy transfer (FRET). The chromatin was extracted from a normal and a tumoral tissue of Wistar rats. The decrease with laser dose of the relative contribution of the excited state lifetimes of ethidium bromide (EtBr) bounded to chromatin constitutes an evidence of the reduction of chromatin deoxyribonucleic acid (DNA) double-strand structure. FRET was performed from dansyl chloride to acridine orange, both coupled to chromatin. The increase of the average distance between these ligands, under the action of laser radiation, reflects a loosening of the chromatin structure. The radiosensitivity of tumor tissue chromatin is higher than that of a normal tissue. The determination of the chromatin structure modification in an excimer laser field can be of interest in laser therapy
International Nuclear Information System (INIS)
Strniste, G.F.; Rall, S.C.
1976-01-01
Ultraviolet (uv)-light-mediated formation of protein-DNA adducts in Chinese hamster cell chromatin was investigated in an attempt to compare chromatin alterations induced in vitro with those observed in vivo. Three independent methods of analysis indicated stable protein-DNA associations: a membrane filter assay which retained DNA on the filter in the presence of high salt-detergent; a Sepharose 4B column assay in which protein eluted coincident with DNA; and a CsCl density gradient equilibrium assay which showed both protein and DNA banding at densities other than their respective native densities. Treatment of the irradiated chromatin with DNase provided further evidence that protein--DNA and not protein-protein adducts were being observed in the column assay. There is a fluence-dependent response of protein-DNA adduct formation when the chromatin is irradiated at low ionic strength and is linear for protein over the range studied. When the chromatin is exposed to differing conditions of pH, ionic strength, or divalent metal ion concentration, the quantity of adduct formed upon uv irradiation varies. Susceptibility to adduct formation can be partially explained in terms of the condensation state of the chromatin and other factors such as rearrangement, denaturation, and dissociation of the chromatin components. Besides providing information on the biological significance of these types of uv-induced lesions, this technique may be useful as a probe of chromatin structure
A proposed holistic approach to on-chip, off-chip, test, and package interconnections
Bartelink, Dirk J.
1998-11-01
The term interconnection has traditionally implied a `robust' connection from a transistor or a group of transistors in an IC to the outside world, usually a PC board. Optimum system utilization is done from outside the IC. As an alternative, this paper addresses `unimpeded' transistor-to-transistor interconnection aimed at reaching the high circuit densities and computational capabilities of neighboring IC's. In this view, interconnections are not made to some human-centric place outside the IC world requiring robustness—except for system input and output connections. This unimpeded interconnect style is currently available only through intra-chip signal traces in `system-on-a-chip' implementations, as exemplified by embedded DRAMs. Because the traditional off-chip penalty in performance and wiring density is so large, a merging of complex process technologies is the only option today. It is suggested that, for system integration to move forward, the traditional robustness requirement inherited from conventional packaging interconnect and IC manufacturing test must be discarded. Traditional system assembly from vendor parts requires robustness under shipping, inspection and assembly. The trend toward systems on a chip signifies willingness by semiconductor companies to design and fabricate whole systems in house, so that `in-house' chip-to-chip assembly is not beyond reach. In this scenario, bare chips never leave the controlled environment of the IC fabricator while the two major contributors to off-chip signal penalty, ESD protection and the need to source a 50-ohm test head, are avoided. With in-house assembly, ESD protection can be eliminated with the precautions already familiar in plasma etching. Test interconnection impacts the fundamentals of IC manufacturing, particularly with clock speeds approaching 1GHz, and cannot be an afterthought. It should be an integral part of the chip-to-chip interconnection bandwidth optimization, because—as we must
International Nuclear Information System (INIS)
Matyasova, J.; Skalka, M.; Cejkova, M.
1979-01-01
The chromatin changes are reevaluated occurring in lymphoid tissues of mice treated with alkylating agents of the nitrogen-mustard type in relation to recent evidence on the nucleosomal organization of chromatin and to our new data on the regular character of chromatin degradation in lymphoid tissues of irradiated mice. DNA was isolated from nuclei at various intervals (1 to 18 h) after treatment of mice and subjected to gel electrophoresis in polyacrylamide gels. Thymus chromatin from treated mice has been shown to degrade in a regular fashion and to yield discrete DNA fragments, resembling those that originate in lymphoid tissues of irradiated mice or in thymus nuclei digested with micrococcal nuclease in vitro. With increasing interval after treatment higher amounts of smaller DNA fragments appear. Chromatin in spleen cells responds to treatment in a similar way, whilst no degradation in vivo takes place in liver chromatin. Chromatin of LS/BL lymphosarcoma cells in mice treated with alkylating agents or with irradiation suffers from a similar regular degradation. The results stress the significance of the action of liberated or activated endogenous nuclease(s) in the development of chromatin damage in lymphoid cells after treatment with alkylating agents. (author)
Chromatin Regulation and the Histone Code in HIV Latency .
Turner, Anne-Marie W; Margolis, David M
2017-06-01
The formation of a latent reservoir of Human Immunodeficiency Virus (HIV) infection hidden from immune clearance remains a significant obstacle to approaches to eradicate HIV infection. Towards an understanding of the mechanisms of HIV persistence, there is a growing body of work implicating epigenetic regulation of chromatin in establishment and maintenance of this latent reservoir. Here we discuss recent advances in the field of chromatin regulation, specifically in our understanding of the histone code, and how these discoveries relate to our current knowledge of the chromatin mechanisms linked to HIV transcriptional repression and the reversal of latency. We also examine mechanisms unexplored in the context of HIV latency and briefly discuss current therapies aimed at the induction of proviral expression within latently infected cells. We aim to emphasize that a greater understanding of the epigenetic mechanisms which govern HIV latency could lead to new therapeutic targets for latency reversal and clearance cure strategies.
A scalable single-chip multi-processor architecture with on-chip RTOS kernel
Theelen, B.D.; Verschueren, A.C.; Reyes Suarez, V.V.; Stevens, M.P.J.; Nunez, A.
2003-01-01
Now that system-on-chip technology is emerging, single-chip multi-processors are becoming feasible. A key problem of designing such systems is the complexity of their on-chip interconnects and memory architecture. It is furthermore unclear at what level software should be integrated. An example of a
Zhao, Ming-Tao; Shao, Ning-Yi; Hu, Shijun; Ma, Ning; Srinivasan, Rajini; Jahanbani, Fereshteh; Lee, Jaecheol; Zhang, Sophia L; Snyder, Michael P; Wu, Joseph C
2017-11-10
Regulatory DNA elements in the human genome play important roles in determining the transcriptional abundance and spatiotemporal gene expression during embryonic heart development and somatic cell reprogramming. It is not well known how chromatin marks in regulatory DNA elements are modulated to establish cell type-specific gene expression in the human heart. We aimed to decipher the cell type-specific epigenetic signatures in regulatory DNA elements and how they modulate heart-specific gene expression. We profiled genome-wide transcriptional activity and a variety of epigenetic marks in the regulatory DNA elements using massive RNA-seq (n=12) and ChIP-seq (chromatin immunoprecipitation combined with high-throughput sequencing; n=84) in human endothelial cells (CD31 + CD144 + ), cardiac progenitor cells (Sca-1 + ), fibroblasts (DDR2 + ), and their respective induced pluripotent stem cells. We uncovered 2 classes of regulatory DNA elements: class I was identified with ubiquitous enhancer (H3K4me1) and promoter (H3K4me3) marks in all cell types, whereas class II was enriched with H3K4me1 and H3K4me3 in a cell type-specific manner. Both class I and class II regulatory elements exhibited stimulatory roles in nearby gene expression in a given cell type. However, class I promoters displayed more dominant regulatory effects on transcriptional abundance regardless of distal enhancers. Transcription factor network analysis indicated that human induced pluripotent stem cells and somatic cells from the heart selected their preferential regulatory elements to maintain cell type-specific gene expression. In addition, we validated the function of these enhancer elements in transgenic mouse embryos and human cells and identified a few enhancers that could possibly regulate the cardiac-specific gene expression. Given that a large number of genetic variants associated with human diseases are located in regulatory DNA elements, our study provides valuable resources for deciphering
Fedina, A B; Gazarian, G G
1976-01-01
Chromosomal non-histone proteins are obtained from nuclei of two types of pigeon erythroid cells: erythroblasts (cells active in RNA synthesis) and erythrocytes (cells with repressed RNA synthesis). They are well soluble in solutions of low ionic strength. Electrophoretic separation of the obtained non-histone proteins in polyacrylamide gels with urea and SDS shows the presence of qualitative differences in the pattern of non-histone proteins of chromatine from erythroblasts and erythrocytes. By electrophoresis in urea some protein bands of non-histone proteins of chromatine from erythroblasts were found which disappear with the aging of cells. At the same time two protein fractions were observed in chromatine from erythrocytes which were absent in that of erythroblasts. Disappearance of some high molecular weight protein fractions from erythrocyte chromatine as compared to erythroblasts was observed by separation of the non-histone proteins in the presence of SDS. These fractions of the non-histone proteins disappearing during aging of cells are well extractable from erythroblast chromatine by 0.35 M NaCl solution. In the in vitro system with E. coli RNA polymerase addition of non-histone proteins of chromatine from erythroblasts to chromatine from erythrocytes increases RNA synthesis 2--3 times. At the same time addition of non-histone proteins from erythrocytes is either without any influence on this process or somewhat inhibiting.
New insights into chromatin folding and dynamics from multi-scale modeling
Olson, Wilma
The dynamic organization of chromatin plays an essential role in the regulation of gene expression and in other fundamental cellular processes. The underlying physical basis of these activities lies in the sequential positioning, chemical composition, and intermolecular interactions of the nucleosomes-the familiar assemblies of roughly 150 DNA base pairs and eight histone proteins-found on chromatin fibers. We have developed a mesoscale model of short nucleosomal arrays and a computational framework that make it possible to incorporate detailed structural features of DNA and histones in simulations of short chromatin constructs with 3-25 evenly spaced nucleosomes. The correspondence between the predicted and observed effects of nucleosome composition, spacing, and numbers on long-range communication between regulatory proteins bound to the ends of designed nucleosome arrays lends credence to the model and to the molecular insights gleaned from the simulated structures. We have extracted effective nucleosome-nucleosome potentials from the mesoscale simulations and introduced the potentials in a larger scale computational treatment of regularly repeating chromatin fibers. Our results reveal a remarkable influence of nucleosome spacing on chromatin flexibility. Small changes in the length of the DNA fragments linking successive nucleosomes introduce marked changes in the local interactions of the nucleosomes and in the spatial configurations of the fiber as a whole. The changes in nucleosome positioning influence the statistical properties of longer chromatin constructs with 100-10,000 nucleosomes. We are investigating the extent to which the `local' interactions of regularly spaced nucleosomes contribute to the corresponding interactions in chains with mixed spacings as a step toward the treatment of fibers with nucleosomes positioned at the sites mapped at base-pair resolution on genomic sequences. Support of the work by USPHS R01 GM 34809 is gratefully acknowledged.
To spread or not to spread - chromatin modifications in response to DNA damage
DEFF Research Database (Denmark)
Altmeyer, M.; Lukas, J.
2013-01-01
Chromatin modifications in response to DNA damage are vital for genome integrity. Multiple proteins and pathways required to generate specialized chromatin domains around DNA lesions have been identified and the increasing amount of information calls for unifying concepts that would allow us...... to grasp the ever-increasing complexity. This review aims at contributing to this trend by focusing on feed-forward and feedback mechanisms, which in mammalian cells determine the extent of chromatin modifications after DNA damage. We highlight the emerging notion that the nodal points of these highly...... dynamic pathways operate in a rate-limiting mode, whose deregulation can disrupt physiological boundaries between damaged and undamaged chromatin, dictate repair pathway choice, and determine the fate of cells exposed to genotoxic stress....
Chip compacting press; Jido kirikuzu asshukuki
Energy Technology Data Exchange (ETDEWEB)
Oura, K. [Yuken Kogyo Co. Ltd., Kanagawa (Japan)
1998-08-15
The chips exhausted from various machine tools are massy, occupy much space and make working environment worse by staying added cutting oil to lower part. The chips are exhausted as a result of machining and have not constant quality. Even if used material is same the chips have various shapes and properties by kinds and machining methods of used machine tools, and are troublesome materials from a standpoint of their treatment. Pressing and solidification of the chips have frequently been tried. A chip compacting press introduced in this paper, a relatively cheap chip compacting press aimed for relatively small scale chip treatment, and has such characteristics and effects as follows. Chips are pressed and solidified by each raw material, so fractional management can be easily conducted. As casting metal chips and curled chips of iron and aluminum can be pressed to about 1/3 to 1/5 and about 1/40, respectively, space saving can be conducted. Chip compacting pressing upgrades its transporting efficiency to make possible to reduce its transporting cost. As chip solidification controls its oxidation and most cutting oil are removed, chips are easy to recycle. 2 figs., 1 tab.
Directory of Open Access Journals (Sweden)
Frederick A Schroeder
Full Text Available Psychiatric diseases, including schizophrenia, bipolar disorder and major depression, are projected to lead global disease burden within the next decade. Pharmacotherapy, the primary--albeit often ineffective--treatment method, has remained largely unchanged over the past 50 years, highlighting the need for novel target discovery and improved mechanism-based treatments. Here, we examined in wild type mice the impact of chronic, systemic treatment with Compound 60 (Cpd-60, a slow-binding, benzamide-based inhibitor of the class I histone deacetylase (HDAC family members, HDAC1 and HDAC2, in mood-related behavioral assays responsive to clinically effective drugs. Cpd-60 treatment for one week was associated with attenuated locomotor activity following acute amphetamine challenge. Further, treated mice demonstrated decreased immobility in the forced swim test. These changes are consistent with established effects of clinical mood stabilizers and antidepressants, respectively. Whole-genome expression profiling of specific brain regions (prefrontal cortex, nucleus accumbens, hippocampus from mice treated with Cpd-60 identified gene expression changes, including a small subset of transcripts that significantly overlapped those previously reported in lithium-treated mice. HDAC inhibition in brain was confirmed by increased histone acetylation both globally and, using chromatin immunoprecipitation, at the promoter regions of upregulated transcripts, a finding consistent with in vivo engagement of HDAC targets. In contrast, treatment with suberoylanilide hydroxamic acid (SAHA, a non-selective fast-binding, hydroxamic acid HDAC 1/2/3/6 inhibitor, was sufficient to increase histone acetylation in brain, but did not alter mood-related behaviors and had dissimilar transcriptional regulatory effects compared to Cpd-60. These results provide evidence that selective inhibition of HDAC1 and HDAC2 in brain may provide an epigenetic-based target for developing
ChromaSig: a probabilistic approach to finding common chromatin signatures in the human genome.
Directory of Open Access Journals (Sweden)
Gary Hon
2008-10-01
Full Text Available Computational methods to identify functional genomic elements using genetic information have been very successful in determining gene structure and in identifying a handful of cis-regulatory elements. But the vast majority of regulatory elements have yet to be discovered, and it has become increasingly apparent that their discovery will not come from using genetic information alone. Recently, high-throughput technologies have enabled the creation of information-rich epigenetic maps, most notably for histone modifications. However, tools that search for functional elements using this epigenetic information have been lacking. Here, we describe an unsupervised learning method called ChromaSig to find, in an unbiased fashion, commonly occurring chromatin signatures in both tiling microarray and sequencing data. Applying this algorithm to nine chromatin marks across a 1% sampling of the human genome in HeLa cells, we recover eight clusters of distinct chromatin signatures, five of which correspond to known patterns associated with transcriptional promoters and enhancers. Interestingly, we observe that the distinct chromatin signatures found at enhancers mark distinct functional classes of enhancers in terms of transcription factor and coactivator binding. In addition, we identify three clusters of novel chromatin signatures that contain evolutionarily conserved sequences and potential cis-regulatory elements. Applying ChromaSig to a panel of 21 chromatin marks mapped genomewide by ChIP-Seq reveals 16 classes of genomic elements marked by distinct chromatin signatures. Interestingly, four classes containing enrichment for repressive histone modifications appear to be locally heterochromatic sites and are enriched in quickly evolving regions of the genome. The utility of this approach in uncovering novel, functionally significant genomic elements will aid future efforts of genome annotation via chromatin modifications.
Fragmentation of chromatin DNA in mouse thymus cells after whole body γ-irradiation
International Nuclear Information System (INIS)
Wei Kang; Liu Xueying; Zhu Xuefen
1984-01-01
The characteristics of soluble chromatin in mouse thymus nuclei after whole body γ-irradiation were investigated by means of polyacrylamide gel electrophoresis. After deproteinization and electrophoresis eight regular DNA bands were revealed. The molecular weights of these bands were estimated by comparing their migration rates with those of the standard fragments obtained from PBR 322 digested completely by restrictive endonuclease Hae III. The molecular weight of the first band was calculated to be 186 base pairs corresponding approximately to the size of DNA fragment from a single nucleosome, and those of other bands appeared to be its multiples. The results suggested that the disintegration of chromatin DNA after γ-irradiation might have occurred at the linkage regions of chromatin. The autolysis product of normal thymus chromatin under sterile condition were also analyzed and its electrophoretic pattern was found to be just the same as that of the postirradiation product. It seems, therefore, that the endonuclease existing in normal tissues might be responsible for the postirradiation chromatin degradation. The mechanism of this kind of enzymatic digestion remains to be elucidated in further investigation. (author)
Experiment list: SRX186675 [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available histone demethylases that plays a role in chromatin regulation and influences transcriptional activation and...containing gene family of histone demethylases that plays a role in chromatin regulation and influences tran
A Poly-ADP-Ribose Trigger Releases the Auto-Inhibition of a Chromatin Remodeling Oncogene.
Singh, Hari R; Nardozza, Aurelio P; Möller, Ingvar R; Knobloch, Gunnar; Kistemaker, Hans A V; Hassler, Markus; Harrer, Nadine; Blessing, Charlotte; Eustermann, Sebastian; Kotthoff, Christiane; Huet, Sébastien; Mueller-Planitz, Felix; Filippov, Dmitri V; Timinszky, Gyula; Rand, Kasper D; Ladurner, Andreas G
2017-12-07
DNA damage triggers chromatin remodeling by mechanisms that are poorly understood. The oncogene and chromatin remodeler ALC1/CHD1L massively decompacts chromatin in vivo yet is inactive prior to DNA-damage-mediated PARP1 induction. We show that the interaction of the ALC1 macrodomain with the ATPase module mediates auto-inhibition. PARP1 activation suppresses this inhibitory interaction. Crucially, release from auto-inhibition requires a poly-ADP-ribose (PAR) binding macrodomain. We identify tri-ADP-ribose as a potent PAR-mimic and synthetic allosteric effector that abrogates ATPase-macrodomain interactions, promotes an ungated conformation, and activates the remodeler's ATPase. ALC1 fragments lacking the regulatory macrodomain relax chromatin in vivo without requiring PARP1 activation. Further, the ATPase restricts the macrodomain's interaction with PARP1 under non-DNA damage conditions. Somatic cancer mutants disrupt ALC1's auto-inhibition and activate chromatin remodeling. Our data show that the NAD + -metabolite and nucleic acid PAR triggers ALC1 to drive chromatin relaxation. Modular allostery in this oncogene tightly controls its robust, DNA-damage-dependent activation. Copyright © 2017 Elsevier Inc. All rights reserved.
Novel RNA Duplex Locks HIV-1 in a Latent State via Chromatin-mediated Transcriptional Silencing
Directory of Open Access Journals (Sweden)
Chantelle Ahlenstiel
2015-01-01
Full Text Available Transcriptional gene silencing (TGS of mammalian genes can be induced by short interfering RNA (siRNA targeting promoter regions. We previously reported potent TGS of HIV-1 by siRNA (PromA, which targets tandem NF-κB motifs within the viral 5′LTR. In this study, we screened a siRNA panel with the aim of identifying novel 5′LTR targets, to provide multiplexing potential with enhanced viral silencing and application toward developing alternate therapeutic strategies. Systematic examination identified a novel siRNA target, si143, confirmed to induce TGS as the silencing mechanism. TGS was prolonged with virus suppression >12 days, despite a limited ability to induce post- TGS. Epigenetic changes associated with silencing were suggested by partial reversal by histone deacetylase inhibitors and confirmed by chromatin immunoprecipitation analyses, which showed induction of H3K27me3 and H3K9me3, reduction in H3K9Ac, and recruitment of argonaute-1, all characteristic marks of heterochromatin and TGS. Together, these epigenetic changes mimic those associated with HIV-1 latency. Further, robust resistance to reactivation was observed in the J-Lat 9.2 cell latency model, when transduced with shPromA and/or sh143. These data support si/shRNA-mediated TGS approaches to HIV-1 and provide alternate targets to pursue a functional cure, whereby the viral reservoir is locked in latency following antiretroviral therapy cessation.
The 7SK snRNP associates with the little elongation complex to promote snRNA gene expression.
Egloff, Sylvain; Vitali, Patrice; Tellier, Michael; Raffel, Raoul; Murphy, Shona; Kiss, Tamás
2017-04-03
The 7SK small nuclear RNP (snRNP), composed of the 7SK small nuclear RNA (snRNA), MePCE, and Larp7, regulates the mRNA elongation capacity of RNA polymerase II (RNAPII) through controlling the nuclear activity of positive transcription elongation factor b (P-TEFb). Here, we demonstrate that the human 7SK snRNP also functions as a canonical transcription factor that, in collaboration with the little elongation complex (LEC) comprising ELL, Ice1, Ice2, and ZC3H8, promotes transcription of RNAPII-specific spliceosomal snRNA and small nucleolar RNA (snoRNA) genes. The 7SK snRNA specifically associates with a fraction of RNAPII hyperphosphorylated at Ser5 and Ser7, which is a hallmark of RNAPII engaged in snRNA synthesis. Chromatin immunoprecipitation (ChIP) and chromatin isolation by RNA purification (ChIRP) experiments revealed enrichments for all components of the 7SK snRNP on RNAPII-specific sn/snoRNA genes. Depletion of 7SK snRNA or Larp7 disrupts LEC integrity, inhibits RNAPII recruitment to RNAPII-specific sn/snoRNA genes, and reduces nascent snRNA and snoRNA synthesis. Thus, through controlling both mRNA elongation and sn/snoRNA synthesis, the 7SK snRNP is a key regulator of nuclear RNA production by RNAPII. © 2017 The Authors.
Utrophin up-regulation by an artificial transcription factor in transgenic mice.
Directory of Open Access Journals (Sweden)
Elisabetta Mattei
2007-08-01
Full Text Available Duchenne Muscular Dystrophy (DMD is a severe muscle degenerative disease, due to absence of dystrophin. There is currently no effective treatment for DMD. Our aim is to up-regulate the expression level of the dystrophin related gene utrophin in DMD, complementing in this way the lack of dystrophin functions. To this end we designed and engineered several synthetic zinc finger based transcription factors. In particular, we have previously shown that the artificial three zinc finger protein named Jazz, fused with the appropriate effector domain, is able to drive the transcription of a test gene from the utrophin promoter "A". Here we report on the characterization of Vp16-Jazz-transgenic mice that specifically over-express the utrophin gene at the muscular level. A Chromatin Immunoprecipitation assay (ChIP demonstrated the effective access/binding of the Jazz protein to active chromatin in mouse muscle and Vp16-Jazz was shown to be able to up-regulate endogenous utrophin gene expression by immunohistochemistry, western blot analyses and real-time PCR. To our knowledge, this is the first example of a transgenic mouse expressing an artificial gene coding for a zinc finger based transcription factor. The achievement of Vp16-Jazz transgenic mice validates the strategy of transcriptional targeting of endogenous genes and could represent an exclusive animal model for use in drug discovery and therapeutics.
Nuclear and chromatin structures and their influence on the radiosensitivity of DNA
International Nuclear Information System (INIS)
Oleinick, N.L.; Chiu, S.-M.
1994-01-01
Among the factors contributing to the distribution of DNA damage within irradiated mammalian cell nuclei are the interactions of DNA with nuclear proteins and the formation of multi-molecular chromatin structures. Studies on the manipulation of chromatin structures of isolated nuclei are summarised. The majority of chromatin within the nucleus of living cells is tightly compacted into nucleosomal superhelices and other higher order structures which have a limited ability to be damaged by radiation. The treatment of isolated nuclei with hypotonic buffers causes a decondensation of these structures and markedly sensitises the DNA to radiation, while retaining the majority of the chromosomal proteins. On the other hand, treatment of nuclei with hypertonic buffers strips the DNA of specific classes of nuclear proteins, destroying chromatin structure, and this procedure also enhances the sensitivity of the DNA to radiation. The various expanded chromatin structures are models for the structure of the minor fraction of DNA which is decondensed in preparation for transcription or replication. The combined results indicate that the majority of nuclear DNA is protected by histones and other nuclear proteins from radiation damage, partially as a result of the limited accessibility of the condensed structures to hydroxyl radical and partially as a result of the scavenging of radicals by the proteins. (Author)
Pivot-Pajot, Christophe; Caron, Cécile; Govin, Jérôme; Vion, Alexandre; Rousseaux, Sophie; Khochbin, Saadi
2003-01-01
The association between histone acetylation and replacement observed during spermatogenesis prompted us to consider the testis as a source for potential factors capable of remodelling acetylated chromatin. A systematic search of data banks for open reading frames encoding testis-specific bromodomain-containing proteins focused our attention on BRDT, a testis-specific protein of unknown function containing two bromodomains. BRDT specifically binds hyperacetylated histone H4 tail depending on the integrity of both bromodomains. Moreover, in somatic cells, the ectopic expression of BRDT triggered a dramatic reorganization of the chromatin only after induction of histone hyperacetylation by trichostatin A (TSA). We then defined critical domains of BRDT involved in its activity. Both bromodomains of BRDT, as well as flanking regions, were found indispensable for its histone acetylation-dependent remodelling activity. Interestingly, we also observed that recombinant BRDT was capable of inducing reorganization of the chromatin of isolated nuclei in vitro only when the nuclei were from TSA-treated cells. This assay also allowed us to show that the action of BRDT was ATP independent, suggesting a structural role for the protein in the remodelling of acetylated chromatin. This is the first demonstration of a large-scale reorganization of acetylated chromatin induced by a specific factor. PMID:12861021
On-chip electrochromic micro display for a disposable bio-sensor chip
Zhu, Yanjun; Tsukamoto, Takashiro; Tanaka, Shuji
2017-12-01
This paper reports an on-chip electrochromic micro display made of polyaniline (PANi) which can be easily made on a CMOS chip. Micro-patterned PANi thin films were selectively deposited on pre-patterned microelectrodes by using electrodeposition. The optimum conditions for deposition and electrochromism were investigated. An 8-pixel on-chip micro display was made on a Si chip. The color of each PANi film could be independently but simultaneously controlled, which means any 1-byte digital data could be displayed on the display. The PANi display had a response time as fast as about 100 ms, which means the transfer data rate was as fast as 80 bits per second.
Evaluation of chromatin integrity of motile bovine spermatozoa capacitated in vitro.
Reckova, Z; Machatkova, M; Rybar, R; Horakova, J; Hulinska, P; Machal, L
2008-08-01
The efficiency of in vitro embryo production is highly variable amongst individual sires in cattle. To eliminate that this variability is not caused by sperm chromatin damage caused by separation or capacitacion, chromatin integrity was evaluated. Seventeen of AI bulls with good NRRs but variable embryo production efficiency were used. For each bull, motile spermatozoa were separated on a Percoll gradient, resuspended in IVF-TALP medium and capacitated with or incubated without heparin for 6 h. Samples before and after separation and after 3-h and 6-h capacitacion or incubation were evaluated by the Sperm Chromatin Structure Assay (SCSA) and the proportion of sperm with intact chromatin structure was calculated. Based on changes in the non-DFI-sperm proportion, the sires were categorized as DNA-unstable (DNA-us), DNA-stable (DNA-s) and DNA-most stable (DNA-ms) bulls (n=3, n=5 and n=9, respectively). In DNA-us bulls, separation produced a significant increase of the mean non-DFI-sperm proportion (p Capacitacion produced a significant decrease in the mean non-DFI-sperm proportion in H+ sperm (p capacitacion, the mean non-DFI-sperm proportion remained almost unchanged. In DNA-ms bulls, neither separation nor capacitacion had any effect on the mean non-DFI-sperm proportion. It can be concluded that, although separation and capacitacion may produce some changes in sperm chromatin integrity, these are not associated with different in vitro fertility of the bulls involved.
Experiment list: SRX186705 [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available t play a role a chromatin remodeling and histone demethylation. PHF8 also bears a...a chromatin remodeling and histone demethylation. PHF8 also bears a PHD (plant homeodomain)- type zinc-finge
Model for the structure of the active nucleolar chromatin
International Nuclear Information System (INIS)
Labhart, P.; Ness, P.; Banz, E.; Parish, R.; Koller, T.; Universitaet Zurich, Switzerland)
1983-01-01
Transcribed ribosomal genes of Xenopus laevis oocytes and of Dictyostelium discoideum were studied electron microscopically using step gradients at different ionic strengths. Under these conditions the fiber of the active chromatin appears smooth and is indistinguishable from free DNA. The accessibility of the coding region and of a nontranscribed spacer region to restriction enzymes and micrococcal nuclease were investigated. All of the results obtained are consistent with a model in which active nucleolar chromatin is mostly composed of free DNA and the components required for transcription. 50 references, 7 figures
Chromatin remodelling: the industrial revolution of DNA around histones.
Saha, Anjanabha; Wittmeyer, Jacqueline; Cairns, Bradley R
2006-06-01
Chromatin remodellers are specialized multi-protein machines that enable access to nucleosomal DNA by altering the structure, composition and positioning of nucleosomes. All remodellers have a catalytic ATPase subunit that is similar to known DNA-translocating motor proteins, suggesting DNA translocation as a unifying aspect of their mechanism. Here, we explore the diversity and specialization of chromatin remodellers, discuss how nucleosome modifications regulate remodeller activity and consider a model for the exposure of nucleosomal DNA that involves the use of directional DNA translocation to pump 'DNA waves' around the nucleosome.
Modulation of chromatin structure by the FACT histone chaperone complex regulates HIV-1 integration.
Matysiak, Julien; Lesbats, Paul; Mauro, Eric; Lapaillerie, Delphine; Dupuy, Jean-William; Lopez, Angelica P; Benleulmi, Mohamed Salah; Calmels, Christina; Andreola, Marie-Line; Ruff, Marc; Llano, Manuel; Delelis, Olivier; Lavigne, Marc; Parissi, Vincent
2017-07-28
Insertion of retroviral genome DNA occurs in the chromatin of the host cell. This step is modulated by chromatin structure as nucleosomes compaction was shown to prevent HIV-1 integration and chromatin remodeling has been reported to affect integration efficiency. LEDGF/p75-mediated targeting of the integration complex toward RNA polymerase II (polII) transcribed regions ensures optimal access to dynamic regions that are suitable for integration. Consequently, we have investigated the involvement of polII-associated factors in the regulation of HIV-1 integration. Using a pull down approach coupled with mass spectrometry, we have selected the FACT (FAcilitates Chromatin Transcription) complex as a new potential cofactor of HIV-1 integration. FACT is a histone chaperone complex associated with the polII transcription machinery and recently shown to bind LEDGF/p75. We report here that a tripartite complex can be formed between HIV-1 integrase, LEDGF/p75 and FACT in vitro and in cells. Biochemical analyzes show that FACT-dependent nucleosome disassembly promotes HIV-1 integration into chromatinized templates, and generates highly favored nucleosomal structures in vitro. This effect was found to be amplified by LEDGF/p75. Promotion of this FACT-mediated chromatin remodeling in cells both increases chromatin accessibility and stimulates HIV-1 infectivity and integration. Altogether, our data indicate that FACT regulates HIV-1 integration by inducing local nucleosomes dissociation that modulates the functional association between the incoming intasome and the targeted nucleosome.
Chromatin Regulation of Neuronal Maturation and Plasticity.
Gallegos, David A; Chan, Urann; Chen, Liang-Fu; West, Anne E
2018-05-01
Neurons are dynamic cells that respond and adapt to stimuli throughout their long postmitotic lives. The structural and functional plasticity of neurons requires the regulated transcription of new gene products, and dysregulation of transcription in either the developing or adult brain impairs cognition. We discuss how mechanisms of chromatin regulation help to orchestrate the transcriptional programs that underlie the maturation of developing neurons and the plasticity of adult neurons. We review how chromatin regulation acts locally to modulate the expression of specific genes and more broadly to coordinate gene expression programs during transitions between cellular states. These data highlight the importance of epigenetic transcriptional mechanisms in postmitotic neurons. We suggest areas where emerging methods may advance understanding in the future. Copyright © 2018 Elsevier Ltd. All rights reserved.
Experiment list: SRX186646 [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available metalloenzymes that play a role a chromatin remodeling and histone demethylation. PHF8 also bears...mes that play a role a chromatin remodeling and histone demethylation. PHF8 also bears a PHD (plant homeodom
Chromatin organisation during Arabidopsis root development
Lorvellec, M.
2007-01-01
The genetic information is stored in a highly compact manner in every nucleus. About 150 bp of DNA is packed around a histone octamer constituting a nucleosome. Nucleosomes are linked together by histone H1 and further compaction of this "beads on a string" form higher-order chromatin structures.
Probing Chromatin-modifying Enzymes with Chemical Tools
Fischle, Wolfgang; Schwarzer, Dirk
2016-01-01
and represent promising drug targets in modern medicine. We summarize and discuss recent advances in the field of chemical biology that have provided chromatin research with sophisticated tools for investigating the composition, activity, and target sites
Radiation-induced XRCC4 association with chromatin DNA analyzed by biochemical fractionation
International Nuclear Information System (INIS)
Kamdar, R.P.; Matsumoto, Yoshihisa
2010-01-01
XRCC4, in association with DNA ligase IV, is thought to play a critical role in the ligation of two DNA ends in DNA double-strand break (DSB) repair through non-homologous end-joining (NHEJ) pathway. In the present study, we captured radiation-induced chromatin-recruitment of XRCC4 by biochemical fractionation using detergent Nonidet P-40. A subpopulation of XRCC4 changed into a form that is resistant to the extraction with 0.5% Nonidet P-40-containing buffer after irradiation. This form of XRCC4 was liberated by micrococcal nuclease treatment, indicating that it had been tethered to chromatin DNA. This chromatin-recruitment of XRCC4 could be seen immediately (<0.1 hr) after irradiation and remained up to 4 hr after 20 Gy irradiation. It was seen even after irradiation of small doses, id est (i.e.), 2 Gy, but the residence of XRCC4 on chromatin was very transient after 2 Gy irradiation, returning to near normal level in 0.2-0.5 hr after irradiation. The chromatin-bound XRCC4 represented only -1% of total XRCC4 molecules even after 20 Gy irradiation and the quantitative analysis using purified protein as the reference suggested that only a few XRCC4-DNA ligase IV complexes were recruited to each DNA end. We further show that the chromatin-recruitment of XRCC4 was not attenuated by wortmannin, an inhibitor of DNA-PK, or siRNA-mediated knockdown of the DNA-PK catalytic subunit (DNA-PKcs), indicating that this process does not require DNA-PKcs. These results would provide us with useful experimental tools and important insights to understand the DNA repair process through NHEJ pathway. (author)
Bozler, Julianna; Nguyen, Huy Q.; Rogers, Gregory C.; Bosco, Giovanni
2014-01-01
Although the nuclear envelope is known primarily for its role as a boundary between the nucleus and cytoplasm in eukaryotes, it plays a vital and dynamic role in many cellular processes. Studies of nuclear structure have revealed tissue-specific changes in nuclear envelope architecture, suggesting that its three-dimensional structure contributes to its functionality. Despite the importance of the nuclear envelope, the factors that regulate and maintain nuclear envelope shape remain largely unexplored. The nuclear envelope makes extensive and dynamic interactions with the underlying chromatin. Given this inexorable link between chromatin and the nuclear envelope, it is possible that local and global chromatin organization reciprocally impact nuclear envelope form and function. In this study, we use Drosophila salivary glands to show that the three-dimensional structure of the nuclear envelope can be altered with condensin II-mediated chromatin condensation. Both naturally occurring and engineered chromatin-envelope interactions are sufficient to allow chromatin compaction forces to drive distortions of the nuclear envelope. Weakening of the nuclear lamina further enhanced envelope remodeling, suggesting that envelope structure is capable of counterbalancing chromatin compaction forces. Our experiments reveal that the nucleoplasmic reticulum is born of the nuclear envelope and remains dynamic in that they can be reabsorbed into the nuclear envelope. We propose a model where inner nuclear envelope-chromatin tethers allow interphase chromosome movements to change nuclear envelope morphology. Therefore, interphase chromatin compaction may be a normal mechanism that reorganizes nuclear architecture, while under pathological conditions, such as laminopathies, compaction forces may contribute to defects in nuclear morphology. PMID:25552604
Bozler, Julianna; Nguyen, Huy Q; Rogers, Gregory C; Bosco, Giovanni
2014-12-30
Although the nuclear envelope is known primarily for its role as a boundary between the nucleus and cytoplasm in eukaryotes, it plays a vital and dynamic role in many cellular processes. Studies of nuclear structure have revealed tissue-specific changes in nuclear envelope architecture, suggesting that its three-dimensional structure contributes to its functionality. Despite the importance of the nuclear envelope, the factors that regulate and maintain nuclear envelope shape remain largely unexplored. The nuclear envelope makes extensive and dynamic interactions with the underlying chromatin. Given this inexorable link between chromatin and the nuclear envelope, it is possible that local and global chromatin organization reciprocally impact nuclear envelope form and function. In this study, we use Drosophila salivary glands to show that the three-dimensional structure of the nuclear envelope can be altered with condensin II-mediated chromatin condensation. Both naturally occurring and engineered chromatin-envelope interactions are sufficient to allow chromatin compaction forces to drive distortions of the nuclear envelope. Weakening of the nuclear lamina further enhanced envelope remodeling, suggesting that envelope structure is capable of counterbalancing chromatin compaction forces. Our experiments reveal that the nucleoplasmic reticulum is born of the nuclear envelope and remains dynamic in that they can be reabsorbed into the nuclear envelope. We propose a model where inner nuclear envelope-chromatin tethers allow interphase chromosome movements to change nuclear envelope morphology. Therefore, interphase chromatin compaction may be a normal mechanism that reorganizes nuclear architecture, while under pathological conditions, such as laminopathies, compaction forces may contribute to defects in nuclear morphology. Copyright © 2015 Bozler et al.
Levitskiĭ, E L; Kholodova, Iu D; Gubskiĭ, Iu I; Primak, R G; Chabannyĭ, V N; Kindruk, N L; Mozzhukhina, T G; Lenchevskaia, L K; Mironova, V N; Saad, L M
1993-01-01
Marked changes in the structural and functional characteristics of liver nuclear chromatin fractions are observed under experimental D-hypovitaminosis, which differ in the degree of transcriptional activity. DNA-polymerase activity and activity of the fraction, enriched with RNA-polymerase I, increases in the active fraction. Free radical LPO reactions are modified in the chromatin fraction with low activity and to the less degree in the active one. Disturbances of chromatine structural properties are caused with the change in the protein and lipid components of chromatin. Administration of ecdysterone preparations (separately and together with vitamin D3) has a partial corrective effect on structural and functional organization of nuclear chromatine. At the action of ecdysterone normalization of LPO reactions modified by pathological changes is observed in the chromatin fraction with low activity and to the less degree in the active one. This kind of influence corrects to the less degree chromatin functional activity and quantitative and qualitative modifications of its protein component. Simultaneous influence of ecdysterone and vitamin D3 leads to the partial normalization of the biochemical indices studied (except for those which characterize LPO reactions) mainly in the active chromatin fraction.
[Microcytomorphometric video-image detection of nuclear chromatin in ovarian cancer].
Grzonka, Dariusz; Kamiński, Kazimierz; Kaźmierczak, Wojciech
2003-09-01
Technology of detection of tissue preparates precisious evaluates contents of nuclear chromatine, largeness and shape of cellular nucleus, indicators of mitosis, DNA index, ploidy, phase-S fraction and other parameters. Methods of detection of picture are: microcytomorphometry video-image (MCMM-VI), flow, double flow and activated by fluorescence. Diagnostic methods of malignant neoplasm of ovary are still nonspecific and not precise, that is a reason of unsatisfied results of treatment. Evaluation of microcytomorphometric measurements of nuclear chromatine histopathologic tissue preparates (HP) of ovarian cancer and comparison to normal ovarian tissue. Estimated 10 paraffin embedded tissue preparates of serous ovarian cancer, 4 preparates mucinous cancer and 2 cases of tumor Kruckenberg patients operated in Clinic of Perinatology and Gynaecology Silesian Medical Academy in Zabrze in period 2001-2002, MCMM-VI estimation based on computer aided analysis system: microscope Axioscop 20, camera tv JVCTK-C 1380, CarlZeiss KS Vision 400 rel.3.0 software. Following MCMM-VI parameters assessed: count of pathologic nucleus, diameter of nucleus, area, min/max diameter ratio, equivalent circle diameter (Dcircle), mean of brightness (mean D), integrated optical density (IOD = area x mean D), DNA index and 2.5 c exceeding rate percentage (2.5 c ER%). MCMM-VI performed on the 160 areas of 16 preparates of cancer and 100 areas of normal ovarian tissue. Statistical analysis was performed by used t-Student test. We obtained stastistically significant higher values parameters of nuclear chromatine, DI, 2.5 c ER of mucinous cancer and tumor Kruckenberg comparison to serous cancer. MCMM-VI parameters of chromatine malignant ovarian neoplasm were statistically significantly higher than normal ovarian tissue. Cytometric and karyometric parametres of nuclear chromatine estimated MCMM-VI are useful in the diagnostics and prognosis of ovarian cancer.
Saccharomyces cerevisiae Linker Histone—Hho1p Maintains Chromatin Loop Organization during Ageing
Directory of Open Access Journals (Sweden)
Katya Uzunova
2013-01-01
Full Text Available Intricate, dynamic, and absolutely unavoidable ageing affects cells and organisms through their entire lifetime. Driven by diverse mechanisms all leading to compromised cellular functions and finally to death, this process is a challenge for researchers. The molecular mechanisms, the general rules that it follows, and the complex interplay at a molecular and cellular level are yet little understood. Here, we present our results showing a connection between the linker histones, the higher-order chromatin structures, and the process of chronological lifespan of yeast cells. By deleting the gene for the linker histone in Saccharomyces cerevisiae we have created a model for studying the role of chromatin structures mainly at its most elusive and so far barely understood higher-order levels of compaction in the processes of yeast chronological lifespan. The mutant cells demonstrated controversial features showing slower growth than the wild type combined with better survival during the whole process. The analysis of the global chromatin organization during different time points demonstrated certain loss of the upper levels of chromatin compaction in the cells without linker histone. The results underlay the importance of this histone for the maintenance of the chromatin loop structures during ageing.
Excision of x-ray-induced thymine damage in chromatin from heated cells
International Nuclear Information System (INIS)
Warters, R.L.; Roti Roti, J.L.
1979-01-01
Experiments were performed to distinguish between two possible modes of hyperthermia-induced inhibition of thymine base damage excision from the DNA of CHO cells: (1) heat denaturation of excision enzyme(s) or (2) heat-induced alteration of the substrate for damage excision (chromatin). While hyperthermia (45 0 C, 15 min) had no apparent effect on the capacity of the excision enzymes to excise damage from DNA it had a dramatic effect (ca. 80% inhibition) on the ability of chromatin to serve as a substrate for unheated enzymes. These results suggest that hyperthermia-induced radiosensitization of CHO cells may be due primarily to lesions in the cellular chromatin
Friend of Prmt1, a novel chromatin target of protein arginine methyltransferases
T.B. van Dijk (Thamar); N. Gillemans (Nynke); C. Stein (Claudia); P. Fanis (Pavlos); J.A.A. Demmers (Jeroen); M.P.C. van de Corput (Mariëtte); J. Essers (Jeroen); F.G. Grosveld (Frank); U.M. Bauer (Uta-Maria); J.N.J. Philipsen (Sjaak)
2010-01-01
textabstractWe describe the isolation and characterization of Friend of Prmt1 (Fop), a novel chromatin target of protein arginine methyltransferases. Human Fop is encoded by C1orf77, a gene of previously unknown function. We show that Fop is tightly associated with chromatin, and that it is modified
Guo, Li; Feng, Yingang; Zhang, Zhenfeng; Yao, Hongwei; Luo, Yuanming; Wang, Jinfeng; Huang, Li
2007-01-01
Archaea contain a variety of chromatin proteins consistent with the evolution of different genome packaging mechanisms. Among the two main kingdoms in the Archaea, Euryarchaeota synthesize histone homologs, whereas Crenarchaeota have not been shown to possess a chromatin protein conserved at the kingdom level. We report the identification of Cren7, a novel family of chromatin proteins highly conserved in the Crenarchaeota. A small, basic, methylated and abundant protein, Cren7 displays a high...
Using local chromatin structure to improve CRISPR/Cas9 efficiency in zebrafish.
Chen, Yunru; Zeng, Shiyang; Hu, Ruikun; Wang, Xiangxiu; Huang, Weilai; Liu, Jiangfang; Wang, Luying; Liu, Guifen; Cao, Ying; Zhang, Yong
2017-01-01
Although the CRISPR/Cas9 has been successfully applied in zebrafish, considerable variations in efficiency have been observed for different gRNAs. The workload and cost of zebrafish mutant screening is largely dependent on the mutation rate of injected embryos; therefore, selecting more effective gRNAs is especially important for zebrafish mutant construction. Besides the sequence features, local chromatin structures may have effects on CRISPR/Cas9 efficiency, which remain largely unexplored. In the only related study in zebrafish, nucleosome organization was not found to have an effect on CRISPR/Cas9 efficiency, which is inconsistent with recent studies in vitro and in mammalian cell lines. To understand the effects of local chromatin structure on CRISPR/Cas9 efficiency in zebrafish, we first determined that CRISPR/Cas9 introduced genome editing mainly before the dome stage. Based on this observation, we reanalyzed our published nucleosome organization profiles and generated chromatin accessibility profiles in the 256-cell and dome stages using ATAC-seq technology. Our study demonstrated that chromatin accessibility showed positive correlation with CRISPR/Cas9 efficiency, but we did not observe a clear correlation between nucleosome organization and CRISPR/Cas9 efficiency. We constructed an online database for zebrafish gRNA selection based on local chromatin structure features that could prove beneficial to zebrafish homozygous mutant construction via CRISPR/Cas9.
"Hook"-calibration of GeneChip-microarrays: Chip characteristics and expression measures
Directory of Open Access Journals (Sweden)
Krohn Knut
2008-08-01
Full Text Available Abstract Background Microarray experiments rely on several critical steps that may introduce biases and uncertainty in downstream analyses. These steps include mRNA sample extraction, amplification and labelling, hybridization, and scanning causing chip-specific systematic variations on the raw intensity level. Also the chosen array-type and the up-to-dateness of the genomic information probed on the chip affect the quality of the expression measures. In the accompanying publication we presented theory and algorithm of the so-called hook method which aims at correcting expression data for systematic biases using a series of new chip characteristics. Results In this publication we summarize the essential chip characteristics provided by this method, analyze special benchmark experiments to estimate transcript related expression measures and illustrate the potency of the method to detect and to quantify the quality of a particular hybridization. It is shown that our single-chip approach provides expression measures responding linearly on changes of the transcript concentration over three orders of magnitude. In addition, the method calculates a detection call judging the relation between the signal and the detection limit of the particular measurement. The performance of the method in the context of different chip generations and probe set assignments is illustrated. The hook method characterizes the RNA-quality in terms of the 3'/5'-amplification bias and the sample-specific calling rate. We show that the proper judgement of these effects requires the disentanglement of non-specific and specific hybridization which, otherwise, can lead to misinterpretations of expression changes. The consequences of modifying probe/target interactions by either changing the labelling protocol or by substituting RNA by DNA targets are demonstrated. Conclusion The single-chip based hook-method provides accurate expression estimates and chip-summary characteristics
Terry, S.Y.A.; Vallis, K.A.
2012-01-01
PURPOSE: The open structure of euchromatin renders it susceptible to DNA damage by ionizing radiation (IR) compared with compact heterochromatin. The effect of chromatin configuration on the efficacy of Auger electron radiotherapy was investigated. METHODS AND MATERIALS: Chromatin structure was
1991-01-01
Close-up of a pixel detector readout chip. The photograph shows an aera of 1 mm x 2 mm containing 12 separate readout channels. The entire chip contains 1000 readout channels (around 80 000 transistors) covering a sensitive area of 8 mm x 5 mm. The chip has been mounted on a silicon detector to detect high energy particles.
FIND: difFerential chromatin INteractions Detection using a spatial Poisson process.
Djekidel, Mohamed Nadhir; Chen, Yang; Zhang, Michael Q
2018-02-12
Polymer-based simulations and experimental studies indicate the existence of a spatial dependency between the adjacent DNA fibers involved in the formation of chromatin loops. However, the existing strategies for detecting differential chromatin interactions assume that the interacting segments are spatially independent from the other segments nearby. To resolve this issue, we developed a new computational method, FIND, which considers the local spatial dependency between interacting loci. FIND uses a spatial Poisson process to detect differential chromatin interactions that show a significant difference in their interaction frequency and the interaction frequency of their neighbors. Simulation and biological data analysis show that FIND outperforms the widely used count-based methods and has a better signal-to-noise ratio. © 2018 Djekidel et al.; Published by Cold Spring Harbor Laboratory Press.
Directory of Open Access Journals (Sweden)
Varvara A Khoroshko
Full Text Available Late-replicating domains (intercalary heterochromatin in the Drosophila genome display a number of features suggesting their organization is quite unique. Typically, they are quite large and encompass clusters of functionally unrelated tissue-specific genes. They correspond to the topologically associating domains and conserved microsynteny blocks. Our study aims at exploring further details of molecular organization of intercalary heterochromatin and has uncovered surprising heterogeneity of chromatin composition in these regions. Using the 4HMM model developed in our group earlier, intercalary heterochromatin regions were found to host chromatin fragments with a particular epigenetic profile. Aquamarine chromatin fragments (spanning 0.67% of late-replicating regions are characterized as a class of sequences that appear heterogeneous in terms of their decompactization. These fragments are enriched with enhancer sequences and binding sites for insulator proteins. They likely mark the chromatin state that is related to the binding of cis-regulatory proteins. Malachite chromatin fragments (11% of late-replicating regions appear to function as universal transitional regions between two contrasting chromatin states. Namely, they invariably delimit intercalary heterochromatin regions from the adjacent active chromatin of interbands. Malachite fragments also flank aquamarine fragments embedded in the repressed chromatin of late-replicating regions. Significant enrichment of insulator proteins CP190, SU(HW, and MOD2.2 was observed in malachite chromatin. Neither aquamarine nor malachite chromatin types appear to correlate with the positions of highly conserved non-coding elements (HCNE that are typically replete in intercalary heterochromatin. Malachite chromatin found on the flanks of intercalary heterochromatin regions tends to replicate earlier than the malachite chromatin embedded in intercalary heterochromatin. In other words, there exists a
Preservation of forest wood chips
Energy Technology Data Exchange (ETDEWEB)
Kofman, P.D.; Thomsen, I.M.; Ohlsson, C.; Leer, E.; Ravn Schmidt, E.; Soerensen, M.; Knudsen, P.
1999-01-01
As part of the Danish Energy Research Programme on biomass utilisation for energy production (EFP), this project concerns problems connected to the handling and storing of wood chips. In this project, the possibility of preserving wood chips of the Norway Spruce (Picea Abies) is addressed, and the potential improvements by anaerobic storage are tested. Preservation of wood chips aims at reducing dry matter losses from extensive heating during storage and to reduce production of fungal spores. Fungal spores pose a health hazards to workers handling the chips. Further the producers of wood chips are interested in such a method since it would enable them to give a guarantee for the delivery of homogeneous wood chips also during the winter period. Three different types of wood chips were stored airtight and further one of these was stored in accordance with normal practise and use as reference. The results showed that airtight storage had a beneficial impact on the quality of the chips: no redistribution of moisture, low dry matter losses, unfavourable conditions for microbial activity of most fungi, and the promotion of yeasts instead of fungi with airborne spores. Likewise the firing tests showed that no combustion problems, and no increased risk to the environment or to the health of staff is caused by anaerobic storage of wood chips. In all, the tests of the anaerobic storage method of forest wood chips were a success and a large-scale test of the method will be carried out in 1999. (au)
Directory of Open Access Journals (Sweden)
Ciira wa Maina
2014-05-01
Full Text Available Gene transcription mediated by RNA polymerase II (pol-II is a key step in gene expression. The dynamics of pol-II moving along the transcribed region influence the rate and timing of gene expression. In this work, we present a probabilistic model of transcription dynamics which is fitted to pol-II occupancy time course data measured using ChIP-Seq. The model can be used to estimate transcription speed and to infer the temporal pol-II activity profile at the gene promoter. Model parameters are estimated using either maximum likelihood estimation or via Bayesian inference using Markov chain Monte Carlo sampling. The Bayesian approach provides confidence intervals for parameter estimates and allows the use of priors that capture domain knowledge, e.g. the expected range of transcription speeds, based on previous experiments. The model describes the movement of pol-II down the gene body and can be used to identify the time of induction for transcriptionally engaged genes. By clustering the inferred promoter activity time profiles, we are able to determine which genes respond quickly to stimuli and group genes that share activity profiles and may therefore be co-regulated. We apply our methodology to biological data obtained using ChIP-seq to measure pol-II occupancy genome-wide when MCF-7 human breast cancer cells are treated with estradiol (E2. The transcription speeds we obtain agree with those obtained previously for smaller numbers of genes with the advantage that our approach can be applied genome-wide. We validate the biological significance of the pol-II promoter activity clusters by investigating cluster-specific transcription factor binding patterns and determining canonical pathway enrichment. We find that rapidly induced genes are enriched for both estrogen receptor alpha (ERα and FOXA1 binding in their proximal promoter regions.
Effect of ultraviolet irradiation on chromatin and its components from Yoshida ascites tumour cells
International Nuclear Information System (INIS)
Ramakrishnan, N.; Patil, M.S.; Pradhan, D.S.
1981-01-01
A study has been made of the effect of U.V. irradiation on Yoshida ascites tumour chromatin and its non-DNA components. The extractability of total histones was increased from 6% to 17% with an increase in U.V. incident radiation dose from 500J/m 2 to 2000J/m 2 . The polyacrylamide gel electrophoresis pattern of chromosomal proteins was examined after irradiation of the chromatin, and the effect of U.V. irradiation of chromatin on histones was also investigated. The results indicated that cross-linking of DNA with chromosomal proteins is an important category of U.V. radiation-induced lesions discerned in U.V. irradiated chromatin. Histones and several non-histone proteins seemed to undergo U.V. radiation-induced cross-linking with DNA, which was taken as indicative of their close association with DNA in the chromatin structure. It is suggested that the cross-link formation between DNA and non-histone proteins may be due to sequence-specific association of non-histone proteins with DNA. (U.K.)
The Impact of Chromatin Dynamics on Cas9-Mediated Genome Editing in Human Cells.
Daer, René M; Cutts, Josh P; Brafman, David A; Haynes, Karmella A
2017-03-17
In order to efficiently edit eukaryotic genomes, it is critical to test the impact of chromatin dynamics on CRISPR/Cas9 function and develop strategies to adapt the system to eukaryotic contexts. So far, research has extensively characterized the relationship between the CRISPR endonuclease Cas9 and the composition of the RNA-DNA duplex that mediates the system's precision. Evidence suggests that chromatin modifications and DNA packaging can block eukaryotic genome editing by custom-built DNA endonucleases like Cas9; however, the underlying mechanism of Cas9 inhibition is unclear. Here, we demonstrate that closed, gene-silencing-associated chromatin is a mechanism for the interference of Cas9-mediated DNA editing. Our assays use a transgenic cell line with a drug-inducible switch to control chromatin states (open and closed) at a single genomic locus. We show that closed chromatin inhibits binding and editing at specific target sites and that artificial reversal of the silenced state restores editing efficiency. These results provide new insights to improve Cas9-mediated editing in human and other mammalian cells.
Statistical-mechanical lattice models for protein-DNA binding in chromatin
International Nuclear Information System (INIS)
Teif, Vladimir B; Rippe, Karsten
2010-01-01
Statistical-mechanical lattice models for protein-DNA binding are well established as a method to describe complex ligand binding equilibria measured in vitro with purified DNA and protein components. Recently, a new field of applications has opened up for this approach since it has become possible to experimentally quantify genome-wide protein occupancies in relation to the DNA sequence. In particular, the organization of the eukaryotic genome by histone proteins into a nucleoprotein complex termed chromatin has been recognized as a key parameter that controls the access of transcription factors to the DNA sequence. New approaches have to be developed to derive statistical-mechanical lattice descriptions of chromatin-associated protein-DNA interactions. Here, we present the theoretical framework for lattice models of histone-DNA interactions in chromatin and investigate the (competitive) DNA binding of other chromosomal proteins and transcription factors. The results have a number of applications for quantitative models for the regulation of gene expression.
INO80 Chromatin Remodeling Coordinates Metabolic Homeostasis with Cell Division
Directory of Open Access Journals (Sweden)
Graeme J. Gowans
2018-01-01
Full Text Available Adaptive survival requires the coordination of nutrient availability with expenditure of cellular resources. For example, in nutrient-limited environments, 50% of all S. cerevisiae genes synchronize and exhibit periodic bursts of expression in coordination with respiration and cell division in the yeast metabolic cycle (YMC. Despite the importance of metabolic and proliferative synchrony, the majority of YMC regulators are currently unknown. Here, we demonstrate that the INO80 chromatin-remodeling complex is required to coordinate respiration and cell division with periodic gene expression. Specifically, INO80 mutants have severe defects in oxygen consumption and promiscuous cell division that is no longer coupled with metabolic status. In mutant cells, chromatin accessibility of periodic genes, including TORC1-responsive genes, is relatively static, concomitant with severely attenuated gene expression. Collectively, these results reveal that the INO80 complex mediates metabolic signaling to chromatin to restrict proliferation to metabolically optimal states.
Rizzo, P J; Burghardt, R C
1980-01-01
Isolated nuclei of the unicellular alga Olisthodiscus luteus, the uninucleate dinoflagellate Crypthecodinium cohnii and the binucleate dinoflagellate Peridinium balticum were lysed and deposited on grids by the microcentrifugation technique. The ultrastructure of the released chromatin fibers was compared to that of mouse liver nuclei. Chromatin from nuclei of Olisthodiscus luteus and the "eukaryotic" nuclei of Peridinium balticum, appeared as linear arrays of regularly repeating subunits which were identical in size and morphology to mouse nucleosomes. In contrast, the chromatin fibers from Crypthecodinium cohnii nuclei appeared as smoothe threads with a diameter of about 6.5 nm. Nuclear preparations containing mixtures of "dinokaryotic" and "eukaryotic" nuclei of Peridinium balticum also contained smooth fibers which most likely originated from the dinokaryotic nuclei. These and other results demonstrating the presence of nucleosomes in lower eukaryotes suggest that the subunit structure of chromatin arose very early in the evolution of the eukaryotic cell.
Chromosome Conformation Capture on Chip (4C)
DEFF Research Database (Denmark)
Leblanc, Benjamin Olivier; Comet, Itys; Bantignies, Frédéric
2016-01-01
4C methods are useful to investigate dependencies between regulatory mechanisms and chromatin structures by revealing the frequency of chromatin contacts between a locus of interest and remote sequences on the chromosome. In this chapter we describe a protocol for the data analysis of microarray-...
Nemetschke, Linda; Eberhardt, Alexander G; Hertzberg, Hubertus; Streit, Adrian
2010-10-12
When chromatin diminution occurs during a cell division a portion of the chromatin is eliminated, resulting in daughter cells with a smaller amount of genetic material. In the parasitic roundworms Ascaris and Parascaris, chromatin diminution creates a genetic difference between the soma and the germline. However, the function of chromatin diminution remains a mystery, because the vast majority of the eliminated DNA is noncoding. Within the parasitic roundworm genus Strongyloides, S. stercoralis (in man) and S. ratti (in rat) employ XX/XO sex determination, but the situation in S. papillosus (in sheep) is different but controversial. We demonstrate genetically that S. papillosus employs sex-specific chromatin diminution to eliminate an internal portion of one of the two homologs of one chromosome pair in males. Contrary to ascarids, the eliminated DNA in S. papillosus contains a large number of genes. We demonstrate that the region undergoing diminution is homologous to the X chromosome of the closely related S. ratti. The flanking regions, which are not diminished, are homologous to the S. ratti autosome number I. Furthermore, we found that the diminished chromosome is not incorporated into sperm, resulting in a male-specific transmission ratio distortion. Our data indicate that on the evolutionary path to S. papillosus, the X chromosome fused with an autosome. Chromatin diminution serves to functionally restore an XX/XO sex-determining system. A consequence of the fusion and the process that copes with it is a transmission ratio distortion in males for certain loci. Copyright © 2010 Elsevier Ltd. All rights reserved.
Manova, Vasilissa; Singh, Satyendra K; Iliakis, George
2012-08-22
Mammalian cells employ at least two subpathways of non-homologous end-joining for the repair of ionizing radiation induced DNA double strand breaks: The canonical DNA-PK-dependent form of non-homologous end-joining (D-NHEJ) and an alternative, slowly operating, error-prone backup pathway (B-NHEJ). In contrast to D-NHEJ, which operates with similar efficiency throughout the cell cycle, B-NHEJ operates more efficiently in G2-phase. Notably, B-NHEJ also shows strong and as of yet unexplained dependency on growth activity and is markedly compromised in serum-deprived cells, or in cells that enter the plateau-phase of growth. The molecular mechanisms underpinning this response remain unknown. Since chromatin structure or changes in chromatin structure are prime candidate-B-NHEJ-modulators, we study here the role of chromatin hyperacetylation, either by HDAC2 knockdown or treatment with the HDAC inhibitor TSA, on the repair by B-NHEJ of IR-induced DSBs. siRNA-mediated knockdown of HDAC2 fails to provoke histone hyperacetylation in Lig4-/- MEFs and has no detectable effect on B-NHEJ function. Treatment with TSA that inhibits multiple HDACs causes efficient, reversible chromatin hyperacetylation in Lig4-/- MEFs, as well as in human HCT116 Lig4-/- cells and the human glioma cell line M059K. The IR yield of DSBs in TSA-treated cells remains similar to that of untreated cells despite the expected chromatin relaxation. In addition, chromatin hyperacetylation leaves unchanged repair of DSBs by B-NHEJ in irradiated exponentially growing, or plateau-phase cells. Notably, under the experimental conditions employed here, chromatin hyperacetylation fails to detectably modulate B-NHEJ in M059K cells as well. In summary, the results show that chromatin acetylation or deacetylation does not affect the kinetics of alternative NHEJ in all types of cells examined both in exponentially growing and serum deprived cultures. We conclude that parameters beyond chromatin acetylation determine B
The N-terminal domain determines the affinity and specificity of H1 binding to chromatin
International Nuclear Information System (INIS)
Öberg, Christine; Belikov, Sergey
2012-01-01
Highlights: ► wt Human histone H1.4 and hH1.4 devoid of N-terminal domain, ΔN-hH1.4, were compared. ► Both histones bind to chromatin, however, ΔN-hH1.4 displays lower binding affinity. ► Interaction of ΔN-hH1.4 with chromatin includes a significant unspecific component. ► N-terminal domain is a determinant of specificity of histone H1 binding to chromatin. -- Abstract: Linker histone H1, one of the most abundant nuclear proteins in multicellular eukaryotes, is a key component of the chromatin structure mainly due to its role in the formation and maintenance of the 30 nm chromatin fiber. It has a three-domain structure; a central globular domain flanked by a short N-terminal domain and a long, highly basic C-terminal domain. Previous studies have shown that the binding abilities of H1 are at large determined by the properties of the C-terminal domain; much less attention has been paid to role of the N-terminal domain. We have previously shown that H1 can be reconstituted via cytoplasmic mRNA injection in Xenopus oocytes, cells that lack somatic H1. The heterologously expressed H1 proteins are incorporated into in vivo assembled chromatin at specific sites and the binding event is monitored as an increase in nucleosomal repeat length (NRL). Using this setup we have here compared the binding properties of wt-H1.4 and hH1.4 devoid of its N-terminal domain (ΔN-hH1.4). The ΔN-hH1.4 displays a drastically lower affinity for chromatin binding as compared to the wild type hH1.4. Our data also indicates that ΔN-hH1.4 is more prone to unspecific chromatin binding than the wild type. We conclude that the N-terminal domain of H1 is an important determinant of affinity and specificity of H1-chromatin interactions.
Sex comb on midleg (Scm) is a functional link between PcG-repressive complexes in Drosophila.
Kang, Hyuckjoon; McElroy, Kyle A; Jung, Youngsook Lucy; Alekseyenko, Artyom A; Zee, Barry M; Park, Peter J; Kuroda, Mitzi I
2015-06-01
The Polycomb group (PcG) proteins are key regulators of development in Drosophila and are strongly implicated in human health and disease. How PcG complexes form repressive chromatin domains remains unclear. Using cross-linked affinity purifications of BioTAP-Polycomb (Pc) or BioTAP-Enhancer of zeste [E(z)], we captured all PcG-repressive complex 1 (PRC1) or PRC2 core components and Sex comb on midleg (Scm) as the only protein strongly enriched with both complexes. Although previously not linked to PRC2, we confirmed direct binding of Scm and PRC2 using recombinant protein expression and colocalization of Scm with PRC1, PRC2, and H3K27me3 in embryos and cultured cells using ChIP-seq (chromatin immunoprecipitation [ChIP] combined with deep sequencing). Furthermore, we found that RNAi knockdown of Scm and overexpression of the dominant-negative Scm-SAM (sterile α motif) domain both affected the binding pattern of E(z) on polytene chromosomes. Aberrant localization of the Scm-SAM domain in long contiguous regions on polytene chromosomes revealed its independent ability to spread on chromatin, consistent with its previously described ability to oligomerize in vitro. Pull-downs of BioTAP-Scm captured PRC1 and PRC2 and additional repressive complexes, including PhoRC, LINT, and CtBP. We propose that Scm is a key mediator connecting PRC1, PRC2, and transcriptional silencing. Combined with previous structural and genetic analyses, our results strongly suggest that Scm coordinates PcG complexes and polymerizes to produce broad domains of PcG silencing. © 2015 Kang et al.; Published by Cold Spring Harbor Laboratory Press.
The impact of CHIP premium increases on insurance outcomes among CHIP eligible children.
Nikolova, Silviya; Stearns, Sally
2014-03-03
Within the United States, public insurance premiums are used both to discourage private health policy holders from dropping coverage and to reduce state budget costs. Prior research suggests that the odds of having private coverage and being uninsured increase with increases in public insurance premiums. The aim of this paper is to test effects of Children's Health Insurance Program (CHIP) premium increases on public insurance, private insurance, and uninsurance rates. The fact that families just below and above a state-specific income cut-off are likely very similar in terms of observable and unobservable characteristics except the premium contribution provides a natural experiment for estimating the effect of premium increases. Using 2003 Medical Expenditure Panel Survey (MEPS) merged with CHIP premiums, we compare health insurance outcomes for CHIP eligible children as of January 2003 in states with a two-tier premium structure using a cross-sectional regression discontinuity methodology. We use difference-in-differences analysis to compare longitudinal insurance outcomes by December 2003. Higher CHIP premiums are associated with higher likelihood of private insurance. Disenrollment from CHIP in response to premium increases over time does not increase the uninsurance rate. When faced with higher CHIP premiums, private health insurance may be a preferable alternative for CHIP eligible families with higher incomes. Therefore, competition in the insurance exchanges being formed under the Affordable Care Act could enhance choice.
Poly(ADP-ribosyl)ation of Methyl CpG Binding Domain Protein 2 Regulates Chromatin Structure*
Becker, Annette; Zhang, Peng; Allmann, Lena; Meilinger, Daniela; Bertulat, Bianca; Eck, Daniel; Hofstaetter, Maria; Bartolomei, Giody; Hottiger, Michael O.; Schreiber, Valérie; Leonhardt, Heinrich; Cardoso, M. Cristina
2016-01-01
The epigenetic information encoded in the genomic DNA methylation pattern is translated by methylcytosine binding proteins like MeCP2 into chromatin topology and structure and gene activity states. We have shown previously that the MeCP2 level increases during differentiation and that it causes large-scale chromatin reorganization, which is disturbed by MeCP2 Rett syndrome mutations. Phosphorylation and other posttranslational modifications of MeCP2 have been described recently to modulate its function. Here we show poly(ADP-ribosyl)ation of endogenous MeCP2 in mouse brain tissue. Consequently, we found that MeCP2 induced aggregation of pericentric heterochromatin and that its chromatin accumulation was enhanced in poly(ADP-ribose) polymerase (PARP) 1−/− compared with wild-type cells. We mapped the poly(ADP-ribosyl)ation domains and engineered MeCP2 mutation constructs to further analyze potential effects on DNA binding affinity and large-scale chromatin remodeling. Single or double deletion of the poly(ADP-ribosyl)ated regions and PARP inhibition increased the heterochromatin clustering ability of MeCP2. Increased chromatin clustering may reflect increased binding affinity. In agreement with this hypothesis, we found that PARP-1 deficiency significantly increased the chromatin binding affinity of MeCP2 in vivo. These data provide novel mechanistic insights into the regulation of MeCP2-mediated, higher-order chromatin architecture and suggest therapeutic opportunities to manipulate MeCP2 function. PMID:26772194
Genome-wide analysis of replication timing by next-generation sequencing with E/L Repli-seq.
Marchal, Claire; Sasaki, Takayo; Vera, Daniel; Wilson, Korey; Sima, Jiao; Rivera-Mulia, Juan Carlos; Trevilla-García, Claudia; Nogues, Coralin; Nafie, Ebtesam; Gilbert, David M
2018-05-01
This protocol is an extension to: Nat. Protoc. 6, 870-895 (2014); doi:10.1038/nprot.2011.328; published online 02 June 2011Cycling cells duplicate their DNA content during S phase, following a defined program called replication timing (RT). Early- and late-replicating regions differ in terms of mutation rates, transcriptional activity, chromatin marks and subnuclear position. Moreover, RT is regulated during development and is altered in diseases. Here, we describe E/L Repli-seq, an extension of our Repli-chip protocol. E/L Repli-seq is a rapid, robust and relatively inexpensive protocol for analyzing RT by next-generation sequencing (NGS), allowing genome-wide assessment of how cellular processes are linked to RT. Briefly, cells are pulse-labeled with BrdU, and early and late S-phase fractions are sorted by flow cytometry. Labeled nascent DNA is immunoprecipitated from both fractions and sequenced. Data processing leads to a single bedGraph file containing the ratio of nascent DNA from early versus late S-phase fractions. The results are comparable to those of Repli-chip, with the additional benefits of genome-wide sequence information and an increased dynamic range. We also provide computational pipelines for downstream analyses, for parsing phased genomes using single-nucleotide polymorphisms (SNPs) to analyze RT allelic asynchrony, and for direct comparison to Repli-chip data. This protocol can be performed in up to 3 d before sequencing, and requires basic cellular and molecular biology skills, as well as a basic understanding of Unix and R.
Chromatin versus pathogens: the function of epigenetics in plant immunity
Ding, Bo; Wang, Guo-Liang
2015-01-01
To defend against pathogens, plants have developed a sophisticated innate immunity that includes effector recognition, signal transduction, and rapid defense responses. Recent evidence has demonstrated that plants utilize the epigenetic control of gene expression to fine-tune their defense when challenged by pathogens. In this review, we highlight the current understanding of the molecular mechanisms of histone modifications (i.e., methylation, acetylation, and ubiquitination) and chromatin remodeling that contribute to plant immunity against pathogens. Functions of key histone-modifying and chromatin remodeling enzymes are discussed. PMID:26388882
Lai, Yi-Shao; Wong, CP
2013-01-01
Advanced Flip Chip Packaging presents past, present and future advances and trends in areas such as substrate technology, material development, and assembly processes. Flip chip packaging is now in widespread use in computing, communications, consumer and automotive electronics, and the demand for flip chip technology is continuing to grow in order to meet the need for products that offer better performance, are smaller, and are environmentally sustainable. This book also: Offers broad-ranging chapters with a focus on IC-package-system integration Provides viewpoints from leading industry executives and experts Details state-of-the-art achievements in process technologies and scientific research Presents a clear development history and touches on trends in the industry while also discussing up-to-date technology information Advanced Flip Chip Packaging is an ideal book for engineers, researchers, and graduate students interested in the field of flip chip packaging.
McKenzie, Neil
1989-12-01
We present a design for a low-cost, functional VLSI chip tester. It is based on the Apple MacIntosh II personal computer. It tests chips that have up to 128 pins. All pin drivers of the tester are bidirectional; each pin is programmed independently as an input or an output. The tester can test both static and dynamic chips. Rudimentary speed testing is provided. Chips are tested by executing C programs written by the user. A software library is provided for program development. Tests run under both the Mac Operating System and A/UX. The design is implemented using Xilinx Logic Cell Arrays. Price/performance tradeoffs are discussed.
DEFF Research Database (Denmark)
Willems, Rhea; Krych, Lukasz; Rybicki, Verena
2015-01-01
AIM: To analyze how enteral food introduction affects intestinal gene regulation and chromatin structure in preterm pigs. MATERIALS & METHODS: Preterm pigs were fed parenteral nutrition plus/minus slowly increasing volumes of enteral nutrition. Intestinal gene-expression and chromatin structure......; no significant differences for colostrum) with corresponding decondensed chromatin configurations. On histology this correlated with mild mucosal lesions, particularly in formula-fed pigs. In CaCo-2 cells, histone hyperacetylation led to a marked increase in TLR4 mRNA and increased IL8 expression upon...... stimulation with lipopolysaccharide (median: 7.0; interquartile range: 5.63-8.85) compared with naive cells (median 4.2; interquartile range: 2.45-6.33; p = 0.03). CONCLUSION: Enteral feeding, particular with formula, induces subclinical inflammation in the premature intestine and more open chromatin...
Diazinon alters sperm chromatin structure in mice by phosphorylating nuclear protamines
International Nuclear Information System (INIS)
Pina-Guzman, B.; Solis-Heredia, M.J.; Quintanilla-Vega, B.
2005-01-01
Organophosphorus (OP) pesticides, widely used in agriculture and pest control, are associated with male reproductive effects, including sperm chromatin alterations, but the mechanisms underlying these effects are unknown. The main toxic action of OP is related to phosphorylation of proteins. Chemical alterations in sperm nuclear proteins (protamines), which pack DNA during the last steps of spermatogenesis, contribute to male reproductive toxicity. Therefore, in the present study, we tested the ability of diazinon (DZN), an OP compound, to alter sperm chromatin by phosphorylating nuclear protamines. Mice were injected with a single dose of DZN (8.12 mg/kg, i.p.), and killed 8 and 15 days after treatment. Quality of sperm from epididymis and vas deferens was evaluated through standard methods and chromatin condensation by flow cytometry (DNA Fragmented Index parameters: DFI and DFI%) and fluorescence microscopy using chromomycin-A 3 (CMA 3 ). Increases in DFI (15%), DFI% (4.5-fold), and CMA 3 (2-fold) were observed only at 8 days post-treatment, indicating an alteration in sperm chromatin condensation and DNA damage during late spermatid differentiation. In addition, an increase of phosphorous content (approximately 50%) in protamines, especially in the phosphoserine content (approximately 73%), was found at 8 days post-treatment. Sperm viability, motility, and morphology showed significant alterations at this time. These data strongly suggest that spermatozoa exposed during the late steps of maturation were the targets of DZN exposure. The correlation observed between the phosphorous content in nuclear protamines with DFI%, DFI, and CMA 3 provides evidence that phosphorylation of nuclear protamines is involved in the OP effects on sperm chromatin
histone H3 predominantly mark the pericentromeric chromatin
Indian Academy of Sciences (India)
SANTOSH KUMAR SHARMA
pericentromeric chromatin during mitosis in monokinetic plants. J. Genet. .... bigger), cytological preparations (easy to difficult) as well as their habitat ... Poaceae. Monocot. Land. 14. Triticum aestivum. Common wheat. Poaceae. Monocot. Land.
Chromatin- and temperature-dependent modulation of radiation-induced double-strand breaks.
Elmroth, K; Nygren, J; Stenerlöw, B; Hultborn, R
2003-10-01
To investigate the influence of chromatin organization and scavenging capacity in relation to irradiation temperature on the induction of double-strand breaks (DSB) in structures derived from human diploid fibroblasts. Agarose plugs with different chromatin structures (intact cells+/-wortmannin, permeabilized cells with condensed chromatin, nucleoids and DNA) were prepared and irradiated with X-rays at 2 or 37 degrees C and lysed using two different lysis protocols (new ice-cold lysis or standard lysis at 37 degrees C). Induction of DSB was determined by constant-field gel electrophoresis. The dose-modifying factor (DMF(temp)) for irradiation at 37 compared with 2 degrees C was 0.92 in intact cells (i.e. more DSB induced at 2 degrees C), but gradually increased to 1.5 in permeabilized cells, 2.2 in nucleoids and 2.6 in naked DNA, suggesting a role of chromatin organization for temperature modulation of DNA damage. In addition, DMF(temp) was influenced by the presence of 0.1 M DMSO or 30 mM glutathione, but not by post-irradiation temperature. The protective effect of low temperature was correlated to the indirect effects of ionizing radiation and was not dependent on post-irradiation temperature. Reasons for a dose modifying factor <1 in intact cells are discussed.
Cache-aware network-on-chip for chip multiprocessors
Tatas, Konstantinos; Kyriacou, Costas; Dekoulis, George; Demetriou, Demetris; Avraam, Costas; Christou, Anastasia
2009-05-01
This paper presents the hardware prototype of a Network-on-Chip (NoC) for a chip multiprocessor that provides support for cache coherence, cache prefetching and cache-aware thread scheduling. A NoC with support to these cache related mechanisms can assist in improving systems performance by reducing the cache miss ratio. The presented multi-core system employs the Data-Driven Multithreading (DDM) model of execution. In DDM thread scheduling is done according to data availability, thus the system is aware of the threads to be executed in the near future. This characteristic of the DDM model allows for cache aware thread scheduling and cache prefetching. The NoC prototype is a crossbar switch with output buffering that can support a cache-aware 4-node chip multiprocessor. The prototype is built on the Xilinx ML506 board equipped with a Xilinx Virtex-5 FPGA.
Grøntved, Lars; Waterfall, Joshua J; Kim, Dong Wook; Baek, Songjoon; Sung, Myong-Hee; Zhao, Li; Park, Jeong Won; Nielsen, Ronni; Walker, Robert L; Zhu, Yuelin J; Meltzer, Paul S; Hager, Gordon L; Cheng, Sheue-yann
2015-04-28
A bimodal switch model is widely used to describe transcriptional regulation by the thyroid hormone receptor (TR). In this model, the unliganded TR forms stable, chromatin-bound complexes with transcriptional co-repressors to repress transcription. Binding of hormone dissociates co-repressors and facilitates recruitment of co-activators to activate transcription. Here we show that in addition to hormone-independent TR occupancy, ChIP-seq against endogenous TR in mouse liver tissue demonstrates considerable hormone-induced TR recruitment to chromatin associated with chromatin remodelling and activated gene transcription. Genome-wide footprinting analysis using DNase-seq provides little evidence for TR footprints both in the absence and presence of hormone, suggesting that unliganded TR engagement with repressive complexes on chromatin is, similar to activating receptor complexes, a highly dynamic process. This dynamic and ligand-dependent interaction with chromatin is likely shared by all steroid hormone receptors regardless of their capacity to repress transcription in the absence of ligand.
International Nuclear Information System (INIS)
Avolio-Hunter, Tina M.; Frappier, Lori
2003-01-01
The Epstein-Barr virus (EBV) protein, EBNA1, activates the replication of latent EBV episomes and the transcription of EBV latency genes by binding to recognition sites in the DS and FR elements of oriP. Since EBV episomes exist as chromatin, we have examined the interaction of EBNA1 with oriP templates assembled with physiologically spaced nucleosomes. We show that EBNA1 retains the ability to efficiently bind its recognition sites within the DS and FR elements in oriP chromatin and that this property is intrinsic to the EBNA1 DNA binding domain. The efficient assembly of EBNA1 on oriP chromatin does not require ATP-dependent chromatin remodeling factors and does not cause the precise positioning of nucleosomes within or adjacent to the FR and DS elements. Thus EBNA1 belongs to a select group of proteins that can efficiently access their recognition sites within nucleosomes without the need for additional chromatin remodeling factors
Izhar, Lior; Adamson, Britt; Ciccia, Alberto; Lewis, Jedd; Pontano-Vaites, Laura; Leng, Yumei; Liang, Anthony C; Westbrook, Thomas F; Harper, J Wade; Elledge, Stephen J
2015-06-09
Localization to sites of DNA damage is a hallmark of DNA damage response (DDR) proteins. To identify DDR factors, we screened epitope-tagged proteins for localization to sites of chromatin damaged by UV laser microirradiation and found >120 proteins that localize to damaged chromatin. These include the BAF tumor suppressor complex and the amyotrophic lateral sclerosis (ALS) candidate protein TAF15. TAF15 contains multiple domains that bind damaged chromatin in a poly-(ADP-ribose) polymerase (PARP)-dependent manner, suggesting a possible role as glue that tethers multiple PAR chains together. Many positives were transcription factors; > 70% of randomly tested transcription factors localized to sites of DNA damage, and of these, ∼90% were PARP dependent for localization. Mutational analyses showed that localization to damaged chromatin is DNA-binding-domain dependent. By examining Hoechst staining patterns at damage sites, we see evidence of chromatin decompaction that is PARP dependent. We propose that PARP-regulated chromatin remodeling at sites of damage allows transient accessibility of DNA-binding proteins. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Lior Izhar
2015-06-01
Full Text Available Localization to sites of DNA damage is a hallmark of DNA damage response (DDR proteins. To identify DDR factors, we screened epitope-tagged proteins for localization to sites of chromatin damaged by UV laser microirradiation and found >120 proteins that localize to damaged chromatin. These include the BAF tumor suppressor complex and the amyotrophic lateral sclerosis (ALS candidate protein TAF15. TAF15 contains multiple domains that bind damaged chromatin in a poly-(ADP-ribose polymerase (PARP-dependent manner, suggesting a possible role as glue that tethers multiple PAR chains together. Many positives were transcription factors; > 70% of randomly tested transcription factors localized to sites of DNA damage, and of these, ∼90% were PARP dependent for localization. Mutational analyses showed that localization to damaged chromatin is DNA-binding-domain dependent. By examining Hoechst staining patterns at damage sites, we see evidence of chromatin decompaction that is PARP dependent. We propose that PARP-regulated chromatin remodeling at sites of damage allows transient accessibility of DNA-binding proteins.
Dietary polyphenols and chromatin remodeling.
Russo, Gian Luigi; Vastolo, Viviana; Ciccarelli, Marco; Albano, Luigi; Macchia, Paolo Emidio; Ungaro, Paola
2017-08-13
Polyphenols are the most abundant phytochemicals in fruits, vegetables, and plant-derived beverages. Recent findings suggest that polyphenols display the ability to reverse adverse epigenetic regulation involved in pathological conditions, such as obesity, metabolic disorder, cardiovascular and neurodegenerative diseases, and various forms of cancer. Epigenetics, defined as heritable changes to the transcriptome, independent from those occurring in the genome, includes DNA methylation, histone modifications, and posttranscriptional gene regulation by noncoding RNAs. Sinergistically and cooperatively, these processes regulate gene expression by changing chromatin organization and DNA accessibility. Such induced epigenetic changes can be inherited during cell division, resulting in permanent maintenance of the acquired phenotype, but they may also occur throughout an individual life-course and may ultimately influence phenotypic outcomes (health and disease risk). In the last decade, a number of studies have shown that nutrients can affect metabolic traits by altering the structure of chromatin and directly regulate both transcription and translational processes. In this context, dietary polyphenol-targeted epigenetics becomes an attractive approach for disease prevention and intervention. Here, we will review how polyphenols, including flavonoids, curcuminoids, and stilbenes, modulate the establishment and maintenance of key epigenetic marks, thereby influencing gene expression and, hence, disease risk and health.
Experiment list: SRX122496 [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available || chip antibody=Rel || treatment=LPS || time=120 min || chip antibody manufacturer 1=Santa Cruz || chip ant...ibody catalog number 1=sc-71 || chip antibody manufacturer 2=Santa Cruz || chip antibody catalog number 2=sc
Smart vision chips: An overview
Koch, Christof
1994-01-01
This viewgraph presentation presents four working analog VLSI vision chips: (1) time-derivative retina, (2) zero-crossing chip, (3) resistive fuse, and (4) figure-ground chip; work in progress on computing motion and neuromorphic systems; and conceptual and practical lessons learned.
Experiment list: SRX122465 [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available 6 || chip antibody=Relb || treatment=LPS || time=120 min || chip antibody manufacturer 1=Bethyl || chip anti...body catalog number 1=A302-183A || chip antibody manufacturer 2=Santa Cruz || chip antibody catalog number 2
Ariel, Federico D.; Jé gu, Teddy; Latrasse, David; Romero-Barrios, Natali; Christ, Auré lie; Benhamed, Moussa; Crespi, Martí n D.
2014-01-01
The eukaryotic epigenome is shaped by the genome topology in three-dimensional space. Dynamic reversible variations in this epigenome structure directly influence the transcriptional responses to developmental cues. Here, we show that the Arabidopsis long intergenic noncoding RNA (lincRNA) APOLO is transcribed by RNA polymerases II and V in response to auxin, a phytohormone controlling numerous facets of plant development. This dual APOLO transcription regulates the formation of a chromatin loop encompassing the promoter of its neighboring gene PID, a key regulator of polar auxin transport. Altering APOLO expression affects chromatin loop formation, whereas RNA-dependent DNA methylation, active DNA demethylation, and Polycomb complexes control loop dynamics. This dynamic chromatin topology determines PID expression patterns. Hence, the dual transcription of a lincRNA influences local chromatin topology and directs dynamic auxin-controlled developmental outputs on neighboring genes. This mechanism likely underscores the adaptive success of plants in diverse environments and may be widespread in eukaryotes. © 2014 Elsevier Inc.
Ariel, Federico D.
2014-08-01
The eukaryotic epigenome is shaped by the genome topology in three-dimensional space. Dynamic reversible variations in this epigenome structure directly influence the transcriptional responses to developmental cues. Here, we show that the Arabidopsis long intergenic noncoding RNA (lincRNA) APOLO is transcribed by RNA polymerases II and V in response to auxin, a phytohormone controlling numerous facets of plant development. This dual APOLO transcription regulates the formation of a chromatin loop encompassing the promoter of its neighboring gene PID, a key regulator of polar auxin transport. Altering APOLO expression affects chromatin loop formation, whereas RNA-dependent DNA methylation, active DNA demethylation, and Polycomb complexes control loop dynamics. This dynamic chromatin topology determines PID expression patterns. Hence, the dual transcription of a lincRNA influences local chromatin topology and directs dynamic auxin-controlled developmental outputs on neighboring genes. This mechanism likely underscores the adaptive success of plants in diverse environments and may be widespread in eukaryotes. © 2014 Elsevier Inc.
Experiment list: SRX122555 [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available chip antibody=Stat1 || treatment=LPS || time=120 min || chip antibody manufacturer 1=Santa Cruz || chip anti...body catalog number 1=sc-346 || chip antibody manufacturer 2=Bethyl || chip antibody catalog number 2=A302-7
Rosa-Garrido, Manuel; Chapski, Douglas J; Schmitt, Anthony D; Kimball, Todd H; Karbassi, Elaheh; Monte, Emma; Balderas, Enrique; Pellegrini, Matteo; Shih, Tsai-Ting; Soehalim, Elizabeth; Liem, David; Ping, Peipei; Galjart, Niels J; Ren, Shuxun; Wang, Yibin; Ren, Bing; Vondriska, Thomas M
2017-10-24
Cardiovascular disease is associated with epigenomic changes in the heart; however, the endogenous structure of cardiac myocyte chromatin has never been determined. To investigate the mechanisms of epigenomic function in the heart, genome-wide chromatin conformation capture (Hi-C) and DNA sequencing were performed in adult cardiac myocytes following development of pressure overload-induced hypertrophy. Mice with cardiac-specific deletion of CTCF (a ubiquitous chromatin structural protein) were generated to explore the role of this protein in chromatin structure and cardiac phenotype. Transcriptome analyses by RNA-seq were conducted as a functional readout of the epigenomic structural changes. Depletion of CTCF was sufficient to induce heart failure in mice, and human patients with heart failure receiving mechanical unloading via left ventricular assist devices show increased CTCF abundance. Chromatin structural analyses revealed interactions within the cardiac myocyte genome at 5-kb resolution, enabling examination of intra- and interchromosomal events, and providing a resource for future cardiac epigenomic investigations. Pressure overload or CTCF depletion selectively altered boundary strength between topologically associating domains and A/B compartmentalization, measurements of genome accessibility. Heart failure involved decreased stability of chromatin interactions around disease-causing genes. In addition, pressure overload or CTCF depletion remodeled long-range interactions of cardiac enhancers, resulting in a significant decrease in local chromatin interactions around these functional elements. These findings provide a high-resolution chromatin architecture resource for cardiac epigenomic investigations and demonstrate that global structural remodeling of chromatin underpins heart failure. The newly identified principles of endogenous chromatin structure have key implications for epigenetic therapy. © 2017 The Authors.
A Method to Identify Nucleolus-Associated Chromatin Domains (NADs).
Carpentier, Marie-Christine; Picart-Picolo, Ariadna; Pontvianne, Frédéric
2018-01-01
The nuclear context needs to be taken into consideration to better understand the mechanisms shaping the epigenome and its organization, and therefore its impact on gene expression. For example, in Arabidopsis, heterochromatin is preferentially localized at the nuclear and the nucleolar periphery. Although chromatin domains associating with the nuclear periphery remain to be identified in plant cells, Nucleolus Associated chromatin Domains (NADs) can be identified thanks to a protocol allowing the isolation of pure nucleoli. We describe here the protocol enabling the identification of NADs in Arabidopsis. Providing the transfer of a nucleolus marker as described here in other crop species, this protocol is broadly applicable.
Retention of the Native Epigenome in Purified Mammalian Chromatin.
Directory of Open Access Journals (Sweden)
Andreas H Ehrensberger
Full Text Available A protocol is presented for the isolation of native mammalian chromatin as fibers of 25-250 nucleosomes under conditions that preserve the natural epigenetic signature. The material is composed almost exclusively of histones and DNA and conforms to the structure expected by electron microscopy. All sequences probed for were retained, indicating that the material is representative of the majority of the genome. DNA methylation marks and histone marks resembled the patterns observed in vivo. Importantly, nucleosome positions also remained largely unchanged, except on CpG islands, where nucleosomes were found to be unstable. The technical challenges of reconstituting biochemical reactions with native mammalian chromatin are discussed.
On-chip digital power supply control for system-on-chip applications
Meijer, M.; Pineda de Gyvez, J.; Otten, R.H.J.M.
2005-01-01
The authors presented an on-chip, fully-digital, power-supply control system. The scheme consists of two independent control loops that regulate power supply variations due to semiconductor process spread, temperature, and chip's workload. Smart power-switches working as linear voltage regulators
Inhibition of factor-dependent transcription termination in ...
Indian Academy of Sciences (India)
Inhibition of factor-dependent transcription termination in Escherichia coli might relieve xenogene silencing by abrogating. H-NS-DNA interactions in vivo. DEEPTI CHANDRAPRAKASH and ASWIN SAI NARAIN SESHASAYEE. Chromatin immunoprecipitation. MG1655 hns::3xFLAG cells were grown in liquid LB me-.
Efficient Double Fragmentation ChIP-seq Provides Nucleotide Resolution Protein-DNA Binding Profiles
Mokry, Michal; Hatzis, Pantelis; de Bruijn, Ewart; Koster, Jan; Versteeg, Rogier; Schuijers, Jurian; van de Wetering, Marc; Guryev, Victor; Clevers, Hans; Cuppen, Edwin
2010-01-01
Immunoprecipitated crosslinked protein-DNA fragments typically range in size from several hundred to several thousand base pairs, with a significant part of chromatin being much longer than the optimal length for next-generation sequencing (NGS) procedures. Because these larger fragments may be
DEFF Research Database (Denmark)
Grøntved, Lars; John, Sam; Baek, Songjoon
2013-01-01
-binding sites are occupied by C/EBPβ. At the majority of these sites, chromatin is preaccessible suggesting a priming function of C/EBPβ for GR recruitment. Disruption of C/EBPβ binding to chromatin results in attenuation of pre-programmed chromatin accessibility, GR recruitment and GR-induced chromatin...... remodelling specifically at sites co-occupied by GR and C/EBPβ. Collectively, we demonstrate a highly cooperative mechanism by which C/EBPβ regulates selective GR binding to the genome in liver tissue. We suggest that selective targeting of GR in other tissues is likely mediated by the combined action of cell...
Moreno-Ramos, Oscar A; Olivares, Ana María; Haider, Neena B; de Autismo, Liga Colombiana; Lattig, María Claudia
2015-01-01
Autism spectrum disorders (ASDs) are a range of complex neurodevelopmental conditions principally characterized by dysfunctions linked to mental development. Previous studies have shown that there are more than 1000 genes likely involved in ASD, expressed mainly in brain and highly interconnected among them. We applied whole exome sequencing in Colombian-South American trios. Two missense novel SNVs were found in the same child: ALDH1A3 (RefSeq NM_000693: c.1514T>C (p.I505T)) and FOXN1 (RefSeq NM_003593: c.146C>T (p.S49L)). Gene expression studies reveal that Aldh1a3 and Foxn1 are expressed in ~E13.5 mouse embryonic brain, as well as in adult piriform cortex (PC; ~P30). Conserved Retinoic Acid Response Elements (RAREs) upstream of human ALDH1A3 and FOXN1 and in mouse Aldh1a3 and Foxn1 genes were revealed using bioinformatic approximation. Chromatin immunoprecipitation (ChIP) assay using Retinoid Acid Receptor B (Rarb) as the immunoprecipitation target suggests RA regulation of Aldh1a3 and Foxn1 in mice. Our results frame a possible link of RA regulation in brain to ASD etiology, and a feasible non-additive effect of two apparently unrelated variants in ALDH1A3 and FOXN1 recognizing that every result given by next generation sequencing should be cautiously analyzed, as it might be an incidental finding.
Directory of Open Access Journals (Sweden)
Yukio Kurihara
2014-12-01
Full Text Available Several transcription factors (TFs coordinate to regulate expression of specific genes at the transcriptional level. In Arabidopsis thaliana it is estimated that approximately 10% of all genes encode TFs or TF-like proteins. It is important to identify target genes that are directly regulated by TFs in order to understand the complete picture of a plant’s transcriptome profile. Here, we investigate the role of the LONG HYPOCOTYL5 (HY5 transcription factor that acts as a regulator of photomorphogenesis. We used an in vitro genomic DNA binding assay coupled with immunoprecipitation and next-generation sequencing (gDB-seq instead of the in vivo chromatin immunoprecipitation (ChIP-based methods. The results demonstrate that the HY5-binding motif predicted here was similar to the motif reported previously and that in vitro HY5-binding loci largely overlapped with the HY5-targeted candidate genes identified in previous ChIP-chip analysis. By combining these results with microarray analysis, we identified hundreds of HY5-binding genes that were differentially expressed in hy5. We also observed delayed induction of some transcripts of HY5-binding genes in hy5 mutants in response to blue-light exposure after dark treatment. Thus, an in vitro gDNA-binding assay coupled with sequencing is a convenient and powerful method to bridge the gap between identifying TF binding potential and establishing function.
STAT3-Activated GM-CSFRα Translocates to the Nucleus and Protects CLL Cells from Apoptosis
Li, Ping; Harris, David; Liu, Zhiming; Rozovski, Uri; Ferrajoli, Alessandra; Wang, Yongtao; Bueso-Ramos, Carlos; Hazan-Halevy, Inbal; Grgurevic, Srdana; Wierda, William; Burger, Jan; O'Brien, Susan; Faderl, Stefan; Keating, Michael; Estrov, Zeev
2014-01-01
Here it was determined that Chronic Lymphocytic Leukemia (CLL) cells express the α-subunit but not the β-subunit of the granulocyte-macrophage colony-stimulating factor receptor (GM-CSFR/CSF3R). GM-CSFRα was detected on the surface, in the cytosol, and the nucleus of CLL cells via confocal microscopy, cell fractionation, and GM-CSFRα antibody epitope mapping. Because STAT3 is frequently activated in CLL and the GM-CSFRα promoter harbors putative STAT3 consensus binding sites, MM1 cells were transfected with truncated forms of the GM-CSFRα promoter, then stimulated with IL-6 to activate STAT3 to identify STAT3 binding sites. Chromatin immunoprecipitation (ChIP) and an electoromobility shift assay (EMSA) confirmed STAT3 occupancy to those promoter regions in both IL-6 stimulated MM1 and CLL cells. Transfection of MM1 cells with STAT3 siRNA or CLL cells with STAT3 shRNA significantly down-regulated GM-CSFRα mRNA and protein levels. RNA transcripts, involved in regulating cell-survival pathways, and the proteins KAP1 (TRIM28) and ISG15 co-immunoprecipitated with GM-CSFRα. GM-CSFRα-bound KAP1 enhanced the transcriptional activity of STAT3, whereas ISG15 inhibited the NF-κB pathway. Nevertheless, overexpression of GM-CSFRα protected MM1 cells from dexamethasone-induced apoptosis, and GM-CSFRα knockdown induced apoptosis in CLL cells, suggesting that GM-CSFRα provides a ligand-independent survival advantage. PMID:24836891
Supply chains of forest chip production in Finland
Energy Technology Data Exchange (ETDEWEB)
Kaerhae, Kalle (Metsaeteho Oy, Helsinki (Finland)), e-mail: kalle.karha@metsateho.fi
2010-07-15
The Metsaeteho study investigated how logging residue chips, stump wood chips, and chips from small sized thinning wood and large-sized (rotten) roundwood used by heating and power plants were produced in Finland in 2008. Almost all the major forest chip suppliers in Finland were involved in the study. The total volume of forest chips supplied in 2008 by these suppliers was 6.5 TWh. The study was implemented by conducting an e-mail questionnaire survey and telephone interviews. Research data was collected in March-May 2009. The majority of the logging residue chips and chips from small-sized thinning wood were produced using the roadside chipping supply chain in Finland in 2008. The chipping at plant supply chain was also significant in the production of logging residue chips. 70% of all stump wood chips consumed were comminuted at the plant and 29% at terminals. The role of the terminal chipping supply chain was also significant in the production of chips from logging residues and small-sized wood chips. When producing chips from large-sized (rotten) roundwood, nearly a half of chips were comminuted at plants and more than 40% at terminals
Supply systems of forest chip production in Finland
Energy Technology Data Exchange (ETDEWEB)
Kaerhae, K. (Metsaeteho Oy, Helsinki (Finland)), e-mail: kalle.karha@metsateho.fi
2010-07-01
The Metsaeteho study investigated how logging residue chips, stump wood chips, and chips from small-diameter thinning wood and large-sized (rotten) roundwood used by heating and power plants were produced in Finland in 2009. Almost all the major forest chip suppliers in Finland were involved in the study. The total volume of forest chips supplied in 2009 by these suppliers was 8,4 TWh. The study was implemented by conducting an e-mail questionnaire survey and telephone interviews. Research data was collected from March-May, 2010. The majority of the logging residue chips and chips from small-diameter thinning wood were produced using the roadside chipping supply system in Finland in 2009. The chipping at plant supply system was also significant in the production of logging residue chips. Nearly 70 % of all stump wood chips consumed were comminuted at the plant and 28 % at terminals. The role of the terminal chipping supply system was also significant in the production of chips from logging residues and small-diameter wood chips. When producing chips from large-sized (rotten) roundwood, similarly roughly 70 % of chips were comminuted at plants and 23 % at terminals. (orig.)
Supply chains of forest chip production in Finland
Energy Technology Data Exchange (ETDEWEB)
Kaerhae, K. (Metsaeteho Oy, Helsinki (Finland)), Email: kalle.karha@metsateho.fi
2009-07-01
The Metsaeteho study investigated how logging residue chips. stump wood chips, and chips from small-sized thinning wood and large-sized (rotten) roundwood used by heating and power plants were produced in Finland in 2008. Almost all the major forest chip suppliers in Finland were involved in the study. The total volume of forest chips supplied in 2008 by these suppliers was 6,5 TWh. The study was implemented by conducting an e-mail questionnaire survey and telephone interviews. Research data was collected in March-May 2009. The majority of the logging residue chips and chips from small-sized thinning wood were produced using the roadside chipping supply chain in Finland in 2008. The chipping at plant supply chain was also significant in the production of logging residue chips. 70% of all stump wood chips consumed were comminuted at the plant and 29% at terminals. The role of the terminal chipping supply chain was also significant in the production of chips from logging residues and small-sized wood chips. When producing chips from large-sized (rotten) roundwood, nearly a half of chips were comminuted at plants and more than 40 % at terminals. (orig.)
Early aberrations in chromatin dynamics in embryos produced under In vitro conditions
DEFF Research Database (Denmark)
Deshmukh, Rahul Shahaji; Østrup, Olga; Strejcek, Frantisek
2012-01-01
standard to that of embryos produced by IVF, parthenogenetic activation (PA), or SCNT. In contrast to IV embryos, chromatin spatial and temporal dynamics in PA, IVF, and SCNT embryos were altered; starting with aberrant chromatin-nuclear envelope interactions at the two-cell stage, delayed chromatin...... decondensation and nucleolar development at the four-cell stage, and ultimately culminating in failure of proper first lineage segregation at the blastocyst stage, demonstrated by poorly defined inner cell mass. Interestingly, in vitro produced (IVP) embryos also lacked a heterochromatin halo around nucleolar...
Large-scale Comparative Study of Hi-C-based Chromatin 3D Structure Modeling Methods
Wang, Cheng
2018-01-01
Chromatin is a complex polymer molecule in eukaryotic cells, primarily consisting of DNA and histones. Many works have shown that the 3D folding of chromatin structure plays an important role in DNA expression. The recently proposed Chro- mosome
Recognition of chromatin by the plant alkaloid, ellipticine as a dual binder
Energy Technology Data Exchange (ETDEWEB)
Banerjee, Amrita; Sanyal, Sulagna; Majumder, Parijat [Biophysics & Structural Genomics Division, Saha Institute of Nuclear Physics, Block-AF, Sector-1, Bidhan Nagar, Kolkata 700064, West Bengal (India); Chakraborty, Payal [Bionivid Technology Pvt Ltd, Kasturi Nagar, Bangalore 560043 (India); Jana, Kuladip [Division of Molecular Medicine, Centre for Translational Animal Research, Bose Institute, P-1/12 C.I.T. Scheme VIIM, Kolkata 700054, West Bengal (India); Das, Chandrima, E-mail: chandrima.das@saha.ac.in [Biophysics & Structural Genomics Division, Saha Institute of Nuclear Physics, Block-AF, Sector-1, Bidhan Nagar, Kolkata 700064, West Bengal (India); Dasgupta, Dipak, E-mail: dipak.dasgupta@saha.ac.in [Biophysics & Structural Genomics Division, Saha Institute of Nuclear Physics, Block-AF, Sector-1, Bidhan Nagar, Kolkata 700064, West Bengal (India)
2015-07-10
Recognition of core histone components of chromatin along with chromosomal DNA by a class of small molecule modulators is worth examining to evaluate their intracellular mode of action. A plant alkaloid ellipticine (ELP) which is a putative anticancer agent has so far been reported to function via DNA intercalation, association with topoisomerase II and binding to telomere region. However, its effect upon the potential intracellular target, chromatin is hitherto unreported. Here we have characterized the biomolecular recognition between ELP and different hierarchical levels of chromatin. The significant result is that in addition to DNA, it binds to core histone(s) and can be categorized as a ‘dual binder’. As a sequel to binding with histone(s) and core octamer, it alters post-translational histone acetylation marks. We have further demonstrated that it has the potential to modulate gene expression thereby regulating several key biological processes such as nuclear organization, transcription, translation and histone modifications. - Highlights: • Ellipticine acts a dual binder binding to both DNA and core histone(s). • It induces structural perturbations in chromatin, chromatosome and histone octamer. • It alters histones acetylation and affects global gene expression.
Recognition of chromatin by the plant alkaloid, ellipticine as a dual binder
International Nuclear Information System (INIS)
Banerjee, Amrita; Sanyal, Sulagna; Majumder, Parijat; Chakraborty, Payal; Jana, Kuladip; Das, Chandrima; Dasgupta, Dipak
2015-01-01
Recognition of core histone components of chromatin along with chromosomal DNA by a class of small molecule modulators is worth examining to evaluate their intracellular mode of action. A plant alkaloid ellipticine (ELP) which is a putative anticancer agent has so far been reported to function via DNA intercalation, association with topoisomerase II and binding to telomere region. However, its effect upon the potential intracellular target, chromatin is hitherto unreported. Here we have characterized the biomolecular recognition between ELP and different hierarchical levels of chromatin. The significant result is that in addition to DNA, it binds to core histone(s) and can be categorized as a ‘dual binder’. As a sequel to binding with histone(s) and core octamer, it alters post-translational histone acetylation marks. We have further demonstrated that it has the potential to modulate gene expression thereby regulating several key biological processes such as nuclear organization, transcription, translation and histone modifications. - Highlights: • Ellipticine acts a dual binder binding to both DNA and core histone(s). • It induces structural perturbations in chromatin, chromatosome and histone octamer. • It alters histones acetylation and affects global gene expression
ATM-dependent pathways of chromatin remodelling and oxidative DNA damage responses.
Berger, N Daniel; Stanley, Fintan K T; Moore, Shaun; Goodarzi, Aaron A
2017-10-05
Ataxia-telangiectasia mutated (ATM) is a serine/threonine protein kinase with a master regulatory function in the DNA damage response. In this role, ATM commands a complex biochemical network that signals the presence of oxidative DNA damage, including the dangerous DNA double-strand break, and facilitates subsequent repair. Here, we review the current state of knowledge regarding ATM-dependent chromatin remodelling and epigenomic alterations that are required to maintain genomic integrity in the presence of DNA double-strand breaks and/or oxidative stress. We will focus particularly on the roles of ATM in adjusting nucleosome spacing at sites of unresolved DNA double-strand breaks within complex chromatin environments, and the impact of ATM on preserving the health of cells within the mammalian central nervous system.This article is part of the themed issue 'Chromatin modifiers and remodellers in DNA repair and signalling'. © 2017 The Author(s).
Single chip camera active pixel sensor
Shaw, Timothy (Inventor); Pain, Bedabrata (Inventor); Olson, Brita (Inventor); Nixon, Robert H. (Inventor); Fossum, Eric R. (Inventor); Panicacci, Roger A. (Inventor); Mansoorian, Barmak (Inventor)
2003-01-01
A totally digital single chip camera includes communications to operate most of its structure in serial communication mode. The digital single chip camera include a D/A converter for converting an input digital word into an analog reference signal. The chip includes all of the necessary circuitry for operating the chip using a single pin.
International Nuclear Information System (INIS)
Mil', E.M.; Binyukov, V.I.; Zhil'tsova, V.M.; Stolyarova, L.G.; Kuznetsov, Yu.V.
1991-01-01
Effect of benzimidazol-derivatives on the DNA-protein binding formation was studied after UV-radiation of chromatin. These derivatives were shown to protect chromatin from UV-induced DNA-protein binding formation. Structural analog contained two aminomethyl residuals sensibilized additional binding formation in chromatin. Results suggested, that benzimidazol interacted with DNA, while aminomethyl groups interacted with protein and sensibilized binding of DNA, whilt aminomethyl groups interacted with protein and sensibilized binding of DNA with histone H1
International Nuclear Information System (INIS)
Taichman, L.B.
1979-01-01
Two procedures are described for the fractionation of chromatin containing unsubstituted (LL) DNA and DNA unifilarly substituted with bromodeoxyuridine (HL). The two procedures rely upon the sensitivity of bromodeoxyuridine-containing DNA to UV light to induce either strand breakage or protein crosslinking. When a mixture of LL and HL chromatin is irradiated with UV light, the HL DNA fragments into molecules of smaller molecular weight than the LL DNA and crosslinks more chromosomal protein than the LL DNA. LL and HL chromatin can be fractionated on the basis of size by centrifuging through a neutral sucrose gradient. The HL DNA-protein adducts that are generated by the UV light have a unique buoyant density and may be isolated by isopycnic centrifugation in Cs 2 S0 4 . The ability to fractionate LL and HL chromatin permits certain studies on the structure of replicating chromatin. (author)
A new non-catalytic role for ubiquitin ligase RNF8 in unfolding higher-order chromatin structure
DEFF Research Database (Denmark)
Luijsterburg, Martijn S; Acs, Klara; Ackermann, Leena
2012-01-01
The ubiquitin ligases RNF8 and RNF168 orchestrate DNA damage signalling through the ubiquitylation of histone H2A and the recruitment of downstream repair factors. Here, we demonstrate that RNF8, but not RNF168 or the canonical H2A ubiquitin ligase RNF2, mediates extensive chromatin decondensation....... Our data show that CHD4, the catalytic subunit of the NuRD complex, interacts with RNF8 and is essential for RNF8-mediated chromatin unfolding. The chromatin remodelling activity of CHD4 promotes efficient ubiquitin conjugation and assembly of RNF168 and BRCA1 at DNA double-strand breaks....... Interestingly, RNF8-mediated recruitment of CHD4 and subsequent chromatin remodelling were independent of the ubiquitin-ligase activity of RNF8, but involved a non-canonical interaction with the forkhead-associated (FHA) domain. Our study reveals a new mechanism of chromatin remodelling-assisted ubiquitylation...
Chromatin dynamics during DSB repair
Czech Academy of Sciences Publication Activity Database
Falk, Martin; Lukášová, Emilie; Gabrielová, Barbora; Ondřej, Vladan; Kozubek, Stanislav
2007-01-01
Roč. 1773, č. 10 (2007), s. 1534-1545 ISSN 0167-4889 R&D Projects: GA ČR(CZ) GP204/06/P349; GA ČR(CZ) 1QS500040508; GA AV ČR(CZ) IAA1065203; GA MŠk(CZ) 1P05OC084 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : chromatin structure * double- strand breaks (DSB) * DNA repair Subject RIV: BO - Biophysics Impact factor: 4.374, year: 2007
H4 replication-dependent diacetylation and Hat1 promote S-phase chromatin assembly in vivo
Ejlassi-Lassallette, Aïda; Mocquard, Eloïse; Arnaud, Marie-Claire; Thiriet, Christophe
2011-01-01
While specific posttranslational modification patterns within the H3 and H4 tail domains are associated with the S-phase, their actual functions in replication-dependent chromatin assembly have not yet been defined. Here we used incorporation of trace amounts of recombinant proteins into naturally synchronous macroplasmodia of Physarum polycephalum to examine the function of H3 and H4 tail domains in replication-coupled chromatin assembly. We found that the H3/H4 complex lacking the H4 tail domain was not efficiently recovered in nuclei, whereas depletion of the H3 tail domain did not impede nuclear import but chromatin assembly failed. Furthermore, our results revealed that the proper pattern of acetylation on the H4 tail domain is required for nuclear import and chromatin assembly. This is most likely due to binding of Hat1, as coimmunoprecipitation experiments showed Hat1 associated with predeposition histones in the cytoplasm and with replicating chromatin. These results suggest that the type B histone acetyltransferase assists in shuttling the H3/H4 complex from cytoplasm to the replication forks. PMID:21118997
Fujisawa, Masaki; Ito, Yasuhiro
2013-01-01
The developmental process of ripening is unique to fleshy fruits and a key factor in fruit quality. The tomato (Solanum lycopersicum) MADS-box transcription factor RIPENING INHIBITOR (RIN), one of the earliest-acting ripening regulators, is required for broad aspects of ripening, including ethylene-dependent and -independent pathways. However, our knowledge of direct RIN target genes has been limited, considering the broad effects of RIN on ripening. In a recent work published in The Plant Cell, we identified 241 direct RIN target genes by chromatin immunoprecipitation coupled with DNA microarray (ChIP-chip) and transcriptome analysis. Functional classification of the targets revealed that RIN participates in the regulation of many biological processes including well-known ripening processes such as climacteric ethylene production and lycopene accumulation. In addition, we found that ethylene is required for the full expression of RIN and several RIN-targeting transcription factor genes at the ripening stage. Here, based on our recently published findings and additional data, we discuss the ripening processes regulated by RIN and the interplay between RIN and ethylene. PMID:23518588
Direct inhibition of TNF-α promoter activity by Fanconi anemia protein FANCD2.
Directory of Open Access Journals (Sweden)
Nobuko Matsushita
Full Text Available Fanconi anemia (FA, an inherited disease, is associated with progressive bone marrow failure, predisposition to cancer, and genomic instability. Genes corresponding to 15 identified FA complementation groups have been cloned, and each gene product functions in the response to DNA damage induced by cross-linking agents and/or in protection against genome instability. Interestingly, overproduction of inflammatory cytokines such as tumor necrosis factor alpha (TNF-α and aberrant activation of NF-κB-dependent transcriptional activity have been observed in FA cells. Here we demonstrated that FANCD2 protein inhibits NF-κB activity in its monoubiquitination-dependent manner. Furthermore, we detected a specific association between FANCD2 and an NF-κB consensus element in the TNF-α promoter by electrophoretic mobility shift assays (EMSA and chromatin immunoprecipitation (ChIP assay. Therefore, we propose FANCD2 deficiency promotes transcriptional activity of the TNF-α promoter and induces overproduction of TNF-which then sustains prolonged inflammatory responses. These results also suggest that artificial modulation of TNFα production could be a promising therapeutic approach to FA.
Cao, Yanli; Zheng, Fanglin; Wang, Lei; Zhao, Guolei; Chen, Guanjun; Zhang, Weixin; Liu, Weifeng
2017-07-01
Cellulase gene expression in the model cellulolytic fungus Trichoderma reesei is supposed to be controlled by an intricate regulatory network involving multiple transcription factors. Here, we identified a novel transcriptional repressor of cellulase gene expression, Rce1. Disruption of the rce1 gene not only facilitated the induced expression of cellulase genes but also led to a significant delay in terminating the induction process. However, Rce1 did not participate in Cre1-mediated catabolite repression. Electrophoretic mobility shift (EMSA) and DNase I footprinting assays in combination with chromatin immunoprecipitation (ChIP) demonstrated that Rce1 could bind directly to a cbh1 (cellobiohydrolase 1-encoding) gene promoter region containing a cluster of Xyr1 binding sites. Furthermore, competitive binding assays revealed that Rce1 antagonized Xyr1 from binding to the cbh1 promoter. These results indicate that intricate interactions exist between a variety of transcription factors to ensure tight and energy-efficient regulation of cellulase gene expression in T. reesei. This study also provides important clues regarding increased cellulase production in T. reesei. © 2017 John Wiley & Sons Ltd.
Ambigapathy, Ganesh; Zheng, Zhaoqing; Keifer, Joyce
2014-08-01
Brain-derived neurotrophic factor (BDNF) is an important regulator of neuronal development and synaptic function. The BDNF gene undergoes significant activity-dependent regulation during learning. Here, we identified the BDNF promoter regions, transcription start sites, and potential regulatory sequences for BDNF exons I-III that may contribute to activity-dependent gene and protein expression in the pond turtle Trachemys scripta elegans (tBDNF). By using transfection of BDNF promoter/luciferase plasmid constructs into human neuroblastoma SHSY5Y cells and mouse embryonic fibroblast NIH3T3 cells, we identified the basal regulatory activity of promoter sequences located upstream of each tBDNF exon, designated as pBDNFI-III. Further, through chromatin immunoprecipitation (ChIP) assays, we detected CREB binding directly to exon I and exon III promoters, while BHLHB2, but not CREB, binds within the exon II promoter. Elucidation of the promoter regions and regulatory protein binding sites in the tBDNF gene is essential for understanding the regulatory mechanisms that control tBDNF gene expression.
Sp5 induces the expression of Nanog to maintain mouse embryonic stem cell self-renewal.
Tang, Ling; Wang, Manman; Liu, Dahai; Gong, Mengting; Ying, Qi-Long; Ye, Shoudong
2017-01-01
Activation of signal transducer and activator of transcription 3 (STAT3) by leukemia inhibitory factor (LIF) maintains mouse embryonic stem cell (mESC) self-renewal. Our previous study showed that trans-acting transcription factor 5 (Sp5), an LIF/STAT3 downstream target, supports mESC self-renewal. However, the mechanism by which Sp5 exerts these effects remains elusive. Here, we found that Nanog is a direct target of Sp5 and mediates the self-renewal-promoting effect of Sp5 in mESCs. Overexpression of Sp5 induced Nanog expression, while knockdown or knockout of Sp5 decreased the Nanog level. Moreover, chromatin immunoprecipitation (ChIP) assays showed that Sp5 directly bound to the Nanog promoter. Functional studies revealed that knockdown of Nanog eliminated the mESC self-renewal-promoting ability of Sp5. Finally, we demonstrated that the self-renewal-promoting function of Sp5 was largely dependent on its zinc finger domains. Taken together, our study provides unrecognized functions of Sp5 in mESCs and will expand our current understanding of the regulation of mESC pluripotency.